Protein Expression and PuriWcation 53 (2007) 404410 www.elsevier.

com/locate/yprep

A novel peptide tag for detection and puriWcation of recombinant expressed proteins
William T. Jones a,, Dawn Harvey a, Christopher Kirk a, Jasna Rakonjac b, Xiaolin Sun a, Nicky Frearson a, Taha Al Samarrai a
a

The Horticulture and Food Research Institute of New Zealand Ltd, Private Bag 11 030, Palmerston North, New Zealand b Institute of Molecular Biosciences, Massey University, Private Bag 11 222, Palmerston North, New Zealand Received 14 December 2006, and in revised form 10 January 2007 Available online 19 January 2007

Abstract Peptide tags have proven useful for the detection and puriWcation of recombinant proteins. However cross reactions of antibodies raised to the tag are frequently observed due to the presence of host proteins containing all or parts of the tag. In this report we have identiWed a unique viral peptide sequence, R-tag, that by blast searches is absent from the commonly expression hosts Arabidopsis thaliana, Escherichia coli, Pichia pastoris and mouse myeloma cell NSO. We have prepared monoclonal antibodies to this peptide and conWrmed the absence of this peptide sequence from the above genomes by Western blotting. We have also modiWed protein expression vectors to incorporate this sequence as a fusion tag in expressed proteins and shown its use to successfully purify recombinant proteins by immunoaYnity procedures. 2007 Elsevier Inc. All rights reserved.
Keywords: Peptide tag; R-tag; Expression vectors; ImmunoaYnity puriWcation; Monoclonal antibody; Single chain antibody fragment; RGL-2; Expression hosts

Expression of recombinant proteins in a variety of expression hosts has become an important approach to characterize gene products for post-genomic research. Alternative systems, such as bacteria, yeast, virus, plant and mammalian cells, for expression of proteins are necessary to obtain soluble, correctly folded and appropriately translational processed proteins similar to their native condition. Such recombinant proteins are required for production of antibody reagents, for functional assays, to characterize their native structure and for the development of aYnity reagents to identify interacting proteins. Generally these recombinant proteins require puriWcation from host cell proteins. To aid in the puriWcation steps, several diVerent tags have been developed and described [1]. These tags have been placed at either the N*

Corresponding author. Fax: +64 6 3517031. E-mail address: wjones@hortresearch.co.nz (W.T. Jones).

or C-terminus of the recombinant proteins and have been used to enhance the solubility of the protein i.e. maltose binding protein [2] and glutathione-S-transferase [3] or for puriWcation and detection i.e. small peptide tags such as polyhistidine [4], FLAG [5] and the sequence TKDPSRVG to which polyol-responsive MAbs have been prepared that allow antigens to be eluted from the aYnity matrix under mild non-denaturing conditions [6]. Problems frequently arise due to the short peptide tag occurring wholly or in part in proteins present in the expression host organism and resulting in co-puriWcation or detection of cross-reacting proteins. In this report we present results which use a novel peptide, R-tag, that is, by Western blotting, undetected in the commonly used protein expression hosts Escherichia coli [7], Arabidopsis thaliana [8], Pichia pastoris [9] or mouse myeloma cell line NSO [10] using high aYnity monoclonal antibodies reactive to R-tag. We also report the puriWcation, using immunoaYnity chromatography, of

1046-5928/$ - see front matter 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2007.01.006

