Sunteți pe pagina 1din 43

i

ii
AGRADECIMIENTOS

AL INSTITUTO NACIONAL DE INVESTIGACIONES FORESTALES, AGRÍCOLAS Y


PECUARIAS (INIFAP), CAMPO EXPERIMENTAL ZACATEPEC, MORELOS

POR EL FINANCIAMIENTO DE LA PRESENTE TESIS DE INVESTIGACIÓN, LA CUAL


FORMA PARTE DEL

PROYECTO:

“IDENTIFICACIÓN DE RESISTENCIA A POKKA BOENG (Fusarium spp.) Y CARBÓN


(Ustilago scitaminea) EN VARIEDADES DE CAÑA DE AZÚCAR”

FONDOS FISCALES 2012, NÚMERO 15422020477:

iii
AGRADECIMIENTOS

A mi alma mater la Universidad Autónoma Chapingo y al

Departamento de Parasitología Agrícola por brindarme la

oportunidad de cursar mis estudios de preparatoria y licenciatura bajo

su modelo educativo.

Al jurado examinador del presente trabajo por su tiempo y atención:

Dra. Marianguadalupe Hernández Arenas, Dr. Santos Gerardo Leyva

Mir, Dr. Cristian Nava Díaz, Dr. Guillermo Mondragón Pedrero y

especialmente al M.C. Juan Manuel Tovar Pedraza por todo su apoyo

y consejos.

A mis amigas Angelina Olvera Julio y Veronica Ruiz Machuca, por

su invaluable amistad y por el tiempo y experiencias compartidos.

A mi pareja Hernán Cortés Gómez por todos estos años de apoyo.

iv
DEDICATORIA

Para la familia Rosas Guevara. A mi padre Santiago Rosas Vázquez; en

especial a mi madre Clara Guevara Martínez por su apoyo

incondicional; y a mis hermanos Santiago, Alejandro y Guadalupe

por su apoyo para que yo pudiera concluir este proyecto de vida.

Para mi pareja Hernán Cortés Gómez por su tiempo, apoyo y

comprensión que me ha brindado siempre.

v
ÍNDICE GENERAL

ÍNDICE GENERAL .................................................................................................. 1


ÍNDICE DE CUADROS ........................................................................................... 2
ÍNDICE DE FIGURAS ............................................................................................. 2
RESUMEN .............................................................................................................. 3
ABSTRACT............................................................................................................. 4
I. INTRODUCCIÓN .............................................................................................. 5
II. REVISIÓN DE LITERATURA ........................................................................... 6
2.1. IMPORTANCIA DE LA CAÑA DE AZÚCAR EN EL MUNDO ........................................ 6
2.2. IMPORTANCIA DE LA CAÑA DE AZÚCAR EN MÉXICO ........................................... 7
2.3. ENFERMEDADES FUNGOSAS EN CAÑA DE AZÚCAR ............................................ 9
2.3.1. Carbón (Sporisorium scitamineum Sydow) ............................................. 9
2.3.2. Roya común (Puccinia melanocephala Syd. & P. Syd)......................... 11
2.3.3. Roya naranja [Puccinia kuehnii (W. Krüger) E.J. Butler] ....................... 12
2.3.4. Pudrición roja de la nervadura (Colletotrichum falcatum Went) ............ 13
2.3.5. Pokkah-boeng o cogollo retorcido ..................................................... 14
2.3.5.1. Historia ........................................................................................... 15
2.3.5.2. Síntomas ........................................................................................ 15
2.3.5.3. Agente causal ................................................................................. 17
2.3.5.3.1. Fusarium verticillioides ............................................................. 17
2.3.5.3.2. Fusarium subglutinans ............................................................. 17
2.3.6. Manejo de Pokkah-boeng .................................................................. 18
III. MATERIALES Y MÉTODOS .......................................................................... 18
3.1. COLECTA DE MUESTRAS ................................................................................. 18
3.2. AISLAMIENTO DE HONGOS ............................................................................... 19
3.3. ALMACENAMIENTO DE AISLADOS ..................................................................... 20
3.4. CARACTERIZACIÓN CULTURAL ......................................................................... 20
3.5. CARACTERIZACIÓN MORFOLÓGICA ................................................................... 21
3.6. CARACTERIZACIÓN MOLECULAR ...................................................................... 22
IV. RESULTADOS Y DISCUSIÓN.................................................................... 23
4.1. CARACTERIZACIÓN CULTURAL Y MORFOLÓGICA ............................................. 23
4.2. CARACTERIZACIÓN MOLECULAR ................................................................... 26
4.3. ESPECIES DE FUSARIUM SPP. PRESENTES EN LAS REGIONES PRODUCTORAS DE
CAÑA DE AZÚCAR EN MÉXICO ................................................................................. 27

V. CONCLUSIONES........................................................................................ 31
LITERATURA CITADA ......................................................................................... 33

1
ÍNDICE DE CUADROS

Página

Cuadro 1. Superficie sembrada y rendimiento de caña de azúcar en los principales


estados productores en México durante el 2012…………………........................5

Cuadro2. Relación de colectas de Fusarium spp. en los estados de Veracruz,


Morelos, Oaxaca y Puebla (2012). ……………………………………………………..5

Cuadro 3. Incidencia de especies de Fusarium spp. en Veracruz, Morelos, Oaxaca


y Puebla…………………………………………………………………………………..28

ÍNDICE DE FIGURAS

Figura 1. Síntomas de Pokkah-boeng………………………………………...….......14

Figura 2. Fusarium proliferatum………………………….….…………………......….22

Figura 3. Fusarium verticillioides………….…………..………………………….……23

Figura 4. Dendrograma generado utilizando el análisis UPGMA……………........24

2
Caracterización cultural, morfológica y molecular de aislados de Fusarium
spp. asociados a caña de azúcar en México.

RESUMEN
V.R. Guevara ; M.G. Hernández-Arenas2; S.G. Leyva Mir3
1

Con el objetivo de identificar las especies y genotipos de Fusarium spp. presentes

en zonas cañeras de México, se analizaron un total de 70 aislados de Fusarium

spp. procedentes de Veracruz, Morelos, Oaxaca y Puebla. Trozos de tejido

enfermo fueron lavados y desinfectados con NaClO al 3% por 3 min, sembrados

en PDA e incubados a 25±1°C. La caracterización morfológica y cultural de los

monospóricos se realizó en PDA y CLA. Se realizó la extracción de ADN y

amplificación de los ITS1 e ITS4 por PCR; el producto amplificado se purifico y

secuencio en Macrogen (Corea). Las secuencias fueron comparadas con la base

de datos del National Center for Biotechnology Information (NCBI), después se

alinearon con ClustalW del programa Mega5. Para el dendrograma se utilizaron

secuencias de F. commune y la matriz de datos alineada se agrupó utilizando el

análisis estadístico UPGMA. Las especies identificadas a nivel morfológico y

molecular fueron Fusarium proliferatum (Teleomorfo: Gibberella intermedia) y

Fusarium verticillioides (Teleomorfo: Gibberella moniliformis) siendo F. proliferatum

la especie más frecuentemente aislada (95.7%). Existe una amplia variabilidad en

síntomas y comportamiento morfológico de las colonias provenientes de Morelos,

Oaxaca, Puebla y Veracruz.

Palabras clave: Pokkah-boeng, caña de azúcar, Fusarium proliferatum, Fusarium

verticillioides, México.

