Sunteți pe pagina 1din 23

Perspective noi în dermatita atopică

: https://www.jci.org/articles/view/21060

Dermatita atopica (AD), una dintre cele mai frecvente


afectiuni cutanate observate la sugari si copii, are de
obicei debutul in primele 6 luni de viata. Prevalența
AD este similară în Statele Unite, Europa și Japonia și
este în creștere, similară cu cea a altor tulburări
atopice, în special a astmului. AD a fost clasificat în
trei faze secvențiale: infantile, copilarie și adulte,
fiecare cu constatări fizice caracteristice. AD are un
efect extrem de negativ asupra calității vieții
pacienților, precum și a familiei, cel mai adesea
tulburător de somn. Condiția creează, de asemenea, o
mare povară financiară atât pentru familie, cât și
pentru societate. Manifestările cutanate ale atopiei
reprezintă adesea începutul marșului atopic. Pe baza
mai multor studii longitudinale, aproximativ jumătate
dintre pacienții cu AD vor dezvolta astm bronșic, în
special cu AD severă, iar două treimi vor dezvolta
rinită alergică. Senzibilizarea epicutanată a fost
considerată responsabilă, cu migrarea ulterioară a
celulelor T sensibilizate în nas și în căile
respiratorii, provocând boala căilor aeriene superioare
și inferioare. Modelele animale și observarea umană
sunt în concordanță cu această teorie. Studiile
preliminare de prevenire cu antihistaminice pe cale
orală oferă dovezi că intervenția timpurie poate
încetini marșul atopic.

Incidența dermatitei atopice este în creștere, ceea ce


reprezintă o povară majoră pentru costurile de
îngrijire a sănătății. O înțelegere precisă a
mecanismelor genetice și imunologice este esențială
pentru dezvoltarea unor strategii eficiente de
tratament pentru dermatita atopică. Diferite studii
indică faptul că are o cauză multifactorială, cu
activarea unor căi complexe imunologice și
inflamatorii. Revizuirea actuală va examina progresele
recente care au fost făcute în înțelegerea noastră a
premiselor genetice și patofiziologice care formează
baza acestei tulburări cutanate comune recalcitrant.

https://www.sciencedirect.com/science/article/pii/S0091
674903023704^
/Tratamentul dermatitei atopice necesită o abordare
cuprinzătoare care include evaluarea posibilelor
declanșatoare și educarea pacientului și a familiei în
ceea ce privește măsurile de evitare adecvate.
Hidratarea pielii și menținerea unei bariere invazive a
pielii rămân integrate în gestionarea adecvată. Deși
corticosteroizii topici au reprezentat un pilon al
terapiei antiinflamatorii, noii inhibitori topici de
calcineurină oferă avantaje pentru tratamentul acestei
boli cronice, recurente. Studiile care vizează
definirea terapiei combinate optime și intervenției
timpurii ar putea schimba paradigma tratamentului
pentru dermatita atopică.

https://www.nejm.org/doi/full/10.1056/NEJMoa021481
/Peptidele antimicrobiene endogene și infecțiile
cutanate la nivelul dermatitei atopice:
fundal

Sistemul imunitar innascut al pielii umane conține


peptide antimicrobiene cunoscute sub numele de
catelicidine (LL-37) și β-defensine. În pielea normală,
aceste peptide sunt neglijabile, dar se acumulează în
piele afectată de boli inflamatorii, cum ar fi
psoriazisul. Am comparat nivelurile de exprimare a LL-
37 și a β-defensinei 2 umane (HBD-2) în pielea
inflamată de la pacienți cu dermatită atopică și de la
cei cu psoriazis.
metode

Expresia proteinei LL-37 și HBD-2 în probele cu biopsie


cutanată de la pacienți cu psoriazis, pacienți cu
dermatită atopică și subiecți normali a fost
determinată prin analiză imunohistochimică. Cantitatea
de peptide antimicrobiene din extractele probelor de
piele a fost, de asemenea, analizată prin analiză
imunotot blot (pentru LL-37) și analiză Western blot
(pentru HBD-2). S-au utilizat testele de reacție cu
transcriptază inversă-transcriptază-reacție în lanț-
polimerază în timp real (RT-PCR) pentru a confirma
exprimarea relativă a ARN-ului mesager HBD-2 și LL-37
(mARN) în probele de biopsie cutanată. Aceste peptide
au fost de asemenea testate pentru activitate
antimicrobiană împotriva Staphylococcus aureus cu
utilizarea unui test de formare a coloniilor.
Rezultate

Analiza imunohistochimică a confirmat prezența LL-37 și


HBD-2 abundente în epiderma superficială a tuturor
pacienților cu psoriazis. În comparație,
imunostabilizarea pentru aceste peptide a fost
semnificativ scăzută în leziunile acute și cronice de
la pacienții cu dermatită atopică (P = 0,006 și,
respectiv, P = 0,03). Aceste rezultate au fost
confirmate prin analize imunotot blot și Western blot.
Real-time RT-PCR a arătat o exprimare semnificativ mai
redusă a ARNm HBD-2 și ARNmLL-37 în leziunile atopice
decât în cazul leziunilor psoriazice (P = 0,009 și,
respectiv, P = 0,02). Combinația dintre LL-37 și HBD-2
a arătat o activitate antimicrobiană sinergică prin
uciderea efectivă a S. aureus.
concluzii

