European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74

Contents lists available at ScienceDirect

European Journal of Obstetrics & Gynecology and

Reproductive Biology
journal homepage: www.elsevier.com/locate/ejogrb

Association of CYP1A1 gene variants rs4646903 (T>C) and rs1048943

(A>G) with cervical cancer in a North Indian population
Mohammad Abbas a, Kirti Srivastava b, Mohd Imran c, Monisha Banerjee a,*
a
Molecular and Human Genetics Laboratory, Department of Zoology, University of Lucknow, Lucknow 226007, Uttar Pradesh, India
b
Department of Radiotherapy, King George’s Medical University, Lucknow 226003, Uttar Pradesh, India
c
Department of Microbiology, Integral University, Lucknow 226026, Uttar Pradesh, India

A R T I C L E I N F O A B S T R A C T

Article history: Objective: To evaluate the association of CYP1A1 gene polymorphisms with cervical cancer susceptibility
Received 11 October 2013 in general and in relation to tobacco smoking.
Received in revised form 13 February 2014 Study design: The study included 408 subjects from North India (208 controls and 200 cases). All subjects
Accepted 22 February 2014
were genotyped for CYP1A1 m1 T>C (rs4646903) and m2 A>G (rs1048943) by polymerase chain
reaction-restriction fragment length polymorphism (PCR-RFLP) followed by statistical analysis (SPSS,
Keywords: version 15.0; SHEsis online version).
SNP
Results: In our population, individuals with TC and CC genotypes of CYP1A1 m1 polymorphism have
Cervical cancer
significantly higher risk of cervical cancer (adjusted odds (OR) 2.76, P = 0.001; 3.13, P = 0.006
CYP1A1
North India respectively). In the case of m2 polymorphism, individuals with AG and GG genotypes show increased
PCR-RFLP risk of cervical cancer (OR 1.90, P = 0.021; and 3.05, P = 0.285 respectively). The ‘C’ allele of m1 and ‘G’
allele of m2 polymorphism were strongly associated with the disease (P < 0.0001 and 0.008
respectively). Multiple combinations showed that women carrying the genotypes viz. TC/AA (+/),
TC/AG (+/+), CC/AG (/+) and CC/AG (+/+) were at higher risk of developing cervical cancer. The
relationship between CYP1A1 m1 and m2 genotypes and tobacco smoking showed an 8–11-fold higher
risk of cervical cancer amongst active smokers and 3–4-fold in passive smokers as well. Linkage
disequilibrium between m1 and m2 showed highly significant association in the case of TA* (P < 0.0001)
haplotype, while ‘CG’ appeared to be the risk haplotype (P = 0.002).
Conclusion: Our results suggest that presence of the ‘C’ allele of m1 (T>C) and ‘G’ of m2 (A>G) may be the
risk alleles for cervical cancer susceptibility. Moreover, CYP1A1 m1 and m2 polymorphisms show
considerable association with tobacco smoking in our study population.
ß 2014 Elsevier Ireland Ltd. All rights reserved.

1. Introduction
Cervical cancer is the second most common cancer in women
worldwide. Approximately 530,000 new cases are diagnosed and
275,000 deaths occur each year. More than 80% of cervical cancer
cases occur in developing countries, while incidence and mortality
have substantially declined in developed countries [1,2]. Each year,
132,000 new cases are diagnosed in India, out of which 74,000
deaths occur annually, accounting for nearly one-third of global
cervical cancer deaths [3]. Apart from the high-risk human
papillomavirus, there are several etiological co-factors such as age
at marriage, early and multiple child births, low socio-economic
* Corresponding author. Tel.: +91 9839500439.
E-mail addresses: rizvi.109@gmail.com (M. Abbas), drkirtis@rediffmail.com
(K. Srivastava), imranmohdkhan@rediffmail.com (M. Imran),
banerjee_monisha30@rediffmail.com, mhglucknow@yahoo.com (M. Banerjee).
status, heavy cigarette smoking, drinking and long duration of oral
contraceptive use [4–6]. Environmental factors such as lifestyle,
exposure to tobacco-derived carcinogens and kitchen smoke along
with genetic factors have been confirmed to be related to the
development of cervical cancer [7–9]. Activation or detoxification of
chemical carcinogens in tobacco smoke by metabolic enzymes
(phase I and phase II respectively) has received a great deal of
attention, as possible genetic factors for a variety of cancers [10,11].
Polymorphisms in the genes encoding the metabolic enzymes result
in their altered expressions which lead to increased or decreased
activation/detoxification of carcinogens [12].
The cytochrome P450s (CYPs) belong to the phase I family of
metabolizing enzymes participating in detoxification of many
carcinogens by formation of reactive intermediates that can
damage DNA, lipids and proteins [13,14]. CYP1A1 metabolically
converts environmental procarcinogens into reactive intermediate
metabolites that have carcinogenic effects [15]. Polymorphic
variants influencing the enzyme activity of CYP1A1 along with

