Supporting Information 

A regulatory cysteine residue mediates reversible inactivation 
of NAD+‐dependent aldehyde dehydrogenase to promote 
oxidative stress response 
Yugang Zhang1, Miao Wang1 and Hening Lin*2
1 Department of Chemistry and Chemical Biology, Cornell University, Ithaca, NY 14853, USA

2 Howard Hughes Medical Institution; Department of Chemistry and Chemical Biology, Cornell University,

Ithaca, NY 14853, USA.

* Corresponding author: hl379@cornell.edu

A. Material and Methods

B. Supplementary Figures and Tables

A. Materials and Methods

Cloning, expression and purification of Ald4 and Ald6. This was performed as previously

described14.

Activation assay of Ald4. For Ald4 activation assay, 1 µM Ald4 with 1 mM acetaldehyde and 1

mM NAD+ was incubated with 1 mM DTT, 1 mM TCEP (pH adjusted), 1 mM CoA, 1 mM

Glutathione (pH adjusted), or just buffer containing 25 mM Tris (pH 8.0), 150 mM NaCl and 1 mM

KCl at room temperature. The production of NADH was monitored at 340 nm using a Cary 50 Bio

UV-vis spectrometer (Varian). The Ald6 activity was measured similarly but with 1 mM

acetaldehyde and 1 mM NADP+ in a buffer containing 25 mM Tris (pH 8.0), 150 mM NaCl and 1

mM MgCl2 at room temperature. The production of NADPH was monitored at 340 nm.

Cloning, expression and purification of Ald4 C325S. The C325S mutant of Ald4 was

generated using quick change with primers YZ348 and YZ349. A single colony was used to

inoculate an overnight starter culture, which was used to inoculate 2 L of lysogeny broth (LB)

containing 50 μg/mL kanamycin. Cells were grown at 37 °C to OD600 of ~0.6 and cooled to 16 °C.

Expression was induced with 0.15 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and grown

overnight at 16 °C. Cells were harvested by centrifugation and lysed using the EmulsiFlex-C3 cell

disruptor (Avestin, Inc.). Cell debris was removed by centrifugation at 20,000 rpm (Beckman

Coulter Avanti J-E) for 30 min. The supernatant was incubated for 30 min with 1.2 ml Ni-NTA

resin (Qiagen) pre-equilibrated with the lysis buffer (500 mM NaCl, 50 mM Tris-HCl at pH 8.0, 5%

glycerol, and 1 mM TCEP) in 4 °C. The Ni-NTA resin was loaded onto a polypropylene column

and washed with 10 ml lysis buffer, followed by 40 ml of 30 mM imidazole in lysis buffer. Protein

was eluted from the column with elution buffers (50 mM, 75 mM, 100 mM and 200 mM imidazole

in the lysis buffer, 5 mL each). Each elution fraction was checked on a 12% SDS-PAGE gel. The

fractions with Ald4 C325S were collected and dialyzed against a buffer with 25 mM Tris-HCl (pH

8.0) and 150 mM NaCl. Protein concentration was determined using the standard Bradford assay.
Cloning, expression and purification of Aldh1a1. The DNA sequence encoding for Aldh1a1

was amplified by PCR with primers YZ380 and YZ381 from human cDNA. The amplified gene

fragment was inserted into the pET28a vector and transformed into the E. coli expression strain

BL21. The expression and purification were carried out similarly as that for Ald4 C325S mutant

describe above.

Mass spectrometry analysis of disulfide bond. Ald4 (80 µg, with and without DTT) was treated

with 8 M urea and 50 mM Tris (pH 8.0) for 1 hr at room temperature. Samples was later treated

with 4 mM iodoacetamide for 1 hr. Both samples were buffer exchanged to 50 mM Tris (pH 8.0),

1 mM CaCl2 with Micro Bio-Spin® 6 column (Bio-Rad). Both samples were further diluted six times

with buffer containing 50 mM Tris (pH 8.0) and 1 mM CaCl2. The diluted samples were treated

with 4 µg of sequencing grade trypsin (Promega V5117) for 18 hrs. The digested product was

desalted with Waters Sap-Pac® vac c18 1cc column according to the protocol provided by the

manufacturer. The desalted peptides were lyophilized and then reconstituted in 30 μL of 0.5%

formic acid (FA) for nanoLC-ESI-MS/MS analysis, which was carried out using an Orbitrap Fusion

