Ministry of Health of the Republic of Moldova

State Medical and Pharmaceutical University

„Nicolae Testemitanu‖

Molecular Biology

Chisinau, 2012

1
 CONTENT
I. INTRODUCTION TO CELL AND MOLECULAR BIOLOGY. GENERAL PRINCIPLES OF
CELLULAR ORGANIZATION .....................................................................................................4
Common characteristics of living cells .......................................................................................4
Levels of organization of biological systems ..............................................................................4
Cell – morphological and structural unity of life ........................................................................5
Comparative characterization of prokaryotes and eukaryotes .....................................................5
Viruses .........................................................................................................................................6
II. CHEMICAL ORGANIZATION OF CELLS. MACROMOLECULES ....................................7
CARBOHYDRATES ..................................................................................................................7
LIPIDS .........................................................................................................................................7
PROTEINS ..................................................................................................................................7
NUCLEIC ACIDS .......................................................................................................................9
DNA ..........................................................................................................................................11
RNA ...........................................................................................................................................14
III. BIOLOGICAL MEMBRANES ..............................................................................................16
Functions of biological membranes ...........................................................................................16
Membrane Structure ..................................................................................................................16
Fluid mosaic model ...................................................................................................................19
Membrane biogenesis ................................................................................................................19
Transport through the membrane ..............................................................................................19
DIVERSITY OF BIOLOGICAL MEMBRANES ....................................................................24
Plasma membrane ......................................................................................................................25
Intercellular connections and communication ...........................................................................26
IV. COMPARTMENTALIZATION OF EUKARYOTIC CELL.................................................27
ER - endoplasmic reticulum ......................................................................................................28
Golgi complex (Golgi apparatus) ..............................................................................................29
Lysosomes .................................................................................................................................30
Peroxisomes ...............................................................................................................................32
Nucleus ......................................................................................................................................33
Mitochondrion ...........................................................................................................................34
Ribosomes .................................................................................................................................34
Cytoskeleton ..............................................................................................................................35
V. NUCLEUS ................................................................................................................................37
Chromatin ..................................................................................................................................37
Levels of DNA condensation ....................................................................................................38
Nuclear Envelope ......................................................................................................................40
Karyoplasm ................................................................................................................................41

2
 Nucleolus ...................................................................................................................................41
VI. THE GENE .............................................................................................................................43
Peculiarities of organization of the structural (II-nd class) genes in eukaryotic cells .................44
Organization Peculiarities of genes Encoding rRNA and tRNA ...............................................45
Mitochondrial Genome ..............................................................................................................45
THE PECULIARITIES OF PROKARYOTES GENES ORGANIZATION ...........................46
VII. TRANSCRIPTION AND RNA PROCESSING ...................................................................48
Components required for transcription: .....................................................................................48
Particularities of Transcription of Eukaryotic Structural Genes ...............................................49
RNA PROCESSING .................................................................................................................52
PARTICULARITIES OF I-ST AND IIIrd CLASS GENES TRANSCRIPTION .......................53
Transcription in Mitochondria ...................................................................................................54
Transcription in prokaryotes......................................................................................................54
VIII. TRANSLATION ..................................................................................................................55
THE GENETIC CODE .............................................................................................................55
The Components Required for Translation ...............................................................................56
THE MECHANISM OF TRANSLATION ...............................................................................58
POST-TRANSLATIONAL EVENTS ......................................................................................60
IX. DNA REPLICATION AND REPAIR ....................................................................................61
Components required for replication: ........................................................................................61
MECHANISMS OF REPLICATION .......................................................................................61
DNA REPAIR ...........................................................................................................................64
MECHANISMS OF DNA REPAIR .........................................................................................65
X. THE CELL CYCLE .................................................................................................................67
Interphase...................................................................................................................................67
Mitosis .......................................................................................................................................68
Regulation of the cell cycle .......................................................................................................70
Apoptosis ...................................................................................................................................71
XI. RECOMBINATION OF GENETIC MATERIAL..................................................................73
STAGES OF MEIOSIS .............................................................................................................73
Fertilization................................................................................................................................76
XII. METHODS OF MOLECULAR GENETICS ........................................................................77
ISOLATION OF NUCLEIC ACIDs .........................................................................................77
DNA CLONING .......................................................................................................................77
POLYMERASE CHAIN REACTION (PCR) ..........................................................................79
DNA SEQUENCING ................................................................................................................82
HYBRIDIZATION OF NUCLEIC ACIDS ..............................................................................83

3
 I. INTRODUCTION TO CELL AND MOLECULAR BIOLOGY. GENERAL
PRINCIPLES OF CELLULAR ORGANIZATION

Biology is a science that studies life. It is based on the fundamental laws of nature
embodied in chemistry and physics. The field of biology today is so wide, that it has been
divided into some separate disciplines. Molecular biology is one of these disciplines. The term
molecular biology was first used in 1945 by William Astbury and was referred to the study of the
chemical and physical structure of biological macromolecules (biopolymers). By that time
biochemists had discovered many fundamental intracellular chemical reactions and explained the
importance of proteins in cell activity. In 1953, scientists identified that DNA was the
macromolecule containing the genetic information of a cell. Following this discovery, the new
field of molecular genetics appeared. In the late 1970, a new method – recombinant DNA
technology – was elaborated. This provided new tools and, in time, information about all cells
became available at an extraordinary rate. As the molecular mechanisms of life have become
clearer, the underlying similarities became more impressive than the differences. Biologists are
confident that a limited number of general principles, summarizing common molecular
mechanisms, will eventually explain even the most complex life processes in terms of chemistry
and physics.

Common characteristics of living cells

There are certain common characteristics of all living organisms: growth, reproduction,
homeostasis, metabolism, sensitivity, and energy acquisition.
1. Growth and development. Even single-celled (unicellular) organisms grow. When first
formed by cell division, the cells are small, and must grow and develop into mature cells.
Multicellular organisms pass through a more complicated process of differentiation and
organogenesis.
2. Reproduction. All living things must be able to reproduce. Through reproduction the
species continues to survive. All their hereditary characteristics that determine a species and
make it suitable for a particular environment are transmitted to their offspring.
3. Homeostasis. It is the maintenance of a constant internal environment in terms of
temperature, pH, water concentrations etc. An organism adjusts its metabolism to maintain stable
internal conditions for an effective functioning of the organism.
4. Metabolism. All living beings must have a metabolism, the ability to carry out chemical
reactions and exchange substances.
5. Sensitivity is the ability to respond to stimuli (both internal and external).
6. Energy acquisition and release. One view of life is that it is a struggle to acquire energy
(from sunlight, inorganic chemicals or another organisms), and release it in the process of
forming ATP.

Levels of organization of biological systems

Life on Earth is incredibly extensive and, to make it easier to study, biologists have broken
living systems up into generalized hierarchical levels:
 molecules
 cells
 tissues
 organisms
 populations
 communities
 ecosystems
 biosphere
4
 The focus of this course is the fundamentals of life, the properties that are held in common
among all living things. We will concentrate almost exclusively on molecular and cellular levels.

Cell – morphological and structural unity of life

Cells are the structural units of all living beings (with the possible exception of viruses).
All cells have the following characteristics in common.
 CELL MEMBRANE that separates the chaos outside a cell from the high degree of
organization within the cell. A cell without a cell membrane is not a cell.
 CONTAINS DNA as its genetic material. All cells contain several varieties of RNA
molecules and proteins; most of them are enzymes.
 All cells are composed of the same BASIC CHEMICALS: carbohydrates, proteins,
nucleic acids, minerals, fats and vitamins.
 All cells REGULATE the flow of nutrients and wastes that enter and leave the cell.
 All cells REPRODUCE and are the result of reproduction.
 All cells require a SUPPLY OF ENERGY.
 All cells are HIGHLY REGULATED by ELABORATING SENSING SYSTEMS
(chemical ―noses‖) that allow them to be aware of every reaction and many of the environmental
conditions around them; this information is continually PROCESSED to make metabolic
decisions.

The above criteria are the minimal requirements of life. Two general cell types have
evolved: prokaryotic and eukaryotic cells. Current data supports the theory that prokaryotes
represent the initial or primitive (the simplest) cell type on earth and that eukaryotic cell types
evolved from them. There is strong data to support the idea that eukaryotes evolved from
aggregates of prokaryotic cells that became interdependent upon one another and eventually
merged (fused) into a single larger cell. Eukaryotic cells are structurally and biochemically more
complex than prokaryotes. They contain many membrane-bound organelles (cell structures with
specific molecular organization and distinct functions), whereas prokaryotic cells contain no
organelles.

Comparative characterization of prokaryotes and eukaryotes

The both cell types do have DNA as genetic material (thus also possessing different RNAs,
ribosomes and proteins), have an exterior membrane (plasma membrane), and are very diverse.
Prokaryotes are bacteria and blue green algae (Kingdom Monera). Prokaryotes are cells
ribosomes without a nucleus and membrane-bound organelles. They have
genetic material, which is however not enclosed
within a membrane. The genetic material is a
single circular DNA situated in the cytoplasm.
The prokaryotic DNA is associated with
proteins, which can be easily separated. The
reproduction of prokaryotes is through binary
fission (no sexual process takes place).
Nevertheless, there is a way for the exchange of
genetic information through transfer of
plasmids (short circles of DNA that pass from
one bacterium to another). Often plasmids carry
genes of resistance to antibiotics. The prokaryotes do not engulf
Fig. 1.Bacterium
Structure solids nor do they have centrioles. The membrane of prokaryotes
lacks cholesterol. Prokaryotes have a cell wall made up of
peptidoglycan. The cytoplasm of prokaryotes is motionless. Any internal membranes are

5
elaborations of the plasma membrane and are known as mesosomes. The mesosome is believed
to play the role of ATP synthesis or energy center of prokaryotic cell.
Eukaryotes form the remaining four kingdoms: Protista (ex.: Protozoa like Amoeba or
Trypanosoma; Algal Protists such as Euglena or Chlamydomonas; and Fungus-like Protists,
which include species of Myxomycota or slime molds), Fungi (yeasts, rusts, smuts, puffballs,
truffles, molds), Plantae (plants), and Animalia (animals and humans). These are cells with a
nucleus – an organelle where the genetic material is surrounded by an envelope (double
membrane). The genetic material is encoded by linear DNA molecules that in complex with
proteins form multiple chromosomes. Eukaryotes also contain membrane-bound organelles
(Endoplasmic Reticulum (ER), Golgi apparatus (GA), lysosomes, peroxisomes, mitochondria,
vesicles, endosomes) and some non-membranous organelles (ribosomes, nucleolus, cenrioles).
The most complex eukaryotes are composed of plant and animal cells. Plants vary from
animal cells in that they have large vacuoles, cell wall, chloroplasts, and a lack of lysosomes,
centrioles, pseudopods, and flagella or cilia. Animal cells do not have the chloroplasts, and may
or may not have cilia, pseudopods or flagella, depending on the type of cell.

Viruses
A virus is a submicroscopic infection particle composed of a protein coat and a nucleic
acid core. The diameter of viral particles is 20-30 nm. Thus, they are much smaller than any
prokaryotic cell. Viruses, like cells, carry genetic information encoded in their nucleic acid, and
can undergo mutation and reproduce; however they cannot carry out metabolism.
Viruses are obligated intracellular parasites, meaning that they require host cells to
reproduce. In the viral life cycle, a virus infects a cell, allowing the viral genetic information to
direct the synthesis of new virus particle by the cell. Outside the cell they can only be in non-
replicative state, as they lack enzymes necessary for complete reproduction of virus particle.
There are many kinds of viruses. Viruses are classified by the type of nucleic acid they
contain and the shape of their protein capsule. They can be: DNA – containing and RNA-
containing. DNA-containing viruses can be spiral, octahedral, complex without envelope,
complex with envelope. RNA – containing viruses have RNA instead of DNA and the enzyme
reverse transcriptase. Once inside the host cell, reverse transcription (making DNA from RNA)
is accomplished by the reverse transcriptase. This new DNA is incorporated into the host DNA,
where it transcribes new viral RNA genomes, as well as the RNA to synthesize new reverse
transcriptase and protein capsules.
Viruses cause a variety of diseases among all groups of living organisms. Viral diseases
include the flu, common cold, herpes, measles, chicken pox and encephalitis.
Bacteriophages (viruses that infect bacteria) invade the host cell and begin replicating
viruses, eventually lysing or bursting the host cell, realizing the new viruses.

6
 II. CHEMICAL ORGANIZATION OF CELLS. MACROMOLECULES
The most frequent chemical elements of living cells are H, C, N, O, P, S, representing 99%
of cell mass. These elements form the organic molecules of the cells - biomolecules: nucleic
acids, proteins, carbohydrates, and lipids.
Organic substances are represented by simple substances and polymers (biopolymers). The
polymers are macromolecules made of monomers. Monomers are linked together through
covalent bonds, which occur when electrons are shared between atoms; this form of bond is
strongest and is found in both energy-rich molecules and molecules essential to life.
Some polymers – the homopolymers – are made from only one type of monomers (ex:
cellulose, starch), other – the copolymers (heteropolymers) – are composed from different types
of monomers (ex: DNA, RNA, proteins). Proteins and nucleic acids are responsible for
conveying genetic information. Nucleic acids carry the information, while proteins provide the
means for executing it. The sequence in which the individual building blocks are joined is the
critical feature that determines the property of the resulting macromolecule.
A polymer has:
- a backbone consisting of a regularly repeating series of bonds;
- side-groups of characteristic diversity that stick out from the backbone.
The process of polymers‘ synthesis is called polymerization (or polycondensation). The
process of polymers‘ destruction is named hydrolysis.

CARBOHYDRATES
The general formula of carbohydrates is Cx(H2O)y, where x and y can be grater then 3.
There are several types of carbohydrates: monosaccharides (glucose, fructose, ribose,
deoxyribose), disaccharides (sucrose), oligosaccharides (different types of cellular receptors)
and polysaccharides (cellulose, starch, glycogen). The monomers are linked by glycosidic
bonds.
The main functions of carbohydrates are structural, energetic and depositary.

LIPIDS
Lipids are organic substances insoluble in water, but soluble in nonpolar solvents
(chloroform, ether). The simplest lipids are the fatty acids with the general formula R-COOH,
where R is the hydrocarbon tail. Fatty acids can also be constituents of more complex lipids such
as triacylglycerols, glycerophospholipids, and sphingolipids, as well as waxes and
eicosanoids. On the other hand there are structurally distinct lipids like steroids and lipid
vitamins which are derived from a five carbon molecule called isoprene.
Lipids can be divided in structural lipids (lipids from membranes) and storage lipids.
Functions of lipids: energetic; structural; mechanical; hormonal; vitamins.

PROTEINS
Each protein consists of a unique sequence of amino acids. A
free amino acid contains an amino group, a carboxyl group (constant
part) and a side group (variable part) (fig. 2). Depending on the
structure of side group there are four types of amino acids: basic,
acidic, neutral and hydrophobic. There are about 150 types of amino
acids; only 20 however participate in protein synthesis.
Amino acids are joined into a chain by peptide bonds (fig. 3),
which are created by the condensation of carboxyl (COOH) group of
one amino acid with the amino (NH2) group of the next one. A longer
chain of amino acids joined in this manner is called a polypeptide.
Fig. 2. The general The protein represents the functional unit, which may consist of one
structure of amino acids
or more polypeptide chains.

7
A critical feature of protein is its ability to fold into a three dimensional conformation. A major
force underlying the acquisition of conformation in
all proteins is the formation of non-covalent bonds:
- Hydrogen bonds are weak electrostatic bonds
that arise between NH and C=O groups of the
peptide backbone. Although these bonds are weak,
the number of hydrogen bonds formed in a
macromolecule may be significant and their overall
contribution to the stability of the conformation is
Fig. 3. Primary structure of proteins substantial. Despite of this, physical (high
temperature) and physiological (action of enzymes)
factors are often causes of hydrogen bonds disruption.
- Ionic bonds occur between groups
that have opposite charges (usually between
acidic and basic amino acids).
- Hydrophobic bonds occur between
amino acids with apolar side chains, which
aggregate together to exclude water.
- Van der Waals attraction – very
weak interactions between atoms.
There is also a covalent bond -
disulphide bond formed between the sulphur
atoms of cysteine.
The conformation can be described in
terms of several levels of structure.
 The primary structure – the sequence Fig. 4. A, B - α-helix; C, D - β-seets
of amino acids linked into polypeptide chain. This linear sequence
is the essential information encoded by genetic material (DNA)
(fig. 3).
 The primary structure folds into secondary structure,
which describes the path that the polypeptide backbone of the
protein follows in the space. Hydrogen bonding between groups
on the same polypeptide chain causes the backbone to twist into a
helix (α-helix; ex: keratin, myosin) or sheet-like structure (β-
sheet; ex: fibroin, collagen) (fig. 4).
 The tertiary structure describes the three dimensional
Fig. 5. Tertiary structure of organization of all the atoms in the polypeptide chain. This
proteins involves side chain interactions and packing of secondary
structure motifs (a combination of α-helixes and β-sheets; ex:
enzymes, myoglobin, globulins) (Fig. 5).
 The highest level of organization – quaternary structure –
occurs in multimeric proteins, which consist of aggregates of two
or more polypeptide chains. The individual chains that make up a
multimeric protein are called protein subunits. Fig. 6 represents
the structure of hemoglobin, which consists of two α chains and
two β chains.
Among the major bio-organic molecules, only proteins
require up to four levels of structure in order to be functional.
Fig. 6. Quaternary structure of
hemoglobin

8
 Some environmental factors
(high or low temperature, pressure,
light etc.) can convert the protein
from the physiological conformation
to some other (inactive) conformation
by disruption of non-covalent bonds
or disulphide bonds – protein
denaturation. If only non-covalent
bonds are broken protein
renaturation is possible by refolding
of a previously unfolded protein into
its native state (fig. 7).

Fig. 7. Protein Denaturation and Renaturation

The proteins are located everywhere in the cell and have many functions:
 Catalytic – serve as enzymes (DNA-polymerase, RNA-polymerase);
 Hormonal – regulation of metabolism (insulin);
 Reception – interaction with hormones or other signal molecules;
 Transport – (Na+/K+ pump, hemoglobin);
 Structural – in membranes, ribosome etc.;
 Immunologic – antibodies (IgA, IgM, IgG).

NUCLEIC ACIDS
There are two types of nucleic acids: DNA (deoxyribonucleic acid) and RNA (ribonucleic
acid). A nucleic acid consists of a chemically linked sequence of monomers – nucleotides. Each
nucleotide contains a nitrogenous base, a pentose sugar and a phosphate group. Nitrogenous
bases fall into two types: Purines (A, G) and Pyrimidines (C, T, U). The bases from DNA are
A, G, C, T and the bases from RNA are A, G, C, U. In DNA pentose is 2-deoxyribose; whereas
in RNA it is ribose (fig. 8).

Cytosin
e
Fig. 8. Nucleotides Components: Nitrogenous Bases and Pentose Sugars

The base is linked to pentose ring in position 1‘ through a glycosidic bond with
participation of N1 of pyrimidines or N9 of purines. A base linked to a sugar forms a nucleoside.
When a phosphate group is added, the base-sugar-phosphate is called nucleotide (Tab. 1; Fig. 9)

9
Table 1. Bases, nucleosides and nucleotides
Abbreviation Abbreviation Abbreviation
Base Nucleoside Nucleotide (1P) (2P) (3P)
RNA DNA RNA DNA RNA DNA
Adenilic
Adenine Adenosine AMP dAMP ADP dADP ATP dATP
acid
Guanilic
Guanine Guanosine GMP dGMP GDP dGDP GTP dGTP
acid
Cytidilic
Cytosine Cytidine CMP dCMP CDP dCDP CTP dCTP
acid
Thymidilic
Thymine Thymidine dTMP dTDP dTTP
acid
Uridylic
Uracil Uridine UMP UDP UTP
acid

Fig. 9. Nucleoside Triphosphates – Monomers of DNA (left) and RNA (right)

Nucleotides are building blocks from

which nucleic acids are constructed.
The nucleotides are linked into a
polynucleotide chain. The 5‘ position
of one pentose ring is connected to the
3‘ position of the next pentose ring via
a phosphate group. The bond that link
nucleotides is called phosphodiester
bond (fig. 10)
Number, type and sequence of
nucleotides in polynucleotide chain
represent the primary structure of
nucleic acids.

