Sunteți pe pagina 1din 78

TEHNOLOGIA ADN RECOMBINANT

CAPITOLUL II

TEHNOLOGIA ADN RECOMBINANT

Tehnologia ADN recombinant se refer la metodologia obinerii moleculelor de ADN recombinant, adic de realizare "in vitro" a unor molecule de ADN noi prin mbinarea de fragmente provenite fie din genomul unor specii biologice diferite, fie de la aceeai specie. Imbinarea respectivelor fragmente se realizeaz ntr-o ordine diferit de cea natural, astfel nct elementele genetice utilizate capt o structur aparte, conferind organismului n care sunt introduse proprieti noi pe care nu le-ar dobndi pe cale natural. Aa cum s-a prezentat anterior (fig.1), pentru a obine moleculele de ADN recombinant este necesar s se parcurg mai multe etape care pot fi sintetizate astfel: 1. izolarea genelor naturale sau sinteza chimic a unor molecule de ADN ce codific proteinele dorite; 2. selecia unui vehicul sau vector adecvat care s transporte genele respective i apt s se replice autonom n celula receptoare; 3. inseria genelor strine n structura genetic a moleculei vector i obinerea unei himere moleculare; 4. introducerea acesteia ntr-o gazd specific i transformarea ei; 5. asigurarea condiiilor care permit exprimarea informaiei strine n celula acceptoare; 6. selectarea celulelor modificate genetic din populaia celular rezultat prin multiplicare; 7. evidenierea produsului genei n celulele modificate sau n mediul de cultur al acestora i purificarea lui pentru a fi folosit n scopurile pentru care s-au realizat tehnicile respective.

35

TEHNOLOGIA ADN RECOMBINANT

2.1. Etapele de lucru pentru obinerea i selecia moleculelor recombinate de ADN Scopul experimentelor de inginerie genetic este acela al obinerii moleculelor de ADN prelucrate in vitro astfel nct ele s conin genele de interes i s poat fi transferate n gazde corespunztoare. Etapele de lucru ce au ca rezultat obinerea acestor molecule presupun elaborarea unor metode de izolare i purificare a acizilor nucleici, a utilizrii unor enzime specifice i selectarea unor vectori de clonare adecvai. 2.1.1. Izolarea i purificarea acizilor nucleici Realizarea experimentelor de clonare a genelor presupune ca etap de baz purificarea unor diferite tipuri de molecule de acizi nucleici: ADN celular total (din celule vegetale, animale, bacteriene sau din levuri), ADN plasmidial, ADN viral sau ARN. In funcie de tipul de molecule de acizi nucleici i de organismul de origine au fost elaborate numeroase metode de izolare i purificare. Indiferent de metoda utilizat este necesar parcurgerea mai multor etape: obinerea (cultivarea) materialului biologic; liza celulelor pentru eliberarea acizilor nucleici; ndeprtarea componentelor celulare nedorite (resturi celulare, proteine etc); purificarea acizilor nucleici de interes; concentrarea acizilor nucleici obinui anterior. 2.1.1.1. Izolarea ADN total Pentru izolarea ADN total se utilizeaz fie fragmente de esuturi (vegetale sau animale), culturi celulare sau suspensii celulare. Indiferent de tipul de celule utilizate n experimente este necesar liza acestora, proces realizat prin metode variate (liza chimic n prezena unor soluii alcaline i/sau a unor detergeni; liza enzimatic cu ajutorul unor enzime specifice; liza produs prin procedee fizice: ultrasonicare, nghearea celulelor n azot lichid, metode mecanice etc). Protejarea de aciunea nucleazelor endogene a ADN liberat prin spargerea celulelor se realizeaz, de regul, prin folosirea unor soluii tampon ce conin EDTA (reactiv ce leag ionii de magneziu fcndu-i inaccesibili DN-azelor, ai cror cofactori sunt). De asemenea, dup ndeprtarea prin centrifugare a resturilor celulare, soluia apoas obinut este supus unor tratamente suplimentare ce au drept scop degradarea ARN (prin adugarea RN-azei) sau a proteinelor contaminante (prin folosirea unor proteaze sau prin extracie cu fenol). ADN este apoi recuperat prin precipitare cu etanol (2-2,5 volume), n
36

TEHNOLOGIA ADN RECOMBINANT

prezena unor cationi monovaleni (de exemplu, ioni de sodiu n concentraie de 0,3M) i apoi prin centrifugare. Deseori, ADN obinut este redizolvat n tampon, proces urmat de o nou rund de deproteinizare, ceea ce asigur o puritate mai bun preparatului. Dac este ns necesar un grad foarte ridicat de puritate, soluia de ADN este supus ultracentrifugrii (n gradient de clorur de cesiu). 2.1.1.2. Izolarea ADN plasmidial Pentru purificarea ADN plasmidial au fost elaborate numeroase metode dar utilizarea uneia sau a alteia depinde de scopul urmrit: evidenierea prezenei plasmidelor n celulele bacteriene sau purificarea plasmidelor i utilizarea lor n diferite experimente (transformarea genetic, clivare cu enzime de restricie, clonri de gene etc). Toate metodele elaborate pn n prezent pentru izolarea plasmidelor bacteriene implic trei etape de baz: cultivarea bacteriilor; depunerea i liza celular; purificarea ADN plasmidial (Mazza, 1986). Posibilitatea de a izola selectiv ADN plasmidial i de a ndeprta ADN cromosomal se datoreaz unor diferene importante dintre cele dou tipuri de molecule. Astfel, ADN cromosomal este reprezentat de molecule de dimensiuni mari, legate de membrana plasmatic, el rmnnd fixat de resturile celulare rezultate dup spargerea celulelor. Avnd dimensiuni mari, moleculele de ADN cromosomal sunt linearizate i fragmentate n cursul procesului de extracie, n timp ce ADN plasmidial este obinut, n cea mai mare parte, sub forma unor molecule circulare nchise covalent (CIC). De asemenea, cele dou tipuri de molecule se comport diferit n prezena unor detergeni (SDS) sau la concentraii mari de sruri. Expunerea la temperaturi ridicate sau tratarea cu soluii cu pH puternic alcalin (12,0 12,4) determin ruperea legturilor de hidrogen dintre cele dou catene ale moleculelor de ADN, ducnd la denaturarea acestora. Datorit conformaiei moleculare speciale (CIC), catenele de ADN plasmidial denaturat se menin alturate, astfel c dup rcire, respectiv neutralizare, aceste molecule redobndesc configuraia iniial. In schimb, ADN cromosomal rmne n stare denaturat fiind eliminat n cea mai mare parte dup centrifugare. Moleculele ce contamineaz soluia de ADN (ARN sau proteine) sunt eliminate prin tratamente similare celor menionate pentru ADN total, iar recuperarea ADN plasmidial se face tot prin centrifugare dup precipitarea cu alcooli (alcool izopropilic sau alcool etilic). Pentru o purificare nalt a ADN plasmidial se poate utiliza ultracentrifugarea n gradient n clorur de cesiu, metod ce permite separarea nu

37

TEHNOLOGIA ADN RECOMBINANT

numai a tipurilor diferite de molecule ci i a moleculelor de ADN plasmidial cu conformaii moleculare diferite (fig.20).
proteine ADN linearizat sau crestat (conformaia CD) ADN de tip CIC Sediment reprezentat de molecule de ARN Fig.20. Separarea moleculelor de ADN prin ultracentrifugare

2.1.1.3. Izolarea ADN viral Pentru obinerea ADN viral este necesar mai nti s se obin celulele ce reprezint gazda specific a virusului de interes. De cele mai multe ori, multiplicarea viral este nsoit de liza celulelor gazd (aa cum este cazul bacteriofagilor litici), astfel nct particulele virale sunt obinute din lizatul celular prin precipitare (de exemplu, prin precipitare cu polietilenglicol) urmat de centrifugare. ndeprtarea capsidei virale se realizeaz prin tratament cu fenol sau prin folosirea unor proteaze. ADN viral este recuperat, dup precipitare, prin centrifugare sau ultracentrifugare n gradient de CsCl. 2.1.1.4. Izolarea moleculelor de ARN In anumite tipuri de experimente n care izolarea genelor direct din moleculele de ADN nu este posibil, pentru fragmentelor de interes este necesar utilizarea unor molecule de ARN care sunt apoi convertite, prin reverstranscriere, la molecule de ADN corespunztoare. Izolarea moleculelor de ARN este relativ complicat de faptul c RN-aza endogen este capabil s degradeze cea mai mare parte a ARN celular. Inactivarea acestei enzime termostabile i rezistente la aciunea EDTA sau a detergenilor este realizat prin folosirea unui inhibitor specific: dietilpirocarbonat. De regul, metodele de izolare ale ARN permit obinerea de ARN total. Pentru purificarea unui anumit tip de ARN se folosesc metode specifice ce in cont de anumite
38

TEHNOLOGIA ADN RECOMBINANT

particulariti ale moleculelor de interes. Spre exemplu, pentru obinerea ARNm se ine cont de faptul c acest tip de ARN, izolat din celule eucariote, prezint la captul 3 o coad monocatenar poliA. Pornind de la aceast caracteristic, pentru purificarea ARNm se utilizeaz metoda cromatografiei de afinitate pe o coloan cromatografic ce conine o umplutur specific la care sunt legate resturi de poliT sau poliU. Secvenele poliT sau poliU interacioneaz specific, pe baz de complementaritate, cu coada poliA a ARNm, legnd moleculele respective. Eluarea moleculelor de interes se realizeaz cu ajutorul unor soluii tampon specifice, iar apoi ARNm este concentrat prin precipitare cu etanol i recuperat prin centrifugare. 2.1.1.5. Determinarea puritii i concentraiei de acizi nucleici Utilizarea acizilor nucleici n diferite experimente este condiionat de un anumit grad de puritate i o cantitate corespunztoare. Concentraia de acizi nucleici din diferite probe se poate determina pe baza absorbiei radiaiilor ultraviolete, tiut fiind faptul c absorbana radiaiilor UV cu lungimea de und de 260nm este direct proporional cu cantitatea de ADN din soluie. Determinrile efectuate asupra unor probe cunoscute (n cuve cu grosimea de 1 cm) au stabilit c valoarea 1,00 a absorbanei la 260 nm corespunde unei concentraii de 50 g/ml ADN dublu catenar sau 40g/ml ARN. Variaia absorbiei n ultraviolet a soluiilor de ADN permite studiul denaturrii acestuia. Odat cu trecerea de la forma dublu catenar la forma monocatenar, absorbia soluiilor de ADN crete cu pn la 40% (efect hipercromic), variaie care depinde de procentul bazelor G-C. Pe baza proprietilor de absorbie a soluiilor de acizi nucleici, se poate evalua puritatea acestora. Acizii nucleici au un spectru de absorbie ntre 250 320 nm. O extincie, la 320 nm, mai mare cu cteva procente dect cea corespunztoare lungimii de und de 260 nm, indic prezena altor tipuri de molecule n soluie. n cazul acizilor nucleici izolai de la E. coli o astfel de contaminare este foarte rar dar pentru preparatele obinute de la alte organisme, absorbia la 320 nm poate fi cu pn la 10% mai ridicat dect la 260 nm. Pentru determinarea tipului de molecule cu care proba este contaminat se citesc extinciile soluiilor la dou lungimi de und diferite: 260 nm lungimea de und la care acizii nucleici au absorbia maxim i 280 nm lungimea de und la care proteinele au absorbia maxim.
39

TEHNOLOGIA ADN RECOMBINANT

Rezultatele obinute pn n prezent au permis stabilirea unor, aa numite, criterii de puritate: - o valoare a raportului A260 / A280 ntre 1,65 i 1,85 indic o puritate ridicat a soluiei de acizi nucleici, dac procentul bazelor G C este unul obinuit; - valori mai mari de 1,85 ar indica prezena n soluie a unei cantiti mari de ARN; - valori sub 1,65 indic o contaminare cu proteine sau fenol a probei analizate. De asemenea, nainte de utilizarea probelor de ADN n experimente de inginerie genetic este necesar s existe, n plus, informaii legate de conformaia molecular a ADN; dac ADN plasmidial este contaminat cu ADN cromosomal sau dac ADN cromosomal este puternic fragmentat. Dac puritatea probei de ADN de interes se poate stabili spectrofotometric, celelalte informaii se pot obine prin utilizarea altor tehnici, cum sunt cele electroforetice. Metoda standard de separare i identificare a moleculelor de ADN izolate dintr-un anumit organism este electroforeza n gel de agaroz. Principiul general al metodei const n faptul c, la pH alcalin sau neutru, acizii nucleici au sarcin negativ i, prin urmare, dac sunt plasai ntr-un cmp electric, ei vor migra spre anod (+). Atunci cnd dimensiunea fragmentelor de ADN este foarte mic (sub 1000 pb), pentru separarea electroforetic se prefer gelul de poliacrilamid, a crui concentraie este aleas n funcie de mrimea moleculelor. Indiferent de tipul de gel utilizat pentru separarea moleculelor de ADN, pentru ca acestea s poat fi vizualizate, este necesar ca mai nti ele s fie colorate. Colorarea se realizeaz cu bromur de etidiu iar vizualizarea benzilor de ADN se face prin expunerea gelului la radiaii UV (pe un transluminator), ele prezentnd o fluorescen roz (fig.21). Metoda electroforezei n gel de agaroz permite stabilirea dimensiunilor moleculelor de ADN precum i conformaia molecular a acestora. 2.1.2. Metode de izolare a fragmentelor de ADN utile pentru clonare Tehnicile care urmresc manipularea direct a ADN prin clonare molecular se desfoar n etape succesive, una dintre acestea fiind obinerea genelor de interes. Aceasta se poate realiza fie prin izolarea genelor naturale, fie prin sinteza chimic a unor molecule de ADN ce codific proteinele dorite. n prezent, prin aceste tehnici se poate realiza prelucrarea i transferul unor secvene relativ mici, de dimensiuni cuprinse ntre 1.000-20.000 pb.

40

TEHNOLOGIA ADN RECOMBINANT


Godeurile unde sunt introduse probele 49,0 kb 21,8 kb 7,53 kb 5,93 kb+ 5,54 kb 4,80 kb 3,41 kb ADN, conformaia CD ADN linearizat ADN parial relaxat ADN, conformaia CIC

Fig.21. Separarea electroforetic a unor molecule de ADN (dup Boffey, 1983)

Reuita experimentelor n urma interveniilor prin diverse procedee este condiionat de prezena integral a genei dorite i a unei ct mai mici cantiti de ADN contaminant, inutil pentru buna funcionare a genei de interes. Obinerea fragmentelor de ADN ce servesc pentru clonare se poate realiza pe mai multe ci: sinteza chimic a genei; sinteza enzimatic a ADN dublu catenar complementar (ADNc); izolarea genelor din ADN natural cu ajutorul enzimelor de restricie; izolarea i amplificarea genelor prin tehnologia PCR. Metodele prezentate mai sus presupun utilizarea unei game variate de enzime, cum ar fi: enzimele de restricie (endonucleaze de restricie), metilazele, ADN polimeraze dependente de ADN, reverstranscriptaza, fosfataza alcalin, ligaza, polinucleotid kinaza, nucleazele (DNaze, RN-aze). 2.1.2.1. Obinerea ADN de interes prin utilizarea endonucleazelor de restricie Enzimele restricie cunoscute i sub numele de endonucleaze de restricie sunt produse de ctre bacterii i sunt rspunztoare de fenomenul de degradare a moleculelor de ADN strin ce ptrund n interiorul celulelor bacteriene. Aceste enzime, dup "recunoaterea" unei secvene nucleotidice specifice, hidrolizeaz moleculele de ADN dublu catenar. Hidroliza ADN se realizeaz prin clivarea a dou legturi fosfodiesterice, situate cte una pe fiecare caten a moleculei de ADN, determinnd formarea unui numr limitat de fragmente per molecul. n celulele productoare, endonucleazele de restricie fac parte integrant dintrun sistem de restricie i modificare, alctuit dintr-o restrictaz i o enzim de modificare. "Modificarea", realizat n special prin metilare, protejeaz ADN propriu fa de aciunea
41

TEHNOLOGIA ADN RECOMBINANT

restrictazelor specifice, n timp ce ADN strin, ptruns n celul, fiind lipsit de o modificare adecvat, este sensibil la distrugerea cu endonucleaze de restricie (Nathans i Smith 1975; Old i Primrose 1980; Zarnea 1986). Sistemele de restricie i modificare au fost descoperite prin efectul lor asupra bacteriofagilor ce infecteaz celulele bacteriene. Astfel, s-a observat c particulele fagice ce au fost eliberate prin liza celulelor bacteriene aparinnd unei anumite tulpini determin infectarea eficient a altor bacterii aparinnd aceleiai tulpini deoarece acestea au acelai tip de modificare ca i gazda iniial. In cazul n care respectivele particule fagice infecteaz bacterii aparinnd altor tulpini, numrul de plaje de liz (dovada eficienei infeciei cu bacteriofagi viruleni) este foarte mic sau chiar nu se produc plaje de liz deoarece ADN fagic infectant a fost atacat i distrus n cea mai mare parte de ctre enzimele de restricie ale noii gazde. Faptul c totui, n anumite situaii apar plaje de liz, dovedete c sistemul de restricie nu este absolut. Exist astfel posibilitatea ca ADN exogen s scape fenomenului de restricie fie datorit unor mutaii spontane aprute la nivelul situsurilor int pentru enzimele de restricie, fie aciunii ineficiente a acestora. Mai mult, particulele fagice din noile plaje de liz sunt capabile s infecteze eficient noua tulpin bacterian, dar nu i cea de origine. Aceasta dovedete c ADN din aceste particule fagice a suferit tipul de modificare specific noii gazde i nu mai este recunoscut de gazda de origine. In 1968, Arber i Linn au demonstrat activitatea restrictazic a enzimei Eco B, produs de o tulpin de E.coli, iar Meselson i Yuan (1968) au purificat o enzim cu aciune similar sintetizat de tulpina E.coli K. Aceste enzime au fost capabile de a degrada ADN izolat din alte surse dar nu i pe cel al tulpinii productoare, ele tind ADN n mod ntmpltor, la nivelul unor situsuri localizate departe de situsul de recunoatere. In 1970, Smith, Wilcox i Kelly au reuit purificarea i caracterizarea unei alte enzime de restricie, Hind II, enzim care taie macromolecula de ADN la nivelul situsului de recunoatere. Aceast enzim a fost apoi utilizat de Dana i Nathans (1971) pentru clivarea genomului circular al virusului SV40 reuind obinerea a 11 fragmente distincte. Acest experiment a nsemnat realizarea primei hri de restricie. Trstura de baz a unui sistem de restricie i modificare este aceea c tulpina bacterian prezint o activitate de metilare a ADN propriu cu aceeai specificitate de secven ca i activitatea restrictazic. Metilaza adaug grupri metil la resturile de adenin sau citozin de la nivelul situsurilor int ale enzimei de restricie corespunztoare, ceea ce

42

TEHNOLOGIA ADN RECOMBINANT

confer respectivelor molecule de ADN rezisten la aciunea restrictazei (protejeaz ADN propriu de autodigestia pe care ar produce-o enzima de restricie sintetizat). Toate endonucleazele de restricie recunosc scurte secvene de nucleotide de la nivelul macromoleculelor de ADN, secvene ce reprezint situsurile de recunoatere i legare. Legarea este urmat de clivarea legturilor fosfodiesterice fie la nivelul situsului de recunoatere fie la deprtare de acesta, n funcie de enzim. ADN genomic al bacteriei ce produce o anumit enzim de restricie este metilat la nivelul situsurilor int, astfel nct devine imun la aciunea enzimei de restricie corespunztoare. ADN este metilat pe ambele catene ns, n cursul procesului de replicare, moleculele fiice conin doar una dintre catene metilat (cea matri); se poate spune n acest fel c ele sunt hemimetilate. In acest moment ntr n aciune enzimele ce catalizeaz procesul de metilare i introduc grupri metil la nivelul bazelor azotate corespunztoare. Atunci cnd n celul ptrunde ns o molecul de ADN strin, care nu prezint modelul de metilare al respectivei gazde, el este rapid recunoscut de enzimele de restricie i degradat. In cazul ADN al tulpinilor de E.coli s-a evideniat faptul c acesta conine mici cantiti de 6-metiladenin i 5-metilcitozin. Aceste baze azotate sunt generate prin aciunea a trei tipuri diferite de metilaze care au fost ncadrate n trei sisteme de modificare specifice: - sistemul hsd care acioneaz pentru a genera un model specific de metilare a adeninei (sau uneori a citozinei); - sistemul dam care este capabil s deosebeasc noile catene de ADN replicate prin metilarea adeninei. El este implicat n controlul procesului de replicare, n marcarea catenelor de ADN n vederea reparrii sau influeneaz activitatea altor elemente cromosomale la E.coli; - sistemul dcm care metileaz citozina dar al crui mecanism de aciune nu este cunoscut. Au fost identificate bacterii ce prezint mutaii la nivelul sistemelor de metilare, ele fiind incapabile de metilare dar capabile de supravieuire; aceasta dovedete c totui metilarea nu este un eveniment esenial pentru supravieuirea bacteriilor. Sistemele enzimatice de restricie/modificare au fost mprite n trei categorii: tipul I, tipul II i tipul III. Diferena principal dintre cele trei categorii este aceea c sistemele enzimatice de tipul II conin enzime diferite ce realizeaz metilarea, respectiv restricia, n timp ce sistemele de tip I i II grupeaz enzime ce prezint att proprieti de metilare ct i de restricie. Enzimele ce alctuiesc aceste sisteme au 2-3 subuniti heterologe cu proprieti
43

