FEMS Immunology and Medical Microbiology 40 (2004) 129^137

www.fems-microbiology.org

Identication of an in vivo CD4 T cell-mediated response to polymorphic membrane proteins of Chlamydia pneumoniae during experimental infection
Tina Mygind
a

a;b;;1

, Brian Vandahl a;b;1 , Anna Soe Pedersen b , Gunna Christiansen a , Per Hollsberg a , Svend Birkelund a;b

Department of Medical Microbiology and Immunology, Wilhelm Meyers Alle, The Bartholin Building, University of Aarhus, DK-8000 Aarhus C, Denmark 2 Loke Diagnostics ApS, Science Park Aarhus, Gustav Wiedsvej 10C, DK-8000 Aarhus C, Denmark Received 3 September 2003; received in revised form 10 October 2003 ; accepted 12 October 2003 First published online 7 November 2003

Abstract
Chlamydia pneumoniae is an obligate intracellular bacterium that causes upper and lower respiratory tract infection in humans. C. pneumoniae harbors the polymorphic membrane protein (Pmp) family with 21 different proteins with a molecular mass around 100 kDa. The Pmps are species-specific, abundant and, together with major outer membrane protein and outer membrane protein 2, the dominant proteins in the C. pneumoniae outer membrane complex. Nevertheless, it is unknown whether Pmps are recognized by the cellmediated immune response. To address this issue, C57BL/6J mice were infected intranasally with C. pneumoniae and the immune response to primary infection was investigated. We demonstrate, as expected, that the primary response is of the Th1 type by IgG2a- and IgG1specific sELISA (Medac) on serum. In vivo-primed spleen lymphocytes were found to be reactive to Pmp8, Pmp20 and Pmp21 in an interferon-Q ELISpot assay. The responses were shown to be mediated by CD4 T cells. To our knowledge, this is the first identification of antigens recognized by CD4 T cells during murine C. pneumoniae infection. 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords : Chlamydia pneumoniae ; Polymorphic membrane protein ; Cellular immune response

1. Introduction Chlamydia pneumoniae is a Gram-negative obligate intracellular bacterium with a biphasic developmental cycle. Elementary bodies (EB) enter a cell by endocytosis. Inside a phagosome termed the inclusion, the EB dierentiate into reticulate bodies (RB) and proliferate by binary ssion. The RB reorganize into EB which are released by host cell lysis 48^84 h after infection [1]. C. pneumoniae causes upper and lower respiratory tract infections accounting for 6^10% of community-acquired pneumonia [2] and may be associated with atherosclerosis [3]. Studies of infection and reinfection of mice with

* Corresponding author. Tel. : +45 8942 1747 ; Fax: +45 8619 6128. E-mail address : mygind@biobase.dk (T. Mygind).
1

These authors contributed equally to this study.

C. pneumoniae have shown that prior infection is partially protective against reinfection for at least 60 days [4^7]. On primary intranasal inoculation BALB/c mice develop a mild infection with a weak immune response, whereas NIH/S mice develop a severe infection with peribronchial inammation [5]. On day 3 after primary intranasal inoculation C57BL/6J mice develop an infection with granulocyte inltration and weight loss [7,8]. As C. pneumoniae is obligately intracellular, a cell-mediated immune response is crucial for protection against infection. The signicance of cellular immune responses in protection against C. pneumoniae infection has been analyzed in two dierent mouse models. In BALB/c mice the response to a primary C. pneumoniae infection shows low interferon-Q (IFN-Q) levels on stimulation of lung-derived mononuclear cells with EB [9]. However, during reinfection the response is primarily mediated by T cells in a Th1biased cell-mediated immune response with high IFN-Q levels and low interleukin-10 (IL-10) levels [9]. Also in

0928-8244 / 03 / $22.00 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/S0928-8244(03)00300-6

130

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137

C57BL/6J mice a Th1 response is most likely important for clearance of infection in both primary infection and reinfection. This was shown by neutralization of IFN-Q by antibodies which increased numbers of bacteria and pneumonia score in the lungs [10]. Additionally, CD8-decient C57BL/6J mice infected with C. pneumoniae have a worse outcome of infection than both CD4- and CD4/CD8-decient mice [11]. Without the CD8 T cells early in primary infection the immune response is skewed towards Th2 as determined by IFN-Q/IL-10 mRNA accumulation in the lungs of the infected genetically modied mice [11]. However, CD4 T cells are important for controlling bacterial growth late in the infection as well as in reinfection [11]. To date a number of CD8 T cell epitopes have been identied [11,14], but no C. pneumoniae antigens recognized by CD4 T cells are known. During primary infection the immune response in humans is similar to that observed for C57BL/6J mice, i.e. a high IFN-Q response and a low IL-10 response [11,14]. Additionally, as prior infection is protective in this mouse strain [7], it is relevant to dissect this immune response to identify antigens recognized by CD4 T cells displaying a Th1 cytokine prole. The C. pneumoniae genome harbors a gene family of 21 genes encoding polymorphic membrane proteins (Pmps) with sizes around 100 kDa [15]. Three genes, pmp6, pmp20 and pmp21, encode long proteins (1408^1724 aa). However, ve genes are shorter due to either truncation of the C-terminal part (pmp12) or frameshift mutations (pmp3, pmp4, pmp5 and pmp17) [16]. Pmp6, 20 and 21 are post-translationally processed into smaller proteins [24]. The Pmps all contain multiple repeats of the motifs FXXN and GGA[ILV] in the N-terminal part. The C-terminal part is predicted to form a L-barrel [16^18]. The N-terminal and C-terminal parts resemble the passenger and transmembrane domains of autotransporters [18]. The repeated motif is the basis for classication of the proteins into one family. The Pmps, however, show high inter- and intra-species amino acid sequence variability [17]. All genes are transcribed during the chlamydial developmental cycle as determined by reverse transcriptase polymerase chain reaction (PCR) [19], and 10 genes (pmp2, 6, 7, 8, 10, 11, 13, 14, 20, 21) are translated and expressed at high levels as determined by two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) of C. pneumoniae EB [20]. Pmps, major outer membrane protein (MOMP) and outer membrane protein 2 (Omp2) are the major proteins in the C. pneumoniae outer membrane complex (COMC) [21]. As Pmps are highly expressed in EB and constitute a major part of protein in COMC, we wanted to investigate whether they are recognized by a cell-mediated immune response. Firstly, the direction of the immune response during primary infection in C57BL/6J mice was determined by a modied sELISA measuring C. pneumoniaespecic IgG2a and IgG1 antibodies in serum. Secondly,