Fig. 10 Polynucleotide Chain

10
 DNA
DNA represents the molecule of heredity and
variability, which contains the genetic program of
an organism, ensuring the passage of characteristic
traits from one generation to another.
The molecule of DNA represents a double
helix, which consists of two polynucleotide chains
associated by hydrogen bounding between the
nitrogenous bases. There are 3 H-bonds between G Fig. 11. Complementary Base Pairing
and C and 2 H-bonds between A and T (fig. 11).
These reactions are described as base
pairing, and the paired bases are said to be
complementary. The polynucleotide chains
run in opposite directions – are antiparallel
(fig. 12).
The double helix of antiparallel
polynucleotide chains linked by hydrogen
bonds between purines and pyrimidines
represents the secondary structure of DNA.
This structure was established in 1953 by
James Watson and Francis Crick. Each base
pair (bp) is rotated ~360 around the axis of the
helix relative to the next pair. Thus ~10 base
pairs make a complete turn of 3600. The
twisting of the two strands around each other
forms a double helix with narrow groove
(~12 Ă across) and a wide groove (22 Ă
across). The double helix is right-handed (fig.
12).
The complementarity of DNA bases assure:
Fig. 12. The double helix of DNA – 2  DNA stability;
antiparallel chains bounded by hydrogen bonds  Replication;
 Transcription;
 Recombination;
 DNA repair.
Different conditions (heating in laboratory experiences or in vivo action of enzymes, such
as DNA-helicases) determine the conversion of the molecule from
double-stranded to the single-stranded state. This process is called DNA
denaturation. Slow cooling of DNA or action of enzymes may determine
the DNA renaturation – reassociation of denatured complementary
single strands of a DNA into a double helix.
DNA can exist in more than one type of double-helical structure.
Each family represents a characteristic type of double helix described by
parameters n (number of nucleotides per turn) and h (the distance
between adjacent repeating units) (Tab. 2). The B-form represents the
general structure of DNA under conditions of a living cell (fig. 13). The
A-form is probably characteristic for hybrid duplex with one strand of
DNA and one strand of RNA. This may occur during transcription. The
Z-form is the only left-handed helix. Its name arises from the zigzag path
that the sugar-phosphate backbone follows along the helix.
Fig. 13. B-DNA
11
 Table 2. Parameters of double-helical DNA structures
Parameters of helix A–DNA B–DNA Z–DNA
Direction Right-handed Right-handed Left-handed
Base pair in turn 11 10,4 12
Distance between bases (Å) 2,9 3,4 3,7
Helical diameter (Å) 25,5 23,7 18,4
The total length of DNA contained within the genome of
an organism varies depending on its genetic complexity, and
may fluctuate from micrometers (viruses) or millimeters
(bacteria), to several centimeters (in higher eukaryotes).
Therefore, the DNA must be organized and packed into higher
order forms within the cell, and DNA molecules in vivo may Fig. 14. Supercoiling of Circular
acquire a compact shape by existing in circular forms (ex: in DNA
prokaryotes), where the two ends of a linear DNA are
covalently bound to each other. These circular
DNA molecules can be twisted into supercoiled
molecules to adopt an even more condensed
configuration than the ―relaxed‖ circular
equivalent (fig.14). In prokaryotic cells, this
supercoiling of the DNA is critical for DNA
packaging into the cells. In prokaryotes the
superhelical state of the DNA plays an
important part in various biological processes
Fig. 15. DNA Packing in Prokaryotes
including replication, transcription and
recombination, by altering the accessibility of
the DNA to proteins (fig. 15).
In eukaryotes the DNA is packed (condensed)
in the nucleus (0.5mm in diameter) with the help of
basic polypeptides called histones (fig. 16). There are
5 classes oh histones: H1, H2A, H2B, H3, H4. Each
DNA molecule is packed in the form of a
chromosome. Chromosomes are composed of
chromatin, a densely staining material initially
recognized in two different forms: highly condensed
heterochromatin and more diffuse euchromatin.
Decondensed chromatin resembles ―beads on a
string‖. Each bead, called nucleosome, contains about Fig. 16. Interaction of DNA with Histones in
two supercoils of DNA wrapped around a core Eukaryotes
histone octamer (made of 8 proteins). Interaction of
DNA with proteins represents the tertiary structure of DNA.

Properties of DNA Molecules

From the perspective of its function in replicating itself and being expressed as protein, the
central property of the double helix is the ability to separate the two strands without disrupting
covalent bonds. This allows the strands to get separated and reunited under physiological
conditions. The specificity of the process is determined by complementary base pairing.
Chemical structure and negative charging permit the interactions of DNA with other molecules.
The main properties of DNA are the following:
Replication – synthesis of new molecules identical with initial copy, which is possible due
to the double stranded state of the molecule.

12
 Repair – represents a range of cellular responses associated with restoration of primary
structure of DNA, based on complementarity of bases.
Denaturation - the conversion of the molecule from double-stranded to the single-stranded
state.
Renaturation – reassociation of denatured complementary single strands of a DNA into a
double helix.
Coiling, supercoiling and unwinding are properties of double helix to change its functional
states.
Chargaff’ rule – the quantity of purines is equal with quantity of pyrimidines ([G] = [C]
and [A] = [T]).
Flexibility – DNA ability to change the type (ex.: from B-DNA to A-DNA during
transcription).
Variability – the state of being variable, changeable. The tendency of individual genetic
characteristics in a population to vary from one another; is assured mainly by mutations and
recombination.
Recombination - the process of exchanges of fragments between different DNA molecules,
resulting in a different genetic combination.
Hybridization - the process of forming a double stranded nucleic acid from joining two
complementary strands of DNA (or RNA).

DNA Functions
DNA is the main genetic molecule of life that carries the hereditary information, which
determines the structure of proteins in all eukaryotic and prokaryotic organisms. It contains the
instructions by which cells grow, divide and differentiate, and has provided a basis for the
evolutionary process both within and between related species. DNA is the information-carrying
material that comprises the genes, or units of inheritance, which are arranged in linear arrays
along the chromosomes of the cell.

Heterogeneity of DNA in Eukaryotes

The total amount of DNA in the genome is characteristic for each living species and is
known as its C-value. There is enormous variation in the range of C-values (106-1011). There is a
discrepancy between genome size and genetic complexity, called C-value paradox:
 there is an excess of DNA compared with the amount that could be expected to code for
proteins;
 there are large variations in C-values between certain species whose apparent complexity
does not vary much.
There is a rough correlation between the DNA content and the number of genes in a cell or
virus. However, this correlation breaks down in several cases of closely related organisms where
the DNA content per haploid cell (C-value) varies widely. This C-value paradox is probably
explained, not by extra genes, but by extra noncoding DNA in some organisms.
Eukaryotic DNA may be divided in some groups depending on complexity: nonrepetitive
DNA – 45-56%; moderately repetitive DNA – 8-30%; highly repetitive DNA – 12-25%.
Nonrepetitive DNA consists of sequences existing in genome in one or a few copies and
usually encodes information about proteins.
Moderately repetitive DNA consists of families of sequences that are not exactly the same,
but are related. In human genome such sequences are represented by genes encoding for
histones, rRNA, actins. Another example is Alu family – short fragments (~300 bp (base pairs))
distributed among the nonrepetitive sequences.
Highly repetitive DNA represents very short sequences repeated many times in tandem in
large clusters. They are also called simple sequences or satellite DNA. The simple sequences are
located mainly in the heterocromatine, especially around the centromere. The tandem clusters of
satellite DNA are highly polymorphic, with wide variations between individuals. Such
13
sequences, called minisatellites, can be used to characterize individual genomes in the technique
of ―DNA fingerprinting‖.
Additional classes of highly repeated
DNA are palindromes, which consist of
inverted repeats – a region of dyad symmetry
(fig. 17). In a double-strand DNA, the
complementary sequences on one strand have Palindrome
the opportunity to base pair only if the strand
separates from its partner. As a result a
hairpin could be formed. The formation of
two apposed hairpins creates a cruciform.
Palindromes are very important for DNA
interactions with proteins; they serve as
indicators in the processes of initiation and
termination of transcription, replication etc. Fig. 17. The structure of palindrome and cruciform

RNA
Molecules of RNA represent single-stranded polymers and consist of nucleotides linked by
phosphodiester bonds 3‘-5‘ (some viral RNA may be double-stranded). The primary structure of
RNA represents a sequence of nucleotides covalently linked through 3,5-phosphodiester bonds
into an unbranched single-stranded chain. The four major bases in RNA are the purines adenine
and guanine, and the pyrimidines cytosine and uracil (A, G, C, and U, respectively). The thymine
nucleoside (T) in DNA is transcribed into U in RNA.
Regions of complementarity within a single-stranded RNA sequence can base-pair with
one another to generate double-stranded regions of secondary structure (hairpin loops). U base-
pairs with A, and G with C, via hydrogen bonding. Further folding can take place to form
complex tertiary structures. The cloverleaf structure of the tRNA molecule is possibly the best-
defined RNA secondary structure (fig. 18).

Fig. 18. A - Secondary structure of tRNA (cloverleaf); B – Tertiary structure of tRNA

Both prokaryotic and eukaryotic cells contain messenger RNA (mRNA), transfer RNA
(tRNA) and ribosomal RNA (rRNA), all of which are involved in various ways in the accurate
conversion of genetic information (in the form of DNA) into protein. This process in eukaryotic
cells also involves two additional classes of RNA - heterogeneous nuclear (or pre-messenger)
14
RNA (hNRNA or pre-mRNA) and small nuclear RNAs (snRNA). All cellular RNAs are
synthesized through the process of transcription, in which a complementary RNA copy of a
DNA template is made.
Messenger RNA is a temporary complementary copy of the sense strand (anticoding
strand) of protein-coding DNA. Messenger RNAs range in length from a few hundred to many
thousands of nucleotides depending largely upon the size of the protein they encode. An mRNA
contains a region that specifies the protein sequence (the protein-coding region), flanked on
either sides by untranslated regions (5‘ and 3‘ untranslated regions). The coding region
represents a sequence of codons, each codon being made of three nucleotides. The sequence of
codons specifies the amino-acid sequence of the polypeptide chain, with each codon representing
a particular amino acid. The mature mRNA molecule is transported to the cytoplasm where it is
translated into protein on the ribosome.
Table 3. Types of rRNAs Ribosomal RNA is a major structural
component of the ribosome. It participates in
Sedimentati
Length the process of protein biosynthesis. Depending
Type of cell on
(bases) on sedimentation coefficient, there are several
coefficient
classes of rRNAs in prokaryotic and eukaryotic
5S 120
cells (Table 3). Sedimentation coefficient
Prokaryotes 16S 1540
characterizes the speed of sedimentation of
23S 2900
particle during centrifugation. As the
5S 120 sedimentation coefficient is dependent on the
5,8S 160 mass of the particle it can be used to estimate
Eukaryotes
18S 1900 molecular mass. Larger molecules have higher
28S 4700 values of sedimentation coefficient.
Sedimentation coefficients are generally expressed as Svedberg units [S].
Transfer RNAs are small RNAs (70-80 nucleotides), which have a key role in translation
(fig. 17). They act as ―adaptor‖ molecules, each tRNA molecule having a 3-base anticodon
complementary to one of the codons, and also having a site at which the appropriate amino acid
is attached. During translation, the anticodon on the charged tRNA pairs with the codon on the
mRNA within the ribosome, and the amino acid is then transferred from the tRNA to the
growing polypeptide chain. Accuracy in the mRNA codon:tRNA anticodon interaction, and in
the recognition of amino acids by tRNAs is central to the insertion of the appropriate amino acid
into the polypeptide chain during translation. There are at least 20 types of tRNAs in the cell
(according to the number of amino acids participating in translation). The maximal number of
tRNA types is 61.
Small nuclear RNAs (snRNA) are present only in eukaryotes. They are parts of some
nuclear enzymatic complexes (primase, telomerase) and participate in the post-transcriptional
modification of RNA.
Heterogeneous nuclear RNAs (hnRNA) represent the primary RNA transcripts, which
are found in the nucleus. It is, as the name implies, a heterogeneous collection of RNA molecules
which are on average some four to five times larger than matured mRNAs and in some cases
more unstable.
Short interfering RNAs (siRNA), as well as microRNA (miRNAs) are 2 classes of
double-stranded RNAs, which are the effector molecules of RNA interference - an endogenous
post-transcriptional gene-silencing mechanism with a great clinical potential. In other words,
siRNAs and miRNAs can knockdown the homologous mRNAs associated with different
diseases.
Small cytoplasmic RNA (scRNA) are small (7S; 129 nucleotides) RNA molecules found
in the cytosol and rough endoplasmic reticulum associated with proteins that are involved in
specific selection and transport of other proteins.

15
 III. BIOLOGICAL MEMBRANES
A biological membrane (biomembrane) is an enclosing or separating layer (possessing
both hydrophilic and hydrophobic properties) that acts as a selective barrier within or around
a cell. Cell membranes define and compartmentalize space, regulate the flow of materials, detect
external signals, and mediate interactions between cells.

Functions of biological membranes

 Biological barrier;
 Selective transportation of ions, micromolecules and macromolecules;
 Receiving and delivering of intracellular and extracellular signals;
 Support for a number of enzymes;
 Enclosing of compartments (organelles) in eukaryotic cells;
 Control of intracellular and intercellular homeostasis.

Membrane Structure
Biological membranes are made of three main components: lipids, proteins and
carbohydrates. All membranes have common general structures, which is highly fluid and most
of the lipid and protein molecules can move about in the plane of the membrane. The lipid and
protein molecules are held together mainly by non-covalent interactions. Sugars are attached by
covalent bonds to some of the lipid and protein molecules.
Lipids
The cell membrane consists of several classes of lipids: phospholipids, glycolipids,
and steroids. The amount of each depends upon the type of cell, but in the majority of cases
phospholipids are the most abundant.
Lipids constitute approximately 50% of the mass of
most biological membranes, although this proportion varies
depending on the type of membrane. Plasma membranes, for
example, are approximately 50% lipid and 50% protein. The
inner membrane of mitochondria, on the other hand, contains
an unusually high fraction (about 75%) of protein, reflecting
the abundance of protein complexes involved in electron
transport and oxidative phosphorylation. The lipid
Fig. 19. Diagram of the composition of different cell membranes also varies.
arrangement of amphipathic lipid Mammalian plasma membranes, for example, are complex,
molecules to form a lipid bilayer. containing four major phospholipids: phosphatidylcholine,
Individual phospholipids can rotate phosphatidylserine, phosphatidylethanolamine, and
and move laterally within a bilayer. sphingomyelin, which together constitute 50 to 60% of total
membrane lipid.
The membrane (fig. 19) consists primarily of a thin layer
of amphipathic phospholipids, consisting of two hydrophobic fatty acid chains linked to a
phosphate-containing hydrophilic head group, which spontaneously arrange so that the
hydrophobic "tail" regions are shielded from the surrounding polar fluid, causing the more
hydrophilic "head" regions to associate with the cytosolic and extracellular faces of the resulting
bilayer. This forms a continuous, spherical lipid bilayer. The arrangement of hydrophilic and
hydrophobic heads of the lipid bilayer prevent polar solutes (e.g. amino acids, nucleic acids,
carbohydrates, proteins, and ions) from diffusing across the membrane, but generally allows for
the passive diffusion of hydrophobic molecules. This affords the cell the ability to control the
movement of these substances via transmembrane protein complexes such as pores and gates.

16
 The entire membrane is held together via non-
covalent interaction of hydrophobic tails; however the structure is
quite fluid and not fixed rigidly in place. Phospholipid molecules in
the cell membrane are "fluid" in the sense that they are free to diffuse
and exhibit rapid lateral diffusion along the layer in which they are
present. However, movement of phospholipid molecules between
layers is not energetically favorable and does not occur to an
appreciable extent. So, phospholipids freely move via rotational
movement (around the longitudinal axis of the molecule), lateral
movement (in the same layer of the membrane) and rarely flip to the
other layer – transversion or ―flip-flop‖. Flipping of phospholipids
from one layer to the other rarely occurs because flipping requires
the hydrophilic head to pass through the hydrophobic region of the
bilayer. Fig. 20. Insertion of
In animal cells cholesterol (a lipid-based molecule - steroid), cholesterol in a membrane.
is normally found dispersed in varying degrees throughout cell Cholesterol inserts into the
membranes, in the irregular spaces between the hydrophobic tails of membrane with its polar
hydroxyl group close to the
the membrane lipids (fig. 20). Cholesterol actually has two polar head groups of the
functions: I) To help stabilize the membrane. 2) To maintain phospholipids.
membrane flexibility as temperature changes. Normally the human
body is capable of producing all the cholesterol it needs. Dietary ingestion of excess saturated
fats and cholesterol is currently thought to be the source of the plaque that builds up in arteries
and can cause heart attacks and strokes.
Other membrane lipids are: glycolipids that contain sugar residues attached to a
phospholipid or sphingolipid, common in myelin; cardiolipids, which are diphosphatidyl
glycerols, found in heart mitochondria.

Carbohydrates
About 5%- 10% of the membrane weight is carbohydrate: glycoprotein and glycolipid.
They are involved in cell recognition.
In many eukaryotic and prokaryotic cells, carbohydrates-containing molecules from the
outer part of plasma membrane with their sugars exposed at the cell surface form the glycocalyx,
which is an important feature in all cells, especially epithelia with microvilli. Recent data suggest
the glycocalyx participates in cell adhesion, lymphocyte homing, and many others.

Proteins
Proteins are the other major constituent of membranes, constituting 25 to 75% of the mass
of the various membranes of the cell. While phospholipids provide the basic structural
organization of membranes, membrane proteins carry out the specific functions of the different
membranes of the cell. These proteins are divided into Integral proteins, lipid anchored proteins,
peripheral proteins (Table 4).
Most membrane proteins must be inserted in some way into the membrane. For this to
occur, an N-terminus "signal sequence" of amino acids directs proteins to the endoplasmic
reticulum, which inserts the proteins into a lipid bilayer. Once inserted, the protein is then
transported to its final destination in vesicles, where the vesicle fuses with the target membrane.
Many integral membrane proteins (called transmembrane proteins) span the lipid bilayer,
with portions exposed on both sides of the membrane. The membrane-spanning portions of these
proteins are usually α-helical regions of 20 to 25 nonpolar amino acids. The hydrophobic side
chains of these amino acids interact with the fatty acid chains of membrane lipids, and the
formation of an α helix neutralizes the polar character of the peptide bonds. Like the
phospholipids, transmembrane proteins are amphipathic molecules, with their hydrophilic
portions exposed to the aqueous environment on both sides of the membrane. Some
17
transmembrane proteins span the membrane only once; others have multiple membrane-spanning
regions. Most transmembrane proteins of eukaryotic plasma membranes have been modified by
the addition of carbohydrates, which are exposed on the surface of the cell and may participate in
cell-cell interactions.

Table 4. Types of Membrane Proteins

Type Description Examples

Span the membrane and have a hydrophilic
cytosolic domain, which interacts with internal
molecules, a hydrophobic membrane-spanning
Integral proteins Ion channels, proton
domain that anchors it within the cell membrane, and
or transmembrane pumps, G-protein-
a hydrophilic extracellular domain that interacts with
proteins coupled receptor
external molecules. The hydrophobic domain
consists of one, multiple, or a combination of α-
helices and β sheet protein motifs.
G-proteins (or GTP-
Covalently-bound to single or multiple lipid binding proteins) –
Lipid anchored molecules; are firmly attached to membrane and can involved in sending
proteins only be removed by treatments disrupting the messages (visual, taste,
membrane (using detergents or organic solvents). smell, some hormones)
across membranes
Attached to integral membrane proteins, or
associated with peripheral regions of the lipid
bilayer. These proteins are weakly bound to
Some enzymes, some
Peripheral proteins membrane, tending to have only temporary
hormones
interactions with biological membranes, and, once
reacted the molecule, dissociates to carry on its work
in the cytoplasm.

Proteins can also be anchored in membranes by lipids that are covalently attached to the
polypeptide chain. Distinct lipid modifications anchor proteins to the cytosolic and extracellular
faces of the plasma membrane.
By other classification, there are:
 Intrinsic membrane proteins that are embedded within the membrane. They may extend
through the membrane and project on both surfaces (transmembrane proteins) or just one
(anchored proteins). Ex.: glycophorin,
which is a glycoprotein with branched
oligosaccharide residues on the part of
the protein projecting on the outer
surface of the plasma membrane. It is
responsible for the MN blood group on
red blood cells.
 Extrinsic membrane proteins
are situated on the surface and are
loosely bound to the membrane
(peripheral proteins). They are easily
removed by mild treatments (altering
the pH or ionic strength). E.g.
cytochromes are found only on the

Fig. 21. Membrane 18

Structure
inner surface of the inner mitochondrial membrane (fig. 21).

Fluid mosaic model

The current model of membrane structure, frequently referred to as the fluid mosaic model,
is based on work completed by Seymour J. Singer and Garth L. Nicholson in 1972. Their
research revealed that the plasma membrane is a mosaic of integral proteins bobbing in a fluid
bilayer of phospholipids. This pattern is not static
because the positions of the proteins are constantly
changing, moving about like icebergs in a sea of lipids.
Peripheral proteins are not embedded in the lipid
bilyaer but are appendages loosely bound to the
membrane surface. Membrane carbohydrates on the
surface function as cell markers to distinguish one cell
from another. This model has been tested repeatedly
and has been shown to accurately predict the
properties of many kinds of cellular membranes; this
structure has also been confirmed using a technique known Fig. 22. Fluid Mosaic Model of
as freeze-fracture electron microscopy. Membrane Structure

Membrane biogenesis
Membranes grow by the expansion of pre-existing membranes. The membranes are
renewed by synthesis of its components on ER, processing and assembling in Golgi apparatus
and transportation in vesicles to plasma membrane or other organelles (Fig. 23).

Fig. 23. Scheme of

Membrane
Biogenesis
in Eukaryotic Cell

Transport through the membrane

Macrotransport Microtransport

◊ Endocytosis active transport passive transport co-transport

◊ Exocytosis carrier proteins diffusion, osmosis
◊ Transcytosis ionic pumps

Passive Transport (is performed in the energetically favorable direction, as determined by

concentration and electrochemical gradient)

19
 The selective permeability of biological membranes to small molecules allows the cell to
control and maintain its internal composition. Only small uncharged molecules can diffuse freely
through phospholipid bilayers. Small nonpolar molecules, such as O2 and CO2, are soluble in the
lipid bilayer and therefore can readily cross cell membranes. Small uncharged polar molecules,
such as H2O, also can diffuse through membranes (process called osmosis), but larger uncharged
polar molecules, such as glucose, cannot. So, the movement of substances from an area of higher
concentration to an area of lower concentration, independent from the motion of other molecules
with no energy requirement, is called simple diffusion.
Charged molecules, such as ions, are unable to diffuse through a phospholipid bilayer
regardless of size; even H+ ions cannot cross a lipid bilayer by free diffusion.

Fig. 24. Permeability of

phospholipid bilayers.
Small uncharged molecules
can diffuse freely through a
phospholipid bilayer.
However, the bilayer is
impermeable to larger polar
molecules (such as glucose
and amino acids) and to ions.

