Nikitski 2019

Thyroid
Page 1 of 41
© Mary Ann Liebert, Inc.

DOI: 10.1089/thy.2019.0284
1
Mouse Model of Thyroid Cancer Progression and Dedifferentiation
Mouse Model of Thyroid Cancer Progression and Dedifferentiation Driven by STRN‐ALK Expression and Loss of p53: Evidence for the Existence of Two Types of Poorly Differentiated Carcinoma (DOI:
Driven by STRN‐ALK Expression and Loss of p53: Evidence for the
This paper has been peer‐reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Existence of Two Types of Poorly Differentiated Carcinoma
Alyaksandr V. Nikitski1, Susan L. Rominski1, Vincenzo Condello1, Cihan Kaya1, Mamta
Wankhede2, *, Federica Panebianco1, Hong Yang3, ⁑, Daniel L. Altschuler2, and Yuri E.
Nikiforov1
1
Downloaded by SENCKENBERG/ZEITSCHRIFTEN from www.liebertpub.com at 07/20/19. For personal use only.
Department of Pathology, University of Pittsburgh, Pittsburgh, PA, USA
2
Department of Pharmacology and Chemical Biology, University of Pittsburgh, Pittsburgh,
PA, USA
3
Division of Experimental Pathology, Department of Pathology, University of Pittsburgh,
Pittsburgh, PA, USA
10.1089/thy.2019.0284)
*
Current affiliation: School for Engineering of Matter, Transport, and Energy, Arizona State
Thyroid
University, Tempe, AZ 85287 USA
⁑
Current affiliation: Department of Medical Ultrasonics, The First Affiliated Hospital of
Guangxi Medical University, Nanning, Guangxi, China
Alyaksandr V. Nikitski, MD, PhD
Department of Pathology, University of Pittsburgh, Scaife Hall A‐721, 3350 Terrace St.,
Pittsburgh, PA 15213; E‐mail: nikitski.alyaksandr@pitt.edu
Susan L. Rominski, B.S.
Pittsburgh, PA 15213; E‐mail: rominskisl@upmc.edu

Page 2 of 41

2
Vincenzo Condello, PhD
Pittsburgh, PA 15213; E‐mail: Vic40@pitt.edu
Cihan Kaya, PhD
Department of Pathology, University of Pittsburgh Medical Center, CLB Room 8029, 3477
Euler Way, Pittsburgh, PA 15213; E‐mail: kayac@upmc.edu
Mamta Wankhede, PhD
School for Engineering of Matter, Transport, and Energy, Arizona State University, 651 E
10.1089/thy.2019.0284)
Tyler Mall, Tempe, AZ 85281; E‐mail: Mamta.wankhede@asu.edu
Thyroid
Federica Panebianco, PhD
Pittsburgh, PA 15213; E‐mail: panebiancof@upmc.edu
Hong Yang, M.D, PhD
Department of Medical Ultrasonics, The First Affiliated Hospital of Guangxi Medical
University, No.6. Shuangyong Rd, Nanning, Guangxi 530021, P.R. China; E‐mail:
yanghonggx@163.com
Daniel L. Altschuler, PhD
Department of Pharmacology and Chemical Biology, University of Pittsburgh, W1316
BSTWR, 200 Lothrop St., Pittsburgh, PA 15213; E‐mail: altschul@pitt.edu
Thyroid
10.1089/thy.2019.0284)
Page 3 of 41

carcinoma
Yuri E. Nikiforov, MD, PhD

Pittsburgh, PA, 15213; E‐mail: nikiforovye@upmc.edu
Running title: Mouse model of thyroid cancer dedifferentiation
Key words: STRN‐ALK, p53, thyroid cancer, dedifferentiation, poorly differentiated
Department of Pathology, University of Pittsburgh, CLB Room 8031, 3477 Euler Way,
3
Page 4 of 41

4
Abstract
Background: Thyroid tumor progression from well‐differentiated cancer to poorly
differentiated thyroid carcinoma (PDTC) and anaplastic thyroid carcinoma (ATC) involves
step‐wise dedifferentiation associated with loss of iodine avidity and poor outcomes. ALK
fusions, typically STRN‐ALK, are found with higher incidence in human PDTC compared to
well‐differentiated cancer and, as we previously have shown, can drive the development
of murine PDTC. The aim of this study was to evaluate thyroid cancer initiation and
progression in mice with concomitant expression of STRN‐ALK and inactivation of the
tumor suppressor p53 (Trp53) in thyroid follicular cells.
Methods: Transgenic mice with thyroid‐specific expression of STRN‐ALK and biallelic p53
loss were generated and aged on a regular diet or with methimazole and sodium
perchlorate goitrogen treatment. Development and progression of thyroid tumors were
10.1089/thy.2019.0284)
monitored using ultrasound imaging, followed by detailed histological and
Thyroid
immunohistochemical evaluation. Gene expression analysis was performed on selected
tumor samples using RNA‐Seq and qRT‐PCR.
Results: In mice treated with goitrogen, first thyroid cancers appeared at 6 months of age
reaching 86% penetrance by the age of 12 months, while a similar rate (71%) of tumor
occurrence in mice on regular diet was observed by 18 months of age. Histological
examination revealed well‐differentiated papillary thyroid carcinomas (PTC) (n=26), PDTC
(n=21) and ATC (n=8) that frequently co‐existed in the same thyroid gland. The tumors
were frequently lethal and associated with the development of lung metastasis in 24% of
cases. Histological and immunohistochemical characteristics of these cancers recapitulated
tumors seen in humans. Detailed analysis of PDTC revealed two tumor types with distinct
cell morphology and immunohistochemical characteristics, designated as PDTC type 1
(PDTC1) and type 2 (PDTC2). Gene expression analysis showed that PDTC1 tumors
retained higher expression of thyroid differentiation genes including Tg and Slc5a5 (Nis) as
compared to PDTC2 tumors.
Page 5 of 41

5
Conclusions: In this study, we generated a new mouse model of multi‐step thyroid cancer
dedifferentiation with evidence of progression from PTC to PDTC and ATC. Further, PDTC
in these mice showed two distinct histologic appearances correlated with levels of
expression of thyroid differentiation and iodine metabolism genes, suggesting a possibility
of existence of two PDTC types with different functional characteristics and potential
implication for therapeutic approaches to these tumors.
10.1089/thy.2019.0284)
Thyroid
Page 6 of 41

6
INTRODUCTION
Thyroid cancer is the most common malignancy of the endocrine system and showed a
steady rise in incidence worldwide in recent decades (1, 2). Most thyroid cancers are well‐
differentiated papillary thyroid carcinomas (PTC), which overall have a more indolent
clinical behavior and 5‐year survival rates >95%; less common, poorly differentiated
thyroid carcinomas (PDTC) and anaplastic thyroid carcinomas (ATC) are aggressive cancers
with a 5‐year mortality of 30‐50% and >90%, respectively (3‐9). Despite the positive effect
of surgical treatment and other therapeutic modalities on survival, PDTC and ATC are still
frequently lethal malignancies due to their rapid infiltrative growth, propensity for regional
and distant spread, and progressive loss of the ability to concentrate radioiodine (RAI) (4,
8‐14).
PDTC and ATC frequently develop as a result of step‐wise dedifferentiation of
preexisting well‐differentiated carcinomas (8, 10, 14‐19). PDTC is a particularly interesting
10.1089/thy.2019.0284)
group of tumors that have an intermediate position between well‐differentiated thyroid
Thyroid
cancers and ATC with respect to histopathologic features, molecular characteristics and
clinical outcomes (20, 21). The diagnostic criteria for PDTC adopted by the WHO
classification of endocrine tumors are based on the Turin consensus proposal (20). They
include the characteristic solid/trabecular/insular architecture, absence of nuclear features
of papillary carcinoma, and presence of a high mitotic rate, convoluted thyroid cell nuclei
or tumor necrosis. Although proposals for calling PDTC based exclusively on high‐grade
features (tumor necrosis and high mitotic count) exist (22), the Turin‐based WHO criteria
offer a standardized, reproducible, and clinically relevant approach to diagnosing these
tumors (21).
The molecular pathogenesis of PDTC involves the accumulation of genetic
alterations that encompass early driver mutations, also shared by well‐differentiated
thyroid cancers, and late driver mutations, which are characteristic of advanced thyroid
cancers including PDTC and ATC (23, 24). The most common early driver mutations are
point mutations in BRAF and RAS, but gene fusions affecting the ALK, RET, and PPARG
genes are also found. Late driver mutations commonly affect TERT and TP53, and less
Page 7 of 41