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404410

405

R-tagged recombinant proteins A. thaliana DELLA RGL-2 [11], [12] N-terminal domain and a single chain antibody fragment (scFv)1 expressed in E. coli. Materials and methods Bovine serum albumin (BSA), RPMI culture media, HAT selection additive, fetal calf serum (Hybrimax), Lglutamine, sodium pyruvate, 2, 4, 10, 14-tetramethyl-pentadecane (Pristane), Tween 20, peroxidase-labelled goat anti-mouse IgG (Fc speciWc, A9303), peroxidase-labelled goat anti-rabbit IgG (A0545) and o-phenylene diamine (OPD) were obtained from Sigma Chemical Co., (St. Louis, MO, USA). Cell culture plasticware and microELISA Xat bottom F16 modules (Maxisorb) were obtained from Nunc (Roskilde, Denmark). Avidin (AV), biotin PEO-N-hydroxy succinimidyl ester), maleimidyl benzoic acid succinimidyl ester (MBS) were from Pierce Chemicals (Global Science, Auckland, New Zealand). Maleimidyl hexanoic acid succinimidyl ester (MHS) was from (Boehringer Mannheim, Germany). Mouse monoclonal antibody (MAb) isotyping kit was obtained from BioRad Laboratories (Auckland, NZ). Hi-Trap NHS-activated columns, PD10 desalting columns were from GE Healthcare (Auckland, NZ). Rabbit polyclonal antibodies (C18) to maltose binding protein (MBP) were from Santa Cruz Biotechnology. Monoclonal antibody BB7 raised against Arabidopsis RGL-2 was prepared in our laboratory (unpublished results). All other reagents and solvents were of analytical grade or better. Gel electrophoresis and Western blotting procedures SDSPAGE analysis [13] on 12% polyacrylamide gels followed by staining with Coomassie brilliant blue R was performed to monitor progress during protein puriWcation procedures and for screening of tissue and cell extracts. For Western blot analysis, proteins separated on 12% SDSPAGE gels were transferred to PVDF membrane. The membrane was blocked with 0.5% I-block (PerkinElmer, Australia) in phosphate buVered saline (PBS) containing 0.1% v/v Tween 20 (PBST), incubated with primary antibodies for 2 h at room temperature, washed with 0.1% w/v I-Block in PBST (3 times for 10 min) and incubated with peroxidase-labelled secondary antibody (1/20,000 dilution in blocking medium; 1 h at room temperature). The immuno-reactive protein bands were developed with chemiluminescence reagent (Western Lightning Plus, NEN Life Science Products) and imaged using a LAS 3000 (Fuji).

Synthesis and conjugation of R-peptide to BSA, KLH and AV R-peptide, H2N-CGGGPDQYEYKYP-amide was synthesized and puriWed to greater than 95% purity (Mimotopes, Melbourne, Australia) and coupled to carrier proteins, bovine serum albumin (BSA), keyhole limpet haemocyanin (KLH) and avidin (AV) using the heterobifunctional reagents maleimidyl benzoic acid succinimidyl ester (MBS) for BSA and AV conjugates, and maleimidyl hexanoyl succinimidyl ester (MHS) for KLH conjugates. BrieXy 5 l of 0.15 M MBS in DMF was added to BSA and AV (10 mg in 1 ml PBS) or 20 l of 0.15 M MHS to KLH (20 mg in 1 ml of PBS) and incubated at 23 C for 1 h. Excess reagent was removed from the activated protein by chromatography on PD10 columns equilibrated in 0.1 M phosphate buVer pH 6.7. Peptide (2.4 mg in 1 ml of phosphate buVer pH 6.7) was added to each of the proteins and incubated at room temperature for 2 h. Conjugates were puriWed from unbound peptides by gel Wltration on PD10 columns equilibrated in PBS and stored at 20 C. ELISA for screening of polyclonal and monoclonal antibodies Flat-bottomed 96-well polystyrene multi-wells (Nunc maxisorb) were incubated with R-peptide-BSA conjugate (200 ng BSA/ml PBS) for 3 h at 37 C and any remaining protein-binding sites were blocked by incubation with 2% BSA in PBS containing 0.02% sodium azide. Plates were stored at 4 C. Between addition of diVerent reagents, wells were washed six times with PBST. The presence of antibodies to R-peptide was determined by diluting sera or hybridoma culture media in 2% BSA/PBST and incubating the wells for 2 h at 37 C. Peroxidase-labelled goat anti-mouse (IgG Fc speciWc diluted 1/2000 in BSA/PBST; 50 l/well) was added to wells and incubated for 1 h at 37 C. Peroxidase substrate, (40 mg O-phenylene diamine, 40 l hydrogen peroxide in 100 ml of citrate/phosphate buVer pH 5.0; 200 l/well) was added to wells for 30 min and the reaction stopped by addition of 4 M sulphuric acid (50 l/well). Absorbance was measured at 492 nm on a Dynatec 5000 absorbance microwell spectrophotometer. Immunization of mice Four female mice (Balb/c PN X DBA) six to eight weeks old were immunized at intraperitoneal and subcutaneous sites with 100 g of KLH conjugates in Freunds complete adjuvant. The mice received a further three immunizations, at 28 day intervals, of 50 g of conjugate in incomplete Freunds adjuvant. Blood was taken from each mouse, prior to the Wrst immunization (pre-immune) and 10 days following the fourth immunization. Both pre-immune and immune sera were tested for the presence of antibodies against Rpeptide-BSA conjugates using ELISA. The mice with the strongest immunological reaction to R-peptide-BSA conjugate were immunized intravenously with 200 g of the

1 Abbreviations used: scFv, single chain antibody fragment; BSA, bovine serum albumin; OPD, o-phenylene diamine; MBS, maleimidyl benzoic acid succinimidyl ester; PBS, phosphate buVered saline; KLH, keyhole limpet haemocyanin.