3
Cultural characterization, morphological and molecular isolates of Fusarium
spp. associated with sugarcane in Mexico.

ABSTRACT
V.R. Guevara ; M.G. Hernández-Arenas2; S.G. Leyva Mir3
1

With the objective of identifying the species and genotypes of Fusarium spp.

present in sugarcane areas of Mexico, analyzed a total of 70 isolates of Fusarium

spp. from Veracruz, Morelos, Oaxaca and Puebla. Pieces of diseased tissue

washed and disinfected with 3% NaClO for 3 min, were planted on PDA and

incubated at 25 ± 1 ° C. The morphological and cultural monosporic held in PDA

and CLA. Extraction was performed and DNA amplification by PCR ITS1 and ITS4

primers, the amplified product was purified and sequenced in Macrogen (Korea).

The sequences were compared with the database of the National Center for

Biotechnology Information (NCBI), after aligned with the ClustalW of the program

Mega5. For dendrogram used sequences of F. commune and aligned data matrix

was pooled using UPGMA statistical analysis. The species identified morphological

and molecular level were Fusarium proliferatum (Teleomorph: Gibberella

intermedia) and Fusarium verticillioides (Teleomorph: Gibberella moniliformis)

being F. proliferatum the most frequently isolated species (95.7%). There is a wide

variability in symptoms and morphological behavior of the colonies from Morelos,

Oaxaca, Puebla and Veracruz.

Key words: Pokkah-boeng, sugarcane, Fusarium proliferatum, Fusarium


verticillioides, Mexico.

4
I. INTRODUCCIÓN

En México, la industria azucarera es una de las más importantes, debido a su

relevancia económica y social en el campo. Actualmente, genera más de dos

millones de empleos, tanto en forma directa como indirecta y se desarrolla en 15

entidades federativas y 227 municipios con un valor de la producción de 30 mil

millones de pesos (SAGARPA, 2013).

Hasta el año 2008, la producción de caña de azúcar presentó una tendencia

ascendente, que se interrumpió en la zafra 2008/2009 debido, entre otros, a los

siguientes factores:

 Clima: principalmente menor cantidad de lluvia en la mayor parte del país,

en la época de maduración de la caña.

 Precios: el uso de fertilizantes se encareció sobre todo en los meses de

junio y julio de 2008.

 Envejecimiento del campo cañero: debido a que el rejuvenecimiento del

campo se ubicó en promedio en 12‐13%, siendo el óptimo un 20% anual.

En caña de azúcar, como en otros cultivos, las enfermedades representan

factores limitantes a la producción. Las enfermedades deben ser oportuna y

eficientemente identificadas y diagnosticadas para su eficiente control (Chavarría,

2006).

Entre las enfermedades foliares, el Pokkah-boeng o cogollo retorcido causado por

el hongo Fusarium verticillIioides y/o Fusarium subglutinans es una de las más

5
frecuentes enfermedades y está prácticamente en todas las áreas productoras de

caña de azúcar del mundo (Raid, 2012). Puede causar graves pérdidas en

variedades comerciales susceptibles con un rango de incidencia que oscila del 1-

90% (Vishwakarma et al. 2013).

Las variedades de caña de azúcar utilizadas en México no han mostrado

tolerancia a ésta enfermedad que adquiere cada vez más importancia en nuestro

país debido a los daños ocasionados.

Es por ello que los objetivos del presente trabajo fueron los siguientes:

1) Aislar e identificar las especies de Fusarium spp. presentes en las principales

zonas productoras de caña de azúcar de Veracruz, Morelos, Oaxaca y Puebla.

2) Caracterizar cultural, morfológica y molecularmente los aislados de Fusarium

spp. presentes.

3) Analizar la relación filogenética existente entre especies de aislados de

Fusarium spp. identificados.

II. REVISIÓN DE LITERATURA

2.1. Importancia de la caña de azúcar en el mundo

La caña de azúcar es un cultivo cuyo centro de origen es Nueva Guinea, desde

donde se esparció a Asia, a las islas del Pacífico y posteriormente al resto del

mundo. A fines del siglo XV fue traída a América por Cristóbal Colón (Rosas et al.

2010).

6
La caña de azúcar que trajo Colón en 1493 a La Hispañola (ahora República

Dominicana), y que después Cortés introdujo a Santiago Tuxtla, Veracruz en

1523-24, fue conocida durante varios siglos como “caña criolla”, la misma que

Linneo clasificó por primera vez con el nombre de Saccharum officinarum en 1753

(Flores, 2001). Su expansión por el territorio mexicano puede explicarse no solo

por haber encontrado condiciones favorables de clima, suelo y ambiente, sino

también por un incremento sostenido en la demanda por parte de los colonos, que

alentó sustancialmente el crecimiento de la producción (Rodríguez, 1994).

Actualmente los principales países productores de esta gramínea son Brasil con

una producción de 670,757, 958 millones de ton de caña de azúcar; en segundo

lugar está la India con 347, 870 millones de ton; le sigue China con 124, 170, 500

millones de ton; Tailandia con 96,500 millones de ton; Pakistán con 58,038

millones de ton y México ocupa el sexto lugar con 50, 946, 483 millones de ton

(FAOSTAT, 2013).

2.2. Importancia de la caña de azúcar en México

En México la industria azucarera es históricamente una de las más importantes,

debido a su relevancia económica y social en el campo; genera más de dos

millones de empleos, tanto en forma directa como indirecta; se desarrolla en 15

entidades federativas (Cuadro 1) y 227 municipios con un valor de la producción

de 30 mil millones de pesos (SAGARPA, 2013).

Cuadro 1. Superficie sembrada y rendimiento de caña de azúcar en los principales

estados productores en México durante el 2012.

7
Estado Superficie sembrada Total nacional (%) Rendimiento
(miles de Ha) (ton ha -1)
Veracruz 279,944 34.98 64.3
Jalisco 79,591 9.94 97.9
San Luis Potosí 72,568 9.06 66.5
Oaxaca 70,593 8.82 69.3
Tamaulipas 61,825 7.72 57.1
Tabasco 36,960 4.61 33.0
Nayarit 34,739 4.34 78.4
Chiapas 30,962 3.86 90.5
Quintana Roo 30,141 3.76 59.8
Sinaloa 24,706 3.08 81.0
Puebla 18,474 2.30 123.7
Morelos 16,974 2.12 117.7
Colima 16,431 2.05 90.0
Michoacán 13,971 1.74 79.9
Campeche 12,337 0.015 No hay dato*
TOTAL 53,347.7 73.98
*Situación al 31 de diciembre de 2012.
Fuente: SIAP (2013)

Veracruz a pesar de ser el principal productor de caña de azúcar obtiene

rendimientos de 64.3 ton ha -1 valor que está por debajo del rendimiento promedio

nacional (SIAP, 2013).

La producción de caña de azúcar mostró una tendencia ascendente que se

interrumpió en la zafra 2008/2009, debido a factores climáticos, encarecimiento de

insumos agrícolas aunado al envejecimiento del campo cañero. En los últimos

años, nuevamente se observa una tendencia ascendente. En la zafra nacional

2011/2012 se industrializó un total de 703, 761 ha con rendimiento promedio de


8
65.7 ton ha-1. Se obtuvo un total de 46, 231, 229 ton de caña que a su vez

produjeron 5, 048, 469 ton de azúcar (SAGARPA, 2013).

