Sunteți pe pagina 1din 68

Programa de Ps-Graduao em Gentica e Melhoramento de Plantas

LGN 5799 - SEMINRIOS EM GENTICA E MELHORAMENTO DE PLANTAS

ANLISE DA EXPRESSO GNICA DURANTE A INTERAO FUNGO-PLANTA


Aline Silva Romo
Orientador: Dr. Welington Luiz de Arajo
Departamento de Gentica Avenida Pdua Dias, 11 - Caixa Postal 83, CEP: 13400-970 - Piracicaba - So Paulo - Brasil Telefone: (0xx19) 3429-4250 / 4125 / 4126 - Fax: (0xx19) 3433-6706 - http://www.genetica.esalq.usp.br/semina.php TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Interaes Fungo-Planta
Patgenos
fungos biotrficos fungos hemibiotrficos fungos necrotrficos
epiftico epiftico

Mutualistas

patgeno patgeno

fungos endofticos fungos epifticos fungos micorrzicos fungos da rizosfera

endfito endfito

micorriza micorriza

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Interaes Fungo-Planta
Dificuldade de entender como comunidades fngicas interagem no interior da planta

Wagner & Lewis, 2003

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Anlise da Expresso Gnica


Abordagens
Estudo de genes especficos
- Nothern-blot - RT-PCR (Reverse Transcription PCR) - PCR quantitativo (qPCR)

Estudo do transcriptoma

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Transcriptoma da Interao
Hospedeiro Microrganismo

Genes no expressos na interao Genes induzidos Transcriptoma da Interao Genes com expresso constitutiva Genes reprimidos
Birch & Kamoun, 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Transcriptoma da Interao
Hospedeiro Interao Fungo

Mtodos de anlise da expresso gnica diferencial

modificado de Birch & Kamoun, 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Anlise da Expresso Gnica em Larga Escala


Diversas metodologias disponveis limitaes especficas e plataforma de dados distintas Base do mtodo Hibridizao
Macroarranjos de cDNA Oligo-microarranjos Microarranjos de cDNA Hibridizao Subtrativa

PCR
cDNA-AFLP Differential Display Hibridizao Subtrativa Supressiva RDA

Seqenciamento
SAGE MPSS ORESTES

ESTs

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

4000
3637

3500 3000
n publicaes
2802

2500 2000 1500 1000 500


116 794 824 485 9 74 746 399 1821

Hibridizao PCR Seqenciamento

D D

m ic ro ig ar ora m y ic ro ar ra y

cD

Pesquisa feita na base de dados PubMed >http://www.ncbi.nlm.nih.gov/sites/entrez?dh=pubmed>. Acesso em 02 jun 07.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

ol

N A-

cD

M PS S O R ES TE S

SS H

SH

AF LP

D A

A TO G

N A-

SA G

Anlise da Expresso Gnica


Microarranjos de cDNA Differential Display (DD) Anlise Serial da Expresso Gnica (SAGE) PCR quantitativo (qPCR)

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos de cDNA
(Schena et al., 1995)
Princpio cDNAs marcados hibridizam, com alta sensibilidade e especificidade, com seqncias de genes conhecidos imobilizadas em um substrato slido Permite a anlise simultnea da expresso de centenas a milhares de genes em um nico experimento Permite estudar as mudanas nos nveis de expresso gnica de um hospedeiro em resposta colonizao por um fungo (e vice-versa). Fornece viso molecular dos eventos que seguem a infeco.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos
Passo 1

Preparo das lminas

estrutura genmica anotada amplificao das sondas por PCR

spotting das sondas na lmina

at 20000 genes

0,05-0,15cm

modificado de Ehrenreich, 2006

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos
Passo 2

Preparo das amostras


amostra A extrao de RNA total amostra B

Cy5

RT-PCR e marcao com corante fluorescente

Cy3

modificado de Ehrenreich, 2006

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos
Passo 3

Hibridizao e Leitura
amostra A amostra B

+
hibridizao

amostra A > B amostra A ~ B amostra B > A

sada digital

leitura da fluorescncia

anlise das imagens

Cy5 532 nm Cy3 635 nm

imagens cruas
modificado de Ehrenreich, 2006

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos
Passo 4

Anlise dos Dados Digitais


Armazenamento dos dados in local ou em bancos de dados pblicos

Anlise de imagem: determinao da margem dos sinais dos spots e quantificao dos dados de fluorescncia

