Am. J. Trop. Med. Hyg., 74(4), 2006, pp.

649657 Copyright 2006 by The American Society of Tropical Medicine and Hygiene

PCR-BASED ASSAY TO SURVEY FOR KNOCKDOWN RESISTANCE TO PYRETHROID ACARICIDES IN HUMAN SCABIES MITES (SARCOPTES SCABIEI VAR HOMINIS)
CIELO PASAY,* SHELLEY WALTON, KATJA FISCHER, DEBORAH HOLT, AND JAMES MCCARTHY Queensland Institute of Medical Research and Australian Centre for International and Tropical Health and Nutrition, University of Queensland, Brisbane, Queensland, Australia; Menzies School of Health Research and Charles Darwin University, Darwin, Northern Territory, Australia

Abstract. Permethrin, in the form of a topical cream, is being increasingly used for community-based programs to control endemic scabies. The development of resistance has reduced the use of pyrethroids for the control of many arthropods of economic and health importance. The best recognized form of pyrethroid resistance, known as knockdown resistance or kdr, has been linked to specific mutations in the target of these agents, the para-homologous voltagesensitive sodium channel gene (Vssc). To develop tools to study resistance to pyrethroid acaricides, we cloned 3711 and 6151 bp, respectively, of cDNA and genomic fragments of the Vssc gene from scabies mite, Sarcoptes scabiei. The sequence encompasses the major polymorphic amino acid residues associated with pyrethroid resistance. A polymerase chain reactionbased strategy has been developed that enables genotyping individual scabies mites. This will facilitate early detection and monitoring of pyrethroid resistance in scabies mite populations under drug selection pressure. INTRODUCTION Infestation of the skin by the itch mite Sarcoptes scabiei results in a disease called scabies. While it is prevalent worldwide, it is a major health problem in many developing countries, where its epidemiology is related primarily to poverty and overcrowding. Infestation occurs when a mite, 0.3 mm in length, burrows into the skin and consumes host epidermis. The predominant disease manifestations are mediated through an allergic reaction to mite products and lead to intensely pruritic lesions. It has been estimated that 300 million people suffer from scabies infestation at any one time.1 The morbidity caused by this ectoparasite is frequently underestimated. In addition to the discomfort caused by the intensely pruritic lesions, infestation causes significant morbidity because of secondary bacterial infections, especially group A Streptococci. Repeated infestation and resultant recurrent pyoderma have now been identified as important precipitants of poststreptococcal renal and rheumatic heart disease, and thus control programs for scabies represent a major focus of public health intervention in endemic communities such as indigenous communities in northern Australia.25 The standard treatment of human scabies in the developed world is topical application of the pyrethroid drug permethrin in a concentration of 5%. In scabies-endemic communities, public health prevention strategies are increasingly based on mass community treatment. In studies evaluating such community control programs, significant short-term success has been shown, with a major reduction in the prevalence of symptomatic scabies and pyoderma.6,7 However, mass community treatment in endemic communities creates an environment for emerging tolerance or resistance, and new approaches to control are needed. The contribution of drug resistance to treatment failure in individual patients has been largely unexplored. To date, treatment failures have been attributed to incorrect application of the acaricide, failure to treat all contacts leading to re-infestation, or the so-called core transmitter crusted scabies patients.7 However, there are increasing reports of treatment failure to acaricidal drugs including 1% gammabenzene hexachloride (Lindane [Drexel Chemical Company, Memphis, TN], Quellada [Stafford-Miller, NSW, Australia]),8 crotamiton 10% (Eurax [Novartis Pharmaceuticals, NSW, Australia]),910 and more recently ivermectin.11 Permethrin was first approved for human use in 1986 in the United States for treatment of head lice caused by Pediculus capitis. Permethrin resistance in head lice is now widespread, with clinical failures reported in Australia, Israel, England, France, and the Czech Republic.12,13 Permethrin in the form of a 5% cream was introduced in northern Australia in 1994 for treatment of scabies. At the time of its introduction, an in vitro study showed a 100% mortality after 1-hour exposure to 5% permethrin.14 Since then, it has been extensively used across central and northern Australia, and such widescale use may have led to the selection of resistance. Indeed, a recently published in vitro acaricide efficacy study suggested that S. scabiei mites are becoming increasingly tolerant to permethrin.15 In this study, 35% of mites exposed to 5% permethrin were still alive after 3 hours, and 4% were still alive after 1822 hours of exposure. These results therefore raise concerns about the development of acaricide resistance in scabies mites. Pyrethroids act on the nervous system of arthropods by altering the function of voltage-sensitive sodium channel (Vssc) in nerve membranes, otherwise known as the parahomologous sodium channel. They slow the kinetics of sodium channel activation and inactivation, resulting in the prolonged opening of the channels that lead to paralysis and death. Arthropod Vsscs are members of a family of large, complex transmembrane proteins that generate the action potentials in the neuronal membranes of higher eukaryotes that are responsible for neurotransmission.16 The subunit of this sodium channel is composed of four homologous repeating domains (IIV) each with six transmembrane segments (S1 S6) that contribute to the functional gating properties of the channel. The best recognized mechanism of reduced sensitivity of the nervous system of arthropods to pyrethroid insec-