Entre las acciones que propone la SAGARPA (2013) para incrementar la

producción nacional de caña de azúcar se menciona, entre otras, la investigación

y generación de nuevas variedades así como el fomento a la sanidad.

2.3. Enfermedades fungosas en caña de azúcar

El cultivo de la caña de azúcar, a nivel mundial, es afectado por diversas

enfermedades causadas por hongos, entre las que destacan: la roya común

(Puccinia melanocephala Sydow), la roya naranja [Puccinia kuehnii (W. Krüger)

E.J. Butler], la pudrición roja de la nervadura (Colletotrichum falcatum Went), el

carbón (Sporisorium scitamineum Sydow) y el Pokkah-boeng (Fusarium

verticillioides, Sheldon) (Ramírez y Nass, 2005).

2.3.1. Carbón (Sporisorium scitamineum Sydow)

El carbón de la caña de azúcar se observó por primera vez en Sudáfrica en 1877.

Esta enfermedad es causada por el hongo Sporisorium scitamineum (Syd.) (sin.

Ustilago scitaminea Sydow & P. Sydow) y ha mostrado suma importancia en casi

todos los países productores de caña de azúcar. Excepto en Australia donde la

enfermedad solo está presente en una zona de producción menor en el oeste de

éste país (Comstock y Lentini, 2005).

El síntoma más reconocible de una planta infectada por carbón es la aparición de

un "látigo de carbón” que es una curva de crecimiento, del grosor de un lápiz,

9
color gris a negro que se desprende de la parte superior de la planta de caña

afectada. Estos "látigos" surgen de la yema terminal o de brotes laterales en los

tallos infectados. Pueden variar en longitud desde unos pocos centímetros a varios

metros de largo. Se compone en parte del tejido de la planta huésped y en parte

del tejido del hongo y comienza a emerger a partir de caña infectada de 2-4 meses

de edad, el crecimiento máximo se produce en el sexto o séptimo mes. Otros

síntomas del carbón pueden ser evidentes antes de ver el látigo característico. Por

ejemplo, las nervaduras de las hojas son erectas antes de que surja el látigo, las

plantas afectadas pueden generar gran cantidad de brotes más delgados y erectos

con pequeñas hojas estrechas. Las plantas que crecen en condiciones de estrés

son más propensas a desarrollar el carbón. El clima seco y caluroso de primavera

favorece la enfermedad (Comstock y Lentini, 2005).

El uso de variedades resistentes es la mejor forma de control del carbón de la

caña. También se debe cuidar el uso de semilla libre de la enfermedad, la cual se

consigue sometiendo la semilla a tratamiento hidrotérmico. Sin embargo, puede

resultar no practico a gran escala y su eficacia depende de la variedad (Comstock

y Lentini, 2005).

En el programa de mejoramiento genético de caña de azúcar en México, los

genotipos susceptibles son eliminados, ya que no existe un método de control

eficiente una vez que se ha presentado la enfermedad en las plantaciones

comerciales.

10
2.3.2. Roya común (Puccinia melanocephala Syd. & P. Syd)

El primer brote grave de la roya común de la caña de azúcar causada por Puccinia

melanocephala Syd. & P. Syd. se reportó en la India en 1907. Se informó por

primera vez en Sudáfrica en 1941 en la variedad Co301 y ahora está presente en

casi todas las áreas cañeras del mundo (Ramouthar, 2009). En Sudáfrica ahora

se describe como una enfermedad importante de la caña de azúcar, causando

pérdidas de rendimiento de hasta 26% en las variedades susceptibles

(Ramouthar, 2009).

Las condiciones optimas para la germinación y el desarrollo de las urediniosporas

del hongo son: humedad relativa mayor al 98 %, entre 20 y 25 °C de temperatura

y nueve horas de humedad de roció (Ramouthar, 2009).

Los primeros síntomas de la infección por roya común son pequeñas y alargadas

manchas amarillas visibles en ambos lados de las hojas. Las manchas se vuelven

de color marrón rojizo en las variedades susceptibles en un periodo de 3-4 días,

se alargan y al plazo de 10-14 días se convierten en pústulas maduras. Los

síntomas característicos son pústulas café rojizas presentes en la superficie

abaxial de las hojas, las cuales miden de 2-20 mm de largo por 1-3 mm de ancho

distribuidas de forma paralela a los haces vasculares. En hojas severamente

infectadas las pústulas coalescen y llegan a formar áreas necróticas. (Raid y

Sullivan, 2000).

Actualmente, el método más fiable y económico para el control de la roya común

es el uso de variedades resistentes (Ramouthar, 2009).

11
2.3.3. Roya naranja [Puccinia kuehnii (W. Krüger) E.J. Butler]

La roya de la caña de azúcar (Saccharum spp. híbrida), causada por Puccinia

kuehnii [(W. Krüger) E.J. Butler], es una enfermedad relativamente nueva en el

hemisferio occidental que reduce considerablemente los rendimientos en los

genotipos de caña de azúcar susceptibles (Zhao et al. 2011).

Los primeros síntomas son manchas amarillentas pequeñas y alargadas en el haz

y envés de la lámina foliar. A medida que crecen se vuelven de color marrón a

pardo anaranjado o rojo-marrón, y desarrollan un tenue, pero definido, halo

clorótico. Miden entre 2 y 10 mm de longitud, pero en ocasiones alcanzar los 30

mm. Rara vez son de más de 1-3 mm de ancho. Los síntomas se observan hacia

la parte apical de la hoja. Las pústulas, que producen esporas, por lo general se

desarrollan en el envés de la hoja. Ciertos cultivares, sin embargo, pueden tener

algunas pústulas en la superficie superior (Raid y Comstock, 2006).

Las urediniosporas de P. kuehnii tienen engrosamiento apical, son más pálidas

en color y generalmente con pocas paráfisis y presenta escasas teliosporas. Las

urediniosporas de P. melanocephala son más pequeñas, de coloración marrón,

poros más prominentes sin engrosamiento apical, abundantes paráfisis y

teliosporas. Las características de la superficie de la urediniosporas también son

diferentes, las de P. melanocephala presentan espinas distanciadas entre si de

1,0-1,5 de forma regular, mientras que las de P. kuehnii son más espaciadas y

distribuidas de manera irregular (Magarey, 2000).

12
Aunque una serie de productos químicos están registrados para el control de

enfermedades foliares en la caña de azúcar no es rentable su uso. El mejor

método para el control de la roya de la caña es cultivar variedades resistentes. Sin

embargo, la resistencia no ha sido estable o duradera en ciertas variedades,

presumiblemente a causa de las variantes de óxido (Raid y Comstock, 2006).

2.3.4. Pudrición roja de la nervadura (Colletotrichum falcatum Went)

Colletotrichum falcatum Went, puede atacar cualquier parte de la planta de caña

de azúcar, ya sea tallo, hojas, brotes y raíces. Completa su ciclo de vida en la hoja

de la caña de azúcar y por lo general no representa una amenaza grave. La fase

más perjudicial de esta enfermedad se produce cuando el patógeno ataca el tallo

ya que dependiendo de la edad de éste, el momento de la infección y la

susceptibilidad del genotipo de caña, es que produce diferentes tipos de síntomas

(Duttamajumder, 2008).