http://dx.doi.org/10.1016/j.ejogrb.2014.02.036
0301-2115/ß 2014 Elsevier Ireland Ltd. All rights reserved.
 M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74
environmental factors such as tobacco smoking play important
roles in different interindividual susceptibilities to gynecological
cancers in women as well as other cancers [6]. The CYP1A1 gene
located on chromosome 15q22-q24 encodes an enzyme with aryl
hydrocarbon hydroxylase activity which plays a role in the
metabolism of polycyclic aromatic hydrocarbons (PAH) from
cigarette smoke, and inherited differences in metabolic capacity
are thought to play a primary role in carcinogenesis [12]. Certain
polymorphisms in the CYP1A1 gene and prolonged exposure to
firewood along with tobacco smoke might lead to high levels of
reactive metabolites, thereby causing DNA damage in addition to a
pre-existing HPV infection. Considering the prevalence of tobacco
chewing and use of wood for cooking among Indian women, it is
possible that polymorphisms in genes encoding xenobiotic
metabolizing enzymes could throw light on disease susceptibility
[16]. Therefore, a hospital-based case-control study was under-
taken to evaluate the potential role of m1 (T>C, rs4646903) and m2
(A>G, rs1048943) polymorphisms in the CYP1A1 gene on
susceptibility to cervical cancer in a North Indian populations.
2. Materials and methods
2.1. Sample collection
Five milliliters venous blood was taken in EDTA vials from all
subjects after approval of the Institutional Ethics Committee (No.
274/R.Cell-10 dated 10th May, 2010) and informed consent. The
study subjects comprised 208 healthy controls and 200 cervical
cancer patients between 30 and70 years of age with similar
ethnicity. The patients with cervical cancer and age-matched
controls were enrolled in the Radiotherapy Department and
Department of Obstetrics and Gynecology of King George’s Medical
University (KGMU), Lucknow, India as per the inclusion/exclusion
criteria. Both cases and controls were interviewed extensively
regarding age, marriage age, parity, smoking status, etc. The
interviews were conducted by expert clinicians for both cases and
controls, following a structured proforma. Clinical diagnosis and
staging of patients were performed by expert medical personnel
following the guidelines of the International Federation of
Gynecology and Obstetrics (FIGO).
Inclusion criteria for patients:
 Age between 30 and70 years with similar ethnicity.
 de novo histopathologically proven carcinoma cervix.
 All stages (I–IV) as per the guidelines of International Federation
of Gynecology and Obstetrics (FIGO).
Exclusion criteria for patients:
 Age >70 years.
 History of other cancers.
 Prior chemotherapy, radiotherapy or chemoradiotherapy.
 Any co-morbid conditions such as allergy, cardiovascular
disease, diabetes, infection and inflammatory response.
Criteria for selection of control subjects:
 Normal healthy age-matched subjects of similar ethnicity and
free from cervical cancer.
2.2. DNA isolation and genotyping of CYP1A1 m1 T>C (rs4646903)
and m2 A>G (rs1048943) variants
Genomic DNA was extracted from peripheral blood leucocytes
by a standard salting-out method with slight modifications
69
[17,18]. The DNA quality and quantity were estimated using a
biophotometer (Eppendorf, USA).
The CYP1A1 m1 (T>C) and m2 (A>G) polymorphisms were
analyzed using polymerase chain reaction-restriction fragment
length polymorphism (PCR-RFLP). Amplification was performed in
a 25 ml reaction mixture containing genomic DNA (100–150 ng),
5 pmol of each primer, 200 mM dNTPs, and 0.5U of Taq DNA
polymerase (MBI-Fermentas, USA) using gradient Master Cycler
(Eppendorf, USA). Primer 3 online software was used to design
primers F-50 ACTCACCCTGAACCCCATTC-30 and R-50 GGCCCCAA-
CTACTCAGAGGCT-30 ; F-50 CTGTCTCCCTCTGGTTACAGGAAGC-30 and
R-50 TTCCACCCGTTGCAGCAGGATAGC C-30 for CYP1A1 m1 T>C and
m2 A>G respectively. The PCR products were checked on ethidium
bromide (EtBr) stained 2% agarose gels and visualized in a gel
documentation system (Vilber Lourmat, France). The PCR products
were digested with 2 units of restriction enzymes (MspI and BsrD1
respectively) at 37 8C for 16 h. The digested products were
electrophoresed on 12% polyacrylamide gel (PAGE) and visualized
with EtBr.
2.3. Statistical analysis
The sample size for each single nucleotide polymorphism (SNP)
was calculated by QUANTO software (v.online) using minor allele
frequency (MAF) and prevalence. The continuous variables of each
group were summarized as mean  SD and compared by Student’s t-
test after ascertaining the normality by the Kolmogorov–Smirnov Z
test. The Hardy–Weinberg equilibrium at individual locus was assessed
by the chi-square (x2) test. Allele frequencies and carriage rate of alleles
in both groups were compared using a 2  2 contingency table and
genotype frequencies in a 2  3 contingency table by using the chi-
square test and Fisher’s exact test. Differences were considered
statistically significant for P < 0.05. Odds ratio (OR) at 95% confidence
intervals (CI) was determined to describe the strength of association
