See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/332018481

Research Article ISSR and SSR markers for determining genetic relationships
among three wild species of Passiflora

Article · January 2019

DOI: 10.4238/gmr18040

CITATIONS READS

0 129

7 authors, including:

Telma NAIR SANTANA Pereira Eileen Azevedo Santos

Universidade Estadual do Norte Fluminense Universidade Estadual do Norte Fluminense
102 PUBLICATIONS   1,316 CITATIONS    42 PUBLICATIONS   338 CITATIONS   

SEE PROFILE SEE PROFILE

Messias Gonzaga Pereira Helaine Christine Cancela Ramos

Universidade Estadual do Norte Fluminense Universidade Estadual do Norte Fluminense
248 PUBLICATIONS   2,955 CITATIONS    53 PUBLICATIONS   373 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Papaya Breeding Program View project

CONSERVAÇÃO E USO DE ESPÉCIES VEGETAIS NATIVAS DA REGIÃO AMAZÔNICA COM POTENCIAL ECONÔMICO PARA A REGIÃO NORTE DO ESTADO DE MATO GROSSO View
project

All content following this page was uploaded by Helaine Christine Cancela Ramos on 10 April 2019.

The user has requested enhancement of the downloaded file.

ISSR and SSR markers for determining genetic
relationships among three wild species of
Passiflora
L.S. Vianna, T.N.S. Pereira, E.A. Santos, A.P. Viana, M.G. Pereira,
H.C.C. Ramos and A.A.B. Rossi

Laboratório de Melhoramento Genético Vegetal, Centro de Ciências e

Tecnologias Agropecuárias, Universidade Estadual do Norte Fluminense
Darcy Ribeiro, Campos dos Goytacazes, RJ, Brasil

Corresponding author: T.N.S. Pereira

E-mail: telmasp@uenf.br

Genet. Mol. Res. 18 (1): gmr18040

Received May 29, 2018
Accepted January 14, 2019
Published February 28, 2019
DOI http://dx.doi.org/10.4238/gmr18040

ABSTRACT. Passiflora cristalina, Passiflora miniata and Passiflora

coccinea are wild species with similar floral characteristics, especially
color and floral structure, as well as the color of their fruits. Due to their
similarities, mainly the floral characteristics, these species are often
confused in the field. Given that hybridization is commonplace between
Passiflora species in the same region, hybrids could result from crosses
involving mainly P. coccinea. We examined genetic distance and
possible hybrid nature across P. cristalina, P. miniata, and P. coccinea,
via ISSR and SSR markers. Genomic DNA was extracted from leaf
samples of five Passiflora species (P. cristalina, P. coccinea, P. miniata,
P. setacea, and P. edulis), the latter two being used as witness species.
Following quantification, the amplification conditions were tested and
optimized. Eighteen ISSR primers presented satisfactory amplification
products, with 81 bands being amplified and 99% polymorphism.
Through genetic distance and cluster analysis, P. cristalina and P.
coccinea were found to be genetically close, while P. miniata remained
in an isolated cluster, nevertheless with low dissimilarity with P.
cristalina. Twenty-three SSR primers were tested, of which 18 were
polymorphic. There was a high transferability rate, 95.65%,
demonstrating that genetic proximity between tax is directly related to
successful transferability. The main coordinates, genetic distance and

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 L.S. Vianna et al. 2

cluster analyses showed a clear separation of species presenting similar

floral characteristics (P. cristalina, P. coccinea, and P. miniata) from the
remaining ones used as controls (P. edulis and P. setacea). SSR markers
identified P. cristalina as a possible natural hybrid between P. miniata
and P. coccinea.