7
frequently genes encoding the members of the PI3K/AKT signaling pathway, SWI/SNF
subunits, and histone methyltransferases (23, 24).
PDTC also occupy an intermediate position with respect to expressing the markers
of thyroid epithelial differentiation. When studied by immunohistochemistry, PDTC
typically preserve immunoreactivity for the transcription factors TTF‐1 and PAX8;
moreover, they express cytokeratins but can lose the expression of thyroglobulin and
epithelial markers such as E‐cadherin. Similarly, on gene expression analysis, these tumors
have decreased or lost expression of thyroid restricted genes such as SLC5A5 (sodium
iodine symporter, NIS) and TG (thyroglobulin), which are essential for thyroid hormone
synthesis, and generally preserve the expression of the key thyroid transcription factors
PAX8, TTF‐1 and FOXE1, as well as cytokeratins (24‐30). The expression and functional
activity of the NIS protein are directly related to the ability of thyroid cells to trap
radioiodine (31‐33), which is the most efficient targeted treatment of those thyroid
10.1089/thy.2019.0284)
carcinomas that retain iodine avidity (34).
Thyroid
Animal models of thyroid cancer are an important tool for dissecting the molecular
mechanisms of cancer progression and exploring new therapeutic approaches in
preclinical studies. Several mouse models of tumor dedifferentiation were based on
introducing BRAF V600E and other genes affected by point mutations combined with a late
event such as p53 inactivation (35‐41), and many of them showed rapid progression to
ATC, often bypassing the stage of PDTC (42‐45). In this respect, thyroid carcinogenesis
driven by ALK fusions could represent an attractive model to study PDTC because ALK
fusions, most commonly STRN‐ALK, are found in different types of human thyroid cancers
including well‐differentiated papillary carcinoma, PDTC, and ATC, with the highest
incidence (4‐9%) in PDTC tumors (24, 29, 46‐48). Furthermore, we have generated a
mouse model of thyroid‐specific expression of STRN‐ALK and showed that this fusion alone
can drive the development of PDTC with histopathological features closely recapitulating
those of PDTC in humans (49). The aim of this study was to expand this observation and
investigate the development of thyroid cancer in mice with thyroid‐specific expression of
STRN‐ALK and inactivation of p53.
Page 8 of 41

8
MATERIALS AND METHODS
Generation of STRN‐ALK/p53KO mice and experimental design
Experimental triple transgenic Tg‐Luc‐tdT‐STRN‐ALK+/‐;Tg‐Cre+/‐;Trp53LoxP/LoxP (STRN‐
ALK;p53KO) mice with a mixed genetic background (C57BL/6J;FVB/N) were created by
crossing already established and characterized Tg‐Luc‐tdT‐STRN‐ALK (49), Tg‐Cre (50) and
Trp53Loxp (51) mouse lines. Experimental animals were arranged into 6‐, 12‐ and 18‐month‐
age groups and aged in standard conditions (noG) or treated with goitrogen (G) (2 months
on and 1 month off). For goitrogen treatment mice were supplied with drinking water
containing 0.5 g/L methimazole (M8506; Sigma, St. Louis, MO, USA) and 5 g/L sodium
perchlorate (410241; Sigma) starting from 5 weeks of age. For control purposes, the
C57BL/6J;FVB/N wild type and double transgenic Tg‐Cre+/‐;Trp53LoxP/LoxP (p53KO) mice
were also generated and aged. Animal care and all experimental procedures were
performed in accordance with federal guidelines and institutional policies.
10.1089/thy.2019.0284)
Thyroid
PCR genotyping and confirmation of thyroid‐specific Trp53 ex2‐10 deletion
DNA was extracted from tail tissues using QuickExtract™ DNA Extraction Solution
(QE09050, Epicentre, Madison, Wi, USA). Genotyping was performed by multiplex PCR
using HotStarTaq DNA polymerase (203025, Qiagen, Germantown, MD, USA) and three
pairs of primers for simultaneous detection of Tg‐Luc‐tdT‐STRN‐ALK, Tg‐Cre, Trp53LoxP and
wild type Trp53 alleles (Supplementary Table S1). For validation of the thyroid‐specific
Trp53loxP ex2‐10 deletion, DNA was extracted from snap‐frozen thyroid and spleen tissues
using a QIAmp DNA Mini Kit (51306, Qiagen) and PCR was performed as described above
with primers covering intron 1 and 10 of the Trp53 (Supplementary Table S1).
Ultrasound imaging
To monitor tumor development and growth, ultrasound screening of thyroids in
experimental mice was performed monthly using a preclinical Vevo 3100 micro ultrasound
imaging system (FUJIFILM VisualSonics, Toronto, ON, Canada). For high‐frequency analysis,
40 MHz B‐Mode imaging with the MX550D transducer with an axial resolution of 40 μm
was used.
Page 9 of 41

9
Thyroid tumor samples and serum collection
Following euthanasia, blood serum was collected by cardiac puncture and stored at ‐80°C
before measurement of serum TSH and free T4 as described previously (52). Guided by the
pre‐sacrifice ultrasound imaging and tumor‐specific red fluorescence from tdTomato,
tissue samples from areas of primary tumors with different morphological appearance
were dissected and snap‐frozen in liquid nitrogen. Remaining tumor tissues were fixed
with 10% buffered FA at 4°C overnight and embedded in paraffin.
Histological and immunohistochemical analysis
Formalin‐fixed paraffin‐embedded (FFPE) tissues were sectioned at a thickness of 4 μm,
deparaffinized and stained with hematoxylin and eosin (H&E) or immunohistochemically
(IHC). For IHC, antigen retrieval and non‐specific blocking were done as described
previously (49). Endogenous biotin was blocked with streptavidin (Thermo Fisher Scientific,
10.1089/thy.2019.0284)
Waltham, MA, USA) followed by incubation with biotin (Thermo Fisher Scientific)
Thyroid
according to the manufacturer instructions. Primary antibodies (Supplementary Table S2)
were applied overnight at 4°C. Secondary biotinylated anti‐rabbit antibodies (1:1000; BA‐
1000; Thermo Fisher Scientific) were applied for 1 hour at room temperature. Following
the incubation with complexes of biotinylated peroxidase (Thermo Fisher Scientific) and
streptavidin for 20 minutes at room temperature, the visualization of the
immunoreactivity was done using DAB Peroxidase Substrate Kit (Vector Laboratories,
Burlingame, CA) according to manufacturer instructions.
RNA extraction, quantitative RT‐PCR, RNA sequencing and gene expression analysis
Tumor samples with verified distinct histology were subjected to RNA extraction. Total
RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) from frozen thyroid
tissues, followed by treatment with DNAse I (Invitrogen) and purification with RNeasy Mini
Kit (Qiagen). RNA from FFPE tumor samples was extracted using an RNeasy FFPE kit
(Qiagen) after H&E‐guided microdissection of tumor regions of interest.
For quantitative RT‐ PCR (qRT‐PCR), the purified RNA was reverse transcribed using
a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA).
Page 10 of 41

10
Samples were tested in triplicates using a 7500 Real‐Time PCR System (Applied Biosystems,
Foster City, CA, USA) with QuantiTect SYBR® Green PCR Kit (Qiagen) and primers listed in
Supplementary Table S1. Expression levels of each gene relative to β‐actin (Actb) were
calculated using Q‐Gene software (53). To minimize biases associated with goitrogen
treatment, all gene expression data from tumor samples were normalized to the average
expression levels of corresponding genes in non‐treated (n=5) or goitrogen‐treated (n=5)
benign thyroid samples.
For RNA sequencing, RNA extracted from frozen tissues was subjected to library
preparation using NEBNext® Ultra™ II RNA Library Prep Kit for Illumina (NEB, Ipswich, MA,
USA) and paired‐end sequenced on the Illumina NovaSeq 6000 S4 flow cell (20M PE150
reads) by Novogene (Novogene Corporation, Sacramento, CA, USA). Raw sequencing data
were imported into CLC Biomedical Genomics Workbench 12 (Qiagen), high‐quality
trimmed paired reads were aligned to the mouse genome (Ensembl v80) and the number
10.1089/thy.2019.0284)
of reads mapped to each gene was normalized using TPM. The principal component
Thyroid
analysis (PCA) was performed on whole‐transcriptome data. For differential gene
expression (DEG) analysis, gene expression data from type 1 PDTC (n=3) and type 2 PDTC
(n=3) tumor samples were compared to gene expression in benign (noG=2, G=2) thyroid
samples while controlling for goitrogen treatment. Genes with an absolute fold change >3
and FDR p‐value of <0.05 were selected as differentially expressed genes and used for
building the Venn diagram. Heatmap of the expression of 15 preselected thyroid
differentiation genes was generated using complete‐linkage clustering (Manhattan
distance). ERK‐score calculation was performed as previously described (47). Gene
expression datasets were additionally analyzed using GSEA (MSidDB database,
http://software.broadinstitute.org/gsea/index.jsp) and Ingenuity Pathway Analysis
(Qiagen) software.
Statistical analysis
Statistical analysis was performed using IBM SPSS Statistics version 21 (IBM, Armonk, NY).
P‐values were 2‐sided and considered significant if ≤0.05. DEG analysis was performed
Page 11 of 41

