Annals of Microbiology, 58 (2) 233-238 (2008)

Expression of recombinant Pichia pastoris X33 phytase for dephosphorylation of rice bran fermented liquid
Ming-Hui CHANG1, Chiu-Chung YOUNG*2, Shiuan-Yuh CHIEN1, A.B. ARUN2
1 Agricultural Chemistry Division, Agricultural Research Institute, Wufeng, Taichung, Taiwan; 2College of Agriculture and Natural Resources, Department of Soil and Environmental Sciences, National Chung Hsing University, 250 Kuo Kuang Rd., Taichung, 402 Taiwan, ROC

Received 5 December 2007 / Accepted 3 April 2008

Abstract - The Aspergillus ficuum phytase gene phyA was overexpressed in Pichia pastoris X33 after replacing Buffered glycerol-complex medium (BMGY medium) using 1% (v/v) glycerol with fresh Buffered methanol-complex medium (BMMY medium) using 1% (v/v) methanol (on daily basis) as carbon sources. The phytase activity increased evidently with the induction time, and reached 200 U mL-1 after 9 days of induction. We examined the possibility of employing thus obtained phytase to recover phosphorus from the fermented liquid of rice bran. When the 0.1 M sodium acetate buffer was replaced with de-ionised water (pH 5.5 0.1) as an enzyme reaction solution, there was an increase in the phosphorus recovery with respect to time and reached 1.31% after 24 h incubation contributing to 81% release of inorganic P from the rice bran phytate. Studies on hydrolysis of rice bran phytate by the addition of different concentrations of phytase ranging from 0-200 U mL-1 produced through the recombinant yeast shows no significant effect in the rate of phytate hydrolysis at enzyme activities of 200, 100, 50 U mL-1. However, rate of hydrolysis varied significantly at 20, 5, 0 U mL-1 enzyme concentrations. Key words: phytase, Pichia pastoris X33, phosphorus, rice bran, SDS-PAGE.

INTRODUCTION Cereals and legumes contain abundant phytic acid (myo-inositol hexakisphosphate), the major storage form of phosphorus (Reddy et al., 1982). Phytatephosphate in plant-derived foods and feeds are poorly available to humans and monogastric animals, such as swine and poultry (Erdman et al., 1989). Phytic acid is also regarded as an anti-nutritional factor since it easily forms insoluble complexes with proteins and binds to several of metal ions such as calcium, magnesium, iron, and zinc, thereby, decreasing the bioavailability of phosphorus (Maga, 1982; Rimbach et al., 1994). Phytases are phosphohydrolases that can hydrolyze phytic acid into less-phosphorylated myo-inositol derivates and free orthophosphoric acid. Microbial phytase enzymes are commonly used as additives in animal feeds to enhance the bioavailability and to reduce the nutritional and environmental problems associated with phytate (Lei et al., 1993). However, the higher production cost of phytase limits its widespread use. This limitation was resolved by designCorresponding author. Phone: 886-4-22861495; Fax: 886-4-22861495; E-mail: ccyoung@mail.nchu.edu.tw

ing an efficient strain of methylotrophic recombinant yeast via genetic engineering in addition to the optimisation of cultivation conditions. This method helped to increase the phytase yield and reduced the production cost (Han and Lei, 1999; Mayer et al., 1999; Chen et al., 2004). Since the properties and yield of a phytase are significantly affected by the expression capability of hosts and their posttranslational modifications, such as glycosylation, a number of expression hosts and systems have been tested for improving phytase function and production (Haefner et al., 2005). The Pichia pastoris expression system has been successfully used for production of various recombinant heterogeneous proteins (Zhang et al., 2007). Aspergillus niger, capable of producing phytase (Shieh and Ware, 1968; Howson and Devis, 1983) and its gene phyA, have been cloned, sequenced (Van Hartingsveldt et al., 1993) and successfully expressed in Pichia pastoris X33, a methylotrophic yeast. Pichia pastoris -1 X33 produced higher levels of phytase (64 U mL ) at 108 h after methanol induction (Han and Lai, 1999). The hydrolysis of phytate present in native seeds that were used as feed-additives, by phytase has been attempted earlier (Han and Wilfred, 1988; Quan et al., 2001).

234

M.-H. CHANG et al.

Rice bran contains abundant phytate that can be hydrolysed to inorganic phosphate using phytase. The released inorganic phosphate can be substituted in expensive commercial phosphate fertiliser in agriculture. However the major limitation step is hydrolysis of phytate, which demands the addition of sodium acetate solution (pH 5.5) as a buffering agent. Although this method appears attractive, neither is economical nor environmentally safe for liquid fertiliser production. The major objectives of this study was to express the phytase gene (phyA) of less investigated member of the genus Aspergillus, A. ficuum (BCRC 32870) in recombinant Pichia pastoris X33 to enhance the recovery of phosphorus in rice bran derived liquid fertiliser.