Key words: Wild species; Molecular markers; Genetic resources

INTRODUCTION

The Passifloraceae family is predominantly found in American and African tropical

and subtropical regions (Cervi, 2006); it includes18 genera; the Passiflora genus is the most
species rich, comprising from 521 to 537 species (Feuillet and Macdougal, 2004;
Vanderplank, 2007). Four genera occur in Brazil, as follows: Ancistrothyrsus Harms, Dilkea
Mast., Mitostemma Mast., and Passiflora L., totaling 150 species, of which 87 are endemic
(Flora do Brasil, 2020, under construction).
New Passiflora species are still being described; about 90% of these species are
native to the Americas (MacDougal, 2011). Passiflora miniata, described by Vanderplank
(2006), belongs to the subgenus Passiflora, Coccinea supersection, and originates and is
distributed in the Amazon region (Peru, Brazil and Colombia) and in the Guianas (Lim,
2012). It presents a red-color flower with three series of purple corona filaments, with small
fruits that have mottled green and cream colors (Vanderplank, 2006).
Passiflora cristalina belongs to the Diasthephana supersection of the subgenus
Passiflora and is found in Cristalino State Park in northeastern Mato Grosso state. It
presents red flowers with two series of red-to-pink corona filaments, and small fruits that
have mottled dark green and cream colors (Vanderplank, 2011).
Passiflora coccinea is native to the Guianas, Venezuela, the Amazon region of
Peru, Bolivia and Brazil; it belongs to the subgenus Passiflora, Diasthephana supersection,
presenting scarlet-red flowers with two series of violet or pinkish-white corona filaments,
and fruit peel of mottled green color with longitudinal stripes (Vanderplank, 2000).
The three species present great morphological similarity, especially in color and
flower structure, as well as similar fruits, with the number and color of the series of corona
filaments as their major differences (Vanderplank, 2006). They are wild species and may be
considered as repositories of genes of interest, though they have been little studied.
Wild species have attracted the attention of breeders due to their genetic potential,
since they have disease and pest resistance genes, besides agronomic traits of interest
(Junqueira et al., 2005; Meletti et al., 2011); however, hybridization with cultivated species
is not always feasible (Hajjarand Hodgkin, 2007). For successful hybridization, parental
species need to be genetically closely related (Pereira et al., 2005). There are several
techniques available to study genetic similarity among species, among which are molecular
markers, which are highly variable and allow estimation of genetic distances between
species at the DNA level (Faleiro et al., 2008).
Among molecular markers, ISSR (Inter Simple Sequence Repeat) markers are
considered as informative in genetic diversity studies (Bornet and Blanchard, 2001). A
number of authors reported high polymorphism levels in Passiflora species when using
such markers (Santos et al., 2011; Costa et al., 2012; Sousa et al., 2015).

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 Genetic relationships among Passiflora species 3

As for microsatellites, or SSR (Simple Sequence Repeats), these have emerged as

the most widely used molecular markers due to their high information content (Oliveira et
al., 2006). In spite of being species-specific, the potential transferability of primers across
species of the same genus enables their use (Bravo, 2006).
The objectives of our study were: i) to estimate genetic distances between five
species of the Passiflora genus (P. cristalina, P. miniata, P. coccinea, P. edulis, and P.
setacea) using ISSR and SSR markers; ii) to assess the potential transferability of
microsatellite markers for detecting polymorphisms in Passiflora genotypes; iii) to ascertain
P. cristalina hybrid nature by comparing band patterns by means of SSR molecular
markers.

MATERIAL AND METHODS

Plant material

Leaf samples of five Passiflora species (P. cristalina, P. coccinea, P. miniata, P.

setacea, and P. edulis), were used, with the latter two used as witnesses.

DNA extraction

Genomic DNA extraction was carried out using the QiagenDNeasy Plant Mini Kit,
following methodology described by the manufacturer. For the analysis using ISSR
markers, DNA extraction was carried out in bulk using 10 individuals per species. For the
analysis using SSR markers, extraction was carried out individually using 5 individuals per
species, and upon confirmation of absence of allelic difference, 1 individual per species was
then selected for analysis. Following extraction, DNA integrity and quantification were
assessed in 1.0% agarose gel and then DNA was diluted to 5 ng.μL-1.