406

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404410

peptide conjugate in PBS four days prior to the preparation of hybridoma. Production of hybridomas Hybridoma cells secreting MAbs to the R-peptide were prepared using electroporation by fusion of azoguanine resistant murine myeloma P3-NS-1-Ag4-1cells (NS-1; Flow Laboratories, Scotland) with splenocytes prepared from immunized mice. BrieXy spleen cells (1 108) were prepared in DMEM basal media (Sigma chemicals) containing 50 g/ ml DNAse1 and suspended at 5 107 cells/ml of media. Avidin conjugated peptide (20 g) was added to the cells and incubated for 2 h at 4 C using gentle rotation. NS-1 cells were washed three times in sterile PBS and suspended at a cell density of 107 cells/ml (10 ml) of PBS. NS-1 cells were tagged with biotin by addition of biotin-PEO -NHS (20 l; 20 mg/ml of DMF) for 30 min at room temperature. Both NS-1 and splenocytes were washed separately three times with DMEM/DNAse1 and suspended in 1 ml of the same media. Both cell types were combined and centrifuged at 380g for 5 min. Cells were suspended and incubated in 1 ml of DMEM for 30 min at room temperature, layered on to 10 ml of sterile isotonic sucrose (272 mM Sucrose, 2 mM phosphate pH 7.2, 1 mM MgCl2, 1 mM CaCl2) and centrifuged at 380g for 10 min at 4 C. The cell pellet was suspended in 1.6 ml of isotonic sucrose and fused, in 0.4 ml aliquots, in 0.4 mm gap electroporation cells using the Gene Pulser 2 electroporator (Bio-Rad Laboratories) with three pulses at 400 V at 1 F capacitance. Cells were diluted into 200 ml of culture media (RPMI media containing 10% fetal calf serum and 2X HAT) and plated at 100 l per well over twenty 96-well tissue culture plates containing 100 l per well of mouse thymocyte cells (4 106/ml of culture media without HAT). Hybridoma colonies were counted seven days post-fusion. Cultures were screened by ELISA, for antibodies to peptide-BSA conjugate, on day 12 when most wells were 70% conXuent. Positive cultures were immediately cloned by limiting dilution [14], propagated and frozen in culture media containing 10% DMSO by slow freezing in liquid N2 vapor and stored in liquid N2. Preparation of monoclonal antibodies Frozen hybridoma cells were rapidly thawed and washed in 10 ml of warm culture media. The cells were collected by centrifugation and suspended at 5 104 cells per ml culture media. Cells were propagated, collected by centrifugation, washed and suspended at 2 106 cells/ml in sterile PBS. Cell suspension (0.5 ml) was injected intraperitoneal into three month old Balb/c male mice. 1014 days after injection of cells, ascitic Xuid was collected, centrifuged to remove cellular material, and the supernatant Xuid frozen at 20 C. MAbs were puriWed using ammonium sulfate fractionation followed by aYnity chromatography on protein A Sepharose [15] as previously

described [16]. The concentration of antibody was determined by absorbance at 280 nm using an extinction coeYcient of 14.49 for a 1% solution of mouse gamma globulin. Immunoglobulin subclass of MAbs was determined using microELISA plates coated with R-peptide-BSA conjugates in combination with the mouse hybridoma isotyping ( Bio-Rad Laboratories). ModiWcation of vectors for expression of R-peptide labelled proteins The MBP-fusion bacterial expression vector pETM-41 (EMBL vector data: http://www.emblhamburg.de/geerlof/ webPP/genetoprotein/clo_vector/our_Ec_vectors. html) was modiWed by annealing and ligation of synthetic oligos, 5 CATGGGCGGCCGCCGCGGCGATATGGAATTCCT GCAGGGTACCGGATCCC-3 and 5 -TCGAGGGATC CGGTACCCTGCAGGAATTCCATATGGCCGCGGC GGCCGCC-3 to replace the MCS with a new MCS containing restriction endonuclease sites Nco1, Not1, SW1, Sac11, Nde1, EcoR1, Pst1, Kpn1, Bam1 and Xho1. The GST-fusion bacterial expression vector pETM-30 was modiWed by incorporation of the same new MCS causing the removal of the DCOH sequence. TrxA from pETM 20 was cut using restriction enzyme Spe1 and cloned using PCR to replace the GST in this new vector backbone, using primers 5 -GGACTAG TATGAGCGATAAAATTATTCACCTG-3 and 5 -GGA CTAGTGGCCAGGTTAGCGT CGAGGAAC-3 containing the Spe1 site (underlined). Further modiWcations were made using two rounds of PCR and cloning products Xba1/ Nco1 into the vector backbone. This incorporated the R-tag 5 of the diVerent N-terminal fusion partners, MBP, GST and TrxA, for any coding sequence cloned into the new MCS and resulted in three new expression vectors (Fig. 1). Second round PCR (common) 5 primer 5 -CTAGTCTAGAAAT AATTTTGTTTAACTTTAAGAAGGAGATATACCA TGCCGGATCA GTATGAATACAAATATCCG-3 . First