CA). The ligation mixture was transformed into E. coli DH5 and plated on a low salt LB agar plates -1 containing 25 g mL zeocin. Thus constructed plasmid was purified and linearised with PmeI and transformed to Pichia pastoris X33 (Invitrogen) by electroporation using EasyjecT PLUS (Equibio Ltd, UK). The phytase-producing transformant was used for further analysis. Chemicals, culture media and solutions used. The phytic acid dodecasodium salt and YNB (Yeast nitrogen base without amino acids and ammonium sulphate) were purchased from Sigma, while all other chemicals used were purchased from Merck. Rice bran was purchased from a local supplier in Taiwan. The BMGY medium contained 1% yeast extract, 2% peptone, 100 mM potassium phosphate -1 (pH 6.0), 1.34% YNB, 0.4 g mL biotin, 1% glycerol. The BMMY medium used in this study was similar to BMGY medium except 1% glycerol in BMGY medium was replaced by 1% methanol in BMMY. As the optimal pH required for the expression of phyA phytase of Pichia pastoris X33 was 5.5 (Han and Lei, 1999), to compare the efficiency of hydrolysis of rice bran phytate by the recombinant Pichia pastoris X33 phytase, de-ionised water and 0.1 M sodium acetate buffer were adjusted to pH 5.5 before use.

MATERIALS AND METHODS Construction of recombinant strains. For obtaining the recombinant Pichia pastoris the phytase gene phyA of Aspergillus ficuum (BCRC 32870) was amplified by PCR using primers (upstream, 5CGGAATTCCTGGCAGTCCCCG3; downstream, 5GCTCTAGACTAAGCAAACACTCC3) (Han and Lei, 1999). The amplified fragment was cloned to EcoRI and XbaI sites of pPICZ A (Invitrogen, San Diego,

FIG. 1 - Schematic diagram of culture and enzyme extraction conditions of recombinant Pichia pastoris X33.

Ann. Microbiol., 58 (2) 233-238 (2008)

235

Growth of recombinant Pichia pastoris X33. The schematic diagram of culture and enzyme extraction conditions of recombinant P. pastoris X33 is presented as Fig. 1. Briefly, single colony of recombinant P. pastoris X33 was selected from the plates and transferred to 25 ml of BMGY medium in a 125 ml baffled flask and incubated at 30 C with 200 rpm for 24 h. One mL of this seed culture was subsequently inoculated to a 100 mL of BMGY medium in a 250 mL baffled flask and conditions mentioned above were maintained. After 48 h of inoculation, cells were harvested by centrifugation (3000 x g for 5 min at 4 C), and the pellet was resuspended in 100 mL of sterile de-ionised water. The pellet was centrifuged, and resuspended in 100 mL of BMMY medium. After 24 h of incubation at 30 C with 200 rpm, 1 mL of culture media was transferred to a 1.5 mL Eppendorf microfuge tubes and centrifuged at 18000 x g for 3 min at 4 C. The supernatant or enzyme extract obtained was stored at 80 C for phytase activity and SDS-PAGE analyses. Further, 1 mL of 100% methanol was added to 100 mL of BMMY medium each day (9 days) to maintain the final concentration of 1% methanol for inducing phytase expression. The final culture after 9 days induction was transferred to 250 mL centrifuge bottle and centrifuged at 3000 x g for 15 min at 4 C, the supernatant was collected and stored at -80 C for further assays. Phytase assay. Phytase activity was measured by the method previously described (Shimizu, 1992; Bae et al., 1999) with slight modification. The method was modified to determine the amount of inorganic phosphate released by the enzyme using sodium phytate as substrate. Briefly, the reaction mixture containing 300 L of 1.5 mM sodium phytate in 0.1 M sodium acetate buffer (pH 5.5) and 75 L of crude phytase extract was incubated at 37 C for 20 min. The reaction was stopped by the addition of 375 L of 5% (w/v) trichloroacetic acid. The inorganic phosphate released was measured after the addition of 375 L of freshly prepared coloured reagent, which was prepared by mixing of 1.5% (w/v) ammonium molybdate in a 5.5% (v/v) sulphuric acid and 2.7% (w/v) ferrous sulphate solution (4:1). The absorbance was measured at 700 nm. Simultaneously, the crude phytase extract inactivated by the addition of 375 L of 5% (w/v) trichloroacetic acid was used as blank and all other conditions were similar to that followed for experimental group. Similarly, a blank treatment containing equal volume of sterile de-ionised water instead of enzyme extract was also taken as control. In both control sets no blue color was developed, indicating that the TCA and assay reagent are unable to hydrolyze the phytic acid and release inorganic phosphate. One unit (U) of phytase activity was defined as that releases 1 mol inorganic phosphate