Amplification conditions and statistical analysis for ISSR

Eighteen ISSR primers were used for the analyses. The volume of amplification
reactions was 13 μL, with 6.08 μL ultrapure water, 1.3 μL PCR (1X) Buffer, 1.5 μL dNTPs,
1.0 μL magnesium chloride, 1.0 μL primer, 0.12 μL Taq polymerase enzyme, and 2 μL
genomic DNA, using a 100 pb Lambda marker. Polymerase chain reactions (PCR) were
carried out in a thermal cycler under the following conditions: 5 min at 94ºC (initial
denaturation), followed by 35 cycles at 94ºC for 1 min, 46-52°C for 1 min, 72ºC for 3 min,
and a final extension at 72ºC for 7 min.
Amplified fragments were separated in 2% agarose gel, stained with a RedTM gel
and Blue Juice (1:1) mixture and exposed to UV light (Minibis Pro documentation system –
Bio-imaging System) in order to view the results. Polymorphisms were tabulated based on
presence (1) or absence (0) of bands.
Dissimilarity analysis was performed through a binary matrix by using Rogers and
Tanimoto’s Simple Matching Coefficient and the cophenetic correlation coefficient (CCC).
Cluster analysis via dendrogram was performed by means of the UPGMA method with the
aid of Mega software version 6 (Kumar et al., 2009).

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 L.S. Vianna et al. 4

Amplification conditions and statistical analysis for SSR

Twenty-three microsatellite primer pairs developed and optimized for P. edulis

(Oliveira, 2006), P. alata; (Pádua et al., 2005), and P. setacea (Cerqueira-Silva et al., 2014)
were tested. All PCR amplifications were performed in a thermal cycler, and the volume of
amplification reactions was 13 μL, with 6.08 μL ultrapure water, 1.3 μL PCR (1X) Buffer,
1.5 μL dNTPs, 1.0 μL magnesium chloride, 1.0 μL primer, 0.12 μL Taq polymerase
enzyme, and 2 μL genomic DNA, using a100 pb Lambda marker. PCRs were performed as
follows: 4 min at 94ºC for initial denaturation, followed by 35 cycles, each consisting of
94ºC for 1 min, 52-64°C for 1 min, 72ºC for 3 min, and a final extension at 72ºC for 7 min.
Fragments were separated in 4% metaphor gel, stained with a RedTM gel and Blue
Juice (1:1) mixture and exposed to UV light (Minibis Pro documentation system – Bio-
imaging Systems) in order to capture images.
A matrix of numerical data was built that was assigned values from 1 to the
maximum number of alleles found per locus. Genetic distance was calculated with the aid
of Genes software (Cruz, 2013), by using Smouse and Peakall index. Clustering analysis via
dendrogram was performed by means of the UPGMA method with the aid of Mega
software version 6 (Kumar et al., 2009).
The mean number of alleles per polymorphic locus (Na), the effective number of
alleles (Ne), Shannon Index (I), expected (He) and observed (Ho) heterozygosity were
calculated per locus using Genalex 6.3 software (Peakall e Smouse, 2012). The dispersion
graph was based on Principal Coordinate Analysis (PCoA) using the Genalex 6.3 software
(Peakalland Smouse, 2012).

Identification of P. cristalina hybrid nature through SSR markers

Since P. cristalina may be a natural hybrid of P. coccinea and P. miniata, hybrid

identification was tested by visual analysis of band patterns derived from this possible
parental combination. Molecular markers generated by the different primers were analyzed
for the presence or absence of informative bands showing clear patterns of single band
easily mapped to the possible parents. Informative bands are marks present in parent 1 and
absent in parent 2, and presence of both in the supposedly hybrid genotype (P. cristalina)
confirmed natural hybridization. Only highly clear and reproducible bands were considered
as informative bands.

RESULTS AND DISCUSSION

ISSR Markers

Fifty-five ISSR primers were tested, 18 of which generated satisfactory

amplification products in the study species. The number of amplified bands per primer
ranged from 3 to 7, showing evident power to detect polymorphisms (Table 1). A total of 81
ISSR bands were amplified, of which 79 were polymorphic, with four bands per primer on
average, which is an expected result when using interspecific analysis (Fajardo et al., 1998;
Santos et al., 2011).