spleen lymphocytes from mice infected intranasally with C. pneumoniae were tested for production of IFN-Q and IL-5 upon stimulation with recombinant Pmps (rPmps) and MOMP in an enzyme-linked immunospot (ELISpot) assay. Determining whether Th1 and Th2 cytokines are secreted by T cells recognizing these antigens is important, as a Th1 cytokine prole is essential in protection against chlamydial infections [10,11,22]. We tested 16 of the 21 Pmps that have uninterrupted and complete reading frames in the C. pneumoniae VR 1310 genome. These proteins include the 10 Pmps that were found to be expressed by 2D-PAGE [20].

2. Materials and methods 2.1. Cloning, expression, dialysis of rPmps and MOMP Cloning and expression of most of the Pmps were previously done by Pedersen et al. [23] and Vandahl et al. [24]. Briey, the pmp1, 2, 6, 11, 13^16 and 18^21 and MOMP genes were amplied by PCR. For pmp1^2, 8^11 and MOMP entire genes were amplied and for pmp6, 7, 13^19 only the DNAs encoding N-terminal parts were amplied as the N-terminal part is the most variable. For pmp20 and pmp21, the sequences corresponding to the N- and C-terminal parts of the respective proteins were cloned and expressed separately. Primers, size of cloned fragments, amino acid numbers and theoretical molecular masses are shown in Table 1 as primers used in this study deviate a little from [23,24]. LIC cloning, expression and protein purication were done as described by [23]. For purication of proteins with low levels of endotoxin (MOMP, Pmp6, 8, 20N, 20C, 21N, 21C) washing steps with 60% isopropanol were incorporated in the protein purication as described by Franken et al. [25]. Collected fractions were tested for purity and concentration of proteins by SDS^PAGE and Bradford protein assay. Proteins were dialyzed against double-distilled water over Spectra/ Por membranes (Spectrum, Rancho Dominguez, CA, USA). All reagents used for subsequent handling of the Pmps were free of endotoxin. 2.2. Endotoxin testing of recombinant proteins and reagents The Limulus amebocyte lysate (LAL) quantitative endotoxin assay QCL-1000 (Cambrex, New Jersey, USA) was used. A 50-Wl sample is mixed with 50 Wl LAL in a microtiter plate and incubated for 10 min at 37C. A standard curve for determining endotoxin concentration in EU ml31 was obtained using a dilution series of Escherichia coli endotoxin as described by the manufacturer. At t = 10 min 100 Wl of chromogenic substrate was added (Ac-IleGlu-Ala-Arg-p-nitroaniline) and incubated at 37C. At t = 16 min 100 Wl stop reagent (25% acetic acid) was added and OD was read at 405 nm in an ELISA reader.