from sodium phytate per minute at pH 5.5 and 37 C. SDS-PAGE analysis. SDS-PAGE analysis of crude phytase extracts at different induction time was performed using 10% acrylamide as running gel and 5% acrylamide as stacking gel. The phytase was stained with Coomassie brilliant blue R250 and photographed. Deglycosylation of expressed phytase. The crude phytase extracts that were collected after 1, 3, 6, 9 days of methanol induction were treated separately with 0.35 IU of endoglycosylase H (Endo Hf; New England Biolabs, Beverly, MA). The reaction mixture was incubated at 37 C for 1 h. The SDSPAGE analyses of the phytase before and after deglycosylation were compared. Rice bran dephosphorylation by the expressed phytase in sodium acetate buffer and deionised water conditions. In vitro hydrolysis of rice bran phytate was carried out (Quan et al., 2001) with slight modifications. The rice bran contained 1.57% of total P consisting of 76.4% of phytate P. In brief, 10 g of autoclaved rice bran (1 h at 121 C) was suspended in 100 mL of de-ionised water (pH 5.5 0.1) and 0.1 M sodium acetate buffer solution (pH 5.5) separately and incubated -1 with 1 mL of crude enzyme extract (200 U mL ) at 37 C on a rotary shaker (110 rpm) for 24 h. The reaction was stopped by the addition of equal quantity of 10% (w/v) trichloroacetic acid. The control group was similar to the experimental group with an exception that crude phytase extract was inactivated with trichloroacetic acid prior to reaction. Similarly, a blank treatment was taken, where enzyme extract was replaced with an equal volume of sterile de-ionised water. The samples were collected at 0, 12 and 24 h. In addition, hydrolysis of rice bran phytate was studied after incubation for different time intervals (0, 1, 3, 6, 9, 12, 16, 20 and 24 h) using de-ionised water (pH 5.5 0.1) instead of 0.1 M sodium acetate buffer solution to study the minimum time required for the maximum activity. Optimisation of the phytase activity for the dephosphorylation. Hydrolysis of rice bran phytate-phosphorous was compared among six different dilutions of phytase extracts (200, 100, 50, 20, -1 5, 0 U mL ) in 0.1 M sodium acetate buffer (pH 5.5). All the methods adopted here were similar to the above experiment with an exception of the enzyme concentrations. Statistical analysis. All the experiments were in triplicates and the differences between the treatment means were analysed by students T-test at 5% level.

236

M.-H. CHANG et al.

RESULTS AND DISCUSSION Expression of recombinant Pichia pastoris X33 The expression of Aspergillus ficuum phyA gene in Aspergillus niger and its detailed characterisation has been reported earlier (Ullah and Sethumadhavan, 2003) and functional expression of an Aspergillus niger phytase (phyA) in Pichia pastoris was studied in detail by Han and Lai (1999). Apart from this, no detailed characterisation of phytase gene phyA are available on the ability of other members of the genus Aspergillus. In this study we used A. ficuum phytase gene phyA to over-express in methylotrophic yeast Pichia pastoris X33, after replacing BMGY medium containing 1% (v/v) glycerol with fresh BMMY medium containing 1% (v/v) methanol (on daily basis) as carbon sources. The phytase activity increased significantly with -1 the induction time and reached 200 U mL after 9 days of induction (Fig. 2). Total concentration of phytase obtained using recombinant Pichia pastoris in our study was higher than the phytase concentration recorded in an earlier study using the same phytase gene phyA (Han and Lai, 1999). Similar observations on the increased induction of phytase was also recorded when the methylotrophic yeast P. pastoris was used for heterologous expression of the E. coli phytase gene appA (Chen et al., 2004). The appA gene was cloned under the control of the AOX1 promoter, which was overexpressed when methanol was used as a sole source of carbon. Quan et al. (2001) reported that a novel yeast Candida krusei showed maximum enzyme activity of 3.5 U -1 mL . But, in this study we report a several fold increase in the enzyme production by the recombinant P. pastoris X33. The intensity of phytase production analysed using SDS-PAGE correlated significantly with induction time (Fig. 3A) indicating that methanol induction was vital for the expression of phytase. The bands obtained on the SDS-PAGE (Fig. 3A) were less intense and larger than that of A. niger (80 kDa), possibly due to the glycosylation of phyA phytase. However, after deglycosylation with Endo Hf, a sharp band of about 55 kDa was visualised (Fig. 3B). Molecular weight of this band was identical to the band obtained in an earlier study (Han and Lai, 1999). Intensity of these bands increased notably with induction time. Comparison between the rates of enzymatic hydrolysis of rice bran phytate in sodium acetate buffer and de-ionised water Enzymatic hydrolysis of rice bran phytate phosphorous requires a pH of 5.5. Generally 0.1 M sodium acetate buffer is being used for this purpose. When 0.1 M sodium acetate buffer was replaced with deionised water (pH 5.5), no significant difference was observed in the rate of hydrolysis between two