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 Genetic relationships among Passiflora species 5

Table 1. ISSR primers used in a genetic diversity study of five Passiflora species in Campos dos Goytacazes.
Primer Identification Sequence (5’-3’) Annealing Temperature No. of amplified loci No. of polymorphic loci
1 (GA)6CC 48ºC 7 7
2 (GT)6CC 48ºC 4 3
7 (AC)8CT 48ºC 4 4
17 (AC)8T 48ºC 5 5
19 (AG)8YA 48ºC 5 5
20 (GA)8YT 48ºC 5 5
23 (CA)8CYG 48ºC 4 4
32 (AG)8C 48ºC 5 4
33 (AG)8T 48ºC 3 3
40 (AC)8CTT 48ºC 3 3
50 (AC)8C 48°C 5 5
51 (ATC)6 48°C 5 5
57 (GA)9T 48ºC 4 4
59 (AC)4Y 48ºC 7 7
70 (GA)7RC 48ºC 3 3
72 (GTG)4RC 46ºC 5 5
73 (CA)7YC 48ºC 4 4
7M (ATC)6 46ºC 3 3

There are few reports on the use of ISSR markers in Passiflora, however, some authors
reported high polymorphism level in their work with species of this genus using such markers.
Santos et al. (2011) evaluated 45 Passiflora accessions (three P. alata accessions and 42 P.
edulis accessions) using 18 ISSR primers and obtained 227 polymorphic bands with 12.61 bands
per primer on average. Costa et al. (2012) characterized 63 genotypes of sour passion fruit vine
in Embrapa’s Manioc and Fruit Production program and obtained 22 polymorphic primers
generating 266 bands with 11.56 bands per primer on average. Sousa et al. (2015) evaluated 25
wild species of Passiflora from the UESC germplasm bank in Ilheus, Bahia, using ISSR markers
and obtained 20 polymorphic primers among the 31 tested, with a total of 331 bands and 16
bands per primer on average.
Four main groups were identified: Group I comprised P. cristalina and P. coccinea
species and Groups II, III and IV were constituted of P. miniata, P. setacea, and P. edulis,
respectively (Figure 1). The cophenetic correlation coefficient (r) was 0.7693, which is a suitable
coefficient, since values of r ≥ 0.56 are considered ideal, thus reflecting consistency with the
genetic distance matrix values (VazPatto et al., 2004).

Figure 1. Dendrogram obtained by UPGMA clustering method complemented with Rogers and Tanimoto’s
Simple Matching Coefficients across five species of the Passiflora genus based on ISSR markers.
Passiflora cristalina and P. coccinea were identified as the least dissimilar, presenting a
value of 0.54; this result was expected, since these two species are morphologically similar and
belong to the same genus, sub-genus and supersection. As for P. miniata, which remained as an

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 L.S. Vianna et al. 6

isolated group, it presented a genetic distance coefficient of 0.59 from P. cristalina and of 0.67
from P. coccinea, therefore, closer to P. cristalina. On the other hand, P. coccinea and P.
setacea were the ones that presented the highest similarity, with a coefficient equal to 0.74
(Figure 1).

SSR Markers

Among the 23 SSR primers tested, 18 were considered as polymorphic, which is

equivalent to a transferability rate of 95.65% (Table 2). This was an expected result, since the
study species belong to the same genus; i.e. they present the same primer sites flanking these
conserved regions, demonstrating that the evolutionary proximity between taxa is directly
related to successful transferability of SSR markers. Therefore, transferability analysis is highly
convenient as it reduces time and costs required for the development of these markers (Carvalho
et al., 2015).
High cross-amplification rates in Passifloras, from SSR primers previously developed
for two species, P. edulis (Oliveira, 2006) and P. alata (Pádua et al., 2005), were observed by
Cerqueira-Silva (2012b) when they examined several wild species of Passiflora in their studies,
with results of 86% transferability.
With respect to genetic diversity among the species that we evaluated, a low number of
alleles were found in all polymorphic loci. The number of alleles per locus ranged from 2 to 3,
with mean of 2.44, obtaining a total of 44 alleles for the 18 loci evaluated (Table 2).