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137 Table 1 Cloning and expression of Pmps and MOMP LIC primer sequence 5P-3P Pmp1 fw: GACGACGACAAGATGGCTACTACGATTTCTTTAACCCC rv: GAGGAGAAGCCCGGTCTAAAAACGAAATTTGCTTCC Pmp2 fw: GACGACGACAAGATGAATTTATTAGGAGCTGCTACTACCG rv: GAGGAGAAGCCCGGTCTAAAATTTGATTTTGCTACCC Pmp6 fw: GACGACGACAAGATGCTACATCCACTAATGGCTGC rv: GAGGAGAAGCCCGGTCTATGCAGGAATCGAGG rPmp7 fw: GACGACGACAAGATGGAGGTGACCTTAGATAGCAGC rv: GAGGAGAAGCCCGGTCTAAAGAGGATAGGTACTAGCAC rPmp8 fw: GACGACGACAAGATGAGCATTGCAACTTACGGAG rv: GAGGAGAAGCCCGGTCTAGAATGAGTATCTTAGCCCAC rPmp9 fw: GACGACGACAAGATGGCTGTTGTTGAAATCAATCTAGG rv: GAGGAGAAGCCCGGTTTAGAACTGGAACTTACCTCC rPmp10 fw: GACGACGACAAGATGTGTTCCACTGTTTTTGCTGC rv: GAGGAGAAGCCCGGTCTAGAATTGGAACTTACCCCC rPmp11 fw: GACGACGACAAGATGAAGACTTCGATTCCTTGGGTTTTAGTTTCC rv: GAGGAGAAGCCCGGTTAGAATCGGAGTTTGGTACCAACATCTACATTG rPmp13 fw: GACGACGACAAGATGTCAACAGCGTTTACTGTAGAAG rv: GAGGAGAAGCCCGGTCTAACCGTCAGTATTATTAGCTC rPmp14 fw: GACGACGACAAGATGGAGACTAGACTCGGAGGGAACTTTG rv: GAGGAGAAGCCCGGTCTAGCCAAGAACATTGACAACCGC rPmp15 fw: GACGACGACAAGATGAATGAAGGTCTCCAACTTCCTTTGG rv: GAGGAGAAGCCCGGTCTATGTTGAGGATGGTGTGGG rPmp16 fw: GACGACGACAAGATGTTCGGGATGACTCCTGCAGTG rv: GAGGAGAAGCCCGGTCTAAGTCTCAGAGTTGGCAGTTGTTGC rPmp18 fw: GACGACGACAAGATGACTCCCTACTCTCATAGAGCAACAC rv: GAGGAGAAGCCCGGTCTAAACTTCTGCGATAGGTTGG rPmp19 fw: GACGACGACAAGATGCGAGCAAACGATGTTCTCCTCCC rv: GAGGAGAAGCCCGGTCTAGGTCAGTTTAGAACCTGGCCC rPmp20N fw: GACGACGACAAGATGGATCCCGCGTCTGTTGAAATAAG rv: GAGGAGAAGCCCGGTCTATCCACTGGAATAGATGCC rPmp20C fw: GACGACGACAAGATGCCTGGAAGCTTCACAATTACCG rv: GAGGAGAAGCCCGGTCTAGAATACAAACCGGATCCC rPmp21N fw: GACGACGACAAGATGTCTGCTCATGTTGAAGAGGCTC rv: GAGGAGAAGCCCGGTCTATGTAGGAAGAGGCGCACTGC rPmp21C fw: GACGACGACAAGATGAGCTCTCCTACACCCAATAAAGA rv: GAGGAGAAGCCCGGTAAGCCCTGTCACATCGAACT MOMP fw: GACGACGACAAGATGCAAGCCTTGCCTGTAGGGAAC rv: GAGGAGAAGCCCGGTTATTAGAATCTGAACTGACCAGATATGTG Size of cloned fragment (bp) 2724 2499 2694 1590 2763) 2739 2760 2814 1599 1430 1443 1446 1728 1470 2592 2607 3264 1395 1377 Cloned aa 26^923 20^842 18^905 25^545 21^931 27^929 20^929 1^929 20^542 25^492 18^478 1^472 1^566 22^501 22^885 856^1723 52^1129 1145^1609 22^480

131

Theoretical MWa (kDa) 102.1 92.0 93.2 57.5 99.9 100.0 99.6 103.4 58 58.0 43.4 55.1 65.7 55.9 87.3 93.3 116.6 51.5 44.2

Nucleotides in bold are the pET-30-specic sequence. MW (peptidesort)+4.5 kDa (part encoded by vector sequence is approx. 4.5 kDa).

2.3. Cultivation of C. pneumoniae and purication of elementary bodies for ELISpot HEp-2 cells were cultivated in RPMI 1640 with 10% fetal calf serum (heat-inactivated and sterile ltered) and 10 mg l31 gentamicin at 37C in a 5% CO2 and 85% humidity atmosphere. Semiconuent monolayers of cells were infected with 0.8 inclusion-forming units (IFU) C. pneumoniae (VR1310, ATCC, Rockville, MD, USA) per cell by 30 min of centrifugation at 1000Ug in a Beckman GS-6R centrifuge. Infected cells were cultivated at 34C in HEp-2 medium containing 2 mg l31 gentamicin and 1 Wg ml31 cycloheximide. Cells were harvested 72 h post infection and disrupted by sonication and EB were puried by ultracentrifugation through a Visipaque gradient (Nycomed, Oslo, Norway) essentially as described by Knudsen et al. [26]. These EB

were used for the ELISpot assays and they are nonviable in our hands. 2.4. Cultivation of C. pneumoniae for infection of mice BHK cells (ATCC no. CCL-10) were cultivated in HEp2 medium and infected as described above. Cells were harvested 72 h post infection and resuspended in 0.2 M buered sucrose. For enhancement of the infectivity, resuspended cells were repeatedly passed through a syringe and needle and centrifuged to remove cellular debris (500Ug for 5 min). The supernatant was centrifuged at 100 000Ug for 30 min to pellet the chlamydiae. The bacteria were resuspended in 0.2 M sucrose phosphate buer, sonicated, frozen in aliquots. These aliquots were used for infection of the mice. One aliquot was thawed for determination of IFU per volume in the following way: a