Anlise de agrupamento ou interpretao biolgica


experimentos

Teste para expresso diferencial

Correo do background e seleo dos sinais de qualidade

Normalizao dos dados

Transformao dos dados


modificado de Ehrenreich, 2006

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

genes

Microarranjos

Aspectos importantes
Repeties

Spotting mesma sonda mltiplas vezes num mesmo arranjo


Marcar e hibridizar vrias vezes (ex. dye swap) Repetir condies experimentais e extrao de RNA (3x pelo menos)

Origem das sondas para anlise de arranjos de DNA


Colees de ESTs ORFs de seqncias genmicas Seqncias sintetizadas na lmina (Biochip) Bibliotecas de cDNA Fragmentos de DNA genmico (lminas cegas)

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos

Principais Vantagens da Tcnica


Anlise global da expresso gnica; Viso da expresso de milhares de genes simultaneamente; Anlises rpidas; Anlise da expresso de genes que atuam em um carter complexo; Dados digitais; Fcil manuseio; Reagentes seguros.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos

Pontos Crticos
Necessidade de conhecimento prvio de seqncias genmicas/ESTs; Sistema fechado; Necessidade de grandes quantidades de mRNA para cada hibridizao; Alto custo e alta demanda tcnica; Sensibilidade das sondas questionada (tamanho e cross-hybridization); Baixa reprodutibilidade; Necessidade de validao dos genes diferencialmente expressos por mtodos independentes (ex. Nothern-blot; qPCR).

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Differential Display (DD)


(Liang & Pardee , 1992)
Princpio Uso de um nmero limitado de primers curtos e arbitrrios em combinao com primers oligo-dT ancorados para amplificar e visualizar de forma sistmica a grande maioria dos mRNAs de uma clula. DD combina trs tcnicas moleculares comuns: RT-PCR PCR Eletroforese em gel de poliacrilamida

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Differential Display
Passo 1

RT-PCR
Amostra Y
RNA total

Amostra X
RNA total

Primers => oligo-dT ancorados


Ex. 5 AAGCTTTTTTTTTTTC-3 H T11 M Notao H-T11M H = stio de restrio da enzima HindIII (AAGCTT) T11 = seqncia de 11 timinas (T) M = Guanina (G), Citosina (C) ou Adenina (A)

Populao de mRNAs

RT-PCR

O uso de oligo-dT ancorados resulta em trs subpopulaes de cDNA, cada qual representa 1/3 dos possveis mRNAs expressos na amostra

modificado de Liang et al., 2007

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Differential Display
Passo 2

Amplificao por PCR


Combinao dos primers oligo-dT ancorados (H-T11M) com um grupo de primers arbitrrios (H-AP)

Subpopulao de cDNAs

PRIMERS ARBITRRIOS (H-AP)


Curtos (13 bases) e aleatrios H = stio de restrio da enzima HindIII (AAGCTT) AP = 7 bases com combinaes aleatrias Ex. 5 AAGCTTGATTGCC-3 H AP N possvel de primers arbitrrios: 47 > 16.000 combinaes de bases Cada primer tem a probabilidade de reconhecer 50-100 mRNAs

PCR

N primers arbitrrios (n) 20 30 40 80

N Reaes PCR 3x20 = 60 3x30 = 90 3x40 = 120 3x80 = 240

Probabilidade de n deteco P=1-(0.96) 56% 71% 80% 96%

modificado de Liang et al., 2007

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Differential Display
Passo 3
Produtos de amplificao

Eletroforese
Amostra Y

Amostra X

Para cada combinao de primers!

Eletroforese

Anlise fluorescncia
banda representa mRNA diferencialmente expresso
Exciso da banda

Gel de poliacrilamida desnaturante melhor resoluo de bandas permite fcil recuperao dos transcritos acomoda grande n amostras

Reamplificao Clonagem Seqenciamento


modificado de Liang et al., 2007

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Differential Display

Principais Vantagens da Tcnica


Anlise da expresso gnica diferencial; Simplicidade tcnica; Sensibilidade; Alta reprodutibilidade; Baixo custo; Sistema aberto.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Differential Display

Pontos Crticos
Alta incidncia de falsos positivos em sistemas com muitas variveis; Alta intensidade de trabalho; Dados no digitais (geralmente); Desconhecimento imediato dos genes diferencialmente expressos; No permite leitura ampla e simultnea de muitos transcritos; Necessidade de validao dos genes diferencialmente expressos por mtodos independentes (ex. Nothern-blot; qPCR).

