CHRONIC CIGARETTE SMOKE EXPOSURE INDUCES DYSBIOSIS AND MUCUS CHANGES IN THE

MURINE GUT

Liesbeth Allais1, Frederiek-Maarten Kerckhof2, Stephanie Verschuere1, Ken Bracke3,

Rebecca De Smet1, Debby Laukens4, Pieter Van den Abbeele2, Martine De Vos4, Nico Boon2,

5 Guy Brusselle3, Tom Van de Wiele2*, Claude A. Cuvelier1*

1
Department of Pathology, Ghent University, Ghent, Belgium

2
Laboratory of Microbial Ecology and Technology (LabMET), Faculty of Bioscience
Engineering, Ghent University, Ghent, Belgium

3
Laboratory for Translational Research in Obstructive Pulmonary diseases, Department of
10 Respiratory Medicine, Ghent University Hospital, Ghent, Belgium

4
Department of Gastroenterology, Ghent University, Ghent, Belgium

*Both authors contributed equally to this paper

Subject category

Microbe-microbe and microbe-host interactions

15 Grant support:

Concerted Research Action of Ghent University (BOF10/GOA/021). Liesbeth Allais is sup-

ported by a doctoral grant from the Special Research Fund of Ghent University (01D41012).

Correspondence:

C. Cuvelier, Department of Pathology, 5 Blok A, University Hospital Ghent, De Pintelaan

20 185, 9000 Ghent, Belgium

E-mail: claude.cuvelier@ugent.be, Telephone: +32-93323663, Fax: +32-93324965.

Running title

Cigarette smoke induces dysbiosis in the gut

 Abstract

25 Inflammatory Bowel Diseases (IBD) are complex multifactorial diseases characterized by an

inappropriate host response to an altered commensal microbiota and a dysfunctional mucus

barrier. Cigarette smoking is the best known environmental risk factor in IBD. Here, we

studied the influence of 24 weeks of smoke exposure on the gut microbiome and mucus layer

composition in conventional mice. Both 454 pyrosequencing and denaturing gradient gel

30 electrophoresis (DGGE) showed a significant increase in the bacterial community structure

and diversity in the colon in response to smoking. We found an increase of Enterococcus sp.

and a decrease of Desulfovibrionales sp. in the entire gut. Rhodococcus sp. decreased only in

the ileum, whereas Allobaculum sp. decreased mainly in the caecum and distal colon. qPCR

analysis demonstrated that Akkermansia muciniphila tends to decrease in the faeces of

35 smoking mice. Interestingly, also changes in the expression of mucus-related genes occurred.

The mRNA expression of MUC2 and MUC3 increased in the ileum, whereas MUC4

increased in the distal colon after smoke exposure. However, no changes in the overall

structural integrity of the mucus layer could be detected, as was shown by the Alcian Blue

(AB)/periodic acid Schiff (PAS) and high iron diamine (HID)/AB staining methods. We infer

40 that the modulating role of chronic smoke exposure in IBD may be driven by the altered

epithelial mucus profiles and changes in microbiome composition, which are important

factors in IBD development.

Keywords: cigarette smoking/dysbiosis/gut microbiome/inflammatory bowel disease/mucus

layer

45

1
 Introduction

Inflammatory bowel diseases (IBD), comprising Crohn’s Disease (CD) and ulcerative colitis

50 (UC), result from a complex interplay between environmental factors, genetics and intestinal

microbiota, which combine to initiate and perpetuate chronic inflammation in the

gastrointestinal tract. CD is associated with a transmural and discontinuous inflammation that

most frequently involves the ileum and colon, but can affect the entire gastrointestinal tract,

while in UC, a superficial inflammation occurs limited to the colon (Jin et al 2012, Khan and

55 Collins 2006). The prevalence of IBD ranges from 174 to 210 for CD and 79 to 122 for UC

per 100.000 inhabitants in Western countries and is still increasing (Hovde and Moum 2012,

Lakatos 2006, Loftus 2004). Disrupted intestinal homeostasis and abnormal immune

responses to host intestinal resident microbiota play a major role in the pathogenesis, although

the exact mechanisms have not been elucidated yet (Strober et al 2007, Xavier and Podolsky

60 2007).

Disturbance of the microbial equilibrium, termed dysbiosis, is characterized by quantitative

and qualitative changes in the microbiota. This is marked by an increase of common bacterial

inhabitants of the gut that become pathogenic under permissive conditions (Stecher et al

2013). Dysbiosis provokes dysregulation of adaptive immune responses in the gut and is

65 increasingly recognized as a contributing factor in the pathogenesis of IBD (Carbonnel et al

2009, Round and Mazmanian 2009). Previous studies showed that bacterial diversity is

decreased in stool samples of IBD patients (Erickson et al 2012, Manichanh et al 2006). In

addition, subjects with alterations in the abundance of species of the most prominent intestinal

phyla Firmicutes, Bacteroidetes, Verrucomicrobia, Actinobacteria and Proteobacteria are

70 susceptible to IBD.

2
 Cigarette smoke is the most prominent environmental risk factor for developing CD, however,

it exerts a protective role in UC (Ananthakrishnan 2013, Persson et al 1990). In addition,

smoke exposure may have an important impact on the composition and dynamics of the gut

microbiome. For instance, the Bifidobacterium population increased in the caecum of rats

75 after four weeks of cigarette smoke exposure (Tomoda et al 2011). In human studies, smoking

has been associated with a higher rate of Clostridium difficile infection, in which current

smokers have the highest risk compared to former and never smokers (Rogers et al 2012).

Moreover, cigarette smoking is a known risk determinant for both bacterial and viral

infections through alterations in cell- and humoral-mediated immune responses in the

80 respiratory tract (Arcavi and Benowitz 2004). We recently demonstrated that cigarette smoke

triggers the gut immune system through the recruitment of immune cells to the Peyer’s

patches (PP), the main lymphoid organs in the gut, and through the induction of autophagy

and apoptosis in the follicle-associated epithelium (FAE) overlying the PP (Verschuere et al

2011, Verschuere et al 2012).

