Sunteți pe pagina 1din 263

Sub red

Dr. M
ef de l
Departa
Univers
Laborat
Public
Univers
Ion Ion
Editura
Iai, Ro




Teh
n m
dacia:
Mihai Mare
lucrri
amentul de M
sitatea Petre
torul de Mico
, Facultatea d
sitatea de tiin
nescu de la Br

a PIM
omnia





hnici de
icologia
e
icrobiologie,
Andrei, Iai
logie Micot
de Medicin V
ne Agricole
rad, Iai
200
laborat
a medic
Facultatea de
toxicologie, D
Veterinar,
i Medicin V
7
tor
cal
Medicin De
Departamentul
Veterinar
entar,
l de Sntate

C
S
sa
S
ad

E
o
w
Ia
Copyright 20
ocietatea Rom


Nici o p
au difuzat n
.R.M.M.M. T
dresate n scri
Societa
OP 6, C
Iai R

Editor v
ing. Ion

Comenz
Societa
OP 6, C
Iai R
e-mail:
www.fu


ditura PIM
os. tefan cel
www.pimcopy
ai Romnia

Descr
Tehni





I. Mar

543.0
582.2
007
mn de Mic
parte a acestei
orice form s
Toate cererile d
is pe adresa:
atea Romn d
CP 1356
Romnia
volum i desig
nu Ailinci
zi la:
atea Romn d
CP 1356
Romnia
comenzi@fu
ungi.ro
Mare nr. 11
.ro
rierea CIP a B
ici de laborat
Mihai Mare
Bibliogr.
Index.
ISBN 978-9
re, Mihai (ed
6
8

II
cologie Medic
i publicaii nu
sau prin orice
de reproducer
de Micologie M
gn copert:
de Micologie M
ngi.ro

Bibliotecii Na
tor n micolo
e. Iai : PIM
973-716-677-
d.)
cal i Micoto
u poate fi repro
mijloace, fr
re a materialel
Medical i M
Medical i M
aionale a Ro
ogia medical
M, 2007
7
oxicologie
odus, transm
acordul scris
lor publicate v
Micotoxicolog
Micotoxicolog
omniei
/ sub red.:
mis, stocat
s al
vor fi
gie
gie


III
Autori

Ingrid Cezara Apetrei
Doctor medic veterinar, doctorand
Laboratorul de Microbiologie Imunologie
Departamentul de Sntate Public
Facultatea de Medicin Veterinar
Universitatea de tiine Agricole i Medicin Veterinar
Ion Ionescu de la Brad, Iai

Olimpia Bazgan
Doctor medic veterinar, doctor n Medicin Veterinar
Profesor universitar
Laboratorul de Micologie - Micotoxicologie
Departamentul de Sntate Public
Facultatea de Medicin Veterinar
Universitatea de tiine Agricole i Medicin Veterinar
Ion Ionescu de la Brad, Iai

Petru Cazacu
Doctor medic veterinar, doctorand
Laboratorul de Histologie
Departamentul de tiine Fundamentale
Facultatea de Medicin Veterinar
Universitatea de tiine Agricole i Medicin Veterinar
Ion Ionescu de la Brad, Iai

Maria Dan
Doctor medic, doctor n Medicin
Laboratorul de Microbiologie
Institutul de Boli Cardiovasculare G. Georgescu Iai

Bogdan Doroftei
Doctor medic, doctor n Medicin
Preparator universitar
Clinica II Obstetric - Ginecologie
Facultatea de Medicin
Universitatea de Medicin i Farmacie Gr. T. Popa Iai




IV



Luminia - Iuliana Malic
Doctor medic veterinar, doctorand
Laboratorul de Micologie - Micotoxicologie
Departamentul de Sntate Public
Facultatea de Medicin Veterinar
Universitatea de tiine Agricole i Medicin Veterinar
Ion Ionescu de la Brad, Iai

Magdalena Mare
Medic dentist, doctorand
Preparator universitar
Departamentul de Protetic
Facultatea de Medicin Dentar
Universitatea Petre Andrei, Iai
SC Dentomedica SRL

Mihai Mare
Medic dentist, doctor medic veterinar, doctor n Medicin
ef de lucrri
Departamentul de Microbiologie
Facultatea de Medicin Dentar
Universitatea Petre Andrei, Iai
Laboratorul de Micologie Micotoxicologie
Departamentul de Sntate Public
Facultatea de Medicin Veterinar
Universitatea de tiine Agricole i Medicin Veterinar
Ion Ionescu de la Brad, Iai













V









































Volum editat cu sprijinul BRD-GSG


VI
Cuprins

Cap. 1 Tehnici de recoltare, transport i procesare primar
a prelevatelor clinice ............................................................................................... 1
1.1. Sngele ..................................................................................................... 2
1.1.1. Recoltarea sngelui pentru hemocultur ................................... 3
1.1.2. Numrul de hemoculturi i momentul prelevrii ...................... 4
1.1.3. Volumul de snge ce urmeaz a fi nsmnat .......................... 4
1.1.4. Medii de cultur ........................................................................ 4
1.1.5. Durata incubrii i prelucrarea hemoculturilor ......................... 7
1.1.6. Semnificaia hemoculturilor pozitive cu fungi saprobioi ........ 8
1.2. Mduva osoas hematogen ..................................................................... 8
1.3. Lichidul cefalo-rahidian ........................................................................... 8
1.4. Raclatul cornean ....................................................................................... 9
1.5. Prelevatul otic .......................................................................................... 9
1.6. Fluidele intraoculare ................................................................................ 9
1.7. Firele de pr ............................................................................................. 9
1.8. Fragmentele unghiale i scuamele cutanate ............................................. 9
1.9. Secreiile respiratorii joase ..................................................................... 10
1.10. Aspiratul pulmonar ................................................................................ 11
1.11. Biopsia pulmonar ................................................................................. 11
1.12. Alte fluide organice normal sterile ......................................................... 11
1.13. Secreiile purulente din abcese subcutanate sau din plgi deschise ....... 12
1.14. Produsele patologice de la nivelul mucoasei orale................................. 12
1.15. Urina ...................................................................................................... 12
1.16. Secreiile vaginale .................................................................................. 14
1.17. Produse patologice de la nivelul tractului genital masculin ................... 15
1.18. Fragmentele tisulare biopsice ................................................................. 15
1.19. Tehnica aspiraiei cu ac fin .................................................................... 15
Bibliografie selectiv ............................................................................. 18

Cap. 2 Tehnici de microscopie direct ................................................................. 21
2.1. Coloraia negativ cu tu de India .......................................................... 22
2.2. Coloraia negativ cu mercurochrom 2% i tu de India ....................... 23
2.3. Coloraia cu lactofenol i albastru de anilin ......................................... 24
2.4. Coloraia cu hidroxid de potasiu i cerneal Parker ............................... 25
2.5. Clarificarea cu hidroxid de potasiu i dimetil sulfoxid .......................... 25
2.6. Coloraia cu calcofluor alb i KOH 10% ............................................... 26
2.7. Coloraia Gram ....................................................................................... 28
2.8. Coloraia Gram - calcofluor alb ............................................................. 30
2.9. Coloraia Giemsa.................................................................................... 31
2.10. Coloraia May-Grunwald-Giemsa .......................................................... 32
2.11. Coloraia Wright .................................................................................... 34
2.12. Coloraia cu mucicarmin Southgat ......................................................... 35
2.13. Coloraia Musto ..................................................................................... 36
Bibliografie selectiv ............................................................................. 39


VII

Cap. 3 Medii de cultivare ...................................................................................... 41
3.1. Generaliti ............................................................................................. 41
3.2. Compoziia mediilor de cultur .............................................................. 42
3.3. Prepararea i sterilizarea mediilor .......................................................... 43
3.4. Controlul de calitate i pstrarea mediilor ............................................. 44
Medii de cultivare .................................................................................. 46
Bibliografie selectiv ............................................................................. 96

Cap. 4 Tehnici de nsmnare i transplantare ............................................... 101
4.1. Tehnici uzuale ...................................................................................... 101
4.2. Tehnici speciale.................................................................................... 103
4.2.1. Tehnica de purificare a izolatelor levurice .............................. 103
4.2.2. Tehnica nsmnrii levurilor pe Agarul cu fin
de porumb i tween 80 ......................................................... 105
4.2.3. Tehnica de cultivare pe suporturi transparente ...................... 105
4.2.4. Tehnica de cultivare n pictur suspendat ....................... 106
4.2.5. Tehnica de cultivare pe bloc de geloz ................................. 106
4.3. Tehnici de transplantare ....................................................................... 107
Bibliografie selectiv ........................................................................... 108

Cap. 5 Tehnici de examinare microscopic a fungilor din culturi ................. 109
5.1. Preparatul extemporaneu cu lactofenol i albastru de anilin
(levuri) .............................................................................................. 109
5.2. Preparatul extemporaneu cu lactofenol i albastru de anilin
(fungi filamentoi) ............................................................................ 110
5.3. Preparatul extemporaneu cu band adeziv ......................................... 110
5.4. Lutarea preparatelor extemporanee ...................................................... 111
Bibliografie selectiv ........................................................................... 112

Cap. 6 Tehnici de histopatologie ........................................................................ 113
6.1. Obinerea probelor ............................................................................... 113
6.2. Examenul macroscopic ........................................................................ 113
6.3. Fixarea .............................................................................................. 113
6.3.1. Formol soluie 10% tamponat pH 6,8 ................................ 115
6.3.2. Fixatorul Bouin ..................................................................... 116
6.3.3. Fixatorul Hollande ................................................................ 116
6.4. Procesarea esuturilor ........................................................................... 117
6.4.1. Deshidratarea ........................................................................ 118
6.4.2. Clarificarea ........................................................................... 119
6.4.3. Impregnarea cu parafin ....................................................... 119
6.4.4. Includerea ............................................................................. 120
6.4.5. Secionarea............................................................................ 120
6.4.6. Etalarea seciunilor ............................................................... 121
6.4.7. Colorarea .............................................................................. 123
6.5. Montarea .............................................................................................. 148
Index


VIII
6.6. Etichetarea i arhivarea ........................................................................ 150
Bibliografie selectiv ........................................................................... 151
Cap. 7 Tehnici de seromicologie ......................................................................... 153
7.1 Fungitell ........................................................................................... 153
7.1.1. Principiul testului .................................................................. 153
7.1.2. Materiale furnizate mpreun cu testul Fungitell .................. 154
7.1.3. Materiale necesare dar nefurnizate mpreun cu kitul .......... 154
7.1.4. Atenionri i precauii ......................................................... 155
7.1.5. Pstrarea reactivilor .............................................................. 155
7.1.6. Recoltarea / Stocarea / Marcarea probelor ............................ 155
7.1.7. Tehnic de lucru ................................................................... 155
7.1.8. Interpretarea rezultatelor ....................................................... 157
7.1.9. Controlul calitii .................................................................. 158
7.1.10. Limite ................................................................................... 158
7.1.11. Interferarea cu alte substane ................................................ 159
7.1.12. Valori ateptate ..................................................................... 159
7.2. Platelia

Aspergillus ............................................................................ 160
7.2.1. Principiul testului .................................................................. 160
7.2.2. Materiale furnizate odat cu kitul ......................................... 160
7.2.3. Materiale necesare, dar nefurnizate odat cu kitul ............... 161
7.2.4. Conservarea reactivilor desigilai
i a celor reconstituii ............................................................ 161
7.2.5. Tehnica de lucru ................................................................... 162
7.2.6. Interpretarea rezultatelor ....................................................... 164
7.3. Platelia

Candida Ac ............................................................................ 165


7.3.1. Introducere ............................................................................ 165
7.3.2. Principiul testului .................................................................. 165
7.3.3. Materiale furnizate mpreun cu kitul ................................... 165
7.3.4. Materiale necesare dar nefurnizate impreun cu kitul .......... 166
7.3.5. Tehnica de lucru ................................................................... 166
7.3.6. Interpretarea rezultatelor ....................................................... 167
7.4. Platelia

Candida Ag ........................................................................... 169


7.4.1. Introducere ............................................................................ 169
7.4.2. Principiul testului .................................................................. 169
7.4.3. Materiale furnizate odat cu kitul ......................................... 169
7.4.4. Materiale necesare dar nefurnizate odat cu kitul ................ 169
7.4.5. Tehnica de lucru ................................................................... 170
7.4.6. Maniera de calcul i interpretarea rezultatelor ...................... 171
7.5. Identificarea speciei Candida dubliniensis
prin latex-aglutinare .............................................................. 172
Bibliografie selectiv ........................................................................... 173

Cap. 8 Teste biochimice i fiziologice ................................................................. 179
8.1. Fermentarea zaharurilor ...................................................................... 179
8.2. Capacitatea de asimilare a surselor de carbon ..................................... 180
8.3. Capacitatea de asimilare a surselor de azot ......................................... 180


IX
8.4. Testul de hidroliz a ureei (producerea de ureaz) la levuri ................ 180
8.5. Testul de hidroliz a ureei (producerea de ureaz) la dermatofii ........ 181
8.6. Testarea rezistenei la cicloheximid ................................................... 181
8.7. Producerea de fenol-oxidaz ................................................................ 182
8.8. Testarea producerii altor enzime .......................................................... 182
8.9. Testul de depistare a necesitilor nutritive speciale ............................ 182
8.10. Testul de cultivare pe Agar BCP-lapte-glucoz. .................................. 183
8.11. Testul de perforare a firului de pr in vitro. ......................................... 184
8.12. Testul de cultivare pe boabe de orez .................................................... 185
8.13. Testul de filamentare (testul de blastez sau germ-tube test) ............... 185
8.14. Testul de termotoleran / termostimulare ........................................... 186
Bibliografie selectiv ........................................................................... 188

Cap. 9 Tehnici de micologie molecular ............................................................ 191
9.1. Extracia ADN-ului pentru PCR .......................................................... 191
9.2. Extracia ADN-ului cu ajutorul kit-ului
High Pure Template Preparation Kit (levuri) .................................... 191
9.3. Extracia ADN-ului prin crioprecipitare (fungi filamentoi) ............... 192
9.4. Controlul calitii acizilor nucleici extrai ........................................... 193
9.5. Identificarea speciei Candida dubliniensis prin PCR duplex ............... 194
9.6. Identificarea molecular a levurilor prin PCR i
secvenializarea regiunilor ITS ......................................................... 196
9.7. Reactivi utilizai n tehnicile de biologie molecular ........................... 200
Bibliografie selectiv ........................................................................... 201

Cap. 10 Tehnici de evaluare a sensibilitii la antifungice ............................... 203
10.1. Tehnica de lucru pentru levuri ............................................................. 203
10.2. Tehnica de lucru pentru fungi filamentoi ........................................... 206
10.3. Testarea sensibilitii la antifungice prin metoda
difuzimetric Kirby-Bauer ................................................................ 208
Bibliografie selectiv ........................................................................... 210

Cap. 11 Tehnici de aeromicologie ...................................................................... 211
11.1. Caseta AIR-O-CELL ........................................................................ 212
11.2. Caseta MICRO-5.................................................................................. 214
11.3. Caseta CYCLEX-D .............................................................................. 215
11.4. Caseta BIOCELL ................................................................................. 215
11.5. Caseta LARO 100 ................................................................................ 216
11.6. Impactorul Zefon Z-A6 ........................................................................ 217
11.7. Dispozitivul CIP 10M .......................................................................... 219
11.8. Aprecierea ncrcturii fungice aeropurtate ......................................... 224
11.9. Tehnici de recoltare/examinare direct a probelor ............................... 225
11.9.1. Banda adeziv BIO TAPETM (Zefon International) ............ 225
11.9.2. Recoltarea fragmentelor inerte .............................................. 226
11.9.3. Recoltarea cu ajutorul tamponului tip exsudat ...................... 226
Bibliografie selectiv ........................................................................... 227
Index


X

Cap. 12 Norme generale de biosecuritate n
laboratoarele de micologie medical ................................................ 229
12.1. Clasificarea fungilor n funcie de clasele de risc biologic .................. 229
12.2. Norme generale de biosecuritate .......................................................... 230
12.2.1. Tehnici de laborator folosite n zona de lucru ....................... 232
12.3. Metode de protecie primar ................................................................ 232
12.3.1. Hote de protecie biologic ................................................... 232
12.4. Substane decontaminante folosite n
laboratoarele de micologie medical ................................................. 233
12.5. Msuri de protecie mpotriva substanelor chimice ........................... 235
Bibliografie selectiv ........................................................................... 236

Anex .................................................................................................................... 237

Index ..................................................................................................................... 245
































XI
Prefa

Fungii microorganisme familiare tuturor prin omniprezena i diversitatea
lor, au fost considerai mult timp inofensivi pentru om, singurele manifestri induse de
acetia candidozele superficiale i dermatofitozele avnd un prognostic vital
favorabil. Odat cu individualizarea micologiei medicale ca tiin de sine stttoare n
cadrul microbiologiei, n prima jumtate a secolului trecut, i intensificrii
investigaiilor n acest domeniu, au aprut date din ce n ce mai certe privind
implicarea fungilor ntr-o serie de entiti nosologice care pot fi grupate n micoze
(superficiale, profunde, sistemice), micotoxicoze i alergoze.
n condiiile actuale, cnd organismele umane sunt supuse interveniei a
numeroi factori agresivi care le destabilizeaz homeostazia i le induc modificri
reactive detrimentale, referindu-ne la posibilitatea implicrii unei specii fungice sau a
alteia n determinarea unor entiti morbide, aseriunea c practic, putem ntlni orice,
oriunde este ct se poate de veridic. Limita dintre patogen i nepatogen, dintre
colonizare i oportunism, este extrem de labil, neexistnd practic o delimitare strict.
Fungi considerai cu cca. 1 2 decenii n urm ca nepatogeni, existnd n mediul
ambiant doar ca banali contaminani, sunt astzi recunoscui ca ageni patogeni
redutabili n cazul gazdelor imunocompromise. Fungii patogeni reprezint astzi o
provocare pentru lumea medical, att din punct de vedere epidemiologic
(augmentarea incidenei micozelor invazive), ct i diagnostic sau terapeutic. Se
consider c aproximativ 5% dintre decesele intraspitaliceti se datoreaz unei cauze
sau complicaii fungice. Micoze precum aspergiloza invaziv, zygomicozele sau
scedosporiozele sunt responsabile de un numr crescnd de decese prin diagnosticarea
adeseori dificil i terapia extrem de costisitoare i de multe ori ineficace.
Scopul prezentului volum este de a pune la dispoziia medicului de laborator i
clinicianului o suit de tehnici utile n diagnosticarea i managementul ulterior al
micozelor. Am ncercat prezentarea acestora n succesiunea lor logic, ntr-o manier
ct mai comprehensibil, urmrind toate etapele demersului diagnostic, de la
prelevarea probelor pn la testele de sensibilitate la antifungice. De asemenea, am
imprimat lucrrii un caracter de ghid practic, reducnd la maxim consideraiile
teoretice. Inevitabil, unele tehnici sau proceduri au fost omise, fie pentru a nu
suprancrca textul cu informaie redundant, fie din cauza performanelor reduse ale
acestora. Bineneles, varianta propus este perfectibil, iar sugestiile cititorilor avizai
vor sta la baza unei eventuale noi ediii.
Sperana noastr, a autorilor, este ca acest ghid s aduc o viziune unitar n
micologia clinic din Romnia i s contribuie la ameliorarea capacitii de diagnostic
i control a micozelor, att a celor superficiale, dar mai ales a celor invazive, cu
prognostic infaust. Salvarea i ameliorarea calitii vieii pacienilor critici, printr-un
diagnostic etiologic corect i o monitorizare riguroas a terapiei antifungice, au
reprezentat argumentele primordiale ale acestui demers publicistic.

Autorii

Iai, iulie 2007


Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


1
C
a
p
i
t
o
l
u
l




Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare

ecoltarea sau prelevarea probelor este o aciune deosebit de important
pentru diagnosticul diverselor micoze interne sau superficiale, ea fiind o
etap critic a acestui demers. Modul de prelevare a probelor i operaiunile ulterioare
la care acestea vor fi supuse sunt specifice fiecrui situs de recoltare i pot reprezenta
tot atia factori limitativi pentru un diagnostic eficient n cazul executrii lor incorecte.
Se recomand ca prelevarea probelor s fie realizat de personalul laboratorului de
micologie, special instruit n acest scop. Cantitatea / volumul prelevatului trebuie s fie
suficient de mare pentru a permite efectuarea examenului microscopic direct,
cultivarea i eventual examenul histopatologic pe biopsie. Procesarea probelor va
ncepe ct mai curnd posibil dup recoltare, fr a depi timpul maxim de ateptare.

Formularul de cerere pentru analize microbiologice

Probele prelevate vor fi nsoite obligatoriu de un formular de cerere pentru
analize microbiologice care va cuprinde datele de identificare ale pacientului, tipul
prelevatului, ora recoltrii i examenele de laborator necesare. Unele date anamnetice
(profesie, cltorii n zone endemice etc.) ca i unele informaii clinice relevante sunt
importante pentru medicul de laborator n procesarea optim a probelor i vor fi
furnizate de ctre clinician n acelai formular. Formularul de cerere va conine i
numele medicului, numrul de telefon, clar indicate, pentru a fi contactat n cazul unor
rezultatele critice sau urgente.
Tratamentele recente cu antifungice trebuie imperios specificate pentru a ajuta
microbiologul la interpretarea rezultatelor testelor i la efectuarea antifungigramei.
Rezultatele serologice i culturale anterioare trebuie de asemenea specificate dac au
fost efectuate.

Precauii

1. Se urmeaz precauiile standard pentru recoltarea i manipularea produselor
biologice. Se trateaz toate probele ca fiind potenial periculoase.
2. Dup recoltare n recipiente adecvate, probele se introduc n pungi din plastic tip
ziplock, cu buzunar lateral (pentru formularul de cerere).
R
1
Tehnici de recoltare, transport i
procesare primar a prelevatelor clinice
Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


2

Recoltarea

1. Cnd este posibil, probele se recolteaz naintea administrrii agenilor
antimicrobieni.
2. Se identific sursa probei i se specific corect zona, astfel nct n cursul
procesrii n laborator s fie selectat mediul de cultur adecvat.
3. Se indic cnd un microorganism particular este cutat n mod special n prob.
4. Dac o prob este recoltat prin traversul pielii intacte, aceasta se va dezinfecta
cu alcool etilic 70%, urmat de o soluie pe baz de iod (1-2% tinctur de iod
sau 10% soluie de povidon-iod). Excesul de tinctur de iod se ndeprteaz
cu ajutorul unui tampon mbibat n alcool, pentru a preveni eventualele iritaii.
5. Pentru recoltarea din situsuri normal sterile se utilizeaz echipament sterilizat i
tehnic aseptic pentru a preveni contaminarea cu microorganisme n timpul
procedurilor invazive.
6. Colectarea probelor se va face n recipiente ermetice, sterile i rezistente, cu
capac filetat, care nu permit crearea de aerosoli n momentul deschiderii.
7. Se eticheteaz clar recipientul de transport cu numele pacientului, numrul de
identificare, data i ora de colectare.
8. Probele obinute prin aspiraie cu ac fin trebuie transferate ntr-un tub steril sau
flacon de transport nainte de a fi trimise la laborator.
9. Dac din probele fluide s-au executat frotiuri imediat dup recoltare, acestea vor
fi individualizate corespunztor prin notare pe captul mat al lamei. Se
recomand trimiterea a 1-5 frotiuri pentru evaluare citologic. Acestea se vor
fixa imediat prin pulverizarea frotiului cu un fixator citologic sau se introduc n
etanol 95 % pentru 20 minute.

1.1. Sngele

Hemocultura este o important metod de diagnostic care poate orienta sau
reorienta terapia antimicrobian n cazul bolilor infecioase grave. Obiectivul major al
tuturor metodelor de hemocultur este reprezentat de depistarea unui numr mic de
microorganisme n snge, de aceea metodele de hemocultur variaz i sunt aproape
proprii fiecrui laborator. Indiferent de metoda aleas, este esenial prelevarea
sngelui n condiii strict aseptice, nsmnarea acestuia pe un mediu lichid, folosirea
unor metode pentru depistarea creterii microorganismelor n mediu lichid i o faz
final de subcultivare pe un mediu solid pentru identificarea i testarea sesibilitii la
antifungice.
Printre factorii cheie pe care eful de laborator trebuie s-i stabileasc se
numr i metoda de hemocultur, cantitatea i compoziia mediului de cultur,
numrul i momentul prelevrii hemoculturilor, volumul de snge care urmeaz a fi
nsmnat, frecvena subcultivrilor i interpretarea rezultatelor.
Prelevarea se face direct n flacoanele de hemocultur de tipul Hemoline
Performance Duo, BacT/ALERT

FA (bioMrieux) sau, mai recomandat, BD


BACTEC
TM
- Mycosis IC/F Medium (BD Diagnostics). n cazul suspectrii unor
infecii fungice cu localizare intracelular a microorganismului (e.g. Histoplasma
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


3
C
a
p
i
t
o
l
u
l

capsulatum), tehnica de liz-centrifugare i utilizarea flacoanelor BD BACTEC


TM

Myco/F Lytic Medium (BD Diagnostics) cresc esenial ansa de izolare a agentului
patogen.

1.1.1. Recoltarea sngelui pentru hemocultur

Sngele pentru hemoculturi trebuie recoltat prin puncie venoas periferic, astfel:
1. Se dezinfecteaz flaconul de hemocultur cu alcool izopropilic 70%, se ateapt
1 minut;
2. Se palpeaz vena;
3. Se antiseptizeaz tegumentul cu alcool 70%, apoi cu tinctur de iod 1-2% (sau
iodofori 10%), concentric, ncepnd din centru;
4. Se ateapt s se usuce i nu se mai palpeaz vena;
5. Se recolteaz sngele, iar dup puncie se nltur iodul de pe tegument cu
alcool (acest pas nu mai este necesar dac se utilizeaz iodofori).

Recoltarea sngelui prin dispozitive intravasculare, arteriale sau venoase, este o
problem controversat. Unele studii comparative arat c nu exist diferene
semnificative ntre sensibilitatea i specificitatea hemoculturilor prelevate de pe cateter
i prin puncie venoas periferic. Factorii care influeneaz acest rezultat favorabil
sunt durata scurt a meninerii cateterului i tehnicile stricte de asepsie. Alte studii
arat c, atunci cnd rezultatele ntre cele dou prelevri sunt discordante,
hemoculturile prelevate prin puncie periferic sunt mai fidele n evidenierea
bacteriemiilor / fungemiilor adevrate fa de cele prelevate pe cateter. Cu toate
acestea, exist un consens asupra faptului c orice hemocultur pozitiv necesit i
interpretarea clinicianului, iar acesta trebuie avertizat cu privire la particularitile
hemoculturilor pozitive prelevate pe cateter. Multe dispute a ridicat i problema
nlocuirii sau nu a acului dup flebotomie pentru inocularea sngelui n flaconul de
hemocultur. Majoritatea studiilor arat c nu exist nici o diferen semnificativ
statistic ntre cele dou metode, astfel c schimbarea acului nu ar fi necesar, reducnd
astfel i riscul accidentelor prin nepare. O antiseptizare atent a tegumentului este mai
important dect schimbarea acului. O meta-analiz a studiilor care au comparat rata
contaminrii hemoculturilor cu i fr schimbarea acului nainte de inoculare a artat
c aceast rat este de 2,0% cnd se schimb acul, fa de 3,7% cnd nu se realizeaz
schimbarea acului. Pe de alt parte, reducerea contaminrii hemoculturilor prin
schimbarea acului ar determina o economie de aproximativ 85000 $ pentru fiecare
1000 de hemoculturi. La modul ideal, pentru recoltarea hemoculturilor, ar trebui s se
apleze la personal special calificat (flebotomiti).








Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


4
1.1.2. Numrul de hemoculturi i momentul prelevrii

Majoritatea cercettorilor sunt de acord c peste trei hemoculturi n 24 ore nu
determin o cretere semnificativ a rezultatelor pozitive. Trei prelevri intermitente n
24 ore, din zone de puncie diferite, cresc sensibilitatea izolrii aproape de 100%.
Hemoculturile trebuie prelevate pe ct posibil naintea instituirii antibioticoterapiei
(dac au fost administrate antibiotice, aceast informaie trebuie luat n consideraie la
interpretarea rezultatelor) i conform evoluiei predictive a curbei febrile sau / i n
momentul cnd bolnavul semnaleaz apariia frisoanelor.

1.1.3. Volumul de snge ce urmeaz a fi nsmnat

Majoritatea autorilor recomand s se recolteze la aduli 10-30 ml de snge
pentru fiecare set de hemoculturi. nsmnarea a 20, respectiv 30 ml snge, crete
sensibilitatea cu 38% i 68% fa de nsmnarea a 10 ml de snge. Recoltarea a peste
30 ml de snge per set de hemocultur mbuntete foarte puin sensibilitatea
hemoculturii i contribuie la instalarea anemiei iatrogene. La copii este necesar un
volum mai mic de snge datorit bacteriemiilor cu un numr mai mare de UFC/ml fa
de aduli. Se recomand 1-2 ml de snge per set la nou-nscui, 2-3 ml la sugari i 3-5
ml la copii.
O raie optim de diluie a sngelui n bulion nu a fost nc stabilit.
Majoritatea autorilor recomand ca aceast diluie s fie ntre 1:5 i 1:10, iar unii au
artat c un raport de diluie de 1:10 este superior celui de 1:5 n ceea ce privete
rapiditatea i sensibilitatea izolrii. Majoritatea sistemelor de hemocultur conin
polianetol sulfonat de sodiu, care pe lng efectul anticoagulant inactiveaz i anumii
ageni antimicrobieni (e.g., aminoglicozidele, polimixinele).

1.1.4. Medii de cultur

Mediile pentru hemocultur prezint variaii n compoziie i de aceea studiile
comparative realizate sunt greu de interpretat.

Sistemele de hemocultur automate i semiautomate computerizate pentru
detecia rapid a microorganismelor n hemoculturi sunt utilizate n multe laboratoare.
Sistemul BACTEC (Becton Dickinson Intruments Systems, Sparks, MD, SUA)
se bazeaz pe detecia direct a producerii de CO
2
prin prelevare seriat de eantioane
de gaz din flaconul de cultur, iar n camera de citire prezena CO
2
este depistat cu
ajutorul luminii infraroii, ultraviolete sau radiometric. Cteva studii comparative au
artat c sistemul BACTEC identific o gam larg de microorganisme, n special
levuri i fungi dimorfici, n timp scurt. n comparaie cu sistemul Isolator, mediile
BACTEC pentru fungi (BACTEC MYCO/F Lytic bottle i BACTEC high-blood-volume
fungal medium) au avantajul monitorizrii automate continue, dar timpii de izolare sunt
echivaleni, cu excepia tulpinilor de Histoplasma capsulatum care au fost izolate doar
n sistemul Isolator.
n sistemul BacT/Alert (Organon Teknika Corp., Durham, NC) creterea este
semnalizat tot prin detecia CO
2
, dar cu ajutorul unui detector colorimetric. BACTEC
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


5
C
a
p
i
t
o
l
u
l

i BacT/Alert, similare n compoziia bulionului pe baz de tripticaz-soia i cazein,


difer n suplimentele nutritive i n concentraia de polianetol sulfonat de sodiu.
Studiile comparative ale celor dou sisteme au artat c sistemul BacT/Alert este
superior n izolarea microorganismelor, n special a stafilococilor i levurilor.
BACTEC este superior bulionului cu supliment de pepton i sistemului VITAL
n depistarea bacteriemiilor i fungemiilor, iar aceast superioritate nu se datoreaz
metodei de detecie.
Flacoanele speciale pentru fungi ar trebui luate n considerare n anumite
situaii particulare (pacieni HIV infectai), deoarece fungii filamentoi i dimorfici
necesit o atenie special. Studii recente arat c flacoanele pentru izolarea bacteriilor
sunt foarte potrivite pentru cultivarea levurilor genului Candida.

Sistemul Oxoid Signal (Oxoid USA, Inc., Columbia, MD) este format dintr-un
singur flacon de cultur, n care presiunea CO
2
degajat de creterea microorganismelor,
foreaz fluidul de cultur s treac ntr-un compartiment semnal, de unde poate fi
examinat microscopic i subcultivat. Dei evalurile iniiale au fost favorabile, studiile
ulterioare au artat c furnizeaz un numr crescut de rezultate fals pozitive i are
dificulti n semnalizarea creterii bacteriilor anaerobe, a majoritii levurilor, a
Hemophillus influenzae, bacililor gram-negativi nonfermentativi, Neisseria
meningitidis, Nocardia spp., i Corynebacterium jeikeium. Noile modele care au
mbuntit compartimentul de semnalizare (creterea volumului) i beneficiaz de
agitare, au dovedit proprieti superioare n izolarea microorganismelor.

Mediile difazice (Septi-Chek: Roche Diagnostic Systems, Nutely, NJ;
Hemoline Performance Duo: BioMerieux, Vacutainer agar slant: Becton Dickinson)
sunt de asemenea larg utilizate. Au caliti superioare bulionului suplimentat cu
pepton, sunt avantajoase pentru izolarea micobacteriilor i brucelelor. nsmnarea
frecvent a pantei poate s furnizeze cultur suficient pentru testarea sensibilitii i
identificare, astfel nct timpul de depistare a microorganismelor poate fi comparabil
cu al sistemelor automate. Folosite n asociaie cu sistemul BACTEC s-a observat o
cretere cu 25% a depistrii episoadelor bacteriemice, fa de folosirea izolat a
sistemului BACTEC.

Metoda lizei cu centrifugare ( denumit anterior DuPont Isolator tube, n
prezent este comercializat de Wampole Laboratories, Cranbury, NJ) izoleaz
majoritatea microorganismelor, dar este indicat n special pentru depistarea
fungemiilor, (mai ales cu fungi dimorfici, fungi filamentoi, Malassezia furfur), a
infeciilor cu micobacterii la pacienii cu SIDA i a oportunitilor (Bartonella
henselae). Sngele, prelevat n tuburi cu liquoid (polietilenglicol i saponin) este
lizat, apoi centrifugat, iar sedimentul este nsmnat pe medii solide adecvate. Metoda
este echivalent sistemului difazic n izolarea fungilor (chiar superioar n izolarea
Histoplasma capsulatum ), de asemenea i n izolarea bacteriilor (metoda lizei cu
centrifugare fiind mai rapid). Unii autori nu recomand aceast metod n investigaia
de rutin a episoadelor febrile la pacienii neutropenici, datorit ratei crescute de
rezultate fals pozitive.
Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


6
Hemoculturile anaerobe. Setul standard de hemoculturi conine un flacon
aerob i unul cu incubare anaerob. Deoarece exist o ans mic de a izola fungi sau
bacterii strict aerobe n flaconul anaerob, folosirea de rutin a flaconului cu incubare
anaerob poate determina scderea sensibilitii hemoculturii. Cteva studii au artat c
n ultimii 20 de ani s-a produs o scdere a incidenei infeciilor sistemice determinate
de bacteriile anaerobe; pe de alt parte, tot n aceast perioad s-a produs o cretere a
incidenei fungemiilor. Aceste schimbri n etiologia infeciilor sistemice au nceput s
pun sub semnul ntrebrii utilitatea folosirii de rutin a flaconului anaerob.
Unii autori au artat c folosirea a dou flacoane aerobe i doar n cazuri
selecionate a flaconului anaerob, a dus la creterea cu 6% a izolrii microorganismelor
cu semnificaie clinic, n comparaie cu practica standard (un flacon aerob i unul
anaerob). Date asemntoare au fost gsite la copii i avnd n vedere cantitatea mic
de snge care se poate recolta de obicei de la aceti pacieni, este indicat ca ntreaga
cantitate s se nsmneze n flacoane aerobe i doar n cazurile cu risc crescut s se
utilizeze flaconul anaerob.
Pe de alt parte, utilizarea flacoanelor anaerobe determin o cretere
semnificativ a izolrii bacteriilor strict anaerobe. n concluzie, la ora actual este
indicat folosirea a dou flacoane aerobe per set i n circumstane bine selecionate
(e.g., afeciuni intraabdominale, infecii orale, neutropenii, celulite, muctur de om)
i pe cea a flaconului anaerob.

Neutralizarea i inactivarea substanelor antimicrobiene. Datorit
frecventei recoltri a sngelui pentru hemoculturi de la pacieni aflai sub terapie
antimicrobian, pe pia au aprut produse care ncearc s nlture posibilele efecte
inhibitorii ale creterii. Sistemul BacT/Alert are variante FAN pentru flacoanele aerobe
i anaerobe. Utilizarea acestora a demonstrat mbuntirea izolrii microorganismelor
n comparaie cu mediile standard, iar noua formul a mediului a optimizat i
microscopia direct din hemocultur. Studiile comparative ale sistemelor BacT/Alert
FAN i BACTEC cu rezin au artat c performanele celor dou medii sunt
echivalente.

Mediile hipertone cu 10% sucroz sunt utilizate pentru a crea un mediu
osmotic protector, mbuntind astfel izolarea bacteriilor i fungilor cu perete defectiv
din sngele pacienilor care au primit antibioticoterapie. n general, aceste medii au fost
evitate n laboratoarele care utilizeaz citirea vizual a creterii datorit rezultatelor fals
pozitive date de efectul hemolitic, dar pe de alt parte producerea unor mari cantiti de
gaz de ctre anumite bacterii, poate fi util n evidenierea creterii. Valoarea acestor
medii n depistarea bacteriemiilor i fungemiilor este controversat. Unele studii arat
o mbuntire a izolrii stafilococilor, bacililor gram-negativi (Enterobacteriaceae,
Pseudomonas aeruginosa) i fungilor, dar o reducere i o ntrziere n izolarea
bacteriilor anaerobe i a Neisseria gonorrhoeae.

Noile metode rapide de identificare i testare a sensibilitii la antibiotice
(Vitek - bioMerieux Vitek, Hazelwood, MO, USA, autoSCAN-W/A - W/A; Dade
Behring Microscan Inc., West Sacramento, Calif.; BD PHOENIX Automated
Microbiology System; PCR) a microorganismelor direct din hemoculturile pozitive,
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


7
C
a
p
i
t
o
l
u
l

furnizeaz rezultate corecte n aproximativ 2-6 ore i pot determina iniierea


antibioticoterapiei, schimbarea terapiei de primointenie cu o terapie mai eficient sau
mai puin costisitoare. Unii autori au estimat o economie de aproximativ 158 $ per
pacient, apreciat la pacienii la care s-a administrat un antibiotic mai ieftin sau la care
a fost ntrerupt antibioticoterapia, prin primirea rezultatelor cu 24-48 de ore mai
devreme.
Metodele moleculare au o sensibilitate i o specificitate de aproximativ 100%
n identificarea bacteriilor i levurilor din hemoculturile monomicrobiene i furnizeaz
rezultatele n aproximativ 2 ore.

1.1.5. Durata incubrii i prelucrarea hemoculturilor

Majoritatea laboratoarelor care utilizeaz sisteme automate, incubeaz
hemoculturile 5-7 zile. Laboratoarele care deservesc spitale n care fungii,
Pseudomonas aeruginosa i grupul HACEK sunt izolai frecvent din sngele
pacienilor, ar trebui s evalueze cu atenie necesitatea subcultivrilor terminale, iar
hemoculturile ar trebui incubate peste 7 zile.
Dac apare semnalizarea creterii n timpul incubrii, proba este examinat
microscopic (frotiu colorat Gram) i subcultivat pe medii solide n funcie de
categoria microscopic observat. n cazul observrii fungilor este indicat
subcultivarea pe Agar Sabouraud cu incubare la 30 sau 37C. n situaia n care nu
sunt depistate microorganisme pe frotiu, trebuie realizate subcultivri oarbe, iar
flaconul reintrodus la incubat.
Pentru sistemele manuale de depistare a creterii, n cazul suspiciunii
fungemiilor, ar trebui realizate subcultivri oarbe la 48 ore i apoi sptmnal, pn
la 30 de zile, pe Agar Sabouraud, cu incubare la 30C.
Examinarea microscopic de rutin, cu ajutorul coloraiei Gram, a
hemoculturilor negative macroscopic dup 24-48 ore de incubare este controversat i
puin indicat, datorit numrului mic de microorganisme care pot fi detectate utiliznd
frotiul colorat Gram (aproximativ 10
5
UFC/ml). Coloraia cu acridin orange este mai
sensibil, detectnd ntre 10
3
i 10
4
UFC/ml. Unii autori au comunicat o cretere de
16,8% n depistarea rapid a septicemiilor prin examinarea cu acridin orange a
hemoculturilor negative macroscopic.
Pentru metoda lizei-centrifugare, sngele (7,5-10 ml) este recoltat n tuburi cu
saponin (lizeaz hematiile i globulele albe). Dup recoltare, tuburile se agit de
cteva ori pentru liza complet, iar apoi se centrifugheaz 15 minute la 3000 rpm
pentru concentrarea microorganismelor. Sedimentul este aspirat i nsmnat astfel: o
plac cu Agar snge-ciocolat i o plac cu Agar tripticaz-soia, se incubeaz 3 zile la
37C, apoi 18 zile la 30C; o plac cu Agar Sabouraud i una cu Agar infuzie cord-
creier, 4 sptmni la 30C. Rata contaminrilor accidentale poate fi controlat printr-o
bun tehnic aseptic n incinta hotei de siguran microbiologic de clas II.





Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


8
1.1.6. Semnificaia hemoculturilor pozitive cu fungi saprobioi

Aspergillus spp. reprezint cea mai frecvent cauz a infeciilor fungice
invazive, dar este rar izolat din snge. Pe de alt parte, Fusarium spp. este izolat n 60-
70% din hemoculturile pacienilor cu fusarioz diseminat. Printre fungii emergeni
implicai tot mai des n infecii invazive, inclusiv n fungemii, se numr Scedosporium
spp., Alternaria spp.i Paecilomyces spp.
Cu excepia fungemiilor asociate cu prezena cateterelor venoase centrale,
determinarea semnificaiei clinice a hemoculturilor pozitive cu fungi, chiar i la
pacienii cu hemopatii maligne reprezint o provocare. Cele mai frecvente cauze de
fungemii adevrate sunt determinate de Scedosporium spp., iar prezena leucemiei sau
transplantului medular reprezint un factor de risc important.
Semnificaia hemoculturilor pozitive cu Aspergillus spp. este nc neclar. n
literatur sunt doar puine cazuri documentate din punct de vedere clinic, histologic i
microbiologic pentru evidenierea aspergilozei invazive cu hemocultur pozitiv cert.
O singur hemocultur pozitiv, n sistemul lizei cu centrifugare, reprezint n mod
obinuit un indicator al pseudoaspergilemiei, iar n faa unei asemenea situaii trebuie
cutate argumentele clinice i radiologice pentru stabilirea semnificaiei clinice a
izolatului. Totui, se consider c hemoculturile pozitive pentru Aspergillus, cu real
semnificaie clinic, sunt foarte rare.
Candida spp (n particular Candida albicans) este frecvent izolat n
hemoculturi, reprezentnd pn la 10% dintre infeciile sistemice nosocomiale; cu toate
acestea aproximativ 50% din hemoculturi rmn negative la pacienii cu candidemie.
n cazul hemoculturilor pozitive cu Candida spp, trebuie depistat posibila surs a
infeciei, iar cateterele intravasculare nlocuite. Candiduria poate apare secundar
candidemiei.

1.2. Mduva osoas hematogen

Se recolteaz prin aspiraie cu sering heparinizat, calea de acces fiind creat
prin puncie sternal sau puncia crestei iliace. Puncia se realizeaz respectnd cele
mai severe msuri de asepsie. Aspiratul medular, n volum de minim 0,5-1 ml, se
transfer ntr-un tub steril cu dop de cauciuc i se expediaz la laborator n maxim 2
ore.Pe parcursul acestui interval de timp, prelevatul se menine la temperatura camerei.

1.3. Lichidul cefalo-rahidian

Lichidul cefalo-rahidian (fluidul cerebro-spinal sau LCR) se recolteaz prin
puncie rahidian n spaiile intervertebrale L3-L4, L4-L5 sau L5-S1. Puncia se
realizeaz respectnd cele mai severe msuri de asepsie i decontaminarea zonei cu
povidon-iod 2%. Dup poziionarea n spaiul subarahnoidian a cateterului de puncie,
LCR se colecteaz prin curgere liber, n tuburi sterile, n volum de 3-5 ml. nainte de
examinare, proba se concentreaz prin centrifugare la 1500 rpm timp de 10 minute.
Supernatantul se pstreaz pentru testarea antigenic, iar sedimentul pentru cultur i
microscopie direct. Timp de ateptare n vederea procesrii: maxim 15 minute. Nu se
refrigereaz!
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


9
C
a
p
i
t
o
l
u
l

1.4. Raclatul cornean



Se instileaz 1-2 picturi de anestezic topic, apoi cu ajutorul unei
microchiurete oftalmologice / spatule Kimura sterile, printr-o micare scurt, se
racleaz zone multiple din segmentul ulcerat. Prelevatul se nsmneaz direct pe
medii de cultur cu ajutorul instrumentului de recoltare, prin nepare; totodat, se
pregtesc frotiuri pentru examenul microscopic direct. Timp maxim de ateptare: 15
minute la temperatura camerei.

1.5. Prelevatul otic

Din conductul auditiv extern se pot preleva probe cu ajutorul tampoanelor
sterile (secreiile) sau prin raclare cu o chiuret (scuamele). Timp maxim de ateptare:
2 ore la temperatura camerei sau 24 ore la 4C.

1.6. Fluidele intraoculare

Se recolteaz prin aspiraie cu un ac fin steril sau prin vitrotomie, apoi se
transfer la laborator n maxim 15 minute pentru procesare. Volumul recomandat este
de cca. 0,5 ml.

1.7. Firele de pr

Se recolteaz cu ajutorul unei pense, de preferat sub lumin UV, n camer
obscur. Se expediaz la laborator n plicuri de hrtie. Timp maxim de ateptare: 72 ore
la temperatura camerei.

1.8. Fragmentele unghiale i scuamele cutanate

Fragmentele unghiale se recolteaz de la nivelul jonciunii esutului sntos cu
cel afectat, prin raclare cu o chiuret steril sau prin cupare cu ajutorul unui foarfece,
dup toaletarea zonei cu ap i spun. Nu se recomand decontaminarea cu alcool
deoarece diminueaz ansa de izolare a dermatofiilor prin cultivare. Raclarea se
realizeaz de obicei pe partea inferioar a tablei unghiale, distal sau lateral, la
jonciunea zonei normale cu cea modificat. n cazul leziunilor de leuconichie
superficial, raclarea va interesa suprafaa superioar a unghiei. Materialul recoltat se
expediaz la laborator n plicuri de hrtie. Timp maxim de ateptare: 72 ore la
temperatura camerei.
La pacienii suspectai de tinea sau impetigo, unguentele sau alte preparate
aplicate n prealabil trebuie ndeprtate prin tergere cu alcool. Pentru recoltare, se va
utiliza un bisturiu neascuit, o pens, o chiuret Vidal sau un careu rectangular de
mochet. Dac leziunile sunt multiple, se va alege pentru prelevarea de probe cea mai
recent, deoarece raclarea scuamelor vechi, n curs de detaare este adesea
nesatisfctoare pentru diagnostic. Scuamele tegumentare se recolteaz prin raclarea
zonei active a leziunii (de obicei cea periferic) cu ajutorul unei chiurete sterile sau
prin tergere apsat i repetat cu un tampon steril preumezit n ser fiziologic steril.
Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


10
Recoltarea cu tamponul este recomandat n cazul leziunilor de epidermofiie circinat
i presupune nsmnarea imediat a prelevatului pe medii de izolare. Recoltarea cu
ajutorul mochetei este mai eficient deoarece asigur concomitent abrazarea leziunii i
reinerea sporilor, crescnd astfel ansele de izolare n cultur. Careurile de mochet se
aplic direct pe suprafaa mediului de cultivare, se las n contact cu acesta cca. 5-10
minute, dup care se ndeprteaz .
Cnd leziunile sunt localizate la nivelul unor pliuri (axilar, fesier, mamar,
crural etc.) i sunt umede / inflamate, recoltarea se va face cu ajutorul unui tampon
pentru exsudate umectat n prealabil cu ser fiziologic, recoltarea fiind indolor.
La pacienii cu Pityriasis versicolor, scuamele se recolteaz cel mai bine
utiliznd un fragment de band adeziv transparent (tip scotch) cu care se
amprenteaz leziunea i care apoi se etaleaz pe o lam de microscopie; n laborator,
pentru efectuarea examenului microscopic direct, se va aduga ntre lam i banda
adeziv o pictur de colorant, de obicei lactofenol cu albastru de anilin.

1.9. Secreiile respiratorii joase

Sputa poate fi prelevat prin expectoraie spontan (neprovocat) i prin
expectoraie indus (provocat).
a) n cazul expectoraiei spontane, pacientul va fi sftuit s-i clteasc cavitatea
bucal cu ap distilat steril sau cu o soluie slab antiseptic (ap de gur)
anterior colectrii sputei. De asemenea, pacientul va fi instruit s nu
expectoreze saliva. Colectarea probelor se va realiza prin tuse profund urmat
de expectorarea secreiei ntr-un recipient steril, cu capac etan. Volumul
minim recoltat va fi de 2 ml. Proba se trimite la laborator n maxim 2 ore (dac
se menine la temperatura camerei) sau n 24 ore (dac este pastrat la
temperatura de refrigerare);
b) n cazul expectoraiei induse, pacientul va fi ndrumat s-i perieze dinii,
mucoasa lingual i gingiile, apoi s se clteasc riguros cu ap. Pentru
inducerea expectoraiei, pacientul va inhala aproximativ 30-50 ml de soluie
cloruro-sodic 3-10%, aerosolizat prin intermediul unui nebulizator
ultrasonic. Sputa obinut prin expectoraia astfel indus se colecteaz ntr-un
recipient steril, cu capac filetat;
c) Aspiratul traheostomic
Canula de traheostomie este colonizat ntr-un interval de cca. 24 ore dup
inserie. Aspirarea probelor se realizeaz cu catetere de suciune, iar sputa
astfel obinut se colecteaz n recipieni sterili. Rezultatele trebuie corelate cu
datele clinice i imagistice;
d) Aspiratul endotraheal
Pentru recoltare, se utilizeaz un cateter de suciune nou, iar secreia aspirat se
stocheaz ntr-un captator de sput steril. Tubul endotraheal este frecvent
colonizat cu bacterii i levuri, de aceea rezultatele trebuie s fie corelate cu
constatrile clinice i cu datele imagistice. Extremitile inferioare ale tuburilor
endotraheale nu reprezint probe acceptabile;
e) Prelevatele bronhoscopice
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


11
C
a
p
i
t
o
l
u
l

Acestea includ lavajul bronhoalveolar (LBA), spltura bronic, periajul


bronic i probele biopsice transbronhiale;
Principalele etape ale bronhoscopiei:
- Bronhoscopul se introduce transnazal sau transoral la pacienii neintubai sau prin
sonda endotraheal la pacienii intubai. Se nainteaz cu bronhoscopul pn la
nivelul unei bronhii segmentare (pentru spltura bronic) sau a unei bronhii
subsegmentare (pentru LBA);
- Se instileaz fracionat soluie de NaCl 0,85% steril, de obicei n volum total de
pn la 150 ml, cu o sering prin canalul bronhoscopului. Se aspir uor soluia
salin ntr-un recipient steril naintea administrrii urmtoarei fracii. Se
consider c lavajul obinut reprezint secreiile de la nivelul a cca. un milion
de alveole i bronhiolele aferente i conine aproximativ 1 ml secreie;
- Probele recoltate n flacoane sterile, n volume suficiente, se trateaz cu substane
mucolitice de tipul N-acetil-cisteinei i se centrifugheaz timp de 20 minute la
1500 rpm. Timp maxim de ateptare: 2 ore la temperatura camerei sau 24 ore
la 4C.

1.10. Aspiratul pulmonar

Se recolteaz prin inserarea transtoracic a unui ac n infiltratul pulmonar, sub
ghidaj radiologic sau computer-tomografic. Se aspir materialul din leziune. Dac
leziunea este de dimensiuni mari sau dac leziunile sunt multiple, se vor colecta mai
multe probe din zonele reprezentative. Aspiratul se transfer ntr-un recipient steril i
se expediaz imediat la laborator.

1.11. Biopsia pulmonar

Se efectueaz n serviciile de chirurgie toracic i vizeaz obinerea unei piese
de 1-3 cm
3
esut. Dac leziunea este de dimensiuni mai mari sau dac se deceleaz
leziuni multiple, se recomand recoltarea mai multor probe din zonele reprezentative.
Probele se trimit la laborator n recipieni sterili, fr formol, protejate ntr-o compres
umectat cu ser fiziologic steril. Timp de ateptare: 15 minute la temperatura camerei.

1.12. Alte fluide organice normal sterile
(pericardic, peritoneal, pleural, sinovial)

Se recolteaz prin puncie, n volume de minim 5-10 ml, stocndu-se n
flacoane sterile. Probele se concentreaz prin centrifugare, sedimentul nsmnndu-se
pe medii solide de izolare sau se transfer ca atare n flacoane coninnd medii pentru
hemocultur. Timp maxim de ateptare: 15 minute la temperatura camerei sau 24 ore la
4C.





Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


12
1.13. Secreiile purulente din abcese subcutanate sau din plgi deschise

Se preleveaz fie prin aspiraie, fie prin tamponament profund. Se recomand
folosirea sistemelor de transport pentru tampoane, n vederea prevenirii desicrii
materialului patogen. De la pacienii cu suspiciune de micetom, se recolteaz puroi din
leziuni pentru studierea culorii granulelor, examenul microscopic direct i cultur. De
la pacienii suspeci de cromomicoz se recolteaz exsudat sau cruste din leziuni pentru
efectuarea de frotiuri sau preparate extemporanee n vederea decelrii corpilor
fumagoizi prin examen microscopic direct. De la pacienii cu sporothricoz se
recolteaz probe prin amprentarea leziunilor cu ajutorul unei lame de microscopie,
frotiul obinut colorndu-se Gram, Musto sau cu calcofluor alb. n cazul criptococozei
diseminate sau a celei cutanate, se recomand recoltarea de probe biopsice sau raclate
din leziunile cutanate n vederea efecturii de frotiuri pentru examenul microscopic
direct. n cazul ulcerelor i nodulilor se urmeaz paii: se decontamineaz suprafaa cu
soluie de povidon-iod, se ndeprteaz detritusurile suprapuse i se chiureteaz baza
ulcerelor sau a nodulilor. Dac exsudatul este prezent, acesta se colecteaz cu o sering
sau cu un tampon steril.
Timp maxim de ateptare: 2 ore la temperatura camerei.

1.14. Produsele patologice de la nivelul mucoasei orale

Se recolteaz cu ajutorul unui tampon steril, preumezit n ser fiziologic, prin
trecerea repetat a acestuia, de minim 10 ori, peste zonele cu leziuni. Alternativ, n
cazul leziunilor pseudo-membranoase sau ulcerate, se poate recurge la raclarea uoar
a acestora cu ajutorul unei chiurete sterile. n cazul aparatelor protetice amovibile,
prelevarea probelor se realizeaz de pe faa mucozal a acestora zona predilect de
apariie a biofilmelor levurice. Din pungile parodontale prelevarea probelor se
efectueaz cu sonda parodontal, n zonele vestibular, oral, vestibulo-distal,
vestibulo-mezial, oro-distal i oro-mezial. n endodontite, probele se preleveaz cu
ajutorul conurilor de hrtie sterile, de diferite diametre, funcie de dimensiunea
canalelor radiculare. Timp maxim de ateptare: 2 ore la temperatura camerei.

1.15. Urina

Tehnici de recoltare (fraciunea mijlocie n timpul miciunii spontane):
a) la femei:
- Persoana care recolteaz proba trebuie s-i igienizeze minile n
prealabil, prin splare cu ap i spun. nainte de recoltare, pacientul
va fi instruit n detaliu asupra manoperelor ce vor urma;
- Se ndeprteaz lenjeria intim, se toaleteaz zona vulvo-vaginal i
deschiderea uretrei cu ap i spun lichid, folosind un tampon de tifon,
din fa ctre spate;
- Se cltete zona cu ap sau se terge cu un tifon umed, cu aceleai
micri din fa ctre spate. Fiecare tampon se utilizeaz o singur
dat;
- n timpul miciunii, labiile se ndeprteaz;
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


13
C
a
p
i
t
o
l
u
l

- Se elimin un volum de aproximativ 40-50 ml urin, fr ca pacienta s-


i ntrerup apoi miciunea;
- Se recolteaz apoi urina din jetul urinar mijlociu, ntr-un recipient steril,
avnd grij ca deschiderea acestuia s nu vin n contact cu suprafee
posibil contaminate;
b) la brbai:
- Persoana care va recolta proba trebuie s fie corect igienizat prin
splarea minilor cu ap i spun. Dac pacientul este cel ce colecteaz
urina, el trebuie s primeasc n prealabil instruciuni detaliate;
- Se toaleteaz glandul penisului i meatul urinar prin retractarea
prepuului (dac nu este circumcis) i splare cu ap i spun lichid;
- Meninndu-se prepuul retractat, se ncepe miciunea, lsnd s curg
primii mililitri de urin. Pacientul nu-i va ntrerupe emisia de urin;
- Se colecteaz apoi urina din jetul urinar mijlociu, ntr-un recipient steril.
c) Recoltarea prin cateterizare vezical
Inserarea cateterului pentru colectarea unei probe de urin este n general
descurajat. Se poate totui utiliza cnd urina se nu se poate obine altfel sau
cnd pacientul se afl n stare critic.
- Se toaleteaz deschiderea uretrei pacientului i a zonei adiacente, cu ap
i spun lichid, apoi se cltete ct mai riguros;
- Se introduce cateterul pn n vezic prin tehnica recomandat, funcie de
sexul pacientului;
- Se ndeprteaz fraciunea iniial, de 30-50 ml urin;
- Se colecteaz urina din fraciunea mijlocie sau terminal, ntr-un
recipient steril.
d) Recoltarea pe cateter preexistent
Trebuie de obicei evitat datorit colonizrii uneori masive cu microorganisme
a cateterelor.
- Se dezinfecteaz peretele cateterului cu alcool 70%;
- Se puncioneaz cateterul, n condiii de asepsie, cu ajutorul unui ac
ataat la o sering. Niciodat se va recolta urina din punga de
colectare !
- Se aspir urina i apoi se descarc seringa ntr-un recipient steril.
e) Recoltarea prin puncie suprapubian
Aspiraia suprapubian se practic pentru diagnosticarea infeciilor urinare la
aduli, n cazul n care se suspecteaz o infecie i rezultatele procedurilor de
rutin au fost nerelevante. Aspiraia suprapubian este de asemenea utilizat la
pacienii pediatrici, atunci cnd probele de urin sunt dificil de obinut.
- Se rade pilozitatea din zona suprapubian (dac este necesar) i se
dezinfecteaz tegumentul cu soluie de povidon-iod;
- Se puncioneaz vezica, pe linia median, n dreptul simfizei pubiene
superioare;
- Se aspir prin acul de puncie cca. 50-100 ml urin i se descarc seringa
ntr-un recipient steril.
Timp maxim de ateptare: 2 ore la temperatura camerei.

Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


14
1.16. Secreiile vaginale

Se recolteaz cu ocazia examinrii pereilor vaginali i a poriunii vaginale a
colului uterin. Se va efectua ntotdeauna naintea tueului vaginal pentru a evita
modificarea secreiilor cervicale sau vaginale prin contaminare sau manevre septice. Se
efectueaz cu pacienta pe masa ginecologic, n poziie ginecologic (decubit dorsal,
coapsele n abducie, flexate pe abdomen, gambele flexate pe coapse i sprijinite n
suporturi). Valvele se aleg n funcie de mrimea vaginului pacientei. Ele sunt inegale -
una mai mare i alta mai mic. Introducerea valvelor n vagin trebuie s fie indolor.
Nu se folosete lubrifiant dac se recolteaz probe pentru frotiu citobacteriologic sau
cultur. Folosirea serului fiziologic steril ca lubrifiant poate fi util n cazul examinrii
unor paciente cu vagin atrofic, deoarece faciliteaz introducerea valvelor i nu
modific rezultatele testelor de laborator.
Se ndeprteaz cu policele i indexul minii stngi labile mici i se introduce
mai nti valva posterioar cu lama situat vertical, apoi printr-o micare de rotaie i
naintare se aduce lama orizontal, meninndu-se traciunea asupra valvei. Valva
anterioar se introduce direct cu lama situat orizontal pn n fundul de sac vaginal
anterior. Se exercit o traciune divergent asupra valvelor pentru a mpiedica
prinderea peretelui vaginal ntre valve i pentru a evidenia colul i fundurile de sac
vaginale. Extragerea valvelor se face n ordine invers introducerii lor, extrgndu-se
iniial valva anterioar i ulterior valva posterioar.
Vizualizarea pereilor vaginali se poate obine i prin folosirea unui speculum -
instrument ginecologic care poate fi confecionat din plastic sau din metal i este
alctuit din dou valve care sunt articulate printr-un urub sau ecartor. Sunt de mai
multe tipuri, mari, mici, cu lame egale, cu lame inegale, cu diverse denumiri (Cusco,
Graves, Pederson, Collin). Introducerea speculumului se face fie cu lamele situate
orizontal (mai uor la multipare), fie cu lamele vertical, imprimndu-se ulterior
introducerii o micare de rotaie i mpingere. Dup introducerea speculumului, se
ndeprteaz lamelele cu ajutorul ecartorului i se examineaz fundurile de sac
vaginale i colul. Extragerea speculumului se face apropiind lamele i efectund
micarea n sens invers introducerii.
Dup introducerea valvelor sau a speculumului se observ i se notez starea
mucoasei vaginale i a colului. Normal, mucoasa vaginal este de culoare roz-
trandafirie, uniform. Poate deveni violacee n sarcin sau palid, atrofiat dup
menopauz. Se mai are n vedere troficitatea mucoasei vaginale, eventuale cicatrici,
chisturi, noduli endometriozici, ulceraii, vegetaii, malformaii i nu n ultimul rnd
secreiile patologice. Acestea difer n funcie de agentul patogen; n candidoze,
secreia este alb, grunjoas, n infeciile cu Trichomonas este spumoas, aerat,
abundent, iar gonococul produce o secreie galben-verzuie, fetid.
Examenul colului va obiectiva situarea, orientarea, forma, mrimea, aspectul
exocolului, prezena unor secreii patologice, prezena unor leziuni. Normal, colul este
de culoare roz, dup menopauz este palid, iar n sarcin este de culoare violacee
(semnul Jaquemier). n caz de inflamaii, mucoasa este hiperemiat. Pe suprafaa
colului se mai pot observa chiti Naboth, focare endometriozice sau noduli fibromatoi.
Pentru a fi ct mai concludent, prelevarea trebuie s respecte anumite condiii:
- prelevarea se face naintea instituirii tratamentului antimicrobian sau antifungic;
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


15
C
a
p
i
t
o
l
u
l

- nu se folosesc creme vaginale sau ovule cu cel puin 2 zile nainte;


- nu se folosesc irigaii vaginale cu cel puin 24 de ore nainte;
- prelevarea nu se realizeaz n prezena sngelui n vagin;
- se folosesc recipiente sterile, pentru a preveni contaminarea probelor;
- evitarea contactului cu substane antimicrobiene a produsului patologic;
- n unele cazuri trebuie folosite medii de transport sau lichide conservante;
-recipientele de transport se nchid ermetic pentru a preveni contaminarea mediului
i a personalului care manipuleaz produsul biologic;
- produsul va fi nsoit de un bilet de trimitere completat corect;
- probele vor fi etichetate i transportate la laborator n cel mai scurt timp posibil.
Secreia se recolteaz cu ajutorul valvelor sau a speculumului, nelubrifiate,
folosind mici tampoane de vat montate pe pense port-tampon sau pipete absorbante.
Instrumentarul trebuie s fie steril. Tampoanele de vat pot fi iniial umezite n ser
fiziologic. Prima recoltare se face din fundul de sac posterior. Produsul recoltat se
etaleaz pe o lam n strat subire, se aplic o pictur de ser fiziologic, eventual o
pictur de albastru de metilen i apoi o lamel. A doua prelevare se realizeaz n
acelai mod, iar dup etalarea pe lam se aplic o pictur de KOH 10%, apoi lamela.
A treia recoltare se realizeaz cu o baghet steril sau cu un tampon pentru exsudate i
presupune tergerea fundului de sac posterior cu vrful acestora.
Probele se expediaz la laborator n maxim 2 ore (stocare la temperatura
camerei).

1.17. Produse patologice de la nivelul tractului genital masculin

n aceast grup includem prelevatele balano-prepuiale (pseudo-membranele
candidozice), secreia prostatic, aspiratul prostatic i biopsia testicular. n cazul
leziunilor balano-prepuiale, recoltarea probelor se realizeaz facil prin tergere
repetat cu un tampon steril de vat, umectat n prealabil cu ser fiziologic.
Secreia prostatic se obine prin efectuarea unui masaj digital transrectal.
Colectarea probelor se realizeaz n tuburi sterile sau cu ajutorul unui tampon steril i
va fi precedat obligatoriu de toaletarea penian. Detectarea ecografic a abceselor
prostatice permite recoltarea de probe prin aspiraie cu ac fin. Aspiratul de prostat se
trimite n recipieni sterili.
Biopsia testicular se efectueaz n servicii chirurgicale, n condiii de asepsie
i antisepsie depline, iar probele se trimit la laborator n recipiente sterile (cele pentru
cultur) sau coninnd fixator Bouin (cele pentru diagnostic histopatologic).