Fig. 1. Vector map for expression of R-tagged fusion protein. pETM-41 EMBL vector was modiWed to replace the existing MCS with a new MCS containing diVerent endonuclease sites Nco1, Not1 , SW1, Nde1, EcoR1, Pst1, Kpm1, BamH1, Xho1. The N-terminal His tag was replaced with the R-tag so as to express the required protein as N-terminal R-Tag-Fusion protein-r-TEV recombinant protein. Three vectors were developed in which the fusion protein was either MBP, or GST or TrxA.

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404410

407

round 5 primers; MBP primer 5 -CCGGATCAGTATGAA TACAAATATCCGATGAAAATCGAAGAAGGTAAA C-3 , GST primer 5 -CCGGATCAGTATGAATACAAAT ATCCGATGTCCCCTATACTAGGTTATTGG-3 , TrxA primer 5 -CCGGATCAGTATGAATACAAATATCCGA TGAGCGATAAAATTATTCACTG-3 . The 3 primer used was the reverse MCS oligo above. The single chain antibody bacterial vector pAK300 [17] was modiWed by replacing the C-terminal His tag with the R-tag using PCR. The product was cloned using an internal Acc1 site and primer derived Hind 3 site (underlined). 5 GAGAAGCTTACTACGGATATTTGTATTCATACTG ATCCGGGAATTCGGCCCCCGAGGCCGATGG-3 and 5 -GAGGGCAAATCATGAAATACC-3 Expression of R-tagged proteins Escherichia coli cells (tuner DE3, Novagen) were transformed with the vectors described above containing DELLA protein At RGL-2 and grown to an optical density at 600 nm of 0.30.5. Expression was induced by addition of IPTG at a concentration of 0.5 mM for 3 h at 30 C. Cells were collected by centrifugation and washed in extraction buVer (25 mM Tris chloride pH 7.4 containing 50 mM NaCl, 1 mM EDTA, 1 mM PMSF, and 1 mM DTT) and the pellet frozen at 20 C overnight. Cells were suspended in extraction buVer (1/30th of culture volume), broken by sonication on ice and centrifuged at 38000g for 20 min to remove insoluble materials. R-tagged single chain antibodies (scFv) were expressed as previously described [17]. PuriWcation of R-labelled proteins Prior to aYnity puriWcation, crude soluble proteins were subjected to ion exchange chromatography using a 5 ml HiTrap DEAE FF column (GE Healthcare). The sample was applied to the column and washed with extraction buVer followed by a steep salt gradient (total gradient volume 60 ml; 050% BuVer B (extraction buVer +1 M NaCl). This served to separate pigmented media components from the proteins. Fractions containing R-tagged proteins were concentrated 10-fold using 10 kDa cut-oV centrifugal concentrators (Vivaspin). Monoclonal antibody D9 (10 or 50 mg) was coupled to either 1 or 5 ml NHS activated Sepharose (GE Healthcare; Hi-Trap columns), respectively, as described by the manufacturer. AYnity columns were equilibrated with extraction buVer containing 100 mM NaCl. The scFv protein was made up to the free volume of the aYnity column (1 or 5 ml) and applied to the column at a Xow rate of 0.2 ml/min. The column was placed at 4 C for 1 h, washed with ten column volumes of equilibration buVer and scFv eluted with 0.1 M glycine/HCl buVer pH 3.0. Fractions were immediately neutralized by collecting fractions into 1 M Tris/Cl to adjust the pH to 7.07.5.