Table 2. Characterization of 18 loci by molecular analysis via SSR markers.

Locus Primers aT
F:CACATTTGCCGTCACTGG
Pad 2 60
R:CGGCATACGATAAATCTCCTG
F:GGCAGGATATGCTTTGGTT
P34 60
R:GCTGTCGGACACATGGAC
F:GAATCAATGGAACACAAGCA
P40 60
R:CCAGCCCACTAGACCACCT
F:ACTCTCACCTCAATCGACC
P76 60
AATTGTTACTCCGTTTCTCTGA
F:GAGAAAGCGAGTCAGCGAGA
Ps16 58
R:GACTCCAATATCGGCACTTCA
F:GTAGCGTCTCGGCAGGTC
Ps3 60
R:ACTCTAAGTCGGCCACTCTTG
F:CTCAGTGAGGAATAAGCAATCA
P43 60
R:ATTTGGCATGCTGTTACGC
F:CCCAATCGCTGAGAGGAGT
Ps21 58
R:CGGTAGGCTCATTCGTGTCA
F:TCGGTCTTCGTATTCAACTCTG
Ps5 58
R:GAGGAACTGGCATCGCAT
F:GAATCAATGGAACACAAGCA
P96 56
R:CCAGCCCACTAGACCACCT
F:TAGCTTAACACAATGCAACAGA
Ps2 54
R:CAACGGAGAACGATGTCAG
F:TAGCTTAACACAATGCAACAGA
Ps1 50
R:CAACGGAGAACGATGTCAG
F:ACAGGGGTGAGGCACATTC
Ps7 56
R:TCTGTTATTATCATCGGCAGG
F:GTTGGATCAAAGGGTCACA
Ps6 58
R:CAACTACTGGATCGAACTGGTA
F:TCAGGAAGATTGCATGTTAGT
P90 58
R:CTGGGTTTTGTTTATGTTGC
F:GTGTTTGTGGCGATGTGATTA
P25 60
R:GACAAACGTTGTTTCCGCT
F:CCCTCTTATCAATAGCGTTGG
P74 62
R:GCACGAGCACGAGTATTTATT
F:CAACAGGAGGTGAGGTGTGA
Ps4 64
R:GACAGTGCAACTTTAGGCGAC
aT - Annealing Temperature

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 Genetic relationships among Passiflora species 7

By means of the Principal Coordinate Analysis (PCoA), we observed that two

coordinates accounted for 84.6% of total variation, which may be seen in the dispersion
chart (Figure 2). A distance between P. edulis and P. setacea and the remaining species is
noticed, which was expected, since these two species present distinct morphological
characteristics. Nevertheless, proximity was observed between P. edulis and P. setacea,
which is supported by a molecular phylogeny study in which conserved plastid sequences
were used (Muschner et al., 2003), and by the Santos et al. (2014) study, which showed that
they present good crossbreeding combining ability in both directions.

Figure 2. Genetic Distance between five species of Passiflora genus.

Formation of three groups could be observed, where three species presenting similar
morphological characteristics (P. cristalina, P. coccinea, and P. miniata) were allocated to
group I, and groups II and III comprised P. setacea and P. edulis, respectively (Figure 3).

Figure 3. Dendrogram obtained by cluster analysis across five Passiflora species using the UPGMA clustering
method.

The genetic distance ranged from 0.89 to 2.11, and this variation demonstrates the
extensive diversity between these species. A smaller distance was observed between P.
coccinea and P. miniata (0.89); this was an expected result, since they present similar traits

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 L.S. Vianna et al. 8

such as red flowers, and they are often erroneously cultivated due to their similarity
(Vanderplank, 2006). Greater dissimilarity was observed between P. setacea and P.
coccinea species (2.11).
In studies with Passiflora using joint analyses of morphologic descriptors by means
of Ward-MLM procedure and SSR markers, (Paiva et al., 2014a,b), P. setacea and P.
coccinea were allocated to different groups, as observed in our study.
Although P. setacea and P. edulis species were not allocated to the same group,
they presented low dissimilarity (1.11). Santos et al. (2014), aiming at obtaining hybrids
resistant to fruit hardening disease, performed interspecific hybridization between these
species and found that such hybridization was successful in both crossbreeding directions,
evidencing that there is genetic compatibility.
Two pairs of SRR primers were sufficient to identify the P. cristalina hybrid nature.
Through analysis of SSR markers, P. cristalina was identified as a possible natural hybrid
between P. miniata and P. coccinea due to the presence of two bands from each of the
possible parents (Figure 4).

