A Parent-Specific Hybridization Assay for Quantifying Therapeutic Oligonucleotides and siRNA in Biological Samples

G. A. Tremblay, P. R. Oldfield and A. J. Bartlett

Charles River Laboratories Preclinical Services Montreal Inc., 22022 Transcanadienne, Senneville, Quebec, Canada H9X 3R3
Patent pending application no. 61258046

Abstract Process

• The dual ligation-hybridization assay workflow is depicted in Figure 1. The

Figure 2: Representative calibration curve with the s2B test OGN in mouse plasma. Figure 4: Reliance of the dual ligation assay on PNK and T4 DNA ligase enzymes.
Table 2: Specificity assessment of s2B in five different lots of pooled mouse plasma (K2EDTA)

Recovery of s2B
Purpose. Investigational oligonucleotide medicines (OMDs) are currently investigated at template probe is fully complementary to the test OGN, in addition to having 50000
Independent lots of Spiked Recovery
the preclinical and clinical stages. Hybridization enzyme immunosorbent assay (ELISAs) extensions on either side of the test OGN-hybridizing portion that are 100000 mouse plasma (0.25 nM)
45000 +PNK +Ligase (% theoretical)
used for determining OMDs in complex biological mixtures include sandwich, ligation, complementary to ligation Probes 1 and 2.
Lot #1 0.28 111.2
cutting and competitive assays. The cutting assay is, in principle, selective for the full- 40000 +PNK -Ligase

Relative Fluorescence (RFU)

length (parent) OMD. However, the selectivity for parent is limited by the specificity of the • Ligation Probe 1 is biotinylated for immobilization to a solid support and -PNK +Ligase Lot #2 0.27 106.7
35000
nuclease used, since N-1 metabolites may also be detected. On the other hand, the synthesized with a phosphate for ligation onto the 3'-end of the test article in a Lot #3 0.31 124.0
ligation assay determines the parent OMD that is intact at the 3'-end, but fails to similar way to the ligation-hybridization assay 2. The template probe is blocked 10000
30000 Lot #4 0.28 113.3
discriminate against 5'-end truncated products. A hybridization assay was developed to with amines at both ends to prevent spurious ligation products. Ligation Probe 2 Lot #5 0.28 110.1
circumvent the specificity limitations of current assay formats. has a free 3' hydroxyl and is modified with 5' digoxigenin (DIG) for downstream 25000
Average: 0.28 113.1
signaling. 20000
Methods. The parent-specific hybridization method is carried-out in a microtiter plate 1000
• Firstly, a biological sample containing the test OGN is mixed with the template Figure 6: Dilution linearity assessment of s2B in mouse plasma.
system and no prior purification of biological samples is required. Hybridization of the 15000

probes, ligation and detection are performed in a distinctive combination to allow for probe and ligation Probe 1. This hybridization mixture is denatured 10000
7
highly specific discrimination; the method is designed to quantify only those OMDs that (90ºC / 8 min.) and annealed at room temperature for 30-45 min, followed by
have both the 5'- and 3'-ends intact. immobilization to a streptavidin-coated 96-well plate. The wells are then washed 5000 6
R2 = 0.9997
in order to remove matrix components and unbound material. 100
0 5
Results. An siRNA sequence test system was implemented. Mock (N-1) metabolites with 0.01 0.1 1 10 100
0 1 2 3 4 5 6 7 8
• The bi-enzymatic reaction, consisting of a phosphorylation and a ligation