O deficiență în exprimarea peptidelor antimicrobiene


poate determina susceptibilitatea pacienților cu
dermatită atopică la infecția pielii cu S. aureus.
prima linie de protecție a pielii împotriva invaziei de
către agenții microbieni este stratul corneum, un strat
neviabil, deshidratat al epidermei.1 Cu toate acestea,
această barieră fizică este susceptibilă la leziuni
care permit intrarea agenților microbieni oportuni în
piele. Sistemul imunitar innascut poate răspunde
imediat la această intruziune, ajutând la prevenirea
invaziei ulterioare. Acest răspuns imun include
fagocitoză prin intermediul neutrofilelor și
macrofagelor și producerea de intermediari de oxigen
reactivi care ucid agenți microbieni.2

Sa demonstrat că un număr de peptide antimicrobiene


endogene joacă un rol integrat în imunitatea
innascuta.3 Două clase principale de peptide din piele
de mamifere, β-defensins4,5 și catelicidine, 6,7 au
activitate antimicrobiană împotriva agenților patogeni
bacterieni, fungici și virali .4,7,9 Aceste peptide,
care sunt produse de keratinocite în piele, 4,7,8
distrug membrana microbului țintă sau penetrează
membrana microbiană, interferând cu funcțiile
intracelulare.10 Expresia unora dintre aceste peptide,
cum ar fi β-defensina umană 1 (HBD-1), este
constitutivă, 8 întrucât expresia altor, inclusiv β-
defensina 2 (HBD-2) și LL-37 umană, o catelicidină,
este declanșată de leziune sau inflamație cutanat.4,7
Modelele animale au arătat că expresia sau activarea
peptidelor antimicrobiene este esențială pentru
capacitatea pielii de a rezista la infecțiile
bacteriene.11,12

Dermatita atopica, o boala cronica inflamatorie a


pielii frecvent descoperita in familiile cu astm si
rinita alergica, 13 este complicata de infectiile
recurente ale leziunilor cutanate de catre agentii
patogeni bacterieni, virali si fungali.14 Aproximativ
30 la suta dintre pacientii cu dermatita atopica au
infectii bacteriene sau virale din piele, comparativ cu
doar 7% dintre pacienții cu psoriazis, 15 chiar dacă
ambele boli sunt caracterizate de o barieră defectuoasă
a pielii.16 Am comparat expresia HBD-2 și LL-37 în
leziunile cutanate de la pacienții cu dermatită atopică
cu expresia lor în leziunile psoriazice și în pielea
normală, folosind colorarea imunohistochimică, blotarea
Western și imunodot și o analiză cantitativă în timp
real a reacției de transcriptază inversă-transcriptază-
polimerază-lanț-reacție (RT-PCR). De asemenea, am
examinat capacitatea factorului de necroză tumorală a
(TNF-a) de a induce exprimarea HBD-2 într-o linie
celulară de keratinocite umane după tratamentul cu
interleukină-4 și interleukină-13, citokine abundente
în pielea pacienților cu dermatită atopică .13 În
final, am evaluat efectele antimicrobiene combinate ale
LL-37 și HBD-2 asupra Staphylococcus aureus.
metode
pacienţii

Participanții la studiu au inclus 8 pacienți cu


dermatită atopică moderată până la severă (vârsta
medie, 33 ani, gradul de implicare a pielii, 20 până la
60%), 11 pacienți cu psoriazis (vârsta medie, 38 ani,
40%) și 6 persoane sănătoase (vârsta medie, 38 ani).
Niciunul dintre pacienți nu a primit anterior
corticosteroizi sistemici și nici unul nu a primit
corticosteroizi actuali timp de cel puțin o săptămână
înainte de înscriere. Studiul a fost aprobat de
consiliul de evaluare instituțional la Centrul Național
Medical și de Cercetare al evreilor din Denver; toți
pacienții și subiecții normali au dat consimțământul în
scris.

S-au efectuat biopsii de biopsie cu probe de 2 mm


obținute din leziuni eritematoase care au fost mai
vechi de trei zile (dermatită atopică acută), leziuni
lichenificate care au fost mai vechi de două săptămâni
(dermatită atopică cronică), leziuni psoriazice și
piele normală. Probele de piele au fost imediat
înghețate la -70 ° C pentru studii imunohistochimice
sau analize Western blot și blot imunodot.
Colorarea imunohistochimică