11
using multi‐factorial statistics based on a negative binominal generalized linear model (by
default in CLC Biomedical Genomics Workbench 12).
RESULTS
Generation of mice with thyroid‐specific expression of STRN‐ALK and loss of p53
In order to investigate the effect of STRN‐ALK expression combined with a common late
event, inactivation of p53 function, we created triple transgenic mice by crossing the
existing Tg‐Luc‐tdT‐STRN‐ALK, Tg‐Cre and Trp53Loxp mouse lines (Fig. 1A, B). Final Tg‐Luc‐
tdT‐STRN‐ALK+/‐;Tg‐Cre+/‐;Trp53LoxP/LoxP (STRN‐ALK;p53KO) experimental animals had
thyroid‐specific expression of the HA‐tagged STRN‐ALK oncoprotein driven by the
transgenic thyroglobulin promoter (Supplementary Fig. S1) and Cre‐recombinase‐mediated
thyroid‐specific deletion of LoxP‐flanked exons 2‐10 of Trp53LoxP alleles (Fig. 1C),
introduced in a homozygous state.
10.1089/thy.2019.0284)
STRN‐ALK;p53KO mice develop metastatic and lethal thyroid tumors with high
Thyroid
penetrance
STRN‐ALK;p53KO mice were divided into 6‐, 12‐ and 18‐month‐age groups (n=11‐16 per
age/treatment group) and housed on normal diet or on goitrogen treatment, which led to
a ~ 3‐fold decrease in FT4 and a ~100‐fold rise in TSH levels (Supplementary Fig. S2).
Thyroid tumor development and progression in these mice were monitored using
ultrasonographic screening. Ultrasound imaging allowed early detection of ~1 mm thyroid
nodules from the age of 7 and 5 months in mice on regular diet (noG) or treated with
goitrogen (G), respectively. Upon initial detection, continuous monitoring of tumor
nodules showed their gradual increase in volume and, in many cases, transition to a phase
of rapid growth accompanied by changes in ultrasonographic patterns. Subsequent
histological examination of such cases revealed areas of PDTC growing adjacent to PTC
(Fig. 2A, B). Visual and manual examination of the mice generally revealed large hard
cervical masses fixed to the surrounding tissues.
Thyroid cancers were first detected on histological analysis of 6‐month old mice on
goitrogen treatment (Table 1). With continued aging, about half of tumor‐bearing animals
Page 12 of 41

12
(noG, n=7; G, n=10) were removed from the experiment before the planned sacrifice date
due to the development of life‐threatening conditions. By the age of 12 months, 48% of
mice on regular diet and 86% mice treated with goitrogen developed histologically
confirmed thyroid cancers. In mice treated with goitrogen, the distribution of histological
cancer types was shifted to dedifferentiated tumors (Table 1). Among age‐matched
controls, wild type (noG, n=17; G, n=11) and p53KO (noG, n=22; G, n=10) mice developed
no cancer.
Irrespective of goitrogen treatment, thyroid cancers in these mice showed
histological features of aggressive behavior including extrathyroidal growth and invasion
into trachea and blood vessels (Fig. 2C). Lung metastases were found in 8 (24%) tumor‐
bearing mice and were presented as multiple small nodules (Fig. 2D,E and Table 1). Most
metastatic tumors had either PDTC histology or contained areas with features of PTC and
PDTC.
10.1089/thy.2019.0284)
Thyroid tumors in STRN‐ALK;p53KO mice undergo step‐wise dedifferentiation
Thyroid
Thyroid tumors developed in these mice included well‐differentiated PTC (n=26), PDTC
(n=21) and ATC (n=8), which frequently co‐existed in the same thyroid gland, although
typically grew as well‐defined tumor nodules (Table 2; Fig. 3). The co‐occurrence of PTC
and PDTC was the most common (n=11), but all other combinations of PTC, PDTC, and ATC
were also observed (Table 2).
PTCs had microscopic features of different tumor variants including follicular
variant, classic type of papillary carcinoma, and hobnail variant. Although PTC was overall
the most common tumor type found, in many mice it was seen as a smaller component,
whereas PDTC tumors were typically most dominant, occupying the majority of the thyroid
volume and reaching a size of 8‐15 mm (Fig. 3). Histologically, all PDTC tumors had
microscopic characteristics similar to those seen in PDTC in humans as defined by the Turin
criteria. They commonly showed a solid growth pattern, although insular and trabecular
architecture were also observed. Nuclear features of papillary carcinoma were lost, and
high mitotic activity and tumor necrosis were frequently seen. Eight cases showed
anaplastic transformation, however the anaplastic component was not prominent and was
Page 13 of 41

13
present as small distinct foci (maximum size of 2‐3 mm) of ATC adjacent to PDTC (6 out of
8 ATC) or next to PTC (2 out of 8 ATC). The ATC tumors typically had a pleomorphic cell
appearance, but spindle cell and squamoid patterns were also seen.
Immunohistochemical analysis showed that PTC and PDTC tumors had strong
expression of HA‐tagged STRN‐ALK whereas cells in ATC generally had focal weak or no
expression of the transgene (Fig. 3). All PTCs and PDTCs preserved the expression of the
transcription factors TTF‐1 and PAX8, with typically higher levels in PTCs. All PTCs and
approximately half of PDTCs preserved immunoreactivity for thyroglobulin. ATC lost
expression of all of these thyroid differentiation markers. Expression of epithelial markers
cytokeratins 17/19 and E‐cadherin showed a gradual decrease and complete loss with
tumor dedifferentiation, with the opposite trend for vimentin, a mesenchymal marker.
PDTC tumors in STRN‐ALK;p53KO mice show two subtypes with distinct histological and
immunohistochemical features
10.1089/thy.2019.0284)
Thyroid
Further histological analysis of the PDTC tumors led us to identify two distinct microscopic
tumor appearances which correlated with the expression of thyroid differentiation
markers detectable by immunohistochemistry (Fig. 4). Although all of these PDTC tumors
fully met the Turin histological criteria of PDTC, 12 tumor nodules were composed of solid
sheets of cells that retained a significant amount of cytoplasm and had smaller‐sized nuclei
with dense, evenly distributed chromatin; we defined these tumors as poorly
differentiated carcinomas of type 1 (PDTC1) (Fig. 4D). We also found 13 PDTC tumor
nodules composed of solid sheets of cells with a reduced amount of cytoplasm and larger,
vesicular nuclei that had prominent and frequently multiple nucleoli; these tumors were
designated as poorly differentiated carcinomas type 2 (PDTC2) (Fig. 4D). In the majority of
mice, the PDTC tumors had histological features of either type 1 (n=8) or type 2 (n=9),
whereas in 4 cases the mouse thyroid glands had nodules with PDTC1 and PDTC2
appearance co‐existing as distinct, well‐delineated nodules located next to each other (Fig.
4B‐C). Foci of anaplastic transformation were found adjacent to PDTC2 tumors in five cases
and adjacent to a PDTC1 tumor in one case. The distribution of PDTC1 and PDTC2 tumors
was similar in mice with and without goitrogen treatment.
Page 14 of 41

14
Although immunohistochemical analysis revealed that both PDTC types had
comparable levels of STRN‐ALK transgene expression, evaluated by staining with the anti‐
HA tag antibody, the immunoreactivity for several thyroid cell markers showed significant
differences between these PDTC types (Fig. 4E). Specifically, PDTC1 tumors consistently
retained typically diffuse and moderately strong or weak staining for thyroglobulin and E‐
cadherin, while both stainings were frequently lost in PDTC2 tumors. TTF‐1 and PAX8
immunoreactivity was preserved in both PDTC types, although in some PDTC2 tumors it
was weaker.
Review of ultrasound images corresponding to histologically diagnosed PDTC1 and
PDTC2 nodules obtained during different time points allowed to trace back the appearance
and growth of these tumors. In those cases where both tumor types were present in one
thyroid gland, the analysis revealed that PDTC1 tumors appeared at earlier age as
compared to PDTC2 (Fig. 4A‐C).
10.1089/thy.2019.0284)
Type 1 and type 2 PDTC tumors have different expression levels of thyroid
Thyroid
differentiation genes
To further explore potential differences between PDTC tumors with type 1 and type 2
morphology, we investigated gene expression profiles of these tumors using RNA‐Seq. We
generated gene expression data for six PDTC tumors (PDTC1, n=3; PDTC2, n=3) as wells as
two well‐differentiated PTC and four benign thyroids (noG, n=2; G, n=2). The unsupervised
principal component analysis (PCA) of tumor transcriptional profiles showed that PDTC and
PTC were clustered separately from each other and from benign thyroids. Moreover, type
1 and type 2 PDTC tumors also appeared to cluster separately (Fig. 5A).
Gene expression analysis in PDTC1 and PDTC2 tumors was performed in
comparison to benign thyroid tissues (absolute fold change >3; FDR p‐value ≤ 0.05)
(Supplementary Table S3A). The analysis revealed significant differences in gene
expression profiles between type 1 and type 2 PDTC tumors (Fig. 5B). Further analysis of
gene expression sets from these tumors showed that PDTC2 tumors had a significant
upregulation of pathways related to cell cycle control and mitosis, downregulation of
genes associated with the epithelial phenotype (Supplementary Fig S3 A, B), and
Page 15 of 41

15
enrichment in other pathways including thyroid hormone biosynthesis (Supplementary
Table S4A‐C).
Next, we focused on the analysis of genes involved in thyroid differentiation, iodine
uptake and metabolism. As compared to benign thyroid tissues, the expression levels of
several thyroid genes involved in iodide metabolism and thyroid hormone synthesis such
as Tg, Tpo, Ano1, and Duox2 were significantly decreased in PDTC2 but not in PDTC1
(Supplementary Table S3B). Both types of PDTC had significantly lower expression of
Slc5a5 (Nis) as compared to benign thyroid tissue, but the average expression was
approximately two‐fold lower in PDTC2. Some of other thyroid differentiation genes (Tshr,
Foxe1, and Glis3) showed a tendency for a lower expression in PDTC2, and in clustering
analysis of thyroid differentiation genes PDTC1 and PDTC2 tumors formed two distinct
clusters (Fig. 5C).To test if the observed downregulation of thyroid differentiation genes
expression is associated with an increased MAPK pathway activity, we calculated the ERK‐
10.1089/thy.2019.0284)
score, which showed a tendency to be higher in PDTC2 tumors, although the number of
Thyroid
studied samples was low (Supplementary Fig. S3C).
To validate the RNA‐Seq data, we performed qRT‐PCR analysis to compare the
expression of key thyroid follicular cell differentiation and iodide metabolism genes
between five PDTC1 and five PDTC2 tumors. The analysis showed that PDTC2 tumors had
significantly lower expression of the Slc5a5 (Nis), Tg, Tpo, and Duox2 genes, whereas the
expression of Tshr, Nkx2‐1 (Ttf‐1), Pax8 and Foxe1 in these tumors displayed a tendency to
decrease, which however did not reach statistical significance (Fig. 5D). These findings
provide further evidence supporting the existence of two types of PDTC in STRN‐
ALK;p53KO mice, which have not only distinct histological and immunohistochemical
characteristics but also different transcriptomic profiles, including genes that are of
relevance for a differentiated thyroid phenotype.
DISCUSSION
In this study, we generated a new mouse model of thyroid‐specific expression of STRN‐ALK
and inactivation of p53 and show that these animals develop metastatic and frequently
lethal thyroid cancers with a step‐wise progression from PTC to PDTC and ATC and
Page 16 of 41

