Sunteți pe pagina 1din 11

EVENT 201 - La loc cu verdeaţă

OgynuFebruary 26, 2020

Shortlink: bit.ly/3ccfxat Materialul poate fi descărcat şi împărţit tuturor în orice formă (mail, site,
print, social, torrent) fără modificări, cu atribuţie: Ogynu. "Share" masiv! Modalităţi de "sharing"
aici: Howto-Event-201.

P.S.: Am văzut că unii deja au plagiat fără referiri  articolul - e de prost gust. Tipic românește
(dacă și în ultimele zile plagiați.. vai de capul vostru). Oricum are dată fixă în telegraph și e
înregistrat cu data februarie în blockchain... (dacă înțelegeți cum merge chestia cu timestamp...)
"Share" înseamnă și un link la original + "autor: Ogynu"...

Grup de discutii pe RIOT (servere distribuite, non GAFA).

CUPRINS:

1. PREAMBUL
2. SUPRAPOPULAŢIA
3. LIMITELE CREŞTERII
4. GLOBALIZAREA
5. PANDEMIA 1320
6. PANDEMIA 2020
7. VIRUSUL COVID-19
8. CRISPR CAS13
9. EVENT-201
10. ID-2020
11. BLOCKCHAIN
12. CONCLUZII
13. NOTE DE SUBSOL

1. PREAMBUL.
Corona-virus COVID-19. La data la care scriu, 26.02.2020, sunt 80k cazuri în lume, 30k
însănătoşiri şi 2760 morţi din cauza corona-virusului COVID-19. Mapa dinamică a răspândirii
este aici, controlată de cei care au simulat pandemia, cu 2 luni INAINTEA izbucnirii. Și o hartă
3D cu răspândirea prin avioanele "globalizate".  OMS estimează că un vaccin nu se va putea
sintetiza înainte de un an. Adică 2021. 

Dar care e substratul? Cine e "de vină"... ? Cheia este la sfârşitul poveştii! 

Pentru cei nerăbdători, e povestea despre cum ajungi de la o pandemie la Revelatia 13:16 în
mod ştiinţific - adică la implant. Cu date certe. Este singura informație de care aveți nevoie în
această viață, deci faceți-vă timp, și citiți!

Pasii sunt:

1. Pandemie declanşată cu un virus controlat în laborator. MIT/Harvard, COVID-19;


CRISPR CAS-19, având însă în prealabil antidotul: CARVER. Se face întâi o simulare
EVENT-201, la care participă Seful Microbiologiei Chineze şi Fundatia lui Bill Gates.
La 2 luni după, se declanşează pandemia, în China. 
2. Epidemia induce haos mondial şi astfel impunerea stării de necesitate în întreaga lume.
Haosul a fost preparat prin impunerea din timp a "globalizarii" şi "liberei circulaţii" - deci
interdependenţă absolută economică între state. Tot din timp a fost introdusă
electronizarea "in masă". Orice cretin are un computer de buzunar, de 10000x mai tare
decat cel de pe modulul lunar Apollo...
3. Introducerea unui vaccin obligator mondial. Alliance ID-2020, Fundatia Gates,
Rockefeller, etc. Bill Gates finanţează vaccinul... si "ne avertiza"  încă din 2018!
4. Odată cu vaccinul se injectează şi microchipul IBM cu Blockchain (Hyperledger);
conform intenţiei declarate a Aliantei ID-2020. Justificarea? Aşa scăpăm de contactul cu
banii sau actele, care pot transmite boli! Cine refuză, e "inamic public al sănătăţii
mondiale" şi ca atare pedepsit sub legea marţială. La noi, vaccinul conpulsor deja a
fost votat (pe şest, chiar după izbucnirea pandemiei), contra principiului "habeas corpus"
(a dispune de corpul tău, textual in latină).
5. Tehnic vorbind, este posibil ca un vaccin să injecteze si ID-ul (adica adresa electonica a
contului) direct in ADN care asa, e modificat "pe vecie" prin tehnologia CRISPR. -
Acesta este "Semnul Fiarei" dextrogir; adică "de mâna dreaptă faţă de axă/frunte",
fiindcă ADN este dextrogir - asta e traducerea corectă a textului din Revelaţia lui Ioan.
6. Tehnic vorbind, ID-ul poate fi injectat într-o zonă aparent neutră a ADN-ului persoanei,
numită "junk-DNA" - adică "gunoi ADN"- cam 90% din ADN! Însă nu este gunoi, ci are
rosturi încă ne-cercetate, pe care însă Cambridge sau  Concordia Univ le bănuie! Existand
deci rosturi ascunse ale ADN-ului zis "gunoi", odata modificat esti un zombie. (vezi
Rev. 14:11). Ai pierdut  "antena fractală naturală"  la frecvenţa ta.
7. Izbucnirea unei pandemii e unica modalitate imaginabilă, de a introduce compulsoriu la
nivel mondial un ID electronic implantat, odată cu vaccinul. Ce altă justificare
"imperativă" ar fi putut avea? Ce altă metodă de a instaura "stare de necesitate"
mondială?? Orice atac la conspiraţie este "demontat" ca "propaganda rusească..." (sic).
De aceea cele mai mari trusturi media participă la Event-201 şi ID-2020. 