Pentru imunozălțarea HBD-2, secțiuni de piele înghețate


de 5 um au fost fixate în acetonă timp de 10 minute și
apoi incubate cu 10% ser de capră nonimmune (Zymed)
timp de 10 minute. S-a eliminat serul de blocare și
secțiunile au fost colorate cu anticorp policlonal de
iepure anti-HBD-2 (Institutul Peptide) la o diluție
1:50 (vol / vol) în soluție salină tamponată cu fosfat
timp de o oră la temperatura camerei într-o atmosferă
umedă. Diapozitivele s-au clătit de două ori cu soluție
salină tamponată cu fosfat și s-au incubat cu un
anticorp secundar antirabbit de capră biotinilat
(Zymed) la temperatura camerei timp de 30 minute, s-au
spălat de două ori cu soluție salină tamponată cu
fosfat și s-au incubat cu un amestec de avidină și
peroxidază de hrean biotinilat : 1 vol / vol, Dako)
pentru încă 30 de minute. Reacția a fost dezvoltată cu
ajutorul soluției unice de amino-etil-carbazol (Zymed)
timp de 10 minute și apoi contracolată cu hematoxilină.
S-au stabilit martori negativi cu utilizarea
anticorpilor izotip nonimune și preincubarea
anticorpilor anti-HBD-2 cu o peptidă sintetică HBD-2
(Institutul Peptide) pentru a asigura specificitatea de
legare a anticorpilor anti-HBD-2. Toate diapozitivele
au fost codificate înainte ca eșantioanele să fie
evaluate astfel încât identitatea subiecților studiului
să nu fie dezvăluită. Intensitatea imunostimulării a
fost evaluată cu ajutorul microscopiei pe o scală de la
0 la 3, cu 0 indicând nici o colorare și 3 cea mai
intensă colorare.
Pentru imunozălțarea LL-37, secțiunile de piele
înghețate au fost tratate în mod similar la început și
apoi incubate cu anticorp anti-LL-37 de iepure, așa cum
s-a descris anterior, 17 în soluție salină tamponată cu
fosfat și 0,1% albumină serică bovină. Secțiunile s-au
spălat în soluție salină tamponată cu fosfat și s-au
colorat cu peroxidază de hrean antirabinant de capră
(kit de iepure Vectastain Elite ABC, Vector
Laboratories) și substrat de diaminobenzidină (Sigma)
conform instrucțiunilor producătorului. Secțiunile au
fost contracarate cu hematoxilină. Specificitatea
reacției primare a anticorpului a fost confirmată în
experimente separate prin adsorbția fie a anticorpului
anti-LL-37 cu cantități în exces de peptidă sintetică.
Specificitatea reacției secundare a anticorpului și a
reactivilor imunocolorizanți a fost confirmată prin
utilizarea de rutină a serului nonimmune de iepure.
Măsurarea peptidelor HBD-2 și LL-37

Probele de biopsie cutanată s-au cântărit și apoi s-au


omogenizat timp de 10 minute cu un omogenizator Dounce
cu fixare liberă în 1 ml de acid clorhidric 1 M și acid
trifluoracetic 1% pe gheață. Țesuturile omogenizate în
soluție au fost apoi rotite peste noapte la 4 ° C. După
centrifugare timp de 20 de minute la 14000 rpm la 4 °
C, supernatantele au fost transferate în tuburi noi și
liofilizate complet. Peletele de proteină rezultate au
fost dizolvate cu apă distilată pentru a obține o
concentrație finală de proteină de 0,1 mg de țesut per
microlitru.

Pentru măsurarea HBD-2, 15 pl din fiecare probă au fost


liofilizate din nou și resuspendate în tampon de
dodecil sulfat de sodiu peste noapte la 4 ° C. Probele
și cantitățile cunoscute de HBD-2 pentru utilizare ca
standard au fost apoi fierte timp de cinci minute și
încărcate pe un gel de poliacrilamidă de dodecil sulfat
de sodiu-tricină 16,5%. Probele au fost plasate pe
membrane Immobilon-PSQ (Millipore) timp de o oră la
0,18 mA în borat de sodiu 0,05 M, pH 9,0, cu 20%
metanol și 0,05% dodecil sulfat de sodiu. Bloturile au
fost fixate timp de 30 de minute cu 0,5% glutaraldehidă
în soluție salină tamponată cu TRIS (500 mM clorură de
sodiu și 20 mM TRIS, pH 7,5), blocată timp de 30 de
minute în 0,75% Blotto (lapte praf degresat) în soluție
salină tamponată cu fosfat (0,9% clorură de sodiu și
tampon fosfat de sodiu 10 mM, pH 7,4), apoi se
incubează timp de 18 ore într-o diluție 1: 500 de ser
anti-HBD-2 de iepure în tampon de diluare a
anticorpului (0,25% Blotto în soluție salină tamponată
cu fosfat conținând 0,01% un conservant). Bloturile au
fost spălate în 0,1% albumină serică bovină în soluție
salină tamponată cu BlOTTO TRIS (0,9% clorură de sodiu
și 20 mM TRIS-acid clorhidric, pH 4,5 până la 5,0) de
trei ori timp de 10 minute de fiecare dată. Membranele
au fost incubate într-o diluție de 1: 2000 de IgG anti-
rabita de capră conjugată cu fosfatază alcalină în
tampon de diluare a anticorpului timp de o oră, apoi
spălate de trei ori ca mai înainte și dezvoltate în
soluție de dezvoltare a fosfatazei alcaline
(bromochloroindolil fosfat-nitroblue tetrazoliu).
Pentru măsurarea LL-37, s-a efectuat analiza imunodot
blot. Măsurătorile pozitive și curbele standard s-au
generat cu o peptidă sintetică LL-37 (fragment C-
terminal, 18-mer, secvența de aminoacizi,
CZQPIKDFLRNLVPRTES, greutate moleculară, 2204). Peptida
a fost diluată în serie între 50 și 1600 nM; 100 pl din
fiecare standard de peptidă și 5 pl din fiecare probă
(echivalent cu 0,5 mg de țesut), extrase într-o manieră
identică cu cea pentru măsurătorile HBD-2, au fost
punctate triplu pe membrana nitrocelulozică. Membrana a
fost blocată cu 10% lapte uscat fără grăsimi (Bio-Rad)
și 0,1% Tween 20 în soluție salină tamponată cu TRIS la
temperatura camerei timp de trei ore și apoi incubat la
4 ° C peste noapte cu anticorp anti-LL-37 de iepure
diluat la 1 : 2500 în soluția de blocare. Membrana a
fost apoi incubată la temperatura camerei timp de două
ore cu anticorp anti-crab de capră-peroxidază de hrean
(Dako) care a fost diluată la 1: 4000 în soluție de
blocare. Spectrul de chemiluminescență cu fulgere
occidentală (Perkin-Elmer Life Sciences) a fost
utilizat pentru a detecta electro-chemiluminescența.
Pentru analiza densitometrică a fost utilizat un sistem
de imagini cu lumină scăzută (ChemiImager 4400, Alpha
Innotech). Semnalul detectat prin analiza punctului
blot a fost confirmat în unele experimente prin analiza
Western blot, care a identificat LL-37 cu lungime
întreagă la 18 kD. Pentru cuantificarea atât LL-37 cât
și HBD-2, intensitatea semnalului extractelor de țesut
a fost direct comparată cu cea a unui standard preparat
simultan, constând din cantități cunoscute din fiecare
peptidă sintetică. Concentrația de peptidă
antimicrobiană în proba originală de biopsie cutanată a
fost apoi estimată prin împărțirea masei determinate
experimental de peptidă antimicrobiană din proba de
biopsie cutanată la volumul epidermic. Volumul
epidermic a fost estimat prin asumarea unei grosimi
epidermice de 0,1 mm; astfel, volumul epidermei într-o
probă cu biopsie de 2 mm a fost de 3,14 x 10-1 mm3.
Analiza RT-PCR a ARN-ului Messenger HBD-2 și LL-37