Although ions and most polar molecules cannot diffuse across a lipid bilayer, many such
molecules (such as glucose) are able to cross cell membranes. These molecules pass across
membranes through facilitated diffusion - via the action of specific transmembrane proteins,
which act as transporters. Such transport proteins determine the selective permeability of cell
membranes and thus play a critical role in membrane function. They contain multiple membrane-
spanning regions that form a passage through the lipid bilayer, allowing polar or charged
molecules to cross the membrane through a protein pore without interacting with the
hydrophobic fatty acid chains of the membrane phospholipids.
There are two general classes of membrane transport proteins:
 channel proteins form open pores through the membrane, allowing the free passage of
any molecule of the appropriate size. Ion channels (or ionophores), for example, allow the
passage of inorganic ions such as Na+ (carried by Monesin), K+ (carried by Valinomycin), H+
(transported by Proton carriers), Ca2+, and Cl- across the plasma membrane. Once open, channel
proteins form small pores through which ions of the appropriate size and charge can cross the
membrane by free diffusion. Not all pores formed by these channel proteins are permanently
open; rather, they can be selectively opened and closed in response to extracellular signals (gated
channels, which are specific ion channels that open only in response to a particular stimulus; ex.:
electrically gated channels, chemically gated channels), allowing the cell to control the
movement of ions across the membrane. Such regulated ion channels have been particularly well
studied in nerve and muscle cells, where they mediate the transmission of electrochemical
signals. Another example of channel proteins is aquaporin - water channel protein - that
accomplishes the water-transporting task. Water permeation through aquaporins is a passive
process that follows the direction of osmotic pressure
across the membrane (fig. 25). Aquaporins are crucial
for life and they are found in all organisms, from
bacteria to man. Aquaporins facilitate rapid, highly
selective water transport, thus allowing the cell to
regulate its volume and internal osmotic pressure
20

Fig. 25. Aquaporin

according to hydrostatic and/or osmotic pressure differences across the cell membrane. The
physiological importance of the aquaporin in human is perhaps most obvious in the kidney,
where ~150-200 liters of water need to be reabsorbed from the primary urine each day. In
kidneys, this is made possible mainly by two aquaporins denoted AQP1 and AQP2 (11 different
aquaporins are known in humans). Studies of water transport in various organisms and tissues
suggested that aquaporins have a narrow pore preventing any large molecule and ions flow while
maintaining an extremely high water permeation rate (~ 109 molecules H2O per channel per
second). Several diseases, such as congenital cataracts and nephrogenic diabetes insipidus, are
connected to the impaired function of these channels.
 In contrast to channel proteins, carrier proteins (fig. 26) selectively bind and transport
specific small molecules, such as glucose. Rather than forming open channels, carrier proteins
act like enzymes to facilitate the passage of specific molecules across membranes. In particular,
carrier proteins bind specific molecules and then undergo conformational changes that open
channels, through which the molecule to be transported can pass across the membrane and be
released on the other side. Carriers operate in the presence of a concentration gradient.

Fig. 26. Channel and carrier proteins (A) Channel proteins form open pores through which molecules
of the appropriate size (e.g., ions) can cross the membrane. (B) Carrier proteins selectively bind the small
molecule to be transported and then undergo a conformational change to release the molecule on the other
side of the membrane.
Active Transport is energetically consumable, usually is coupled to ATP hydrolysis as a
source of energy; it is performed against the gradient (Fig. 27).
As described so far, molecules may be transported by either channel or carrier proteins
cross membranes in the energetically favorable direction through passive transport. However,
carrier proteins, called pumps, provide a mechanism through which the energy changes are
associated with transporting molecules (such as small ions (Na+, K+, Cl-, H+), amino acids, and
monosaccharides) across a membrane. Molecules are transported in an energetically unfavorable
direction across a membrane (e.g., against a concentration gradient) if their transport in that
direction is coupled to ATP hydrolysis as a source of energy — a process called active transport.
The free energy stored as ATP can thus be used to control the internal composition of the cell, as
well as to drive the biosynthesis of cell constituents.
The protein pump binds to a molecule of the substance to be transported on one side of the
membrane, then it uses the released energy (ATP) to change its shape, and releases it on the
other side. Protein pumps are catalysts in the splitting of ATP → ADP + phosphate, so they are
called ATPase enzymes. Most of these are ion pumps. They are specific: there is a different
pump for each molecule to be transported. Ex.: the sodium-potassium pump (also called the
Na+/K+-ATPase enzyme) actively moves sodium out of the cell and potassium into the cell.
These pumps are found in the membrane of virtually every cell, and are essential in transmission
of nerve impulses and in muscular contractions.

21
 Cystic fibrosis is a genetic disorder that results in a mutated chloride ion channel (mutated
-
Cl -ATPase). By not regulating chloride secretion properly, water flow across the airway surface
is reduced and the mucus becomes dehydrated and thick.

Fig. 27. Model of active transport. H+-ATPase. Energy derived from the hydrolysis of ATP is used to
transport H+ against the electrochemical gradient (from low to high H+ concentration). Binding of H+ is
accompanied by phosphorylation of the carrier protein, which induces a conformational change that
drives H+ transport against the electrochemical gradient. Release of H+ and hydrolysis of the bound
phosphate group then restore the carrier to its original conformation.

Protein-mediated Transport
Fig. 28. Scheme of Protein-
mediated Transport
There are three main types of proteins
that shuttle molecules across the membrane
(fig. 28):
Uniport: transport a single
molecule across the membrane. Ex.: glucose
transporter.
Symport: transport two different
molecules in the same direction. Ex.: amino
acids and Na+.
Antiport: transport two different
molecules in opposite directions. Ex.: the
mitochondrial ADP/ATP translocase (AAT)
catalyses the exchange, across the inner membrane of
mitochondrion, of cytosolic ADP for ATP, produced in the
matrix by ATP-synthase. The AAT undergoes substantial

conformational changes during transport. An example of active

antiport transporter that uses the energy of ATP to transport 3
Na+ ions outside of the cell in exchange for the influx of 2 K+
ions into the cell is Na+/K+-ATPase.
Symport and antiport are examples of co-transport (the
transport of more than one molecule at the same time; fig. 29).
This process couples an energy-utilizing transport to an
energy-releasing transport. Example: Co-transport of glucose.
Fig. 29. Co-transport of
Sodium and glucose
22 (antiport)
Glucose may be transported into a cell against a concentration gradient utilizing the energy
generated by the flow of Na+ ions along a concentration gradient.
Macrotransport (vesicular transport - transport of large molecules via vesicles)
The main purpose of the plasma membrane is to provide a barrier that keeps cellular
components inside the cell while simultaneously keeping unwanted substances from entering the
cell. The membrane allows essential nutrients to be transported into the cell and aids in the
removal of waste products from the cell.
Cells constantly transport substances across their cell membranes. Endocytosis (from the
Greek ―endo” meaning "in" and ―cytosis” meaning ―cell") is the process by which cells bring
molecules into their structure.
There are different types of endocytosis:
 Pinocytosis (from the Greek ―pino” meaning "to drink") - during pinocytosis the cell
membrane folds inward, forming a small pocket (vesicle) around fluid that is directly outside
the cell membrane. Fluid consumed by cells may contain small molecules, such as lipids.
Endothelial cells, which line capillaries, are constantly undergoing the process of
pinocytosis, "drinking" from the blood within the capillaries.
 Phagocytosis (from the Greek “phago” meaning "to eat"). It also plays a critical role in
defense systems by eliminating microorganisms or damaged cells in mammals. Once a
particle (or microorganism) is ingested, it is wrapped within a vesicle, and then the vesicle
fuses with a lysosome. The digestive enzymes of the lysosome then digest the contents of the
vesicles.
 Receptor-mediated
endocytosis occurs when specific
molecules in the fluid
surrounding the cell bind to
specialized receptors in the
plasma membrane. As in
pinocytosis, the plasma
membrane folds inward and the
formation of a vesicle follows.
Certain hormones are able to
target specific cells by receptor-
mediated endocytosis. Receptor-
hormone complexes cluster
together in special regions of
plasma membrane (coated pits)
that have a clathrin coating (fig.
30).

Fig. 30. Receptor-

mediated Endocytosis
The release of material
from a cell is known as exocytosis (from the Greek ―exo” meaning "out‖). First the cell forms
the cell product and then packages it. The package, or vesicle, is comprised of the same material
that makes up the cell membrane. When the vesicle reaches the membrane, the two structures
merge together much like air bubbles do in liquid. The contents of the vesicle are then expelled
from the cell. For example, secretory cells that manufacture specific proteins, such as the
pancreatic cells that manufacture insulin, use the process of exocytosis to secrete insulin into the
blood.
Another type of vesicular transport is transcytosis - a mechanism for transcellular
transport in which a cell encloses extracellular material in an invagination of the cell membrane

23
to form a vesicle, then moves the vesicle across the cell to eject the material through the opposite
cell membrane by the reverse process.

DIVERSITY OF BIOLOGICAL MEMBRANES

Different types of biological membranes have diverse lipid and protein compositions. The
content of membranes defines their physical and biological properties. Some components of
membranes play a key role in medicine, such as the efflux pumps that pump drugs out of a cell.
Natural membranes from different cell types exhibit a variety of shapes, which complement a
cell‘s function. The smooth
flexible surface of the erythrocyte
plasma membrane (the shape of
which is maintained by spectrin)
allows the cell to squeeze through
narrow blood capillaries (Fig.
31). Some cells have a long,
slender extension of the plasma
membrane, called a cilium or
flagellum, which beats in a whip
like manner. This motion causes
fluid to flow across the surface of
an epithelium or a sperm cell to
swim through the medium. The
Fig. 31. Erythrocyte axons of many neurons are encased by multiple layers of modified
Plasma Membrane
plasma membrane called the myelin sheath. This membranous
structure is elaborated by an adjacent supportive cell and facilitates the conduction of nerve
impulses over long distances.

TYPES OF BIOLOGICAL MEMBRANES

Within a eukaryotic cell, there are membranous compartments, as well as other structures
(such as ribosomes) that lack membranes but possess distinctive shapes and functions, which are
called organelles. Each of these organelles has specific roles in its particular cell. These roles are
defined by chemical reactions:
 The nucleus contains most of the cell‘s genetic material (DNA). The duplication of the
genetic material and the first steps in decoding genetic information take place in the nucleus.
 The mitochondrion is a power plant and industrial park, where energy stored in the bonds of
carbohydrates is converted to a form more useful to the cell (ATP) and certain essential
biochemical conversions of amino acids and fatty acids occur.
 The endoplasmic reticulum and Golgi apparatus are compartments in which proteins are
packaged and sent to appropriate locations in the cell.
 Lysosomes and vacuoles are cellular digestive systems in which large molecules are
hydrolyzed into usable monomers.
The membrane surrounding each organelle does two essential things: (1) it keeps the
organelle‘s molecules away from other molecules in the cell with which they might react
inappropriately; (2) it acts as a traffic regulator, letting important raw materials into the organelle
and releasing its products to the cytoplasm. The evolution of compartmentalization was an
important development in the ability of eukaryotic cells to specialize, forming the organs and
tissues of a complex body.
According to the structure it surrounds, the membranes are:
 Plasma membrane = plasmalemma

24
  Inner membranes: -- nuclear envelope, membranes of smooth and rough ER,
membranes of Golgi apparatus, membranes of mitochondrion (inner and outer), membrane of
lysosome, membrane of peroxisome, membranes of different vesicles.

There are two classes of internal membrane-bound structures in eukaryotic cells. There are
discrete organelles such as mitochondria and peroxisomes; then there is the dynamic
endomembrane system: nuclear membrane, endoplasmic reticulum, Golgi apparatus, lysosomes,
and vesicles.
The membranes could also be classified in:
Single Membrane Double Membrane Special Membrane
1. plasma membrane 1. nuclear membrane 1. human myelin
2. Golgi body membrane 2. mitochondrial memb. 2. light sensitive
membrane
3. Endoplasmatic reticulum memb. 3. chloroplast membrane
4. Lysosome membrane
5. Vesicle membrane
Plasma membrane
The plasma membrane is a thin membrane that surrounds and defines the boundaries of all
living cells. It consists of a double layer (bilayer) of phospholipids with various proteins attached
to or embedded in it. In many cases, these proteins protrude into the cytoplasm and into the
extracellular environment.
Functions of the plasma membrane:
 it allows the cell to maintain a more or less constant internal environment, which is a key
characteristic of life.
 it acts as a selectively permeable barrier, preventing some substances from crossing while
permitting other substances to enter and leave the cell.
 as the cell‘s boundary with the outside environment, the plasma membrane is important in
communicating with adjacent cells and receiving extracellular signals.
 the plasma membrane often has molecules protruding from it that are responsible for binding
and adhering to adjacent cells.
The specific functions of a membrane depend on the kinds of phospholipids and proteins
present in the plasma membrane.
The main components of the plasma membrane are:
Component Function
Cell surface markers "Self'-recognition; tissue recognition
Interior protein network Determines shape of cell
Phospholipid molecules Provide permeability barrier, matrix for proteins
Transmembrane proteins Transport molecules across membrane and against gradient.
The cell membrane, being exposed to the outside environment, is an important site of cell-
cell communication. As such, a large variety of protein receptors and identification proteins,
such as antigens, are present on the surface of the membrane. Functions of membrane proteins
can also include cell-cell contact, surface recognition, cytoskeleton contact, signaling, enzymatic
activity, or transporting substances across the membrane.

25
Fig. 32. Structure of a Plasma Membrane
 Intercellular connections and communication
Plasma membranes can form different types of "supramembrane" structures such as cell
junctions, desmosomes, hemidesmosomes, etc.
Cell junctions are the specialized connections between the plasma membranes of
adjoining cells. The three general types of cell junctions are tight junctions, anchoring junctions,
and communicating junctions. Tight junctions bind cells together, forming a barrier that is leak-
proof. For example, tight junctions form the lining of the digestive tract, preventing the contents
of the intestine from entering the body. Anchoring (or adhering) junctions, such as
desmosomes (protein attachments between adjacent cells, bearing a disk shaped structure from
which protein fibers extend into the cytoplasm), link cells together, enabling them to function as
a unit and forming tissues that undergo considerable stress, such as heart muscle or the
epithelium that comprises skin. Communicating (or gap) junctions allow rapid chemical and
electrical communication between cells. They consist of channels that connect the cytoplasm of
adjacent cells.
Cells communicate with each other via small, signaling molecules that are produced by
specific cells and received by target cells. This communication system operates on both a local
and long-distance level. The signaling molecules can be proteins, fatty acid derivatives, or gases.
Nitric oxide is an example of a gas that is part of a locally based signaling system and is able to
signal for a human's blood pressure to be lowered. Hormones are long-distance signaling
molecules that must be transported via the circulatory system from their production site to their
target cells.
In order to respond to a signal, a cell needs a receptor molecule that recognizes the signal.
A cell's response to a specific signal varies according to the signal. Some signals are local signals
(e.g., growth factors), while others act as distance signals (e.g., hormones). There are two basic
types of hormones, those that bind to receptors on the cell surface and those whose receptors are
found within cytoplasm. Both types cause the cellular machinery to change its activities.

26
 IV. COMPARTMENTALIZATION OF EUKARYOTIC CELL
In eukaryotes (which are approximately a thousand times the volume of bacteria) the rates
of chemical reactions would be limited by the diffusion of small molecules if a cell were not
partitioned into smaller compartments termed organelles. Each organelle is surrounded by one
or more biomembranes, and each type of organelle contains a unique complement of proteins –
some embedded in its membrane(s), others in its aqueous interior space, or lumen. These
proteins enable each organelle to carry out its characteristic cellular functions.
The table below provides a short description of the main organelles of an animal cell
(Table 5, fig. 33).
Table 5. Main Organelles of an Animal Cell.
STRUCTURE DESCRIPTION BIOLOGICAL ROLE
STRUCTURAL ELEMENTS
Cytosketeton Network of protein filaments Structural support; cell movement
Flagella(cilia, Cellular extensions Motility or moving fluids over
microvilli) surfaces
Centrioles Hollow microtubules Moving chromosomes during cell
division
ENDOMEMBRANE SYSTEM
Plasma membrane Lipid bilayer in which proteins are Regulates what passes into and out of
embedded cell; cell-to-cell communication
Endoplasmic Network of internal membranes; Rough type processes proteins for
reticulum forms compartments and vesicles secretion and synthesizes
phospholipids; smooth type synthesize
fats and steroids
Nucleus Structure bounded by double Control center of cell; directs protein
membrane; contains chromosomes synthesis and cell reproduction
Golgi apparatus Stacks of flattened vesicles Modifies and packages proteins for
export from cell; forms secretory
vesicles
Lysosomes Vesicles derived from Golgi Digest worn-out mitochondria and cell
complex that contain hydrolytic debris; play role in cell death
digestive enzymes
ENERGY-PRODUCTING ORGANELLES
Mitochondria Bacteria-like elements with double Power plant of the cell; site of
membrane oxidative metabolism; synthesis of
ATP
ORGANELLES OF GENE EXPRESSION
Chromosomes Long threads of DNA that form a Contain hereditary information
complex with protein
Nucleolus Site of rRNA synthesis Assembles ribosomes
Ribosomes Small, complex assemblies of Site of protein synthesis
protein, often bound to ER
The cytoplasm is the part of the cell outside the largest organelle, the nucleus. It is
composed of hyaloplasm and cell organelles dispersed in it. The cytosol, the aqueous part of the
hyaloplasm also contains its own distinctive proteins.
Cytoplasm
Hyaloplasm
Cell organelles
Cytosol Cytoskeleton

27
 The cytoplasm is a colloidal solution. It is viscous, semifluid and precipitates if placed into
water. It is constantly active (rotation and streaming), allowing the cell to be in a continuous
dynamic flux.

Fig. 33. An Animal Cell

ER - endoplasmic reticulum
Generally, the largest membrane in a eukaryotic cell encloses the endoplasmic reticulum
(ER) – an extensive network of closed, flattened membrane-bounded sacs called cisternae. The
endoplasmic reticulum has a number of functions in the cell but is particularly important in the
synthesis of lipids, membrane proteins, and secreted proteins.
The Smooth Endoplasmic Reticulum - it lacks ribosomes and is the place for synthesis of
fatty acids and phospholipids. Although many cells have very little smooth ER, this organelle is
abundant in hepatocytes. Enzymes in the smooth ER of the liver also modify or detoxify
hydrophobic chemicals such as pesticides and carcinogens by chemically converting them into
28
more water-soluble, conjugated products that can be excreted from the body. High doses of such
compounds result in a large proliferation of the smooth ER in liver cells.
The Rough Endoplasmic Reticulum – its cytosolic face is studded with ribosomes.
Ribosomes bound to the rough ER synthesize certain membrane and organelle proteins and
virtually all proteins to be secreted from the cell. A ribosome that fabricates such a protein is
bound to the rough ER by the nascent polypeptide chain of the protein and is attached by
ribophorin (an integral membrane protein). As the growing polypeptide emerges from the
ribosome, it passes through the rough ER membrane, with the help of translocases - specific
proteins in the membrane. Newly made membrane proteins remain associated with the rough ER
membrane, and proteins to be secreted accumulate in the lumen of the organelle. All eukaryotic
cells contain a noticeable amount of rough ER because it is needed for the synthesis of plasma
membrane proteins and proteins of the extracellular matrix. Rough ER is particularly abundant in
specialized cells that produce an abundance of specific proteins to be secreted. For example,
plasma cells produce antibodies, pancreatic acinar cells synthesize digestive enzymes, and cells
in the pancreatic islets of Langerhans produce the polypeptide hormones insulin and glucagon. In
secretory cells a large part of the cytosol is filled with rough ER and secretory vesicles.
Several minutes after proteins are synthesized in the rough ER, most of them leave the
organelle within small membrane-bounded transport vesicles. These vesicles, which bud from
regions of the rough ER not coated with ribosomes, carry the proteins to another membrane-
limited organelle, the Golgi complex.

Golgi complex (Golgi apparatus)

This organelle is a series of flattened
membrane vesicles or sacs (cisternae),
surrounded by a number of more or less
spherical membrane-limited vesicles. The stack
of Golgi cisternae has three defined regions—
the cis, the medial, and the trans. Transport
vesicles from the rough ER fuse with the cis
region of the Golgi complex, where they deposit
their protein contents. These proteins then
progress from the cis to the medial and to the
trans region (fig. 34). Within each region are
different enzymes that modify proteins to be
secreted and membrane proteins differently,
depending on their structures and their final
destinations.
After proteins to be secreted and
membrane proteins are modified in the Golgi
complex, they are transported out of the
Fig. 34. Golgi Apparatus complex by a second set of vesicles, which
seem to bud from the trans side of the Golgi
complex. Some vesicles carry membrane proteins destined for the plasma membrane or soluble
proteins to be released from the cell surface; others carry soluble or membrane proteins to
lysosomes or other organelles.
So, Golgi complex functions as a factory in which proteins received from the ER are
further processed and sorted for transport to their eventual destinations: lysosomes, the plasma
membrane, or secretion. In addition, glycolipids and sphingomyelin are synthesized within the
Golgi. Proteins, as well as lipids and polysaccharides, are transported from the Golgi apparatus
to their final destinations through the secretory pathway. This involves the sorting of proteins
into different kinds of transport vesicles, which bud from the trans Golgi network and deliver
29
their contents to the appropriate cellular
locations (Fig. 35). Proteins that function
within the Golgi apparatus must be retained
within that organelle, rather than being
transported along the secretory pathway. In
contrast to the ER, all of the proteins retained
within the Golgi complex are associated with
the Golgi membrane rather than being soluble
proteins within the lumen. The signals
responsible for retention of some proteins
within the Golgi have been localized to their
transmembrane domains, which retain proteins
within the Golgi apparatus by preventing them
from being packaged in the transport vesicles
that leave the trans Golgi network.
Functions of Golgi apparatus:
1) biogenesis of membranes, the formation of
the plasma membrane;
2) the synthesis of polysaccharides,
glycoproteins, glycolipids and sphingomyelin
(the only nonglycerol phospholipid in cell
membranes); Fig. 35. Transport from the Golgi apparatus.
3) the modification of products through the Proteins are sorted in the trans Golgi network and
addition of fatty acids, sulfation and transported in vesicles to their final destinations. In
glycosylation; the absence of specific targeting signals, proteins are
4) the concentration and packaging of carried to the plasma membrane by constitutive
secretion. Alternatively, proteins can be diverted
synthesized material into secretory versicles; from the constitutive secretion pathway and targeted
5) the biogenesis of lysosomes. to other destinations, such as lysosomes or regulated
secretion from the cells.
Biogenesis: Large membrane-bounded
organelles, such as the Golgi apparatus and the endoplasmic reticulum, break up into many
smaller fragments during M phase, which ensures their even distribution into daughter cells
during cytokinesis. In such a way these organelles are developed from the preexisting organelles
(ER or GA).

