2010 Blackwell Verlag GmbH

Accepted on 25 May 2010 J Zool Syst Evol Res doi: 10.1111/j.1439-0469.2010.00577.x

Department of Zoology, Graduate School of Science, Kyoto University, Sakyo, Kyoto, Japan

Mitochondrial phylogeography of the Japanese pond turtle, Mauremys japonica (Testudines, Geoemydidae)
Dai Suzuki and Tsutomu Hikida

Abstract
The phylogeography of the Japanese pond turtle, Mauremys japonica (Temminck and Schlegel, 1835), which is an endemic species in Japan, was studied by analyzing the variation in two mitochondrial DNA sequences, the cytochrome b gene and the control region. These analyses suggest that M. japonica comprises two major groups. The rst one was found in the more eastern region, eastern Honshu Island and Shikoku Island, while the second was found in a western region, Kyushu Island and the Chugoku District (the westernmost part of Honshu Island). The boundary between the two groups is located in the Chugoku District. The nucleotide and haplotype diversities were very low, and these low diversities seem to have been caused by a bottleneck in the last glacial age. These results suggest that this species survived the last glacial period in two refugia, one in the central part of Honshu Island and the other one in Kyushu Island. Subsequently, population expansion took place in the postglacial period, and the groups from the two refugia extended their distribution ranges to the present boundary in the Chugoku District which represents a secondary contact zone. Key words: Control region cytochrome b freshwater turtle Mauremys japonica mtDNA phylogeography

Introduction
Phylogeography deals with the geographical distribution and spatial arrangements of genetic lineages, especially those within and among closely related species (Avise 2000, 2009). In intraspecic phylogeny, the relationship between the geographical distribution of haplotypes and their position in a gene genealogy shows the population structure and evolutionary history (Serb et al. 2001). Recent phylogeographical studies using molecular methods such as DNA marker analysis have also enabled the detection of variation that is dicult to recognize by morphological analysis (Okamoto et al. 2006). The northern limit of the distribution of most reptiles that originated in East Asia has been considered to be the Japanese main islands and the Primorsky Kray region in Russia, although several species of Squamata that originated in Europe appear around boreal forests (Hikida 2002). Hikida also suggested that several species had been isolated in the Japanese main islands and the Korean Peninsula in glacial ages and that they might have acquired cold resistance and dierentiated from southern populations. Thus, the Japanese main islands are an attractive region for the phylogeographical studies of reptiles to investigate the eects of cold climate during the glacial age, but there are few studies of reptiles compared to other vertebrates. The Japanese pond turtle, Mauremys japonica (Temminck and Schlegel, 1835), is an endemic species in the Japanese main islands and inhabits streams, rivers, and ponds in Honshu, Shikoku, Kyushu, and adjacent islands (Sengoku 1979; Yasukawa et al. 2008). Subspecies have not been described, and an intraspecic variation, such as a morphological variation, has not been reported (Yasukawa et al. 2008). Several molecular studies indicated that the genus Mauremys is paraphyletic with respect to the genera Chinemys and Ocadia, and that M. japonica is closer to the members of the genera Chinemys and Ocadia than other Mauremys species (Honda
Corresponding author: Dai Suzuki (dai@zoo.zool.kyoto-u.ac.jp) Contributing author: Tsutomu Hikida (tom@zoo.zool.kyoto-u.ac.jp)

et al. 2002; Barth et al. 2004; Feldman and Parham 2004; Spinks et al. 2004; Sasaki et al. 2006). Several recent studies included the three genera in the genus Mauremys, but the genera Chinemys and Ocadia exhibit extremely dierent morphology from the conventional genus Mauremys (see Hirayama et al. 2007). Accordingly, the genera Chinemys and Ocadia were used in this study. The Chinese red-necked pond turtle, C. nigricans (Gray, 1834), and the Chinese stripenecked turtle, O. sinensis (Gray, 1834), are distributed in East Asia but not currently in Japan (Hirayama 2001). Although the Reeves pond turtle, C. reevesii (Gray, 1831), is distributed not only in East Asia but also widely in Japan today, this species is considered to have been introduced to Japan from the Korean Peninsula (Hirayama et al. 2007). In addition, a soft shell turtle, Pelodiscus sinensis (Wiegmann, 1834), occurs in the Japanese main islands, and three geoemydid species, M. mutica kami Yasukawa, Ota and Iverson, 1996, Geoemyda japonica Fan, 1931, and Cuora avomarginata evelynae Ernst and Lovich, 1990, are native to the Ryukyu islands and not to the Japanese main islands. Thus, these closely related species do not naturally appear in the Japanese main islands, M. japonica being the only one inhabiting there. This study is the rst assessment of the geographical variation of M. japonica. We have analyzed the mitochondrial DNA diversity of M. japonica using a DNA sequencing technique and have determined the phylogeny of haplotypes. The evolutionary history of M. japonica is discussed from a phylogeographical viewpoint based on the molecular ndings.