Tribrid (Thermo-Fisher Scientific) mass spectrometer equipped with a nanospray Flex Ion Source,

and coupled with a Dionex UltiMate3000RSLCnano system (Thermo). The extracted peptide

samples (6 μL) were injected onto a PepMap C-18 RP nano trapping column (5 µm, 100 µm i.d x

20 mm) at 20 µL/min flow rate for rapid sample loading and then separated on a PepMap C-18

RP nano column (2 µm, 75 µm x 25 cm) at 35 °C. The tryptic peptides were eluted in a 60 min

gradient of 2% to 35% acetonitrile (ACN) in 0.1% FA at 300 nL/min., followed by a 4 min ramping

to 90% ACN-0.1% FA and a 4 min hold at 90% ACN-0.1% FA. The column was re-equilibrated

with 0.1% FA for 27 min prior to the next run. The Orbitrap Fusion was operated in positive ion

mode with spray voltage set at 2.1 kV and source temperature at 275°C. External calibration for

FT, IT and quadrupole mass analyzers was performed. In data-dependent acquisition (DDA)

analysis, the instrument was operated using FT mass analyzer in MS scan to select precursor

ions followed by 3 second “Top Speed” data-dependent CID ion trap MS/MS scans at 1.6 m/z
quadrupole isolation for precursor peptides with multiple charged ions above a threshold ion count

of 10,000 and normalized collision energy of 30%. MS survey scans at a resolving power of

120,000 (fwhm at m/z 200), for the mass range of m/z 375-1575. Dynamic exclusion parameters

were set at 30 s of exclusion duration with ±10 ppm exclusion mass width. All data were acquired

under Xcalibur 3.0 operation software (Thermo-Fisher Scientific). The DDA raw files for CID

MS/MS were subjected to database searches using Byonic software (Protein Metrics Inc.). All

raw MS files for samples were used for database search. The database search was conducted

against a Saccharromyces cerevisiae database downloaded from Uniprot on Sept 2017 along

with the recombinant Ald4 or Aldh1a1 protein sequence added. The peptide precursor tolerance

was set to 10 ppm and fragment ion tolerance was set to 0.6 Da. Variable modification of

methionine oxidation, deamidation of asparagine/glutamine, fixed modification of cysteine

carbamidomethylation (only for DTT treatment sample) were set for the database search. The

disulfide/ -2.015650 @ C/Xlink was kept active for disulfide linkage search. Protein FDR was set

to 2% FDR.

Glutathione response measurement. In a buffer containing 25 mM Tris (pH 8.0), 150 mM NaCl,

and 1 mM KCl, 1 µM Ald4 WT or Ald4 C325S or Aldh1a1 was incubated with 1 mM acetaldehyde,

1 mM NAD+ and 1, 2, 3, 5, 7, or 10 mM glutathione (pH adjusted) at room temperature. The

production of NADH was monitored with UV-vis absorption at 340 nm using a Cary 50 Bio UV-vis

spectrometer (Varian). The slope of absorption change was measured and plotted against the

concentrations of glutathione.

Knock-in of Ald4 and Ald4 325S in Δald4. Full length Ald4 and Ald4 C325S was cloned into

pFA6A 3XFlag His3MX6 vector before the 3XFlag sequence with primers YZ430 and YZ431. The

fragment with Ald4 or Ald4C325S, 3XFlag and His3MX6 was PCR amplified with primers YZ423

and YZ432 that contain sequences overlapping with Ald4 5’ upstream and 3’ downstream

genomic sequences. The PCR fragment was transformed into Δald4. The transformed product

was plated on agar plates with synthetic complete media with 2% glucose but lacking histidine.
The colonies were verified using PCR to confirm the insertion of the fragment into the specific

gene locus (Fig S5). The knock in of Ald4 or Ald4 C325S with C-terminal 3XFlag tag was achieved

with the deletion of stop codon with primer YZ668 and YZ669. pFA6A 3XFlag His3MX6 was gift

from Mark Hochstrasser (Addgene plasmid # 20753).