between the two SNPs by the logistic regression model. Most of the
analyses were performed by SPSS (Version 15.0). Haplotype analysis of
the two SNPs was performed using SHEsis software (online version).
3. Results
3.1. Clinical stage, histopathological and demographic
characterization of cases
Out of 200 cases, 58% were in stage II while 38.5 and 5.5% were
in stages III/IV and I respectively. All 200 cases were histopatho-
logically confirmed, of which 5.5% (11 out of 200) were
adenocarcinoma and remaining 94.5% were squamous cell
carcinoma. Squamous cell carcinoma was further differentiated
according to cell types; well (40.5%), moderately (28.5%), and
poorly differentiated (4.5%) and no differentiation (21.0%) accord-
ing to the histopathological report.
The demographic variables of the study population recorded for
both squamous cell carcinoma and adenocarcinoma subtypes
showed no difference in age distribution between controls and
cases, the mean ages being 48.09  8.347 and 48.54  9.529 years
respectively (P = 0.605). It was observed, however, that cervical cancer
patients were married at a younger age (18.06  2.106) and had more
number of children (4.48). Marriage age, parity and hemoglobin in cases
showed highly significant association when compared to controls
(P < 0.0001). Significant association was also observed between
controls and patients in the case of passive smokers (P < 0.0001) (Fig. 1).
3.2. Genetic analysis
Genotype patterns of two SNPs (rs4646903 and rs1048943) in
the CYP1A1 gene are represented in Fig. 2a and b. Distribution of
[(Fig._1)TD$IG]
70 M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74
Fig. 1. Comparison of clinical parameters in controls (n = 208) and cervical cancer cases (n = 200). Age (in years); Hb (Hemoglobin %); MA (marriage age in years); *P value
between never and active smokers; #P value between never and passive smokers.
genotypes, allele frequencies and carriage rate among controls and
cases are shown in Table 1. The prevalence of TC and CC genotypes
of CYP1A1 m1 was more in cases (51% and 16% respectively) when
compared to controls (34% and 10%). The high frequency of TC and
CC genotypes was significantly associated with an increased risk if
cervical cancer (2.44-fold, P < 0.0001, and 2.51-fold, P = 0.004
respectively). The risk showed a further increase when the data
were adjusted for age, marriage age, parity and smoking in
multivariate logistic regression (2.76-folds P = 0.001, and 3.13-
fold, P = 0.006 respectively).
[(Fig._2)TD$IG]
Fig. 2. Ethidium bromide stained polyacrylamide gels showing different genotypes
of CYP1A1 gene. (a) SNP (T>C) showing CC: 194, 46 bp; TC: 240, 194, 49 bp; TT:
240 bp; M1: pUC 19/Mspl digest. (b) SNP (A>G) showing AA: 149, 55 bp; AG: 204,
149, 55 bp; GG: 204 bp; M2: PhiX174/Hae III digest.
In CYP1A1 m2 polymorphism, there was increase in the
frequency of genotypes AG and GG in cases when compared to
controls (Table 1). The risk of cervical cancer significantly
increased with the AG genotype (1.65-fold, P = 0.015). After
adjusting the risk was found to increase slightly (1.90-fold) though
it remained statistically significant (P = 0.021). The increased
frequency of GG genotypes conferred a 3.84-fold increased cervical
cancer risk, which decreased slightly when the data were adjusted
for the confounding factors (3.05-fold). Allele frequencies of the
two polymorphisms were higher in cases as compared to controls
and showed highly significant association (P < 0.0001 and 0.008
respectively). Absence of the ‘C’ allele in m1 and ‘G’ allele in m2
polymorphisms was significantly higher in controls (P < 0.0001
and P = 0.013) (Table 1).
Logistic regression analysis showed the possible effect of
double combinations of genotypes on the risk of developing
cervical cancer. Out of nine possible combinations, six were found
with frequencies ranging from 5% to 45% in the study population
(Table 2). Recessive genotype frequency (CC and GG) was very low
in the population so their combination with other genotypes was
not considered. The risk of TC/AA (+/) was 0.65-fold but after
adjusting the risk increased to 2.10-fold. CC/AG (+/+) and TC/AG (+/
+) combinations showed 2–2.50-fold higher risk which increased
to 2.90–2.97-fold after adjustment (P = 0.040 and P = 0.002
respectively). The risk in the case of CC/AG (/+) was increased
1.80-fold after the data were adjusted (Table 2). For haplotype
analysis with two loci of CYP1A1 gene polymorphisms, linkage
disequilibrium between m1 rs4646903 and m2 rs1048943 is
shown in Fig. 3 (D: 0.535; r2: 0.137). The frequency of haplotypes
TA* was 52.2% in cases, which is significantly lower as compared to
controls (66.0%; P < 0.0001), while the haplotype CG* was more
frequent in cases than controls (17.7% vs. 10.4%, P = 0.002).
Association of SNPs with tobacco smoking status of subjects
showed that the risk of cervical cancer in active smokers and
passive smokers with AG/GG and TC/CC genotypes was 8–11 and
2.95–4.32-fold higher with significant association (Table 3).
Another observation was that the genotype frequencies of CYP1A1
 M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74 71