16
phenotypical characteristics recapitulating thyroid cancers in humans. Further, we
demonstrate that in this mouse model the PDTC tumors have two distinct morphological
appearances that correspond to different levels of expression of thyroid differentiation
genes.
Fusions of the ALK oncogene are found in various types of thyroid cancers, with a
higher incidence in dedifferentiated tumors and particularly in PDTC as compared to well‐
differentiated thyroid PTC (24, 46‐48). In a recent study, we have confirmed the oncogenic
properties of the most common type of ALK fusion, STRN‐ALK, and demonstrated that
mice with thyroid‐specific expression of STRN‐ALK develop PDTC (49). Based on the fact
that human PDTC and ATC frequently harbor additional late mutations such as alterations
of TP53 (23, 24), we expanded our mouse model of STRN‐ALK‐driven PDTC by adding a
thyroid‐specific biallelic inactivation of p53. Loss of p53 function in these mice lead to a
higher penetrance with respect to generation of PDTC and progression to complete tumor
10.1089/thy.2019.0284)
dedifferentiation with formation of ATC.
Thyroid
The observed patterns of co‐occurrence of tumors with different degrees of
differentiation and a shift to more dedifferentiated tumors in older animals, especially
after treatment with goitrogen, recapitulate the accepted paradigm of step‐wise
dedifferentiation of thyroid cancer in humans. In includes the progression of well‐
differentiated cancer like PTC to less differentiated PDTC and fully dedifferentiated ATC, a
process that is accompanied by progressive accumulation of driver mutations and a loss of
tumor suppressors (54, 55). This progression model is supported by the co‐occurrence of
well‐differentiated and/or poorly differentiated cancer areas in 30‐80% of ATC in humans
(12, 16, 56‐61). Additional and more direct evidence is offered by animal models of thyroid
cancer driven by an early event such as activating BRAF or RAS mutations or inactivation of
Pten combined with the loss of p53 or Nf2 tumor suppressor genes or activating mutation
in PIK3CA. These animals develop thyroid cancer with either rapid anaplastic
transformation (42‐45) or show cancer dedifferentiation with a well‐defined step of PDTC
(35‐41).
Page 17 of 41

17
The tyroid tumors present in this mouse model of thyroid‐specific STRN‐ALK
expression coupled with p53 inactivation are morphologically and functionally similar to
the respective cancer types seen in humans. Interestingly, among PTC tumors, we
observed classical papillary type, follicular variant, as well as hobnail variant tumors. The
latter resembled the hobnail variant of PTC in humans that frequently carry mutations in
TP53 and show progression to PDTC (62‐66). In many of these mice, PDTC was the
dominant tumor type found on histological examination. These tumors had all
morphologic characteristics defined for human PDTC by the Turin criteria which have been
adopted by the WHO classification of endocrine tumors (20, 21). Similar to human tumors,
PDTC in these mice show a variable decrease or loss of immunoreactivity for thyroglobulin
and epithelial markers such as E‐cadherin and preserved PAX8 and TTF‐1 thyroid
differentiation markers, consistent with an intermediate immunophenotype between well‐
differentiated cancer and ATC observed in humans (25, 26, 28, 29, 67, 68).
10.1089/thy.2019.0284)
However, despite fully meeting the Turin diagnostic criteria, PDTC tumors in STRN‐
Thyroid
ALK;p53KO mice revealed two distinct tumor cell appearances with respect to the amount
of cytoplasm, size of nuclei and appearance of chromatin, and nucleus to cytoplasm (N:C)
ratio. Tumors designated as PDTC1 are composed of cells with smaller hyperchromatic
nuclei, a larger amount of cytoplasm, and an overall lower N:C ratio. This cellular
appearance is more reminiscent of well‐differentiated thyroid cancer cells, and indeed,
these tumors preserve stronger immunoreactivity for thyroglobulin and E‐cadherin and
higher levels of expression of mRNA of genes related to thyroid differentiation and iodine
metabolism. In contrast, PDTC2 tumors are composed of cells with larger nuclei, vesicular
chromatin with prominent and typically multiple nuclei, a smaller volume of cytoplasm,
and a higher N:C ratio. These cells have virtually no resemblance to differentiated thyroid
cancer cells, but they retain a monomorphic appearance of the nuclei without the marked
atypia seen in AC cells. Compared to PDTC1, PDTC2 tumors show a more pronounced loss
of markers of thyroid differentiation on immunohistochemistry and gene expression
analysis. However, both types of PDTC found in this study do not differ with respect to
predominantly solid growth pattern, high mitotic activity, and presence of coagulative
necrosis, which are diagnostic features of PDTC in humans.
Page 18 of 41

18
Most tumor‐bearing thyroid glands contained either PDTC type 1 or type 2 tumors,
which frequently were located adjacent to areas of well‐differentiated PTC. However, in
four cases, both PDTC types were found co‐existing in the same thyroid. Reconstruction of
tumor nodule growth using ultrasound images taken at different time intervals suggests
the possibility of progression from PDTC1 to PDTC2. Furthermore, in most cases, areas of
ATC were found adjacent to type 2 PDTC. These findings point towards the possibility of
progression from PDTC1 to PDTC2 and then to ATC. Nevertheless, in two cases, the areas
of ATC were seen adjacent to PTC without appreciable PDTC tumor present, which
suggests that a direct transition from well differentiated PTC to ATC may also occur.
Overall, based on the frequencies of various tumor types coexisting in the same thyroid, it
appears that dedifferentiation of thyroid cancer driven by activated ALK kinase coupled
with loss of p53 may often involve a PTC → PDTC1 → PDTC2 → ATC progression, although
deviations from such linearity or more direct dedifferentiation pathways are also possible
(Fig. 6).
10.1089/thy.2019.0284)
Thyroid
Differences in expression of Nis and other genes involved in thyroidal iodide uptake
and organification found between the two PDTC types in these mice are intriguing and
potentially relevant. In humans, PDTCs are known to have significant variability in iodine
uptake and response to RAI. In fact, most studies showed that approximately half of PDTCs
in humans retain substantial and occasionally a strong ability to concentrate RAI, whereas
the other half are RAI‐refractory (4, 69, 70). The results of this study raise at least a
theoretical possibility that the group of PDTC defined by the current diagnostic criteria is
not homogeneous and, while still occupying an intermediate position in terms of thyroid
differentiation between well‐differentiated cancer and ATC, may include two tumor types
with different degrees of expression of iodide‐metabolizing genes and responses to RAI.
However, it remains unclear whether the same PDTC types can be found in humans and
whether or not the differences in expression of thyroid differentiation genes would
translate into variable abilities of these tumor cells to concentrate and retain radioiodine.
We observed that goitrogen treatment accelerated thyroid tumor development
and progression from PTC to PDTC and ATC. This is likely caused by the elevated TSH levels
and, surprisingly, preserved expression of Tshr in the majority of mouse PDTC tumors. This
Page 19 of 41

19
observation is consistent with other studies showing that elevated levels of TSH play a role
in initiation and progression of thyroid cancers and are associated with a more severe
tumor phenotype in mice (71, 72) and humans (73‐75).
This mouse model has a limitation related to the expression of STRN‐ALK controlled
by a transgenic thyroglobulin promoter, which results in a significant decrease or
disappearance of transgene expression during anaplastic transformation. This may be
responsible for a lower penetrance with respect to the formation of ATC, and make these
mice unsuitable to study the effect of targeted ALK kinase inhibition. The generation of a
new doxycycline‐inducible STRN‐ALK mouse line is ongoing, which should overcome the
differentiation‐dependent limitation of the current model. In addition, the number of
tumor samples used for histological and molecular characterization of the two groups of
PDTC tumors was limited and the ability of these tumors to concentrate and retain RAI was
not analyzed in this study. Therefore, it would be important to expand the analysis to a
10.1089/thy.2019.0284)
larger cohort of PDTC samples and evaluate RAI uptake by PDTC type 1 and type 2 tumors
Thyroid
in vivo or using established tumor cell primary cultures.
In summary, the results of our study demonstrate that expression of STRN‐ALK with
simultaneous loss of p53 function in murine thyroid cells initiates a program of thyroid
carcinogenesis and multi‐step dedifferentiation with evidence of progression from PTC to
PDTC and ATC. Furthermore, our findings raise the possibility of the existence of two PDTC
types with different levels of thyroid differentiation and expression of iodine‐metabolizing
genes. These findings may prove to be relevant to human PDTC, which requires further
investigation.
ACKNOWLEDGMENTS
We thank Dr. Satdarshan P. Monga and Dr. Aaron W. Bell (Division of Experimental
Pathology, Department of Pathology, University of Pittsburgh, Pittsburgh, PA, USA) for the
help with mouse ultrasound imaging screening. We also thank Dr. Samuel Refetoff and Dr.
Xia Hui Liao (Departments of Medicine (X‐H.L., S.R.) and Pediatrics and Genetics (S.R), The
University of Chicago, Chicago, IL, USA) for assistance with measurement of mouse TSH
Thyroid
10.1089/thy.2019.0284)