* Address correspondence to Cielo Pasay, Clinical Tropical Medicine Laboratory, Infectious Diseases and Immunology Division, Queensland Institute of Medical Research, Herston, Queensland 4029, Australia. E-mail: cielop@qimr.edu.au

649

650

PASAY AND OTHERS

ticides is known as knockdown resistance (kdr). This is mediated by specific mutations in this Vssc. The most important mutations associated with the kdr phenotype have been identified in domain II. Such mutations were initially identified in pyrethroid-resistant houseflies (Musca domestica) and subsequently in several other species,1719 including Anopheles gambiae,20 the mosquito vector for malaria, and Culex pipiens,21 an important mosquito vector for flavivirus infection. The functional significance of these mutations has been verified by electrophysiological study of mutant alleles in Xenopus laevis oocytes.22 Of significance, these kdr mutations located in domain II have not been detected in pyrethroid-resistant arthropods more closely related to the scabies mites, such as the cattle tick (Boophilus microplus) and honeybee mite (Varroa destructor). Instead, a point mutation was identified in domain III in pyrethroid-resistant cattle ticks23 and in the linker connecting domains III and IV and in domain IV itself in pyrethroid-resistant honeybee mites.24 These results suggest that distinct sodium channel gene mutations may be selected in different arthropod species in response to pyrethroid drug pressure. The aim of this study was to clone and sequence the Vssc gene in the human scabies mite, S. scabiei var hominis, and develop a polymerase chain reaction (PCR)-based assay to enable survey for mutations in the para-homologous gene that may be associated with permethrin resistance.

MATERIALS AND METHODS cDNA libraries. Two S. scabiei cDNA libraries were used for isolation of the gene of interest: a S. scabiei var hominis cDNA library25 and a S. scabiei var vulpes cDNA library.26 S. scabiei var hominis genomic DNA. Genomic sequence was obtained by PCR from human scabies mites collected from shed skin of a crusted scabies patient. Genomic DNA was extracted as previously described.27 In brief, 50 mites were placed in Prepman Ultra Reagent (Applied Biosystems, Foster City, CA), homogenized with a motorized homogenizer, and boiled for 10 minutes. After cooling in ice for 2 minutes, the tube was spun, and 1 L of the supernatant was used as template for PCR. S. scabiei var suis cDNA. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbard, CA) from scabies mites collected from a pigs ear. Pig mite cDNA was derived by reverse transcription using Gene Racer 5 primer (Invitrogen) and a gene-specific primer. PCR strategies. Primers for PCR were designed from Vssc orthologs in GenBank and are listed in Table 1. Degenerate primer pairs were used to amplify domains IIIIV of the SsVssc from the S. scabiei var hominis cDNA library. The region spanning domain II was initially isolated from genomic DNA extracted from human scabies mites using a degenerate forward primer and a scabies gene-specific reverse primer. The corresponding cDNA sequence was amplified from pig

TABLE 1 List of primers

Name Sequence (5 to 3 ) Location

PCR primers used to amplify S. scabiei Vssc cDNA NAC* AAYYTNTTYATHGGNGTNATHATHGAYAA F NAD* TTYTCNARDATNAYNGCDATRTACATRTT R NA2M* GARTGGATHSARWCNATGTGGGA F NACRC* TTRTCDATDATNACNCCDATRAANARRTT R 3177F GTGATTGCGGAACAAAGGAAT F 1172F GCCCTAGTTGTGTTCGATCCTTT F 2052R GAAGAGAGCAACAAAGCCAAGAAC R 479R TTGACGCCACAAAGTGCTGC R PCR primers used to amplify S. scabiei Vssc genomic sequence 1595F GGCGTGTGAGGCTCGAAATC 2538R TAGCAGCCAAGACATGATCCC 189F GTTAGCATTTGGCTTCTATGGC 1595R ATTTCGAGCCTCACACGCC 86F GGTAAAGAGATTCCGAGA 189R GCCATAGAAGCCAAATGCTAAC 1045F AGACCATYGTMGGCGCYGTY 3205R CGCCTGAAACACGCATACAATC F R F R F R F R