TEHNOLOGIA ADN RECOMBINANT

funcionale distincte. Sistemele enzimatice de tip I i II sunt mai puin cunoscute i mai puin folosite n practic dei sunt interesante din punct de vedere biologic. Sistemul de tip II include o serie de enzime de restricie foarte bine cunoscute, ele fiind utilizate n numeroase experimente de biologie molecular. Au mai fost descrise i alte tipuri de enzime de restricie care acioneaz asupra ADN doar dac acesta este metilat. Acesta este cazul enzimei de restricie Dpn I produs de unele tulpini de Streptococcus pneumoniae: ea cliveaz situsul de recunoatere GATC doar dac acesta este metilat. Din contr, enzima DpnII, produs de alte tulpini de streptococi, i exercit aciunea doar asupra situsurilor de recunoatere GATC nemetilate. In ceea ce privete nomenclatura enzimelor de restricie, a fost propus un model original, ce combin denumirea speciei i a tulpinii de la care s-a izolat enzima (abreviere) i numrul de enzime pe care aceasta le produce (cifre romane). De exemplu, tulpina Escherichia coli R produce mai multe enzime de restricie notate Eco RI, Eco RII, Eco RV, n timp ce Bacillus globigii sintetizeaz dou enzime de restricie, Bgl I i Bgl II (tabelul 2). Tabelul 2. Caracteristicile unor enzime de restricie
Tulpina bacterian Anabaena variabilis Bacillus amyloliquefaciens Bacillus globigii Escherichia coli Haemophilus aegyptius H. haemolyticus H.parainfluenzae H.influenzae Rd Moraxella bovis Providencia stuartii Serratia marcescens Streptomyces stanford Thermus aquaticus Xanthomonas malvacearum Denumirea enzimei Ava I Bam HI Bgl II Eco RI Hae III Hha I Hpa II Hind III Mbo I Pst I Sma I Sst I Taq I Xma I Situs de recunoatere i clivare

CCGGAG GGATCC AGATCT GAATTC GGCC GCGC CCGG AAGCTT GATC CTGCAG CCCGGG GAGCTC TCGA CCCGGG

Relativ recent (Jacquier i Dujon, 1985; Macreadie i colab., 1985) au evideniat faptul c anumite gene mitocondriale, cloroplastice sau chiar nucleare de la unele organisme eucariote conin introni ce codific nucleaze specifice. Aceste nucleaze determin clivri
44

TEHNOLOGIA ADN RECOMBINANT

dublu-catenare ale ADN, la nivelul unor situsuri specifice, ntr-un mod similar aciunii enzimelor de restricie produse de bacterii. Spre deosebire de acestea ns, secvenele de recunoatere nu sunt protejate prin metilare ci ele, se pare c sunt implicate n eliminarea intronilor din anumite gene, genernd gene alele fr introni. Endonucleazele eucariote recunosc secvene mai lungi de nucleotide, formate din 1012 perechi de baze, astfel c ele ar putea fi utilizate n experimentele n care se dorete obinerea unor fragmente de ADN de dimensiuni mai mari (ca n cazul construirii bncilor genomice). Una dintre caracteristicile enzimelor de restricie este aceea c ele recunosc anumite secvene de nucleotide (situsul de recunoatere) i cliveaz n mod specific legturile fosfodiesterice dintre anumite nucleotide (situsul de clivare), situsurile fiind plasate pe ambele catene ale ADN. In cazul multor enzime de restricie, situsul de recunoatere coincide cu cel de clivare (mai ales la enzimele de restricie de tip II), fiind format dintr-un numr limitat de nucleotide (4, 5, 6, 7 sau 8 perechi de nucleotide), cu structur de palindrom. De exemplu, enzima Eco RI recunoate o secven specific format din 6 nucleotide, GAATTC. Uneori, palindromul este ntrerupt de o serie de 1 pn la 9 nucleotide nespecifice. De exemplu, enzima de restricie Sfi I recunoate secvena GGCCNNNNNGGCC, unde N poate fi orice baz azotat. Deseori, situsul de recunoatere al unei enzime de restricie nu coincide cu cel de clivare, acesta din urm fiind localizat la o anumit deprtare de situsul de recunoatere, spre captul 5 sau 3. Un exemplu de acest tip este enzima Mbo II care recunoate situsul GAAGA, dar locul de clivare este situat la o distan de 8 nucleotide de la captul 3 al situsului de recunoatere pe o caten i la o distan de 7 nucleotide spre captul 5 pe cealalt caten. Numrul i mrimea fragmentelor de ADN generate prin aciunea enzimelor de restricie depinde de frecvena apariiei situsurilor de recunoatere la nivelul ADN supus clivrii. Presupunnd c, n medie, coninutul n G+C al ADN ar fi 50%, aceasta ar nsemna c un situs de restricie format din patru nucleotide s-ar regsi la nivelul acelui ADN la fiecare 256 perechi de baze (44). Dac situsul de restricie este format din ase nucleotide, el s-ar regsi la fiecare 4096 perechi de baze (46), n timp ce un situs de restricie format din opt nucleotide ar putea aprea la fiecare 65.536 perechi de baze (48). In funcie de enzima de restricie utilizat i de scopul urmrit n experiment, ADN poate fi scindat n fragmente de dimensiuni mici (ca n cazul experimentelor de amprentare genetic = DNA fingerprinting)
45

TEHNOLOGIA ADN RECOMBINANT

sau mai mari, mai ales atunci cnd sunt folosite enzime al cror situs de recunoatere este format din 8 nucleotide (ca n cazul experimentelor de clonare a unor fragmente genomice sau n cele de cartare genetic). Un alt aspect de care se ine seama atunci cnd se alege o enzim de restricie pentru un anumit tip de experiment este acela al tipului de extremiti pe care le genereaz enzima dup clivarea macromoleculei de ADN. Se cunoate faptul c enzimele de restricie ce recunosc secvene de tip palindrom rup legturile fosfodiesterice la nivelul acestor secvene, genernd fie extremiti monocatenare complementare 3 sau 5 (atunci cnd clivarea se face decalat n raport cu axul de simetrie al secvenei palindromice), fie extremiti drepte (atunci cnd clivarea se face n aceeai poziie pe ambele catene ale ADN). In cazul fragmentelor de restricie cu extremiti monocatenare, ele se pot reasocia pe baza complementaritii, ntre ele stabilindu-se legturi de hidrogen; legarea este mai stabil atunci cnd extremitile respective conin mai multe baze azotate de tip GC. Pentru testarea aciunii enzimelor de restricie se pot utiliza diferite tipuri de ADN la care se cunoate numrul de situsuri de recunoatere (stabilit prin studii anterioare). Dintre acestea, cele mai utilizate molecule de ADN provin de la bacteriofagul , de la adenovirusul Ad2, bacteriofagul X174, plasmida pUC18 sau pBR322 (tabelul 3). Tabelul 3. Aciunea unor enzime de restricie pe diferite tipuri de molecule de ADN
Enzima Bam HI Bgl II Dpn I Eco RI Eco RV Hind III Hinf I Mbo I Pst I Pvu I Sma I Taq I Situs de recunoatere i clivare G GATCC A GATCT GmeA TC G AATTC GAT ATC A AGCTT G ANTC GATC CTGCA G CGAT CG CCC GGG T CGA Numr de situsuri
Ad2 X174 pUC18 pBR322

5 6 116 5 21 7 148 116 28 3 3 121

3 11 87 5 9 12 72 87 30 7 12 50

0 0 0 0 0 0 21 0 1 0 0 10

1 0 15 1 0 1 6 15 1 2 1 4

1 0 22 1 1 1 10 22 1 1 0 7

= indic locul clivrii; N = reprezint orice nucleotid; Gme = indic starea metilat a bazei respective

46

TEHNOLOGIA ADN RECOMBINANT

Izolarea genelor din ADN genomic cu ajutorul enzimelor de restricie constituie cea mai simpl metod de obinere a unor fragmente de ADN ce pot conine gena dorit. Metoda const n fragmentarea specific a genomului unui organism cu ajutorul enzimelor de restricie, urmat de selecia i purificarea fragmentului dorit. Fragmentarea a ADN cu ajutorul endonucleazelor de restricie se bazeaz pe proprietatea acestor enzime de a cliva moleculele de ADN la nivelul situsului de recunoatere, aa cum este cazul endonucleazelor de tipul II. Acestea cliveaz ADN dublu catenar prin ruperea a dou legturi fosfodiesterice, cte una pe fiecare caten, producnd fie extremiti drepte fie extremiti decalate (ce determin prelungiri monocatenare lungi de 3, 4 sau 5 baze, n funcie de enzima folosit)(Cornea i colab., 1998). Cele mai multe situsuri de recunoatere ale enzimelor de restricie sunt palindromice, astfel c prelungirile monocatenare formate de o anumit enzim la extremitile moleculei de ADN sunt complementare, coezive ("lipicioase"), fapt care asigur legarea lor eficient, pe baz de complementaritate, indiferent de proveniena moleculelor de ADN. Cu toate avantajele sale, metoda se poate aplica numai dac genomul organismului de la care se dorete izolarea unei gene se poate purifica, dac i se cunoate harta genetic sau, i mai bine, harta sa de restricie. Condiia esenial este ca enzima de restricie folosit s cliveze gena, astfel nct funcia acesteia s rmn nealterat. Atunci cnd nu exist informaii asupra localizrii genelor, clivarea se face la ntmplare, iar informaiile obinute sunt prelucrate astfel nct s permit stabilirea ordinii situsurilor de restricie i apoi a identificrii prezenei genei (genelor) de interes la nivelul fragmentelor selectate. Trebuie precizat faptul c examinarea exclusiv a mrimii fragmentelor de restricie nu ofer informaii asupra localizrii situsurilor de recunoatere. Pentru determinarea poziiei situsurilor la nivelul moleculei de ADN analizate se aplic teste suplimentare (fig.22). Etapele unor asemenea teste sunt urmtoarele: ADN de interes este clivat mai nti cu o anumit enzim de restricie, de exemplu, Pst I, obinndu-se mai multe fragmente de restricie de dimensiuni diferite Fragmentele obinute cu prima enzim sunt supune aciunii unei alte enzime de restricie, de exemplu, Hind III, rezultnd fragmente de dimensiuni mai mici Experimentul se reia prin inversarea ordinii de aciune a celor dou enzime de restricie, mai nti Hind III i apoi Pst I.
47

TEHNOLOGIA ADN RECOMBINANT

n final se compar dimensiunea fragmentelor finale i se stabilete ordinea situsurilor de restricie pentru Pst I i Hind III.

Fig.22. Stabilirea localizrii situsurilor de restricie la nivelul unui fragment de ADN. A. Fragmentul originar de 6,6 kb este clivat separat cu enzimele Hind III i PstI, iar fragmentele obinute sunt digerate cu cealalt enzim de restricie. B. Pe baza dimensiunii fragmentelor obinute prin simpla i dubla clivare s-a stabilit ordinea situsurilor de restricie (dup Snyder i Champness, 1997).

O alt metod de stabilire a hrii fizice este aceea a realizrii unei biblioteci de fragmente de restricie de ADN provenit de la organismul analizat. Dup clivarea ADN cu o enzim de restricie, fragmentele rezultate sunt introduse ntr-un vector de clonare i apoi ntro gazd caracteristice, obinndu-se un numr mare de clone. Clonele sunt apoi analizate prin folosirea hibridizrii moleculare (Southern-blot hybridization). Astfel, dup separarea electroforetic a fragmentelor de restricie, acestea sunt denaturate iar ADN monocatenar este transferat pe o membran de nitroceluloz. Fragmentele respective sunt supuse apoi interaciunii cu o prob de ADN marcat radioactiv, determinndu-se n acest fel care dintre fragmentele de restricie se suprapun unele cu altele. Odat ce clonele au fost identificate i ordonate, situsurile de restricie sunt determinate la nivelul fiecrui fragment conform metodei prezentate anterior, dup care rezultatele obinute pentru fiecare fragment n parte sunt alturate obinndu-se n acest fel cartarea ntregii molecule de ADN supuse analizei.

48

TEHNOLOGIA ADN RECOMBINANT

Uurina cu care genele de interes pot fi izolate depinde de localizarea lor pe cromosomi. Pe baza efectelor lor fenotipice, a organizrii la nivelul cromosomilor i a gradului de dificultate al izolrii lor, genele de la procariote pot fi clasificate n mai multe categorii: gene simple care codific enzime monomere, ARNt, ARNr. Aceste gene sunt cel mai uor de izolat; gene complexe pentru proteine multimere, constituite din subuniti diferite care, deseori, nu sunt localizate grupat pe cromosomi; operoni pentru diferite ci metabolice; regloni sau minioperoni dispersai pe cromosom, avnd rol n controlul funciilor de biosintez; reglonii multipli, cum sunt cei ce controleaz sinteza antibioticelor din precursori ai mai multor ci metabolice diferite (Vtafu, 1995). Pentru a stabili localizarea anumitor gene la nivelul unei molecule de ADN, deci pe o hart fizic, pot fi utilizate diferite metode, una dintre ele presupunnd localizarea anumitor mutaii lund ca referin situsuri de restricie cunoscute. Organismele aparinnd unei anumite specii conin aceleai gene, ordonate la fel la nivelul hrii genetice, dar ntre indivizi exist unele diferene la nivelul secvenei de nucleotide din ADN. Aceste diferene asigur polimorfismul individual. Polimorfismul genetic a fost utilizat din cele mai vechi timpuri, la nceput n mod empiric, pentru ameliorarea organismelor: prin ncruciarea a doi indivizi diferii aparinnd aceleiai specii sau obinut organisme noi, cu performane mbuntite. Deoarece diferitele forme ale unei gene se datoreaz variaiilor n secvena de nucleotide ce le alctuiete, poziia situsurilor de restricie pentru anumite enzime poate varia, fenomenul putnd fi evideniat electroforetic dup migrarea fragmentele de ADN obinute prin clivarea cu o enzim de restricie. Tehnica a primit denumirea de RFLP (restriction fragment lenght polymorphism), ea fiind cuplat, de obicei, cu tehnica Southern blot pentru caracterizarea unei regiuni de ADN (prin utilizarea unei probe de ADN specific regiunii de analizat)(fig.23) La eucariote, unde harta genetic este departe de a fi cunoscut, apar dificulti suplimentare n ceea ce privete obinerea genelor prin metoda descris. In acest caz, deoarece nu exist informaii suficiente asupra localizrii genei de interes, prin utilizarea enzimelor de
49

TEHNOLOGIA ADN RECOMBINANT

restricie pentru clivarea ADN genomic, se obine o populaie heterogen (ca dimensiuni) de fragmente de restricie.

50

TEHNOLOGIA ADN RECOMBINANT Fig.23. Reprezentarea schematic a etapelor tehnicii RFLP, aplicate n scopul identificrii localizrii unei gene la nivelul unui fragment de restricie, pe dou probe de ADN (1 i 2) (dup Bougaize i colab.,2000)

Clonarea ulterioar a tuturor acestor fragmente (separate pe baza dimensiunii lor) n vectori de clonare specifici i apoi introducerea lor n E.coli permite obinerea, aa numitelor "bnci genomice" ("biblioteci de gene"). Numrul de clone recombinate de E.coli ce trebuie analizate pentru a gsi fragmentul ce conine gena dorit (n funcie de dimensiunea sa) este dat de ecuaia:

N = ln(1-p)/ln(1-x/y)
unde N = numrul de clone ce trebuie analizate pentru a obine secvena dorit cu o probabilitate de 95% sau 99% p = probabilitatea de obinere a genei de interes (de obicei se alege 99%) x = dimensiunea n kb a secvenei integrate y = dimensiunea n kb a genomului haploid al organismului analizat ln = logaritm natural Pentru analiza genomului celulelor eucariote se prefer folosirea unor enzime de restricie ce recunosc secvene mai lungi de nucleotide, astfel nct fragmentele rezultate s aib dimensiuni mai mari. Ulterior, clonarea acestora se face n vectori speciali, ce permit inserarea unor secvene de dimensiuni mai mari, dup care, selecia genei de interes se poate realiza prin diferite metode. O astfel de tehnic a fost folosit de Maxam i colab.(1977) pentru izolarea genei ce codific sinteza ARNr 5S de la drojdii. Tehnologia ADN recombinant presupune combinarea unor fragmente de ADN de origini diferite astfel nct s se obin o molecul nou, ce codific funcii specifice. Aa cum s-a precizat deja, fragmentele de ADN sunt obinute, de obicei, cu ajutorul enzimelor de restricie care genereaz extremiti monocatenare complementare. Deseori se pot folosi fragmente de ADN obinute prin utilizarea a dou tipuri de enzime de restricie, cu condiia ca cele dou enzime s fie compatibile, adic s formeze acelai tip de extremiti monocatenare. De exemplu, n aceast categorie intr enzimele Bam HI, Bgl II, Sau 3A i Bcl I care formeaz extremiti monocatenare de tip GATC.
51

TEHNOLOGIA ADN RECOMBINANT

Exist i enzime de restricie (Hpa I, Eco RV, Sma I) care, prin aciunea asupra ADN int, formeaz extremiti drepte (extremiti oarbe = blunt ends). Avantajul unor asemenea extremiti este c indiferent de enzima folosit, extremitile formate sunt compatibile putnd fi utilizate pentru legare i formarea moleculelor de ADN recombinant. Eficiena legrii fragmentelor cu extremiti drepte este ns cu mult mai mic dect cea nregistrat prin folosirea fragmentelor cu extremiti monocatenare complementare. Totui, n anumite experimente este necesar legarea unor fragmente cu extremiti necompatibile, situaie n care acestea sunt convertite la extremiti drepte. Aceasta se realizeaz fie prin ndeprtarea extremitilor monocatenare n urma tratamentului cu nucleaza S1, fie prin sinteza unei catene complementare utilizndu-se ADN-polimeraza I (fragmentul Klenow). 2.1.2.2. Obinerea ADN de interes prin utilizarea ADN polimerazelor ADN polimerazele sunt enzimele necesare pentru sinteza ADN n timpul replicrii cromosomale sau a procesului reparator. ADN polimerazele catalizeaz formarea de legturi fosfodiesterice ntre nucleotidele de la captul 3OH al catenelor de ADN i grupul fosfat de la nivelul dNTP libere, cu liberarea unei molecule de pirofosfat:

ADN polimeraza (dNMP) n + dNTP (dNMP)n+1 + PPi cationi bivaleni (Mg2+)


Caracteristic acestor enzime este faptul c, pentru a aciona, ele au nevoie de o secven de tip primer care s prezinte captul 3OH liber, alungirea catenei de ADN realizndu-se n direcia 5 3 prin utilizarea unei alte catene de ADN drept matri. In absena primerului, sinteza de ADN nu este posibil. Unele ADN polimeraze (cum este ADN polimeraza I produs de E.coli) manifest nu numai activitate polimerazic ci i exonucleazic n sensul 5 3 i/sau 3 5 (eliminarea pe rnd a nucleotidelor fie de la captul 3 fie 5). Activitatea exonucleazic n sensul 3 5 este asociat in vivo cu rolul reparator al polimerazei respective: recunoaterea i apoi eliminarea nucleotidei incorect adugat (necomplementar). Deseori ns, datorit activitii exonucleazice 5' 3' a ADN polimerazei I, apar probleme ce in de degradarea captului 5' al primerilor i eliminarea gruprilor 5' fosfat de la capetele fragmentelor de ADN utilizate c
52

