.=) 1993 Oxford University Press
24 5799-5800
Localization of single copy gene
Caterina Cintil, Spartaco Santi2 and Nadir Mario Maraldil 2, *
1Laboratorio di Biologia Cellulare e Microscopia Elettronica IOR, Bologna and 21stituto di
Citomorfologia Normale e Patologica CNR, via di Barbiano 1/10, 40136 Bologna, Italy
Received September 7, 1993; Revised and Accepted October 22, 1993
Fluorescent In Situ Hybridization (FISH) technique, represents
a versatile technique which combines the accuracy of molecular
hybridization with fluorescence-labeling and cytogenetic
description of chromosome morphology, to provide a physical
localization of genes within DNA segments of interest (1). The
probes may be unique DNA sequences used with or without their
vector (phage, plasmid, YAC). The actual resolution of FISH
allows distinction of DNA sequences separated a few megabase
apart in metaphase or meiotic prophase chromosomes and a low-
end resolution limit around 50 kilobase pairs in interphase nuclei
(2), in which, however, no banding pattern can be obtained.
Oligonucleotide-PRimed IN Situ DNA synthesis (PRINS)
technique has been shown (4) be a rapid method, alternative to
Fluorescent In Situ Hybridization, which has been utilized for
studying the distribution of the alphoid sequences of the human
X chromosome (3). However, until now it sensitivity appeared
limited to the detection of repeated sequences (4).
The PRINS technique is based on the sequence specific
annealing of unlabeled oligonucleotide DNA in situ. This DNA
operates as primer for in situ chain elongation catalyzed by Taq
I polymerase. Using Biotin- or Digoxigenin-labeled nucleotides
as substrate for the chain elongation, the new DNA chain can
be labeled by immunocytochemistry, using FITC-conjugated
antibody. Here we report results which demonstrate the possibility
of detecting single copy sequences by the PRINS technique using
unlabeled oligonucleotides rather han a labeled full length probe.
Two oligonucleotides for the polymorphic region of the factor
IX gene (Xl = 5' ACCTTATGGGACCACTGTCG 3', X2 =
5' ATAT'T'CTCCTTCCCTCCCTC 3'; Biotech Italy) have been
used.
Human fixed metaphase chromosomes from PHA stimulated
peripheral blood lymphocytes were spread onto glass slides and
allowed to dry for 10 days. The chromosomes were dehydrated
in an ethanol series (70%, 90%, 100%) and then denatured in
70% formamide, 2x SSC pH 7.0 for 10 min at 72°C. The
samples were further dehydrated in an ethanol series at 4°C and
air-dried. The slides were incubated in a reaction mixture
containing (in 50 d1): 200 pmol of each oligonucleotide (XI and
X2), 5 Iul of lOx PCR Buffer II (AmpliTaq, Perkin-Elmer,
Norwalk, CT), 2 ul DIG DNA labeling mixture (1 mM dATP,
1 mM dCTP, 1 mM dGTP, 0.65 mM dTTP, 0.35 mM DIG-
dUTP; Boehringer, Mannheim) and 2 U of Taq I DNA
polymerase (Amplitaq, Perkin-Elmer, Norwalk, CT), for 10 min
at 580C (the annealing temperature for the oligonucleotide used)
*To whom correspondence should be addressed at: Istituto di Citomorfologia Normale e
Italy
Nucleic Acids Research, 1993, Vol. 21, No.
by PRINS technique
and for 30 min at 72°C. The slides were then washed two times
in 2 x SSC pH 7.0 and in 4x SSC pH 7.0 for 5 min at room
temperature. The slides were then placed in 4 x SSC, 0.5%
Bovine Serum Albumin (BSA) pH 7.0 for 5 min and incubated
for 45 min at room temperature with anti-Digoxigenin-FITC
(Boehringer, Mannheim) diluted 1:100 in 4 x SSC, 0.5 % BSA
pH 7.0. The slides were washed in 4x SSC, 0.05% Triton X-100
and counterstained with 1 jg/ml Propidium Iodide (PI).
The crucial steps in the specimen procedure with respect to
those previously reported (3, 4) were: i) drying of the samples
onto the glass for at least 10 days; ii) avoiding preheating the
glass and the incubation mixture; iii) omitting treatment with 50
mM NaCl, 50 mM EDTA at 700C.
The identification of a single spot in X chromosome in a male
metaphase plate (Figure la) and in an interphase nucleus (Figure
lb) and of two spots in the X chromosomes in a female metaphase
plate (Figure lc) and in an interphase nucleus (Figure ld) was
obtained with a Confocal Laser Scanning Microscope (CLSM
Sarastro, Molecular Dynamics). The FITC and PI signals were
detected simultaneously, independently elaborated and the final
projections were superimposed with a Silicon Graphic Computer
Personal IRIS4D/20 workstation. With conventional fluorescence
microscopy, in fact, the spots are barely detectable and, in any
case, the signal-to-noise ratio and the fading do not allowed us
to obtain satisfactory photographic recording.
The signal has been detected in almost all samples,
chromosome plates or nuclei; however, about 10% of female
samples present just one spot and about 20% present one of the
two spots smaller than the other one. This phenomenon has been
commonly observed when a single copy gene probe was used
in the FISH technique.
The identification of a single copy gene by using very short
sequences obtained from synthesized oligonucleotides opens the
possibility of a new strategy in the physical mapping of human
chromosomes. This method offers the possibility of using every
known gene sequence as a source of oligonucleotides and,
moreover, of detecting by cytogenetic analysis, the deletion of
a single exon, unlike the FISH technique in which, with a small
deletion, the probe may hybridize with the whole sequence. The
use of oligonucleotides for the identification of single copy DNA
sequences within chromosome bands could change the whole
oudook on the FISH technical approach to the physical mapping
of human chromosome, just as sequence tagged sites (5) changed
the approach to human genome mapping. There would be no
Patologica CNR, c/o IOR, via di Barbiano 1/10, 40136 Bologna,
5800 Nucleic Acids Research, 1993, Vol. 21, No. 24