Materials and Methods

Sampling
A total of 238 individuals of M. japonica were collected from 43 localities across the entire range of the species (Fig. 1 and Appendix S1). We caught individuals in natural rivers and ponds by hand or using traps. Muscle tissues or blood taken from each individual were stored at )80C or in 99% ethanol until molecular processing. Voucher specimens were deposited in the Zoological Collection of the Kyoto University Museum (KUZ: see Appendix S1 for further details).

J Zool Syst Evol Res (2011) 49(2), 141147

142

Suzuki and Hikida

Fig. 1. Sampling localities of Mauremys japonica in Japan. Dashed lines indicate boundaries of the natural distribution, according to Yasukawa et al. (2008).

Laboratory procedures
Total genomic DNA was extracted by the methods of Wada et al. (1992) and Honda et al. (1999). Our target sequences were the mitochondrial cytochrome b gene (cyt b) and control region (CR). We used the polymerase chain reaction (PCR) to amplify the two regions using an Ex Taq polymerase kit (TAKARA BIO Inc., Otsu, Japan) with a PCR system GeneAmp 2700 Thermal Cycler (Applied Biosystems, Lincoln, NE, USA). The primers were GLU5eeg (5TGATATGAAAAACCACCGTTG -3) (modied from Palumbi 1996) and M (5- TCATCTTCGGTTTACAAGAC -3) (Shaer et al. 1997) for cyt b, and Mauremysd-loopF (5- TCTCCCGTGCCCAACAGAGAAATGTC -3) (this study) and Mauremysd-loopR (5GTTGCTCTCGGATTTAGGGGTTTGACG -3) (this study) for CR. The thermocycling parameters were 94C for 5 min, followed by 35 cycles at 94C for 1 min, 48C (for cyt b) or 58C (for CR) for 2 min and 72C for 2 min, and a nal extension at 72C for 7 min. Before sequencing, unincorporated primers were removed from PCR products by PEG precipitation by adding 0.6 volumes of PEG solution (20% PEG6000, 2.5 M NaCl). The sequencing primers were the above fourones plus two additional ones, L15192cbEu (5- TGAGGCGCAACCGTAATTACAAACCT -3) (Okamoto and Hikida 2009) and H15263cbMauremys (5- TGAAAGGTGAAGAATCGGGTTAGGG -3) (modied from Okamoto and Hikida 2009) for cyt b. Cycle sequencing was performed using 40 cycles of 10 s at 96C, 5 s at 48C, and 4 min at 60C for cyt b, and 40 cycles of 10 s at 96C, 4 min at 60C for CR. Products were sequenced using ABI PRISM 377 and 3130 Sequencers (Applied Biosystems).

combined sequence data set of cyt b and CR with TCS ver. 1.21, which is based on statistical parsimony (Templeton et al. 1992). The historical demography of populations was inferred from the mismatch distribution (Schneider and Excoer 1999) and Tajimas D (Tajima 1989) neutrality test. We used the combined sequence data of cyt b and CR and performed the above two tests for the entire data set, and for the two genetic groups that were revealed by phylogenetic analysis (see Results), using ARLEQUIN 3.12. Mismatch distribution is the distribution of observed numbers of pairwise dierences among mtDNA haplotypes. When populations are at demographic equilibrium, the distribution becomes multimodal, whereas in the case of populations that have experienced a recent demographic expansion, the distribution is unimodal (Rogers and Harpending 1992; Excoer 2004). Tajimas D neutrality test estimates historical population growth, which generally leads to a negative D value. To investigate a correlation between genetic distances and geographical distance and to test a possible scenario of isolation by distance (IBD), we conducted partial Mantel tests with 1000 randomizations using the program ibd version 1.52 (Bohonak 2002) with three input matrices, the genetic distance (mean distance) of the combined sequence data of cyt b and CR implemented in MEGA 3.0 (Kumar et al. 2004), the geographical distance, and an indicator (0, 1) matrix that was categorized by genetic groups (0 = Group A, 1 = Group B: see Results) among sites. Because two genetic groups were observed together in three sites, we used these sites divided into two dierent sites based on the genetic groups in the partial Mantel test.