TEHNOLOGIA ADN RECOMBINANT

substrat pentru ligare. De aceea, activitatea exonucleazic 5' 3' poate fi eliminat prin tratament proteolitic, obinndu-se un fragment de dimensiuni mari, numit fragment Klenow, capabil de activitate ADN polimerazic i exonucleazic 3' 5'. 2.1.2.2.1. ADN polimeraze termostabile i tehnologia PCR Elaborarea i apoi perfecionarea tehnologiei PCR (Polymerase Chain Reaction) a determinat gsirea unor noi ADN polimeraze cu aciune mai eficient i, eventual termorezistente. Tehnica PCR utilizeaz unele trsturi fundamentale ale replicrii ADN: ADNpolimeraza folosete ca matri ADN monocatenar pentru a determina sinteza unei catene noi, complementar. Metoda permite amplificarea "in vitro" a unei secvene de ADN, de aproximativ 10kb, de pn la 106 ori; ea poate fi aplicat i pentru amplificarea ARN dar, pentru aceasta, mai nti, se sintetizeaz o molecul de ADNc i apoi aceasta este multiplicat. Pentru a realiza amplificarea unei anumite secvene de ADN este necesar s fie cunoscute dou mici secvene de ADN, care flancheaz regiunea dorit. Aceste secvene sunt apoi utilizate ca baz pentru sinteza chimic a doi primeri oligonucleotidici de aproximativ 20 baze, care sunt complementari cu regiunile corespunztoare de pe ambele catene ale genei de interes (fig.24). Matria de ADN monocatenar este obinut prin nclzirea unei soluii de ADN dublu catenar la o temperatur apropiat celei de fierbere i apoi rcire brusc, astfel nct cele dou catene complementare rmn desprite (denaturate). La acest ADN denaturat se adaug un primer specific, necesar pentru iniierea reaciei de polimerizare catalizat de ADNpolimeraz, precum i nucleotide. n tehnica de multiplicare "in vitro", ambele catene ale unui fragment de ADN pot servi ca matri pentru sinteza catenelor complementare, cu condiia adugrii unor primeri oligonucleotidici pentru fiecare dintre cele dou catene. Dup un ciclu de replicare, amestecul este nclzit pentru a se desface catenele nou sintetizate de cele vechi i ciclul este reluat (Benedetto, 1993). n acest fel, numrul de molecule de ADN nou sintetizate crete n progresie geometric dup fiecare ciclu de replicare, estimndu-se c, spre exemplu, dup 32 cicluri de replicare se pot obine 1.073.741.824 molecule de ADN dublu catenar, pornind de la o unic molecul iniial.
53

TEHNOLOGIA ADN RECOMBINANT

O etap critic a acestei tehnici este alegerea primerilor specifici, dar utilizarea lor nu mai face necesar izolarea prin alte metode a secvenei dorite de ADN dintr-o populaie heterogen de molecule de ADN. Cantitatea de ADN necesar ca material de start a reaciei este foarte mic, sub 1 g de ADN genomic total, dar se poate amplifica o secven de ADN pornind chiar de la o singur molecul.
5.CTGACACAACTGTGTTCACTAGCAA.AAGGTGAACGTGGATGAAGTTGGTG3 3.GACTGTGTTGACACAAGTGATCCTT..TTCCACTTGCACCTACTTCAACCAC.5

nclzire (denaturare)
5.CTGACACAACTGTGTTCACTAGCAA.AAGGTGAACGTGGATGAAGTTGGTG3

3.GACTGTGTTGACACAAGTGATCCTTTTCCACTTGCACCTACTTCAACCAC.5

adugarea unor secvene complementare (primeri)


5.CTGACACAACTGTGTTCACTAGCAA.AAGGTGAACGTGGATGAAGTTGGTG3 3 CCACTTGCACCTACTTCAACC 5 5ACACAACTGTGTTCACTAGG 3 3.GACTGTGTTGACACAAGTGATCCTTTTCCACTTGCACCTACTTCAACCAC.5

nceperea sintezei de ADN pornind de la captul 3 al primerilor


5.CTGACACAACTGTGTTCACTAGCAA.AAGGTGAACGTGGATGAAGTTGGTG3 3 TTCCACTTGCACCTACTTCAACC 5

5ACACAACTGTGTTCACTAGCAA

3.GACTGTGTTGACACAAGTGATCCTTTTCCACTTGCACCTACTTCAACCAC.5

Fig.24. Reprezentarea schematic a primerilor utilizai pentru amplificarea genei pentru -globin (dup Watson i colab., 1992). Secvenele de 20 nucleotide marcate sunt folosite ca primeri pentru ca ADN-polimeraza s-i poat exercita funcia de sintez.

Prima etap a procesului de amplificare presupune nclzirea soluiei de ADN la 94oC, timp de 5 minute, pentru a rupe legturile de hidrogen, n aa fel nct ambele catene complementare separate s poat servi ca matri pentru ADN-polimeraz. La acest ADN se adaug primerii oligonucleotidici ce vor fi folosii drept amors pentru ADN-polimeraz, ca i amestecul celor patru dezoxiribonucleotide. Temperatura este apoi sczut la 30-65 oC pentru a asigura prinderea primerilor la secvenele complementare din catena de ADN
54

TEHNOLOGIA ADN RECOMBINANT

corespunztoare. Continuarea experimentului depinde de valoarea temperaturii la care se desfoar acest eveniment (fig.25). Urmtoarea etap const n creterea temperaturii la 72oC; aceast temperatur se menine timp de 2-5 minute, pentru a se realiza procesul de polimerizare a ADN. Din nou, temperatura este crescut la 94oC pentru 20 secunde, pentru ca noile catene sintetizate s se desfac de cele vechi, dup care procesul se reia pentru 30-60 cicluri de sintez.

Fig.25. Schema realizrii reaciei de polimerizare n lan (PCR)(dup Cornea i colab., 1998) 1 separarea catenelor originare i adugarea primerilor (P1 i P2); 2 sinteza catenelor complementare pornind de la primerii P1 i P2; 3 separarea celor dou catene i adugarea unor noi cantiti de primeri; 4 nou rund de sintez a ADN; 5 separarea catenelor i adugarea de noi primeri; 6 nou rund de sintez, ciclurile putndu-se repeta. Sgeata indic sensul sintezei ADN.

n fazele de nceput ale elaborrii tehnicii PCR era necesar s se adauge, dup fiecare ciclu de sintez, cantiti noi de ADN polimeraz, deoarece polimeraza de E.coli, fiind termosensibil, era denaturat n momentul creterii temperaturii. Cercetrile realizate pentru optimizarea procesului de polimerizare, n sensul gsirii i utilizrii unor ADN polimeraze capabile s reziste la variaiile mari de temperatur pe care le presupune tehnica menionat au condus la izolarea i caracterizarea Taq polimerazei. Aceasta este o ADN polimeraz termostabil, ce acioneaz eficient la temperaturi de 75-80oC. Enzima a fost izolat de la o bacterie termofil (Thermus aquaticus). Ca orice ADN polimeraz, ea nu poate iniia "de novo" sinteza de ADN, ci necesit pentru aciune prezena unei secvene de nucleotide care s funcioneze ca primer. O aciune similar are i enzima
55

TEHNOLOGIA ADN RECOMBINANT

Pfu polimeraza izolat de la o alt bacterie termofil, Pyrococcus furiosus, ea manifestnd n plus i o activitate exonucleazic 3 5, ceea ce i mrete fidelitatea. Utilizarea unei asemenea enzime pentru sinteza ADN asigur o fidelitate de 12 ori mai mare dect cea obinut prin folosirea Taq polimerazei. Studierea bacteriilor din genul Thermus a permis izolarea de la specia T.thermophilus a cinci ADN polimeraze termostabile, dintre care dou sau dovedit eficiente n tehnologia PCR. De asemenea, n ultimii ani au fost obinute ADN polimeraze nalt termostabile prin modificarea controlat a genelor ce codific asemenea enzime la bacterii termofile cum sunt Thermus thermophilus, Thermotoga maritima sau Thermococcus litoralis (Newton i Graham, 1997). Spre exemplu, ADN polimeraza recombinat notat Tth, obinut prin clonarea n E.coli a unei gene modificate ce codific una dintre ADN polimerazele de la T.thermophilus, s-a dovedit extrem de eficient n sinteza ADN n anumite condiii: adugarea ionilor de magneziu i chelarea cationilor de mangan. Dac ns ionii de mangan sunt prezeni, la temperaturi de aproximativ 70oC, enzima recombinat Tth manifest activitate de reverstranscriere, ceea ce permite utilizarea acestei enzime n experimentele de amplificare a ADN pornind de la molecule matri de ARN (molecule bogate n secvene G-C sau care prezint structuri secundare). Utilizarea Tth polimerazei pentru ARN-PCR prezint unele avantaje fa de procedeul convenional n care sunt folosite dou enzime distincte (mai nti se folosete o reverstranscripaz, care asigur sinteza unor molecule de ADNc, iar apoi se utilizeaz o polimeraz termostabil pentru amplificarea fragmentului dorit). Avantajele constau n faptul c se utilizeaz o singur enzim ce manifest, n funcie de condiiile de reacie, fie activitate reverstranscriptazic fie de ADN polimeraz. n privina surselor de ADN ce pot fi multiplicate prin PCR exist mai multe posibiliti de obinere a acestora. In primul rnd, poate fi utilizat ADNc obinut prin reverstranscrierea ARNm i introdus ntr-un vector de clonare, metoda numindu-se n acest caz revers-PCR (RT-PCR). Condiia ca reacia de polimerizare s se desfoare este existena primerilor oligonucleotidici complementari pentru anumite secvene din vector (de obicei, secvenele ce flancheaz situsurile de clonare). n aceast situaie se pot studia mai multe tipuri de fragmente de ADN clonate ntr-un anumit vector, la nivelul situsului corespunztor (cu secvena cunoscut). Metoda poate fi aplicat i pentru identificarea secvenelor de ADN ai cror primeri nu sunt stabilii: selecia fragmentelor obinute prin clonare i apoi
56

TEHNOLOGIA ADN RECOMBINANT

amplificare se face cu ajutorul unor metode variate (de exemplu, Southern blotting). Ulterior, acest ADN poate servi pentru subclonare n diverse gazde sau se poate realiza secvenierea sa. Pornind de la aceast aplicaie iniial, metoda PCR a cptat o larg utilizare n diverse domenii ale biologiei moleculare. Astfel, prin intermediul ei se poate stabili existena unor boli ereditare la nou-nscui, de exemplu a fenilcetonuriei. Tot cu ajutorul tehnicii PCR se pot amplifica secvene specifice din genom, cum este cazul secvenelor Alu din genomul uman (regiuni ce conin aproximativ 106 copii ale unei secvene de 300 pb, dispersate n ntreg genomul uman). De asemenea, se poate determina eficiena tratamentului unor tipuri de cancer cu citostatice sau radiaii, testul PCR permind s se stabileasc dac celulele maligne au fost sau nu distruse. O alt utilizare este legat de determinarea sexului ftului nainte de natere, prin utilizarea unor celule fetale. n acest caz se folosesc primeri pentru anumite secvene de ADN, coninute doar de cromosomul Y. Asemenea analize s-au fcut, n special la familii cu risc mare de a avea urmai cu boli genetice X linkate. Tehnica PCR este utilizat i pentru studii moleculare asupra nrudirii filogenetice a unor specii. Prin acuratee i sensibilitate, metoda a putut fi folosit chiar i pentru multiplicarea unor probe de ADN aparinnd unor organisme care au disprut, pornind de la resturi fosilizate ale acestora (tabelul 4). Tabelul 4. Aplicarea tehnicii PCR pentru analiza unor probe de ADN strvechi (dup Newton i Graham, 1997)
Originea probei de ADN Lupul marsupial Oase umane Creier uman Mamut siberian Frunze fosile de magnolie Viespi fosilizate n chihlimbar Termite fosilizate n chihlimbar Gena amplificat ADNmt (cyt b) ADNmt (ARNr 12S) ADNmt (NADH dehidrogenaza) ADNmt (cyt b2) ADNmt (cyt b) Gene cloroplastice (rbc L) ARNr 18S ADNmt (ARNr 16S) ADN nuclear (ARNr 18S) Mrimea ampliconului (pb) 116 94 205 471 375 820 555, 195 sau 597 150 225 Vrsta probei (ani) ~100 300-5500 7000 47.000 17-20.000.000 30.000.000 30.000.000

In ultimii ani, tehnica PCR a servit ca punct de start pentru dezvoltarea unor tehnici speciale de caracterizare a fragmentelor de ADN: tehnica RAPD (randomic amplified polymorphic DNA=amplificare randomizat a ADN polimorfic), AFLP (amplified
57

TEHNOLOGIA ADN RECOMBINANT

fragment lenght polymorphisms = polimorfismul lungimii fragmentelor amplificate), stabilirea microsateliilor (secvene de TG sau CA repetate de 10-60 ori) sau VNTR (variable number tandem repeats = numrul variabil al repetiiilor n tandem). Dintre aceste metode, cea mai mare utilizare o au tehnicile RAPD i AFLP. Tehnica RAPD presupune utilizarea unor secvene scurte de nucleotide (de aproximativ 10 nucleotide) drept primeri arbitrari pentru amplificarea unor fragmente de ADN fa de care manifest complementaritate, chiar dac nu perfect. Metoda este utilizat frecvent n experimentele de amprentare genetic deoarece este rapid, necesit cantiti sczute de material i este simpl din punct de vedere tehnic. Cu toate acestea, deoarece complementaritatea primerilor nu este ntotdeauna perfect cu fragmentele amplificate, metoda nu este aplicat n situaiile n care este necesar o acuratee ridicat, aa cum este cazul testelor de paternitate sau analizele de pedigree. In schimb, metoda este utilizat pentru caracterizarea tulpinilor bacteriene aparinnd aceluiai serotip sau pentru studiile de ameliorare a plantelor (la cpun, gru, ovz, orz, soia, tomate, cartof sau porumb), prin folosirea unor seturi de primeri arbitrari. Astfel, acelai primer folosit pentru amplificarea unor fragmente de ADN provenite de la linii nrudite de plante poate determina apariia unui profil electroforetic diferit, ceea ce poate ilustra, de exemplu, existena unor mutaii la unele linii consangvine (fig.26).
M 1 2 3 4 5 6 7 8 9

Fig.26. Profilul electroforetic al fragmentelor de ADN de la diferite soiri de vi-de vie, amplificate prin utilizarea primerului GTGATCGCAG (tehnica RAPD)(dup Mutulescu, 2002) M.-ADNmarker (1 Kb); 1.- Profilul soiului Feteasca neagra; 2.- Profilul soiului Feteasca alba;3.Profilul soiului Feteasca regala; 4.- Profilul soiului Grasa de Cotnari; 5.- Profilul soiului Furmint; 6.Profilul soiului Coarna alba; 7.- Profilul soiului Coarna neagra; 8.- Profilul soiului Petit Sauvignon; 9.Profilul soiului Gros Sauvignon;

Tehnica AFLP se bazeaz pe amplificarea selectiv a unor fragmente de restricie provenite prin clivarea ADN genomic cu o anumit enzim de restricie. Astfel, dup clivarea ADN de analizat cu una sau dou endonucleaze, la fragmentele rezultate, se adaug adaptori
58

TEHNOLOGIA ADN RECOMBINANT

specifici, complementari cu extremitile monocatenare generate de enzime. Se refac, n acest fel, la extremitile fragmentelor, situsurile de recunoatere pentru enzimele folosite (fig.27). Amplificarea se realizeaz prin utilizarea a 1-2 categorii de primeri a cror secven de nucleotide corespunde situsurilor de recunoatere pentru enzimele de restricie folosite (fig 27). Ca urmare, doar primerii complementari cu extremitatea 3 a fragmentului de restricie vor realiza amplificarea, rezultnd o populaie de fragmente amplificate. Din aceast populaie de fragmente amplificate, prin utilizarea unor primeri cu o mai mare specificitate (conin att nucleotidele corespunztoare situsului de restricie ct i un numr de alte nucleotide, alese de experimentator) sunt apoi selectate o serie de fragmente care pot avea valoare de markeri moleculari. De remarcat c, n acest caz, primerii utilizai pot fi marcai radioactiv la extremitatea 5, prin folosirea unei polinucleotid kinaze i a [-33P] ATP, iar dup separarea electroforetic n gel de poliacrilamid 6% (care permite evidenierea i a fragmentelor foarte mici), fragmentele amplificate sunt identificate prin autoradiografie.

Fig.27. Comparare a profilului electroforetic al fragmentelor de ADN genomic de la dou tipuri de albine, africane i europene, obinute prin aplicarea tehnicii AFLP (dup Suazo i Hall, 1999)

2.1.2.2.2. ADN-polimeraze dependente de ARN Tipurile de ADN polimeraze menionate mai sus utilizeaz drept matri o alt molecul de ADN (sunt dependente de ADN). Spre deosebire de acestea, reverstranscriptazele realizeaz sinteza de ADN pornind de la o matri ARN (sunt ADN polimeraze dependente de ARN), obinndu-se molecule de ADNc (complementar). Reacia de polimerizare depinde de existena celor patru deoxiribonucleotide trifosforilate n
59

TEHNOLOGIA ADN RECOMBINANT

concentraie mare pentru a obine un ADN complementar cu lungime mare. Omiterea unui dNTP din amestecul de reacie duce la oprirea polimerizrii. Obinerea i clonarea direct a ADN genomic mai ales la eucariote este tehnic mai dificil i, n consecin, s-a recurs la o tehnic indirect de sintez a genei sub forma de ADN complementar, origine viral. In acest scop, ARNm este izolat din celulele esutului n care gena dorit se exprim la maximum. n anumite condiii fiziologice favorabile, un anumit tip de ARNm poate reprezenta ntre 0,1 i 10% din cantitatea de ARNm celular total. n alte cazuri el este prezent n cantiti foarte mici. Izolarea ARNm i identificarea tipului dorit presupune anumite dificulti. n general, alegerea unui anumit tip de ARNm se poate face prin determinarea capacitii de a controla sinteza unei proteine specifice n sisteme acelulare sau prin hibridare cu oligonucleotide sintetice. Deoarece la eucariote ARNm matur prezint la captul 3' OH o extremitate lung de pn la 150 nucleotide = capt poliadenilat, pentru a se iniia sinteza ADN complementar se folosete o secven sintetic oligo dT, lung de aproximativ 10 nucleotide (resturi de timin), care va fi cuplat cu extremitatea poliadenilat. Aceast secven constituie de fapt primerul de la care va ncepe polimerizarea nucleotidelor de ctre reverstranscriptaz (fig.28). pornind de la ARNm corespunztor. Tehnica a fost denumit reverstranscriere i se bazeaz pe utilizarea unei enzime specifice, reverstranscriptaz, de

Fig.28. Reprezentarea schematic a etapelor procesului de sintez a ADNc prin procesul de reverstranscriere

60

TEHNOLOGIA ADN RECOMBINANT

Toate variantele de clonare a ADN complementar dublu catenar pornesc de la sinteza unei copii ADN pe matria de ARNm cu ajutorul reverstrancriptazei. Aceast copie monocatenar de ADN este convertit la forma dublu catenar cu ajutorul unei ADNpolimeraze "normale", dup ce mai nti se ndeprteaz ARNm matri prin tratament cu RN-aza H (enzim ce degradeaz n mod specific ARN din duplexul ARN-ADN). ADN complementar monocatenar obinut prin reverstranscriere are la captul 3' o bucl n "ac de pr", format prin interaciunea intramolecular a bazelor componente. Pornind de la acest capt, se iniiaz sinteza catenei complementare (bucla funcionnd ca "primer"), cu ajutorul unei ADN polimeraze. Dup ncheierea sintezei catenei complementare (legat covalent de catena matri) se elimin bucla monocatenar prin folosirea unei nucleaze (nucleaza S1). Deseori nu este posibil s se separe un anumit tip de ARNm, n aceste situaii fiind preferat varianta obinerii bibliotecilor de ADN complementar; pornind de la ARNm total, izolat din anumite tipuri de celule. Obinerea bibliotecii complete sau pariale de molecule de ADNc de la un anumit organism se face prin convertirea ntregii populaii de ARNm, sau doar a unei poriuni din ea, n ADN complementar (ADNc). Moleculele de ADNc prezint importan pentru clonarea genelor dar, n acelai timp, reprezint i o surs pentru obinerea unor probe n vederea hibridizrii, folosite ulterior pentru purificarea de ARNm specific. Pentru a alege celulele n care gena de interes s-a integrat, este necesar s se analizeze un numr foarte mare de clone recombinate. Teoretic, numrul de colonii ce trebuie analizate poate fi calculat pe baza urmtoarei ecuaii:

N = ln(1-p)/(1-n)
unde N = numrul de clone de trebuie analizate p = probabilitatea de izolare a clonei dorite (de obicei 0,95 sau 0,99) n = proporia reprezentat de ARNm corespunztor genei de interes din totalul populaiei de ARNm ln = logaritm natural.
61

TEHNOLOGIA ADN RECOMBINANT

Spre exemplu, pentru a identifica o clon ce conine ADNc de interes, tiind c n = 1000 (deci ARNm de la care s-a pornit pentru sinteza genei este relativ rar n celulele utilizate pentru purificare), este necesar s se analizeze 5000 de clone recombinate. n cazul celulelor mamaliene ce pot conine aproximativ 20.000 tipuri diferite de ARNm, pentru a identifica o anumit secven ADNc trebuie analizate 106 clone. n prezent exist dou forme comerciale ale enzimei reverstranscriptaz: una ce provine de la virusul mieloblastozei aviare (din culturi celulare infectate cu acest virus), iar alta a fost izolat din celule de E.coli (tulpini modificate genetic), ce conin clonat gena corespunztoare de la virusul leucemiei murine. Enzima avian este alctuit din dou catene polipeptidice care prezint att activitate polimerazic, ct i o puternic activitate de RN-az H. Enzima murin este alctuit dintr-o singur caten polipeptidic cu puternic activitate polimerazic i o mai slab activitate de RN-az H. Aceast slab activitate RN-azic este considerat ca avantaj atunci cnd se dorete sinteza de ADNc, pornind de la molecule lungi de ARNm. Procesul ncepe prin adugarea la amestecul de reacie a unor oligonucleotide dT care se leag, prin complementaritate la captul 3' al ARNm (la nivelul secvenei poliA). Se constituie astfel secvena primer necesar ADN polimerazei pentru a-i ncepe aciunea. Hibrizi ARN-ADN obinui sunt supui aciunii RN-azei (de tip RN-aza H) a reverstranscriptazei: aceasta ncepe s degradeze matria de ARN, elibernd catena de ADNc. Ulterior, prin folosirea unei ADN-polimeraze corespunztoare (ADN-polimeraza I) se sintetizeaz catena complementar a ADNc, obinndu-se o molecul de ADN dublu-catenar ce poate fi inserat ntr-un vector adecvat. 2.1.2.2.3. Terminal-transferaza Un tip special de ADN polimeraz este terminal transferaza (TT) care adaug mononucleotide la captul 3 OH liber al ADN monocatenar, ADN dublu catenar sau chiar al ARN, aciunea enzimatic nefiind dependent de existena unei matrie ADN. Terminal transferaza este folosit n practic pentru adugarea de extremiti homopolimere, de obicei la nivelul unor fragmente de ADN sau, n anumite situaii, pentru adugarea unei singure nucleotide modificate de tipul dideoxinucleotidelor (in cazul experimentelor de secveniere). Activitatea enzimatic este condiionat de prezena n amestecul de reacie a ionilor de Co2+

62

TEHNOLOGIA ADN RECOMBINANT

(preferai n cazul n care se dorete adugarea purinelor) sau Mg2+ (preferai pentru adugarea pirimidinelor)(Cornea i colab., 1998).