FIG. 2 - Expression of phytase activity by the recombinant Pichia pastoris X33 after replacement of BMGY media with BMMY media and 1% methanol induction in the baffled flask.

A
kDa 200 97 66 45 M 1 2 3 4 5 6 7 8 9

B
kDa 200 97 66 45 M 1 2 3 4 5 6 7 8

FIG. 3 - SDS-PAGE analysis of the crude phytase extracts. A: Different induction time before/without deglycosylation by Endo Hf. Lane M: protein molecular weight marker. Lanes 1-9: induction of phytase from day 1-9. Results are representative of three experiments. B: Treatment with and without endoglycosylase by Endo Hf. Lane M: protein molecular weight marker. Lanes 1, 3, 5 and 7 samples after 1, 3, 6 and 9 days of induction. Lanes 2, 4, 6 and 8 the samples treated with Endo Hf.

treatments during different time intervals (0, 12 and 24 h) (Table 1). Only an insignificant change in the pH value was observed in the de-ionised water added rice bran, after prolonged incubation period (data not shown). In addition, the concentration of inorganic phosphorus increased significantly with time and at the end of 24 h after incubation concentration reached 1.31% compared to 0.3% P in control (Fig. 4). This amounted to 81% recovery of inorganic P from the rice bran phytate P. However, the TCA inactivated enzyme and sterile de-ionised water controls did not show any hydrolysing activi-

Ann. Microbiol., 58 (2) 233-238 (2008)

237

TABLE 1 - Concentration of inorganic phosphorus hydrolysed in rice bran after incubation of crude phytase extract with DeH2O and 0.1 M acetate buffer as reaction solutions at different time intervals Solution Phosphorus content (%) Crude phytase extract* Incubation (0 h) De-H2O Acetate buffer 0.1 M Incubation (12 h) De-H2O Acetate buffer 0.1 M Incubation (24 h) De-H2O Acetate buffer 0.1 M Control**

0.32 0.01 0.31 0.01

0.30 0.00 0.28 0.00

1.04 0.00 0.98 0.03

0.30 0.02 0.28 0.00

1.31 0.04 1.20 0.03

0.33 0.01 0.34 0.01

ties. Above results indicate that equivalent amounts of phosphorus can be hydrolysed from rice bran phytate by recombinant P. pastoris X33 phytase after replacing 0.1 M sodium acetate buffer with deionised water (pH 5.5) without producing any objectionable odour and microbial contamination. Simulation of the digestive tract conditions for biodegradation of phytate using a novel yeast Candida krusei was attempted (Quan et al., 2001). Concentration of phosphorus recorded using that condition was only 0.8% after 12 h, which is lower than P released by the recombinant P. pastoris X33 of our study irrespective of the media used (deionised water or sodium acetate). Optimisation of phytase activity for hydrolysing the phytate to inorganic P from rice bran Wet sterilisation (autoclaving) of the rice bran did not dephosporylate the phytate. No significant difference was observed between the amount of hydrolysed P (1.16%) after 24 h incubation with -1 enzyme concentrations of 200, 100 and 50 U mL while, significant decline in hydrolysis of inorganic P -1 was recorded when 20 and 5 U mL enzyme concentrations were used (Fig. 5). Enzyme concentra-1 tion as low as 5 U mL showed significantly higher levels of P released (0.93%) compared to the control. No significant difference between the levels of P released in the sterile de-ionised water-only blank and inactivated control was observed (data not presented). In conclusion, recombinant P. pastoris X33 phytase gene expression can be enhanced by choosing methanol as the carbon source during the induction period. Recombinant P. pastoris X33 also has a potential to enhance phytase production, if methanol controller is altered in the fermentation process, which has been already shown by Chen et al. (2004). Fermentation of rice bran for the enzymatic hydrolysis of phytate can be simplified by selecting de-ionised water at pH 5.5. Efficiency of the recombinant P. pastoris X33 phytase is very high and 81% of the phytate P was released from the rice bran within 24 hours of incubation with the crude enzyme extract. Acknowledgements Financial support from Council of Agriculture, Executive Yuan, Republic of China (Grant No. 92AS4.2.3-CI-C1; 93AS-4.2.1-CI-C1) is gratefully acknowledged.