1.18. Fragmentele tisulare biopsice

Se recolteaz n timpul interveniilor chirurgicale i se transport nvelite n
tifon steril umectat cu ser fiziologic, n containere sterile. Timp maxim de ateptare: 15
minute la temperatura camerei. Fragmentele de esut suspectate a proveni dintr-un
focar de zygomicoz nu se mojareaz, nu se tritureaz, deoarece se distruge miceliul i
crete enorm riscul de a obine culturi negative.


Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


16
1.19. Tehnica aspiraiei cu ac fin

Aspiraia cu ac fin (AAF) este util pentru diagnosticul leziunilor care sunt
uor palpabile, cum ar fi excrescenele pielii, leziunile deformante ale esutului
subcutanat, tiroid, limfonoduri, glande salivare i sni. Aspiraia ghidat prin tehnici
imagistice cum ar fi computer-tomografia sau ultrasonografia permite obinerea de
probe i n cazul leziunilor organelor interne ca pulmonul, organele abdominale i
retroperitoneale, prostata etc. Riscul sczut al complicaiilor permite executarea ei n
ambulatoriu. AAF este indicat i la pacienii debilitai, cu leziuni multiple, fiind o
tehnic minim invaziv.
Acele pentru puncie vor avea un calibru standard de 22-24 G i lungime de
2,5-4 cm. Lungimea i calibrul acului trebuie s fie adecvate mrimii, profunzimii,
zonei i consistenei intei. Pentru leziunile subcutanate mici, acele de calibru 23G i
lungime de 2,5 cm sunt ideale, dei n leziunile profunde sunt necesare ace mai lungi i
cu diametru mai mare. Acele fine sunt de asemenea recomandate pentru copii, i pentru
organele vascularizate, cum ar fi tiroida.
Seringile recomandate n aceast tehnic sunt cele single-use, cu volum util de
10 ml. Seringile trebuie s fie de calitate, capabile s produc o presiune negativ
adecvat aspirrii. Seringile cu capacitate de 5 ml pot fi utilizate pentru organele
vascularizate precum tiroida. Un factor important este adaptarea etan a acului la
captul seringii. O potrivire neglijent a acestuia poate compromite procedura.
Manipularea pistonului seringii se realizeaz cu o mn, iar cu cealalt se fixeaz
leziunea.

Tehnica aspiraiei

naintea executrii aspiraiei trebuie urmate etapele:
1. Efectuarea unei anamneze riguroase i a unui examen clinic detaliat, cu
revederea rezultatelor radiologice i stabilirea diagnosticul prezumtiv. Trasarea
cu ajutorul unui marker a zonei corporale n care se va executa aspiraia;
2. Leziunea ce urmeaz s fie aspirat este palpat i fixat pentru a aprecia
punctul optim de abordare. Se va alege n consecin acul cel mai adecvat;
3. Procedura trebuie s fie clar explicat pacientului i consimit de acesta.
Pacientul poate prezenta o stare de anxietate, fiind necesar o premedicaie cu
tranchilizante. Pielea se dezinfecteaz ferm cu un tampon de vat mbibat n
soluie iodat. Anestezia local este uneori necesar;
4. nainte de nceperea procedurii, ne vom asigura c tot echipamentul necesar,
instrumentarul i accesoriile sunt disponibile;
5. Poziionarea pacientului: orice poziie poate fi aleas, inndu-se bineneles cont
de confortul pacientului i asigurarea cii de abord. AAF este de obicei
executat cu pacientul aezat n decubit dorsal pe un pat de examinare;
6. Imobilizarea leziunii: leziunea este fixat ntre policele i indexul minii stngi,
cu pielea uor tensionat. Se ncearc evitarea interpunerii maselor musculare
importante;
7. Penetrarea leziunii: se puncioneaz leziunea printr-o micare atent i rapid,
unghiul i profunzimea penetrrii variind dup caz. Pentru formaiunile mici,
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


17
C
a
p
i
t
o
l
u
l

este indicat aspiraia din zona central . Pentru formaiunile mai mari, care pot
avea necroze, modificri chistice sau hemoragice centrale, aspiraia poate fi
executat i de la periferie. Dac se aspir numai puroi sau material necrotic
din leziunile mari, AAF poate fi repetat imediat, de la periferie. Dac acul se
plaseaz tangenial n cazul unei formaiuni mici sau dac penetreaz dincolo
de formaiune, materialul nu va putea fi recoltat.
Not: Dac suprafaa zonei de execuie a AAF este localizat lng cutia toracic
(formaiuni nodulare axilare sau supraclaviculare), aspiraia se va executa ntr-un
plan paralel fa de cutia toracic pentru a evita penumotoraxul. n AAF la nivelul
tiroidei, pacientul trebuie instruit s nu nghit sau s vorbeasc cnd acul este plasat
n interiorul formaiunii.
8. Crearea vacuumului i obinerea materialului biologic: aspiraia este executat
dup ptrunderea n leziune i se menine n timp ce acul este acionat viguros
prin multiple micri de ,,du-te - vino, n cteva direcii diferite dar
convergente. ntreaga procedur trebuie s dureze maxim 6-8 secunde. Nu se
rotete acul i nici nu se fac micri de pompare a pistonului seringii (nuntru-
nafar). Rezultatul aspiraiei este extragerea de fragmente de esut i celule
dislocate de bizoul acului.
9. Eliberarea vacuumului i retragerea acului: cnd materialul biologic este
observat la baza acului, procedura se ntrerupe. naintea retragerii acului, se
elibereaz din tensiune pistonul seringii, apoi acul se scoate din formaiune,
drept, fr al nclina. Pistonul revine singur, ncet (fr a fi mpins). O eliberare
insuficient a presiunii negative n interiorul formaiunii va cauza aspirarea
materialului biologic la intrarea n sering, ceea ce-l va face dificil de
recuperat. n situaii excepionale, seringa i acul pot fi cltite cu ser fiziologic
sau fixator care apoi se va centrifuga pentru a prepara un frotiu. Imediat dup
retragerea acului, pe zona puncionat se aplic un tampon mbibat cu
dezinfectant i se preseaz cteva minute, de preferat de ctre un asistent.
Aceasta se realizeaz cu scopul de a preveni formarea unui hematom n zonele
intens vascularizate.
















Tehnici de recoltare, transport i procesare primar a prelevatelor clinice


18
Bibliografie selectiv

1. Artal M E (2004) - Diagnstico histopatolgico de las micosis; Rev
Iberoam Micol; 21:1-9.
2. Bates D W, Cook E F, Goldman L, et al. (1990) - Predicting bacteremia in
hospitalized patients: a prospectively validated model; Ann Intern Med;
113:495-500.
3. Brouqui P, Raoult D (2001) - Endocarditis Due to Rare and Fastidious
Bacteria; Clin Microbiol Rev; 24(1): 177-207.
4. Buiuc D, Negu M (1999) - Tratat de microbiologie clinic; Ed. Medical;
Bucureti.
5. Cicalese L (1999) - Bacterial translocation in intestinal transplant
recipients; Transplantation; 67(9): S589.
6. Darby J M, Linden P, Pasculle W, et al. (1997) - Utilization and diagnostic
yield of blood cultures in a surgical intensive care unit; Crit Care Med;
25:989-994.
7. Debelian G J (1998) - Anaerobic bacteremia and fungemia in patients
undergoing endodontic therapy: an overview; Ann Periodontol; 3(1):281-
287.
8. Doern G V (1994) - Manual blood culture systems and the antimicrobial
removal device; Clin Lab Med; 14:133-147.
9. Edgeworth J D, Treacher D F, Eykyn S J (1999) - A 25-year study of
nosocomial bacteremia in an adult intensive care unit; Crit Care Med;
27:1421-1428.
10. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed.
Viaa Medical Romneasc; Bucureti.
11. Grillot R (1996) - Les mycoses humaines - dmarche diagnostique;
Elsevier; Paris.
12. Hampton J R, Harrison M J G (1964) - Sterile blood cultures in bacterial
endocarditis; QJ Med; 36:167-174.
13. Harlod C N (1986) - Cost Effective Blood Cultures - Is It Possible or
Impossible to Modify Behavior? Infection Control; 7(1):32-33.
14. Hoog G S de, Guarro J, Gen J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
15. Jaimes F, Arango C, Ruiz G et al (2004) - Predicting Bacteremia at the
Bedside; Clinical Infectious Diseases; 38:357-362.
16. Lichtman Steven M (2001) - Baterial Translocation in Humans; Journal
of Pediatric Gastroenterology & Nutrition; 33(1):1-10.
17. Lionaskis M S (2004) - The significance of blood cultures positive for
emerging saprophytic moulds in cancer pacients; Clin Microb Infect; 10
(10):922-926.
18. Maoxin W, David E B (2004) - Fine Needle Aspiration, Cancer
Investigation; 22(4).
19. Peeanu V, Peeanu V, Balt M (1997) - Examene i investigaii n
ginecologie i obstetric; Ed. Ex Ponto, Bucureti.
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mare, Mihai Mare


19
C
a
p
i
t
o
l
u
l

20. Richardson M D, Warnock D W (2003) - Fungal infection - Diagnosis


and Management; Blackwell Publishing.
21. Ronveaux O, Jans B, Suetens C, Carasauw H (1998) - Epidemiology of
Bloodstream infections in Belgium 1992-1996; Eur J Clin Infect Dis; 17:
695-700.
22. Sutton D A (2003) - Specimen collection, transport, and processing:
Mycology; In Murray P R et al. (eds.); Manual of clinical microbiology;
8
th
edition; ASM Press; Washington D C; 2:1659-1667.
23. Varghese C, Venkataraman K, Bhagwat S et al. (2005) - Manual for
Cytology; Directorate General of Health Services Ministry of Health and
Family Welfare, India.
24. Warran D, Zack J, Elward A, Cox M, Fraser V (2001) - Nosocomial
primary bloodstream infections in intensive care unit patients in a
nonteaching community medical center: a 21-month prospective study;
Clin Infect Dis; 33:1329-1335.
25. Wingard J R (1999) - Fungal infections after bone marrow transplant; Biol
Blood Marrow Transplant; 5(2):55-68.







Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


21
C
a
p
i
t
o
l
u
l





Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan

xamenul microscopic direct al produselor patologice recent recoltate poate
orienta diagnosticul ctre o infecie fungic i uneori poate chiar oferi
indicii importante privind etiologia acesteia prin evidenierea unor formaiuni sau
elemente caracteristice. El este obligatoriu pentru orice tip de prelevat cu excepia
sngelui i are valoare diagnostic intrinsec deoarece permite confirmarea rapid a
suspiciunii de infecie micotic i informarea timpurie a clinicianului, cu mult timp
nainte de pozitivarea culturii. Se efectueaz pe prelevate n stare proaspt, cu sau fr
colorare prealabil (calcofluor, Giemsa etc.): lavaj bronhoalveolar (dup centrifugare),
biopsii (frotiuri prin amprent), sput (dup tratare cu N-acetil-cistein), hemoculturi,
prelevate superficiale cutanate, sinusale, conjunctivale, unghiale, auriculare.

Produsele patologice pentru care exist suspiciunea c ar conine fungi se pot
examina microscopic prin una dintre urmtoarele forme:
- preparat extemporaneu ntre lam i lamel, cu soluie 20% KOH (scuame,
fragmente unghiale, secreii linguale, vaginale); sensibilitatea metodei este
relativ sczut, depinznd de abilitatea i experiena anterioar a
examinatorului. n acest scop, se omogenizeaz pe o lam de microscopie
volume egale din materialul patologic i soluia clarificant, dup care se
acoper cu o lamel, astfel nct s se evite formarea bulelor de aer. Decelarea
formaiunilor fungice n prelevate este mult ameliorat dac la soluia
clarificant se adaug un colorant negru clorazol, cerneal Parker sau o
substan fluorescent cu afinitate pentru glicanul din peretele fungilor
(Blankophor, Calcofluor n proporie de 0,1%). Utilizarea substanelor
fluorescente incumb examinarea preparatului la un microscop cu fluorescen.
- preparat extemporaneu cu soluie 20% KOH + substan fluorescent sau frotiu
colorat cu aceeai substan fluorescent (Calcofluor, Blankophor etc.); este
metoda optim de detecie a fungilor n prelevate datorit unei sensibiliti i
specificiti excelente, dar necesit microscopie n lumin ultraviolet (fig. nr.
2-1 vezi Anexa). Cteva fragmente din prelevatul recoltat de la pacient se
depun pe o lam de sticl, ntr-o pictur de lichid clarificant (soluie 10-20%
KOH cu adaos de calcofluor 0,1%) care prin digerarea keratinei i a celulelor
somatice va permite observarea la microscop a diverselor formaiuni
E
2
Tehnici de microscopie direct
Tehnici de microscopie direct


22
caracteristice fungilor. Dup un contact de cca. 10-15 minute (eventual mai
ndelungat n cazul fragmentelor unghiale), lama se acoper cu o lamel i se
examineaz la microscop, cu obiectivele 10, 20 i 40, dup caz. Aciunea
lichidului clarificant poate fi intensificat prin nclzirea lamei la flacra unui
bec de gaz, fr ns a-l aduce la fierbere. n general, lama se poate examina
cnd opacitatea preparatului s-a diminuat vizibil.
- frotiu colorat Gram: pune cu uurin n eviden filamentele, pseudohifele,
artrosporii i blastosporii de dimensiuni mari, ns este inadecvat pentru
detecia celulelor levurice de dimensiuni mici de exemplu, Candida glabrata
(fig. nr. 2-2 vezi Anexa)
- frotiu pregtit pentru imunofluorescen prin tratare cu anticorpi monoclonali
cuplai cu markeri fluoresceni (n special pentru detecia Pneumocystis
jiroveci n prelevatele respiratorii)
- preparat extemporaneu colorat cu tu de India: pune n eviden levurile capsulate
din genul Cryptococcus, n sedimentul LCR, urinar, etc. (fig. nr. 2-3 vezi
Anexa)
- frotiu colorat May-Grunwald-Giemsa: metod de rutin pentru depistarea
levurilor intracelulare de tip Histoplasma, dar poate fi utilizat i pentru
detectarea levurilor prin microscopie direct (fig. nr. 2-4 vezi Anexa)
- frotiu necolorat sau colorat cu albastru de metilen 3%: metoda se poate folosi
pentru detectarea levurilor din hemoculturi, ns alte tehnici cu specificitate
mai ridicat sunt recomandate (fig. nr. 2-5 vezi Anexa)
- preparat extemporaneu cu band adeziv, colorat cu albastru de metilen n
lactofenol: metod expeditiv de diagnostic tip one-step a leziunilor de
Pityriazis versicolor (fig. nr. 2-6 vezi Anexa)
- frotiuri obinute prin etalare sau amprent (pornind de la prelevate ca aspiratul
bronic, LBA sau biopsiile) care apoi se coloreaz Musto sau cu calcofluor i
se examineaz n vederea decelrii aspectelor particulare care ar pleda pentru o
zygomicoz, aspergiloz etc.

Elementele morfologice identificabile prin examen microscopic direct sunt
levurile (burjeonate sau nu, intra- sau extracelulare, cu sau fr capsul), fragmentele
hifale, septate sau nu, uneori ramificate, celulele fumagoide - celule cu aspect
muriform, melanizate, de 4-12 m diametru, septate longitudinal i transversal,
granulele (numite i scleroi - elemente sferice, dure, de cca. 1 mm diametru, formate la
nivelul micetoamelor prin ntreeserea dens a hifelor), rar structurile de fructificare ale
unor fungi filamentoi.

2.1. Coloraia negativ cu tu de India

Scop
Se recomand pentru decelarea levurilor aparinnd speciei C. neoformans n
sedimentul unor fluide biologice (LCR, urin, etc.).

Echipamente
Lame i lamele de microscopie, mnui de unic folosin, pipete
Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


23
C
a
p
i
t
o
l
u
l


Reactivi
Tu de India sau tip Parker

Mod de lucru
1. Pe o lam de sticl degresat se depun i se amestec o pictur din sedimentul
probei de analizat i o pictur tu de India;
2. Se acoper cu o lamel de sticl evitnd formarea bulelor de aer;
3. Preparatul extemporaneu astfel obinut se examineaz la microscop
(x100, x400).

Rezultatul colorrii
Cryptococcus neoformans se prezint sub form de celule levurice rotunde,
nmugurite sau nu, nconjurate de un halou clar, necolorat, facil de vizualizat pe fondul
maron-negru al preparatului. Datorit necolorrii capsulei polizaharidice, metoda mai
poart denumirea de coloraia negativ cu tu de India.

2.2. Coloraia negativ cu mercurochrom 2% i tu de India

Scop
Reprezint o variant mbuntit a metodei anterioare, permind
vizualizarea a trei zone n componena capsulei i a unor corpusculi n interiorul
celulelor levurice la C. neoformans, ceea ce crete considerabil specificitatea
examenului microscopic direct.

Echipamente
Lame i lamele de microscopie, mnui de unic folosin, pipete

Reactivi
Soluie 2% mercurochrom (C
20
H
8
Br
2
HgNa
2
O
6
sarea disodic a 2,7-dibrom-4-
(hidroxomercurio)-fluoresceinei)
Tu India (sau tu negru tip Parker)

Mod de lucru
1. Pe o lam de sticl degresat se depun succesiv i se omogenizeaz o pictur
din sedimentul probei de analizat, o pictur sol. 2% mercurochrom i o
pictur tu de India;
2. Se acoper cu o lamel;
3. Se examineaz la microscop (x100, x400, x1000).

Rezultatul colorrii
Cryptococcus neoformans se prezint sub form de celule levurice rotunde,
nmugurite sau nu, nconjurate de o capsul clar, format din 3 zone concentrice; n
interiorul celulelor levurice sunt adesea observabili corpusculi de form rotund.


Tehnici de microscopie direct


24
2.3. Coloraia cu lactofenol i albastru de anilin (Lactophenol Cotton Blue)

Scop
Metod destinat colorrii i evidenierii prin microscopie a fungilor din unele
prelevate clinice i culturi.

Echipamente
Lame i lamele de microscopie, curate i degresate, ans de nsmnare,
mnui de protecie, pahar Berzelius, plnie, hrtie de filtru, agitator magnetic.

Reactivi

Lactofenol cu albastru de anilin

Albastru de anilin ......................................... 0,05 g
Fenol, cristale .............................................. 20,00 g
Glicerol ...................................................... 40,00 ml
Acid lactic .................................................. 20,00 ml
Ap distilat ............................................... 20,00 ml

Prepararea acestei soluii dureaz cca. dou zile:
1. n prima zi, se dizolv albastrul de anilin n apa distilat. Se las peste noapte
pentru decantarea colorantului insolubil;
2. AIIa zi, purtnd mnui de protecie, se adaug cristalele de fenol n acidul
lactic, ntr-un pahar Berzelius. Se omogenizeaz apoi folosind un agitator
magnetic pn la dizolvarea complet a fenolului;
3. Se adaug glicerolul;
4. Se filtreaz soluia de albastrul de anilin i se adaug n soluia de fenol /
glicerol / acid lactic. Se amestec i se pstreaz la temperatura camerei n
flacoane cu dop picurtor.

Mod de lucru
1. Se etaleaz pe o lam o cantitate suficient de prob;
2. Se adaug 1-2 picturi soluie de lactofenol i albastru de anilin;
3. Se omogenizeaz uor;
4. Se acoper cu o lamel i se examineaz la microscop.

Rezultatul colorrii
Fungii albastru-nchis

Not:
Soluia de lactofenol i albastru de anilin este disponibil comercial: Merck, Remel,
Becton-Dickinson (Lactophenol blue solution)



Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


25
C
a
p
i
t
o
l
u
l

2.4. Coloraia cu hidroxid de potasiu i cerneal Parker



Scop
Evidenierea elementelor fungice n raclatele tegumentare, pr i fragmente
unghiale, prin examen microscopic direct.

Echipamente
Lame i lamele de microscopie, curate i degresate, ans de nsmnare, pens

Reactivi

Hidroxid de potasiu .......................................... 10 g
Glicerol ........................................................... 10 ml
Cerneal Parker Quink Permanent Blue ......... 10 ml
Ap distilat .................................................... 80 ml

Se dizolv KOH n ap, apoi se adaug glicerol i cerneala Parker. Glicerolul
previne cristalizarea reactivului i deshidratarea probei.

Mod de lucru
1. Se utilizeaz o ans de nsmnare sau pens pentru ndeprtarea unei mici
poriuni din proba de esut, n special din zonele necrotice sau purulente.
Aceasta se etaleaz ntr-o pictur de colorant, pe o lam de microscopie;
2. Se acoper cu o lamel i apoi se comprim preparatul cu ajutorul captului unei
anse de nsmnare pentru ndeprtarea excesului de fluid. Se nclzete uor
preparatul prin trecerea acestuia de 2-3 ori prin flacr, evitndu-se fierberea;
3. Dup clarificarea preparatelor (15-20 minute pentru raclatele pielii i cteva ore
pentru raclatele unghiale), acestea se vor examina la microscop (x10, x20, x40)
pentru punerea n eviden a elementelor fungice.

Rezultatul colorrii
Elementele fungice apar colorate n albastru pal.

Not:
1. Aceast tehnic este frecvent utilizat, dar timpul necesar pentru clarificarea i colorarea
complet poate fi mai ndelungat. Preparatele se pot pstra pn cnd rezultatele culturii
sunt cunoscute.
2. Probele negative la prima citire trebuie pstrate i reexaminate n ziua urmtoare pentru a
evita raportarea unor rezultate fals negative, datorit ntrzierii clarificrii i colorrii
probei.

2.5. Clarificarea cu hidroxid de potasiu i dimetil sulfoxid

Scop
Evidenierea elementelor fungice prin examenul microscopic direct al
raclatelor tegumentare, pr i unghii (n special detecia dermatofitozelor).

Tehnici de microscopie direct


26
Echipamente
Lame i lamele de microscopie, curate i degresate, ans de nsmnare, pens

Reactivi

Dimetil sulfoxid (DMSO) ............................... 40 ml
Ap distilat .................................................... 60 ml
Hidroxid de potasiu .......................................... 10 g

Se adaug dimetil sulfoxidul n apa distilat i apoi se dizolv KOH n soluia
respectiv.

Mod de lucru
1. Se utilizeaz o ans de nsmnare sau o pens pentru recoltarea unei mici
poriuni din prelevat. Aceasta se etaleaz apoi ntr-o pictur de KOH-DMSO
pe o lam de microscopie;
2. Se acoper cu o lamel, se comprim uor preparatul cu ajutorul captului unei
anse de nsmnare i apoi se ndeprteaz excesul de fluid. Preparatul nu se
nclzete;
3. Se examineaz la microscop, cu diafragma semideschis pentu a surprinde mai
uor elementele fungice refringente, necolorate.

Note:
1. DMSO permite o macerare i o clarificare mult mai rapide dect hidroxidul de potasiu
singur.
2. Preparatele nu se vor pstra dup examinare.

2.6. Coloraia cu calcofluor alb i KOH 10%

Scop
Evidenierea elementelor fungice din diverse prelevate, prin microscopie cu
fluorescen.

Echipamente
Lame i lamele de microscopie, curate i degresate, ans de nsmnare,
pens.










Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


27
C
a
p
i
t
o
l
u
l


Reactivi

Soluia A

Hidroxid de potasiu .......................................... 10 g
Glicerol ........................................................... 10 ml
Ap distilat .................................................... 90 ml

Se dizolv KOH n ap i apoi se adaug glicerolul.

Soluie B

Calcofluor alb .................................................. 0,1 g
Ap distilat ............................................... 100,0 ml

Se dizolv calcofluorul alb pulbere n apa distilat uor nclzit.

Mod de lucru
1. Se amestec o pictur din fiecare soluie (A i B) n centrul unei lame de
microscopie;
2. Se etaleaz proba de esut n soluie i apoi se acoper cu o lamel, comprimnd
preparatul cu captul unei anse de nsmnare. Excesul de lichid se elimin;
3. Alternativ, n funcie de natura prelevatului se pot obine i frotiuri prin
amprent sau tergere, care se trateaz apoi cu soluiile reunite menionate;
4. Se nclzete uor lama i se examineaz la microscopul cu fluorescen echipat
cu filtre adecvate.

Rezultatul colorrii
Elementele fungice prezente n preparat vor apare colorate n albastru
fluorescent sau verde-deschis, n funcie de filtrele utilizate.

Note:
1. Este o metod expeditiv i sensibil, totui este necesar ca microscopul cu fluorescena s
fie dotat cu filtre care s determine o sensibilizare la lumina ultraviolet, cu o lungime de
und joas, de cca. 400 nm.
2. Calcofluorul alb (M2R pulbere - Polysciences sau Blankophor BA - Bayer) este utilizat ca
agent de albire n industria hrtiei, legndu-se selectiv de celuloz i chitin. Este un
colorant fluorescent pentru fungi.







Tehnici de microscopie direct


28
2.7. Coloraia Gram
*


Scop
Identificarea fungilor prin examenul microscopic al frotiurilor executate din
diverse lichide biologice.

Fixator
Metanol absolut

Echipamente
Lame de sticl pentru microscopie (25/75 mm) cu un capt mat, pipete Pasteur,
anse de nsmare microbiologic, ace de inoculare, recipiente pentru depozitarea de
deeuri biologice
Materiale opionale, depinznd de sursa probelor i de protocolul laboratorului:
a) plit nclzitoare, 60C;
b) centrifug;
c) agitator tip Vortex;
d) tuburi sterile cu dop filetat;
e) foarfece sterile, bisturie, pense.

Reactivi

Soluia de cristal violet

Cristal violet ....................................................... 2 g
Etanol 95% ..................................................... 20 ml
Oxalat de amoniu ............................................. 0,8 g
Ap distilat .................................................... 80 ml

Se dizolv cristalul violet n etanol i oxalatul de amoniu n ap. Se las soluia
de oxalat de amoniu peste noapte pentru solubilizare complet sau se nclzete uor
pn la dizolvare. Se amestec cele dou soluii i apoi se filtreaz.

Soluia iod-iodurat Gram (soluia Lugol)

Iod ....................................................................... 1 g
Iodur de potasiu ................................................ 2 g
Ap distilat .................................................. 275 ml

Se adaug iodul peste iodura de potasiu, n aproximativ 25 ml ap distilat.
Cnd solubilizarea este complet se adaug restul de ap.
Atenie! Iodul este coroziv. Se evit inhalarea, ingestia sau contactul cu pielea.



*
vezi coloraia Gram-calcofluor alb
Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


29
C
a
p
i
t
o
l
u
l

Soluia de alcool-aceton

Etanol 95% ................................................... 100 ml
Aceton ......................................................... 100 ml

Se omogenizeaz i se pstreaz ntr-un recipient brun, etichetat cu data
preparrii, la temperatura camerei. Soluia este stabil 1 an.
Atenie! Etanolul i acetona sunt inflamabile.
Safranin O 0,4 %

Safranin O ......................................................... 1 g
Ap distilat .................................................. 250 ml

Mod de lucru
1. Frotiurile pot fi fixate prin nclzire sau cu metanol;
2. Frotiurile se pot usca n aer sau se menin pe o platin nclzitoare electric, la
60C, pn la uscare:
3. Dac frotiurile sunt uscate n aer se vor trece de dou sau trei ori printr-o flacr.
Pentru a evita denaturarea frotiului, acesta nu se supranclzete.
4. Se las lama s se rcesc nainte de colorare;
5. Fixarea cu metanol previne liza eritrocitelor. De asemenea, fixarea cu metanol
este recomandat pentru toate prelevatele clinice lichide, n special pentru
urin, deoarece previne splarea probelor n timpul colorrii. Metanolul se
stocheaz n sticle brune cu dop etan. O cantitate de lucru poate fi pstrat n
recipieni de plastic, dac aceasta se nlocuiete la fiecare 2 sptmni. Pentru
fixare, se adaug cteva picturi de metanol pe lam, se las n contact timp de
1 minut, apoi se vars i se las lama s se usuce la aer;
6. Se inund frotiul astfel fixat, cu soluie de cristal violet. Se las n contact 60
secunde;
7. Se vars soluia de cristal violet i se cltete lama uor cu ap de robinet.
Atenie! Cltirea excesiv poate determina ndeprtarea cristalului violet din
celulele gram-pozitive. Apa se vars pe unul din capetele lamei, oblic, pentru a
asigura o curgere lent peste frotiu.
8. Se cltete apoi cu soluie Lugol, timp de 3 secunde;
9. Se inund frotiul cu soluie Lugol i se las n contact 30 secunde;
10. Se spal cu ap de robinet;
11. Se toarn soluie alcool-aceton peste frotiu, ntr-un capt al lamei, oblic, pn
cnd soluia care se scurge la capatul opus devine clar. Timpul de decolorare
variaz n funcie de grosimea frotiului (n general 8-10 secunde);
12. Se spal cu ap de robinet;
13. Se inund lama cu soluie de safranin 0,4 %, timp de 30 secunde;
14. Se ndeprteaz colorantul (safranin 0,4%) cu un jet de ap de robinet ;
15. Se usuc lama n aer, n poziie vertical, iar apoi se terge reversul acesteia cu
un erveel mbibat n alcool sau aceton.


Tehnici de microscopie direct


30
Rezultatul colorrii
Fungii sunt Gram-pozitivi, deci se vor colora n violet.

Note:
1.Dac soluia de cristal violet prezint precipitat sau sediment, se refiltreaz nainte de
utilizare. Unii colorani, n special safranina, se pot contamina. Cnd se suspecteaz
acest lucru, se nlocuiesc.
2. Evaporarea poate altera eficacitatea reactivilor; soluiile de lucru trebuie schimbate
regulat.
3. Zilnic sau cnd se folosete un nou lot de reactivi se realizeaz controlul de calitate prin
executarea unui frotiu din Escherichia coli (ATCC 25922) i Staphylococcus
epidermidis (ATCC 12228) sau Staphylococcus aureus (ATCC 25923). Acesta se
fixeaz i se coloreaz dup tehnica descris mai sus. Rezultatele colorrii frotiului de
control:
a) coco-bacili Gram-negativi: roz;
b) coci Gram-pozitivi: violet intens.
4. Cteva dintre cauzele cele mai frecvente care duc la obinerea unor rezultate
nesatisfctoare ale coloraiei Gram:
a) utilizarea unor lame de microscopie insuficient degresate. Pentru acest lucru, se
pstreaz lamele ntr-un pahar cu etanol 95%. Excesul de alcool se
ndeprteaz prin tergerea sau flambarea lamelor nainte de utilizare;
b) executarea unor frotiuri prea groase;
c) supranclzirea frotiului cnd acesta este fixat prin cldur;
d) splarea excesiv pe durata procedurii de colorare.

2.8. Coloraia Gram - calcofluor alb

Scop
Uneori, fungii nu se pot distinge cu acuratee n frotiurile colorate Gram sau
pot rmne mascai de alte materiale din prob. n aceast situaie, calcofluorul alb
poate fi utilizat pentru supracolorarea frotiurilor colorate Gram n vederea unei mai
bune evidenieri a elementelor fungice.

Echipamente
Lame i lamele pentru microscopie, hrtie de filtru, beioare din lemn,
microscop cu fluorescen, sticlrie de laborator

Reactivi

Xilen
Metanol absolut
Soluie de hidroxid de potasiu 10 sau 20%
Calcofluor alb

Mod de lucru
1. Se coloreaz frotiul prin tehnica de colorare Gram;
2. Se aplic peste frotiul colorat Gram un fragment de hrtie absorbant, pentru a-l
usca;
Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


31
C
a
p
i
t
o
l
u
l

3. Se inund lama cu xilen pentru 1-2 ore, n funcie de grosimea frotiului;


4. Se cltesc lamele n metanol absolut pentru a ndeprta resturile tisulare;
5. Se inund lama cu soluie KOH 10-20% pentru 1-2 ore, n funcie de grosimea
frotiului;
6. Se ndeprteaz KOH, se adaug o pictur de calcofluor alb 0,1% i se
omogenizeaz uor cu un beior de lemn;
7. Se aplic apoi o lamel prin presare uoar. Preparatul se examineaz la
microscopul cu fluorescen folosind filtre speciale (490-520 nm);
8. Elementele fungice care n prealabil nu sunt vizibile sau sunt neidentificabile n
frotiurile colorate Gram, pot fi distinse mai facil ca structuri fluorescente.

Not:
Multe din prelevatele clinice trimise laboratoarelor de microbiologie pentru
examinare pot conine i elemente fungice, care de multe ori sunt nedetectate sau confundate.
De aceea este imperios necesar o instruire a personalului n vederea creterii performanelor
examenului microscopic direct i n ceea ce privete detectarea elementelor fungice pe frotiuri
colorate Gram.

2.9. Coloraia Giemsa

Scop
Evidenierea trofozoiilor i a corpilor intrachitici (nu i a chitilor) la
Pneumocystis carinii, prin examenul microscopic al frotiurilor executate din prelevate
respiratorii joase.

Fixator
Metanol absolut

Echipamente
Lame i lamele pentru microscopie, curate i degresate, sticlrie de laborator,
hrtie de filtru

Reactivi

Soluia Giemsa stoc

Colorant Giemsa, pulbere ................................ 0,8 g
Glicerol ........................................................ 50,0 ml
Metanol absolut ........................................... 50,0 ml

Se dizolv pulberea de colorant Giemsa n glicerol, apoi se nclzete soluia
pe baie de ap pn la 56-60C, timp de 90-120 minute. Se adaug metanolul, se
omogenizeaz i se filtreaz. Soluia stoc se va pstra la temperatura camerei ntr-un
recipient nchis.

Soluie Giemsa de lucru
Soluia stoc se dilueaz n proporie de 1:50 cu soluie de fosfat Sorensen.
Tehnici de microscopie direct


32

Soluie fosfat Sorensen pH 6,4

Fosfat de potasiu monobazic ......................... 6,63 g
Fosfat de potasiu dibazic anhidru .................. 2,56 g
Ap distilat ................................................ 1000 ml

Mod de lucru
1. Se usuc frotiul n aer;
2. Se fixeaz cel puin 30 secunde (uzual 3-4 minute) n metanol absolut;
3. Se ndeprteaz metanolul prin nclinarea lamei sau prin scoaterea acesteia din
paharul cu fixator, apoi se usuc n aer;
4. Se introduc lamele complet uscate ntr-un pahar Berzelius sau se aeaz
orizontal n suportul unei baterii de colorare care conine soluie Giemsa de
lucru, pentru 20-30 minute;
5. Se spal lama cu ap distilat;
6. Se terge pe verso, apoi se usuc n aer;
7. Se monteaz sau nu, apoi se examineaz la microscop. nainte de montare,
lamela se introduce n xilen pentru a evita apariia bulelor.

Rezultatul colorrii
Trofozoiii apar de obicei n plaje, aglomerai, cu nucleul colorat n rou-
violet i citoplasma n gri.

Note:
1. Prelungirea imersiei n soluia Giemsa diluat poate face ca materialul biologic de pe
lam s se desprind.
2. Colorantul Giemsa este disponibil comercial.


2.10. Coloraia May-Grunwald-Giemsa (MGG)

Scop
Este o coloraie de elecie pentru depistarea intramacrofagic a formei levurice
aparinnd speciei Histoplasma capsulatum var. capsulatum.

Fixator
Metanol absolut

Echipamente
Lame i lamele pentru microscopie, curate i degresate, sticlrie de laborator,
hrtie de filtru




Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


33
C
a
p
i
t
o
l
u
l

Reactivi

Soluia de colorare I (May- Grnwald)

May-Grnwald pulbere ................................... 0,3 g
Metanol absolut ......................................... 100,0 ml

Dup preparare se pstreaz ntr-un recipient etan, la temperatura camerei
timp de 24 ore. Se filtreaz nainte de utilizare.


Soluia de colorare II (Giemsa)

Colorant Giemsa pulbere .................................... 1 g
Glicerol ........................................................... 66 ml
Metanol absolut .............................................. 66 ml

Colorantul Giemsa se dizolv n glicerol i apoi se nclzete la 56C timp de
90-120 minute. Se adaug metanolul agitnd pentru omogenizare. Soluia final se
pstreaz la temperatura camerei ntr-un recipient nchis. Se filtreaz nainte de
utilizare.

Soluia tampon Srensen pH 6,8

Fosfat de sodiu dibazic .................................... 0,3 g
Fosfat de sodiu monobazic .............................. 0,7 g
Ap distilat ............................................... 100,0 ml

Dup preparare, soluia se pstreaz la frigider; este stabil timp de 1 an.

Mod de lucru
1. Se fixeaz frotiurile n metanol absolut, timp de 30 secunde;
2. Se ndeprteaz metanolul;
3. Se aplic soluia de colorare I proaspt diluat 1:1 cu soluie tampon, timp de 5
minute (lama va fi poziionat orizontal sau introdus ntr-un pahar);
4. Se transfer lamele fr splare prealabil n soluia de colorare II diluat recent
cu 9 pri de soluie tampon, pentru 10-15 minute;
5. Se imerseaz lamele n soluie tampon pentru ndeprtarea colorantului;
6. Se spal lamele cu ap de robinet din abunden;
7. Se transfer ntr-un pahar cu ap pentru 2-5 minute;
8. Se usuc apoi ntr-o poziie oblic. Nu se usuc prin tergere;
9. Se poate monta o lamel, ns nu este neaprat necesar.

Rezultatul colorrii
Fungii nuane de roz, albastru, violet

Tehnici de microscopie direct


34
Note:
1. Este important ca lamele s nu se usuce n timpul colorrii, pentru a preveni apariia
artefactelor sau formarea de precipitate.
2.Soluia stoc May-Grunwald i colorantul Giemsa sunt disponibile comercial

2.11. Coloraia Wright

Scop
Evidenierea formelor levurice la Histoplasma capsulatum var. capsulatum
prin examen microscopic al frotiurilor executate din snge i mduv osoas
hematogen

Fixator
Metanol absolut

Echipamente
Lame i lamele pentru microscopie, curate i degresate, sticlrie de laborator,
hrtie de filtru

Reactivi

Soluie de colorare (care poate fi achiziionat ca soluie gata preparat sau ca pulbere
din diverse surse comerciale)

Colorant Wright pulbere .................................. 0,3 g
Metanol absolut ......................................... 100,0 ml

Dup preparare, soluia se menine ntr-un recipient etan la temperatura
camerei timp de 24 ore i se filtreaz nainte de utilizare.

Soluie tampon Sorensen pH 6,4

KH
2
PO
4
anhidru ............................................ 6,63 g
Na
2
HPO
4
anhidru ........................................... 2,56 g
Ap distilat .......................................... ad 1000 ml.

Mod de lucru
1. Se usuc frotiul i se fixeaz apoi cel puin 30 secunde n metanol absolut;
2. Se ndeprteaz metanolul prin nclinarea lamei;
3. Se aplic soluia de colorare, timp de 2 minute, peste lama poziionat orizontal,
numrnd picturile;
4. Se adaug peste colorant aceeai cantitate din soluia tampon. Se omogenizeaz
atent colorantul i soluia tampon fr a atinge suprafaa filmului de lichid (va
apare o strlucire metalic la suprafaa amestecului);
5. Se las amestecul n contact cu frotiul timp de 3 minute;
6. Se cltete lama cu ap distilat timp de 30 secunde;
Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


35
C
a
p
i
t
o
l
u
l

7. Lamele se usuc n poziie vertical. Nu se vor terge;


8. Dac se dorete, frotiul se poate monta prin acoperire cu o lamel.

Rezultatul colorrii
Fungii culoare violet

2.12. Coloraia cu mucicarmin Southgat

Scop
Coloraia se utilizeaz pentru detectarea materialului capsular la Cryptococcus
neoformans


Echipamente
Lame i lamele de microscopie, curate i degresate, ans de nsmnare,
pahare Berzelius, plnie de filtrare, hrtie de filtru, baie de ap

Reactivi

Rou Carmin .................................................... 1,0 g
Hidroxid de aluminiu pulbere .......................... 1,0 g
Etanol 50% ................................................ 100,0 ml

Dup omogenizarea acestor substane, n soluie se adaug:

Clorur de aluminiu anhidr ............................ 0,5 g

Se fierbe pe baia de ap pentru 2-3 minute, apoi se las s se rceasc. Se
completeaz pn la volumul iniial cu etanol 50% i apoi se filtreaz. Soluia stoc este
stabil cteva luni.

Hematoxilina Ehrlich
Vezi coloraia hemalaun-eozin

Alcool acid 0,5%
Vezi coloraia hemalaun-eozin

Mod de lucru
1. Se hidrateaz seciunile sau se execut un frotiu (dup caz);
2. Se coloreaz cu hematoxilin timp de 15 minute;
3. Se difereniaz cu alcool-acid i apoi se cltesc cu ap de robinet;
4. Se coloreaz pentru 30 minute n soluia rou carmin;
5. Cltire n ap distilat, deshidratare, clarificare i montare.



Tehnici de microscopie direct


36
Rezultatul colorrii
Mucicarminul coloreaz mucinele acide n roz (capsula va deveni astfel
colorat)

2.13. Coloraia Musto

Scop
Punerea n eviden a elementelor fungice prin examenul microscopic al
frotiurilor

Echipamente
Lame i lamele pentru microscopie, curate i degresate, sticlrie de laborator,
plit electric, vase din sticl Pyrex

Reactivi

Metenamin - soluie stoc

Metenamin 3 % ........................................... 100 ml
Azotat de argint 0,15 % .................................... 5 ml

n momentul adaugrii soluiei de metenamin peste soluia de azotat de argint,
se va forma un precipitat alb, care va dispare prin agitarea paharului. Soluia final este
stabil 3 luni i se pstreaz la 4C.
Atenie! Coroziv, posibil carcinogen.

Metenamin - soluie de lucru

Borax 5% .......................................................... 2 ml
Ap distilat .................................................... 25 ml
Metenamin soluie stoc ................................. 25 ml

Se adaug soluia de borax n ap distilat, apoi se omogenizeaz cu soluia
stoc de metenamin. Se prepar extemporaneu.

Acid cromic 5%

Trioxid de crom .................................................. 5 g
Ap distilat .................................................. 100 ml

Soluia se poate pstra 6 luni.
Atenie! Acidul este coroziv, posibil carcinogen. Se vor evita contactul i
inhalarea.



Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


37
C
a
p
i
t
o
l
u
l

Borax 5%

Borat de sodiu .................................................. 5,0 g
Ap distilat .......................................... ad 100,0 ml

Soluia este stabil 3 luni.

Bisulfit de sodiu 1%

Bisulfit de sodiu .................................................. 2 g
Ap distilat ............................................. ad 200 ml

Se pstreaz la 4C.

Clorur de aur 0,2%

Clorur de aur .................................................. 0,2 g
Ap distilat ............................................... 100,0 ml

Se pstreaz la frigider n recipiente etane, riguros igienizate n prealabil.
Soluia este stabil 1 an.
Atenie! Se evit contactul i inhalarea.

Tiosulfat de sodiu 2 %

Tiosulfat de sodiu ............................................... 4 g
Ap distilat ............................................. ad 200 ml

Se pstreaz la 4C.

Verde luminos 1%

Verde luminos SF yellow ................................... 1 g
Ap distilat ............................................. ad 100 ml
Acid acetic glacial .................................... 5 picturi

Dup preparare se pstreaz la frigider.
Atenie! Se evit contactul i inhalarea.

Mod de lucru
1. Fixarea: se nclzete acidul cromic 5% pn la 65C pe o plit electric i apoi
se imerseaz imediat lamele timp de 1 minut;
2. Cltire de dou ori n ap distilat ;
3. Se introduc preparatele n bisulfitul de sodiu, timp de 1 minut;
4. Se cltesc lamele n ap distilat
Tehnici de microscopie direct


38
5. Impregnarea argentic: soluia de lucru se transfer ntr-un vas de sticl Pyrex i
apoi se imerseaz lamele. Se nclzete rapid la 90-95C timp de 2-3 minute:
soluia i schimb culoarea de la cenuiu la negru, iar lamele devin maro;
6. Cltire de trei ori n ap distilat;
7. Lamele se introduc n clorur de aur 0,2% timp de 1 minut;
8. Cltire cu ap distilat;
9. Imersare n tiosulfat de sodiu, timp de 1 minut;
10. Cltire cu ap distilat;
11. Contra-colorarea cu verde luminos, timp de 1 minut;
12. Cltire cu ap de robinet, timp de 2 minute;
13. Deshidratare n etanol 95% cteva secunde, apoi n alcool absolut, de dou ori
timp de cteva secunde;
14. Se introduc lamele n xilen sau metil-ciclohexan cteva secunde, pentru
clarificare;
15. Se monteaz lamele n Eurik.

Rezultatul colorrii
Fungii culoare brun-negricios
Fondul verde

Not:
1. Coloraia Musto este versiunea rapid a metodei Gomori-Grocott, utiliznd tot
principiul impregnrii argentice.
2. Soluiile din bateria de colorare se rennoiesc dup 4 etape sau din 2 n 2 sptmni.
3. Aceast metod comport n principal trei faze:
fixarea cu acid cromic
colorarea cu nitrat de argint - metenamin
contra-colorare cu verde luminos
4. Oxidarea gruprii hidroxil a polizaharidelor fungice parietale i complexarea lor cu
reactivul argentic, determin coloraia brun-negricioas a fungilor pe un fond verde
al preparatului.
5. Aceast tehnic prezint mai multe avantaje:
reproductibilitate excelent i rapiditate (aproximativ 20 minute)
costuri moderate
posibilitatea de aplicare pentru o varietate larg de probe biologice, inclusiv
pentru prelevatele bronho-alveolare n investigarea pentru pneumocistoz
simplitatea tehnicii i uurina cu care se detecteaz elementele fungice, chiar
dac acestea sunt foarte rare
6. Pentru reuita coloraiei trebuie respectate trei condiii eseniale:
indicaiile tehnice
folosirea unei lame-martor la fiecare serie de colorare
rennoirea regulat a reactivilor
7. Frotiurile sero-fibrinoase (lichid pleural, articular etc.) prezint uneori inconvenientul
c se desprind de pe lam n cursul colorrii. Acest inconvenient nu poate fi remediat,
dar dac frotiul nu s-a desprins n totalitate se poate recurge la o metod de
examinare microscopic direct ntre lam i lamel.


Mihai Mare, Bogdan Doroftei, Petru Cazacu, Maria Dan


39
C
a
p
i
t
o
l
u
l

Bibliografie selectiv

1. Bridgman C P (1992) - Micoscopic Anatomy Laboratory Manual;
Washington University School of Medicine, St. Louis, Missouri.
2. Buiuc D, Negu M (1999) - Tratat de microbiologie clinic; Ed. Medical;
Bucureti.
3. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed. Viaa
Medical Romneasc; Bucureti.
4. Grillot R (1996) - Les mycoses humaines - dmarche diagnostique; Ed.
Elsevier; Paris.
5. Hoog G S de, Guarro J, Gen J, Figueras M J (2000) - Atlas of clinical fungi;
2
nd
ed; Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili.
6. Houwen B (2000) - Blood Film Preparation and Staining Procedures;
Laboratory Hematology; Carden Jennings Publishing Co Ltd.
7. Richardson M D, Warnock D W (2003) - Fungal infection - Diagnosis and
Management; Blackwell Publishing.
8. Zerba R, HuiHuicho L, Guillen A (1996) - Modified India ink preparation for
C.neoformans in cerebrospinal fluid specimens; J Clin Microbiol; 34(9):2290-
2291.


Luminia Malic, Olimpia Bazgan, Mihai Mare


41
C
a
p
i
t
o
l
u
l




Luminia Malic, Olimpia Bazgan, Mihai Mare

3.1. Generaliti

efinirea mediilor de cultur ntr-o manier complet i complex, n
contextul varietii covritoare a entitilor taxonomice microbiene i a
exigenelor nutritive extrem de diverse pe care acestea le reclam n dezvoltarea lor,
este o ncercare destul de dificil pentru microbiologul practician. Acest demers
rmne n domeniul speculativ, deoarece orice ncercare n acest sens va tinde s
satisfac mai curnd legile semanticii dect rigorile practicii medicale.
Totui, putem defini mediile de cultur ca un complex de substane chimice
pure sau dimpotriv, de substraturi organice i minerale cu un grad mai redus de
puritate, care s ofere microorganismelor posibilitatea dezvoltrii i multiplicrii,
imitnd pe ct posibil condiiile trofico-habituale din organismele gazd sau din
biotopurile naturale specifice.
Izolarea n condiii de laborator a fungilor din prelevatele patologice, indiferent
de natura lor, este o necesitate indiscutabil pentru nelegerea procesului morbid
infecios i pentru iniierea terapiei etiotrope.
Diversitatea fungilor, ca bioentiti cu potenial patogen, justific includerea n
mediile de cultur a unei game largi i variate de nutrieni care s asigure izolarea
i/sau identificarea lor n condiii optime. Au fost formulate astfel o multitudine de
medii de cultivare incluznd ingrediente cu grade diferite de specificitate, care s
corespund dezideratelor de eficien, precizie i expeditivitate din micologia clinic.
Investigarea particularitilor biochimice ale fungilor, n special a profilului lor
enzimatic, a fcut posibil n ultimul timp formularea unor medii de cultur mai
complexe, care permit identificarea mai facil a acestor microorganisme din
prelevatele patologice. Astzi, o adevrat industrie, susinut de o intens activitate de
cercetare, produce o gam extrem de diversificat de substraturi nutritive i medii de
cultivare, care ofer generoase posibiliti de folosire n demersul diagnostic al bolilor
infecioase induse de fungi.



D
3
Medii de cultivare
Medii de cultivare

42
3.2. Compoziia mediilor de cultur

Particularitile metabolice i numrul apreciabil al fungilor incumb folosirea
unor substraturi nutritive variate, fcnd practic imposibil obinerea unui mediu
standard pentru toate speciile de interes medical. Unele formule (Sabouraud, Czapek,
PDA) permit totui dezvoltarea unui numr mare de entiti taxonomice aparinnd mai
multor genuri.
n general, principalele componente ale mediilor de cultur sunt reprezentate
de substanele nutritive, agenii revelatori, factorii inhibitori, apa i agenii de
solidificare (n cazul mediilor solide).
Substanele nutritive sau nutrienii sunt reprezentate de o grupare pletoric de
substane chimice care sunt incluse n medii pentru a oferi fungilor: o surs de carbon,
o surs de azot i promotori de cretere (substane minerale, vitamine, acizi grai etc.).
Din punct de vedere al structurii chimice, nutrienii pot fi:
n cazul surselor de carbon:
1. monozaharide (glucoza sau dextroza, fructoza, manoza, galactoza, xiloza,
ramnoza, arabinoza)
2. di- i oligozaharide (zaharoza sau sucroza, lactoza, maltoza, celobioza,
trehaloza, rafinoza)
3. polizaharide (amidon, glicogen, celuloz, chitin etc.)
4. acizi organici (tartric, citric, oxalic, malonic etc.)
5. lipide
n cazul surselor de azot:
1. substane anorganice azotate (nitrai, nitrii, sruri de amoniu)
2. peptide i proteine (pepton, hidrolizat de cazein, gelatin, cazein,
keratin, ovalbumin)
3. aminoacizi (glicin, triptofan, glutamin, histidin .a.)
4. uree
n cazul promotorilor de cretere:
1. substane minerale (sub form de sruri care s conin Na, K, Mg, Ca,
Fe, Cu, Zn, Co, P, S .a.)
2. vitamine (tiamin, acid nicotinic, inozitol etc.)
3. acizi grai cu lan lung de atomi de carbon (C
12
-C
24
), necesari pentru
dezvoltarea levurilor lipodependente ale genului Malassezia.
Se recomand ca n mediile de cultur solide destinate izolrii fungilor,
raportul C:N s fie de 9-12:1. Factorii inhibitori sunt reprezentai de substane ce pot
supresa dezvoltarea unor categorii de microorganisme, mai ales a celor contaminante,
indezirabile n manoperele de izolare i identificare a fungilor cu semnificaie clinic.
Este vorba, n principal, de bacterii i fungi saprobioi, ubicuitari, care alturi de fungii
patogeni sau condiionat patogeni, compun n mod obinuit microflora diverselor
prelevate recoltate din situsuri normal nesterile. Pentru anihilarea dezvoltrii
bacteriilor, se recomand nglobarea n mediile de cultur destinate izolrii fungilor, a
unor substane din grupa antibioticelor (penicilin, streptomicin, cloramfenicol,
gentamicin, ciprofloxacin, tobramicin) sau a coloranilor (cristal violet, Rose
Bengal).
Luminia Malic, Olimpia Bazgan, Mihai Mare


43
C
a
p
i
t
o
l
u
l

Izolarea fungilor patogeni este favorizat de nsmnarea prelevatelor pe


medii solide ce conin cicloheximid, substan capabil s inhibe parial sau total
dezvoltarea fungilor contaminani.
Formularea unor medii difereniale, care s asigure o bun discriminare ntre
diferitele specii de fungi potenial prezente n diverse prelevate, a presupus includerea
unor ageni revelatori n compoziia mediilor de cultur; n marea lor majoritate,
acetia sunt substraturi ale diverselor enzime produse n special de micromiceii
levuriformi, prin a cror scindare se formeaz compui fluoresceni (identificabili n
lumina ultraviolet) sau compui caracterizai printr-o culoare specific.
Primele medii difereniale cromogene, utilizate pentru identificarea prezumtiv
a diverselor specii de Candida, au fost mediul Nickerson i mediul Pagano-Levin,
agenii revelatori folosii fiind reprezentai de sulfitul de bismut, respectiv srurile de
trifenil-tetrazoliu. ns numrul redus de specii identificabile a determinat n timp
renunarea la aceste medii i nlocuirea lor cu altele mai performante, att ca spectru de
microorganisme identificabile, ct i ca grade de specificitate i sensibilitate ale
metodei.
Paleta acestor medii difereniale este destul de larg, doar n cazul speciei
Candida albicans i a altor ctorva levuri, fiind disponibile comercial nu mai puin de
6 astfel de medii (tabelul 1-1). Ele conin substratul fluorogen sau cromogen pentru
una sau dou enzime (-D-galactozaminidaz i/sau L-prolin-aminopeptidaz),
permind chiar izolarea i identificarea simultan, ntr-o singur etap, a levurilor din
diverse prelevate, fr a fi necesar utilizarea suplimentar a altor medii.

3.3. Prepararea i sterilizarea mediilor

Prepararea mediilor este o etap extrem de important, care condiioneaz
hotrtor dezvoltarea, replicarea i exprimarea fenotipic plenar a tuturor caracterelor
culturale ale fungilor. Calitatea ingredientelor, modul de solubilizare a acestora,
succesiunea adugrii lor, ajustarea pH-ului i repartizarea mediilor n vederea
sterilizrii pot reprezenta tot atia factori limitativi ai demersului diagnostic, dac nu li
se acord importana cuvenit.
n prezent, n laboratoarele de diagnostic microbiologic este cvasigeneralizat
prepararea mediilor de cultur prin hidratarea asocierilor complete de ingrediente
standardizate, condiionate sub form de pulbere, comercializate de diferite firme. Prin
utilizarea unor astfel de medii standardizate sunt eliminate inconvenientele legate de
procurarea unor ingrediente de calitate, iar rezultatele obinute prin cultivarea fungilor
sunt reproductibile.
n general, mediile deshidratate sunt reconstituite prin solubilizarea unor
cantiti precise de pulbere n ap distilat sau ap de robinet, de preferat nclzit la
70-80C, urmat apoi de fierberea amestecului pn la dizolvarea complet a tuturor
ingredientelor. n cazul mediilor ce conin ingrediente care nu suport nclzire la
temperaturi crescute, se va renuna la etapa de fierbere.
n general, la prepararea mediilor de cultivare comercializate se vor respecta
riguros instruciunile firmei productoare.
Dup preparare, mediile repartizate n flacoane sau tuburi se vor steriliza prin
autoclavare, timp de 15-20 minute la 121C (sau respectnd parametrii recomandai de
Medii de cultivare

44
productor). Componentele ce nu pot fi autoclavate datorit termolabilitii lor, se vor
prepara separat i se vor aduga la mediul de baz dup sterilizarea acestuia.
n vederea autoclavrii eficiente se recomand repartizarea mediilor n
flacoane cu o capacitate care s nu depeasc 400-500 ml. Cele mai indicate sunt cele
confecionate din sticl Pirex, gradate, cu capac filetabil, tip Deltalab - Spania.

3.4. Controlul de calitate i pstrarea mediilor

Fiecare nou lot de medii de cultur, indiferent de proveniena sa (medii gata de
folosire, repartizate n plci sau tuburi single-use livrate de diverse firme sau medii
preparate n laborator) va fi supus unui control de rutin care vizeaz analiza unor
nsuiri eseniale cum ar fi aspectul, pH-ul, sterilitatea i performanele mediului.
Aspectul (culoare, transparen, consisten) i pH-ul trebuie s corespund
parametrilor standard specifici pentru respectivul mediu de cultivare. Starea de
sterilitate a mediilor se verific prin incubarea ctorva recipiente la temperaturile de
30C, respectiv 37C, timp de 24-48 ore. Absena dezvoltrii unor colonii bacteriene
sau fungice indic o corect sterilizare a mediului. Performanele de cretere se verific
utiliznd tulpini tip din colecia laboratorului, alese n funcie de tipul de mediu i de
recomandrile privind aplicabilitatea acestuia n diagnostic:
- Mediile de izolare neselective se verific prin evaluarea capacitii lor de a
asigura dezvoltarea optim a tulpinilor nsmnate;
- Mediile selective se verific prin nsmnarea unor tulpini tip rezistente i a
unora sensibile la agenii inhibitori existeni n mediu;
- Calitatea mediilor difereniale se evalueaz prin modul de reacie al acestora n
urma nsmnrii cu tulpini productoare de reacii pozitive i negative.
Conservarea mediilor de cultur preparate n laborator i a celor reconstituite
prin rehidratare se face de preferin la temperaturi de refrigerare (2-8C), plcile Petri
plasndu-se n pungi de polietilen sau cutii nchise ermetic, iar tuburile vor fi
etaneizate cu dopuri confecionate din material neporos pentru a preveni desicarea. n
aceste condiii, mediile condiionate n plci Petri se pot pstra pn la 3 luni, iar cele
n tuburi cu dop etan pn la 6 luni. Excepie fac unele medii ce conin ingrediente
perisabile, degradabile, a cror stocare n timp este limitat.













Luminia Malic, Olimpia Bazgan, Mihai Mare


45
C
a
p
i
t
o
l
u
l

Tabelul 3-1
Utilitatea diagnostic a unor medii cromogene
Denumirea mediului i
firma productoare
Specii identificate Aspectul coloniilor
CandiSelect 4
(Bio-Rad)
Candida albicans
Culoare roz-violet, contur
regulat
C. tropicalis
Culoare turcoaz intens,
bombate, contur regulat,
de tip S.
C. glabrata
Culoare turcoaz mai
estompat, strlucitoare,
plate, contur regulat, de
tip S.
C.krusei
Culoare verde-turcoaz,
mate, contur neregulat, de
tip R.
Chromogenic Candida
Agar (Oxoid)
C. albicans
Culoare verde
C. tropicalis
Culoare albastru-nchis
C. krusei
Culoare roz-nchis, mate,
contur neregulat
C. glabrata
Culoare galben-bej
C. parapsilosis
Culoare brun
CHROMagar Candida
(BD Sciences)
C. albicans
Culoare verde-smarald
C. glabrata
Culoare violet-deschis
(lila), mate
C. krusei
Culoare roz-pal,
albicioase la periferie, de
tip R
C. tropicalis
Culoare albastr-verzuie
pn la albastru-metalizat
Candida ID2
(bioMrieux)
C. albicans
Culoare albastr
C. tropicalis
C. lusitaniae
C. kefyr

Culoare roz
Candichrom II
(Elitech, Frana)
C.albicans



Alte levuri
Culoare alb -crem,
colonii lucioase,
albastre verzui

Culoare alb
Agar cu extract de
semine de Niger
(Birdseed Agar)
Cryptococcus
neoformans
Culoare brun
Alte levuri Culoare alb crem
Medii de cultivare

46
Medii de cultivare

M01 Agar acetat Fowell

Compoziie
Acetat de sodiu x 3H
2
O
Agar
Ap purificat
5 g
20 g
ad 1000 ml

Preparare: se dizolv acetatul de sodiu trihidrat n ap, dup care se
ajusteaz pH-ul ntre 6,5-7 nainte de a aduga agarul. Se
nclzete amestecul pn la completa solubilizare a agarului.
Se sterilizeaz prin autoclavare, la 121C timp de 15 minute.
Aspect: geloz translucid
pH final la 25C : 6,5-7
Controlul calitii: Saccharomyces cerevisiae ATCC 9763 dezvoltare cu
producere de ascospori
Utilizare: stimularea producerii formelor sexuate la levuri
Stocare: n eprubete, 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.

M02 Agar acetat McClary

Compoziie
Acetat de potasiu
Glucoz
Clorur de sodiu
Sulfat de magneziu
heptahidrat
Extract de drojdie
Agar
Ap purificat
9,8 g
1 g
1,2 g
0,7 g
2,5 g
15 g
ad 1000 ml

Preparare: se dizolv ingredientele n apa prenclzit, nainte de a aduga
agarul. Se nclzete amestecul pn la completa solubilizare a
agarului. Se sterilizeaz prin autoclavare, la 121C timp de 15
minute.
Aspect: geloz glbuie, translucid
pH final la 25C : 6,0 0,2
Controlul calitii: Saccharomyces cerevisiae ATCC 9763 dezvoltare cu
producere de ascospori
Utilizare: stimularea producerii formelor sexuate la levuri
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.

Luminia Malic, Olimpia Bazgan, Mihai Mare


47
C
a
p
i
t
o
l
u
l

M03 Agar BCG Candida



Compoziie
Pepton
Extract de drojdie
Dextroz
Agar
Verde de bromcrezol
Ap distilat
10,0 g
1,0 g
40,0 g
15,0 g
0,02 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat i se fierb un minut
pn la completa dizolvare. Se autoclaveaz la 121
0
C timp de
15 minute. Se adaug neomicin 500 mg/l, dup rcirea
mediului la o temperatur de 50-55
0
C.
Aspect: geloz albastru-verzuie, uor opalescent
pH final la 25
0
C: 6,1 0,1
Controlul calitii: Candida albicans ATCC 10231: virarea culorii mediului spre
galben.
Candida tropicalis ATCC 9968: virarea culorii mediului spre
galben.
Escherichia coli ATCC 25922: virarea culorii mediului spre
verde.
Utilizare: mediu diferenial i selectiv folosit pentru izolarea primar i
detecia speciilor genului Candida din prelevatele clinice.
Plcile Petri nsmnate se incubeaz 72 ore la o temperatur
de 30 2
0
C.
Stocare: 28 C
Disponibil comercial: Difco (SUA)

M04 Agar BIGGY (Agar bismut - sulfit - glucoz - glicin - drojdie)
Agar Nickerson

Compoziie
Citrat amoniacal de
bismut
Sulfat de sodiu
Dextroz
Glicin
Extract de drojdie
Agar
Ap distilat
5,0 g
3,0 g
10,0 g
10,0 g
1,0 g
16,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, sub agitare
continu. Mediul se rcete la 45 - 50

C, dup care se
Medii de cultivare

48
repartizeaz n plci Petri. Nu se autoclaveaz. nainte de
utilizare se recomand verificarea sterilitii i a pH-ului.
Aspect: mediu omogen, opalescent, alb-glbui
pH final la 25
0
C: 6,8 0,2
Controlul calitii: Candida albicans ATCC 10231 ++
Candida kefyr ATCC 8553 ++
Candida tropicalis ATCC 1369 ++
Utilizare: mediu recomandat pentru izolarea i identificarea speciilor
aparinnd genului Candida. Inocularea se realizeaz din
culturi proaspete, iar incubarea are loc la o temperatur de 25
2C, 18-24 ore (3-5 zile dac este necesar)
Stocare: 2-8C
Disponibil comercial: Becton Dickenson (SUA)

M05 Agar Blasto "D"

Compoziie
Glucoz
Tween 80
Sulfat de potasiu
Citrat de magneziu
Fosfat dipotasic
Asparagin
Aminoacizi de tipul
"Casamino"
Clorur de sodiu
Agar
Ap deionizat
7 g
0,2 ml
0,5 g
1,5 g
5 g
5 g
3 g
0,85 g
15 g
ad 1000 ml

Preparare: ingredientele se adaug n apa purificat prenclzit i se fierb
apoi sub agitare pn la completa lor dizolvare. Se sterilizeaz
prin autoclavare la 121C timp de 15 minute.
Aspect: geloz clar, transparent
pH final la 25
0
C: 6,6 0,2
Utilizare: transformarea formei filamentoase n form levuric la specia
Blastomyces dermatitidis, prin incubare la 37
0
C.
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.