85 Many studies have investigated the impact of specific intestinal bacteria on host gene and

protein expression in the intestine (Rolli et al 2010) and their role in IBD development.

Nevertheless, the role of smoking in the emergence of dysbiosis, which might modulate the

risk for the development of IBD, still needs further investigation. Cigarette smoke alters host-

micro-organism interaction dynamics in the airways, causing respiratory tract infections and

90 contributing to chronic obstructive pulmonary disease (COPD) (Garmendia et al 2012).

However, the mechanisms by which chronic cigarette smoking adversely affects the gut

mucosa and its microbial environment remain to be elucidated. Therefore, we first examined

the diversity of the bacterial community in the ileum and colon of mice exposed to smoke or

air for six months. Additionally, we explored which species were sensitive to smoke exposure

95 and correlated these results to composition of the mucus layer.

3
 Materials and Methods

Animals

Male C57BL/6 wild-type (WT) mice were purchased from Charles River Laboratories. All

mice were 8-9 weeks old at the start of the smoke exposure. The local Ethics Committee for

100 animal experimentation of the faculty of Medicine and Health Sciences (Ghent, Belgium)

approved all experiments (ECD 27/07).

Cigarette Smoke Exposure

Mice were exposed to main stream cigarette smoke, as described previously (D'Hulst A et al

2005). Briefly, groups of 10–12 mice were exposed to the tobacco smoke of five cigarettes

105 (Reference Cigarette 3R4F without filter; University of Kentucky, Lexington, KY, USA) four

times a day with 30 min. smoke-free intervals, 5 days per week for 24 weeks (chronic smoke

exposure). An optimal smoke:air ratio of 1:6 was obtained. The control groups were exposed

to air. Carboxyhaemoglobin in serum of smoke-exposed mice reached a non-toxic level of 8.7

± 0.31% (compared with 0.65 ± 0.25% in air-exposed mice), which is similar to

110 carboxyhaemoglobin blood concentrations of human smokers (Macdonald et al 2004).

Staining methods

Paraffin-embedded tissue sections of 4 µm taken from ileum and distal colon were dewaxed

and rehydrated. The sections were stained with either Alcian Blue (AB)/Periodic Acid Schiff

(PAS), in which AB stains blue secretable mucins and PAS stains purple-pink for cell surface

115 mucins, or with high iron diamine (HID)/AB, in which sulphated mucins are stained dark

brown by HID and sialylated mucins are stained blue by AB. In case of the AB/PAS staining

method, slides were stained using the PAS Staining Kit and Alcian Blue for PAS Staining Kit

4
 on the automated Ventana system (Roche Diagnostics, Vilvoorde, Belgium). Slides were im-

mersed in the Alcian Blue solution for five min before incubation in 1% aqueous periodic

120 acid for five min. Slides were then washed in distilled water and immersed in Schiff’s reagent

for 15 min. In case of the HID/AB staining method, slides were treated with diamine solution

(N,N-dimethyl-meta-phenylenediamine-dihydrochloride; N,N-dimethyl-para-

phenylenediamine-dihydrochloride; ferric chloride 60% solution and distilled water) for 24h

at room temperature. After incubation, slides were washed and counterstained in 1% Alcian

125 blue solution for five min. Finally, sections from both staining methods were dehydrated in

absolute alcohol, cleared in three changes of xylene and mounted.

Scoring of microscopic analysis

Histologic and goblet cell assessment was performed using light microscopy. For 10

130 AB/PAS-stained sections in each group, positively stained goblet cells were counted in two

regions of 10 aligning longitudinal crypts. For 10 HID/AB-stained sections in each group,

sulfomucin-positive stained goblet cells were counted in two regions of 10 aligning longitu-

dinal crypts. Histologic assessments were carried out in a blinded fashion.

135 Quantitative real-time PCR

RNA from ileum and distal colon was extracted using the Qiagen miRNeasy Mini Kit

(Qiagen, Hilden, Germany). Subsequently, cDNA was synthesized by reverse transcription

using the iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Nazareth, Belgium) following

the manufacturer’s instructions. Expression of target genes MUC1, MUC2, MUC3 and

140 MUC4, and reference genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and

hydroxymethylbilane synthase (HMBS) (Table 1), was analyzed by qRT-PCR using the

SensiMix™ SYBR No-ROX Kit (Bioline, London, UK). qRT-PCR was performed on a

5
 LightCycler480 detection system (Roche, Vilvoorde, Belgium) with the following cycling

conditions: 10 min incubation at 95°C, 45 cycles of 95°C for 10 seconds and 60°C for 1 min.

145 Melting curve analysis confirmed primer specificity. The PCR efficiency of each primer pair

was calculated using a standard curve from reference cDNA. The amplification efficiency was

determined using the formula 10-1/SLOPE - 1.

For faeces, DNA was extracted using the FastPrep DNA extraction method(Vilchez-Vargas et

al 2013). The abundance of Akkermansia muciniphila was analyzed as described

150 previously(Collado et al 2007), using the Power SYBR Green PCR Master Mix (Applied

Bioystems, Life Technologies, Gent, Belgium). This was performed on a Step One Plus

detection system (Applied Bioystems, Life Technologies, Gent, Belgium) with the following

cycling conditions: 2 min incubation at 50°C, 10 min incubation at 95°C, 40 cycles of 95°C

for 15 seconds and 60°C for 1 min, and finally 15 seconds at 95°C, 20 seconds at 60°C and 15

155 sec. The expression data were normalized using a standard curve of a dilution series of an A.

muciniphyla standard clone.