ARN-ul total a fost izolat din probe de biopsie de


piele de 2 mm de la subiecți cu utilizarea Reagentului
TRI (Sigma) conform protocolului fabricantului.
Primerii și sonda pentru HBD-2 au fost concepute cu
ajutorul software-ului de detecție a secvenței Prism
7700 (Primer Express, Perkin-Elmer Applied Biosystems).
Secvențele de primer au fost 5
'TCCTCTTCTCGTTCCTCTTCATATTC3' (primer prim) și
5'TTAAGGCAGGTAACAGGATCGC3 '(primer revers). Secvența
sondei (TaqMan, Perkin-Elmer) a fost
5'ACCACCAAAAACACCTGGAAGAGGCA3 '; capătul 5 'a fost
marcat cu 6-carboxifluoresceină și capătul 3' a fost
marcat cu 6-carboxi-tetrametil-rhodamină.

Reacțiile de amplificare s-au efectuat cu ajutorul unui


detector de secvență (ABI Prism 7700, Perkin-Elmer
Applied Biosystems) în eprubete optice MicroAmp
(Perkin-Elmer Applied Biosystems) într-un amestec de 25
μl conținând 8% glicerol, 1 x tampon TaqMan A 500 mM
clorură de potasiu, 100 mM TRIS-acid clorhidric, 0,1 M
EDTA și 600 nM colorant de referință pasivă, pH 8,3, la
temperatura camerei), câte 300 pM de trifosfat
deoxiadenozină, deoxiguanosin trifosfat și deoxicidină
trifosfat și 600 pM deoxiuridină trifosfat; Clorură de
magneziu de 5,5 mM; 900 nM primer înainte; Un primer
reversibil de 900 nM; Sondă de 200 nM; 0,625 U de
polimerază ADN de aur AmpliTaq (Perkin-Elmer); 6,25 U
de transcriptază reversibilă a virusului leucemiei
murine murine Moloney (Life Technologies); 10 U de
inhibitor de ribonuclează RNasin (Promega); și ARN-ul
șablonului. Analiza RT a fost efectuată la 48 ° C timp
de 30 de minute, urmată de activarea TaqGold la 95 ° C
timp de 10 minute. Patruzeci de cicluri de amplificare
au fost apoi efectuate la 95 ° C timp de 15 secunde și
la 60 ° C timp de 1 minut.