Luminia Malic, Olimpia Bazgan, Mihai Mare


49
C
a
p
i
t
o
l
u
l

M06 Agar Bromcrezol purpur cazein - glucoz


(Bromcresol purple casein glucose Agar )

Compoziie soluie A
Lapte ecremat
Soluie etanolic de
Bromcrezol purpur 1,6%
Ap distilat
80 g

2 ml
ad 1000 ml

Compoziie soluie B
Glucoz
Agar
Ap distilat
40 g
30 g
ad 1000 ml

Preparare: dup solubilizarea ingredientelor n apa distilat prenclzit,
cele dou soluii se sterilizeaz separat astfel: sol. A - 8 minute
la 115C, sol. B - 15 minute la 121C. Dup rcire la 45-
50C, cele dou soluii se amestec, se omogenizeaz, se
ajusteaz pH-ul la valoarea 6,6 i apoi se repartizeaz n tuburi
sterile, n pant.
Aspect: geloz n pant, bleu pal, opac
pH final la 25C : 6,6 0,2
Controlul calitii: Trichophyton rubrum ATCC 28188: dezvoltare fr alcali-
nizare (mediul nu i modific nuana);
Trichophyton mentagrophytes ATCC 9533: dezvoltare cu alca-
linizare (virarea culorii n violet-purpuriu);
Utilizare: test de identificare a speciilor de dermatofii
Stocare: o lun la temperatura de refrigerare
Disponibil comercial: nu se comercializeaz.

M07 Agar Ciocolat (Agar Chocolate)

Compoziie
Tripton
Pepton din soia
Clorur de sodiu
Agar
Ap distilat
Snge defibrinat ovin
15,0 g
5,0 g
5,0 g
15,0 g
ad 1000 ml
5-10 %

Preparare: se dizolv ingredientele n apa distilat prenclzit i se fierb
un minut. Mediul se repartizeaz (cte 90 ml) n flacoane i se
sterilizeaz prin autoclavare la 121C timp de 15 minute. Dup
sterilizare, mediul se rcete la 75-80C, moment n care se
Medii de cultivare

50
adaug cte 10 ml de snge defibrinat ovin n fiecare flacon. Se
agit sub protecia unei hote bacteriologice de clas II, pn la
apariia culorii brun-ciocolatii.
Aspect: geloz brun-rocat, opac
pH final la 25C : 7,3 0,2
Controlul calitii: Candida albicans ATCC 10231 ++ (colonii gri, de consisten
cremoas, cu filamentare evident la periferie - aspect stelat)
Candida parapsilosis ATCC 22019 ++ (colonii netede, fr
filametare periferic)
Utilizare: identificarea tulpinilor de Candida albicans prin incubare la
37C, n atmosfer cu 6% CO
2
, timp de 48 ore
Stocare: 2-8C
Disponibil comercial: mediul baz - Becton Dickenson (SUA), Remel (SUA),
Biokar Diagnostics (Frana)

M08 Agar Christensen

Compoziie soluia A
Pepton
Glucoz
Fosfat monopotasic
Clorur de sodiu
Uree
Rou fenol
Ap distilat
1 g
1 g
2 g
5 g
20 g
0,012 g
100 ml

Compoziie soluia B
Agar
Ap distilat
15 g
900 ml

Preparare: se pregtete soluia A i se sterilizeaz prin filtrare, apoi se
fierbe agarul cu apa distilat pn la dizolvare. Soluia B se
sterilizeaz prin autoclavare la 121C timp de 15 min, iar dup
rcire la 50C se adaug soluia A prenclzit. Mediul astfel
obinut se repartizeaz n tuburi i se las s se solidifice n
poziie nclinat. Soluia A se poate steriliza i prin
autoclavare, n acest caz ureea adugndu-se sub form de
soluie steril, dup rcirea amestecului la 50C.
Aspect: geloz galben-orange, transparent
pH final la 25C : 6,8 0,2
Controlul calitii: Candida albicans ATCC 10231 dezvoltare fr modificarea
culorii mediului;
Cryptococcus albidus ATCC 66030 dezvoltare cu virarea
culorii mediului spre roz-rou;
Luminia Malic, Olimpia Bazgan, Mihai Mare


51
C
a
p
i
t
o
l
u
l

Utilizare: identificarea speciilor fungice ureazo-pozitive (Cryptococcus


spp., Rhodotorula spp., Trichosporon spp. i unii dermatofii)
Stocare: 2 luni la temperatura de refrigerare
Disponibil comercial: un mediu-baz care se aditiveaz dup autoclavare cu soluie
steril de uree Merck (Germania), Remel (SUA).

M09 Agar cu acid cafeic i citrat feric

Compoziie
Sulfat acid de sodiu
Glucoz
Extract levuric
Fosfat dipotasic
Sulfat de magneziu
hidratat
Acid cafeic
Cloramfenicol
Citrat feric
Agar
Ap distilat
5 g
5 g
2 g
0,8 g
0,7 g
0,18 g
0,05 g
0,002 g
15 g
ad 1000 ml

Preparare: ingredientele se adaug n apa purificat prenclzit i se fierb
apoi sub agitare pn la completa lor dizolvare. Se sterilizeaz
prin autoclavare, la 121C timp de 15 minute.
Aspect: geloz maron deschis, translucid
pH final la 25
0
C: nu se determin
Controlul calitii: Cryptococcus neoformans ATCC 14116: colonii brune cu
aspect mucoid;
Utilizare: mediu pentru izolarea i identificarea speciei Cryptococcus
neoformans;
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.













Medii de cultivare

52
M10 Agar cu extract de cartof i glucoz (PDA)

Compoziie
Glucoz (dextroz)
Infuzie de cartofi pulbere
Agar
Ap purificat
20 g
4 g
20 g
ad 1000 ml

Preparare: ingredientele se adaug n apa purificat prenclzit i se fierb
apoi sub agitare pn la completa lor dizolvare. Se sterilizeaz
prin autoclavare, la 121C timp de 15 minute
Aspect: geloz alb-glbuie, translucid
pH final la 25C : 5,6 0,2
Controlul calitii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 ++
Trichophyton mentagrophytes ATCC 9533 +
Utilizare: mediu folosit pentru cultivarea i identificarea levurilor i
fungilor filamentoi
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Merck (Germania), Remel (SUA), Biokar Diagnostics
(Frana).

M11 Agar cu extract de drojdie i cloramfenicol
(Yeast Extract Glucose Chloramphenicol Agar)

Compoziie
Extract de drojdie
Glucoz
Cloramfenicol
Agar
Ap distilat
5,0 g
20,0 g
0,1 g
13,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, dup care
se fierb un minut. Se autoclaveaz la 121C timp de 15 minute.
Aspect: geloz galben pal, translucid
pH final la 25C: 6,6 0,2
Controlul calitii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Escherichia coli ATCC 25922 -
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: cultivarea i identificarea fungilor levuriformi i filamentoi
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Difco (SUA).

Luminia Malic, Olimpia Bazgan, Mihai Mare


53
C
a
p
i
t
o
l
u
l

M12 Agar cu extract de drojdie i fiton


(Phytone Yeast Extract Agar)

Compoziie
Pepton din soia
Extract de drojdie
Dextroz
Cloramfenicol
Agar
Ap distilat
10,0 g
5,0 g
40,0 g
0,05 g
17,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit,
amestecnd continuu, cu meninerea temperaturii de fierbere
timp de un minut. Autoclavarea are loc la o temperatur de
121
o
C timp de 15 minute.
Aspect: geloz glbuie, translucid
pH final la 25C: 6,6 0,2
Controlul calitii: Aspergillus niger ATCC 16404 +
Candida albicans ATCC 10231 +
Penicillium roqueforti ATCC 9295 +
Saccharomyces cerevisiae ATCC 25923
Trichophyton verrucosum ATCC 38485 +
Utilizare: mediu pentru izolarea i identificarea fungilor din prelevatele
clinice, n special a dermatofiilor din specia Trichophyton
verrucosum
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Difco (SUA).

M13 Agar cu extract de orez

Compoziie
Extract de orez
Agar
Ap distilat
5,0 g
20,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit,
amestecnd continuu, cu meninerea temperaturii de fierbere
timp de un minut. Autoclavarea are loc la o temperatur de
121
o
C timp de 15 minute.
Aspect: geloz de culoare galben-pal, translucid
pH final la 25C: 6,6 0,2
Controlul calitii: Candida albicans ATCC 10231 +
Candida albicans ATCC 60193 +
Utilizare: formarea clamidosporilor la speciile de Candida
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Medii de cultivare

54
Disponibil comercial: Becton Dickinson (SUA).

M14 Agar cu extract de paprika
(Ground red hot pepper agar)

Compoziie
Paprika
Glucoz
Agar
Ap distilat
40,0 g
4,0 g
15,0 g
ad 1000 ml

Preparare: ingredientele se adaug n apa distilat i se aduc la punctul de
fierbere, apoi se sterilizeaz prin autoclavare la 116C timp de
30 minute.
Aspect: geloz opac, de culoare brun-rocat, cu miros de paprika
pH final la 25C: 4,9
Controlul calitii: Cryptococcus neoformans var. neoformans colonii alb-
cremoase dup 48 ore de incubare la 30C, care se
pigmenteaz n brun dup aceast perioad
Utilizare: izolarea i identificarea prezumtiv a tulpinilor de
Cryptococcus neoformans
Stocarea: 2- 8C
Disponibil comercial: nu se comercializeaz.

M15 Agar cu extract de sol

Prepararea
extractului de sol: 1 kg sol de grdin se amestec cu 1000 ml ap de robinet, se
nclzete 30 de minute, se decanteaz, se filtreaz i se
completeaz la 1000 ml cu ap distilat. La 1000 ml extract de
sol se adaug 2 g glucoz, 1 g extract de drojdie, 15 g agar i
6,6 g de pr uman tocat i sterilizat. Mediul este recomandat
pentru obinerea de cleistoteci la specii de Arthroderma
(formele teleomorfe ale dermatofiilor).
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.










Luminia Malic, Olimpia Bazgan, Mihai Mare


55
C
a
p
i
t
o
l
u
l

M16 Agar cu extract de tutun (Tobacco Agar)



Compoziie
Extract din frunze de
tutun
Agar
1000 ml
20 g

Preparare: 50 grame frunze de tutun se fierb timp de 30 minute ntr-un
litru de ap distilat. Extractul obinut se filtreaz; se ajusteaz
pH-ul la valoarea 6 i se readuce volumul la 1000 ml cu ap
distilat. Dup adugarea agarului, amestecul se nclzete
pn la dizolvarea complet a acestuia. Mediul se sterilizeaz
prin autoclavare la 121C timp de 15 minute. Dup sterilizare,
mediul se repartizeaz n plci Petri sterile ( 90 mm), cte 25
ml/plac.
Aspect: geloz translucid, de culoare galben-maronie
pH final la 25C: 6,0 0,1
Controlul calitii: Candida dubliniensis CBS 7987 (formare de clamidospori n
urma nsmnrii prin tehnica Dalmeau i incubare la 30C)
Utilizare: mediu destinat identificrii tulpinilor de Candida albicans i
Candida dubliniensis pe baza stimulrii producerii de
clamidospori (C. albicans 96% dintre tulpini, C.dubliniensis
100% dintre tuplini)
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M17 Agar cu fin de porumb (Cornmeal agar)

Compoziie
Fin de porumb
Glucoz
Agar
Ap distilat
40 g
10 g
15 g
ad 1000 ml

Preparare: se amestec fina de porumb cu apa distilat i se nclzete
amestecul la 52C timp de o or sau la 121C timp de 10
minute. Dup tratamentul termic, amestecul se filtreaz prin
tifon i vat, apoi prin hrtie de filtru. n filtratul obinut se
introduc agarul i glucoza, fierbndu-se pn la topirea
acestora. Se readuce volumul la 1000 ml, apoi se sterilizeaz la
121C timp de 15 minute.
Aspect: geloz albicioas, translucid
pH final la 25C : 6,0 0,2
Medii de cultivare

56
Controlul calitii: Trichophyton rubrum ATCC 28188: pigment rou n mediul
subiacent
Trichophyton mentagrophytes ATCC 9533: pigment brun sub
colonie
Utilizare: stimuleaz pigmentogeneza la suele de T. rubrum i le
difereniaz de tulpinile aparinnd speciei T. mentagrophytes.
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA).

M18 Agar cu fin de porumb i Tween 80 (Cornmeal Agar Tween 80)

Compoziie
Fin de porumb
Tween 80
Agar
Ap distilat
40 g
10 ml
20 g
ad 1000 ml

Preparare: fina de porumb se adaug n 500 ml ap distilat i se
macereaz timp de o or la 65C; dup filtrare i reajustarea
volumului la 500 ml, soluia astfel obinut se amestec cu
agarul n prealabil solubilizat n 500 ml ap distilat i cu 10
ml Tween 80. Se ajusteaz pH-ul la 6,6 - 6,8 i apoi se
sterilizeaz prin autoclavare la 121C timp de 20 minute.
Aspect: geloz albicioas, translucid
pH final la 25C : 6,8 0,2
Controlul calitii: Candida albicans ATCC 10131 ++
Candida albicans ATCC 60193 (cu apariia clamidosporilor
prin cultivare submers)
Utilizare: identificarea diferitelor specii ale genului Candida prin
studierea caracterelor morfologice microscopice etalate de
acestea n urma cultivrii submerse, la 30C timp de 48 ore
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Becton Dickenson (SUA), Remel (SUA)

M19 Agar cu frunze de garoaf

Preparare: frunzele de garoaf sunt tiate n buci, uscate i sterilizate
prin expunerea la radiaii gamma sau oxid de etilen. Cteva
buci sterile sunt introduse n 1,5% agar nesolidificat. n locul
frunzelor de garoaf se pot folosi de asemenea i buci de
hrtie de filtru sterile. Acest mediu este recomandat pentru
cultivarea i identificarea speciilor aparinnd genului
Fusarium.



Luminia Malic, Olimpia Bazgan, Mihai Mare


57
C
a
p
i
t
o
l
u
l

M20 Agar cu L-canavanin glicin - albastru de bromtimol (CGB Agar)



Compoziie soluia A
Glicin
Fosfat monopotasic
Sulfat de magneziu
Tiamin HCl
L-canavanin sulfat
Ap distilat
10 g
1 g
1 g
1 mg
30 mg
ad 100 ml

Dup solubilizarea complet a ingredientelor enumerate, se
ajusteaz pH-ul la 5,6 i amestecul se sterilizeaz prin filtrare
utiliznd filtre cu porozitate de 0,22 m. Soluia astfel obinut
se pstreaz la frigider (+4C).

Compoziie soluia B
Albastru de bromtimol
Hidroxid de sodiu 0,01 N
Ap distilat
0,4 g
64 ml
36 ml

Albastrul de bromtimol se dizolv n soluia de hidroxid de
sodiu, apoi se adaug apa distilat.
Preparare: pentru obinerea unui litru de mediu, se amestec 880 ml ap
distilat cu 20 ml soluie B i 20 g pulbere de agar. Sterilizarea
se realizeaz prin autoclavare la 121C, timp de 15 minute.
Dup rcirea mediului la 48C, se adaug 100 ml soluie A i
se omogenizeaz, apoi se repartizeaz n plci Petri.
Aspect: geloz translucid de culoare galben-verzuie
pH final la 25C : 5,8 0,1
Controlul calitii : Cryptococcus neoformans var. neoformans dezvoltare
disgonic, fr modificarea culorii mediului;
Cryptococcus neoformans var. gattii - dezvoltare eugonic, cu
virarea culorii mediului de la galben-verzui la albastru-cobalt;
Utilizare: mediul este recomandat pentru diferenierea celor dou
varieti ale speciei Cryptococcus neoformans (var.
neoformans i var. gattii). Dup nsmnarea tulpinilor de
testat, incubarea se realizeaz la 25C timp de 5 zile. Doar var.
gattii are capacitatea de a cultiva n prezena L-canavaninei i
de a folosi glicina ca unic surs de carbon. Aceste
particulariti metabolice determin pozitivarea testului pe
Agar CGB, adic schimbarea de pH (de la 5,8 la aproximativ
7,0) i modificarea culorii mediului (de la galben-verzui la
albastru-cobalt).
Stocare: n plci o lun la 2-8C
Medii de cultivare

58
Disponibil comercial: nu se comercializeaz.

M21 Agar cu sucroz i creatin

Compoziie
Creatin
Sucroz
KCl
MgSO
4
FeSO
4

K
2
HPO
4

Bromcrezol purpur
Agar
Ap distilat
3 g
30 g
0.5 g
0.5 g
0.01 g
1.3 g
0.05 g
15 g
ad 1000 ml

Preparare: ingredientele se introduc n apa distilat prenclzit i se
omogenizeaz pn la completa dizolvare. Se autoclaveaz la
121C timp de 15 minute. Se ajusteaz pH-ul la valoarea 6,0
0,2.
Aspect: geloz opalescent, de culoare roz
pH final la 25 C: 6,0 0,2
Controlul calitii: Aspergillus niger ATCC 1015 ++
Utilizare: mediu destinat izolrii i identificrii fungilor filamentoi
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.





















Luminia Malic, Olimpia Bazgan, Mihai Mare


59
C
a
p
i
t
o
l
u
l

M22 Agar cu sucroz, creatin i dicloran


(Creatine Sucrose Dichloran Agar)

Compoziie
Creatin
Sucroz
KCl
KH
2
PO
4

MgSO
4

FeSO
4
K
2
HPO
4

Cloramfenicol
Dicloran
Bromcrezol purpur
ZnSO
4

CuSO
4

Agar
Ap distilat
3 g
30 g
0.5 g
1 g
0.5 g
0.01 g
0,05 g
0,05 g
0,002 g
0,05 g
0,01 g
0,005 g
20 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, se
sterilizeaz prin autoclavare la temperatura de 121C timp de
15 minute. Se adaug 0,05 g clortetraciclin i se ajusteaz
pH-ul la valoarea 4,8.
Aspect: geloz de culoare roz, uor opalescent
pH final la 25 C: 4,8
Controlul calitii: Aspergillus niger ATCC 1015 +
Utilizare: mediu destinat izolrii i identificrii fungilor filamentoi
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M23 Agar - acid acetic dicloran - extract de drojdie
(Acetic Acid Dichloran Yeast Extract Agar)

Compoziie
Extract de drojdie
Sucroz
MgSO
4
x 7 H
2
O
Dicloran
Agar
Ap distilat
20 g
150 g
0.5 g
0.002g
20 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, se
autoclaveaz la 121 C timp de 15 minute, dup care se adaug
0,5 % acid acetic glacial.
Aspect: geloz translucid, de culoare glbuie
Medii de cultivare

60
Controlul calitii: Aspergillus niger ATCC 1015 ++
Utilizare: mediu destinat izolrii i identificrii fungilor filamentoi
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M24 Agar dicloran - extract de drojdie - 18 % glicerol
(Dichloran Yeast Extract 18% Glycerol Agar)

Compoziie
Extract de drojdie
Sucroz
K
2
HPO
4
MgSO
4

Cloramfenicol
Dicloran (0,2% n etanol)
ZnSO
4

CuSO
4

Agar
Glicerol
Ap distilat
20 g
150 g
1 g
0,5 g
0,05 g
1 ml
0,01 g
0,005 g
20 g
220 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, se
sterilizeaz prin autoclavare la temperatura de 121C timp de
15 minute. Se adaug 0,05 g clortetraciclin.
Aspect: geloz de culoare glbuie, uor opalescent
pH final la 25 C: nu se determin
Controlul calitii: Aspergillus niger ATCC 1015 +
Utilizare: mediu destinat izolrii i identificrii fungilor filamentoi
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M25 Agar difereniere Aspergillus

Compoziie
Mediu deshidratat Becton
Dickenson


Preparare: conform recomandrilor firmei productoare
Aspect: geloz glbuie, translucid
pH final la 25
0
C: 7,0 0,5
Controlul calitii: tulpinile de A. flavus produc virarea culorii mediului n galben
-portocaliu. Alte specii de Aspergillus (A.parasiticus, A.
sclerotiorum, A. thomii) produc de asemenea modificri ale
culorii mediului de cultivare, dar acestea sunt distincte fa de
cele produse de A. flavus.
Luminia Malic, Olimpia Bazgan, Mihai Mare


61
C
a
p
i
t
o
l
u
l

Utilizare: acest mediu de cultur conine cazein, aminoacizi, extract de


drojdie mbogit cu complex vitaminic B. Citratul feric este
esenial pentru producerea pigmentului galben care ajut la
diferenierea speciei A. flavus de alte specii cu semnificaie
clinic ale aceluiai gen. Cu ajutorul unei anse sterile, se
etaleaz pe suprafaa mediului cteva colonii dup care se
incubeaz la 25C timp de 10 zile, pentru a permite virarea
culorii spre diferite nuane de galben.
Stocare: 2-8C
Disponibil comercial: Difco (SUA).

M26 Agar Dixon

Compoziie
Agar cu extract de mal
Bil de bou deshidratat
Tween 40
Glicerol mono-oleat
Ap distilat
60 g
20 g
10 ml
2,5 ml
ad 1000 ml

Preparare: glicerolul mono-oleat se emulsioneaz cu Tween 40 apoi se
adaug treptat, sub agitare continu, mediul preparat prin
amestecarea celorlalte ingrediente. Se sterilizeaz prin
autoclavare, la 121C timp de 15 minute.
Aspect: geloz nchis la culoare, translucid
pH final la 25C : 5,6 0,2
Controlul calitii: Malassezia furfur ATCC 12078 ++
Utilizare: izolarea levurilor lipofile aparinnd genului Malassezia
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.















Medii de cultivare

62
M27 Agar Dixon modificat

Compoziie
Extract de mal
Bil de bou deshidratat
Tween 40
Pepton
Glicerol
Acid oleic
Agar
Ap distilat
36 g
20 g
10 ml
6 g
2 ml
2 ml
15 g
ad 1000 ml

Preparare: glicerolul i acidul oleic se emulsioneaz cu Tween 40, apoi se
adaug treptat, sub agitare continu, mediul preparat prin
amestecarea celorlalte ingrediente. Se sterilizeaz prin
autoclavare, la 121C timp de 15 minute.
Aspect: geloz nchis la culoare
pH final la 25C : 6,0 0,2
Controlul calitii: Malassezia furfur ATCC 12078++
Utilizare: izolarea levurilor lipofile din prelevate patologice
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.

M28 Agar glucoz - pepton - drojdie
(Glucose Peptone Yeast Extract Agar)

Compoziie
Glucoz
Pepton
Agar
Extract de drojdie
Ap distilat
20 g
5 g
20 g
5 g
ad 1000 ml

Preparare: ingredientele se solubilizeaz n apa prenclzit. Se
sterilizeaz prin autoclavare la 121C timp de 15 minute.
Aspect: geloz glbuie, uor opalescent
pH final la 25C : nu se determin
Controlul calitii: Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 ++
Utilizare: cultivarea levurilor n vederea conservrii
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.



Luminia Malic, Olimpia Bazgan, Mihai Mare


63
C
a
p
i
t
o
l
u
l

M29 Agar infuzie cord - creier (Brain Heart Agar BHI )



Compoziie
Infuzie de cord
Infuzie de creier
Pepton
Glucoz
Clorur de sodiu
Fosfat disodic
Agar
Ap distilat
250 ml
200 ml
10 g
2 g
5 g
2,5 g
15 g
ad 1000 ml

Preparare: ingredientele se adaug n apa distilat prenclzit, apoi
amestecul se fierbe sub agitare pn la completa dizolvare a
acestora. Mediul astfel obinut se repartizeaz n eprubete sau
flacoane i se sterilizeaz prin autoclavare, la 121C timp de
15 minute. Reeta se poate modifica prin mbuntirea cu 5-
10% snge defibrinat de berbec sau prin adaos de
cloramfenicol i/sau gentamicin (500 mg/l).
Aspect: geloz transparent, de culoare galben-pal; geloz opac de
culoare roie (varianta aditivat cu snge)
pH final la 25 C: 7,4 0,2
Controlul calitii: Candida albicans ATCC 10231 ++
Streptococcus pyogenes ATCC 19615 ++ ( - n cazul variantei
aditivate cu antibiotice)
Utilizare: izolarea unei game largi de microorganisme cu exigene
nutritive particulare, cum ar fi fungii dimorfici
Stocare: eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Frana), Becton
Dickinson (SUA), bioMrieux (Frana).

M30 Agar izolare Candida

Compoziie
Extract de drojdie
Extract de mal
Pepton
Dextroz
Agar
Albastru de anilin
Ap distilat
3,0 g
3,0 g
5,0 g
10,0 g
20,0 g
0,1 g
ad 1000 ml

Medii de cultivare

64
Preparare: ingredientele se adaug n apa distilat i se fierb un minut
pn la completa solubilizare. Se autoclaveaz la 121
0
C timp
de 15 minute.
Aspect: geloz de culoare albastr, opalescent
pH final la 25
0
C: 6,2 0,2
Controlul calitii: Candida albicans ATCC 10231: produce fluorescen bleu
verzuie la 354 nm;
Bacillus subtilis ATCC 6633: nu produce fluorescen;
Escherichia coli ATCC 25922 : nu produce fluorescen;
Utilizare: izolarea i identificarea speciei Candida albicans din prelevate
clinice. Plcile Petri nsmnate se incubeaz 72 ore la o
temperatur de 30 2
0
C.
Stocare: 28C
Disponibil comercial: Becton Dikinson (SUA).

M31 Agar Lactrimel (Borelli)

Compoziie
Fin de gru
Lapte praf ecremat
Miere
Agar
Cloramfenicol
Cicloheximid
Ap distilat
14 g
14 g
7 g
20 g
0,5 g
0,5 g
ad 1000 ml

Preparare: ingredientele se amestec cu apa distilat prenclzit, sub
agitare continu, pn la completa lor solubilizare. Se
sterilizeaz prin autoclavare la 105C timp de 10 minute. Dup
autoclavare se repartizeaz n plci Petri.
Aspect: Geloz opac, de culoare alb
pH final la 25C: 6,8 0,2
Controlul calitii: Microsporum canis ATCC 1162: dezvoltare cu sporulare
intens i pigmentogenez
Utilizare: favorizeaz sporularea marii majoriti a dermatofiilor i
stimuleaz producerea pigmentului specific n cazul M.
audouinii, M. canis i T. rubrum
Stocare: o lun, n plci Petri la 2-8C
Disponibil comercial: nu se comercializeaz.







Luminia Malic, Olimpia Bazgan, Mihai Mare


65
C
a
p
i
t
o
l
u
l

M32 Agar Leeming



Compoziie
Pepton
Glucoz
Bil de bou deshidratat
Tween 60
Glicerol
Glicerol mono-stearat
Lapte integral
Extract de drojdie
Cloramfenicol
Agar
Ap distilat
10 g
5 g
4 g
0,5 ml
1 ml
0,5 g
10 ml
0,1 g
0,5 g
12 g
ad 1000 ml

Preparare: glicerolul i glicerolul mono-stearat se emulsioneaz cu Tween
60, apoi se adaug treptat, sub agitare continu, mediul
preparat prin amestecarea celorlalte ingrediente. Se sterilizeaz
prin autoclavare, la 121C timp de 15 minute.
Aspect: geloz nchis la culoare
pH final la 25C : 6 0,2
Controlul calitii: Malassezia furfur ATTC 12078 ++
Utilizare: izolarea levurilor lipofile din prelevate patologice
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.

M33 Agar Littman (Littman Oxgall Agar)

Compoziie
Pepton
Dextroz
Bil de bou deshidratat
Agar
Cristal violet
Streptomicin
Ap distilat
10,0 g
10,0 g
15,0 g
20,0 g
0,01 g
30,0 mg
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 121
o
C timp de 15
minute, cu rcire la 47C pentru adugarea antibioticului;
streptomicina se poate nlocui cu cloramfenicol, acesta
putndu-se aduga chiar naintea autoclavrii.
Aspect: geloz de culoare bleu-cenuie, uor opalescent
Medii de cultivare

66
pH final la 25C: 7,0 0,2
Controlul calitii: Candida albicans ATCC 10231 +
Escherichia coli ATCC 25922
Trichophyton mentagrophytes ATCC 9533 ++
Utilizare: mediu pentru cultivarea i identificarea fungilor, n special a
celor dermatofii
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA), Difco (SUA).

M34 Agar Mueller Hinton - glucoz 2%

Compoziie
Extract de carne pulbere
Cazein
Amidon
Agar
Glucoz
Albastru de metilen
Ap distilat
2 g
17,5 g
1,5 g
15 g
20 g
0,5 mg
ad 1000 ml

Preparare: ingredientele se solubilizeaz n apa distilat prenclzit, sub
agitare continu. Se repartizeaz n tuburi sau flacoane i se
sterilizeaz prin autoclavare la 110C, timp de 20 minute.
Aspect: geloz opalescent
pH final la 25
0
C: 6,9 - 7,1
Utilizare: mediul se folosete pentru testarea susceptibilitii la
antifungice (voriconazol i fluconazol) prin metoda CLSI
M44-A (metod difuzimetric cu discuri). Se recomand ca
grosimea stratului de mediu s fie de 4 0,5 mm (cca. 25 ml/
plac Petri cu 90mm sau cca. 60 ml / plac Petri cu 150
mm).
Stocare: 2-8C
Disponibil comercial: mediul baz (fr glucoz) este comercializat de Remel (SUA),
Biokar Diagnostics (Frana), Becton Dickinson (SUA),
bioMrieux (Frana).

M35 Agar cu fin de ovz (Oatmeal Agar)

Compoziie
Fin de ovz
Agar
Ap distilat
60,0 g
18,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Luminia Malic, Olimpia Bazgan, Mihai Mare


67
C
a
p
i
t
o
l
u
l

Autoclavarea are loc la o temperatur de 121


o
C timp de 15
minute.
Aspect: geloz albicioas, uor opalescent
pH final la 25C: 6,0 0,2
Controlul calitii: Aspergillus niger ATCC 16404 +
Candida albicans ATCC 10231 +
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: mediu pentru cultivarea i studierea caracterelor morfologice
ale fungilor filamentoi; stimuleaz sporularea
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Difco (SUA).

M36 Agar Pal

Compoziie
Glucoz
Fosfat monopotasic
Creatinin
Agar
Extract apos din semine
integrale de floarea-
soarelui
1 g
1 g
1 g
15 g
ad 1000 ml

Preparare: se mrunesc 50 g semine de floarea-soarelui nedecorticate,
nesrate, cu ajutorul unui blender i se fierb timp de 30 minute
ntr-un litru de ap distilat. Se filtreaz, se adaug restul
ingredientelor, se ajusteaz pH-ul la 5,5 i se sterilizeaz apoi
prin autoclavare la 110C timp de 20 minute.
pH final la 25C: 5,5
Controlul calitii: Candida albicans ATCC 10231 ++
Candida dubliniensis CBS 7987 ++
Utilizare: diferenierea speciilor C. albicans i C. dubliniensis pe baza
morfologiei coloniilor i producerii de clamidospori; C.
dubliniensis produce clamidospori i colonii cu filamentare
periferic evident, prin incubare la 30C timp de 48-72 ore, n
timp ce C. albicans nu.
Stocare: 2-8C
Disponibil comercial: nu este disponibil comercial.







Medii de cultivare

68
M37 Agar pentru studierea morfologiei levurilor
(Yeast Morphology Agar)

Compoziie
Sulfat de amoniu
Asparagin
Dextroz
L-histidin HCl
LD-metionin
LD-triptofan
Biotin
Calciu pantotenat
Acid folic
Inizitol
Niacin
Acid p-aminobenzoic
Piridoxin HCl
Riboflavin
Tiamin HCl
Acid boric
Sulfat de cupru
Iodur de potasiu
Clorur feric
Sulfat de magneziu
Molibdat de sodiu
Sulfat de zinc
Fosfat monopotasic
Sulfat de magneziu
Clorur de sodiu
Clorur de calciu
Agar
Ap distilat
3,5 g
1,5 g
10,0 g
10,0 mg
20,0 mg
20,0 mg
2,0 g
400,0 g
2,0 g
2000,0 g
400,0 g
200,0 g
400,0 g
200,0 g
400,0 g
500,0 g
40,0 g
100,0 g
200,0 g
400,0 g
200,0 g
400,0 g
1,0 g
0,5 g
0,1 g
0,1 g
18,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, dup care
se fierb un minut. Se autoclaveaz la 121C timp de 15 minute.
Aspect: geloz galben-pal, opalescent
pH final la 25C: 5,6 0,2
Controlul calitii: Kloeckera apiculata ATCC 9774 +
Saccharomyces cerevisiae ATCC 9080 +
Candida albicans ATCC 10231 +
Utilizare: cultivarea i identificarea levurilor pe baza caracterelor
culturale i a celor morfologice
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Difco (SUA)


Luminia Malic, Olimpia Bazgan, Mihai Mare


69
C
a
p
i
t
o
l
u
l

M38 Agar pepton - glucoz - fluconazol



Compoziie
Pepton
Glucoz
Agar
Cloramfenicol
Gentamicin
Fluconazol
Ap distilat
10 g
20 g
20 g
40 mg
25 mg
5 mg
ad 1000 ml

Preparare: ingredientele se solubilizeaz n apa distilat prenclzit. Se
ajusteaz valoarea pH-ului la 7,0. Se autoclaveaz la 121C
timp de 15 minute.
Aspect: geloz glbuie, translucid
pH final la 25
0
C: 6,8-7,0
Controlul calitii: Aspergillus flavus ATCC 10124 ++
Candida albincans ATCC 66027
Utilizare: mediu destinat izolrii precoce a fungilor filamentoi din
prelevate contaminate cu levuri (ex. sput)
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.























Medii de cultivare

70
M39 Mediul RPMI 1640
(cu glutamin, glucoz 0,2%, rou fenol, fr bicarbonat)

Compoziie
L-arginin
L-asparagin anhidr
Acid L-aspartic
L-cistin hidrocloric
Acid L-glutamic
L-glutamin
Glicin
L-histidin
L- hidroxiprolin
L-izoleucin
L- lizin hidrocloric
L- metionin
L- fenilalanin
L-prolin
L-serin
L-treonin
L-triptofan
L-tirozin disodic
L-valin
Biotin
Acid D-pantotenic
Colin HCl
Acid folic
Mio-inozidol
Niacinamid
PABA
Piridoxin HCl
Riboflavin
Tiamin HCl
Vitamina B
12

Nitrat de calciu
monohidrat
Clorur de potasiu
Sulfat de magneziu
Clorur de sodiu
Fosfat disodic anhidru
D-glucoz
Glutation redus
Rou fenol
Ap distilat
200 mg
50 mg
20 mg
65,2 mg
20 mg
300 mg
10 mg
15 mg
20 mg
50 mg
40 mg
15 mg
15 mg
20 mg
30 mg
20 mg
5 mg
28,83 mg
20 mg
0,2 mg
0,25 mg
3 mg
1 mg
35 mg
1 mg
1 mg
1 mg
0,2 mg
1 mg
0,005 mg
100 mg
400 mg
48,84 mg
6000 mg
800 mg
2000 mg
1 mg
5,3 mg
ad 1000 ml

Luminia Malic, Olimpia Bazgan, Mihai Mare


71
C
a
p
i
t
o
l
u
l

Preparare : mediul se gsete sub form ready for use (Sigma Aldrich),
ct i sub form de pulbere pentru prepararea n laborator.
Pulberea se dizolv n ap bidistilat n cantitate de 10,4 g
pentru mediul uzual i 20,8 g pentru mediul dublu concentrat.
Aspect: bulion transparent de culoare roiatic
Utilizare: pentru utilizare, mediul se tamponeaz cu MOPS [3-(N-
morpholino) propanesulfonic acid], concentraia final a
acestuia fiind 0,165 mol/litru. Se obine astfel un pH cu
valoarea 7,0 convenabil dezvoltrii microorganismelor ce vor
fi testate.
Stocare: 2-8C
Disponibil comercial: Sigma Aldrich (Germania).

M40 Agar SABHI

Este un mediu de cultivare disponibil comercial n multiple
variante (cu i fr Cloramfenicol, Gentamicin sau
Cicloheximid) obinut prin amestecul unor cantiti
echivalente de Agar Sabouraud i Agar infuzie cord - creier. Se
recomand pentru cultivarea i izolarea selectiv a fungilor
patogeni.
Disponibil comercial: Remel (SUA), Becton Dickinson (SUA).

M41 Agar Sabouraud cicloheximid

Compoziie
Pepton
Dextroz
Agar
Cicloheximid
Cloramfenicol
Ap distilat
10,0 g
10,0 g
15,5 g
0,4 g
0,05 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 115
o
C timp de 15
minute.
Aspect: geloz de culoarea chihlimbarului, transparent
pH final la 25C: 6,9 0,2
Controlul calitii: Aspergillus niger ATCC 16404
Aureobasidium pullulans ATCC 9348
Blastomyces dermatitidis ATCC 56218 +
Candida albicans ATCC 10231 +
Escherichia coli ATCC 25922
Microsporum audouinii ATCC 9079 +
Medii de cultivare

72
Penicillium roquefortii ATCC 9295
Phialophora verrucosa ATCC 10223 +
Staphylococcus aureus ATCC 25923
Streptomyces rimosus ATCC 10970
Trichophyton mentagrophytes ATCC 9533 +
Utilizare: mediu pentru izolarea selectiv a fungilor rezisteni la
cicloheximid, n special a dermatofiilor
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Becton Dickinson (SUA), Merck (Germania), Remel (SUA),
Biokar Diagnostics (Frana).

M42 Agar Sabouraud cloramfenicol

Compoziie
Pepton
Glucoz
Cloramfenicol
Agar
Ap distilat
10 g
40 g
0,5 g
15 g
ad 1000 ml

Preparare: ingredientele se adaug n apa distilat prenclzit, apoi
amestecul se fierbe sub agitare pn la completa dizolvare a
acestora; mediul astfel obinut se repartizeaz n eprubete sau
flacoane i se sterilizeaz prin autoclavare, la 121C timp de
15 minute.
Aspect: geloz de culoarea chihlimbarului, transparent
pH final la 25 C: 5,6 0,2
Controlul calitii: Candida albicans ATCC 10231 ++
Aspergillus niger ATCC 16404 ++
Trichophyton rubrum ATCC 28188 ++
Escherichia coli ATCC 25922
Proteus vulgaris ATCC 13315
Utilizare: izolarea unei game largi de fungi patogeni i oportuniti din
prelevatele patologice
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Frana), Becton Dickinson
(SUA), bioMrieux (Frana).

M43 Agar Sabouraud Emmons

Compoziie
Pepton
Glucoz
Agar
Ap distilat
10 g
20 g
15 g
ad 1000 ml
Luminia Malic, Olimpia Bazgan, Mihai Mare


73
C
a
p
i
t
o
l
u
l


Preparare: ingredientele se adaug n apa distilat prenclzit, apoi
amestecul se fierbe sub agitare pn la completa dizolvare a
acestora. Se ajusteaz pH-ul la valoarea 7,0. Mediul astfel
obinut se repartizeaz n eprubete sau flacoane i se
sterilizeaz prin autoclavare, la 121C timp de 15 minute.
Aspect: geloz de culoarea chihlimbarului, transparent
pH final la 25 C: 7,0 0,2
Controlul calitii: Candida albicans ATCC 10231 ++
Aspergillus niger ATCC 16404 ++
Trichophyton rubrum ATCC 28188 ++
Escherichia coli ATCC 25922
Proteus vulgaris ATCC 13315
Utilizare: izolarea unei game largi de fungi patogeni i oportuniti din
prelevatele patologice (variantele aditivate)
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: exist numeroase variante mbuntite cu Cloramfenicol,
Gentamicin, Cicloheximid.

M44 Agar snge - glucoz - cistein

Compoziie
Tripton agar baz
L-cistein
Snge de berbec
defibrinat
Cloramfenicol
Ap deionizat
33 g
1 g
50 ml
0,5 g
ad 1000 ml

Preparare: ingredientele (cu excepia sngelui) se solubilizeaz n apa
prenclzit, apoi se autoclaveaz timp de 15 minute la 121C.
Dup autoclavare, mediul se rcete lent la 45-50C, moment
n care se adaug sngele i se omogenizeaz.
Aspect: geloz de culoare roie-vie, opac
pH final la 25
0
C: 7,2 0,2
Controlul calitii: Escherichia coli ATCC 25922 -
Utilizare: mediu de conversie (folosit pentru transformarea formei
filamentoase n cea levuric) pentru identificarea tulpinilor de
Histoplasma capsulatum, Blastomyces dermatitidis,
Paracoccidioides brasiliensis i Sporothrix schenckii.
Stocare: n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.



Medii de cultivare

74
M45 Agar selectiv cu triptofan

Este un mediu solid cu o compoziie simpl, incluznd ca
ingrediente principale doar L-triptofan (0,01%) i o surs
lipidic. La pH 5 i 37
o
C, permite dezvoltarea selectiv a
speciei Malassezia furfur, cu producerea unui pigment brun ce
difuzeaz n substratul nutritiv subiacent.

M46 Agar Staib (Agar cu infuzie de Niger) Bird seed Agar

Compoziie
Extract apos din semine
de Niger
Glucoz
Fosfat monopotasic
Creatinin
Agar
1000 ml
10 g
1 g
1 g
15 g

Preparare: 50 g semine de Niger (Guizotia abyssinica) se autoclaveaz
ntr-un litru de ap timp de 10 minute la 115C, apoi se
filtreaz. n acest extract apos se adaug restul ingredientelor i
se nclzete pn la completa dizolvare a acestora. Se readuce
volumul la 1000 ml i se autoclaveaz la 121C timp de 15
minute. Mediul se poate aditiva cu cloramfenicol (500 mg/l).
Aspect: geloz de culoare bej, opalescent
pH final la 25C : 5,5- 6,0
Controlul calitii: Cryptococcus neoformans ATCC 14116: colonii brune, cu
aspect mucoid;
Candida albicans ATCC 10231 : colonii netede, lucioase;
Utilizare: mediu diferenial pentru Filobasidiella (Cryptococcus)
neoformans; mediul este util i pentru diferenierea speciilor
Candida albicans (colonii de tip S, lucioase, similare celor de
pe mediile uzuale de cultivare) i Candida dubliniensis
(colonii de tip R, majoritatea cu marginile franjurate).
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Becton - Dickinson (USA)










Luminia Malic, Olimpia Bazgan, Mihai Mare


75
C
a
p
i
t
o
l
u
l

M47 Agar Takaschio (Agar Sabouraud diluat)



Compoziie
Glucoz
Neopepton
Sulfat de magneziu
Fosfat monopotasic
Agar
Ap distilat
2 g
1 g
1 g
1 g
20 g
ad 1000 ml

Preparare: ingredientele se amestec cu apa distilat prenclzit, sub
agitare continu, pn la completa lor solubilizare. Se
sterilizeaz prin autoclavare la 121C timp de 15 minute.
Aspect: geloz translucid, de culoare glbuie
pH final la 25C: 6,2 0,2
Controlul calitii: Microsporum canis ATCC 11621 - dezvoltare cu sporulare
intens
Uitlizare: favorizeaz sporularea tulpinilor de dermatofii
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz.

M48 Agar Tween 80 (destinat testului de opacifiere)

Compoziie
Bacto pepton
Clorur de sodiu
Clorur de calciu
Tween 80
Agar
Ap distilat
10 g
5 g
0,1 g
5 ml
15 g
ad 1000 ml

Preparare: ingredientele (cu excepia Tween-ului) se dizolv n apa
distilat prenclzit i se fierb un minut. Se sterilizeaz prin
autoclavare la 121C timp de 15 minute. Se rcete la 50C,
moment n care se adaug Tween-ul. Mediul se repartizeaz n
plci Petri sterile ( 90 mm), cte 25 ml/plac.
Aspect: geloz transparent, de culoare galben pai
pH final la 25C: 6,8
Controlul calitii: permite dezvoltarea diferitelor specii ale genului Candida, cu
apariia unui halo opac n jurul coloniilor de levuri secretoare
de esteraz (Candida albicans, Candida guilliermondii,
Candida rugosa, Candida tropicalis).
Utilizare: mediul este recomandat pentru diferenierea tulpinilor de C.
albicans i C. dubliniensis. Tulpinile de testat se inoculeaz n
Medii de cultivare

76
puncte separate, iar incubarea se realizeaz la 30C timp de 10
zile. Tulpinile de C. albicans i C. tropicalis determin apariia
unui halo opac n jurul coloniilor, la 2-3 zile post-inoculare, n
timp ce tulpinile de C. dubliniensis nu pozitiveaz testul nici n
10 zile post-inoculare. Tulpinile cu aciune lipolitic secret o
esteraz capabil s scindeze Tween-ul i s elibereze acizii
grai care se vor cupla cu ionii de Ca
2+
formnd sruri vizibile
sub forma unei zone de opacifiere n jurul coloniilor. C.
dubliniensis este lipsit de aciune lipolitic, comportament util
n diferenierea de C. albicans.
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M49 Agar cu amidon

Compoziie
Amidon solubil
Extract de drojdie
Agar
Ap distilat
40 g
5 g
20 g
ad 1000 ml

Preparare: substanele se introduc n ap i se dizolv pe baie de ap. Nu
este necesar ajustarea pH-ului care, dup sterilizare, are
valoarea 6,5-7.
Aspect: geloz glbuie, uor opalescent
pH final la 25C: 6,5-7
Controlul calitii: Fusarium solani ATCC 22278 - dezvoltare cu sporulare
intens;
Utilizare: mediu destinat stimulrii sporulrii la fungii filamentoi
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.

M50 Agar ap de robinet

Compoziie
Agar
Ap de robinet
15-25 g
ad 1000 ml

Preparare: agarul se dizolv n apa prenclzit i apoi se sterilizeaz 20
minute la 121C. Se pot aduga paie de gru sau boabe de orez
sterilizate.
Aspect: geloz glbuie, translucid
pH final la 25C: nu se determin
Controlul calitii: Fusarium solani ATCC 22278 - dezvoltare cu sporulare
Luminia Malic, Olimpia Bazgan, Mihai Mare


77
C
a
p
i
t
o
l
u
l

Utilizare: muli fungi sensibili sporuleaz bine pe acest mediu. Este


utilizat att pentru izolarea genului Pythium, ct i pentru
izolarea i stimularea sporulrii la speciile de Fusarium. De
asemenea, transferul pe acest mediu a culturilor pleomorfe ale
dermatofiilor induce sporularea i chiar revenirea la tipul
wild a speciilor dezvoltate n prealabil pe mediul Sabouraud.
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.

M51 Bulion cu uree ( test rapid pentru identificarea levurilor )
(Rapid Urea Broth Test for Yeasts)

Compoziie
Pepton
NaCl
Fosfat monopotasic
Rou fenol
Glucoz
Uree
Ap distilat
1 g
5 g
2 g
0,012 g
1 g
20 g
ad 1000 ml

Preparare: ingredientele (cu excepia ureei) se solubilizeaz n 500 ml ap
distilat prenclzit i apoi se sterilizeaz prin autoclavare la
121C timp de 15 minute. Ureea se solubilizeaz n apa
distilat rmas i se sterilizeaz prin filtrare, utiliznd
membrane cu porozitate de 0,22 m. Cele dou soluii astfel
obinute se rcesc la temperatura camerei i se amestec sub
protecia unei hote microbiologice de clas II; bulionul obinut
se repartizeaz n tuburi (cte 3 ml).
Aspect: bulion transparent, de culoare glbuie
pH final la 25C: 6,8 0,2
Controlul calitii : Cryptococcus neoformans ATCC 66031 - ureazo pozitiv (rou)
Candida albicans ATCC 1023 - ureazo negativ (galben)
Utilizare: diferenierea tulpinilor levurice ureazo-pozitive de cele ureazo-
negative i identificarea prezumtiv a unor genuri
(Cryptococcus, Rhodotorula i Trichosporon )
Stocare: - 20C timp de 2 luni
Disponibil comercial: Remel (SUA).







Medii de cultivare

78
M52 Bulion Sabouraud

Compoziie
Pepton
Glucoz
Ap distilat
10 g
20 g
ad 1000 ml

Preparare: ingredientele se solubilizeaz n apa distilat prenclzit, apoi
mediul astfel obinut se repartizeaz n eprubete, n volum de
cte 5 ml. Se sterilizeaz prin autoclavare, la 121C timp de 15
minute.
Aspect: bulion de culoare glbuie, transparent
pH final la 25 C: 5,6 0,2
Controlul calitii: Candida albicans ATCC 10231 ++
Aspergillus niger ATCC 16404 ++
Utilizare: purificarea suelor de fungi contaminate cu bacterii; n acest
caz mediul se aditiveaz cu acid clorhidric 1N
Stocarea: o lun la temperatura de refrigerare
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Frana), Becton Dickinson
(SUA),bioMrieux (Frana).

M53 CHROMagar Candida

Compoziie
Pepton
Amestec cromogen
Cloramfenicol
Agar
Ap purificat
10 g
22 g
0,5 g
15 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat i se fierb un minut
pn la completa solubilizare. Se autoclaveaz la 121C timp
de 15 minute. Se adaug neomicin, 500 g/ml, n momentul
rcirii mediului la o temperatur de 50-55C.
Aspect: transparent, uor opalescent
pH final la 25
0
C: 6,1 0,1
Controlul calitii: Candida albicans ATCC 10231 ++
Candida tropicalis ATCC 1369 ++
Candida krusei ATCC 34135 ++
Utilizare: izolarea levurilor din prelevatele patologice i identificarea
speciilor: C. albicans - colonii de culoare verde-smarald, C.
krusei - colonii de tip R de culoare roz-pal, albicioase la
periferie, C.tropicalis - colonii de culoare albastru-verzui pn
la albastru-metalizat, C.glabrata colonii mate de culoare
violet deschis (lila);
Luminia Malic, Olimpia Bazgan, Mihai Mare


79
C
a
p
i
t
o
l
u
l

Stocare: n plci, 2 luni, la temperatura de refrigerare


Disponibil comercial: Becton Dickinson (SUA)

M54 Ciree - Agar

Compoziie
Extract de ciree
Agar
Ap distilat
300 ml
20 g
ad 1000 ml

Preparare: obinerea extractului de ciree - se scot smburii din fructele
roii, la 450 g pulp de ciree adugndu-se 1000 ml ap
distilat. Amestecul se fierbe nnbuit 2 ore. Se filtreaz prin
tifon i se sterilizeaz o or la 110C. Extractul se pstreaz n
flacoane, la frigider. Se dizolv agarul n ap i se adaug
extractul. Se distribuie n eprubete sterilizate i se autoclaveaz
5 minute la 120C. Nu se supranclzete deoarece reacia
acid a mediului mpiedic solidificarea.
Aspect: geloz roiatic, translucid
pH final la 25C: 3,5 - 4,6
Utilizare: favorizeaz sporularea la fungii filamentoi superiori
Stocare: n eprubete 4 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.

M55 Agar glicerin

Compoziie
Glicerin
Sucroz
Pepton
MgSO
4
x 7H
2
O
KH
2
PO
4
NaCl
Agar
Ap distilat
7,5 g
7,5 g
5,0 g
0,05 g
0,06 g
4,0 g
20,0 g
ad 1000 ml

Preparare: glicerina, sucroza, sulfatul de magneziu i fosfatul de potasiu
se adaug n 200 ml ap. Se omogenizeaz peptona i clorura
de sodiu cu 200 ml ap prenclzit la 60C i se adaug peste
prima soluie. Agarul se dizolv n 600 ml ap i apoi se
amestec cu celelalte soluii. Nu se ajusteaz pH-ul.
Autoclavarea mediului se face la 121C timp de 20 minute.
Aspect: geloz glbuie, uor opalescent
pH final la 25C: nu se determin
Medii de cultivare

80
Controlul calitii: Aspergillus niger ATCC 16404 ++
Utilizare: cultivarea i identificarea speciilor aparinnd genului
Aspergillus.

M56 Infuzie de cartofi

Compoziie
Cartofi
Ap de robinet
300 g
900 ml

Preparare: se las cartofii taiai, n ap, la frigider, timp de 24 de ore, dup
care se filtreaz i se autoclaveaz infuzia 1 or la 110
0
C.
Aspect: lichid alb-glbui, translucid
pH final la 25C : nu se determin
Controlul calitii: nu se realizeaz
Utilizare: pentru prepararea mediului PDA
Stocare: se recomand utilizarea imediat
Disponibil comercial: nu se comercializeaz.

M57 Mal agar (Malt Agar)

Compoziie
Extract de mal
Agar
Ap distilat
30,0 g
15,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 121
o
C timp de 15
minute. Mediul nu se va renclzi.
Aspect: geloz de culoarea chihlimbarului, uor opalescent
pH final la 25C: 5,5 0,2
Controlul calitii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: mediu pentru conservarea fungilor i pentru studierea
caracterelor morfologice ale acestora n vederea identificrii
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Merck (Germania), Remel (SUA), Biokar Diagnostics
(Frana).




Luminia Malic, Olimpia Bazgan, Mihai Mare


81
C
a
p
i
t
o
l
u
l

M58 Mal extract agar (Malt Extract Agar)



Compoziie
Maltoz
Dextrin
Glicerol
Pepton
Agar
Ap distilat
12,75 g
2,75 g
2,35 g
0,78 g
15,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 121
o
C timp de 15
minute.
Aspect: geloz de culoarea chihlimbarului, transparent
pH final la 25C: 4,7 0,2
Controlul calitii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: mediu pentru cultivarea, identificarea i aprecierea cantitativ a
fungilor filamentoi i levuriformi
Stocare: n eprubete 2 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA), Becton Dickinson (SUA), Merck (Germania)






















Medii de cultivare

82
M59 Mediu baz pentru levuri
(Yeast Carbon Base)

Compoziie
Dextroz
L-histidin
monohidrocloric
LD-metionin
LD-triptofan
Biotin
Calciu pantotenic
Acid folic
Inozitol
Niacin
Acid p-amino benzoic
Piridoxin hidrocloric
Riboflavin
Tiamin hidrocloric
Acid boric
Sulfat de cupru
Iodur de potasiu
Clorur feric
Sulfat de mangan
Molibdat de sodiu
Sulfat de zinc
Fosfat monopotasic
Sulfat de magneziu
Clorur de sodiu
Clorur de calciu
Ap distilat
10,0 g
1,0 g
2,0 mg
2,0 mg
2,0 g
400,0 g
2,0 g
2000,0 g
400,0 g
200,0 g
400,0 g
200,0 g
400,0 g
500,0 g
40,0 g
100,0 g
200,0 g
400,0 g
200,0 g
400,0 g
1,0 g
0,5 g
0,1 g
0,1 g
ad 1000 ml

Preparare: n vederea sterilizrii prin filtrare se prepar o soluie de
concentraie 10 x prin dizolvarea a 11,7 g pulbere n 100 ml
ap distilat prenclzit. Apoi se filtreaz utiliznd filtre cu
porozitate de 0,2 m. Varianta de lucru se prepar prin
adugarea de ap distilat sterilizat n proporie de 9 volume
la un volum mediu concentrat.
Aspect: bulion transparent, de culoare galben-pai
pH final la 25C: 5,5 0,2
Utilizare: mediu baz pentru auxonograma levurilor
Stocare: 2- 8C
Disponibil comercial: Difco (SUA)




Luminia Malic, Olimpia Bazgan, Mihai Mare


83
C
a
p
i
t
o
l
u
l

M60 AM3
(Antibiotic medium 3)

Compoziie
Extract de carne pulbere
Extract de drojdii
Pepton
Dextroz
Clorur de sodiu
Fosfat dipotasic
Fosfat monopotasic
Ap distilat
5,0 g
1,5 g
5,0 g
1,0 g
3,5 g
3,68 g
1,32 g
ad 1000 ml

Preparare: ingredientele se dizolv n ap distilat prenclzit sub agitare
continu. Se repartizeaz n tuburi sau flacoane i se
autoclaveaz la 121C timp de 15 minute.
Aspect: mediu transparent de culoarea chihlimbarului
pH final la 25
0
C: 7,0 0,5
Controlul calitii: incubare la 35
0
C 2
0
C / 24 ore
Escherichia coli ATCC 10536 +
Staphylococcus aureus ATCC 6538 +
Candida albicans ATCC 10231 +
Utilizare: mediu destinat depistrii rezistenei la amfotericin prin
metoda benzilor E-test.
Stocare: 2-8C
Disponibil comercial: Becton Dickenson (SUA)

M61 Mediu sintetic pentru testul de filamentare

Compoziie
Glucoz
Fosfat monopotasic
Clorur de calciu
Sulfat de magneziu
Sulfat de amoniu
Ap distilat
0,5 g
2,0 g
0,05 g
0,05 g
0,5 g
ad 1000 ml

Preparare: dup solubilizarea glucozei i a tuturor srurilor, pH-ul se
ajusteaz la 6,75 cu ajutorul unei soluii de hidroxid de potasiu
2M i amestecul se sterilizeaz prin autoclavare
Aspect: mediu lichid, transparent
pH final la 25C: 6,75-6,80
Controlul calitii: Candida albicans ATCC 10231 ++
Candida parapsilosis ATCC 22019 ++
Medii de cultivare

84
Utilizare: permite producerea de tubi germinativi la tulpinile de Candida
albicans, prin incubare pe baia de ap, la 37C timp de 4 ore.
Este utilizat pentru trierea selectiv a tulpinilor levurice i
identificarea prezumtiv a speciilor C. albicans i C.
dubliniensis (diferenierea ntre acestea necesit teste
suplimentare).
Stocare: n eprubete 4 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.

M62 Mediul Bilai

Compoziie
KH
2
PO
4
KNO
3

MgSO
4
x 7H
2
O
KCl
Amidon pudr
Glucoz
Sucroz
Agar
Ap distilat
1 g
1 g
0,5 g
0,5 g
0,2 g
0,2 g
0,2 g
18,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat prenclzit, se fierb un
minut, apoi se autoclaveaz la 121C timp de 15 minute.
Aspect: geloz albicioas, opalescent
pH final la 25C: nu se determin
Controlul calitii: Fusarium solani ATCC 22278 - dezvoltare cu sporulare
intens
Utilizare: mediul induce formarea conidiilor la Fusarium
Stocare: n eprubete 4 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.

M63 Mediu cu lapte diluat

Compoziie
Lapte natural pasteurizat
Cloramfenicol
Ap distilat steril
170 ml
0,250 g
ad 1000 ml

Preparare: ingredientele se omogenizeaz sub protecia unei hote cu flux
laminar de clas II i se repartizeaz n flacoane. Este
obligatorie folosirea laptelui pasteurizat UHT, deoarece este
steril.
Aspect: mediu lichid, de culoare alb, opac
Luminia Malic, Olimpia Bazgan, Mihai Mare


85
C
a
p
i
t
o
l
u
l

Controlul calitii: Candida albicans ATCC 10231 (dezvoltare abundent, cu


producere de pseudomiceliu i clamidospori)
Utilizare: mediu recomandat pentru studierea caracterelor morfologice la
levuri (clamidospori, hife, pseudohife, blastoconidii,
artrospori). n acest scop se suspensioneaz o colonie tnr n
3-4 ml mediu i se incubeaz la 28-30C timp de 24-48 ore.
Se observ la microscop ntre lam i lamel (x100 ... x400).
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M64 Mediu cu pine

Felii de pine se taie n form de prisme de 5 cm lungime i 1
cm lime. Se introduc n eprubete i se adaug ap. Pentru
sterilizare se nclzete treptat pentru a evita frmiarea
miezului. Folosind cantiti variabile de ap se obine
sporularea speciilor higrofile, mezofile, xerofile, n special la
Aspergillus, Penicillium i Mucor; mediu utilizat de asemenea
pentru izolarea zygomicetelor din infecii cerebrale
(fragmentele de esut cerebral cu dimensiuni de civa mm
diametru se nsmneaz n mai multe puncte, pe fragmentele
de pine, apoi se incubeaz la 37C).
Stocare: n eprubete 4 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.

M65 Mediu cu sol

Solul (pmnt de grdin cernut printr-o sit fin) se introduce
n eprubete sau flacoane i se sterilizeaz 30 de minute la
121C. Dup 7 zile se sterilizeaz din nou pentru a distruge
toate microorganismele termorezistente care au supravieuit
primei sterilizri. Se inoculeaz solul i se umezete n acelai
timp cu 2-3 ml suspensie de spori. Se incubeaz culturile 10-14
zile apoi se pstreaz la 3-6C. Mediul este recomandat
pentru conservarea fungilor.
Stocare: n eprubete 4 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: nu este disponibil comercial.









Medii de cultivare

86
M66 Bulion / Agar Czapek-Dox (Czapek - Dox Broth / Agar)

Compoziie
Zaharoz
Nitrat de sodiu
Fosfat dipotasic
Sulfat de magneziu
Clorur de potasiu
Sulfat feric
Ap distilat
30,0 g
3,0 g
1,0 g
0,5 g
0,5 g
0,01 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 121
o
C timp de 15
minute; n cazul mediului solid se adaug 15 g agar.
Aspect: transparent, uor opalescent; uneori poate prezenta un uor
precipitat
pH final la 25
o
C: 7,3 0,2
Controlul calitii: Aspergillus niger ATCC 9642 ++
Candida albicans ATCC 10231 ++
Candida tropicalis ATCC 750 ++
Saccharomyces cerevisiae ATCC 9763++
Utilizare: mediu utilizat pentru izolarea fungilor aparinnd speciilor
Aspergillus, Penicillium i Paecilomyces din probele de ap
conform unor standarde; mediu pentru identificarea tulpinilor
de Aspergillus
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Merck (Germania), Remel (SUA), Biokar Diagnostics (Frana).

M67 Mediul Kurung-Yegian

Compoziie soluia A
Fulgi de cartofi
Ap deionizat
5 g
500 ml

Compoziie soluia B
Melanj de ou
Glbenu de ou
250 ml
500 ml

Preparare: se prepar separat cele dou soluii, apoi se amestec i se
repartizeaz n tuburi. Se sterilizeaz prin autoclavare la
110C timp de 10 minute.
Aspect: mediu n tuburi, turnat n pant, de culoare galben, opac
Luminia Malic, Olimpia Bazgan, Mihai Mare


87
C
a
p
i
t
o
l
u
l

pH final la 25C : 6,6 0,2


Utilizare: asigur conversia la forma levuric n cazul speciilor
Histoplasma capsulatum i Blastomyces dermatitidis
Stocare: n eprubete o lun la 2-8C
Disponibil comercial: nu se comercializeaz.

M68 Mediul Nikersen-Mankovski

Compoziie
Fosfat monopotasic
Sulfat de amoniu
Biotin
Albastru de tripan
Agar
Ap distilat
1,0 g
1,0 g
5,0 g
0,10 g
15,0 g
ad 1000 ml

Preparare: se solubilizeaz toate substanele n apa distilat prenclzit.
Se sterilizeaz prin autoclavare la 121C timp de 15 minute.
Mediului rcit (la 50C) i se adaug 20 g glicogen sau amidon
purificat i sterilizat prin tindalizare.
Aspect: geloz opalescent, de culoare bleu- pal
Controlul calitii: Candida albicans ATCC 10231 dezvolt clamidospori n 24-
48 de ore de incubare la 25C
Utilizare: mediu destinat stimulrii producerii de clamidospori la levuri
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M69 Mediul Pagano-Levin (TTC Sabouraud Agar)

Compoziie
Pepton
Dextroz
Agar
Clorur de
trifeniltetrazoliu sol.1%
(TTC)
Neomicin sau
Cloramfenicol
Ap distilat
10,0 g
40,0 g
15,0 g
10 ml
0,5 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 115
o
C timp de 15
Medii de cultivare

88
minute. La temperatura de 50-55C se adug sol. 1% TTC i
antibioticul.
Aspect: geloz transparent, de culoare slab glbuie, opalescent
pH final la 25
0
C: 5,6 0,2
Controlul calitii: Candida albicans ATCC 26790 ++
Candida albicans ATCC 36232 ++
Candida krusei ATCC 34135 ++
Escherichia coli ATCC 25922
Utilizare: acest mediu diferenial este recomandat pentru identificarea
speciei Candida albicans din prelevatele patologice. Tulpinile
acestei specii prezint pe mediul Pagano-Levin culoarea alb-
deschis, n timp ce alte specii din genul Candida prezint
colonii roz, de diferite nuane.
Stocare: n plci o lun la 2-8C
Disponibil comercial: bioMrieux (Frana).

M70 Mediu pentru izolarea dermatofiilor (DTM)

Compoziie
Pepton din soia
Dextroz
Rou fenol
Cicloheximid
Cloramfenicol
Agar
Ap distilat
10,0 g
10,0 g
0,2 g
0,5 g
0,1 g
20,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 121
o
C timp de 15
minute
Aspect: agar galben-portocaliu, uor opalescent
pH final la 25C: 5,5 0,2
Controlul calitii: Aspergillus niger ATCC 16404
Microsporum audouinii ATCC 9079 ++
Pseudomonas aeruginosa ATCC 10145
Trichophyton mentagrophytes ATCC 9533 ++
Utilizare: mediu selectiv i diferenial pentru izolarea i identificarea
dermatofiilor din prelevatele clinice
Stocare: n eprubete 2 luni la 2-8 C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA), Becton Dickinson (SUA)





Luminia Malic, Olimpia Bazgan, Mihai Mare


89
C
a
p
i
t
o
l
u
l

M71 Mediul RPMI 1640 - MOPS (CLSI)



Compoziie
Mediu RPMI 1640
MOPS
Ap distilat
10,4 g
34,53 g
ad 1000 ml

Preparare: se amestec ingredientele sub agitare continu pn la
completa dizolvare. La 25
0
C se ajusteaz pH-ul la valoarea 7,0
cu ajutorul unei soluii de NaOH 1M. Se sterilizeaz prin
filtrare utiliznd un filtru cu porozitate 0,2 m. Se stocheaz la
4C pn la utilizare. nainte de utilizare se testeaz sterilitatea
i pH-ul .
Aspect: bulion transparent, de culoare roiatic
pH final la 25
0
C: 6,9 - 7,1
Controlul calitii: trebuie s se obin CMI-urile recomandate pentru tulpinile
test.
Utilizare: mediu destinat testrii susceptibilitii la antifungice prin
tehnicile CLSI
Stocare: 2C8C
Disponibil comercial: nu se comercializeaz.