2.1.2.3. Obinerea ADN de interes prin sintez chimic Sinteza moleculelor mari de ADN pe cale pur chimic prezint serie de dificulti care apar, n principal, la asamblarea nucleotidelor pentru obinerea catenelor polinucleotidice lungi. Aceste dificulti au determinat ca sinteza total a unei gene s nu fie realizat numai prin metodele chimiei organice. n aceste cazuri se combin metodele chimice care permit doar sinteza unor oligonucleotide cu o secven dorit, cu metodele biochimice ce asigur legarea oligonucleotidelor ntre ele. Strategia adoptat pentru sinteza chimic a unor gene a implicat realizarea a dou etape fundamentale, i anume: sinteza chimic a unor segmente oligodeoxinucleotidice cu lungimea medie de 8-12 uniti; legarea cap-coad a segmentelor respective, ntr-o ordine identic celei din gena natural, cu ajutorul ADN-ligazei; Prima sintez chimic a unei gene, cea care codific sinteza ARNt pentru alanin, efectuat de Khorana i colab. (1970), a fost considerat, pe drept cuvnt, ca marcnd debutul ingineriei genelor ca domeniu de activitate. Sinteza s-a fcut sub forma unor mici fragmente oligonucleotidice, pornind de la fosfodiesteri. Condensarea succesiv a blocurilor oligonucleotidice a determinat formarea unor secvene mai mari de oligonucleotide. n timpul reaciilor de condensare are loc blocarea selectiv a gruprilor funcionale ale nucleotidelor cu grupri chimice protectoare i pstrarea liber numai a acelor grupri care intr n reacie n momentul dorit. Randamentul de obinere a fragmentelor de ADN scade pe msur ce lungimea catenei crete, astfel c produii finali se obin n cantiti mici. Fiecare etap de condensare este controlat i nsoit de purificarea produsului obinut. Segmentele obinute n acest mod sunt monocatenare, fiind apoi fosforilate la captul 5' cu ajutorul kinazei de fag T4 dup care se face legarea ordonat a segmentelor obinute cu ajutorul ligazei.
63

TEHNOLOGIA ADN RECOMBINANT

Itakura i colab. (1970) au realizat o alt metod, mai rapid, pentru sinteza de ADN. Aceasta presupune parcurgerea mai multor etape: sinteza unor trimeri cu secvena bazelor prestabilit; cuplarea trimerilor ntre ei pentru obinerea de oligonucleotide cu secvena bazelor dorit; legarea oligonucleotidelor ntre ele cu ajutorul ADN-ligazei, pentru a obine genele de interes. n prezent exist adevrate "maini de fabricat gene" care, asistate de un microprocesor, sunt capabile s sintetizeze ADN monocatenar pe baza unei secvene date (introdus n computer), lung de aproximativ 40 nucleotide, asigurnd legarea unei nucleotide la fiecare 30 minute. Sinteza chimic a ADN are o serie de avantaje: permite producerea de gene funcionale, chiar dac nu se cunoate secvena bazelor din ADN natural. Sinteza se realizeaz pe baza secvenei de aminoacizi din proteina dorit, care este mai uor de determinat. Deoarece prezena intronilor blocheaz exprimarea unei gene de tip eucariot n E.coli, sinteza chimic, ca de altfel i ADNc sintetizat pe baza ARNm matur, furnizeaz o versiune scurtat a genei respective (ce conine doar secvene exonice), funcional n E.coli; deoarece bacteriile i celulele animale tind s utilizeze anumii codoni n mod preferenial pentru un anumit aminoacid, n sinteza chimic pot fi utilizai codonii cei mai potrivii pentru gazda n care se dorete exprimarea genei; n cursul sintezei chimice pot fi introduse substituiri de aminoacizi care modific avantajos proprietile biologice ale proteinelor codificate de gena sintetic. In prezent, prin sintez chimic s-au obinut unele gene de dimensiuni mai mici (de exemplu, secvenele codificatoare ale insulinei umane) i, de asemenea, se obin primerii necesari proceselor de sintez enzimatic a genelor (prin reverstranscriere, prin tehnologia PCR sau prin folosirea altei ADN polimeraze). 2.1.2.4. Alte enzime utilizate n tehnologia ADN recombinant Pentru obinerea moleculelor de ADN recombinant este necesar utilizarea unor enzime ce catalizeaz formarea legturilor fosfodiesterice dintre extremitile 3' OH i 5' P ale fragmentelor de ADN participante la realizarea respectivelor molecule hibride. Aceste enzime au fost denumite ADN-ligaze.
64

TEHNOLOGIA ADN RECOMBINANT

Studiul ligazelor a nceput n urma observaiilor experimentale efectuate asupra proceselor de recombinare, procese n care au loc ruperi i apoi reuniri ale moleculelor de ADN, ca i prin constatarea faptului c, n procesul de infectare a E.coli cu bacteriofagul , ADN fagic ptruns n celula bacterian trece din forma linear ntr-o form circular. Aceste fapte au sugerat existena n celulele bacteriene a unor mecanisme de legare enzimatic a moleculelor lineare de ADN. In anul 1967 a avut loc descoperirea enzimelor implicate n procesele amintite mai sus att n celulele de E.coli infectate cu bacteriofagul T4 ct i n cele neinfectate. Identificarea acestor enzime a coincis cu ipoteza enunat de Okazaki privind mecanismul de replicare segmentar a ADN, prin fragmente scurte care sunt unite ulterior ntr-o caten continu. Prin aceasta s-a definit i rolul major al ADN-ligazelor ca parte integrant a mecanismelor de replicare a ADN. Dup descoperirea ligazelor din E.coli neinfectate cu bacteriofagi, activiti similare acestei ligaze au fost observate i ntr-o mare varietate de esuturi provenite de la organisme eucariote (n splina i mduva osoas de iepure, n microsporocitele de crin c i n celulele infectate cu virusul sarcomului Rous, n mieloame murine etc.). Aceste date demonstreaz existena ADN ligazelor la toate organismele vii, ele fiind eseniale pentru replicarea materialului genetic i pentru meninerea integritii sale. Pentru a se putea realiza legarea fragmentelor de ADN, este necesar c n amestecul de reacie s existe o serie de elemente: cofactorii specifici ai ligazei (NAD pentru ligaza de E.coli i ATP pentru ligaza de fag T4) ioni de magneziu, n concentraie optim de 10mM ditiotreitol; n absena sa activitatea enzimei se reduce la 25% (fig.28). nlocuirea ditiotreitolului cu -mercaptoetanol duce, de asemenea, la scderea cu 60% a activitii enzimei. In experimentele de inginerie genetic este preferat ADN-ligaza de fag T4, datorit proprietilor sale. Pentru obinerea sa se pornete de la o cultur bacterian de E.coli B, infectat cu bacteriofagul T4, din care apoi se separ enzima activ. Pentru mbuntirea randamentului de obinere a enzimei a fost creat n mod artificial un bacteriofag n care a fost inclus gena 34 provenit de la fagul T4 (gena rspunztoare de sinteza ligazei). Cu acest bacteriofag a fost lizogenizat o tulpin de E.coli. Pentru obinerea ligazei se face inducia fagului cu ajutorul temperaturii (42oC) i apoi se procedeaz la purificarea enzimei. Cu ajutorul acestei metode cantitatea de enzim obinut pornind de la
65

TEHNOLOGIA ADN RECOMBINANT

acelai volum de cultur bacterian este de 500 ori mai mare. Ligaza de fag T4 este capabil de a lega att fragmentele de ADN cu extremiti coezive ct i fragmente cu extremiti drepte (fig.29). Testarea activitii enzimatice n procesul de purificare se realizeaz prin mai multe procedee dintre care, cel mai rapid presupune reconvertirea ADN plasmidial linearizat la forma circular. Cele dou forme, circular i linear migreaz diferit n gel de agaroz i, n consecin, se poate recunoate i activitatea ligazei. a) legarea fragmentelor de ADN cu extremiti coezive 5 pApCpG-OH pGpApTpCpCpGpT 3 3 TpGpCpCpTpApGp OH-GpCpAp 5 ATP Mg2+ 5 pApCpGpGpApTpCpCpGpT 3 3 TpGpCpCpTpApGpGpCpAp 5 b) legarea fragmentelor de ADN cu capete drepte 5 pApCpGpG-OH pApTpCpCpGpT 3 3 TpGpCpCp OH-TpApGpGpCpAp 5 ATP Mg2+

5 pApCpGpGpApTpCpCpGpT 3 3 TpGpCpCpTpApGpGpCpAp 5
Fig.29. Modalitile de aciune ale ADN ligazei de fag T4

Fosfataza alcalin este o enzim care catalizeaz ndeprtarea gruprii fosfat de la captul 5' al ADN sau ARN, ceea ce determin defosforilarea fragmentelor respective. Enzima poate fi de origine bacterian sau poate fi izolat din intestin de viel. Fosfataza alcalin bacterian este mai activ dect cea eucariot; este termostabil i rezist la aciunea unor detergeni. Pentru blocarea reaciei de defosforilare, aciunea enzimei este inhibat prin diferite metode: tratament cu proteinaz K, folosirea EDTA sau nclzirea la 75oC. Cel mai adesea, fosfataza alcalin este utilizat pentru ndeprtarea gruprii fosfat de la captul 5' al ADN, n scopul prevenirii autocircularizrii plasmidelor sau autolegarea
66

TEHNOLOGIA ADN RECOMBINANT

fragmentelor obinute prin aciunea unor enzime de restricie care genereaz capete coezive (fig.30). Atunci cnd plasmidele linearizate defosforilate sunt utilizate pentru clonare (pentru introducerea la nivelul lor a unor fragmente de ADN i apoi tratare cu ligaza) ele sunt supuse unor tratamente specifice care inhib aciunea fosfatazei alcaline.

Fig.30. Reprezentarea schematic a utilizrii fosfatazei alcaline n experimentele de clonare molecular

Polinucleotid-kinaza de fag T4 este utilizat pentru transferul unui grup fosfat de la ATP la captul 5' al ADN sau ARN, ea avnd o aciune invers fosfatazei alcaline. Datorit acestei aciuni, enzima poate fi utilizat pentru marcarea radioactiv a capetelor 5' ale ADN n experimentele de secveniere prin metoda Maxam i Gilbert sau pentru analiz cu nucleaza S1
67

TEHNOLOGIA ADN RECOMBINANT

i pentru fosforilarea linkerilor sintetici sau a altor fragmente de ADN la care lipsesc gruprile 5' fosfat necesare pentru legare. Nucleaza S1 este o enzim izolat din Aspergillus oryzae, care determin degradarea ADN sau ARN monocatenar genernd mono- sau oligonucleotide 5 fosfat. De regul, ADN sau ARN dublu-catenar precum i hibrizii ADN-ARN prezint rezisten la aciunea acestei enzime. Cu toate acestea, acizii nucleici dublu-catenari sunt digerai complet n prezena unor cantiti mari de nucleaz S1. Utilizarea n experimente a unor cantiti moderate de enzim determin clivarea acizilor nucleici dublu-catenari doar la nivelul unor crestturi, genernd fragmente de dimensiuni mari. Aceast enzim poate fi utilizat pentru: analizarea structurii hibrizilor ADNARN; pentru ndeprtarea cozilor monocatenare de la nivelul fragmentelor de ADN determinnd formarea de extremiti drepte; pentru crestarea buclei de tip ac de pr format n cursul procesului de reverstranscriere. 2.1.3. Vectori de clonare Un vector de clonare reprezint o molecul de ADN n care este integrat fragmentul de ADN de interes obinndu-se molecule recombinate. Acestea sunt apoi introduse ntr-o gazd specific pentru exprimarea informaiei genetice noi. Pentru a putea fi utilizat n experimentele de clonare, un vector trebuie s ndeplineasc mai multe condiii: s prezinte markeri genetici selectabili (cum ar, fi rezistena la antibiotice); s aib mai multe situsuri unice de clivare cu enzime de restricie, la nivelul unor regiuni neeseniale ale vectorului; s i se cunoasc secvena de nucleotide; s prezinte siguran n folosire (s aib o transmisibilitate redus n prezena unor plasmide conjugative, iar replicarea s fie sensibil la temperatura corpului mamiferelor); s aib o greutate molecular mic i s prezinte ct mai multe copii per celul (eventual s fie amplificabil prin tratament cu cloramfenicol); s fie uor de purificat, s permit obinerea unor cantiti mari, suficiente pentru experimentele de clonare.
68

TEHNOLOGIA ADN RECOMBINANT

Cercetrile efectuate pn n prezent asupra particularitilor vectorilor de clonare au determinat completarea caracteristicilor deja menionate cu altele noi pe care ar trebui s le ndeplineasc vectorii ideali: s prezinte dimensiuni din ce n ce mai reduse dar s permit clonarea unor fragmente mari de ADN heterolog; s conin un numr crescut de situsuri unice de restricie grupate la nivelul unei regiuni specifice numit situs multiplu de clonare ("multiple cloning site"); s conin secvene specifice de ADN ce permit selecia rapid a clonelor recombinate (selecie direct pe medii specifice sau selecie prin teste histochimice); s prezinte secvene care s asigure generarea de molecule monocatenare necesare tehnicilor de secveniere sau pentru construirea de sonde de ADN; s conin secvene specifice de tip promotori, terminatori, activatori (enhanceri) ce asigur transcrierea "in vitro" a ADN clonat. Cei mai cunoscui i mai utilizai vectori de clonare sunt cei derivai de la plasmidele bacteriene. Dei multe dintre plasmidele naturale ndeplinesc o parte dintre caracteristicile unui vector ideal, s-a preferat prelucrarea lor "in vitro", n sensul eliminrii sau adugrii anumitor secvene, care s permit obinerea unei eficiene mari n experimentele de clonare de gene. n acest fel, Boyer i colab. au "construit" n laborator o plasmid hibrid, pornind de la trei plasmide naturale: pSC101, pMB1 (derivat de la ColE1) i RSF2124. Aceast plasmid, denumit pBR322, a reprezentat, pentru mult timp, vectorul cel mai frecvent utilizat n clonarea de gene n E.coli. Perfecionarea tehnicilor de prelucrare in vitro a materialului genetic a permis nlocuirea acestui vector (i a derivailor si) cu vectori noi, care asigur exprimarea mai eficient a genelor clonate (de exemplu, vectorii de exprimare). Dintre particularitile plasmidei pBR322 menionm: are dimensiuni mici, coninnd 4362pb (2,9 MDa); prezint o replicare relaxat, avnd un numr mare de copii/celul (conine secvena ori de la plasmida ColE1); este amplificabil prin tratament cu cloramfenicol; este uor de purificat;
69

TEHNOLOGIA ADN RECOMBINANT

conine doi markeri genetici de selecie: gena de rezisten la tetraciclin (derivat de la plasmida pSC101) i gena de rezisten la ampicilin (derivat din plasmida RSF2124);

are mai multe situsuri unice de restricie pentru diferite enzime de restricie: EcoRI, Bam HI, Pst I, Hind III, Sal I etc; permite clonarea inserional deoarece conine situsuri unice de restricie n genele marker: Bam HI n gena de rezisten la tetraciclin i Pst I n gena de rezisten la ampicilin (fig.31).

Majoritatea vectorilor de clonare obinui pn n prezent sunt specifici pentru E.coli dar, pentru c n experimentele de clonare sunt utilizate gazde foarte variate, au fost construii vectori specifici pentru acestea, ei fiind prezentai ntr-un capitol urmtor. Vom prezenta n continuare principalele tipuri de vectori de clonare pentru E.coli.

Fig.31. Harta genetic a plasmidei pBR322 Ampr = gena de rezisten la ampicilin; Tetr =gena de rezisten la tetraciclin; ori = originea replicrii plasmidei

n general, pentru clonarea de gene n celulele de E.coli se pot folosi mai multe tipuri de vectori care, n funcie de structur i mod de funcionare, pot fi: vectori plasmidiali, vectori virali i vectori hibrizi. La rndul lor, vectorii hibrizi pot fi fagimide (cu structur hibrid, de plasmid i de fag filamentos) sau cosmide (cu structur hibrid, de genom de fag i de plasmid). Pe lng aceste categorii corespunztoare originii lor, vectori de clonare mai pot fi clasificai i n funcie de alte criterii (Stoica, 1997): 1. n funcie de posibilitatea studierii exprimrii fragmentelor de ADN clonate: vectori de clonare (permit doar clonarea unei anumite secvene de ADN, nu i analiza exprimrii sale, deoarece nu conin secvene promotor)
70

TEHNOLOGIA ADN RECOMBINANT

vectori de exprimare (au n structura lor secvene promotor, astfel c permit, inclusiv exprimarea fragmentului de ADN clonat, determinnd, n anumite situaii, obinerea de proteine de fuziune)

2. n funcie de tehnica folosit pentru clonarea fragmentului de ADN de interes: vectori de clonare inserional (ADN de interes este introdus la nivelul unui situs unic de restricie din vector) vector de clonare prin nlocuire (ADN strin nlocuiete un fragment din vector, dup fragmentarea acestuia cu dou enzime de restricie). 3. n funcie de spectrul de gazde (posibilitatea replicrii i meninerii stabile a vectorului): vectori congenerici (pot fi folosii doar la organisme aparinnd aceluiai gen taxonomic) vectori de tip "shuttle" (naveta) (se replic i se menin stabil n dou gazde microbiene diferite). Un grup modern de vectori plasmidiali este reprezentat de vectorii de tip pUC (pUC 18, pUC19). Aceti vectori au fost construii ntre anii 1982-1985 de ctre grupul de cercettori condui de Messing, denumirea vectorilor reprezentnd locul unde acetia au fost obinui (plasmid of University of California). Ei sunt derivai de la pBR322, prin includerea genei lacZ' (partea din gena pentru -galactozidaz ce codific secvena NH2-terminal a proteinei = peptidul ce conine primii 145 de aminoacizi din cei 1023 ci are fiecare dintre catenele tetramerului -galactozidaza) i a unei secvene sintetice (polilinker de 54 perechi de baze) ce conine situsuri unice de recunoatere pentru mai multe enzime de restricie (13 enzime de restricie)(fig.32).

71

TEHNOLOGIA ADN RECOMBINANT

Fig.32.Reprezentarea schematic a vectorilor de tip pUC (pUC 18 i pUC 19)

Prezena fragmentului din gena lacZ permite complementaie intraalelic de tip cu o alt form defectiv a genei lacZ' (ce codific regiunea COOH-terminal a galactozidazei formei respective de peptid i lipsesc aminoacizii din poziiile 11-41 existeni n -galactozidaz) dintr-o gazd bacterian adecvat (fig.33). n urma procesului de complementaie genic, tulpina defectiv dar purttoare a vectorului nerecombinat este capabil s refac integral enzima -galactozidaza. Vector de clonare H2N 1 145 Bacteria mutant care nu produce -galactozidaz COOH 41 1023

Bacterie transformat capabil s sintetizeze -galactozidaz


Fig.33. Reprezentarea schematic a procesului de complementaie genic

Sub aciunea IPTG (inductor al genei lacZ), o asemenea tulpin este capabil s degradeze analogul lactozei, X-gal (substrat cromogen), coloniile formate fiind albastre. De asemenea, prezena acestei gene permite selectarea clonelor recombinate (a celor care conin plasmide n care a fost integrat un fragment de ADN strin, la nivelul polilinkerului): aceste colonii manifest rezisten la ampicilin i sunt albe, n timp ce coloniile nerecombinate sunt albastre (n prezena X-gal i a inductorului specific = IPTG).

72

TEHNOLOGIA ADN RECOMBINANT

2.1.3.1. Vectori derivai de la fagul Aa cum se cunoate, bacteriofagul are un genom reprezentat de o molecul linear de ADN dublu catenar, ce conine 48502 perechi de baze. La capetele acestei molecule lineare se gsesc secvene specifice, complementare (coezive) de 12 nucleotide (situsul cos), care permit circularizarea ADN fagic n celulele bacteriene infectate (tulpini de E.coli). n forma sa natural, fagul poate prelua, ca fag transductor, doar scurte secvene de ADN din genomul gazdei n care s-a multiplicat (dup ce a parcurs ciclul lizogen), dimensiunea acestora fiind limitat de capsida fagic. De asemenea, numrul mare de situsuri de recunoatere pentru enzime de restricie, plasate la nivelul unor regiuni eseniale pentru evoluia litic a fagului limiteaz utilizarea sa ca vector de clonare. Cu toate acestea, pornindu-se de la genomul fagului , prin prelucrri "in vitro" au fost construii o serie de vectori de clonare, ncadrai n dou categorii: vectori de nlocuire i vectori de inserie. Pentru a se putea obine asemenea vectori, genomul fagului a fost modificat: au fost eliminate situsurile de restricie din zonele eseniale, iar prin folosirea oligonucleotidelor sintetice, situsurile de restricie au fost plasate n poziiile cele mai favorabile pentru clonare. Mai mult, tiind c regiunea central a genomului viral (aproximativ o treime din genom) nu este esenial pentru evoluia litic, ea poate fi ori eliminat complet, ori nlocuit cu ADN de interes. Vectorii de nlocuire (substituie) se caracterizeaz prin faptul c ADN heterolog nlocuiete un fragment neesenial din vector, dup ce acesta a fost tratat cu dou enzime de restricie ale cror situsuri de aciune flancheaz respectiva regiune viral. Asemenea vectori permit clonarea unor fragmente de ADN de 9-23 kb, fiind folosii, de obicei, pentru obinerea bibliotecilor de gene (colecie de vectori recombinai ce conin fragmente de restricie de ADN genomic de la o anumit specie). Din aceast categorie fac parte vectorii de tip Charon i EMBL. Vectorii Charon sunt vectori care permit doar clonarea unui anumit fragment de ADN strin, nu i exprimarea sa. Aceti vectori au fost obinui prin introducerea unor modificri importante la nivelul genomului fagului : deleii la nivelul regiunii de imunitate; mutaii la nivelul genei cI (vectorul nu poate fi meninut n stare lizogen); deleia genelor necesare atarii i integrrii; mutaii la nivelul genelor pentru proteinele capsidale A i B, etc.
73

TEHNOLOGIA ADN RECOMBINANT

Vectorii de acest tip (Charon 4A, Charon 40) prezint dou grupe de situsuri de clonare (MCS) la capetele unei regiuni neeseniale a ADN viral, astfel c aceasta poate fi nlocuit de ADN strin. Pentru a se realiza clonarea, att vectorul ct i ADN strin sunt tratai cu o aceeai endonucleaz de restricie (al crei situs se regsete la nivelul MCS din vector); fragmentele rezultate se amestec i se trateaz cu ligaz, obinndu-se vectorul recombinat. Dup introducerea vectorului recombinat ntr-o gazd corespunztoare (E.coli recA-) se realizeaz selecia fagilor recombinai din plajele de liz, produse la nivelul tulpinii bacteriene sensibile, ei fiind analizai ulterior pentru determinarea caracteristicilor fragmentului de ADN clonat. Vectorii EMBL sunt tot vectori de clonare prin nlocuire, la care regiunea neesenial a genomului viral este flancat de dou situsuri de policlonare (MCS). La nivelul regiunii neeseniale se gsesc genele red i gam implicate n recombinare (prezint deci fenotip Spi+, ceea ce nseamn c n gazde lizogene pentru fagul P2 asemenea vectori nu se pot dezvolta, deci nu produc plaje de liz)(fig.34). Genele de interes ce sunt clonate la nivelul unor asemenea vectori nlocuiesc regiunea viral neesenial, fr a afecta funcionarea vectorului. Selecia vectorilor recombinai se realizeaz n gazde specifice, lizogene pentru fagul P2, prin apariia plajelor de liz (eliminarea genelor red i gam determin apariia fenotipului Spi-, deci formarea de plaje de liz).

Fig.34. Reprezentarea schematic a vectorului EMBL 4: A-R = gene ale bacteriofagului ; red, gam = gene fagice; trp = gen ce codific sinteza triprofanului; MCS = situs de policlonare ce conine secvenele de recunoatere pentru enzimele de restricie EcoRI, BamHI i SalI.

Vectorii de inserie se caracterizeaz prin faptul c ADN de interes este clonat la nivelul unui situs unic de restricie, localizat la nivelul unei gene neeseniale pentru evoluia litic a fagului. Din aceast categorie fac parte vectorii de tip gt i cei de tip ZAP.

74

TEHNOLOGIA ADN RECOMBINANT

Vectorii gt sunt vectori de clonare i exprimare, ce permit introducerea unor fragmente mici de ADN strin (de pn la 6kb). Din aceasta categorie menionm vectorii gt 10 i gt 11. n cazul vectorului gt 10, situsul unic de restricie (EcoRI) la nivelul cruia se poate clona ADN de interes se gsete la nivelul regiunii de imunitate. n acest fel, vectorii nerecombinai sunt cI+, deci sunt capabili de a lizogeniza n gazdele corespunztoare; vectorii recombinai au fenotip cI-, incapabili de lizogenie, ei producnd plaje de liz caracteristice. Vectorul gt 11 permite att clonarea unui fragment de ADN heterolog (de pn la 7,2kb) ct i exprimarea acestuia sub forma unei proteine de fuziune cu -galactozidaza, deoarece situsul unic de restricie, EcoRI, n care se integreaz ADN de interes se afl localizat la nivelul genei lacZ. n acest fel, vectorii gt 11 recombinai determin fenotipul de tip Lac- (nu mai are loc complementaia genetic n gazdele corespunztoare)(fig.35).

Fig.35. Reprezentarea schematic a vectorului gt 11

Vectorii de tip ZAP sunt vectori de inserie compleci. Ei conin, la nivelul regiunii centrale neeseniale, n locul genelor virale, vectorul pBluescript SK (M13-)(fig.36). La nivelul genei lacZ' din pBluescript, n situsul multiplu de clonare, se poate introduce ADN de interes (pn la 10kb). Asemenea vectori pot fi utilizai pentru experimente de secvenializare a ADN i ARN; pentru obinerea de sonde ARN cu ajutorul promotorilor T3 i T7 ce flancheaz ADN clonat; pentru obinerea de proteine de fuziune cu -galactozidaza.

Fig. 36. Reprezentarea schematic a unui vector de tip ZAP: A-R = gene fagice; MCS = situs de policlonare; I, T = secvene semnal pentru iniierea/terminarea exciziei fagimidului pBluescript, sub form de monocatene +

2.1.3.2.Vectorii hibrizi de tip cosmide

75

TEHNOLOGIA ADN RECOMBINANT

Aceti vectori reprezint plasmide modificate, ce conin secvena cos de la fagul necesar mpachetrii ADN n particulele fagice. De asemenea, cosmidele prezint originea replicrii de la plasmida ColE1 i un marker de selecie (de obicei, gena de rezisten la ampicilin). n acest fel, cosmidele se pot replica i menine ca plasmide (permind selecia coloniilor purttoare pe mediu ce conine antibioticul corespunztor) sau, n condiii specifice, datorit prezenei situsului cos, ele se pot mpacheta n particule fagice, fiind propagate prin transducie sau transfecie (transformarea celulelor sensibile cu ADN izolat din particule fagice recombinate). Asemenea vectori permit clonarea la nivelul lor a unor fragmente mari de ADN strin (de pn la 45 kb), favoriznd n acest fel propagarea unor gene eucariote ntregi. Deoarece n cosmide se pot insera fragmente mai mari de ADN, comparativ cu vectorii derivai de la fagul , ele sunt preferate n experimentele de realizare a bncilor genomice la eucariote. O categorie special de cosmide sunt cele de tip Charomid. Acestea, pe lng elementele specifice ale unei cosmide (secvena cos, originea replicrii, o gen marker), conin o secven spaiatoare, format din 1-23 copii repetate n tandem ale unui fragment de 2kb derivat din pBR322, flancat de dou situsuri de restricie pentru endonucleaza AvaI. Datorit prezenei secvenei spaiatoare, vectorii Charomid trebuie meninui n gazde recA(incapabile de recombinare). Prin transferul lor n gazde recA+ se realizeaz destabilizarea regiunii spaiatoare i apariia unor molecule Charomid cu dimensiuni variate, n funcie de numrul de copii ale secvenei de 2kb (de la 0 la 23 copii). Variaia dimensiunii secvenei spaiatoare determin dimensiunea fragmentului de ADN ce poate fi clonat ntr-un asemenea vector: micorarea dimensiunii secvenei spaiatoare este nsoit de posibilitatea introducerii unui fragment mai mare de ADN de interes. Vectorul recombinat rezultat este mpachetat n particule fagice (2-45 kb), prin folosirea unor fagi ajuttori. Vectorii de tip Charomid sunt mult utilizai n experimentele de obinere a bncilor genomice pentru ADN de origine mamalian. 2.1.2.3. Vectorii hibrizi de tip fagimide Fagimidele sau plasmidofagii reprezint o categorie special de vectori, ce combin caracteristicile vectorilor de tip plasmidiali cu cele ale fagilor filamentoi. Fagimidele, n cea mai simplificat form, conin:
76

TEHNOLOGIA ADN RECOMBINANT

originea replicrii de la plasmida ColE1 (asigur meninerea vectorului n forma plasmidial); gen marker de selecie (rezisten la antibiotice, sintez de -galactozidaz etc); copie a unei secvene dintr-un fag filamentos (de obicei M13 sau f1), ce conine informaia genetic pentru replicarea ADN viral i pentru morfogeneza particulelor fagice.

Datorit acestor caracteristici, fagimidele pot fi propagate i meninute stabil n forma plasmidial ntr-o tulpin bacterian cultivat n condiii normale de mediu (pe mediu selectiv ce conine antibioticul corespunztor). Atunci cnd celulele gazd sunt infectate cu un fag filamentos ajuttor ("helper"), sunt activate funciile virale, iar ADN este mpachetat n particule fagice (ca ADN monocatenar circular). ADN monocatenar purificat din asemenea particule poate fi utilizat pentru procesele de secveniere a fragmentelor de ADN clonate sau pentru obinerea de sonde moleculare (de ADN monocatenar). ADN heterolog poate fi integrat ntr-un asemenea vector, la nivelul unui MCS localizat la nivelul unei gene ce permite rapida selecie a vectorilor recombinai. Dintre cele mai cunoscute i utilizate fagimide menionm pUC118/pUC119 i pBluescript. Primul grup de fagimide deriv din plasmidele pUC18, respectiv pUC19, i conin: originea replicrii din ColE1; originea replicrii fagului filamentos M13; gena lacI ce codific represorul Lac I al operonului lac; gena lacZ' (gena lacZ mutant, ce codific peptidul ), precedat de secvenele promotor i operator proprii; un situs MCS localizat la nivelul genei lacZ'. Clonarea ADN de interes se face la nivelul MCS determinnd blocarea sintezei de peptid . n felul acesta, selecia clonelor recombinate se va face pe baza testelor histochimice (colonii albe/albastre pe mediu cu X-gal, n prezena IPTG). Vectorii de tip pBluescript sunt vectori multifuncionali, construii pentru a simplifica clonarea molecular i analiza genetic (fig.37).

77

TEHNOLOGIA ADN RECOMBINANT

Fig.37. Reprezentarea schematic a vectorului pBluescript SK+/-. Apr = gena de rezisten la ampicilin; ori = originea replicrii plasmidei (derivat de la ColE1); lac Z= gena pentru sinteza galactozidazei; lac I= gena reglatoare a operonului lac; ori f1 (+) = originea replicrii ca fag filamentos; MCS = situs multiplu de clonare; T3 i T7 = promotori specifici derivai de la fagii T3 i T7.

Comparativ cu celelalte tipuri de vectori, fagimidele pBluescript ofer unele avantaje n procesul de clonare: clonare la nivelul unui MCS (polilinker), ce conine 20 situsuri diferite de restricie (SacI, Bst XI, Not I, Eag I, Xba I, Spe I, Bam HI, Sma I, Pst I, Eco RI, Eco RV, Hind III, Cla I, Sal I, Acc I, Hinc II, Xho I, Apa I, Dra II, Kpn I. Regiunea este ncadrat de promotorii fagici T3 i T7, iar ntreaga secven este flancat de cte un situs pentru endonucleaza de restricie Bss H II (situs foarte rar n genomuri), cu ajutorul creia poate fi, deci, excizat; selecia rapid a clonelor recombinate (teste histochimice: pe mediu cu X-gal i IPTG coloniile recombinate sunt albe) transcrierea eficient in vitro a ADN heterolog, mediat de promotorii T3 i T7. Cei doi promotori se gsesc n orientare invers unul fa de cellalt i, ca urmare, ADN heterolog clonat poate fi transcris de pe oricare dintre cele dou catene, n funcie de orientarea pe care o are n molecula de vector recombinat i de activarea specific a unuia sau altuia dintre promotorii fagici;
78

TEHNOLOGIA ADN RECOMBINANT

obinerea de monocatene de ADN datorit existenei secvenelor de origine viral (fag filamentos). Pentru a obine ADN monocatenar, tulpina bacterian n care se afl vectorul recombinat este infectat cu un fag M13 defectiv ce conine gena II mutant. Produsul acestei gene virale va aciona preferenial asupra secvenei ori-f1 din fagimid, declannd replicarea ADN pe modelul fagilor filamentoi. n funcie de orientarea regiunii de origine a replicrii virale, ADN monocatenar rezultat va conine catena sens sau cea antisens a genei lac Z. Pentru a putea infecta gazda bacterian cu un fag filamentos (cu M13) este necesar ca tulpina bacterian s fie de tip Hfr, astfel nct s prezinte pili de sex la suprafaa peretelui celular. Procesul de infectare a unei bacterii de ctre un fag filamentos presupune, ca prim etap, ataarea fagilor la nivelul pililor de sex.

obinerea de proteine de fuziune formate din proteina codificat de ADN heterolog i -galactozidaza), ceea ce asigur obinerea unor cantiti importante de proteine de interes.

2.1.3.4. Vectorii de exprimare Scopurile foarte variate ale experimentelor de inginerie genetic au determinat o permanent perfecionare a vectorilor utilizai, astfel nct acetia s asigure succesul clonrii n gazdele corespunztoare. Grupul vectorilor de exprimare este foarte heterogen, ei permind fie obinerea ARNm pentru gena de clonat, fie sinteza polipeptidului codificat de aceasta. Vectorii de acest tip conin situsuri de clonare plasate sub controlul unor promotori puternici, sau la captul unei secvene semnal. In acest fel, n urma clonrii se obine o gen hibrid format din gena de interes fuzionat cu o gen marker. Proteina de fuziune rezultat poate fi apoi transportat n citoplasm, facilitndu-se n acest fel purificarea sa. Unii vectori plasmidiali de exprimare poart promotori derivai de la bacteriofagii T3, T7 i/sau SP6 alturi de situsul multiplu de clonare (MCS). ADN inserat la nivelul MCS poate fi transcris in vitro atunci ADN plasmidial recombinat linearizat este incubat cu ARN polimeraza corespunztoare i cu precursorii de ribonucleotide. ARNm sintetizat poate fi sens (dac gena a fost clonat i citit n sensul corect) sau antisens (dac gena a fost clonat n poziie invers celei normale). Din acest punct de vedere, fagimida pBluescript poate fi
79

TEHNOLOGIA ADN RECOMBINANT

considerat c fiind un vector de exprimare deoarece situsul multiplu de clonare prezint la un capt promotorul T3 i la cellalt promotorul T7 (fig.37). n acest fel, gena clonat la nivelul MCS poate fi transcris prin folosirea alternativ drept matri a ambelor catene de ADN, n funcie de tipul de ARN polimeraz utilizat n reacia de transcriere. Moleculele de ARN sintetizate n acest mod pot reprezenta probe pentru hibridizare sau pot fi traduse la proteinele corespunztoare n sisteme acelulare. De asemenea, atunci cnd se dorete exprimarea unei gene ce nu conine nici o secven recunoscut de echipamentul enzimatic procariot, clonarea ei se face n aa fel nct s conduc la obinerea unei proteine de fuziune. Proteinele de fuziune sunt obinute prin unirea a dou secvene cu cadru de citire deschis (open reading frame), astfel nct produsul rezultat n urma traducerii acestei secvene de ADN s conin secvene de aminoacizi derivate de la ambele gene. Promotorul, situsul de legare la ribosomi i regiunea aminoterminal sunt reprezentate de secvene ale vectorului, ceea ce asigur transcrierea i traducerea eficient a produsului de fuziune. Producerea unor asemenea proteine de fuziune conduce la exprimarea unor fragmente scurte de gene i, consecutiv, la separarea domeniilor funcionale din interiorul unor proteine complexe. Dintre genele folosite pentru obinerea proteinelor de fuziune menionm: lac Z, gst (pentru glutation S-transferaza), gfp (pentru green fluorescence protein, gen izolat de la meduza Aequorea victoria), gena pentru proteina A de la Staphylococcus aureus etc. n cazul vectorilor de clonare ce conin gena lac Z, la nivelul captului 3 al acesteia (deci n regiunea ce codific extremitatea COOH a proteinei -galactozidaza) s-a introdus o secven oligonucleotidic sintetic (polilinker) ce conine situsul de recunoatere al mai multor enzime de restricie (secvena MCS). De asemenea, unii vectori ce conin aceast gen mai prezint la nivelul MCS un situs Nco I (CCATGG) ce cuprinde codonul ATG, de iniiere a genelor eucariote. n acest fel, genele clonate la nivelul MCS sunt exprimate ca proteine de fuziune cu -galactozidaza, ceea ce le asigur protecie fa de aciunea proteazelor gazdei i identificare rapid (pe baza activitii enzimei -galactozidaza). Un vector utilizat foarte frecvent pentru clonarea de gene n E.coli i obinerea de proteine de fuziune este pGEX 4T1 (fig.38).