132

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137

24-well tray with coverslips was seeded with 50 000 BHK cells per well and infection was done as described above with two-fold dilutions of the C. pneumoniae stock from 1:100 to 1:6400. After 72 h of incubation at 37C the cells were xed with formaldehyde. Immunouorescence microscopy was used to determine IFU per volume of bacteria with monoclonal antibody 20.1 [27] as the primary antibody and an anti-mouse uorescein isothiocyanateconjugated secondary antibody (Dako, Glostrup, Denmark). 2.5. Infection of mice with C. pneumoniae C57BL/6J mice were infected intranasally under isourane anesthesia with 2U106 IFU (in 20 Wl) or 2.5U105 IFU (in 30 Wl and enhanced for infectivity) of C. pneumoniae cultivated at 37C in BHK cells. On days 4, 8, 21, 35 and 84 after infection the cellular immune response to C. pneumoniae antigens was measured by ELISpot. On day 17 retro-orbital blood samples for ELISA were drawn. Control mice were uninfected C57BL/6J mice of the same age. All mice were killed under isourane anesthesia and the spleen was dissected. Splenocytes were recovered by homogenization in a glass tube with a pestle. 2.6. Depletion of CD4+/CD8+ cells Splenocytes were depleted of either L3T4-positive (CD4 ) cells or Lyt2-positive (CD8 ) cells with magnetic Dynabeads (Dynal, Oslo, Norway) coated with rat monoclonal antibodies specic for either mouse L3T4 or Lyt2. Dynabeads were used in accordance with the manufacturers instructions and the depleted cells were used for ELISpot. The eciency of the depletion was tested by ow cytometry. Non-depleted and CD4 /CD8 -depleted cells were labelled with biotin-conjugated rat anti-mouse CD4 and CD8 antibodies (catalog numbers MCA1415B and MCA609B from Serotec, Oslo, Norway). For uorescent labelling uorescein conjugated to streptavidin was used (Dako). Cells were washed and resuspended in 0.2 ml phosphate-buered saline (PBS) with 1% bovine serum albumin (BSA) and 20 mM glucose. Flow cytometric analysis was performed with a FACSCalibur instrument (Becton Dickinson). 2.7. IFN-Q and IL-5 ELISpot The ELISpot assay was modied from [28]. A capture antibody (rat anti-mouse IFN-Q, PharMingen catalog number 18181D, or rat anti-mouse IL-5, PharMingen catalog number 554393) was diluted to 10 Wg ml31 in carbonate coating buer pH 9.6 and 75 Wl was added to each well of a 96-well Multiscreen IP Sterile Plate with 0.45-Wm Immobilon-P membrane (Millipore, Glostrup, Denmark). Plates were incubated overnight at 4C. Plates were washed ve times in sterile PBS and blocked with 2%

BSA in PBS for 30 min at room temperature. Plates were washed ve times in sterile PBS and 2U106 , 106 , 5U105 and 2.5U105 splenocytes per well were added in duplicates. 2^4 Wg of antigen was added to each well and the plates were incubated for 24^48 h at 37C, 5% CO2 . The plates were washed twice in PBS and three times in PBS+0.05% Tween 20. The detection antibody (Biotin rat anti-mouse IFN-Q, Becton and Dickinson catalog number 554410 or Biotin rat anti-mouse IL-5, PharMingen catalog number 554397) was diluted to 1 Wg ml31 , 80 Wl was added to each well and the plates were incubated for 3 h at room temperature. ABComplex/AP (Dako) was prepared and diluted in accordance with the manufacturers instructions, 100 Wl was added to each well. The plates were then incubated for 1 h at room temperature. The plates were washed four times in 20 mM Tris^HCl, 150 mM NaCl, 0.05% Tween 20, pH 7.5 and once in AP buer (100 mM NaCl, 5 mM MgCl2 , 100 mM Tris, pH 9.5). Plates were developed using a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (KemEnTec, Denmark). The color reaction was stopped under running tap water. ELISpot results were evaluated visually and spots were counted manually in duplicate wells at 25U magnication on a TV monitor. EB wells were positive controls in IFN-Q experiments. Wells with added ionomycin (0.4 Wg ml31 ) and phorbol myristate acetate (PMA) (25 ng ml31 ) were positive controls in IL-5 experiments. 2.8. IgG isotype ELISA on sera from infected mice Blood samples were obtained from mice (n = 4) infected with 2U106 IFU on day 17 after infection. The levels of IgG2a and IgG1 antibodies recognizing C. pneumoniae in sera were determined by a modied sELISA (Medac, Hamburg, Germany). The antigen in the sELISA kit is COMC. IgG standard plates were coated with mouse immunoglobulin reference serum (Bethyl Laboratories, Montgomery, TX, USA) in a two-fold dilution series ranging from 16 ng ml31 to 500 ng ml31 (total Ig concentration) in carbonate coating buer (0.1 M Na2 CO3 , pH 9.6). This gives IgG1 concentrations between 3 and 105 ng ml31 and IgG2a concentrations between 3 and 91 ng ml31 . Coating was performed overnight at 4C. Plates were blocked with 75 Wl per well PBS containing 15% fetal calf serum. After 1 h of incubation at 37C, the plates were washed four times with PBS containing 0.05% Tween 20. Mouse sera were diluted 1:200, in Medac antibody buer. Antibody buer (50 Wl) was added to the plates coated with mouse immunoglobulin reference serum. As secondary antibodies IgG1(Q) and IgG2a(Q) horseradish peroxidase-conjugated immunoglobulins (Caltag Laboratories, Burlingame, CA, USA) were used in a dilution of 1:1000 in antibody buer. Color development was done using 3,3,5,5-tetramethylbenzidine. OD values were read at 450 nm with a reference wavelength of 620 nm. The

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137

133

present results represent the means of duplicate wells. Standard deviation for all results was 6 0.01.