După amplificare, s-au efectuat achiziții și analiza


datelor în timp real. Datele de fluorescență s-au
exprimat ca semnal reporter normalizat, calculat prin
împărțirea cantității de semnal reporter cu cantitatea
de semnal de referință pasivă sau ca schimbare în
semnalul reporterului normal, calculată ca cantitatea
de semnal reporter normalizată minus cantitatea
semnalului reporter înainte de PCR. Pragul de detecție
a fost setat peste valoarea medie a liniei de bază
pentru fluorescență determinată pe baza primelor 15
cicluri. Reacțiile de amplificare în care intensitatea
fluorescenței au depășit pragul au fost definite ca
reacții pozitive. Ciclul de prag (Ct) este ciclul PCR
la care poate fi detectată mai întâi o creștere a
semnalului reporter deasupra semnalului de bază. O
curbă standard a fost generată prin utilizarea datelor
fluorescente din diluțiile seriale de 10 ori ale ARN-
ului total dintr-o probă de biopsie cutanată de la un
pacient cu psoriazis. Această curbă a fost utilizată
pentru a calcula cantitățile relative ale HBD-2 în
probele de testare. Cantitățile de HBD-2 din probele de
testare au fost normalizate la ARN-ul ribozomal 18S
(rRNA) corespunzător (P / N 4308310, Perkin-Elmer
Applied Biosystems).
Testul PCR în timp real, cantitativ pentru LL-37 a fost
realizat cu ajutorul unui sistem de detecție a
secvenței (GeneAmp 5700, Perkin-Elmer). Primerii
clasici 18S (Ambion) au fost utilizați pentru a
amplifica rRNA 18S. Secvențele de primer utilizate
pentru a amplifica ADN complementar LL-37 (cADN) au
fost 5'GCAGTCACCAGAGGATTGTGAC3 '(primer prim) și
5'CACCGCTTCACCAGCCC3' (primer revers). Pentru analiza
PCR a LL-37, s-au folosit 1,2 pl de reacție RT; Au fost
folosite 1,2 pl de reacție RT diluată de 200 de ori
pentru PCR de ARN 18S. Au fost efectuate reacții de
amplificare într-un volum final final de 25,7 pl
conținând SYBR Green PCR Master Mix (Applied
Biosystems), primer 10 uM și apă fără nuclează. Analiza
a fost efectuată la 50 ° C timp de 2 minute și la 95 °
C timp de 10 minute. Patruzeci de cicluri de
amplificare au fost apoi efectuate la 94 ° C timp de 15
secunde și la 60 ° C timp de 1 minut. Rezultatele au
fost analizate cu ajutorul metodei Ct comparative.
Această metodă se bazează pe presupunerea că primii
țintă (LL-37) și de referință (18S) se amplifică cu
aceeași eficiență într-un anumit interval de
concentrații ale ARN-ului mesager inițial (mRNA).
Pentru a testa această ipoteză, ADNc a fost obținut din
ARN total al unei probe de psoriazis la concentrațiile
inițiale totale de ARN de 1000, 500, 100, 50 și 10 ng.
PCR în timp real a fost efectuat în triplicat pentru
fiecare concentrație de pornire și s-a calculat
schimbarea în Ct (ΔCt). Pentru fiecare concentrație
inițială de ARN total, ΔCt = CtR - CtG, unde CtR denotă
Ct și CtG de referință Ct țintă. Această valoare a fost
reprezentată grafic în raport cu log-ul concentrației
inițiale totale de ARN. Eficacitatea amplificării genei
a fost suficient de apropiată de faptul că un factor de
corecție peste intervalul specificat nu era necesar
dacă panta era mai mică sau egală cu 0,1. Am calculat
ΔΔCt pentru eșantioane după cum urmează: ΔΔCt = ΔCtE -
ΔCtB, unde CtE denotă Ct și CtB experimentale linia de
bază Ct. Proba de bază a fost o probă de control
normală, care a avut o exprimare scăzută a ARNm LL-37.
Expresia relativă a fost calculată ca 2ΔΔCt pentru a
ține cont de amplificarea exponențială a reacției PCR.

Cultură de celule

Celulele HaCat, o linie celulară de keratinocite umane,


au fost crescute în mediu Eagle modificat de Dulbecco
(Cellgro), suplimentat cu 10% ser fetal de vițel
(Gemini) și 1% din fiecare dintre următoarele: 200 mM
L-glutamină, mediu esențial minim MEM) cu aminoacizi
neesențiali (GIBCO), soluție de vitamine MEM (Life
Technologies) și penicilină-streptomicină. Pentru a
studia efectele interleukinei-4 și interleukinei-13
asupra exprimării ARNm HBD-2 în celulele HaCat s-au
incubat 5 x 105 celule pe mililitru în mediu de
control, 20 ng de TNF-a per mililitru singur sau 20 ng
de TNF-a per mililitru plus 50 ng de interleukină-4 pe
mililitru, singur sau în combinație cu 50 ng de
interleukină-13 per mililitru, timp de 24 de ore.
Celulele au fost apoi spălate o dată și omogenizate în
reactivul TRI prin pipetare repetată. ARN-ul total a
fost izolat în conformitate cu protocolul
producătorului.
Măsurarea activității antimicrobiene

Peptidele LL-37 și HBD-2 s-au sintetizat așa cum s-a


descris anterior.17,18 Activitatea antimicrobiană a
peptidelor a fost determinată cu ajutorul unei analize
a unității care formează colonia soluției (CFU). S-a
evaluat S. aureus de tip sălbatic izolat de la pacienți
cu dermatită atopică. Bacteriile au fost crescute până
la o concentrație la care s-au înmulțit exponențial
(faza intermediară log, A600 1,5 = 8,0 x 109 CFU pe
mililitru) în mediul de bulion Todd Hewitt (Sigma).
Bacteriile au fost spălate de două ori cu soluție
tampon de fosfat de sodiu 10 mM (pH 7,4) conținând
bulion Todd Hewitt 0,1% (greutate / volum) și diluate
până la o concentrație finală de 2,0 x 107 celule pe
mililitru în același tampon. Zece microlitri din
această suspensie bacteriană au fost apoi plasate în
plăci de cultură de celule cu 96 de godeuri cu fund
rotund și incubate la 37 ° C și 100% umiditate timp de
două ore cu diferite concentrații de LL-37, HBD-2 sau
ambele. Activitatea citotoxică și activitatea minimă
bactericidă a LL-37 și HBD-2 au fost analizate prin
plierea diluțiilor seriale ale amestecului de incubație
în triplicat pe plăcile de agar de bulion Todd Hewitt
și determinarea CFU în ziua următoare. Procentul de
bacterii uciși a fost exprimat ca [1 - (CFU după
incubarea peptidelor) ÷ (CFU după incubarea
controlului)] × 100.
Analize statistice
Testarea mediană neparametrică din pachetul statistic
JMP419 a fost utilizată pentru a determina diferențele
semnificative. Am constrâns rate de eroare
experimentale la nivelul alfa standard de 0,05 prin
metoda Bonferroni; nivelul alfa a fost de 0,025 pentru
o comparație a două mijloace și 0,017 pentru o
comparație a trei mijloace