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Anlise Serial da Expresso Gnica (SAGE)


(Velculescu, 1995) 2 Princpios Bsicos
1 Princpio - Uma seqncia de nucleotdeos (tag) de 9-10pb possui informao suficiente para identificao de um transcrito nico.

~ 256pb

Uma seqncia de apenas 9 pb pode distinguir 49 = 262.144 transcritos


Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Anlise Serial da Expresso Gnica (SAGE)


2 Princpio - Ligao (concatenao) dos tags permite anlise eficiente dos transcritos de um modo serial, pelo seqenciamento de mltiplos tags contidos em um nico clone.
Anlise Serial

Anlise paralela 64 a 96 amostras por corrida (1600-2400 tags por corrida) Anlise paralela Seqenciadores mltiplos

Anlise paralela 2 corridas por dia (3200-4800 tags por dia)

Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE
Passo 1

mRNA

RT-PCR
cDNA

Sntese do DNA complementar (cDNA) a partir de mRNA, utilizando-se como iniciador uma seqncia oligo-d(T) biotinilada

Ho Song & Wyse, 2004; Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE
Passo 2
Digesto com endonuclease (enzima de ancoramento NlaIII). A maioria dos cDNAs deve ser cortada pelo menos uma vez.

cDNA

DIGESTO
Fragmentos de cDNA

44 = 256 bases

CAPTURA
cDNA ligado a estreptavidina

As fraes dos cDNAs mais prximas extremidade 3 so capturadas por ligao da biotina dos iniciadores com estreptavidina ligada partculas magnticas.

Ho Song & Wyse, 2004; Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE
Passo 3
Cada metade dos cDNAs ligada nas extremidades a um adaptador distinto, mas ambos contendo seqncia de reconhecimento para enzima de restrio do tipo IIS (enzima de tagging BsmFI).

cDNAs ligados a estreptavidina


Diviso da amostra de cDNAs em duas partes

LIGAO
Adaptador B

Adaptador A

cDNAs ligados a estreptavidina e adaptador

DIGESTO
cDNAs ligados a adaptador

Digesto com enzima BsmFI, que corta a uma distncia definida a partir do seu stio de reconhecimento. Da clivagem resulta a liberao dos adaptadores ligados a um pedao curto de cDNA (9-10pb + stio NlaIII).

Ho Song & Wyse, 2004; Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE
Passo 4

cDNAs ligados a adaptador

LIGAO

Aps terem suas extremidades reparadas pela enzima Klenow, as duas fraes de cDNAs so ligadas pela enzima T4 DNA ligase.

AMPLIFICAO

Amplificao das ditags usando iniciadores complementares aos adaptadores.

Ho Song & Wyse, 2004; Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE
Passo 5
A clivagem com enzima de ancoramento (NlaI) libera os adaptadores das ditags e cria extremidades coesivas.

grande quantidade de ditags

DIGESTO

LIGAO
Aps fracionamento dos concatmeros por tamanho via eletroforese em gel de agarose ou poliacrilamida, coleta-se fraes de 300-500pb e 500-1000pb e introduz-se separadamente em vetores para que sejam clonadas e depois seqnciadas.

concatmeros

CLONAGEM SEQENCIAMENTO CONTAGEM ANOTAO DAS tags

Ho Song & Wyse, 2004; Madden et al., 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE
Passo 6

Anlise dos Dados Digitais


Seqncias de referncia (genes conhecidos do EMBL/NCBI GenBank) ou ESTs
Extrao das tags e anotao Extrao e tabulao das tags a) remoo das ditags em duplicata b) extrao das tags a partir das ditags

Arquivos com seqncias dos clones SAGE

Projeto dos perfis de abundncia das tags

Banco de dados de tags de referncia espcie-especfico


Gerao de relatrios

Comparao do projeto e verificao da identidade com tags de referncia


Filtragem e classificao

maiores investigaes
Tuteja & Tuteja, 2004

tags candidatas para

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE

Pontos Crticos
Comprimento das tags; Long Sage, SuperSage e GLGI Necessidade de grande quantidade de material inicial (mRNA); MiniSage, MicroSage Tipo de enzima de restrio IIS (BsmFI) que nem sempre produz fragmentos de um mesmo comprimento; Temperatura constante 65C Construo das bibliotecas envolve muitos passos; Alto custo com seqenciamento; Necessidade de validao dos genes diferencialmente expressos por mtodos independentes (ex. Nothern-blot; qPCR).