Lysosomes
Lysosomes provide an excellent example of the ability of
intracellular membranes to form closed compartments in which
the composition of the lumen differs substantially from that of the
surrounding cytosol. Found exclusively in animal cells,
lysosomes are responsible for degrading certain components that
have become obsolete for the cell or organism. The process by
which an aged organelle is degraded in a lysosome is called
autophagy (―eating oneself‖). A process in which excessive
amounts of secreted material (ex.: proteins, hormones, etc.) are
fused with lysosomes for hydrolysis is called crinophagy.
Materials taken into a cell by endocytosis or phagocytosis also
may be degraded in lysosomes. In phagocytosis, large, insoluble
particles (e.g., bacteria) are enveloped by the plasma membrane
and internalized.
Lysosomes contain a group of enzymes that degrade
polymers into their monomeric subunits (fig. 36). For example,
Fig. 36. Content of a
Lysosome 30
nucleases degrade RNA and DNA into nucleotides; proteases degrade a variety of proteins and
peptides; phosphatases remove phosphate groups from nucleotides, phospholipids, and other
compounds, etc. All the lysosomal enzymes work most efficiently at acid pH values and
collectively are termed acid hydrolases. The enzymes are synthesized by ribosomes on the ER
and are processed and packaged by the Golgi apparatus.
Like all other intracellular organelles, the Fig. 37
lysosome not only contains a unique collection of
enzymes, but also has a unique surrounding
membrane (fig. 37). Two types of transport
proteins in the lysosomal membrane work together
to pump H+ (H+-ATPase) and Cl- ions from the
cytosol across the membrane, thereby acidifying
the lumen. The acid pH helps to denature proteins,
making them accessible to the action of the
lysosomal hydrolases. Most of the lysosomal
membrane proteins are unusually highly
glycosylated, which helps to protect them from the
lysosomal proteases in the lumen (making the lysosomal membrane resistant to acid
denaturation). Lysosomal enzymes are poorly active at the neutral pH of cells and most
extracellular fluids. Thus, if a lysosome releases its enzymes into the cytosol, where the pH is
between 7.0 and 7.3, they cause little degradation of cytosolic components.
Lysosomes vary in size and shape, and several hundred may be present in a typical animal
cell. Several types of lysosomes can be distinguished: Primary lysosomes are roughly spherical
and do not contain obvious particulate or membrane debris. Secondary lysosomes, which are
larger and irregularly shaped, appear to result from the fusion of primary lysosomes with other
membrane-bounded organelles and vesicles. They contain particles or membranes in the process
of being digested. Tertiary lysosomes include the undigested materials.
The functions of lysosomes are:
 The digestion of intracellular and
extracellular materials;
 The autolysis (the self destruction if a cell is
deformed or aged);
 The function of defense of a cell against
invasion by bacteria, viruses and toxic substances
(fig. 38);
 They play an important role in the
fertilization of an ovum by a sperm cell. The
acrosome at the tip of the head of the sperm contains
Fig. 38. Functions of Lysosomes lysosomes which hydrolyze the membrane of the
ovum.
Lysosomal storage diseases result in the accumulation of the undigested substrates in
lysosomes, with severe pathological consequences, most often in the nervous system. This
occurs in Hurler's disease, for example, in which the enzyme required for the breakdown of
glycosaminoglycans is defective or missing. Tay-Sachs disease is caused by a defect in one
enzyme catalyzing a step in the lysosomal breakdown of gangliosides. The resulting
accumulation of these glycolipids, especially in nerve cells, has devastating consequences. The
symptoms of this inherited disease are usually evident before the age of 1. Affected children
commonly become demented and blind by age 2 and die before their third birthday. Nerve cells
from such children are greatly enlarged with swollen lipid-filled lysosomes. The most severe
form of lysosomal storage disease, however, is a very rare disorder called inclusion-cell disease
(I-cell disease). In this disease almost all of the hydrolytic enzymes are missing from the
31
lysosomes of fibroblasts, and their undigested substrates accumulate in lysosomes, which
consequently form large ―inclusions‖ in the patients' cells.
PROTEASOMES
Cytosolic and nuclear proteins generally are not degraded in lysosomes
but rather in proteasomes, large multiprotein complexes located mainly in the
cytosol (fig. 39). The numerous proteasomes dispersed throughout the cell
proteolytically cleave ubiquitin-tagged proteins in an ATP-dependent process
that yields short (7- to 8-residue) peptides and intact ubiquitin (Ub - a special
polypeptide) molecules.
Proteasomes functions:
1. They remove abnormal and misfolded proteins from the cell.
2. They are involved in the cell's stress response. Fig. 39.
Proteasome
3. As part of the Ub system, they are involved in regulating the cell cycle.
4. They are involved in cellular differentiation (where they degrade transcription factors and
metabolic enzymes).
5. They play an important role in the immune system.
Proteasomes are cylindrical structures very similar to chaperons (a large group of protein
families whose role is to stabilize unfolded proteins, unfold them for translocation across
membranes or for degradation, and/or to assist in their correct folding and assembly).

Peroxisomes
All animal cells (except erythrocytes) contain peroxisomes, a class of single-membrane
bound, roughly spherical organelles that contain several oxidases – enzymes that use molecular
oxygen to oxidize organic substances, in the process forming hydrogen peroxide (H2O2), a
corrosive substance.

Peroxisomes also contain abundant amounts of the enzyme catalase, which utilizes the
H2O2 generated by other enzymes in the organelle to oxidize a variety of other substrates, such as
phenols, formic acid, formaldehyde, and alcohol, by the ―peroxidative‖ reaction:
H2O2 + R′ H2 → R′ + 2H2O
This type of oxidative reaction is particularly important in liver and kidney cells, where the
peroxisomes detoxify various toxic molecules that enter the bloodstream. About 25% of the
ethanol we drink is oxidized to acetaldehyde in this way. Catalase also degrades hydrogen
peroxide to yield water and oxygen:
2 H2O2 Catalase→ 2 H2O + O2
In contrast with the oxidation of fatty acids in mitochondria, which produces CO2 and is
coupled to the generation of ATP, peroxisomal oxidation of fatty acids yields acetyl groups and
is not linked to ATP formation. The energy released during peroxisomal oxidation is converted
into heat, and the acetyl groups are transported into the cytosol, where they are used in the
synthesis of cholesterol and other metabolites. In most eukaryotic cells, the peroxisome is the
principal organelle in which fatty acids are oxidized, thereby generating precursors for important
biosynthetic pathways. Particularly in liver and kidney cells, various toxic molecules that enter
the bloodstream also are degraded in peroxisomes, producing harmless products.
In the human genetic disease X-linked adrenoleukodystrophy (ADL), peroxisomal
oxidation of very long chain fatty acids is defective. The ADL gene encodes the peroxisomal
membrane protein that transports into peroxisomes an enzyme required for the oxidation of these
fatty acids. Persons with the severe form of ADL are unaffected until midchildhood, when severe
neurological disorders appear, followed by death within a few years. Another example of
peroxisomal misfunction is the inherited human disease Zellweger syndrome, in which a defect
in importing proteins into peroxisomes leads to a severe peroxisomal deficiency. These
individuals, whose cells contain ―empty‖ peroxisomes, have severe abnormalities in their brain,
liver, and kidneys, and they die soon after birth. One form of this disease has been shown to be
32
due to a mutation in the gene encoding a peroxisomal integral membrane protein, the peroxin
Pex2, involved in protein import.
Biogenesis: Since 1985 it has been thought that peroxisomes are autonomous organelles
multiplying by growth and division (like mitochondrion). Lately though support for an ER-
peroxisome connection came (fig. 40). Recent studies show that peroxisomes are at most semi-
autonomous organelles because the ER supplies the membrane of peroxisomes. This process is
guided by a few pioneering peroxisomal membrane proteins that start their life in the ER and
contribute to the
formation of a
specialized extension
from the rough ER.
After reaching a
considerable size,
this specialized ER
is detached from the
rough ER.
Additional integral
membrane and
peripheral proteins
are recruited until
the protein import
machinery has been
assembled and the
Fig. 40. ER-Peroxisome Connection
PM - plasma membrane; L - lysosome; E - endosome, P - peroxisome; G - Golgi;
import of matrix
ER - endoplasmic reticulum; N - nucleus. proteins can start as
the last step in the
peroxisome maturation pathway.
Peroxisomal proteins are synthesized on free polyribosomes. The folding starts in the
cytosol before they are taken en route to their final destination within the cell. Peroxisomal
targeting signals (PTSs) are recognized by cytosolic proteins (receptors) that guide their cargo to
the peroxisomal membrane.

Nucleus
The nucleus, the largest organelle in animal cells, is surrounded by two membranes, each
one a phospholipid bilayer containing many different types of proteins. The inner nuclear
membrane defines the nucleus itself. In most cells, the outer nuclear membrane is continuous
with the rough endoplasmic reticulum, and the space between the inner and outer nuclear
membranes is continuous with the lumen of the rough endoplasmic reticulum. The two nuclear
membranes appear to fuse at nuclear pores, the ringlike complexes composed of specific
membrane proteins through which material moves between the nucleus and the cytosol. In a
growing or differentiating cell, the nucleus is metabolically active, replicating DNA and
synthesizing rRNA, tRNA, and mRNA. Within the nucleus mRNA binds to specific proteins,
forming ribonucleoproteid particles. Most of the cell‘s ribosomal RNA is synthesized in the
nucleolus, a subcompartment of the nucleus that is not bounded by a phospholipid membrane.
Some ribosomal proteins are added to ribosomal RNAs within the nucleolus as well. The
finished or partly finished ribosomal subunits, as well as tRNAs and mRNA-containing particles,
pass through a nuclear pore into the cytosol for use in protein synthesis. In mature erythrocytes
from nonmammalian vertebrates and other types of ―resting‖ cells, the nucleus is inactive or
dormant and minimal synthesis of DNA and RNA takes place.
In a nucleus that is not dividing, the chromosomes are dispersed and not dense enough to
be observed in the light microscope. Only during cell division individual chromosomes are
visible by light microscopy. In the electron microscope, the nonnucleolar regions of the nucleus,
33
called the nucleoplasm, can be seen to have dark- and lightstaining areas. The dark areas, which
are often closely associated with the nuclear membrane, contain condensed concentrated DNA,
called heterochromatin. Fibrous proteins called lamins form a two-dimensional network along
the inner surface of the inner membrane, giving it shape and apparently binding DNA to it. The
breakdown of this network occurs early in cell division. The lightstaining areas form the
euchromatin – transcriptionally active part.

Mitochondrion
Most eukaryotic cells contain many mitochondria, which occupy up to 25 percent of the
volume of the cytoplasm. The two membranes that bound a mitochondrion differ in composition
and function. The outer membrane, composed of about half lipid and half protein, contains
porins that make the membrane permeable to certain molecules. The inner membrane, which is
much less permeable, is about 20 – 25% lipid and 75 - 80% protein - a higher proportion of
protein than exists in other cellular membranes. The surface area of the inner membrane is
greatly increased by a large number of infoldings, or cristae, that protrude into the matrix, or
central space (fig. 41).
In nonphotosynthetic cells, the
principal fuels for ATP synthesis are
fatty acids and glucose. The
complete aerobic degradation of
glucose to CO2 and H2O is coupled
to the synthesis of as many as 30
molecules of ATP. In eukaryotic
cells, the initial stages of glucose
degradation take place in the
cytosol, where 2 ATP molecules per
glucose molecule are generated. The
Fig. 41. Structure of a Mitochondrion terminal stages of oxidation and the
coupled synthesis of ATP are
carried out by enzymes in the mitochondrial matrix and inner membrane. As many as 28 ATP
molecules per glucose molecule are generated in mitochondria. Similarly, virtually all the ATP
formed in the oxidation of fatty acids to CO2 is generated in mitochondria. Thus mitochondria
can be regarded as the ―power plants‖ of the cell.
Mitochondrial genome: Mitochondria contain also their own genetic apparatus composed
of DNA (circular), mRNA, tRNA, rRNA, which is situated in matrix. The mt genome contains
37 genes, all of which are involved in the production of energy and its storage in ATP. Thirteen
of these genes encode proteins; 22 genes encode tRNAs and 2 genes - ribosomal RNAs that
translate the proteins' genes within the mitochrondrion. Mammalian mt genes use a slightly
different genetic code than nuclear genes. Mammalian mitochondrial ribosomes (55S) differ
unexpectedly from bacterial (70S) and cytoplasmic ribosomes (80S), as well as other kinds of
mitochondrial ribosomes (70S).
Biogenesis: Mitochondria are self-replicative, which means that one mitochondrion can
form a second one, a third one, whenever the cell needs increased amounts of ATP.
Ribosomes
Ribosomes are essential for almost all prokaryotic and eukaryotic
cells. Prokaryotic ribosomes have a sedimentation value of 70S when
centrifuged and are found in bacteria, mitocondria and chloroplasts.
Mammalian mitochondrial ribosomes are 55S. Eukaryotic ribosomes
have a value of 80S and are found in the cytoplasm of eukaryotic cells.
The ribosome complex may be attached to both the endoplasmic
reticulum and the nuclear membrane. They are also as free floating Fig. 42. Ribosomal
Subunits
34
structures in the cytoplasm. They often cluster together in groups along a strand of mRNA to
form polyribosomes (polysomes).
Biogenesis: Ribosomes are approximately 150-200 Ao in size and consist of 1 large and 1
small subunit (fig. 42). Normally these subunits exist independently in different regions of the
cell, but associate to perform protein synthesis. The subunits consist of rRNA and ribosomal
proteins, which associate together in the nucleolus (place of ribosomal biogenesis).
The ribosomes are involved in translation, one of the last steps of gene expression and
protein biosynthesis (table 6).
Table 6. Function of free ribosomes and those attached to rER
Types of ribosomes Free ribosomes Attached ribosomes
Location Cytosol Attached to ER
Mitochondria, Membranes,
Function: synthesis of Nucleus, sER, rER, Golgi Apparatus,
proteins for: Peroxisomes, Lysosomes,
Cytoskeleton Secretor vesicles, for export

Cytoskeleton
The cytosol is a major site of cellular metabolism and contains a large number of different
enzymes. Proteins constitute about 20–30% of the cytosol by weight, and from a quarter to half
of the total protein within cells is in the cytosol. The cytosol of a eukaryotic cell contains three
types of filaments that can be distinguished on the bases of their diameter, type of subunit, and
subunit arrangement (fig. 43).
Microfilaments, also called actin
filaments (because they are made mainly of a
globular protein - actin), are 8–9 nm in diameter
and have a twisted two-stranded structure. They
play an important role in the movement of
substances within the cell, form an elastic
support for the cell membrane, in muscle cells
they are organized into a special contractile
machine that is the basis of muscle contraction.
Microtubules are hollow tube-like
structures, 25 nm in diameter, that radiate from
the centrioles towards the periphery of a cell.
Their walls are formed by 13 parallel filaments
called protofilaments. Microtubules are made of
tubulin subunits. They are presented in
cytoplasm, in flagellum of a sperm, in cilium, in
centrioles and the mitotic spindle.
Intermediate filaments (IFs) have the
Fig. 43. Structural Organization of Microtubule,
Microfilament and Intermediate Filament structure of a 10-nm-diameter rope. Unlike
microfilaments and microtubules, which are
assembled from one or two proteins, intermediate filaments are assembled from a large diverse
family of proteins. The most common intermediate filaments, found in the nucleus, are composed of
lamins. Intermediate filaments constructed from other proteins are expressed preferentially in certain
tissues: for example, keratin-containing filaments in epithelial cells, desmin-containing filaments in
muscle cells, and vimentin-containing filaments in mesenchymal cells.
Most eukaryotic cells contain all three types of cytoskeletal filaments, often concentrated
in distinct locations. For example, in the absorptive epithelial cells that line the lumen of the
intestine, actin microfilaments are abundant in the apical region, where they are associated with

35
 cell–cell junctions and support a dense carpet of microvilli. Actin filaments are also present in a
narrow zone adjacent to the plasma membrane in the lateral regions of these cells. Keratin
intermediate filaments, forming a meshwork, connect microvilli and are tethered to junctions
between cells. Lamin intermediate filaments support the inner nuclear membrane. Finally,
microtubules, aligned with the long axis of the cell, are in close proximity to major cell
organelles such as the endoplasmic reticulum, Golgi complex, and vesicles.
The cytoskeleton has been highly conserved in evolution. A comparison of gene sequences
shows only a small percentage of differences in sequence between yeast actin and tubulin and
human actin and tubulin. This structural conservation is explained by the variety of critical
functions that depend on the cytoskeleton. A mutation in a cytoskeleton protein subunit could
disrupt the assembly of filaments and their binding to other proteins. Analyses of gene sequences
and protein structures have identified bacterial homologs of actin and tubulin. The absence of IF-
like proteins in bacteria and unicellular eukaryotes is evidence that intermediate filaments
appeared later in the evolution of the cytoskeletal system. The first IF protein to arise was most
likely a nuclear lamin from which cytosolic IF proteins later evolved.

CENTRIOLES
Centrioles both assemble and organize
long, hollow cylinders of microtubules. Under
the electron microscope the centrioles appear as
two short, hollow, cylinders usually lying at
right angles to each other. Each centriole is
made up of nine microtubule triplets, which lie
evenly spaced in a ring. There are no
microtubules in the center (9+0 arrangement,
fig. 44).
The centrioles appear as two, darkly
staining granules, usually above the nucleus in
Fig. 44. Centriole
animal cells. They are generally absent in plant
cells, except in motile cells.
The centrioles lie in a small mass of specialized cytoplasm called centrospheres (or
pericentriolar material). The centrioles and the centrosphere are together described as
centrosome that serves as microtubule organizing centers (MTOCs). Microtubules help
determine the cell shape, move chromosomes during cell division, and provide the internal
structure of cilia and flagella.
Biogenesis: During interphase of each cell cycle, the centrioles and other components of
the centrosome are duplicated but remain together as a single complex on one side of the
nucleus. As mitosis begins, this complex
splits in two and each centriole pair
becomes part of a separate MTOC that
nucleates a radial array of microtubules
called an aster. The two asters move to
opposite sides of the nucleus to form the
two poles of the mitotic spindle. As
mitosis ends and the nuclear envelope re-
forms around the separated
chromosomes, each daughter cell
Fig. 45. Centriole Replication. At a certain point in G1 phase
the two centrioles separate by a few micrometers. During S
receives a centrosome (the former
phase a daughter centriole begins to grow near the base of each spindle pole) in association with its
old centriole and at a right angle to it, the elongation being chromosomes (fig. 45).
completed by G2 phase. The two centriole pairs remain close
together in a single centrosomal complex until the beginning of
36
M phase, when the centrosome splits in two and the two halves
begin to separate.
 V. NUCLEUS
Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion.
Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents
some linear molecules and mitochondrial DNA represents circular molecules.
All eukaryotic cells contain at least
one nucleus. The contents of the nucleus are
present as a viscous, amorphous mass of
material enclosed by a complex nuclear
envelope (fig. 46). Nucleus consists of:
 Chromosomes, which are present as
extended nucleoprotein fibers, called
chromatin;
 Nuclear matrix, which is a protein-
containing fibrillar network;
 Nucleolus (or some nucleoli) that
are responsible for synthesis of rRNA and
assembling of ribosomes;
 Nucleoplasm (or karyoplasm) – the
fluid substance in which the solutes of
Fig. 46. Position of Nucleus in the Cell
nucleus are dissolved.
Chromatin
The eukaryotic cell nucleus is typically ~1mm in diameter. It contains a large amount of
DNA (a total length of 1-2 meters), which must be efficiently packaged in such a way as to
guarantee access to genetic information (fig. 47). Thus, each DNA molecule is packed forming
chromatin, a densely staining material initially recognized in two different forms: highly
condensed heterochromatin and more diffuse euchromatin. Chemically chromatin is organized
from 30% DNA + 40% histones + 25% non-histones + 5% RNA.
Chromatin fragments contain DNA (a negatively charged polymer) in complex with
highly positively charged (basic) proteins called histones, and much smaller amounts of other
DNA-binding proteins, collectively referred to
as non-histone proteins. Human histone genes
are represented as a family of moderately
repeated sequences with variations in the
structure, organization, and regulation of the
different copies. The histones organize DNA
into a regular repeating structure, the basic unit
of which is the nucleosome, which wrap and
compact DNA into chromatin, limiting DNA
accessibility to the cellular machineries which
require DNA as a template. Histones thereby
play a central role in transcription regulation,
DNA repair, DNA replication and chromosomal
stability. There are 5 classes of histones: H1,
H2A, H2B, H3, H4. They contain Leucine,
Lysine, Arginine and other basic amino acids.
The quantity of histones is the same in all tissues
and they have no tissue-specificity. They induce
the tertiary structure of DNA (DNP). The non-
histones are acid proteins, are very
heterogeneous and comprise: enzymes (for Fig. 47. Various Stages of Chromatin Condensation
chromatin
37
replication, repair, transcription, RNA processing, biogenesis of ribosomes), site-specific
proteins, scaffold proteins. More active tissues contain larger quantity and diversity of non-
histones.
Euchromatin represents the active part of
chromatin; contain structural genes that are transcribed.
It is less compacted and replicates early in the S period
of interphase (fig. 48).
Heterochromatin is tightly condensed and
contains inactive sequences which are not transcribed
(fig. 48). It replicates late in the S period. There are
two types of heterochromatin: constitutive and
facultative. Facultative heterochromatin contains
genes that in some condition, in some tissues may be
active, so it can be transformed into euchromatin. It
contains coding but inactive sequences. Facultative
heterochromatin assures cell differentiation, sexual
differentiation, and control of ontogenesis.
Constitutive heterochromatin contains repetitive
sequences, which always remain condensed. It is
represented by centromeres, telomeres, satellites,
spacers between genes. Constitutive heterochromatin is
the same in all cells.
Fig. 48. Structure of the Nucleus

Levels of DNA condensation

I. Nucleosomal. Decondensed chromatin viewed in the electron microscope resembles
―beads on a string‖. Each bead is a nucleosome containing 146 bp of DNA wrapped around the
core histone octamer, and sealed by a single
molecule of linker histone (H1) bound at the point
where the DNA enters and exits. H1 also binds to
the linker DNA (the string connecting one bead to
the next) (Fig. 47, 49). The histone octamer is
composed of two molecules each of the four core
histones: 2xH2A, 2xH2B, 2xH3 and 2xH4. These
Fig. 49. Schematic diagram of
are small, basic proteins, which have been highly
nucleosome core particle conserved during evolution.
Histone H1, the linker histone, is not a
part of the nucleosome core (Fig. 50). It is
very rich in lysine residues, less well
conserved than the core histones, and is
larger. The length of DNA in the core Fig. 50. Binding of H1 to the Linker DNA
particle is invariable (146 bp), but the
average length of the linker DNA varies between species and tissues, giving rise to a
characteristic repeat length (the average length of DNA in a nucleosome).
II. Chromatin folding (Solenoid).
Most of the chromatin in the nucleus
is in the form of a highly condensed
filament about 30-nm in diameter (the 30-
nm filament). Formation of these highly
condensed filaments is dependent on H1
(one H1 molecule per nucleosome). The
Fig. 51. The Solenoidal Model of Chromatin
38
condensed 30-nm filament is the result of solenoidal (helical) folding of the beads-on-a-string
nucleosomal (10 nm) filament, having 6-12 nucleosomes per turn (Fig. 51).
III. Chromatin Loops. The interphase
chromosomes are organized into loops of chromatin
filament attached to the nuclear skeleton (nuclear
matrix) at their bases and projecting into the interior
of the nucleus (Fig. 52). Each loop may contain a
gene or related cluster of genes whose expression
may be regulated at the level of loop structure. The
regions of DNA which interact with matrix are called
MARs (matrix associated regions) or SARs (scaffold
attachment regions), while the proteins that assure the Fig. 52. Attachment of Solenoid Fiber to Scaffold
attachement are called SAP (scaffold associated
proteins). The loops contain an average of 40 000 - 80 000 bp.

IV. Metaphase Chromosomes. When the nuclear membrane breaks down during mitosis,
chromatin is reorganized to form metaphase chromosomes in which a chromosomal metaphase
scaffold is folded to form a quite regular helical coil, to which
chromatin loops are attached at their bases (Fig. 53). Sister
chromatids are usually of opposite helical handedness. The
organization of DNA into the organelle, which is a
chromosome, is most obvious at metaphase when the
chromosome is condensed into a highly structured body. At
this point in the cell cycle important chromosomal elements
are visible: two arms (short – p and long – q), centromere and
telomere.
The telomeres are special sequences responsible for
preventing the shortening of chromosomes during replication,
protect linear molecules of DNA against actions of
exonucleases and prevent joining of different chromosomes.
Structurally, the telomeres are rich in tandemly repeated G/C
sequences with a total length of 3 – 20 kb.
The centromere is the genetic element (formed by
constitutive heterochromatin) responsible for chromosome
Fig. 53. Structure of a Chromosome
segregation during cell division. It is visible at metaphase as a
constriction in mammalian chromosomes and is the site of attachment of spindle microtubules to
the proteins that make up the kinetochore. Centromere contains A/T rich repetitive sequences.
Within centromeres, H3 histone is substituted by CENP-A histone.

Chromatine activation:
Gene activity depends on: the stage of ontogenetic period, type of cell, environment. It also
depends on the level of DNA condensation. Transcription is associated with nucleosomal level
only.
Transcriptionally active chromatin regions have core histones undergoing high rates of
acetylation and deacetylation. Histone acetylation (which is a type of post-translational
modification of histones) is generally linked to gene activation. The enzymes that acetylate
conserved lysine amino acids on histone proteins by transferring an acetyl group (functional
group COCH3) are called histone acetyltransferases (HAT), which can also acetylate non-
histone proteins, such as transcription factors and nuclear receptors to facilitate gene expression.
Removal of the acetyl group by histone deacetylases (HDACs) condenses DNA structure,
thereby preventing transcription. Another common way to block DNA and inhibit gene
39
transcription is DNA methylation, which involves the addition of a methyl group (CH3) to
cytosine or adenine.

So, the post-translational modifications of histones include:

 Methylation of H3 (Lys4) – active expression of a gene;
 Methylation of H3 (Lys9) – diminishing of transcription;
 Histone acetylation – assisting the transcription, gene activation;
 Histone deacetylation – chromatin condensation, inactivation of transcription;
 Phosphorylation of H1 – chromatin supercoiling
 Dephosphorylation of H1 – chromatin decondensation.

Nuclear Envelope
Nuclear envelope is a double membrane that
surrounds the nucleus during most of the cell's
lifecycle (fig. 54). The outer nuclear membrane
is continuous with the membrane of the rough
endoplasmic reticulum (ER), having numerous
Fig. 54.
ribosomes attached to the surface. The outer
membrane is also continuous with the inner
nuclear membrane since the two layers are fused
together at numerous tiny holes called nuclear
pores that perforate the nuclear envelope. These
pores regulate the selective passage of molecules
between the nucleus and cytoplasm, The space
between the outer and inner membranes is termed
the perinuclear space and is connected with the lumen of the rough ER.
Structural support is provided to the nuclear envelope by two different networks of
intermediate filaments. Along the inner surface of the nucleus, one of these networks is
organized into the nuclear lamina (made of fibrous proteins – nuclear lamins and membrane
associated proteins), which binds to chromatin, integral membrane proteins, and other nuclear
components. The nuclear lamina is also thought to play a role in directing materials inside the
nucleus toward the nuclear pores for export and in the disintegration of the nuclear envelope
during cell division and its subsequent reformation at the end of the process. The other
intermediate filament network is located on the outside of the outer nuclear membrane and is not
organized in such a systemic way as the nuclear lamina.
The amount of traffic that must pass through the nuclear envelope on a continuous basis in
order for the eukaryotic cell to function properly is considerable. RNA and ribosomal subunits
must be constantly transferred from the nucleus where they are made to the cytoplasm, and
histones, gene regulatory proteins, DNA and RNA polymerases, and other substances required
for nuclear activities must be imported from the cytoplasm. An active mammalian cell can
synthesize about 20,000 ribosome subunits per minute, and at certain points in the cell cycle, as
many as 30,000 histones per minute are required by the nucleus. In order for such a tremendous
number of molecules to pass through the nuclear envelope in a timely manner, the nuclear pores
must be highly efficient at selectively allowing the passage of materials to and from the nucleus.
Nuclear Pores
It is generally thought that a protein structure called the nuclear pore complex (NPCs)
that surrounds each pore plays a key role in allowing the active transport of a selected set of
large molecules into and out of the nucleus (fig. 55). The nuclear pore proteins are called
nucleoporins, which are not only engaged in nucleocytoplasmic transport, but also in
transcription regulation, kinetochore organization and other cellular events. Given the various
40
functions of nucleoporins, it is not surprising to find them involved in a wide variety of human
disease.
In addition to their role in nuclear transport, nuclear pores are important as sites where the
outer membrane and inner membrane of the nuclear envelope are fused together. Due to this
fusion, the membranes can be considered continuous with one another although they have
different biochemical characteristics and can function in distinctive ways. Since the outer nuclear
membrane is also continuous with the membrane of the endoplasmic reticulum (ER), both it and
the inner nuclear membrane can exchange membranous materials with the ER. This capability
enables the nuclear envelope to grow bigger or smaller when necessary to accommodate the
dynamic contents of the nucleus.

Fig. 55.

Karyoplasm
The karyoplasm or nucleoplasm or nuclear sap is a highly viscous liquid contained within
the nucleus that surrounds the chromosomes and other subnuclear organelles. A network of
fibers known as the nuclear matrix (scaffold, skeleton) can also be found in the nucleoplasm.

Nuclear Scaffold
The skeleton maintains the overall size and shape of the nucleus. The matrix acts as a
structural attachment site for the DNA loops during the interphase: evolutionary highly
conserved 300-1000 bp long DNA sequences, referred to as SARs (Scaffold Associated
Regions), have been identified that define the base of DNA loops, anchoring them to specific
proteins (SAPs - Scaffold Associated Proteins). By means of such chromosomal attachment
sites, the matrix might help to organize chromosomes, localize genes, and regulate DNA
transcription and replication within the nucleus.

Nucleolus
Nucleolus is a part of nucleus responsible for biogenesis of ribosomes (fig. 56). It is the
place of: transcription of ribosomal genes and synthesis of precursor rRNA (45S), followed by
processing of 45S rRNA and formation of 3 types of rRNA: 5.8S + 18S + 28S. As a result of
assembling the RNP is formed: rRNA 18S + 33 ribosomal proteins = 40S RNP (small ribosomal
subunit) and rRNA 28S + rRNA 5.8S +rRNA 5S + 49 ribosomal proteins =60S RNP (large
ribosomal subunit).
Sequences of DNA containing ribosomal genes (tandem repeats of rRNA genes) form the
nucleolar organizer region (NOR). The human genome contains more than 200 clustered
copies of the rRNA genes on five different chromosomes (13, 14, 15, 21, 22). Transcription of
rRNA genes is executed by RNA-polymerase I (rRNA 45S) and III (for rRNA 5S). Further
processing is needed to generate the 18S RNA, 5.8S and 28S RNA molecules. This processing
41
involves the function of a class of small nucleolar RNAs (snoRNAs) which are complexed with
proteins and exist as small-nucleolar-ribonucleoproteins (snoRNPs). Once the rRNA subunits are
processed, they are ready to be assembled into larger ribosomal subunits.

Fig. 56. Scheme of Ribosome Biogenesis.

42
 VI. THE GENE
The gene is the basic unit of heredity and carries the genetic information for a given
protein and/or RNA molecule. In biochemical terms a gene represents a fragment of
deoxyribonucleic acid (DNA), which in turn is a part of a much larger genetic unit, the
chromosome. Even the simplest unicellular organisms (e.g. bacteria) require several thousands of
different genes and their respective gene products, while complex multicellular organisms may
require up to 50 000 different genes. The human genome is estimated to contain 30.000 to
40.000 genes.
The term ―gene‖ was first used in 1911 by Danish geneticist Wilhelm Johannsen as a
convenient term for Mendel's particulate factors. A realization that genes were carried on
chromosomes began to emerge at about the same time, mainly based on the studies of Thomas
Hunt Morgan. In 1910 he provided the first definitive evidence for the so-called ―Chromosomal
Theory of Inheritance‖, a theory first proposed in 1902 by Walter Sutton and Theodor Boveri.
By the early 1930s a dogma has been accepted: genes carried genetic information that
determined a specific phenotype, and that such genes were carried as linear arrays on
chromosomes, which in turn were located in the nucleus. The chemical nature of genes was
confirmed only in 1944. The three-dimensional structure of DNA and was established in 1953 by
Francis Crick and James Watson in collaboration with Maurice Wilkins and Rosalind Franklin.
Not all genes are made of DNA; some animal and plant viruses and some bacteriophages
have genetic systems based on RNA rather than DNA.
Genes are the ―blueprints‖ for all RNA and protein molecules found in the cell. Some
genes encode RNA molecules as the final gene product (genes for ribosomal RNA, transfer
RNA, and other small RNAs), whereas others encode polypeptide chains, which are synthesized
by way of the intermediate messenger RNA.
Studies by Archibald Garrod, at the beginning of this century, began to suggest that genes
encode the information for specific polypeptides. Later (in the 1940s), George Beadle and E.L.
Tatum experimentally established the ―One gene – One enzyme‖ hypothesis. The hypothesis was
afterwards changed as ―One gene – One polypeptide chain‖.

Fig. 57. The general structure of gene

The genes consist of transcribed region and regulatory regions. The regulatory regions
are represented by promoter and terminator (Fig. 57). A sequence of DNA that is transcribed
from a single promoter is called transcription unit. In eukaryotes, transcription units are usually
single genes (monocistronic); in bacteria and other prokaryotes, several genes may be grouped
together to form a single (polycistronic) transcription unit under the control of a promoter, an
operon.
The transcribed region consists of coding region, which contains information about a
macromolecule (polypeptide, RNA) and non-coding regions at the ends.
The promoter region is a sequence at 5‘-end that is required to promote the enzyme RNA-
polymerase to bind to the gene at the correct position with respect to the region that needs to be
transcribed. The promoter nucleotides are marked with (-). The first nucleotide of the transcribed
region is +1. The prokaryotic promoter is relatively simple to define in physical terms whereas a
typical eukaryotic promoter is generally much larger; DNA sequences placed many thousands of
base pairs away from +1 are still able to profoundly affect the rates of gene transcription.
The terminator region serves to terminate the migration of the RNA-polymerase molecule
once it has crossed the gene's transcriptional unit.
Classification of nuclear genes in eukaryotes
43
 In eukaryotic cells the genes are classified as:
- I-st class: encode for rRNAs 5.8S, 18S, 28S; are transcribed by RNA-polymerase I.
- II-nd class: encode for mRNAs and snRNAs; are transcribed by RNA-polymerase II.
- III-rd class: encode for tRNAs and rRNA 5S; are transcribed by RNA-polymerase III.
Nuclear genome includes a set of genes, derived by duplication from some ancestral gene,
forming a gene family. Its members may be clustered together or dispersed on different
chromosomes or combination of both. The members of a repetitive gene family usually have
related or even identical functions (repetitive gene family – e.g. genes for rRNA or histone
proteins). Gene families may include copies of one of the genes with the same effect, but they
have different structure and functions (genes for globins, HLA etc.).
Pseudogenes are sequences resulted from the duplication, but that are inactive in all
tissues. They accumulate mutations and after a period of time may result as a new member of the
family, with distinctive peculiarities.

Peculiarities of organization of the structural (II-nd class) genes in eukaryotic

cells
An eukaryotic structural gene promoter consists of hundreds of nucleotides placed at the 5‘
end of the gene (fig. 58). This region contains a combination of consensus sequences that contain
sites recognized by transcription factors. In the position -20 –30 nucleotides (from the initiation
sites (+1)), the promoter of the structural genes encloses the Goldberg–Hogness box or TATA
box. This sequence directs the RNA–polymerize II to the sites of transcription initiation. CAAT-
box is positioned at -75 b.p. and controls the bounding of specific proteins during the
transcription initiation.
-75 -20 Another sequence, GC-box,
GC CAAT GC TATA placed at -90 b.p., assure the
START correct movement of RNA-
-nd
Fig. 58. Structure of the II Class Promoter polymerase and may be
present in several copies.
There are other different consensus sequences that bond to specific regulatory proteins
during gene activation. They are required for differential expression of the genes in different
tissues and different periods of cell cycle.
Coding region
The gene structure of eukaryotic cells is discontinuous (Fig. 59). The transcribed units of
genes contain coding regions called exons and non-coding region – introns. The number of
exons and introns varies and depends on the complexity of the encoding protein:
 The -globin gene contains 3 exons and 2 introns;
 The gene for procollagen contains 51 exons and 50 introns;
 The gene for blood factor VIII contains 26 exons and 25 introns (the DNA sequence
consist of 18000 b.p. and the molecule of mRNA has a length of 9000 b.p.);
 The gene that encodes dystrophin contains more than 76 exons (25 million b.p. in gene,
but only 14000 b.p. in mRNA).

Exons
Exons are coding sequences of a gene. They are present in the RNA precursors, in the
mRNA and are translated into amino acid sequence of the protein. At the 5‘ end the first exon
contains the universal site of translation initiation (ATG). At the 3‘ end of the last exon, one of
the three stop-codons (TAA, TAG, TGA), determining the termination of the protein synthesis
and a short nontranslated sequence are placed. The number of exons differs in different genes.

44
 Transcribed region

sequence
Leading
Coding region Terminator
Promoter

Site of initiation Site of termination

of translation of translation
Point of initiation Site of
of transcription polyadenilation

Fig. 59. Structure of II-nd Class Gene

Introns
Introns represent non-coding sequences of genes. They are present in precursor RNA and
absent in mRNA. During splicing the introns are removed from the precursor RNA. Usually
introns are longer that exons. Each intron has a GT sequence at the 5‘ end and AG sequence at
the 3‘ end. Special enzymes recognize these sequences during the process of non-coding regions
remove.

Organization Peculiarities of genes Encoding rRNA and tRNA

Genes for RNA (5.85; 185; 285) are organized in polycistronic transcription units and form
the nucleolus organizer (located on chromosomes 13, 14, 15, 21, 22 in many copies).
Transcription units are separated by non-transcribed sequences called spacers. In the human, the
transcription units for I-st class genes do not contain introns and have ~ 12000 b.p. length
(Fig.60). The promoters are recognized by RNA–polymerase I. Promoters have a bipartite
structure: a basic sequence situated at -45 to +20 that controls the initiation of transcription and
an additional control element, UCE (upstream control element), at -180 to -107.
Spacer

Repetitive unit
Transcription unit

Fig. 60. Structure of Eukaryotic Ribosomal Genes

Genes for 5S rRNA are located outside the nucleus and are transcribed by RNA-
polymerase III. This genes form a transcription unit in which the gene for 5S rRNA is repeated.
The promoter is localized inside the genes at +55, +80.
Genes for tRNA are organized in transcription units too, in which coding sequences are
separated by non-coding sequences. Genes for tRNA are transcribed by RNA-polymerase III and
the promoter has a similar structure with the 5S rRNA genes.

Mitochondrial Genome
The mitochondrial genome is represented by a circular 16.6 kb long molecule of DNA (fig.
61). Every mitochondrion contains a different number (2 to 10) of molecules depending on cell

45
energy necessity. The mitochondrial DNA of the human cells comprises almost exclusively only
coding sequences (has no introns); regulatory fragments are very short.
Fig. 61. Structure of Mitochondrial Genome
All the genes form two
transcriptional units: one on the heavy
strand with the HSP promoter and another
on the light strand controlled by the LSP
promoter.
The mitochondrial DNA contains 13
structural genes, 2 rRNA genes (12S
and 16S) and 22 tRNA genes (Fig. 61).
The mitochondrial genes are maternally
inherited. The nuclear genome cooperates
with the mitochondrial genome: about 90
nuclear genes encode the proteins that
support the mitochondria: ribosomal
proteins, aminoacyl-tRNA-synthetases,
DNA- and RNA-polymerases. Some
proteins encoded by the nuclear genes
mediate the control of the number of
mitochondria per cell and the quantity of
the proteins synthesized by these
organelles.

THE PECULIARITIES OF PROKARYOTES GENES ORGANIZATION

The genetic apparatus of the prokaryotic cells is represented by circular molecules of DNA
located in cytoplasm (nucleoid and plasmids). The prokaryotic genome contains only a few non-
coding fragments. The genes have a simple structure without introns.
A lot of genes involved in a metabolic chain form polycistronic transcriptional units called
operons. The operon contains a single promoter at the 5‘ end, some structural genes (the number
of structural genes is equal to the number of proteins involved in a particular metabolic process),
and the terminator at the 3‘ end (Fig. 62).

Promoter Gene 1 Terminat

Gene 2 Gene 3 Gene 4

Polycistronic
RNA

Protein 1 Protein 2 Protein 4

Fig. 62. Operon Protein
Structure3
Some operons contain other control fragments (operator regions, attenuation regions etc.).
In position -10, the promoter of the prokaryotic genes includes specific fragments known as the
Pribnow box, responsible for the initiation of the local unwinding of the DNA and in position -
35, the TTGACA box, involved in the association to RNA-polymerase (Fig. 63).

46
 Fig. 63. Promoter Structure of Prokaryotic Genes

The other gene classes (genes for rRNA, tRNA) are organized in mixed transcriptional
units, separated by the spacers. Fig. 64 represents the structure of such cluster of genes.

P1 P2
15 S tRNA 23 S 5S tRNA

Primary
transcript

15Fig.
S 64. Structure
tRNA of Prokaryotic Genes
23encofing
S 5S tRNA
tRNAs and rRNAs

47
 VII. TRANSCRIPTION AND RNA PROCESSING
All the information about organisms is stored in DNA. The use of this information is made
through gene expression.
Gene expression represents the conversion of genetic information encoded in a gene into
RNA or protein, by transcription of a gene into RNA and (in the case of protein-coding genes)
the subsequent translation of mRNA to produce a protein. In both eukaryotes and prokaryotes
there are steps of gene expression.
DNA replication
DNA repair The steps of gene expression in
Genetic recombination prokaryotic cells:
DNA 1. Activation and transcription of genes;
2. Translation of mRNA – synthesis of
proteins;
3. Conformation – post-translational
DNA transcription modification of proteins.
RNA synthesis
The steps of gene expression in
RNA eukaryotic cells:
1. Activation and transcription of genes;
2. Processing of RNAs;
Codons Protein synthesis
3. Export of RNAs from nucleus to
cytoplasm;
Protein 4. Translation of mRNA – synthesis of
proteins;
5. Conformation – post-translational
Amino acids
modification of proteins.
Fig. 65. Steps of Gene Expression

Transcription is the first step in gene expression. Transcription represents the process of
complimentary synthesis of RNA from a DNA template.
A sequence of DNA that is transcribed as a single continuous RNA strand, a transcript, is
called a transcription unit. A unit of transcription may contain one or several sequences encoding
polypeptides (translational open reading frames (ORF) or cistrons). In prokaryotes polycistronic
mRNAs are common. In eukaryotes, monocistronic mRNAs are the general rule, but some
transcription units encode more than one polypeptide as a consequence of alternative
transcriptional start sites and/or alternative pathways of RNA splicing or other types of post-
transcriptional RNA processing.
Components required for transcription:
- template - DNA molecule containing regulatory (promoter, terminator) and coding
sequences;
- RNA-polymerases;
- General and specific transcription factors;
- NTP (ATP, GTP, CTP, UTP).
Transcription is the main step of gene expression control in both prokaryotes and
eukaryotes. There are three steps of transcription:
1) Initiation (the most important);
2) Elongation;
3) Termination.

48
 RNA-polymerases
RNA-polymerases are enzymes which catalyze the synthesis of RNA using DNA as
template. Direction of synthesis of RNA is 5'→3' and DNA is read in direction 3'→5'. The DNA
strand that serves as template is named sense chain (or non-coding strand), and the other
strand, identical with RNA, is named coding strand (fig. 66).

Fig. 66. Transcription and RNA Synthesis

The prokaryotic cells have only one type of RNA-polymerase, which synthesizes all kinds
of RNAs.
The eukaryotic cells have three distinct classes of RNA-polymerases:
- RNA-polymerase I: the most active polymerase (involved in synthesis of 50-70% of all
cellular RNAs). It works in nucleolus and synthesizes rRNA 5.8S, 18S, 28S.
- RNA-polymerase II: works in nucleoplasm, synthesizes mRNAs and snRNAs (10-40%).
- RNA-polymerase III: functions in nucleoplasm, synthesizes tRNAs and 5S rRNA (10%).
Transcription factors
There are molecules (usually proteins) that mediate transcription by interaction with DNA
or other proteins involved in transcription. There are two types of transcription factors:
General transcription factors that are the same for all cell. Their functions:
- Facilitate the interaction between promoter and RNA-polymerase;
- Participate in choosing of template strand and indicate the direction of transcription;
- Unwind and rewind DNA double helix;
- Prevent premature removing of RNA-polymerase from template;
- Assure termination of transcription.
Specific transcription factors are specific for each kind of cells. They participate in
decondensation of chromatin and specifically bind to promoter, activating it.