For acid labile proteins, R-tagged proteins were bound to the aYnity column as described above. The column was washed with three column volumes of 25 mM Tris chloride buVer pH 8.0 containing 1 mM EDTA, 1 mM DTT and 100 mM NaCl (protease buVer). His tagged r-TEV protease [18] (r-TEV: R-tagged protein 1:50 w/w) was dissolved in one column volume of protease buVer, applied to the aYnity column and incubated overnight at 4 C. r-TEV protease has a very stringent sequence speciWcity for the sequence ENLYFQG/S, cleaves between the QG or QS and this peptide sequence is uncommon. Incubation of the anti-R-tag MAbs with rTEV protease followed by SDSPAGE did not result in any detectable degradation of the MAbs. The column was washed with protease buVer (Wve column volumes) and the eluate containing the scFv and r-TEV protease was concentrated to less than 1 ml and applied to a DEAE column (GE Healthcare; 5 ml). r-TEV protease did not bind to DEAE anion exchanger (r-TEV pI D 9.15) and was eluted in the column washings. RGL-2 was eluted with 150 mM sodium chloride. The proteins were then dialyzed against PBS containing 10 mM EDTA and 40% glycerol and stored at 20 C. The aYnity column was regenerated using 0.1 M glycine/HCl pH 3.0 and immediately neutralized and stored in 20 mM Tris chloride pH 8.0 containing 0.1 M NaCl and 0.1% sodium azide. Results and discussion Production of monoclonal antibodies recognizing R-tag Peptide tags are now commonly used for the puriWcation of recombinant proteins. However problems associated with tags include the formation of insoluble incorrectly folded proteins [19], diYculties with protein crystallized [20], and in cross reactions that result in co-puriWcation with host cell proteins [21,22]. For these reasons we have searched for and identiWed a novel and unique peptide sequence, R-tag, that is absent from commonly used protein expression hosts. Mice were immunized with R-peptide conjugated to KLH. The titers of mouse sera were determined by an ELISA assay on peptide BSA conjugates as described above. Titers of sera ranged from 1/32,0001/256,000 to give an optical density at 492 nm of approximately 1.5 whilst for sera at 1/100 dilution the absorbance was less than 0.05 for BSA at the same plating concentration. Preimmune sera, at 1/100 dilution, showed no reaction with peptide-BSA conjugate. The mouse with the highest immune response to R-BSA conjugate was selected as the spleen donor for the preparation of hybridomas. At day 7 the number of colonies per well was determined by microscopy and on day 12 post fusion, 1000 wells supported cell growth, 60 of which contained single colonies. When screened for MAbs, using the ELISA assay against peptide-BSA conjugate, approximately 400 wells were positive including the 60 wells containing single colonies. Six of the wells containing single colonies recorded an absorbance at 492 nm of greater than 3.0. The method of

408

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404410

antigen-directed fusion and electroporation for producing hybridoma used in our laboratory results in a greater percentage (3070%) of desirable antibody secreting hybridoma compared to polyethylene glycol induced fusions [23] (0.1 10%) commonly used for production of hybridoma. These six cultures were cloned until stable and the hybridoma cells were either frozen in liquid nitrogen or injected into Balb/c PN mice for production of ascitic tumors. Monoclonal antibodies were prepared from ascitic tumors as previously described [16] and stored at 80 C. Isotyping indicated that all MAbs were IgG1,k. AYnity constants (KD) for each of the monoclonal antibodies, determined using the Biacore X, were, 1.3 1010 M, 2.5 108 M and 1.5 107 M for MAbs D9, (D2, C8) and (F6, B2 and G5), respectively . Non-speciWc binding to A. thaliana, P. pastoris, E. coli, Mammalian cell line NSO Extracts were prepared from A. thaliana, E. coli, mouse myeloma NSO and P. pastoris. These extracts together with samples spiked with 0.5 ng of puriWed E. coli expressed Rtagged maltose binding protein (MBP) were subjected to denaturing polyacryamide gel electrophoresis and transferred to PVDF membrane. The blots were probed with MAb D9 (100 ng/ml) and peroxidase-labelled anti-mouse IgG and developed as described above and are shown in Fig. 2A. No reaction was observed between MAb D9 and any expression host molecule (Fig. 2A, lanes 2, 4, 6 and 8). Spiking the host extracts with 0.5 ng of R-Tag MBP resulted in detection of a single protein of the approximately 43 kDa (Fig. 2A, lanes 3, 5, 7 and 9). The blots were washed in distilled water and the protein bands stained with coomassie blue R (Fig. 2B). Thus by Western blotting we have shown that monoclonal antibody D9 reacts speciWcally with the R-tag epitope and that R-tag epitope cannot be identiWed in expression hosts E. coli, A. thaliana, P. pastoris and mammalian mouse myeloma NSO cells.