Ald4 and Ald4 C325S reactivation. Ald4 and Ald4 C325S (100 µM) were treated with 4 mM

H2O2 overnight on ice. The treated enzymes were desalted with Micro Bio-spinTM Size Exclusion

Spin columns (Bio-rad). The activity was measured with 1 µM enzyme, 1 mM acetaldehyde, 1

mM NAD+, with or without 1 mM DTT in a buffer containing 25 mM Tris (pH 8.0), 150 mM NaCl

and 1 mM KCl at room temperature. The absorption at 340 nm at different time points was

measured and the slop was calculated as the initial reaction rate. Ald4 WT and C325S activities

in different conditions were normalized to their corresponding full activities (before H2O2 treatment

with DTT in reaction buffer).

Yeast growth assay on agar plates for yeast cells expressing Ald4 WT or C325S mutant.

ΔAld4 strain with Ald4 WT or Ald4 C325S knock-in was cultured in synthetic complete liquid media

with 2% glucose and histidine dropout at 30 °C overnight. The next day, cells were collected and

washed twice with water, and then diluted to OD600 = 0.2 in synthetic complete media with 2%

ethanol lacking histidine. After 6 hours, cells were collected and washed with water twice and then

dilute to OD600 = 0.2 in water. The cell suspension was then diluted serially with 4-fold increment,

and 4 µL of each dilution was spotted on agar plates with synthetic complete media with 2%

ethanol, 1 mM H2O2, and histidine dropout. The plates were incubated at 30 °C. Cell growth was

recorded 2-3 days after plating.

Survival assay for yeast cells expressing Ald4 WT or C325S mutant. Δald4 strain bearing

Ald4 WT or C325S mutant knock-in was cultured in synthetic complete liquid media with 2%

glucose and lacking histidine at 30 °C overnight. The next day, cells were collected and washed

twice with water, and then diluted to OD600 = 0.2 in synthetic complete media with 2% ethanol

and lacking histidine. After 6 hours, cells were diluted to OD600 = 0.2 in synthetic complete media
with 2% ethanol, 3 mM H2O2, and lacking histidine. After 6 hours of H2O2 treatment, the culture

was diluted 10000 times and 100 µL aliquot was plated on YPD plates. The colonies were counted

after 2-3 days incubation at 30 °C.

NADPH measurement. Δald4 knock-in with Ald4 or Ald4C325S was cultured in synthetic

complete media with 2% ethanol without histidine overnight. The overnight culture was diluted to

OD600=0.1 in the same media. 2 mM H2O2 was treated to the media directly when OD600 is

between 0.3 and 0.8. 1.5 108 yeast cell was used for NADPH determination (1 OD/ mL 3 107).

NADPH concentration was quantified with SensoLyte ® NADP/NADPH Assay Kit *Colorimetric*

(Anaspec) according to the protocol with following modifications. Yeast pellet was resuspended

in 200 µL of NADPH extraction buffer. 200 µg acid washed glass beads were added. Yeast was

lysed with TissueLyser LT (Qiagene). The supernatant was heated at 60 °C for 30 min to get rid

of NADP+. The supernatant was used for the quantification.

Western Blots. Δald4 knock-in with Ald4 or Ald4C325S was cultured in synthetic complete media

with 2% glucose without histidine overnight. The overnight culture was diluted to OD600=0.1 in

the same media. The yeast was harvested when OD600 was 0.3 to 0.8. Yeast pellet was

resuspended in 200 µL of 8M urea, 75 mM NaCl and 50 mM Tris (pH 8.0). 200 µg acid washed

glass beads were added. Yeast was lysed with TissueLyser LT (Qiagene). Lysate was centrifuged

at 5000 g for 5 min. Protein concentration in the supernatant was quantified with BCA assay kit

(Thermofisher scientific). 20 µg protein was used for SDS-page gel. The protein gel was

transferred to a PVDF membrane. Anti-Flag M2 antibody conjugated with HRP (A8592, Sigma)

was used to reveal the protein amount.