Denaturing gradient gel electrophoresis (DGGE)

The ileal and colonic samples were obtained snap-frozen and stored at -80°C. The 16S rRNA

genes for all bacteria were amplified by PCR adding a GC-clamp of 40 bp. Denaturing Gra-

160 dient Gel Electrophoresis (DGGE) was performed using the INGENYphorU System (Ingeny

International BV, The Netherlands), after which PCR fragments were loaded onto 8% (w/v)

polyacrylamide gels containing 40-60% denaturing gradients (Muyzer et al 1993, Ovreas et al

1997). To process and compare the different gels, an in-house developed marker of different

PCR fragments was loaded on each gel (Boon et al 2002).

165 The normalization and analysis of DGGE gel patterns was done with the BioNumerics soft-

ware 5.10 (Applied Maths, Sint-Martens-Latem, Belgium). During this processing, the differ-

6
 ent lanes were defined, background was subtracted, differences in the intensity of the lanes

were compensated during normalization and bands and band classes were detected

454 pyrosequencing

170 Pyrosequencing was performed on amplicons from total DNA extracted from snap-frozen gut

tissue samples. Barcoded amplicons were prepared as described previously (Dowd et al

2008). Amplicons were generated by using FastStart High Fidelity Taq DNA Polymerase kit

(Roche, Vilvoorde, Belgium) using the following cycle conditions: an initial denaturation step

at 98ºC for 30 s, followed by 30 cycles of denaturation at 98ºC for 5 s, annealing at 53ºC for

175 20 s, elongation at 72ºC for 20 s, and then a final elongation step at 72ºC for 5 min.

Amplicons were purified with the High Pure PCR Product Purification Kit (Roche, Vilvoorde,

Belgium) and pooled equimolarly as determined by picogreen DNA concentration

measurement. The purity and quality of the PCR products was verified on an agarose gel.

Emulsion PCR, emulsion breaking and sequencing were performed applying the GS FLX

180 Titanium chemistry protocols and using a 454 GS FLX pyrosequencer (Roche, Vilvoorde,

Belgium) as recommended by the manufacturer. The raw flowgrams were processed and

analyzed in an in-house Mothur (Schloss et al 2009) (http://www.mothur.org, version 1.26.0)

and R (http://www.r-project.org/ version 2.15.1)/Sweave pipeline. Sequencing error was

reduced using the Mothur implementation of the SeqNoise algorithm (Quince et al 2011),

185 alignment with the SILVA 16S reference alignment (Pruesse et al 2007) was performed and

sequences were trimmed to overlap in the same alignment space. Chimeric sequences were

removed using Uchime (Edgar et al 2011). A Bayesian classifier was used with the RDP

training set (Cole et al 2009) of RDP release 9 (http://rdp.cme.msu.edu/) to classify the

sequences. 213128 bacterial 16S gene sequences were analysed after pre-processing was

190 finished. 5298 unique sequences were then clustered into 904 OTUs with a 97% sequence

7
 identity threshold, with subsequent classification using the RDP release 9 into 904 classified

Operating Taxonomic Units (OTUs) at the 85% bootstrap cut-off.

Statistical analysis

Reported gene expression values are expressed as mean ± SEM (standard error of the mean)

195 and error bars depict the s.e.m. Statistical analysis was performed by SPSS 21 Software

(SPSS 21 Inc., Chicago, IL, USA) using Student’s t-test for normally distributed populations

and Mann–Whitney U-test for populations where normal distribution was not accomplished.

A p-value of less than 0.05 was considered significant.

Clustering of DGGE data was done based on the abundance-based Jaccard index (with fuzzy

200 logic) and the unweighted pair group method with arithmetic mean (UPGMA). Similarities

and abundances were extracted from the software and statistical analysis was performed using

R version 2.15.1.

Based on the 454 pyrosequencing data, descriptive α-diversity statistics were calculated using

the Inverse Simpson and the Shannon index. For β-diversity statistics, we applied the sparse

205 Partial Least Squares Discriminant Analysis (sPLS-DA) with ad hoc optimalisation from the

MixOmics package, considering ileum, caecum and distal colon originating from the same

mouse as paired samples (Liquet et al 2012). Furthermore, a dissimilarity based Multivariate

Analysis of Variance (MANOVA) was performed using the Adonis function in Vegan

(McArdle and Anderson 2001). To identify changes in specific species, both the linear

210 discriminant analysis (LDA) with effect size (LEfSe) and the sPLS-DA were executed

(Segata et al 2011).

8
 Results

215 Gut bacterial community shifts in response to cigarette smoke

To determine the response of the host microbiome to cigarette smoke, the taxonomical

community structure of the microbiome in ileal, caecal and distal colonic samples of 12

smoke-exposed and 12 air-exposed mice was analyzed by DGGE as profiling technique.

Dendrograms applying the Abundance-based Jaccard and Yue & Clayton’s Theta index were

220 used to visualize the clustering of the samples (Figure 1). Considering the distinct intestinal

regions, the dendrograms showed a clear separation in community structure between smokers

and non-smokers in caecum and distal colon, while this bacterial shift was less clear in the

ileum.

We then applied a deeper phylogenetic analysis method, 454 pyrosequencing, which allows to

225 determine both the abundance of specific Operating Taxonomic Units (OTU) and α- and β-

diversity in the community. We randomly selected four mice (two smoking and two non-

smoking, originating from four distinct cages) of which ileal, caecal and distal colonic

samples were included in the analysis. 454 pyrosequencing allows analysis of the complete

taxonomic metagenomic profile, including the rare biosphere. After extensive preprocessing

230 of the data, we assessed both α- and β-diversity. The data were randomly subsampled at 6142

sequences per sample, as this was the lowest reasonable amount of sequences recovered. One

ileal and one caecal sample were discarded because too few sequences were recovered. All

subsequent analyses were executed on this subsampled dataset. The α-diversity analysis was

based on two distinct indices: the Inverse Simpson and the Shannon index. We observed a

235 higher diversity in the caecum and distal colon of smoke-exposed mice. In the ileum however,

no differences in bacterial diversity were detected in smoking versus non-smoking mice (data

not shown).