Table 1
Genotypic, allelic and carriage rate frequencies of CYP1A1 m1 (T>C) and m2 (A>G) gene polymorphisms in controls (n = 208) and cervical cancer cases (n = 200).

Genotypes/alleles Controls (%) Cases (%) Unadjusted OR (95% CI) P value Adjusteda OR (95% CI) P value

CYP1A1 m1
TT 114 (54.8) 66 (33.0) 1.0 (Ref.) 1.0 (Ref.)
TC 72 (34.6) 102 (51.0) 2.44 (1.595–3.753) <0.0001 2.76 (1.542–4.927) 0.001
CC 22 (10.6) 32 (16.0) 2.51 (1.349–4.678) 0.004 3.13 (1.395–7.015) 0.006
T* allele 300 (72.1) 234 (58.5) 1.0 (Ref.)
C* allele 116 (27.9) 166 (41.5) 1.84 (1.369–2.457) <0.0001

CYP1A1 m2
AA 141 (67.8) 110 (55.0) 1.0 (Ref.) 1.0 (Ref.)
AG 65 (31.2) 84 (42.0) 1.65 (1.101–2.493) 0.015 1.90 (1.102–3.283) 0.021
GG 2 (1.0) 6 (3.0) 3.84 (0.761–19.424) 0.103 3.05 (0.396–23.437) 0.285
A* allele 347 (83.4) 304 (76.0) 1.0 (Ref.)
G* allele 69 (16.6) 96 (24.0) 0.63 (0.445–0.889) 0.008

Carriage rate
CYP1A1 m1
T (+) 186 (89.4) 168 (84.0) 1.0 (Ref.) 1.0 (Ref.)
T () 22 (10.6) 32 (16.0) 0.62 (0.347–1.111) 0.106 0.51 (0.24–1.09) 0.077
C (+) 94 (45.2) 134 (67.0) 1.0 (Ref.) 1.0 (Ref.)
C () 114 (54.8) 66 (33.0) 2.46 (1.648–3.680) <0.0001 2.90 (1.668–5.026) <0.0001

CYP1A1 m2
A (+) 206 (99.0) 194 (97.0) 1.0 (Ref.) 1.0 (Ref.)
A () 2 (1.0) 6 (3.0) 0.31 (0.063–1.574) 0.138 0.26 (0.261–0.033) 0.23
G (+) 67 (32.2) 90 (45.0) 1.0 (Ref.) 1.0 (Ref.)
G () 141 (67.8) 110 (55.0) 1.72 (1.151–2.576) 0.008 2.00 (1.160–3.437) 0.013

Bold numerals provided in tables show association with disease. CI = confidence interval; OR = odds ratio.
a
Adjusted for age, marriage age, parity and smoking; 1.0 (Reference), Alleles*, total number of chromosomes in controls = 416 and cases = 400.

m1 polymorphism significantly deviated from Hardy–Weinberg
equilibrium among controls (Pearson’s x2 = 4.037, df = 1, P = 0.045)
and marginally for m2 polymorphism (Pearson’s x2 = 3.480, df = 1,
P = 0.062).
4. Comments
Gene variations called polymorphisms in individuals of a
population result in different responses to xenobiotic metabolizing
enzymes. This is evident from the fact that all smokers (active or
passive) do not develop cancer. Polymorphisms in the coding
regions may cause amino acid substitution thus altering the
[(Fig._3)TD$IG]
enzymatic activity of xenobiotics [15]. Many carcinogens require
metabolic activation by phase I enzymes like CYP1A1 and thereafter
they are detoxified by phase II enzymes like GSTM1 and GSTT1
[19,20]. Some active metabolites which are not detoxified form DNA
adducts and eventually lead to mutations causing cancer. Cigarette
smoking, either active or passive, has been linked to the secretion of
tumor-specific metabolites in cervical mucus. This mucus maintains
cervical HPV infection longer and decreases the potential of clearing
an oncogenic infection [21].
The carcinogenic potential of nitrosoamines present within
cervical epithelium has been clearly described [7]. The CYP1A1
enzyme is responsible for aryl hydrocarbon hydroxylase activity of