46214649 55215549 29532975 46214649 25672587 11721194 186209 31073126 15121531 25012521 11431164 15121531 724 11431164 884903 103124 11351156 20982116 20982116 28342858 28342858 37093732 37093732 47824803 47824803 61326151

Genotyping PCR primers D2A TTGTTTTTGGTGCTGGATCCGT D2B GCTTTTTGGTATCCGCACT LA ACTGCGGATACCAAAAAGC LB GGATTGTTTTCCATCGAGCCCAGAA D3A TTCTGGGCTCGATGGAAAACAATCC D3B TATGTTACCTAAACCAGCAATACC D3C GGTATTGCTGGTTTAGGTAACATA D3D TTGTAATATTTTTTCTGATCTT D4A AAGATCAGAAAAAATATTACAA D4B TTGACGCCACAAAGTGCTGC
Position in M. domestica Vssc sequence (GenBank accession no. U38814). Position in S. scabiei Vssc cDNA sequence (GenBank accession no. DQ077149). Position in V. destructor Vssc sequence (GenBank accession no. AY259834). Position in S. scabiei Vssc genomic sequence (GenBank accession no. DQ077148). * (From He, et al, 1999).

KDR GENE OF SCABIES MITES

651

scabies mites, S. scabiei var suis, using a gene-specific primer pair. The 3 end of the scabies sodium channel was initially amplified from the S. scabiei var vulpes cDNA library using a gene-specific primer and a bacteriophage lambda vector primer (T7). The corresponding 3 region was subsequently amplified from the S. scabiei var hominis cDNA library. PCR reactions were performed in 50- L volumes with 5 L of 10 buffer with 27.5 mmol/L MgCl2, 30 pmol of each primer, 1 L of 10 mmol/L dNTPs, 3 L of cDNA, and 1.25 units of Taq polymerase. Cycling conditions used were as follows: a denaturation temperature of 94C for 1 minute; annealing temperature of 4555C (depending on the pair of primers used) for 1 minute; and extension temperature of 6872C for 30 seconds to 2 minutes (depending on the size of expected product). Optimal cycling protocols were determined by varying the annealing temperature of reaction with each primer pair used and modifying cycling conditions from standard PCR protocols following the suppliers recommendations to touchdown protocols. Optimizing of the PCR also included varying the amount of template, MgCl2 concentration, and source of Taq polymerase. PCR products were separated by agarose gel electrophoresis and purified by a Roche PCR product purification kit (Roche, Mannheim, Germany). Cloning and DNA sequencing. Purified products were ligated into pGEM T Easy vector and recombinant plasmids transformed into JM109 competent cells (Promega, Madison, WI). Plasmid DNA was purified with the Roche Plasmid Purification Kit. Insert-positive clones were verified by restriction enzyme digestion and subjected to DNA cycle sequencing. Cycle sequenced products were precipitated by 70% isopropanol and analyzed using the ABI Prism 3100 Genetic Analyzer sequencing apparatus. Sequences were analyzed using MacVector 7.2 (Accelrys, San Diego, CA) and compared with orthologs in GenBank using Blast X. Ethics approval. Ethics approval for collection of skin samples containing mites was obtained from the Human Research Ethics Committee of the Menzies School of Health Research and the Royal Darwin Hospital, and ethics approval for collection of mites from pigs ear was obtained from Animal Ethics Committee of the Queensland Institute of Medical Research. RESULTS Cloning S. scabiei Vssc cDNA. A 0.9-kb fragment encompassing domain IIIS6 to IVS5 was amplified by PCR from the human scabies mite cDNA library using a pair of degenerate primers, NAC and NAD, designed from conserved amino acid residues of sodium channels of D. melanogaster and M. domestica.28 A 1.8-kb fragment covering domain IIS6 to IIIS5 was cloned by PCR using the reverse and compliment of NAC as a reverse primer plus another degenerate forward primer, Na2M, designed from conserved regions of known sodium channel proteins of two arthropod species mentioned earlier.23 A 0.8-kb fragment spanning domain II was cloned by PCR from pig scabies mite cDNA using a pair of gene specific primers (1172F and 2052R) designed from previously derived genomic sequence. The 3 end cDNA sequence of 1 kb was amplified from a fox scabies mite cDNA library using a scabies mite-specific forward primer, 3177F, and vector primer, T7, and subsequently from the human scabies mite cDNA library using 3177F and 479R (Table 1).