9
 Furthermore, the β-diversity was evaluated by the sPLS-DA method with two-factor design,

which is a combined multilevel and multivariate method. The Partial Least Squares (PLS)

240 method distinguishes between within-sample and between-sample variation, after which the

discriminant analysis (DA) is executed on the between-sample variation (Liquet et al 2012).

This showed a clear clustering between the smoking and non-smoking murine microbiome for

both caecum and distal colon, but not for ileum (Figure 2), which confirmed the DGGE-based

clustering. Additionally, hypothesis testing results agreed with the above described ordination

245 analyses. The MANOVA analysis demonstrated a significant difference in bacterial

community structure between smoke-exposed and air-exposed mice, based on distinct pair-

wise β-diversity matrices (Table 2).

The abundance of specific bacterial species is influenced by smoke exposure

To further investigate the effect of smoke exposure on the bacterial community in the murine

250 gut, we used the 454 pyrosequencing to identify the taxa and OTUs showing changes in

abundance. Therefore, two distinct methods were applied. Firstly, the LEfSe statistical design

was used to reveal relevant taxa with an LDA score ranking the taxa according to

significance. Due to low log10 (LDA) scores, we applied a normalization procedure which

assigns the value 1 to the mean of the non-zero observations (Oksanen, 1983). This analysis

255 provides which taxa differ in both ileum, caecum and colon in response to smoking (Figure

2a). We observed a decrease of Desulfovibrionales sp. in ileum, caecum and distal colon of

smoking mice (Figure 2b). Rhodococcus sp. decreased mainly in the ileum (Figure 2d),

whereas Enterococcus sp. increased in the entire gut of smoking mice compared to non-

smoking (Figure 2c).

260 Furthermore, we applied the sPLS-DA method to identify the abundance of specific OTU in

each separate intestinal region. An ad hoc estimation procedure is used to include only the

10
 statistically relevant OTUs (Liquet et al 2012). Applying tuning parameter two, as described

by Liquet et al., the relevant OTUs were selected in order to model the data into three sPLS-

DA components. All relevant OTUs were clustered using the UPGMA algorithm and

265 displayed in a heatmap (Figure 3), which demonstrates that OTU010, representing

Allobaculum sp., which decreases strongly in caecum and distal colon and to a lesser extent in

the ileum in response to smoking.

Additionally, we investigated whether mucolytic bacteria, which are in tight association with

the mucus layer, are affected by chronic smoke exposure. The abundance of A. muciniphila,

270 which is severely reduced in IBD patients, was analyzed by qPCR on faeces of six smoking

and six non-smoking mice. We observed a nominal decrease (p = 0,065) in A. muciniphila in

the faeces of mice already after 10 weeks of smoke exposure (Figure 4a).

Cigarette smoke exposure affects the specific mucin expression pattern, but

not the main mucin classes in ileum and distal colon

275 The prominent changes in bacteria that colonize the mucus layer prompted us to investigate

whether the mucin composition of the mucus layer is altered upon smoke exposure. Mucins in

the gut can be subdivided in two main classes: secretable mucins, and cell surface mucins

(Hoebler et al 2006). We examined the amount of goblet cells in ileum and distal colon. The

number of goblet cells was considered as a measure for mucin production in the gut. For each

280 group, ileum and distal colon sections were scored. No significant differences were detected

(Figure 4b). Additionally, tissue sections of the same gut samples were stained with HID and

AB to differentiate between sulfo- and sialomucins. Again, no significant differences were

detected (Figure 4c).

Furthermore, we examined the mRNA expression pattern of MUC1, MUC2, MUC3 and

285 MUC4. MUC2 is stored in goblet cells and typically secreted, whereas MUC1, MUC3 and

11
 MUC4 are membrane-bound cell surface mucins, which are anchored in the glycocalyx,

located at the apical surface of the enterocyte (Hoebler et al 2006). Expression analysis in

both the smoke- and air-exposed group (n=6 in each group) showed a shift in the mucin

expression pattern in response to cigarette smoke in ileum and distal colon (Figure 4d,e). In

290 the ileum, MUC2 and MUC3 expression is upregulated in response to cigarette smoke, while

MUC1 and MUC4 expression is not significantly altered by cigarette smoke exposure.

Remarkably, MUC2 and MUC3 expression in air-exposed ileum appears much lower than in

distal colon, which presumes that cigarette smoke triggers a colon-like expression signature

for MUC2 and MUC3 in the ileum. In the distal colon, only MUC4 expression is increased in

295 smoke-exposed compared with air-exposed animals.

300

305

12
 Discussion

In this study, we demonstrate that chronic exposure to cigarette smoke significantly affects

the mucosa-associated bacterial community and mucus layer composition in the gut of mice,

310 mainly in the colon. We revealed a shift of the community structure in the caecum and distal

colon and changes in the abundance of specific species in the entire gut, some of which are

known to affect the integrity of the gut mucosa. Furthermore, in the ileum, mRNA expression

of MUC2 and MUC3 significantly increased after cigarette smoke exposure, whereas in the

colon, an increased expression of MUC4 was observed.

315 Firstly, we studied the influence of cigarette smoke on the bacterial community structure in

the mucosa of different parts of the gut (ileum, caecum and distal colon). Therefore, we

applied two complementary methods based on overlapping regions of the 16S rDNA of

bacteria: DGGE and 454 pyrosequencing. DGGE analysis is a quick profiling technique and

showed a clear shift in the bacterial community structure in response to cigarette smoke in the

320 caecum and distal colon. This was confirmed with 454 pyrosequencing. Furthermore, we

performed two distinct α-diversity analyses (Shannon and Inverse Simpson index) that

demonstrated increased bacterial diversity in caecum and distal colon of smoking mice, and

not in the ileum. Smoking thus seems to exert an ambiguous effect on the gut, depending on

the location. In literature, a decrease in bacterial diversity is reported in faeces of human

325 subjects after smoking cessation (Biedermann et al 2013), however, it is challenging to

extrapolate these data since the mucosa-adherent and fecal bacterial composition in the gut

differs drastically (Durban et al 2012).