Concentration (nM)
one nucleotide truncated at the 5'-end or one nucleotide truncated at the 3'-end were not Concentration (nM)
detectable at three QC levels. The standard curve and QC concentrations of the full- reaction, is initiated in the presence of ligation Probe 2. Whereas only the Concentration (nM) 4

length analyte were within 10% of the theoretical concentrations in mouse plasma. ligation reaction is necessary at the 3'-end of the test OGN, the recessed 5'-end
of the immobilized test OGN-template probe duplex requires to be 3
Different oligonucleotide and matrix combinations documented the hybridization assay.
phosphorylated by PNK prior to ligation onto the 3'-end of ligation Probe 2. Specificity for the parent compound Versatility with the phosphorothioate chemistry 2
Table 1: Intra-Assay Precision & Accuracy of s2B in Mouse Plasma (K2EDTA) • After bi-enzymatic processing (ca. 1h 30 min), the plates are washed with water
• To assess the specificity of the dual ligation assay for the parent compound • The ligation-hybridization assay typically works with a variety of OGN 1
to remove un-ligated probes at the 3' and 5'-end sides of the template probe.
relative to metabolites, (Figure 3) the signal generated at different chemistries including DNA, RNA and phosphothioates 2 (PS); T4 DNA ligase is
Oligonucleotide Concentration in Therefore, in order for the DIG to be covalently linked to the plate, both ends of
Mouse Plasma (nM) §
Intra-Assay Precision & Accuracy (n=3) concentrations for the FLP of s2B versus s2B truncated by 1 nucleotide at permissive to a variety of nucleic acid chemistries. 0
the test OGN must have ligated the 5'-end of the test OGN having been
either the 3' or the 5'-end (3' N-1 or 5' N-1 metabolites) were compared. • However, since PNK has been reported to be inhibited by fully modified or 0 0.002 0.004 0.006 0.008 0.01 0.012
Theoretical Measured CV (%) Recovery (%) phosphorylated by PNK prior to ligation.
• A relatively low interference (≤4%) was observed with the 3' metabolite only, chimeric PS OGN 4, we wanted to verify whether or not the dual ligation- Dilution-1
Low QC 0.375 0.412 9.2 110.0
AAPS, Los Angeles, CA

• Signaling is carried-out using an anti-DIG-HRP conjugate and a fluorescent HRP for concentrations above 4.5 nM (Figure 3). Lower concentrations were below hybridization assay will work for this chemistry.

Conclusion
Mid QC 2.400 2.506 3.5 104.4
substrate. the lower limit of quantitation (LLOQ) for the 3' metabolite, whereas no • Consequently, we compared the signal generated with the dual ligation assay
High QC 4.500 4.433 13.3 98.5
§ Both 5’ and 3’ (N-1) truncated sequences were <LLOQ and therefore undetected.
interference was detected for the 5' metabolite (all data points <LLOQ). performed for the phosphodiester s2B versus a fully PS s2B in mouse plasma.
• Metabolites shorter than 1 nucleotide have not been tested. Nonetheless, it is Surprisingly, the dual ligation assay is permissive for PS OGN (Figure 5). In
Figure 1: Schematic representation of the dual ligation-hybridization assay.
safe to assume that there will be less interference with shorter metabolites fact it is at the upper end of the curve that we begin to see an inflexion, A dual ligation-hybridization assay has been developed that is highly specific for the
Conclusion. Active pharmaceutical ingredient (API) parent oligonucleotide compounds, Test Oligonucleotide: 3’OH 5’OH
since T4 DNA ligase will be less likely to join nucleotides that are farther from perhaps because the inhibition of PNK by PS is manifesting at higher parent test OGN and without detection of metabolites.
and not metabolites, are detected using the parent-specific hybridization assay. The + each other. concentrations of PS OGN.
method can be adapted to different OMDs and test systems. Template Probe: 5’NH2 3’NH2 The dual ligation assay relies on a bi-enzymatic reaction comprising DNA ligase and
polynucleotide kinase from phage T4. We have shown that both enzymes are
+ necessary for the dual ligation assay to detect a test OGN.
5’PO4