80

TEHNOLOGIA ADN RECOMBINANT

Fig.38. Reprezentarea schematic a plasmidei pGEX 4T-1

Acesta face parte dintr-o familie de vectori de tip GEX, diferenele dintre ei fiind datorate fie situsurilor unice de restricie de la nivelul MCS, fie situsului de recunoatere pentru o proteaz specific (pentru factorul Xa sau pentru trombin) plasat n faa MCS. Aa cum se observ n fig.38, vectorul pGEX 4T-1 conine elementele genetice necesare funcionrii n E.coli: originea replicrii de la pBR322, gena de rezisten la ampicilin (Apr), gena lacI ce controleaz, prin represorul codificat, transcrierea genelor plasate sub controlul promotorului inductibil tac i a operatorului lac. Gena gst ce codific enzima glutation S-transferaza a fost izolat de la Schistosoma japonicum i clonat sub controlul unor elemente genetice ce-i asigur o exprimare foarte eficient. La extremitatea 3' a acestei gene se afl regiunea MCS, la nceputul creia a fost introdus o secven caracteristic, ce codific o succesiune de patru aminoacizi, reprezentnd situsul de recunoatere pentru o proteaz (factorul Xa, trombin = Tr sau o proteaz recombinat, n funcie de varianta de vector) ce asigur separarea produsului de interes de proteina GST (codificat de vector). Clonarea la nivelul MCS a unei gene de interes determin sinteza unei proteine de fuziune (GST + proteina codificat de gena clonat). Aceast protein de fuziune poate fi detectat prin tehnici imunologice (interaciune specific cu anticorpi anti-GST) sau prin tehnici biochimice (incubarea proteinei de fuziune cu un substrat cromogen = 1-cloro2,4- dinitrobenzen, care sub aciunea GST este convertit la un compus de culoare galben ce poate fi detectat i msurat colorimetric). Purificarea proteinei se realizeaz prin cromatografie de afinitate, prin trecerea lizatului celular pe o coloan de Sefaroza 4G, pe care s-a imobilizat glutation. Eluarea proteinei de fuziune se face n condiii nedenaturante, utiliznd glutation redus care asigur meninerea funciilor proteinei de interes i caracterul antigenic al acesteia. Dup purificare, proteina de fuziune este tratat cu proteaza corespunztoare (n exemplul dat este vorba
81

TEHNOLOGIA ADN RECOMBINANT

despre trombin) care cliveaz situsul de recunoatere i separ cele dou proteine: GST i proteina de interes. In ultimii ani sistemul menionat a fost perfecionat, n sensul purificrii proteinei de interes ntr-o singur etap: dup legarea proteinei de fuziune de interes la coloana cromatografic are loc incubarea sa, peste noapte, cu proteaza specific (ea nsi protein de fuziune cu gena pentru GST), iar a doua zi, eluatul obinut este trecut pe o a doua coloan (ce conine glutation imobilizat), legat de prima, care asigur legarea proteazei, a proteinelor de fuziune neclivate i proteina GST liber. In schimb, proteina de interes nu este reinut, ea fiind recuperat n fraciunile corespunztoare (Sigrell, 2002). Un asemenea protocol a permis obinerea unor cantiti importante de proteine de interes: de exemplu, se pot obine 10 mg de protein uman de legare a calciului (hipocalcin), a crei gen a fost clonat ntr-un vector pGEX i exprimat n E.coli. 2.1.4. Modaliti de obinere a moleculelor de ADN recombinant Clonarea molecular reprezint procesul de construire a unor molecule de ADN hibride (himere) prin inserie de informaie genetic strin ntr-un vector (vehicul) adecvat, capabil s se replice independent. Hibridul molecular respectiv este utilizat pentru a transforma celulele bacteriilor receptoare (gazda obinuit a experimentelor de clonare). Pentru integrarea fragmentelor de ADN strin n vector se pot folosi mai multe variante experimentale, ce presupun sau nu prelucrarea "in vitro" a fragmentului de ADN dorit, dup care se realizeaz legarea covalent a acestor fragmente cu ajutorul ADN-ligazelor. Pentru obinerea moleculelor de ADN hibride au fost imaginate mai multe procedee dintre care, cele mai importante vor fi descrise n continuare. 1. Modalitatea cea mai simpl de incorporare este aceea care utilizeaz fragmentele obinute cu ajutorul enzimelor de restricie de tipul II, care cliveaz ADN la situsuri specifice palindromice, producnd capete monocatenare complementare. Astfel, utiliznd aceeai enzim de restricie att pentru clivarea ADN exogen ct i a vectorului de clonare, se pot obine molecule hibride indiferent de proveniena ADN de interes, datorit extremitilor monocatenare complementare identice. Unirea iniial a segmentelor de restricie se face pe baz de complementaritate, prin formarea legturilor de hidrogen la nivelul capetelor monocatenare, dup care amestecul se trateaz cu ligaz, de obicei de fag T4, care reunete covalent moleculele respective (fig.39).
82

TEHNOLOGIA ADN RECOMBINANT

De notat c, transformarea bacteriilor gazd se poate face direct cu amestec de fragmente de restricie fr a utiliza ligaza de fag T4, refacerea legturilor fosfodiesterice fiind produs de ligaza endogen, specific celulei transformate. n acest sistem de ligare "in vivo" a moleculelor, proporia de celule transformate ce conin molecule hibride este, de aproximativ 1000 ori, mai mic comparativ cu sistemul care utilizeaz ligarea "in vitro". Eficiena de obinere a moleculelor hibride poate fi mrit prin tratarea cu fosfataz alcalin a vectorului linearizat. Acest tratament determin ndeprtarea gruprilor 5' P terminale de la nivelul vectorului linearizat, prevenindu-se recircularizarea i formarea dimerilor plasmidiali. n acest caz, circularizarea vectorului se produce numai prin inseria ADN exogen netratat cu fosfataz alcalin, care va furniza captul 5' fosfat necesar ligazei, la nivelul fiecrei legturi. Cu toate acestea, la fiecare jonciune rmne cte o caten nelegat, refacerea legturilor fosfodiesterice fiind realizat n final de sistemele specifice (reparatorii) ale gazdei.

Fig.39. Realizarea moleculelor de ADN hibrid prin metoda legrii capetelor coezive produse de o enzim de restricie.

2. O alt metod utilizat frecvent n experimentele de clonare molecular este cea a adugrii de extremiti homopolimere complementare la secvenele de ADN de origine diferit. Aceast metod permite inseria fragmentelor de ADN tiate drept, fr decalaj (fr extremiti monocatenare), produse de anumite enzime de restricie (Hae III, Hind II), ntr-un vector de clonare corespunztor.
83

TEHNOLOGIA ADN RECOMBINANT

Este drept c, n cazul unor fragmente diferite de ADN cu capete netede (necoezive), pentru refacerea legturilor fosfodiesterice se poate utiliza direct ligaza de fag T4 care are capacitatea de a uni asemenea molecule, dar eficiena de legare este sczut. Tehnica adugrii de capete homopolimere complementare se bazeaz pe proprietatea unei enzime, terminal-deoxinucleotidil transferaza, izolat din timus de viel, de a extinde extremitile 3'OH ale ADN, prin adugarea progresiv de dezoxiribonucleotide (dNTP). Enzima poate forma o caten homopolimer sau "coad" cu o lungime definit, la ambele extremiti 3'OH ale unui ADN dublu catenar complementar (sintetizat pe baza ARNm). Dac asemenea extremiti complementare se produc i la capetele unei plasmide linearizate, prin amestecul lor se pot obine molecule recombinante, stabile. Formarea acestor molecule recombinante nu este dependent de legarea enzimatic a celor dou componente (fig.40).

Fig.40. Reprezentarea schematic a utilizrii cozilor homopolimere pentru clonare

Folosirea extremitilor complementare poli dG - poli dC are marele avantaj ca aceti hibrizi sunt mai stabili dect cei poli dA - poli dT. Eficiena n clonare a fragmentelor cu cozi poli dC - poli dG, lungi de 10-20 nucleotide, este de 10-100 ori mai mare dect atunci cnd se folosesc "cozi" poli dA- poli dT, lungi de 50-100 nucleotide, aceasta datorndu-se, probabil, diferenelor de lungime. 3. O alt metod, larg utilizat n ultimii ani, este aceea a folosirii moleculelor linker pentru unirea segmentelor de ADN lipsite de extremiti coezive, indiferent de modul cum au fost obinute. Linkerii, comercializai ntr-o gam foarte variat de tipuri, sunt oligonucleotide decamerice cu secvene, n general, palindromice, care corespund situsurilor
84

TEHNOLOGIA ADN RECOMBINANT

de recunoatere ale unor enzime de restricie. Dup legarea lor la extremitile moleculelor de ADN tiate drept, ele se reunesc cu ajutorul ligazei de fag T4 n structuri bicatenare, cu secvene simetrice, care reconstituie situsul de recunoatere al unei enzime de restricie. Prin adugarea lor la extremitile moleculelor de ADN se creeaz situsuri int pentru aciunea enzimelor de restricie cu care se trateaz att ADN heterolog ct i molecula vectorului, aprnd astfel extremiti adezive complementare pentru clonare. Acest lucru permite, ulterior, reizolarea genei (genelor) din molecula de ADN recombinant prin folosirea enzimelor de restricie ce recunosc situsurile marginale (fig.41).

Fig.41. Schema utilizrii linkerilor pentru clonare 1 = secven linker decameric ce conine situsul de recunoatere pentru EcoRI; 2 = fragment de ADN cu capete drepte; 3 = linkeri; fragment de ADN ce prezint capete coezive rezultate prin clivarea linkerilor cu EcoRI

O varietate de linkeri o constituie cea care a primit denumirea de linkeri "adaptativi" (=adaptori). Acetia sunt secvene oligonucleotidice, n general decamere, care permit legarea a dou molecule de ADN prevzute cu extremiti adezive (rezultate ns prin aciunea unor enzime de restricie diferite). Ei pot face s fuzioneze dou situsuri de restricie diferite: unul se leag la extremitatea 3'OH a unei molecule, iar cellalt la extremitatea 5' P a celeilalte, reconstituind ambele secvene (fig.42). Prezena la nivelul adaptorilor a extremitilor monocatenare 5OH mpiedic autorecircularizarea secvenelor de interes. n prezent se produc i se comercializeaz linkeri-adaptori sintetici care conin secvene promotor, operator, situsuri de legare la ribosomi, de iniiere i de terminare a sintezei proteice, flancai de ambele pri de situsuri pentru restrictaze. Este de remarcat c, n cazul folosirii linkerilor cu situsuri pentru enzime de restricie, este obligatoriu s se cunoasc
85

TEHNOLOGIA ADN RECOMBINANT

faptul c molecula de ADN creia i se adaug aceti linkeri nu conine acel situs de restricie n structura sa intern. Un avantaj al metodei n care se utilizeaz linkerii este i acela c eficiena procesului de transformare cu ADN supus aciunii ligazei este mult mai mare comparativ cu cea produs de ADN numai circularizat (ca n cazul celui obinut prin metoda extremitilor homopolimere complementare).

Fig.42. Schema utilizrii linkerilor adaptativi (adaptorilor) pentru clonare (a) adaptor EcoRI; (b) utilizarea adaptorilor EcoRI care sunt ataai la nivelul capetelor drepte ale fragmentului de interes, determinnd formarea de capete coezive.

4. O modalitate special de clonare a genelor o reprezint folosirea ca vectori a cosmidelor (fig.43).

Fig.43. Reprezentarea schematic a utilizrii cosmidelor pentru clonarea genelor

Aa cum se poate remarca din fig.43, strategia general de clonare n vectorii de tip cosmide este urmtoarea:
86

TEHNOLOGIA ADN RECOMBINANT

se izoleaz vectorul n forma sa de plasmid i se linearizeaz prin clivare cu o enzim de restricie specific. Aceeai enzim este folosit pentru obinerea fragmentelor de ADN de clonat.

vectorul linearizat i fragmentele de ADN genomic se amestec, se trateaz cu ligaz, obinndu-se molecule lineare recombinate de tipul cos-ori-Apr-ADN heterolog-cos.

moleculele recombinate sunt supuse unui proces de mpachetare "in vitro" prin tratarea cu un "extract de mpachetare" sau cu un fag mutant (helper); se obin n acest fel particule fagice ( ) ce conin cosmida recombinat.

prin

infectarea

unei

gazde

corespunztoare

(E.coli),

cosmida

se

recircularizeaz i funcioneaz ca plasmid. Selecia clonelor recombinate se face pe baza rezistenei la antibiotice conferit de cosmid. 2.1.5. Metode de introducere a moleculelor de ADN recombinant n celulele gazd Meninerea i multiplicarea moleculelor de ADN recombinant este condiionat de ptrunderea lor ntr-o gazd adecvat, n al crei sistem genetic s se integreze. Principala metod utilizat pentru introducerea moleculelor de ADN recombinant ntr-o celul gazd este transformarea genetic. Transformarea genetic reprezint transferul de informaie genetic, realizat prin intermediul unei fraciuni de ADN eliberat dintr-o celul donor, prin liz celular i extracie chimic. Fenomenul natural a fost descoperit la bacterii de ctre Griffith, n 1928. n principiu, sistemele de transformare bacteriene se mpart n dou grupe (Lorenz i Wackernagel, 1994): primul grup cuprinde acele sisteme la care capacitatea celulelor receptoare de a reaciona cu ADN transformant este strns legat de o etap fiziologic important, n care se realizeaz starea de "competen", Aceast stare apare n timpul creterii celulelor ntr-un mediu special i se menine o perioad strict determinat. Sistemele cel mai bine caracterizate din cadrul acestui grup sunt reprezentate de Bacillus subtilis, Diplococcus pneumoniae, Haemophilus influenzae.

87

TEHNOLOGIA ADN RECOMBINANT

al doilea grup este reprezentat de acele organisme la care competena este indus artificial, prin tratamente cu CaCl2 sau RbCl, cel mai bine studiat fiind fenomenul de transformare de la E.coli. Procesul se realizeaz prin permeabilizarea nveliurilor celulare n urma tratrii bacteriilor cu CaCl2 70100mM, ceea ce suprim bariera celular normal fa de nglobarea ADN. Mecanismul transformrii cu ADN plasmidial este analog cu cel al transformrii genetice cu ADN cromosomal, dar exist i unele diferene. Astfel, att la E.coli ct i la B.subtilis, transformarea plasmidial este afectat de sistemul de restricie al gazdei (ca i n cazul transfeciei fagice). La B.subtilis, plasmidele de tip oligomer i nu cele monomere sunt active n transformare, pe cnd la E.coli aceast difereniere nu se remarc. Dup ptrunderea lor n celula gazd (prin fenomenul de transformare), moleculele de ADN exogen se multiplic datorit sistemului propriu de replicare. Ca urmare a replicrii i prin amplificare, fiecare molecul recombinat d natere unei clone moleculare, adic unei populaii omogene de plasmide sau fagi (n funcie de tipul de vector utilizat), care propag un segment determinat de ADN. Spre deosebire de celulele natural competente, bacteriile la care competena a fost indus prin tratament cu ioni de calciu sunt capabile s preia att ADN monocatenar ct i dublu catenar. Aceasta nseamn c ele pot fi transformate nu numai cu ADN cromosomal linear ci i cu ADN plasmidial circular. Aceasta particularitate a celulelor devenite competente prin tratament in vitro este de mare importan pentru experimentele de clonare molecular sau pentru alte aplicaii care necesit introducerea n celule a ADN plasmidial sau fagic. De remarcat faptul c atunci cnd se dorete introducerea n celule a ADN viral (sau n anumite situaii a ARN viral), procesul este numit transfecie, rezultatul fiind producerea de particule virale (fagi progeni) ce determin apariia de plaje de liz. O situaie special apare n cazul anumitor virusuri la care simpla transfecie a bacteriilor cu ADN viral nu conduce la multiplicarea viral. Aceasta se datoreaz faptului c, n condiiile infeciei normale, odat cu genomul viral, n celulele bacteriene este introdus i o ARN-polimeraz viral care asigur transcrierea genelor virale timpurii. In absena acestei ARN-polimeraze de origine viral nu poate avea loc sinteza proteinelor virale necesare multiplicrii fagului, iar n final nu se produc plaje de liz (dovada eficienei infeciei virale). In cazul utilizrii pentru transformarea celulelor devenite competente n mod artificial a ADN cromosomal linear, eficiena procesului este n general mic deoarece fragmentele de
88

TEHNOLOGIA ADN RECOMBINANT

ADN dublu catenar sunt degradate n interiorul celulei acceptoare de ctre nucleaza Rec BCD. Aceast nucleaz atac fragmentele de ADN de la nivelul extremitilor, n timp ce plasmidele circulare sau ADN fagic circularizat sunt rezistente la aciunea enzimei respective. Pentru a obine ns o eficien crescut a procesului de transformare, drept celule acceptoare ale ADN exogen se utilizeaz mutante recBCD- (Snyder i Champness, 1997). Experimentele realizate n ultimii ani au evideniat faptul c, la numeroase microorganisme, metoda transformrii genetice "clasice" (prin competen natural sau indus) nu este posibil de aplicat. De asemenea, tipurile de celule gazd, acceptoare de ADN exogen, s-au diversificat, astfel nct i modalitile de introducere a genelor de interes n acestea au trebuit mbuntite. Dintre metodele noi de introducere n celulele gazd a moleculelor de ADN recombinat menionm: electrotransformarea, microinjectarea, "bombardarea" celulelor cu particule acoperite cu ADN etc. Electrotransformarea a fost descoperit pe baza studiilor efectuate asupra celulelor animale (hematii) supuse aciunii cmpurilor electrice (Zimmermann, 1981-1986) i se bazeaz pe fenomenul electroporrii. Procesul de electroporare const n inducerea unei permeabilizri reversibile a celulelor procariote sau eucariote, prin utilizarea unui cmp electric. Astfel, atunci cnd o celul este expus ntr-un cmp electric, componentele membranei devin polarizate iar membrana este traversat de un potenial electric. Dac diferena de potenial depete o valoare prag, membrana se "rupe" n anumite zone, iar celula devine permeabil pentru molecule exogene. Permeabilitatea indus este reversibil cu condiia ca mrimea sau durata aplicrii cmpului electric s nu depeasc o valoare critic limit, pentru c altfel celula este afectat ireversibil. Mecanismul electroporrii nu este pe deplin cunoscut. S-a stabilit experimental c diferena de potenial necesar "ruperii" membranei i formrii porilor la eucariote este de 0,2-2kV/cm, porii rezultai avnd un diametru de 10 m. La bacterii valoarea cmpului aplicat este mult mai mare: 2-25kV/cm, el variind n funcie de specie. Diferenele aprute depind de o serie de factori, cum ar fi: compoziia membranei, temperatura de lucru, durata aplicrii cmpului electric, specia testat. Electrotransformarea este dependent de mai muli factori, cum ar fi: concentraia ADN transformant (la bacterii eficiena maxim de transformare fiind atins cu 1-5 g ADN/ml);
89

TEHNOLOGIA ADN RECOMBINANT

dimensiunea moleculelor de ADN (moleculele mai mici au eficien mai mare de transformare); conformaia molecular a ADN (ADN suprancolcit este mai eficient dect cel linear).

Primele experimente de electroporare au fost realizate cu celule animale (hematii), care sunt lipsite de perete celular. Modelul experimental utilizat pentru acestea a fost apoi aplicat i celulelor vegetale, levurilor i bacteriilor, dar numai dup ce peretele celular a fost ndeprtat prin tratament enzimatic (deci dup convertirea celulelor la protoplati). Cele mai multe rezultate, promitoare de altfel, au fost obinute la plante i la bacterii, selectndu-se clone recombinate ce conin vectori specifici. Cu toate acestea, metoda prezint unele limitri ce in de: sensibilitatea celulelor la tratamentul cu curent electric (a celor lipsite de perete celular); barierele de restricie ale celulelor receptoare; posibila prezen n mediul de electroporare a unor nucleaze nespecifice.

O parte dintre aceste probleme au fost rezolvate prin mai multe metode: metilarea ADN exogen, utilizarea unor molecule de ADN cu funcii de cru ("carrier DNA"); folosirea unor inhibitori nucleazici, etc. De asemenea, n ultima vreme n experimentele de electroporare s-au folosit celule intacte, la care perete celular nu a mai fost ndeprtat. n cazul microorganismelor, au fost stabilite condiiile optime de electrotransformare pentru bacteriile Gram negative (E.coli, Agrobacterium tumefaciens) (Potter, 1991), ca i pentru anumite specii de drojdii. Microinjectarea este o metod relansat n ultimii ani, dup ce a fost iniial utilizat n experimente n anii 40, prin folosirea unor micromanipulatoare noi. Primele rezultate semnificative de transfer de gene prin utilizarea acestei tehnologii au fost obinute abia prin anii 70, cnd s-a reuit transplantarea unor nuclei din celule difereniate de amfibieni n celule ou enucleate. De asemenea, n 1974 s-au obinut oareci transformai (mozaicai) prin injectarea n celule embrionare a ADN viral de SV40 (Jaenisch i Mintz, 1974). Metoda este aplicabil doar celulelor eucariote, ea putnd fi considerat ca o metod de rutin n cazul celulelor animale, n scopul obinerii de animale transgenice. Eficiena obinerii de animale transgenice prin aceast metod este de 5-15%, n funcie de specia testat; cele mai bune rezultate fiind nregistrate la oareci i porci i mai slabe la vaci i oi.
90

TEHNOLOGIA ADN RECOMBINANT

Dintre descendenii organismelor transgenice, numai aproximativ jumtate primesc i exprim gena de interes, deoarece exprimarea acesteia depinde de locul unde s-a realizat integrarea n genomul gazdei i de eficiena secvenelor reglatoare nsoitoare. n cazul aplicrii metodei microinjectrii la plante sunt necesare unele adaptri tehnice, cauzate de particularitile structurale ale celulelor vegetale (prezena peretelui celular i a vacuomului)(fig.44).

Fig.44. Reprezentarea schematic a procesului de microinjectare a ADN de interes n celulele vegetale

Cele mai multe rezultate au fost obinute cu protoplati vegetali evacuolai, prin introducerea fie a unor cromosomi de la specii diferite, fie a unor vectori derivai de la plasmida Ti de la Agrobacterium tumefaciens. Tehnica microinjectrii la plante permite obinerea de clone transgenice din protoplati sau himere transgenice din proembrioni derivai din microspori. De remarcat c, prin aceast metod doar o celul primete ADN de interes. Avantajele aplicrii acestei metode la plante ar putea fi urmtoarele: cantitatea de ADN introdus ntr-o celul poate fi optimizat; se poate decide care celul va primi ADN; introducerea ADN poate fi urmrit la microscop; celulele microinjectate pot fi reluate cu uurin, cultivate i apoi multiplicate pe medii specifice, din ele regenerndu-se organisme ntregi, transgenice, obinndu-se n acest fel clone. Metoda biolistic const n "bombardarea" celulelor int cu particule acoperite cu ADN. Metoda a fost elaborat de Klein i colab. (1987) fiind aplicat, de obicei, celulelor vegetale intacte. Principul metodei este urmtorul: ADN de interes este depus pe suprafaa unor particule de tungsten sau aur (cu un diametru de aproximativ 1m), prin precipitare cu CaCl2,
91

TEHNOLOGIA ADN RECOMBINANT

acestea constituind "gloanele". Particulele astfel pregtite sunt introduse ntr-un dispozitiv special, numit "puc" (fig.45).