Fig. 3. Haplotype analysis of SNPs viz. CYP1A1 m1 (rs4646903) and m2 (rs1048943) for association with cervical cancer cases in North Indian population. Kinkage
diseuiliburim (LD) in subjects is represented as pink square for LD (SHEsis Software, ver. Online).
72 M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74

Table 2
Distribution of double combinations of SNPs CYP1A1 m1 (T>C) and m2 (A>G) in controls (n = 208) and cervical cancer cases (n = 200).

Genotypes Controls (%) Cases (%) Unadjusted OR (95% CI) Adjusteda OR (95% CI)
P value P value

TT&AA
(/) 46 (22.1) 78 (39.0) 1.0 (Ref.) 1.0 (Ref.)
(/+) 48 (23.1) 56 (28.0) 0.69 (0.405–1.169) 0.57 (0.268–1.154)
0.167 0.115
(+/) 21 (10.1) 12 (6.0) 0.34 (0.152–0.748) 0.24 (0.086–0.664)
0.008 0.006
(+/+) 93 (44.7) 54 (27.0) 0.34 (0.209–0.562) 0.28 (0.146–0.550)
<0.0001 <0.0001

TT&AG
(/) 50 (24.0) 60 (30.0) 1.0 (Ref.) 1.0 (Ref.)
(/+) 44 (21.2) 74 (37.0) 1.40 (0.826–2.379) 1.78 (0.858–3.687)
0.211 0.121
(+/) 93 (44.7) 56 (28.0) 0.50 (0.304–0.828) 0.52 (0.257–1.043)
0.007 0.065
(+/+) 21 (10.1) 10 (5.0) 0.40 (0.171–0.920) 0.36 (0.120–1.055)
0.031 0.062

TC&AA
(/) 33 (15.9) 28 (14.0) 1.0 (Ref.) 1.0 (Ref.)
(/+) 103 (49.5) 70 (35.0) 0.81 (0.412–1.577) 0.66 (0.315–1.398)
0.529 0.281
(+/) 34 (16.3) 62 (31.0) 0.65 (0.377–1.106) 2.10 (0.913–4.755)
0.111 0.081
(+/+) 38 (18.3) 40 (20.0) 1.73 (0.941–3.188) 1.09 (0.452–2.608)
0.077 0.854

TC&AG
(/) 105 (50.5) 73 (36.5) 1.0 (Ref.) 1.0 (Ref.)
(/+) 31 (15.0) 25 (12.5) 1.16 (0.633–2.126) 1.36 (0.631–2.919)
0.631 0.435
(+/) 38 (18.2) 43 (21.5) 1.63 (0.959–2.762) 1.61 (0.765–3.403)
0.071 0.209
(+/+) 34 (16.3) 59 (29.5) 2.50 (1.488–4.186) 2.97 (1.483–5.966)
0.001 0.002

CC&AA
(/) 55 (26.4) 74 (37.0) 1.0 (Ref.) 1.0 (Ref.)
(/+) 131 (63.0) 94 (47.0) 0.53 (0.344–0.877) 0.52 (0.288–9.42)
0.005 0.031
(+/) 12 (5.8) 16 (8.0) 0.99 (0.434–2.263) 1.45 (0.531–3.976)
0.983 0.467
(+/+) 10 (4.8) 16 (8.0) 1.20 (0.501–2.821) 1.04 (0.314–3.436)
0.694 0.950

CC&AG
(/) 131 (63.0) 99 (49.5) 1.0 (Ref.) 1.0 (Ref.)
(/+) 55 (26.4) 69 (34.5) 1.70 (1.069–2.578) 1.80 (0.988–3.244)
0.024 0.055
(+/) 12 (5.8) 17 (8.5) 1.88 (0.856–4.105) 1.87 (0.636–5.518)
0.116 0.255
(+/+) 10 (4.8) 15 (7.5) 2.00 (0.855–4.605) 2.90 (1.050–8.025)
0.110 0.040

Bold numerals provided in tables show association with disease. CI = confidence interval; OR = odds ratio.
a
Adjusted for age, marriage age, parity and smoking; 1.0 (Reference).