3. Results 3.1. Isotype of IgG antibodies against C. pneumoniae in infected C57BL/6J mice IgG isotypes produced during infection were determined to clarify and conrm whether the overall immune response during primary infection in C57BL/6J mice is of the Th1 or Th2 type. An IgG2a response is known to be associated with a Th1 type cell-mediated immune response and IgG1 is associated with a Th2 cytokine prole and an antibody-dominated response [29]. Sera from infected mice were investigated by ELISA to determine which isotype IgG antibodies were produced. Four of four infected mice produced more IgG2a than IgG1 directed against C. pneumoniae (Table 2). IgG2a concentrations were between 1.3 and 2.2 times higher than IgG1 concentrations indicating an overall Th1 response with an underlying Th2 response. 3.2. Cell-mediated immune response to EB and rPmps and time dependence of the response An IFN-Q-based ELISpot assay was used to detect whether Pmps are recognized by a cell-mediated immune response in C57BL/6J mice infected with C. pneumoniae (2U106 IFU). The assay also made it possible to detect the time course of such a response. Splenocytes taken from mice on days 4, 8, 21, 35 and 84 days after infection were tested. Splenocytes were stimulated with EB and rPmp antigens. rPmp1, 2, 8^11 were complete antigens, rPmp20 and 21 were mixtures of the N- and C-terminal parts, and rPmp6, 7, 13^19 were the N-terminal parts of the antigens (Table 1). The results are displayed in Fig. 1. EB stimulation gave a low response on day 4, a rising response at 8 days, and maximal response at 21 and 35 days after infection. At 84 days after infection the response was declining but still at a higher level than 4 days after infection. For the Pmps the highest responses were also observed at 21 and 35 days after infection. No responses to Pmps were observed at 4 and 84 days after
Table 2 Isotype antibody response against C. pneumoniae in infected mice determined with sELISA, 17 days after infection Mouse number 1 2 3 4 Mean S.D. IgG1 (Wg ml31 ) 0.8 1.0 1.1 1.1 1.0 0.2 IgG2a (Wg ml31 ) 1.1 1.6 2.4 1.5 1.7 0.6

Fig. 1. Enumeration of splenic C. pneumoniae Pmp- and EB-specic IFN-Q-producing cells by ex vivo ELISpot. Mice were infected intranasally with 2U106 IFU C. pneumoniae and killed at the indicated point in time after infection. Splenocytes from two infected mice from all points in time after infection were mixed and stimulated with EB and a panel of Pmps. rPmp2, 8, 11, 13, 21N, 21C, 20N, and 6 had endotoxin concentrations higher than 50 EU mg31 and rPmp1, 7, 9, 10, 14, 15, 16, 18, 19, and 20C and MOMP had endotoxin concentrations less than 50 EU mg31 . The response was measured by ELISpot. Mixed splenocytes from two mice were used at each point in time. Numbers of spots were enumerated visually and the background, from the controls to which no antigen was added, was subtracted. Values less than zero were set to be zero. Numbers displayed with an error bar represent the mean of two replicates S.D., whereas numbers with no error bars represent a single data point. The broken line represents the cuto for selection of Pmps for the next experiments.

infection. rPmp8, 20 and 21 (complete antigens) gave positive responses on days 8, 21 and 35 after infection. In addition, rPmp6 (N-terminal part), 9, 10, and 11 (complete antigens) were recognized occasionally, but not consistently over time. rPmp8, 20, 21 (complete antigens) and rPmp6 (N-terminal part) gave the highest responses ranging from 40 to 190 IFN-Q-producing cells per 2U106 cells. rPmp9, 10 and 11 (complete antigens) gave low responses with 10^60 IFN-Q-producing cells per 2U106 cells. Pmp1, 2 (complete antigens), 7, 14^19 (N-terminal parts) gave no or very low responses (Fig. 1). 3.3. IFN-Q and IL-5 response in ELISpot using selected proteins Pmp6 (N-terminal part), 8, 20 and 21 (complete antigens) were chosen for further experiments because they gave the highest and/or most consistent responses in the time experiments, with more than two responses above the broken line in Fig. 1. Additionally, MOMP was included because it is the dominant immunogen in both the humoral and cell-mediated immune response in Chlamydia trachomatis infections [22]. The presence of EB or no antigen served as positive and negative controls. Twenty-one days

134

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137

Fig. 2. Number of Pmp- and MOMP-specic IFN-Q- and IL-5-producing cells determined by ex vivo ELISpot. Mice were infected intranasally with 2.5U105 IFU of C. pneumoniae and killed 21 days after infection. Splenocytes from six infected mice and three control mice were stimulated with EB and endotoxin-reduced recombinant proteins. Unstimulated splenocytes were controls and number of spots was determined in duplicate wells for each mouse stimulated with each antigen. The endotoxin concentration in the protein preparations used in this set of experiments was less than 50 EU mg31 . Numbers of specic IFN-Q- or IL-5-secreting cells were enumerated visually and the background, from the controls to which no antigen was added, was subtracted. Values less than zero were set to be zero. Each point in the graph represents the mean count for six mice S.D.

after infection with 2.5U105 IFU the splenocytes were harvested from the mice, because the response was high at this time (Fig. 1). IFN-Q and IL-5 production in ELISpot was measured on stimulation with the recombinant proteins. This was done to investigate whether the observed responses were of the Th1 (IFN-Q) or Th2 (IL-5) type. In Fig. 2 the mean IFN-Q responses for six mice are shown measured as number of spots per 5U105 splenocytes. The highest and most consistent responses in all six mice were observed with rPmp8, 20 and 21 (complete antigens). They showed a mean number of 75^152 IFN-Q-producing cells per 5U105 splenocytes. Additionally, low responses to Pmp6 (N-terminal part) were observed in four of the mice. MOMP showed no response in any mouse. For IL-5 only low responses (mean number of less than 15 IL-5-producing cells per 5U105 splenocytes) were consistently observed for all the IFN-Q-inducing antigens. This means that the response recognizing these antigens was predominantly of the Th1 type (Fig. 2). The positive controls with ionomycin and PMA showed around 35 spots per 5U105 splenocytes. 3.4. Depletion of CD4+ or CD8+ T cells To test whether the ELISpot responses observed were mediated by CD8 T cells or CD4 T cells, we used non-

Fig. 3. ELISpot results with CD4 - and CD8 -depleted cells. Mice were infected with 2U106 IFU C. pneumoniae and killed at 14^60 days after infection, mixed spleen lymphocytes from two or three mice were used in each ELISpot run (IFN-Q). Splenocytes from two or three uninfected mice were used as controls. Examples of ELISpot results of stimulated splenocytes from infected mice (non-depleted) or from CD4 - or CD8 -depleted splenocytes are shown. In all wells 2U106 splenocytes are used. Top row indicates EB-stimulated cells. Middle row indicates rPmp8-stimulated cells. Bottom row indicates unstimulated cells.