Particularities of Transcription of Eukaryotic Structural Genes

Initiation
Transcription initiation is a consequence of events, which consist in gene activation and
beginning of transcription. It includes the following steps:

49
 - Chromatin decondesation; DNA
demethylation;
- Interaction of specific transcription
factor with promoter;
- Binding of TFIID (TBP) to TATA-
box (TF – Transcription Factor, II –
polymerase II; TBP – TATA Binding
Protein);
- TFIIA binds upstream from the
TBP. It stabilizes the TBP-TATA-box
complex;
- TFIIB binds in front of TBP, which
unwind DNA using ATP;
- RNA-polymerase II, activated by
TFIIF binds to promoter. TFIIF is a
helicase, which locally unwinds the
DNA;
- After binding of TFIIE and TFIIH,
RNA-polymerase can move along the
DNA template strand;
- Reading of the first nucleotide (+1)
and incorporation of the first
ribonucleotide (usually ATP);
- Initiation is finished by formation of
the first phosphodiester bond in the
Fig. 67. Transcription Initiation newly synthesized RNA (Fig. 67).
Some distant sequences can also participate in the process of transcription. They may
facilitate the recognition of promoter by RNA-polymerase (enhancer) or interfere in this process
(silencer) (Fig. 68).
Regulatory protein Regulatory protein
attached to enhancer attached to promoter

Enhancer Promoter

Enhancer

RNA
polymeraze
II

Promoter
Fig. 68. Interaction of enhancer with promoter and RNA-polymerase

Elongation
o TFIIB and TFIIE are released from RNA-polymerase. TFIIF and FTIIH remain attached to
the enzyme;
o RNA polymerase II reads DNA in direction 3'→5' and polymerizes RNA in direction 5'→3'
(30 bases/sec);
o TFIIS prevents premature removing of RNA-polymerase;
o FTIID, FTIIA that can interact with other RNA-polymerase remain attached at the promoter.

50
 Termination
Fig. 69 shows the structure of a terminator. It contains a palindrome sequence - a region in
which the sequence on both strands is identical when read in an antiparallel direction.

Fig. 69. Terminator Structure

After RNA-polymerase transcribess the sequence corresponding to the terminator, RNA

forms a hairpin loop. RNA-polymerase stops and a termination factor rho (ρ) interacts with the
enzyme and dissociates the complex DNA-enzyme-RNA (Fig. 70).

RNA-polymerase
transcribes DNA

rho attaches to
recognition site on RNA

rho moves along RNA,

following RNA-
polymerase

RNA-polymerase pauses
at terminator and rho
catches up; rho unwinds
DNA-RNA hybrid

Termination:
RNA-polymerase, rho
and RNA are released

Fig. 70. Termination of Transcription

51
 RNA PROCESSING
The primary transcript
represents an immature RNA.
Processing of RNA includes the
events that result in modification
of the RNA ends and remove of
non-coding sequences (Fig. 71).

CAPPING
The 5'-end of the primary Fig. 71. The Steps of RNA Processing
transcript is modified during transcription.
Once 30 bases are synthesized,
guanylyltrasferase adds a methylated GTP by
unusual 5'-5' bond to the first nucleotide of
RNA (usually an Adenine). This structure
(7MeG5ppp5N) is named “CAP”. The next
riboses in position 2' can also be methylated
(Fig. 72).
CAP has the following functions:
 Stabilizes RNA due to unusual 5' - 5'bond;
 Represents a site of recognition for
ribosome during translation initiation.
Fig. 72 The CAP Structure

POLYADENYLATION
After transcription, the 3'-end of RNA contains a palindromic loop, which is removed by
excision in the AAUAAA site. The enzyme poly(A) polymerase adds 100-200 residues of
adenylic acid. mRNA encoding histones are not polyadenylated.
Poly(A)-tail performs the following functions:
 Assures the stability of 3'-end of RNA. Molecules that contain longer tails are more stable.
 Participates in passing of mRNA through
nuclear envelope.
SPLICING
Splicing represents the process of
removing of introns from pre-mRNA and
sealing of exons. This process takes place with
participation of an enzymatic complex –
splicesome. Enzymes (U1-U6) represent
ribonucleoproteins and contain snRNA. Introns
are recognized by sequences GU at 5'-end and
AG at 3'-end. There are several steps in the
process of splicing (Fig. 73):
 Site GU is recognized by U1;
 U2 binds to an Adenine from the interior of
intron (branch site);
 U4,U5,U6 associate to U1 and U2 forming a
loop by binding of 5'-end of intron to Fig. 73. Splicing of pre-mRNAs
Adenine via an unusual 5'–2'bond;

52
 After U4 removal, 3'-end of intron is cleaved. The intron forms a lasso and is removed
together with U2, U5, and U6 proteins;
 The 3' and 5'-ends of exons are sealed.
The resulted mRNA is transported to the cytoplasm to be used as template for protein
synthesis.
There are several types of splicing:
 Constitutive splicing – all introns are removed from pre mRNA and exons are sealed in the
same order as in the gene.
 Alternative splicing – in mRNA remain only some of exons, and only some of introns are
removed. From one gene can be synthesized more types of proteins.

Fig. 75. Types of Splicing

 Exon shuffling – change of the order of exons in mRNA as compared to their position in
the gene.
 Trans-splicing – exons from different pre-mRNA participate to make one molecule of
mRNA.
RNA Editing
RNA editing is defined as a process responsible for any differences between the final
sequence of a messenger RNA (mRNA) and its genetically determined template. This process
takes place in cytoplasm and involves adding, removing or conversion of some nucleotides.
PARTICULARITIES OF I-ST AND IIIrd CLASS GENES TRANSCRIPTION
Eukaryotic ribosomes contain four
RNA molecules: 5S, 5.8S, 18S and 28S. In
the nucleolus there are several hundred
copies of transcription units which encode
5.8S, 18S and 28S. The mammalian primary
transcript of I-st class genes is a 45S RNA
containing the sequences of 5.8S, 18S and
28S rRNAs. During maturation, the primary
transcript is cleaved in 5 places, spacers are
removed and 3 types of rRNA result (Fig
Fig 76. Transcription and rRNA Processing 76).

53
 The genes for the 5S rRNA are contained in a
separate transcription unit. These genes are also
arranged in tandem: there are several repeating units
separated by untranscribed segments (Fig. 77). This
Fig. 77. Organization of genes for the 5S rRNA
type of rRNA is transcribed by RNA-polymerase
III. Note that in higher eukaryotes the rRNA sequences do not contain introns.
Eukaryotic tRNA molecules are also excised from larger transcripts (called pre-tRNA),
which may contain one or more tRNA sequences. During processing, the introns and spacer
sequences are removed, at the 3‘ end a specific CCA sequence is added.

Transcription in Mitochondria
In mammalian mitochondrial genomes are very compact; they are no introns. The 13
mRNA, 2 rRNA and 22 tRNA genes are under control of two promoters: HSP and LSP. Most
genes are expressed in the same direction and tRNA genes lie between the genes coding for
rRNA or protein. 12 mRNA-coding, 2 rRNA-coding and 14 tRNA-coding regions are
transcribed in clockwise direction; 1 mRNA-coding and 8 tRNA-coding regions are read counter
clockwise. Beginning with the promoter DNA is transcribed into a single transcript, from which
RNAs are cleaved to release the mRNAs, rRNAs and tRNAs.

Transcription in prokaryotes
In bacteria and other prokaryotes, several genes may be grouped together to form a single
transcription unit under the control of a promoter – an operon. In an operon, genes encoding, for
example, the different enzymes of a metabolic pathway or the subunits of an enzyme complex,
are clustered and are transcribed together into a polycistronic transcript, under the control of a
single promoter. This transcript is then translated to give the individual proteins. Operons enable
the rapid and efficient coordinate expression of a set of genes required to respond to a change in
the external or internal environment (See section VI. THE GENE).

54
 VIII. TRANSLATION
Protein synthesis is the final step in the decoding and expression of the protein-coding
information stored in nucleic acids and is the process by which the amino acid chain of a protein
(a polypeptide chain) is assembled in the correct sequence. The sequence of amino acids in a
polypeptide chain is determined by the sequence of nucleotides in an mRNA, which is itself a
copy of the nucleotide sequence of the corresponding gene. The correspondence of amino acid
sequence to nucleotide sequence follows the rules of the genetic code in which each triplet of
three consecutive nucleotides (a codon) in the mRNA encodes a particular amino acid. Decoding
of mRNA to produce a polypeptide chain is also termed translation. Translation occurs on
subcellular particles called ribosomes. Each ribosome is made up of two nonidentical subunits
(`large' and `small') each of which contains one or more rRNA molecules and different ribosomal
proteins. Several ribosomes may simultaneously translate the same mRNA molecule; such
groups of ribosomes are referred to as polyribosomes or polysomes.
In eukaryotic cells, translation occurs outside the nucleus, primarily in the cytoplasm;
proteins encoded by mitochondrial or chloroplast DNA are, however, translated in these
organelles. The essential mechanism of translation is extremely similar in all cases but there are
important differences in detail, especially between eukaryotic cytoplasmic translation on the one
hand, and translation in prokaryotes and in cellular organelles on the other. Henceforward,
`eukaryotic' will refer to translation in the cytoplasmic compartment of eukaryotic cells.

THE GENETIC CODE

The genetic code is a collection of base sequences (codons) that correspond to each amino
acid and translation stop signals.
Table 7. The Genetic Code
U C A G Proprieties of the genetic code:
(Phe) (Ser) (Tyr) (Cys) U ▬ Consists of triplets of bases (codons). A sequence
U
(Phe) (Ser) (Tyr) (Cys) C of three successive bases in nucleic acid specifies a
(Leu) (Ser) STOP STOP A particular amino acid or a translation termination
(Leu) (Ser) STOP (Trp) G signal.
(Leu) (Pro) (His) (Arg) U
▬ The genetic code contains 64 codons of which 61
(Leu) (Pro) (His) (Arg) C
C
(Leu) (Pro) (Gln) (Arg) A
define one or other of the 20 amino acids known in
(Leu) (Pro) (Gln) (Arg) G proteins. The remaining three codons encode signals for
(Ile) (Thr) (Asn) (Ser) U the termination of translation (STOP).
(Ile) (Thr) (Asn) (Ser) C ▬ The genetic code is universal. With the exception
A
(Ile) (Thr) (Lys) (Arg) A of eukaryotic mitochondria, the same codon encodes
(Met) (Thr) (Lys) (Arg) G the same amino acid.
(Val) (Ala) (Asp) (Gly) U ▬ The genetic code is redundant (degenerated):
(Val) (Ala) (Asp) (Gly) C
G several codons encode the same amino acid. These
(Val) (Ala) (Glu) (Gly) A
(Val) (Ala) (Glu) (Gly) G codons a called synonym.
▬ The genetic code is specific. Each codon encodes a
single amino acid.
▬ The genetic code is not overlapping. In the mRNA molecule each nucleotide is a part of a
single codon (fig. 78). Correct
▬ There is a single initiation codon – AUG,
which encodes for methionine. ACCGACUUCGAUGCCAGGCACAUUUGC
▬ There are three STOP codons – UAA, Incorrect
UGA, UAG. Correct
ACCGACUUCGAUGCCAGGCACAUUUGC
Incorrect
Any one of three ways a nucleotide
sequence can be read as a series of triplets. Fig. 78. Genetic code is not overlapping

55
Messenger RNAs generally contain only one translatable reading frame, which is dictated by the
position of the initiation codon (AUG). The reading frame that first contains initiation codon is
called open reading frame (fig. 79).

ACCGACUUCGAUGCCAGGCACAUUUGC
Open reading frame

Fig. 79 Coosing of open reading frame

The Components Required for Translation

- mRNA as template
- ribosomes
- tRNAs – at least 21 types
- aminoacyl tRNA syntethases – 20 types
- amino acids – 20 types
- ATP and GTP – as sources of energy
- MG2+, Ca2+ - for activation of enzymes
- specific proteins – translation factors.
Eukaryotic mRNA contains information about synthesis of one type of polypeptide, so it
is monocistronic. After synthesis in nucleus, molecules of primary transcripts are processed
(CAPped, polyandenilated, spliced), than mRNAs are transported trough nuclear pores into
cytoplasm. Each molecule of mRNA contains at 5‘ end a specific site – CAP, which protects
RNA and during initiation of translation serves as site of recognition for ribosome. The sequence
between CAP and first AUG (initiation codon) is called leader sequence. The translated region
consists of exons and determines the sequence of amino acids in polypeptide. At the end of
translated sequence one of STOP codons is located. 3‘ end of mRNA is protected by poly(A) tail
(Fig. 80).
mRNA
CAP AUG UAA Poly(A)
5’ 3’
Leader sequence Translated sequence Untranslated 3’
sequence
Fig. 80. Structure of Eukaryotic mRNA

Prokaryotic mRNAs are resulted from transcription of an operon. This mRNA is not
processed and may be easily destroyed in cytoplasm. Prokaryotic mRNAs are usually
polycistronic and contain information about the structure of many polypeptides. Synthesis of
each polypeptide begin at AUG, so every AUG preceded at a few bases by sequence Shine-
Dalgarno (5‘…AGGAGG…3‘) represents a signal for initiation of translation (Fig. 81).
AUG STOP AUG STOP AUG STOP
5’ 3’
Fig. 81. Structure of Polycistronic Prokaryotic mRNA
Different products are translated from polycistronic mRNA molecule by the ribosomes.
The prokaryiotic ribosome translates all the sequences, while the eukaryotic ribosome translates
only the sequence with AUG located near the 5‘ terminus of the mRNA (Fig. 82).

Fig. 82. Translation of the same mRNA using Prokaryotic and Eukaryotic Ribosomes

56
 Transfer ribonucleic acid (tRNA).
Transfer RNA (tRNA) is a family of
small nucleic acids that mediate the translation
of the nucleic acid code into the amino-acid
sequence of a protein. tRNA molecules act as
adaptor molecules, which match the codon in
mRNA to its particular amino acid. They
could recognize a codon in mRNA and could
also be able to bind the amino acid
corresponding to that codon. The main
function of tRNAs is to carry amino acids to
the ribosomes and to incorporate the correct
amino acid into the nascent protein chain.
There are 61 types of tRNAs, which transport
20 types of amino acids.
tRNAs are between 74 and 90
ribonucleotides long. The secondary structure
can be written in the form of a cloverleaf.
Most of the bases are adenine (A), uracil (U),
Fig. 83. Secondary Structure of tRNA guanine (G), and cytosine (C), but up to 10%
of the bases are modified during tRNA
maturation (dihydrouridine, pseudouridine, thymine). tRNA sequences show a very high degree
of conservation, the principal feature being the terminal CCA sequence which is present in all
tRNAs.
The acceptor arm contains the 3‘ and 5‘ ends of the molecule. The free 2 or 3 hydroxyl
groups of the terminal adenine at the 3-terminal CCA is the primary site of aminoacylation (can
be linked to an amino acid). The anticodon arm (anticodon loop) contains the anticodon base
triplet. The D arm (D loop) is named for its content of the modified base dihydrouridine. It
interacts with aminoacyl-tRNA synthetase. The Ψ arm is named after the modified base
pseudouridine. It interacts with ribosome. The extra arm is the most variable region of the
molecule. The functional significance of the extra arm is unknown (Fig. 83).
Aminoacyl tRNA synthetases are enzymes responsible for covalently linking amino acids
to 2‘ or 3‘-OH position of tRNA. There are 20 aminoacyl tRNA synthetases. These enzymes sort
the tRNAs and amino acids into corresponding sets, each synthetase recognizing a single amino
acid and all tRNAs that should be charged with it. The catalytic domain includes the binding
sites for ATP, amino acid and tRNA (Fig. 84). The reaction takes place in two steps:
I. Amino acid + ATP  Aminoacyl-AMP + P~P
II. Aminoacyl-AMP + tRNA  Aminoacyl-tRNA + AMP.

Fig. 84. An Aminoacyl-tRNA Synthetase Charges tRNA with an Amino Acid

Ribosomes. A ribosome represents a large ribonucleoprotein particle which is present in
many copies in all cells and which is the site of protein synthesis. All ribosomes consist of two
subunits of unequal size, the large and small subunit, whose size and composition differ between

57
prokaryotic and eukaryotic cell, although the overall architecture is similar. Bacterial ribosomes
have a sedimentation coefficient of 70S. They are composed of a large subunit of 50S and a
small subunit of 30S. The 50S subunit is made up of 34 different proteins and the rRNAs 23S
and 5S. The 30S subunit contains 21 ribosomal proteins and a 16S rRNA.
Eukaryotic ribosomes have a sedimentation coefficient of 80S. They are composed of a
large subunit of 60S and a small subunit of 40S. The large subunit contains three rRNAs (5S,
28S, and an rRNA unique to eukaryotes, 5.8S rRNA), and 50 proteins. The small subunit
contains 33 proteins and an 18S rRNA. In eukaryotes, ribosomes are assembled in the nucleolus
from rRNAs transcribed in the nucleolus and ribosomal proteins imported from the cytoplasm.
Assembled ribosomes are then exported from the nucleus to the cytoplasm.
All ribosomes contain several active sites. The most important are:
- A-site (acceptor site), which binds with incoming aminoacyl-tRNA.
- P-site (donor site), which is occupied by peptidyl-tRNA, a tRNA carrying the nascent
polypeptide chain.

THE MECHANISM OF TRANSLATION

Proteins are synthesized starting with their N termini, corresponding to translation of the
mRNA in the 5‘ to 3‘ direction. Translation of mRNA may be conveniently divided into three
stages: initiation, where the correct site on the mRNA for commencing translation is identified
and binding of the ribosome to the mRNA occurs; elongation, during which the coding sequence
of the mRNA directs the synthesis of the polypeptide chain; and termination, which occurs
when the ribosome encounters a stop or termination codon signaling the end of the coding
sequence of the mRNA which results in release of the completed polypeptide chain and the
ribosome from the mRNA. During the elongation stage, tRNAs carrying the appropriate amino
acid recognize the codons in mRNA by means of anticodon:tcodon interactions and thus deliver
amino acids for addition to the growing peptide chain in the correct order.
Initiation. Translation commences at an initiation codon. This is generally AUG although
other closely related codons such as GUG may also be used, especially in bacteria. Since AUG
encodes the amino acid methionine, this is the first amino acid incorporated (even when non-
AUG codons are employed). In bacteria the methionine is modified to N-formylmethionine.
AUG is the only codon to code for methionine, and different tRNAs exist for methionine as the
initial amino acid (initiator tRNA) and for methionine in internal positions within polypeptide
chains. Initiation is mediated by proteins termed initiation factors.
As the AUG codon is ambiguous (it can indicate either the start of translation of the
mRNA or merely the location of methionine residues within proteins) mechanisms must exist to
distinguish between these functions. In bacteria, the initiator AUG (`start codon') is distinguished
from internal AUGs on the basis of an interaction between complementary sequences in the
rRNA of the small ribosomal subunit (16S rRNA) and a purine-rich sequence immediately
upstream of the start codon (the Shine-Dalgarno sequence) in the mRNA.
In eukaryotes no such interaction occurs. All eukaryotic cellular cytoplasmic mRNAs have
at their 5‘ end a cap consisting of 7-methylguanosine triphosphate linked to the first nucleotide
of the mRNA itself by a 5‘:5‘-phosphodiester bond. Several eukaryotic initiation factors can
interact directly or indirectly with the cap (and are therefore termed cap-binding proteins). They
are believed to mediate the unwinding of regions of secondary structure within the 5‘-leader
region of the mRNA, which interfere with initiation. The ribosome binds to the mRNA and scans
along the mRNA in a 5‘→3‘ direction to locate the start AUG codon: translation in eukaryotes
generally starts at the first AUG from the 5‘-end.
There are some steps during initiation of translation (Fig. 85):
- Binding of methionine to tRNAMet;
- Activation of GTP to methionyl-tRNAMet complex;
- Binding of methionyl-tRNAMet-GTP complex to P-site of small ribosomal subunit;
- Attaching of this complex to mRNA;
58
 - Moving into 3‘ direction and recognition of AUG; An ATP is used as energy;
- Adding of large subunit.

Fig. 85. Initiation of Translation

Elongation. This process is essentially identical in all organisms. Immediately after
initiation, the ribosomal P-site is occupied by the initiator methionyl-tRNA and the next codon is
aligned with the vacant ribosomal A (aminoacyl)-site. Entry of the correct cognate aminoacyl-
tRNA (whose anticodon matches the codon in the A-site) is mediated by an elongation factor,
associated with GTP. Formation of the peptide bond between the methionine moiety of
methionyl-tRNA and the amino acid carried by the incoming aminoacyl-tRNA then follows,
catalysed by the peptidyltransferase activity associated with the large ribosomal subunit. The
GTP is also hydrolysed to GDP and Pi. The second elongation factor then mediates the
translocation step in which the spent tRNA leaves the P-site, the peptidyl-tRNA moves from the
A- to the P-site and the ribosome moves by the equivalent of one codon (three nucleotides)
relative to the mRNA to align the next codon with the A-site. This step is also associated with
GTP hydrolysis. Peptide-chain elongation consists of repetitive cycles of this elongation process,
the nascent chain being extended by one amino acid residue at each cycle (Fig. 86).

Fig. 86. Elongation of Translation

59
 Termination occurs when the translating ribosome encounters a termination or stop codon
(UAA, UAG or UGA). Since no tRNA exists to decode such codons, elongation ceases. The
termination process involves release of the complete polypeptide chain, the final tRNA and the
ribosomal subunits, which are then free to participate once more in mRNA translation. This
process requires proteins termed release factors (Fig. 87).

Fig. 87. Termination of Translation

POST-TRANSLATIONAL EVENTS
The polypeptide chain released from the ribosome is not necessarily the final functional
form of the protein, and it may undergo post-translational modification(s) (e.g. limited
proteolysis, glycosylation, phosphorylation), assembly into a larger multisubunit protein (or
other macromolecular assemblies) or translocation to other sites in the cell (e.g. to organelles, or
through the secretory pathway).