După cum vedem a venit şi momentul ăsta din "sfârşitul lumii" care nu era în 2012 (cum au
tradus ăştia greşit din mayaşi) ci în 2020. O mică eroare, nesemnificativă. Desigur nu se sfârşeşte
Universul, ci doar civilizaţia de kkt, din zona asta galactică...  

ŞI ACUM, POVESTEA: 

2. SUPRAPOPULAŢIA

În mod sigur, oamenii suprapopulează azi planeta. Oamenii (ca specie de animal) sunt un
fenomen ciudat. Cu excepţia liliecilor şi a unor maimuţe, nici un mamifer nu are ciclu lunar, ci
anual (suntem guvernaţi în reproducere de Lună/28 zile, nu de Soare). Astfel omul e "proiectat"
să se înmulţească repede. Atipic de repede pentru mărimea sa!

Azi suntem (la kilogram luaţi) comparabili cu insectele, care sunt cele mai numeroase animale de
pe uscat. Dacă un om are în medie 75 kg, insectele "la kg" per-om au 143 kg. Nici un mamifer
mare nu este măcar aproape de oameni ca nr. de exemplare, cu excepţia celor pe care le creştem
pentru a le mânca. Unii fac mai putini copii, in mod natural, ca reactie la "aglomeratie"...(romanii
doar 1,5/femeie, in medie)

Cand e suprapopulatie, in Biblie se scrie: "e timpul secerisului" (R 14:16)

3. LIMITELE CRESTERII

În anul 1972 a fost publicată o carte, numită "Limitele Creşterii". Autorii au legătură cu Clubul
de la Roma, iar cartea a fost sponsorizată de Fundaţia Volkswagen. Este vorba de creştere versus
resurse limitate; nu putem umfla pământul cu pompa. Iar Clubul de la Roma e convins că
"mesajul este actual şi azi". Mai ales azi!

Dar dacă populaţia tot creşte, mânată de instinctele animalice, cineva trebuie să şi moară. Asta e
firea lucrurilor. Şi fiind mulţi, trebuie să moară mulţi. Trebuie să dăm obolul Zeului Morţii (sau
Shiva la indieni şi oculţi). Adică "Malthusianism": cand e suprapopulatie, ea e terminată de boli
si războaie, "natural".

O prima măsură a fost interzicerea DDT; aşa (prin ţânţari+malarie) au murit cam 20 mil. în
Africa între 2004 si 2020. Dar nu este de ajuns. Nu războiul ci bolile sunt cele mai bune mijloace
de a micşora populaţia. Sunt non-conflictuale, discrete. "Dumnezeu" e de vină... Şi sunt şi
"ecologice", nu? "Eco! - La loc cu verdeaţă"
4. GLOBALIZAREA

Globalizarea (inventată de socialişti, vezi "internationala") este probabil cea mai ticăloasă chestie
implementată în utimii ani; depindem de producţia din alte ţări, creierele sunt înfierbântate de
internet, banii "se sug" la centru. E un castel din cărţi de joc, care nu poate cădea decât deodată -
adică tot globul! Asta era şi ideea, în fond! :)

In Biblie, globalizarea este corespondenta "Turnului Babel". Când crezi că l-ai prins pe
Dumnezeu de picior (şi nu-ţi mai ajunge NIMIC în aroganţa ta...) cade castelul... Este un simbol
şi nimic mai mult; dar exprimă TOTUL (indiferent ce crezi despre acea carte).