Cloning S. scabiei genomic DNA. Fragments corresponding to the cDNA of the SsVssc sequence were amplified from S. scabiei var hominis genomic DNA using primers designed from the cDNA sequence (Table 1). Genomic fragment (GF1) of 2 kb in length spanning domain IIS1S6 was amplified by a degenerate forward primer, 1045F, and a gene-specific reverse primer, 3205R; genomic fragment 2 (GF2) of 1.1 kb spanning domain IIS6 to domain IIIS2 was amplified by genespecific primers 86F and 189R; genomic fragment 34 (GF3 4) of 1.4 kb was amplified by gene-specific primers 189F and 1595R; and genomic fragment 5 (GF5) of 1.1 kb was amplified by gene-specific primers 1595F and 2538R. The S. scabiei var suis genomic sequence was cloned in a similar manner. Scabies mite sodium channel gene. The partial SsVssc cDNA encompasses 3,711 nucleotides with an open reading frame (ORF) encoding 1,237 amino acids (GenBank accession no. DQ077149: S. scabiei var hominis; no. DQ077150: S scabiei var suis). The putative stop codon (TAA) is at nucleotide 3238. At the 3 end of the cDNA sequence, a poly (A) tail sequence, was found after 297 bp of 3 untranslated region. Alignment of the deduced amino acid sequence of SsVssc with the cattle tick, B. microplus sodium channel gene23 showed strongest similarity at domains III and IV, with 74% identity at the amino acid level (Figure 1). The SsVssc also showed high similarity to the honeybee mite, V. destructor,29 Vssc protein at domain II, with 81% identity at the amino acid level. As expected, the SsVssc sequence of the short intracellular linker between domains III and IV was highly conserved compared with the B. microplus sequence (98% identity) and the V. destructor (96% identity). A number of important hallmarks of a Vssc protein were present in the SsVssc. The positively charged amino acid K(Lys) and R(Arg) were located every third position in segment 4:5 in domain IIS4, 5 in domain IIIS4, and 7 in domain IVS4. This S4 feature acts as a voltage sensor that initiates voltage-dependent activation by moving outward under the influence of electric field.30 An MFM (Met/Phe/Met) tripeptide motif was found in place of the IFM(Ile/Phe/Met) motif found at the same location in Drosophila para and para orthologs. This motif in the intracellular linker that connects domains III and IV has been hypothesized to play a crucial role in the fast inactivation of sodium channels.30 We did not find the DEKA (Asp/Glu/Lys/Ala) signature sequence motif located in the putative pore positions connecting S5 and S6 of domains IIV, critical for sodium ion selectivity.30 The corresponding genomic DNA sequence of S. scabiei var hominis (Genbank accession no. DQ077148) was analyzed to determine genomic organization of the scabies mite sodium channel gene. A 55-bp intron in the transmembrane linker connecting domains II and III and a 72-bp intron in the transmembrane linker connecting domains III and IV were found. A 67-bp intron was found in the middle of domain II S4, and a 508-bp intron was found within domain III S2. Other introns were detected in intracellular linkers connecting segments S1 and S2 of domain II (61 bp); segments S5 and S6 of domain II (75 bp); segments S1 and S2 of domain III (61bp); segments S4 and S5 of domain III (382 bp); and segments S5 and S6 of domain III (96 bp) (data not shown). Comparison of S. scabiei var humanis and var suis Vssc genes. A comparison of the S. scabiei var hominis and S. scabiei var suis Vsscs (GenBank accession no. DQ 145115) ge-

652

PASAY AND OTHERS

FIGURE 1. Alignment of deduced amino acid sequence of SsVssc with V. destructor and B. microplus. The four homologous domains (IIV) with six transmembrane segments (S1S6) are shown in bold. Asterisks represent identical residues. The putative stop codon for S. scabiei is indicated by a bold asterisk.

nomic sequences showed identical intron/exon structures with 99% identity at the amino acid level (data not shown). Development of a genotyping strategy. Based on the derived genomic sequence, genotyping primers were designed to cover the coding regions of the genomic sequence that includes sites associated with permethrin resistance in a range of arthropods, and a PCR amplification strategy that results in five PCR products, each of approximately 1 kb in length was developed (Figure 2; Table 1). The first pair of gene-specific primers (D2A and D2B) covered domain II S1S6 of the SsVssc gene and resulted in a 982-bp product. The optimal cycling conditions were as fol-

lows: 35 cycles of 94C for 30 seconds, 52C for 30 seconds, and 72C for 1 minute. The next pair of primers amplified the linker region between domains II and III and used primers LA and LB resulting in a 761-bp product. The optimal cycling conditions were as follows: 35 cycles of 94C for 30 seconds, 51C for 30 seconds, and 68C for 35 seconds. Two PCR primer pairs were designed to span domain III because it contains four introns of 61508 bp. The first pair (D3A and D3B) amplified a 899-bp product and covered the region of domain III S1S3. Optimal cycling conditions were as follows: 35 cycles of 94C for 30 seconds, 51C for 30 sec-

KDR GENE OF SCABIES MITES

653

FIGURE 1.