Antibiotic inhibitors of translation

A number of antibiotics and other agents inhibit mRNA translation usually by interacting
with ribosomes and impairing specific steps in the process. These compounds include
chloramphenicol, cycloheximide, erythromycin, puromycin, streptomycin and tetracycline. Such
agents have proven extremely useful as antibacterial agents owing to the selectivity for bacterial
(70S) ribosomes rather than eukaryotic (80S) ribosomes, or to their selective entry into bacterial
cells.

60
 IX. DNA REPLICATION AND REPAIR
Replication represents the duplication of the genetic information encoded in DNA that is
the crucial step in the reproduction of living organisms and growth of multicellular organisms.

Replication is semiconservative so that

each new DNA double helix consists of one
parental template strand hydrogen bonded along
its entire length by base-pairing to a newly
synthesized strand (Fig. 88).
Components required for replication:
- DNA as template;
- dNTPs for synthesis of DNA;
- NTPs for synthesis of primers;
- proteins for unwinding the DNA double-
helix;
- proteins for initiation of replication;
- proteins for polymerization of nucleotides.
Fig. 88. Replication Model

In the process of replication a lot of proteins, including enzymes participate:

 DNA helicases: enzymes that unwind DNA to facilitate separation of the two strands of
the duplex.
 Primase: a RNA-polymerase that synthesizes the short RNA primers for DNA replication
using DNA as a template.
 Topoisomerases: enzymes that catalyse the interconversion of different topological
isomers of DNA that involves the transient breakage of one (type I) or both strands (type
II) of DNA and can result in the removal of negative or positive supercoils from DNA or
the introduction of negative supercoils.
 DNA-polymerases: enzymes that synthesis new strands of DNA in the direction 5‘-3‘. All
polymerases can only continue strands, requiring free 3‘ ends for initiation of their activity.
Some DNA-polymerases have also exonuclease activity: can remove nucleotides from the
end in the direction 5‘-3‘ or 3‘-5‘.
 DNA-ligases: enzymes that bind the fragments of DNA with 3‘-5‘ phosphodiester bonds.
 SSB protein: bind single-stranded DNA regions.
Replication initiates at specific replication origins (ORI), to generate two replication forks,
which are elongated bidirectionally by multienzyme replication complexes - the replisome.
Prokaryotic circular DNAs are replicated from a single origin, but eukaryotic DNAs have
multiple origins of replication so that the large chromosomes can be replicated sufficiently
rapidly. A region or unit of a chromosome served by a single origin of replication is called
replicon.

MECHANISMS OF REPLICATION
The two strands of a DNA double helix are antiparallel, that is, they run in opposite
directions so that the terminal 5'PO4 of one strand is opposite the terminal 3'OH of the other.
However, DNA polymerases can only add nucleotides to the 3'OH group of a polynucleotide
chain. These constraints are overcome by the use of RNA primers and a semi-discontinuous
mode of synthesis. With rare exceptions, DNA chains are initiated by synthesis of short RNA
primers, which are initiated de novo by RNA polymerases known as primases using the DNA
strand as a template. These provide a 3' hydroxyl group from which DNA polymerases can
synthesize new DNA. Since the strands are antiparallel and DNA polymerases can only add to
the 3' end, synthesis of both strands at a single replication fork requires two mechanisms. One
61
strand, the leading strand, is synthesized continuously by the repeated addition of nucleotides to
its 3' end, whereas the other lagging strand is synthesized discontinuously in segments called
Okazaki fragments which are about 1000 nucleotides long in bacteria or 150 nucleotides in
eukaryotes. Gaps between the fragments are subsequently filled to form the second continuous
DNA strand (Fig. 89).

Fig. 89. Mechanism of Replication

DNA Polymerases
DNA polymerases polymerize deoxyribonucleoside triphosphates into DNA by a
condensation reaction that forms a phosphodiester bond linking the 3-OH of the sugar
component of one nucleotide and the 5-OH of the sugar of the next with the release of
pyrophosphate. There are several types of DNA polymerase in any organism. In Escherichia
coli, DNA polymerase III synthesizes both leading and lagging strands. The gaps between
Okazaki fragments are filled by DNA polymerase I.
In eukaryotes, chromosomal DNA is replicated by three DNA polymerases α, δ, and ε.
Polymerase α contains an integral primase. Polymerase α is required for lagging strand synthesis
and possibly for the initial priming of leading strands too. Polymerase δ is required for leading
strand synthesis. Mitochondrial DNA is synthesized by polymerase γ. Most DNA polymerases,
but probably not polymerase α, contain a proofreading exonuclease which excises
misincorporated bases, increasing the fidelity of template copying.

Initiation of Replication
Prokaryotes initiate DNA replication at unique sites, called origins of replication. In
eukaryotes multiple origins are used, so that eukaryotic chromosomes are replicated by many
replication forks simultaneously.
In prokaryotes and some animal viruses, and presumably elsewhere, replication origins are
recognized by sequence-specific binding proteins, which can locally unwind a specific region of
the double helix allowing replication to initiate.

62
 Initiation occurs in several steps:
 recognition of ORI by special proteins;
 DNA-helicase unwinds DNA;
 Primase synthesis a short fragment of RNA
– primer;
 DNA-polymerase adds new nucleotides at
3‘ end (Fig. 90).
All proteins participating at initiation form
the primosome.
Unidirectional replication occurs in some
phages and some prokaryotic circular DNAs
replicate by a rolling circle mechanism (Fig. 91).
Fidelity of DNA replication is assured by
proofreading and DNA repair mechanisms.
Regulation of DNA replication is a critical control
point in cell proliferation.
Fig. 90. Initiation of Replication

Fig. 91. Rolling Circle Mechanism of Replication

Termination and Telomeres

63

Fig. 92. Replication of Telomeres
When two converging
replication forks meet, their
nascent strands are joined. DNA
topoisomerase II is required to
unwind the two progeny DNA
molecules from around each other
in these final stages. The ends of
the long linear chromosomes of
eukaryotes, called telomeres, are
replicated by a different
mechanism. They consist of many
copies of a short repeating
sequence which are added by the
enzyme telomerase. This enzyme
contains an RNA template which
it copies into DNA to complete
the chromosome ends (Fig. 92).
Mitochondrial DNA has
two ORI – one for light strand (L)
and the other for heavy strands
(H).

DNA REPAIR
DNA repair represents a range of cellular responses associated with restoration of primary
structure of DNA.

Mechanisms of alteration of DNA molecules:

- base substitution during replication
- base changes resulting from chemical instability of bases
- alterations resulting from the action of other chemical and environmental agents.

The possible defects in DNA molecules:

 An incorrect base in one strand cannot form hydrogen
bond with the corresponding base in the other:
▪ Defect can result from replication errors or
▪ Deamination of C to U, followed by replacing of U
by T in subsequent rounds of replication;
 Missing bases – depurination: alkylating agents (used
in cancer treatment) react with G and weak N-
glycosidic bond;
 Altered bases:
 chemical and physical agents can break purine
and pyrimidine rings,
 Formation of thymine dimmers (Fig. 93).
 Single-strand breaks:
▪ Peroxides, Fe2+, Ca2+, Ionizing radiation can attack
the phosphodiester bonds
▪ DNases present in cells make phosphodiester
scissions.
 Double-strand breaks. Highly ionizing radiations Fig. 93. Formation of Pyrimidinic Dimers
can produce numerous single strand breaks and as result – double-strand breaks.

64
 MECHANISMS OF DNA REPAIR
 Excision repair – excision of damaged bases;
 Recombination repair – reconstruction of DNA from undamaged fragments;
 SOS repair – in prokaryotic cells. Enzymes synthesis DNA without fidelity of
replication.
Types of repair
Photoreactivation - direct repair, when enzymatic cleavage of thymine dimers is activated
by visible light. Photolyase was discovered in different species, but is active only in bacteria.
Repair of alkylation damages by MGMT – O6-methyl-guanine DNA methyltransferase (in
human). 20% of human tumor cell have reduced MGMT activity.
Base excision repair (BER) – reparation of single nucleotide damage (Fig. 94 A).
▪ DNA-glycosylase removes the damaged (modified, fragmented) base from DNA;
▪ AP-lyase makes an excision at 3‘ end (AP – apurinic/apyrimidinic sites);
▪ AP-hydrolase incises at 5‘ end;
▪ DNA-polymarease fills in the gap beginning with 3‘ end;
▪ DNA-ligase seals the nick.

A B
Fig. 94. A - Base Excision Repair (BER); B - Nucleotide Excision Repair (NER)

Nucleotide excision repair (NER) – reparation of bulky DNA damages (Fig. 94 B).
 A complex of proteins (XPA-RPA) recognizes the damaged fragment;
 Excinuclease cuts the 5th phosphodiester bond 3‘ and 24th phosphodiester bond 5‘ to the
lesion (single-strand incisions);
 The gap is filled by DNA-polymerases δ and ε;
 DNA-ligase seals the nick.

65
 Mismatch repair (MMR) reparation of misincorporations during replication and the
mismatches resulted of deamination of 5-methylcytosine to uracil.
▪ An unknown enzyme excises the mismatch bases;
▪ The alkylation agents induced expression of DNA-polymerase β which fills in
the gap;
▪ DNA-ligase seals the nick.

Recombination repair (Fig. 95)

 Excision of damaged fragment of DNA;
 Transport of homologous fragment from another molecule;
 Ligation of the fragments.

Fig. 95. Recombination repair

66
 X. THE CELL CYCLE
STAGES OF THE CELL CYCLE
Animal development from a single-cell zygote to fertile adult requires many rounds of cell
division. Cell cycle is a complement of genetic, biochemical and morphological events from cell
birth till its division, differentiation or death.
The cell cycle is an ordered set of periods that
includes interphase and the division, culminating in cell
growth and separation into two daughter cells (fig. 96,
97). The interphase stages are G1-S-G2-M, where the G1
stage stands for "GAP 1"; the S stage stands for
"Synthesis" (when DNA replication occurs), the G2 stage
stands for "GAP 2". The M stage stands for "mitosis",
and is the period when nuclear division (karyokinesis)
and cytoplasmic division (cytokinesis) occur. Mitosis is
further divided into the following phases: prophase,
prometaphase, metaphase, anaphase and telophase.
Interphase
Interphase generally lasts at least 12 to 24 hours in
mammalian tissue. During this period, the cell is
constantly synthesizing RNA, producing protein and
growing in size.
Fig. 96. Periods and Checkpoints of the
There are a lot of
Cell Cycle activities during
this period: the cell
obtains nutrients, makes ATP, grows, reads its DNA, and
conducts other "normal" cell functions including
preparation for cell division.
G1 (presynthetic or postmitotic) stage of interphase
is a period of cell growth in which proteins, carbohydrates,
and lipids typical for a given cell type are synthesized, but
DNA is not replicated (the "G" refers to the "gap" or break
in DNA synthesis during this stage). So, chromosomes are
single-chromatid (in a diploid cell the number of Fig. 97. The Cell Cycle
chromosomes (n) is equal to the number of chromatids
(c): 2n=2c), decondensed, with transcriptionally active parts (euchromatin) and inactive parts
(heterochromatin).
At some point, if the cell is going to divide, DNA replication begins. The initiation of
DNA replication ends G1 and begins the S period of interphase (from S=DNA
synthesis). During S phase, the entire nuclear complement of DNA is duplicated. The
chromosomes thus become bichromatid (each chromosome consists of 2 identical DNA that
make 2 sister chromatids, united at centromere (2n=4c). Histone and nonhistone chromosomal
proteins associated with DNA, as well as proteins required for a successful replication and repair
are synthesized.
This period is also marked by duplication of
centrosomes (fig. 98). Doubling of a centrosome is
similar to DNA replication in two respects: the
semiconservative nature of the process and the action of
cdk2 (cyclin-dependent kinase) as a regulator of the
process. But the processes are essentially different in
that centrosome doubling does not occur by template
Fig. 98. Centrosomes Duplication reading and assembly. The mother centriole just aids in
67
the accumulation of materials required for the assembly of the daughter centriole. Aberrant
numbers of centrosomes in a cell have been associated with cancer.
As replication is completed, S ends and the cell enters the final stage of interphase, G2. G2
(postsynthetic or premitotic) is characterized by control of replication quality, DNA repair,
synthesis and accumulation of a group of proteins necessary for progress through mitosis
(tubulin, factors for cell division). Most cell types remain in G2 only briefly; and at the end of G2,
which marks the end of interphase, mitosis begins. After mitotic division is complete, the two
cell products each enter G1 of the next cell cycle.
G0 is a state of cell cycle arrest. This is the time when a cell quits dividing. It is a period of
proliferative rest. Some cells may stay in G0 permanently. This is the case of highly
differentiated cells, such as cells of nervous system, muscles, crystalline, which have lost their
proliferation properties. Other cells may be temporally resting in G0: liver cells, lymphocytes –
differentiated cells with low proliferation activity.
The main genetic events performed during interphase and absent during division are: gene
expression (transcription, translation), replication and repair.
Mitosis
Mitosis is the type of
division of somatic cells, which
assures the growth of the
organism and tissue regeneration.
Cell growth and protein
production stop at this stage in
the cell cycle. All of the cell's
energy is focused on the complex
and orderly division into two
similar daughter cells (fig. 99).
Mitosis is much shorter than
interphase, lasting perhaps only
one to two hours.
Prophase
Chromatin in the nucleus
begins to condense and becomes
visible in the light microscope.
Chromatin condensation is
mediated by the condensin
complex, which reorganizes
chromosomes into their highly
Fig. 99. Stages of Mitosis compact mitotic structure. The
nucleolus disappears. Centrioles
begin moving to opposite ends of the cell. The mitotic spindle is formed.
Since the genetic material has been duplicated in an earlier phase of the
cell cycle, the chromosome consists of 2 identical copies of DNA, called
sister chromatids, which are attached to each other at the centromere. The
replicated sister chromatids are ―glued‖ together by a specific proteic
complex called cohesin, which maintain chromatids together till they split at
anaphase (fig. 100).
Prophase accounts for approximately 3% of the cell cycle's duration.
An important organelle in mitosis is the centrosome, the microtubule
organizing center (MTOC) in animal cells. The centrosome is copied
only once per cell cycle so that each daughter cell inherits one Fig. 100. Proteic Complex of
a Mitotic Chromosome
centrosome, containing two centrioles. The centrosome replicates
68
during the S phase. During prophase, the two centrosomes have their
microtubule-activity increased due to the recruitment of γ-tubulin. The
centrosomes are pushed apart to opposite ends of the cell nucleus by the
action of molecular motors (motor proteins: dyneins and kinesins that
use microtubules and hydrolysis of ATP for movement, fig. 101). The
nuclear envelope breaks down to allow the microtubules to reach the
kinetochores (a DNA–protein complex required for attachment of
mitotic spindle at centromere) on the chromosomes, marking the end of
prophase. During prometaphase the chromosomes are captured by the Fig. 101. Motor Proteins
microtubules.
Prometaphase
The nuclear membrane dissolves completely, marking the beginning of prometaphase.
Proteins attach to the centromeres creating the kinetochores. Microtubules attach at the
kinetochores and the chromosomes begin moving to the cell equator.
Metaphase
During this stage of mitosis in which condensed and
highly coiled chromosomes align in the middle of the cell before
being separated into each of the two daughter cells. Metaphase
accounts for approximately 4% of the cell cycle's duration.
The centromeres of the chromosomes arrange themselves on
the metaphase plate (or equatorial plate), an imaginary line
that is equidistant from the two centrosome poles (fig. 102).
This even alignment is due to the counterbalance of the
pulling powers generated by the opposing kinetochores.
Fig. 102. Mitotic Spindle
Anaphase
During anaphase the longitudinal cleavage of
centromeres occurs. As a result of chromatids disjunction the single-chromatid chromosomes
separate. Each chromatid moves to opposite poles of the cell, the opposite ends of the mitotic
spindle, near the microtubule organizing centers. During this stage, errors (such as chromatids
nondisjunction, transversal cleavage or anaphase lag) could happen, resulting in abnormal
number or structure of chromosomes in daughter cells.
Anaphase begins abruptly and accounts for approximately 1% of the cell cycle's duration.
At this point, a protease known as separase cleaves cohesin, a protein responsible for holding
sister chromatids together. The movement of chromatids is achieved by the shortening of spindle
microtubules from kinetochores sites by depolymerization at their plus ends. No motor protein is
involved in chromatid movement. Molecular motors are however required for microtubule
reorganization during late anaphase.
Telophase
During telophase, the effects of prophase and prometaphase events are reversed. Two
daughter nuclei form in the cell. The nuclear envelopes of the daughter cells are formed from the
fragments of the nuclear envelope of the parent cell. As the nuclear envelope forms around the
chromosomes, the nucleoli reappear. The DNA decondensation processes begin. Telophase
accounts for approximately 2% of the cell cycle's duration.
Cytokinesis (distribution of the cytoplasm) usually
occurs at the same time that the nuclear envelope is
reforming, yet they are distinct processes.
In animal cells, a contractile ring, made of non-
muscle myosin II and microfilaments, assembles
Fig. 103. The Contractile Ring equatorially (fig. 103). Myosin II uses the ATP energy to
69
move along the actin filaments, constricting the cell membrane to form a cleavage furrow. The
cleavage furrow thus develops where the metaphase plate used to be, pinching off the separated
nuclei. Each daughter cell has a complete copy of the genome of its parent cell (2n=2c), and
mitosis is complete.
Regulation of the cell cycle
Cell external signals and cell intrinsic (internal) information together determine whether
cells enter a division cycle. In general, external signals affect this decision only until cells
commit to go through the entire cycle, at a time in G1 known as "Restriction point" in mammals.
From there on, progression through the cell cycle is controlled intrinsically by the cell-cycle
machinery.
The collective results from studies in various eukaryotes have demonstrated that
progression through the cell-division cycle is driven by activation and inactivation of cyclin-
dependent kinases (cdk), which trigger the transition to subsequent phases of the cycle. CDKs
are small protein kinases that require association with a cyclin for their activation. Members of
the cyclin family of proteins are thus key regulators of the cell cycle (Table 8).
Cyclins are grouped into several classes:
Cyclin D family members are G1 phase cyclins that regulate the entry of cells into G1 from
Go. Cyclin D is upregulated by growth factor and external signals. Cyclin D couples with Cdk4
and Cdk6. Cyclin D-Cdk4 facilitates the expression of cyclin E. Cyclin E and Cyclin A are able
to bind Cdk2 and promote the cell cycle progression through G1/S transition. Cyclin E stimulates
replication complex assembly. Cyclin A activates DNA synthesis. Cyclins B1 and B2 are M-
phase cyclins. Cyclin B1 and cyclin B2 and their catalytic partner, Cdk1 are components of the
MPF (M phase/maturation promoting) factor that regulates processes that lead to assembly of
the mitotic spindle and sister-chromatid pair alignment on the spindle.

Table 8. Proteins Assuring the Regulation of the Cell Cycle

Period Cyclins Cyclin-dependent kinases (Cdks)
G1 D cyclins Cdk4, Cdk6
S-phase cyclins E and A Cdk2
Mitosis mitotic cyclins (B cyclins) Cdk1
These are short-life proteins. Their Their levels in the cell remain fairly stable, but
levels in the cell rise and fall each must bind the appropriate cyclin (whose
with the stages of the cell cycle. levels fluctuate) in order to be activated.

Cell Cycle Checkpoints

The cell has several systems for interrupting the cell cycle if something goes wrong. Since
DNA is the main cell component that assures the molecular processes and cell life, DNA
integrity is controlled at specific DNA damage checkpoints, which arrest the cell cycle till the
DNA is repaired. DNA damage checkpoints sense DNA damage both before the cell enters S
phase (a G1 checkpoint, assuring that everything is ready for DNA synthesis: DNA is not
damaged, the internal and external cell environments are favorable, cell grows normally), as well
as after S phase (a G2 checkpoint, to determine if the DNA is properly replicated, cell is grown
enough and can now proceed to enter M mitosis). If the damage is so severe that it cannot be
repaired, the cell self-destructs by apoptosis.
One of the cell cycle checkpoints occurs during prometaphase and metaphase – spindle
checkpoint. Only after all chromosomes have become aligned at the metaphase plate, when
every kinetochore is properly attached to a bundle of microtubules, does the cell enter anaphase.
It is thought that unattached or improperly attached kinetochores generate a signal to prevent
premature progression to anaphase, even if most of the kinetochores have been attached and
most of the chromosomes have been aligned.

70
 DNA replication and chromosome distribution are indispensable events in the cell cycle
control. Cells must accurately copy their chromosomes, and through the process of mitosis,
segregate them to daughter cells. The checkpoints are surveillance mechanism and quality
control of the genome to maintain genomic integrity. Checkpoint failure often causes mutations
and genomic arrangements resulting in genetic instability. Genetic instability is a major factor of
birth defects and in the development of many diseases, most notably cancer.
All the checkpoints examined require the services of a complex of proteins. Mutations in
the genes encoding some of these have been associated with cancer; that is, they are oncogenes.
This should not be surprising since checkpoint failures allow the cell to continue dividing despite
damage to its integrity.
Examples of checkpoint proteins:
The p53 protein senses DNA damage and can stop progression of the cell cycle in G1 (by
blocking the activity of Cdk2). The p53 protein prevents a cell from completing the cell cycle if
its DNA is damaged or the cell has suffered other types of damage. When the damage is minor,
p53 arrests the cell cycle until the damage is repaired. If the damage is major and cannot be
repaired, p53 triggers the cell to commit suicide by apoptosis. These functions make p53 a key
player in protecting against cancer; that is, it is an important tumor suppressor gene. More than
half of all human cancers do, in fact, harbor p53 mutations and have no functioning p53 protein.
Cells with functional p53 arrest in G1 or G2 when exposed to γ-irradiation.
The Rb (retinoblastoma) protein integrates the signals reaching the cell to determine
whether it is safe for the cell to complete the passage from G1 of the cell cycle to mitosis. The Rb
protein also plays a role in mitosis itself: it is needed for proper chromosome condensation
starting in prophase, as well as their proper attachment to the spindle. Failure of Rb function
during mitosis can lead to aneuploidy (abnormal number of chromosomes) and chromosome
breakage.
Cells that fail to replicate all their chromosomes do not enter mitosis (G2 checkpoint
arrest). Operation of this checkpoint control involves the recognition of unreplicated DNA and
inhibition of MPF activation. Although the ability of unreplicated DNA to inhibit entry into
mitosis is well documented, little is yet known about the proteins that mediate this checkpoint
control.
Restriction Points
The eukaryotic restriction point is a particular checkpoint where it is proposed that cells are
arrested under growth limiting conditions and DNA damage. Progression through the cell cycle
restriction point makes the cell independent of external stimuli. The 2 main restriction points are:
R1 - G1/S (control of the readiness for DNA synthesis) and R2 - G2/M (control of replication
quality and readiness for cell division).
Apoptosis
Apoptosis, programmed or physiological cell death, is a
normal process of the development and health of multicellular
organisms. Cells die in response to a variety of stimuli and during
apoptosis they do so in a controlled, regulated fashion. This
makes apoptosis distinct from another form of cell death called
necrosis, in which uncontrolled cell death leads to lysis of cells,
inflammatory responses and, potentially, to serious health
problems. Apoptosis, by contrast, is a process in which cells
Fig. 104. Programmed Cell play an active role in their own death (which is why apoptosis is
Death often called as cell suicide, fig. 104).
The following cells undergo apoptosis: mutant,
transformed cells; old cells; cells with abnormal receptors, recognized as foreign; cells that have
lost contacts with neighbor cells; excessive number of cells.