CORRESPONDENCE
nikiforovye@upmc.edu
DISCLOSURE STATEMENT

No competing financial interests exist
supported by the National Institutes of Health grant CA181150.
8031, 3477 Euler Way, Pittsburgh, PA, 15213; Fax: (412)‐802‐6799; E‐mail:
and FT4 supported by the National Institutes of Health grant DK15070. This work was
Yuri E. Nikiforov, MD, PhD, Department of Pathology, University of Pittsburgh, CLB Room
20
Page 20 of 41
Page 21 of 41

21
REFERENCES
1. Siegel RL, Miller KD, Jemal A 2019 Cancer statistics, 2019. CA Cancer J Clin 69:7‐34.
2. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM,
Forman D, Bray F 2015 Cancer incidence and mortality worldwide: sources,
methods and major patterns in GLOBOCAN 2012. Int J Cancer 136:E359‐386.
3. Ibrahimpasic T, Ghossein R, Shah JP, Ganly I 2019 Poorly Differentiated Carcinoma of
the Thyroid Gland: Current Status and Future Prospects. Thyroid 29:311‐321.
4. de la Fouchardiere C, Decaussin‐Petrucci M, Berthiller J, Descotes F, Lopez J, Lifante
JC, Peix JL, Giraudet AL, Delahaye A, Masson S, Bournaud‐Salinas C, Borson Chazot F
2018 Predictive factors of outcome in poorly differentiated thyroid carcinomas. Eur
J Cancer 92:40‐47.
10.1089/thy.2019.0284)
5. Kebebew E, Greenspan FS, Clark OH, Woeber KA, McMillan A 2005 Anaplastic
Thyroid
thyroid carcinoma. Treatment outcome and prognostic factors. Cancer 103:1330‐

1335.
6. Wendler J, Kroiss M, Gast K, Kreissl MC, Allelein S, Lichtenauer U, Blaser R, Spitzweg
C, Fassnacht M, Schott M, Fuhrer D, Tiedje V 2016 Clinical presentation, treatment
and outcome of anaplastic thyroid carcinoma: results of a multicenter study in
Germany. Eur J Endocrinol 175:521‐529.
7. Siironen P, Hagstrom J, Maenpaa HO, Louhimo J, Heikkila A, Heiskanen I, Arola J,
Haglund C 2010 Anaplastic and poorly differentiated thyroid carcinoma: therapeutic
strategies and treatment outcome of 52 consecutive patients. Oncology 79:400‐408.
8. Segerhammar I, Larsson C, Nilsson IL, Backdahl M, Hoog A, Wallin G, Foukakis T,
Zedenius J 2012 Anaplastic carcinoma of the thyroid gland: treatment and outcome
over 13 years at one institution. J Surg Oncol 106:981‐986.
9. Ibrahimpasic T, Ghossein R, Carlson DL, Nixon I, Palmer FL, Shaha AR, Patel SG,
Tuttle RM, Shah JP, Ganly I 2014 Outcomes in patients with poorly differentiated
thyroid carcinoma. J Clin Endocrinol Metab 99:1245‐1252.
Page 22 of 41

22
10. Lee DY, Won JK, Lee SH, Park DJ, Jung KC, Sung MW, Wu HG, Kim KH, Park YJ, Hah JH
2016 Changes of Clinicopathologic Characteristics and Survival Outcomes of

Anaplastic and Poorly Differentiated Thyroid Carcinoma. Thyroid 26:404‐413.
11. Xue F, Li D, Hu C, Wang Z, He X, Wu Y 2017 Application of intensity‐modulated
radiotherapy in unresectable poorly differentiated thyroid carcinoma. Oncotarget
8:15934‐15942.
12. Rao SN, Zafereo M, Dadu R, Busaidy NL, Hess K, Cote GJ, Williams MD, William WN,
Sandulache V, Gross N, Gunn GB, Lu C, Ferrarotto R, Lai SY, Cabanillas ME 2017
Patterns of Treatment Failure in Anaplastic Thyroid Carcinoma. Thyroid 27:672‐681.
13. Wassermann J, Bernier MO, Spano JP, Lepoutre‐Lussey C, Buffet C, Simon JM,
Menegaux F, Tissier F, Leban M, Leenhardt L 2016 Outcomes and Prognostic Factors
in Radioiodine Refractory Differentiated Thyroid Carcinomas. Oncologist 21:50‐58.
10.1089/thy.2019.0284)
14. Lee DY, Won JK, Choi HS, Park do J, Jung KC, Sung MW, Kim KH, Hah JH, Park YJ 2016
Thyroid
Recurrence and Survival After Gross Total Removal of Resectable Undifferentiated

or Poorly Differentiated Thyroid Carcinoma. Thyroid 26:1259‐1268.
15. Spires JR, Schwartz MR, Miller RH 1988 Anaplastic thyroid carcinoma. Association
with differentiated thyroid cancer. Arch Otolaryngol Head Neck Surg 114:40‐44.
16. Venkatesh YS, Ordonez NG, Schultz PN, Hickey RC, Goepfert H, Samaan NA 1990
Anaplastic carcinoma of the thyroid. A clinicopathologic study of 121 cases. Cancer
66:321‐330.
17. Hundahl SA, Cady B, Cunningham MP, Mazzaferri E, McKee RF, Rosai J, Shah JP,
Fremgen AM, Stewart AK, Holzer S 2000 Initial results from a prospective cohort
study of 5583 cases of thyroid carcinoma treated in the united states during 1996.
U.S. and German Thyroid Cancer Study Group. An American College of Surgeons
Commission on Cancer Patient Care Evaluation study. Cancer 89:202‐217.

Page 23 of 41

23
18. Aldinger KA, Samaan NA, Ibanez M, Hill CS, Jr. 1978 Anaplastic carcinoma of the
thyroid: a review of 84 cases of spindle and giant cell carcinoma of the thyroid.
Cancer 41:2267‐2275.
19. Han JM, Bae Kim W, Kim TY, Ryu JS, Gong G, Hong SJ, Kim JH, Oh YL, Jang HW, Kim
SW, Chung JH, Shong YK 2012 Time trend in tumour size and characteristics of
anaplastic thyroid carcinoma. Clin Endocrinol (Oxf) 77:459‐464.
20. Volante M, Collini P, Nikiforov YE, Sakamoto A, Kakudo K, Katoh R, Lloyd RV, LiVolsi
VA, Papotti M, Sobrinho‐Simoes M, Bussolati G, Rosai J 2007 Poorly differentiated
thyroid carcinoma: the Turin proposal for the use of uniform diagnostic criteria and
an algorithmic diagnostic approach. The American journal of surgical pathology
31:1256‐1264.
21. Lloyd RV, Osamura RY, Klöppel G, Rosai J 2017 WHO Classification of Tumours of
10.1089/thy.2019.0284)
Endocrine Organs. 4th ed. IARC Press, Lyon.
Thyroid
22. Hiltzik D, Carlson DL, Tuttle RM, Chuai S, Ishill N, Shaha A, Shah JP, Singh B, Ghossein
RA 2006 Poorly differentiated thyroid carcinomas defined on the basis of mitosis
and necrosis: a clinicopathologic study of 58 patients. Cancer 106:1286‐1295.
23. Nikiforov YE 2004 Genetic alterations involved in the transition from well‐
differentiated to poorly differentiated and anaplastic thyroid carcinomas. Endocr
Pathol 15:319‐327.
24. Landa I, Ibrahimpasic T, Boucai L, Sinha R, Knauf JA, Shah RH, Dogan S, Ricarte‐Filho
JC, Krishnamoorthy GP, Xu B, Schultz N, Berger MF, Sander C, Taylor BS, Ghossein R,
Ganly I, Fagin JA 2016 Genomic and transcriptomic hallmarks of poorly
differentiated and anaplastic thyroid cancers. J Clin Invest 126:1052‐1066.
25. Asioli S, Erickson LA, Righi A, Jin L, Volante M, Jenkins S, Papotti M, Bussolati G,
Lloyd RV 2010 Poorly differentiated carcinoma of the thyroid: validation of the Turin
proposal and analysis of IMP3 expression. Mod Pathol 23:1269‐1278.