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137

135

depleted, CD4 - and CD8 -depleted cells for the ELISpot assay. The depletion method was tested by ow cytometry with CD4- and CD8-specic antibodies. The non-depleted splenocytes from infected mice contained 17.7% CD4 cells and 9.5% CD8 cells. The CD4 -depleted cells contained 0.1% CD4 cells and 8.8% CD8 cells. The CD8 depleted cells contained 16.2% CD4 and 0.4% CD8 cells. Depleted cells were used for testing of EB as well as rPmp6 (N-terminal part), 8 and 21 (complete antigens). Fig. 3 shows a representative example of the ELISpot responses from depleted/non-depleted splenocytes from infected mice after stimulation with EB and rPmp8 (complete antigen). Only the non-depleted and CD8 -depleted cells responded to both antigens, indicating that the response was mediated by CD4 T cells (Fig. 3).

4. Discussion It is well established that prior C. pneumoniae infection partially protects against subsequent infection in C57/BL6 mice [7]. This immunity is probably mediated by both CD4 and CD8 T cell responses [11] in a Th1 type cytokine response [10]. Identication of antigens recognized by CD4 T cells is important for understanding the role of a CD4 T cell response during infection. Such antigens can be tested for their protective eect in subsequent immunization experiments, which may allow development of pathogen-specic preventive or therapeutic strategies. We found that IgG2a isotype antibodies directed against C. pneumoniae dominate in infected C57BL/6J mice. This is in agreement with other studies which showed that the overall immune response in C57BL/6J mice infected with C. pneumoniae is of the Th1 type [10,11]. Since this immune response is partially protective against reinfection, it is possible that protective antigens can be identied by dissecting it. However, in agreement with other studies on immunity [9] we found that the cellmediated immune response diminished over time (Fig. 1). Consequently, identication of the protective antigens is only a part of dening a preventive strategy. Measures to induce a long-term memory response need to be explored in future studies, e.g. immunization with dierent adjuvants or delivery vehicles for the antigens. We found Pmp8, 20 and 21 (complete antigens) to be consistently recognized by a cell-mediated immune response (CD4 ) and MOMP not to be recognized. The recognition of Pmps by the cell-mediated murine immune response agrees with observations by Halme et al. [30]. They found proteins with total molecular masses approximately within the size range 92^98 kDa to be recognized by human T cells. Especially Pmp8 (98 kDa), which in our experiments showed the strongest response, might also have been recognized by the human T cells in [30]. Interestingly, the C. trachomatis homolog of Pmp21, denoted PmpD, is recognized by human CD4 T cells [31]. We

may have missed additional responses as some rPmps (rPmp6, 7, 13^19) contained only the N-terminal part of the proteins. rPmp6 (N-terminal part) and rPmp9, 10, 11 (complete antigens) were recognized inconsistently over time and/or with low responses. As EB and rPmp8 (complete antigen) were recognized in all experiments, this variability was not due to lack of infection in some mice. We speculate that an explanation is either inter-mouse immune recognition variability or a variation in the expression levels of the Pmps in individual mice. Pmp1, 3 and 10 have been shown to be dierentially expressed in cell culture [19,23]. That rPmp6 (N-terminal part) was recognized with only a low response in the repeated experiments (Fig. 2) could be explained by the fact that endotoxin-reduced proteins were used in these experiments. The high responses to rPmp6 (N-terminal part) in Fig. 1 might have been caused by endotoxin interference as it may unspecically induce cytokine production [32]. Non-recognition of MOMP by the cell-mediated immune response during C. pneumoniae infection is in contrast to C. trachomatis infections, where MOMP contains CD4 T cell epitopes in both mice and humans [33,34]. Nevertheless, C. pneumoniae MOMP contains CD8 T cell epitopes [12,13]. The sequence of MOMP in C. trachomatis varies between serovars, and the gene sequence contains four variable domains interrupted by conserved sequences [35]. The C. pneumoniae MOMP gene sequence is conserved among the dierent isolates [36]. This probably reects that the C. trachomatis MOMP gene is under higher selection pressure by the immune response compared to the C. pneumoniae gene. During C. trachomatis infections MOMP is reliably recognized by the humoral immune response [37], but during C. pneumoniae infections it is more inconsistently recognized [38]. This correlates with the fact that we did not nd any CD4 T cell recognition of MOMP during murine C. pneumoniae infection. It was established that the Pmps are recognized by CD4 T cells during infection in mice. We expected to see preferentially CD4 T cell responses in the ELISpot assay, because recombinant proteins in aquatic solution and whole non-viable EB will preferentially be endocytosed by antigen-presenting cells and thereby enter the classical MHC class II antigen-presenting pathway. Our observation of CD4 T cells only agrees with the observations by Wizel et al. [13]. They found that cytotoxic T lymphocyte lines obtained from infected mice were not able to lyse cells inoculated with non-viable EB in a 51 Cr release assay, but only actively infected cells or cells pulsed with known epitopes provided as peptides [13]. Therefore, we cannot conclude from these data whether the Pmps are recognized by a CD8 T cell response. It is possible as for example Saren et al. [12] found Pmp10 to be recognized by CD8 T cells in a cytotoxicity assay. Fig. 3 shows that the CD8 -depleted cells gave lower spot counts than non-depleted cells which indicates that interactions between the