rezultate
Figura 1 prezintă imunostainarea HBD-2 și LL-37 în
probele de biopsie cutanată. Probele din leziunile
psoriazice au avut o colorare mult mai intensă atât
pentru HBD-2, cât și pentru LL-37 decât probele din
leziunile atopice acute sau cronice sau ale pielii
normale. Figura 2 prezintă datele compozite privind
imunograma HBD-2 pentru toate probele de biopsie
cutanată. Intensitatea imunostimulării probelor din
leziunile atopice acute nu diferă semnificativ de cea a
leziunilor atopice cronice sau a pielii normale.
Leziunile psoriazice, totuși, au prezentat o
imunozălțire semnificativ mai intensă decât leziunile
atopice acute (P = 0,006), leziunile atopice cronice (P
= 0,03) sau pielea normală (P = 0,02). Rezultatele
imunostimulării pentru LL-37 în probele de leziuni
cutanate și psoriazice normale au fost în concordanță
cu un studiu anterior care a arătat că leziunile
psoriazice au o expresie mai mare a LL-37 decât pielea
normală.7 Leziunile cutanate inflamatorii de la
pacienții cu dermatită atopică au avut scăderea
expresiei LL-37 decât leziunile cutanate de la
pacienții cu psoriazis. Cea mai mare diferență a fost
în regiunea stratului celular granular și a stratului
corneum, care a fost relativ lipsit de LL-37 în
leziunile atopice, dar a avut cea mai mare expresie a
LL-37 în leziunile psoriazice. Absența HBD-2 și LL-37
în pielea normală confirmă, de asemenea, rapoartele
anterioare că aceste peptide antimicrobiene nu sunt
produse în mod normal, dar sunt reglate în sus în
condiții inflamatorii.4,7
>Imunostaining pentru HBD-2 (Panel A) și LL-37 (Panel
B) în secțiunile de piele înghețate de la pacienți cu
psoriazis sau dermatită atopică (AD) și subiecți
normali.

Intensitatea imunofarbirelor pentru HBD-2 în piele de


la pacienții cu dermatită atopică, pacienți cu
psoriazis și subiecți normali.
Pentru o mai mare cuantificare a cantităților relative
de peptide antimicrobiene în leziunile cutanate,
probele de biopsie de 2 mm au fost extrase cu acid și
s-a măsurat cantitatea totală de LL-37 și HBD-2 (Figura
3). Au fost disponibile suficiente probe de piele
pentru analiză de la doar cinci pacienți cu psoriazis
și șase cu dermatită atopică. Western blot, comparativ
cu o curbă standard de HBD-2 recombinant, a arătat că
cantitatea de HBD-2 prezentă în leziunile psoriazice a
variat de la 2,3 la 157 pM (median, 20), în timp ce nu
a fost detectabil HBD-2 la nivelul atopic leziuni
(figura 3A). Rezultatele cuantificării LL-37 în probele
de biopsie cutanată cu ajutorul analizei imunotot blot
au fost similare, cu o abundență de LL-37 în leziunile
psoriazice (mediană, 304 uM, interval 0-1605); doar una
dintre cele șase leziuni atopice a avut detectabil LL-
37 (Figura 3B). Eșantionul unic pozitiv de la un
pacient cu dermatită atopică provine dintr-o leziune
cronică, probabil reflectând contribuția LL-37 dintr-un
infiltrat de celule inflamatorii.
Cuantificarea HBD-2 (Panel A) și LL-37 (Panel B) în
Epidermia de leziuni cutanate atopice și psoriazice.

Diferența în exprimarea proteinei HBD-2 și LL-37 între


leziunile atopice și leziunile psoriazice a fost
confirmată în continuare prin măsurarea mARN cu
utilizarea RT-PCR în timp real. După cum se arată în
figura 4, expresia ARNm HBD-2 a fost semnificativ mai
scăzută în leziunile atopice acute (mediană, 98 pg pe
nanograma ARNm) și leziunile atopice cronice (mediana,
3268 pg pe nanogram de ARNm) decât în cazul leziunilor
psoriazice , 31,660 pg pe nanogram de ARNm, P = 0,009
pentru ambele comparații). Analizele RT-PCR în timp
real ale mRNA LL-37 au arătat rezultate similare, cu
exprimare semnificativ mai scăzută a peptidei LL-37 în
leziunile atopice acute și cronice decât în cazul
leziunilor psoriazice (P = 0,02 pentru ambele
comparații) (Figura 4).

HBD-2 și LL-37 Messenger ARN (mRNA) în leziunile


cutanate atopice și psoriazice.