Page 24 of 41

24
26. Nonaka D, Tang Y, Chiriboga L, Rivera M, Ghossein R 2008 Diagnostic utility of
thyroid transcription factors Pax8 and TTF‐2 (FoxE1) in thyroid epithelial neoplasms.
Mod Pathol 21:192‐200.
27. Bejarano PA, Nikiforov YE, Swenson ES, Biddinger PW 2000 Thyroid transcription
factor‐1, thyroglobulin, cytokeratin 7, and cytokeratin 20 in thyroid neoplasms. Appl
Immunohistochem Mol Morphol 8:189‐194.
28. Basolo F, Pisaturo F, Pollina LE, Fontanini G, Elisei R, Molinaro E, Iacconi P, Miccoli P,
Pacini F 2000 N‐ras mutation in poorly differentiated thyroid carcinomas:

correlation with bone metastases and inverse correlation to thyroglobulin
expression. Thyroid 10:19‐23.
29. Romei C, Tacito A, Molinaro E, Piaggi P, Cappagli V, Pieruzzi L, Matrone A, Viola D,
Agate L, Torregrossa L, Ugolini C, Basolo F, De Napoli L, Curcio M, Ciampi R,
10.1089/thy.2019.0284)
Materazzi G, Vitti P, Elisei R 2018 Clinical, pathological and genetic features of
Thyroid
anaplastic and poorly differentiated thyroid cancer: A single institute experience.

Oncol Lett 15:9174‐9182.
30. Giordano TJ, Kuick R, Thomas DG, Misek DE, Vinco M, Sanders D, Zhu Z, Ciampi R,
Roh M, Shedden K, Gauger P, Doherty G, Thompson NW, Hanash S, Koenig RJ,
Nikiforov YE 2005 Molecular classification of papillary thyroid carcinoma: distinct
BRAF, RAS, and RET/PTC mutation‐specific gene expression profiles discovered by
DNA microarray analysis. Oncogene 24:6646‐6656.
31. Chung T, Youn H, Yeom CJ, Kang KW, Chung JK 2015 Glycosylation of Sodium/Iodide
Symporter (NIS) Regulates Its Membrane Translocation and Radioiodine Uptake.
PLoS One 10:e0142984.
32. Dohan O, De la Vieja A, Paroder V, Riedel C, Artani M, Reed M, Ginter CS, Carrasco N
2003 The sodium/iodide Symporter (NIS): characterization, regulation, and medical
significance. Endocr Rev 24:48‐77.

Page 25 of 41

25
33. Martin M, Geysels RC, Peyret V, Bernal Barquero CE, Masini‐Repiso AM, Nicola JP
2019 Implications of Na(+)/I(‐) Symporter Transport to the Plasma Membrane for
Thyroid Hormonogenesis and Radioiodide Therapy. J Endocr Soc 3:222‐234.
34. Haugen BR 2017 2015 American Thyroid Association Management Guidelines for
Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: What is
new and what has changed? Cancer 123:372‐381.
35. McFadden DG, Vernon A, Santiago PM, Martinez‐McFaline R, Bhutkar A, Crowley
DM, McMahon M, Sadow PM, Jacks T 2014 p53 constrains progression to anaplastic
thyroid carcinoma in a Braf‐mutant mouse model of papillary thyroid cancer. Proc
Natl Acad Sci U S A 111:E1600‐1609.
36. La Perle KM, Jhiang SM, Capen CC 2000 Loss of p53 promotes anaplasia and local
invasion in ret/PTC1‐induced thyroid carcinomas. Am J Pathol 157:671‐677.
10.1089/thy.2019.0284)
37. Garcia‐Rendueles ME, Ricarte‐Filho JC, Untch BR, Landa I, Knauf JA, Voza F, Smith
Thyroid
VE, Ganly I, Taylor BS, Persaud Y, Oler G, Fang Y, Jhanwar SC, Viale A, Heguy A,
Huberman KH, Giancotti F, Ghossein R, Fagin JA 2015 NF2 Loss Promotes Oncogenic
RAS‐Induced Thyroid Cancers via YAP‐Dependent Transactivation of RAS Proteins
and Sensitizes Them to MEK Inhibition. Cancer Discov 5:1178‐1193.
38. Champa D, Russo MA, Liao XH, Refetoff S, Ghossein RA, Di Cristofano A 2014
Obatoclax overcomes resistance to cell death in aggressive thyroid carcinomas by
countering Bcl2a1 and Mcl1 overexpression. Endocr Relat Cancer 21:755‐767.
39. Knauf JA, Ma X, Smith EP, Zhang L, Mitsutake N, Liao XH, Refetoff S, Nikiforov YE,
Fagin JA 2005 Targeted expression of BRAFV600E in thyroid cells of transgenic mice
results in papillary thyroid cancers that undergo dedifferentiation. Cancer Res
65:4238‐4245.
40. Knauf JA, Sartor MA, Medvedovic M, Lundsmith E, Ryder M, Salzano M, Nikiforov
YE, Giordano TJ, Ghossein RA, Fagin JA 2011 Progression of BRAF‐induced thyroid
cancer is associated with epithelial‐mesenchymal transition requiring concomitant
MAP kinase and TGFbeta signaling. Oncogene 30:3153‐3162.
Page 26 of 41

26
41. Vitagliano D, Portella G, Troncone G, Francione A, Rossi C, Bruno A, Giorgini A,
Coluzzi S, Nappi TC, Rothstein JL, Pasquinelli R, Chiappetta G, Terracciano D,
Macchia V, Melillo RM, Fusco A, Santoro M 2006 Thyroid targeting of the N‐
ras(Gln61Lys) oncogene in transgenic mice results in follicular tumors that progress
to poorly differentiated carcinomas. Oncogene 25:5467‐5474.
42. Charles RP, Silva J, Iezza G, Phillips WA, McMahon M 2014 Activating BRAF and
PIK3CA mutations cooperate to promote anaplastic thyroid carcinogenesis. Mol
Cancer Res 12:979‐986.
43. Zhu X, Zhao L, Park JW, Willingham MC, Cheng SY 2014 Synergistic signaling of KRAS
and thyroid hormone receptor beta mutants promotes undifferentiated thyroid
cancer through MYC up‐regulation. Neoplasia 16:757‐769.
44. Antico Arciuch VG, Russo MA, Dima M, Kang KS, Dasrath F, Liao XH, Refetoff S,
10.1089/thy.2019.0284)
Montagna C, Di Cristofano A 2011 Thyrocyte‐specific inactivation of p53 and Pten
Thyroid
results in anaplastic thyroid carcinomas faithfully recapitulating human tumors.

Oncotarget 2:1109‐1126.
45. Knauf JA, Luckett KA, Chen KY, Voza F, Socci ND, Ghossein R, Fagin JA 2018 Hgf/Met
activation mediates resistance to BRAF inhibition in murine anaplastic thyroid
cancers. J Clin Invest 128:4086‐4097.
46. Kelly LM, Barila G, Liu P, Evdokimova VN, Trivedi S, Panebianco F, Gandhi M, Carty
SE, Hodak SP, Luo J, Dacic S, Yu YP, Nikiforova MN, Ferris RL, Altschuler DL, Nikiforov
YE 2014 Identification of the transforming STRN‐ALK fusion as a potential
therapeutic target in the aggressive forms of thyroid cancer. Proc Natl Acad Sci U S
A 111:4233‐4238.
47. Cancer Genome Atlas Research N 2014 Integrated genomic characterization of
papillary thyroid carcinoma. Cell 159:676‐690.
48. Chou A, Fraser S, Toon CW, Clarkson A, Sioson L, Farzin M, Cussigh C, Aniss A, O'Neill
C, Watson N, Clifton‐Bligh RJ, Learoyd DL, Robinson BG, Selinger CI, Delbridge LW,

Page 27 of 41

27
Sidhu SB, O'Toole SA, Sywak M, Gill AJ 2015 A detailed clinicopathologic study of
ALK‐translocated papillary thyroid carcinoma. Am J Surg Pathol 39:652‐659.
49. Nikitski AV, Rominski SL, Wankhede M, Kelly LM, Panebianco F, Barila G, Altschuler
DL, Nikiforov YE 2018 Mouse Model of Poorly Differentiated Thyroid Carcinoma
Driven by STRN‐ALK Fusion. Am J Pathol 188:2653‐2661.
50. Kero J, Ahmed K, Wettschureck N, Tunaru S, Wintermantel T, Greiner E, Schutz G,
Offermanns S 2007 Thyrocyte‐specific Gq/G11 deficiency impairs thyroid function
and prevents goiter development. J Clin Invest 117:2399‐2407.
51. Marino S, Vooijs M, van Der Gulden H, Jonkers J, Berns A 2000 Induction of
medulloblastomas in p53‐null mutant mice by somatic inactivation of Rb in the
external granular layer cells of the cerebellum. Genes Dev 14:994‐1004.
52. Di Cosmo C, Liao XH, Dumitrescu AM, Philp NJ, Weiss RE, Refetoff S 2010 Mice
10.1089/thy.2019.0284)
deficient in MCT8 reveal a mechanism regulating thyroid hormone secretion. J Clin
Thyroid
Invest 120:3377‐3388.
53. Muller PY, Janovjak H, Miserez AR, Dobbie Z 2002 Processing of gene expression
data generated by quantitative real‐time RT‐PCR. Biotechniques 32:1372‐1374,
1376, 1378‐1379.
54. Nikiforov YE, Biddinger PW, Thompson LDR 2018 Diagnostic Pathology and
Molecular Genetics of the Thyroid: A Comprehensive Guide for Practicing Thyroid
Pathology, Edition 3. Lippincott Williams & Wilkins.
55. Lloyd RV, R.Y. O, G. K, J. R 2017 World Health Organization Classification of Tumours
of Endocrine Organs. IARC Press, Lyon.
56. Nishiyama RH, Dunn EL, Thompson NW 1972 Anaplastic spindle‐cell and giant‐cell
tumors of the thyroid gland. Cancer 30:113‐127.
57. Carcangiu ML, Steeper T, Zampi G, Rosai J 1985 Anaplastic thyroid carcinoma. A
study of 70 cases. Am J Clin Pathol 83:135‐158.
Page 28 of 41