1I

Figure 1. The localization of factor IX gene, in male (a,b) and female (c,d) chromosomes and nuclei. Two oligonucleotides for polymorphic region of factor IX
gene: Xl = 5' ACCTTATGGGACCACTGTCG 3'; X2 = 5' ATATTTCTCCTTCCCTCCCTC 3', have been used. The identification of neo-synthesized probes
by PRINS technique is described in the text. The images have been obtained by CSLM. Bar, 1 ytm.

further need to exchange clones among different laboratories, REFERENCES

or to store them in perpetuity, with the risks of mutations or
inactivation.
ACKNOWLEDGEMENTS
We thank Dr J.Gosden, Dr S.Squarzoni and Dr L.Stuppia for
exchanges of views and technical advice. This work was
supported by grants P.F. Ing.Genet. subproget 'Genoma Umano'
C.N.R. and by 'Ricerca Corrente 1993' Istituti Ortopedici
Rizzoli, Italy.
1. Lichter,P., Tang,C.J., Call,K., Hermanson,G., Evans,G.A., Housman,D.
and War,D.C.(1990) Science 247, 64-69.
2. Trask,B.J., Pinkel,D. and Van den Eng,G. (1989) Genomics 5, 710-717.
3. Kock,J.E., Kolvraa,S., Petersen,K.B., Gregersen,M.and Bolund,L. (1989)
Chromosoma 98, 259-265.
4. Gosden,J., Hauratty,D., Starling,J., Fantes,J., Mitchell,A. and Porteous,D.
(1991) Cytogenet. Cell Genet. 57, 100-104.
5. Olson,M., Hood,L., Cantor,C. and Botstein,D. (1989) Science 245,
1434-1435.