B. Supplementary Figures and Tables

Figure S1. ALDH reaction mechanism and inactivation. Upon oxidation, adjacent cysteine
and catalytic cysteine form disulfide bond inactivating ALDH reversibly.

Figure S2. The purification of Ald4 a), Ald4C325S b), Ald6 c), and Aldh1a1 d).
Figure S3. Sequence alignment of yeast and human aldehyde dehydrogenase. The red box
highlights the catalytic cysteine residue and the adjacent regulatory cysteine (if present).

A B

Figure S4. The adjacent regulatory cysteine in Aldh1a1. (A) The overall structure of Aldh1a1.
C303 and C304 are shown in sticks. The two cysteines are exposed. (B) Closer view of C303 and
C304. The active site residue C303 and the cysteine right next to it C304 are shown in spheres.
Carbons are colored green. Oxygens are colored red. Nitrogens are colored blue. And sulfurs are
colored yellow.
 A

Figure S5. Mass spectrometry identification of disulfide bond in Aldh1a1. (A) C302 and C303
form disulfide bond. Disulfide formation was indicated by loss of 2 Dalton. (B) DTT treatment
reduced disulfide bond formed between C302 and C303. Carbamidomethylation of cysteine was
observed on cysteine C302 and C303.
Figure S6. Verification of Ald4 or Ald4 C325S knock-in. The PCR was performed with Ald4 open
reading frame (ORF) 5’ primer (YZ228) and Ald4 ORF 3’ primer (YZ292) or Ald4 ORF 5’ primer
(YZ228) and Ald4 3’ untranslated region (UTR) primer (YZ507) respectively. The 1.5 Kb shift in
the gel indicates the incorporation of Ald4 or Ald4 C325S with His3 selection marker into the Ald4
original genome locus.

WT  C325S 
IB:Flag 

CBB 

Figure S7. Western blot verification of expression level of Ald4 WT and Ald4 C325S. Ald4 and
Ald4 C325S with C-terminal 3XFlag tag was revealed by Flag western blot.
Table S1. Km and Kcat of Ald4 and Ald4C325S

KM,acetaldehyde (µM) kcat (min-1)

Ald4 61 4 72 5

Ald4C325S 5 1 101 9 2 101

Table S2. Yeast strains used

Strain Genotype Source
HL813Y MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Open Biosystems (YSC1048)
HL1719Y MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Open Biosystems (YSC6273-
ald4Δ0::KanMX6 201938124)
HL2123Y MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 This study
ALD4::His3MX6
HL2124Y MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 This study
ALD4C325S::His3MX6
HL2249Y MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 This study
ALD4::3XFlag::His3MX6
HL2250Y MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 This study
ALD4C325S::3XFlag::His3MX6
   
Table S3. List of primers used
YZ228 AGTCAGGGATCCATGTTCAGTAGATCTACGCTCT
YZ291 AGTCAGCCATGGGCTTCTCACACCTTCCTATGACAGTG
YZ292 AGTCAGGAATTCTTAATGATGATGATGATGATGCTCGTCCAATTTGGCACG
YZ348 TCTGGTGAGGTCTGTTCTGCGGGTTCAAGGGTG
YZ349 AGAACAGACCTCACCAGAATTGTAGTAGATACC
YZ380 AGTCAGGAATTCATGTCATCCTCAGGCACGC
YZ381 AGTCAGCTCGAGTTATGAGTTCTTCTGAGAGATTTTCACTGT
YZ423 GTAAGCATCGATTGGACACCAGGCTTATTGATGACCTTAGAATTCGAGCTCGTTTAAAC
YZ430 AGTCAGAAGCTTGAAAACTACAATAACAAAAATAAATAAAGCATGTTCAGTAGATCTAC
YZ431 AGTCAGGGATCCTTACTCGTCCAATTTG
YZ432 GTGTTAGGATTAGAAGTATCTGGAAAACCAACCAAGAAAACTACAATAACAAAAATAAA
YZ507 ATGCTATGTTTGACCAAGGTGATG
YZ668 GCCAAATTGGACGAGGGGATCCCCGGGTTAA
YZ669 CCTCGTCCAATTTGGCACGGACCGCTTTAAC