Secondly, we explored which bacterial species might be susceptible to smoke exposure.

Analysis of our pyrosequencing data using LEfSe and sPLS-DA allows detecting changes in

330 species groups. The LEfSe analysis demonstrated a decrease of Desulfovibrionales sp. and an

13
 increase of Enterococcus sp. in ileum, caecum and distal colon. The Desulfovibrionales sp.

include the most prevalent sulphate-reducing bacteria of the intestinal microbiota. Hydrogen

sulfide, the metabolic end-product of sulfite reduction, can exert both cytotoxic and

cytoprotective effects (Medani et al 2011). Interestingly, Rhodococcus sp. decreased only in

335 the ileum. Furthermore, the sPLS-DA analysis showed a decrease of Allobaculum sp. mainly

in the caecum and distal colon of smokers and to a lesser extent in the ileum. It has been

shown previously that Allobaculum sp. is prominent in the microbiota of immunodeficient

CD45-knock-out mice compared to wild-type, suggesting that this bacterium is sensitive to

the status of the gut immune system (Dimitriu et al 2013). This is in agreement with our

340 findings that chronic smoke exposure affects the gut immune system by inducing the

recruitment of immune cells to the Peyer’s patches (Verschuere et al 2011). We also

investigated the abundance of Akkermansia muciniphila in gut tissue and faeces. A.

muciniphila is a mucin-degrading bacterium of which several studies have reported its

importance in the healthy gut (Collado et al 2007). This prompted us to investigate whether A.

345 muciniphila can be influenced by smoking. We observed a nominal decrease of A.

muciniphila in faeces after only 10 weeks of smoke exposure. However, we could not detect

any changes in gut tissue (ileum and distal colon) due to large inter-mouse variation. To date,

only the effect of a subacute smoke exposure of four weeks on gut microbiota has been

investigated in a rat model showing a decrease of Bifidobacterium sp. in the caecum in

350 response to smoking (Tomoda et al 2011). There is a constant turn-over of the microbiota in

the gut, rendering its composition vulnerable to short term exposure to environmental hazards.

In our study, we assume that 24 weeks of smoke exposure induces a stable microbial

community.

An increase in Firmicutes and Actinobacteria and a decrease in Bacteroidetes and

355 Proteobacteria has been reported reported in healthy human subjects after smoking cessation

14
 (Biedermann et al 2013). In IBD, the composition of the gut microbiota is affected. A

decrease in Desulfovibrionales sp., as we have shown in the current study, may have a

cytoprotective effect due to the decrease in H2S production. Yet, a complete drop in H2S may

lead to a lack of activation of endogenous anti-oxidant systems (Medani et al 2011).

360 Furthermore, the Enterococcus sp. , for which we observed an increase after smoke exposure,

are reported to be increased in the colon of pediatric CD patients. Their role in the pathogenic

mechanisms leading to IBD has been hightlighted by their potential to induce colitis in germ-

free IL-10 knock-out mice (Balish and Warner 2002). This might be due to the ability of

enterococci to release hydrogen peroxide into the extracellular space, thereby increasing

365 oxidative stress (Golinska et al 2013). Our observed changes in Desulfovibrionales sp. and

Enterococcus sp. suggest a further increase of reactive oxygen species on top of the oxidative

stress burden caused by cigarette smoke components (Fujihara et al 2008).

A third important finding in this study was that smoking is able to induce changes in the

mucus layer. Previous studies have shown that smoking causes mucin hypersecretion in the

370 lung of patients suffering from COPD (Di et al 2012, Kim 2012, Yu et al 2012). The major

mucins in the intestine are MUC2, a secretable mucin mainly produced and delivered to the

lumen by goblet cells, and MUC3, a cell surface mucin (Hoebler et al 2006, Linden et al

2008, Shirazi et al 2000). MUC4 is a cell surface mucin which acts purely anti-adhesive

(Hattrup and Gendler 2008). Here, we showed that ileal expression of MUC2 and MUC3

375 raised significantly upon smoke exposure. In distal colon, cigarette smoke caused an increase

of MUC4 mRNA. Interestingly, quantitative changes in mucin secretion also occur in human

IBD (Boltin et al 2013). The composition of the protective mucin layer plays an important

role in inhibiting direct contact between the host and potentially offending bacteria and

through reducing the exposure time by increasing their transit. The changes in mucin

380 expression that we observed might either be a direct effect of the exposure to the chemical

15
 components of smoke or induced as a protection mechanism to counteract local physiological

changes in the gut. In addition, a shifting composition of mucolytic organisms from A.

muciniphila to other mucolytic species such as Ruminococcus gnavus occurs in pathological

conditions, such as IBD, and may therefore be a suitable biomarker for mucosal integrity

385 (Berry and Reinisch 2013, Png et al 2010). A. muciniphila, for which we showed a nominal

decrease in faeces, is associated with a protective or anti-inflammatory role in health, which is

lost in IBD.

Our data show that chronic smoke exposure has a profound effect on the gut microbiota and

the associated mucus layer in mice, which is likely to occur in human as well. Although the

390 gut microbial similarity between mice and humans at the phylum level is remarkable, many

differences exist at the species level (Dethlefsen et al 2007). Both in human and C57BL6/J

mice, the two most abundant phyla are the Firmicutes and the Bacteroidetes, however, 85%

of the murine sequences represent species that have not been detected in humans (Ley et al

2005). Nevertheless, the use of a murine model offers the advantage of housing in

395 standardized conditions which minimize environmental influences. Therefore, extrapolation

to human might be challenging due to the heterogeneity of the population.