136

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137 N. (2000) Acquired immunity to Chlamydia pneumoniae is dependent on gamma interferon in two mouse strains that initially dier in this respect after primary challenge. Infect. Immun. 68, 960^964. Rottenberg, M.E., Gigliotti Rothfuchs, A.C., Gigliotti, D., Svanholm, C., Bandholtz, L. and Wigzell, H. (1999) Role of innate and adaptive immunity in the outcome of primary infection with Chlamydia pneumoniae, as analyzed in genetically modied mice. J. Immunol. 162, 2829^2836. Saren, A., Pascolo, S., Stevanovic, S., Dumrese, T., Puolakkainen, M., Sarvas, M., Rammensee, H.G. and Vuola, J.M. (2002) Identication of Chlamydia pneumoniae-derived mouse CD8 epitopes. Infect. Immun. 70, 3336^3343. Wizel, B., Starcher, B.C., Samten, B., Chroneos, Z., Barnes, P.F., Dzuris, J., Higashimoto, Y., Appella, E. and Sette, A. (2002) Multiple Chlamydia pneumoniae antigens prime CD8( ) Tc1 responses that inhibit intracellular growth of this vacuolar pathogen. J. Immunol. 169, 2524^2535. Halme, S., Latvala, J., Karttunen, R., Palatsi, I., Saikku, P. and Surcel, H.M. (2000) Cell-mediated immune response during primary Chlamydia pneumoniae infection. Infect. Immun. 68, 7156^7158. Kalman, S., Mitchell, W., Marathe, R., Lammel, C., Fan, J., Hyman, R.W., Olinger, L., Grimwood, J., Davis, R.W. and Stephens, R.S. (1999) Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nat. Genet. 21, 385^389. Christiansen, G., Pedersen, A.S., Hjerno, K., Vandahl, B. and Birkelund, S. (2000) Potential relevance of Chlamydia pneumoniae surface proteins to an eective vaccine. J. Infect. Dis. 181 (Suppl. 3), S528^ S537. Grimwood, J. and Stephens, R.S. (1999) Computational analysis of the polymorphic membrane protein superfamily of Chlamydia trachomatis and Chlamydia pneumoniae. Microb. Comp. Genomics 4, 187^ 201. Henderson, I.R. and Lam, A.C. (2001) Polymorphic proteins of Chlamydia spp.-autotransporters beyond the Proteobacteria. Trends Microbiol. 9, 573^578. Grimwood, J., Olinger, L. and Stephens, R.S. (2001) Expression of Chlamydia pneumoniae polymorphic membrane protein family genes. Infect. Immun. 69, 2383^2389. Vandahl, B.B., Birkelund, S., Demol, H., Hoorelbeke, B., Christiansen, G., Vandekerckhove, J. and Gevaert, K. (2001) Proteome analysis of the Chlamydia pneumoniae elementary body. Electrophoresis 22, 1204^1223. Vandahl, B., Christiansen, G. and Birkelund, S. (2002) 2D-PAGE analysis of the Chlamydia pneumoniae outer membrane complex. In: Proceedings of the Tenth International Symposium on Human Chlamydial Infections, Grafmat, Turkey, pp. 547^550. Igietseme, J.U., Black, C.M. and Caldwell, H.D. (2002) Chlamydia vaccines: strategies and status. BioDrugs 16, 19^35. Pedersen, A.S., Christiansen, G. and Birkelund, S. (2001) Dierential expression of Pmp10 in cell culture infected with Chlamydia pneumoniae CWL029. FEMS Microbiol. Lett. 203, 153^159. Vandahl, B.B., Pedersen, A.S., Gevaert, K., Holm, A., Vanderkerckhove, J., Christiansen, G. and Birkelund, S. (2002) The expression, proccessing and localization of polymorphic membrane proteins in Chlamydia pneumoniae strain CWL029. BMC Microbiol. 2, 36. Franken, K.L., Hiemstra, H.S., van Meijgaarden, K.E., Subronto, Y., den Hartogh, J., Ottenho, T.H. and Drijfhout, J.W. (2000) Purication of his-tagged proteins by immobilized chelate anity chromatography: the benets from the use of organic solvent. Protein Expr. Purif. 18, 95^99. Knudsen, K., Madsen, A.S., Mygind, P., Christiansen, G. and Birkelund, S. (1999) Identication of two novel genes encoding 97- to 99-kilodalton outer membrane proteins of Chlamydia pneumoniae. Infect. Immun. 67, 375^383. Christiansen, G., stergaard, L. and Birkelund, S. (1997) Molecular biology of the Chlamydia pneumoniae surface. Scand. J. Infect. Dis. 104 (Suppl.), 5^10.