Au mai existat globalizări în istorie deşi nescrise ca atare; prima a fost a lui Makedon care a
"deschis cutia Pandorei" spre "Drumul Mătăsii". S-a terminat prost cu inflaţie şi haos. 

Apoi este cea a "Renaşterii Gotice" - între 1100 şi 1320 italienii mâncau macaroane produse în
China (de aci a rămas obiceiul în Italia). Comerţul Eurasiei duduia, şi europenii nu mai făceau
altceva decât să se fâţâie pe drumuri, să viziteze sau cucerească "Ţara Sfântă". (Cam ca azi, cu
"travelling") S-a terminat prost, într-o pandemie > Ciuma Neagră - în 80 ani populaţia Eurasiei s-
a micşorat la 50%. 

5. PANDEMIA 1320

Să vedem puţin ce s-a întâmplat atunci, demult. Au fost bolile "naturale", "de la Dumnezeu" sau
sunt involvate şi personaje în toată treaba? Poate puţin din ambele! 

E un fapt cert că natura va reacţiona cândva furioasă la distrugerea echilibrului ecologic, prin
suprapopulaţia oricărei specii. Dar decât să aştepţi ceva necunoscut şi ne-controlabil, mai bine
provoci ceva controlabil în avans! 

Pentru a controla evenimentul fatidic, ai nevoie de 2 lucruri: să poţi manipula un patogen, şi să


ai protecţie gen: medicaţii, vaccinuri. Pare imposibil la acea vreme? 

Veţi rămâne perplecşi să aflaţi că alchimiştii cunoşteau atât manipularea unor patogeni (ca
Yersinia Pestis din cadavre de animale) cât şi: vaccinul (derivat din acupunctură), antibiotice gen
uleiuri esenţiale (thieves blend) + argint coloidal ba chiar şi tetraciclina în bere (foarte efectivă
împotriva bacteriilor gen Yersinia). Deci VIP-urile erau protejate. Iar asta e angular, în orice
"razboi biologic". Cand declanşezi, trebuie sa ai antidot, pentru tine.

Aşa s-a întâmplat cu Ciuma lui Justinian, care (ştim azi) a provenit din comerţul cu Egiptul -
unde se produceau cerealele, dar unde erau şi cei mai mulţi alchimişti vechi. Asta exact la
momentul când Constantinopole se pregătea să cucerească Roma/Scaunul Papal. De fapt ciuma a
izbucnit exact pe acele corăbii (541 A.D.). Coincidenţă, desigur... 
Motivul declanşării ciumei după "Renastearea Gotică"? Pe la 1312 A.D. Philip al Franţei şi apoi
Papa Clement (din Avignon) au distrus Ordinul Templierilor (citiţi "Regii Blestemaţi"). Însă
deoarece tempierii erau bancherii de facto ai Europei, Drumul Mătăsii (şi finanţele sale) cădeau
în mâna tătarilor, care cuceriseră deja China (locul de producţie). Atât unii chinezi cât şi
societăţile secrete europene ar fi avut interesul să distrugă dominaţia tatara pe această rută
comercială - altfel azi eram ... tătari. Aşa că sub dominaţie tătară, China a avut întâi inflaţie
galopantă (bani de hârtie) şi apoi ciuma (Yersinia Pestis). Cam pe la 1320 a izbucnit, şi s-a
răspândit apoi până în Europa... Supravieţuitori? 50%. "Drumul Mătăsii" a fost distrus 500 de
ani. 

De ce nu stiti astea? Fiindcă istoria oficială nu se preocupă decat despre ce "mascul alfa" a batut
alt "mascul alfa"... E istorie de "maimuţe". Nu e ascuns nimic, dar pare "ne-important" cretinilor
de la catedră. Deşi, asta e de fapt istoria reală.

6. PANDEMIA 2020

Condiţiile de azi seamănă ca 2 picături de apă cu cele de la 1320, păstrând proporţiile. Adică:
globalizare, un centru de finanţe, toată producţia de marfă de larg consum în China, etc. În rolul
lui Gingis-Han, este Putin (bau-bau). Desigur, călătorii intense isterizate de reclama ubicuă:
"descoperiţi culturi noi"... Culturi unde unii (din cauză de suprapopulaţie) mănacă insecte şi
lilieci... :) Treaba e cam ca "pelerinajul cruciat" obligator, pe la 1300, în care Biserica era
"agenţia de voiaj". Azi, e cam aşa: "Vai ţaţo, am mers în Malayezia, fă!" Toţi cretinii
admiră Rembrandt şi Van-Gogh în original...(au aflat de aceştia de la agenţia de voiaj...)

COVID-19 a izbucnit tot în China ca şi Yersinia-Pestis acum 700 ani. Căci între cele 2
evenimente sunt exact 700 de ani ("7" e o cifră preferată de ocultişti)

Există doar o singură întrebare; e posibil să fie involvat cineva în a "ajuta natura" şi azi? O
bacterie nu se mai poate folosi, căci avem antibiotice, şi astfel focarele se pot "controla din faşă".
Deci singurii utilizabili sunt viruşii. Contra viruşilor nu avem prea multe mijloace de apărare -
uneori nici măcar vaccinul preventiv nu merge. 

Dar să adâncim puţin subiectul, cu "ultimele cercetări". Căci aşa cum spuneam pentru a provoca
dar şi controla o epidemie, trebuie să ai 2 elemente: agentul patogen şi un mijloc de apărare; o
medicaţie pentru VIP-uri. 

7. VIRUSUL COVID-19

Virusul acesta face parte de fapt dintr-o familie destul de comună. Multe viroze respiratorii,
răceli şi pneumonii sunt provocate de viruşi din familia "corona". Diferenta cu acest nou
COVID-19, este doar că e mai agresiv decât cele "obişnuite". Adică NOI nu suntem "obişnuiţi"
cu el - Orice virus a omorât întâi mii de persoane iar supravieţuitorii au lăsat urmaşi "rezistenţi"...
Aşa merge treaba în natură. 

Putem vedea detalii de pe pagina "corona" din Wikipedia. (care în acest caz, e destul de acurată).
Aceşti corona sunt "viruşi anvelopati", adică nucleul ARN este îmbrăcat într-o coajă, aşa cum e
miezul în nucă. 

Mai aflăm din Wikipedia că împotriva acestor genuri de virus nu funcţionează nici măcar
vaccinul, şi în orice caz nu funcţionează "preventiv" ci curativ. Deci nu avem cum să "izolăm
focarele" eficient. 

De asemeni într-un articol adiacent vedem că liliecii sunt "oaia neagră" ca (posibil) rezervor
pentru acest fel de viruşi, ca şi pentru multe alte boli similare (aşa cum şobolanii erau pentru
ciumă). Convers, dacă vrei să manipulezi genetic viruşi, întâi îi cauţi la lilieci... :) 

Din cauză că nu există nici măcar vaccinuri, se pare că nici nu poate fi folosit ca "armă de
extincţie" fiindcă VIP-urile nu-s protejate! (am pus condiţia asta esenţială în avans, vezi mai sus)
Întrebarea este: chiar nu avem mijloace de a contracara astfel de viruşi cu toată tehnica modernă
şi ingineria genetică? Hmmmm... :)

8. CRISPR CAS13

Să facem acum cunoştinţă cu un instrument fantastic numit CRISPR. Ca să nu intrăm în detalii


tehnice ne-inteligibile, este ca "foarfece+maşină de cusut ADN" Cu alte cuvinte, dacă ştii ce faci,
poţi tăia şi croi ADN-ul aşa cum un croitor repară sau creează haine. De exemplu poţi tăia ADN-
ul din drojdia de bere, şi băga un "tiv" cu o genă care să producă uleiuri esenţiale rare şi
imposibil de sintetizat chimic. Sau enzime. Sau peptide. Orice, este posibil... Eşti ca Dumnezeu
(dar numai aparent...).

De exemplu poti injecta in ADN un text din Coran sau Biblie (tradus in bazele ADN AGCT) ....
Tot aşa poti injecta în ADN şi un ID matematic care să poată fi citit de un microchip, in base64
care foloseste cifre si litere traduse in AGCT la fel. Firma Carverr ofera asta, inclusiv modul de
"citire".

Acest detaliu este angular căci prin el se poate modifica ADN-ul cu "semnul Fiarei" adică un un
hash criptografic de blockchian inserat în ADN. ȘI asta nu privește numai creștinii; orice
persoană cu ADN modificat devine "Zombie" (nu mai are "antena naturală").

CRISPR-kit se vinde "la liber" şi asta e îngrozitor; nici un stat nu mai poate controla
"monstruleţii" care ies din mâna unui croitor prost sau şi mai rău, nebun. Dar asta e situaţia, nu-s
eu cel care poate să o schimbe.

În prima fază acest kit ştia să manipuleze doar ADN, care este specific organismelor complexe şi
bacteriilor. Dar dupa 2016, s-a completat cu elemente care pot manipula ARN (care e cam ca
"juma de ADN"). Ei bine, ARN este specific viruşilor, inclusiv celor "corona"! ARN-ul este
"ADNul lor" îmbrăcat în "anvelopa" menţionată.

Cu alte cuvinte poţi manipula ceva în acei viruşi. Şi cu asta avem juma de "dovadă". Ştim CĂ
pot, şi CUM pot fi manipulaţi. 

Dar nu ştim încă dacă există medicaţie specifică acestor viruşi, uşor modificaţi. Ei bine, există!
Anul trecut chiar (2019), oamenii de ştiinţă au folosit CISPR CAS13 pentru a crea o metodă
(CARVER) care omoară viruşii noi, în celulele infestate! Şi cu asta avem a 2-a condiţie: să
existe medicaţie pentru VIP-uri. 

Ca supremă ironie, aceiaşi cercetatori (de la Harvard)  folosesc acelaşi CRISPR CAS13 pentru a
"cerceta" COVID-19. Toate elementele "conspirative" sunt îndeplinite. Numa' că nu-s puse în
practică... :) Oare?

Şi acum începe deabia, povestea cu adevărat nebună. 

9. EVENT 201

Vineri 18 Octombrie 2019 o serie de VIP-uri mondiale se întâlneau la hotelul de ultra-lux Pierre
din New-York, pentru a face o simulatie globală - Event 201 (link la site oficial).

Ce simulau dânşii la acea dată, în acea pașnică întrunire? 

O pandemie mondială, creată de un virus corona, transmis de la lilieci la porci şi oameni... (sună
cunoscut?) Rezultatul simulării: 65 milioane de morţi pe tot mapamondul, şi o scădere a
bursei de 40%. Epidemia se rezolvă după un an, apare un vaccin şi după aceea virusul devine
"mai inofensiv" ca o boală de copilărie (gen pojar..). 

Dacă nu v-aţi prins încă, menţionez că 18 Octombrie 2019 este cu 2 luni înainte de primul caz de
corona depistat în China - în decembrie 2019. Că aşa se face; întâi o simulaţie, să ştii ce rezultat
obţii. Nuu? Asa e profesional!

Cine participă? Nu guverne, iar WHO lipseste... ( e logic cand se simuleaza o pandemie, nuuu?)
Participa un mix bizar de consorţii prin reprezentanţi + câteva organizaţii, inclusiv private; de
exemplu fundatia lui Bill Gates (ala cu vaccinurile)... Dar şi World Economic Forum. Toate
datele sunt publice aici.

Între participanţi sunt reprezentanţi ai unor companii: Hasti Taghi (NBC & WEF), Latoya D.
Abbott (Marriot Int.), Martin Knuchel (Lufthansa) Lavan Thiru (Monetary Authority of
Singapore), etc...

Dar şi oameni de ştiinţă deosebit de capabili şi cu statut de VIP în lumea medicală mondială. Mai
precis  George F. Gao, Directorul General al Centrului de Prevenţie şi Control al Bolilor din
China şi Preşedintele Institutului de Microbiologie al Acad. Chineze. A cercetat şi la Harvard
(ăia cu CRISPR-CAS13, vezi mai sus). Iar domeniul său de cercetare e fix microbiologia, în
speţă viruşi anvelopaţi (deci şi corona). Treaba incepe să fie limpede.

10. ID-2020

Bun. Că trebuie să răsfirăm, am înţeles. Că treaba mai bine e controlată decât să o facă natura, iar
am înţeles. Că virusul atacă predilect bătrânii, e logic (economie la fondul de pensii...). Că unii
au fabricat medicamentul deja, pentru VIP-uri, iar e clar. Dar, pardon, ce caută Bill Gates în toată
treaba? Că vrea să ia la lopată economia, are o logică. Dar şi mai interesantă e logica de a
combina un vaccin (de care Bill e foarte obsedat) cu un ID electronic (carte identitate). Via
microchip injectat odată cu vaccinul.

Sigur, asta e doar o "teorie conspiraţionistă", fiindca aşa ceva nu se poa'. Serios? Iete aici:
Alianta ID-2020, asta fiind pagina oficială - cu vaccin+ID: Microsoft, Gavi (Alinata
vaccinurilor) Fundatia Rockefeller (+câţiva din media, de umplutură). Combină vaccinul
compulsoriu (obligator) cu un microchip injectat! (creat deja de IBM) Explicaţia in engleză in
acest articol. Sau aici. Numele alianţei arată că planul e fix: anul 2020.

Acum totul se limpezeste: pandemie controlată> vaccin obligator> Bill bagă chipul în vaccin
> deci în "fundul nostru". Dat fiind "starea de necesitate" (ca o dictatură) nu poţi refuza
vaccinul (deci chipul) fiindcă "periclitezi sănătatea publică"! Ce treaba are sănătatea cu
microchipul?... Păi cum să mai atingi bani si acte de hârtie, fără să dai virusul si altora? Nuuu? E
logic! De fapt, fără o pandemie era imposibil să justifice aşa ceva. Bine ticluit, ce să zic....

E clar despre ce e vorba: Revelatia 13:16."Ca nimeni să nu poată să cumpere sau să vândă fără
să aibă semnul fiarei"...etc. Adica implant. Oameni credincioşi ce mai! Doamne ajută! Aşa că,
pentru cine se opune injectării, băieţii au aranjat deja cosciuge in lagare FEMA şi... 30,000
ghilotine. Comandate din timp de guvernul USA - à la Robespierre. Aceasta este moartea intaia,
Rev. 20:6.

11. BLOCKCHAIN

Tehnologia de urmărire fără drept de apel prin microchip este o capodoperă matematică numită
Blockchain. Nu este doar un ban pur electronic, acesta a fost creat demult, în 1985 de Chaum.
Dar acea versiune a fost refuzată, că nu era controlabilă "de la ţentru", vorba lui Caragiale!
Fiindcă moneda electronică rămânea la tine pe computer, ca în buzunar!

Noua "monedă virtuală" nu e o monedă, ci o bază de date imutabilă şi imposibil de spart cu


cunoştinţele noastre matematice actuale. (detalii în engleză în acest blog) Nu-i monedă fiindca e
un cont, iar tu nu posezi nimic la tine, înafara de ID. (iar ID-ul poate fi injectat  in ADN cu
CRISPR) Este "centralizată" la băncile numite "mineri" care se spionează una pe alta electronic-
automat, să nu falsifice datele... acolo stau banii de fapt. Lumea fără bani, visată de bolşevici. Nu
are rost să intru în detalii. Există versiuni "neoficiale" sau unele "oficiale" controlate autoritativ.
E clar ce variantă va fi implementată... 

"Blocurile-de-lanturi" (blockchains), au apărut de nicăieri, creatorul fiind anonim. Cine ştie ce


"alien" este Satoshy Nakamoto...? Şi dacă e "alien" cine ştie ce intenţii a avut? Sau cine stie ce
matematică superioară a folosit?

Oricum, toată "conspiraţia" a sărit în barca asta, pentru a controla fiecare suflare de pe Terra. Să
o pună în "lanturi-matematice". Aşa cum Prometeu era legat de piatră când vulturul îi mânca
ficatul... Le plac "lanţurile", ca la sclavi, ce aveţi cu ei? 

12. CONCLUZII

Ştim acum următoarele: 

1. Pandemiile puteau fi "ajutate" de alchimişti în trecut cu 2 condiţii: să cunoască cum se


manipulează patonegul (ciuma pe atunci, uşor de extras din cadavre de animal) şi apoi să
aibă un antidot secret pentru VIP-uri: tetraciclină in bere, uleiurile esenţiale, argintul,
vaccinul (documentat în China pe la anul 1000) 
2. Azi putem modifica ARN-ul unui virus cu ajutorul enzimei CAS13 şi a kit-ului CRISPR.
De asemeni putem genera enzime care să distrugă virusul în celula-gazdă, cu ajutorul
aceluiaşi CAS13- CARVER. Deci ar putea exista antidot pentru VIP-uri. Şi tot cu CAS13
(şi de aceiaşi specialişti de la Harvard/MIT) se cercetează virusul COVID-19.Tot prin
CRISPR se poate injecta un blockchain-ID (un hash) în ADN, mai precis în partea de
"non-coding" numită "junk". Deci se poate injecta "Semnul Fiarei".
3. Timing: Pe la mijlocul 2019 s-a descoperit antidotul de viruşi la Harward, cu CAS13. În
18 Octombrie 2019 s-a simulat o pandemie cu corona provenit de la lilieci. La acea
simulare a participat şeful microbiologiei chineze care şi el a lucrat cu echipa Harward şi
are specializarea în viruşi anvelopaţi. De asemeni a participat fundaţia lui Bill Gates, ăla
cu vaccinurile care "micşorează populaţia". Apoi s-a lansat virusul in China.
4. Pe pagina fundaţiei sale, Gates zice: "Toate vieţile au valoare egală. Suntem nerăbdători
şi optimişti să reducem inechitatea." Trebuie să recunoaştem că în faţa morţii, chiar
suntem toţi egali. Ştie Bill ce spune. Și are și umor - chiar dacă lugubru... (Vrea omu' să
reducă inechitatea! Ce aveţi cu el?) ..... Vedeti? Asta e soarta inventatorilor americani.
Edison a început cu becul şi a sfârșit inventând scaunul electric. Ăsta a produs un sistem
operare (copiat după  Gary Kildall) niște ferestre (copiate după Apple) și a sfârșit copiind
viruși de lilieci... ca sa bage microchipuri in curul lumii (plagiate dupa Ioan 13:16).
Plagiate rau, caci codul de bare e cu 666.
5. Sensul final este sa bage un vaccin obligator, si odata cu el un microchip injectat,
conform Aliantei ID-2020. În viitorul imediat, direct codul - in ADN. D-aia toata
tevatura... Asa că totul, absolut totul va fi "electronizat" via Blockchain / Hyperledger. Cu
semnul dextrogir in ADN - (R 13:16). Gata, nu mai pui mâna pe bani sau acte, şi aşa nu
mai iei viruşi! Ne-a "salvat"! E "salvatorul" (salvator=soter, christ în greacă)... Totodată e
şi anti-salvatorul, că el a provocat toată treaba. Adică, în greacă.... ştiţi. Antichrist.

Cam asta. Totul e logic şi ecologic: La loc cu verdeaţă (şi Windows-10 bagat in fund).
Merge ş-aşa; Doamne ajută!

13. NOTE DE SUBSOL

Revelatia: Poate vă frământă cum a putut Ioan din Patmos să știe acum 2000 ani toate aceste
detalii. E simplu; prin time-travel. Daca noi o vom putea face în viitorul apropiat, cum să nu o
poată face Dumnezeu! Tot așa cum putem teleporta în câțiva ani 725MB x 2, deci ADN-ul unei
persoane, de exemplu direct în uterul unei fecioare. Cu resurecția e mai greu.... pentru noi. Deci
textul "ocult, ignorant" e complet adevărat, și chiar științific.