28
58. Albores‐Saavedra J, Hernandez M, Sanchez‐Sosa S, Simpson K, Angeles A, Henson
DE 2007 Histologic variants of papillary and follicular carcinomas associated with
anaplastic spindle and giant cell carcinomas of the thyroid: an analysis of rhabdoid
and thyroglobulin inclusions. The American journal of surgical pathology 31:729‐
736.
59. Hirokawa M, Sugitani I, Kakudo K, Sakamoto A, Higashiyama T, Sugino K, Toda K,
Ogasawara S, Yoshimoto S, Hasegawa Y, Imai T, Onoda N, Orita Y, Kammori M,
Fujimori K, Yamada H 2016 Histopathological analysis of anaplastic thyroid

carcinoma cases with long‐term survival: A report from the Anaplastic Thyroid
Carcinoma Research Consortium of Japan. Endocr J 63:441‐447.
60. Tiedje V, Ting S, Herold T, Synoracki S, Latteyer S, Moeller LC, Zwanziger D, Stuschke
M, Fuehrer D, Schmid KW 2017 NGS based identification of mutational hotspots for
targeted therapy in anaplastic thyroid carcinoma. Oncotarget 8:42613‐42620.
10.1089/thy.2019.0284)
Thyroid
61. Bonhomme B, Godbert Y, Perot G, Al Ghuzlan A, Bardet S, Belleannee G, Criniere L,
Do Cao C, Fouilloux G, Guyetant S, Kelly A, Leboulleux S, Buffet C, Leteurtre E,
Michels JJ, Tissier F, Toubert ME, Wassef M, Pinard C, Hostein I, Soubeyran I 2017
Molecular Pathology of Anaplastic Thyroid Carcinomas: A Retrospective Study of
144 Cases. Thyroid : official journal of the American Thyroid Association 27:682‐
692.
62. Asioli S, Erickson LA, Sebo TJ, Zhang J, Jin L, Thompson GB, Lloyd RV 2010 Papillary
thyroid carcinoma with prominent hobnail features: a new aggressive variant of
moderately differentiated papillary carcinoma. A clinicopathologic,
immunohistochemical, and molecular study of eight cases. Am J Surg Pathol 34:44‐
52.
63. Lee YS, Kim Y, Jeon S, Bae JS, Jung SL, Jung CK 2015 Cytologic, clinicopathologic, and
molecular features of papillary thyroid carcinoma with prominent hobnail features:
10 case reports and systematic literature review. Int J Clin Exp Pathol 8:7988‐7997.

Page 29 of 41

29
64. Cameselle‐Teijeiro JM, Rodriguez‐Perez I, Celestino R, Eloy C, Piso‐Neira M,
Abdulkader‐Nallib I, Soares P, Sobrinho‐Simoes M 2017 Hobnail Variant of Papillary
Thyroid Carcinoma: Clinicopathologic and Molecular Evidence of Progression to

Undifferentiated Carcinoma in 2 Cases. Am J Surg Pathol 41:854‐860.
65. Amacher AM, Goyal B, Lewis JS, Jr., El‐Mofty SK, Chernock RD 2015 Prevalence of a
hobnail pattern in papillary, poorly differentiated, and anaplastic thyroid carcinoma:
a possible manifestation of high‐grade transformation. Am J Surg Pathol 39:260‐
265.
66. Teng L, Deng W, Lu J, Zhang J, Ren X, Duan H, Chuai S, Duan F, Gao W, Lu T, Wu H,
Liang Z 2017 Hobnail variant of papillary thyroid carcinoma: molecular profiling and
comparison to classical papillary thyroid carcinoma, poorly differentiated thyroid
carcinoma and anaplastic thyroid carcinoma. Oncotarget 8:22023‐22033.
10.1089/thy.2019.0284)
67. Rocha AS, Soares P, Fonseca E, Cameselle‐Teijeiro J, Oliveira MC, Sobrinho‐Simoes
Thyroid
M 2003 E‐cadherin loss rather than beta‐catenin alterations is a common feature of
poorly differentiated thyroid carcinomas. Histopathology 42:580‐587.
68. Barroeta JE, Baloch ZW, Lal P, Pasha TL, Zhang PJ, LiVolsi VA 2006 Diagnostic value of
differential expression of CK19, Galectin‐3, HBME‐1, ERK, RET, and p16 in benign
and malignant follicular‐derived lesions of the thyroid: an immunohistochemical
tissue microarray analysis. Endocr Pathol 17:225‐234.
69. Patel KN, Shaha AR 2006 Poorly differentiated and anaplastic thyroid cancer. Cancer
Control 13:119‐128.
70. Lin JD, Chao TC, Hsueh C 2007 Clinical characteristics of poorly differentiated
thyroid carcinomas compared with those of classical papillary thyroid carcinomas.
Clinical endocrinology 66:224‐228.
71. Lu C, Zhao L, Ying H, Willingham MC, Cheng SY 2010 Growth activation alone is not
sufficient to cause metastatic thyroid cancer in a mouse model of follicular thyroid
carcinoma. Endocrinology 151:1929‐1939.
Page 30 of 41

30
72. Franco AT, Malaguarnera R, Refetoff S, Liao XH, Lundsmith E, Kimura S, Pritchard C,
Marais R, Davies TF, Weinstein LS, Chen M, Rosen N, Ghossein R, Knauf JA, Fagin JA
2011 Thyrotrophin receptor signaling dependence of Braf‐induced thyroid tumor

initiation in mice. Proc Natl Acad Sci U S A 108:1615‐1620.
73. Haymart MR, Repplinger DJ, Leverson GE, Elson DF, Sippel RS, Jaume JC, Chen H
2008 Higher serum thyroid stimulating hormone level in thyroid nodule patients is
associated with greater risks of differentiated thyroid cancer and advanced tumor
stage. J Clin Endocrinol Metab 93:809‐814.
74. Boelaert K, Horacek J, Holder RL, Watkinson JC, Sheppard MC, Franklyn JA 2006
Serum thyrotropin concentration as a novel predictor of malignancy in thyroid
nodules investigated by fine‐needle aspiration. J Clin Endocrinol Metab 91:4295‐
4301.
10.1089/thy.2019.0284)
75. Fiore E, Vitti P 2012 Serum TSH and risk of papillary thyroid cancer in nodular
Thyroid
thyroid disease. J Clin Endocrinol Metab 97:1134‐1145.

Page 31 of 41

31
Table 1. Cancer frequencies in STRN‐ALK;p53KO mice
Cancer type** Lung
Age Total
Goitr metastases,
group*, number
ogen PTC PDTC ATC Any type % of primary
months of mice
tumors
6 13 ‐ ‐ ‐ ‐ ‐
‐ 12 23 11 (48%) 5 (22%) 3 (13%) 11 (48%) 1 (9%)
18 7 5 (71%) 2 (29%) 1 (14%) 5 (71%) 2 (40%)

6 20 3 (15%) 3 (15%) ‐ 5 (25%) 1 (20%)
+ 12 14 7 (50%) 11 (79%) 4 (29%) 12 (86%) 4 (33%)
18 1 ‐ ‐ ‐ ‐ ‐
* Due to the early removal events, age groups are based on time of sacrifice
10.1089/thy.2019.0284)
** Some mice had more than one cancer type
Thyroid

Thyroid
10.1089/thy.2019.0284)

‐
+
n
Goitroge
Total
8
2
10
PTC only

0
4
4
only
PDTC
4
7
11
PDTC
PTC &
2
1
ATC
PTC &
Cancer type
3
3
ATC
PDTC &
Table 2. Thyroid cancer types in all age groups of STRN‐ALK;p53KO mice
3
0
3
ATC
PTC & PDTC &
32
Page 32 of 41
Page 33 of 41

33
FIGURE LEGENDS

Figure 1. STRN‐ALK;p53KO mice generation and validation of the genotypes. (A) Simplified
overview of mouse breeding and scheme of transgenic alleles and their interaction
resulting in the STRN‐ALK;p53KO phenotype. tpTg, transgenic thyroglobulin promoter; Cre
encodes transgenic Cre recombinase; Luc‐tdT encodes transgenic fusion protein of
Luciferase (not measured in this study) and tdTomato (red fluorescence was used for
10.1089/thy.2019.0284)
detection of lung metastases during dissection) ; T2A, “self‐cleaving” peptide sequence;
HA‐STRN‐ALK encodes transgenic HA‐tagged STRN‐ALK; epTrp53, endogenous Trp53
Thyroid
promoter; Trp53 encodes endogenous TRP53 (p53). (B) Representative results of multiplex
PCR used for verification of the genotypes during the generation of experimental mice. (C)
PCR confirmation of thyroid‐specific deletion of exons 2‐10 in Trp53loxP alleles in STRN‐
ALK;p53KO mice.