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

SAGE

Principais Vantagens da Tcnica


Permite leitura ampla da expresso gnica; Deteco de genes pouco expressos; Dados gerados so passveis de mltiplas comparaes; Aplicvel nas mais diferentes reas; No requer conhecimento prvio dos genes de interesse nem do genoma; Gerao de dados digitais qualitativos e quantitativos.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Microarranjos X DD X SAGE

TCNICA

Comparao entre amostras 2 (ou mais) ilimitada

Diferenas detectveis

Sensibilidade

Complexidade

Custo

Deteco de novos genes geralmente no sim

Confiabilidade

Intensidade de trabalho mdia alta

Anlise da expresso global sim no sim

Microarranjos de cDNA Differential Display SAGE

>2 vezes 1,1-1vezes ou mais todas

mdia alta

depende/alta baixa

alto baixo/mdio

mdia mdia

ilimitada

mdia

baixa

baixo/mdio

sim

alta

alta

modificado de Stein & Liang, 2002 e Spira, 2005

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

PCR Quantitativo (qPCR)


Se baseia na tcnica de PCR (Mullis, 1986), com adequaes para um nvel de sensibilidade muito maior. Tcnica descrita como quantitativa porque consegue realizar a avaliao do n de molculas produzidas ciclo a ciclo.

Estratgia para monitorar e quantificar em tempo real o aumento de molculas de RNA, cDNA ou DNA durante a PCR

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

PCR Quantitativo (qPCR)


Princpio

Molcula alvo, durante a amplificao, emite fluorescncia e um leitor no termociclador captura a fluorescncia ciclo a ciclo.
A emisso dos compostos fluorescentes gera um sinal que aumenta na proporo direta da quantidade de produto da PCR

Os valores da fluorescncia so gravados durante cada ciclo e representam a quantidade de produto amplificado

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Requisitos do qPCR
Corantes especiais; Procedimentos de otimizao; Termociclador com sistema tico; Computador com programa para aquisio de dados e anlise final da reao.

Bio-Rad

Applied Biosystems

Roche

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Sistemas de Fluorescncia
Fluorforos so molculas que absorvem e emitem luz em um comprimento de onda especfico TIPOS Corantes que se ligam a dsDNA Sondas de hibridizao Sondas de hidrlise Sondas do tipo grampo (hairpin)

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Corantes dsDNA

Sondas de Hibridizao

Sondas de Hidrlise

SYBR Green I

TaqMan

Sondas do tipo grampo

Molculas Beacon

Scorpion

Sunrise primers

LUX primers

Wong & Medrano, 2005 TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Curva padro
declividade reflete a eficincia de amplificao (E)

(logN) concentrao inicial

Construo: a partir de diluies seriadas e em condies otimizadas (sem limitao de reagentes)


TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Curva de Amplificao
plat fase exponencial (log)

fase linear

CT (Cycle Threshold) => ciclo na qual a reao atinge o limiar da fase exponencial Este ponto permite a quantificao exata e reprodutvel baseado na fluorescncia
Novais & Pires-Alves, 2004

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Quantificao
Curva de amplificao Curva padro

(logN) concentrao inicial

Tn
Tn=T0(E)n

CT diretamente proporcional ao log de quantidade inicial de DNA / RNA

Tn= Nmero de molculas de DNA no ciclo de referncia (CT) T0= Nmero inicial de molculas DNA E = Eficincia da PCR (0<E<1)

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Aplicaes
Avaliao quantitativa dos nveis de expresso de genes; Anlise de splicing alternativo; Diagnsticos clnicos; Anlise de seqncias virais, bacteriana, fngicas ou de protozorios a partir de vrias fontes; Anlise de mutaes; Discriminao allica em DNA genmico; Deteco de transgnicos; Anlise de patgenos em alimentos.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

qPCR

Principais Vantagens da Tcnica


Quantifica expresso gnica com alta preciso; Mtodo rpido e independente de processos ps-PCR; Alta sensibilidade e facilidade na quantificao; Alta reprodutibilidade e acurcia; Melhor controle de qualidade no processo e menor risco de contaminao (qualitativo).

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

OBJETIVOS Determinar o perfil de expresso gnica de plantas de arroz colonizadas por um fungo simbionte (Glomus intraradices), atravs de microarranjos; Comparar a expresso gnica em resposta ao fungo simbionte com a expresso em resposta patgenos (Magnaporthe grisea e Fusarium

moniliforme)
Comparar a resposta colonizao por fungos entre monocotiledneas e dicotiledneas.
TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

METODOLOGIA
Infeco pelo simbionte: Razes de Oryza sativa cv. Nipponbare (45 plantas, 6 semanas) inoculadas com

Glomus intraradices;
Infeco pelos patgenos: Razes de Oryza sativa cv. Nipponbare (plntulas com 10 dias) foram inoculadas com os patgenos Magnaporthe grisea linhagem Guy 11 e Fusarium moniliforme. Razes foram coletadas 2, 4 e 6 dias aps inoculao. Anlise de expresso gnica por microarranjos: RNAtotal foi isolado de razes infectadas; Uso do GeneChip (sySYNG003a) de genoma de arroz (Syngenta, Basel) - ~50.000 genes. PCR em Tempo Real: Validao dos dados de microarranjos e testes de expresso gnica com patgenos. TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS Transcriptoma de arroz em resposta colonizao micorrzica MICROARRANJOS 256 genes regulados pela colonizao micorrzica: - 20 genes foram reprimidos (3 a 14 vezes) - 236 genes foram induzidos (3 a 203 vezes)
Genes regulados pela colonizao micorrzica aqueles que apresentaram uma mudana de expresso de 3 vezes (reprimidos ou induzidos) em relao s plantas controle.

Controle positivo (acmulo de transcritos especficos do fungo micorrzico): - gene OsPT11 presente no chip => apresentou aumento de expresso de 154 vezes.
TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS Validao dos dados de Microarranjos qPCR Teste da expresso de 224 genes (dos 256 candidatos): - Induo (1,5 a 300.000 vezes) => 209 genes - Represso (2,4 a 23 vezes) => 15 genes Gene controle positivo (OsPT11) => apresentou induo de 1500 vezes em relao s plantas controle.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS Transcriptoma de arroz em resposta patgenos qPCR


Teste da expresso dos 224 genes regulados pela colonizao micorrzicas em razes infectadas por M. grisea e F. moniliforme:

Expresso diferencial de 95 genes em resposta colonizao micorrzica e um ou ambos os patgenos.

Figura 1. Esquema da viso geral dos genes de arroz regulados pela colonizao micorrzica em comparao com a resposta aos patgenos. Nmeros em preto representam genes induzidos; nmeros em cinza representam genes reprimidos.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS Genes regulados pela colonizao micorrzica so conservados entre monocotiledneas e dicotiledneas? tBlastX foi conduzido entre 625 genes de dicotiledneas (descritos anteriormente como regulados por micorrizas) e os 224 genes de arroz:
- 96 genes foram identificados: 76 apresentaram mesmo padro de expresso em mono e dico - 44 genes de arroz regulados especificamente por micorrizas - 25 genes relacionados com colonizao geral por fungos - 20 genes apresentaram padro de expresso oposto entre mono e dico

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

CONCLUSES 43% dos genes avaliados apresentaram respostas similares para G. intraradices, M. grisea e F. moniliforme; A induo do gene OsAM205 durante as trs interaes fungo-planta avaliadas sugere que esse seja um fator de transcrio envolvido na regulao da reposta de plantas diferentes infeces fngicas; Foi possvel observar certa conservao da resposta transcricional do arroz colonizado por simbiontes e patgenos; Os padres de expresso observados refletem uma resposta geral de plantas colonizao por fungos, sugerindo que apesar da divergncia filogentica, mono e dico possuem mecanismos conservados de resposta colonizao.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

OBJETIVO Isolar genes, do patgeno Penicillium expansum e de mas, induzidos durante a interao fungo-planta via DD RT-PCR.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

METODOLOGIA
DD RT-PCR Penicillium expansum Link, isolado CMP1; