Sunteți pe pagina 1din 11

Probleme rezolvate - structura

acizilor
1. Câte nucleotide are o moleculă ADN dacă una dintre catene are 10.000 de nucleotide?

Răspuns: o moleculă ADN este alcătuită din două catene complementare, deci dacă o catenă are
10.000 de nucleotide și cealaltă catenă va avea tot 10.000 de nucleotide:

10.000 nucleotide X 2 = 20.000 de nucleotide


2. Știind că o moleculă ADN are 300 de nucleotide cu adenină și 400 de nucleotide cu citozină
aflați câte nucleotide cu timină are această moleculă.

Răspuns: știind că bazele purinice (adenina și guanina) sunt complementare cu cele pirimidinice
(timina și citozina) rezultă că într-o moleculă ADN câte nucleotide conțin adenină tot atâtea
nucleotide conțin și timină. Deci 300 nucleotide cu adenină, rezultă că sunt tot 300 nucleotide cu
timină.
3. Aflați numărul nucleotidelor cu adenină dintr-o moleculă ADN de 6000 de nucleotide, știind
că 1000 de nucleotide conțin guanină.

Răspuns: din complementaritatea bazelor știm că numărul nucleotidelor cu guanină este riguros egal
cu numărul nucleotidelor cu citozină:

1000 nucleotide cu guanină => 1000 nucleotide cu citozină

așadar 2000 de nucleotide guanină + citozină;

6000 - 2000 = 4000 nucleotide cu adenină și timină;

știind că numărul nucleotidelor cu adenină este riguros egal cu cel al nucleotidelor ce conțin timină:

4000 : 2 = 2000 nucleotide cu adenină

4. O moleculă ADN conține 1000 de nucleotide. Știind că 10% dintre ele conțin citozină aflați
numărul de molecule care conțin adenină.

Răspuns: aflăm numărul de nucleotide ce conțin citozină:

10% X 1000 = 100 nucleotide cu citozină;

100 nucleotide cu citozină => 100 nucleotide cu guanină;

100 + 100 = 200 nucleotide (citozină + guanină);

1000 - 200 = 800 nucleotide (adenină + timină);

800 : 2 = 400 nucleotide cu adenină


5. Aflați câte legături duble de hidrogen conține o moleculă ADN de 3000 de nucleotide știind
că ea conține 20% nucleotide cu guanină.

Răspuns:
 aflăm numărul nucleotidelor cu guanină:

3000 X 20% = 600 nucleotide cu guanină;


 aflăm numărul nucleotidelor cu guanină și citozină:

600 X 2 = 1200 nucleotide cu guanină și cu citozină;


 aflăm numărul nucleotidelor cu adenină:

3000 - 1200 = 1800 nucleotide cu adenină și cu timină;

1800 : 2 = 900 nucleotide cu adenină;


 aflăm numărul legăturilor duble:

900 nucleotide cu adenină => 900 nucleotide cu timină => 900 de legături duble.

Mai există un model de rezolvare. Puteți rezolva problema și în alt mod?

6. Câte legături de hidrogen conține o moleculă ADN de 800 de nucleotide știind că nucleotidele
cu timină reprezintă 30% din numărul total de nucleotide?

Răspuns:
 aflăm numărul nucleotidelor cu timină:

800 X 30% = 240 nucleotide cu timină;


 aflăm numărul nucleotidelor cu citozină:

[800 - (240 x 2)]: 2 = 160 nucleotide cu citozină;


 aflăm numărul legăturilor duble și triple:

240 nucleotide cu timină => 240 legături duble de hidrogen

160 nucleotide cu citozină => 160 legături triple de hidrogen


 aflăm numărul total de nucleotide din molecula ADN:

(240 x 2) + (160 x 3) = 960 de legături de hidrogen


7. Aflați câte nucleotide are o moleculă ADN știind că are 700 nucleotide cu guanină și de trei
ori mai multe nucleotide cu adenină.

Răspuns:
 aflăm numărul nucleotidelor cu adenină:

700 x 3 = 2100 nucleotide cu adenină;


 aflăm numărul nucleotidelor din moleculă:

(700 x 2) + (2100 x 2) = 5600 nucleotide în total

8. Stabiliți structura catenei complementare următoarei catene ADN:

ATCGTTGCAAATGCAATGTTACAATTGCTCAAAGGTCACTGCTGA

Răspuns: pe baza complementarității bazelor

ATCGTTGCAAATGCAATGTTACAATTGCTCAAAGGTCACTGCTGA

TAGCAACGTTTACGTTACAATGTTAACGAGTTTCCAGTGACGACT
9. O catenă a unei molecule ADN conține 2500 de nucleotide. Știind că 40% sunt cu timină
aflați numărul nucleotidelor cu adenină din catena complementară.

Răspuns:
 aflăm numărul de nucleotide cu timină:

2500 x 40% = 1000 nucleotide cu timină;


 aflăm numărul de nucleotide cu adenină din catena complementară:

1000 nucleotide cu timină => 1000 nucleotide cu adenină în catena complementară


10. Sinteza unei proteine cerebrale se face pe baza informației deținute de un fragment al unei
molecule de ADN. Știind că o catenă din acest fragment conține 1880 de nucleotide și că
fragmentul bicatenar conține 848 nucleotide cu adenină stabiliți numărul nucleotidelor cu
citozină din fragmentul bicatenar.