Results
Analysis
Cytochrome b and CR sequences were aligned separately with CLUSTALX version 2.0.5 (Larkin et al. 2007). All alignment parameters were held constant at the default values. Population genetics statistics, haplotype diversity and nucleotide diversity of cyt b, CR, and combined cyt b and CR fragments were estimated using ARLEQUIN ver. 3.12 (Excoer and Schneiser 2005). To investigate the relationships among haplotypes, we constructed a haplotype network of the

Genetic variation We determined the sequences of a 970-bp region of cyt b and a 716-bp region of CR. The sequence data have been submitted to GenBank database (AB559016559491). We detected 13, 23, and 34 haplotypes from cyt b, CR, and the combined data set, respectively. The haplotype diversity (h) of cyt b, CR, and combined sequences was 0.54, 0.80, and 0.84, respectively.

J Zool Syst Evol Res (2011) 49(2), 141147 2010 Blackwell Verlag GmbH

Mitochondrial phylogeography of the Japanese pond turtle The nucleotide diversity (p) was 0.067%, 0.371%, and 0.196%, respectively. The haplotype and nucleotide diversities of CR were higher than those of cyt b. Geographical distribution of haplotypes Intraspecic variation was analyzed by using combined cyt b and CR fragments and the aligned total 1686 bp. In the haplotype network (Fig. 2), two groups, A and B, were recognized. They consisted of two more frequent haplotypes, A-4 and B-1, with many less frequent haplotypes. These two major haplotypes were located in an interior position of their respective group, and there were a minimum of ve and maximum of seven mutational steps between haplotypes A-4 and B-1. The geographical distribution of haplotypes is shown in Fig. 3. The Group A haplotypes occurred in sites 124, 28, 33, and 34, that is, in most of Honshu Island and throughout Shikoku Island. Haplotype A-4, which had the highest frequency among all observed haplotypes, had the largest geographical range, i.e., sites 48, 12, 13, 1524, 33, and 34. Especially, this major haplotype was found in all sites in the Kinki District (sites 1524) of the central part of Honshu Island. Other haplotypes of Group A having lower frequency diered by one to four steps from haplotype A-4. In contrast, Group B haplotypes were found in sites 2932 and 3543, that is, in the western part of the Chugoku District of Honshu Island, and in the whole region of Kyushu and Tanegashima Islands. Haplotype B-1 was found in all the sites where this group was present. The remaining haplotypes of Group B were present in a small number of individuals and diered from haplotype B-1 by one to three mutational steps. The locality having the highest diversity in Group B was site 42, the northern area of Tanegashima Island, and where ve haplotypes (B-1, and B-1013) were found. These haplotypes were unique to site 42, except haplotype B-1. The two groups (haplotypes A-9, A-13, A-14, B-1, B-7, and B-9) were found together in sites 2527 in the Chugoku District. The intrapopulational genetic distances in these sympatric sites were higher than those of any other sites in our study. For example, there were eight mutational steps between haplotypes A-9 and B-1 in site 26 (see Appendix S1). Furthermore, sites 28 and 29 are geographically close to each other, but the compositions of the haplotypes in these sites were completely dierent. Most of the individuals in site 28 were haplotype A-9, while most of those in site 29 were B-8, which diered by eight mutational steps from A-9. Population genetics analyses The results of historical demography analyses are shown in Fig. S1 and Table S1. Mismatch distribution analyses yielded bimodal results for the entire data set and unimodal results for Groups A and B, and signicantly supported the conclusion that all three data sets do not deviate from the expected expansion model. Although the Tajimas D scores were negative for all three data sets, rapid population expansion was only signicantly supported for Groups A and B. We found a signicant correlation (p < 0.001, R2 = 0.3294; slope = 0.0000059) between genetic and geographical pairwise distance measures. A Partial Mantel test also showed that correlations were signicantly supported