M72 Mediul RPMI 1640 - MOPS ( EUCAST)

Compoziie mediu concentraie uzual 1X
Mediu RPMI 1640
MOPS
Glucoz
Ap distilat
10,4 g
34,53 g
18 g
ad 1000 ml


Compoziie mediu dublu concentrat 2X
Mediu RPMI 1640
MOPS
Glucoz
Ap distilat
20,8 g
69,06 g
36 g
ad 1000 ml

Preparare: se adaug ingredientele n ap bidistilat, amestecndu-se
continuu pn la dizolvarea lor complet. Se ajusteaz pH-ul la
valoarea 7,0 folosind NaOH soluie 1 M. se completeaz cu
ap bidistilat pn la 1 litru. Se sterilizeaz prin filtrare,
utiliznd un filtru cu porozitate 0,22 m. Se pstreaz la 4C
pn n momentul folosirii. nainte de utilizare, se testeaz
sterilitatea mediului i se verific pH-ul.
Medii de cultivare

90
Aspect: bulion transparent de culoare roiatic
pH final la 25
0
C: 6,9- 7,1
Controlul calitii: trebuie s se obin CMI-urile recomandate pentru tulpinile test
Utilizare: mediu destinat testrii susceptibilitii la antifungice prin
tehnicile EUCAST
Stocare: 2-8C
Disponibil comercial: nu se comercializeaz.

M73 Agar RPMI - MOPS - glucoz 2 %

Compoziie
Mediu RPMI 1640
(cu L-glutamin i rou
fenol, fr bicarbonat)
MOPS
Glucoz
Agar pulbere
NaOH soluie 1M
Ap distilat
8,4 g
34,5 g
20,0 g
15,0 g
80-90 ml
ad 1000 ml

Preparare: se dizolv pulberile de RPMI i MOPS n cca. 450 ml ap
distilat i se sterilizeaz prin filtrare utiliznd un filtru cu
porozitate 0,2 m. Se solubilizeaz glucoza i agarul n cca.
450 ml ap distilat i se sterilizeaz prin autoclavare timp de
15 minute la 121C; se rcete apoi amestecul la 45-50C. Se
nclzete lent soluia coninnd RPMI i MOPS la cca. 45C
i se amestec cu cea care conine glucoza i agarul, sub
protecia unei hote microbiologice de clas II. Se ajusteaz
pH-ul amestecului la valoarea 7,0 utiliznd soluie NaOH 1M,
i se aduce volumul final al amestecului la 1000 ml. Se toarn
mediul n plci Petri (cca. 60 ml/ plac 150 mm sau cca 25
ml / plac Petri 90 mm, sub protecia lmpii UV, utiliznd o
hot microbiologic de clas II. Se stocheaz la 4C.
Aspect: geloz translucid, de culoare roiatic
pH final la 25
0
C: 6,9-7,1
Controlul calitii: se realizeaz cu benzi E-Test la 48 ore










Luminia Malic, Olimpia Bazgan, Mihai Mare


91
C
a
p
i
t
o
l
u
l

Intervalul CMI (g/ ml)



Tulpina test FC AP FL IT VO
C.parapsilosis
ATCC 22019
0,064 -
0,258
0,25 - 1
1 - 4 (rar
colonii
izolate la
8)
0,064 -
0,25
0,016 -
0,064
C.krusei
ATCC 6258
32 0,5 - 2 128 -256 0,25 - 1 0,25 - 1
C.albicans
ATCC 90028
0,5 - 2 0,125 -0,5 0,125 -0,5
0,064 -
0,25
0,004 -
0,016

Utilizare: mediu destinat testrii susceptibilitii la antifungice cu benzi
E-test
Stocare: 2-8C
Disponibil comercial: AES Laboratoire (Frana)

M74 Agar Dicloran - Rose Bengal - cloramfenicol
(DRBC Agar)

Compoziie
Pepton proteazic 3
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Dicloran
Roz Bengal
Cloramfenicol
Agar
Ap distilat
5,0 g
10,0 g
1,0 g
0,5 g
2,0 m g
25,0 m g
0,1 g
15,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatur de 121
o
C timp de 15
minute
Aspect: geloz de culoare roz, transparent sau uor opalescent
Medii de cultivare

92
pH final la 25C: 5,6 0,2
Controlul calitii: Aspergillus niger ATCC 1015 - colonii albe
Candida albicans ATCC 10231 - colonii roz.
Escherichia coli ATCC 25922 -
Micrococcus luteus ATCC 10240 -
Utilizare: mediu pentru cultivarea i identificarea fungilor filamentoi
Stocare: n eprubete 2 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Frana).

M75 Trichophyton Agar 1-7

* Trichophyton Agar 1

Compoziie
Aminoacizi Casamino
Difco
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Agar
Ap distilat
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
ad 1000 ml

* Trichophyton Agar 2

Compoziie
Aminoacizi Casamino
Difco
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Agar
Inozitol
Ap distilat
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
50,0 mg
ad 1000 ml












Luminia Malic, Olimpia Bazgan, Mihai Mare


93
C
a
p
i
t
o
l
u
l

* Trichophyton Agar 3

Compoziie
Aminoacizi Casamino
Difco
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Agar
Inozitol
Tiamina HCL
Ap distilat
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
50,0 mg
200 g
ad 1000 ml

* Trichophyton Agar 4

Compoziie
Aminoacizi Casamino
Difco
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Agar
Tiamin HCl
Ap distilat
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
200 g
ad 1000 ml

* Trichophyton Agar 5

Compoziie
Aminoacizi Casamino
Difco
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Acid nicotinic
Agar
Ap distilat
2,5 g
40,0 g
1,8 g
0,1 g
200 g
15,0 g
ad 1000 ml








Medii de cultivare

94
* Trichophyton Agar 6

Compoziie
Nitrat de amoniu
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Agar
Ap distilat
1,5 g
40,0 g
1,8 g
0,1 g
15,0 g
ad 1000 ml

* Trichophyton Agar 7

Compoziie
Nitrat de amoniu
Histidin HCl
Dextroz
Fosfat monopotasic
Sulfat de magneziu
Agar
Ap distilat
1,5 g
30,0 mg
40,0 g
1,8 g
0,1 g
15,0 g
ad 1000 ml

Preparare: ingredientele se amestec cu apa distilat pn la completa
dizolvare i se fierb un minut. Se autoclaveaz la 121C timp
de 12 minute.
Aspect: geloz glbuie, uor opalescent
pH final la 25C: 6,8 0,2
Controlul calitii: Trichophyton concentricum ATCC 9358 ++
Trichophyton schoenleinii ATCC 4822 ++
Trichophyton verrucosum ATCC 34470 ++
Utilizare: cultivarea i identificarea speciilor aparinnd genului
Trichophyton
Stocare: n eprubete 4 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: Difco (SUA)

M76 Agar pepton 3% (Agar Sabouraud conservare)

Compoziie
Pepton
Agar
Ap distilat
30,0 g
20,0 g
ad 1000 ml

Preparare: ingredientele se dizolv n apa distilat, amestecnd continuu,
cu meninerea temperaturii de fierbere timp de un minut.
Luminia Malic, Olimpia Bazgan, Mihai Mare


95
C
a
p
i
t
o
l
u
l

Autoclavarea are loc la o temperatur de 121


o
C timp de 15
minute.
Aspect: geloz de culoare galben-pal, translucid
pH final la 25C: nu se determin
Controlul calitii: M. persicolor - colonii cu tent roz-lila
Utilizare: mediu pentru diferenierea M. persicolor de T. mentagrophytes
i pentru conservarea suelor de dermatofii
Stocare: n eprubete 2 luni la 2-8C, n plci o lun la 2-8C
Disponibil comercial: nu se comercializeaz


































Medii de cultivare

96
Bibliografie selectiv

1. Abildgren M P, Lund F, Thrane U, Elmhold S (1987) - Czapek-Dox agar
containing iprodione and dicloran as a selective medium for the isolation
of Fusarium species; Lett Appl Microbiol; 5:83-86.
2. Acha P N, Szyfrer B (1989) - Zoonoses et maladies transmissibles
communes lhomme et aux animaux; Office International des
Epizooties; 2
nd
edition; Paris.
3. Andrews S (1992) - Differentiation of Alternaria species isolated from
cereals on dichloran malt extract agar. In Modern Methods in Food
Mycology, Samson R A, Hocking A D, Pitt J I, King A D (eds.); Ed.
Elsevier, Amsterda; 351-355.
4. Andrews S, Pitt J I (1986) - Selective medium for the isolation of
Fusarium species and dematiaceous Hyphomycetes from cereals; Appl
Environ Microbiol; 51:1235-1238.
5. Baertschi C, Berthier J, Guiguettaz C, Valla G (1989) - A selective
medium for the isolation and enumeration of Mucor species; Mycological
Research; 95:373-374.
6. Baron E J, Peterson L R, Finegold S M (1994) - Bailay & Scotts
diagnostic microbiology; 9
nd
edition. Mosby-Year Book; Inc; St. Louis;
M.O.
7. Barr F S, Collins G F (1996) - A rapid method for isolation and
identification of Candida; J Southern Med Assoc; 59:694-695.
8. Baumgartner C, Freydiere A-M, Gille Y (1996) - Direct identification and
recognition of yeast species from clinical material by using Albicans ID
and CHROMagar Candida plates; J Clin Microbiol; 34:456-465.
9. Bensignore E, Feuilhade de Chauvin M (1999) - Microsporum persicolor
(Sabouraud) Guiard et Grigorakis 1929 chez lanimal et chez lhomme:
etude in vitro et revue de la littrature; Rec Md Vt; 175(1-2):45-60.
10. Booth C (1971) - Fungal culture media. In Methods in Microbiology, ed.
Booth C; Academic Press, London; 49-94.
11. Buiuc D, Negu M (1999) - Tratat de microbiologie clinic; Ed. Medical;
Bucureti.
12. Chabasse D (Editor) (2004) - Les dermatophytes; Cahier de formation en
Biologie mdicale; Bioforma; Paris; No. 31.
13. Chabasse D, Cimon B, Gentile L, Bouchara J P (1991) - Les mycoses
transmises danimal lhomme; Revue franaise des laboratoires;
10(228):77-83.
14. Chermette R, Bussieras J (1993) - Abrg de parasitologie vtrinaire;
Fasc. V; Mycologie vtrinaire; ENV dAlfort; Paris.
15. Coman I, Mare M (2000) - Micologie medical aplicat; Ed. Junimea,
Iai.
16. Constantinescu O (1974) - Metode i tehnici n micologie; Ed. Ceres;
Bucureti.
Luminia Malic, Olimpia Bazgan, Mihai Mare


97
C
a
p
i
t
o
l
u
l

17. Costa S O, de Lourdes Branco C (1964) - Evaluation of a molybdenum


culture medium as selective and differential for yeasts; J Pathol Bacteriol;
87:428-431.
18. Cutsem Van J, Rochette F (1992) - Mycoses des animaux domestiques;
Janssen Researchers Foundation.
19. Freydire A M, Guinet R (1997) - Rapid methods for identification of the
most frequent clinical yeasts; Rev Iberoam Micol; 14:85-89.
20. Freydiere A-M, Rousselle P, Gille P (1995) - Apport des milieux
didentification rapide de Candida albicans: Fluoroplate et Albicans ID; J
Med Mycol; 5:190-191.
21. Garcia-Martos P, Garcia-Agudo R, Hermandez- Molina J M et al. (1998) -
Identificacion de levadudas de interes clinico en el medio de cultivo
CHROMagar Candida; Rev Iberoam Micol; 15:131-135.
22. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed.
Viaa Medical Romneasc; Bucureti.
23. Grillot R (1996) - Les Mycoses humaines: demarche diagnostique; Ed.
Elsevier, Paris.
24. Gueho E, Midgley G, Guillot J (1996) - The genus Malassezia with
description of four new species; Antonie van Leeuwenhoek; 69:337-355.
25. Guillot J, Gueho E, Mialot M, Chermette R (1998) - Importance des
levures du genre Malassezia en dermatologie vtrinaire; Le point
Vtrinaire; 29:691-701.
26. Hocking A D, Pitt J I (1980) - Dichloran-sucrose agar, a differential
medium for enumeration of xerophilic fungi from low-moisture foods.
Appl Environ Microbiol; 39:488-492.
27. Hoog de G S, Guarro J, Gen, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
28. Hopfer R L, Blank F (1975) - Caffeic acid - containing medium for
identification of Cryptococcus neoformans; J Clin Microbiol; 2:1158-
1200.
29. Jacquemin P, Jacquemin J L (1974) - Abrg de parasitologie clinique;
Masson et C
ie
; Paris.
30. Jarvis B (1973) - Comparison of an improved rose bengal-chlortetracycline
agar with other media for the selective isolation and anumeration of
moulds and yeasts in foods; J Appl Bacteriol; 36:723-727.
31. Kane J (1984) - Conversion of Balstomyces dermatitidis to the yest form at
37C and 26C; J Clin Microbiol; 20:594-596.
32. King A D,Hocking A D, Pitt J I (1979) - Dichloran-rose bengal medium
for enumeration and isolation of moulds from foods; Appl Environ
Microbiol; 37:959-964.
33. Kumar Girish C P, Menon T (2005) - Tobacco agar: a new medium for
chlamydosporulation in Candida albicans and Candida dubliniensis; Med
Mycol; 43(5):473-475.
Medii de cultivare

98
34. Kurtzman C P, Boekhout T, Robert V, Fell W, Deak T (2003) - Methods
to identify yeasts. In Boekhout T, Robert V (eds) - Yeasts in Food; B
Behrs Verlag GmbH & Co; Hamburg; Germany.
35. Kurung J M, Yegian D (1954) - Medium for maintenance and conversion
of Histoplasma capsulatum to the yeast like phase; Am J Clin Pathol;
24:505-508.
36. Kwon-Chung K J, Bennett J E (1992) - Medical Mycology; Lea & Febiger;
Philadelphia.
37. Leeming J P, Notman F H (1987) - Improved methods for isolation and
enumeration of Malassezia furfur from human skin; J Clin Microbiol;
25:2017-2019.
38. Martin M V, Schneidau J D (1970) - A simple and reliable assimilation
test for the identification of Candida species; Am J Clin Pathol; 53:875-
879.
39. Mayser P, Wille G, Imkampe A., Thoma W et al. (1998) - Synthesis of
fluorchromes and pigments in Malassezia furfur by use of triptophane as
single nitrogen sourse; Mycoses; 41:265-271.
40. Mc Ginnis M R (1980) - Laboratory handbook of medical mycology;
Academic Press; New York.
41. Mitroiu P (1976) - Micoze i micotoxicoze la animale; Ed. Ceres;
Bucureti.
42. Mosaid al A, Sullivan D, Coleman D C (2003) - Differentiation of
Candida dubliniensis from Candida albicans on Pals Agar; J Clin
Microbiol; 41(10): 4787-4789.
43. Mosaid al A, Sullivan D, Salkin I F et al.(2001) - Differentiation of
Candida dubliniensis from Candida albicans on Staib Agar and Caffeic
Acid- Ferric Citrate Agar; J Clin Microbiol; 39(1):323-327.
44. Moser S A, Lyon F L, Greer D L (1988) - Sistemic mycoses; In BB
Wentworth (ed.) - Diagnostic procedures for mycotic and parasitic
infection; American Public Health Association; Washington DC; 173-238.
45. Nelson C S, Yau Y C W, Richardson E S, Matlow A (1995) - Improved
detection of Malassezia species in lipid-supplemented Peds Plus Blood
Culture Bottles; J Clin Microbiol; 33:1005-1007.
46. Peman J, Martin-Mazuelos E, Rubio Calvo M C (eds) (2001) - Guia
Practica de Identificacion y Diagnostico en Micologia Clinica; Rev
Iberoam Micol; Bilbao.
47. Percebois G (1973) - Introduction une etude des dermatophytes;
Socit dImpressions Typographiques; Nancy.
48. Pfaller M A, Messer S A, Boyken L et al.(2004) - Evaluation of the
NCCLS M44-P Disk Diffusion Method for Determining Susceptibilities of
276 Clinical Isolates of Cryptococcus neoformans to Fluconazole; J Clin
Microbiol; 42(1):380-383.
49. Randhawa H S, Chowdhary A, Sinha K P et al. (2006) - Evaluation of
peptone glucose fluconazole agar as a selective medium for rapid and
enhanced isolation of Aspergillus fumigatus from the respiratory tract of
Luminia Malic, Olimpia Bazgan, Mihai Mare


99
C
a
p
i
t
o
l
u
l

bronchopulmonary aspergillosis patients colonized by Candida albicans;


Med Mycol; 44(4):343-348.
50. Rousselle P, Freydiere A-M, Couillerot P J et al. (1994) - Rapid
identification of Candida albicans by using Albicans ID and Fluoroplate
agar plates; J Clin Microbiol; 32:3034-3036.
51. Segretain G, Drouhet E, Mariat F (1987) - Diagnostic de laboratoire en
micologie mdicale; Maloin; Paris.
52. Sheth C C, Johnson E, Baker E M et al. (2005) - Phenotypic identification
of Candida albicans by growth on chocolate agar; Med Mycol; 43(8):735-
738.
53. Sinski J T, Kelley L M, Reed G L (1975) - Pagano-Levin Candida test
medium; evaluation using vaginal samples; J Clin Microbiol; 1:206-211.
54. Slifkin M (2000) - Tween 80 opacity test responses of various Candida
species; J Clin Microbiol; 38(12):4626-4628.
55. Staib F, Arasth K (2000) - Chlamydospore formation on Staib Agar.
Observations made before Candida dubliniensis was described; Mycoses ;
44:23-27.
56. Staib F, Seibold M, Antweiler E et al. (1987) - The brown color effect
(BCE) of Cryptococcus neoformans in the diagnosis, control and
epidimiology of Cryptococcus neoformans infections in AIDS patiens;
Zentralbl Bakteriol Microbiol Hyg A; 266:167-177.
57. Staib P, Morschhauser J (1999) - Chlamidospore formation on Staib agar
as a species-specific characteristic of Candida dubliniensis; Mycoses;
45:521-524.
58. Stepanovi S, Vukovi D, Radonji I et al. (2002) - Ground red hot pepper
agar in the isolation and presumption identification of Cryptococcus
neoformans; Mycoses; 45:384-388.
59. Strachan A A, Yu R J, Blank F (1971) - Pigment production of
Cryptococcus neoformans grow with extracts of Guizotia abyssinica; Appl
Microbiol; 22:478-179.
60. Summerbell R C, Rosenthal A S, Kane J (1988) - Rapid method for
differentiation of Trichophyton rubrum, Trichophyton mentagrophytes,
and related dermatophyte species; J Clin Microbiol; 26(11): 2279-2282.
61. Waller J, Koenig H, Debruyne, Contant (1993) - Evaluation dun nouveau
milieu disolement des levures et de diagnostic rapide de Candida
albicans; Revue Franaise de Laboratoire; 252:89-92.
62. Warren N G, Hazen K C (1995) - Candida, Cryptococcus and other yeasts
of medical importance; In Muray P R, Baron E J, Pfaller M A et al. (eds) -
Manual of clinical microbiology; 6
nd
edition; American Society for
Microbiology; Washington D C; 723-737.
63. Willinger B, Hillowoth, Selitsch B (2001) - Performance of Candida ID, a
new chromogenic medium for presumptive identification of Candida
species, in comparison to CHROMagar Candida; J Clin Microbiol;
39:3793-3795.
Medii de cultivare

100
64. Willinger B, Manafi M, Selitsch B, Hillowoth C (1999) - Bewetung von
CHROMagar Candida zum schnellachweis von Candida - Arten aus
Klinischer Untersuchungsmaterial; Mycoses; 42:61-65.
65. Willinger B, Manafi, Rotter M L (1994) - Comparison of rapid methods
using flourogenic assays for detecting Candida albicans; Lett Appl
Microbiol; 18:47-49.
66. Yamane N, Saitoh Y (1985) - Isolation and detection of multiple yeasts
from a sigle clinical sample by use of Pagano-Levin agar medium; J Clin
Microbiol; 21:276-277.
67. * * * CLSI (2002) - Quality assurance for commercially prepared
microbiological culture media; Approved Standard: M22-A2; Villanova;
P.A.
68. * * * Subcommittee on Antifungal Susceptibility Testing (AFST) of the
ESCMID European Committee for Antimicrobial Susceptibility Testing
(EUCAST) (2002) - Method for the determination of minimum inhibitory
concentration (MIC) by broth diluation of fermentative yeasts (E. Dis.
7.1).
Mihai Mare, Olimpia Bazgan


101
C
a
p
i
t
o
l
u
l





Mihai Mare, Olimpia Bazgan

4.1. Tehnici uzuale

a regul general, nsmnarea prelevatelor se poate face prin mai multe
tehnici uzuale:
- epuizare pe medii solide condiionate fie n plci Petri, fie n tuburi (n pant)
asigur separarea fungilor cu semnificaie clinic de cei contaminani i inhib
prin diluare eventualele substane antimicrobiene cu rol antifungic;
- etalare n puncte izolate prin spotare: la unele prelevate paucibacilare sub
form de lichide organice LCR, pasaje din hemoculturi (fig. nr. 4-1 vezi
Anexa), sedimente, fragmente de esut i prin nepare: la fire de pr, scuame,
diverse raclate;
- nglobare n medii solide pretopite i rcite la 45C: la fire de pr, fragmente
unghiale, scuame.

n timpul nsmnrilor se va ine seama de urmtoarele reguli:
- nsmnrile se vor executa n boxe sau hote speciale, care se pot steriliza
periodic i nu permit formarea de cureni de aer n timpul lucrului.
nsmnarea prelevatelor provenite din situsuri normal sterile se va face
preferabil sub protecia unei hote microbiologice clas 2, pentru a preveni
eventuala lor contaminare cu spori fungici ambientali.
- Se evit conversaia i orice micare n jurul operatorului;
- Instrumentul utilizat la nsmnare (ans microbiologic, ac de nsmnare,
pipet etc.) nu se va atinge de obiecte nesterilizate (halat, mas de lucru );
- nsmnrile se vor executa ntr-un timp scurt, pentru a reduce la minim
contactul materialului de nsmnat cu atmosfera ambiant;
- n timpul ct tuburile de cultur sunt deschise, vor fi inute ntr-o poziie oblic,
ct mai aproape de orinzontalitate i cu deschiderea n imediata apropiere a
flcrii becului de gaz;
- Operatorul trebuie s poarte masc de protecie;
- Tuburile i plcile Petri nsmnate se noteaz cu markerul, fr a omite numrul
probei, denumirea abreviat a mediului de cultivare i data nsmnrii.

C
4
Tehnici de nsmnare i transplantare
Tehnici de nsmnare i transplantare

102
nsmnarea se execut n faa flcrii unui bec de gaz care asigur condiii de
antisepsie n timpul aciunii. n micologia medical, produsele patologice se
nsmneaz n mod similar cu cel din bacteriologie. Acul de nsmnare / ansa se
flambeaz i se rcete n ser fiziologic sterilizat, apoi se ia un fragment de produs
patologic ce ader de ac i se depune pe suprafaa mediului de cultur. Din aceeai
prob, se nsmneaz mai multe plci sau tuburi, n puncte separate, cte 3 4
fragmente de cercetat.
Culturile se examineaz zilnic, urmrindu-se aspectul macroscopic (suprafaa,
relieful, culoarea, prezena pigmentrii, consistena i viteza creterii). n timpul
dezvoltrii, coloniile i schimb aspectele macroscopice. Aspectele coloniilor se
noteaz periodic, pentru a surprinde toate caracterele culturale. Paralel se face i
examenul morfologic al fragmentelor de colonii.
ansele de izolare a fungilor cu semnificaie clinic cresc direct proporional
cu numrul probelor nsmnate. Temperatura de incubare dup nsmnare este de
36-37C pentru prelevatele interne / profunde i de 30C pentru cele superficiale.
Atenie! Fragmentele biopsice recoltate din leziuni suspecte de zygomicoz nu
se omogenizeaz cu diluant prin mojarare sau fragmentare, deoarece se distruge
miceliul i cultura va fi fals negativ. Temperatura de incubare recomandat este
37C.
Pentru izolarea levurilor, nsmnarea prelevatelor se face pe Agar Sabouraud
aditivat cu cloramfenicol. Acest mediu permite o bun dezvoltare a levurilor i
supreseaz multiplicarea eventualelor bacterii contaminante. Pentru levurile lipo-
dependente ale genului Malassezia, cultivarea prelevatelor se face fie pe Agarul
Sabouraud cu cloramfenicol pe suprafaa cruia s-a etalat prin striere o fin pelicul de
ulei de msline sterilizat prin autoclavare, fie pe medii speciale (Dixon, Leeming). Pe
Agar Sabouraud cu cloramfenicol, culturile mixte aprute prin asocierea a dou sau
mai multe specii de levuri sunt uneori dificil de observat, de aceea ideal ar fi ca
nsmnarea prelevatelor s se fac pe un mediu diferenial cromogen, care pe lng
discriminarea ntre speciile levurice poate aduce informaii eseniale pentru
identificarea agentului etiologic. Se realizeaz astfel ntr-o singur etap, att izolarea,
ct i identificarea levurii / levurilor incriminate. Pe mediile de izolare, levurile de
interes medical se dezvolt n 24-72 ore de incubare. n funcie de proveniena
prelevatului se va face i alegerea temperaturii de incubare. Pentru prelevatele
provenind din situsuri n care n mod normal temperatura este identic cu cea a
organismului, se va alege temperatura de 37C pentru incubare. n cazul celor
provenind de la nivelul tegumentului sau unghiilor, incubarea se va face att la 37C,
ct i la 30C, deoarece unele levuri cultivabile la 30C dar necultivabile la 37C, pot
avea semnificaie clinic fiind cauza unor micoze superficiale.
n cazul dermatofitozelor, se recomand ca primocultura s se efectueze n
plci Petri i nu n tuburi, deoarece att nsmnarea ct i manoperele ulterioare sunt
mult facilitate. Mediul de elecie pentru izolarea dermatofiilor este Agarul Mycobiotic
(Agar Sabouraud aditivat cu cloramfenicol i cicloheximid); prezena
cloramfenicolului suprim dezvoltarea bacteriilor care pot contamina prelevatul, iar
cicloheximida (Actidione) inhib multiplicarea fungilor contaminani, facilitnd
izolarea dermatofiilor. Materialul patologic se nsmneaz n mai multe puncte
pentru a crete probabilitatea izolrii dermatofiilor i a putea acorda semnificaie
Mihai Mare, Olimpia Bazgan


103
C
a
p
i
t
o
l
u
l

clinic tulpinii izolate. Cu ct numrul punctelor de nsmnare pozitivate este mai


mare, cu att implicarea clinic a tulpinii izolate este mai sigur. Este posibil i
nsmnarea prin nglobarea prelevatului n mediul de cultur, ns interpretarea
semnificaiei clinice devine mai dificil. Incubarea se realizeaz la 25-30C, timp de
cca. 4 sptmni. Cnd se suspicioneaz o infecie cu T. verrucosum, plcile se vor
incuba la 37C (cretere accelerat). n cazul absenei sporulrii n primocultur,
tulpinile se pot pasa pe medii speciale care favorizeaz producerea macroconidiilor i
pigmentogeneza: mediul Lactrimel (Borelli), PDA, agar pepton 3%. Se recomand
observarea culturilor de 2 ori / sptmn pentru a surprinde n dinamic aspectele
caracteristice coloniilor de dermatofii. Importante din punct de vedere diagnostic sunt
viteza de cretere, caracterele morfologice macro- i microscopice. La unele specii de
dermatofii apar aa-numitele formaiuni ornamentale care reprezint de fapt hife cu
aspect modificat, al cror rol nu este nc elucidat: hife n rachet sau cu aspect de
tij de bambus, candelabre favice, hife spiralate (vrile), celule osiforme (aspect de
ganter), organe nodulare, hife pectinate.

4.2. Tehnici speciale

4.2.1. Tehnica de purificare a izolatelor levurice

Dup obinerea primoculturii, se va verifica obligatoriu puritatea acesteia
deoarece contaminarea bacterian este indezirabil n aciunea ulterioar de identificare
a speciei. n acest scop, se pregtesc fie preparate ntre lam i lamel, fie frotiuri
colorate Gram care se examineaz la microscop, cu obiectivul de imersie. n cazul
prezenei bacteriilor, se recurge la pasarea tulpinii n bulion Sabouraud aditivat cu acid
clorhidric soluie 1N, conform schemei prezentate n fig. nr. 4-2.
Dup incubare i reverificare prin coloraia Gram, se epuizeaz 0,1 ml din
tubul cu numrul maxim de picturi de HCl care a permis dezvoltarea levurilor, pe
suprafaa unui Agar Sabouraud cu cloramfenicol n vederea obinerii coloniilor
purificate.

Tehnici de nsmnare i transplantare

104



Fig. nr. 4-2. Purificarea izolatelor levurice metodologie de lucru




Mihai Mare, Olimpia Bazgan


105
C
a
p
i
t
o
l
u
l


4.2.2. Tehnica nsmnrii levurilor pe Agarul cu fin de porumb i tween 80
(metoda Dalmau)

Prin cultivare submers pe acest mediu, levurile i exprim plenar toate
detaliile morfologice: blastospori, pseudohife (pseudofilamente), filamente (hife),
clamidospori, artrospori, ascospori. n funcie de gen i specie, aceste formaiuni apar
sau nu i prezint anumite caracteristici utile identificrii. Rezultatele acestui test pot fi
doar rareori utilizate singular; de obicei, ele se coroboreaz obligatoriu cu rezultatele
profilului biochimic al tulpinii n cauz (fermentarea zaharurilor, asimilarea diverselor
surse de carbon sau azot, producerea unor enzime ca ureaza, fenol-oxidaza,
hexozaminidaza, L-prolin-aminopeptidaza, catalaza.
Tehnica de lucru: se pregtesc plci Petri cu o grosime a mediului de 4-5 mm
(cca. 25-30 ml mediu / plac cu 90 mm); dup solidificare, cu ajutorul ansei
microbiologice cu care s-a prelevat n prealabil o mic poriune din colonia levurii de
identificat, se practic 3 incizii ale mediului, dup cum urmeaz: primele dou
paralele ntre ele, la distan de cca. 1-1,5 cm, apoi o aIIIa perpendicular pe celelalte
(fig. nr. 4-3). n timpul nsmnrii mediului, ansa se menine nclinat sub o inciden
de cca. 60-70 fa de orizontal. Poriunea de agar astfel nsmnat se acoper cu o
lamel sterilizat. Dup o incubare de 48-72-96 ore la 25C-30C, placa Petri se
examineaz direct la microscop, formaiunile dezvoltate n mediu fiind observabile
prin traversul lamelei. Alternativ, dup nsmnare, mediul nu se acoper cu lamel,
iar pentru examinare se preleveaz cu ajutorul ansei un bloc de geloz de pe linia de
nsmnare i se etaleaz prin strivire ntre lam i lamel. Se examineaz apoi la
microscop, fr colorare suplimentar, urmrindu-se prezena clamidosporilor, forma i
mrimea pseudohifelor, modul de dispunere a blastosporilor (blastoconidiilor) de-a
lungul acestora.



Fig. nr. 4-3. Tehnica nsmnrii levurilor pe CMA (cultivare submers).


4.2.3. Tehnica de cultivare pe suporturi transparente

Metoda const n plasarea unei lamele sterilizate pe suprafaa gelozei, foarte
aproape de colonia activ. Miceliul va crete peste lamel, care la un anumit interval de
timp poate fi ridicat i examinat la microscop.
Tehnici de nsmnare i transplantare

106
n locul lamelelor se pot folosi ptrate de celofan de mrimea lamelelor,
sterilizate prin autoclavare. Inoculul se depune n mijlocul ptratului de celofan, iar
dup dezvoltarea miceliului, pelicula de celofan se monteaz pe lam i se examineaz
la microscop.

4.2.4. Tehnica de cultivare n pictur suspendat

Inele de sticl cu diametrul de 2 cm i nlimea de 1 cm se imerseaz n
parafin topit i imediat se aeaz pe o lam de sticl sterilizat. n interiorul inelului
de sticl se pune o pictur de ap distilat sterilizat. Lamela de sticl se flambeaz i
n zona central se depune o pictur de bulion Sabouraud, n care se nsmneaz
materialul de cercetat. Marginea superioar a inelului de sticl se greseaz cu lanolin,
se trece prin flacr pentru sterilizare i se aplic apoi lamela cu pictura nsmnat
n jos.
Lamela se examineaz la microscop dup cteva zile de incubaie.

4.2.5. Tehnica de cultivare pe bloc de geloz (cultivarea pe lam)

Cultura pe bloc de geloz (pe lam) este recomandat pentru studierea n
dinamic a morfologiei structurilor de fructificare (generatoare de conidii) la fungii
filamenoi septai (nu ns la cei din genurile Aspergillus i Penicillium). n acest scop,
fungul de identificat se nsmneaz n dou puncte opuse ale unui bloc de geloz
(PDA) de 1 x 1 x 0,5 cm etalat pe o lam de sticl. Dup nsmnare, acesta se
acoper cu o lamel, iar lama se aeaz pe o baghet de sticl n form de U plasat
ntr-o camer umed (de fapt, o plac Petri ce conine un fragment de hrtie de filtru
umectat cu cca. 5 ml ap distilat). Camera umed (fig. nr. 4-4) se incubeaz la 25-
30C, un timp variabil, pn la apariia pe lam a structurilor de fructificare cu
morfologie caracteristic, fapt constatat n urma examinrii microscopice. n final,
blocul de geloz se ndeprteaz, iar din lam, respectiv lamel, se obin prin adugare
de lactofenol i montare, dou preparate extemporanee. Aceste dou preparate obinute
se pot pstra, dac vor fi lutate, timp de aproximativ cinci ani.


Fig. nr. 4-4. Camer umed pentru cultivarea fungilor pe bloc de geloz.


Mihai Mare, Olimpia Bazgan


107
C
a
p
i
t
o
l
u
l



4.3. Tehnici de transplantare

Prin transplantri sau pasaje se urmrete izolarea n stare pur a fungilor de
interes medical din culturile mixte sau meninerea lor n timp, n condiii de laborator
(tulpini de colecie) i obinerea de colonii monosporale.
Din culturile pe medii lichide, recoltarea materialului de transplantat se poate
face cu pipeta Pasteur sau cu ansa de nsmnare. Cu pipeta Pasteur se recolteaz o
cantitate din cultura veche, din care se nsmneaz cteva picturi n mediul lichid i
cteva picturi pe suprafaa mediului solid. n cazul transplantrii cu ansa, se introduce
ansa sterilizat n cultura veche, apoi se face nsmnarea pe mediile proaspete (nti
pe mediul lichid i apoi n trei puncte pe mediul solid).
Din culturile pe medii solide, transplantarea se face cu ansa sau cu o
microspatul, lund o cantitate redus de miceliu de la periferia coloniei vechi. Acest
material biologic se transfer pe bulion i pe un mediu agarizat (Agar Sabouraud, PDA,
Agar Czapek Dox, Agar cu extract de mal etc.).





























Tehnici de nsmnare i transplantare

108


Bibliografie selectiv

1. Bazgan O (1999) - Diagnostic de laborator i igiena alimentelor de
origine animal; Ed. Moldogrup; Iai.
2. Buiuc D, Negu M (1999) - Tratat de microbiologie clinic; Ed. Medical;
Bucureti.
3. Coman I, Mare M (2000) - Micologie medical aplicat; Ed. Junimea;
Iai.
4. Constantinescu O (1974) - Metode i tehnici n micologie; Ed. Ceres;
Bucureti.
5. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed.
Viaa Medical Romneasc; Bucureti.
6. Grillot R (1996) - Les mycoses humaines dmarche diagnostique;
Elsevier; Paris.
7. Guho E, Midgley G, Guillot J (1996) - The genus Malassezia with
description of four new species; Antonie van Leeuwenhoek; 69:337-355.
8. Hoog G S de, Guarro J, Gen J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
9. Ribes J A, Vanover-Sams C L, Baker D J (2000) - Zygomycetes in Human
Disease; Col Rev; 2(13):236-301.
10. Ribes J A, Vanover-Sams C L, Baker D J (2000) Zygomycetes in Human
Disease; Col Rev ; vol. 13(2): 236-301.




Mihai Mare, Olimpia Bazgan


109
C
a
p
i
t
o
l
u
l














Mihai Mare, Olimpia Bazgan

xamenul microscopic al fragmentelor de colonii fungice urmrete:

- Aspectul hifelor - septate sau nu;
- Aspectul miceliului - difuz, gros, colorat, incolor;
- Prezena i tipul sporilor sexuai - zigospori, ascospori;
- Prezena corpilor fructificani asexuai (tipul i aspectul sistemului sporal,
aranjarea (mbinarea) conidioforilor i a sporangioforilor, forma, culoarea,
mrimea i eventuala septare a sporului;
- Prezena i tipul unor structuri particulare: rizoizi, stoloni, scleroi, celule Hlle.
Pentru studiul morfologiei microscopice a fungilor obinui n urma
nsmnrii prelevatelor se utilizeaz mai multe tehnici, n funcie de tipul acestora:
- levuri - frotiuri (colorate Gram, cu albastru de metilen etc.) sau preparate
extemporanee (ntre lam i lamel) cu tu de India sau lactofenol i albastru
de anilin;
- fungi filamentoi preparate extemporanee cu lactofenol i albastru de anilin,
preparate cu band adeziv sau preparate obinute prin cultivare pe lam.

5.1. Preparatul extemporaneu cu lactofenol i albastru de anilin (levuri)

Este o metod mai rar utilizat pentru studierea morfologiei levurilor, ns este
uneori preferat pentru expeditivitatea sa, mai ales n cazul levurilor din primoculturi.
n acest scop, pe o lam de microscopie curat i degresat, se depune o pictur de
lactofenol cu albastru de anilin n care se va suspensiona apoi cu micri ct mai fine,
cu ajutorul unei anse microbiologice, o mic poriune din colonia levuric de studiat.
Suspensia astfel obinut se acoper cu o lamel i se examineaz la microscop (x10,
x20, x40, x100 dup caz). Pentru reuita preparatului, este important cantitatea de
material biologic prelevat din colonie; aceasta trebuie s fie cat mai redus, astfel nct
densitatea suspensiei obinute s fie mic.



E
5
Tehnici de examinare microscopic
a fungilor din culturi
Tehnici de examinare microscopic a fungilor din culturi


110

5.2. Preparatul extemporaneu cu lactofenol i albastru de anilin
(fungi filamentoi)

Se obine parcurgnd urmtoarele etape:
- se depune o pictur de lactofenol pe o lam de microscopie, curat i degresat;
- se preleveaz cu ajutorul unui ac sau al unei microspatule metalice un fragment
de dimensiuni milimetrice din colonia de examinat, se etaleaz n pictura de
lactofenol i se dilacereaz cu micri fine miceliul, utiliznd dou ace;
- se acoper cu o lamel curat, se preseaz, se nclzete uor la flacr pentru a
obine un film ct mai fin de lactofenol i a elimina eventualele bule de gaz;
- se examineaz la microscop, folosind succesiv obiectivele x10, x20, x40,
eventual x100;
- n cazul n care se dorete pstrarea preparatului n lamotec, pentru conservarea
sa, acesta se poate luta (fig. nr. 5-1 vezi Anexa).

5.3. Preparatul extemporaneu cu band adeziv

n acest caz, prelevarea structurilor fungice de la nivelul coloniilor se face cu
ajutorul unui fragment de band adeziv transparent (tip scotch), cu dimensiuni de
1,0-1,5 x 2,5-3,0 cm, cu care se amprenteaz marginea coloniei. Acest fragment de
band adeziv se lipete apoi pe o lam pe care s-a etalat n prealabil o pictur de
lactofenol (fig. nr. 5-2). Opional, peste band se pot etala o nou pictur de lactofenol
i apoi o lamel, n vederea ameliorrii vizibilitii la examinarea microscopic
ulterioar. n cazul coloniilor care sporuleaz intens (Aspergillus spp., Penicillium spp.
etc.) se recomand pregtirea a 2-3 preparate cu band adeziv din acelai loc prima
va fixa sporii, iar urmtoarele vor recolta conidioforii, astfel nct prin examinarea
ulterioar s fie surprinse toate aspectele utile ncadrrii taxonomice.


Fig. nr. 5-2. Obinerea preparatului extemporaneu cu band adeziv

180
scotch
lam
lamel
Mihai Mare, Olimpia Bazgan


111
C
a
p
i
t
o
l
u
l


O alt variant a tehnicii presupune etalarea fragmentului de band adeziv pe
o lamel cu o pictur de lactofenol, adugarea peste aceasta a unei alte picturi de
colorant i apoi a lamei de microscopie. Preparatul se rotete apoi cu 180 pentru a-l
aduce n poziia de examinare. Prin acest procedeu, claritatea imaginii este maxim
datorit faptului c ntre ochiul examinatorului i structurile fungice se interpune doar
lamela, nu i banda scotch ca n tehnicile anterioare.

5.4. Lutarea preparatelor extemporanee

Etanarea sau lutarea preparatelor este necesar pentru a evita evaporarea
lichidului de montare. Suprafeele lamei i lamelei, pe care se aplic substanele de
etanare, trebuie s fie perfect uscate i curate. Substanele folosite la etanare nu
trebuie s reacioneze cu lichidul de montare, s fie impermeabile, elastice, persisente
i s adere de suprafaa sticlei.

Rinile naturale
Se pot folosi pentru lutare colofoniul, guma arabic, erlacul, balsamul de
Canada.

Lacul pentru unghii este cel mai utilizat la etanarea preparatelor deoarece se
usuc repede i se manipuleaz uor. Se ndeprteaz excesul de lichid de montare de
pe lam i lamel, prin tergere cu un fragment de hrtie de filtru. Cu un penson se
aplic un strat subire de lac peste marginea lamelei i suprafaa lamei din imediata
apropiere a acesteia. Se las s se usuce, apoi se poate stoca.

Cimentul Thorner, cunoscut sub denumirea de Glyceel este format din:
- ulei polimerizat .......................... 31,75 ml
- alcool metilic industrial ................ 4,76 ml
- acetat de butil ............................. 20,41 ml
- toluen (fr sulf) ......................... 20,41 ml
Glyceelul este un lichid siropos, incolor, se usuc repede, formnd o pelicul
elastic, rezistent i care ader bine de sticl.

Amestecul de cear galben de albine i colofoniu
20 g cear de albine se topesc ntr-o capsul de porelan, apoi se adaug treptat
80 g colofoniu i se nclzesc pn la topirea complet. Amestecul se aplic cu o
spatul pe marginile lamei i lamelei montate. nainte de fiecare folosire, amestecul se
retopete.

Amestecul de colofoniu i lanolin (60%, respectiv 40%)
Se omogenizeaz prin topire, apoi se distribuie n plci Petri i se las la
solidificare. n momentul folosirii, se lichefiaz cu ajutorul aplicatorului nclzit la
flacr. Se folosete similar cu celelalte lichide de lutare.


Tehnici de examinare microscopic a fungilor din culturi


112
Bibliografie selectiv

1. Bazgan O (1999) - Diagnostic de laborator i igiena alimentelor de
origine animal; Ed. Moldogrup; Iai.
2. Buiuc D, Negu M (1999) - Tratat de microbiologie clinic; Ed. Medical;
Bucureti.
3. Coman I, Mare M (2000) - Micologie medical aplicat; Ed. Junimea;
Iai.
4. Constantinescu O (1974) - Metode i tehnici n micologie; Ed. Ceres;
Bucureti.
5. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed.
Viaa Medical Romneasc; Bucureti.
6. Harris J (2000) - Safe, low-distortion tape touch method for fungal
mounts; J Clin Microbiol; 38(12):4683-4684.
7. Hoog G S de, Guarro J, Gen J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.





























Petru Cazacu


113
C
a
p
i
t
o
l
u
l




Petru Cazacu

ragmentele de esut recoltate de la pacient n vederea diagnosticului trebuie
procesate n laboratorul de histopatologie pentru a obine preparate
permanente care vor fi examinate microscopic de ctre morfopatolog. Fragmentele de
esut pot fi recoltate prin biopsie, prin exerez chirurgical i prin autopsie. Procesarea
esuturilor n vederea diagnosticului histopatologic presupune o suit de operaiuni i
tehnici care vor permite vizualizarea elementelor fungice intratisulare i / sau a
leziunilor specifice determinate de acestea.

6.1. Obinerea probelor

Probele de esut primite n laboratorul de histopatologie trebuie s fie nsoite
de un formular de cerere a examenului de laborator n care vor fi specificate datele
pacientului i istoricul bolii, precum i descrierea zonei de origine a fragmentului de
esut. Probelor primite li se va atribui un numr care va identifica fiecare prob pentru
fiecare pacient. Acest numr va corespunde cu numrul de ordine din registrul
laboratorului.

6.2. Examenul macroscopic

Examinarea macroscopic const n descrierea probelor, alegerea zonelor
relevante pentru diagnostic i introducerea lor (total sau parial) n mici casete din
plastic, unde vor sta pe toat durata procesrii iniiale, pn n momentul includerii n
parafin. Iniial, casetele sunt plasate ntr-un fixator.

6.3. Fixarea

Fixarea are scopul de a conserva morfologia esuturilor aa cum se prezint ea
n momentul recoltrii. Fixarea trebuie realizat ct mai curnd posibil dup prelevarea
probelor de esut pentru a preveni autoliza. Nu exist un fixator perfect, dei
formaldehida este considerat aproape un gold standard. Exist o varietate de
fixatori, care se vor folosi n funcie de tipul de esut.

F
6
Tehnici de histopatologie
Tehnici de histopatologie


114
Factorii care influeneaz procesul fixrii:
-soluia-tampon;
-penetrarea;
-volumul piesei vs. volumul fixatorului;
-temperatura;
-concentraia fixatorului;
-intervalul de timp.

Fixarea trebuie realizat la un pH aproape de neutralitate, adic ntre 6 i 8.
Datorit hipoxiei esuturilor, fixatorul trebuie s aib capacitatea de a tampona
aciditatea acestora prevenind dehiscena lizozomal i autoliza tisular consecutiv
acesteia. Aciditatea favorizeaz formarea de pigment hem - formol care apare colorat
n negru, prin depuneri polarizate n esuturi. Soluiile-tampon includ fosfatul de sodiu,
bicarbonatul de sodiu, cocodilatul de sodiu i veronalul. Formolul comercial este o
soluie de formaldehid n tampon fosfat cu pH 7.
Penetrarea esuturilor depinde de difuzibilitatea fiecrui fixator. Formolul i
alcoolul penetreaz foarte bine, iar glutaraldehida foarte prost. Ceilali fixatori au un
grad intermediar de penetrabilitate tisular. O posibilitate de a rezolva acest
inconvenient este secionarea ct mai fin a esuturilor (2-3 mm grosime), deoarece
penetrarea unei seciuni subiri va fi mult mai rapid dect cea a unei seciuni mai
groase.
Volumul de fixator este de asemenea extrem de important. Acesta trebuie s fie
n raport de 10:1 (fixator-esut). Se recomand schimbarea fixatorului la diferite
intervale de timp pentru a evita o eventual scdere a volumului acestuia. Agitarea
probelor n fixator va intensifica fixarea.
Creterea temperaturii, ca n cazul tuturor reaciilor chimice, va crete viteza de
fixare, dar se va avea totui n vedere s nu degradeze esuturile. Formolul fierbinte va
fixa esuturile mai repede i acesta este adesea primul pas n procesarea automatizat a
esuturilor.
Concentraia fixatorului va fi cea mai redus concentraie activ, acest fapt
reprezentnd i un avantaj economic. Formolul este cel mai activ la 10%;
glutaraldehida este n general activ la concentraii de 0,25-4%. Concentraiile prea
ridicate pot avea efect advers asupra esuturilor producnd artefacte asemntoare cu
cele ale creterii temperaturii fixatorului.
De asemenea, foarte important este intervalul de timp recomandat pentru
meninerea probelor n afara fixatorului. Dup fixare, probele vor fi prelucrate rapid
deoarece prin deshidratare se vor produce artefacte. esuturile meninute temporar n
afara vasului cu fixator, se vor umezi cu ser fiziologic.
Tipul fixatorului indicat este dat de tipul de esut i de detaliile histologice care
urmeaz a fi vizualizate. Formolul este utilizat pentru toate esuturile recoltate
chirurgical i necropsic, cnd se dorete obinerea unor preparate colorate H-E.
Formolul este cel mai puin pretenios dintre toi fixatorii atunci cnd condiiile de
fixare nu sunt cele ideale, el dunnd aproape neglijabil esutului respectiv. Pentru
fixarea esuturilor n vederea procesrii lor pentru diagnosticul histopatologic al
micozelor profunde se folosesc frecvent urmtorii fixatori: soluia de formol 10%
tamponat pH 6,8, fixatorul Bouin i fixatorul Hollande. Pentru fixarea frotiurilor
Petru Cazacu


115
C
a
p
i
t
o
l
u
l

citologice cu importan n diagnosticul micologic se folosesc: metanolul absolut,


etanolul 90% i acidul cromic 5%. Alcoolii sunt fixatori rapizi i ieftini. Deoarece
frotiurile nu sunt groase, acestea nu pun probleme de contractare i ntruct frotiurile
nu sunt seciuni, acestea nu prezint inconvenientul friabilitii. Alcoolii nu se
recomand pentru fixarea frotiurilor obinute din fluide biologice sau patologice.
Alturi de imersie, fixarea frotiurilor se poate realiza i prin pulverizarea
fixatorului peste frotiu. Fixatorii care se pulverizeaz sunt compui dintr-un alcool care
fixeaz celulele i parafin care formeaz un strat protector subire peste acestea
(Carbowax - conine polietilenglicol). Fixativii de pr (e.g. Diaphine Spray), cu un
coninut ridicat de alcool i un minimum de lanolin sau ulei, sunt de asemenea fixatori
eficace. Distana optim de pulverizare a fixatorilor este de 25-30 cm. Fixarea cu
fixatori aerosolizabili nu este recomandat pentru frotiurile de snge sau a celor
executate din lichide hemoragice pentru c determin clumping eritrocitar (aglutinare).
Parafinele i uleiurile din spray-urile fixative de pr modific reaciile de colorare dac
nu sunt ndeprtate adecvat. Astfel, naintea colorrii, lamele trebuie meninute peste
noapte n etanol 95% pentru a ndeprta fixatorul de acoperire.

6.3.1. Formol soluie 10% tamponat pH 6,8

Scop
Este un fixator larg utilizat, cu pH 6,8

Reactivi

Fosfat de sodiu monobazic ........................... 4,0 mg
Fosfat de sodiu dibazic ................................. 6,5 mg
Formaldehid 37% ..................................... 100,0 ml
Ap distilat ............................................... 900,0 ml

Se omogenizeaz, apoi se eticheteaz i se dateaz.
Atenie! Carcinogen.

Timpul de fixare
Fragmentele biopsice ar trebui fixate timp de minim 1-4 ore. Un timp mai
ndelungat se recomand pentru piesele mai mari.

Tehnica fixrii
1. Piesele recoltate de chirurgi sunt pstrate n acest tip de fixator;
2. Primele dou staii ale tuturor procesatoarelor de esuturi conin formol 10%;
3. Probele pot fi pstrate n formol 10% indefinit sau sunt transferate n etanol
70%.

Note:
1. Se lucreaz ntr-un spaiu ventilat. Se vor purta ochelari de protecie, mnui i halat.
2. Formaldehida este puternic iritant pentru ochi i piele. Este sensibilizant (prin
contact) pentru piele i aparatul respirator. Este toxic prin ingestie i inhalare. Are
Tehnici de histopatologie


116
aciune coroziv i carcinogen. Se eticheteaz cu inscripia: ATENIE
FORMALDEHID!

6.3.2. Fixatorul Bouin

Scop
Se utilizeaz pentru fixarea pieselor biopsice; de asemenea este un mordantant
n diferite tehnici de colorare.

Reactivi

Acid picric saturat .................................... 3000,0 ml
Formaldehid ........................................... 1000,0 ml
Acid acetic glacial ..................................... 200,0 ml

Atenie! Soluia este carcinogen, iritant i toxic.

Timpul de fixare
Probele biopsice de dimensiuni mici, 2-4 ore, iar probele de dimensiuni mari
pot rmne n fixator pn la trei zile.

Tehnica fixrii
1. esuturile fixate pot rmne n formol 10% sau etanol 70%;
2. Se ndeprteaz acidul picric din esut nainte de colorare prin:
a) splare cu ap de robinet;
b) tratare cu etanol 50%;
c) sau soluie saturat de etanol 70% cu carbonat de litiu.

Note:
1. Se lucreaz n spaii bine ventilate, se vor purta mnui, halat i ochelari de protecie.
Se evit contactul i inhalarea.
2. Acidul picric poate deveni exploziv dac se usuc. Este toxic de contact.
3. Formaldehida este puternic iritant pentru ochi i piele. Este sensibilizant prin contact,
pentru piele i aparatul respirator. Este toxic prin ingestie i inhalare. Are aciune
coroziv i carcinogen. Se eticheteaz cu inscripia: ATENIE FORMALDEHID!
4. Acidul acetic: aparatul respirator este organul int afectat. Este coroziv.

6.3.3. Fixatorul Hollande

Scop
Acest fixator confer o strlucire coloraiilor care utilizeaz hematoxilin -
eozin i reduce consistena esuturilor evitnd astfel obinerea unor seciuni casante.
Acidul picric lizeaz hematiile.




Petru Cazacu


117
C
a
p
i
t
o
l
u
l

Reactivi

Acetat de cupru .............................................. 75 mg
Ap distilat ................................................ 3000 ml
Acid picric ................................................... 120 mg
Formaldehid ................................................ 300 ml
Acid acetic glacial .......................................... 45 ml

Se dizolv acetatul de cupru n ap fr nclzire, apoi se adaug treptat acidul
picric. Se amestec pn se dizolv complet. Se adaug formaldehida i acidul acetic.
Se eticheteaz i se dateaz.
Atenie! Soluia este carcinogen, iritant i coroziv.

Timpul de fixare
Probele de dimensiuni mici 2-4 ore, iar cele mai mari pn la 3 zile.

Tehnica fixrii
1. Probele biopsice sunt imersate imediat n fixatorul Hollande, notndu-se timpul
pe recipient;
2. Cnd fixarea este complet, proba de esut se trece apoi n etanol 70%;
3. Nu se permite ca probele fixate cu Hollande s vin n contact cu soluia de
formol 10%, deoarece poate determina apariia unui precipitat albastru.

Note:
1. Se lucreaz ntr-un spaiu bine ventilat sau n nia chimic, se poart mnui, halat i
ochelari de protecie. Se evit contactul i inhalarea.
2. Acidul picric poate exploda dac se usuc. Este toxic prin expunere cutanat.
3. Formaldehida este iritant puternic pentru ochi i piele. Este toxic prin ingestie i
inhalare. Afecteaz aparatul respirator. Este coroziv i carcinogen. Se eticheteaz
cu: ATENIE FORMALDEHID !
4. Acidul acetic afecteaz aparatul respirator. Este coroziv.

6.4. Procesarea esuturilor

Odat ce esuturile au fost fixate, ele trebuie nglobate ntr-o form care s
permit manipularea i efectuarea unor seciuni seriate foarte subiri. Cel mai folosit
material n acest scop este parafina. esuturile incluse n parafin pot fi secionate n
fragmente cu grosimi de la 3 la 10 m, uzual 4-6 m. Tehnica de includere n parafin
a esuturilor fixate se numete Procesarea esuturilor. Paii principali ai acestui
proces sunt deshidratarea i clarificarea.
- esuturile fixate umed (n soluii apoase) nu pot fi direct impregnate cu parafin
deoarece aceasta nu este miscibil cu apa. De aceea, esuturile trebuie
deshidratate. Aceasta se realizeaz de obicei cu ajutorul unor soluii de etanol,
de concentraii crescnde - 70%, 95% i 100%. Uneori, primul pas este tratarea
cu un amestec format din formol i etanol. Pot fi utilizai i ali deshidratani,
dar unii prezint dezavantaje majore: acetona dei este foarte rapid, este
inflamabil, de aceea se poate utiliza doar pentru mici seturi de esuturi
Tehnici de histopatologie


118
procesate manual. Dioxanul poate fi utilizat fr clarificare, dar vaporii si sunt
toxici.
- Etapa urmtoare se numete Clarificare i const n ndeprtarea
deshidratantului cu o substan care va fi miscibil cu mediul de includere
(adic cu parafina). Xilenul este agentul de clarificare cel mai frecvent
ntrebuinat. Toluenul clarific bine i este mult mai tolerant fa de cantitile
mici de ap rmase n esuturi, dar este de 3 ori mai costisitor dect xilenul.
Cloroformul acioneaz lent i este periculos pentru cei care-l manipuleaz.
Salicilatul de metil este rar utilizat datorit costului ridicat.

n final, proba de esut este impregnat cu agentul de includere care aproape
ntotdeauna este parafina. Parafina poate avea diferite puncte de topire, ceea ce permite
obinerea unor grade variate de duritate. Un produs numit Paraplast conine un adaos
de plastifiani care fac ca blocurile de parafin s fie mai uor de procesat de ctre
tehnologi n vederea secionrii. Pentru a asigura o mai bun penetrare a esutului de
ctre agentul de includere, n interiorul procesatorului de esuturi se poate crea o
presiune negativ cu ajutorul unei pompe de vacuum.
Procedurile de mai sus sunt aproape ntotdeauna automatizate pentru un volum
mare de probe ce trebuie procesate de rutin. Automatizarea const ntr-un dispozitiv
circular, programabil, care imerseaz succesiv probele de esut n diferite bi de
deshidratare i clarificare, dup o scal de timp presetat.
Dup procesarea probelor n procesatorul de esuturi, acestea sunt nc n
casete, urmnd a fi incluse n parafin lichid. Procesul este foarte important deoarece
esuturile trebuie orientate corespunztor n momentul includerii pentru a asigura
obinerea ulterioar a unor seciuni de calitate. O alternativ pentru includerea n
parafin este folosirea diverselor mase plastice care permit obinerea unor seciuni
subiri. Astfel de mase plastice sunt meta-acrilatul de metil, meta-acrilatul glicol i
eponul. Materialele plastice necesit reactivi speciali pentru deshidratare i clarificare,
de obicei foarte costisitori. Pentru secionarea acestor blocuri este necesar un microtom
special. Blocurile trebuie s fie mici, tehnica pretndu-se de exemplu pentru biopsiile
hepatice sau cerebrale.

6.4.1. Deshidratarea

1. Dac piesa de esut a fost imersat n ap dup scoaterea din fixator, ea trebuie
s fie transferat n etanol 30%, 1-2 ore;
2. Etanol 50%, 1-2 ore;
3. Etanol 70%, 1-2 ore;
4. Etanol 95%, 1-2 ore;
5. Etanol 100%, 1-2 ore;
6. Etanol 100%, 1-2 ore;
7. esuturile deshidratate vor fi pregtite pentru clarificare, adic se scot piesele
histologice din etanol i se trec n toluen.

Not: Etanolul absolut produce o deshidratare foarte rapid a esuturilor: pentru a avea
aceast siguran, flacoanele cu etanol se vor pstra nchise etan.
Petru Cazacu


119
C
a
p
i
t
o
l
u
l

6.4.2. Clarificarea

1. Se transfer piesele histologice din etanol 100% ntr-un amestec constituit din o
parte toluen i 3 pri etanol 100%, 1 or;
2. Se trec apoi n amestecul de 1:1 toluen-etanol 100%, 1 or;
3. Apoi n amestecul de 3:1 toluen-etanol 100%, 1 or;
4. Toluen 100%, 3-4 ore;
5. Toluen 100%, 3-4 ore;
6. Dup clarificare, esuturile sunt gata pentru impregnare cu parafin.

Not:
Agenii de clarificare, cum ar fi etanolul, trebuie introdui lent pentru a preveni
degradarea esuturilor. Aceste amestecuri de toluen i etanol permit n plus i ndeprtarea
oricror urme de ap. Flacoanele se nchid etan. Apariia unei turbiditi a soluiilor sau a
unor pete opace pe esuturi sunt indicatori siguri ai deshidratrii incomplete. n ambele cazuri,
lamele cu seciuni se reintroduc n etanol 100% pentru o deshidratare suplimentar, apoi se
continu cu bile de toluen - etanol. Insuficienta ndeprtare a alcoolului va determina
imposibilitatea impregnrii cu parafin n zonele respective ale esutului, ceea ce va produce
dificulti de secionare. Actualmente, exist numeroi ageni de clarificare disponibili
comercial (Histosolve, Americlear etc.) care sunt mai puin toxici i au un miros mai plcut
dect toluenul sau xilenul.

6.4.3. Impregnarea cu parafin

1. Se transfer esuturile din agentul de clarificare ntr-un nou flacon cu un amestec
prenclzit de parafin - toluen 1:2. Se acoper etan flaconul i se las la
etuv, la 45C, timp de 1 or;
2. Se transfer esuturile ntr-un al doilea flacon care conine un amestec nclzit de
parafin - toluen 1:2. Se acoper flaconul i se meine la 45C timp de 1 or;
3. Se transfer piesele apoi n prima baie de parafin pur. Aceasta este un flacon
cu parafin lichid care se menine n etuv setnd o temperatur superioar
punctului de topire al parafinei. Piesele se menin n aceast baie timp de 2-4
ore;
4. Se transfer piesele n a doua baie de parafin, unde se menin nc 2-4 ore;
5. Se includ (pasul urmtor).

Not:
O alternativ a metodei de impregnare:
1. Se introduce piesa histologic n agentul clarificator proaspt i apoi se adaug
parafin pn la saturarea clarificatorului. Se las n repaus 1 or la 30C 60C,
apoi se mai adaug parafin i se las peste noapte. n dimineaa urmtoare, se
adaug parafin pn cnd amestecul conine aproximativ 75 % parafin, apoi se
menine 1 or la 45C.
2. Se trece piesa apoi direct prin 2 bi de parafin pur.




Tehnici de histopatologie


120
6.4.4. Includerea

1. Se lubrifiaz interiorul barelor Leuckart, al sticlelor de ceas sau al diferitelor
tvie metalice cu un amestec de etanol 60% - glicerin 9:1. Acesta va preveni
aderarea parafinei la recipientul ce constituie forma de turnare a blocurilor.
Acest lucru nu este necesar dac se utilizeaz matrie de hrtie.
2. Se rcete matria prin meninerea prii sale inferioare pe ghea cteva minute.
3. Se scoate recipientul cu parafin topit din etuv i se vars n matri.
4. Se introduce esutul n matri cu ajutorul unei pense hemostatice nclzite i se
verific dac piesa a fost orientat corect. n funcie de dimensiunea matriei,
se pot include simultan mai multe piese (1-10) obinndu-se un numr
echivalent de blocuri. Etichetele din hrtie sunt ataate n parafin, la marginea
matriei, n dreptul piesei histologice.

6.4.5. Secionarea

Dup includere, esuturile trebuie secionate pentru a putea fi etalate pe lam.
Secionarea se realizeaz cu un microtom, la grosimi de 4-6 m. Pentru realizarea unor
seciuni corespunztoare este necesar ca lama cuitului s fie perfect ascuit; se prefer
utilizarea cuitelor single use. Odat obinute seciunile, acestea se depun pe suprafaa
apei dintr-o baie de ap prenclzit, fapt care ajut la deplierea panglicii secionate.
Fragmentele de panglic sunt recuperate cu ajutorul unei lame de microscopie. Lama
cu seciunea etalat este apoi plasat ntr-o etuv timp de aproximativ 15 minute pentru
ca, prin topirea parial a parafinei, seciunile s adere mai bine la lam.

1. Blocurile de parafin cu piesele incluse, se secioneaz rectangular pe lng
esut, lsndu-se civa milimetri de parafin pe fiecare fa a blocului;
2. Urmeaz o nou fasonare a blocului cu ajutorul unei lame de ras. Se va ndeprta
mai nti parafina de pe faa de secionare la microtom, ct mai aproape de
esutul din bloc. Urmtoarele secionri se vor face pe celelalte fee ale
blocului, n aa fel ca acestea s devin paralele una cu alta. Se va lsa
suficient parafin la baza blocului astfel nct acesta s poat fi ataat la
obiectiv. Tierea bazei blocului se va face n aa fel nct ea s fie paralel cu
faa de secionare;
3. Se ataeaz blocul de parafin la discul obiectiv. Se depune un mic fragment de
parafin pe discul obiectiv i se modeleaz cu o spatul nclzit prin flambare
la un bec de gaz. Se las ca stratul de parafin s se rceasc, apoi se pregtesc
cele dou suprafee (baza blocului i suprafaa obiectului) n vederea aderrii
prin topirea stratului superficial de parafin (se ating cele dou suprafee timp
de cteva secunde cu spatula bine nclzit). Se preseaz apoi blocul de
parafin pe discul obiectiv i se las n repaus pentru solidificare;
4. Se fixeaz discul obiectiv cu blocul ataat n mandrina microtomului, se
ajusteaz poziia n aa fel ca blocul s fie paralel cu tiul cuitului de
microtom;
5. Ajustarea unghiului cuitului se face prin ncercri succesive. Unghiul diedru
format de faa cuitului i faa blocului trebuie s fie de aproximativ 5 grade.
Petru Cazacu


121
C
a
p
i
t
o
l
u
l

6. Se alege grosimea de secionare (4-6 m pentru majoritatea esuturilor) i se


ncepe secionarea cu vitez moderat. Se manevreaz panglica rezultat prin
nlnuirea seciunilor cu ajutorul unui penson, preferabil din pr de cmil. Se
secioneaz aproximativ 25 de seciuni, apoi se ndeprteaz panglica de la
cuit i se depune pe o coal de hrtie colorat n negru.
7. Dac se vor practica seciuni mai subiri (de 2-4 m) sau dac esutul este dur, se
pot obine rezultate superioare prin rcirea blocului de parafin i a cuitului. n
acest scop, se ia un cub de ghea i se las s se topeasc n aa fel ca gheaa
topit s se preling peste partea frontal a blocului. Alt cub de ghea se pune
pe faa anterioar a cuitului. Se va folosi un material absorbant (lavete,
prosoape de hrtie) pentru colectarea apei rezultate n urma topirii gheii i
rcirii piesei / cuitului. Cuburile de ghea se vor menine cca. 1-2 minute,
apoi se ndeprteaz orice pictur de ap de pe cuit i bloc cu ajutorul unui
prosop de hrtie i se ncepe secionarea. Rcirea blocului de parafin se poate
face i prin meninerea sa timp de cteva minute n congelator.
8. Microtomul i cuitul de secionare se toaleteaz dup fiecare utilizare. Niciodat
nu se las fixat cuitul n microtom cnd nu este folosit.