Today, the link between host (patho)physiology and the gut microbiome is being increasingly

recognized (Arumugam et al 2011, Elinav et al 2011). In-depth knowledge of the human

bacterial ecosystem in relation to disease might pave the way for the generation of customized

400 therapeutics and probiotics. We hypothesize that the induction of dysbiosis and the alteration

of epithelial mucus profiles by chronic cigarette smoke exposure modulates the risk for the

development of IBD, which may contribute to the adaptation of treatment strategies

depending on smoking behaviour. Future research exposing colitic mice to chronic smoke

exposure will be necessary to be able to attribute a specific role of dysbiosis and mucus

405 changes in the development of disease.

16
 Acknowledgements

We thank the FLAMES statistical center for advice in our statistical analyses. We are grateful

to Dorothea van Limbergen, Ran Rumes and Lynn Supply for the support with the animal

experiments and the processing of the samples, and Eliane Castrique, Christelle Snauwaert,

410 Marie-Rose Mouton, Katleen de Saedeleer, Anouk Goethals, Ann Neesen, Indra de Borle,

Evelyn Spruyt and Greet Barbier for the excellent technical support with the animal

experiments. We thank Tim Lacoere, Siska Maertens and Lois Maignien from LabMET for

the support with the DGGE and 454 pyrosequencing. This work was supported by the Special

Research Fund of Ghent University (01D41012), the Concerted Research Actions of Ghent

415 University (BOF10/GOA/021, BOF12/GOA/008) and the Interuniversity Attraction Poles

program (IUAP, P7/30). Liesbeth Allais is supported by a doctoral grant from the Special

Research Fund of Ghent University (01D41012). Frederiek-Maarten Kerckhof is supported by

a doctoral grant of Concerted Research Actions of Ghent University. Ken Bracke is a

postdoctoral researcher of the Fund for Scientific Research Flanders (FWO Vlaanderen).

420

425

17
 References

Ananthakrishnan AN (2013). Environmental risk factors for inflammatory bowel disease.

Gastroenterol Hepatol (N Y) 9: 367-374.

430
Arcavi L, Benowitz NL (2004). Cigarette smoking and infection. Arch Intern Med 164: 2206-2216.

Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR et al (2011). Enterotypes of

the human gut microbiome. Nature 473: 174-180.

435
Balish E, Warner T (2002). Enterococcus faecalis induces inflammatory bowel disease in interleukin-
10 knockout mice. Am J Pathol 160: 2253-2257.

Berry D, Reinisch W (2013). Intestinal microbiota: a source of novel biomarkers in inflammatory

440 bowel diseases? Best Pract Res Clin Gastroenterol 27: 47-58.

Biedermann L, Zeitz J, Mwinyi J, Sutter-Minder E, Rehman A, Ott SJ et al (2013). Smoking cessation

induces profound changes in the composition of the intestinal microbiota in humans. PLoS One 8:
e59260.

445
Boltin D, Perets TT, Vilkin A, Niv Y (2013). Mucin function in inflammatory bowel disease: an
update. J Clin Gastroenterol 47: 106-111.

Boon N, De Windt W, Verstraete W, Top EM (2002). Evaluation of nested PCR-DGGE (denaturing

450 gradient gel electrophoresis) with group-specific 16S rRNA primers for the analysis of bacterial
communities from different wastewater treatment plants. FEMS Microbiol Ecol 39: 101-112.

Carbonnel F, Jantchou P, Monnet E, Cosnes J (2009). Environmental risk factors in Crohn's disease
and ulcerative colitis: an update. Gastroenterol Clin Biol 33 Suppl 3: S145-157.

455
Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ et al (2009). The Ribosomal Database
Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res 37: D141-D145.

Collado MC, Derrien M, Isolauri E, de Vos WM, Salminen S (2007). Intestinal integrity and
460 Akkermansia muciniphila, a mucin-degrading member of the intestinal microbiota present in infants,
adults, and the elderly. Appl Environ Microbiol 73: 7767-7770.

D'Hulst A I, Vermaelen KY, Brusselle GG, Joos GF, Pauwels RA (2005). Time course of cigarette
smoke-induced pulmonary inflammation in mice. Eur Respir J 26: 204-213.

465
Dethlefsen L, McFall-Ngai M, Relman DA (2007). An ecological and evolutionary perspective on
human-microbe mutualism and disease. Nature 449: 811-818.

18
 Di YP, Zhao J, Harper R (2012). Cigarette smoke induces MUC5AC protein expression through the
470 activation of Sp1. J Biol Chem 287: 27948-27958.

Dimitriu PA, Boyce G, Samarakoon A, Hartmann M, Johnson P, Mohn WW (2013). Temporal

stability of the mouse gut microbiota in relation to innate and adaptive immunity. Environ Microbiol
Rep 5: 200-210.

475
Dowd SE, Sun Y, Secor PR, Rhoads DD, Wolcott BM, James GA et al (2008). Survey of bacterial
diversity in chronic wounds using Pyrosequencing, DGGE, and full ribosome shotgun sequencing.
BMC Microbiol 8.

480 Durban A, Abellan JJ, Jimenez-Hernandez N, Salgado P, Ponce M, Ponce J et al (2012). Structural
alterations of faecal and mucosa-associated bacterial communities in irritable bowel syndrome.
Environ Microbiol Rep 4: 242-247.

Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011). UCHIME improves sensitivity and
485 speed of chimera detection. Bioinformatics 27: 2194-2200.

Elinav E, Strowig T, Kau AL, Henao-Mejia J, Thaiss CA, Booth CJ et al (2011). NLRP6
inflammasome regulates colonic microbial ecology and risk for colitis. Cell 145: 745-757.

490 Erickson AR, Cantarel BL, Lamendella R, Darzi Y, Mongodin EF, Pan C et al (2012). Integrated
metagenomics/metaproteomics reveals human host-microbiota signatures of Crohn's disease. PLoS
One 7: e49138.