143

Fig. 2. Parsimony network of mtDNA haplotypes (combined cyt b and CR sequences) of Mauremys japonica population. Node size corresponds to approximate frequency of samples. Lines between nodes correspond to one mutation step. White squares indicate intermediate haplotypes not sampled in this study

(p < 0.001) for genetic and geographical distances controlling for indicator matrix, and for genetic distance and indicator matrix controlling for geographical distance. Thus, genetic and geographical distances were correlated with each other within the genetic groups A and B, and there was an apparent eect of IBD in each group. On the other hand, intergroup genetic distances were uniformly distributed at high positions on the genetic distance axis, and these were independent of geographical distances (Fig. S2). This also meant that Groups A and B were two distinct genetic groups and did not constitute a single group. J Zool Syst Evol Res (2011) 49(2), 141147 2010 Blackwell Verlag GmbH

144

Suzuki and Hikida

Fig. 3. Distribution of haplotype groups in Mauremys japonica population. Black circles represent Group A and white circles represent Group B. The black circle indicated by an arrow includes four sites: 16, 17, 18, and 19. Symbol size corresponds to approximate numbers of individuals sampled: small, middle, and large sizes mean 12, 35, and over 6 individuals, respectively. The area surrounded by dashed lines indicates that haplotype A-4 was observed

Discussion
Population structure of Mauremys japonica For a species that has experienced a recent population growth from small or modest numbers of founders, one expected genealogical signature is a star phylogeny (Avise 2000). Additionally, if each of two long-isolated populations has undergone recent population expansion, the species should display a dumbbell gene tree with two star phylogenies connected by a longer branch (Avise 2000). Older haplotypes having higher frequency in the population have a greater probability of becoming interior haplotypes than younger haplotypes which are connected to the major ones independently by short branches in the network, and will be more broadly distributed geographically on average (Posada and Crandall 2001). We showed here that M. japonica had two genetic groups and showed a dumbbell gene tree in the network (Fig. 2). Each group had a major haplotype, A-4 and B-1, respectively, in the centre of the network, and these haplotypes were widely distributed in their respective geographical range, especially in the central areas (Figs 2, 3 and Appendix S1). Thus, haplotypes A-4 and B-1 might be the respective ancestor in each group, and the other haplotypes might have been derived from them. On the other hand, younger haplotypes which were separated by one or more mutational steps from the major ones tended to be found in the peripheral areas of the distribution range, particularly in Group A (Fig. 3 and Appendix S1). Similarly, the Partial Mantel test signicantly supported IBD within each genetic group. This study also revealed that the boundary area between the two groups in M. japonica occurs around sites 2529, and the genetic distances between the two groups near the boundary J Zool Syst Evol Res (2011) 49(2), 141147 2010 Blackwell Verlag GmbH

area were higher than those in other areas. This means that the two groups contacted each other there. Furthermore, the boundary was found in narrow areas where the two groups were geographically close to each other, and historical demography analyses, mismatch distribution analysis, and Tajimas D neutrality test also signicantly supported the notion that Groups A and B had experienced rapid population expansion (Fig. S1 and Table S1). Thus, these results suggested that the two dierent groups presented a recent secondary contact in that region. Phylogeographical pattern and impact of the last glacial age No fossils of M. japonica have been recorded, but a fossil species of M. yabei (Shikama, 1949) was found from the Late Pleistocene (Shikama 1949). Although it was considered that M. yabei was closely related to M. japonica on the basis of shell morphology (Shikama 1949), Hirayama et al. (2007) suggested that this fossil species seemed too dierent and specialized to be regarded as the direct ancestor of the living species. On the other hand, fossil records of members of the genera Ocadia and Chinemys were reported from the Early Miocene (Ocadia sp), the late Early Pliocene (O. sinensis and C. cf. nigricans), and the Middle Pleistocene (O. nipponica Hirayama, Kaneko and Okazaki, 2007) in Japan (Hirayama 2001; Hasegawa et al. 2002; Hirayama et al. 2007). These fossil records suggest that the initial divergence between M. japonica and closely related species, Ocadia and Chinemys, was completed at least in the Early Miocene and in the late Early Pliocene, respectively. Furthermore, as proto-Japan became an island arc isolated from the Asian continent in the Miocene (Maruyama et al. 1997) and the fossil records of Ocadia sp