Introduction
Biotinylated 1st Ligation Probe:
Figure 3: Specificity of the dual ligation assay for the parent compound (full-length product) evaluated against Figure 5: Versatility of the dual ligation assay comparing phosphorothioate and phosphodiester variants of the test
the 5' N-1 metabolite and the 3' N-1 metabolite.
The specificity of the dual ligation assay for the parent compound is supported by the
Biotin oligonucleotide.
capacity to discriminate against N-1 metabolites both at the 5' and 3'-ends. We
Whether at the discovery, preclinical or clinical stages, bioanalysis for the determination Denature & Anneal
50000 35000 observed a low unspecific background (≤4% at the upper end the curve) coming from
of investigational oligonucleotide (OGN) therapeutics in biological matrices is performed 45000 the ligation over a one nucleotide-gap at the 3'-end of the test OGN and no
Full-length product Phosphodiester
using hybridization assays 1. They include sandwich, competitive, ligation 2 and nuclease-
- Bind to Microtiter Plate via Biotin
- Wash-off Unbound Oligonucleotides and Matrix
30000 background coming from the 5'-end.

Relative Fluorescence (RFU)

40000 5' N-1 metabolite Phosphorothioate

Relative Fluorescence (RFU)

based 3 methods.
5’PO4 3’OH 35000
3' N-1 metabolite 25000 With the added advantage of specificity for the FLP, overall the dual ligation assay
5’OH
performed similarly to the ligation-hybridization assay, and notably from the
At this time, there appears to be no hybridization assay that is specific only for parent 30000
20000 perspective of OGN chemistry versatility. Validation parameters including intra-assay
(full-length) test OGNs. Indeed metabolites short of 1, 2 or more nucleotides over the full-
T4 Polynucleotide Kinase 25000 precision and accuracy, matrix specificity, dilution linearity and prozone effect
length product (FLP) will also be detected.
15000 demonstrated the robustness and reproducibility of the dual ligation assay.
20000
5’PO4 3’OH
It was thought to be of great benefit to develop a method to determine FLPs, which have 5’PO4
One advantage of chromatography and electrophoresis (CGE) over hybridization
15000
both 5'- and 3'-ends intact. The ligation reaction was thought to be well suited for this 10000
assays are in separating parent OGN and metabolites, where individual species are
purpose, considering the considerable specificity of T4 DNA ligase. Ligation however Single Step
Reaction
10000
separated as peaks in function of size and/or change. The dual ligation assay can be
cannot occur at the 5'-end since most OGN therapeutics bear 5' hydroxyls instead of DIG-labeled 2
nd
Ligation Probe: on Solid
Support 5000
5000
modified for determining parent as well as shortmers simply by designing the
phosphate moieties which are required for ligation. 3’OH T4 DNA Ligase
appropriate (N-x) template probes complementary to each individual species. Similarly,
0 0
another application for the dual ligation assay is to determine the purity of test OGNs
As a workaround, we have developed a dual ligation-hybridization assay based on 1/ the Ligation site 1 Ligation site 2 0 1 2 3 4 5 6 7 8 0 1 2 3 4 5 6 7 8
that are not amenable to analysis either by HPLC or CGE. Template probes are
reaction of polynucleotide kinase (PNK) adding a phosphate group to 5' hydroxyls and, Concentration (nM) Concentration (nM) synthesized that will detect 5' N-1, N-2, N-3, etc. synthesis aborts whose signal will be
2/ the workability of a bi-enzymatic reaction mixture consisting of recombinant PNK and compared to that of the FLP (unpublished results).
DNA ligase from phage T4. Validation parameters: precision and accuracy, specificity, prozone effect and
Reliance on the bi-e
e nzymatic reaction
Wash-off Un-Ligated Metabolites