PuriWcation and crystallization of R-tagged proteins The R-tag modiWed scFv vector, pAK300 [17] containing scFv 2E12 was expressed in E. coli and applied to the anti-R-tag aYnity matrix. scFv was eluted with 0.1 M glycine/HCl buVer pH 3.0 into 1 M Tris to immediately adjust the pH to 77.5 and concentrated to 500 l. Denaturing polyacrylamide electrophoresis of the scFv-R-tag and subsequent staining with coomassie blue R dye showed the presence of a single pure scFv protein C-Terminal R-tag of approximately 28 kDa (Fig. 3, lane 4). When either the E-tag (GE Healthcare) or c-myc tag systems [24] have been used for scFv puriWcation [17], signiW-

Fig. 3. PuriWcation of R-tagged scFv 2E12. scFv 2E12 from extracts of E. coli transformed with pAK300 vector containing the R-tagged-scFv 2E12 was puriWed by immunoaYnity chromatography on MAbD9 coupled matrix, separated by electrophoresis on 12% SDSPAGE and stained for protein with coomassie blue R. Lane 1, molecular weight markers; lane 2, E. coli extract load; lane 3, non-bound proteins; lane 4, scFv 2E12 puriWed by MAb D9 immunoaYnity chromatography.

Fig. 2. SpeciWcity of MAb D9 anti R-tag. Western blots were prepared as described in Methods. Lane 1: prestained molecular weight markers (Invitrogen); 2 and 3: 10 l of extract of Arabidopsis thaliana (1 g fresh weight leaf tissue extracted into 3 ml SDS buVer); 4 and 5: 10 l of extract of E. coli (1011 cells / ml); 6 and 7: 10 l of extract of NSO myeloma cells (109 cells/ml); 8 and 9: 10 l of culture media from Pichia pastoris (optical density 600 nm D 25). Lanes 3, 5, 7 and 9 were spiked with R-tagged MBP (0.5 ng/well). (A) Western blot developed with MAb D9 and peroxidase-labelled goat anti-mouse IgG as described in Methods. B. Blot was washed in distilled water and stained with Coomassie blue R.

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404410

409

cant contamination with E. coli proteins was observed (results not shown) presumably due to cross reactions between the anti-E-tag or anti-c-myc antibodies, used for aYnity puriWcation, and E. coli proteins. Approximately 2 mg of R-tagged scFv2E12, 85% recovery, was obtained from the anti-R-tag aYnity puriWcation and was applied to a Superdex75 16/60 gel Wltration column (GE Healthcare) equilibrated with 10 mM Tris/Cl, pH 7.4, 10 mM NaCl to exchange buVer for crystallization experiments. The antibody was eluted as a single peak. PuriWed 2E12 was concentrated to 5 mg/ml in 10 mM Tris/ Cl, pH 7.4, 10 mM NaCl. Crystallization trials of scFv 2E12 were carried out, using the vapor diVusion hanging drop method [25] in combination with Crystal Screen I (Hampton Research), ammonium sulfate and mono-disperse polyethylene 3350. Small thin plate crystals appeared within one week in 50 mM Tris/Cl, pH 8.3, 12% PEG 3350. Fine screens around this condition resulted in single crystals being produced with 50 mM Tris/Cl, pH 8.3, 0.1 M (NH4)2SO4, 15% PEG3350 and ratio of protein solution to well solution of 2:1. The crystals are shown in Fig. 4.

Fig. 4. Crystals of scFv 2E11. The single crystals, average size 0.2 mm, were grown using the hanging drop method with well solution: 50 mM Tris/Cl, pH 8.3, 0.1 M (NH4)2SO 4, 15% PEG 3350.

We also puriWed an acid labile protein, A. thaliana RGL2 DELLA protein [11] from fusion protein R-Tag-MBPrTEV-RGL-2 using a modiWed procedure. The R-tagged protein was captured on a MAb D9 aYnity column, and the RGL-2 was released from the matrix by in situ proteolysis of r-TEVsite, The aYnity column was regenerated by washing the column with acidic buVer to remove the R-tag fusion partner from the aYnity column. PuriWcation was monitored by Western blots, stained for protein (Fig. 5A) or probed with antibodies to MBP (Fig. 5B), MAb BB7 to RGL-2 (Fig. 5C), and MAb D9 to R-tag (Fig. 5D). N-R tag-MBP-RGL-2 was bound to the MAb D9 aYnity matrix and impurities were separated by washing with Wve column volumes of buVer (Fig. 5 A, lane 3). After column in situ rTEV proteolytic cleavage, RGL-2 protein, together with rTEV protease was eluted from the matrix (Fig. 5A, lane 4, Fig. 5C, lane 4). R-tagged MBP was removed from the aYnity column by column regeneration with glycine/Cl (0.1 M, pH 3.0) as shown in Fig. 5A, B and D, lane 5. Pure RGL-2 (Fig. 5A and C, lane 6) was obtained by removal of trace impurities ( r-TEV and degraded fusion protein) by anion exchange chromatography. Similar results were obtained for fusions to TrxA and GST (results not shown). Successful puriWcation for labile proteins relies on the absence of r-TEV sites in the recombinant protein since the monoclonal antibody anti-R-tag does not contain the cleavage sequence. In cases where the rTEV cleavage site is present in the recombinant protein other systems such as the use of polyol-responsive MAbs [6], [26] should be used for immunoaYnity puriWcation. In conclusion, we have identiWed and raised high aYnity monoclonal antibodies to a novel peptide, R-tag, and shown, by Western blotting, the absence of this peptide sequence in the commonly used expression hosts A. thaliana, E. coli, P. pastoris and mouse myeloma cell NSO. Also we have modiWed protein expression E. coli vectors to incorporate the R-tag and used a monoclonal antibody, speciWc for the R-tag, to prepare an aYnity matrix for puriWcation of acid labile and acid stable recombinant proteins.

Fig. 5. PuriWcation of recombinant Arabidopsis thaliana RGL-2 DELLA protein. (At) RGL-2 was expressed as n-R-Tag MBP fusion protein and puriWed from extracts of E. coli by immunoaYnity chromatography on MAbD9 coupled matrix. Proteins were separated by electrophoresis on 12% SDSPAGE and transferred to PVDF membrane by Western blotting. (A) Blot stained with coomassie blue R. (B) Probed with rabbit anti-MBP polyclonal antibody and peroxidase-labelled anti-rabbit IgG. (C) Blot probed with MAb BB7 speciWc for RGL-2 and peroxidase-labelled anti-mouse IgG. (D) Blot stained with MAb D9 anti R-tag and peroxidase-labelled anti-mouse IgG. Proteins on blots B, C and D were detected by chemiluminescence and imaged on a LAS 3000 (Fuji). Lane 1, molecular weight markers; lane 2, sample from DEAE puriWcation containing R-tag fusion protein and applied to MAb-D9 immunoaYnity matrix; lane 3, proteins non-bound to D9 aYnity matrix; lane 4, proteins released from immunoaYnity column after treatment with rTEV protease; lane 5, protein eluted from aYnity matrix with 0.1 M glycine HCl pH 3.0; lane 6, PuriWed RGL-2 DELLA protein (N-terminal domain).