Mitochondrial phylogeography of the Japanese pond turtle were reported from the Miocene in Japan (Hasegawa et al. 2002), the speciation of M. japonica from these closely related species might have occurred before the insularization of Japan. Additionally, although at least M. japonica and species of Ocadia and Chinemys were initially present in Japan, only M. japonica survives until present except for three geoemydid species in the Ryukyu Islands. C. reevesii is widely distributed in Japan nowadays, but probably this species was introduced more recently, as Hirayama et al. (2007) suggested. The haplotype and nucleotide diversities of a Mediterranean turtle, Mauremys leprosa (Schweigger, 1812), were 0.81 and 0.57%, respectively, for cyt b, and such low genetic diversity suggested that this turtle experienced reduction of its population size and a bottleneck eect during the last glacial age (Fritz et al. 2006). In the present study, the haplotype and nucleotide diversities of M. japonica were 0.54 and 0.067%, and the nucleotide diversity was surprisingly low compared to that of M. leprosa. Thus, M. japonica seems to have gone through a more severe reduction than M. leprosa. The haplotype distributions of M. japonica do not appear to reect the presence of existing barriers. Although Honshu and Kyushu Islands are separated by a shallow sea at present, the boundary between haplotypes was not located there. Similarly, Shikoku Island, which is surrounded by seas and is not connected with the other Japanese islands nowadays, shows a haplotype composition quite similar to that in Honshu Island. Thus, it appears that the present geographical variation was strongly aected by some historical processes rather than the present geographical structure alone. Similarly, the present sea straits also do not constitute phylogeographical barriers in the Western Palaearctic terrapin species M. leprosa, Emys orbicularis (Linnaeus, 1758), and M. rivulata (Valenciennes, 1833) (Fritz et al. 2006, 2007, 2008). These facts suggest that sea

145 straits generally may be rather easily crossed by aquatic terrapin species. The distributions of many animals and plants are considered to have been restricted to some refugia during the glacial periods. Likely, refugia can be inferred by relating haplotype distributions to geological records (Wilson et al. 1996). This study suggests that each of the two groups has one major haplotype, A-4 or B-1, which is considered to be the origin of the respective group, and is mainly distributed in the Kinki District of Honshu Island and Kyushu Island, respectively. As indicated by the analyses of fossil pollen at the last glacial maximum (2018 kya), the Kinki District and Kyushu Island were then covered with temperate deciduous forest (Gotanda and Yasuda 2008) and are presumed to have been relatively warm areas. Therefore, it is possible that these two areas were refugia for M. japonica in the last glacial age and were the ancestral areas of the present distribution: The refugium in the Kinki District was the origin of Group A and the one in Kyushu Island was that of Group B. We propose the following hypothetical evolutionary history of M. japonica after the last glacial age (Fig. 4): Before the last glacial age Mauremys japonica seems to have been distributed in the Japanese main islands since the Miocene. Before the last glacial age, M. japonica was composed of at least two lineages that were the ancestors of present Groups A and B. The last glacial period Mauremys japonica survived in two refugia, the Kinki District (for Group A) and Kyushu Island (for Group B), in the last

Fig. 4. Map showing dispersal patterns of Mauremys japonica from two refugia following glacial retreat. Black and white ellipses represent the hypothetical refugium of Groups A and B, respectively. Arrows mean dispersal patterns of the genetic groups after the glacial age. The circle having equal black and white frequencies indicates secondary contact of Groups A and B