Fujihara M, Nagai N, Sussan TE, Biswal S, Handa JT (2008). Chronic cigarette smoke causes
495 oxidative damage and apoptosis to retinal pigmented epithelial cells in mice. PLoS One 3: e3119.

Garmendia J, Morey P, Bengoechea JA (2012). Impact of cigarette smoke exposure on host-bacterial

pathogen interactions. Eur Respir J 39: 467-477.

500 Golinska E, Tomusiak A, Gosiewski T, Wiecek G, Machul A, Mikolajczyk D et al (2013). Virulence

factors of Enterococcus strains isolated from patients with inflammatory bowel disease. World J
Gastroenterol 19: 3562-3572.

Hattrup CL, Gendler SJ (2008). Structure and function of the cell surface (tethered) mucins. Annu Rev
505 Physiol 70: 431-457.

Hoebler C, Gaudier E, De Coppet P, Rival M, Cherbut C (2006). MUC genes are differently expressed
during onset and maintenance of inflammation in dextran sodium sulfate-treated mice. Dig Dis Sci 51:
381-389.

510
Hovde O, Moum BA (2012). Epidemiology and clinical course of Crohn's disease: results from
observational studies. World J Gastroenterol 18: 1723-1731.

19
 Jin Y, Lin Y, Lin L, Zheng C (2012). IL-17/IFN-gamma Interactions Regulate Intestinal Inflammation
515 in TNBS-Induced Acute Colitis. J Interferon Cytokine Res.

Khan WI, Collins SM (2006). Gut motor function: immunological control in enteric infection and
inflammation. Clin Exp Immunol 143: 389-397.

520 Kim KC (2012). Role of epithelial mucins during airway infection. Pulm Pharmacol Ther 25: 415-
419.

Lakatos PL (2006). Recent trends in the epidemiology of inflammatory bowel diseases: up or down?
World J Gastroenterol 12: 6102-6108.

525
Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI (2005). Obesity alters gut
microbial ecology. Proc Natl Acad Sci U S A 102: 11070-11075.

Linden SK, Florin TH, McGuckin MA (2008). Mucin dynamics in intestinal bacterial infection. PLoS
530 One 3: e3952.

Liquet B, Le Cao KA, Hocini H, Thiebaut R (2012). A novel approach for biomarker selection and the
integration of repeated measures experiments from two assays. Bmc Bioinformatics 13.

535 Loftus EV (2004). Clinical epidemiology of inflammatory bowel disease: Incidence, prevalence, and
environmental influences. Gastroenterology 126: 1504-1517.

Macdonald G, Kondor N, Yousefi V, Green A, Wong F, Aquino-Parsons C (2004). Reduction of

carboxyhaemoglobin levels in the venous blood of cigarette smokers following the administration of
540 carbogen. Radiother Oncol 73: 367-371.

Manichanh C, Rigottier-Gois L, Bonnaud E, Gloux K, Pelletier E, Frangeul L et al (2006). Reduced

diversity of faecal microbiota in Crohn's disease revealed by a metagenomic approach. Gut 55: 205-
211.

545
McArdle BH, Anderson MJ (2001). Fitting multivariate models to community data: A comment on
distance-based redundancy analysis. Ecology 82: 290-297.

Medani M, Collins D, Docherty NG, Baird AW, O'Connell PR, Winter DC (2011). Emerging role of
550 hydrogen sulfide in colonic physiology and pathophysiology. Inflamm Bowel Dis 17: 1620-1625.

Muyzer G, Dewaal EC, Uitterlinden AG (1993). Profiling of complex microbial-populations by

denaturing gradient gel-electrophoresis analysis of polymerase chain reaction-amplified genes-coding
for 16S ribosomal-RNA. Appl Environ Microbiol 59: 695-700.

555
Ovreas L, Forney L, Daae FL, Torsvik V (1997). Distribution of bacterioplankton in meromictic Lake
Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene
fragments coding for 16S rRNA. Appl Environ Microbiol 63: 3367-3373.

20
560 Persson PG, Ahlbom A, Hellers G (1990). Inflammatory bowel disease and tobacco smoke--a case-
control study. Gut 31: 1377-1381.

Png CW, Linden SK, Gilshenan KS, Zoetendal EG, McSweeney CS, Sly LI et al (2010). Mucolytic
Bacteria With Increased Prevalence in IBD Mucosa Augment In Vitro Utilization of Mucin by Other
565 Bacteria. Am J Gastroenterol 105: 2420-2428.

Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig WG, Peplies J et al (2007). SILVA: a
comprehensive online resource for quality checked and aligned ribosomal RNA sequence data
compatible with ARB. Nucleic Acids Res 35: 7188-7196.

570
Quince C, Lanzen A, Davenport RJ, Turnbaugh PJ (2011). Removing Noise From Pyrosequenced
Amplicons. Bmc Bioinformatics 12.

Rogers MA, Greene MT, Saint S, Chenoweth CE, Malani PN, Trivedi I et al (2012). Higher rates of
575 Clostridium difficile infection among smokers. PLoS One 7: e42091.

Rolli J, Loukili N, Levrand S, Rosenblatt-Velin N, Rignault-Clerc S, Waeber B et al (2010). Bacterial

flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis-like
systemic inflammatory response in mice. Crit Care 14: R160.

580
Round JL, Mazmanian SK (2009). The gut microbiota shapes intestinal immune responses during
health and disease. Nat Rev Immunol 9: 313-323.

Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB et al (2009). Introducing
585 mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and
Comparing Microbial Communities. Appl Environ Microb 75: 7537-7541.

Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS et al (2011). Metagenomic

biomarker discovery and explanation. Genome Biol 12: R60.

590
Shirazi T, Longman RJ, Corfield AP, Probert CS (2000). Mucins and inflammatory bowel disease.
Postgrad Med J 76: 473-478.