6.4.6. Etalarea seciunilor

Albumina Baker

Albu de ou .................................................. 50,0 ml
Ap distilat ................................................. 50,0 ml
NaCl ................................................................. 0,5 g
p-hidroxibenzoat de sodiu
1
............................... 0,1g

n apa distilat nclzit la 90C, se dizolv clorura de sodiu i conservantul (p-
hidroxibenzoatul de sodiu). Dup rcire se adaug albuul, se centrifugheaz pn cnd
supernatantul devine clar, se filtreaz prin vat ori se las n repaus pn cnd stratul
superior devine clar. Ca adeziv, se utilizeaz numai supernatantul clar. Pentru o bun
conservare, acesta se pstreaz la frigider.

Albumina Baker diluat

Albumin Baker........................................ 4 picturi
Ap distilat .................................................... 10 ml







1
Moldex, Tegosept, timolul sau salicilatul de sodiu se pot folosi ca substitueni ai
p-hidroxibenzoatului de sodiu.
Tehnici de histopatologie


122
Albumina Baker comercial

Adeziv ........................................................... 2,5 ml
Ap distilat ............................................... 100,0 ml

Soluia trebuie nclzit i corect omogenizat nainte de utilizare. Se va
prepara extemporaneu.

Mod de lucru

Procedura 1
1. Se degreseaz lamele i lamelele prin imersia lor n alcool acidifiat 95% (1 ml
HCl concentrat la 100 ml etanol) i se terg energic cu o pnz curat din
bumbac. Seciunile nu vor adera la lam dac acestea nu sunt complet
degresate. Se evit contactul degetelor cu suprafaa lamelor;
2. Se plaseaz seciunile pe lam cu ajutorul unor ace de disociere. Acestea vor
pluti la adugarea ctorva picturi de albumin diluat la marginea panglicii.
Ne vom asigura c seciunile au fost montate pe faa lamei cu captul mat i nu
pe faa cu captul lucios;
3. Seciunile se plaseaz pe lama nclzit cu ajutorul unei platine nclzitoare
reglat la o temperatur cu aproximativ 5-10C sub punctul de topire al
parafinei;
4. Seciunile se vor ntinde i netezi rapid. Excesul de fluid se va ndeprta prin
nclinarea lamei, meninnd panglica cu seciuni cu ajutorul unor ace de
disociere;
5. Se transfer lamele cu seciuni n etuv, la 30-40C i se las peste noapte pentru
a se asigura deshidratarea complet a acestora.

Procedura 2
1. Se utilizeaz lame degresate ca mai sus; se adaug o pictur de adeziv nediluat
pe lam i se etaleaz cu pulpa degetului mic prin micri circulare. Excesul se
terge cu pulpa degetului inelar. Degetele vor fi degresate n prealabil cu alcool
acidifiat 95 %;
2. Se plaseaz una sau dou seciuni pe suprafaa apei ntr-o baie reglat la o
temperatur cu 5-10C sub punctul de topire a parafinei. Se las cteva minute
pentru ntinderea seciunilor;
3. Se introduce lama n baie, sub seciune i folosind un ac de disociere se prinde i
se fixeaz fragmentul de panglic pe lam, dup care aceasta se scoate din
baie; fragmentul de panglic va adera la lam;
4. Se las lamele cu seciuni n etuv peste noapte pentru uscare. Dezlipirea
seciunilor de pe lam n timpul colorrii este o problem frecvent ntlnit la
histotehnicienii debutani. Dac lamele sunt curate i seciunile sunt
ntotdeauna uscate complet dup etalare, aceste incidente vor fi rare.



Petru Cazacu


123
C
a
p
i
t
o
l
u
l

6.4.7. Colorarea

Procesul de includere n parafin, necesar secionrii pieselor, trebuie urmat de
deparafinarea seciunilor etalate pe lam astfel nct s fie permis penetrarea
coloranilor hidrosolubili. Lamele cu seciuni se deparafineaz prin trecerea succesiv
n bi de xilen (sau nlocuitori), alcool etilic i ap. Tehnicile de colorare sunt diverse
i se selecteaz n funcie de abilitatea lor de a colora diferite componente celulare i
esuturi. Coloraia de rutin este Hematoxilin-Eosin (HE), celelalte metode de
colorare sunt coloraii speciale, pentru c se utilizeaz n situaii specifice conform
nevoilor de diagnostic.

6.4.7.1. Coloraia Hemalaun Eozin

Scop
Aceasta este cea mai comun coloraie histologic i histopatologic utilizat
pentru studierea de ansamblu a citoarhitectonicii tisulare. n cazul micozelor profunde,
permite aprecierea leziunilor la nivel microscopic, ns are o valoare diagnostic redus
pentru decelarea speciei implicate. Hemalaun-Eozin este o metod de colorare de
rutin, dar care necesit o execuie atent pentru a asigura obinerea unor rezultate
corecte i uniforme. Evideniaz elemente fungice aparinnd genurilor Pneumocystis,
Blastomyces, Coccidioides, dar i unele aspecte din cromomicoze, rinosporidioz,
adiaspiromicoz, ca i fenomenul Splendore-Hoeppli sau culoarea original a fungilor
dematiacei (pigmentai).

Fixator
Se obin rezultate excelente, comparabile, folosind diveri fixatori

Tehnica de secionare
Seciuni cu grosimea de 4-5 m, din fragmente de esut incluse n parafin

Echipament
Sticlrie de laborator, timer de laborator

Reactivi

Hematoxilina Ehrlich (1886)

Hematoxilin ...................................................... 2 g
Etanol 95% ................................................... 100 ml
Ap distilat .................................................. 100 ml
Glicerin ....................................................... 100 ml
Alaun de potasiu, n exces ..................... aprox. 20 g
Acid acetic ...................................................... 10 ml



Tehnici de histopatologie


124
Hematoxilina Harris

Hematoxilin ................................................... 5,0 g
Etanol 95% .................................................. 50,0 ml
Alaun de potasiu .......................................... 100,0 g
Ap distilat ................................................ 1000 ml
Oxid de mercur ................................................ 2,5 g

Se dizolv hematoxilina n etanol i alaunul n ap cu ajutorul cldurii. Se
amestec cele dou soluii. Amestecul se aduce la fierbere ct mai repede posibil i
apoi se adaug oxidul de mercur. Se continu fierberea pn cnd apare o culoare
purpurie intens (rou-nchis, violet), apoi se introduce recipientul ntr-o baie de ap
pn la rcirea complet. Dup rcire, se adaug 40 ml de acid acetic glacial. Cnd se
observ o strlucire aurie a soluiei, aceasta se filtreaz. Dac aceast strlucire nu
apare, coloraia va fi de calitate inferioar.

Hematoxilina Mayer

Hematoxilin ................................................... 5,0 g
Ap distilat ............................................... 700,0 ml
Alaun de potasiu ............................................ 50,0 g
Glicerin .................................................... 300,0 ml
Iodat de sodiu .................................................. 0,4 g
Acid acetic glacial ....................................... 20,0 ml

Se dizolv hematoxilina ntr-o cantitate redus de ap, apoi alaunul n
aproximativ 650 ml de ap distilat. Se amestec cele dou soluii i se completeaz
pn la 700 ml. Se adaug iodatul de sodiu n soluie, dup care aceasta se nclzete
blnd pentru a grbi oxidarea hematoxilinei. Soluia se las la rcit pentru o jumtate
de or, se filtreaz, apoi se adaug acidul acetic glacial i glicerina. Soluia poate fi
utilizat imediat i este stabil 2-3 luni.

Soluia de albstrire Scott

Sulfat de magneziu ........................................ 20,0 g
Bicarbonat de sodiu ......................................... 3,5 g
Ap distilat ................................................ 1000 ml

Se dizolv srurile separat, apoi se amestec soluiile i se adaug un cristal de
timol.

Alcool - acid 0,5 %

Etanol 70% ................................................ 100,0 ml
HCl ................................................................ 0,5 ml
sau
Petru Cazacu


125
C
a
p
i
t
o
l
u
l

HCl ................................................................... 3 ml
Etanol 95% ..................................................... 97 ml

Se adaug acidul clorhidric peste alcool.

Eozin Y - alcoolic, soluia stoc

Eosin Y, solubil n ap i alcool ................... 2,5 g
Ap distilat ............................................... 500,0 ml
Acid clorhidric concentrat ................................ 4 ml

Se dizolv eozina (tetrabromfluorescein de sodiu) n ap i se adaug treptat
acidul clorhidric care se va combina cu sodiul. Precipitatul rezultat este forma acid a
tetrabromfluoresceinei, insolubil n ap. Se las precipitatul s se stabilizeze i apoi se
decanteaz supernatantul fluid. Se adaug aproximativ 500 ml ap distilat peste
precipitat i se agit pn cnd colorantul se afl complet n suspensie, apoi se las n
repaus pentru sedimentare. Se repet procesul de splare de aproximativ 6 ori, pn
dispar toate urmele de ioni de sodiu i clor. Se filtreaz i apoi se las hrtia de filtru
mpreun cu colorantul la uscat n etuv (max. 60C). Ponderea pulberii de colorant
dizolvate n 100 ml de etanol 95% este de 0,5 g. Se filtreaz i se stocheaz ntr-un
recipient transparent cu dop rodat. Tratnd eozina astfel, se va obine un colorant cu o
putere tinctorial mai mare, colorantul fiind mult mai stabil n alcool.
Pentru utilizare se dilueaz 1:5 n etanol 95%.

Tehnica de colorare

1. Deparafinarea i hidratarea cu ap distilat a seciunilor;
2. Se imerseaz preparatele ntr-una din soluiile de hematoxilin, un timp variabil,
conform variantei de hematoxilin ntrebuinate: 5-10 minute pentru
hematoxilina Mayer, 5 minute pentru hematoxilina Harris i 15 minute pentru
hematoxilina Ehrlich;
3. Se spal lamele cu ap distilat, apoi se introduc n soluia de albstrire Scott
pentru 1-2 minute. Se cltesc n ap distilat i se examineaz la microscop.
Seciunea trebuie s fie supracolorat;
4. Se difereniaz cu alcool - acid 0,5% pentru a ndeprta excesul de colorant din
fond, lsnd colorai numai nucleii;
5. Cltire cu ap distilat i apoi reimersare n soluia de albstrire Scott pentru
nc 1-2 minute;
6. Se reexamineaz la microscop i dac seciunile sunt suficient decolorate se
continu cu pasul urmtor. Dac seciunea este insuficient difereniat atunci se
repet paii 4 i 5;
7. Splare n ap de robinet 5-10 minute;
8. Colorare cu eozin alcoolic (se las lamele cu seciuni n soluia de colorare
pn cnd acestea sunt uor supracolorate);
9. Cltire n 2 bi de etanol 95%;
10. Difereniere n alcool absolut pn cnd se obine o coloraie optim;
Tehnici de histopatologie


126
11. Deshidratare ntr-o baie de alcool absolut;
12. Clarificare n cteva bi de xilol;
13. Montarea lamelelor cu balsam de Canada, Xam sau alte medii neutre de
montare care sunt miscibile cu xilolul.

Rezultatul colorrii
Nucleii albastru purpuriu
Hematiile rou
Celulele musculare roz intens
Fibrele de colagen roz

Not:
Pentru realizarea coloraiei Hematoxilin-Eozin, se poate folosi oricare din soluiile
de hematoxilin prezentate la reactivi.

6.4.7.2. Albastru Alcian pH 2,5 pentru mucopolizaharide acide

Scop
Coloraia cu Albastru Alcian pune n eviden mucopolizaharidele acide. Se
poate utiliza pentru evidenierea mucopolizaharidelor capsulare la Cryptococcus
neoformans. Este o metod destul de eficient pentru diferenierea criptococilor
capsulai tipici de ali patogeni yeast-like, cu form i dimensiuni similare.

Fixator
Formol 10% tamponat pH 6,8, Bouin sau Hollande

Tehnica de secionare
Seciuni cu grosimea de 4 m, din fragmente de esut incluse n parafin

Echipamente
Pahare Berzelius, pH-metru, cuptor cu microunde, microscop

Reactivi

Acid acetic 3%

Acid acetic glacial ............................................ 3 ml
Ap distilat ............................................. ad 100 ml

Soluia este stabil 1 an.

Soluie Albastru Alcian

Acid acetic glacial 3% .................................. 100 ml
Albastru Alcian 8GX .......................................... 1 g

Petru Cazacu


127
C
a
p
i
t
o
l
u
l

Se amestec cele dou ingrediente apoi se ajusteaz pH-ul la 2,5, utiliznd acid
acetic. Se filtreaz i se adaug un cristal de timol, apoi se eticheteaz i se dateaz.
Soluia este stabil 2 pn la 6 luni.
Atenie! Conine acid, evitai contactul i inhalarea.

Nuclear fast red (Kernechtrot)

Sulfat de aluminiu...25,0 g
Ap distilat.......500 ml
Nuclear fast red.0,5 g

Se dizolv sulfatul de aluminiu n ap. Se adug Nuclear fast red i se dizolv
prin nclzirea soluiei. Se filtreaz i se adaug un cristal de timol. Soluia este stabil
timp de 1 an.
Atenie! Iritant - se va evita contactul i inhalarea.

Tehnica de colorare
1. Se hidrateaz preparatul n ap distilat;
2. Se introduc lamele n acid acetic 3%, 3 minute;
3. Se introduc preparatele n soluia de albastru Alcian, la cuptorul cu microunde
(la o treapt superioar), timp de 30 secunde; n metoda convenional, soluia
de albastru Alcian cu lamele, se menine la temperatura camerei, timp de 30
minute;
4. Se spal lamele cu ap de robinet 2 minute i apoi se cltesc n ap distilat;
5. Se coloreaz cu Nuclear fast red, 5 minute, apoi se spal n ap de robinet;
6. Se deshidrateaz, se clarific i se monteaz lamela.

Rezultatul colorrii
Mucopolizaharidele acide: albastru
Nucleii: roz-roiatic

Note:
1. Nu este o coloraie specific pentru capsula C. neoformans, deoarece s-a constatat c
peretele altor fungi ca Blastomyces dermatitidis, Paracoccidioides brasiliensis sau
Rhinosporidium seeberi pot fixa colorantul; ns, datorit diferenelor morfologice
certe, aceti fungi nu pot fi confundai cu C. neoformans.
2. Albastru Alcian face parte din grupul coloranilor bazici polivaleni solubili n ap.
Culoarea albastr se datoreaz prezenei cuprului n moleculele sale. Soluia de acid
acetic glacial 3% (pH 2,5) i soluia de albastru Alcian coloreaz mucopolizaharidele
acide sulfatate i carboxilate dar i sialomucinele (glicoproteinele) sulfatate i
carboxilate. Se crede c srurile formeaz legturi cu gruprile acide ale acizilor
mucopolizaharidici.
3. Pentru siguran se poart mnui, ochelari de protecie i halat. Se adug acidul
acetic n ap. Coloraia se face sub hot. Se evit contactul i inhalarea coloranilor.
Acidul acetic este iritant pentru aparatul respirator. Este de asemenea coroziv.



Tehnici de histopatologie


128
6.4.7.3. Coloraia Bauer

Scop
Coloraia Bauer pune n eviden glicogenul, diferite mucosubstane i fungii

Fixator
Este recomandat formolul 10% tamponat pH 6,8, dar se pot folosi i ali
fixatori. Majoritatea coloraiilor tricromice necesit ca fixatori acidul picric sau clorura
mercuric. Formolul fixeaz bine esuturile, dar pentru obinerea unei coloraii de
calitate superioar se recomand o fixare secundar cu lichidul Bouin.

Tehnica de secionare
Seciuni cu grosimea de 5 m, din fragmente de esut incluse n parafin

Echipament
Sticlrie de laborator, microscop

Reactivi

Reactiv Schiff de Tomasi

Fucsin bazic .................................................... 1 g
Ap distilat ............................................. ad 200 ml
Metabisulfit de potasiu ....................................... 1 g
Acid clorhidric 1N .......................................... 20 ml
Crbune activat (pulbere) ................................... 2 g

Se nclzete apa distilat pn la fierbere ntr-un flacon Erlenmeyer de
dimensiuni mari. Se ndeprteaz flaconul de pe sursa de cldur i se adaug imediat
colorantul, cu grij, pentru c dizolvarea are loc cu efervescen. Se agit pn la
dizolvarea colorantului. Se las soluia s se rceasc pn la 50C, apoi se adaug
acidul clorhidric i se omogenizeaz. Se las n continuare soluia la rcit pn la 25C,
moment n care se adaug metabisulfitul de potasiu. Se omogenizeaz din nou. Se
nchide flaconul cu dop etan i se pstreaz la ntuneric pentru 1-2 zile. Dac soluia
nu este limpede, se adaug crbune activat i se agit pentru aproximativ un minut. Se
filtreaz soluia. Se pstreaz la temperatura de refrigerare, ntr-un flacon de sticl
nchis etan. Metabisulfitul de potasiu se poate nlocui cu cel de sodiu, fr a diminua
calitatea coloraiei. Conform Indexului Merck, bisulfitul de sodiu comercial este
realizat predominant din metabisulfit de sodiu. Soluia final trebuie s fie incolor sau
de culoarea chihlimbarului, dar foarte pal. Soluiile brune vor colora adesea foarte
prost. De obicei, acestea au fost realizate dintr-o fucsin bazic care conine o cantitate
inferioar de pararosanilin.




Petru Cazacu


129
C
a
p
i
t
o
l
u
l

Hemalaun Mayer (hematoxilina Mayer, Langeron 1942)



Hematoxilin ................................................... 1,0 g
Alaun de potasiu ............................................ 50,0 g
Ap distilat ........................................... ad 1000 ml
Iodat de sodiu .................................................. 0,2 g
Acid citric ........................................................ 1,0 g
Cloral hidrat ................................................... 50,0 g

Se dizolv hematoxilina n apa distilat, se nclzete apoi i se fierbe timp de
5 minute. Se ndeprteaz recipientul de pe sursa de cldur i se adaug iodatul de
sodiu, apoi se las soluia pentru maturare timp de 10 minute. Se adaug treptat restul
substanelor n ordinea dat, dizolvnd-o pe fiecare nainte de adugarea celeilalte. Se
eticheteaz cu iniialele denumirii i data preparrii, soluia fiind stabil timp de un an.
Atenie! Se va evita contactul i inhalarea.

Acid cromic

Trioxid de crom .................................................. 4 g
Ap distilat ............................................. ad 100 ml

Acid sulfuros

Metabisulfit de sodiu 10% sol. apoas ............. 6 ml
Acid clorhidric 1N ........................................... 5 ml
Ap distilat ............................................. ad 100 ml

Tehnica de colorare
1. Se introduc seciunile n ap distilat dup ce au fost trecute prin bile cu xilen i
etanol;
2. Se oxideaz n acid cromic timp de 40-60 minute;
3. Se cltesc lamele n ap de robinet, apoi n ap distilat;
4. Se introduc preparatele n reactivul Schiff pentru 15 minute;
5. Apoi n acid sulfuros, 3 bi a cte 2 minute fiecare;
6. Se spal cu ap de robinet;
7. Supracolorare cu hemalaun, 1 minut;
8. Se deshidrateaz cu etanol;
9. Se face clarificarea cu xilen i montare cu balsam de Canada.

Rezultatul colorrii
Glicogenul i mucosubstanele roii
Fungii roii
Nucleii celulelor somatice albatri




Tehnici de histopatologie


130
Note:
1. n practica modern se evit cltirea cu acid sulfuros, splarea realizndu-se cu
cantiti mari de ap de robinet.
2. Mucinele, de obicei, nu sunt aa de intens colorate ca n coloraia PAS.
3. Meninerea n acid cromic un timp mai ndelungat va reduce colorarea datorit
continurii oxidrii aldehidelor.

6.4.7.4. Coloraia Chick

Scop
Prin aceast coloraie se pot pune n eviden fungii, la microscopul cu
fluorescen.

Fixator
Formol 10% tamponat pH 6,8

Tehnica de secionare
Seciuni cu grosimea de 5 m, din fragmente de esut incluse n parafin

Echipament
Sticlrie de laborator, microtom, microscop cu fluorescen

Reactivi

Hematoxilin feric Weigert

Soluia stoc A

Hematoxilin ................................................... 5,0 g
Etanol 95% ................................................ 500,0 ml

Se omogenizeaz, apoi se eticheteaz, notnd iniialele denumirii i data
preparrii. Soluia este stabil 1 an.
Atenie! Inflamabil, se evit contactul i inhalarea.

Soluia stoc B

Clorur feric 29% ...................................... 20,0 ml
Ap distilat ............................................... 475,0 ml
Acid clorhidric ............................................... 5,0 ml

Se omogenizeaz, apoi se eticheteaz, notnd iniialele i data preparrii.
Soluia este stabil 1 an.
Atenie! Coroziv, se evit contactul i inhalarea.



Petru Cazacu


131
C
a
p
i
t
o
l
u
l

Soluia de lucru

Soluia stoc A .............................................. 25,0 ml
Soluia stoc B ............................................... 25,0 ml

Se omogenizeaz ct mai atent. Soluia va rmne stabil 3-4 zile.

Acridin orange

Acridin orange ............................................... 0,1 g
Ap distilat ............................................... 100,0 ml

Tehnica de colorare
1. Dup trecerea lamelor cu seciuni prin xilen i etanol, acestea se introduc ntr-o
baie de ap;
2. Hematoxilin feric Weigert (soluia de lucru), 5 minute;
3. Se spal cu ap de robinet;
4. Se introduc lamele n soluia de acridin orange, 2 minute;
5. Se spal n ap de robinet, 30 minute;
6. Se deshidrateaz, clarific i monteaz ntr-o rin nefluorescent.

Rezultatul colorrii
Se utilizeaz filtrele BG 12 i OG 4 (galben) i / sau OG 5 (portocaliu).
Fungii vor apare colorai fluorescent verde-rou.

Not:
Aceasta este cea mai indicat metod de screening.

6.4.7.5. Coloraia Gridley

Scop
Coloraia Gridley pune n eviden fungii viabili din preparatele histologice
obinute din esuturi incluse n parafin i secionate. Nu este satisfctoare pentru
detecia elementelor fungice neviabile, degradate.

Fixator
esuturile se fixeaz n soluie tamponat de formol 10 %, cu pH 6,8

Tehnica de secionare
Seciuni cu grosimea de 5 m, din fragmente de esut incluse n parafin

Echipament
Sticlrie de laborator, microscop



Tehnici de histopatologie


132
Reactivi

Reactiv Schiff de Tomasi
Vezi coloraia Bauer (6.4.7.3).

Fucsin-aldehid

Fucsin bazic .................................................... 1 g
Paraldehid, proaspt ...................................... 1 ml
Acid clorhidric concentrat ................................ 1 ml
Etanol 70 % .................................................. 200 ml

Se dizolv colorantul n etanol, apoi se adaug paraldehida i acidul clorhidric.
Se las la temperatura camerei timp de 48-72 ore, pentru maturare. Se pstreaz la
frigider, soluia fiind stabil 2-3 luni.

Acid cromic

Trioxid de crom .................................................. 5 g
Ap distilat .................................................. 500 ml

Decolorant

Metabisulfit de sodiu .......................................... 5 g
Ap distilat .................................................. 500 ml

Metanil yellow (Galben metanil)

Metanil yellow .................................................... 1 g
Ap distilat .................................................. 400 ml
Acid acetic glacial .................................... 2 picturi

Tehnica de colorare
1. Dup trecerea seciunilor prin bile cu xilen i etanol, acestea se imerseaz n
ap distilat;
2. Se introduc apoi n acid cromic, 1 minut;
3. Se spal cu ap de robinet;
4. Se trateaz cu soluie de metabisulfit, 1 minut;
5. Se spal cu ap de robinet;
6. Se cltesc cu ap distilat;
7. Se introduc lamele n reactivul Schiff, 20 minute;
8. Se spal cu ap de robinet;
9. Se cltesc cu etanol 70%;
10. Colorare cu fucsin-aldehid, 30 minute;
11. Se cltesc cu etanol 95%;
12. Se spal cu ap de robinet;
Petru Cazacu


133
C
a
p
i
t
o
l
u
l

13. Supracolorare cu metanil yellow, 1 minut;


14. Se cltesc cu ap distilat;
15. Preparatele colorate se deshidrateaz, clarific i apoi se monteaz lamela cu
balsam de Canada.

Rezultatul colorrii
Fungii culoare purpurie
Fondul galben

Not:
La pasul 2, meninerea n soluia de acid cromic 10% pentru 10 minute va da rezultate similare.

6.4.7.6. Coloraia Schmorl

Scop
Aceast metod de colorare pune n eviden fungii din preparatele histologice
obinute din fragmente de esut incluse n parafin i secionate la microtom.

Fixator
Fragmentele de esut se fixeaz n soluie de formol 10 % tamponat 6,8, dar se
pot folosi i ali fixatori.

Tehnica de secionare
Seciuni cu grosimea de 5 m, din fragmente de esut incluse n parafin

Echipament
Sticlrie de laborator

Reactivi

Decolorantul Mallory

Soluia A

Permanganat de potasiu ...................................... 1 g
Ap distilat .................................................. 100 ml

Soluia B

Acid sulfuric ..................................................... 1 ml
Ap distilat .................................................. 100 ml





Tehnici de histopatologie


134
Soluia C

Acid oxalic ......................................................... 1 g
Ap distilat .................................................. 100 ml

Soluia de lucru

Soluia A ..................................................... 1 volum
Soluia B ..................................................... 1 volum

Soluie de acid periodic

Se folosete soluia de acid periodic 0,5% (McManus) din coloraia PAS sau
urmtoarea variant:

Iodat de sodiu ..................................................... 1 g
Acid nitric 0,5% soluie apoas .................... 100 ml

Ambele soluii de acid periodic dau aceleai rezultate.

Acetanilin

Anilin ............................................................ 10 ml
Acid acetic glacial .......................................... 90 ml

Tiosemicarbazid

Tiosemicarbazid ................................................ 1 g
Ap distilat .................................................. 100 ml

Soluie Schmorl

Clorur feric, sol. apoas 1% ........................ 30 ml
Ferocianur de potasiu, sol. apoas 1% ............ 4 ml
Ap distilat ...................................................... 6 ml

Soluia trebuie s fie proaspt, preparndu-se nainte de utilizare. Nu se
reutilizeaz!

Tehnica de colorare
1. Dup trecerea seciunilor prin bile cu xilen i etanol, acestea se introduc
n ap distilat;
2. Urmeaz decolorarea Mallory:
Lamele cu seciuni etalate se introduc n soluia de lucru timp de
10 minute;
Se cltesc apoi n ap distilat;
Petru Cazacu


135
C
a
p
i
t
o
l
u
l

Se introduc n soluia C cteva minute, pn cnd se observ


decolorarea seciunilor;
Se cltesc cu ap;
Se continu cu urmtorii timpi ai tehnicii de colorare;
3. Se spal cu ap de robinet;
4. Se oxideaz n acid periodic pentru 10-20 minute;
5. Se cltesc cu ap de robinet;
6. Tratare cu acetanilin, 30 minute;
7. Se spal cu ap de robinet;
8. Se readuc preparatele n acid periodic pentru nc 20 minute;
9. Se cltesc cu ap de robinet;
10. Se introduc lamele n tiosemicarbazid, 10 minute;
11. Se spal cu ap de robinet pentru ndeprtarea tuturor urmelor de
tiosemicarbazid;
12. Se introduc lamele n soluia proaspt Schmorl, 10 minute;
13. Se spal cu ap de robinet;
14. Opional, supracolorare cu nuclear fast red sau eosin;
15. Se cltesc cu ap de robinet;
16. Se deshidrateaz cu etanol, se clarific cu xilen i se monteaz lamelele
cu balsam de Canada.

Rezultatul colorrii
Fungii albatri
Nucleii celulelor somatice roii
Fondul roz

Note:
1. Este binecunoscut faptul c azidele metalelor pot fi explozive. Totui, tiosemicarbazida
nu este o simpl azid metalic.
2. Formula tiosemicarbazidei este H
2
NNHCSNH
2
. Grupul hidrazinic (H
2
NNH-) combinat
cu orice aldehid genereaz prin acidul periodic o reacie de oxidare. Gruparea
tiocarbamilic (-CSNH
2
) este un agent reductor mult mai puternic dect sunt
aldehidele i reduce rapid fericianida la ferocianid, cu formarea imediat a unui
depozit de albastru de Prusia.
3. Decolorantul Mallory clarific uor fondul, mbuntind contrastul. El poate produce i
unele aldehide care vor fi ndeprtate n etapa 6.

6.4.7.7. Coloraia Fontana-Masson

Scop
Aceast metod de colorare se utilizeaz pentru a evidenia melanina i
substanele de tip melanin-like. Melanina este un pigment negru-brun prezent n mod
normal n pr, piele, retin, iris, n unele zone ale sistemului nervos central, dar i n
peretele unor fungi (Cryptococcus spp., fungii dematiacei). De asemenea, coloraia
poate fi utilizat pentru detecia intratisular a fungilor aparinnd genurilor
Aspergillus, Candida sau zygomicetelor.

Tehnici de histopatologie


136
Fixator
Fragmentele de esut se fixeaz n soluie de formol 10 % tamponat 6,8

Tehnica de secionare
Seciuni cu grosimea de 4 m, din fragmente de esut incluse n parafin

Echipamente
Sticlrie de laborator, cuptor cu microunde (sau etuv reglat la 60C),
microscop

Reactivi

Argint amoniacal, soluie stoc

Nitrat de argint 10% .................................... 25,0 ml

Se adaug hidroxid de amoniu, pictur cu pictur, pn la precipitarea
soluiei i apoi limpezirea ei;

Se adaug apoi nitrat de agint 10% ............... 1,0 ml

Soluia va deveni puin tulbure i se va lsa n repaus pentru 4-24 ore. Dup
utilizare, soluia se arunc.
Atenie! Soluie coroziv - se va evita contactul i inhalarea.

Argint amoniacal, soluie de lucru

Argint amoniacal, soluie stoc ..................... 12,5 ml
Ap distilat ................................................. 37,5 ml

Se pipeteaz tot argintul amoniacal, lsndu-se apoi la decantat. Se filtreaz.
Soluia nu se reutilizeaz.
Atenie! Soluie coroziv - se va evita contactul i inhalarea.

Nitrat de argint 10%

Nitrat de argint ............................................... 20,0 g
Ap distilat .......................................... ad 200,0 ml

Se agit amestecul pentru solubilizare. Soluia se pstreaz la frigider ntr-un
recipient brun de sticl, tratat n prealabil cu amestec sulfo-cromic. Soluia se poate
folosi timp de 6 luni de la preparare.
Atenie! Se evit contactul i inhalarea.



Petru Cazacu


137
C
a
p
i
t
o
l
u
l

Clorur de aur 0,1 %



Clorur de aur 1%, soluie stoc ...................... 5,0 ml
Ap distilat ................................................. 45,0 ml

Atenie! Se evit contactul i inhalarea.

Tiosulfat de sodiu 5%

Tiosulfat de sodiu ........................................... 200 g
Ap distilat .................................................... ad 4 l

Se dizolv tiosulfatul de sodiu n apa distilat. Se pstreaz ntr-un recipient cu
volum corespunztor, care se eticheteaz i dateaz.
Atenie! Se evit contactul i inhalarea.

Nuclear fast red (Kernechtrot)

Sulfat de aluminiu......................................... 25, 0 g
Ap distilat .............................................. 500, 0 ml
Nuclear-fast red ............................................... 0,5 g

Se dizolv sulfatul de aluminiu n apa distilat, apoi nucler fast red-ul, folosind
cldura (fierbere pentru 5 minute). Se las soluia s se rceasc, apoi se filtreaz,
adugndu-se cteva cristale de timol pentru conservare. Se eticheteaz i se dateaz.
Soluia este stabil timp de 1 an.
Atenie! Iritant, se evit contactul i inhalarea.

Tehnica de colorare
1. Seciunile etalate se vor deparafina i hidrata cu ap distilat;
2. Soluia de lucru de argint amoniacal cu lamele se introduce n cuptorul cu
microunde (la o treapt superioar), timp de 2 minute. Se verific lamele la
microscop pentru a observa dac intensitatea impregnrii este adecvat, iar
dac este necesar, soluia cu lame se va plasa suplimentar n cuptorul cu
microunde timp de cteva secunde (n metoda convenional soluia se
introduce n etuv la 60C pentru 1 or);
3. Cltire n ap distilat;
4. Clorur de aur 0,1%, 10 minute;
5. Cltire n ap distilat;
6. Tiosulfat de sodiu 5%, 5 minute;
7. Se spal lamele n ap de robinet i apoi se cltesc n ap distilat;
8. Nuclear fast red, 5 minute;
9. Se spal n ap de robinet;
10. Se deshidrateaz, clarific i se acoper cu lamel.


Tehnici de histopatologie


138
Rezultatul colorrii
Melanina i celulele argentafine negre (fig. nr. 6-1 vezi Anexa)
Nucleii celulelor somatice - roii

Note:
1. O reacie argentafin pozitiv este dat de faptul c celulele absorb argintul pe care l
reduc apoi la o form metalic vizibil, fr ajutorul unui agent reductor.
2. Atenie! Se vor purta n timpul lucrului mnui, ochelari de protecie i halat de
laborator. Se evit contactul i inhalarea. Nitratul de argint: este iritant sever pentru
piele i ochi, oxidant, ingestia va produce un puternic disconfort gastrointestinal;
posibil carcinogen. Soluia de argint amoniacal poate fi exploziv; n caz de vrsare
accidental, se va ndeprta folosind un volum mare de ap de robinet. Hidroxidul de
amoniu: este un iritant puternic pentru ochi i aparatul respirator. Se manipuleaz n
ni chimic. Tiosulfatul de sodiu: toxic prin ingestie, iritant gastric, tegumentar,
ocular i respirator.

6.4.7.8. Coloraia Gridley fluorescent

Scop
Aceast metod de colorare pune n eviden fungii din preparatele histologice,
prin microscopia cu fluorescen

Fixator
Fragmentele de esut se fixeaz n formol 10% tamponat pH 6,8, dar se pot
folosi i ali fixatori.

Tehnica de secionare
Seciuni din fragmente de esut incluse n parafin, cu grosimea de 5 m

Echipamente
Sticlrie de laborator, microscop cu fluorescen

Reactivi

Reactiv Schiff fluorescent

Acriflavin .......................................................... 1 g
Ap distilat .................................................. 200 ml
Metabisulfit de potasiu ....................................... 2 g
Acid clorhidric 1N .......................................... 20 ml

Se dizolv colorantul n ap i se omogenizeaz. Se adaug apoi succesiv
acidul clorhidric i metabisulfitul, omogenizndu-se ct mai atent. Se nchide etan
recipientul, se las la ntuneric pentru 48 ore, apoi se filtreaz. Acridina orange poate fi
de asemenea utilizat la prepararea acestei soluii.


Petru Cazacu


139
C
a
p
i
t
o
l
u
l

Soluia A

Trioxid de crom ................................................ 50 g
Ap distilat .................................................. 500 ml

Soluia B

Sulfit de sodiu ..................................................... 5 g
Ap distilat .................................................. 500 ml

Soluie C

Etanol 70% ................................................... 495 ml
Acid clorhidric .................................................. 5 ml

Tehnica de colorare
1. Dup trecerea seciunilor prin bile cu xilen i etanol, acestea se introduc n ap
distilat;
2. Imersare n soluia A, 10 minute;
3. Cltire cu ap de robinet;
4. Decolorare n soluia B, 1 minut;
5. Splare cu ap de robinet;
6. Cltire cu ap distilat;
7. Tratare cu reactiv Schiff fluorescent, 20 minute;
8. Splare cu ap de robinet;
9. Imersare n soluia C, dou bi, cte 5 minute fiecare;
10. Splare cu ap distilat;
11. n final, preparatele se deshidrateaz, clarific i apoi se monteaz lamela cu o
rin nefluorescent.

Rezultatul colorrii
Pentru examinare se utilizeaz filtrele BG 12, OG 4 (galben) i / sau OG 5
(portocaliu). Fungii apar colorai n galben-fluorescent cu acriflavin i verde-rou cu
acridin orange.

Note:
1. Aceast metod de colorare este utilizat frecvent ca metod de screening.
2. Dac fluorescena fondului este prea intens pentru a distinge fungii, aceasta se poate
atenua prin tratare cu hemalaun (1 minut) sau cu soluie apoas 0,5% de
permanganat de potasiu (1 minut). Aceast atenuare se realizeaz nainte de
deshidratarea final, cu precauie pentru a nu reduce excesiv fluorescena fungilor.

6.4.7.9. Coloraia Gomori-Grocott (Methenamine silver - modificat)

Scop
Evidenierea fungilor n esuturi. Este o coloraie superioar pentru depistarea
filamentelor aspergilare, a chitilor de Pneumocystis, a elementelor tipice pentru
Tehnici de histopatologie


140
Candida, zygomicete, Cryptococcus, Histoplasma, Blastomyces, Paracoccidioides,
Coccidioides, Lacazia loboi, Penicillium marneffei, Rinosporidium, Emmonsia. De
asemenea, evideniaz actinomicetele, Nocardia i algele de tipul Prototheca sau
Chlorela.

Fixator
Fragmentele de esut se fixeaz n soluie de formol 10 % tamponat pH 6,8.

Tehnica de secionare
Seciuni din fragmente de esut incluse n parafin, cu grosimea de 4-5 m

Echipamente
Sticlrie de laborator, cuptor cu microunde

Reactivi

Acid cromic 2%

Trioxid de crom ............................................. 10,0 g
Ap distilat ............................................. ad 500 ml

Dup solubilizare, soluia se transfer ntr-un recipient etan n care poate fi
stocat pn la 6 luni.
Atenie! Acidul este coroziv, posibil carcinogen, se evit contactul i
inhalarea.

Metabisulfit de sodiu 1%

Metabisulfit de sodiu ....................................... 5,0 g
Ap distilat ............................................. ad 500 ml

Soluia este stabil 6 luni.

Borax 5%

Borat de sodiu .................................................. 5,0 g
Ap distilat ............................................. ad 100 ml

Soluia este stabil 3 luni.

Metenamin-argint, soluia stoc

Metenamin 3%
(hexametilentetraamin) ........................... .100,0 ml
Nitrat de argint 5% ........................................ 5,0 ml

Petru Cazacu


141
C
a
p
i
t
o
l
u
l

Cele dou soluii se amestec ntr-un recipient brun de sticl, tratat n prealabil
cu amestec sulfo-cromic, cltit n ap distilat i uscat. Soluia este stabil 3 luni, la
temperaturi de refrigerare.
Atenie! Coroziv, posibil carcinogen.

Clorur de aur 0,5%

Clorur de aur .................................................. 0,5 g
Ap distilat .......................................... ad 100,0 ml

Se pstreaz la frigider, n recipiente tratate cu amestec sulfo-cromic, cltite i
uscate. Soluia este stabil 1 an.
Atenie! Se evit contactul i inhalarea.

Verde luminos 0,2%

Verde luminos (Light Green SF yellow) ......... 0,2 g
Ap distilat ............................................... 100,0 ml
Acid acetic glacial ......................................... 0,2 ml

Soluia este stabil 6 luni.
Atenie! Se evit contactul i inhalarea.

Tehnica de colorare
1. Deparafinare i hidratare n ap distilat;
2. Lamele cu seciuni se transfer n soluia de acid cromic 2% i se menin n
cuptorul cu microunde la o treapt superioar, 45 secunde; alternativ, se pot
menine i 5 minute, dar la o treapt inferioar (n metoda convenional,
acidul cromic 5%, se menine pe baie de ap la 60C, timp de 1 or);
3. Se spal lamele n ap de robinet i apoi se cltesc cu ap distilat;
4. Urmeaz tratarea cu soluia de metabisulfit de sodiu 1%, 1 minut, la temperatura
camerei;
5. Splare n ap de robinet, apoi cltire n 3 bi succesive de ap distilat;
6. Se introduc lamele cu seciuni n soluia de metenamin-argint, la cuptorul cu
microunde (treapt superioar), 70 secunde: esuturile trebuie s capete o
coloraie brun, asemntoare hrtiei de ambalaj. Se agit preparatul n soluia
fierbinte (n metoda convenional soluia de argint se nclzete pe baie de ap
la 60C, pentru o or sau pn la apariia unei coloraii brune);
7. Cltire n 2 bi de ap distilat;
8. Tratare cu clorur de aur 5% , 1 minut sau pn la apariia unei coloraii gri;
9. Splare n ap distilat;
10. Tiosulfat de sodiu 5%, 3 minute;
11. Splare n ap de robinet i cltire n ap distilat;
12. Verde luminos 1 minut;
13. Cltire n ap distilat;
14. Preparatele se deshidrateaz, se clarific i apoi se monteaz lamela.
Tehnici de histopatologie


142
Rezultatul colorrii
Fungii brun-negri
Fondul verde

Note:
1. Componentele mucopolizaharidice ale peretelui celulelor fungice sunt oxidate pn la
punerea n libertate a gruprilor aldehidice. Gruprile aldehidice reacioneaz
ulterior cu nitratul de argint, reducndu-l pn la argint metalic.
2. n cazul n care culoarea acidului cromic vireaz n brun, atunci este necesar ca acesta
s fie schimbat. De notat c soluia 2% este mai indicat dect cea 5%, utilizat n
metoda convenional, acidul cromic mai concentrat provocnd desprinderea esutului
de pe lam cnd se utilizeaz tehnica cu microunde.
3.Cnd culoarea fungilor nu vireaz n negru, se verific prospeimea acidului cromic, a
metabisulfitului de sodiu i a boraxului.
4. Cnd lucrm cu soluia de nitrat de argint, dac se observ o tulburare a sa sau un
aspect de oglind pe faa paharului, atunci este necesar prepararea unei noi
soluii.
5. Pentru protecie se vor purta mnui, ochelari de protecie i halat de laborator. Se
respect modul de lucru cu soluiile sub hot. Se evit contactul i inhalarea. Acidul
cromic: coroziv pentru piele i mucoase. Foarte toxic! Organul int este rinichiul.
Carcinogen. Metabisulfitul de sodiu: toxic prin ingestie, poate cauza gastroenterite.
Iritant pentru piele, ochi i mucoase. Nitratul de argint: iritant sever pentru piele i
ochi, oxidant. Posibil carcinogen. Tiosulfatul de sodiu: toxic prin ingestie, poate irita
stomacul. Iritant pentru piele, ochi i tractul respirator. Verde luminos SF yellow:
posibil carcinogen.
6. Exist n comer i kit-ul de colorare GMS Staining Kit, produs de Ventana, nr. catalog
860-007 ; informaii: Europe Ventana Medical Systems, S.A. Parc dInnovation BP
30 144 Rue G. de Kaysersberg F - 67404 Illkirch Cedex France 33 (0) 3 90 40 52 00.

6.4.7.10. Coloraia fluorescent cu acid periodic Schiff
(PAS - fluorescent)

Scop
Aceast metod de colorare pune n eviden fungii, prin microscopia cu
fluorescen.

Fixator
Fragmentele de esut sunt fixate n soluie de formol 10% tamponat pH 6,8,
dar pot fi folosii i ali fixatori.

Tehnica de secionare
Seciuni din fragmente de esut incluse n parafin, cu grosimea de 5 m

Echipamente
Sticlrie de laborator, microscop cu fluorescen



Petru Cazacu


143
C
a
p
i
t
o
l
u
l

Reactivi

Soluie de acid periodic
Vezi coloraia Schmorl (6.4.7.6.).

Reactiv Schiff fluorescent
Vezi coloraia Gridley fluorescent (6.4.7.8.).

Alcool - acid 5%
Vezi coloraia hemalaun eozin (6.4.7.1.).

Tehnica de colorare
1. Se deparafineaz i se hidrateaz seciunile;
2. Tratare cu acid periodic, 10 minute;
3. Splare n ap de robinet;
4. Cltire cu ap distilat;
5. Tratare cu reactiv Schiff fluorescent, 20 minute;
6. Splare n ap de robinet;
7. Alcool - acid, dou bi a 5 minute fiecare;
8. Splare cu ap de robinet;
9. Lamele cu seciuni se deshidrateaz, se clarific i apoi se monteaz lamela cu o
rin nefluorescent.

Rezultatul colorrii
Se utilizeaz filtrele BG 12, OG 4 (galben) i / sau OG 5 (portocaliu). Fungii
apar colorai n galben-fluorescent cu acriflavin i verde-rou cu acridin orange.

Note:
1. Unele formaiuni fluorescente vor apare colorate n rou sau roz la coloraia PAS.
2. Dac fluorescena fondului este prea intens pentru a distinge fungii, aceasta se poate
atenua prin tratare cu hematoxilin 1 minut sau cu soluie apoas 0,5% de
permanganat de potasiu 1 minut. Fluorescena se atenueaz naintea deshidratrii
finale. Aceasta atenuare a fluorescenei de fond trebuie s se fac cu precauie pentru
a nu reduce fluorescena fungilor.

6.4.7.11. Coloraia cu acid periodic Schiff

Scop
Coloraia cu acid periodic Schiff (engl. Periodic Acid Schiff, PAS) se poate
utiliza pentru colorarea fungilor din preparatele histologice.

Fixator
Probele de esut sunt fixate n soluie formol 10% tamponat pH 6,8, dar se pot
utiliza i ali fixatori (ns glutaraldehida trebuie evitat).

Tehnica de secionare
Seciuni din fragmente de esut incluse n parafin cu grosimea de 4-5 m
Tehnici de histopatologie


144

Echipamente
Sticlrie de laborator, cuptor cu microunde

Reactivi

Acid periodic 0,5 %, dup McManus

Acid periodic ................................................... 0,5 g
Ap distilat ............................................... 100,0 ml

Dup completa solubilizare a acidului periodic, soluia se eticheteaz cu data
preparrii i iniialele denumirii. Soluia este stabil 1 an.
Atenie! Se va evita contactul i inhalarea.

Reactivul Schiff (Lillie, la rece)

Fucsin bazic .............................................. 10, 0 g
Metabisulfit de sodiu ..................................... 18,0 g
Ap distilat ............................................. 1000,0 ml
Acid clorhidric ............................................. 10,0 ml

Se adaug fucsina i metabisulfitul n acidul clorhidric. Se agit soluia timp de
2 ore, apoi se menine la ntuneric, la temperaturi de 8-10C. Soluia devine limpede,
de culoare brun-deschis pn la galben-deschis. A doua zi se adaug:
Crbune activat (pulbere) ................................ 5,0 g

Se omogenizeaz 1-2 minute, apoi se filtreaz prin hrtie de filtru Whatman nr.
2 ntr-un cilindru gradat de 1000 ml. Hrtia de filtru se va nlocui frecvent. Se readuce
volumul la 1000 ml cu ap distilat. Soluia final trebuie s fie incolor sau de
culoarea chihlimbarului, dar foarte pal. Soluiile brune vor produce frecvent coloraii
necorespunztoare. De obicei, aceste soluii au fost preparate cu fucsin bazic ce
conine o cantitate mic de pararosanilin. Se pstreaz la frigider, soluia fiind stabil
timp de 6 luni. La prepararea reactivului se vor purta mnui, ochelari de protecie,
masc i halat de protecie. Se lucreaz sub hot, recipientul cu reactiv se pstreaz
acoperit, iar soluiile de preparare n nia chimic.
Atenie! Reactivul este carcinogen i corosiv, se evit inhalarea. Acidul
clorhidric este caustic, se va utiliza cu atenie!








Petru Cazacu


145
C
a
p
i
t
o
l
u
l

Hematoxilina Gill

Hematoxilin ................................................... 4,0 g
Sulfat de aluminiu.......................................... 70,4 g
Ap distilat .............................................. 750,0 ml
Etilenglicol ................................................ 250,0 ml
Iodat de sodiu ................................................. 4,0 g
Acid acetic glacial ....................................... 20,0 ml

Se amestec etilenglicolul cu apa distilat, se adaug hematoxilina, iodatul de
sodiu, apoi sulfatul de aluminiu i acidul acetic glacial. Se agit o or la temperatura
camerei. Se filtreaz nainte de utilizare. Soluia poate fi utilizat imediat i este stabil
pentru aproximativ un an. Hematoxilina trebuie s fie anhidr; dac este hidratat
(C
16
H
14
O
6
x 3H
2
O) se utilizeaz o cantitate de 4,72 g.

Tehnica de colorare
1. Deparafinarea i hidratarea seciunilor cu ap distilat;
2. Se introduc apoi lamele n acid periodic 0,5 %, timp de 5 minute;
3. Cltire n ap distilat;
4. Se introduc lamele cu seciuni n reactivul Schiff, la cuptorul cu microunde
(treapt superioar), pentru 45-60 secunde; preparatul va cpta o culoare
magenta (n metoda convenional, reactivul Schiff se menine la temperatura
camerei, timp de 30 minute);
5. Se spal continuu n ap de robinet, timp de 5 minute;
6. Tratare cu hematoxilin, timp de 3 minute;
7. Se spal n ap de robinet, apoi n ap distilat;
8. Se deshidrateaz n alcool, se clarific i se monteaz lamela.


Rezultatul colorrii
Glicogenul i fungii: magenta (fig. nr. 6-2 vezi Anexa)
Nucleii celulelor somatice: albatri

Note:
1. Pentru a verifica calitatea reactivului Schiff, se adaug n 10 ml de formaldehid cteva
picturi de reactiv Schiff; culoarea trebuie s vireze imediat n rou-purpuriu.
2. Dac n timpul pstrrii la frigider a reactivului culoarea acestuia vireaz n roz,
reactivul Schiff se nlocuiete.
3. Dac se observ un precipitat alb n recipientul cu reactiv Schiff, acesta se poate
redizolva prin nclzirea uoar a rectivului i agitarea soluiei.

6.4.7.12. Coloraia Ziehl - Neelsen

Scop
Aceast coloraie este utilizat pentru evidenierea bacteriilor din genul
Mycobacterium, diferenierea filamentelor de Nocardia (Ziehl pozitive) i actinomicete
Tehnici de histopatologie


146
(Ziehl negative). De asemenea, se pot pune n eviden elemente fungice caracteristice
speciilor de Histoplasma i Blastomyces.

Fixator
Fragmentele de esut se fixeaz n soluie de formol 10 % tamponat pH 6,8.

Tehnica de secionare
Seciuni din fragmente de esut incluse n parafin, cu grosimea de 4-5 m

Echipamente
Sticlrie de laborator, cuptor cu microunde

Reactivi

Fenol-Fucsin Ziehl - Neelsen

Fucsin bazic ................................................. 2,5 g
Ap distilat ............................................... 250,0 ml
Etanol absolut ............................................. 25,0 ml
Cristale de fenol topite ................................. 12,5 ml

Se omogenizeaz, se filtreaz i se pstreaz ntr-un recipient brun de sticl.
Acesta se eticheteaz cu data preparrii i cu timpul de stabilitate al soluiei (cca. 1 an).
Atenie! Carcinogen i toxic.

Alcool - acid 1%

Acid clorhidric ................................................ 10 ml
Etanol 70 % .................................................. 990 ml

Se omogenizeaz i se eticheteaz cu data preparrii i timpul de stabilitate al
soluiei (1 an).
Atenie! Coroziv.

Albastru de metilen, soluia stoc

Albastru de metilen .......................................... 0,7 g
Ap distilat ................................................. 50,0 ml

Se omogenizeaz, se filtreaz i se pstreaz ntr-un recipient etan. Se
eticheteaz menionndu-se data preparrii i perioada de stabilitate a soluiei (1 an).

Albastru de metilen, soluia de lucru

Albastru de metilen sol. stoc ............................ 5 ml
Ap distilat .................................................... 45 ml
Petru Cazacu


147
C
a
p
i
t
o
l
u
l


Soluia se pstreaz ntr-un recipient de sticl, fiind stabil timp de 2 luni. Se
va evita contactul i inhalarea.

Tehnica de colorare
1. Deparafinare, apoi hidratare cu ap distilat a seciunilor etalate pe lame;
2. Lamele se introduc n soluia de fenol-fucsin, care apoi se menine n cuptorul
cu microunde (treapt intermediar), 45 secunde. Lamele se vor lsa n soluia
fierbinte timp de nc 5 minute. Soluia se filtreaz o dat pe sptmn;
3. n metoda convenional, preparatele se menin la etuv, la 60C timp de 1 or;
4. Splare cu ap de robinet;
5. Tratare cu alcool - acid 1% pn la apariia culorii roz-deschis, persistente;
6. Splare cu ap de robinet, 5 minute;
7. Cltire cu ap distilat;
8. Albastru de metil, soluie de lucru, 30 secunde;
9. Cltire cu ap de robinet;
10. Se deshidrateaz, se clarific i se monteaz lamela cu balsam de Canada.

Rezultatul colorrii
Structurile acido-rezistente roii strlucitoare
Fondul albastru

Note:
1. Componenta lipoidic a bacteriilor acido-rezistente se coloreaz cu fenol-fucsin,
rezistent la decolorarea cu acid diluat.
2. Se utilizeaz filtre Millipore
TM
pentru filtrarea apei necesare n procesul colorrii.
3. n timpul preparrii soluiilor se vor purta mnui, ochelari de protecie i halat. Se
evit contactul i inhalarea soluiilor.
4. Fucsina bazic este carcinogen.
5. Acidul clorhidric: iritant puternic pentru piele, ochi i aparatul respirator.

6.4.7.13. Reactivi suplimentari

Amestec sulfo-cromic (pentru tratarea sticlriei)

Scop
Curarea sticlriei utilizate la colorare i pentru proceduri care necesit
sticlrie perfect igienizat.



Echipamente
Balon de 4000 ml, agitator magnetic, un recipient de sticl cu volum de 6-7
litri, cu capac



Tehnici de histopatologie


148
Reactivi

Soluie acid de curare

Bicromat de potasiu ....................................... 400 g
Ap distilat ................................................ 4000 ml
Acid sulfuric ................................................. 400 ml

Se dizolv bicromatul de potasiu n ap. Se toarn soluia ntr-un recipient de
6-7 litri, apoi se adaug ncet acidul sulfuric. Soluia se pstreaz pn cnd culoarea sa
devine maro-nchis (depinde de frecvena utilizrii). Se eticheteaz i se dateaz.

Soluie acid de splare a sticlriei 1,5%

Ap distilat .................................................. 985 ml
Acid clorhidric ................................................ 15 ml

Se omogenizeaz i se eticheteaz.

Note:
Pentru protecie se vor utiliza mnui, ochelari i halat. Acidul sulfuric: vaporii sunt
toxici, nu se inhaleaz. Afecteaz pielea, aparatul respirator, reproductor i esuturile fetale.
Este iritant pentru piele, ochi i aparatul respirator. Acidul sulfuric concentrat se adaug lent
n ap i soluii apoase, nu invers. Bicromatul de potasiu: toxic prin inhalare i ingestie.
Afecteaz sistemul reproductor i esuturile fetale. Coroziv pentru piele, ochi i mucoase.
Acidul clorhidric: puternic iritant pentru piele, ochi i aparatul respirator. Este coroziv.

6.5. Montarea

Montarea presupune n prealabil deshidratarea i clarificarea seciunilor.
nainte de introducerea lamelor cu seciuni n prima baie de etanol, acestea se
usuc prin compresare uoar cu hrtie de filtru pe ambele fee. De asemenea, lamele
se terg pe verso cu un tifon curat pentru a ndeprta resturile de colorant.
Urmeaz deshidratarea:

1. Etanol 95 %, 5 minute;
2. Etanol 95 %, 5 minute;
3. Etanol 100 %, 5 minute;
4. Etanol 100%, 5 minute;
5. Toluen, 10 minute.

Dac seciunile nu sunt complet deshidratate, la introducerea lor n toluen va
apare o turbiditate albicioas. Aceasta va limita conservabilitatea preparatelor.




Petru Cazacu


149
C
a
p
i
t
o
l
u
l

Medii de montare

Balsamul de Canada

Este o rin a coniferului Abies balsamea, dizolvat n proporie de 55 % n
xilol. Prin nvechire capt o coloraie glbuie, iar unele coloraii nu se conserv
corespunztor (ex. coloraiile cu fucsin acid, verde luminos).

D.P.X.

Distiren 80 ..................................................... 10,0 g
Dibutilftalat ................................................. 80,5 ml
Xilol ............................................................. 35,0 ml

Este o rin sintetic, neutr chimic, ceea ce asigur o conservare mai bun a
coloranilor i implicit a preparatelor.


Pe lama umectat cu toluen se pune o pictur de mediu de montare, iar
deasupra se aeaz o lamel:
1. Lamela se aeaz pe lam, sub o inciden de 45, atingnd cu marginea pictura
de mediu de montare; dup ce pictura s-a extins pe toat lungimea marginii ce
formeaz unghiul diedru cu lama, aceasta se preseaz uor (fig. nr. 6-3 a, b).
Fig. nr. 6-3
Montarea seciunilor n medii
anhidre (a, b) i
n medii apoase (c, d).
Tehnici de histopatologie


150
2. Se depune o pictur de mediu de montare pe lam i una pe lamel, apoi
acestea se aduc paralel pn cnd cele dou picturi conflueaz, apoi lamela se
preseaz uor (fig. nr. 6-3 c, d).
Se ndeprteaz eventualele bule de aer de sub lamel cu ajutorul unui ac de
disociere. Excesul de mediu de montare se ndeprteaz cu ajutorul unui tifon mbibat
n benzen. Preparatele histologice astfel obinute se menin n poziie orizontal la
temperatura camerei, timp de 2-3 zile.

6.6. Etichetarea i arhivarea

Dup ce excesul de mediu de montare este ndeprtat, preparatele se pot
eticheta. Preparatele histologice se eticheteaz prin plasarea unor mici etichete
dreptunghiulare adezive la captul mat al lamei. Aceast etichet se completeaz cu
ajutorul unei tu rezistent la ap i va cuprinde instituia, numrul din registrul
laboratorului, anul, natura probei, coloraia etc.
Arhivarea preparatelor histologice trebuie s asigure n primul rnd protejarea
acestora de ocuri mecanice, de lumin, umiditate i praf. Dup interpretarea
microscopic i fotografierea aspectelor morfologice de interes, preparatele histologice
permanente se arhiveaz n cutii speciale n ordinea seriei, n fante numerotate, iar
cutiile se introduc n sertarele histotecii. Blocurile de parafin se vor pstra n plicuri
care vor avea aceleai nsemnri ca i preparatele i vor fi depozitate n rafturile unor
dulapuri special destinate acestui scop. n registrul de laborator, n dreptul fiecrei
probe de esut, se vor nota datele de identificare i locul de depozitare al preparatelor
i blocurilor (Histoteca nr., sertarul nr, cutia nr.., rndul nr...). Ele se
menin minim 10 ani i sunt refcute cnd este necesar. Pentru o mai bun conservare,
preparatele histologice permanente se vor luta. Lutarea se poate realiza cu lac de
unghii, parafin topit sau cu amestecul 3:6:1 format din colofoniu, cear de albine i
seu. Acestea se aplic cu o pensul fin pe marginea lamelei, de jur mprejur, astfel
nct s se realizeze etaneizarea seciunii.

















Petru Cazacu


151
C
a
p
i
t
o
l
u
l

Bibliografie selectiv

1. Bancroft J, Stevens A (1982) - Theory and Practice of Histological
Techniques, 2
nd
ed., Churchill Livingstone, N.Y.
2. Bancroft, J D, Stevens A (1982) - Theory and practice of histological
techniques 2
nd
ed., Churchill Livingstone, Edinburgh & London, UK.
3. Carson F (1990) - Histotechnology: A Self-Instructional Text, 1
st
ed., ASCP,
III.
4. Crookham J, Dapson R (1991) - Hazardous Chemicals in the Histopathology
Laboratory, 2
nd
ed., Anatech.
5. Culling C F A (1974) - Handbook of histopathological and histochemical
techniques; 3
nd
ed., Butterworth, London, UK.
6. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed. Viaa
Medical Romneasc; Bucureti.
7. Gray P (1954) - The Microtomist's Formulary and Guide. The Blakiston
Co. Robert E. Krieger Publishing.
8. Hayashi I , Tome Y, Shimosato Y (1989) - Thiosemicarbazide used after
periodic acid makes methenamine silver staining of renal glomerular
basement membranes faster and cleaner; Stain Technology.
9. Humason G L (1967) - Animal tissue techniques, 2
nd
ed., W H Freeman &
Company, San Francisco, Ca, USA.
10. Lillie R D (1954) - Histopathologic technique and practical histochemistry 2
nd

ed., Blakiston, New York, USA.
11. Lillie R D, Glenner G G (1957) - Journal of Histochemistry and
cytochemistry; 5:311.
12. Luna L (1968) - Manual of Histologic Staining Methods of the AFIP, 3
nd
ed.,
McGraw-Hill, NY.
13. McManus J F A, Mowry R W (1960) - Staining Methods Histologic and
Histochemical; Harper & Row, New York, NY, USA.
14. Sheehan D, Hrapchak B (1980) - Theory and practice of Histotechnology; 2
nd

ed., Battelle Press, Ohio.
15. http://www-medlib.med.utah.edu/WebPath/webpath.html


Ingrid Apetrei, Mihai Mare


153
C
a
p
i
t
o
l
u
l






Ingrid Apetrei, Mihai Mare

7.1 Fungitell (Cape Code Inc. SUA)
Test de detecie rapid a (1,3)--D-glucan-ului

7.1.1. Principiul testului

ungitell este un test cromogen, sensibil i rapid, ce poate detecta (1,3)--D-
glucanul din serul de analizat n circa o or. (1,3)--D-glucanul este un
constituent al peretelui celor mai importani fungi de interes medical precum Candida
sau Aspergillus. Abilitatea testului de a detecta n ser (1,3)--D-glucanul cu exprimare
n picograme, reprezint un balon de oxigen pentru clinicieni, privind identificarea
precoce a infeciilor fungice invazive. (1,3)--D-glucanul se regsete n doze mici n
sngele indivizilor sntoi, dar valorile serice de 80 pg/ml sau mai mari, la pacienii
cu risc crescut vor putea fi corelate cu infecii fungice invazive. Analiza seriat a
probelor prelevate de la pacienii cu risc pentru infecii fungice a relevat utilitatea
diagnostic a acestui test, rezultatele fiind verificate prin metode alternative de
diagnostic.
Fungii care nu sintetizeaz (1,3)--D-glucan, precum specii din genul
Cryptococcus sau aparinnd clasei Zygomycetes, respectiv Absidia, Mucor sau
Rhizopus, nu vor pozitiva testul. Un rezultat pozitiv nu va indica i clasa fungic a
speciilor incriminate, testul fiind recomandat pentru stabilirea unui diagnostic
prezumtiv n colaborare cu alte proceduri de diagnostic, precum examenul micologic al
prelevatelor clinice, tehnicile de histopatologie n cazul prelevatelor biopsice sau
analiza imagistic (Rx, CT, RMN). Testul poate decela (1,3)--D-glucanul produs de
fungii primar patogeni sau de cei oportuniti aparinnd genurilor: Candida,
Aspergillus, Fusarium, Trichosporon, Saccharomyces, Acremonium, Coccidioides,
Histoplasma, Sporothrix, Blastomyces i Pneumocystis.
Rezultatele testului sunt cuantificate n pg/ml ser, cu valori minime de detecie
stabilite la 31,25 pg/ml. Cu toate acestea, intervalul de detecie a fost ncadrat n limite
superioare pentru o mai bun acuratee a testrii i pentru evitarea unor posibile
interferri antigenice. Valori ale (1,3)--D-glucanului mai mici de 60 pg/ml sunt
considerate a fi negative, iar depirea acestei valori (pozitivarea testului) nu va putea
fi automat corelat cu prezena evolutiv a bolii fr o serie de investigaii clinice /
F
7

Tehnici de seromicologie
Tehnici de seromicologie


154
paraclinice complementare, n vederea stabilirii unui diagnostic ct mai exact. Valori
mai mari sau egale cu 80 pg/ml sunt interpretate ca fiind net pozitive, cu valoare mare
de diagnostic pentru evoluia unei afeciuni invazive cu etiologie fungic.
Valorile cuprinse n intervalul 60-79 pg/ml sugereaz o posibil infecie
fungic, dar acestea au valoare diagnostic incert, fiind recomandat retestarea seric
a pacienilor la intervale de timp prestabilite (2-3 ori pe saptmn). Rezultate fals
pozitive au fost nregistrate la pacienii hemodializai, n cazul folosirii membranelor
celulozice sau administrrii unor produse de origine sangvin precum albumina sau
imunoglobulinele, n timp ce utilizarea pentru hemodializ a unor membrane
confecionate din celuloz triacetat sau polimetil-metacrilat nu au provocat creteri ale
valorilor de (1,3)--D-glucan seric. Fiind un test cromogen rezultatele obinute mai pot
fi interferate de prezena bilirubinei serice sau de turbiditatea serului de analizat
cauzat de hiperlipemie.