Figure 4. Electrophoresis analysis of DNA amplification products related to three wild species of Passiflora. P1 –
parent 1 (P. coccinea); P2 – parent 2 (P. miniata); F1 – hybrid (P. cristalina); M – molecular marker; Ps1 and
P90 – SSR primers.

This result is consistent with data obtained by cluster analysis using both dominant
and co-dominant markers. By the cluster analysis based on ISSR markers, it was found that
P. miniata did not cluster with P. cristalina and P. coccinea; however, it presented a low
genetic dissimilarity with P. cristalina (0.59). In the cluster analysis using SSR markers, the
three species remained in the same group, with a shorter distance between P. coccinea and
P. miniata being observed.
The number and color of corona filaments are considered as a characteristic
morphological marker among these species: P. coccinea has white filaments, while P.
miniata has red filaments, and P. cristalina has pink filaments (Vanderplank, 2006; Zappi,
2011), and this may be considered an intermediate trait between theparents, suggesting
interspecific hybridization.
Several methodologies may be used to confirm hybrids, from those based on
morphological traits (Oliveira et al., 2005), to those done at molecular and cytogenetic
levels. Molecular markers are excellent tools to confirm hybridization, by which the use of
one or two primers or primer combinations with at least one informative band is sufficient
for confirmation (Faleiro et al., 2003). Hybridization confirmation in Passiflora has been
performed based on molecular markers that consist of a more reliable methodology to

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 Genetic relationships among Passiflora species 9

confirm parenthood in hybrid passion fruit plants, such as RAPD (Junqueira et al., 2008;
Conceição et al., 2011) and SSR (Santos et al., 2012) analyses.

CONCLUSIONS

Based on our results, we concluded that a) there is similarity among P. cristalina, P.

coccinea, and P. miniata, estimated using both ISSR and SSR molecular markers; b) we
found an increased transferability rate for SSR markers, evidencing that the evolutionary
proximity between taxa is directly related to successful transferability; c) SSR markers were
shown to be effective in identifying the hybrid nature of P. cristalina, which was
considered, in this study, as a possible natural hybrid between P. miniata and P. coccinea.

ACKNOWLEDGMENTS

The authors are thankful to Fundação de Amparo à Pesquisa do Estado do Rio de

Janeiro (FAPERJ) for scholar ships and financial support and Coordination for the
Improvement of Higher Education Personnel - Brazil (CAPES) - Finance Code 001.