Studiile anterioare au arătat că LL-37 și HBD-2 sunt


mult mai mari la pacienții cu afecțiuni cutanate
inflamatorii.5-7 De aceea, diminuarea exprimării
peptidelor în leziuni de la pacienți cu dermatită
atopică a fost o observație neașteptată. Pentru a
determina mecanismul care stă la baza expresiei reduse
a peptidelor antimicrobiene în dermatita atopică, am
studiat efectele a două citokine (interleukină-4 și
interleukină-13) care sunt ridicate în dermatita
atopică, dar nu în psoriazis.13 Figura 5 prezintă
efectele interleukinei -4 și interleukină-13 asupra
exprimării induse de TNF-a a HBD-2 în celulele HaCat.
Interleukina-4 singur sau în combinație cu
interleukina-13 a suprimat în mod semnificativ reglarea
în sus a ARNm HBD-2 prin TNF-a (P = 0,04). În pielea
umană normală, atât interleukina-4, cât și
interleukina-13 au suprimat expresia ARNm HBD-2 indusă
de TNF-a în aceste explante (datele nu sunt
prezentate). Deoarece leziunile atopice sunt
caracterizate prin predominarea expresiei
interleukinei-4 și a interleukinei-13, suprimarea ARNm
HBD-2 de către aceste citokine poate explica exprimarea
scăzută a HBD-2 în aceste leziuni.

Efectele interleukinei-4 și interleukinei-13 asupra


expresiei HBD-2 indusă de factorul α (TNF-a) de la
celulele HaCat.
Absența relativă a HBD-2 și LL-37 în epiderma în
leziunile atopice, comparativ cu leziunile psoriazice,
a sugerat că lipsa acestor peptide antimicrobiene la
pacienții cu dermatită atopică ar putea contribui la
susceptibilitatea acestora la colonizare bacteriană și
infecție. Pentru a investiga această posibilitate, am
evaluat susceptibilitatea izolatelor clinice ale S.
aureus la activitatea citotoxică atât de LL-37 cât și
de HBD-2. Singur, LL-37 a prezentat o activitate
puternică (Figura 6A), în timp ce HBD-2 a fost mult mai
puțin potențial (concentrație minimă bactericidă,> 160
pM). Nu a fost detectată o diferență semnificativă în
susceptibilitatea la aceste peptide antimicrobiene în
izolatele clinice, comparativ cu S. aureus de tip
sălbatic (American Type Culture Collection nr. 25923),
dar toate izolatele au fost mai rezistente decât
tulpinile sensibile la defensin, modificări care
conferă rezistență.20 Rezistența relativă a izolatelor
de S. aureus de la pacienții cu dermatită atopică
susține reversia bacteriilor la formele mai puțin
rezistente la această tulburare. Când aceste tulpini
rezistente de S. aureus au fost expuse la peptide
antimicrobiene exprimate în piele psoriazică, totuși,
prezența ambelor peptide a crescut activitatea lor
citotoxică (Figura 6). O combinație de HBD-2 (la 80 uM
sau 160 uM) și LL-37 (la 4 uM) a ucis semnificativ mai
multe organisme de S. aureus decât HBD-2 singur.
Activitatea citotoxică a HBD-2 și LL-37 împotriva
Staphylococcus aureus de tip sălbatic.

Discuţie

Dermatita atopica este o boala foarte frecventa a


pielii cunoscuta a fi asociata cu o prevalenta ridicata
a infectiilor cutanate, in special cu S. aureus.13
Densitatea S. aureus in leziunile atopice inflamate
fara superinfectie clinica poate fi la fel de mare ca
107 unitati care formeaza colonii pe centimetru pătrat
de piele leziunii. Rolul important al S. aureus este
susținut de observația că, chiar și la pacienții cu
dermatită atopică care nu au suprainfecție, severitatea
bolii pielii este redusă prin tratamentul cu o
combinație de antibiotice antistafilococice și
corticosteroizi topici.21
Deoarece infecția cu S. aureus este un declanșator
frecvent pentru exacerbarea bolilor de piele, a existat
un interes considerabil în mecanismele care stau la
baza colonizării crescute a leziunilor cutanate atopice
cu S. aureus.22 Pielea atopică are afinitate de legare
semnificativ mai mare pentru S. aureus decât piele
nonatopică sau psoriazică, probabil ca urmare a
inflamației subiacente.23 Această părere este susținută
de observația că tratamentul cu glucocorticoizi topici
sau tacrolimus reduce numărul de S. aureus pe pielea
atopică.24,25 Într-adevăr, un studiu recent a arătat că
numărul din organismele S. aureus care se leagă la
leziunile inflamatorii ale pielii sunt semnificativ mai
mari atunci când inflamația este mediată de celule T
helper de tip 2 decât atunci când este mediată de
celule T helper de tip 1. 26

Aviditatea crescuta a S. aureus pentru pielea atopica,


cu toate acestea, poate explica doar o crestere de mai
multe ori a S. aureus pe pielea atopica.23 Examinarea
probelor de biopsie cutanata de la pacientii cu
dermatita atopica a aratat ca S. aureus creste in
coloniile din straturile superioare ale epidermei între
keratinocite.27 Aceasta sugerează că o creștere
exponențială a S. aureus ar putea rezulta din eșecul
sistemului imunitar innascut de apărare a pielii
atopice de a restrânge creșterea organismelor.
Peptidele antimicrobiene prezente pe cale naturala sunt
o componenta critica a acestui sistem imunitar
innascut, care sa dovedit a oferi pieilor de mamifere
rezistenta la infectii bacteriene. 11 Peptidele
antimicrobiene HBD-2 si LL-37 sunt produse in mod
normal de keratinocite ca raspuns la stimuli
inflamatori cum ar fi psoriazis sau leziune.7 În
concordanță cu conceptul că activitatea keratinocitelor
în dermatita atopică diferă de cea a psoriazisului,
observațiile recente indică faptul că în dermatita
atopică, dar nu în psoriazis, keratinocitele produc un
profil distinct al chemokinelor care promovează
influxul de eozinofile și tip 2 celule T helper în
piele, în timp ce keratinocitele psoriazice promovează
infiltrarea prin neutrofile și celulele T helper de tip
1. 28