widespread environmental carcinogens like polyaromatic hydro-
carbons, polyaromatic amines, dibenzofurans and biphenyls. Due
to altered CYP1A1 enzyme activity these substances lead to
formation of DNA adducts causing cell damage [22,23]. Several
SNPs have been found in CYP1A1 gene, the most commonly studied
being m1 T>C (rs4646903) at nucleotide 3801 in the 3’flanking
region which alters the gene expression level [24,25]. CYP1A1 m2
A>G (rs1048943) is another polymorphism at nucleotide 2455, an
isoleucine to valine transition which increases enzyme activity
involving the activation of specific tobacco carcinogens [26]. The
m2 polymorphic variant A>G displays two times higher catalytic
activity compared to wild type [27].
The association of gene polymorphisms of CYP1A1 with
susceptibility to several types of cancer, e.g. lung, bladder,
pancreatic, breast, ovarian, prostate, oral and gynecological malig-
nancies including cervical cancer, has been evaluated in different
populations [28–36]. Sugawara et al. [37], however, did not find any
relation between CYP1A1 and gynecological malignancies. A strong
correlation was found between homozygous m2 polymorphism and
lung cancer among Japanese, unlike Caucasians [38]. In the present
study, the allele frequencies of m1 (T>C) and m2 (A>G) were higher
in cases when compared to controls and showed significant
association with cervical cancer. The genotypes of m1, TC and CC
were more frequent in cases than controls (Table 1) and revealed a
threefold higher risk. In the case of m2 polymorphism, however, the
GG genotype showed threefold higher risk while AG showed only a
marginal 1.9-fold risk with significant association when compared
to the AA genotype (Table 1). In the case of double combinations of
genotypes, TC/AA (+/), TC/AG (+/+), CC/AG (/+) and CC/AG (+/+)
showed 2–3-fold higher risk (Table 2). The significant deviation from
Hardy–Weinberg equilibrium observed in controls for CYP1A1 m1
polymorphism may be due to the small sample size.
 M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74 73

Table 3
CYP1A1m1 (T>C) and m2 (A>G) genotypes and their association with smoking status in controls (n = 208) and cervical cancer cases (n = 200).

Population Genotype (%)

(smoking status)
CYP1A1m1 (T>C) CYP1A1m2 (A>G)

TT TC/CC OR (95%CI) AA AG/GG OR (95%CI)

P value P value

Never
Controls 56 (26.9) 63 (30.3) 1.0 (Ref.) 74 (35.6) 45 (21.6) 1.0 (Ref.)
Cases 30 (15.0) 44 (22.0) 1.30 49 (24.5) 25 (12.5) 0.84
(0.725–2.346) (0.457–1.541)
0.376 0.571

Active
Controls 6 (2.9) 3 (1.4) 1.0 (Ref.) 7 (3.4) 2 (0.9) 1.0 (Ref.)
Cases 2 (1.0) 11 (5.5) 11.00 4 (2.0) 9 (4.5) 7.86
(1.420–85.201) (1.105–56.123)
0.022 0.039

Passive
Controls 52 (25.0) 28 (13.5) 1.0 (Ref.) 60 (28.9) 20 (9.6) 1.0 (Ref.)
4.32 2.95
Cases 34 (17.0) 79 (39.5) (2.344–7.945) 57 (28.5) 56 (28.0) (1.576–5.513)
<0.0001 0.001

Bold numerals provided in tables show association with disease. CI = confidence interval; OR = odds ratio; 1.0 (Reference).