Stecher B, Maier L, Hardt WD (2013). 'Blooming' in the gut: how dysbiosis might contribute to
595 pathogen evolution. Nat Rev Microbiol 11: 277-284.

Strober W, Fuss I, Mannon P (2007). The fundamental basis of inflammatory bowel disease. J Clin
Invest 117: 514-521.

600 Tomoda K, Kubo K, Asahara T, Andoh A, Nomoto K, Nishii Y et al (2011). Cigarette smoke
decreases organic acids levels and population of bifidobacterium in the caecum of rats. J Toxicol Sci
36: 261-266.

21
 Verschuere S, Bracke KR, Demoor T, Plantinga M, Verbrugghe P, Ferdinande L et al (2011).
605 Cigarette smoking alters epithelial apoptosis and immune composition in murine GALT. Laboratory
investigation; a journal of technical methods and pathology 91: 1056-1067.

Verschuere S, Allais L, Bracke KR, Lippens S, De Smet R, Vandenabeele P et al (2012). Cigarette

smoke and the terminal ileum: increased autophagy in murine follicle-associated epithelium and
610 Peyer's patches. Histochem Cell Biol 137: 293-301.

Vilchez-Vargas R, Geffers R, Suarez-Diez M, Conte I, Waliczek A, Kaser VS et al (2013). Analysis

of the microbial gene landscape and transcriptome for aromatic pollutants and alkane degradation
using a novel internally calibrated microarray system. Environ Microbiol 15: 1016-1039.

615
Xavier RJ, Podolsky DK (2007). Unravelling the pathogenesis of inflammatory bowel disease. Nature
448: 427-434.

Yu H, Li Q, Kolosov VP, Perelman JM, Zhou X (2012). Regulation of cigarette smoke-mediated

620 mucin expression by hypoxia-inducible factor-1alpha via epidermal growth factor receptor-mediated
signaling pathways. J Appl Toxicol 32: 282-292.

625

630

22
 Titles and legends to figures

635 Figure 1 Clustering dendrograms using the abundance-based Jaccard distance measure (a, c,

e) or Yue & Clayton’s θ (b, d, f) based on the normalized DGGE data. a, b: clustering

dendrograms for ileum. c, d: clustering dendrograms for caecum. e, f: clustering dendrograms

for distal colon. SM: smoking, NSM : non-smoking. DC: distal colon. IL: ileum. CC: caecum.

Figure 2 The effect of smoking on the abudance of species groups – LefSe analysis. (a)

640 Cladogram displaying the species groups more prominent in smoking (green) and non-

smoking mice (red). (b) Histogram showing the abundance of Desulfovibrionales sp. in

caecum (CC), distal colon (DC) and ileum (IL). The abundance of two samples per region is

displayed with the mean indicated as a black line. (c) Histogram showing the abundance of

Enterococcus sp. in caecum (CC), distal colon (DC) and ileum (IL). (d) Histogram showing

645 the abundance of Rhodococcus sp. in caecum (CC), distal colon (DC) and ileum (IL).

Figure 3 Heatmap with UPGMA clustering using the sparse Partimonial Least Squares

Discriminant analysis (sPLS-DA). Only the most relevant OTUs are displayed (ranked by

sPLS-DA Xw score (X within, (Liquet et al 2012)).

Figure 4 (a) Relative abundance of A. muciniphila in faeces of mice after 10 weeks of smoke

650 exposure. The amount of A. muciniphila tended to decrease in faeces of smoke-exposed mice

(p = 0,065). (b) Staining of mucins in ileum and distal colon after 24 weeks of smoke

exposure. Acidic mucins are stained in blue, neutral mucins are stained in purple-pink. (c)

Staining of sulfo- and sialomucins in ileum and distal colon after 24 weeks of smoke

exposure. Sulfomucins are stained in brown-black, sialomucins are stained in blue. (d) mRNA

655 expression of mucins in the ileum after air and smoke exposure, relative to the expression of

two reference genes (glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and

hydroxymethylbilane synthase (HMBS)). Expression of MUC2 and MUC3 significantly

23
 increases after smoke exposure (p = 0,039 and p = 0,0321 respectively). (e) mRNA

expression of mucins in the distal colon after air and smoke exposure. Expression MUC4

660 significantly increased after smoke exposure (p = 0,0274).

P-values lower than 0,05 were considered significant. Data are represented as mean±SEM.

N = 6 in each group. *: p < 0,05

24
 Table 1. Mouse primer sequences qRT-PCR

Gene
Accession Number Forward Primer (5’-3’) Reverse primer (3’-5’) Effic R2
Symbol

Hmbs AAGGGCTTTTCTGAGGCACC AGTTGCCCATCTTTCATCACTG 99 0,99

NM_001110251

Gapdh CATGGCCTTCCGTGTTCCTA GCGGCACGTCAGATCCA 106 0,9986

NM_008084

Muc1* NM_013605 GCAGTCCTCAGTGGCACCTC CACCGTGGGCTACTGGAGAG 105 0,99

Muc2 CAAGGGCTCGGAACTCCAG CCAGGGAATCGGTAGACATCG 97 0,92

NM_023566

Muc3* CGTGGTCAACTGCGAGAATG CGGCTCTATCTCTACGCTCTCC 104 0,94

XM_355711 G

Muc4* CAGCAGCCAGTGGGGACAG CTCAGACACAGCCAGGGAACT 110 0,96

AF520422 C

*Primer sequences were adapted from Hoebler et al., 2006.

 Table 2. Dissimilarity based Multivariate Analysis of Variance (MANOVA) based on pair-wise β-diversity matrices.

β-diversity measure Smoking vs Non-Smoking

Significant
(p-value)
Adapted Simpson (Lennon) yes
dissimilarity (βsim) 0,02098

Sørensen dissimilariteit (βw) yes

0,01698

Slope of Arrhenius species-area yes

0,02298
model (z, βz)

Jaccard distances yes

0,02597