În studiul nostru, mai multe abordări independente au


demonstrat că la nivelul proteinei și al nivelului
mRNA, LL-37 și HBD-2 sunt deficitare în leziunile
cutanate de la pacienții cu dermatită atopică. Am
demonstrat, de asemenea, că combinația dintre HBD-2 și
LL-37 la concentrațiile găsite în leziuni psoriazice,
dar nu leziuni atopice, a fost suficientă pentru a
ucide S. aureus. Aceste peptide antimicrobiene au
activitate nu numai împotriva bacteriilor, ci și
împotriva ciupercilor și a virușilor. Astfel,
observațiile noastre pot explica susceptibilitatea
crescută a pacienților cu dermatită atopică la
infecțiile fungice și virale, cum ar fi herpes simplex
și molluscum contagiosum.

De asemenea, am investigat mecanismul (sau mecanismele)


potențiale pentru reducerea expresiei peptidelor
antimicrobiene, cum ar fi HBD-2. Deoarece este bine
stabilit că leziunile atopice ale pielii sunt asociate
cu creșterea expresiei interleukinei-4 și
interleukinei-13, am explorat posibilitatea ca aceste
citokine helper de tip 2 să inhibe exprimarea genelor
HBD-2. Într-adevăr, am constatat că combinația de
interleukină-4 și interleukină-13 a fost foarte
eficientă în inhibarea exprimării genelor HBD-2.
Astfel, citokinele de tip 2 helper nu se referă numai
la concentrațiile ridicate de IgE și la eozinofilie la
pacienții cu dermatită atopică, dar și la creșterea
susceptibilității acestora la infecții cutanate.

În concluzie, studiul nostru a arătat că leziunile


cutanate inflamatorii de la pacienții cu dermatită
atopică au avut concentrații semnificativ mai scăzute
de HBD-2 și LL-37 decât leziunile cutanate de la
pacienții cu psoriazis. Efectele inhibitorii ale
interleukinei-4 și ale interleukinei-13, ambele fiind
abundente în pielea atopică, pot explica această
constatare. Mai mult, concentrațiile scăzute de HBD-2
și LL-37 la pacienții cu dermatită atopică nu au putut
să ucidă S. aureus. Prin urmare, o deficiență în
exprimarea peptidelor antimicrobiene induse de
inflamație poate explica susceptibilitatea pacienților
cu dermatită atopică la infecțiile cutanate.
Constatările noastre demonstrează prezența
imunodeficienței localizate la nivelul pielii în
dermatita atopică și corelația dintre expresia
deficitară a peptidelor antimicrobiene și infecția.
Aceste constatări indică rolul funcției peptidice
antimicrobiene în boala clinică și evidențiază
importanța luării în considerare a interacțiunii dintre
sistemele imunitare înnăscute și cele adaptative.

Abstract:
https://www.sciencedirect.com/science/article/pii/S0190
962201379902

Context: În ciuda numeroaselor studii privind


posibilele efecte protectoare ale alăptării împotriva
declanșării dermatitei atopice în copilărie, această
problemă rămâne controversată. Obiectiv: Am efectuat o
analiză sistematică cu meta-analiză a studiilor
prospective care au evaluat asocierea dintre alăptarea
exclusivă în primele 3 luni de la naștere și dermatita
atopică. Metode: O căutare cuprinzătoare a bazei de
date MEDLINE 1966-2000 și revizuirea listelor de
referință cu articole relevante a identificat 18 studii
prospective care îndeplinesc criteriile de includere
predefinite. Prin intermediul unei abordări
standardizate, 2 dintre investigatori au evaluat în mod
independent calitatea metodologică a studiilor, durata
și exclusivitatea alăptării, măsurarea rezultatelor și
controlul factorilor potențiali de confuzie. Aceeași
abordare a fost aplicată în timpul abstractizării
datelor și evaluării estimărilor asociației. S-au
calculat, apoi, masele de asociere. Rezultate: Raportul
de probabilitate sumară (OR) pentru efectul protector
al alăptării în studiile analizate a fost 0,68
(interval de încredere 95% [CI], 0,52-0,88). Această
estimare a efectului a fost mai mare în grupul de
studii în care copiii cu antecedente familiale de
atopie au fost investigați separat (OR = 0,58; CI,
0,41-0,92) decât în cazul populațiilor combinate (OR =
0,84; CI, 0,59-1,19). Un subgrup mic de studii cu copii
fără antecedente de atopie în rudele de gradul întâi nu
a evidențiat nicio asociere între alăptare și debutul
dermatitei atopice (OR = 1,43; CI, 0,72-2,86).
Concluzie: Alăptarea exclusivă în primele 3 luni de
viață este asociată cu rate mai scăzute de incidență a
dermatitei atopice în timpul copilariei la copiii cu
antecedente familiale de atopie. Acest efect este redus
în populația generală și este neglijabil în cazul
copiilor fără rude atopice de prim ordin. Alăptarea
trebuie recomandată cu fermitate mamei sugarilor cu
antecedente familiale de atopie, ca posibil mijloc de
prevenire a eczemei atopice. (J Am Acad Dermatol 2001;
45: 520-7).