REFERENCES
Bornet B and Branchard M (2001). Nonanchored inter simple sequence repeat (ISSR) markers: reproducible and specific
tool for genome fingerprinting. Plant. MolBiol. Rep. 19: 209-215.
Bravo JP, Hoshino AA, Angelici CMLCD, Lopes CR, et al. (2006). Transferability and use of microsatellite markers for
the genetic analysis of the germplasm of some Arachis section species of the genus Arachis. Genet. MolBiol 29:
516-524.
Carvalho SIC, Ragassi, CF, Oliveira IB, Amaral ZPS, et al. (2015). Transferability of microsatellite markers of
Capsicum annuum L. to C. frutescens L. and C. chinense Jacq. Genet.Mol. Res. 14: 7937-7946.
Cerqueira-Silva CBM, Santos ESL, Vieira JGP, Mori GM, et al. (2014). New Microsatellite Markers for Wild and
Commercial Species of Passiflora (Passifloraceae) and CrossAmplification. Appl. Plant. Sci. 2 (2): 1300061.
Cerqueira-Silva CBM, Santos ESL, Souza AM, Mori GM, et al. (2012b). Development and characterization of
microsatellite markers for the wild South American Passiflora cincinnata (Passifloraceae). Am. J. Bot 99: e170–172
Cerqueira-Silva CBM, Conceição LDHCS, Cardoso-Silva CB, Oliveira AC, et al. (2008a). Amplificação cruzada de
marcadores microssatélites (SSR) em espécies do gênero Passiflora. In: 20º Congresso Brasileiro de Fruticultura,
54th Annual Meeting of the Interamerican Society for Tropical Horticulture, Vitória – ES.
Cervi AC (2006). O gênero Passiflora L. (Passifloraceae) no Brasil, espécies descritas após o ano de 1950. Adumbr.
Summae. Ed. 16: 1-5.
Conceicão LDHCS, Belo GO, Souza MM, Santos SF, et al. (2011). Confirmation of cross-fertilization using molecular
markers in ornamental passion flower hybrids. Genet. Mol. Res. 10: 47-52,
Costa JL, Jesus ON, Oliveira GAF and Oliveira EJ (2012). Effect of selection on genetic variability in yellow passion
fruit. Crop. Breed. Appl. Biotechnol. 12: 253-260.
Cruz CD (2013). GENES - a software package for analysis in experimental statistics and quantitative genetics. Acta Sci.
Agron. 35: 271-276.
Fajardo D, AngeL F, Grum M, Tohme J, et al. (1998). Genetic variation analysis of the genus Passiflora L. using RAPD
markers. Euphytica. 101: 341-347.
Faleiro FG, Pires JL and Lopes UV (2003). Uso de Marcadores Moleculares RAPD e Microssatélites Visando a
Confirmação da Fecundação Cruzada entre Theobroma cacau e Theobroma grandiflorum. Agrotrópica. 15: 41-46.
Faleiro FG, Junqueira NTV, Braga MF and Peixoto JR (2008). Caracterização de germoplasma e melhoramento genético
do maracujazeiro assistidos por marcadores moleculares: resultados de pesquisa 2005-2008. Boletim de Pesquisa e
Desenvolvimento, No 207. Planaltina: Embrapa Cerrados, 59 p.
Feuillet C and Macdougal JM (2004). A new infrageneric classification of Passiflora. Passiflora. Beltsville. 14: 1-4.
Flora do Brasil (2020). Jardim Botânico do Rio de Janeiro. Available at:
http://floradobrasil.jbrb.gov.br/reflora/floradobrasil/FB12506. Accessed on December 12, 2017.