Continued

onds, and 68C for 35 seconds. The second pair of primers (D3C and D3D) covered domain III S4S6 and resulted in a 1,095-bp product with optimal cycling conditions of 94C for 30 seconds, 49C for 30 seconds, and 68C for 1 minute for 35 cycles. The domain IV genotyping protocol resulted in the amplification of a PCR product of 1,370 bp using primer pairs D4A and D4B with optimal cycling conditions of 94C for 30 seconds, 49C for 30 seconds, and 68C for 1 minutes and 25 seconds for 35 cycles. Genotyping of single mites. Individual human scabies mites were obtained from the bedding of crusted scabies patients,

whereas individual scabies mites were obtained from the ears of infested pigs using a dissecting microscope. Single mites were suspended in Prepman Ultra reagent, and standardized PCR protocols covering the five genotyping regions were performed for each mite. PCR products were purified, and direct cycle sequencing was performed. This protocol enabled successful genotyping of individual mites (Figure 3). From a total of 27 mites that were genotyped, complete sequences were obtained in 19 mites in all domains, a success rate of 70%. To date, no nucleotide polymorphism resulting in a codon change at positions associated with knockdown resistance in other arthropods has been identified in this preliminary survey.

654

PASAY AND OTHERS

FIGURE 1.

Continued

DISCUSSION As is true for all chemotherapeutic agents, the mechanism of resistance to pyrethroids can be caused by 1) target alteration (e.g., mutations in the sodium channel gene),31 2) by enzymatic degradation of the target drug32 by hyperproduction of the enzyme or an increase in substrate specificity,33 or 3) removal of the drug by an efflux pump such as Pglycoprotein.34 The first mechanism for pyrethroid resistance (target alteration) has been rigorously studied in the housefly (M. domestica), where specific gene mutations causing the kdr phenotype were first identified. These include a substitution of leucine by phenylalanine at domain II S6 (L1014F) and a replacement of methionine by threonine (M918T) in the nearby linker of S4 and S5 in the same domain. If both mutations are present, the highly resistant trait, the so-called super kdr, is observed. The same mutations have been found in a range of agricultural pests with pyrethroid resistance.35,36 The association of mutations in the sodium channel gene with knockdown resistance has led to the search for other novel resistance conferring mutations in other species. In a pyrethroid-resistant strain of an arachnid arthropod, the southern cattle tick, B. microplus, a point mutation associated with pyrethroid resistance was identified at domain III S6

(F1538I). This mutation is located at a site distant from where mutations in the Vssc gene have been found in pyrethroidresistant insects.23 The same is true for the pyrethroidresistant honeybee mite, V. destructor, where multiple mutations, in domain III S6 (F758L), in domain IV S5 (I982V), in domain IVS6 (M1055I), and in the linker region connecting domains III and IV (L826P), have been identified.24 Amino acid residues linking domains III and IV constitute part of the intracellular mouth of the sodium channel pore and form the inactivation gating particle, and mutations in this region have been associated with resistance to pyrethroid insecticides.30 In all cases, these mutations affect the sensitivity of the channels by accelerating the decay of the tail currents that enhances pyrethroid dissociation from sodium channels. The majority of the resistance-associated mutations have been identified in the S6 transmembrane segment of domains I, II, and III, which suggests that they occur at residues forming the pyrethroid-binding sites. Structural alterations arising from these mutations may alter the interaction of pyrethroids with sodium channels, therefore reducing the sensitivity to pyrethroid insecticides.23 An alternate mechanism for pyrethroid resistance among arthropod pests is an increase in pesticide degrading enzyme activity. This can be caused by either an increase in substrate specificity caused by steric effects on enzymesubstrate inter-

KDR GENE OF SCABIES MITES

655

FIGURE 2. Structural diagram of SsVssc gene showing domains IIV (segments 16) and genotyping regions spanning kdr-associated mutations in different arthropod species (numbered according to their positions in the amino acid sequence of M. domestica Vssc; GenBank accession no. U38813). The mutations in V. destructor are numbered according to its Vssc cDNA sequence (GenBank accession no. AY259834). The segments of the gene amplified by the genotyping primers are represented by arrows.