Fig.45. Reprezentarea schematic a dispozitivului utilizat pentru introducerea unor particule "nvelite" cu ADN de interes direct n celula int (dup Watson i colab., 1992)

Particulele cu ADN sunt apoi mpinse de macroproiectil, dobndind o viteza mare; trec prin orificiul de la nivelul dispozitivului de reinere i lovesc inta. Metoda are o serie de avantaje i o aplicabilitate larg n cazul celulelor eucariote: este uor de realizat, cu condiia existenei n laborator a dispozitivului specific; printr-o singur "lovitur" se poate asigura transferul genelor de interes n mai multe celule; genele aflate la suprafaa particulelor i menin activitatea biologic; celulele int pot fi foarte variate (polen, celule de calus, meristeme), ele putnd supravieui dup "bombardarea" cu microproiectile; permite introducerea de gene la nivelul unor organe, att la suprafaa lor ct i n profunzime; metoda depinde doar de parametri fizici ce pot fi optimizai n funcie de materialul biologic folosit sau de scopul urmrit n experiment. De remarcat c, prin utilizarea unei asemenea metode se pot introduce gene nu numai n nucleul celulei int ci chiar i n organitele celulare (de exemplu, n cloroplaste), ceea ce nseamn c se poate asigura o exprimare specific a ADN transferat. Alturi de metodele descrise mai sus care sunt destul de mult utilizate n laboratoare, n ultimii ani au mai fost elaborate i testate i tehnici noi, neconvenionale care, dei promitoare, necesit studii suplimentare pentru optimizare. Printre acestea, poate fi menionat metoda electroforetic, elaborat iniial pentru celulele vegetalr dar putnd fi aplicat i celulelor animale.
92

TEHNOLOGIA ADN RECOMBINANT

In varianta sa original, metoda electroforetic presupune utilizarea unui sistem special n care embrionul vegetal este plasat ntre doi electrozi, ntr-o camer electroforetic speciala (Songstad i colab., 1995). Catodul este conectat cu o pipet subire ce conine ADN inclus ntr-o cantitate mic de agar (sau agaroz). Pipeta atinge embrionul vegetal, la nivelul meristemului apical. De asemenea, embrionul este atins la extremitatea bazal de o a doua pipet, ce conine tampon specific, ea fiind conectat cu anodul. Electroforeza se realizeaz timp de o or, la un curent de 0,1mA i 2-10V/cm, sensul de migrare fiind de la catod la anod. Evidenierea prezenei genei de interes (a exprimrii sale tranzitorii) la nivelul embrionului se realizeaz dup electroforez, prin utilizarea unor probe de ADN marcat (de obicei, prin hibridizare "in situ"). Eficiena metodei este influenat de anumii factori fizici asociai cu esutul vegetal, precum i de factori chimici cum ar fi: valoarea pH, cationii divaleni, compoziia tamponului de electroforez. Pe lng aceast metod de transfer direct de gene au mai fost raportate i altele: transformarea polenului sau introducerea ADN n sacii polinici; macroinjectarea, care const n introducerea ADN la nivelul unor esuturi conductoare de la baza meristemului floral imatur de secar; utilizarea microlaserului pentru a produce "guri" n peretele celular i membrana plasmatic prin care s poat ptrund moleculele de ADN. Toate aceste tehnici au fost aplicate sporadic, rezultatele fiind discutabile. Moleculele de ADN recombinant purttoare de informaie genetic nou vor asigura proprieti noi celulelor receptoare, indiferent de metoda utilizat pentru introducerea ADN de interes n celulele gazd. Aceste noi proprieti se transmit descendenilor, putndu-se menine stabil la lungul generaiilor, oferindu-se astfel posibilitatea multiplicrii, dup dorin, a noii informaii genetice. 2.1.6. Selecia i analiza clonelor recombinate Una dintre etapele eseniale ale tehnologiei ADN recombinant este reprezentat de detectarea i selecia celulelor gazd transformate, adic a celor ce conin fragmentul de ADN dorit. Aceast etap este foarte dificil de realizat dar absolut necesar, mai ales n cadrul experienelor de tip "shotgun" prin care se cloneaz o populaie mare de fragmente heterogene (a unor fragmente de ADN genomic sau a ADNc). Selecia clonelor ce conin vectorul recombinat se face pe mediu selectiv ce conine un antibiotic sau prin metode histochimice
93

TEHNOLOGIA ADN RECOMBINANT

(exemplu testul Xgal). Rezult astfel o colecie de fragmente de ADN genomic, propagate de obicei ntr-o bacterie (E.coli), ceea ce constituie o "banc" sau "bibliotec" de gene. De remarcat ns c, aceast banc de gene conine o gam foarte variat de clone, astfel c se pune problema seleciei acelor celule, respectiv colonii, care conin ADN de interes. 2.1.6.1. Selecia clonelor recombinate i a genelor de interes Selectarea clonelor recombinate i, prin urmare, a genelor de interes se poate realiza prin utilizarea unor metode variate care au fost grupate n trei categorii principale: metode microbiologice, genetice i imunochimice, ele presupunnd: utilizarea unor "sonde" de ADN sau ARN complementare secvenei de interes; selectarea produsului genei clonate prin folosirea anticorpilor anti-proteina respectiv; utilizarea unor teste de evideniere a activitii proteinei de interes; amplificarea prin PCR a secvenei clonate i analiza ei prin subclonare; determinarea secvenei de nucleotide sau modificarea acesteia prin mutageneza la situs-specific etc. 2.1.6.1.1. Metode microbiologice Aceste metode sunt dintre cele mai simple deoarece se bazeaz pe evidenierea indirect a ADN recombinant prin detectarea prezenei unui marker genetic, cum ar fi dobndirea sau pierderea rezistenei la un anumit antibiotic. Se mai poate utiliza i apariia unei noi proprieti ce este codificat de gena strin, inserat n vector sau a unei necesiti nutritive. Dobndirea capacitii de a sintetiza o anumit enzim sau prezena produilor ei de metabolism se poate face prin teste simple, ce vizeaz modificarea culorii unui indicator specific (teste histochimice). Aceast proprietate presupune, de exemplu, integrarea ntr-un vector a genei lacZ ce conine un situs multiplu de clonare; clonarea genei de interes la nivelul acestui situs duce la dispariia culorii caracteristice (albastre) a coloniilor bacteriene aprute pe mediul de cultur ce conine substratul specific (Xgal). Aceasta este situaia vectorilor de clonare din categoria plasmidelor pUC (pUC18, pUC19), dar i a unor fagimide (pBluescript), sistemul permind diferenierea coloniilor purttoare de plasmide recombinate de cele
94

TEHNOLOGIA ADN RECOMBINANT

nerecombinate, pe baza modificrii culorii lor dup cultivarea pe mediu de cultur ce conine substratul X-gal i a inductorului, IPTG. n cazul n care scopul experimentelor este obinerea unei bnci de gene, este necesar o cale mai rapid pentru selecia bacteriilor ce conin vectori recombinani. Pentru a evita manipularea a mii de colonii n scopul detectrii celor recombinate, au fost realizai vectori ce permit selecia direct a clonelor respective. Aa este vectorul pUN121, derivat din pBR322, la care gena pentru rezisten la tetraciclin a fost clonat sub controlul promotorului PR, izolat din genomul bacteriofagului . De asemenea, vectorul conine gena cI, al crei produs regleaz activitatea promotorului viral. In acest mod, transcrierea pornind de la promotorul PR este represat de produsul genei reglatoare cI. Prin urmare, celulele ce poart un asemenea vector vor fi sensibile la tetraciclin i rezistente numai la ampicilin. La rndul ei, gena cI conine o secven MCS, la nivelul creia se gsesc situsuri unice de recunoatere pentru enzimele de restricie Eco RI, Hind III, Bcl I i Sma I. Clonarea la nivelul MCS a unui fragment de ADN exogen determin inactivarea inserional a genei cI, ceea are ca efect activarea promotorului PR. n acest mod, celulele care conin plasmide recombinate vor deveni rezistente i la tetraciclin, ele putnd fi rapid selectate prin simpla cultivare pe mediu cu tetraciclin. 2.1.6.1.2. Metode imunochimice Pentru identificarea i izolarea celulelor care conin vectori cu ADNc de origine eucariot se poate folosi capacitatea acestora de a determina sinteza n E.coli a unor molecule proteice funcionale. Pentru a simplifica evidenierea acestora se folosesc anticorpi specifici proteinelor de interes, marcai de obicei radioactiv. Identificarea i analiza produsului sintetizat de clonele recombinate este deosebit de important, deoarece numai pe baza lor se poate stabili succesul sau insuccesul experimentului. De asemenea, pentru a demonstra existena ntr-o anumit prob a produsului unei gene de interes se poate folosi i una dintre variantele testului ELISA (Enzyme Linked Immunosorbent Assay), al crui principiu este asemntor celui ce folosete anticorpi marcai radioactiv (test RIA), numai c se utilizeaz marcarea biochimic n locul celei radioactive (fig.46).

95

TEHNOLOGIA ADN RECOMBINANT

Fig.46. Reprezentarea schematic a detectrii produilor de interes (sintetizai de clonele recombinate) prin utilizarea metodei imunochimice

n principiu, acest test utilizeaz imobilizarea antigenului (sau substana pe care vrem s o detectm) pe un suport solid, dup care se cupleaz cu anticorpul specific. Dac antigenul este solubil, atunci se imobilizeaz anticorpii corespunztori i se trateaz cu antigenul. Dup splarea complexului format (pentru ndeprtarea anticorpilor nelegai, sau a antigenului, n cazul celei de-a doua variante), se adaug un al doilea tip de anticorpi, ce recunosc anticorpii anteriori. Ei sunt cuplai cu o enzim (fosfataz alcalin, peroxidaz) a crei activitate poate fi uor evideniat prin teste spectrofotopmetrice. In final, dup ndeprtarea anti-anticorpilor nelegai, se determin activitatea enzimei cuplate folosindu-se un substrat specific (de obicei cromogen). Spre exemplu, folosirea n experiment a conjugatului anti-anticorp - fosfataz alcalin determin transformarea substratului cromogen -nitrofenolfosfat (incolor) n nitrofenol, compus de culoare galben, intensitatea culorii fiind evaluat colorimetric. 2.1.6.1.3. Metode genetice Acestea permit detectarea cu mare sensibilitate i eficien a genelor incorporate n vectorii de clonare. Se utilizeaz teste de hibridare n care identificarea coloniilor bacteriene sau a plajelor de liz ce poart genele dorite se face cu ajutorul "sondelor" moleculare. Coloniile sau plajele de liz supuse analizei sunt reluate pe filtre de nitroceluloz sau membrane de nylon i apoi incubate cu proba de ADN sau ARN (sau cu anticorpi specifici) (fig.47). Atunci cnd secvena genei clonate este cunoscut, se utilizeaz probe specifice sau foarte nrudite. Sondele moleculare marcate cu 32P sunt folosite ca "undi" molecular pentru a identifica acele colonii care poart ADN corespunztor, complementar, de care rmn legate

96

TEHNOLOGIA ADN RECOMBINANT

i sunt evideniate prin autoradiografie. ARNm se leag specific de gena corespunztoare, chiar dac aceasta este "ascuns" printre alte sute sau mii de gene.

Fig.47. Selecia clonelor recombinate (plaje de liz) prin utilizarea "sondelor" moleculare A placa cu plajele de liz ce vor fi analizate; B filtru de nitroceluloz; C filtrul de nitroceluloz pe care s-au adsorbit fagii din plajele de liz; D - soluie ce conine sonda de ADN marcat cu 32P. 1 acoperirea plcii iniiale (ce conine plajele de liz de interes) cu filtrul de nitroceluloz; 2 ndeprtarea proteinelor fagice i legarea ADN fagic la filtru; 2 adugarea soluiei cu sonda marcat; 3 cuplarea sondei ADN la nivelul zonelor de complementaritate din ADN fagic legat de filtru; 4 expunerea filtrului cu hibrizii ADN-ADN la radiaii X (autoradiografie); 5 developarea filmului, compararea cu placa originar, alegerea plajelor recombinate i purificarea moleculelor de interes.

Deoarece purificarea unui anumit tip de ARNm este dificil i niciodat perfect, se recurge la obinerea unui ADN complementar fa de el, care apoi se leag de gena de interes la fel de specific ca i ARNm. Tehnicile din aceast categorie folosesc molecule de ARNm marcate radioactiv sau fragmente de ADNc, lungi de 14 - 18 nucleotide, cu secvena identic sau foarte apropiat de unele regiuni ale ADN cutat. Pentru identificarea coloniilor bacteriene care poart o plasmid cu ADNc specific se aplic o folie de nitroceluloz pe suprafaa mediului de cultur, n aa fel nct atunci cnd aceasta este ridicat, o parte dintre celulele din fiecare colonie sunt reluate pe filtru, iar altele rmn pe plac. Aranjarea coloniilor pe plac i pe filtru este identic. Filtrul de nitroceluloz este tratat cu soluii ce determin liza celular, apoi cu NaOH pentru denaturarea ADN iar n
97

TEHNOLOGIA ADN RECOMBINANT

final, dup uscarea filtrelor, se aplic ADNc marcat. Moleculele marcate hibridizeaz cu secvenele omoloage din structura plasmidei recombinate, fapt evideniat prin autoradiografie. De multe ori ns, nu se cunoate nimic despre secvena de nucleotide a genei, astfel c proba de ADN folosit este reprezentat de o secven oligonucleotidic sintetic (obinut "in vitro" pe baza secvenei de aminoacizi a proteinei de interes). Secvenele nucleotidice de interes pot fi identificate prin hibridizare, dup separarea electroforetic (n gel de agaroz) a fragmentelor de ADN rezultate, de obicei, prin clivare cu enzime de restricie (fig.48).

Fig.48. Reprezentarea schematic a etapelor implicate n detectarea unei gene de interes (de exemplu, a genei pentru -globin (adaptare dup Mathew, 1983)

Tehnica, elaborat n 1975 de ctre Southern, presupune mai multe etape de lucru: purificarea moleculelor de ADN; migrarea electroforetic; transferul fragmentelor de ADN pe filtre de nitroceluloz; hibridizare, n condiii speciale, cu proba de ADN marcat (32P); autoradiografia, ce presupune expunerea membranelor de nitroceluloz marcate la un film sensibil la radiaii X, timp de mai multe zile, urmat de developare i fotografiere. Metoda Southern este laborioas i folosete probe de ADN sau ARNm marcate radioactiv, dar rezultatele sunt precise (fig.49) .
98

TEHNOLOGIA ADN RECOMBINANT

Fig.49. Detectarea unor secvene de ADN de interes (de exemplu, gena pentru -globina uman) prin utilizarea metodei Southern (dup Mathew, 1983). A = separarea electroforetic a ADN clivat cu enzime de restricie; B = autoradiografia fragmentelor separate electroforetic prin utilizarea unei probe de ADN marcat.

Exist i variante ale metodei descrise de Southern, care permit identificarea, dup separare electroforetic, a unor molecule de ARN sau a unor proteine. Astfel, metoda Northern const n identificarea moleculelor de ARN de interes, dintr-un amestec supus separrii electroforetice; n acest caz, sonda molecular este un fragment de ADN, complementar cu ARN cutat. In schimb, metoda Western se refer la identificarea unor proteine de interes (de exemplu, a celor recombinate sau a celor doficiate de genele clonate). Dup separarea proteinelor prin electroforez n gel de poliacrilamid, ele sunt reluate pe filtre de nitroceluloz, iar evidenierea se face cu ajutorul anticorpilor specifici. n ultimii ani, au fost puse la punct metode de identificare "in situ" a secvenelor de ADN dorite, prin marcare neradioactiv sau radioactiv. Tehnicile de hibridizare "in situ" permit detectarea unor secvene specifice de ADN direct n cromosomi, n celule sau pe seciuni de esuturi variate. Combinat cu tehnici de imunocitochimie, hibridizarea "in situ" permite obinerea de informaii asupra localizrii celulare i a funciei genei (la nivel de ADN, ARNm i proteine). Datorit condiiilor speciale pe care le necesit folosirea probelor marcate radioactiv, efortul cercettorilor s-a ndreptat spre gsirea unor modaliti de marcare neradioactiv a "sondelor" moleculare. n prezent exist dou categorii de metode de hibridizare neradioactiv: metoda direct i metoda indirect. Metoda direct presupune ca molecula de ADN marcat s se lege direct la probele de acizi nucleici de studiat, iar hibrizii formai s fie vizualizai imediat la microscop. Spre exemplu, marcarea terminal cu fluorocromi a unor probe de ARN (prin utilizarea unor
99

TEHNOLOGIA ADN RECOMBINANT

nucleotide marcate ce sunt incorporate ntr-o molecul de ARN) i introducerea lor n celulele int va permite, ulterior identificarea celular a hibrizilor fluoresceni. Metoda indirect presupune ca proba ce conine molecula marcat s fie detectabil prin citochimie de afinitate. In acest fel, moleculele marcate trebuie s fie accesibile anticorpilor. Pentru atinge acestui scop au fost elaborate mai multe sisteme, dintre care dou sunt mai mult utilizate: sistemul biotin-streptavidin i sistemul de detectare cu digoxigenin. n cazul folosirii digoxigeninei (steroid izolat de la speciile Digitalis lanata sau D.purpurea), aceasta este legat la uridin-trifosfat (UTP), la nivelul carbonului din poziia 5 a nucleului pirimidinic prin intermediul unui "bra" spaiator format din 11 atomi de carbon. Nucleotidele astfel marcate sunt apoi incorporate enzimatic ntr-o prob de acizi nucleici, ele fiind acceptate ca substrat att de ADN polimeraze (ADN-polimeraza de la E.coli, ADN-polimeraza de fag T4, reverstranscriptaza, Taq-polimeraza) i terminaltransferaz, ct i de ARN-polimeraz. Amestecul de marcare neradioactiv conine, pe lng una dintre enzimele menionate mai sus, cele patru nucleotide nemarcate (dATP, dCTP, dTTP i dGTP), UTP-marcat cu digoxigenin, un tampon corespunztor (Tris-HCl, pH 7,5), ioni de magneziu, ditiotreitol i albumin seric bovin. Incorporarea nucleotidei marcate se realizeaz la fiecare a 20-a sau 25-a nucleotid (nlocuind dTTP al crei analog este), la temperatura de 20oC. Detectarea probelor hibride (ADN de interes + proba marcat cu digoxigenin) se realizeaz cu anticorpi anti-digoxigenin, conjugai cu o enzim (fosfataza alcalin, peroxidaz) sau cu un colorant fluorescent (fluorescein sau rodamin). n cazul utilizrii anticorpilor anti-digoxigenin conjugai cu fosfataza alcalin sau peroxidaz, identificarea hibrizilor se face prin folosirea unor substraturi cromogene: n prezena enzimei are loc modificarea culorii substratului, detectarea realizndu-se colorimetric sau histochimic. Atunci cnd se folosesc anticorpi anti-digoxigenina conjugai cu fluorocromi, identificarea se face dup iluminare specific, prin microscopie cu fluorescen, fluorimetrie (fluorescen galben, roie sau albastr, n funcie de markerul utilizat). Atunci cnd se prefer marcarea cu biotin (substan ce face parte din grupul vitaminelor B, numindu-se i vitamina H), etapele de lucru sunt asemntoare celor descrise mai sus, pentru digoxigenin. Detectarea se poate face fie cu anticorpi anti-biotin, fie cu streptavidin (sau avidin). Aceasta substan, izolat fie de la anumite tulpini bacteriene (Streptomyces avermectilis produce streptavidin), fie din albu de ou (avidina), este preferat

100

TEHNOLOGIA ADN RECOMBINANT

pentru detectarea hibrizilor marcai. Recent, gama de nucleotide biotinilate s-a lrgit la adenozin i citidin-trifosfai, nucleotidele marcate fiind analogi ai celor naturale. 2.1.6.2. Analiza secvenelor de ADN clonate Dup clonare i selecia clonelor recombinate, fragmentul sau fragmentele de ADN de interes pot fi analizate prin mai multe metode. Pe de o parte, se pot utiliza diverse enzime de restricie pentru clivarea ADN clonat, dup care fragmentele obinute sunt analizate prin electroforez n gel de agaroz. De asemenea, gena de interes poate fi amplificat prin utilizarea tehnologiei PCR, subclonat ntr-un vector specific i introdus ntr-o gazd nou, sau gena poate fi modificat prin mutagenez "in vitro" iar funciile sale (modificate) sunt studiate ulterior. 2.1.6.2.1.Determinarea secvenei de nucleotide a fragmentului de ADN de interes n multe experimente de tehnologia ADN recombinant este necesar ca, n final, s se stabileasc secvena de nucleotide din diferite fragmente de ADN, fie chiar a ntregului genom al unui organism. Pentru aceasta au fost elaborate mai multe metode de secveniere, toate presupunnd ns etape de lucru laborioase i posibilitatea tehnic a separrii electroforetice a fragmentelor rezultate (deci aparatur special de electroforez). Primul organism viu la care s-a determinat secvena de nucleotide a fost Haemophilus influenzae, anterior obinndu-se notabile doar n cazul genomurilor unor virusuri (tabelul 5). Pn n prezent a fost determinat secvena de nucleotide de la peste 800 categorii de genomuri, dintre care majoritatea sunt virusuri (599), 20 bacteriofagi, 205 plasmide, 185 organite, 38 genomuri procariote dintre care 8 sunt arhebacterii, 30 aparin eubacteriilor, iar patru sunt eucariote. Trebuie ns precizat faptul c, deseori, descifrare complet nseamn de fapt determinarea a aproape ntregii secvene de nucleotide, aa cum este cazul genomului uman, a crui descifrare aproape complet (94%) a fost comunicat n februarie 2001 (Harry, 2001). La lista prezentat n tabelul 5 se adaug, din 2001, secvenierea genomului de 130Mb al speciei Arabidopsis thaliana, iar din aprilie 2002 cea a genomului de orez (Oryza sativa ssp.japonica)(Goff i colab., 2002).