11/2009
Secondary Antibody / Signaling dilution linearity Finally, we envisage that a dual ligation assay can be developed for multiplexing
complex OGN indications, for example using the Luminex technology platform, by
Methods
• Next we wanted to verify that the two reactions of phosphorylation and ligation
Quantification of the Full-Length (Parent) Test Oligonucleotide
• We have evaluated validation parameters for s2B with the dual ligation assay. using different bead-coupled ligation probes complementary to their corresponding
are necessary for the FLP to be detected. In Figure 4, when the enzymatic
www.criver.com

s2B is a phosphodiester oligodeoxynucleotide with the sequence of a
published siRNA 3. All oligonucleotides are DNA and have 5'-OH and 3'-OH unless
otherwise stated. All oligonucleotides were purified by HPLC.
s2B: gcctcagcacgtacctctatt
s2B 5' N-1: cctcagcacgtacctctatt
s2B 3' N-1: gcctcagcacgtacctctat
s2B template probe: NH2-gaatagcgaaatagaggtacgtgctgaggcggattcacg-NH2
Ligation probe 1: PO4-tcgctattc-[Biotin-TEG]
Ligation probe 2: [Digoxigenin]-cgtgaatcc
Mouse, monkey or human plasma (K2EDTA) were from Bioreclamation Inc.
Oligonucleotides were obtained from IDT Inc. The PNK was purchased from New
England Biolabs whereas T4 DNA ligase was from USB. Anti-DIG HRP was from
Roche Inc. QuantaBlu and HBC Neutravidin-coated plates were from Pierce Inc.
Results
Standard curve
• A representative calibration curve obtained with the dual ligation-hybridization
assay is shown in Figure 2.
• The analyte, s2B, is a 21-nucleotide long DNA OGN that is the positive strand
of a published siRNA 3. The matrix used in this curve for all results reported is
mouse plasma with a K 2EDTA anticoagulant.
• The curve working range was 0.12 nM (0.8 ng/mL) to 4.5 nM (28 ng/mL) using
a linear regression model. The range and overall behavior of the curve is similar
to what is achieved using the more traditional ligation-hybridization assay.
reaction is carried-out with either of the individual enzymes, no signal was
detected above the LLOQ. For a signal above background to be generated,
both T4 PNK and T4 DNA ligase need to be present.
• This demonstrates that the reaction is occurring as schematized in Figure 1,
where a bi-enzymatic reaction takes place. Figure 4 also demonstrates that
there is no background coming from un-reacted compounds and that the
washing conditions satisfactorily eliminate un-ligated OGN.
Generally speaking, the assay performed with comparable results in mouse,
•
monkey and human plasma (K 2EDTA).
In Table 1, the intra-assay precision and accuracy demonstrates that we can
reproducibly determine the test OGN within 10% accuracy in mouse plasma.
• As shown in Table 2, the assay was specific for s2B within ±25% of the
theoretical concentration in five different lots of mouse plasma. Therefore the
dual ligation assay can quantify a test OGN irrespective of individuals'
variations.
• No interference was observed in all matrices tested (mouse, human, monkey)
and there was no detectable prozone effect when tested at a concentration ca.
100-fold the upper limit of quantitation (ULOQ) in mouse plasma.
• In Figure 6, the s2B test OGN was serially diluted in mouse plasma and
analyzed using the dual ligation assay. We demonstrated that the recovery is
linear over the range analyzed.
test OGN-specific template probe.
References
1.Tremblay, G.A. and Oldfield, P.R. 2009. Bioanalysis of siRNA and oligonucleotide therapeutics in
biological fluids and tissues. Bioanalysis. 1(3), 595-609.
2.Baker BF, Yu Z, Leed JM. 2002. Development of an ultrasensitive noncompetitive hybridization-ligation
enzyme-linked immunosorbent assay for the determination of phosphorothioate oligodeoxynucleotide
in plasma. Anal Biochem. 304(1): 19-25.
3.Overhoff, M., Wünsche, W. and Sczakiel, G. 2004. Quantitative detection of siRNA and single-stranded
oligonucleotides: relationship between uptake and biological activity of siRNA Nucleic Acids Res.
Vol. 32, No. 21, e170.
4.Teasdale, R.M., Matson, S.J., Fisher, E. and Krieg, A.M. 1994. Inhibition of T4 polynucleotide kinase
activity by phosphorothioate and chimeric oligodeoxynucleotides. Antisense Res Dev. 4 (4): 295-97.