7.1.2. Materiale furnizate mpreun cu testul Fungitell

Fungitell este destinat diagnosticului in vitro. Urmtoarele materiale (libere de
orice urm de 1,3--D-glucan) sunt furnizate mpreun cu kitul i suficiente pentru 2
plci de microtitrare:
1. Reactivul Fungitell - (1,3)--D-glucan liofilizat, specific LAL (Limulus
Amebocyte Lysate) sau lizat din amebocitele unei specii de crab;
2. Tampon Pyrosol (Tris HCl 2M pH 7,4);
3. Glucan standard liofilizat ce conine ntre 250 i 350 pg s.a. / fiol i solvent
inert;
4. Ap - reactiv conform standardului ISO 3696:1987;
5. Microplci de titrare cu 96 godeuri, cu fund plat;
6. KCl 1,2 M
7. KOH 0,25 M

7.1.3. Materiale necesare dar nefurnizate mpreun cu kitul

Toate materialele i sticlria trebuie s fie libere de interferare glucanic.
Sticlria trebuie s fie uscat la cald, depirogenat la 235C timp de 7 ore, pentru a fi
adecvat folosirii. Toate recipientele din material plastic vor fi libere de orice tipuri de
interferri. Materialele de unic folosin sunt de preferat.
1. Vrfuri pipete 10-100 l, 250 l, 1000 l;
2. Micropipete pentru volume de 20l, 200 l i 1000 l;
3. Micropipet multipas pentru volume de 100 l;
4. Tuburi de testare pentru diluia probelor i pregtirea mixului de extracie seric;
5. Incubator-cititor cu fluorescen, lungime de und 405 nm monocrom, cu 2500
uniti densitate optic i software pentru interpretare asistat de PC;
6. Tuburi sterile de plastic cu dop, pentru mixarea probelor;
7. Tuburi de colectare a serului.
Atenie! Vrfurile de pipet cu filtru de bumbac pot constitui surs de glucan.
Toate produsele furnizate de Cape Code. Inc. sunt certificate ca fiind libere de
interferare glucanic.
Ingrid Apetrei, Mihai Mare


155
C
a
p
i
t
o
l
u
l

7.1.4. Atenionri i precauii



Testul Fungitell necesit o atenie sporit din punct de vedere tehnic i
procedural.
1. Specii nedetectate de test. Unele specii fungice produc cantiti reduse de (1,3)-
-D-Glucan i nu sunt de regul detectate de test. Din aceast categorie fac parte
specii ale genului Cryptococcus, precum i specii din categoria zygomycetelor,
ca Absidia, Mucor i Rhizopus;
2. Nu se pipeteaz nici o substan cu gura, nu se fumeaz, nu se consum alimente
n spaiul destinat testrilor;
3. Se utilizeaz reactivi i materiale care sunt certificate ca fiind libere de glucani,
tiut fiind c apa, hainele, praful pot fi surse de glucan;
4. Nu se utilizeaz reactivi cu termenul de valabilitate depit, seruri hiperlipemice
sau care conin bilirubin;
6. Se utilizeaz echipament de protecie i mnui fr talc n manoperele ce
implic prelevatele;
7. Pacienii hemodializai pot acumula un nivel ridicat de (1,3)--D-glucan cnd
sunt utilizate membrane celulozice. Cele de tipul triacetat sau polimetil-
metacrilat nu par a afecta concentraia sanguin de glucan;
8. Anumite manopere chirurgicale ce implic utilizarea unor materiale absorbante
sau de sutur derivate din bumbac sau mtase pot conduce postoperator la
acumularea unui nivel ridicat de (1,3)--D-glucan, care s contribuie la falsa
pozitivare a rezultatelor testrii acestor pacieni.

7.1.5. Pstrarea reactivilor

Toate substanele se vor pstra la 2-8C, ferite de lumin. Reactivul Fungitell
reconstituit va fi pstrat la 2-8C i utilizat n maxim 2 ore. Pe termen mai ndelungat,
soluia reconstituit poate fi congelat o singur dat la -20C, pentru circa 20 zile.

7.1.6. Recoltarea / Stocarea / Marcarea probelor

1. Probele de ser se vor recolta n tuburi vidate (tip Venoject) care s permit o
rapid formare a coagulului i centrifugarea ulterioar n vederea separrii ct
mai nete a serului de analizat, la 1800 rpm timp de 10 minute. Serul astfel
obinut, se transfer n condiii aseptice n fiole sterile i se stocheaz;
2. Stocarea probelor naintea nceperii testrii se realizeaz la 2-8C pentru maxim
48 de ore sau se pot congela la -20C;
3. Marcarea prelevatelor const n notarea numelui i prenumelui pacientului
alturi de data recoltrii sau se utilizeaz sisteme de identificare unic.

7.1.7. Tehnic de lucru

1. Prepararea glucanului standard furnizat odat cu kitul
a. Se dizolv o fiol de glucan standard ntr-un volum corespunztor de ap
standard prembuteliat, pentru obinerea unei soluii cu 100 pg/ml (soluia 1);
Tehnici de seromicologie


156
Se vortexeaz cel puin 10 secunde pentru omogenizarea soluiei. Soluia astfel
preparat va fi stocat la 2-8C i utilizat n maxim 3 zile;
b. Se prepar apoi o soluie standard cu 50 pg/ml prin mixarea a 400 l ap
reactiv cu 400 l din soluia 1, ntr-un tub liber de glucan (soluia 2);
c. Din soluia 2 se prepar un nou standard cu 25 pg/ml prin mixarea a 400 l
ap reactiv i 400 l din soluia 2, ntr-un tub liber de glucan (soluia 3);
d. Pornind de la soluia anterioar, se prepar un standard cu 12.5 pg/ml prin
mixarea a 400 l ap reactiv cu 400 l din solutia menionat, ntr-un tub liber
de glucan (soluia 4);
e. Se prepar apoi un ultim standard cu 6.25 pg/ml prin mixarea 400 l ap
reactiv cu 400 l din soluia 4, ntr-un tub liber de glucan (soluia 5);
2. Prepararea reagentului de tratare a serului
Tratarea alcalin a serului va desface triplul helix al glucanului conferindu-i o
reactivitate mai mare n timpul testului. Un pH mai alcalin va inactiva serin-
proteazele precum i inhibitorii acestora, care pot da rezultate fals positive sau
fals negative.
a. Pregtirea reagentului de tratare a serului (0.6 M KCl i 0.125 M KOH) prin
transferarea a 400 l din soluia 0.25 M KOH ntr-un tub liber de glucan i adiia
a 400 l din soluia 1.2 M KCl. Soluia se omogenizeaz uor i se utilizeaz n
cel mult 30 de minute. Fiolele se acoper cu parafilm, putnd fi stocate la 2-8C
pentru a fi utilizate mai trziu, cu cea de-a doua microplac.

Not: Cnd se traseaz curba de etalonare, se multiplic pg/ml cu cinci, astfel nct
limita s fie ncadrat n intervalul 31.25 - 500 pg/ml. Volumul standard din testare este de 25
l pentru fiecare godeu, adic de cinci ori volumul probei de ser. Placa de microtitrare are
zon standard (st), zon martor (blank = blk) i zon test (unknowns = uk) cu fiecare variant
n triplu exemplar, dup urmtorul model (fig. Nr. 7-1).

Fig. nr. 7-1 Zonele standard (st), martor (blk) i test (uk) ale plcii de microtitrare

3. Tratarea serului cu reactivul de tratare a serului. Not: Pentru evitarea
contaminrii accidentale se pstreaz microplcile acoperite pe parcursul
desfurrii manoperelor, capacul ndeprtndu-se pentru citire.
Ingrid Apetrei, Mihai Mare


157
C
a
p
i
t
o
l
u
l

a. Decongelarea probelor de ser se realizeaz la temperatura camerei, iar


omogenizarea lor se realizeaz prin vortexare timp de 10 secunde;
b. Se transfer 5 l din proba de ser n fiecare din cele trei godeuri desemnate
(uk). Operaiunea se repet pentru fiecare prob de ser;
c. Se adiioneaz 20 l din reagentul de tratare a serului n fiecare godeu ce deja
conine cei 5l de ser;
d. Se agit placa 5 secunde i se incubeaz 10 minute la 37C n cititor;
4. Pipetarea blanc-ului i a standardelor. Se ndeprtez microplaca din cititor i:
a. Se adaug 25 l din soluia standard 1 n godeurile notate B2, B3, B4;
b. Se adaug 25 l din soluia standard 2 n godeurile notate C2, C3, C4;
c. Se adaug 25 l din soluia standard 3 n godeurile notate D2, D3, D4;
d. Se adaug 25 l din soluia standard 4 n godeurile notate E2, E3, E4;
e. Se adaug 25 l din soluia standard 5 n godeurile notate F2, F3, F4;
f. Se distribuie cte 25 l ap standard n godeurile notate G2, G3, G4;
5. Prepararea reagentului Fungitell i conduita procedural
a. Se reconstituie o fiol de reagent Fungitell cu 2,8 ml ap standard i se
aditiveaz cu 2,8 ml de Pyrosol tampon, cu ajutorul micropipetei de 1000 l;
b. Se agit uor fiola pentru dizolvarea complet a coninutului; nu se
vortexeaz. Se adaug apoi 100 l de reagent Fungitell n fiecare godeu cu
ajutorul micropipetei multicanal. Se ndeprteaz capacul de pe microplac i se
aeaz n cititor odat cu setarea temperaturii la 37C. ndeprtarea capacului
este opional, excepie fcnd situaiile cnd acesta ar putea mpiedica
vizualizarea probei. Microplaca se agit timp de minim 5 secunde naintea citirii.
Citirea are loc la 405 nm, la intervale de 15-30 secunde, timp de 40 minute, la
37C;
c. Colectarea rezultatelor i analiza acestora: se calculeaz rata medie de variaie
a densitii optice (mili-uniti de absorban/minut) pentru toate punctele, ntre
0 i 40 minute;
d. Se nregistreaz concentraia de glucan a probelor testate.

7.1.8. Interpretarea rezultatelor

Rezultatele testului Fungitell vor fi utilizate n diagnosticul infeciilor invazive
fungice doar n coroborare cu alte date. Rezultatele sunt exprimate n pg/ml ser,
ncepnd cu valori considerate a fi nedetectabile (< 31,25 pg/ml) pn la valori mai
mari de 500 pg/ml, acestea fiind printate cu ajutorul softului furnizat sau sunt citite pe
curba etalon. Pentru acurateea aprecierilor, n cazul valorilor de peste 500 pg/ml, se
recomand diluarea probei de ser cu ap standardizat i retestarea acesteia.
Laboratorul care efectueaz testrile are obligaia de a informa clinicianul c sfera de
detecie a kitului nu cuprinde specii ale genului Cryptococcus (produc cantiti infime
de (1,3)--D-glucan) sau specii de zygomycete precum Absidia, Mucor sau Rhizopus
care nu produc (1,3)--D-glucan.

Rezultate negative: un rezultat negativ nseamn c (1,3)--D-glucanul nu a fost
detectat sau c valorile s-au ncadrat sub limita de detecie a kitului. Valori ale (1,3)--
D-glucanului mai mici de 60 pg/ml sunt interpretate ca fiind negative.
Tehnici de seromicologie


158

Rezultate pozitive: un rezultat pozitiv nseamn c (1,3)--D-glucanul a fost detectat,
dar acest rezultat nu este definitoriu pentru prezena bolii i trebuie interpretat n
coroborare cu rezultatele metodelor complementare de diagnostic. Valorile mai mari
sau egale cu 80 pg/ml sunt considerate pozitive.

Rezultate incerte: valorile cuprinse n intervalul 60-79 pg/ml sugereaz o posibil
infecie fungic. Pentru certitudine, sunt necesare probe seriate i testri adiionale
pentru o interpretare corect a rezultatelor.

7.1.9. Controlul calitii

Ghidul controlului de calitate al standardelor de laborator poate fi accesat la
adresa URL www.nccls.org (documentul C24-A).
- Curba etalon cu cele cinci concentraii de glucan servete drept model de control
pozitiv a kitului Fungitell. Coeficientul de corelaie al curbei standard
(ordonat / abscis) ar trebui s fie mai mare de 0,980;
- Blanc-ul (25 l de ap standard) reprezint controlul negativ, cu valori mai mici
cu 50% dect cea mai mic valoare incert indicat de standard. Dac nu se
ndeplinesc aceste condiii, testarea trebuie repetat cu nlocuirea tuturor
reagenilor;
- Dac se observ c probele de ser sunt hemolizate, prezint turbiditate sau dau
prin citire la densitatea optic de 405 nm o valoare mai mare de 0,06, acestea
vor fi diluate cu reagentul baz i retestate. O bun practic de laborator
nseamn c ambele verificri de pozitivare sau negativare a probelor vor fi
puse n practic, n vederea verificrii reagenilor i tehnicii de lucru. Fiecare
laborator care utilizeaz aceast test de diagnostic va stabili i o serie de criterii
proprii privind controlul de calitate.

7.1.10. Limite

1. Localizarea tisular a infeciilor fungice, ncapsularea i nivelul de (1,3)--D-
glucan produs de anumii fungi influeneaz concentraia seric de antigen.
Cryptococcus spp. produce un nivel sczut de (1,3)--D-glucan. Specii
aparinnd genurilor Absidia, Mucor i Rhizopus, nu produc (1,3)--D-glucan;
2. Anumii indivizi sntoi au concentraii serice detectabile de (1,3)--D-glucan
ceea ce poate conduce spre o zon de incertitudine privind calitatea
diagnosticului. n astfel de cazuri sunt recomandate testrile suplimentare;
3. Frecvena testrii pacienilor se va stabili n funcie de riscul la care acetia sunt
expui, cu o rat de cel puin 2-3 ori pe sptmn;
4. Rezultate pozitive datorate creterii valorilor de (1,3)--D-glucan seric au fost
evideniate la pacienii hemodializai al cror tratament const n administrarea
unor produse de origine sanguin, albumin seric sau imunoglobuline;
5. Intervalul de detecie al testului este ntre 31,25 i 500 pg/ml.


Ingrid Apetrei, Mihai Mare


159
C
a
p
i
t
o
l
u
l

7.1.11. Interferarea cu alte substane



n urmtoarele situaii pot avea loc interferri privind acurateea rezultatelor:
Hemoliza;
Turbiditatea probei cauzat de hiperlipemie;
Prezena vizual a bilirubinei;
Turbiditatea serului.

7.1.12. Valori ateptate

Valorile crescute de -glucan sunt relevante ntr-o varietate de infecii fungice.
Cnd semnele / simptomele sunt prezente la nivelul de 80 pg/ml sau mai mare,
valoarea predictiv la care subiectul este pozitiv pentru infecii fungice se ncadreaz n
intervalul 74,4% - 91,7%. n absena semnelor clinice i mai puin de 60 pg/ml,
predicia negativ se ncadreaz n intervalul 65,1% - 85,1%.































Tehnici de seromicologie


160
7.2. Platelia

Aspergillus

7.2.1. Principiul testului

Kitul Platelia Aspergillus este un test imuno-enzimatic de tip sandwich care
permite detecia galactomananului (GM) n serul uman. Acest test utilizeaz anticorpi
monoclonali (Ac) de obolan EBA-2, dirijai contra GM aspergilar. Aceti anticorpi
permit o marj de detecie de 1 ng GM/ml. Calitatea i acurateea rezultatelor depind
de maniera de lucru a fiecrui laborator n parte, de reactivii utilizai, de urmarea cu
strictee a specificaiilor privind protocolul de lucru. Se vor utiliza seruri de control
pozitiv i negativ pentru validarea rezultatelor.
nclzirea serului n prezena EDTA are rolul de a disocia complexele imune i
de a precipita proteinele serice care ar putea interfera rezultatele testrii, crescnd astfel
sensibilitatea reaciei. Dup tratarea serului i centrifugare, supernatantul este recuperat
i analizat rapid (n aceeai zi). Dac se dorete retestarea unei probe de ser,
ntotdeauna se depoziteaz serul ca atare i nu prelevatul tratat.
Se vor incuba simultan serul i conjugatul n godeurile microplcii
sensibilizate n prealabil cu anticorpii monoclonali, permindu-se astfel formarea
complexelor de tip Ac GM Ac peroxidaz. Dup splare, complexele sunt
evideniate prin adiia substratului. Rezultatul reaciei este detectat la un
spectrofotometru cu lungime de und 450 / 620 nm, dup 30 minute de incubare la
temperatura ambiant, reacia fiind stopat prin adugarea acidului sulfuric 1,5N.
Din cauza problemelor de fals pozitivitate, serurile intermediare sau pozitive
vor fi sistematic retestate; este recomandat s se recolteze o nou prob de ser de la
pacienii cu risc, pentru a fi testat suplimentar. Datorit caracterului ubicuitar al
conidiilor de Aspergillus i Penicillium, n vederea evitrii contaminrii accidentale a
serului sau reactivilor, se vor utiliza doar materiale sterile, ferite de praf.
Galactomananul fiind termostabil, sterilizarea nu poate garanta absena GM
contaminant, de aceea se va limita la maxim contactul serului sau al reactivilor cu aerul
ambiant. Se recomand manipularea n hot cu flux de aer laminar clas II.

7.2.2. Materiale furnizate odat cu kitul

Microplci cu 96 godeuri sensibilizate cu anticorpi monoclonali EBA2
antigalactomanan, 1 buc;
Soluie concentrat de splare soluie concentrat (10X); Tampon TRIS-
NaCl (pH 7,41), Tween 20 sol.1%; conservant: 0,01% tiomersal 1x 100ml;
Control negativ ser de control negativ (liofilizat): ser uman liber de
galactomanan, negativ la testarea pentru anticorpi anti-HIV1 i anti-HIV2,
pentru antigene HBs i anticorpi anti-HCV; 2 x 1ml;
Ser de calibrare ser standard (liofilizat): ser uman cu coninut n
galactomanan (1ng/ml), negativ pentru anticorpi antiHIV1 i antiHIV2,
antigene HBs i anticorpi anti HCV; 2 x 1ml.
Control pozitiv ser de control pozitiv (liofilizat): ser uman coninnd
galactomanan, negativ pentru anticorpii anti-HIV1 i anti-HIV2, pentru
antigene HBs i anticorpi anti-HCV; 2 x 1ml;
Ingrid Apetrei, Mihai Mare


161
C
a
p
i
t
o
l
u
l

Conjugat conjugat gata de utilizare: anticorpi monoclonali anti-galactomanan


marcai cu peroxidaz; conservant: 0,01% tiomersal 1 x 8ml;
Soluie de tratare a serului (gata de utilizare): soluie acid EDTA, fr
conservani; 1 x 10,5 ml;
TMB (Tetra-Metil-Benzidin) tampon substrat tampon substrat pentru
peroxidaz (gata de utilizare): soluie de acid citric i acetat de Na, pH 5,2
coninnd 0,009% H
2
O
2
i 4% dimetilsulfoxid (DMSO); 1x 60 ml;
Soluie cromogen TMB soluie cromogen (concentrat): soluie DMSO
90% cu 0,6% Tetra-Metil-Benzidin (TMB); 1 x 1 ml;
Soluie de stopare (gata de utilizare): soluie de acid sulfuric 1,5 N.

7.2.3. Materiale necesare, dar nefurnizate odat cu kitul

Ap distilat sau perfect demineralizat pentru soluia de splare;
Ap purificat steril pentru reconstituirea serurilor de control;
Hrtie absorbant;
Mnui de unic folosin;
Ochelari de protecie;
Hipoclorit de Na (ap Javel) i bicarbonat de Na;
Pipete simple i multicanal, reglabile sau fixe, pentru msurarea i distribuirea a
50l, 100 l, 300 l i 1000 l;
Tuburi Eppendorf conice, de 1,5 ml capacitate, cu nchidere ermetic, capabile
s suporte temperaturi de minim 100C;
Centrifug pentru tuburi Eppendorf conice de 1,5 ml, care s dezvolte minim
10000 rpm;
Agitator tip Vortex;
Baie de ap cu termostatare la 100
0
C;
Incubator de microplci cu termostatare la 37C;
Sistem de splare automat, semiautomat sau manual pentru microplci;
Sistem de citire a microplcilor echipat cu filtre de 450 / 620 nm.

7.2.4. Conservarea reactivilor desigilai i a celor reconstituii

Microplcile dup deschiderea pachetului vidat, pot fi pstrate la 2-8C n
ambalajul original, timp de pn la 5 sptmni, verificndu-se periodic n
privina desicrii;
Soluia concentrat de splare dup diluare, aceasta se poate conserva 15 zile
la 2-8C. Dup utilizare, dac nu a suferit contaminri, poate fi pstrat la 2-
25C pn la data nscris pe ambalaj;
Soluia cromogen, dup ce a fost diluat, este stabil cca. 6 ore la temperatura
ambiant (18 30C) i la ntuneric;
Serurile de control negativ, pozitiv i soluia de calibrare dup reconstituire,
pot fi imediat congelate la 20C.

Tehnici de seromicologie


162
Se vor incuba simultan serul i conjugatul n godeurile microplcii
sensibilizate n prealabil cu anticorpii monoclonali, permindu-se astfel formarea
complexelor de tip Ac GM Ac peroxidaz. Dup splare, complexele sunt
evideniate prin adiia substratului. Rezultatul reaciei este detectat la un
spectrofotometru cu lungime de und 450 / 620 nm, dup 30 minute de incubare la
temperatura ambiant, reacia fiind stopat prin adugarea acidului sulfuric 1,5N.
Din cauza problemelor de fals pozitivitate, serurile intermediare sau pozitive
vor fi sistematic retestate; este recomandat s se recolteze o nou prob de ser de la
pacienii cu risc, pentru a fi testat suplimentar. Datorit caracterului ubicuitar al
conidiilor de Aspergillus i Penicillium, n vederea evitrii contaminrii accidentale a
serului sau reactivilor, se vor utiliza doar materiale sterile, ferite de praf.
Galactomananul fiind termostabil, sterilizarea nu poate garanta absena GM
contaminant, de aceea se va limita la maxim contactul serului sau al reactivilor cu aerul
ambiant. Se recomand manipularea n hot cu flux de aer laminar clas II.

7.2.5. Tehnica de lucru

Se va urma ntocmai protocolul de lucru. naintea utilizrii, toi reactivii vor fi
lsai s ating temperatura mediului ambiant.

7.2.5.1. Reconstituirea reactivilor

Soluia concentrat de splare se dilueaz de 10 ori n ap distilat steril,
obinnd astfel soluia gata de utilizare. Vor fi necesari 160 ml pentru splarea
a 2 barete cu cte 8 godeuri;
Controlul negativ, soluia de calibrare i controlul pozitiv coninutul unui astfel
de flacon va fi reconstituit cu 1000 l de ap steril extrapur, va fi lsat 2-3
minute pentru rehidratare i omogenizat uor. Se vor repartiza 3 x 300 l, n
tuburi Eppendorf, iar dac dou tuburi nu se utilizeaz n aceeai zi pot fi
congelate la 20C. Aceast reconstituire trebuie s se realizeze naintea
utilizrii serurilor n reacia imunoenzimatic i tratate ca toate serurile
provenite de la pacieni (300 l de ser + 100 l soluie de tratare);
Nu se conserv serurile de control dup tratare;
Se va dilua de 50 de ori soluia cromogen n substratul tampon pentru
peroxidaz. Se vor prepara 4 ml soluie de revelare pentru fiecare baret de
reacie (e.g. 200 l de soluie cromogen + 10 ml de reactiv substrat
peroxidaz).

7.2.5.2. Tratarea serurilor

Se introduc 300 l ser de testat ntr-un tub Eppendorf de 1,5 ml;
Se adaug 100 l din soluia de tratare a serului;
Se omogenizeaz cu ajutorul vortexului;
Se nchide ermetic tubul;
Tubul va fi plasat 3 minute pe baie de ap la 100
0
C;
Se centrifugheaz la 10000 rpm timp de 10 minute;
Ingrid Apetrei, Mihai Mare


163
C
a
p
i
t
o
l
u
l

Supernatantul obinut va fi utilizat pentru detecia antigenului galactomanan.


Odat ce serul a fost tratat, va trebui testat n cel mai scurt timp posibil;
Dac dup analiza rezultatelor se decide retestarea unui ser, se va lucra cu serul
de origine i nu cu cel deja tratat;
Stricta respectare a condiiilor de temperatur reprezint un factor esenial pentru
reuita reaciei, de aceea se recomand ca pe tot parcursul desfurrii
operaiunilor s se utilizeze un termometru tip sond;
Nu se conserv serul dup tratare, nici cel de control, nici cel provenit de la
pacieni.

7.2.5.3. Reacia imunoenzimatic

Se stabilete un plan de distribuie a serurilor de analizat provenite de la pacieni,
precum i a celor de control i calibrare;
Baretele necesare testului se scot din ambalaj, restul fiind pstrate conform
condiiilor amintite;
Se omogenizeaz flaconul ce conine conjugatul;
Dac se utilizeaz o pipet multicanal, se va preleva doar volumul necesar
realizrii unei serii, adic 2 ml pentru 16 godeuri;
Se vor distribui succesiv n godeuri, cu respectarea regulilor de mai jos:
50 l conjugat;
50 l din supernatantul serului tratat;
un godeu va fi destinat serului de control negativ, dou pentru cel de
calibrare i nc unul pentru serul de control pozitiv, distribuia
acestora pe plac fcndu-se la alegere;
Se acoper microplaca cu un film adeziv ce s asigure o bun etaneizare;
Incubarea microplcii pe baie de ap cu termostat sau ntr-un incubator, timp de
90 minute la 37
0
C;
Prepararea soluiei de splare (diluat);
Se ndeprteaz filmul adeziv, se aspir coninutul tuturor godeurilor i se
depune n soluia decontaminant. Apoi se procedeaz la splarea succesiv a
acestora de cinci ori. Ulterior, baretele sunt lsate s se usuce prin ntoarcere
pe o foaie absorbant, pentru absorbia soluiei de splare;
Prepararea soluiei revelatoare - soluia cromogen diluat 1/50 n soluia
tampon pentru substratul peroxidazei i distribuirea rapid a cte 200 l n
fiecare godeu. Operaiunea se va desfura n lumin puternic. Se las ca
reacia s se desfoare apoi n obscuritate, timp de 30 minute la temperatura
laboratorului (18 30
0
C), fr a se proteja godeurile cu filmul adeziv;
Se stopeaz reacia enzimatic prin adugarea a 100 l soluie de stopare n
fiecare godeu, n ordinea n care a fost adugat i soluia revelatoare;
Se va citi densitatea optic la 450 / 620 nm cu ajutorul unui cititor de plci, pe
parcursul celor 30 de minute de dup stoparea reaciei;
nainte de transcrierea rezultatelor ne asigurm c exist concordan ntre
valorile citite, aferente fiecrui godeu / microplci i planul de distribuie
prestabilit al acestora.
Tehnici de seromicologie


164
7.2.6. Interpretarea rezultatelor

Rezultatele sunt exprimate prin densitatea optic (DO) a eantionului vs.
valoarea standard. Acest calcul permite limitarea variaiilor de DO ntre testri, ct i
ntre rezultatele raportate ntre diferite laboratoare.
Testul este valid dac:
Valoarea de referin este mai mare sau egal cu valori cuprinse n intervalul
0,3 0,8 DO;
Valoarea serului pozitiv este mai mare de 2 DO;
Valoarea serului negativ este mai mic de 0,5 DO;
Un ser este:
negativ, dac indicele este mai mic de 1 DO;
intermediar, dac se ncadreaz n intervalul 1 1,5 DO;
pozitiv, dac valorile sunt mai mari sau egale cu 1,5 DO.
































Ingrid Apetrei, Mihai Mare


165
C
a
p
i
t
o
l
u
l

7.3. Platelia

Candida Ac
Detecia anticorpilor serici anti-manan
prin metoda imunoenzimatic

7.3.1. Introducere

Incidena crescut a infeciilor fungice invazive reprezint o constant a
patologiei umane n ultimele dou decenii. Infeciile produse de diverse specii
aparinnd genului Candida au rangul de infecii nosocomiale, oportuniste grave,
caracterizate printr-o morbiditate accentuat asociat mediului spitalicesc, traduse prin
prelungirea perioadei de spitalizare a pacienilor i creterea consumului de antifungice
sistemice. Mortalitatea direct atribuabil acestor infecii se plaseaz n jurul valorii de
40%. Diagnosticul se stabilete cu dificultate ca urmare a lipsei unor semne clinice cu
caracter patognomonic. n practica clinic, la stabilirea unui diagnostic concur o serie
de tehnici - radiologice, micologice etc., care permit evaluarea riscului instalrii unei
candidoze invazive.
n acest context, dozarea anticorpilor anti-Candida, bisptmnal, va ajuta la
orientarea diagnosticului etiologic prin completarea examenelor micologice de rutin.
Seroconversia i nivelul ridicat al anticorpilor sunt n general asociate unui focar de
candidoz profund.
Chiar dac apariia anticorpilor i cuantificarea acestora se realizeaz tardiv,
acestea sunt elemente preioase n vederea stabilirii unui diagnostic, fie el chiar i
retrospectiv n cazul n care pacienii au fost tratai empiric, fr o examinare
micologic anterioar. Observarea unui nivel ridicat de anticorpi poate pune n discuie
existena unei candidoze evolutive. n practica clinic, este recomandat ca reacia de
evideniere a anticorpilor anti-Candida s fie dublat i de detecia antigenelor
circulante (GM). n fapt, numeroasele studii efectuate au demonstrat c pacienii care
au fost diagnosticai cu o candidoz profund au prezentat pe parcursul infeciei o
antigenemie crescut n absena anticorpilor sau un nivel ridicat al anticorpilor n
absena antigenelor detectabile, astfel nct cele dou teste sunt complementare.

7.3.2. Principiul testului

Platelia Candida Ac este o tehnic imunoenzimatic de tip indirect, n doi
timpi, ce permite detecia anticorpilor anti-manan (izotip A, G i M) n serul uman.
Acest test automatizabil se preteaz practicii medicale ntr-un laborator spitalicesc de
micologie clinic.

7.3.3. Materiale furnizate mpreun cu kitul

- Soluie de lavaj concentrat, care se va dilua de 10 ori n ap distilat steril : 10
ml soluie de lavaj la 90 ml ap distilat;
- Conjugat (gata de utilizare) - anticorpi de capr anti-Ig (A, G, M) umane marcai
cu peroxidaz;
- Diluant pentru eantioane (gata de utilizare);
Tehnici de seromicologie


166
- Tampon pentru substrat de peroxidaz (gata de utilizare) - soluie de acid citric i
acetat de sodiu pH 5,2 coninnd 0,009% H
2
O
2
i 4% DMSO;
- Soluie cromogen (concentrat) - soluie de DMSO 90% coninnd tetra-metil
benzidin (TMB);
- Soluie de stopare (gata de utilizare) - soluie de acid sulfuric 1,5N;
- Film adeziv.

7.3.4. Materiale necesare dar nefurnizate mpreun cu kitul

- Ap distilat sau perfect demineralizat pentru pregtirea soluiei de lavaj;
- Agitator tip Vortex;
- Centrifug pentru tuburi Eppendorf conice, de 1,5 ml capacitate;
- Spltor de microplci;
- Spectrofotometru echipat cu filtre de 450 / 620 nm;
- Incubator de microplci (37
0
C);
- Kit comercial Platelia Candida Ac.

7.3.5. Tehnica de lucru

naintea utilizrii, toi reactivii vor fi adui la temperatura ambiant (20 25
0
C).

Pregtirea gamei de etalonare :

Soluia-mam, gata de utilizare (se dilueaz R4 n raport 1/20).
Exemplu : 40 l de R4 Ac + 800 l din soluia diluant

Realizarea gamei de etalonare n 6 puncte (concentraii variabile de anticorpi) :

80 UA (uniti anticorpi) - diluia soluiei-mam 1/5 : 100 l soluie-mam
+ 400 l diluant.....Tubul E1;
40 UA : diluia soluiei-mam pn la punctul 80 UA : 200 l din tubul E1
+ 200 l diluant.....Tubul E2;
20 UA : diluia soluiei-mam pn la punctul 40 UA : 200 l din tubul E2
+ 200 l diluant.....Tubul E3;
10 UA : diluia soluiei-mam pn la punctul 20 UA : 200 l din tubul E3
+ 200 l diluant.....Tubul E4;
5 UA : diluia soluiei-mam pn la punctul 10 UA : 200 l din tubul E4
+ 200 l diluant.....Tubul E5;
2,5 UA : diluia soluiei-mam pn la punctul 5 UA : 200 l din tubul E5
+ 200 l diluant.....Tubul E6.

Diluia eantioanelor (seruri de testat, seruri de control negativ i pozitiv)

Se dilueaz extemporaneu eantioanele - dou diluii succesive de 1/80 : 10 l
ser + 790 l de diluant rezultnd 1/80, apoi 10 l din diluia precedent + 790 l
diluant rezultnd diluia final 1/6400.
Ingrid Apetrei, Mihai Mare


167
C
a
p
i
t
o
l
u
l


Reacia imunoenzimatic

- Se stabilete un plan de lucru privind distribuia serului de control i a etaloanelor
n funcie de numrul eantioanelor de testat;
- Se distribuie serul diluat (punctele de reper de la E1 E6, eantioanele de testat i
cele de control) 100 l per godeu;
- Se identific baretele cu ajutorul unui marker permanent;
- Se acoper microplaca cu ajutorul unui film adeziv, ntinzndu-se ct mai bine pe
toat suprafaa n vederea asigurrii unei bune etaneizri;
- Se aeaz placa n incubatorul de microplci timp de 60 minute la 37
0
C;
- Se prepar soluia de lavaj (prin diluare 1:10). Se pregtesc 200 ml pentru dou
barete, respectiv 20 ml soluie de lavaj concentrat la 180 ml de ap distilat;
- Se ndeprteaz filmul adeziv i se aspir coninutul tuturor godeurilor;
- Coninutul aspirat se depune ntr-o soluie de hipoclorit de sodiu 2%, iar splarea
godeurilor se face de 4 ori, cu circa 300 l soluie de splare / godeu;
- Se usuc baretele prin tamponare cu o hrtie absorbant i se lovesc uor pentru
eliminarea n totalitate a soluiei de splare;
- Se omogenizeaz flaconul ce conine conjugatul, apoi se distribuie cte 100 l n
godeurile aferente;
- Se acoper din nou microplaca cu filmul adeziv i se incubeaz timp de 60
minute la 37
0
C;
- Se ndeprteaz filmul adeziv i se aspir coninutul tuturor godeurilor, n
maniera prezentat anterior;
- Prepararea soluiei de revelare prin diluarea de 50 de ori a soluiei cromogene
concentrate n soluia tampon pentru peroxidaz (e.g. 5 ml de reactiv tampon
substrat de peroxidaz la 100 l de soluie cromogen concentrat tetrametil-
benzidin) i distribuirea rapid a acesteia, n volum de cte 200 l, n toate
godeurile;
- Reacia este lsat s se desfoare n obscuritate, timp de 30 minute, la
temperatura ambiant;
- Se stopeaz reacia enzimatic prin adugarea a 100 l soluie de stopare n
fiecare godeu;
- Se citete densitatea optic la 450 / 620 nm pe parcursul a 30 de minute dup
stoparea reaciei.

7.3.6. Interpretarea rezultatelor

Valori ale densitii optice ateptate:

Densitate optic : 0,400 < DO la punctul din scala etalon 5 UA < 1,200

Raport :

- DO corespunztoare punctului etalon 20 UA / DO nseamn 5 UA > 2
- DO corespunztoare punctului etalon 10 UA / DO nseamn 5 UA > 1,4
Tehnici de seromicologie


168
- DO corespunztoare punctului etalon 2,5 UA / DO nseamn 5 UA < 0,8
Concentraia n anticorpi;
- C3 < 2,5 UA/ml
- C5 = concentraia indicat pe flacon 2,5 UA/ml

Curba etalon este realizat n baza a 6 repere / etaloane - 2,5, 5, 10, 20, 40, 80
UA/ml preparate pe baza R4, etalonul etichetat i furnizat odat cu kitul. Se va opta
pentru trasarea sigmoid a curbei de etalonare care s permit extrapolarea pe abscis a
concentraiilor n UA/ml (interpretare logaritmic) i pe ordonat DO (liniar). Dac
cititorul nu permite acest tip de trasare, se poate opta doar pentru o trasare de reliefare
a etaloanelor.

- < 0,5 UA/ml: ser negativ
- ntre 5 10 UA/ml: ser intermediar (rezultat incert)
- 10 UA/ml: ser pozitiv































Ingrid Apetrei, Mihai Mare


169
C
a
p
i
t
o
l
u
l

7.4. Platelia

Candida Ag
Detecia mananului seric prin metoda imunoenzimatic

7.4.1. Introducere

Antigenul Candida, n acest caz mananul - polizaharid major de perete,
reprezint markerul principal n identificarea unei candidoze invazive. Eliberarea
acestui polizaharid n organism are loc intermitent, iar prezena seric a acestuia este de
multe ori pasager. Detecia rapid a acestui compus depinde de o serie de factori,
precum captarea de ctre anticorpii specifici circulani i degradarea de ctre
manozidazele serice. Deci evidenierea mananului seric va trebui corelat cu cea a
anticorpilor antimanan circulani. Tandemul celor dou tipuri de teste va concura att
la ameliorarea gradului de sensibilitate ct i la cea a precocitii stabilirii unui
diagnostic integrat.

7.4.2. Principiul testului

Platelia

Candida Ag este o tehnic imunoenzimatic de tip sandwich ce


permite detecia semicantitativ a mananului n serul uman. Aceast metod se bazeaz
pe utilizarea anticorpilor monoclonali de obolan (EBCA-1) dirijai contra unui penta
manozid - exprimat prin manan i manoproteine, existent la pricipalele specii de interes
clinic ale genului Candida. Aceti anticorpi sunt utilizai n dublu sens: ageni de
sensibilizare a plcii de microtitrare i revelatori dup cuplarea cu peroxidaza.

7.4.3. Materiale furnizate odat cu kitul

- Soluie de lavaj concentrat care se va dilua de 10 ori n ap distilat;
- Conjugat (gata de utilizare) - anticorpi monoclonali anti-manan, marcai cu
peroxidaz;
- Soluie de tratare a serului (gata de utilizare) - soluie acid EDTA fr
conservani;
- Tampon pentru substratul peroxidazei (gata de utilizare) - soluie de acid citric i
acetat de sodiu pH 5,2 coninnd 0,009% H
2
O
2
i 4% DMSO;
- Soluie cromogen (concentrat) - soluie de DMSO 90% coninnd tetra-metil-
benzidin (TMB);
- Soluie de stopare (gata de utilizare) - soluie de acid sulfuric 1,5N.

7.4.4. Materiale necesare dar nefurnizate odat cu kitul

- Ap distilat sau perfect demineralizat pentru pregtirea soluiei de lavaj;
- Agitator tip Vortex;
- Centrifug pentru tuburi Eppendorf conice, de 1,5 ml capacitate;
-Baie uscat cu dispozitiv de nclzire (temperatura preconizat 120
0
C) sau baie
de ap reglabil la 100
0
C;
- Spltor de microplci;
- Spectrofotometru echipat cu filtre de 450 / 620 nm;
Tehnici de seromicologie


170
- Incubator de microplci (37C);
- Tuburi Eppendorf conice, de 1,5 ml capacitate;
- Kit comercial Platelia Candida Ag.

7.4.5. Tehnica de lucru

naintea utilizrii, toi reactivii vor fi lsai s ajung la temperatura ambiant
(20 25C).
Pregtirea curbei etalon:
- Etalon: concentraia n manan - 2ng/ml, 1ng/ml, 0,5ng/ml i 0,25ng/ml;
- Ser control negativ - 150l, 225l i 262,5l;
- Ser etalon de 2ng/ml - 300 l, 150 l, 75 l i 37,5 l.

7.4.5.1. Tratarea serului de control i a celui etalon

Serurile de control (negativ i pozitiv) i concentraiile etalon vor trebui tratate
concomitent cu eantioanele prelevate de la pacieni dup modelul urmtor :
- Se repartizeaz 300 l ser de testat ntr-un tub Eppendorf de 1,5 ml;
- Se adaug 100 l soluie de tratare;
- Se omogenizeaz energic la Vortex;
- Se nchide ermetic tubul (prin apsarea capacului sau ataarea unui dispozitiv de
siguran);
- Tubul va fi plasat 6 min la 120
0
C n vederea distrugerii complexelor imune deja
existente n ser (Ag-Ac);
- Centrifugare la 10000 rpm timp de 10 minute;
- Testarea supernatantului.

7.4.5.2. Reacia imunoenzimatic

- Se stabilete un plan de lucru privind distribuia serului de control i a etaloanelor
n funcie de numrul eantioanelor de testat;
- Se omogenizeaz flaconul ce conine conjugatul prin ntoarceri repetate nainte de
utilizare i se preleveaz doar volumul necesar realizrii seriei (e.g. pentru
dou barete a cte 8 godeuri sunt necesari 2 ml);
- Se distribuie succesiv n godeuri, cu respectarea ordinii de distribuie a
reactivilor, 50 l conjugat i 50 l supernatant din serul de testat tratat n
prealabil;
- Se acoper microplaca cu ajutorul unui film adeziv, acesta ntinzndu-se ct mai
bine pe toat suprafaa n vederea asigurrii unei bune etaneizri;
- Se aeaz placa n incubatorul de microplci timp de 90 minute la 37C;
- Se prepar soluia de lavaj prin diluare 1:10. Se pregtesc 200 ml pentru dou
barete, respectiv 20 ml de soluie de lavaj concentrat la 180 ml de ap
distilat;
- Se ndeprteaz filmul adeziv i se aspir coninutul tuturor godeurilor;
- Coninutul aspirat se depune ntr-o soluie de hipoclorit de sodiu 2%, iar splarea
godeurilor se repet de 5 ori cu cca. 300 l soluie de splare / godeu;
Ingrid Apetrei, Mihai Mare


171
C
a
p
i
t
o
l
u
l

- Se usuc baretele prin ntoarcere pe o hrtie absorbant i se lovesc uor pentru


eliminarea n totalitate a soluiei de splare;
- Prepararea soluiei revelatoare prin diluarea de 50 ori a soluiei cromogene
concentrate n soluia tampon peroxidaz ( e.g. 160 l soluie cromogen n 8
ml de reactiv tampon substrat de peroxidaz) i distribuirea rapid a acesteia,
200 l n toate godeurile. Reacia este lsat s se desfoare n obscuritate
timp de 30 minute, la temperatura ambiant;
- Se stopeaz reacia enzimatic prin adugarea a 100 l soluie de stopare n
fiecare godeu;
- Se citete densitatea optic la 450 / 620 nm pe parcursul celor 30 de minute de la
stoparea reaciei.

7.4.6. Maniera de calcul i interpretarea rezultatelor

Valori ale densitii optice ateptate:
- la 0,5 ng/ml, DO va fi de 0,300 1,100;
- pentru concentraia de manan a controlului pozitiv, valorile sunt cele indicate pe
flacon 20%;
- raportul DO privind etaloanele trebuie s fie mai mare de 2,1.

Trasarea curbei etalon

Curba etalon este realizat n baza a patru repere: 2, 1, 0,5, 0,25 ng/ml. Astfel
se traseaz o curb cu diferite puncte reprezentate de cantitile amintite, pe abscis
concentraiile de manan n ng/ml i pe ordonat densitatea optic.

Determinarea concentraiei n manan a serurilor de testat i interpretarea
rezultatelor

Avnd ca punct de plecare valorile prestabilite trasate de curba etalon se poate
determina pentru fiecare prob de ser concentraia n manan exprimat n ng/ml.
- Mananemia cu valori mai mici de 0,25 ng/ml se consider rezultat negativ;
- n intervalul 0,25 ng/ml 0,5 ng/ml vorbim de un rezultat echivoc, altfel spus
incert;
- Dac valorile constatate depesc sau sunt egale cu pragul de 0,5 ng/ml, rezultatul
este pozitiv.

Toate rezultatele pozitive vor trebui confruntate cu simptomatologia observat
clinic i corelate cu alte tehnici n vederea stabilirii unui diagnostic fr echivoc de
candidoz invaziv, fapt ce va fi urmat de instituirea unei medicaii antifungice.






Tehnici de seromicologie


172
Fig. nr. 7-2. Testul de latex-aglutinare
BICHRO-DUBLI. Aspectul testului
pozitiv (C.dubliniensis) i negativ
(C.albicans).
7.5. Identificarea speciei Candida dubliniensis prin latex-aglutinare
(BICHRO-DUBLI, Fumouze)


Un test expeditiv, perfect adaptat pentru utilizarea n laboratoarele clinice n
vederea diferenierii speciilor C. albicans i C. dubliniensis, este testul de latex-
aglutinare Bichro-Dubli (Fumouze Frana). Acest test folosete particule de latex
sensibilizate cu anticorpi monoclonali specifici unui antigen de suprafa ntlnit
doar la C. dubliniensis.

Tehnica de lucru
- Se depun cte 20 l reactiv n fiecare cerc al cardului de testare;
- Se stabilesc prin numerotare locurile pentru martorul pozitiv (o tulpin de C.
dubliniensis), martorul negativ (o tulpin de C. albicans) i proba de testat (o
tulpin de interes clinic, pozitiv la testul de filamentare);
- Cu ajutorul unei anse microbiologice se preleveaz pe rnd cte 2-3 colonii din
tulpinile respective;
- Se suspensioneaz coloniile n reactivul adugat n prealabil astfel nct s se
obin un amestec omogen;
- Se imprim cardului de testare o micare circular lent, timp de 3-5 minute;
- Se noteaz eventuala apariie a aglutinrii la proba de testat (similar martorului
pozitiv);
-Proba pozitiv este indicat de apariia unui aspect granular (aglomerri bleu pe
fond roz sau violet) datorat particulelor de latex care au aderat la celulele de C.
dubliniensis.




Ingrid Apetrei, Mihai Mare


173
C
a
p
i
t
o
l
u
l

Bibliografie selectiv

1. Aketagawa J, Tanaka S, Tamura H, Shibata Y, Saito H (1993) - Activation
of Limulus coagulation factor G by several (1,3)--D-glucans: Comparison
of the potency of glucans with identical degree of polymerization but
different conformations; J Biochem; 113:683-686.
2. Alexander B (2002) - Diagnosis of fungal infection: new technologies for
the mycology laboratory; Transpl Infectious Dis; 4 (Suppl. 3):32-37.
3. Becker M J, de Marie S, Willemse D, Verbrugh H A, Bakker-
Woudenberg I A J M (2000) - Quantitative galactomannan detection is
superior to PCR in diagnosing and monitoring invasive pulmonary
aspergillosis in an experimental rat model; J Clin Microbiol; 38:1434-
1438.
4. Bretagne S, Costa J-M, Marmorat-Khuong A et al. (1995) - Detection of
Aspergillus species DNA in bronchoalveolar lavage samples by
competitive PCR; J Clin Microbiol; 33:1164-1168.
5. Bretagne S, Costa J-M, Bart-Delabesse E et al. (1997) - Comparison of
serum galactomannan antigen detection and competitive polymerase chain
reaction for diagnosing invasive aspergillosis; J Clin Infect Dis; 26:1407-
1412.
6. Chambon-Pautas C, Costa J-M, Chaumette M-T, Cordonnier C, Bretagne
S (2001) - Galactomannan and polymerase chain reaction for the
diagnosis of primary digestive aspergillosis in a patient with acute myeloid
leukaemia; J Infect; 43:213-214.
7. Costa C, Costa J-M, Desterke C, Botterel F, Cordonnier C, Bretagne S
(2002) - Real-time PCR coupled with automated DNA extraction and
detection of galactomannan antigen in serum by enzyme-linked
immunosorbent assay for diagnosis of invasive aspergillosis; J Clin
Microbiol; 40:2224-2227.
8. Erjavec Z, Verweij P E (2002) - Recent progress in the diagnosis of fungal
infections in the immunocompromised host; Drug Resist; 5:3-10.
9. Faille C, Mackenzie D W, Michalski J C, Poulain D (1992) - Evaluation
of an enzyme immunoassay using neoglycolipids constructed from
Candida albicans oligomannosides to define the specificity of anti-mannan
antibodies; Eur J Clin Microbiol Infect; 11:438-446.
10. Fishman J A , Rubin R H (1998) - Infection in organ-transplant recipients;
New England Journal of Medicine; 338(24):1741-1751.
11. Freydiere A M, Guinet R, Boiron P (2001) - Yeast identification in the
clinical microbiology laboratory: phenotypical methods; Med Mycol;
39:9-33.
12. Fukazawa Y (1989) - Antigenic structure of Candida albicans.
Immunochemical basis of the serological specificity of the mannans in
yeasts; Immunol Ser; 47:37-62.
13. Georges E, Garrigues M L, Stynen D, Poirot J L (1991) - Spcificit in
vitro d'un anticorps monoclonal (Acm) anti-mannane et du latex sensibilis
Tehnici de seromicologie


174
par cet anticorps au cours de la candidose dissmine exprimentale; J
Mycol Med; 118:21-24.
14. Hashiguchi K, Niki Y, Soejima R (1994) - Cyclophosphamide induces
false-positive results in detection of Aspergillus antigen in urine; Chest;
105:975-976.
15. Hashimoto A , Yamakami Y, Kamberi P et al. (1998) - Comparison of
PCR, (1-3)-beta-D-glucan and galactomannan assays in sera of rats with
experimental invasive aspergillosis; J Clin Lab Anal; 12:257-262.
16. Hebart H, Loeffler J, Kanz L, Einsele H (2000) - Molecular methods in
the diagnosis of infections in the immunocompromised host; Curr Opin
Infect Dis; 13:355-359.
17. Hyams K C (1998) - Developing case definitions for symptom-based
conditions: the problem of specificity; Epidemiol Rev; 20:148-156.
18. Iwanaga S, Morita T, Nakamura T, Aketagawa J (1986) - The hemolymph
coagulation system in invertebrate animals; J. Protein Chem; 5: 255-268
19. Jacquinot P M , Plancke Y, Sendid B, Strecker G, Poulain D (1998) -
Nature of Candida albicans-derived carbohydrate antigen recognized by a
monoclonal antibody in patient sera and distribution over Candida species;
FEMS Microbiol Lett;169:131-138.
20. Jacquinot P M, Plancke Y, Sendid B, Strecker G, Poulain D (1998) -
Nature of Candida albicans-derived carbohydrate antigen recognized by a
monoclonal antibody in patient sera and distribution over Candida species;
FEMS Microbiol Lett;169:131-138.
21. Jarvis W R (1995) - Epidemiology of nosocomial fungal infections, with
emphasis on Candida species; Clin Infect Dis; 20:1526-1530.
22. Kappe R (1989) - Coexistence of free antigens, free antibodies and
immune complexes in sera from patients with suspected deep-seated
candidosis; Mycoses; 32:24-32.
23. Kato A, Takita T, Furuhashi M et al. (2001) - Elevation of blood (1,3)--
D-glucan concentrations in hemodialysis patients; Nephron; 89:15-19.
24. Kawamura S, Maesaki S, Noda T et al. (1999) - Comparison between
PCR and detection of antigen in sera for diagnosis of pulmonary
aspergillosis; J Clin Microbiol; 37:218-220.
25. Kontoyiannis D P, Vaziri I, Hanna H A et al. (2001) - Risk factors for
Candida tropicalis fungemia in patients with cancer; Clin Infect Dis;
33:1676-1681.
26. Kurzai O, Heinz W J, Sullivan D J et al. (1999) - Rapid PCR test for
discriminating between Candida albicans and Candida dubliniensis
isolates using primers derived from the pH-regulated PHR1 and PHR2
genes of C.albicans; J Clin Mircobiol; 37:1587-1590.
27. Latge J P (1999) - Aspergillus fumigatus and aspergillosis; J Clin
Microbiol; 12:310-340.
28. Lescher-Bru V, Cavalier A, Pernot-Marino E et al. (1998) - Aspergillus
galactomannan antigen detection with Platelia

Aspergillus: multiple
positive antigenemia without Aspegillus infection; J Mycol Med; 8:112-
113.
Ingrid Apetrei, Mihai Mare


175
C
a
p
i
t
o
l
u
l

29. Loeffler J, Herbart H, Sepe S (1998) - Detection of PCR - amplified


fungal DNA by using a PCR-ELISA system; Med Mycol; 36:275-279.
30. Loeffler J, Schmidt K, Hebart H, Schumacher U, Einsele H (2002) -
Automated extraction of genomic DNA from medically important yeast
species and filamentous fungi by using the MagNA Pure LC system; J
Clin Microbiol; 40:2240-2243.
31. Maertens J, Verhaegen J, Lagrou K, Van Eldere J, Boogaerts M (2001) -
Screening for circulating galactomannan as a noninvasive diagnostic tool
for invasive aspergillosis in prolonged neutropenic patients and stem cell
transplantation recipients: a prospective validation; Blood; 97:1604-1610.
32. Maertens J, Van Eldere J, Verhaegen J et al. (2002) - Use of circulating
galactomannan screening for early diagnosis of invasive aspergillosis in
allogeneic stem cell transplant recipients; J Infect Dis; 186:1297-1306.
33. Manso E, Montillo M, De Sio G et al (1994) - Value of antigen and
antibody detection in the serological diagnosis of invasive aspergillosis in
patients with haematological malignancies; Eur J Clin Microbiol Infect
Dis; 13:756-760.
34. Mitsuya M, Wada K, Yamaguchi H (1994) - In vitro studies on the release
of G Test-positive (1,3)--D-glucans from various fungal pathogens; In
Committee on Organic Dusts, ICOH, Report 1/94, Rylander R, Goto H.
(eds.); 29-37.
35. Miyazaki T, Kohno S, Mitsutake K et al. (1995) - Plasma (1-3)--d-
glucan and fungal antigenemia in patients with candidemia, aspergillosis,
and cryptococcosis; J Clin Microbiol; 33:3115-3118.
36. Morace G, Pagano L, Sanguinetti M et al. (1999) - PCR-restriction
enzyme analysis for detection of Candida DNA in blood from febrile
patients with haematological malignancies; J Clin Microbiol; 37:1871-
1875.
37. Morace G, Sanguinetti M, Posteraro B, Lo Cascio G, Fadda G (1997) -
Identification of various medically important Candida species in clinical
specimens by PCR-restriction enzyme analysis; J Clin Microbiol; 35:667-
672.
38. Obayashi T (1995) - Plasma (1,3)-beta-glucan measurement in diagnosis
of invasive deep mycosis and fungal febrile episodes; Lancet; 345:17-20.
39. Obayashi T, Yoshida M, Mori T, et al. (1995) - Plasma measurement in
diagnosis of invasive deep mycosis and fungal febrile episodes; Lancet;
345: 17-20.
40. Odabasi Z , Mattiuzzi G, Estey E, et al. (2004) - -D-glucan as a
diagnostic adjunct for invasive fungal infections: Validation, cutoff
development, and performance in patients with Acute Myelogenous
Leukemia and Myelodysplastic Syndrome; Clin Infect Dis; 39:199-205.
41. Pfaller M A, Jones R N, Doern G V et al. (1999) - International
surveillance of blood stream infections due to Candida species in the
European SENTRY program: species distribution and antifungal
susceptibility including the investigational triazole and echinocandin
agents; Diagn Microbiol Infect Dis; 35:19-25.
Tehnici de seromicologie


176
42. Pfaller M A, Jones R N, Doern G V et al. (2000) - Bloodstream infections
due to Candida species: SENTRY antimicrobial surveillance program in
North America and Latin America, 1997-1998; Antimicrob Agents
Chemother; 44:747-751.
43. Pinel C, Fricker-Hidalgo H, Lebeau B et al. (2003) - Detection of
circulating Aspergillus fumigatus galactomannan: value and limits of the
Platelia test for diagnosing invasive aspergillosis; J Clin Microbiol;
41:2184-2186.
44. Podzorski R P, Gray G R, Nelson R D (1990) - Different effects of native
Candida albicans mannan and mannan-derived oligosaccharides on
antigen-stimulated lymphoproliferation in vitro; J Immunol; 144:707-716.
45. Ponton J, Quindos G (2002) - Non-culture-based diagnostics, In R. A.
Calderone (ed.), Candida and candidiasis; American Society for
Microbiology; 393-425.
46. Reiss E, Morrison C J (1993) - Nonculture methods for diagnosis of
disseminated candidiasis; Clin Microbiol Rev; 6:311-323.
47. Richardson M D, Kokki M H (1999) - New Perspectives in the diagnosis
of systemic fungal infections; Ann Med; 31:327-333.
48. Saito H, Yoshioka Y, Uehara N (1991) - Relationship between
conformation and biological response for (1,3)--Dglucans in the
activation of coagulation factor G from Limulus amebocyte lysate and
host-mediated antitumor activity. Demonstration of single-helix
conformation as a stimulant; Carbohydrate Res; 217:181-190.
49. Sanguinetti M, Posteraro B, Pagano L et al. (2003) - Comparison of real-
time PCR, conventional PCR and galactomannan antigen detection by
enzyme-linked immunosorbent assay using bronchoalveolar lavage fluid
samples from hematology patients for diagnosis of invasive pulmonary
aspergillosis; J Clin Microbiol; 41:3922-3925.
50. Sendid B, Poirot J L, Tabouret M et al. (2002) - Combined detection of
mannanaemia and antimannan antibodies as a strategy for the diagnosis of
systemic infection caused by pathogenic Candida species; J Med
Microbiol; 51:433-442.
51. Sendid B, Tabouret M, Poirot J L et al. (1999) - New enzyme
immunoassays for sensitive detection of circulating Candida albicans
mannan and antimannan antibodies: useful combined test for diagnosis of
systemic candidiasis; J Clin Microbiol; 37:1510-1517.
52. Sendid B, Tabouret M, Poirot J L, Mathieu D, Fruit J, Poulain D (1999) -
New enzyme immunoassays for sensitive detection of circulating Candida
albicans mannan and antimannan antibodies: useful combined test for
diagnosis of systemic candidiasis; J. Clin. Microbiol; 37:1510-1517.
53. Skladny H, Buchheidt D, Baust C et al. (1999) - Specific detection of
Aspergillus species in blood and bronchoalveolar lavage samples of
immunocompromised patients by two-step PCR; J Clin Microbiol;
37:3865-3871.
54. Stynen D, Sarfati J, Symoens F, Goris A, Nolard N, Latge J-P (1991) -
Rat monoclonal antibodies against exocellular carbohydrate antigens of
Ingrid Apetrei, Mihai Mare


177
C
a
p
i
t
o
l
u
l

Aspergillus and dermatophytes; Latge J-P, Boucias D (eds.), Fungal cell


wall and immune response; Springer - Verlag; 181-193.
55. Sulahian A,Touratier S, Ribaud P (2003) - False positive test for
Aspergillus antigenaemia related to concomitant administration of
piperacillin and tazobactam; N Engl J Med; 349:2366-2367.
56. Suzuki S (1997) - Immunochemical study on mannans of genus Candida. I.
Structural investigation n of antigenic factors 1, 4, 5, 6, 8, 9, 11, 13, 13b
and 34. Curr. Top; Med Mycol; 8:57-70.
57. Swanink C, Meis J F G, Rijs A J M M, Donnelly J P, Verweij P E (1997) -
Specificity of a sandwich enzyme-linked immunosorbent assay for
detecting Aspergillus galactomannan; J Clin Microbiol; 35:257-260.
58. Tamura H, Tanaka S, Obayashi T, Yoshida M, Kawai T (1992) - A new
sensitive microplate assay of plasma endotoxin; J Clin Lab Anal;
6(4):232-238.
59. Tanaka S, Aketagawa J, Takahashi S, Tsumuraya Y, Hashimoto Y (1991) -
Activation of a Limulus coagulation factor G by (1,3)--D-glucans;
Carbohydrate Res; 218:167-174.
60. Trinel P A, Faille C, Jacquinot P M, Cailliez J C, Poulain D (1992) -
Mapping of Candida albicans oligomannosidic epitopes by using
monoclonal antibodies; Infect Immun;60:3845-3851.
61. van Burik J, Myerson D, Schreckhise R, Bowden R (1998) - Panfungal
PCR assay for detection of fungal infection in human blood specimens; J
Clin Microbiol; 36:1169-1175.
62. Verweij P E, Figueroa J, van Burik J, Holdom M D, Del-Cas E, Gmez B-
L, Mendes-Giannini M-J (2000) - Clinical applications of non-culture
based methods for the diagnosis and management of opportunistic and
endemic mycoses; Med Mycol; 38:(Suppl. 1):161-171.
63. Verweij P E, Meis J F (2000) - Microbiological diagnosis of invasive
fungal infections in transplant recipients; Transplant Infect Dis; 2:80-87.
64. Walsh T J, Groll A H (1999) - Emerging fungal pathogens: evolving
challenges to immunocompromised patients for the twenty-first century;
Transpl Infectious Dis;1:247-261.
65. Yeo S F, Wong B (2002) - Current status of non-culture methods for
diagnosis of invasive fungal infections; Clin Microbiol Rev;15:465-484.
66. Yera H, Sendid B, Francois N, Camus D, Poulain D (2001) - Contribution
of serological tests and blood culture to the early diagnosis of systemic
candidiasis; Eur J Clin Microbiol Infect Dis; 20:864-870.


Mihai Mare, Olimpia Bazgan


179
C
a
p
i
t
o
l
u
l





Mihai Mare, Olimpia Bazgan

ungii prezint o serie de nsuiri metabolice i eco-fiziologice care pot fi
utile n demersul de identificare a speciei, n special pentru discriminarea
ntre specii cu caractere culturale i aspecte microscopice similare. Evaluarea prezenei
sau absenei acestor nsuiri se realizeaz prin punerea n practic a unor teste cum ar fi
cele biochimice i cele fiziologice.
Aceste teste sunt mijloace absolut necesare n laboratorul clinic, n special
pentru identificarea levurilor de interes medical. Dei importana lor este covritoare
i unanim recunoscut, aceste teste nu reuesc de fiecare dat s elucideze cu exactitate
apartenena taxonomic a unei anumite tulpini i sunt necesare teste suplimentare, n
principal de biologie molecular, pentru identificarea acesteia. Deoarece testele de
biologie molecular bazate pe analiza ADN-ului sunt accesibile doar laboratoarelor din
Centrele de Referin i sunt relativ costisitoare, utilizarea profilul biochimic i a
caracterelor morfologice reprezint o soluie acceptabil pentru laboratoarele clinice,
rspunznd de manier satisfctoare cerinelor de diagnostic din spitale i ambulatorii
de specialitate. Profilul biochimic cuprinde datele obinute prin efectuarea unei
multitudini de teste, ntre care cele mai importante sunt redate n continuare.

8.1. Fermentarea zaharurilor

Utilizarea metabolic a zaharurilor n condiii de anaerobioz presupune
cultivarea levurilor pe medii minimale coninnd 0,3% extract de drojdie i 0,5%
pepton, aditivate cu un anumit substrat glucidic n proporie de 2%. Interpretarea se
face pe baza dioxidului de carbon acumulat n tubuleele Durham introduse n mediu.
Cele mai utilizate zaharuri sunt: D-glucoza, D-galactoza, maltoza, sucroza, rafinoza,
trehaloza i D-xiloza. Acest test este util n diferenierea diverselor specii aparinnd
genului Candida, dar nu i a levurilor din genurile Cryptococcus i Rhodotorula care
sunt nefermentative.





F
8
Teste biochimice i fiziologice
Teste biochimice i fiziologice


180
8.2. Capacitatea de asimilare a surselor de carbon

Abilitatea levurilor de a crete pe diverse medii n prezena anumitor substane
chimice adugate ca unic surs de carbon, poart numele de auxanogram.
Substanele folosite pentru acest test sunt mai numeroase i mai diverse n ceea ce
privete complexitatea structural:
- hexoze: D-glucoz, D-galactoz, L-ramnoz, L-sorboz;
- pentoze: D-xiloz, D-riboz, L-arabinoz, D-arabinoz;
- dizaharide: sucroz, maltoz, celobioz, trehaloz, lactoz, melibioz;
- trizaharide: rafinoz, melezitioz;
- polizaharide: amidon solubil, inulin;
- alcooli: eritritol, adonitol, D-manitol, m-inozitol, metanol, etanol, glicerol, glicol,
1,2-propandiol, 2,3-butandiol, dulcitol, D-sorbitol;
- acizi organici: succinat, citrat, DL-lactat, D-gluconat, D-glucuronat, 2-ceto-D-
gluconat, 5-ceto-D-gluconat;
- ali compui: D-glucozamin HCl, N-acetil-glucozamin.

8.3. Capacitatea de asimilare a surselor de azot

Principiul acestui test este similar cu cel al testului anterior. Sursele de azot
testate sunt: nitraii, etilamina, L-lizina, cadaverina, nitriii, creatina, creatinina. Testul
de asimilare a nitratului de sodiu este important pentru diferenierea levurilor
aparinnd genurilor Cryptococcus i Rhodotorula prin determinarea activitii nitrat-
reductazei cu anumii ageni revelatori de tipul acidului sulfanilic i alfa-naftilaminei.