actions or hyperproduction of the enzyme. This hyperproduction may result in increased detoxification of insecticide esters initially by sequestration followed by hydrolysis during reactivation of inhibited esterase.37 Increased hydrolysis of insecticides by esterases has been implicated in insecticide resistance in some species such as the blowfly, Lucilia cuprina,38,39 and cattle tick, B. microplus.40 It has also been shown that increased detoxification of insecticides was also related to amplification of esterase genes in the mosquito, Culex quinquefaciatus,41 and the aphid Myzus persicae.42 While three classes of degrading enzyme have been implicated in insecticide detoxification (cytochrome P-450 mixed function oxidases, glutathione S-transferases, and esterases), available evidence supports the role of B1 carboxylesterase as the degrading enzyme responsible for permethrin resistance. It has been shown recently that a strain of permethrinresistant cattle ticks, B. microplus, without kdr mutations, had hyperproduction of B1 carboxylesterase instead.37,43 Such hy-

FIGURE 3. Results of single mite genotyping at five regions of the SsVssc gene. Lane 1, 1-kb ladder; lane 2, domain II S1S6; lane 3, linker region; lane 4, domain III S1S3; lane 5, domain III S4S6; lane 6, domain IV S1S6.

perproduction is a well-recognized mechanism of pyrethroid resistance in the mosquito, Cx. quinquefasciatus, and the peach potato aphid, M. persicae. In both species, gene duplication has been identified as the mechanism of resistance.44 A point mutation (Asp to Asn) in this resistance-conferring esterase gene has also been identified in the drug-resistant strain of cattle tick.32 In this study, a major mechanism for pyrethroid resistance, kdr, which has been well established in a range of arthropods, was studied in S. scabiei. It is of significance because there were no previous studies conducted on sodium channel gene associated with knockdown resistance in scabies mites. Comparison of DNA sequences from human mite genomic DNA and cDNA was undertaken to study possible sites of alternative splicing. Alternative splicing is a major mechanism by which ion channels of the nervous system of animals increase structural and functional diversity. Extensive alternative splicing of the para sodium channel gene has been reported in previous studies,45,46 and its functional significance has been shown in the German cockroach to produce pharmacologically distinct channels.47 A possible alternative splice site has been identified in the S. scabiei Vssc at a location similar to that in the V. destructor Vssc (data not shown). Further analysis of gene transcripts for investigation of alternative splice events is planned. Genotyping primers were designed based on the derived genomic sequence covering domains IIIV, where the majority of the known resistance-associated mutations was located. Using the genotyping protocol developed, we are now able to genotype individual scabies mites from different sources with varying susceptibilities to permethrin. The ability to genotype individual mites will enable us to identify polymorphisms that maybe associated with knockdown resistance in scabies mites. Once polymorphisms have been identified, it will be possible to verify their functional significance by electrophysiological studies using Xenopus laevis oocytes.22 It will then be possible to design mutation-specific PCR protocols, targeting the highly associated kdr mutations, thus enabling survey of populations of mites.

656

PASAY AND OTHERS

Received June 6, 2005. Accepted for publication December 8, 2005. Acknowledgments: The authors thank Professor David Kemp for sharing the S. scabiei var hominis cDNA library and for support of K. Fischer under his Australian National Health and Medical Research Council (NHMRC) program Grant 290208, Dr. J. G. Mattsson of the National Veterinary Institute, Uppsala, Sweden, for sharing the S. scabiei var vulpes cDNA library, and Professor Bart Currie from the Menzies School of Health Research. Financial support: This work was supported by the Australian National Health and Medical Research Council (Grant 288301) and Australian Centre for Tropical Health and Nutrition (ACITHN), University of Queensland, Australia. Authors addresses: Cielo Pasay, Katja Fischer, and James Mc Carthy, Queensland Institute of Medical Research and Australian Centre for International and Tropical Health and Nutrition, University of Queensland, 300 Herston Road, Herston, Queensland 4029, Australia. Shelley Walton and Deborah Holt, Menzies School of Health Research, PO Box 41096, Casuarina, Darwin NT 0811, Australia and Institute of Advanced Studies, Charles Darwin University, Darwin, Northern Territory, Australia. Reprint requests: Cielo Pasay, Clinical Tropical Medicine Laboratory, Infectious Diseases and Immunology Division, Queensland Institute of Medical Research, Herston, Queensland 4029, Australia. E-mail: cieloP@qimr.edu.au. 18.

19.

20.

21.

22. 23.

24.