* 20 U g-1 rice bran. **Control represents inactivated enzyme. No significant difference was observed when enzyme blank was replaced with sterile de-ionised water as control.

FIG. 4 - Hydrolysis of rice bran phytate-phosphorous by recombinant Pichia pastoris X33 phytase after incubating at different time intervals. Control represents inactivated enzyme. No significant difference was observed when enzyme blank was replaced with sterile de-ionised water as control.

REFERENCES Bae H.D., Yanke L.J., Cheng K.J. Selinger L.B. (1999). A novel staining method for detecting phytase activity. J. Microbiol. Methods, 39: 17-22. FIG. 5 - Effect of different phytase concentrations on the inorganic phosphorus released from rice bran phytate. Chen C.C., Wu P.H., Huang C.T., Cheng K.J. (2004). A Pichia pastoris fermentation strategy for enhancing the

238

M.-H. CHANG et al.

heterologous expression of an Escherichia coli phytase. Enzyme Microbiol. Technol., 35: 315-320. Erdman L.W., Poneros S.K. (1989). Phytic acid interaction with divalent cations in foods and in the gastrointestinal tract. Adv. Exp. Med. Biol., 249:161-171. Han Y., Lei X.G. (1999). Role of glycosylation in functional expression of an Aspergillus niger phytase (phyA) in Pichia pastoris. Arch. Biochem. Biophys., 364:83-90. Han W.Y., Wilfred, A.G.. (1988). Phytate hydrolysis in soybean and cottonseed meals by Aspergillus ficuum phytase. J. Agric. Food Chem., 36:259-262. Haefner S., Knietsch A., Scholten E., Braun J., Lohscheidt M., Zelder O. (2005). Biotechnological production and applications of phytases. Appl. Microbiol. Biotechnol., 68:588-597. Howson S. J., Davis R. P. (1983). Production of phytatehydrolysing enzyme by some fungi, Enzyme Microb. Technol., 5:377-382. Lei X.G.., Ku P.K., Miller E.R., Yokoyama M.T. (1993). Supplementing corn-soybean meal diets with microbial linearly improves phytate P utilization by weanling pigs. J. Anim. Sci., 71: 3359-3367. Maga J.A. (1982). Phytate: its chemistry, occurrence, food interactions, nutritional significance, and methods of analysis. J. Agric. Food Chem., 30:1-9. Mayer A.F., Hellmuth K., Schlieker H., Lopez-Ulibarri Oertel R. S., Dahlems U., Strasser, A. W. M., van Loon A. P. G. M. (1999). An expression system matures: a highly efficient and cost-effective process for phytase production by recombinant strains of Hansenula polymorpha. Biotech. Bioeng., 63:373-381.

Reddy N.R., Sathe S.K., Salunkhe D.K., (1982). Phytates in legumes and cereals. Adv. Food Res., 28:1-92. Rimbach G.H., Ingelmann J., Pallauf J. (1994). The role of phytase in the dietary bioavailability of minerals and trace elements. Ernahrungsforschung. 39:1-10. Shieh E.T., Ware J.H. (1968). Survey of microorganisms for the production of extracellular phytase. Appl Microbiol., 16:1348-1351. Shimizu, M. (1992). Purification and characterization of phytase from Bacillus subtilis (natto) N-77. Biosci. Biotechnol. Biochem., 56:1266-1269. Quan C.L., Zhang Y., Wang Y., Ohta Y. (2001). Production of phytase in low phosphate medium by a novel yeast Candida krusei. J. Biosci. Bioeng., 92:154-160. Ullah A.H.J., Sethumadhavan K. (2003). PhyA gene product of Aspergillus ficuum and Peniophora lycii produces dissimilar phytases. Biochem. Biophy. Res. Commun., 303: 463468. Van Hartingsveldt W., van Zeijl C.M.J.G.M., Harteveld M., Gouka R.J., Guykerbuyk Luiten M.E.G., van Paridon R.G.M.M., Selten G.C., Veenstra A.E., van Gorcom R.F.M., van den Hondel C.A.M.J.J. (1993). Cloning, characterization and expression of the phytase-encoding gene phyA of Aspergillus niger. Gene. 127; 87-94. Zhang Y., Liu R., Wu X. (2007). The proteolytic systems and heterologous proteins degradation in the methylotrophic yeast Pichia pastoris. Ann. Microbiol., 57: 553-560.