101

TEHNOLOGIA ADN RECOMBINANT

Tabelul 5. Organisme la care s-a determinat secvena de nucleotide din ADN genomic (dup Melcher, 2000)
Organismul x174 SV40 CaMV VMT Bacteriofagul Virusul vaccinei Citomegalovirus Haemophilus influenzae Mycoplasma genitalium Methanococcus jannaschi Escherichia coli Saccharomyces cerevisiae Caenorhabditis elegans Drosophila melanogaster Homo sapies Mrimea genomului secvenializat 5,4 kb 5,8 kb 8 kb 6,3 kb 48,5 kb 192 kb 229 kb 1,9 Mb 0,58 Mb 1,66 Mb 4,3 Mb 13 Mb 100 Mb 170 Mb 3000 Mb Anul determinrii secvenei 1977 1979 1980 1982 1982 1990 1991 1995 1995 1996 1997 1996 1998 2000 2001

Pentru obinerea secvenelor oligonucleotidice din ADN supus analizei pot fi utilizate dou metode: metoda propus de Sanger (1975) sau metoda descris de Maxam i Gilbert (1980). Metoda Sanger presupune folosirea ADN monocatenar pentru stabilirea secvenei de nucleotide. Acesta poate fi obinut fie prin denaturarea ADN dublu catenar (izolat printr-o metod specific), fie prin clonarea fragmentelor de interes n vectori de tip fagimide i apoi stabilirea condiiilor de producere a ADN monocatenar (prin inducerea multiplicrii ca fag filamentos a vectorului). Indiferent de metoda folosit pentru obinere, ADN monocatenar este folosit ca matri pentru aciunea ADN polimerazei I de la E.coli, la amestec fiind adugate toate cele patru dezoxiribonucleotide (dintre care una marcat radioactiv cu
32

P)

precum i o scurt secven complementar sintetizat in vitro, ce va fi folosit drept primer. Primerul se ataeaz specific la regiunea de omologie, de la nivelul su ncepnd sinteza enzimatic a unor secvene de 15-300 nucleotide. n cadrul acestei metode exist dou variante de lucru: metoda "plus i metoda minus", ambele metode prezentnd primele etape comune (fig.50). ADN polimeraza este utilizat mai nti pentru a asigura sinteza unei catene complementare catenei matri, ea coninnd ns dNTP marcate. Deoarece sinteza nu este sincronizat se vor obine oligonucleotide de diferite lungimi.
102

TEHNOLOGIA ADN RECOMBINANT


Catena de ADN utilizat ca matri3'---------G-C-T-C-G-C-A-T-----5' Primer 5'---3' ADN polimeraza + amestec de dNTP (dintre care una marcat cu 32P) 3'---------G-C-T-C-G-C-A-T-----5' 5'---------C-G-A-G-C-G-T-A 5'---------C-G-A-G-C-G-T copii complementare marcate 5'---------C-G-A-G-C-G 5'---------C-G-A-G-C 5'---------C-G-A-G 5'---------C-G-A 5'---------C-G 5'---------C Sistemul "minus" (polimerizare n absena G, de ex.) 3'---------G-C-T-C-G-C-A-T-----5' 5'---------C-G-A-G-C-G-T-A----3' 5'---------C-G-A-G-C-G-T-A 5'---------C-G-A-G-C-G-T-A 5'---------C-G-A-G-C 5'---------C-G-A-G-C 5---------C-G-A 5'---------C-G-A 5'---------C Sistemul "plus" (polimerizare n prezena G, de ex.) 3'---------G-C-T-C-G-C-A-T-----5' 5'---------C-G-A-G-C-G 5'---------C-G-A-G-C-G 5'---------C-G-A-G-C-G 5'---------C-G-A-G 5'---------C-G-A-G 5'---------C-G 5'---------C-G

Fig.50. Determinarea secvenei de nucleotide a unui fragment de ADN prin utilizarea metodei "plusminus" (dup Gaastra i Oudega, 1983)

n metoda "minus", dup ndeprtarea nucleotidelor neutilizate, amestecul de oligonucleotide cuplate cu matria este reincubat cu ADN polimeraza, dar n absena uneia dintre cele patru dNTP.

103

TEHNOLOGIA ADN RECOMBINANT

Sinteza se desfoar pn cnd, n catena ce se sintetizeaz, ar trebui inclus nucleotida lips. n acest fel, sinteza se va termina, la toate secvenele nucleotidice din amestec, la captul 3' al acestora, la nivelul nucleotidei ce precede nucleotida absent. Deoarece n experimente se realizeaz patru variante diferite (de fiecare dat omindu-se cte o nucleotid), se poate obine un set complet de oligonucleotide ce respect principiul descris mai sus. Noile catene sintetizate sunt apoi separate de matri lor i supuse electroforezei n gel de poliacrilamid, n prezena unei concentraii foarte mari de uree (8M), n final detectarea fragmentelor oligonucleotidice monocatenare fcndu-se prin autoradiografie. n cazul metodei "plus", amestecul de oligonucleotide marcate, obinute n prima etap, este supus aciunii ADN polimerazei de fag T4 care, datorit activitii sale exonucleazice n sensul 3'-5', degradeaz ADN dublu catenar, ncepnd cu captul 3'. n plus, n amestecul de reacie este introdus o anumit dNTP, astfel c aciunea exonucleazic se oprete la nivelul nucleotidei care este prezent n amestecul de incubare (fig.50). n privina variantei cu dideoxinucleotide (Gaastra i Oudega, 1983), principiul metodei este urmtorul: se creeaz condiiile sintezei unei catene complementare matriei de ADN (a crei secven se dorete a fi cunoscut), prin utilizarea unei ADN polimeraze I Klenow (lipsit de activitate exonucleazic 5'3'). Sinteza este iniiat de un primer complementar cu o secven specific de la captul 3' al matriei i continuat n prezena celor patru dNTP, dintre care una este marcat cu 32P. ncheierea sintezei ADN complementar este determinat de adugarea la amestecul de reacie a unor analogi ai dNTP, aa cum sunt analogii de tip 2'-3'-dideoxy (ddNTP): ddATP, ddCTP, ddTTP, ddGTP, sau cei de tip -D-arabinofuranosil) (fig. 51). Analogii ddNTP nu mai conin grupri hidroxil la nivelul atomilor de carbon din poziiile 2' i 3' ale pentozei. n acest fel, deoarece pentru alungirea catenei noi de ADN este necesar adugarea de nucleotide la nivelul captului 3'-OH, aceasta este blocat n prezena ddNTP corespunztor (fig.51). Dup ncheierea sintezei n toate cele patru variante de ddNTP adugat, se obin oligonucleotide cu dimensiuni diferite (deoarece sinteza nu este sincronizat) care, dup ce au fost supuse aciunii unei enzime de restricie pentru a ndeprta primerul, sunt denaturate prin nclzire n prezena formamidei. ADN monocatenar obinut este supus electroforezei i apoi detectrii prin autoradiografie.

104

TEHNOLOGIA ADN RECOMBINANT


Catena de ADN utilizat ca matri3'---------G-C-T-C-G-C-A-T-----5' Primer 5-.. 3' ADN-polimeraza + amestec de dNTP (dintre care una marcat)

+ddGTP 5' C-G-A-G-C-ddG 5' C-G-A-ddG 5C-ddG

+ddATP

+ddTTP

+ddCTP 5' C-G-A-G-ddC 5' ddC

5' C-G-A-G-C-G-T-ddA 5' C-G-A-G-C-G-ddT 5' C-G-ddA

Fig.51. Determinarea secvenei de nucleotide a unui fragment de ADN prin utilizarea metodei dideoxinucleotidelor (dup Gaastra i Oudega, 1983).

Metoda Maxam i Gilbert presupune utilizarea unui anumit segment de ADN monocatenar care este mai nti este tratat cu fosfataz alcalin pentru a elimina radicalul 5 fosfat, apoi se adaug ATP, marcat cu
32

P, i polinucleotid-kinaz care ataeaz

32

P la

nucleotida de la captul 5'. Probele marcate astfel obinute sunt supuse unor tratamente care asigur clivarea specific a secvenei de ADN, la nivelul unor situsuri cunoscute (sunt rupte legturile fosfodiesterice dintre dou nucleotide, dintre una este cunoscut) (fig.52).

Fig.52. Reprezentarea schematic a metodei de secvenializare elaborat de Maxam i Gilbert (1977)


105

TEHNOLOGIA ADN RECOMBINANT

Exist diferite modaliti de tratament ale probei de interes care asigur realizarea mai multor variante de clivare: clivarea guaninei presupune ca ADN de studiat s fie tratat, fie cu dimetilsulfat ce determin metilarea guaninei n poziia 7 i a adeninei n poziia 3, fie, mai rar, cu ageni chimici care distrug guanina. Urmeaz apoi supunerea moleculei de ADN metilat la aciunea piperidinei care determin ruperea legturilor fosfodiesterice alturi de poziia ocupat de guanin; clivarea guaninei-adeninei presupune tratarea ADN metilat cu dimetilsulfat cu piridin-formiat. Aceasta face ca tratarea ulterioar cu piperidin s determine clivarea legturilor fosfodiesterice ori de cte ori n segmentul de ADN apare A sau G; clivarea timinei-citozinei presupune ca ADN de interes s fie mai nti supus aciunii hidrazinei care interacioneaz specific cu timina i citozina, iar apoi, amestecul obinut, este tratat cu piperidin care cliveaz legturile fosfodiesterice din secvena de ADN ori de cte ori apar nucleotidele de tip dTTP sau dCTP; clivarea citozinei se realizeaz n aceleai condiii ca i cele descrise mai sus, cu excepia faptului c prima reacie, cea cu hidrazin, se face n prezena NaCl 5M care inhib aciunea acesteia la nivelul timinei. n acest fel, tratarea probei de ADN cu piperidin determin clivarea legturilor fosfodiesterice doar la nivelul citozinei (fig.53).

Fig.53. Evidenierea comparativ a autoradiografiilor unor geluri de secveniere obinute prin tehnica Sanger (gelul din stnga secvena de nucleotide a genei pentru o lipaz de la obolan) sau prin tehnica Maxam i Gilbert (gelul din dreapta secvena de nucleotide a genomului virusului hepatitei B) (dup Etienne i Clauser, 2001).

106

TEHNOLOGIA ADN RECOMBINANT

n prezent au fost elaborate sisteme automatizate de determinare a secvenei de nucleotide a genelor i de analiz computerizat a acesteia. Cunoscnd secvena de nucleotide dintr-o gen se poate deduce foarte simplu secvena de aminoacizi din proteina codificat. De asemenea, perfecionarea vectorilor de clonare i a metodelor de amplificare genic prin PCR au permis o mai bun analiz a genelor clonate. Spre exemplu, vectorii derivai de la fagul M13 asigur clonarea genei de interes la nivelul unui situs multiplu de clonare aflat n gena lacZ, n apropierea unei secvene "primer universal" ("universal sequencing primer" = USP), iar dup multiplicarea sa sub form monocatenar (prin activarea funciilor fagului filamentos), gena poate fi folosit pentru secveniere (fig.54.).

Fig.54.Utilizarea vectorului M13sup18 pentru clonarea i apoi secvenierea genei de interes. 1 clivarea vectorului de clonare cu EcoRI; 2 integrarea ADNc la nivelul vectorului linearizat (integrarea se poate face n ambele orientri); 3 transformarea celulelor competente de E.coli i cultivarea pe mediu cu Xgal; 4 plaje albe recombinate; 5 plaje albastre nerecombinate; 6 cultivarea fagilor recombinai i utilizarea ADN monocatenar pentru secvenializare. USP = secvena primer universal (universal primer sequence); L = polilinker ce conine situsul de recunoatere pentru EcoRI; P = promotorul genei lac Z.
107

TEHNOLOGIA ADN RECOMBINANT

Dup tratarea vectorului linearizat cu o enzim de restricie cu fragmentul de ADN de interes i adugarea la acest amestec a ligazei, are loc transformarea celulelor de E.coli. Selecia se face pe plci cu X-gal, dup inducerea cu IPTG, obinndu-se "spoturi albastre", corespunztoare celulelor de E.colilizate ce conineau vectorul nerecombinat, respectiv "spoturi" albe, reprezentate de celulele bacteriene recombinate lizate (transformate cu vector recombinat). Particulele fagice recombinate sunt apoi izolate din plajele de liz corespunztoare, din ele fiind extras apoi ADN monocatenar ce poate fi utilizat drept matri pentru secveniere, folosindu-se drept primer o secven oligonucleotidic sintetic, complementar USP din vector. In experimente similare se pot utiliza i fagimidele care permit multiplicarea genei clonate fie n cadrul plasmidei fie, dup adugarea unui fag ajuttor, sub form de monocatene, ceea ce face ca protocolul de secveniere s fie mai simplu. Au mai fost elaborate i alte metode de obinere a ADN a crui secven se dorete a fi determinat, cum ar fi tehnica PCR-asimetric ("asymmetric PCR")(Innis i colab., 1990). Spre deosebire de tehnica PCR "clasic" n urma creia se obin fragmente de ADN dublu catenar, varianta sa "asimetric" presupune utilizarea unor cantiti diferite din cei doi primeri necesari amplificrii secvenei dorite (n raport de 1/100) astfel c, reacia de sintez a fragmentelor de ADN dublucatenar se oprete n momentul n care unul dintre primer nu mai este accesibil. Din acest moment, sinteza continu folosindu-se un singur primer, obinnduse doar una dintre cele dou catene ale fragmentului de interes. ADN monocatenar sintetizat prin aceasta metod este suficient din punct de vedere cantitativ pentru a fi supus secvenierii (de obicei prin utilizarea metodei Sanger, cu dideoxinucleotide). 2.1.6.2.2. Mutageneza "in vitro" Aa cum se cunoate, mutageneza poate fi definit ca fiind procesul de modificare a structurii ADN (sau a ARN, n cazul ribovirusurilor), care nu este consecina recombinrii genetice. Cele mai multe mutaii au consecine fenotipice evidente dar, n anumite situaii, efectele nu sunt vizibile, mutaiile fiind "tcute" ("silenioase"). Mutageneza "n vitro" poate fi utilizat pentru modificarea controlat a secvenei de nucleotide a unei gene, urmat de introducerea acesteia ntr-o gazd corespunztoare i apoi studierea funciilor acesteia. n acest caz, cercetrile experimentale pornesc de la secvena genei i apoi se examineaz funcia acesteia, deci invers fa de experimentele "clasice" (cnd
108

TEHNOLOGIA ADN RECOMBINANT

se pornete de la protein i se caut gena codificatoare). Din acest motiv, acest tip de abordare permis de tehnologia ADN recombinant a primit denumirea de "genetic invers" ("reverse genetics"). Strategia general pentru experimentele de mutagenez "in vitro" este urmtoarea: ADN de interes introdus ntr-un vector de clonare adecvat este supus unui anumit tip de mutagenez i apoi este transferat ntr-o gazd corespunztoare (de obicei E.coli). Se obin n acest caz diferite organisme recombinate ce permit studierea funciilor modificate (sau nu) ale ADN de interes. Modificarea secvenei de nucleotide se poate face la ntmplare, prin mutagenez "clasic" cu ageni mutageni obinuii (fizici sau chimici), sau prin inducerea unor greeli de incorporare a nucleotidelor cu ajutorul unor enzime (cum ar fi, reverstranscriptaza produs de virusul mieloblastozei aviare). Consecinele acestor tratamente pot fi de tipul deleiilor, adiiilor, substituiilor, inversiilor etc. n ultimii ani au fost elaborate metode de mutagenez la situs-specific care asigur modificarea controlat (prin adiii, deleii sau substituii de nucleotide) a unei anumite secvene de ADN. Un exemplu de mutagenez la situs-specific este cel al utilizrii secvenelor de recunoatere pentru anumite enzime de restricie: la nivelul acestora se pot produce, n mod controlat, deleii sau adiii de nucleotide, modificndu-le. Spre exemplu, enzima EcoRI recunoate secvena GAATTC, determinnd n urma clivrii apariia unor capete monocatenare complementare. Dac, la nivelul extremitilor monocatenare sunt adugate nucleotidele complementare (sub aciunea ADN polimerazei i a dNTP corespunztoare), astfel nct s se refac structura dublu-catenar, se obin fragmente cu capete drepte ce pot fi reunite cu ajutorul ADN-ligazei. In acest fel sunt create molecule de ADN reasamblate, de dimensiuni mai mari dect cele de origine (prin inserarea a 4 nucleotide la nivelul fiecrui situs EcoRI iniial). Aceasta are ca rezultat pierderea secvenelor de recunoatere pentru EcoRI, iar consecina la nivelul genelor este modificarea cadrului de citire al mesajului genetic. n mod similar, prin tratarea cu nucleaza S1 a secvenelor lineare de ADN obinute cu EcoRI, are loc eliminarea extremitilor monocatenare complementare. Consecina final (dup legarea fragmentelor rezultate) este eliminarea din ADN iniial a unor secvene scurte de nucleotide (cte patru nucleotide de la nivelul fiecrui situs EcoRI) i, deci, modificarea cadrului de citire a mesajului genetic.

109

TEHNOLOGIA ADN RECOMBINANT

De asemenea, mutageneza la situs-specific se poate realiza prin diferite metode care depind de utilizarea de oligonucleotide sintetice pentru inducerea unui anumit tip de modificare a secvenei de nucleotide int. n principiu, mutageneza la situs-specific prin folosirea oligonucleotidelor sintetice se realizeaz n mai multe etape: introducerea ADN dublu-catenar n E.coli i selecia clonelor normale i a celor mutante (fig.55 );

Fig.55.Schem general a mutagenezei situs-specific prin utilizarea oligonucleotidelor

secvena de ADN de interes (ce va fi supus mutagenezei) este clonat ntr-un vector capabil s produc ADN monocatenar (vectori de tip fagimide); se induce obinerea de ADN monocatenar prin activarea funciilor fagice; se alege o secven de oligonucleotide sintetizat "n vitro" (de exemplu un primer mutant), capabil s recunoasc o zon omoloag din ADN int;
110

TEHNOLOGIA ADN RECOMBINANT

amestecarea ADN int cu oligonucleotidele sintetice mutante i crearea condiiilor de sintez a catenei complementare (prin adugarea de ADN polimeraz, dNTP i ADNligaz); O alt variant de mutagenez "in vitro" este aceea a introducerii la nivelul unei

molecule de ADN de analizat a unor linkeri. Inseria linkerilor se face dup ce ADN de interes a fost tratat cu DN-aza I (care taie ADN dublu-catenar n mod randomic, genernd molecule lineare). Legarea ulterioar a ADN linearizat cu linkerii respectivi determin obinerea mai multor tipuri de molecule de ADN modificate, ele fiind analizate dup introducerea i multiplicarea n E.coli (fig.56).

Fig.56. Reprezentarea schematic a mutagenezei in vitro prin inseria unui linker.

111

TEHNOLOGIA ADN RECOMBINANT

Mutageneza "in vitro" are numeroase aplicaii, ntre care sunt de menionat urmtoarele: permite caracterizarea unor regiuni ale ADN care controleaz exprimarea unei gene; a inaugurat domeniul "ingineriei proteice" care presupune realizarea unor modificri n produsul natural al unor gene astfel ca acesta s-i ndeplineasc rolul ct mai bine (stabilitate termic ridicat; sporirea activitii specifice; creterea rezistenei la aciunea unor inhibitori etc), ceea ce poate avea o semnificaie biotehnologic deosebit.

112