Răspuns:
 aflăm numărul de nucleotide al fragmentului bicatenar:

1880 x 2 = 3760 nucleotide;


 aflăm numărul nucleotidelor cu timină din fragmentul bicatenar:

848 nucleotide cu adenină => 848 nucleotide cu timină;


 aflăm numărul nucleotidelor cu guanină și citozină din fragmentul bicatenar:

3760 - (848 + 848) = 2064 nucleotide cu citozină și guanină;


 știind că numărul de nucleotide cu citozină este egal cu numărul celor cu guanină:

2064 : 2 = 1032 nucleotide cu citozină.


Probleme rezolvate cu grupe de sange
Problema 1

Mama are grupa de sânge 0 iar tatăl are grupa de sânge AB. Ce grupe de sânge pot avea
copiii?

Rezolvare:

Fenotipurile celor doi părinți sunt grupa de sânge 0 și grupa de sânge AB. Căutăm în tabel să
vedem care sunt genotipurile acestor fenotipuri și iată ce găsim: genotipul grupei 0 este ll iar
genotipul grupei AB este LALB. Schematic, încrucișarea celor doi indivizi ar arăta așa:

Așadar copiii pot avea fie fenotipul grupa de sânge A (genotip LAl) fie fenotipul grupa de sânge B
(genotip LBl). Exista 50% șanse pentru fiecare dintre aceste variante.

Problema 2

Mama are grupa de sânge A homozigot iar tatăl are grupa de sânge B homozigot. Ce grupe de
sânge pot avea copiii?

Rezolvare:

Fenotipurile celor doi părinți sunt grupa de sânge A homozigot și grupa de sânge B homozigot.
Căutam în tabel să vedem care sunt genotipurile acestor fenotipuri și iată ce găsim: genotipul grupei
A homozigot este LALA iar genotipul grupei B homozigot este LBLB. Schematic, încrucișarea celor
doi indivizi ar arăta așa:
Așadar copiii pot avea doar fenotipul grupa de sânge AB (genotip LALB).

Problema 3

Mama are grupa de sânge A heterozigot iar tatăl are grupa de sânge B heterozigot. Ce grupe
de sânge pot avea copiii?

Rezolvare:

Fenotipurile celor doi părinți sunt grupa de sânge A heterozigot și grupa de sânge B heterozigot.
Căutam în tabel să vedem care sunt genotipurile acestor fenotipuri și iată ce găsim: genotipul grupei
A heterozigot este LAl iar genotipul grupei B heterozigot este LBl. Schematic, încrucișarea celor doi
indivizi ar arăta așa:

Așadar copiii pot avea orice grupă de sânge.


Problema 4

Mama are grupa de sânge A heterozigot iar copilul are grupa de sânge B heterozigot. Ce grupe de
sânge ar putea avea tatăl?

Rezolvare:

Fenotipul mamei este grupa de sânge A heterozigot iar fenotipul copilului grupa de sânge B
heterozigot. Căutam în tabel sa vedem care sunt genotipurile acestor fenotipuri și iată ce găsim:
genotipul grupei A heterozigot este LAl iar genotipul grupei B heterozigot este LBl. Schematic,
încrucișarea a doi indivizi dintre care unul are genotipul amintit ar arăta așa:

După cum se observă din schema de mai sus copilul are o gena LB pe care nu o poate primi decât de
la tată (deoarece mama nu are gena aceasta). Așadar tatăl trebuie să aibă obligatoriu gena LB. Privind
în tabel observăm care sunt grupele de sânge ce conțin această genă: grupa B homozigot, grupa B
heterozigot și grupa AB. Deci tatăl va fi un bărbat care are grupa de sânge fie B, fie AB.
Probleme rezolvate
1. Câți codoni conține o catenă ARNm matur care copiază un fragment de 600 de nucleotide a
unei catene ADN?

Răspuns: știind că un codon are 3 nucleotide, știind că molecula ARNm are 600 de nucleotide:

600 : 3 = 200 de codoni.


2. Știind că prin maturarea ARNm se pierd 40% dintre nucleotide aflați câte nucleotide are
molecula de ARNm matur care trascrie o catenă de 1200 de nucleotide.

Răspuns: ARNm precursor va avea 1200 de nucleotide


 aflăm numărul de nucleotide din introni:

40% x 1200 = 480 nucleotide;


 aflăm numărul de nucleotide din molecula ARNm matur:

1200 - 480 = 720 de nucleotide.


3. Câți aminoacizi are un polipeptid pentru care se copiază o catenă ADN de 400 de nucleotide
știind că molecula de ARNm precursor pierde 10% din nucleotide în procesul de maturare?