71
 Upon receiving specific signals instructing the cells to undergo apoptosis a number of
distinctive changes occur in the cell. Proteins known as caspases are typically activated in the
early stages of apoptosis. These proteins cleave key cellular components that are required for
normal cellular function including structural proteins in the cytoskeleton and nuclear proteins
such as DNA repair enzymes. The caspases also activate other degradative enzymes such as
DNases, which begin to cleave the DNA in the nucleus, causing its fragmentation. The
breakdown of chromatin in the nucleus often leads to nuclear condensation and in many cases
the nuclei of apoptotic cells take on a "horse-shoe" like appearance. Further proteolytic processes
lead to cell fragmentation and formation of apoptotic bodies (small vesicles), which undergo
phagocytosis by neighbor cells.
There are a number of mechanisms through which apoptosis can be induced in cells. In
some cases the apoptotic stimuli comprise extrinsic signals such as the binding of death inducing
ligands to cell surface receptors called death receptors. In other cases apoptosis can be initiated
following intrinsic signals that are produced following cellular stress. Cellular stress may occur
from exposure to radiation or chemicals or to viral infection. It might also be a consequence of
growth factor deprivation or oxidative stress caused by free radicals. In general intrinsic signals
initiate apoptosis via the involvement of the mitochondria.

72
 XI. RECOMBINATION OF GENETIC MATERIAL
One of the mechanisms assuring the survival of species is variability that is described as
biological diversity, which is guaranteed mainly by genetic recombination. There are several
types of recombination: intrachromosomal, interchromosomal and genomic. In eukaryotes
genomic recombination is connected to sexual reproduction: fertilization, as well as exchange of
fragments between homologous chromosomes and independent segregation of chromosomes
during meiosis.
Meiosis is a nuclear division process that occurs in germ cells only and leads to formation
of haploid daughter cells. This means that while the normal number of human chromosomes is
46 over cell, the final number in each germ cell is 23. And not just only half: Each gamete ends
up with one pair of homologous monochromatidian chromosomes.
Meiosis consits of two divisions (fig. 105), called reductional division (meiosis I) and
equational division (meiosis II).
The Importance of Meiosis
 It links parents with their offspring;
 It ensures a constant number of chromosomes in a species in all generations;
 It permits exchange of genetic information (recombination) between pair of homologous
chromosomes (crossing-over), which in turn leads to variation in the traits of offspring.

STAGES OF MEIOSIS
Meiosis I: is the reductional division; in consequence, from the one diploid cell with 46
bichromatidian chromosomes (primary cyte) two haploid cells with 23 bichromatidian
chromosomes (secondary cytes) are formed.
Prophase I:
1) Leptotene
* The chromatin fibres condense by coiling and folding to form chromosomes, which are
like thin threads, with each thread being two sister, chromatids in close alingment.
2) Zygotene
* Homologous chromosomes begin to pair by attaching (each paternal chromosome
attaches to the homologous maternal chromosome). Such a pair is called bivalent and this
phenomenon is called synapse;
* The contact between chromosomes is so perfect that they become stitched point by
point, gene by gene along their entire length, with little space between them;
* Sex chromosomes are found in the condensed form, they do not conjugate along their
length but ‗‘head by head‘‘ and form a ‗‘sex vesicle‘‘.
3) Pachytene
* The connection between chromosomes is very tight;
* Each bivalent has 4 chromatids, forming a tetrad;
* Non-sister chromatids undergo breakage at one or more sites along their length and
exchange corresponding segments ate the breakage point; this recombination of the genetic
material is called crossing-over. This type of recombination is called intra-chromosomal
recombination.
4) Diplotene
* The separation of the homologous cèromosomes from tetrads begins, they remain be
united only on the level of chiasmata (points in which breakage and re-union occurs).
5) Diakinesis
* The chromosomes attain their maximal condensation;
* The homologous chromosomes in a bivalent remain connected by one or two
chiasmata, which persist until first meiotic anaphase;
* The two sex chromosomes X and Y differentiate from the sex vesicle;
* The nuclear envelope starts disappearing;
73
* Formation of spindle.

Fig. 105. The Stages of Meiosis

METAPHASE I:
▬ The bivalents become positioned with the centromeres of the two homologous
chromosomes on opposite sides of the plane through the middle of the spindle;

74
 ▬ The co-orientation of the undivided centromeres of each bivalent relative to the two poles
of the spindle occurs at random and determines the members of each pair of chromosomes that
will subsequently move to a particular pole.

ANAPHASE I:
During this stage the homologous chromosomes, each composed of two chromatids joined
at an individual centromere, separate from one another and move to apposite poles of the spindle.
Each member of the pair moves randomly. This phenomenon is called inter-chromosomal
recombination (fig. 106).

Fig. 106. Chromosome segregation in meiosis I

At metaphase I, the kinetochores of sister chromatids are either fused or
adjacent to one another. Microtubules from the same pole of the spindle
therefore attach to the kinetochores of sister chromatids, while
microtubules from opposite poles attach to the kinetochores of
homologous chromosomes. Chiasmata are disrupted at anaphase I, and
homologous chromosomes move to opposite poles of the spindle.

TELOPHASE I:
▬ A haploid set of chromosomes consisting of one
homologue from each bivalent is located near each pole of
the spindle;
▬ The spindle brakes down;
▬ A nuclear envelope forms around each group of
chromosomes.

MEIOSIS II, which resembles a mitotic division,

takes place after a short interphase called interkinese.
During prophase II the chromatin condenses, the nuclear envelope brake down and the second-
division spindles form. In metaphase II the centromeres of the chromosomes align on the
central plane of the spindle. During anaphase II the centromeres separate (longitudinal
cleavage) and the chromatids of each chromosome move to opposite poles. Telophase II is
marked by a transition to the interphase condition of the chromosomes in the four haploid nuclei
accompanied by division of the cytoplasm.

Meiosis reduces
the diploid number by
half for the
forthcoming gametes
(fig. 107). Each gamete
produced is haploid,
with only one of each
pair of homologous
chromosomes. The
union of two gametes
at fertilization restores
the diploid number in
the new individual
(genomic
recombination).

A B
Fig. 107. The stages of spermatogenesis (A) and oogenesis (B)
75
 Fertilization
At fertilization, the sperm binds to a receptor on the surface of the egg and fuses with the
egg plasma membrane, initiating the development of a new diploid organism containing genetic
information derived from both parents (fig. 108). Not only does fertilization lead to the mixing of
paternal and maternal chromosomes, but it also induces a number of changes in the egg
cytoplasm that are critical for further development. These alterations activate the egg, leading to
the completion of oocyte meiosis and initiation of the mitotic cell cycles of the early embryo.

Figure 108. Fertilization and completion of meiosis (A) Fertilization

induces the transition from metaphase II to anaphase II, leading to
completion of oocyte meiosis and emission of a second polar body (which
usually degenerates).

76
 XII. METHODS OF MOLECULAR GENETICS
Methods of molecular genetics are based on physical and chemical properties of DNA,
RNA and proteins. They are aimed to establish structure and function of genes and their
products. The DNA is highly polymorphic and has specific peculiarities among representatives
of the same population, different populations of the same species and different species. These
polymorphisms are based on quantitative or qualitative changes in coding or non-coding
sequences and lead to normal or abnormal variations of traits. Abnormal variations determine
diseases or predisposition to diseases. Depending on the aim of gene analysis – research or
testing – different methods may be used:
The methods of molecular genetics include:
- Isolation and purification of nucleic acids;
- Cloning of DNA;
- Obtaining of DNA libraries;
- Sequencing of DNA;
- Polymerase Chain Reaction (PCR);
- Hybridization of nucleic acids.

ISOLATION OF NUCLEIC ACIDs

Isolation of DNA:
- Collecting of biological material (may be used all tissues, usually blood);
- Lysis (destruction) of cells using detergents;
- Collecting of nucleus by centrifugation;
- Hydrolyzation of proteins using proteases and removing of debris with organic
solvents (phenol, chloroform);
- Precipitation of DNA using alcohol;
- Solvation in water.

Isolation of RNA:
- Collecting of biological material (specific tissue, at specific stage of development, in
specific condition)
- Lysis of cells using detergents, at low temperature;
- Hydrolyzation of proteins using proteases and removing of debris with organic
solvents (phenol, chloroform);
- Precipitation of RNA using alcohol;
- Solvation in water.

Isolated and purified nucleic acids may be stored in refrigerator or used immediately.

DNA CLONING
Cloning a fragment of DNA allows indefinite amounts to be produced from even a single
original molecule. A clone is defined as a large number of cells or molecules all identical with an
original ancestral cell or molecule. Cloning technology involves the construction of novel DNA
molecules by joining sequences from different sources. The product is called recombinant DNA
and the technique – genetic engineering. The DNA to be cloned may be derived directly from a
genome, or may be in the form of complementary DNA (cDNA) copies of the pool of mRNAs
found in a particular tissue. A collection of cloned DNA fragments from a single source is
known as a DNA library.
The components required for cloning:
- DNA to be cloned;
- A vector, which may carry a foreign fragment of DNA;
- Host cells in which vectors may multiply.

77
 Most vectors for DNA cloning are based on either plasmids or bacteriophages, which
replicate independently of the host chromosome to produce high numbers of progeny molecules
per host cell. Yeast Artificial Chromosomes (YACs) and Bacterial Artificial Chromosomes
(BACs), which can carry very large inserts of DNA (up to 1000 kb), have also been developed as
cloning and expression vectors. There are also cloning vehicles based on eukaryotic viruses such
as SV40 and the cauliflower mosaic virus.
A cloning vector must possess certain basic requirements:
1. DNA sequences and/or genes (e.g. origin of replication) that allow it to be replicated in
the host cell of choice; this is usually the bacterium Escherichia coli, but other bacteria and
Saccharomyces cerevisiae are also used as host cells for particular applications.
2. A site into which the DNA to be cloned can be inserted without interfering with
replication and maintenance of the vector in the host cell.
3. One or more genes for some selectable phenotype (such as antibiotic resistance), which
can be used to distinguish the esultingclones of host cells that have picked up a recombinant
DNA.
The Cloning Procedure
A purified sample of the DNA to be cloned is first cleaved into smaller fragments by
restriction enzymes. Restriction enzymes are endonucleases that cleave DNA in response to a
recognition site on the DNA. The recognition site (restriction site) consists of a specific sequence
of nucleotides in the DNA duplex, typically 4-8 base pairs (bp) long (Fig. 109). These
endonucleases are found in many species of bacteria, where they destroy foreign DNA.

Fig. 109. Restriction Enzymes Cleave DNA in Restriction Sites

Restriction enzymes cleave phosphodiester bonds to leave 5‘ phosphates and 3‘ hydroxyl

groups. The terminus can therefore be acted on by DNA ligase to join two or more restriction
fragments together. Some enzymes make fragments with single-strand extensions – ―sticky
ends‖ or cohesive ends (Not I, EcoR I, Pst I). Other restriction enzymes make fragments with
blunt ends (Hpa I).
Both the DNA to be cloned and the vector are cut with the same restriction enzyme. When
treated samples of source DNA and vector DNA are mixed, the cohesive ends of the DNA
fragments will transiently pair with at least a proportion of the complementary cohesive ends of
the cleaved vector molecules. The gap between vector and insert DNA is joined by the enzyme
DNA ligase. The end result of ligation is a population of recombinant DNAs each containing a
different insert (Fig. 110). The resulting mixture is used to transform bacterial cells.

78
 There are several types of DNA libraries:
- Chromosomal libraries, which contain
entire chromosomes
- Genomic libraries, which contain
fragments of nuclear or mitochondrial DNA
- cDNA libraries, which contain
fragments of complementary DNA, synthesized
on the base of mRNA.
The steps of cDNA libraries construction
include:
- Isolation of mRNA from specific
tissue at a specific stage of development, in
specific condition;
Fig. 110. DNA Recombination Procedure
- Synthesis of cDNA (complementary
DNA) using enzyme reverse transcriptase.

The basic protocol of cDNA synthesis is a three-step process and begins with total
cellular RNA (Fig. 111). In the first step a DNA strand complementary to the mRNA is
enzymatically synthesized using an oligo(dT) (oligodeoxythymidine) primer which anneals to
the 3' poly(A) tail. DNA synthesis is catalyzed by the enzyme reverse transcriptase. In the second
step, the mRNA strands of the mRNA-
DNA hybrid are destroyed either
enzymatically or chemically. In the final
step the full double-stranded DNA
molecule is enzymatically generated using
DNA polymerase and exploiting as a
primer a hairpin loop formed by reverse
transcriptase during the synthesis of the
first DNA strand. cDNA molecules
generated in this way can then be cloned by
standard protocols. cDNAs represent
double-stranded DNA copies of transcribed
regions in cells and, if fully mature mRNA
is used as the template, they will lack any
introns and the promoter and terminator
regions associated with the genomic copy
of the transcribed region. The double
stranded cDNA is used for ligation with the
vector during the process of cloning. Fig.111. Synthesis of cDNA

POLYMERASE CHAIN REACTION (PCR)

The amplification of particular genes or DNA sequences from genomic DNA may also be
achieved directly through methods based on the Polymerase Chain Reaction (PCR). PCR
involves a repetitive series of temperature cycles with each cycle comprising three stages:
denaturation of the template DNA at 950C to separate the strands of the target molecule, then
cooling to 50C to allow annealing to the template of single-stranded oligonucleotide primers
which are specifically designed to flank the region of DNA of interest, and finally, extension of
the primers by a specific DNA polymerase – Taq-polymerase at about 720C (Fig. 112). Thus,
one cycle of PCR doubles the number of target DNA molecules, since the newly synthesized
strands can themselves act as templates in the next round of amplification. This logarithmic
growth in product implies that 20 PCR cycles could theoretically result in a million-fold
79
amplification of a DNA fragment whose length is defined by the 5 ends of the primers. One of
the main advantages of PCR is the exquisite sensitivity of the technique.

Fig. 112. The Steps of Polymerase Chain Reaction (PCR)

80
PCR Applications
Direct genomic cloning. PCR is a method of in vitro genes synthesis: large quantities of
DNA template can be amplified directly from trace amounts of genomic DNA, using suitable
primers designed from predetermined sequence data from the native gene. The DNA synthesized
from PCR can then be sequenced directly. Alternatively, the PCR product can be cloned into an
appropriately cleaved vector to facilitate further manipulations.
Generating template for sequencing
RNA analysis
RNA molecules can also be analyzed with PCR by first converting them to cDNA by
reverse transcription using the enzyme reverse transcriptase. The resulting DNA transcript can
then be amplified by the normal PCR process. With this approach, even rare mRNA molecules
can be detected and monitored.
Forensic applications
Forensic investigations often involve the analysis of biological material deposited at the
scene of a crime such as hairs, blood, saliva, and semen stains. The PCR reaction requires small
amount of DNA and a number of approaches have been developed. One forensic PCR test is
amplification of loci, which vary in length according to the number of repeated sequences they
contain. Analysis simply involves resolving and visualizing the products of PCR on agarose or
acrylamide gels.
Medical uses
Medical applications of PCR are broadly in the areas of research, genetic counseling, and
clinical investigations. The first paper published on PCR, in 1985, described its use in detecting
the sickle-cell mutation (Fig. 113). Tests have subsequently been developed for other
haemoglobinopathies including β-thalassaemia, as well as for other genetic diseases such as
phenylketonuria, Duchenne muscular dystrophy and cystic fibrosis. PCR is ideally suited to
prenatal diagnosis since it is rapid and only trace amounts of fetal DNA are required for
amplification. Sexing embryos generated by in vitro fertilization is now also possible by taking a
single cell from a blastomere comprising 6-10 cells, and amplifying a Y chromosome-specific
repetitive element. Such a diagnostic procedure is invaluable for couples at risk of transmitting
diseases such as X-linked mental retardation. PCR is ideal for the detection of pathogens because
it is possible to amplify a specific sequence present at low concentration within a complex DNA
mixture. With regard to detection of viral infections, a test for HIV-1 has been developed which
can detect the presence of the virus earlier than any discernible antibody response in the infected
person. Likewise, PCR has been used in the detection of herpes, hepatitis, and
cytomegaloviruses, as well as the human papilloma viruses, which are associated with cervical
cancer.

Fig. 113.
Detection of
aMutation
(deletion) by
PCR

81
 DNA SEQUENCING
The sequence of nucleotides in DNA carries the genetic information encoding proteins and
RNAs. The ability to determine the sequence of any piece of DNA rapidly and easily is therefore
crucial to many problems in molecular biology. Two fundamental methods to determine the
order of nucleotides in DNA were developed in the 1970s - Maxam-Gilbert chemical sequencing
and Sanger dideoxy chain termination sequencing. Although contrasting in approach (the
Maxam-Gilbert method is degradative, whereas the Sanger method depends on the synthesis of
complementary-strand DNA) they both depend on the same principle: the generation of a nested
set of single-stranded DNA molecules having one invariant end with the other ends differing by
increments of single bases. A set of four reactions, specific for each base, generates a set of
fragments which, when fractionated in parallel on the basis of length, allows the sequence to be
deduced.

Maxam-Gilbert chemical sequencing

Chemical sequencing utilizes reactions that chemically modify bases in such a way that
they can then be removed from the polynucleotide chain, which is therefore broken at that point.
Two of the modifying reactions are specific for one base (G or C) while two others are specific
for either the two purines or the two pyrimidines. The Maxam-Gilbert protocol is very suitable
for the study of modified bases and the interaction of proteins with DNA, but is very laborious.

Sanger dideoxy chain termination sequencing

The dideoxy chain termination method has become the most widely used technique,
particularly for large-scale sequencing projects. This technique depends on 2',3'-
dideoxyribonucleoside triphosphates (ddNTPs) (Fig. 114) being incorporated into an extending
copy of a template DNA strand.

Fig. 114. ddNTPs contain –H group in both 2’ and 3’ position

Having been incorporated, such a nucleotide cannot form the phosphodiester bond required
to extend the chain further. Growth of the chain is thus terminated. In order to generate a
complete set of such terminated chains, a small amount of a specific ddNTP is included in the
reaction mixture in addition to the four deoxyribonucleoside triphosphates (dNTPs) required for
normal DNA synthesis. A set of four reactions required for a sequence determination will thus
each consist of a template DNA strand a short complementary oligonucleotide primer, the four
dNTPs, and the correct ratio of one of the four ddNTPs. The chain is extended from the primer
by a DNA polymerase. The set of generated fragments is fractionated by length by
electrophoresis in a polyacrylamide gel. During electrophoresis the shorter fragments run quickly
to positive pole while the longer fragments run slowly. Gel is read from bottom to top (fig. 115).

82
 Fig. 115. Sanger Dideoxi Method of DNA Sequencing

HYBRIDIZATION OF NUCLEIC ACIDS

Nucleic acid hybridization is a powerful and widely used technique, which exploits the
ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to
form a double helix. Hybridization can take place between two complementary DNA sequences,
between a single-stranded DNA and a complementary RNA, or between two RNA sequences.
Usually, one of the nucleic acid components of the hybridization is immobilized on a membrane
filter (nitrocellulose or nylon).
There are some types of hybridization according to goal of analysis:
- Southern-blot analysis for analysis of DNA
- Northern-blot analysis for analysis of RNA
- in situ hybridization for analysis of distribution of a particular mRNA transcript in an
organism, a particular tissue, or within a cell, by hybridization of the tissue with a labeled probe
of the required specificity.

Southern Blot Analysis

DNA is first digested with a restriction endonuclease and then separated according to the
size of DNA fragments by electrophoresis through an agarose gel. Small fragments are able to
migrate more quickly through the gel than are long fragments. Most restriction enzymes will
digest human DNA into about a million fragments. We will want to compare only those, which
are interested. To do this the DNA is first denatured, (made single stranded), by treatment with
NaOH. It is then transferred to the surface of a nylon filter by blotting. A probe is prepared.
Usually this means incorporating a label into a fragment of DNA from the target sequence. The
label may be either a radioactive isotope (often 32P) or a fluorescent agent.
The single stranded probe is annealed to its target sequence, which is then stringently
washed to remove any probe, which has bound unspecific. Finally the position of the annealed
probe is determined, (by autoradiography in the case of a radioactive probe) (Fig. 116).
83
 The result of Southern blot analysis may be Restriction Fragment Length Polymorphism
(RFLP) – a DNA polymorphism which results from a loss or creation of a site at which a
particular restriction enzyme cuts. DNA carrying the different `allelic' forms will give different
sizes of DNA fragments on digestion with the appropriate restriction enzyme. Where a RFLP is
closely linked to the defective allele at a disease locus it can sometimes be used to detect the
presence of the defective gene in a carrier or affected fetus. Polymorphic restriction sites provide
useful markers for building up physical and genetic maps. Also, RFLPs can be used both to
identify a particular individual and to determine family relationships.

Fig. 116. Steps of Southern Blot Analysis

Northern Blotting
Northern blotting represents a method of transferring denatured RNA onto a nitrocellulose
or nylon filter for subsequent use in a hybridization assay. RNA is electrophoresed in a
denaturing agarose gel before being transferred onto a membrane by capillary action. A
radioactively labeled DNA or RNA probe is hybridized to the filter-bound RNA to detect
specific sequences. The northern blot analysis is used for identification of presence of gene
expression in a particular tissue, level of gene expression, presence of some riboviruses (which
contain RNA as genetic material).

84