Fiara: În ce priveşte tehnologia cu INTERNET + CRISPR, gândiţi-vă la următoarele: Un


păianjen întâi întinde o plasă (internet-ul). Apoi injectează victimele prinse (internauţii, adică
miliarde aici) cu un suc gastric peptidic paralizant (aici CRISPR + blockchain-ID). Păianjenul
e singura fiinţă de pe Terra care digeră prada în exteriorul corpului... după care o "suge cu paiul".
Poate că e "alien-arahnid". Sau poate doar un simbol, ca Arachne. Cea care a concurat şi sfidat
zeii... Iar Fiul Omului e al Omului, nu al "insectei" după cum se vede la ăştia.

Obiectele sfintite: Bolile nu se iau de pe obiectele sfintite din 2 motive: A. Efectul Placebo al


credintei ( Placebo e un mister și azi, vezi Marcu 11:22). B. Uleiurile esențiale din busuioc,
cimbru și alte mirodenii + argintul linguriței, în vinul de împărtășanie. Aceste 2 elemente
funcționează la boli ușoare, în special efectul Placebo. Gândiți-vă la apa Gangelui, complet
jegoasă, care ar omorî orice alt om, înafara credincioșilor indieni. Dacă însă nu "crezi destul", iei
boala. Așa s-a întâmplat în "Ciuma lui Justinian" sau azi la Corona, când Biserica recomandă să
nu mai pupi icoanele din biserici...

Howto: Cum se poate realiza "vaccinul" cu Blockchain-ID? (Adică "Semnul FIarei" dextrogir,


final)

Se generează un hash, de exemplu în BITADRESS. Am generat unul:

Adresa secretă:  L3mdJxXpHytepfpTaVVhufiqZagapvZDUv13x3HYBCiv3qygnuK4 


Adresa publică: 1E1z4xmjzQjnsk3QTVtmiPUZcQZyHUvBBi

Adresa secretă o transpunem in ACGT -adică bazele ADN- in DNA-WRITER

ATCGTGACATACTGCAGTAGTGAGCGTGACTAGCTA
GAGGCTGAGTAGACTGTAGTACGTGATGCTCTGTAT
GCAACTGTCACTGAGGTAGCATACGATGTATCTGTG
AGTGTGCGTGACCATTCACTGGTAGTGTATGACGTC CTCGATTCGAGA

Aceasta mică secvenţă de gene se transpune in realitate cu o maşină ca aceasta: KILOBASER,


care practic "printează" moleculele. Microsoft (al lui Bill Gates, n.n.) are una  de mare serie, ca și
soft pentru CRISPR -(CRISPR-ML) Se pot multiplica apoi, cu un aparat ieftin PCR.

Ca să citeşti secvența de gene ai nevoie de un aparat ca acestea: NANOPORETECH şi eventual


de un aparat ieftin PCR. Intre punctele 3 si 4 mai rămane un pas esential: injectarea acestei mici
secvențe ADN in zona de"noncoding-DNA". Aceasta se poate face cu CRISPR via vaccin
(virusii sintetici Vectorbuilder), în viitorul imediat (max. 3-4 ani). Primul pas e insă pur
electronic, cu microchip injectat.

Referințe: mulți oameni au intuit că "Semnul Fiarei" ar avea cumva legatură cu modificarea
ADN-ului, dar precizările nu erau clare, din lipsă de date... Soluția tehnică + oportunitatea e
simplă, explicată mai sus. Căutați online "Mark of the Beast DNA" și găsiți:

The Genetics of the Mark of the Beast - Amazon.com

How the Mark of the Beast Will Rewrite the Human Genome

VW: Mark of the Beast: a potential scenario?

26- Is The Mark of the Beast A DNA Change? – Prophecy Talk

CERN, DNA, and the Mark of the Beast | - Jim Duke Perspective

...etc, etc.

P.S.#2: iată nivelul de "credință" din Romania; e a 2-a țară după Turcia ca procent de folosire a
banilor crypto... 12%.