Răspuns:
 aflăm numărul de nucleotide al moleculei de ARNm matur:

400 - (10% x 400) = 360 de nucleotide;


 aflăm numărul de codoni:

360 : 3 = 120 de codoni;


 aflăm numărul de aminoacizi din catena polipeptidului (știind că ultimul codon este NON-
SENS):

120 - 1 = 119 aminoacizi


4. Câte nucleotide conține fragmentul ADN prin a cărui transcripție se formează un hormon
polipeptidic de 350 de aminoacizi știind că prin procesul de maturare se îndepărtează 90% din
nucleotidele ARNm precursor?

Răspuns:
 aflăm numărul de nucleotide al moleculei ARN matur:

350 x 3 = 1050 nucleotide;


 aflăm numărul de nucleotide ale moleculei de ARNm precursor:

1050........................10%

x............................100%

-----------------

x = 10.500 nucleotide

fragmentul de ADN are 10.500 de nucleotide transcrise în molecula ARNm precursor


5. Prin transcripție se formează o moleculă de ARNm precursor de 2000 de nucleotide Știind că
intronii reprezintă 70% din această moleculă aflați:

a) numărul de aminoacizi sintetizați în ribozom pe baza acestei molecule ARN;

b) numărul de nucleotide ale moleculei ADN de pe care s-a copiat informația, știind că s-a
transcris jumătate dintr-o catenă;

c) completați problema cu altă cerință pe care s-o rezolvați.

Răspuns:
 aflăm numărul de nucleotide din molecula ARN matur:

2000 - (70% x 2000) = 600 nucleotide;


 aflăm numărul de codoni conținuți de ARNm:

600 : 3 = 200 codoni;


 aflăm numărul de aminoacizi:

200 - 1 = 199 de aminoacizi;


 aflăm numărul de nucleotide al catenei de pe care s-a transcris informația în ARNm:

2000 x 2 = 4000 nucleotide;


 aflăm numărul de nucleotide din moleculă:

4000 x 2 = 8000 de nucleotide;


 altă cerință:

Câte nucleotide conțin intronii din molecula ARNm obținută prin transcripție?

Rezolvare: 70% x 2000 = 1400 nucleotide.


Probleme rezolvate

Problema 1

Ce volum de sânge are un bărbat de 75 de kg?

Rezolvare:

Știind că volemia (volumul de sânge) al unui om este de 7% din greutatea corporală, calculăm cât
reprezintă acesta din greutatea omului în chestiune:75 X 7% = 5,25 l de sânge. Calculul poate fi făcut
și cu regula de trei simplă:

100kg..............................7l sânge

75kg...............................xlsânge

_________________________

x = 7 X 75 / 100

x = 5,25l de sânge

Problema 2

Ce volum de plasmă are un om de 60 de kg?

Rezolvare:

Aflăm, inițial, ce volum de sânge are omul respectiv: 60 X 7% = 4,20 l de sânge. Știind ca plasma
reprezintă 45% din volumul sângelui aflăm volumul de plasmă: 4,20 X 45% = 1,89 l de plasmă.

Problema 3

Ce volum de apă are în sânge un om de 120 de kg?

Rezolvare:

Aflăm volemia acestui om: 120 X 7% = 8,4 l de sânge. Apoi aflăm volumul de plasmă: 8,4 X 45% =
3,78 l de plasmă. Știind ca 90% din volumul plasmei este apa, aflăm volumul de apă din plasmă: 3,78
X 90% = 3,4 l de apă în plasmă.
Problema 4

Câte hematii are o femeie de 50 de kg?

Rezolvare:
6
Aflăm volemia femeii: 50 X 7% = 3,5 l de sânge. Știm că o femeie are 4,5 X 10 (4,5 milioane) de
3 3
hematii în fiecare mm de sânge, știind că 1 litru este echivalent cu un dm , aflăm câți mm3 de sânge
3 6 3 3 6
are femeia: 3,50 l = 3,50 dm = 3,5 X 10 mm . Dacă fiecare mm de sânge conține 4,5 X 10 hematii,
6 6 3 12
atunci numărul total de eritrocite al femeii este: 4,5 X 10 X 3,5 X 10 mm = 15,75 X 10 hematii.

ȚINE MINTE!!!!

1. Un decimetru cub (dm3) este egal cu un litru! 1 dm3 = 1 l;


2. Un decimetru cub are 1 milion (106) de milimetri cubi (mm3);

3. Este mult mai ușor să lucrezi cu puteri ale lui zece, iar dacă înmulțești numere mari, puterile lui 10
se adună:

106 X 106 = 1012

106 X 105 = 1011


Problema rezolvata respiratie
Aflați capacitatea vitală a unui sportiv în următoarele condiții:
1. volumul curent este de 500 ml;
2. CPT are valoarea 5500 ml;
3. volumul rezidual este de trei ori mai mare decât volumul curent;

REZOLVARE:
1. Dacă VR este de trei ori mai mare decât VC înseamnă că VR = 3 X VC (3 X 500 ml), așadar va avea
valoarea de 1500 de ml;
2. Știind că CPT este suma între volumul rezidual și capacitatea vitală aflăm, prin scădere, valoarea
capacității vitale: 5500 ml - 1500 ml = 4000 de ml.

Răspunsul corect este:

CV = 4000 de ml de aer.