8.4. Testul de hidroliz a ureei (producerea de ureaz) la levuri

Scop
Acest test pune n eviden capacitatea unor levuri de a produce enzima numit
ureaz. Se folosete pentru identificarea prezumtiv a levurilor aparinnd genurilor
Cryptococcus, Rhodotorula i Trichosporon.

Tehnic de lucru
Se folosesc medii lichide care conin uree i un indicator (rou-fenol): bulion
Christensen preparat n laborator, medii gata de utilizare comercializate de diverse
firme (BD Diagnostics, BioMrieux, Remel etc.). n urma scindrii ureei de ctre
ureaza secretat de levuri, se produce o cretere a pH-ului prin eliberarea amoniacului,
fapt semnalat de virarea culorii indicatorului de la galben-chihlimbar la roz-rou.
Se nsmneaz 0,5 ml mediu de testare cu o ans ncrcat de celule,
prelevat din cultura levurii de identificat. n paralel, se nsmneaz obligatoriu un
martor pozitiv (Cryptococcus neoformans) i unul negativ (Candida albicans).
Rezultatele se citesc dup 3, respectiv 24 ore de incubare la 37C. Interpretare: testul
este pozitiv pentru genurile Cryptococcus, Rhodotorula, Trichosporon i negativ
pentru Blastoschizomyces, Candida i Geotrichum.


Mihai Mare, Olimpia Bazgan


181
C
a
p
i
t
o
l
u
l

Precauii
Tulpina de testat trebuie s fie necontaminat bacterian, deoarece se pot
produce erori prin interferarea reaciei.

8.5. Testul de hidroliz a ureei (producerea de ureaz) la dermatofii

Scop
Pune n eviden producerea de ureaz de ctre dermatofii, prin cultivare pe
bulion sau agar Christensen. n cazul producerii acestei enzime, ureea din mediu este
descompus cu generare de amoniac care va modifica pH-ul mediului (alcalinizare),
fenomen indicat de schimbarea culorii indicatorului; astfel, culoarea mediului va vira
de la galben-orange la roz-rou (fig. nr. 8-1, vezi Anexa).

Tehnic de lucru
Mediul solid, turnat n pant, se inoculeaz ntr-un singur punct, cu tulpina de
analizat. n paralel, se inoculeaz un martor pozitiv (e.g. T. mentagrophytes) i un
martor negativ (e.g. T. verrucosum). Dup inoculare, mediul se incubeaz la 25-30C,
timp de pn la 7 zile.

Testul ureazei este:
- pozitiv pentru urmtoarele specii de dermatofii M. canis, M. cookei, M.
gypseum, M. nanum, M. persicolor, M. praecox, T. ajelloi, T. mentagrophytes
(ambele varieti) i T. Terrestre;
- slab pozitiv pentru urmtoarele specii de dermatofii E. floccosum i rar M.
canis;
- variabil (inconstant pozitiv sau negativ, n funcie de tulpin) pentru urmtoarele
specii de dermatofii M. audouinii, T. rubrum, T. schoenleinii, T. tonsurans i
T. violaceum;
- negativ pentru urmtoarele specii de dermatofii M. ferrugineum, T.
concentricum i T. verrucosum.

Precauii
Este obligatorie absena contaminrii bacteriene a culturii dermatofitului din
care se fac pasajele pe mediul Christensen.

8.6. Testarea rezistenei la cicloheximid

Testul se refer la abilitatea levurilor de a se dezvolta pe medii de cultur
coninnd dou concentraii de cicloheximid 0,01%, respectiv 0,1%. Aceste
concentraii pot fi critice pentru anumite specii, supresndu-le total sau parial
dezvoltarea, sau dimpotriv, pot fi permisive pentru altele, creterea lor nefiind deloc
stnjenit.




Teste biochimice i fiziologice


182
8.7. Producerea de fenol-oxidaz

Producerea acestei enzime este detectat cu ajutorul unor discuri impregnate
cu acid cafeic (Caffeic Acid Disk, Remel SUA) sau prin cultivarea levurilor pe medii
bogate n polifenoli de tip acid cafeic (Agar pe baz de extract din semine de Niger
sau Agar cu acid cafeic i citrat feric) i permite identificarea speciei Cryptococcus
neoformans pe baza unei reacii de culoare. Sub aciunea fenol-oxidazei, care
catalizeaz oxidarea polifenolilor i transformarea lor n pigment melanic, apare o
brunificare a discului ntr-un interval de aproximativ 4 ore de incubare la 30C,
respectiv colonii brune pe mediile amintite, dup 48-72 ore (fig. nr. 8-2, vezi Anexa).

8.8. Testarea producerii altor enzime

Enzime cum ar fi -galactozaminidaza, L-prolin-aminopeptidaza etc., sunt
evideniabile prin cultivarea levurilor pe medii cromogene: CandiSelect 4 (fig. nr. 8-
3, vezi Anexa), Candichrom

II, Albicans ID2 agar, CHROMagar Candida (fig. nr. 8-4,


vezi Anexa), Oxoid Chromogenic Candida Agar (fig. nr. 8-5, vezi Anexa).
Diferite combinaii ale acestor nsuiri biochimice au fost folosite pentru
conceperea unor teste comercializabile, utile pentru identificarea rapid a speciilor
levurice de interes medical n laboratoarele clinice. Aceste teste pot identifica un
numr diferit de specii, dup cum urmeaz:
- o singur specie: Caffeic Acid Disk (Remel), C. albicans Screen (Remel), Rapid
Trehalose Assimilation (Remel), RTT Glabrata (Fumouze);
- cteva specii: CandiSelect (Bio-Rad), CHROMagar Candida (BD Sciences),
Candida ID2 (bioMrieux), Candichrom II (International Microbio),
Chromogenic Candida Agar (Oxoid);
- specii multiple (zeci de specii din cteva genuri): ID 32C (bioMrieux), RapID
Yeast Plus Panel (Remel), Uni-Yeast Tek Plates (Remel), Auxacolor 2 (Bio-
Rad) (fig. nr. 8-6 i 8-7, vezi Anexa), Microplate (Biolog) (fig. nr. 8-8, vezi
Anexa).

8.9. Testul de depistare a necesitilor nutritive speciale

Unele specii de dermatofii au exigene nutritive particulare, reclamnd
prezena n mediile de cultur a unor factori trofici ca vitaminele (acid nicotinic,
inozitol, tiamin) sau aminoacizii (histidin). Testul presupune cultivarea suei de
identificat pe un set de 7 medii (Trichophyton Agar) notate 1...7:

1. mediu bazal ce conine cazein, fr vitamine;
2. 1 + inozitol;
3. 1 + inozitol + tiamin;
4. 1 + tiamin;
5. 1 + acid nicotinic;
6. mediu bazal coninnd nitrat de amoniu, fr aminoacizi;
7. 6 + histidin.

Mihai Mare, Olimpia Bazgan


183
C
a
p
i
t
o
l
u
l

Acest set de medii este disponibil comercial: Trichophyton Agar 1-7 (Remel,
BD Diagnostics).
Tuburile cu cele 7 medii se nsmneaz prin transferul unui mic fragment din
colonia de testat, avnd grij s nu se preleveze i poriuni de mediu. Ele se incubeaz
apoi la 25-30C sau la 37C (cnd se suspicioneaz T. verrucosum), timp de 14 zile.
Interpretarea rezultatelor se face dup 7, respectiv 14 zile, innd cont de eventuala
stimulare a creterii pe mediile aditivate cu vitamine sau aminoacizi comparativ cu cea
observat pe mediile bazale (tabelul 8-1).

Tabelul 8-1
Comportamentul dermatofiilor pe setul de 7 medii aditivate cu factori trofici
Specia 1 2 3 4 5 6 7
E. floccosum + + + + +
M. audouinii + + + + + + +
M. canis + + + + + + + + + + + + + +
M. cookei + + + + + + +
M. ferrugineum + + + + + + + +
M. gypseum + + + + + + +
M. nanum + + + + + + + +
M. persicolor + + + + + + +
M. praecox + + + + + + +
T. ajelloi + + + + + + +
T. concentricum - + + + + + -
T. mentagrophytes
var. interdigitale
+ + + + + + + + + + + + + +
T. mentagrophytes
var. mentagrophytes
+ + + + + + + + + + + + + +
T. rubrum + + + + + + + + + + +, - + +
T. schoenleinii + + + + + + + +
T. terrestre + + + + + + +
T. tonsurans +, - +, - +, - + +, - + +, - , -
T. verrucosum - + + + - - -
T. violaceum +, - + + + + + + +
Legend: + (cretere normal), - (absena creterii), + + (cretere stimulat), (cretere disgonic)

8.10. Testul de cultivare pe Agar BCP lapte glucoz.

Scop
Permite observarea schimbrilor de pH datorit indicatorului (bromcrezol
purpur) inclus n mediu i ajut la diferenierea speciilor de dermatofii de interes
clinic.

Tehnic de lucru
Mediul, turnat n plci Petri sau flacoane cu capacitate de 25-30 ml (nclinat n
acest caz), se nsmneaz cu tulpina dermatofitului de identificat ntr-un singur punct.
Recipientele nsmnate se incubeaz la 30C timp de 5-10 zile, funcie de viteza de
cretere a fiecrei tulpini n parte. Alcalinizarea mediului n urma dezvoltrii culturii
Teste biochimice i fiziologice


184
dermatofitului va antrena virarea culorii acestuia, de la albastru-pal la violet-purpuriu.
Speciile capabile s alcalinizeze mediul sunt: E. floccosum, M. audouinii, T.
mentagrophytes (var. interdigitale), T. schoenleinii, T. terrestre, T. verrucosum, T.
violaceum. Unele specii (T. verrucosum) sunt capabile s hidrolizeze cazeina din lapte,
producnd o clarificare a mediului n jurul coloniei.

Precauii
Trebuie s ne asigurm c tulpina de testat nu este impurificat cu alte
microorganisme (bacterii sau fungi) care ar putea da reacii pozitive eronate.

8.11. Testul de perforare a firului de pr in vitro

Scop
Diferenierea speciilor de dermatofii de interes clinic pe baza producerii
organelor perforatoare in vitro.

Tehnic de lucru
Se utilizeaz fire de pr de copil, care se cupeaz n fragmente de 0,5-1 cm i
se autoclaveaz n plci Petri timp de 10 minute la 121C. Dup autoclavare, se adaug
n fiecare plac cte 25 ml ap distilat sterilizat i cteva picturi extract de drojdie
10%. Plcile astfel pregtite se nsmneaz cu cteva fragmente din colonia
dermatofitului de identificat, apoi se incubeaz la 25C, timp de 21 zile. La fiecare 7
zile, utiliznd fragmente de pr inoculate, se pregtesc preparate extemporanee (cu
lichid clarificant, ntre lam i lamel). O alt variant, ar fi etalarea unor fragmente de
0,5-1,5 cm din firele de pr autoclavate direct pe suprafaa coloniilor dezvoltate pe
Agar Sabouraud i continuarea incubrii timp de 21 zile. Testul pozitiv este indicat de
prezena organelor perforatoare care strbat tija pilar din loc n loc, avnd traiect
perpendicular pe aceasta (fig. nr. 8-9, vezi Anexa). Comportamentul speciilor de
dermatofii la acest test este prezentat n tabelul 8-2.

Tabelul 8-2
Comportamentul speciilor de dermatofii la testul de perforare a firului de pr
Test de perforare pozitiv Test de perforare negativ Test de perforare variabil
M. canis M. audouinii E. floccosum
M. cookei M. praecox T. erinacei
M. gypseum T. equinum T. tonsurans
M. persicolor T. concentricum
T. ajelloi M. ferrugineum
M. galinae T. rubrum
M. nanum T. schoenleinii
T. terrestre T. verrucosum
T. mentagrophytes T. violaceum
T. soudanense




Mihai Mare, Olimpia Bazgan


185
C
a
p
i
t
o
l
u
l


8.12. Testul de cultivare pe boabe de orez

Scop
Este util pentru diferenierea M. audouinii (cretere restrictiv, pigment brun-
maroniu, absena sporulrii) de M. canis (cretere abundent, pigment galben,
sporulare intens) (fig. nr. 8-10, vezi Anexa). Aceast metod este util i pentru
inducerea sporulrii unor tulpini dermatofitice nesporulate, disgonice sau cu sporulare
atipic.

Tehnic de lucru
Mediul se prepar n flacoane Erlenmeyer cu capacitate de 100 ml, n care se
adaug 8 g orez decorticat i 25 ml ap distilat. Se sterilizeaz prin autoclavare la
121C timp de 15 minute. Dup inoculare, flacoanele se incubeaz la 25-30C timp de
pn la 2 sptmni.

8.13. Testul de filamentare (testul de blastez sau germ-tube test)

Scop
Test tip screening pentru trierea izolatelor de levuri n laboratorul clinic i
identificarea prezumtiv a tulpinilor de C. albicans i C. dubliniensis.

Tehnic de lucru
Ca medii pentru blastez se utilizeaz serul sanguin de cal, serul sanguin uman
(Atenie! Risc crescut de contaminare cu HIV, HVB) sau medii artificiale
comercializate de diverse firme (Germ Tube Solution Remel, SUA). n fiole cu
capacitatea de 2 ml se pun n contact 0,5 ml suspensie levuric i 0,5 ml ser sanguin de
cal. Fiolele se menin apoi n baia de termostatare la 36C timp de 2 ore. Suspensia
levuric se prepar n soluie salin fiziologic, densitatea acesteia ajustndu-se la 0,5
Mc Farland (cca. 10
5
-10
6
celule/ml). Dup expirarea celor 2 ore, fiolele se agit i din
fiecare amestec se preleveaz un volum de 25 l care se etaleaz apoi ntre lam i
lamel. Preparatul extemporaneu astfel obinut se examineaz la microscop n vederea
decelrii tubilor germinativi caracteristici tulpinilor de Candida albicans i Candida
dubliniensis filamente scurte care emerg din blastospor fr trangulare (fig. nr. 8-11,
vezi Anexa). Ca martor al filamentrii, se utilizeaz de fiecare dat o tulpin-tip de
Candida albicans. Se va avea n vedere c i alte levuri pot produce formaiuni
similare de tipul pseudofilamentelor, ns ele se difereniaz de adevraii tubi
germinativi prin existena unei trangulri la locul de emergen din blastospor.

Precauii
Nu se recomand suspensionarea levurilor direct n mediul de blastez,
deoarece concentraia mare a acestora pe unitatea de volum scade sensibilitatea reaciei
prin diminuarea drastic a numrului de celule care vor produce tubi germinativi.
Nivelul rezultatelor fals negative este n mod normal de cca. 5%, ns el tinde s
creasc odat cu mrirea densitii suspensiei levurice.

Teste biochimice i fiziologice


186

8.14. Testul de termotoleran / termostimulare

Scop
Testul este folosit n special pentru diferenierea speciilor de dermatofii, dar
este aplicabil i n cazul altor fungi filamentoi sau levuriformi. Are la baz faptul c
unele specii de dermatofii tolereaz temperatura de 37C pentru dezvoltare (E.
floccosum, T. mentagrophytes, T. rubrum, T. schoenleinii, T. tonsurans, T. verrucosum,
T. violaceum), altele nu (T. ajelloi, T. terrestre etc.); n plus, pentru unele specii (T.
verrucosum, T. soudanense), temperatura de 37C acioneaz chiar stimulativ asupra
dezvoltrii coloniilor comparativ cu temperaturile mai sczute (25C, 30C).

Tehnic de lucru
n vederea studierii acestor caracteristici, se nsmneaz perechi de tuburi
coninnd Agar Sabouraud solidificat n pant cu tulpinile n cauz i se incubeaz
difereniat la 25 sau 30C i 37C (n cazul dermatofiilor), la 30C, 37C, 40C, 42C
i 45C (n cazul levurilor) i la 30C, 37C, 40C, 42C, 45C, 52C i 54C (n cazul
fungilor filamentoi) . Interpretarea testului se realizeaz n momentul cnd coloniile
ajung la maturitate pe mediile incubate la temperatura cea mai sczut (25-30C sau
37C). Principalele aspecte privind permisivitatea dezvoltrii la aceste temperaturi n
cazul unor specii de fungi de interes clinic sunt prezentate n tabelul 8-3.




























Mihai Mare, Olimpia Bazgan


187
C
a
p
i
t
o
l
u
l

Tabelul 8-3
Comportamentul diverselor specii de fungi la testul de termotoleran
Nr. crt. Specia 37C 40C 42C 45C 52C 54C
1 Absidia corymbifera + + + + + -
2 Cunninghamella bertholletiae + + + + + -
3 Mucor circinelloides + - - + - -
4 Mucor indicus + + + - - -
5 Rhizomucor variabilis + - - - - -
6 Rhizomucor pussilus + + + - - +
7 Rhizomucor miehei + + + + + +
8 Rhizopus azygosporus + + + + + -
9 Rhizopus microsporus + + + + - -
10 Rhizopus oryzae + + ? + + -
11 Saksenaea vasiformis + + + - - -
12 Syncephalastrum racemosum + + - - - -
13 Malassezia furfur + + - - - -
14 Malassezia pachydermatis + + - - - -
15 Malassezia sloofiae + + - - - -
16 Malassezia sympodialis + + - - - -
17 Arxiozyma telluris + + - - - -
18 Candida albicans + + + + - -
19 Candida chiropterorum + + - - - -
20 Candida dubliniensis + + + - - -
21 Candida glabrata + + + - - -
22 Candida kefyr + + - - - -
23 Candida krusei + + - - - -
24 Candida lusitaniae + + + - - -
25 Candida tropicalis + + - - - -
26 Geotrichum capitatum + + - - - -
27 Pseudoalescheria boydii + - - - -
28 Acremonium alabamense + + + + - -
29 Coccidioides immitis + + + - - -
30 Cladophialophora arxii + + - - - -
31 Cladophialophora bantiana + + - - - -
32 Emmonsia parva + + - - -
33 Epidermophyton floccosum + - - - - -
34 Exophiala dermatitidis + + - - - -
35 Trichophyton mentagrophytes + - - - - -
36 Trichophyton rubrum + - - - - -
37 Trichophyton schoenleinii + - - - - -
38 Trichophyton tonsurans + - - - - -
39 Trichophyton verrucosum + - - - - -
40 Trichophyton violaceum + - - - - -
41 Scedosporium prolificans + + - - - -
42 Sporothichum pruinosum + + + + - -
43 Aspergillus fumigatus + + + + v v
44 Bipolaris specifera + + - - - -
Legend: + (dezvoltare normal), ? (nu sunt date disponibile), v (rspuns variabil), - (absena dezvoltrii)
Teste biochimice i fiziologice


188
Bibliografie selectiv

1. Artal M E (2004) - Diagnstico histopatolgico de las micosis; Rev
Iberoam Micol; 21:1-9.
2. Barnett J A, Payne R W, Yarrow D (2000) - Yeasts: Characteristics and
Identification; 3
nd
edition; Cambridge University Press; Cambridge.
3. Bosnea D, Diaconescu V, Colar L et al. (2003) - Particularitile izolatelor
din hemoculturi la Centrul de Cardiologie Iai (2001-2003); Rev Med
Chir; 107-3(Supl.1):176-179.
4. Buiuc D (1998) - Microbiologie clinic; Ed. Didactic i Pedagogic RA;
Bucureti.
5. Buiuc D, Negu M (1999) - Tratat de microbiologie clinic; Ed. Medical;
Bucureri.
6. Coman I, Mare M (2000) - Micologie medical aplicat; Ed. Junimea;
Iai.
7. Fidel P L, Vazquez J A, Sobel J D (1999) - Candida glabrata: review of
epidemiology, pathogenesis and clinical disease with comparison to
Candida albicans; Clin Microbiol Rev ; 12(1):80-96.
8. Freydire A-M, Guinet R (1997) - Rapid methods for identification of the
most frequent clinical yeasts; Rev Iberoam Micol; 14:85-89.
9. Giammanco G M, Pizzo G, Pecorella S, Distefano S, Pecoraro V, Milici M
(2002) - Identification of Candida dubliniensis among oral yeastisolates
from an Italian population of human immunodeficiency virus-infected
(HIV+) subjects; Oral Microbiol Immunol; 17:89-94.
10. Golescu M (1997) - Diagnosticul i tratamentul micozelor interne; Ed.
Viaa Medical Romneasc; Bucureti.
11. Gorka B Z (2002) - Vulvovaginitis candidiasica; Rev Iberoam Micol;
19:22-24.
12. Grillot R (1996) - Les mycoses humaines dmarche diagnostique;
Elsevier; Paris.
13. Hazen K C, Howell S A (2003) - Candida, Cryptococcus and other yeasts
of medical importance; In Murray P (ed.) - Manual of clinical
microbiology; 8
th
edition.; ASM Press; Washington.
14. Hoog G S de, Guarro J (1995) - Atlas of clinical fungi; Centraalbureau
voor Schimmelcultures; Baarn.
15. Hoog G S de, Guarro J, Gen J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
16. Jabra-Rizk M A, Ferreira S M S, Sabet M et al.(2001) - Recovery of
Candida dubliniensis and other yeasts from human immunodeficiecy
virus-associated periodontal lesions; J Clin Microbiol ; 39(12):4520-4522.
17. Ribes J A, Vanover-Sams C L, Baker D J (2000) - Zygomycetes in Human
Disease; Clin Microbiol Rev; 13(2):236-301.
18. Salkin I F, Gordon M, Samsonoff W, Rieder C (1985) - Blastoschizomyces
capitatus, a new combination; Mycotaxon; 22:375-380.
Mihai Mare, Olimpia Bazgan


189
C
a
p
i
t
o
l
u
l

19. Samaranayake Y H, Samaranayake L P (1994) - Candida krusei: biology,


epidemiology, pathogenicity and clinical manifestations of an emerging
pathogen; J Med Microbiol; 41:295-310.
20. Silva V, Cabrera M, Diaz C M, Abarca C, German H (2003 a) -
Prevalencia de serotipos de Candida albicans en aislamientos de
hemocultivo en Chile y primer caso de candidemia por Candida
dubliniensis; Rev Iberoam Micol; 20:46-51.
21. Silva V, Zepeda G (2003 b) - First chilean report of nosocomial urinary
tract infection due to Trichosporon asahii, in 2 patients; Rev Med Chil;
131(4):461-463.
22. Smith A (2004) - Identifying Candida species - An increasing cause of
serious systemic infections; Eur Clin Lab; 23(6):12-15.
23. Sullivan D J, Westerneng T J, Haynes K A, Bennett D E, Coleman D C
(1995) - Candida dubliniensis sp. nov: phenothypic and molecular
characterisation of a novel species associated with oral candidosis in HIV-
infected individuals; Microbiol; 141:1507-1521.
24. Sullivan D, Moran G, Donnelly S, Gee S, Pinjon E et al. (1999) - Candida
dubliniensis: An update; Rev Iberoam Micol; 16:72-76.
25. Sutton D A, Fothergill A W, Rinaldi M G (1998) - Guide to clinically
significant fungi; Williams & Wilkins; Baltimore.
26. Warren G, Hazen K C (1995) - Candida, Cryptococcus and other yeasts
of medical importance n Fromtling R A - Mycology; VII
th
section;
Murray P R, Baron E J, Pfaller M A, Tenover F C, Yolken R A (eds.):
Manual of Clinical Microbiology; VI
th
ed.; ASM Press; Washington DC.




















Mihai Mare


191
C
a
p
i
t
o
l
u
l




Mihai Mare

9.1. Extracia ADN-ului pentru PCR

e prefer folosirea kit-urilor comercializate (e.g. High Pure PCR Template
Preparation Kit, Roche Diagnostics GmbH, Mannheim, Germany)
metodelor artizanale de extracie a ADN-ului. Recomandabil este ca fiecare laborator
s se familiarizeze i s foloseasc de rutin unul, cel mult dou metode / kit-uri de
extracie.

9.2. Extracia ADN-ului cu ajutorul kit-ului
High Pure Template Preparation Kit (levuri)

Principiul metodei
Reactivii acestui kit permit lizarea celulelor ntr-o scurt perioad de timp de
coincubare cu proteinaza K, n prezena unui inactivator al nucleazelor (guanidina
hidrocloric). Acizii nucleici precipit i ader la suprafaa unor fibre de sticl
existente ntr-un microtub, ceea ce ulterior va permite prezervarea lor n timpul
operaiunilor de splare-centrifugare destinate ndeprtrii moleculelor indezirabile. Nu
sunt necesare precipitri sau extracii suplimentare cu solveni organici.

Etape

1) din cultura tulpinii levurice (pe medii solide uzuale, veche de 24-48 ore)
se preleveaz o ans de 10 l bine ncrcat (aproximativ 10
8
- 10
9
celule);
2) se suspensioneaz levurile prelevate ntr-un ml ap purificat / distilat
sterilizat;
3) se centrifugheaz suspensia obinut 5 minute la 10000 rpm;
4) se ndeprteaz supernatantul, apoi se adaug peste sediment 200 l
Tissue lysis buffer (TLB);
5) se adaug 40 l proteinaz K;
6) se vortexeaz energic;
7) se incubeaz la 55C timp de 30 de minute;
8) se centrifugheaz imediat pentru a readuce n supernatant picturile de
condens aprute pe buon;
9) se adaug 200 l Lyis Binding Buffer (LBB);
S
9
Tehnici de micologie molecular
Tehnici de micologie molecular


192
10) se vortexeaz;
11) se incubeaz la 70C timp de 15 minute;
12) se repet etapa nr. 8;
13) se adaug 100 l izopropanol;
14) se vortexeaz;
15) se transfer n microcoloan (disponibil n kit);
16) se centrifugheaz 1 minut la 8000 rpm;
17) se nlocuiete tubul colector pentru microcoloan;
18) se adaug 450 l Inhibitor Removal Buffer;
19) se centrifugheaz 1 minut la 8000 rpm;
20) se repet etapa nr. 17;
21) se adaug 450 l Washing Buffer;
22) se centrifugheaz 2 minute la 13000 - 14000 rpm;
23) se aeaz microcoloana pe un tub Eppendorf de 1,5 ml;
24) se adaug exact n centrul microcoloanei 50 l Elution Buffer prenclzit
la 70C;
25) se centrifugheaz 1 minut la 8000 rpm;
26) se marcheaz corespunztor i se pstreaz la + 4C.

9.3. Extracia ADN-ului prin crioprecipitare (fungi filamentoi)

Principiul metodei
Celulele sunt lizate cu ajutorul cloroformului, dup care ADN-ul este precipitat
prin meninerea la temperaturi sczute.

Etape

1) ntr-un tub Eppendorf de 1 ml capacitate, coninnd 40-100 mg Kieselgel-
2, se introduc 300 l CTAB buffer;
2) se adaug apoi cu ajutorul unei spatule, o mic poriune din colonia de
analizat, care se fragmenteaz n poriuni ct mai mici;
3) se adaug 200 l CTAB buffer;
4) se vortexeaz;
5) se incubeaz la 65C, timp de 10 minute;
6) se adaug 500 l cloroform;
7) se vortexeaz;
8) se centrifugheaz 5 minute la 14000 rpm;
9) se transfer stratul superior ntr-un nou tub Eppendorf;
10) se adaug un volum dublu (aprox. 800 l) de alcool etilic absolut prercit
(+ 4C);
11) se agit uor;
12) se menine amestecul la 20C, minim 30 minute (chiar i pn a II-a zi),
pentru precipitarea ADN-ului;
13) se centrifugheaz 5-10 minute la 14000 rpm;
14) se las n repaus pentru decantare;
15) se spal precipitatul cu alcool etilic 70% rece;
Mihai Mare


193
C
a
p
i
t
o
l
u
l

16) se usuc timp de 10 minute ntr-o instalaie de vacuum;


17) se resuspend precipitatul n 97,5 l TE buffer cu 2,5 l ribonucleaz.

9.4. Controlul calitii acizilor nucleici extrai

Indicaii
Confirmarea calitii acizilor nucleici obinui n urma extraciei i a lipsei
degradrii acestora

Metoda
Electroforez n gel de agaroz

Etape

1 - Prepararea gelului de agaroz 1% n TAE 1x
a) se adaug pulberea de agar n soluia TAE, apoi se nclzete amestecul pe
o plit electromagnetic sau ntr-un cuptor cu microunde pn la
solubilizarea total;
b) se rcete cteva minute sub agitare continu;
c) se toarn gelul n suport, evitnd formarea de bule care pot afecta
migrarea ADN-ului i se las n repaus pn la solidificarea sa complet.
2 - Pregtirea probelor de ADN i a markerilor de greutate molecular
a) probe: 10 l extract ADN + 2 l albastru de bromfenol 2x;
b) markeri de greutate molecular (500 g/ml):
1 l marker 1 kb + 9 l ap distilat steril + 2 l albastru de
bromfenol 6 x;
c) pipetarea probelor de ADN i a markerilor de greutate molecular pe linia
de start a gelului de agaroz (12 l);
3 - Electroforeza : ca tampon se folosete TBE 0,5x, iar migrarea va dura 20 minute la
100 V;
4 - Colorarea: dup ncheierea migrrii, blocul de gel se imersioneaz timp de cel puin
15 minute ntr-o baie de colorare coninnd bromur de etidiu n TAE 1x (10
g/ml).
Atenie !!! Bromura de etidiu este o substan cu potenial carcinogen. Se va
manipula doar cu mnui de protecie !
5 - Vizualizarea gelului n lumin ultraviolet (folosind un transluminator) i
fotografierea acestuia; ADN-ul de calitate se prezint sub forma unei benzi
compacte, cu greutate molecular mare (fig. nr. 9-1)
Tehnici de micologie molecular


194

Fig. nr. 9-1 Controlul calitii ADN-ului


9.5. Identificarea speciei Candida dubliniensis prin PCR duplex

Diferenierea cu acuratee a speciilor Candida albicans i Candida dubliniensis
exclusiv pe baza caracterelor fenotipice este discutabil datorit rezultatelor
inconstante. n vederea identificrii corecte a speciei Candida dubliniensis, este
preferabil, pentru sigurana i expeditivitatea ei, o tehnic de biologie molecular care
presupune folosirea a dou perechi de primeri (amorse): una de amorse specifice unui
intron al genei codante pentru actin (DUBF / DUBR) i alta de amorse universale
pentru ADN-ul ribozomal (ITS1 / ITS4). Dintre cele dou specii amintite, doar
Candida dubliniensis genereaz n urma amplificrii dou benzi - una de 288 perechi
de baze (pb) cu setul DUBF / DUBR i una de cca. 600 pb, cu amorsele universale (fig.
nr. 9-2). Candida albicans va genera o singur band, pe cea de 600 pb, cu amorsele
universale.

ITS 1: 5TCCTGAGGTGAACCTGCGG3
ITS 4: 5TCCTCCGCTTATTGATATGC3
DUBF: 5GTATTTGTCGTTCCCCTTTC3 (nucleotidele 251-270)
DUBR: 5GTGTTGTGTGCACTAACGTC3 (nucleotidele 519-538)

Reactivi necesari

- ADN Candida albicans (martor pozitiv 1)
- ADN Candida dubliniensis (martor pozitiv 2)
- ADN-ul tulpinii de identificat
- soluii stock ale reactivilor destinai PCR
- ap purificat (martor negativ)
Mihai Mare


195
C
a
p
i
t
o
l
u
l


Fig. nr. 9-2 Aspectul celor dou tipuri de
benzi dup developarea gelului de agaroz n
bromur de etidiu i fotografiere n UV; n
ordine, de la stnga la dreapta: Candida
albicans martor, Candida dubliniensis
martor i o tulpin de identificat (1B5D - C.
dubliniensis).

Mod de lucru

1 - Se calculeaz cantitile de reactivi necesare preparrii mixului (conform
tabelului 9-1) avnd n vedere cele patru eantioane ce vor fi folosite (martor
pozitiv 1, martor pozitiv 2, martor negativ, proba de testat). Se vor aduga n
plus cantitile de reactivi necesare pentru nc un eantion, astfel nct n
momemtul divizrii mix-ului, cantitile necesare pentru cele patru eantioane s
fie suficiente.
Tabelul 9-1
Prepararea mixului
Numr de eantioane: 4+1
MIX Volum / eantion (l) Volum / Mix (l)
PCR Buffer 10x 2 10
MgCl
2
25 Mm 2 10
dTTP, dATP, dCTP, dGTP 2,5 mM 2 10
Amorse
DUBF (20 M) 0,5 2,5
DUBR (20 M) 0,5 2,5
ITS 1 (20 M) 0,5 2,5
ITS 4 (20 M) 0,5 2,5
Amplitaq gold
5 U/l
0,25 1,25
Ap purificat
ad 20 l
10,5 52,5
ADN 1 l

Tehnici de micologie molecular


196
2. Se decongeleaz reactivii (cu excepia Amplitaq gold) i se menin la ghea
pn la utilizare;
3. Se prepar mixul, se adaug enzima i apoi se vortexeaz;
4. Se distribuie mixul n tuburi PCR de 0,2 ml;
5. Se adaug:
- 1 l ADN Candida albicans n eantionul pentru martorul pozitiv 1;
- 1 l ADN Candida dubliniensis n eantionul pentru martorul pozitiv 2;
- 1 l ADN tulpin de identificat n eantionul probei de testat;
- 1 l ap purificat n eantionul martorului negativ.
6. Se introduc tuburile n thermocycler i se supun urmtorului regim termic:
50C/5 minute
95C/ 10 minute

apoi, 94C/ 30 sec.
58C/ 30 sec.
72C/ 30 sec.

30 cicluri


apoi, 72C/ 10 minute

7. Dup ncheierea amplificrii, eantioanele se menin la + 4C pn la
vizualizarea pe gel de agaroz.


9.6. Identificarea molecular a levurilor prin PCR
i secvenializarea regiunilor ITS

Reactivii necesari acestei tehnici constau n:
- matricea ADN care conine regiunea de amplificat (n cazul de fa :
ITS 1 i ITS 4 din cadrul ADN-ului codant al ARN-ului ribozomal);
- doi primeri (amorse) specifici care identific nceputul i sfritul
regiunii de amplificat;
- ADN-polimeraza care copie regiunea de amplificat;
- nucleotide, cu ajutorul crora ADN-polimeraza va genera noul ADN;
- soluia tampon care asigur condiiile de reacie necesare activitii
ADN-polimerazei;

Primeri pentru regiunile ITS

ITS 1 : 5-TCC GTA GGT GAA CCT GCGG (3)
ITS 4 : 5-TCC TCC GCT TAT TGA TAT GC (3)
ITS 5: 5-GGA AGT AAA GTC GTA ACA AGG (3)
LR6: 5-CGC CAG TTC TGC TTA CC (3)
V9D: 5-TTA AGT CCC TGC CCT TTG TA (3)
LS266: 5- GCA TTC CCA AAC AAC TCG ACTC (3)


Mihai Mare


197
C
a
p
i
t
o
l
u
l



Tehnica de lucru

1. Se decongeleaz reactivii necesari (cu excepia enzimei Taq) i apoi se menin la
ghea pn n momentul utilizrii;
2. Se calculeaz cantitile necesare pentru amplificarea numrului de eantioane
luate n lucru (conform tabelului 9-2), adugnd totdeauna un supliment pentru
un eantion n plus (n vederea suplinirii pierderilor din timpul pipetrii
ulterioare a mix-ului). Volumul final al fiecrui eantion va fi de 50 l. Astfel,
dac avem doar o singur prob de ADN pentru identificare, vom pregti un
mix pentru 3+1 eantioane: proba ADN pentru identificare, un martor pozitiv,
un martor negativ i un eantion suplimentar; n cazul a dou probe pentru
identificare: 4+1 .a.m.d.

Tabelul 9-2
Prepararea mixului
Reactivi
Volum/eantion
(l)
Volum/ total mix (l)
Concentraia
final
Tampon PCR 10x 5 (nr. eantion+supliment)x5 1x
MgCl
2
25 mM 5 (nr. eantion+ supliment)x5 2,5 mM
dNTP 2,5 mM 5 (nr. eantion+ supliment)x5 0,25 mM
Primer ITS 1 20M
sau primer V9D 20
M
1,25
(nr. eantion+
supliment)x1,25
25 p mol
Primer ITS 4 20 M
sau primer LS 266
20 M
1,25
(nr. eantion+ supliment)x
1,25
25 p mol
Amplitaq Gold 5U/
l
0,25
(nr. eantion+
supliment)x0,25
1,25 U
Ap distilat steril
ad 45 l
27,25
(nr. eantion+
supliment)x27,25
-
ADN * 5 l -
* fiecare eantion cu ADN-ul su, exceptnd martorul negativ i eantionul
suplimentar

3. Se vortexeaz mix-ul i se repartizeaz cte 45 l n tuburi PCR cu volum de
0,2 ml;
4. Se adaug n fiecare tub (martor pozitiv, probe de analizat) 5 l ADN,
omogeniznd apoi coninutul cu ajutorul pipetei;
5. Se plaseaz tuburile n thermocycler i se supun urmtorului regim termic:
95C/ 10 min
apoi, 94C/ 30 sec.
58C/ 30 sec.
72C/ 30 sec.

30 cicluri
apoi, 72C/ 10 min.
Tehnici de micologie molecular


198

6. Purificarea produilor PCR obinui, cu ajutorul kit-urilor comercializate (de tip
QIAquick, Qiogen)
Aceast etap este necesar pentru ndeprtarea primerilor, nucleotidelor,
enzimelor, srurilor, agarozei, bromurii de etidiu i a altor impuriti restante n
eantioanelor de ADN i obinerea n stare pur a regiunilor amplificate prin PCR.
- se transfer produii de PCR ntr-un tub Eppendorf de 1,5 ml;
- se adaug un volum de 5 ori mai mare de tampon PB i se omogenizeaz (225 l
tampon PB pentru 45 l);
- se introduce amestecul ntr-o coloan QIAquick;
- se centrifugheaz apoi timp de 30-60 sec la 13000 rpm pentru fixarea ADN-ului
pe coloan;
- se ndeprteaz faza lichid, plasndu-se coloana pe acelai tub colector;
- se spal ADN-ul fixat pe coloan adugnd 0,75 ml tampon PE i se
centrifugheaz apoi 30-60 sec la 13000 rpm;
- se ndeprteaz lichidul i se recentrifugheaz;
- se aeaz coloana pe un tub Eppendorf de 1,5 ml;
- se elueaz ADN-ul prin depunerea strict n centrul membranei a 50 l tampon
EB (10 mM Tris Cl, pH 8,5);
- se menine 1 minut la temperatura camerei;
- se centrifugheaz 1 minut la 13000 rpm;
7. Verificarea produilor de PCR prin migrare n gel de agaroz.
Precizri importante
- gel de agaroz 3% n TAE 1x;
- eantioanele ce urmeaz a fi pipetate se compun din 5 l produs PCR i 2 l
albastru de bromfenol;
- martorii de greutate molecular ce urmeaz a fi co-pipetai (500 g/ml) se prepar
din 1 l marker 100 pb, 9 l ap distilat steril i 2 l albastru de bromfenol
6x;
- migrare timp de o or la 100 V;
- developare n baie cu bromur de etidiu, timp de minim 15 minute;
- vizualizarea gelului n lumin UV (la transluminator i fotografierea benzilor de
ADN).
8. Secvenializarea fragmentelor de ADN amplificate prin PCR (de preferat
utiliznd un secvenializator de tip BigDye Perkin Elmer, SUA)
9.Analiza secvenelor cu ajutorul unui soft specializat (e.g. CHROMAS fig. nr.
9-3) i compararea cu secvenele dintr-o baz de date n vederea detectrii
speciilor cu un nalt grad de omologie a secvenelor. Sistemul BLAST (Basic
Local Alignment Search Tool) (fig. nr. 9-4) i baza de date GenBank a National
Center for Biotechnology Information (NCBI) - Bethesda (SUA) sunt cele mai
utilizate mijloace pentru identificarea fungilor (adresa URL:
www.ncbi.nlm.nih.gov/blast).
Mihai Mare


199
C
a
p
i
t
o
l
u
l



Fig. nr. 9-3. Interfaa de lucru a software-ului CHROMAS



Fig. nr. 9-4. Pagina de lucru pentru analiza secvenelor de ADN








Tehnici de micologie molecular


200


9.7. Reactivi utilizai n tehnicile de biologie molecular


- CTAB tampon

Tris ............................................ 2,42 g
Clorur de sodiu .......................... 8,2 g
EDTA sodic .............................. 0,74 g
Bromur de cetil-amoniu ............ 2,0 g
Ap bidistilat .......................... 100 ml


Se ajusteaz pH-ul la valoarea 7,5
cu ajutorul unei soluii HCl 1N.
Se autoclaveaz 15 minute la
121C. Se pstreaz la temperatura camerei.

- Proteinaza K

Proteinaz K .......................... 10 U/ml
Tris (pH 7,4) .............................. 0,24 g
Clorur de calciu dihidrat ........ 3,0 mg
Ap bidistilat .......................... 100 ml

Se sterilizeaz prin filtrare i se
pstreaz n fiole la -20C.

- TAE tampon 50x (Tris-acetate
EDTA buffer 50x)

Tris-HCl ...................................... 240 g
Acid acetic glacial .................. 57,1 ml
EDTA disodic 0,5 M ............... 100 ml
Ap bidistilat ................... ad 1000 ml

Se sterilizeaz prin autoclavare timp
de 15 minute la 121C. Se stocheaz la
temperatura camerei. Se dilueaz cu ap
bidistilat n momentul folosirii.





- TE tampon (Tris-EDTA buffer)

Tris ............................................ 0,12 g
Na-EDTA .................................. 0.04 g
Ap bidistilat ..................... ad 100 ml

Se ajusteaz pH-ul la valoarea 8,0 cu
soluie NaCl 1 N. Se sterilizeaz prin
autoclavare timp de 15 minute la 121C. Se
stocheaz la temperatura camerei.

- TBE tampon (Tris Borate ETDA
buffer)

Tris ............................................ 108 g
Acid boric ..................................... 55 g
EDTA tetrasodic ......................... 9,3 g
Ap bidistilat ................... ad 1000 ml
pH 8,3

- PB tampon (Phosphate Buffer 0,2 M)

Fosfat disodic anhidru ............... 21,8 g
Fosfat monosodic anhidru ........... 6,4 g
Ap bidistilat .................. ad 1000 ml

Se ajusteaz pH-ul la 7,4; se
stocheaz la temperatura camerei.

- PE tampon (Phosphate Elution
Buffer)

Const ntr-o soluie 4mM de fosfat
monopotasic care se prepar prin diluarea cu
ap bidistilat a unei soluii stoc de fosfat
monopotasic 1M.




Mihai Mare


201
C
a
p
i
t
o
l
u
l

Bibliografie selectiv

1. Donnely S M, Sullivan D J, Shanley D B, Coleman D C (1999) - Phylogenetic
analysis and rapid identification of Candida dubliniensis based on analysis of
ACT 1 intron and exon sequences; Microbiol; 145(8):1871-1882.
2. Hoog de G S, Guarro J, Gen, Figueras M J (2000) - Atlas of clinical fungi; 2
nd

edition ; Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili.
3. Kawasaki M, Aoki M (2006) - Application of molecular biological techniques to
medical mycology; In Topley & Wilsons, Microbiology and Microbial
Infections 10
th
edition; Hodder Arnold.
4. Kurtzman C P, Boekhout T, Robert V, Fell W, Deak T (2003) - Methods to
identify yeasts; In: Boekhout T, Robert V (eds) - Yeasts in Food; B.Behrs
Verlag GmbH & Co; Hamburg; Germany.
5. Peman J, Martin-Mazuelos E, Rubio Calvo M C (eds) (2001) - Guia Practica de
Identificacion y Diagnostico en Micologia Clinica; Rev Iberoam Micol; Bilbaos.































Mihai Mare


203
C
a
p
i
t
o
l
u
l

1
0






Mihai Mare

Tabelul 10-1
Codul i intervalul concentraiilor de antifungic al benzilor E-test
(AB Biodisk, Solna-Suedia)

Cod Denumire antifungic Intervalul concentraiilor
(m /ml)
AP Amfotericin B 0,002 32
FC 5 Flucitozin 0,002 32
FL Fluconazol 0,016 256
IT Itraconazol 0,002 32
VO Voriconazol 0,002 32
CS Caspofungin 0,002 32
POS Posaconazol 0,002 - 32

10.1. Tehnica de lucru pentru levuri
(fungi din genurile Candida, Cryptococcus, Rhodotorula, Trichosporon)

1 - Prepararea inoculului
Pornind de la culturi efectuate pe Agar Sabouraud sau PDA, vechi de 24 ore
(Candida spp.) sau 48-72 ore (Cryptococcus neoformans) se prepar o suspensie n ser
fiziologic sterilizat utiliznd ansa microbiologic.
Densitatea suspensiei se ajusteaz la valoarea 0,5 McFarland pentru levurile genului
Candida i 1 McFarland n cazul tulpinilor de C.neoformans.
2 - nsmnarea mediului
Ca mediu de testare se folosete Agar RPMI MOPS glucoz 2%, cu grosime de 4
0,5 mm. n cazul amfotericinei B, pentru depistarea cu acuratee a rezistenei este
recomandat mediul AM3.
n vederea nsmnrii mediului, se depun n centrul plcii cca. 200 l inocul (pentru
cele cu 90 mm) sau 400 l (pentru cele cu 150 mm). Inoculul se disperseaz apoi n trei
direcii cu ajutorul unui tampon. Plcile se las n repaus la 35C timp de 1015 minute,
10
Tehnici de evaluare a sensibilitii la
antifungice
Tehnici de evaluare a sensibilitii la antifungice


204
pentru uscarea suprafeei mediului (o alternativ ar fi expunerea suprafeei mediului la fluxul
de aer laminar dintr-o hot microbiologic cls. II).
3 - Alegerea antifungicelor
n funcie de tulpinile testate vom alege benzile E-test cu antifungice (tabelul 10-2).

Tabelul 10-2
Alegerea antifungicelor pentru testare
Trichosporon spp. Candida spp. Cryptococcus spp. Rhodotorula spp.
AP (CMI-uri
obinuit crescute)
FL
IT
VO
AP
CS (frecvent CMI-uri
crescute pentru
C.parapsilosis)
FC
FL (rezisten
primar pentru
C.krusei)
IT
VO
AP
FL
VO
AP
FL(frecvent CMI-uri
crescute)
IT
VO

4 - Aplicarea benzilor E-test
- Numrul optim al benzilor ce vor fi aplicate este de 5/plac 150 mm i 1/plac
90 mm, dispuse radiar, concentraia maxim fiind plasat excentric;
- Benzile se stocheaz la -20C i se las la temperatura camerei 15 20 de minute,
nainte de a fi utilizate;
- Benzile se pot aplica cu ajutorul unei pense, cu aplicatorul manual, cu stiloul
vacuumatic Nema C88 sau cu aplicatorul automat Simplex C76. Dup aplicare, se verific
contactul ntre benzi i mediu, eliminnd prin presare eventualele bule de gaz;
- Benzile se aplic cu scala gradat nspre capacul plcii i cu concentraia maxim
spre periferia acesteia;
- Odat aplicate, benzile nu se mic.
5 - Incubarea plcilor se face cu capacul n jos, timp de 24-48 ore (Candida spp.) i 48-72 de
ore (C.neoformans).
6 - Citirea concentraiei minime inhibitorii (CMI) se face lund n considerare punctul n care
elipsa zonei de inhibiie intersecteaz banda E-test.

Reguli de citire a CMI n cazul levurilor

- AP: se va ine cont de toate coloniile ; citire la 100% inhibiie (fig. nr. 10-1);
- FL, IT, VO: citire la 80 % inhibiie; se ine cont de prima schimbare n modul de cretere a
coloniilor (diminuarea dimensiunilor acestora). Nu se va ine cont de microcolonii (chiar
semiconfluente) care pot apare n interiorul zonei de inhibiie. n schimb, dac sunt prezente
macrocolonii ele semnific heterorezisten (prezena unei clone rezistente pe lng cea
sensibil) i se va raporta CMI-ul maxim (fig. nr. 10-2);
Atenie! Plcile se citesc sistematic la 24 i 48 de ore.
- FC: citire la 90- 95 % inhibiie. Nu se ine cont de microcoloniile ce pot apare la periferia
zonei de inhibiie (fig. nr. 10-3);
Mihai Mare


205
C
a
p
i
t
o
l
u
l

1
0

- CS : citire la 100 % inhibiie. Poate apare uneori efecul paradoxal de cretere - microcolonii
n jurul concentraiilor maxime: nu va fi luat n considerare la lectura CMI (fig. nr. 10-4);
n cazul asimetriilor (concentraii diferite pe cele dou laturi ale benzii E-test) se va raporta
drept CMI concentraia cea mai mare.




Fig. nr. 10-1. Aspectul zonei de inhibiie n
cazul AP (CMI: 0,064 mg/l)



















Fig. nr. 10-2. Aspectul zonei de inhibiie n
cazul FC (CMI: 0,064 mg/l)


Tehnici de evaluare a sensibilitii la antifungice


206


Fig. nr. 10-3. Aspectul zonei de inhibiie
n cazul unei tulpini de C. krusei
(rezisten la FL); CMI: > 256 mg/l




Fig. nr. 10-4. Aspectul zonei de inhibiie
n cazul CS (CMI: 0,094 mg/l)

10.2. Tehnica de lucru pentru fungi filamentoi
(fungi din genurile Aspergillus, Fusarium, Rhizopus, Scedosporium)

1- Prepararea inoculului
Peste culturile de 5-7 zile dezvoltate pe SDA sau PDA nclinat, se adaug 1-2
ml ser fiziologic steril i cu ajutorul unei pipete Pasteur sau anse microbiologice se
realizeaz o suspensie de spori i hife care se transfer ntr-un tub steril. Acesta se
vortexeaz uor i apoi se las n repaus cca. 15-20 minute pentru sedimentarea
particulelor grosiere. Dup expirarea acestui interval de timp, supernatantul se
recupereaz i se transfer n alt tub steril. Turbiditatea acestuia se ajusteaz cu ser
fiziologic la 0,5 McFarland sau se corecteaz astfel nct s se obin o transmitan de
cca. 70% prin citire la spectrofotometru (530 nm). Concentraia obinut va fi de cca.
10
6
UFC/ml inocul.
2- Inocularea plcilor
Se realizeaz n mod similar celui prezentat pentru levuri.
3- Alegerea antifungicelor (tabelul 10-3)






Mihai Mare


207
C
a
p
i
t
o
l
u
l

1
0

Tabelul 10-3
Alegerea antifungicelor pentru testare
Aspergillus spp. Fusarium spp. Rhizopus spp. Scedosporium spp.
AP (A.terreus
rezisten primar)
CS
IT
POS
VO
AP
VO
POS
AP
POS
CS
*
POS
*
VOR
*
*doar pentru S. apiospermum i S.aurantiacum

4 - Aplicarea benzilor E-test
Se realizeaz n mod similar celui prezentat la levuri.
5 - Incubarea plcilor
Se realizeaz la 35C timp de 24-48-72 de ore n funcie de dinamica dezvoltrii
fiecrei tulpini. Pentru tulpinile de Fusarium spp. plcile se incubeaz la 35C timp de
24-48 de ore, apoi se menin la 25C pentru 24-48 ore n vederea clarificrii CMI.
6 - Citirea CMI:
- Rhizopus spp. - la 18-24 ore;
- celelalte specii- 24-48 (chiar 72 ore pentru tulpinile cu cretere lent) .

Reguli de citire a CMI n cazul fungilor filamentoi
- AP: citire la 100% inhibiie; elipsa zonei de inhibiie trebuie s fie clar (fig. nr. 10-5)
- IT, VO, POS : citire la 100% inhibiie (fig. nr. 10-6)
- CS : citire la inhibiie parial (fig. nr.10-7)




















Fig. nr. 10-5 Aspectul zonei de
inhibiie n cazul AP
(CMI: 16 mg/l)

Tehnici de evaluare a sensibilitii la antifungice


208






































10.3. Testarea sensibilitii la antifungice prin metoda difuzimetric Kirby-Bauer
(cu discuri)

Pentru testarea sensibilitii la voriconazol i fluconazol a levurilor din genul
Candida i Cryptococcus se poate folosi i metoda recomandat de CLSI (M44-A). n
acest scop, se utilizeaz ca mediu de testare Agarul Meller-Hinton aditivat cu 2%
glucoz (ca agent de stimulare a creterii) i 0,5 g/ml albastru de metilen (pentru
evidenierea optim a conturului zonelor de inhibiie a creterii), volumul repartizat n
Fig. nr. 10-6. Aspectul zonei
de inhibiie n cazul IT
(CMI: 0,75 mg/l)
Fig. nr. 10-7. Aspectul zonei de
inhibiie n cazul CS
(CMI: 0,047 mg/l)

Mihai Mare


209
C
a
p
i
t
o
l
u
l

1
0

placa Petri fiind de aproximativ 25 ml/plac cu 90 mm i 67-70 ml/plac cu 150


mm. Mediul se inoculeaz cu 200 l (400 l n cazul plcilor cu 150 mm) suspensie
levuric 0,5 McFarland care se distribuie uniform prin strieri n 3 direcii cu ajutorul
unui tampon steril. Suprafaa plcilor astfel nsmnat se usuc la fluxul de aer
laminar al unei hote microbiologice dup care se etaleaz n centrul acestora cte un
disc de voriconazol (1 g) sau fluconazol (25 g).
Plcile se incubeaz 20-24 ore la 36 1C, dup care se msoar diametrul
zonei de inhibiie (fig. nr. 10-8). Se consider c procentul de 80% inhibare a creterii
este aplicabil i n cazul acestor 2 derivai azolici, de aceea microcoloniile aprute la
limita sau n interiorul zonei de inhibiie nu vor fi luate n considerare. Pentru
interpretarea semnificaiei diametrului zonei de inhibiie a creterii se utilizeaz
recomandrile prezentate n tabelul 10-4 i tabelul 10-5.


Fig. nr. 10-8. Aspectul zonei de inhibiie pentru voriconazol
n cazul unei tulpini de Candida albicans

Tabelul 10-4
Recomandri de interpretare a susceptibilitii la fluconazol
Sensibil Sensibil dependent de doz Rezistent
19 mm 15 18 mm 14 mm
8g/ml 16 32 g/ml 64 g/ml

Tabelul 10-5
Recomandri de interpretare a susceptibilitii la voriconazol
Sensibil Sensibil dependent de doz Rezistent
17 mm 14 16 mm 13 mm
1g/ml 2 g/ml 4 g/ml



Tehnici de evaluare a sensibilitii la antifungice


210
Bibliografie selectiv

1. Espinel-Ingroff A, Rezusta A (2002) - E-Test Method for Testing
Susceptibilities of Aspergillus spp. to the New Triazoles Voriconazole and
Posaconazole and to Established Antifungal Agents: Comparison with
NCCLS Broth Microdilution Method; J Clin Microbiol; 40(6):2101-2107.
2. Groll A. H, Kolve H (2004) - Antifungal Agents: In Vitro Susceptibility
Testing, Pharmacodynamics, and Prospects for Combination Therapy, Eur
J Clin Microbiol Infect; 23(3):256-270.
3. John H R, Pfaller, M A, Walsh T J et al. (2001) - Antifungal Susceptibility
Testing: Practical Aspects and Current Challenges; Clin Microbiol Rev;
14(4): 643-658.
4. Pfaller M A , Boyken L, Messer S A et al. (2005) - Comparison of Results
of Voriconazole Disk Diffusion Testing for Candida Species with Results
from a Central Reference Laboratory in the ARTEMIS Global Antifungal
Surveillance Program; J Clin Microbiol; 43(10):5208-5213.
5. Pfaller M A, Messer S A, Boyken L et al. (2004) - Evaluation of the
NCCLS M44-P Disk Diffusion Method for Determining Susceptibilities of
276 Clinical Isolates of Cryptococcus neoformans to Fluconazole; J Clin
Microbiol; 42(1):380-383.
6. Peman J, Martin-Mazuelos E, Rubio Calvo M C (2001) - Guia Practica de
Identificacion y Diagnostico en Micologia Clinica; Rev Iberoam Micol;
Bilbao.
Ingrid Cezara Apetrei


211
C
a
p
i
t
o
l
u
l

1
1










Ingrid Cezara Apetrei

gam variat de metode analitice este astzi disponibil pentru a studia
agenii biologici din spatele uilor nchise. Din moment ce nu exist la ora
actual o metod standardizat, universal acceptat, n plan naional i internaional
pentru determinarea / cuantificarea fungic de macro / microclimat, studierea
comparativ a mai multor metode sau tehnici de recoltare i analiz va servi unei mai
bune aprecieri ambientale, dezideratul final constnd n scderea ncrcturii
microbiologice n ansamblu. n general, ncrctura fungic de microclimat ar trebui s
aib coresponden cu cea exterioar n privina genurilor / speciilor identificate i s
fie mai redus din punct de vedere cantitativ.
Fungii aeropurtai sunt factori antisanogeni binecunoscui, producnd alergeni,
substane cu efect iritant i/sau toxic. Inhalarea sau contactul direct cu aceste subtane
pot induce la indivizii mai sensibili un rspuns alergic amplu cu episoade febrile,
strnut, congestie conjunctival, rinoree, dermatit etc. n funcie de particularitile
imunitare ale fiecrui caz n parte, rspunsul alergic poate fi imediat sau ntrziat.
Cercetrile privind influena sporilor fungici din habitate asupra sntii umane sau
animale sunt n continu desfurare. Dac se constat un nivel fungic mai ridicat n
spaiile nchise dect n exterior, atunci sigur se poate vorbi de existena unor factori
care favorizeaz aceast schimbare a raportului de fore. n plus, identificarea anumitor
genuri / specii fungice, chiar n cuantum sczut, la nivel de microclimat, impune
efectuarea unor evaluri ulterioare ce s conduc la interpretri statistice. Scopul
recoltrii probelor este acela de a aprecia ntregul prin analiza subseturilor
populaionale ale acestuia. La ora actual exist o multitudine de metode de testare ce
pot fi utilizate pentru detecia fungilor aflai n aerosuspensie sau sedimentai i a celor
care se dezvolt pe diverse suporturi / substraturi inerte din diverse spaii.







O
11
Tehnici de aeromicologie
Tehnici de aeromicologie


212
11.1. Caseta AIR-O-CELL
2


Principii procedurale
Caseta Air-O-Cell destinat colectrii probelor de aer este un dispozitiv
destinat analizrii rapide a unei game variate de particule aerosolizate (aeroparticule),
precum spori fungici, pollen, celule epiteliale, fibre, particule anorganice sau poriuni
din corpul unor insecte (fig. nr. 11-1).
Aerul ptrunde n caset absorbit cu ajutorul unei pompe, iar particulele sunt
impactate pe un substrat incolor i aderent, ntr-o camer numit capcan de spori, ca
apoi acesta s fie eliberat printr-un orificiu de evacuare.
Designul i construcia casetei sunt gndite de o aa manier nct particulele
aspirate s fie distribuite i depozitate uniform pe suprafaa aderent a lamei de sticl
din interior.

Beneficii
Acest instrument de recoltare este util pentru testrile iniiale, mai ales atunci
cnd creterea fungic nu este vizibil. Este o tehnic rapid, simpl i ferit de
contaminrile ce pot surveni n timpul manoperelor clasice.

Dezavantaje
Fungii nu vor putea fi identificai cu uurin la nivel de specie prin utilizarea
acestei metode, deoarece ei nu sunt cultivabili. De exemplu, Aspergillus spp. i
Penicillium spp. sunt de cele mai multe ori identificate mpreun ca urmare a
similitudinilor privind morfologia sporilor. Viabilitatea sporilor nu va putea fi de
asemenea analizat. Calibrarea fluxului de aer nu va putea fi modificat dect la cerere,
depinznd de posibilitile firmei productoare, iar caseta va fi utilizat doar cu
minipompa furnizat la livrare (fig. nr. 11-2).











Fig. nr. 11-1 Caseta AIR-O-CELL

Prelevarea probelor
Caseta este destinat pentru un debit de aspirare de 15 l/minut. Dac rata de
absorbie scade, sporii se pot pierde iar repartizarea particulelor n ansamblu se va

2
Air-O-Cell este marc nregistrat a Zefon International. EMSL Analytical
Fig. nr. 11-2. Mini pomp
ZEFON, adaptat
Casetei AIR-O-CELL
Ingrid Cezara Apetrei


213
C
a
p
i
t
o
l
u
l

1
1

realiza de o manier neuniform, n timp ce creterea acesteia poate duce la deprecierea


materialului recoltat.

1. Se calibreaz pompa la 15 l/minut;
2. Se ndeprtez i se reine banda adeziv ce obtureaz orificiile de intrare i
ieire ale casetei Air-O-Cell;
3. Se ataeaz capacul la tubul adaptor (valabil la cerere/comand).
4. Se deschide pompa de aspirare pentru o perioad variabil de timp;
5. Dup expirarea timpului de aspirare, se ndeprteaz caseta Air-O-Cell de la
conexiunea cu tubul de absorbie i se resigileaz cu benzile adezive originale;
6. Proba astfel obinut se trimite spre analiz unui laborator.

Durata de recoltare
Timpul de expunere al casetei este dependent de densitatea estimat a
particulelor n spaiul analizat. Este important s se in seama c suprancrcarea
casetei va face imposibil o identificare cu precizie a tipurilor de spori sau a altor tipuri
de particule prezente. Timpii urmtori sunt recomandai funcie de spaiul vizat, pentru
obinerea unei ct mai bune dispersii a sporilor:

- Spaiu nchis curat sau spaiul ambiental: 10 minute;
- Spaiu nchis cu activitate susinut i personal prezent: 5 minute;
- Spaiu n amenajare, industrial sau murdar, cu miros sesizabil de mucegai: un
minut.

Recomandri privind controlul de calitate
- O interpretare judicioas a rezultatelor se va realiza n urma comparrii datelor
obinute prin colectarea probelor de exterior cu cele de interior. Prelevarea i
analiza probelor de exterior va oferi o baz de calcul / raportare privind
amplificarea fungic din spaiile nchise;
- Se vor preleva spre comparare i probe din zonele adiacente celor supuse
controlului;
- Rata de aspirare trebuie respectat cu strictee pentru acurateea rezultatelor,
aceasta va fi calibrat i reglat dup fiecare recoltare (15 l/minut);
- Nu se utilizeaz casete expirate sau uzate.












Tehnici de aeromicologie


214
11.2. Caseta MICRO-5

Principii procedurale
Micro-5 (fig. nr. 11-3), prin utilizarea unei camere de
impactare de 360 a reprezintat o premier n maniera de colectare a
aeroalergenilor precum polenul, sporii fungici, praful i alte
particule animate sau inerte.
Caseta este destinat s opereze la o vitez de impactare de
5 l/minut n vederea obinerii unei eficiene maxime a colectrii.
Caseta trebuie stocat la 20-27C. Ca principiu de funcionare,
caseta conine o lam de sticl acoperit cu o substan adeziv
pentru capturarea sporilor. Eficiena colectrii la 5 l/minut este de
50% pentru o dimensiune a particulelor de 0,8 microni i un volum
total de aspirare de 25 litri.

Dezavantaj
Inconvenientul utilizrii acestui dispozitiv este acela c
timpul de expunere este prea scurt i probele astfel obinute nu pot
fi reprezentative.

Prelevarea probelor
1. Se ndeprteaz capacul din partea inferioar a
casetei Micro-5;
2. Dac se utilizeaz o pomp de aspiraie
convenional se va conecta tubul de aspirare
la orificiul inferior al casetei, descoperit dup
ndeprtarea capacului, nefiind necesari ali
adaptori (fig. nr. 11-4);
3. Se conecteaz apoi cellalt capt al tubului la
pompa de aspirare precalibrat la o rat de 5
l/minut;
4. Se ndeprteaz capacul superior conic al
casetei;
5. Se pornete pompa i se preleveaz proba de aer;
6. Dup recoltare, se repun capacele casetei Micro-5, att cel superior ct i cel
inferior.

Durata de recoltare
- Spaiu nchis, curat sau spaiu ambiental: 8-10 minute;
- Spaiu nchis cu activitate susinut i personal prezent: 5 minute;
- Spaiu n amenajare, industrial sau murdar, cu miros sesizabil de mucegai: 1-3
minute;
- Spaiile cavitare, cu adaptor special (guri de aerisire, hote): 1-2 minute;
A nu se utiliza la temperaturi mai mici de 0
0
C !


Fig. nr. 11-3
Caseta
Micro5
Fig. nr. 11-4.
Adaptarea casetei la
pompa de aspiratie
Ingrid Cezara Apetrei


215
C
a
p
i
t
o
l
u
l

1
1

11.3. Caseta CYCLEX-D



Att maniera de recoltare a probelor, ct i modul de utilizare a casetei Cyclex-
D sunt asemntoare cu cele ntlnite n cazul modelelor comerciale mai sus amintite.
Diferenele sunt legate de viteza aerului pompat n caset, n cazul de fa 20 l/minut.

Durata de recoltare
- Spaiu nchis curat sau spaiu ambiental: 10 minute;
- Spaiu nchis cu activitate susinut i personal prezent: 5-8 minute;
- Spaiu n amenajare, industrial sau murdar cu miros, sesizabil de mucegai: 1-2
minute.

11.4. Caseta BIOCELL

Din punct de vedere procedural, pentru caseta BIOCELL (fig. nr. 11-5) se
urmresc instruciunile precizate la caseta Air-O-Cell.

Durata de recoltare
- Spaiu deschis (15 l/minut): 8-10 minute;
- Spaiu curat, fr depuneri de praf observabile (15
l/minut) : 5-8 minute ;
- Spaiu nchis, cu activitate susinut i personal prezent
(15 l/minut): 3-5 minute ;
- Spaiu n amenajare, industrial sau murdar, cu miros
sesizabil de mucegai (15 l/minut): 1-3 minute;
- Spaiile cavitare, cu adaptor special (guri de aerisire,
hote) (15 l/minut): 30 secunde 1 minut.
















Fig. nr. 11-5
Caseta
BioCELL
Tehnici de aeromicologie


216
11.5. Caseta LARO 100
3


Caseta LARO-100 (fig. nr. 11-6) poate absorbi n
procent de 100% particulele fungice din aer, precum i orice
alte tipuri de
particule sau fibre, utiliznd un filtru celulozic cu pori de 0,8
microni.
Durata de recoltare poate atinge 8 ore la un debit de
aspirare de 0,5-1 l/minut (pentru a obine n final un volum total
de 240-480 litri). Suprancrcarea dispozitivului prin depirea
perioadei de recoltare va ngreuna mult analiza ulterioar.
Probele obinute mai pot fi analizate i prin imersarea filtrului
n ap, dup recoltare, urmat de colectarea lichidului de splare
i nsmnarea acestuia pe medii de cultur.



Principii procedurale
Caseta LARO-100 produce presiune negativ astfel nct este necesar
utilizarea unui rotametru calibrat deja la standardele indicate de productor, ntre
pomp i dispozitivul de recoltare. Pompa va fi amplasat la captul de descrcare al
casetei, iar productorul recomand setarea acesteia la un volum de aspirare de 4-5
l/minut. Prelevarea probelor i stabilirea volumului de aer aspirat depind de condiiile
de micro / macroclimat constatate. Gradul de vizibilitate n interiorul casetei este mare,
astfel nct observarea nivelului de recoltare pe filtru se poate realiza cu uurin.

Beneficii
Caseta, conceput ca un vortex, prezint un spaiu ngust, rectangular, prevzut
cu un filtru de captur, fiind metoda ideal sub raport pre / calitate pentru analiza
individual a gradului de expunere la poluarea aeromicrobiologic. Probele astfel
recoltate pot fi analizate imediat prin microscopie optic.

Durata de recoltare
- Interior/exterior, fr prezen fungic vizibil (4 l/minut): 10 minute sau mai
mult ;
- Monitorizare personal [8 ore] (12 l/minut): timpul necesar pentru a obine 300
480 l ;
- Zone comune de acces (4 l/minut): 36 minute;
- Suprafee plane (4 l/minut): se eantioneaz suprafee de 10-100 cm
2
.






3
Environmental Monitoring Solutions www.emssales.net EMSL Analytical
Fig. nr. 11-6
Caseta
LARO 100
Ingrid Cezara Apetrei


217
C
a
p
i
t
o
l
u
l

1
1

11.6. Impactorul Zefon Z-A6


4


Particulele aerosolizate, solide sau lichide, pot avea dimensiuni cuprinse ntre
0,1 i 100 microni diametru, putnd fi individuale, neataate sau agregate. Aceste
caracteristici particulare produc dificulti n obinerea unor probe de aer reprezentative
care s poat fi utilizate n vederea aprecierii din punct de vedere microbiologic a
calitii aerului. Mai nti, microorganismele vor recoltate din aer, pentru ca apoi,
particulele viabile, capabile de multiplicare, s poat fi analizate, iar rezultatele
interpretate statistic.

Principii procedurale
Zefon Z-A6 este un dispozitiv din aluminiu, format din dou pri metalice
susinute lateral de trei cleme (fig. nr. 11-7) Dispozitivul este prevzut cu un tub lateral
de circulaie a aerului, un con superior cu o baz plat i 400 orificii. Cnd aerul este
aspirat n aparat sub forma jeturilor multiple, particulele din aer sunt direcionate spre
suprafaa mediului de colectare din dispozitiv. Aceast metod de recoltare implic
impactarea unui volum de aer cunoscut pe suprafaa mediului de cultur dintr-o plac
Petri. Ulterior, plcile sunt incubate astfel nct microorganismele impactate s se
poat multiplica i genera colonii cuantificabile, att din punct cantitativ, ct i
calitativ.
Prile componente livrate odat cu aparatul :
Pomp de vacuum
Rotametru
Tub flexibil

Beneficii
Cultivarea prelevatelor poate determina gradul de
viabilitate fungic i permite ulterior
identificarea la nivel de gen i specie.

Dezavantaje
Dezvoltarea culturilor urmat de identificarea microorganismelor poate dura o
perioad ndelungat de timp (6-10, chiar 30 zile);
Chiar dac sunt prezente aeroparticule neviabile care nu se vor dezvolta pe
mediile de cultur, acestea pot juca un rol semnificativ n instalarea unor reacii
alergice sau iritative;
Exist posibilitatea ca unele microorganisme s nu poat fi identificate ca urmare
a absenei corpilor fructificani sau s nu mai fi fost caracterizate anterior din
punct de vedere al apartenenei taxonomice. De asemenea, particulele neviabile
de origine fungic nu pot fi identificate.

Prelevarea probelor
1. n vederea evitrii supracontaminrii probelor se vor utiliza mnui de protecie;

4
EMSL Analytical, Inc. www.emssales.net

Fig. nr. 11-7
Dispozitiv Zefon Z-A6
Tehnici de aeromicologie


218
2. Se conecteaz tubul flexibil la pomp i apoi la dispozitivul lateral al
colectorului;
3. naintea nceperii recoltrii se pornete i se calibreaz pompa de vacum la 1
ACFM (28.3 l/minut) cu ajutorul rotametrului;
4. Dup calibrare, se terge dispozitivul pe ntreaga sa suprafa cu alcool
izopropilic, utiliznd un tampon steril;
5. Dup pregtirea aparatului, se ndeprteaz partea superioar a acestuia n
vederea introducerii n interior, pe fundul plat, a unei plci cu mediu solid ce
va servi drept suprafa de recoltare. Placa a fost lsat n prealabil acoperit
pentru a ajunge la temperatura camerei. Se fixeaz componentele aparatului cu
cele trei cleme metalice prin rsfrngerea acestora, acoperindu-se astfel imediat
placa cu mediu prin ataarea prii superioare a dispozitivului;
6. Se pornete pompa de vacuum pentru 2-5 minute. Aerul este aspirat prin conul
superior i dirijat prin orificiile de precizie, fiind apoi impactat pe suprafaa de
recoltare placa Petri cu mediu solid. Exhaustarea se realizeaz prin
mpingerea aerului spre tubulatura de la baza aparatului unde va fi colectat de o
camer de vid ataat pompei de vacuum;
7. Dup recoltare, se va ndeprta dispozitivul de nchidere i se va nlocui placa
substrat, aceasta fiind acoperit, sigilat i trimis laboratorului spre analiz n
cel mai scurt timp;
8. nainte de a se recolta o alt prob, dispozitivul de recoltare va trebui
dezinfectat, iar manipularea se va face rapid i doar cu mnui de protecie.

Mediile de cultivare i manipularea lor
n principiu, pot fi utilizate pentru recoltare cu acest impactor diverse medii de
cultivare, turnate n prealabil n plci Petri standard de 15 x 90 mm. Mediile de
cultivare recomandate prelevrii i analizei fungice sunt:
PDA (Agar cu extract de cartof glucozat)
MEA (Agar cu extract de mal)
DG 18 (Agar dicloran glicerol-18%)

- Plcile cu medii agarizate vor fi pstrate la temperatura de refrigerare pn n
momentul utilizrii, cnd vor fi lsate (aproximativ 20 minute) s ajung la
temperatura mediului ambiant;
- Capacul plcii Petri se ndeprteaz doar n momentul recoltrii;
- Dup recoltarea probelor, capacul plcii se repune iar placa se va sigila cu
Parafilm sau band adeziv i se va trimite laboratorului spre analiz n cel
mult 24 de ore;
- Dac placile se transport cu o geant frigorific acestea nu vor fi lsate s vin
n contact direct cu gheaa pentru a se preveni degradarea mediului, testarea n
acest caz fiind invalidat.

Recomandri
- Se vor purta mnui de latex pe tot parcursul desfurrii manoperelor de
recoltare;
Ingrid Cezara Apetrei


219
C
a
p
i
t
o
l
u
l

1
1

- Se va folosi alcoolul izopropilic 70% pentru decontaminarea dispozitivului de


recoltare dup fiecare prelevare;
- Pe parcursul recoltrii, capacul plcii Petri se va pstra ntr-un sac steril de
plastic;
- Pompa de vacuum trebuie s fie calibrat cu ajutorul unui rotametru, cu att mai
des cu ct nu sunt ntotdeauna ntrunite condiiile optime de presiune i
temperatur. O plac martor, neexpus recoltrii, va servi la fiecare prelevare
drept control negativ. Probele prelevate din mediul ambiant vor fi comparate
cu cele de microclimat. De asemenea, vor trebui recoltate probe i din zonele
adiacente celei de interes. Niciodat nu se vor utiliza medii de cultivare
expirate sau contaminate.

11.7. Dispozitivul CIP 10M

CIP 10 este un dispozitiv de dimensiuni reduse
destinat colectrii particulelor aerosolizate i a prafului
din aer (fig. nr. 11-8). A fost schiat ca i concept n
anii 80 la CHERCHAR (Centre dtudes et de
Recherches de Charbonnage de France) actualmente
INERIS (Institut National de lEnvironnement
Industriel et des Risques) de ctre Paul Courbon. n
prezent este produs i comercializat cu licen INERIS
de ctre ARELCO A.R.C.
n 2003, a fost perfectat un nou subansamblu
destinat recoltrii microorganismelor, dispozitivul
schimbndu-i denumirea din CIP 10 n CIP 10 M.
Pentru recoltare, n mod normal este amplasat
ct mai aproape de cile respiratorii, la nivelul
toracelui, dar poate fi amplasat i n diverse zone ale
spaiului de lucru considerate a fi puncte critice. Mai mult, scopul utilizrii
dispozitivului este acela de a recolta particulele ce reprezint o real ameninare la
adresa sntii umane (cantonabile la nivel alveolar, bronic, sinusal ), n conformitate
cu CEN 481 i standardul ISO 7708. Particulele astfel recoltate pot fi cntrite graie
interschimbabilitii selectorilor, determinndu-se totodat i greutatea probei recoltate,
urmat cnd se impune i de analiza compoziiei probei.
Dispozitivul are form alungit, de bloc compact prevzut cu un selector
cilindric, o incint rotativ n partea superioar - destinat colectrii particulelor, i o
baz plat de separare a circuitului electric din partea inferioar motor, baterii i
circuit electric. Forma ergonomic a dispozitivului faciliteaz ataarea acestuia cu un
sistem de curele ct mai aproape de cile respiratorii sau purtarea acestuia ntr-un
buzunar.





Fig. nr. 11-8
Dispozitivul CIP 10M
Tehnici de aeromicologie


220
Beneficii
- Este de dimensiuni mici, compact, uor, silenios;
- Arhitectura modular permite aprecierea tuturor fraciilor respiratorii conform
standardelor, prin utilizarea la recoltare a selectorilor i a unui debit de aer
prestabilit;
- Supapa omnidirecional protejat de capac blocheaz ptrunderea accidental pe
parcursul aspirrii, a unor particule de mari dimensiuni sau a picturilor de ap;
- Aparatul nu este afectat de schimbarea poziiei sau de micri brute, avnd o
construcie intern robust i un exterior din plastic antistatic;
- Debitul este constant, iar filtrele sunt reutilizabile;
- Colectorul prezint o serie de elemente de siguran precum uruburi speciale de
nchidere, ntreruptor magnetic, led de funcionare este compus din materiale
conforme standardelor europene privind utilizarea aparaturii de recoltare n
medii ostile;
- nlime total : 175 mm, diametru : 45 mm, greutate total 300 g.

CIP 10 este echipat cu selectori de recoltare pentru aerosoli i praf, conform
standardelor europene n vigoare NF EN 481, existnd abateri doar n cazul
particulelor foarte fine.
CIP 10 sau varianta CIP 10 M nu necesit pe parcursul timpului de funcionare
un control extern sau ajustri suplimentare. Se remarc printr-o remarcabil stabilitate
a fluxului de aer n corelaie cu viteza de rotaie a cupei meninut constant de ctre
un regulator de vitez.
Porii filtrului poliuretanic au cteva sute de microni diametru i cu toate
acestea, rmn larg deschii pe parcursul recoltrii pn n momentul cnd praful
colectat atinge valoarea de 50 mg n cupa de rotaie i cteva sute de miligrame la
nivelul selectorului destinat fraciilor respirabile alveolare.

1. Selectorul de particule destinat fraciilor respirabile alveolar

Aceast selecie a particulelor respirabile alveolar se realizeaz cu aspirare n
unghi de 45 prin dou filtre poliuretanice. Fraciile aerosolizate obinute astfel,
ntrunesc condiiile impuse de standardele europene CEN AFNOR 481 i ISO 7708.

2. Selectorul de particule destinat fraciilor respirabile toracic

CIP 10 T sau CIP 10 MT reprezint dou variante constructive ale
dispozitivului destinat seleciei particulelor ce pot ptrunde bronic, printr-o serie de
fante de dirijare a aerului n unghi de 90 ctre opt orificii dispuse radiar n
extremitatea superioar a tubului de inox. ntruct particulele de dimensiuni mari
exercit fore gravitaionale sporite acestea nu sunt deviate, fiind capturate la baza
selectorului (filtrului).




Ingrid Cezara Apetrei


221
C
a
p
i
t
o
l
u
l

1
1

3. Selectorul de particule destinat fraciilor inhalabile



CIP 10 I sau CIP 10 MI servesc seleciei particulelor inhalabile prin
direcionarea supapei de admisie i prezena orificiilor de selecie, tubul conic
ghidndu-le n continuare spre cupa rotativ de colectare.

4. Un nou selector destinat fraciilor inhalabile

O nou metod de selectare a fraciilor inhalabile a fost dezvoltat pentru a
diminua depunerile nedorite pe suprafaa interioar / superioar a peretelui capsulei de
colectare i pentru o mai bun satisfacere a cerinelor standardului EN 481. Fluxul de
aer va fi forat s urmeze un traseu concentric convergent spre un punct de retur care s
imprime apoi o direcionare vertical.

5. Selectorul de praf total fracii maximale

Cu ajutorul dispozitivului CIP 10 se pot aprecia fraciile maximale / praful
total, n acest scop fiind indicat utilizarea unui cap alveolar cu pstrarea camerei de
recoltare i a duzei aferente. Astfel, toate particulele suspendate n aer, inclusiv cele
recent depuse vor fi aspirate de dispozitiv.

Prelevarea probelor
CIP 10 include o cup de rotaie echipat cu un filtru poliuretanic montat pe
axul de rotaie al motorului ce funcioneaz la turaie mare ntr-o incint, cu fluxul de
intrare axial i cel de ieire tangenial. Datorit rotaiei cupei, se genereaz un flux de
aer asemntor cu efectul unui ventilator, asigurndu-se astfel captura particulelor ce
au scpat de selecia filtrelor anterioare.
Motorul este acionat de acumulatori, iar viteza sa este setat de ctre un
circuit de control electromagnetic. Debitul de aer este direct proporional cu viteza de
rotaie. Aerul este aspirat prin supapa omnidirecional, iar n interior acesta urmeaz o
cale sau alta n funcie de dimensiunea particulelor ce urmeaz a fi studiate. Fraciile
nedorite din punct de vedere dimensional vor fi oprite de selectoarele superioare.
Particulele care strbat selectorul rmn n suspensie n lichidul de eluare, iar aerul
astfel filtrat se rentoarce n atmosfer prin fantele laterale ale cupei de rotaie.
Dispozitivul CIP 10M este dotat cu o cup de rotaie prevzut n partea
superioar cu lame orizontale care n micare imprim aerului aspirat efectul de rotaie
centrifugal. Frecarea aerului de partea superioar a lichidului coninut de cup,
precum i de pereii laterali ai acesteia va genera o zon de presiune sczut ce
faciliteaz direcionarea aerului dincolo de lichidul de recoltare. n acest mod, aerul
astfel aspirat va urma o micare de rotaie helicoidal pentru captarea uoar a celulelor
n lichidul colector, garantndu-se astfel viabilitatea acestora. naintea nceperii
colectrii cupa trebuie sterilizat prin autoclavare sau tratare cu solveni speciali i
alimentat cu 2-2,5 cm
3
lichid de colectare - ap distilat sau soluie peptonat etc.
Dac soluia este adugat n exces, aceasta va fi eliminat n momentul nceperii
recoltrii.

Tehnici de aeromicologie


222
Colectarea probelor n atmosfer uscat

Umiditatea relativ sczut a mediului ambiant poate limita eficiena recoltrii
n sensul epuizrii rapide a lichidului de recoltare, reducndu-se astfel i perioada de
recoltare.

Colectarea sporilor sau a miceliului

Lund n considerare natura hidrofob a sporilor sau a miceliului, se poate
anticipa o rat sczut de capturare a acestora, de aceea este recomandat adugarea n
lichidul colector a unui agent surfactant tensioactiv pentru forarea mixrii
bioaerosolilor cu lichidul camerei de compactare (de obicei Tween 80 n proporie de
0,05-0,1).
1211
Transportul probelor

CIP 10 nu necesit precauii speciale privind transportul probelor. Este
recomandat totui, transportarea n poziie vertical a dispozitivului atunci cnd cupa
de recoltare nu a fost ndeprtat.

Manipularea n laborator dup colectare

Dup recoltare, aparatul CIP 10 (sau CIP 10M) este meninut n poziie
vertical, i se ndeprteaz capacul i se scoate cupa colectoare cu un extractor special.
Se recolteaz lichidul din cup, cupa splndu-se de trei ori, lichidul de splare
pstrndu-se de asemenea n vederea analizrii prin cultur, identificare PCR,
determinare ATP, epifluorescen.

Ajustarea i controlul debitului de aer

Reglarea debitului de aer ntre 7 i 10 l/minut, n funcie de necesiti,
reprezint singura ajustare necesar pentru funcionarea dispozitivului CIP 10M i se
realizeaz cu ajutorul unui poteniometru plasat n interiorul carcasei. Operaiunile
procedurale implic urmatorii pai: verificarea gradului de ncrcare a bateriilor,
ndeprtarea clemelor de fixare ale cupei de rotaie i ndeprtarea acesteia pentru a
avea acces la locaia poteniometrului.
Se plaseaz apoi cupa de rotaie ce conine filtrul poliuretanic deasupra
motorului, se aeaz capacul, se pornete aparatul, poteniometrul ajustndu-se pentru
ca cititorul manometrului s indice 0 Pa i astfel s existe un echilibru ntre debitul de
aer ce ptrunde n aparat i cel evacuat, fr pierderi de aer, urmrindu-se gradul de
etaneizare al aparatului. Cu ajutorul unui tahometru se va aprecia, dup ndeprtarea
capacului, viteza cupei de rotaie fr ca aceasta s fie atins de dispozitiv pentru a se
evita ncetinirea acesteia (ntre 6800 - 7000 rpm n funcie de varianta constructiv).
Doar n cazul n care se observ o deviaie mai mare de 150 rpm de la standard se poate
interveni cu ajustri suplimentare asupra dispozitivului. n caz contrar orice valoare
observat sub cea amintit este considerat valoare nominal.
Ingrid Cezara Apetrei


223
C
a
p
i
t
o
l
u
l

1
1


Determinarea greutii probei recoltate

Determinarea masei prafului colectat se realizeaz prin cntrirea cupei de
rotaie ce conine filtrul poliuretanic, att nainte ct i dup colectarea probelor,
utilizndu-se o balan electronic de laborator cu o deviaie standard admis de maxim
0,1 mg. Filtrul poliuretanic este sensibil la umiditatea aerului, de aceea formula final
de calcul va ine cont de schimbrile majore privind umiditatea relativ a zonei de
microclimat unde are loc recoltarea.

INRS recomand urmtoarea succesiune procedural:

- Pregtirea cupei se va realiza cu atenie: va fi splat cu o soluie decontaminant
fierbinte i cltit de mai multe ori, de preferat numai cu ap distilat steril;
- Va fi lsat 12 ore s se usuce la temperatura de 50C - 60C;
- Filtrul se va pregti separat i se va pstra ntr-un loc uscat ferit de praf sau alte
impuriti;
- Se vor purta mnui de protecie pe toat durata desfurrii manoperelor de
recoltare.

Procesarea probelor dup recoltare

Dup recoltare, cupele sunt recondiionate de maniera amintit anterior, fiind
totui recomandat plasarea lor, dup nlturarea capacului protector, ntr-un termostat
la 50 60C timp de 4 ore, dac prelevarea a avut loc ntr-un spaiu cu umiditate
relativ prea ridicat. Dup condiionare, se determin masa probei colectate cu
formula:

H = H
m
-H


unde:

H
m
- reprezint diferena de greutate a cupelor nainte i dup recoltare;
H

- reprezint cea mai mare valoare de diferen nregistrat ntre cele dou cntriri,
nainte i dup recoltarea probelor.

Determinarea concentraiei particulelor

Concentraia se calculeaz n mg/m
3
fiind determinat prin formula :

C [
mg
m
3

=
M
F


unde :
M - reprezint masa probei colectate, dup specificaiile amintite (n mg);
V - reprezint volumul de aer filtrat (n m
3
).

Tehnici de aeromicologie


224
Manipularea filtrului poliuretanic al dispozitivul CIP 10

Filtrul poliuretanic este deosebit de rezistent la aciunea agenilor chimici i
stabil din punct de vedere structural. Poate fi splat prin metode uzuale, incinerat sau
mineralizat funcie de tipul analizei ce urmeaz a fi realizat.
Urmtoarele operaiuni de splare sunt permise asupra filtrului poliuretanic, n
vederea recuperrii prafului recoltat:
- Se las filtrul ntr-o soluie cald de splare,15 minute;
- Se extrage din soluie cu mna protejat de mnui;
- Se cltete cu ap distilat de mai multe ori pn cnd soluia de splare rmne
clar;
- Se recupereaz i praful depus la baza cupei de recoltare tot prin splare i se
adaug lichidului deja obinul prin splarea filtrului;
- Urmeaz filtrarea i centrifugarea n vederea recuperrii depozitului de analizat,
pierderile ce apar pe parcursul desfurrii manoperelor fiind neglijabile

11.8. Aprecierea ncrcturii fungice aeropurtate
prin tehnica sedimentrii Koch

Se utilizeaz plci Petri sterilizate, cu diametrul de 90 mm, n care se
repartizeaz cte 15-20 ml mediu agarizat special destinat cultivrii fungilor
(Sabouraud cloramfenicol agar, PDA, Agar cu extract de mal). Se oprete instalaia de
climatizare i n absena personalului de lucru se expun plcile cu mediu, fr capac, n
anumite puncte prestabilite, un interval de timp variabil ntre 5 i 15 minute.
n fiecare punct de recoltare se expun cte 2 plci din fiecare mediu. Pe
capacul fiecrei plci se inscripioneaz tipul de mediu, data i ora recoltrii, poziia
plcii, timpul de expunere. Dup expirarea timpului de expunere stabilit, plcile se
acoper cu capacele proprii, se nvelesc n hrtie i se transport n caserole de plastic
la laborator, unde se incubeaz, la temperatura de 25
o
C. Obligatoriu, n paralel se
incubeaz cte o plac martor coninnd aceleai medii, fr a fi deschise n prealabil.
Dup 5 zile se monitorizeaz eventuala dezvoltare a coloniilor i se calculeaz
nr. UFC /m
3
aer.

N.0PC
m
3
uc
=
N 10 000
SK



N - media numrului de colonii dezvoltate pe suprafaa mediului din cele 2 plci
expuse;
S - suprafaa plcii (cm
2
) (3,14 x R
2
);
K - coeficientul timpului de expunere: pentru 5 minute este egal cu 1, pentru
10minute este egal cu 2, iar pentru 15minute este egal cu 3.





Ingrid Cezara Apetrei


225
C
a
p
i
t
o
l
u
l

1
1

11.9. Tehnici de recoltare/examinare direct a probelor


de pe suprafee

Examinarea direct permite detectarea rapid a prezenei sporilor fungici ntr-
un spaiu examinat precum i genurile incriminate ntr-o astfel de contaminare,
contribuind astfel alturi de alte metode de analiz la acurateea rezultatelor obinute.

11.9.1. Banda adeziv BIO TAPE
TM
(Zefon International)

Acest tip de band reprezint varianta standardizat de recoltare a
specimenelor de pe suprafee. Probele se mai pot recolta i prin utilizarea unei benzi
adezive tip scoth. n vederea examinrii microscopice a particulelor colectate, banda
adeziv trebuie s aib proprieti optice superioare i s suporte toate tipurile de
colorani ce pot fi utilizai n practica de laborator funcie de speciile suspectate.

Prelevarea probelor

1. Se pregtete lama prin exteriorizarea benzii adezive duble, evitndu-se
atingerea prii ce servete pentru colectarea probei (fig. nr. 11-9);














2. Se aplic zona central a benzilor pe suprafaa de recoltare, prin apsare
moderat (fig. nr. 11-10);
3. Se desprind uor benzile i se reataeaz una de alta
sau se lipesc de suprafaa interioar a unui sac de
plastic steril (ziplock), avnd grij ca acesta s nu
prezinte cute;
4. n fiecare ambalaj va fi transportat o singur prob.



Recomandri
Benzile se vor utiliza doar n scopul pentru care au fost
concepute i nu la temperaturi mai mici de 5C;
Se ndeprteaz celofanul
protector
Se nscriu elementele de
identificare a probei
Mijlocul zonei adezive,
de recoltare a probei
Fig. nr. 11-9 Componentele lamei Bio-Tape
Fig. nr. 11-10.
Recoltarea probelor
Tehnici de aeromicologie


226
Nu se vor trimite ctre laborator, benzi ataate unei lame sau acoperite cu o
lamel, ci doar n ambalajul special destinat transportului, furnizat odat cu
pachetul standard.

11.9.2. Recoltarea fragmentelor inerte

Aceste probe sunt reprezentate de poriuni din diverse materiale ce ar putea fi
contaminate, constituind astfel substrat al dezvoltrii fungice (seciuni de tapet,
covoare, mochete, filtre de aer, fragmente de mobilier, de instalaie sanitar ). Dac
specimenul are dimensiuni mari, se vor alege fragmente de recoltat reprezentative,
evitndu-se contaminarea prin manopere suplimentare.
Scopul acestui tip de recoltare este acela de a obine poriuni din materialele de
analizat, suficient de mici pentru a putea fi uor transportate i manipulate, dar
reprezentative sub aspectul ncrcturii fungice. Analiza probelor se va realiza prin
cultivarea pe medii speciale sau prin microscopie direct.

11.9.3. Recoltarea cu ajutorul tamponului tip exsudat

Principiul de lucru este foarte asemntor cu cel al benzii adezive. Tija cu
tamponul steril este gzduit de o eprubet / un tub cu soluie tampon pH 7,0 sau
soluie de eluare a sporilor (ser fiziologic cu 0,05% Tween 80). Probele astfel obinute
pot fi analizate prin cultivare sau prin microscopie direct.

Beneficii
Examinarea direct este necostisitoare i poate fi rapid efectuat.
Reprezint un test preliminar de valoare i poate indica sursele generatoare de
spori aeropurtai.

Dezavantaje
Zona de recoltare fiind redus ca dimensiuni, nu va oferi o imagine de ansamblu
asupra gradului de contaminare fungic a unui habitat, de aceea se recomand
recoltarea din mai multe puncte.
Problemele de sntate cauzate de multiplicarea fungic din habitate sunt corelate
cu inhalarea unui numr substanial de spori aeropurtai, uneori perioade
ndelungate de timp. Prezena microorganismelor sub form de depozite pe
diverse suprafee nu poate constitui un indicator direct al aeropolurii.
Prin intermediul acestor tehnici se pot detecta att sporii viabili, ct i cei
neviabili, fr a se putea face o distincie ntre cele dou tipuri. Dac testrile
intereseaz n mod special cunoaterea viabilitii recoltatului este indicat
combinarea tehnicilor directe cu cele de cultivare.
De cele mai multe ori, fungii nu pot fi identificai la nivel de specie i nici chiar la
nivel de gen prin intermediul tehnicilor directe, n absena corpilor de
fructificare.



Ingrid Cezara Apetrei


227
C
a
p
i
t
o
l
u
l

1
1

Bibliografie selectiv

1. Barry S L, Wegman D H (2000) - Occupational Health: Recognizing &
Preventing Work - Related Disease & Injury, 4
th
edition; Lippincott
Williams & Wilkins.
2. EMSL Analytical (2003) - LARO-100 Sampling Guide.
3. Goddish Thad (2002) - Indoor Environment Notebook: Everything You
Wanted to Know About Indoor Air Pollution and More; Ball State
University, Department of Natural Resources and Environmental
Management; LARO-100 Product Information.
4. Grinshpun Surgey A (2002) - Collection and Enumeration of Airborne
Spores Using Aerosol Impactors with Low Jet-To-Plate Distance, Project
3, Micro5 Microcell (5 lpm); University of Cincinnati Environmental
Health Foundation.
5. * * * - Minnesota Department of Health (2003) - Environmental Health in
Minnesota: Testing for Mold; Sampling methodology for fungal
bioaerosols and amplifiers in cases of suspected indoor mold proliferation.
6. * * * - Qualit de lair. Air des lieux de travail - Dtermination du dpt
alvolaire de la pollution particulaire. Mthode de la coupelle rotative.
(Air-Quality: Workplace Air - Gravimetric determination of particulate
pollution deposits. Rotating disk method); NF X43-262.
7. * * * - Atmosphres sur les lieux de travail - Dfinition des fractions de
taille pour le mesurage des particules en suspension dans lair. (Workplace
Atmospheres - Size fraction definitions for measurement of airborne
particles.); NF EN 481 X43-276.
8. * * * - Air des lieux de travail - Dtermination par rayons X de la
concentration de dpt alvolaire de silice cristalline- chantillonnage par
dispositif coupelle rotative. (Workplace Air - X-Rays Determination of
the conventional alveolate fraction of crystalline silica - Sampling using a
rotating cup device); NF X43-295.
9. * * * - Qualit de lair - Dfinitions des fractions de taille des particules
pour lchantillonnage li aux problmes de sant. (Air Quality - Particle
size fraction definitions for health related sampling); NF ISO 7708.
10.* * * - Air des lieux de travail - Dosage par spectromtrie infrarouge
transforme de Fourier de la silice cristalline - chantillonnage par
dispositif coupelle tournante ou sur membrane filtrante. (Workplace Air -
Fourier Transform Infrared Spectrometric determination of crystalline
silica - Sampling using a rotating cup device or filtering membrane); XP
X43-243.



Luminia-Iuliana Malic


229
C
a
p
i
t
o
l
u
l

1
2














Luminia-Iuliana Malic

12.1. Clasificarea fungilor n funcie de clasele de risc biologic

n funcie de gradul de risc biologic pe care microorganismele l prezint
pentru om, acestea se clasific n trei clase:
- Clasa I cuprinde acele microorganisme care rareori pot manifesta risc de
mbolnavire la om i animale;
- Clasa II cuprinde acele microorganisme care pot cauza apariia de afeciuni la
om i animale i pot reprezenta un pericol pentru personalul din laborator risc
individual redus, risc colectiv neglijabil. Profilaxia i tratamentul folosite n
afeciunile cauzate de aceste microorganisme sunt eficace. Cuprinde
majoritatea fungilor de interes clinic (tabelul 12-1);
- Clasa III cuprinde acele microorganisme care pot cauza afeciuni la om i care
reprezint un real pericol pentru personalul din laboratoarele de micologie
risc individual mare, risc colectiv semnificativ. De asemenea, exist riscul
diseminrii n colectivitate. Tratamentul i profilaxia sunt eficace;
- Clasa IV cuprinde acele microorganisme care pot cauza afeciuni grave la om i
care reprezint un pericol pentru personalul din laborator risc individual
crescut, risc colectiv crescut. De asemenea, exist riscul de contaminare a
colectivitilor, iar de cele mai multe ori, nu exist un tratament eficace al
afeciunilor cauzate de aceste microorganisme












12
Norme generale de biosecuritate n
laboratoarele de micologie medical
Norme generale de biosecuritate n laboratoarele de micologie medical


230
Tabel 12-1
Clasificarea principalelor specii de fungi n funcie de grupa de risc biologic i
capacitatea alergizant
Specia
Clasa de
risc
biologic
Capacitatea
alergizant
Aspergillus fumigatus 2 X
Blastomyces dermatitidis 3
Candida albicans 2 X
Cladophialophora bantiana 3
Candida tropicalis 2
Coccidioides immitis 3 X
Cryptococcus neoformans var. neoformans 2 X
Cryptococcus neoformans var. gattii 2 X
Emmonsia parva var. parva 2
Emmonsia parva var. crescens 2
Epydermophyton floccosum 2 X
Fonsecaea compacta 2
Fonsecaea pedrosoi 2
Histoplasma capsulatum var. capsulatum 3
Histoplasma capsulatum var. duboisii 3
Madurella grisea 2
Madurella mycetomatis 2
Microsporum spp. 2 X
Paracoccidioides brasiliensis 3
Penicillium marneffei 2 X
Scedosporium apiospermum 2
Scedosporium prolificans 2
Sporothrix schenckii 2
Trichophyton rubrum 2

12.2. Norme generale de biosecuritate

- Accesul n laborator este permis doar personalului autorizat;
- Personalul din laborator trebuie s participe la implementarea i respectarea
normelor de biosecuritate;
- Pardoseala laboratorului va fi confecionat din materiale rezistente acoperite cu
rini epoxidice sau linoleu antistatic, neted, uor lavabil;
- Pe uile de acces n Laboratorul de Micologie Medical se va aplica semnul
internaional Pericol biologic (Biohazard) care, n cazul acestor laboratoare
corespunde nivelului 2 de securitate microbiologic (fig. nr. 12-1). Cu acelai
semn se vor marca frigiderele i congelatoarele folosite pentru pstrarea
microorganismelor cu risc biologic 2;


Luminia-Iuliana Malic


231
C
a
p
i
t
o
l
u
l

1
2



Fig. nr. 121. Semnul convenional pentru risc biologic (Biohazard)

- Uile i ferestrele laboratorului trebuie sa fie n permanen nchise pentru
asigurarea izolrii spaiului;
- Laboratorul va fi separat de zona de circulaie a personalului cu ajutorul unui sas;
- Laboratorul trebuie s fie n permanen ventilat forat. Aportul de aer va fi de
cca. 60 m
3
per persoan per or;
- Toate suprafeele de lucru se vor spla i dezinfecta zilnic. Toate reziduurile vor
fi incinerate n incinte speciale, autorizate, iar depozitarea i transportul
acestora se va face n cutii nchise ermetic, rezistente i impermeabile, n
funcie de fiecare tip de reziduu, marcate de asemenea cu semnul de risc
biologic;
- Laboratorul trebuie s beneficieze de un lavoar pentru splarea minilor, care s
funcioneze prin acionarea cu ajutorul cotului sau cu o pedal;
- Transportul probelor de la i ntre laboratoare se va realiza cu ajutorul lzilor
izoterme, ermetice, rigide, rezistente la lovituri, uor de curat i dezinfectat;
- Personalul din laborator va evita contactul direct cu materialele potenial
patogene. n acest scop se va folosi echipament de protecie adecvat n
momentul manevrrii probelor sau a culturilor fungice. Echipamentul de
protecie va fi ndeprtat n momentul prsirii zonei de lucru. Minile se vor
spla n mod repetat cu spun lichid antiseptic, dup fiecare ndeprtare a
mnuilor de protecie;
- Este interzis pipetarea materialului patologic cu gura;
- n zona de lucru nu se vor depozita cri sau hrtii, deoarece sunt dificil de
sterilizat;
- n laboratoarele de micologie medical sunt strict interzise:
Consumarea de alimente sau buturi de orice fel;
Depozitarea de alimente i buturi;
Folosirea lentilelor de contact;
Norme generale de biosecuritate n laboratoarele de micologie medical


232
Aplicarea de produse cosmetice;
- Plgile se vor acoperi cu bandaj nainte de aplicarea echipamentului de
protecie.

12.2.1. Tehnici de laborator folosite n zona de lucru

- Toate culturile fungice (n special la speciile cu miceliu aerian sporulat) i
prelevatele clinice se vor manevra de preferat n interiorul unei hote de
protecie biologic clas II, pentru evitarea contaminriii personalului i
incintei laboratorului;
- Plcile ce conin mediu de cultivare pentru fungi se vor nchide i se vor aeza cu
capacul n jos pentru evitarea deschiderii accidentale i contaminrii;
- Incubarea plcilor se va face n termostate cu umidificatoare;
- n cazul utilizrii mediilor de cultivare repartizate n tuburi, acestea trebuie s
beneficieze de dopuri fixe, sigure;
- Deschiderea plcilor i tuburilor ce conin medii de cultivare se va face doar sub
protecia unei hote microbiologice de clas II sau n vecintatea flcrii unui
bec de gaz;
- n cazul fungilor dimorfici se impune analizarea acestora sub protecia unei hote
de securitate biologic grad III. Plcile cu astfel de culturi se etaneizeaz
obligatoriu cu Parafilm.

12.3. Metode de protecie primar

Aceste metode se refer la echipamentele de protecie a personalului i la
aparatura utilizat n vederea realizrii proteciei microbiologice.

12.3.1. Hote de protecie biologic

Hotele sau cabinetele de protecie sunt incinte n care fluxul de aer este filtrat
i dirijat astfel nct s se obin diferite grade de protecie biologic. Exist trei tipuri
de astfel de incinte specializate, n funcie de domeniul n care sunt folosite: hote fizico
chimice, hote cu flux laminar verical sau orizontal, hote de protecie biologic clasa
I, clasa II, clasa III i cabinete destinate aplicaiilor PCR.
Hotele fizico chimice sunt folosite pentru reinerea fumului i vaporilor
chimici ce apar n urma manipulrii diferiilor reactivi, dar nu realizeaz protecia
biologic.
Hotele cu flux laminar de aer sunt dotate cu filtre principale HEPA (High
Efficiency Particulate Air) aflate n spatele zonei de lucru, aerul fiind ntotdeauna
filtrat nainte de a trece peste probe. Fluxul de aer poate fi verical sau orizontal. Aceste
hote ofer protecie doar pentru materialul care se afl n interior, operatorul nefiind
protejat microbiologic. Aceste hote sunt recomandate pentru protecia n momentul
manevrrii mediilor de cultivare i a reactivilor sterilizai.
Hotele de protecie biologic sunt incinte puternic ventilate, destinate limitrii
riscului de contaminare a personalului din laborator ce lucreaz cu ageni patogeni.
Aceste echipamente sunt destinate limitrii zonei de lucru i evitrii diseminrii
Luminia-Iuliana Malic


233
C
a
p
i
t
o
l
u
l

1
2

particulelor patogene pe calea aerului spre operator i n spaiul laboratorului. Hotele


de protecie biologic dispun de dou sisteme care mpiedic diseminarea agenilor
patogeni: bariera de aer i filtrele. Bariera de aer se realizeaz prin recircularea aerului
din incinta hotei ntr-o singur direcie, cu vitez constant, fr turbulene i poart
numele de flux de aer laminar. Filtrele au ca scop reinerea particulelor existente n
fluxul de aer. Cele mai uzitate sunt filtrele tip HEPA care rein particulele cu diametrul
de pn la 0,3 microni, n proporie de 99,9%.
Exist trei tipuri de hote de protecie biologic: clasa I, clasa II i clasa III.
Hotele de protecie biologic clas I
Sunt incinte nchise, cu deschidere frontal, ce permit accesul braelor
operatorului. Aerul ptrunde frontal n spaiul de lucru i este evacuat n exterior dup
trecerea prin filtrele HEPA. Viteza fluxului de aer este de cca. 4,4 m/s. Acest tip de
hot este recomandat pentru manipularea microorganismelor de clas 1, 2 i 3.
Dezavantajul acestui tip de hot de protecie biologic este acela c nu asigur
protecia materialului biologic, existnd riscul contaminrii acestuia. Din acest motiv,
hotele de protecie biologic clas I nu se recomand a fi folosite n laboratoarele de
micologie medical.
Hotele de protecie biologic clas II
Se difereniaz de cele prezentate anterior prin gradul ridicat de protecie oferit
utilizatorului, mediului ambiental, dar mai ales materialului biologic analizat, fa de
posibilii ageni contaminani.
Spaiul de lucru este ventilat utilizndu-se aer filtrat prin filtrele HEPA. De
asemenea, evacuarea aerului se realizeaz dup o filtrare ulterioar prin alte filtre
HEPA. Acest tip de hot este recomandat pentru manevrarea microorganismelor din
clasa de risc biologic tip 1, 2 i 3, n care sunt inclui i fungii.
n funcie de caracteristicile de fabricaie, fluxul de aer i sistemul de evacuare,
hotele de protecie biologic clas II sunt clasificate n:
- Hote de protecie biologic clasa II-A: evacueaz aerul filtrat n incinta
laboratorului sau n afara acestuia. Aerul poate fi recirculat n proporie de
70%;
- Hote de protecie biologic clasa II-B1: evacueaz aerul filtrat n afara
laboratorului. Recircularea aerului se realizeaz n proporie de 30%;
- Hote de protecie biologic clasa II-B2: evacueaz aerul filtrat n afara
laboratorului far ca acesta s fie recirculat;
- Hote de protecie biologic clasa II-B3: evacueaz aerul filtrat n afara
laboratorului dup o recirculare n proporie de 70%.

12.4. Substane decontaminante folosite n laboratoarele de micologie medical

Capacitatea antifungic (fungicid i fungistatic) a substanelor
decontaminante este diferit n funcie de structura chimic a acestora i de clasa de
fungi asupra creia dorim s acionm. Astfel, gama este destul de limitat, existnd
doar cteva opiuni utilizabile eficient (tabelul 12-2).



Norme generale de biosecuritate n laboratoarele de micologie medical


234
Tabel 12 2
Capacitatea antifungic a substanelor decontaminante
Substana
dezinfectant
Exemple
Nivelul
de
aciune
Mod de aciune
Concentraii
recomandate
Fenoli / Bi-fenoli
Triclosan,
Hexaclorofen
+ + +
Acioneaz
asupra
membranei
citoplasmatice
1 3%
Hipoclorii
Hipoclorit de Na,
K, Ca
+ Efect oxidant
0,5 1%
Cl activ
Alcooli
Alcool etilic
Alcool izopropilic
-
Nu manifest
efect fungicid
60- 90%
Aldehide Glutaraldehida + + +
Acioneaz
asupra peretelui
fungic
interacionnd
cu chitina
2%
Stocarea la
pH acid,
potenare la
pH alcalin
Formaldehid + + +
Efect fungicid
mai redus dect
al
glutaraldehidei
4 %
Biguanidine
Clorhexidina
gluconat
+ +
Aciune
levuricid prin
coagularea
constituenilor
citoplasmatici
0,2 0,5%
Iodofori Povidon iod + + +
Aciune asupra
nucleotidelor,
acizilor grai i
a unelor
proteine
1 10%
Compui
cuaternari de
amoniu
Clorur de
benzalkoniu
Clorur de
cetilpiridiniu
+
Aciune prin
dezorganizarea
membranei
plasmatice
0,5%

- Zilnic, dup terminarea programului, se va efectua curirea suprafeelor cu
hipoclorii, n concentraie de 0,5% Cl activ.
- Suprafeele de lucru se vor terge cu detergent lichid i prosoape de hrtie pentru
ndeprtarea substanelor organice cu potenial contaminant, dup care pot fi
aplicai compui pe baz de iod. Datorit coloraiei imprimate de iod
suprafeelor tratate, se recomand utilizarea derivailor iodoforici, de exemplu
povidon-iod (polivinilpirolidon-iod) n concentraie de 2%, datorit efectului
antifungic imediat, i cltirea cu ap dup cteva minute pentru eliminarea
coloraiei reziduale.
Luminia-Iuliana Malic


235
C
a
p
i
t
o
l
u
l

1
2

- n cazul contaminrii accidentale cu suspensie fungic, suprafaa respectiv se va


acoperi cu hrtie de filtru pentru evitarea extinderii ei, se va pulveriza
hipoclorit cu o concentraie superioar fa de concentraia uzual. Timpul de
aciune va fi de minim 20 minute. De asemenea, pot fi folosii i compui pe
baz iod. Toate materialele care intr n contact cu suprafaa contaminat vor fi
aruncate ntr-o cutie special pentru materiale patogene i se trimit spre
incinerare.

12.5. Msuri de protecie mpotriva substanelor chimice

- Hipocloritul de sodiu - produsele dezinfectante care conin n compoziia lor
hipoclorit de sodiu sunt ageni oxidani puternici care elibereaz clor gazos;
eliberarea acestuia este accelerat n mediul acid.
- Compuii cuaternari de amoniu - sunt substane ncorporate n multiple produse
dezinfectante, datorit gradului redus de periculozitate. Se va ine ns seama
de capacitatea iritativ pentru tegument i de cea alergizant;
- Formaldehida i glutaraldehida - sunt produse cu un nalt grad de toxicitate;
formaldehida poate fi stocat n laborator n forma gazoaz, lichid (soluie de
formalin) sau solid (paraformaldehida). Aceste substane pot produce, n
urma contactului direct, iritaii oculare i ale tractului respirator superior, iar
contactul prelungit duce la apariia dermatitelor, alergiilor cutanate i
respiratorii. Ambele substane posed efect cancerigen. Din acest motiv,
manipularea acestora se va face doar cu masc i ochelari de protecie;
- Coloranii - sunt substane folosite pentru diagnostic, n cantiti foarte mici. Cu
toate acestea, se va evita contactul direct cu acetia, n special cu produii
derivai din acridin cunoscui ca substane cancerigene.




















Norme generale de biosecuritate n laboratoarele de micologie medical


236
Bibliografie selectiv

1. Block S S (1991) - Desinfection, sterilization and preservation;
Pennsylvania; Lea & Febiger.
2. Borell N, Mesquida X, Alomar P (2001) - Normas de seguridad; In Peman
J, Martin-Mazuelos E, Rubio Calvo M C (eds) - Guia Practica de
Identification y Diagnostico en Micologia Clinica; Rev Iberoam Micol,
Bilbao.
3. Collins C H (1993) - Laboratory-acquired; History, incidence, causes and
prevention; Oxford, Butterworth - Heinemann.
4. Hoog G S de, Guarro J, Gen J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
5. Loza E, Alomar P, Bernal A, et al. (1999) - Seguridad en el Laboratorio
de Microbiologia clnica; Procedimientos en Microbiologia clnica;
Recomendaciones de la Sociedad Espanola de Enfermedades infecciosa y
Microbiologia Clinica; Madrid, SEIMC.
6. McDonnell G, Russell A D (1999) - Antiseptics and desinfectants: activity,
action and resistance; Clin Microbiol Rev; 12:147-179.
7. Sewell D L (1995) - Laboratory-associated infections and biosafety; Clin
Microbiol Rev; 8:389-405.
8. Warnock D W (2000) - Mycotic agents of human disease; In Fleming D O,
Hunt D L (eds.) Biological safety principles and practices; American
Society for Microbiology Press;
Washington D C.
Anex


237
A
n
e
x

Anex
Fig. nr. 2-1.
Zygomicoz cerebral experi-
mental; examen microscopic
direct; frotiu prin amprent,
coloraie cu calcofluor, x 200.
Fig. nr. 2-2.
Frotiu secreie vaginal;
col. Gram, x 400.
Fig. nr. 2-3.
Frotiu sediment LCR; col. tu
de India, x 400.
Anex


238




Fig. nr. 2-4.
Frotiu mduv osoas
hematogen;
Col. May-Grunwald-Giemsa,
x 400.

Fig. nr. 2-5.
Frotiu hemocultur;
necolorat, x 900.
Fig. nr. 2-6.
Preparat extemporaneu cu
band adeziv; lactofenol cu
albastru de metilen, x 900.
Anex


239
A
n
e
x











































Fig. nr. 4-1.
nsmnarea hemoculturii n pictur.
Fig. nr. 5-1.
Lutarea preparatelor extemporanee.

Fig. nr. 6-1.
Zygomicoz pulmonar;
Col. Fontana-Mason, x 400.

Anex


240





Fig. nr. 6-2.
Candidoz renal;
col. PAS, 400.
Fig. nr. 8-1.
Testul de hidroliz a ureei negativ
(stnga), pozitiv (dreapta)

Fig. nr. 8-2.
Colonii de C. neoformans pe Agar cu
extract din semine de Niger

Anex


241
A
n
e
x





Fig. nr. 8-3.
Aspectul coloniilor aparinnd
speciilor levurice identificabile
prin cultivare pe CandiSelect
4.

Fig. nr. 8-4.
Aspectul coloniilor aparinnd
speciilor levurice identificabile
prin cultivare pe CHROMagar
Candida.
Fig. nr. 8-5.
Aspectul coloniilor aparinnd
speciilor levurice identificabile
prin cultivare pe Chromogenic
Candida Agar.

Anex


242




Fig. nr. 8-6.
Kitul Auxacolor 2

Fig. nr. 8-7.
Aspectul galeriei Auxacolor 2
n cazul speciei C. tropicalis
Fig. nr. 8-8.
Aspectul galeriei de
identificare -Microplate
(Biolog)
Anex


243
A
n
e
x




Fig. nr. 8-9.
Aspect microscopic, preparat
extemporaneu, x 1000 fir de
pr - organe perforatoare in
vitro.
Fig. nr. 8-10.
Cultur de M. canis pe boabe
decorticate de orez

Fig. nr. 8-11.
Candida albicans
Tubi germinativi, preparat
extemporaneu cu lactofenol i
albastru de anilin; x 400


Index


245
I
n
d
e
x

Index

(
(1,3)Dglucan,...........................................153
5
5flucitozin..................................................203
A
abcessubcutanat............................................12
acidcafeic.....................................................182
acidnicotinic.................................................182
acridin.........................................................235
ADNpolimeraza...........................................196
Agar
acetatFowell.............................................46
acetatMcClary..........................................46
acidaceticdicloranextractdedrojdie......59
apderobinet...........................................76
BCGCandida..............................................47
BIGGY........................................................47
Blasto"D"..................................................48
Borelli........................................................64
Bromcrezolpurpurcazeinglucoz..........49
Christensen...............................................50
Ciocolat.....................................................49
ciree.........................................................79
cuacidcafeicicitratferic........................51
cuamidon..................................................76
cuextractdecartofiglucoz...................52
cuextractdedrojdieicloramfenicol.......52
cuextractdedrojdieifiton....................53
cuextractdemal.....................................81
cuextractdeorez......................................53
cuextractdepaprika.................................54
cuextractdesol........................................54
cuextractdetutun....................................55
cufindeovz.........................................66
cufindeporumb...................................55
cufindeporumbiTween80...............56
cufrunzedegaroaf.................................56
cuinfuziedeNiger.....................................74
cuLcanavaninglicinalbastrude
bromtimol............................................57
cusucrozicreatin................................58
cusucroz,creatinidicloran.................59
CzapekDox...............................................86
DicloranRoseBengalcloramfenicol...91
dicloran,extractdedrojdie18%glicerol..60
difereniereAspergillus.............................60
Dixon...................................................61,62
glicerin.....................................................79
glucozpeptondrojdie.......................62
infuziecordcreier..................................63
izolareCandida.........................................63
Lactrimel...................................................64
Leeming.....................................................65
Littman......................................................65
mal...........................................................80
MuellerHintonglucoz2%.................66
Nickerson..................................................47
Pal.............................................................67
pentrustudiereamorfologieilevurilor.....68
peptonglucozfluconazol..................69
pepton3%...............................................94
RPMIMOPSglucoz..............................90
SABHI........................................................71
Sabouraudcicloheximid..........................71
Sabouraudcloramfenicol..........................72
Sabourauddiluat.......................................75
SabouraudEmmons..................................72
SabouraudTTC..........................................87
sngeglucozcistein..........................73
selectivcutriptofan..................................74
Staib..........................................................74
Takaschio..................................................75
Trichophyton.....................................92,182
Trichophyton1..........................................92
Trichophyton2..........................................92
Trichophyton3..........................................93
Trichophyton4..........................................93
Trichophyton5..........................................93
Trichophyton6..........................................94
Trichophyton7..........................................94
Tween80............................................56,75
albastrudemetilen3%..................................22
alcalinizare...................................................183
alcooletilic...................................................234
alcoolizopropilic..........................................234
alcooli...........................................................234
aldehide........................................................234
AM3................................................................83
amfotericinB..............................................203
amorse.........................................................196
amplitaqgold...............................................195
antibioticmedium3.......................................83
Index

246
Antifungigrama
alegereaantifungicelor...................204,206
aplicareabenzilorEtest..........................204
Aspergillus...............................................206
Candida...................................................203
CLSIM44A..............................................208
Cryptococcus...........................................203
Fusarium..................................................206
heterorezisten......................................204
metodadifuzimetricKirbyBauer..........208
preparareainoculului......................203,206
recomandrideinterpretare..................209
regulidecitireaCMI.......................204,207
Rhizopus..................................................206
Rhodotorula............................................203
Scedosporium..........................................206
tehnicadelucrupentrufungi
filamentoi.........................................206
tehnicadelucrupentrulevuri.................203
Trichosporon............................................203
aparateproteticeamovibile...........................12
artrospori........................................................85
ascospori........................................................46
asimilareasurselordeazot...........................180
asimilareasurselordecarbon......................180
aspiratulendotraheal.....................................10
aspiratulprostatic...........................................15
aspiratulpulmonar.........................................11
aspiratultraheostomic...................................10
B
bandadeziv.................................................22
bandaadezivBIOTAPE...............................225
BHI..................................................................63
bifenoli........................................................234
biguanidine...................................................234
biopsiapulmonar..........................................11
biopsiatesticular..........................................15
biosecuritate.................................................229
Blankophor.....................................................21
Blast..............................................................198
blastoconidii...................................................85
bromcrezolpurpur.......................................183
bromurdeetidiu.........................................193
bronhoscopia..................................................11
Bulion
cuuree......................................................77
CzapekDox................................................86
Sabouraud.................................................78
C
C.albicans....................................................185
C.dubliniensis.......................................185,194
calcofluor.......................................................21
capacitatealergizant..................................230
Caseta
AIROCELL..............................................212
BIOCELL...................................................215
CYCLEXD.................................................215
LARO100................................................216
MICRO5..................................................214
caspofungin................................................203
cateter..............................................................3
cernealParker..............................................21
CHROMagarCandida................................45,78
Chromas.......................................................198
clamidospori..................................55,67,85,87
clarificareacuKOHidimetilsulfoxid............25
clasederiscbiologic.....................................229
clorhexidinagluconat...................................234
clorurdebenzalkoniu.................................234
clorurdecetilpiridiniu................................234
colorani.......................................................235
Coloraia
albastruAlcianpentrumucopolizaharide
acide..................................................126
Bauer.......................................................128
Chick........................................................130
cuacidperiodicSchiff.............................143
cucalcofluoralbiKOH10%.....................26
cuhidroxiddepotasiuicernealParker.25
culactofenolialbastrudeanilin............24
cumucicarminSouthgat...........................35
fluorescentcuacidperiodicSchiff........142
FontanaMasson.....................................135
Giemsa......................................................31
GomoriGrocott......................................139
Gram.........................................................28
Gramcalcofluoralb.................................30
Gridley.....................................................131
Gridleyfluorescent................................138
HemalaunEozin.................................123
MayGrunwaldGiemsa.............................32
methenaminesilvermodificat..............139
Musto........................................................36
negativcumercurochrom2%itude
India.....................................................23
negativcutudeIndia............................22
PAS..........................................................143
PASflourescent.....................................142
Schmorl...................................................133
Wright.......................................................34
Index


247
I
n
d
e
x

ZiehlNeelsen.........................................145
compoziiamediilordecultur.......................42
compuicuaternardeamoniu......................234
conservaredermatofii...................................95
controlulcalitiiacizilornucleici.................193
controluldecalitate.......................................44
cromomicoz..................................................12
cultivaresubmers.......................................105
cultivareanpictursuspendat.............106
cultivareapeblocdegeloz.........................106
cultivareapelam........................................106
cultivareapesuporturitransparente...........105
D
dermatofii...................................................184
deteciaCO
2
......................................................4
difereniere...................................................185
dispozitiveintravasculare.................................3
dispozitivulCIP10M.....................................219
DTM................................................................88
durataincubrii................................................7
E
electroforezangeldeagaroz....................193
endodontite....................................................12
epuizarepemediisolide...............................101
etalarenpuncteizolate...............................101
evideniereacapsulei......................................22
examenmicroscopicdirect.............................21
expectoraieindus........................................10
expectoraiespontan....................................10
extractdecartofi............................................80
extraciaADN...............................................191
extraciaADNuluiprincrioprecipitare.........192
F
fenoli.............................................................234
fermentareazaharurilor...............................179
filtreHEPA....................................................232
firedepr.........................................................9
fixarea...........................................................113
Fixatori
Bouin...............................................114,116
Hollande..........................................114,116
soluiadeformol10%tamponat...114,115
flacoanedehemocultur..................................2
fluconazol.....................................................203
fluideleintraoculare.........................................9
formaldehid................................................234
formulardecerere...........................................1
fragmentetisularebiopsice............................15
fragmenteunghiale..........................................9
frotiucitobacteriologic...................................14
frotiucoloratMayGrunwaldGiemsa............22
fungiaeropurtai..........................................211
Fungitell........................................................153
controlulcalitii.....................................158
interpretarearezultatelor.......................157
limite.......................................................158
tehnicdelucru......................................155
valoriateptate.......................................159
G
galactomanan...............................................160
geldeagaroz1%.........................................193
GenBank.......................................................198
germtubetest.............................................185
glutaraldehida..............................................234
Guizotiaabyssinica.........................................74
H
Hemocultura
volumuldesnge........................................4
hexaclorofen................................................234
hidrolizacazeinei..........................................184
hife.................................................................85
hipocloritdeCa............................................234
hipocloritdeK..............................................234
hipocloritdeNa............................................234
hipoclorii.....................................................234
histidin........................................................182
HistidinHCl...................................................94
hotedeproteciebiologic..........................232
hoteledeproteciebiologic.......................233
I
impactorulZefonZA6..................................217
impetigo...........................................................9
imunofluorescen.........................................22
infuziedecartofi......................................52,80
nglobare......................................................101
inozitol..........................................................182
Index

248
inozitol............................................................93
iodofori.........................................................234
itraconazol....................................................203
ITS1......................................194,195,196,197
ITS4......................................194,195,196,197
K
kiturideextracieADN................................191
L
latexaglutinareC.dubliniensis.....................172
lavajulbronhoalveolar....................................11
LBA..................................................................11
lichidpericardic..............................................11
lichidperitoneal..............................................11
lichidpleural...................................................11
lichidsinovial..................................................11
lichidulcefalorahidian.....................................8
Lprolinaminopeptidaza..............................182
Lutare
preparateextemporaneu........................111
M
M.audouinii.................................................185
M.canis........................................................185
mduvaosoashematogen............................8
mananseric..................................................169
markeridegreutatemolecular...................193
mediicromogene............................................45
mediidecultivare...........................................46
mediidifazice....................................................5
mediidifereniale...........................................43
mediihipertone................................................6
Mediu
bazpentrulevuri.....................................82
culaptediluat............................................84
cupine.....................................................85
cusol.........................................................85
deconversie..............................................86
pentruizolareadermatofiilor...................88
sinteticpentrutestuldefilamentare........83
mediul
Christensen.............................................181
Mediul
Bilai............................................................84
KurungYegian...........................................86
NikersenMankovski..................................87
PaganoLevin.............................................87
RPMI1640...........................................70,89
RPMI1640MOPS(CLSI)............................89
RPMI1640MOPS(EUCAST)......................89
metodaDalmau............................................105
metodalizeicucentrifugare.............................5
micetom.........................................................12
momentulprelevrii.........................................4
mucoasaoral................................................12
mucopolizaharidecapsulare........................126
Musto.............................................................22
N
NCBI..............................................................198
negruclorazol.................................................21
O
organeperforatoare.....................................184
P
pstrareamediilor..........................................44
PCR...............................................................191
PCRduplex...................................................194
PDA.....................................................42,52,80
periajulbronic...............................................11
Pityriasisversicolor...................................10,22
plgideschise.................................................12
Platelia

Aspergillus......................................160
PlateliaAspergillus
interpretarearezultatelor.......................164
principiultestului....................................160
tehnicadelucru......................................162
PlateliaCandidaAC
interpretarearezultatelor.......................167
principiultestului....................................165
tehnicadelucru......................................166
PlateliaCandidaAg
interpretarearezultatelor.......................171
principiultestului....................................169
tehnicadelucru......................................170
Platelia

CandidaAc.....................................165
Platelia

CandidaAg.....................................169
posaconazol..................................................203
povidoniod................................................234
prelevatebalanoprepuiale...........................15
prelevatulotic..................................................9
preparareamediilor.......................................43
Index


249
I
n
d
e
x

preparatextemporaneu...........................21,22
Preparatulextemporaneu
cubandadeziv.....................................110
culactofenolialbastrudeanilin..........109
primeri..........................................................196
principiulimpregnriiargentic.....................38
probelebiopsicetransbronhiale.....................11
procesareaesuturilor..................................117
Procesareaesuturilor
clarificarea...............................................119
colorarea.................................................123
deshidratarea..........................................118
etalareaseciunilor.................................121
etichetareaiarhivarea...........................150
impregnareacuparafin.........................119
includerea...............................................120
montarea.................................................148
secionarea..............................................120
producereaaltorenzime..............................182
producereadefenoloxidaz........................182
producereadeureaz...................................180
proteinazaK..................................................191
pseudohife......................................................85
puncierahidian..............................................8
punciesternal................................................8
puncievenoasperiferic...............................3
pungiparodontale..........................................12
purificareaizolatelorlevurice.......................103
R
raclatulcornean................................................9
Recoltare
precauii......................................................1
rezistenalacicloheximid...........................181
risccolectiv...................................................229
riscindividual................................................229
S
snge................................................................2
scotch...........................................................110
scuamecutanate..............................................9
secreiaprostatic..........................................15
secreiipurulente...........................................12
secreiirespiratoriijoase................................10
secreiivaginale..............................................14
secvenializareafragmenteloramplificate...198
secvenializarearegiunilorITS......................196
secvenializator............................................198
seminedeNiger..........................................182
semnificaiahemoculturilorpozitive................8
sersanguin...................................................185
sistemeautomate............................................4
sistemesemiautomate.....................................4
splturabronic..........................................11
speculum........................................................14
sporothricoz.................................................12
sputa..............................................................10
sterilizareamediilor.......................................43
substanecancerigene.................................235
substanedecontaminante..........................233
T
Tehnica
nsmnriilevurilorpeAgarulcu
findeporumbitween80..................105
tehnicaaspiraieicuacfin..............................16
tehnicasedimentriiKoch............................224
Tehnici
deaeromicologie....................................211
deevaluareasensibilitii
laantifungice....................................203
deexaminaremicroscopicafungilor
dinculturi..........................................109
dehistopatologie....................................113
densmnare.......................................101
demicroscopiedirect..............................21
deprocesareprimar..................................1
derecoltare.................................................1
deseromicologie.....................................153
detransplantare.............................101,107
detransport................................................1
testdeopacifiere...........................................75
testureaz......................................................77
testebiochimice...........................................179
testefiziologice............................................179
Testul
deblastez..............................................185
decultivarepeAgarBCPlapteglucoz..183
decultivarepeboabedeorez.................185
dedepistareanecesitilornutritive
speciale..............................................182
defilamentare.........................................185
dehidrolizaureeiladermatofii...........181
dehidrolizaureeilalevuri....................180
deperforareafiruluideprinvitro.......184
determostimulare..................................186
determotoleran..................................186
tiamin.........................................................182
tiaminHCl.....................................................93
tinea.................................................................9
Index

250
transluminator..............................................193
triclosan........................................................234
tubgerminativ..............................................185
tubigerminativi..............................................84
tudeIndia.....................................................22
U
Urina
cateterismvezical......................................13
cateterizarevezical..................................13
recoltarelabrbai....................................13
recoltarelafemei......................................12
recoltareapecateterpreexistent..............13
recoltareaprinpunciesuprapubian.......13
V
valve...............................................................14
vizualizareagelului.......................................193
voriconazol...................................................203
Y
YeastCarbonBase..........................................82
Z
zygomicete.....................................................85
zygomicoza.....................................................15

galactozaminidaza.....................................182


w
w
m





P

V

A

Se

Tr



www.fungi.ro
www.journal.fu
micologiemedi
OP 6, C
Iai, Ro
Consil
Preedinte:
Vicepreedinte
dministrator p
ecretar:
Trezorier:

fungi.ro
icala@gmail.c
CP 1356
omnia
liul director
e:
publicaii:
de M

251


com
:
Dr. M
mih
Dr. Bo
bogd
Ing. Io
ionu
Dr. In
ingr
Dr. Lu
lum
Soci
Micologie M
1
Mihai Mare
aimares@fun
ogdan Dorofte
dandoroftei@
onu Ailinci
utailincai@fun
ngrid Cezara A
ridapetrei@fun
uminia Malic
initamalic@fu
ietatea Rom
Medical i M
ngi.ro
ei
@fungi.ro
ngi.ro
Apetrei
ngi.ro
c
fungi.ro
mn
Micotoxicoloogie