Documente Academic
Documente Profesional
Documente Cultură
RBS
6xHN tag
Aat II Xho I EK site
(2080) (2151) MCS
Xba I (238)
PLtetO-1 Avr II (349)
I T1
III
Cmr
pPROTet.E
. kb II
Col E1
ori
t0
Sac I
(1279)
Spe I
pPROTet.E Promoter (1163)
–33 –10
1 tetO2 hexamer tetO2 hexamer
•
TCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTC
86 EcoR I
• RBS 6xHN tag
ATTAAAGAGGAGAAAGGTACCCATG GGT CAT AAT CAT AAT CAT AAT CAT AAT CAT AAT CAC AAC GGT GGA
Kpn I
156
• EK site
GAT GAC GAT GAC AAG –
pPROTet.E MCSs
Restriction Map and Promoter/MCS of the pPROTet.E 6xHN Vectors. All restriction sites shown are unique. The promoter
region (bases 1–170) is common to all three vectors.
Notes:
• The attached sequence file and the numbering of the map above are for pPROTet.E133. pPROTet.E133 is one base shorter
than pPROTet.E233 and one base longer than pPROTet.E333, as indicated by the asterisks (*) in the MCS diagrams.
• DNA methylation inhibits digestion at the Cla I site (+) in all three vectors. If you wish to use this site to construct new
vectors, propagate these vectors in a dam– strain.
• The pPROTet.E333-lacZ Control Vector was constructed by cloning the lacZ gene into pPROTet.E333 at the Hind III and
Pst I sites.
Description:
The pPROTet.E 6xHN vectors, part of the Pro™ Bacterial Expression System (1–4), are highly inducible, tetracycline-
regulated bacterial expression vectors available in three reading frames (see sequence on page 1). These vectors
contain three modules separated by unique Aat II, Xba I, and Sac I sites to allow for the creation of other vectors by
substituting for individual modules.
• Module I (Aat II–Xba I):
Contains the novel hybrid PLtetO-1 promoter, a ribosome binding site (RBS), a 6xHN affinity tag, an enterokinase
(EK) site for removal of the 6xHN affinity tag following protein expression, and a multiple cloning site (MCS). The
PLtetO-1 promoter takes advantage of the high expression levels from the PL promoter of phage λ, but has had the
lambda repressor sites replaced with two copies of operator 2 of the Tn10 tetracycline resistance operon. This
new promoter is thus tightly repressed by the Tet repressor protein and induced in response to tetracycline (Tc)
and Tc derivatives such as anhydrotetracycline (aTc, Cat. No. 631310), allowing quantitative control of expres-
sion over a wide range. Unique EcoR I and Kpn I sites are also located near the RBS to allow cloning upstream
or downstream of the RBS, respectively.
• Module II (Xba I–Sac I):
Contains the Col E1 origin of replication and the T1 and t0 transcription termination sequences.
• Module III (Sac I–Aat II):
Contains the chloramphenicol resistance gene (Cmr).
Use:
The PROTet.E 6xHN Vectors combine a highly-inducible, tightly-regulated, novel hybrid regulatory unit with a high-
copy replication origin to deliver a 2,500-fold range of expression. Gene expression is induced from these vectors in
response to the presence of Tc or aTc. The extensive MCS allows cloning at a variety of restriction sites in different
frames relative to the RBS and 6xHN tag. The 6xHN epitope is specifically designed to permit rapid and efficient
purification of expressed proteins using IMAC resins such as TALON® resin. pPROTet.E 6xHN Vectors can be used
with our PROLar Vectors, which contain a different promoter, for simultaneous expression of two independently
regulated genes of interest in the same cell.
Location of Features:
• PLtetO-1 hybrid promoter/operator: 6–79
• 5' PROTet Seq Primer binding site: 57–78
• Ribosome binding site: 87–100
• Start codon: 108–110
• 6xHN epitope tag sequence: 114–149
• Enterokinase cleavage site: 156–170
• T1 transcription termination sequence: 243–347
• 3' PROTet Seq Primer binding site: 355–372
• Col E1 origin of replication: 496–1095
• t0 transcription termination sequence: 1168–1273
• Chloramphenicol resistance gene (Cmr): 1289–1948
Propagation in E. coli:
• Suitable host strains: DH5αPRO and BL21PRO
• Selectable marker: plasmid confers resistance to chloramphenicol (34 µg/ml) on E. coli hosts
• E. coli replication origin: Col E1
• Copy number: high
References:
1. Lutz, R. & Bujard, H. (1997) Nucleic Acids Res. 25(6):1203–1210.
2. PRO Bacterial Expression System (1997) Clontechniques XII(4):6–8.
3. PRO Inducible Bacterial Expression System (1998) Clontechniques XIII(4):18–19.
4. PROTet 6xHN Bacterial Expression System (1999) Clontechniques XIV(4):24–25.
Note: The attached sequence file has been compiled from information in the sequence databases, published literature,
and other sources, together with partial sequences obtained by Clontech. This vector has not been completely
sequenced.
Notice to Purchaser
This product is intended to be used for research purposes only. It is not to be used for drug or diagnostic purposes, nor is it intended for human use. Clontech
products may not be resold, modified for resale, or used to manufacture commercial products without written approval of Clontech Laboratories, Inc.
Clontech, Clontech logo and all other trademarks are the property of Clontech Laboratories, Inc. Clontech is a Takara Bio Company. ©2005