410

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404410 [12] D. Cao, A. Hussain, J. Peng, Loss of function of four DELLA genes leads to light- and gibberellin-independent seed germination inArabidopsis, Planta 223 (2005) 105113. [13] U.K. Laemmli, Cleavage of structural proteins during the assembly of bacteriophage T4, Nature 227 (1970) 660661. [14] J.W. Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, New York, 1983. [15] P.L. Ey, S.J. Prowse, C.R. Jenkin, Isolation of pure IgG1, IgG2a and IgG2b immunoglobulins from mouse serum using protein A Sepharose, Immunochemistry 15 (1978) 429436. [16] W.T. Jones, P.H.S. Reynolds, S.D. Jones, C.P. Liddane, K.A. Rodber, Production and characterization of monoclonal antibodies against aspartate aminotransferase-P2 from lupin root nodules, Plant Physiol. 94 (1990) 13581364. [17] A. Krebber, S. Bornhauser, J. Burmester, A. Honegger, J. Willuda, H.R. Bosshard, A. Pluckthun, Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a re-engineered phage display system, J. Immunol. Methods 201 (1997) 3555. [18] T.D. Parks, K.K. Leuther, S.A. Johnston, W.G. Dougherty, Release of proteins and peptides from fusion proteins using a recombinant plant virus proteinase, Anal. Biochem. 216 (1994) 413417. [19] M.I. Donnelly, M. Zhou, C. Sanville-Milard, S. Clancy, L. Stols, W.H. Eschenfeldt, F.R. Collart, A. Joachimiak, An expression vector tailored for large scale, high throughput puriWcation of recombinant proteins, Protein Expr. Purif. 47 (2006) 446454. [20] M.H. Bucher, A.G. Evdokimov, D.S. Waugh, DiVerential eVects of short aYnity tags on the crystallization of Pyrococcus furiosus maltodextrin-binding protein, Acta Crystallogr. D Biol. Crystallogr. 58 (2002) 392397. [21] J.J. Lichty, J.L. Malecki, H.D. Agnew, D.J. Michelson-Horowitz, S. Tan, Comparison of aYnity tags for protein puriWcation, Protein Expr. Purif. 41 (2005) 98105. [22] B.S. Wojczyk, M. Czerwinski, M.M. Stwora-Wojczyk, D.L. Seigel, W.A. Abrams, W.H. Wunner, S.L. Spitalnik, PuriWcation of a secreted form of recombinant Rabies virus glycoprotein: comparison of two aYnity tags, Protein Expr. Purif. 7 (1996) 183193. [23] G. Galfre, C. Milstein, Preparation of monoclonal antibodies: strategies and procedures, in: J.J. Langone, H. Van Vunakis (Eds.), Methods in Enzymology, Academic Press, New York, 1981, pp. 346. [24] M.C. Hillman, L.S. Yang, S. Sun, J.L. Duke, K.T. ONeil, J.E. Kochie, A. Karjoo, P. Nath, L.A. Breth, K. Murphy, O.H. Ross, T.C. Burn, G.F. Hollis, R. Wynn, A Comprehensive system for protein puriWcation and biochemical analysis based on antibodies to c-myc peptide, Protein Expr. Purif. 23 (2001) 359368. [25] A. McPherson, Preparation and analysis of protein crystals, Wiley, New York, 1982. [26] R.R. Burgess, N.E. Thompson, Advances in gentle immunoaYnity chromatography, Curr. Opin. Biotechnol. 13 (2002) 304308.

Acknowledgements We thank Dr. Gunter Stier and Dr. Arie Geerlof, Protein Expression and PuriWcation Facility European Molecular Biology Laboratory (EMBL) Meyerhofstrasse 1, D-69117 Heidelberg, Germany for supplying us with the rTEV expression vector and pETM vectors. This work was supported by a grant from the New Zealand Foundation for Research, Science and Technology. References
[1] K. Terpe, Overview of tag fusions: from molecular and biochemical fundamentals to commercial systems, App. Microbiol. Biotechnol. 60 (2003) 523533. [2] C. di Guan, P. Li, P.D. Riggs, H. Inouye, Vectors that facilitate the expression and puriWcation of foreign peptides in Escherichia coli by maltose-binding protein, Gene 67 (1988) 2130. [3] D.B. Smith, K.S. Johnson, Single-step puriWcation of polypeptides expressed in Escherichia coli as fusions with glutathione-S-transferase, Gene 67 (1988) 3240. [4] E. Hochuli, H. Dobeli, A. Schacher, New metal chelate absorbent selective for proteins and peptides containing neighbouring histidine residues, J. Chromatogr. 422 (1987) 177184. [5] B.L. Brizzard, R.G. Chubet, D.L. Vizard, ImmunoaYnity puriWcation of FLAG epitope-tagged bacterial alkaline phosphatase using a novel monoclonal antibody and peptide elution, Biotechniques 16 (1994) 730735. [6] S.J. Duellman, N.E. Thompson, R.R. Burgess, An epitope tag derived from human transcription factor IIB that reacts with a polyol-responsive monoclonal antibody, Protein Expr. Purif. 35 (2004) 147155. [7] L.D. Cabrita, W. Dai, S.P. Bottomley, A family of E. coli expression vectors for laboratory scale and high throughput soluble protein production, BMC Biotechnol. 6 (2006) 1220. [8] S.J. Clough, A.F. Bent, Floral dip: a simpliWed method for Agrobacterium mediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735743. [9] K. Nico-Farber, W. Harder, G. Ab, M. Veenhuis, Methylotrophic yeasts as factories for the production of foreign proteins, Yeast 11 (1995) 13311344. [10] C.R. Bebbington, G. Renner, S. Thomson, D. King, D. Abrams, G.T. Yarrington, High-level expression of a recombinant antibody from myeloma cells using a glutamine synthetase gene as an ampliWable selectable marker, Biotechnology 10 (1992) 169175. [11] H. Cheng, L.J. Qin, S.C. Lee, X.D. Fu, D.E. Richards, D.N. Cao, D. Luo, N.P. Harberd, J.R. Peng, Gibberellin regulates Arabidopsis Xoral development via suppression of DELLA protein function, Development 131 (2004) 10551064.