J Zool Syst Evol Res (2011) 49(2), 141147 2010 Blackwell Verlag GmbH

146 glacial period. A bottleneck eect seems to have reduced the genetic diversity at each refugium. After the glacial age After the last glacial age, the two groups of M. japonica expanded their distributions from the two refugia. The two groups showed dierent dispersal patterns. Radial expansion occurred in Group A, which spread throughout Honshu and Shikoku Islands. By contrast, Group B extended only to the Chugoku District of Honshu Island. Currently, these two groups are in contact at a boundary in the Chugoku District. Comparison with phylogeographical patterns of freshwater shes The geographical patterns of mtDNA variation in freshwater turtles in the southeastern United States are reported to be similar to those of the freshwater shes (Walker and Avise 1998). Several studies have shown that the present distributions and phylogeographical patterns of Japanese freshwater shes are correlated with the histories of river systems (Shimizu et al. 1993; Matsuda et al. 1997; Sakai et al. 1998; Watanabe and Nishida 2003). In the last glacial age, Honshu, Shikoku, and Kyushu Islands were connected to each other as sea level was lower than at present (Ohshima 1990), and there were paleo-rivers in the present Kii and Bungo straits (see Fig. 1). The genetic components of the freshwater shes around these paleo-river systems were rather similar to those in adjacent areas at present. In this study, the M. japonica individuals in the watershed of the Kii strait are found to belong to Group A but those of the Bungo strait did not show a uniform distribution pattern (Fig. 3). The individuals from sites 3537 located in Kyushu Island were members of Group B. On the other hand, all four individuals from site 34, Shikoku Island, were Group A, and thus dierent from those of Kyushu Island. This result implies that the recent haplotype distribution of M. japonica is dierent from that of freshwater shes and that there was not a strong inuence of the paleoriver system on it.

Suzuki and Hikida

ostlichen Teil der Insel Honshu sowie auf der Insel Shikoku verbreitet, wahrend die andere Gruppe im westlichen Teil der Insel Honshu (Chugoku Bezirk) sowie auf der Insel Kyushu vorkommt. Die Verbreitungsgebiete beider Gruppen grenzen im Chugoku-Bezirk aneinander. Die Nukleotid- und Haplotypendiversitat der Art ist niedrig, was vermutlich auf einen genetischen Flaschenhals wahrend der letzten Eiszeit zuruckzufuhren ist. Die Ergebnisse deuten darauf hin, dass die zwei Gruppen dieser Art in zwei Refugien uberlebten: eine im zentralen Teil der Insel Honshu und die andere auf der Insel Kyushu. Nacheiszeitliches Wachstum der Populationen fuhrte dazu, dass beide Gruppen ihre Verbreitungsgebiete ausdehnten und nun im Chugoku-Bezirk eine sekundare Kontaktzone haben.

References
Avise JC (2000) Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, MA. Avise JC (2009) Phylogeography: retrospect and prospect. J Biogeogr 36:315. Barth D, Bernhard D, Fritzsch G, Fritz U (2004) The freshwater turtle genus Mauremys (Testudines, Geoemydidae) a textbook example of an eastwest disjunction or a taxonomic misconcept? Zool Scr 33:213221. Bohonak AJ (2002) IBD (Isolation By Distance): a program for analyses of isolation by distance. J Hered 93:153154. Excoer L (2004) Patterns of DNA sequence diversity and genetic structure after a range expansion: lessons from the innite-island model. Mol Ecol 13:853864. Excoer L, Schneiser S (2005) Arlequin (ver. 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online 1:4750. Feldman CR, Parham JF (2004) Molecular systematics of old world stripe-necked turtles (Testudines: Mauremys). Asiatic Herpetol Res 10:2837. Fritz U, Barata M, Busack SD, Fritzsch G, Castilho R (2006) Impact of mountain chains, sea straits and peripheral populations on genetic and taxonomic structure of a freshwater turtle, Mauremys leprosa (Reptilia, Testudines, Geoemydidae). Zool Scri 35:97108. Fritz U, Guicking D, Kami H, Arakelyan M, Auer M, Ayaz D, Fernandez CA, Bakiev AG, Celani A, Dzukic G, Fahd S, Havas P, Joger U, Khabibullin VF, Mazanaeva LF, Siroky P, Tripepi S, Velez AV, Anton GV, Wink M (2007) Mitochondrial phylogeography of European pond turtles (Emys orbicularis, Emys trinacris) an update. Amphibia-Reptilia 28:418426. Fritz U, Ayaz D, Buschbom J, Kami HG, Mazanaeva LF, Alou AA, Auer M, Rifai L, Silic T, Hundsdorfer AK (2008) Go east: phylogeographies of Mauremys caspica and M. rivulata discordance of morphology, mitochondrial and nuclear genomic markers and rare hybridization. J Evol Biol 21:527540. Gotanda K, Yasuda Y (2008) Spatial biome changes in southwestern Japan since the Last Glacial Maximum. Quat Int 184:8493. Hasegawa Y, Hirayama R, Hashimoto K (2002) A Miocene turtle (Ocadia sp.: family Bataguridae; Superfamily Testudinoidea) from the Takaku Group, Usuiso, Taira, Iwaki City, Fukushima Prefecture, Japan (In Japanese with English abstract). Bull Gunma Mus Natu Hist 6:5358. Hikida T (2002) Evolution of Reptiles (In Japanese). Tokyo University Press, Tokyo. Hirayama R (2001) Fossil turtles from the Tsubusagawa Formation (Pliocene) of Ajimu-cho, Oita Prefecture, northern Kyushu, Japan (In Japanese with English abstract). Res rep the Lake Biwa Mus 18:7996. Hirayama R, Kaneko N, Okazaki H (2007) Ocadia nipponica, a new species of aquatic turtle (Testudines: Testudinoidea: Geoemydidae) from the Middle Pleistocene of Chiba Prefecture, central Japan. Paleontol Res 11:119. Honda M, Ota H, Kobayashi M, Nabhitabhata J, Yong HS, Hikida T (1999) Phylogenetic relationships of the ying lizards genus Draco (Reptilia, Agamidae). Zool Sci 16:535549. Honda M, Yasukawa Y, Ota H (2002) Phylogeny of the freshwater turtles of the genus Mauremys Gray, 1869 (Testudines), with special