Page 34 of 41

34
10.1089/thy.2019.0284)
Thyroid
Figure 2. Ultrasonographic monitoring, survival and tumor phenotype of STRN‐ALK;p53KO
mice. (A) Ultrasonography‐based follow up of tumor development and progression. PTC,
papillary thyroid carcinoma; PDTC, poorly differentiated thyroid carcinoma. (A and B)
Correlation of ultrasonographic patterns with histopathological findings. The area of PDTC
shows marked hypoechogenicity compared to PTC. (B) Representative microscopic H&E
images showing the co‐occurrence of PTC and PDTC in the same thyroid lobe. (C)
Representative microscopic H&E images of extrathyroidal extension (ETE) into the larynx,
tracheal (TI) and vascular invasion (VI). (D) Representative gross‐necropsy image showing
cervical tumor mass, dislocation of the trachea (black arrow) and red fluorescence (from
tdTomato encoded by same transgenic allele as HA‐STRN‐ALK) of the primary tumor and
lung metastases (white arrows). (E) Representative image of PDTC lung metastases
positive for thyroglobulin (TG) and HA‐tagged STRN‐ALK (HA).

Thyroid
10.1089/thy.2019.0284)

Page 35 of 41
differentiated thyroid carcinoma; ATC, anaplastic thyroid carcinoma.

Figure 3. Histological and immunohistochemical features of different stages of thyroid
thyroid carcinoma; hvPTC, hobnail variant of papillary thyroid carcinoma; PDTC, poorly
cancer dedifferentiation seen in STRN‐ALK;p53KO mice. fvPTC, follicular variant of papillary
35
Page 36 of 41

36
10.1089/thy.2019.0284)
Thyroid
Figure 4. Ultrasonographic, microscopic and immunohistochemical features of poorly
differentiated thyroid carcinoma type 1 (PDTC 1) and type 2 (PDTC 2) in STRN‐ALK;p53KO
mice. (A) Ultrasonographic image of the thyroid gland with PDTC type 1 and (B)
subsequent appearance of PDTC type 2 nodule within one month. (B and C) Correlation
between ultrasonographic and histological appearances of PDTC1 and PDTC2. Type 2 PDTC
with more solid morphology shows lower echogenicity compared to type 1 PDTC. (D)
Representative microscopic H&E images showing histological differences between type 1
and type 2 of PDTCs. High‐power inserts represent differences in nuclear‐to‐cytoplasm
ratio and nuclear features between two types of PDTC. (E) Representative microscopic
H&E and immunohistochemistry images showing preserved expression of HA‐tagged
STRN‐ALK and thyroid differentiation marker TTF‐1 in both types of PDTC; and loss of
thyroglobulin and E‐cadherin immunoreactivities in PDTC2.
Page 37 of 41

37
10.1089/thy.2019.0284)

Thyroid
Figure 5. Distinct gene expression profiles of type 1 and type 2 PDTC tumors. (A) Principal
component analysis of whole‐transcriptome data obtained from type 1 PDTC (n=3), type 2
PDTC (n=3) and PTC (n=2) tumor samples and benign (regular diet (BnoG),n=2; goitrogen
(BG), n=2) thyroids. Each dot corresponds to a particular sample. PDTC1, poorly
differentiated thyroid carcinoma of type 1, PDTC2, poorly differentiated thyroid carcinoma
of type 2; PTC, papillary thyroid carcinoma. (B) Venn diagram showing differentially
expressed genes (absolute fold change >3, FDR p‐value of ≤0.05) in PDTC1 (n=3) and PDTC2
(n=3) compared to benign thyroids (n=4). (C), Cluster analysis and heatmap of 15 thyroid
differentiation genes expression in PDTC1 (n=3) and PDTC2 (n=3) tumor samples. (D), Box‐
plots showing relative expression of main thyroid differentiation genes in PDTC1 (n=5) and
PDTC2 (n=5) normalized to benign thyroids (regular diet, n=5; goitrogen, n=5) while
controlling for goitrogen treatment. Data presented as % of corresponding gene
expression in benign thyroid tissues. Boxes represent 25th‐75th percentiles; Whiskers
represent maximum and minimum values. *, P‐value <0.05, **, P‐value <0.005, Mann‐
Whitney test.
Thyroid
10.1089/thy.2019.0284)

ALK;p53KO mice. Thickness of arrows represents number of cases.

Figure 6. Putative scheme of progression and dedifferentiation of thyroid cancer in STRN‐
38
Page 38 of 41
Page 39 of 41

39
Supplementary Table S1. Primers used in the study

Primers used for genotyping
Allele Primer ID Primer sequence, 5'‐3' Product, bp
F_Luc CAGTCGTCGTGCTGGAACA
Tg‐Luc‐tdT‐STRN‐ALK 144
R_Luc CAACTTGCCGGTCAGTCCTT
Wild type Trp53 and F_int1_p53 GGTTAAACCCAGCTTGACCA wt Trp53 ‐270;
transgenic Trp53Loxp R_int1_p53 GGAGGCAGAGACAGTTGGAG Trp53Loxp ‐390

F_Cre AGTCCCTCACATCCTCAGGTT
Tg‐Cre 450
R_Cre ATGCCAACCTCACATTTCTTG

Primers used for confirmation of thyroid‐specific deletion of ex2‐ex10 of Trp53Loxp
Allele Primer ID Primer sequence, 5'‐3' Product, bp
10.1089/thy.2019.0284)
F_int1_p53 GGTTAAACCCAGCTTGACCA Intact Trp53LoxP ‐

Thyroid
R_int1_p53 GGAGGCAGAGACAGTTGGAG 390; ex2‐10

Trp53Loxp
deleted Trp53LoxP
R_int10_p53 GAAGACAGAAAAGGGGAGGG
‐ 612

Primers used for qRT‐PCR
Gene Primer ID Primer sequence, 5'‐3' Product, bp
Tg_F TGGATACTGAAGGCCAGGTT
Tg 103
Tg_R CCAAGGAAAGCTTGTTCAGC
Slc5a5_F GCTCAGTCTCGCTCAAAACC
Slc5a5(Nis) 166
Slc5a5_R CGTGTGACAGGCCACATAAC
Tpo_F CCACAGAGCACTAGCACAGC
Tpo 128
Tpo_R GTAGAAAGGCAGGCATGCAG
Duox2_F GGACAGCATGCTTCCAACAAGT
Duox2 222
Duox2_R GCCTGATAAACACCGTCAGCA
Duox1_F CCCCCGACACCTTAGTAACA
Duox1 131
Duox1_R AGCCTGGTGTTTCCACACTC
Thyroid
10.1089/thy.2019.0284)

Actb
Tshr
Pax8
Foxe1
Nkx2.1(Ttf‐1)

Tshr_F
Tshr_R
Actb_F
Actb_R
Pax8_F
Pax8_R
Foxe1_F
Foxe1_R
Nkx2.1_F
Nkx2.1_R
GGATGCTGCCAGTCTCGTA
CTCTCTTACCCGAGCCACTG
AACCTCACCCTCAACGACTG
CAAGCGCATCTCACGTCTCA
GCTTTCGAACATGTCCTCGG
GGACCCCTCAAGATGTTCAC
GTCAACGCATTGTGGACTTG
TCCAGCCTATCCCATCTGAACT
CTGAACCCTAAGGCCAACCGTG
GGCATACAGGGACAGCACAGCC
101
108
117
103
130
40
Page 40 of 41
Page 41 of 41

41
Supplementary Table S2. Primary antibodies used in the study

Catalog
Antibody Host Dilution Manufacture
number
Cell Signaling, Danvers, MA,
anti‐HA‐Tag Rabbit 1:400 #3724
USA
anti‐TTF‐1 Rabbit 1:500 ab13706 Abcam, Cambridge, MA, USA

Proteintech, Rosemont, IL,
anti‐PAX8 Rabbit 1:500 10336‐1‐AP
USA
Dako, Agilent Technologies,
anti‐Thyroglobulin Rabbit 1:3000 A251
Santa Clara, CA, USA
anti‐CK17/19 Rabbit 1:300 #3184
USA
10.1089/thy.2019.0284)
anti‐E‐cadherin Rabbit 1:200 #3195
Thyroid
USA
anti‐Vimentin Rabbit 1:50 #5741
USA
Thermo Fisher Scientific,
anti‐Ki‐67 Rabbit 1:100 RM‐9106
Waltham, MA, USA

Nikitski 2019

Încărcat de

Informații document

Titlu original

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

Nikitski 2019

Încărcat de

Drepturi de autor:

Formate disponibile

Thyroid

thyroid carcinoma. Treatment outcome and prognostic factors. Cancer 103:1330‐

2016 Changes of Clinicopathologic Characteristics and Survival Outcomes of

Recurrence and Survival After Gross Total Removal of Resectable Undifferentiated

Pacini F 2000 N‐ras mutation in poorly differentiated thyroid carcinomas:

anaplastic and poorly differentiated thyroid cancer: A single institute experience.

results in anaplastic thyroid carcinomas faithfully recapitulating human tumors.

Fujimori K, Yamada H 2016 Histopathological analysis of anaplastic thyroid

Thyroid Carcinoma: Clinicopathologic and Molecular Evidence of Progression to

2011 Thyrotrophin receptor signaling dependence of Braf‐induced thyroid tumor

18 7 5 (71%) 2 (29%) 1 (14%) 5 (71%) 2 (40%)

Allele Primer ID Primer sequence, 5'‐3' Product, bp

transgenic Trp53Loxp R_int1_p53 GGAGGCAGAGACAGTTGGAG Trp53Loxp ‐390

F_int1_p53 GGTTAAACCCAGCTTGACCA Intact Trp53LoxP ‐

R_int1_p53 GGAGGCAGAGACAGTTGGAG 390; ex2‐10

anti‐TTF‐1 Rabbit 1:500 ab13706 Abcam, Cambridge, MA, USA

S-ar putea să vă placă și