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

 L.S. Vianna et al. 10

Hajjar R and Hodgkin T (2007). The use of wild relative in crop improvement: a survey of developments over the last 20
years. Euphytica. 156: 1 – 13
Junqueira NTV, Braga MF, Faleiro FG, Peixoto JR, et al. (2005). Potencial de espécies silvestres de maracujazeiro como
fonte de resistência a doenças. In: Faleiro FG, Junqueira NTV, Braga MF. (Ed.). Maracujá: germoplasma e
melhoramento genético. Planaltina: Embrapa Cerrados. Chapt. 4: 81-107.
Kumar S, Puniya AK, Puniya M, et al. (2009). Factors affecting rumen methanogens and methane mitigation strategies.
World. J.Microbiol. and Biotechnol. 25: 1557–1566.
Lim TK (2012). Passifloraminiata. Edible Medicinal and Non-Medicinal Plants: Volume 4, Fruits. 178 – 180p.
Liu K and Muse SV (2005). PowerMarker: an integrated analysis environment for genetic marker analysis.
Bioinformatics 21: 2128–2129.
Macdougal JM (2011). Two new species of Passionflower (Passiflora, Passifloraceae) from southwestern Mexico.
Novon. 11: 69 – 75.
Meletti LMM (2011). Avanços na cultura do maracujá no Brasil. Rev. Bras. Frutic. 33: 83 – 91
Muschner RIAC, Lorenz ALP, Cervi ARC, Bonatto SAL, et al. (2003). First molecular phylogenetic analysis of
Passiflora (Passifloraceae). Amer. J. Bot. 1229–1238.
Oliveira RP, Novelli VM and Machado MA (2005). Frequência de híbridos em cruzamento entre tangerina ‘cravo’ e
laranja ‘pêra’. Pesquisa Agropecuária Brasileira, v. 35: 1895-1903.
Oliveira EJ (2006). Desenvolvimento e uso de marcadores microssatélites para construção e integração de mapas
genéticos de maracujá-amarelo (Passiflora edulis Sims f. flavicarpa Deg.). Ph.D. thesis. Escola Superior de
Agricultura Luiz de Queiroz, Piracicaba, Brazil.
Oliveira EJ, Pádua JG, Zucchi MI, Vencovsky R, et al. (2006). Origin, evolution and genome distribution of
microsatellites. Genet. Mol. Biol. 29: 294-307.
Pádua JG, Oliveira EJ, Zucchi MI, Oliveira GCX, et al. (2005). Isolation and characterization of microsatellite markers
from the sweet passion fruit (Passifloraalata Curtis: Passifloraceae). Mol. Ecol. Notes. 5: 863-865.
Paiva CL, Viana AP, Santos EA, Silva RN, et al. (2014a). Diversidade genética de espécies do gênero Passiflora com o
uso da estratégia Ward-MLM. Rev. Bras. Frutic. 36: 381- 390.
Paiva CL, Viana AP, Santos EA, Freitas, JCO, et al. (2014b). Genetic variability assessment in the genus Passiflora by
SSR marker. Chil. J. Agric. Res. 74: 355-360.
Peakall R and Smouse PE (2012). GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and
research—an update. Bioinformatics. 28: 2537-2539.
Pereira TNA, Nicoli RG, Madureira HC, Junior PCD, et al. (2005). Caracterização morfológica e reprodutiva de espécies
silvestres do gênero Passiflora. In: Faleiro FG, Junqueira NTV, Braga MF, Pinto ACQ, Sousa ES. (Eds) IV
Reunião Técnica de pesquisas em Maracujazeiro. Planaltina, DF: EmbrapaCerrados, p. 29-34.
Santos LF, Oliveira EJ, Santos AS, Carvalho FM, et al. (2011). ISSR markers as a tool for the assessment of genetic
diversity in Passiflora. Biochem. Genet. 49: 540-554.
Santos EA, Souza MM, Abreu PP and Conceição LDHCS (2012). Confirmation and characterization of interspecific
hybrids of Passiflora L. (Passifloraceae) for ornamental use. Euphytica 184: 389-399.
Santos EA, Viana AP, Freitas JCO, Souza MM, et al. (2014). Phenotyping of Passiflora edulis, Passiflorasetacea, and
their hybrids by a multivariate approach. Genet. Mol. Res. 13: 9828-9845.
Sousa AGR, Souza MM, Melo CAF and Sodré GA (2015). ISSR markers in wild species of Passiflora L.
(Passifloraceae) as a tool for taxon selection in ornamental breeding. Genet. Mol. Res. 14: 18534-18545.
Vanderplank RJR (2000). Passion flowers. 3rd ed. Cambridge: The MIT Press. 224p.
Vanderplank RJR (2006). Passiflora miniataPassifloraceae. The Board of Trustees of the Royal Botanic Gardens, Kew.
Vanderplank RJR (2007). There arelies, damned lies and statistics. A statistical look at the genus Passiflora. Passiflora
17: 14–15
Vanderplank RJR and Zappi D (2011). Passiflora cristalina, a striking new species of Passiflora (Passifloraceae) from
Mato Grosso, Brazil. Curtis’s. Bot. Mag. 66: 149 – 153
Vaz Patto MC, Satovic Z, Pego S and Fevereiri P (2004). Assessing the genetic diversity of Portuguese maize
germplasm using microsatellite markers. Euphytica 137: 63-72.

Genetics and Molecular Research 18 (1): gmr18040 ©FUNPEC-RP www.funpecrp.com.br

View publication stats