Acknowledgements
We express our gratitude to A. Katayama, Y. Kosuge, T. Inadome, T. Okamoto, T. Shimada, H. Takeuchi, T. Yamashita, T. Yoshida, Y. Yoshida, N. Yoshikawa, and the Misumi River Fishing Association for providing part of the materials, to T. Okamoto for improving an earlier version of this manuscript, to E. Nakajima for checking the English of text, and to T. Ohno for linguistic advice on the German summary. We are also much indebted to M. Nakagawa for providing specimens and traps to capture turtles, and to H. Fujita, K. Imai, K. Kuwabara, Y. Okada, S. Teraoka, M. Toda, T. Yabe, and Y. Yasukawa for providing valuable information. This study was partially supported by the Global COE program for Biodiversity and Evolution (A06) from MEXT, Japan.

Zusammenfassung
Mitochondriale Phylogeographie der japanischen Schildkrote Mauremys japonica (Geoemydidae, Testudines) Die Phylogeographie der in Japan endemischen Schildkrote Mauremys japonica (Temminck and Schlegel, 1835) wurde anhand zweier mitochondrialer DNA-Sequenzen, dem Cytochrom-b-Gen sowie der Kontrollregion, analysiert. Die Ergebnisse der Analysen zeigen, dass Mauremys japonica in zwei Gruppen untergliedert ist. Eine Gruppe ist im