Los síntomas típicos en el tallo son manchas blancas en contraste con áreas

necróticas (rojo oscuro). Tejidos internodales y nodales necróticos aparecen

cuando el cultivo está en la etapa final del ciclo productivo. En las primeras etapas

de la infección, es difícil reconocer la presencia de la enfermedad en el campo, ya

que la planta no muestra ningún síntoma. En una etapa posterior, coloración

oscura en la corteza del tallo a menudo se hace evidente cuando los tejidos

internos se han visto gravemente dañados y están totalmente podridos. Esto es

más pronunciado en el tallo de genotipos de color claro. Al final, los tallos o la

13
planta afectada mueren. En la plantación se puede observar en manchones o el

daño total (Duttamajumder, 2008).

Los esquejes usados como semilla pueden portar el patógeno que se va a

desarrollar dependiendo de las condiciones ambientales. Esto afecta a la

germinación y el establecimiento inicial del cultivo. El tipo de los síntomas varía

dependiendo de las condiciones meteorológicas imperantes (Duttamajumder,

2008).

El uso de variedades resistentes es el método más eficaz para la prevención y

control. Los factores que determinan la resistencia a la pudrición roja no se

entienden completamente. Hay dos tipos de la resistencia: (1) morfológica, lo que

puede prevenir o retardar el proceso de infección, y (2) fisiológica, en el que las

células vivas de la planta de suprimir o prevenir patógeno crecimiento. La

incidencia de la pudrición roja de la nervadura puede reducirse a través de las

buenas prácticas culturales, como la compensación de campos de exceso de

basura y drenaje eficiente (Raid, 2006).

2.3.5. Pokkah-boeng o cogollo retorcido

Entre las enfermedades foliares, el Pokkah-boeng o cogollo retorcido causado por

el hongo Fusarium verticilloides y/o Fusarium subglutinans está presente en la

mayoría, sino en todas, las áreas productoras de caña de azúcar del mundo (Raid,

2012) y puede causar graves pérdidas en variedades comerciales susceptibles

con un rango de incidencia del 1-90% (Vishwakarma et al. 2013).

14
2.3.5.1. Historia

El Pokkah-boeng fue descrito originalmente en Java, India y es un término

Javanese que significa malformación o distorsión del cogollo (Raid, 2012). Se

reportó por primera vez en Java por Walker en 1886 y más tarde por Edgerton en

1955 y por Martin y colaboradores en 1961(VSI, 2013).

El Pokkah-boeng se convirtió en una enfermedad importante de caña de azúcar en

Java con la propagación de la variedad comercial POJ 2878 y se investigó

extensamente en ese país por Bolle durante 1927-1937 (VSI, 2013).

2.3.5.2. Síntomas

Los primeros síntomas de la enfermedad son áreas cloróticas en la base de las

hojas jóvenes (Figura 1A), distorsión (arrugamiento y enrollamiento) (Figura 1C) y

acortamiento de las hojas afectadas (Figura 1B), y en casos severos, muerte del

tallo (Whittle y Irawan, 2000; Raid, 2012).

La base de las hojas afectadas es frecuentemente mas estrecha que la de las

hojas sanas (Figura 1A). En las hojas maduras, dentro de las partes cloróticas, se

desarrollan manchas y líneas irregulares rojizas. En las áreas rojizas a veces se

desarrollan orificios que no tienen arreglo definido. Este tejido rojizo puede formar

lesiones “escalera”, frecuentemente con cortes oscuros. Las nervaduras de las

hojas también pueden llegar a estar cloróticas y desarrollar áreas irregulares

necróticas de color rojizo (Whittle y Irawan, 2000; Raid, 2012).

15
En ocasiones la infección del cogollo desciende dentro del tallo con líneas café

rojizas y se pueden encontrar largas y severas depresiones en los entrenudos

mezcladas con lesiones que dan la apariencia de corte de cuchillo. Estas lesiones

a veces atraviesan la corteza causando curvatura y distorsión del tallo. En la

mayoría de etapas avanzadas del Pokkah-boeng el cogollo (punto de crecimiento)

de las plantas muere (referido como “pudrición de punta”) (Figura 1C). La

severidad de los síntomas varía de acuerdo a la susceptibilidad de la variedad y

a las condiciones ambientales que determinan el desarrollo del patógeno (Whittle y

Irawan, 2000; Raid, 2012).

Figura 1. Síntomas de Pokkah-boeng. A) área cloróticas en base de hojas jóvenes y base


estrecha; B) acortamiento de las hojas afectadas; y C) distorsión (arrugamiento y enrollamiento)
de hojas afectadas y “pudrición de punta”.

16
2.3.5.3. Agente causal

López et al. (1998) y Raid (2012) reportaron a Fusarium verticillioides (Nirenberg)

[sin. F. moniliforme (Shledon)] y a Fusarium subglutinans ( sin. F. moniliforme

var. subglutinans) en Cuba y Florida, EE. UU., respectivamente, como los

causantes de esta enfermedad y López y López (2000) reportaron a F.

verticillioides como la especie más frecuentemente aislada en Cuba.

2.3.5.3.1. Fusarium verticillioides

Fusarium verticillioides en un hongo ampliamente distribuido cuyo estado

teleomorfico corresponde a la especie Gibberella fujikuroi ( Leslie y Summerell,

2006). Es de gran importancia económica, pues entre sus hospedantes comunes

figuran maíz, arroz, caña de azúcar, esparrago y plátano, a los que ocasiona

ahogamiento, pudriciones y otras anormalidades. En maíz es bien conocida la

pudrición del tallo y mazorca, en caña de azúcar induce la pudrición del tallo o

Pokkah-boeng y en arroz la enfermedad de Bakanae o gigantismo, provocado por

la giberelina que en esta planta produce F. verticillioides (Romero, 1993) y en

espárrago produce la pudrición de la corona (Leslie y Summerell, 2006).

2.3.5.3.2. Fusarium subglutinans

Fusarium subglutinans cuyo estado teleomorfico es Gibberella fujikuroi es más

común en las zonas frías donde el maíz se cultiva y se asocia a la pudrición del

tallo y podredumbre de la mazorca de maíz y puede ser transmitido por semilla.

Este patógeno puede persistir en los residuos de maíz, ya sea en la superficie del

17
suelo o enterrados en un campo durante al menos 21 meses. Varias cepas

genéticamente distintas de F. subglutinans pueden ser recuperados a partir de una

sola planta de maíz (Leslie y Summerell, 2006).

2.3.6. Manejo de Pokkah-boeng

El desarrollo de variedades de caña de azúcar está relacionado con el hecho de

que la caña de azúcar es un monocultivo, que se mantiene sin rotación y sin

barbecho por muchos años lo que permite que las plagas y enfermedades se

adapten y por consiguiente, los daños a las plantaciones se acumulen. Así el

desarrollo de nuevas variedades permite aumentar la producción de sacarosa, y

enfrentar grandes desafíos como nuevas plagas y la pérdida de fertilidad de los

suelos (Rosas et al. 2010).

En el caso de Pokkah-boeng para el control químico se usa carbendazim al 0.1%

(1gramo por litro de agua); oxicloruro de cobre al 0.2% (2 gramos por litro de

agua); o mancozeb al 3% (3 gramos por litro de agua) para reducir la enfermedad

del Pokkah boeng (VSI, 2013). Sin embargo, la única medida de control eficiente

es el uso de variedades resistentes (Lyrene et al. 1977; Comstock y Lentini 2005;

Raid, 2012).

III. MATERIALES Y MÉTODOS

3.1. Colecta de muestras

18
En el periodo de enero a diciembre de 2012, se realizaron una serie de colectas

de hojas de caña de azúcar con síntomas de Pokkah-boeng en parcelas

comerciales establecidas en los estados de Veracruz, Morelos, Oaxaca y Puebla.

Cada punto de muestreo se geo-referenció con ayuda de un GPS (Garmin®, Etrex

Legend Hcx). Las muestras, se colocaron en bolsas de polietileno debidamente

etiquetadas para su fácil identificación y se transportaron en una hielera al

Laboratorio de Sanidad Vegetal del Instituto Nacional de Investigaciones

Forestales Agrícolas y Pecuarias (INIFAP) Campo Experimental Zacatepec en

Zacatepec, Morelos.

3.2. Aislamiento de hongos

A partir de tejidos de caña de azúcar con síntomas típicos de Pokkah-boeng se

cortaron trozos de la zona de transición entre tejido sano y enfermo. Los trozos se

lavaron y desinfestaron por inmersión en una solución de hipoclorito de sodio

(NaClO) al 3% por tres minutos y se enjuagaron con agua destilada estéril por el

mismo periodo de tiempo, tres veces consecutivas; finalmente se colocaron sobre

papel absorbente estéril para retirar el exceso de humedad. Posteriormente, se

colocó cinco trozos de tejido medio de cultivo papa-dextrosa-agar (PDA) y se

incubaron a 25±1°C.

Tres días después, los crecimientos de hongos se purificaron por la técnica de

punta de hifa en una nueva caja Petri con PDA, las cuales se incubaron a 25±1°C

hasta que se observó la presencia de macroconidios (10-15 días después).

19
Para la obtención de cultivos monospóricos se colocaron 10 mL de agua destilada

estéril en las cajas Petri con el hongo completamente desarrollado; se agitaron

ligeramente para facilitar el desprendimiento de los conidios y el líquido se extrajo

nuevamente con una pipeta Pasteur para depositarla en un tubo de ensaye de 100

mL. A partir de esta solución madre, se realizaron diluciones de 1:10 hasta obtener

una concentración de 1 x 103 conidios mL-1 contabilizando con una cámara de

Neubauer. Posteriormente, se depositó una gota de la última dilución en medio

PDA, distribuyéndola homogéneamente en la superficie con ayuda de una varilla

de vidrio, y se incubó a 25±1°C. A los tres días se seleccionó un conidio

individual germinado de cada aislado y se transfirió para su incremento a una caja

Petri con medio PDA manteniéndola en incubación.

3.3. Almacenamiento de aislados

Se obtuvieron 70 aislados monospóricos que fueron conservados al extraer los

conidios de los monospóricos con 10 ml de agua destilada estéril y depositarlos

en un tubo para centrifuga (EPPENDORF®, EE.UU.) de 5 mL y se almacenaron a

-20°C.

3.4. Caracterización cultural

La descripción cultural de los 70 aislados se realizó a partir de los cultivos

monospóricos de cada aislado en medio PDA, ya que este es el medio reportado

como el más adecuado para observar estas características según López y López,

(2004) y Leslie y Summerell (2006). Se incubaron a temperatura ambiente (26

°C±1 °C) por 30 días con alternancia de 12 horas luz/oscuridad natural. Se

20
evaluaron características de la colonia como son: crecimiento radial promedio por

día (cm /día) y pigmentación.

3.5. Caracterización morfológica

Para la observación y análisis de las características macroscópicas de Fusarium

spp., se empleó el medio CLA (Agar Hoja de Clavel) de acuerdo a la metodología

de López y López (2004) y Leslie y Summerell ( 2006) .

Para preparar el medio de cultivo CLA, se cortaron trozos de 5 mm 2 de hojas de

clavel, las cuales se empaquetaron en aluminio y se secaron en estufa a 70 °C±

1°C por 3 horas con 30 minutos. Una vez secas se enviaron al Instituto Nacional

de Investigaciones Nucleares (ININ) para esterilizar con irradiación gama (2.5

megarads).

Este medio se preparó de la siguiente forma: agua agar al 2% (20 gramos de agar

en 1000 mL de agua destilada estéril) y se colocaron de 10 a 12 piezas de hojas

de clavel estériles por caja Petri. Posteriormente, cada aislado monosporico, se

transfirió a una caja Petri con medio de cultivo CLA que se incubaron a

temperatura ambiente (26±1° C) por 20 días. Al vigésimo día se realizaron las

preparaciones para observar las variantes morfológicas correspondientes.

Preparaciones semipermanentes con lactofenol se prepararon para la

caracterización de conidios. En un microscopio compuesto (Nikon SMZ800®,

EE.UU) con cámara digital instalada y usando el objetivo de 40X, se tomaron

21
fotografías para realizar la caracterización cualitativa (forma) y cuantitativa (largo

por ancho) de 25 macroconidios y 25 microconidios de cada aislado.

3.6. Caracterización molecular

La extracción del DNA, se realizó a partir de micelio de colonias cultivadas en

medio PDA y con el uso del DNeasy Plant Mini Kit de QIAGEN ® de acuerdo al

protocolo sugerido por el fabricante. Mientras que, la amplificación de la región ITS

se realizó con el uso de los iniciadores ITS1 (secuencia 5”

TTCGTAGGTGAACCTGCG G3”) e ITS4 (secuencia 5”

GGAAGTAAAAGTCGTAACAAGG3”) mediante la reacción en cadena de la

polimerasa (PCR) utilizando un termociclador My Cycler termal cycler (BiO RAD®).

Múltiples reacciones se llevaron a cabo en un volumen final de 25 µl de mix de

reactivos PROMEGA®. Cada tubo contenía 5µl de buffer 1X, 1.5µl de MgCll de

MgCl2, 0.5µl de dNTP¨”S, 2 µl de ITS1, 2µl de ITS4, 0.2 µl de Taq polimerasa

(1U/µl), 11.8 µl de H2O y 2µl de ADN.

Las condiciones de amplificación consistieron en una desnaturalización de 95°C/5

min, seguida de 35 ciclos de 95°C/45 s, 57°C/45 s y 72° C/60 s, y una extensión

final de 72°C/5 min. Los productos de PCR se separaron por electroforesis en gel

de agarosa (2%) y se visualizó por tinción con bromuro de etidio.

El producto amplificado se purificó y secuenció en Macrogen (Corea). Las

secuencias se compararon con la base de datos del Centro Nacional de

Información sobre Biotecnología (National Center for Biotechnology Information)

NCBI. El análisis de las secuencias se llevo a cabo al alinearlas con ClustalW.

22
Para el dendrograma se utilizaron secuencias de F. commune y la matriz de datos

alineada se agrupó utilizando el análisis estadístico UPGMA en Mega5.

IV. RESULTADOS Y DISCUSIÓN

4.1. Caracterización cultural y morfológica

De los 70 aislados analizados en este estudio, 67 (95.7 %) presentaron colonias

con abundante micelio aéreo de blanco a purpura (Figuras 2A-D) y con

pigmentación variable desde blanco hasta rojo oscuro (Figuras 2E-H),

características que coincidieron con lo reportado por Leslie y Summerell, (2006)

para F. proliferatum en medio de cultivo PDA. El crecimiento micelial radial fue de

0.43-1.1 cm día-1 el cual fue un dato similar a lo que reportaron Jahan et al.