Smoking habit (active as well as passive) has been confirmed as
a risk factor for cervical cancer [4], where passive smoking is the
inhalation of smoke from tobacco products used by others [39,40].
Many case-control and cross-sectional studies indicate that
women married to smokers experience a higher risk of cervical
neoplasia than those married to nonsmokers [41]. Cotinine, a
nicotine metabolite, has been found in cervical mucus of women
exposed to passive smoking, which contribute to carcinogenesis
through the same pathways as active smoking, including genotoxic
and immunomodulatory effects [7,42]. The relationship between
the CYP1A1 gene and exposure to tobacco smoke revealed a highly
significant risk of cervical cancer in active smokers with AG/GG and
TC/CC genotypes (8–11-fold). The association studies with passive
smoking also showed risk and significant association but to a lesser
extent (Table 3). In this study, however, the number of active
smokers was very low because Indian women are rarely smokers.
Since our results showed early marriage age and more children
increase the susceptibility of Indian women to cervical cancer, it
may be advisable to keep these factors in mind for reducing risk of
the disease. The haplotype analyses in the present study suggest
that the TA* haplotype of the two SNPs may be protective in nature
while CG* is the risk haplotype, showing 1.8-fold higher risk with
significant association (P = 0.002) (Fig. 3).
It is evident from this study that the genetic polymorphisms in
metabolic enzymes play a role in development of cervical cancer.
Our results suggest that presence of the ‘C’ allele of rs4646903 and
‘G’ allele of rs1048943 might be leading to cervical cancer and may
be the risk alleles for disease susceptibility in our population. This
is probably the first study to examine the association of CYP1A1
polymorphisms with smoking in North Indian women. The risk of
cervical cancer in tobacco smoking women also increases with m1
and m2 polymorphisms. A larger sample size is required, however,
to confirm the possible interactions between CYP1A1 gene
polymorphisms and smoking outcomes in cervical cancer cases
from North India.
Funding
The work was supported by Council of Science & Technology-
Uttar Pradesh (CST-UP), Lucknow, ICMR, DST-FIST-PURSE, New
Delhi, India. M.A. is thankful to CST-UP for research fellowship.
Conflicts of interest
The authors declare no conflicts of interest.
References
[1] Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics.
CA Cancer J Clin 2011;61:69–90.
[2] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin
2012;62:10–29.
[3] Kaarthigeyan K. Cervical cancer in India and HPV vaccination. Indian J Med
Paediatr Oncol 2012;33:7–12.
[4] Sobti RC, Kaur S, Kaur P, Singh J, Gupta I, Nakahara A. Interaction of passive
smoking with GST (GSTM1, GSTT1, and GSTP1) genotypes in the risk of cervical
cancer in India. Cancer Genet Cytogenet 2006;166:117–23.
[5] Vasilevska M, Ross SA, Gesink D, Fisman DN. Relative risk of cervical cancer in
indigenous women in Australia, Canada, New Zealand, and the United States:
a systematic review and metaanalysis. J Public Health Policy 2012;33:148–
64.
[6] Xia L, Gao J, Liu Y, Wu K. Significant association between CYP1A1 T3801C
polymorphism and cervical neoplasia risk: a systematic review and meta-
analysis. Tumor Biol 2013;34:223–30.
[7] Prokopczyk B, Cox JE, Hoffmann D, Waggoner SE. Identification of tobacco-
specific carcinogen in the cervical mucus of smokers and non smokers. J Natl
Cancer Inst 1997;89:868–73.
[8] Simons AM, Philips DH, Coleman DV. Damage to DNA in cervical epithelium
related to smoking tobacco. Br Med J 1993;306:1444–8.
[9] Velema JP, Ferrera A, Figueroa M, et al. Burning wood in the kitchen increases
the risk of cervical neoplasia in HPV-infected women in Honduras. Int J Cancer
2002;97:536–41.
[10] Olshan AF, Weissler MC, Bell DA. GSTM1, GSTT1, GSTP1, CYP1A1, and NAT1
polymorphisms, tobacco use, and the risk of head and neck cancer. Cancer
Epidemiol Biomark Prev 2000;9:185–91.
[11] D’Errico A, Taioli E, Xhen X, Vineis P. Genetic metabolic polymorphisms and
the risk of cancer: a review of the literature. Biomarkers 1996;1:149–73.
[12] Sabitha K, Reddy MV, Jamil K. Smoking related risk involved in individuals
carrying genetic variants of CYP1A1 gene in head and neck cancer. Cancer
Epidemiol 2010;34:587–92.
[13] Tsuchiya Y, Nakajima M, Yokoi T. Cytochrome P450-mediated metabolism of
estrogens and its regulation in human. Cancer Lett 2005;227:115–24.
[14] Nebert DW, Dalton TP. The role of cytochrome P450 enzymes in endogenous
signalling pathways and environmental carcinogenesis. Nat Rev Cancer
2006;6:947–60.
[15] Taskiran C, Aktas D, Yigit-Celik N, et al. CYP1A1 gene polymorphism as a risk
factor for cervical intraepithelial neoplasia and invasive cervical cancer.
Gynecol Oncol 2006;101:503–6.
[16] Joseph T, Chacko P, Wesley R, Jayaprakash PG, James FV, Pillai MR. Germline
genetic polymorphisms of CYP1A1, GSTM1 and GSTT1 genes in Indian cervical
cancer: associations with tumor progression, age and human papillomavirus
infection. Gynecol Oncol 2006;101:411–7.
[17] Miller SA, Dykes DD, Polesky HF. Simple salting out procedure for extracting
DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.
74 M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74
[18] Gautam S, Agrawal CG, Bid HK, Banerjee M. Preliminary studies on CD36 gene
in type 2 diabetic patients from north India. Indian J Med Res 2011;134:
107–12.
[19] Nebert DW. Role of genetics and drug metabolism in humancancer risk. Mutat
Res 1991;247:267–81.
[20] Oude Ophuis MO, van Leishout EM, Roelofs HM, Peters WH, Manni JJ. Gluta-
thione S-transferase M1 and T1 and cytochrome P4501A1 polymorphisms in
relation to the risk for benign and malignant head and neck lesions. Cancer
1998;82:936–43.
[21] Crofts F, Taioli E, Trachman J, et al. Functional significance of different human
CYP1A1 genotypes. Carcinogenesis 1994;15:2961–3.
[22] Nebert DW, McKinnon RA, Puga A. Human drug–metabolizing enzyme poly-
morphisms: effects on risk of toxicity and cancer. DNA Cell Biol 1996;15:
273–80.
[23] Crofts F, Cosma GN, Currie D, Taioli E, Toniolo P, Garte SJ. A novel CYP1A1 gene
polymorphism in African-Americans. Carcinogenesis 1993;14:1729–31.
[24] Shah PP, Saurabh K, Pant MC, Mathur N, Parmar D. Evidence for increased
cytochrome P450 1A1 expression in blood lymphocytes of lung cancer
patients. Mutat Res 2009;670:74–8.
[25] Agundez JA. Cytochrome P450 gene polymorphism and cancer. Curr Drug
Metab 2004;5:211–24.
[26] Autrup H. Genetic polymorphisms in human xenobiotica metabolizing
enzymes as susceptibility factors in toxic response. Mutat Res 2000;464:
65–76.
[27] Giuliano AR, Sedjo RL, Roe DJ, et al. Clearance of oncogenic human papilloma
virus (HPV) infection: effect of smoking (United States). Cancer Causes Control
2002;13:839–46.
[28] Li H, Xiao D, He T. Association of CYP1A1 polymorphisms with prostate cancer
risk: an updated meta-analysis. Mol Biol Rep 2012;39:10273–84.
[29] Ozturk T, Kahraman OT, Toptas B, et al. The effect of CYP1A1 and GSTM1 gene
polymorphisms in bladder cancer development in a Turkish population. In
Vivo 2011;25:663–8.
[30] Liu G, Ghadirian P, Vesprini D, et al. Polymorphisms in GSTM1, GSTT1 and
CYP1A1 and risk of pancreatic adenocarcinoma. Br J Cancer 2000;82:1646–9.
[31] Chen C, Huang Y, Li Y, Mao Y, Xie Y. Cytochrome P450 1A1 (CYP1A1) T3801C
and A2455G polymorphisms in breast cancer risk: a meta-analysis. J Hum
Genet 2007;52:423–35.
[32] Mrozikiewicz PM, Grzeskowiak E, Seremak-Mrozikiewicz A, et al. Importance
of CYP1A1 polymorphism and its transcriptional regulation in ovarian and
endometrial cancer. Ginekol Pol 2011;82:925–32.
[33] Kumar V, Yadav CS, Singh S, et al. CYP 1A1 polymorphism and organochlorine
pesticides levels in the etiology of prostate cancer. Chemosphere 2010;
81:464–8.
[34] Aktas D, Guney I, Alikasifoglu M, Yuce K, Tuncbilek E, Ayhan A. CYP1A1 gene
polymorphism and risk of epithelial ovarian neoplasm. Gynecol Oncol
2002;86:124–8.
[35] Hung RJ, Boffetta P, Brockmoller J, et al. CYP1A1 and GSTM1 genetic poly-
morphisms and lung cancer risk in Caucasian non-smokers: a pooled analysis.
Carcinogenesis 2003;24:875–82.
[36] Karina C, Iris E, Dante C, et al. Oral cancer susceptibility associated with the
CYP1A1 and GSTM1 genotypes in Chilean individuals. Oncol Lett 2010;1:549–
53.
[37] Sugawara T, Nomura E, Sagawa T, Sakuragi N, Fujimoto S. CYP1A1 polymor-
phism and risk of gynecological malignancy in Japan. Int J Gynecol Cancer
2003;13:785–90.
[38] Marchand LL, Sigfried A, Lum A, Wilkins LR, Lau AF. Association of CYP1A1,
GSTM1 and CYP2E1 polymorphisms with lung cancer suggest cell type spe-
cifications to tobacco carcinogens. Cancer Res 1998;58:4858–63.
[39] Xian-Tao Z, Ping-An X, Chun-Yi L, Yi G. Passive smoking and cervical cancer
risk: a meta-analysis based on 3,230 cases and 2,982 controls. Asian Pacific J
Cancer Prev 2012;13:2687–93.
[40] Abbas M, Srivastava K, Imran M, Banerjee M. Association of Glutathione S-
transferase (GSTM1, GSTT1 and GSTP1) polymorphisms and passive smoking
in cervical cancer cases from North India. Int J Biomed Res 2013;12:655–62.
[41] Trimble CL, Genkinger JM, Burke AE, et al. Active and passive cigarette smoking
and the risk of cervical neoplasia. Obstet Gynecol 2005;105:174–81.
[42] Szarewski A, Jarvis MJ, Sasieni P, et al. Effect of smoking cessation on cervical
lesion size. Lancet 1996;347:941–3.