J Zool Syst Evol Res (2011) 49(2), 141147 2010 Blackwell Verlag GmbH

Mitochondrial phylogeography of the Japanese pond turtle

reference to a close afnity of M. japonica with Chinemys reevesii. J Zool Syst Evol Res 40:195200. Kumar S, Tamura K, Nei N (2004) MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5:150163. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinform 23:29472948. Maruyama S, Isozaki Y, Kimura G, Terabayashi M (1997) Paleogeographic maps of the Japanese Islands: plate tectonic synthesis from 750 Ma to the present. The Island Arc 6:121142. Matsuda M, Yonegawa H, Hamaguchi S, Sakaizumi M (1997) Geographic variation and diversity in the mitochondrial DNA of the medaka, Oryzias latipes, as determined by restriction endonuclease analysis. Zool Sci 14:517526. Ohshima K (1990) The history of straits around the Japanese islands in the late Quaternary (In Japanese with English abstract). Quat Res 29:193208. Okamoto T, Hikida T (2009) Three genetic lineages of the Japanese skink Plestiodon japonicus (Scincidae, Squamata), and the genetic composition of their contact zones. J Zool Syst Evol Res 47:181 188. Okamoto T, Motokawa J, Toda M, Hikida T (2006) Parapatric distribution of the lizards Plestiodon (formerly Eumeces) latiscutatus and P. japonicus (Reptilia:Scincidae) around the Izu Peninsula, central Japan, and its biogeographic implications. Zool Sci 23:419425. Palumbi SR (1996) Nucleic acids II: the polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK (eds), Molecular Systematics, 2nd edn. Sinauer Associates, Sunderland, MA, pp. 205247. Posada D, Crandall KA (2001) Intraspecic gene genealogies: trees grafting into networks. Trends Ecol Evol 16:3745. Rogers AR, Harpending H (1992) Population growth makes waves in the distribution of pairwise genetic differences. Mol Biol Evol 9:552 569. Sakai H, Tamamoto C, Iwata A (1998) Genetic divergence, variation and zoogeography of a freshwater goby, Odontobutis obscura. Ichthyol Res 45:363376. Sasaki T, Yasukawa Y, Takahashi K, Miura S, Shedlock AM, Okada N (2006) Extensive morphological convergence and rapid radiation in the evolutionary history of the family Geoemydidae (old world pond turtles) revealed by SINE insertion analysis. System Biol 55:912927. Schneider S, Excoer L (1999) Estimation of demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: application to human mitochondrial DNA. Genetics 152:10791089. Sengoku S (1979) Ishi-game (Mauremys japonica). In: Okazaki T (ed), Basic Studies of Animals for Teaching Materials (In Japanese). Bunyo-sha, Tokyo, pp. 201203. Serb JM, Phillips CA, Iverson JB (2001) Molecular phylogeny and biogeography of Kinosternon avescens based on complete mitochondrial control region sequences. Mol Phyl Evol 18:149162. Shaer HB, Meylan P, McKnight ML (1997) Tests of turtles phylogeny: molecular, morphological, and paleontological approaches. System Biol 46:235268. Shikama T (1949) The Kuzuu ossuaries : geological and palaeonto logical studies of the limestone ssure deposits in Kuzuu, Tochigi Prefecture. Sci Rep Tohoku Univ, 2nd ser (Geology) 23:1201.

147
Shimizu T, Taniguchi N, Mizuno N (1993) An electrophoretic study of genetic differentiation of a Japanese freshwater goby, Rhinogobius umineus. Ichthyol Res 39:329343. Spinks PQ, Shaer HB, Iverson JB, McCord WP (2004) Phylogenetic hypotheses for the turtle family Geoemydidae. Mol Phyl Evol 32:164177. Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585595. Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram estimation. Genetics 132:597601. Wada H, Makabe KW, Nakauchi M, Satoh N (1992) Phylogenetic relationships between solitary and colonial ascidians, as inferred from the sequence of the central region of their respective 18S rDNA. Biol Bull 183:448455. Walker D, Avise JC (1998) Principles of phylogeography as illustrated by freshwater and terrestrial turtles in the Southeastern United States. Annu Rev Ecol System 29:2358. Watanabe K, Nishida M (2003) Genetic population structure of Japanese bagrid catshes. Ichthyol Res 50:140148. Wilson CC, Hebert PDN, Reist JD, Dempson JB (1996) Phylogeography and postglacial dispersal of arctic charr Salvelinus alpinus in North America. Mol Ecol 5:187197. Yasukawa Y, Yabe T, Ota H (2008) Mauremys japonica (Temminck and Schlegel, 1835) Japanese pond turtle. In: Rhodin AFJ, Pritchard PCH, van Dijk PP, Saumure RA, Buhlmann KA, Iverson JB (eds), Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Res Monogr 5:003.1003.6.

Supporting Information
Additional Supporting Information may be found in the online version of this article: Figure S1. Pairwise mismatch distributions for Group A, Group B, and the total population of Mauremys japonica. Figure S2. Correlation between genetic distances and geographical distances among sites in Mauremys japonica. Table S1. Mismatch distribution model and neutrality test (Tajimas D parameters) for Groups A and B, and the total population of Mauremys japonica studied with mitochondrial sequences in Japan. Appendix S1. Sampling site name, locality, sample code (Kyoto University Zoological collection, KUZ), haplotype name, and GenBank accession number of sequences of the individuals used to study the phylogeographical patterns of Mauremys japonica in Japan. Site names correspond to those in Fig. 1. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

J Zool Syst Evol Res (2011) 49(2), 141147 2010 Blackwell Verlag GmbH