CD8 and CD4 T cells are needed to give a full response. This, however, needs further investigation.
[11]

5. Conclusions We conrmed that a predominant Th1 response develops during C. pneumoniae infection in C57BL/6J mice. We found that Pmp8, 20 and 21 were consistently recognized by a cell-mediated immune response of the Th1 type. The Pmp-specic responses were mediated by CD4 T cells, but we cannot exclude the possibility that the proteins are also recognized by CD8 T cells.
[12]

[13]

[14]

Acknowledgements We thank The Danish Medical Research Council (Grants 9900750 and 9700659) and European Commission (Grant QLRT-1999-31536) for nancial support. We thank Karin Skovgard Srensen, Inger Andersen and Bettina Bundgaard for technical assistance and Lisbet Wellejus Pedersen for linguistic assistance.
[15]

[16]

[17]

References
[18] [1] Wolf, K., Fischer, E. and Hackstadt, T. (2000) Ultrastructural analysis of developmental events in Chlamydia pneumoniae-infected cells. Infect. Immun. 68, 2379^2385. [2] Grayston, J.T. (1992) Infections caused by Chlamydia pneumoniae strain TWAR. Clin. Infect. Dis. 15, 757^761. [3] Saikku, P. (2000) Chlamydia pneumoniae in atherosclerosis. J. Intern. Med. 247, 391^396. [4] Erkkila, L., Laitinen, K., Laurila, A., Saikku, P. and Leinonen, M. (2002) Experimental Chlamydia pneumoniae infection in NIH/S mice: eect of reinoculation with chlamydial or cell preparation on culture, PCR and histological ndings of lung tissue. Vaccine 20, 2318^2324. [5] Kaukoranta-Tolvanen, S.E., Laurila, A.L., Saikku, P., Leinonen, M. and Laitinen, K. (1995) Experimental Chlamydia pneumoniae infection in mice: eect of reinfection and passive immunization. Microb. Pathog. 18, 279^288. [6] Murdin, A.D., Dunn, P., Sodoyer, R., Wang, J., Caterini, J., Brunham, R.C., Aujame, L. and Oomen, R. (2000) Use of a mouse lung challenge model to identify antigens protective against Chlamydia pneumoniae lung infection. J. Infect. Dis. 181 (Suppl. 3), S544^S551. [7] Mygind, T., Birkelund, S. and Christiansen, G. (2002) Detection and quantication of experimental Chlamydia pneumoniae infection in immunized and control mice by real-time PCR and by weight loss determination. In: Proceedings of the Tenth International Symposium on Human Chlamydial Infections, Grafmat, Turkey, pp. 309^312. [8] Mygind, T., Birkelund, S., Falk, E. and Christiansen, G. (2001) Evaluation of real-time quantitative PCR for identication and quantication of Chlamydia pneumoniae by comparison with immunohistochemistry. J. Microbiol. Methods 46, 241^251. [9] Penttila, J.M., Anttila, M., Puolakkainen, M., Laurila, A., Varkila, K., Sarvas, M., Makela, P.H. and Rautonen, N. (1998) Local immune responses to Chlamydia pneumoniae in the lungs of BALB/c mice during primary infection and reinfection. Infect. Immun. 66, 5113^5118. [10] Vuola, J.M., Puurula, V., Anttila, M., Makela, P.H. and Rautonen,

[19]

[20]

[21]

[22] [23]

[24]

[25]

[26]

[27]

T. Mygind et al. / FEMS Immunology and Medical Microbiology 40 (2004) 129^137 [28] Miyahira, Y., Murata, K., Rodriguez, D., Rodriguez, J.R., Esteban, M., Rodrigues, M.M. and Zavala, F. (1995) Quantication of antigen specic CD8 T cells using an ELIspot assay. J. Immunol. Methods 181, 45^54. [29] Snapper, C.M. and Paul, W.E. (1987) Interferon-gamma and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236, 944^947. [30] Halme, S., Saikku, P. and Surcel, H.M. (1997) Characterization of Chlamydia pneumoniae antigens using human T cell clones. Scand. J. Immunol. 45, 378^384. [31] Goodall, J.C., Yeo, G., Huang, M., Raggiaschi, R. and Gaston, J.S. (2001) Identication of Chlamydia trachomatis antigens recognized by human CD4 T lymphocytes by screening an expression library. Eur. J. Immunol. 31, 1513^1522. [32] Gao, B. and Tsan, M.F. (2003) Endotoxin contamination in recombinant human heat shock protein 70 (Hsp70) preparation is responsible for the induction of tumor necrosis factor alpha release by murine macrophages. J. Biol. Chem. 278, 174^179. [33] Su, H., Morrison, R.P., Watkins, N.G. and Caldwell, H.D. (1990)

137

[34]

[35]

[36]

[37]

[38]

Identication and characterization of T helper cell epitopes of the major outer membrane protein of Chlamydia trachomatis. J. Exp. Med. 172, 203^212. Stagg, A.J., Elsley, W.A., Pickett, M.A., Ward, M.E. and Knight, S.C. (1993) Primary human T-cell responses to the major outer membrane protein of Chlamydia trachomatis. Immunology 79, 1^9. Stephens, R.S., Sanchez-Pescador, R., Wagar, E.A., Inouye, C. and Urdea, M.S. (1987) Diversity of Chlamydia trachomatis major outer membrane protein genes. J. Bacteriol. 169, 3879^3885. Jantos, C.A., Heck, S., Roggendorf, R., Sen-Gupta, M. and Hegemann, J.H. (1997) Antigenic and molecular analyses of dierent Chlamydia pneumoniae strains. J. Clin. Microbiol. 35, 620^623. Newhall, W.J., Batteiger, B. and Jones, R.B. (1982) Analysis of the human serological response to proteins of Chlamydia trachomatis. Infect. Immun. 38, 1181^1189. Kutlin, A., Roblin, P.M. and Hammerschlag, M.R. (1998) Antibody response to Chlamydia pneumoniae infection in children with respiratory illness. J. Infect. Dis. 177, 720^724.