(2013) para el caso de F. proliferatum.

Con respecto al crecimiento de los 67 aislados en medio de cultivo CLA,

únicamente 20 (29.8 %) esporularon y formaron microconidios no septados

(Figura 2J) de 6.1-15.3×1.5-3.1µm en falsas cabezas (Figuras 2K y 2L);

macroconidios con célula apical curvada y célula basal en forma de pie, de 21.6-

60.1×1.8-4.6 µm, de 3-5 septos transversales (Fig.2I); clamidosporas ausentes.

Los datos anteriores coincidieron con los descritos por Pavlovic et al. (2009) para

el caso de F. proliferatum.

23
Figura 2. Fusarium proliferatum. Variabilidad en el tipo de micelio (2A-D) y
pigmentación (2E-H); microconidios (2I); falsas cabezas (2J) y macroconidios
(2K).

De los 70 aislados analizados solo 3 (4.3%) presentaron las siguientes

características en medio de cultivo PDA: micelio blanco, violeta y hasta púrpura

(Figuras 3A-C), pigmentación de naranja a casi negro (Figuras 3D-F) lo cual

coincidió con lo señalado por Leslie y Summerell (2006), para Fusarium

verticillioides. Se observó un crecimiento micelial radial de 0.66-0.9 cm día-1 dato

similar a lo reportado por Hirata et al. (2001) para la misma especie.

De los 3 aislados solamente 2 de ellos (66.6%) produjeron microconidios sin

septos (Figura 3G), en monofialides (Figura 3H), de 6.7-19.0 × 1.4-4.8 µm;

24
macroconidios (Figura 3I) de 3 septos transversales, con célula apical ligeramente

curvada y célula basal en forma de pie (Figura 3K) de 24.2-31.8 × 2.0- 3.1 µm;

clamidosporas ausentes. Esto coincide con la descripción de Fusarium

verticilloides reportada por Hirata et al. (2001) en fruta de plátano importada de

México en Japón.

Figura 3. Fusarium verticillioides. Variación de micelio (3A-C) y de


pigmentación (3D-F); microconidios (3G); falsas cabezas (3H) y macroconidios
(3I).

25
4.2. Caracterización molecular

Figura 4. Dendrograma generado utilizando el análisis UPGMA, basado la región parcial del
gen 18 S, ITS1, 5.8s, ITS2 y región parcial del 28 S. Se utilizó la secuencia de Fusarium
proliferatum y Fusarium verticillioides como referencia y a F. commune como grupo externo. 26
El análisis de la región ITS confirmó la identificación morfológica. Los 67 aislados

fueron agrupados con Fusarium proliferatum y dos con Gibberella moniliformis

(Figura 4). Una secuencia no fue incluida en el análisis filogenético debido a que

resultó ser muy corta después de la secuenciación.

Las especies del genero Fusarium asociadas a plantas de caña de azúcar con

síntomas de Pokkah-boeng en las regiones productoras de Veracruz, Morelos,

Oaxaca y Puebla fueron Fusarium proliferatum y Fusarium verticillioides Ambas

especies ya han sido reportadas como patógenos de la caña de azúcar. La

variación genética que existe entre los aislados de cada especie está presente

pero de modo que no representa la formación de grupos interespecíficos, de modo

que en este trabajo se encontró que únicamente estas dos especies están

asociadas a la enfermedad descrita como Pokkah-boeng.

Para confirmar estos resultados será necesario realizar pruebas de patogenicidad

como una segunda etapa del proyecto del que forma parte este trabajo de

investigación.

4.3. Especies de Fusarium spp. presentes en las regiones


productoras de caña de azúcar en México

En el cuadro 2 se observan la relación de colectas de Fusarium spp. realizadas

en los estados de Veracruz, Morelos, Oaxaca y Puebla en el año 2012.

Cuadro 2. Relación de colectas de Fusarium spp. en los estados de Veracruz,

Morelos, Oaxaca y Puebla (2012).

27
ESTADO CLAVE ALTITUD LATITUD LONGITUD ESPECIE
Veracruz F14 19°01' 06.09" 96°37'15.22” Fusarium proliferatum
Morelos F37 951 18°42'28.0" 99°22'32.8" Fusarium proliferatum
Morelos A 25 912 18°37'23.3" 99°09'41.8" Fusarium proliferatum
Morelos A26 912 18°37'23.3" 99°09'41.8" Fusarium proliferatum
Morelos F22 898 18°36'4.5" 99°19'15.3" Fusarium proliferatum
Morelos F23 898 18°36'4.5" 99°19'15.3" Fusarium proliferatum
Morelos F4 897 18°36'22.3" 99°10'40.1" Fusarium proliferatum
Morelos F5 897 18°36'22.3" 99°10'40.1" Fusarium proliferatum
Morelos F6 897 18°36'22.3" 99°10'40.1" Fusarium proliferatum
Morelos F7 897 18°36'22.3" 99°10'40.1" Fusarium proliferatum
Morelos F8 897 18°36'22.3" 99°10'40.1" Fusarium proliferatum
Morelos F9 897 18°36'22.3" 99°10'40.1" Fusarium proliferatum
Morelos F10 905 18°35'43.8" 99°11'40.0" Fusarium proliferatum
Morelos F11 905 18°35'43.8" 99°11'40.0" Fusarium proliferatum
Morelos F12 905 18°35'43.8" 99°11'40.0" Fusarium proliferatum
Morelos F13 905 18°35'43.8" 99°11'40.0" Fusarium proliferatum
Morelos F19 905 18°35'43.8" 99°11'40.0" Fusarium proliferatum
Morelos A12 897 18°34'58.5" 99°11'50.2" Fusarium proliferatum
Morelos A 14 884 18°35'00.2" 99°11'49.2" Fusarium proliferatum
Morelos A15 879 18°34'54.9" 99°11'49.4" Fusarium proliferatum
Morelos A16 880 18°34'54.9" 99°11'49.4" Fusarium proliferatum
Morelos A7 897 18°34'58.5'' 99°11'50.2'' Fusarium verticilloides
Morelos A8 879 18°34'54.9'' 99°11'49.4'' Fusarium proliferatum
Morelos A9 879 18°34'54.9'' 99°11'49.4'' Fusarium proliferatum
Morelos A10 879 18°34'54.9'' 99°11'49.4'' Fusarium proliferatum
Morelos A31 897 18°34'58.5'' 99°11'50.2'' Fusarium proliferatum
Morelos F 16 921 18° 39' 13.9" 99° 11' 55.2" Fusarium proliferatum
Morelos F 17 921 18° 39' 13.9" 99° 11' 55.2" Fusarium proliferatum
Morelos F18 921 18° 39' 13.9" 99° 11' 55.2" Fusarium proliferatum
Morelos F20 921 18° 39' 13.9" 99° 11' 55.2" Fusarium proliferatum
Morelos A27 897 18°36'22.1" 99°10'37.0" Fusarium proliferatum
Morelos A28 898 18°36'22.1" 99°10'37.0" Fusarium proliferatum
Morelos F43 933 18°39'53.3" 99°10'57.2" Fusarium proliferatum

28
Morelos A29 957 18°40'38.7'' 99°09'59.5'' Fusarium proliferatum
Morelos F41 1168 18°42'58.4" 98°56'32.1" Fusarium verticilloides
Morelos F35 1164 18°42'57.0" 98°56'35.6" Fusarium proliferatum
Morelos F36 1164 18°42'57.0" 98°56'35.6" Fusarium proliferatum
Morelos F38 1164 18°42'57.0" 98°56'35.6" Fusarium proliferatum
Morelos F39 1164 18°42'57.0" 98°56'35.6" Fusarium proliferatum
Morelos F40 1165 18°42'57.0" 98°56'35.6" Fusarium verticilloides
Morelos F15 1171 18°43'36.5'' 98°59'39.8'' Fusarium proliferatum
Morelos A17 Fusarium proliferatum
Morelos A18 Fusarium proliferatum
Morelos A19 Fusarium proliferatum
Morelos A20 Fusarium proliferatum
Morelos A21 Fusarium proliferatum
Morelos A22 Fusarium proliferatum
Morelos A23 Fusarium proliferatum
Morelos A24 1305 18°51'12.1" 98°59'44.2" Fusarium proliferatum
Morelos F31 1254 18°47'38.6" 98°58'42.8" Fusarium proliferatum
Morelos F32 1254 18°47'38.6" 98°58'42.8" Fusarium proliferatum
Morelos F33 1247 18°47'35.4" 18°58'36.0" Fusarium proliferatum
Morelos F34 1247 18°47'35.4" 18°58'36.0" Fusarium proliferatum
Oaxaca F29 17°57'51.2" 96°05'16.0" Fusarium proliferatum
Oaxaca F30 18°35'05.2" 96°39'0.67" Fusarium proliferatum
Oaxaca F3 17°15'45.3" 96°12'06.1" Fusarium proliferatum
Oaxaca A30 Fusarium proliferatum
Oaxaca F25 18°08'13.3" 96°13'18.7" Fusarium proliferatum
Oaxaca F26 18°09'08.6" 96°11'57.6" Fusarium proliferatum
Oaxaca F27 18°03'57.1" 96°14'21.3" Fusarium proliferatum
Oaxaca F28 18°00'34.2" 96°02'11.8" Fusarium proliferatum
Puebla P1 1348 18.6317 98.3668 Fusarium proliferatum
Puebla P5 1338 18°37'53.8" 98°21'55.6" Fusarium proliferatum
Puebla P4 1338 18°37'53.8" 98°21'55.6" Fusarium proliferatum
Puebla P13 1224 18.5404 98.4997 Fusarium proliferatum
Puebla P22 1208 18°32'17.3" 98°30'05.5" Fusarium proliferatum
Puebla P23 1208 18.54128 99.4995 Fusarium proliferatum

29
Puebla P34 1159 18°32'30.2" 98°32'4.6" Fusarium proliferatum
Puebla P49 1012 18°28'29.2" 98°41'46.5" Fusarium proliferatum
Puebla P40 1201 18°57'12.7" 98°55'94.2" Fusarium proliferatum

En el estado de Morelos se aisló e identificó a F. proliferatum (Teleomorfo :

Gibberella intermedia) y F. verticilloides (Teleomorfo: G. moniliformis) y en los

estados de Oaxaca, Puebla y Veracruz se encontró a F. proliferatum lo cual

colocó a dicha especie como la mas frecuentemente aislada en las regiones

muestreadas en este estudio (95.7%) (Cuadro 3).

El estado con mayor variabilidad de especies es Morelos al presentar el total de

especies aisladas e identificadas en el presente estudio. En el cuadro 3 se

observa la incidencia de especies de Fusarium spp. en Veracruz, Morelos, Oaxaca

y Puebla.

Cuadro 3. Incidencia de especies de Fusarium spp. en Veracruz, Morelos, Oaxaca

y Puebla.

Origen Fusarium proliferatum Fusarium verticillioides Total

Veracruz 1.43 % 1.43 %

Morelos 69.99 % 4.3 % 74.29 %

Oaxaca 11.43 % 11.43 %

Puebla 12.85 % 12.85 %

Total 95.7 % 4.3 % 100 %

30
En el presente estudio, basados en la combinación de caracterización morfológica

y amplificación de la región ITS del rDNA, se identificó a F. proliferatum y F.

verticilloides (con 95.7% y 4.3% de incidencia, respectivamente) como las

especies presentes en las zonas productoras de caña de azúcar en Veracruz,

Oaxaca, Puebla y Morelos, México, lo cual coincidió con lo reportado por

McFarlane et al. (2009) quien encontró a Fusarium proliferatum en solo una área

geográfica (Midlands del Norte, Sudáfrica) y en la variedad más usada en dicha

área (N12); y con Mohammadi et al. (2012) quien reportó a Fusarium verticillioides

aislado de plantas de caña de azúcar afectadas por Pokkah-boeng en Irán.

Asimismo, la especie mas frecuentemente aislada en las regiones productoras de

caña de azúcar en México fue F. proliferatum (95.7%) lo cual se contrapone a lo

reportado por López y López (2000) y Mohammadi et al. (2012) quienes

reportaron a F. verticilloides como la especie predominantemente aislada de caña

de azúcar con síntomas de Pokkah-boeng en Cuba e Irán, respectivamente.

V. CONCLUSIONES

En este estudio se aisló e identificó a F. proliferatum y F. verticilloides como las

especies asociadas a síntomas de Pokkah-boeng, presentes en las zonas

productoras de caña de azúcar en Veracruz, Oaxaca, Puebla y Morelos, México.

La especie mas frecuentemente aislada en las regiones productoras de caña de

azúcar en México fue F. proliferatum con frecuencia de 95.7% total; distribuido de

la siguiente manera: 1.43% en Veracruz, 69.99% en Morelos, 11.43% en Oaxaca y

31
12.85% en Puebla. Fusarium verticillioides se aisló solamente en el estado de

Morelos con incidencia de 4.3% respecto al total.

La colonia de Fusarium proliferatum presentó abundante micelio aéreo de blanco a

purpura con pigmentación variable, desde blanco hasta rojo oscuro; crecimiento

micelial radial de 0.43-1.1 cm día-1. Formó microconidios no septados de 6.1-

15.3×1.5-3.1µm en falsas cabezas; macroconidios con célula apical curvada y

célula basal en forma de pie, de 21.6-60.1×1.8-4.6 µm, con 3-5 septos

transversales; clamidosporas ausentes.

La colonia de Fusarium verticillioides desarrolló micelio blanco, violeta y hasta

púrpura con pigmentación de naranja a casi negro; crecimiento micelial radial de

0.66-0.9 cm día-1. Formó microconidios sin septos en monofialides de 6.7-19.0 ×

1.4-4.8 µm; macroconidios de 3 septos transversales, con célula apical

ligeramente curvada y célula basal en forma de pie de 24.2-31.8 × 2.0- 3.1 µm;

clamidosporas ausentes.

El análisis de la región ITS confirmó las especies del genero Fusarium asociadas a

plantas de caña de azúcar con síntomas de Pokkah-boeng en las regiones

productoras de Veracruz, Morelos, Oaxaca y Puebla.

La especie que presentó mayor variabilidad morfológica, cultural y genética fue

Fusarium proliferatum lo cual puede ser indicativo de cepas con diferentes

virulencias hacia determinados genes de resistencia lo que afecta directamente el

desarrollo de una estrategia de manejo general.

32
LITERATURA CITADA

Campos H., A. y Lugo A., A. 2011. Características agronómicas de cuatro

variedades de caña de azúcar para el estado de Morelos. Recursos genéticos y

mejoramiento. VI Reunión Nacional de Innovación Agrícola, León, Guanajuato.

Memoria. p. 235.

Chavarría, S. E. 2006. Escalas descriptivas para la evaluación de enfermedades

de la caña de azúcar. LAICA (Liga Agrícola Industrial de la Caña de Azúcar). San

José, Costa Rica. pp.53.

Comstock J., C. and Lentini R., S. 2005. Sugarcane smut disease University of

Florida, Florida Cooperative Extension Service, Institute of Food and Agricultural

Sciences. SSAGR208.

De Sousa-V., R.; Briceño, R.; Díaz, A.; Rea, R; Niño, M.; Rivero, A.; Aza, G.; Ortiz,

A. y George, J. 2008. Programa venezolano de desarrollo de variedades de caña

de azúcar. Revista Digital INIA HOY N° 1, enero-abril. Enlace:

http://www.inia.gob.ve/index2.php?option=com_docman&task=doc_view&gid=215

&Itemid=28

Duttamajumder, K.S., 2008. Red rot of sugarcane. Indian Institute of sugarcane

Research. pp.16.

FAOSTAT, 2013. Datos disponibles en el siguiente enlace:

http://faostat3.fao.org/faostat-gateway/go/to/download/Q/QC/S

33
Flores, C. S. 2001. Las variedades de caña de azúcar en México, s/e México. pp.

209-210.

Hirata, T.; Kimishima, E.; Aoki, T.; Nirenberg I., H. and Donnell , C. 2001.

Morphological and molecular characterization of Fusarium verticillioides from rotten

banana imported into Japan. Mycoscience 42. pp. 155-166.

Jahan Q, A. S.; M, S.; H, J. and B.M.A., A.Z. 2013. Characterization of Fusarium

proliferatum through species specific primers and its virulence on rice seeds.

International journal of agriculture and biology. Vol. 15, No. 4. Pp. 650-656.

Leslie and John F., 2006. The Fusarium Laboratory Manual. Blackwell Publishing

Professional 2121 State Avenue, Ames, Iowa, 50014, USA.

López, M. O.; I. Sandoval y J. Mena. 1998. Manual para la identificación de los

hongos fitopatógenos de la caña de azúcar en Cuba. INISAV, La Habana. p. 75

López D. y López O., M. 2000. Estudio del efecto inhibitorio de Fusarium

moniliforme Sheldon sobre la germinación de la semilla agamica de la caña de

azúcar (Saccharum sp. hibrida). Fitosanidad Vol.4 marzo, junio, 2000. no. 1-2.

Lyrene P., M., Dean J., L., and James N., I. 1977. Inheritance of resistance to

pokkah boeng in sugarcane crosses. Phytopathology 67: 689-692.

MacFarlane S., A., Govender P. and Rutherford R.,S. 2009. Interactions between

Fusarium species from sugarcane and the stalk borer, Eldana saccharina

(Lepidoptera: Pyralidae). South African Sugarcane Research Institute, KwaZulu-

34
Natal, South Africa. Research article: Annals of Applied Biology ISSN 0003-4746.

pp. 349-359.

Magarey C.R., 2000. Orange rust. In: A guide to sugarcane diseases. Rott, P.;

Bailey A., R.; Comstock C., J.; Croft J., B. and Saumtally S., A. Editors., pp. 121-

124.

Mohammadi A., Nejad R., F. and Mofrad N., N. 2012. Fusarium verticillioides from

sugarcane, vegetative compatibility groups and pathogenicity. Plant Protect. Sci.,

48. pp. 80–84.

McIntyre, C.L. y Jackson P.A. 2001. Low level of selfing found in a sample of

crosses in Australian sugarcane breeding programs. Euphytica 117: 245-249.

SAGARPA, 2013. Cultivos agroindustriales, Impactos de la caña. Información

obtenida en línea:

http://www.sagarpa.gob.mx/agricultura/Documents/Cultivos%20Agroindustriales/Im

pactos%20Ca%C3%B1a.pdf

SIAP, 2013. Información obtenida en línea en el siguiente enlace consultado el 03

de diciembre de 2013. Disponible en:

http://www.siap.gob.mx/index.php?option=com_wrapper&view=wrapper&Itemid=2

07

Pavlovic D., S; Stojsin B., V; Stojanovic D., S.; Starovic S., M. ; Bagi F., F. and

Budakov B., D. 2009. Gibberella intermedia the pathogen of st. john's wort,

35
coneflower and marshmallow in Serbia. Actas de la Sociedad Cultural Serbia de

las Ciencias Naturales. No. 116. pp. 191-199.

Raid R., N. and Comstock J.C., 2006. Sugarcane rust disease. University of

Florida, Florida Cooperative Extension Service, Institute of Food and Agricultural

Sciences. SS-AGR-207.p. 3.

Raid R., N. and Sullivan, S. 2000. Common rust. In: A guide to sugarcane

diseases. Rott, P.; Bailey A., R.; Comstock C., J.; Croft J., B. and Saumtally S., A.

Editors., p. 85-89.

Raid R., N. 2012. Pokkah boeng disease of sugarcane. University of Florida,

Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences.

SS-AGR-204. p. 2.

Raid R., N. Sugarcane red rot disease. University of Florida, Florida Cooperative

Extension Service, Institute of Food and Agricultural Sciences. SS-AGR-206. p. 2.

Ramírez P., E. y Nass, H. 2005. Presencia de patógenos fúngicos en el cultivo de

la caña de azúcar en Venezuela (2002-2004). Caña de azúcar, 23(1 y 2): 5-15.

Ramouthar P.,V. 2009. Studies on brown rust (Puccinia melanocephala) of

sugarcane in South Africa. Thesis Master of Science, Discipline of Plant Pathology,

University of KwaZulu-Natal, Pietermaritzburg, Republic of South Africa.

Rodríguez, R. 1994. El cultivo de la caña de azúcar en México. Colegio de

Posgraduados. Montecillo. Edo de México. p 7.

36
Rosas R., J.A.; Galindo T., M.E.; Lee E., H.E. y Alvarado G., O.G. 2010.

Variabilidad genética en 22 variedades hibridas de caña de azúcar (Saccharum

spp. Híbrido). Revista Internacional de botánica experimental. FYTON ISSN 0031

9457, (2010) 79: 87-94

Vishwakarma SK, Kumar P, Nigam A, Singh A, Kumar A. 2013. Pokkah boeng: an

emerging disease of sugarcane. Journal Plant Pathology and Microbiology 4: 170.

http://dx.doi.org/10.4172/2157-7471.1000170.

VSI. 2013. Vasatndada Sugar Institute. Sugarcane diseases information. Pokkah

boeng. VSI, India. Consultado en: 29 octubre, 2013. Disponible en:

http://www.vsisugar.com/india/agriculture_divisions/plantpathology/pokkaboengdis

ease-sugarcane.htm

Whittle P., and Irawan L. (2000): Pokkah boeng. In: Rott P.,Bailey R.A., Comstock

J.C., Crott B.J., Saumtally A.S. (eds): A Guide to Sugarcane Diseases. pp. 136–

140.

Zhao, D., Glynn, N. C., Glaz, B., Comstock, J. C., and Sood, S. 2011. Orange rust

effects on leaf photosynthesis and related characters of sugarcane. Plant Disease

95:640-647.

37