REFERENCES
1. Taplin D, Meinking TL, Chen JA, Sanchez R, 1990. Comparison of crotamiton 10% cream (Eurax) and permethrin 5% cream (Eliminate) for the treatment of scabies in children. Pediatr Dermatol 7: 6773. 2. Currie BJ, Connors CM, Krause VL, 1994. Scabies program in aboriginal communities. Med J Aust 161: 636637. 3. Hoy W, 1996. Renal disease in Australian Aboriginals. Med J Aust 165: 126127. 4. White AV, Hoy WE, McCredie DA, 2001. Childhood poststreptococcal glomerulonephritis as a risk factor for chronic renal disease in later life. Med J Aust 174: 492496. 5. Hoy W, McDonald SP, 2004. Albuminuria: marker or target in indigenous populations. Kidney Int Suppl 92: S25S31. 6. Carapetis JR, Connors C, Yarmirr D, Krause V, Currie BJ, 1997. Success of a scabies control program in an Australian aboriginal community. Pediatr Infect Dis J 16: 494499. 7. Wong LC, Amega B, Barker R, Connors C, Dulla ME, Ninnal A, Cumaiyi MM, Kolumboort L, Currie BL, 2002. Factors supporting community sustainability of a community-based scabies control program. Austral J Dermatol 43: 274277. 8. Hernandez-Perez, 1983. Resistance to antiscabietic drugs. J Am Acad Dermatol 8: 11211122. 9. Coskey R, 1979. Scabies resistance to treatment with crotamiton. Arch Dermatol 115: 109. 10. Roth W, 1991. Scabies resistant to lindane 1% lotion and crotamiton 10% cream. J Am Acad Dermatol 24: 502503. 11. Currie BJ, Harumal P, McKinnon M, Walton S, 2004. First documentation of in vivo and in vitro ivermectin resistance in Sarcoptes scabiei. Clin Infect Dis 39: e812. 12. Witkowski JA, Parish LC, 2002. Pediculosis and resistance: the perennial problem. Clin Dermatol 20: 8792. 13. Bailey AM, Prociv P, 2000. Persistent head lice following multiple treatments: evidence for insecticide resistance in Pediculus humanus capitis. Australas J Dermatol 41: 250254. 14. Fraser J, 1994. Permethrin: a top end viewpoint and experience. Med J Aust 160: 806. 15. Walton SF, Myerscough MR, Currie BJ, 2000. Studies in vitro on the relative efficacy of current acaricides for Sarcoptes scabiei var hominis. Trans R Soc Trop Med Hyg 94: 9296. 16. Vais H, Williamson MS, Devonshire AL, Usherwood PNR, 2001. The molecular interactions of pyrethroid insecticides with insect and mammalian sodium channels. Pest Manag Sci 57: 877 888. 17. Miyazaki M, Ohyama K, Dunlap DY, Matsumura F, 1996. Cloning and sequencing of the para-type sodium channel gene from 25.

26. 27. 28.

29. 30. 31. 32. 33. 34. 35.

36.

37.

susceptible and kdr-resistant German cockroaches (Blattella germanica) and housefly (Musca domestica). Mol Gen Genet 252: 6168. Dong K, 1997. A single amino acid change in the para sodium channel protein is associated with knockdown-resistance (kdr) to pyrethroid insecticides in the German cockroach. Insect Biochem Mol Biol 27: 93100. Guerrero FD, Jamroz RC, Kammlah D, Kunz SE, 1997. Toxicological and molecular characterization of pyrethroid-resistant horn flies, Haematobia irritans: identification of kdr and superkdr point mutations. Insect Biochem Mol Biol 27: 745755. Martinez-Torres D, Chandre F, Williamson MS, Darriet F, Berge JB, Devonshire AL, Guillet P, Pasteur N, Pauron D, 1998. Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae. Insect Mol Biol 7: 179184. Martinez-Torres D, Chevillon C, Brun-Barale A, Berge JB, Pasteur N, Pauron D, 1999a. Voltage-dependent Na+ channels in pyrethroid-resistant Culex pipiens L mosquitoes. Pest Sci 55: 10121020. Goldin AL, 1992. Maintenance of Xenopus laevis and oocyte injection. Meth Enzymol 207: 266297. He H, Chen AC, Davey RB, Ivie GW, George JE, 1999. Identification of a point mutation in the para-type sodium channel gene from a pyrethroid-resistant cattle tick. Biochem Biophysic Res Com 261: 558561. Wang R, Liu Z, Dong K, Elzen PJ, Pettis J, Huang ZY, 2002. Association of novel mutations in a sodium channel gene with fluvalinate resistance in the mite, Varroa destructor. J Apicultural Res 40: 1725. Fischer K, Holt D, Harumal P, Currie B, Walton S, Kemp D, 2003. Generation and characterization of cDNA clones from Sarcoptes scabiei var hominis for an expressed sequence tag library: identification of homologues of house dust mite allergens. Am J Trop Med Hyg 68: 6164. Mattson JG, Ljunggren EL, Bergstrom K, 2001. Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression. Parasitology 122: 555562. Mounsey KE, Holt DC, Fischer K, Kemp DJ, Currie BJ, Walton SF, 2005. Analysis of Sarcoptes scabiei finds no evidence of infection with Wolbachia. Int J Parasitol 35: 131135. Williamson MS, Martinez-Torres D, Hick CA, Devonshire AL, 1996. Identification of mutations in the housefly para-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides. Mol Gen Genet 252: 5160. Wang R, Huang ZH, Dong K, 2003. Molecular characterization of an arachnid sodium channel gene from the varroa mite (Varroa destructor). Insect Biochem Mol Biol 33: 733739. Catterall W, 2000. From ionic currents to molecular mechanisms: the structure and function of voltage-gated sodium channels. Neuron 26: 1325. Soderlund DM, Knipple DC, 2003. The molecular biology of knockdown resistance to pyrethroid insecticides. Insect Biochem Mol Biol 33: 563577. Devonshire AL, 1991. Role of esterases in resistance of insects to insecticides. Biochem Soc Trans 19: 755759. Devonshire AL, Field LM, 1991. Gene amplification and insecticide resistance. Annu Rev Entomol 36: 123. Prichard RK, 2001. Genetic variability following selection of Haemonchus contortus with anthelmintics. Trends Parasitol 17: 445453. Martinez-Torres D, Foster SP, Field LM, Devonshire AL, Williamson MS, 1999b. A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Insect Mol Biol 8: 339346. Schuler TH, Martinez-Torres D, Thompson AJ, Denholm I, Devonshire AL, Duce JR, Williamson MS, 1998. Toxicological electrophysiological and molecular characterization of knockdown resistance to pyrethroid insecticides in the diamondback moth, Plutella xylostella (L). Pestic Biochem Physiol 59: 169 192. Hernandez R, Haiqi H, Chen AC, Waghela SD, Wayne Ivie G, George JE, Gale Wagner G, 2000. Identification of a point mutation in an esterase gene in different populations of the

KDR GENE OF SCABIES MITES

657

38.

39.

40. 41.

42.

southern cattle tick, Boophilus microplus. Insect Biochem Mol Biol 30: 969977. Newcomb RD, Campbell PM, Ollis DL, Cheah E, Russell RJ, Oakeshott JG, 1997. A single amino acid substitution converts a carboxylesterase to an organophosphorus hydrolase and confers insecticide resistance on a blowfly. Proc Natl Acad Sci USA 94: 74647468. Heidari R, Devonshire AL, Campbell BE, Bell KL, Dorrian SJ, Oakeshott JG, Russell RJ, 2004. Hydrolysis of organophosphorus insecticides by in vitro modified carboxylesterase E3 from Lucilia cuprina. Insect Biochem Mol Biol 34: 353363. De Jersey J, Nolan P, Davey PA, Riddles PW, 1985. Separation and characterization of pyrethroid-hydrolyzing esterases of the cattle tick, Boophilus microplus. Pestic Biochem Physiol 23: 349357. Mouches C, Pasteur N, Berge JB, Hyrien O, Raymond M, De Saint Vincent BR, De Silvestre M, Georghiou GP, 1986. Amplification of an esterase gene is responsible for insecticide resistance in a California Culex mosquito. Science 233: 778780. Field LM, Devonshire AL, Forde BG, 1988. Molecular evidence

43. 44.

45. 46. 47.

that insecticide resistance in peach-potato aphids (Myzus persicae Sulz) results from amplification of an esterase gene. Biochem J 251: 309312. Pruett JH, Guerrero FD, Hernandez R, 2002. Isolation and identification of an esterase from a Mexican strain of Boophilus microplus (Acari: Ixodidae). J Econ Entomol 95: 10011007. Hemingway J, Karunaratne SH, 1998. Mosquito carboxylesterases: a review of the molecular biology and biochemistry of a major insecticide resistance mechanism. Med Vet Entomol 12: 112. Thackeray JR, Ganetzky B, 1995. Conserved alternative splicing patterns and splicing signals in the Drosophila sodium channel gene para. Genetics 141: 203214. Lee SH, Ingles PJ, Knipple DC, 2002. Developmental regulation of alternative exon usage in the house fly Vssc1 sodium channel gene. Invert Neurosci 4: 125133. Tan J, Liu Z, Nomura Y, Goldin AL, Dong K, 2002. Alternative splicing of an insect sodium channel gene generates pharmacologically distinct sodium channels. J Neurosci 22: 53005309.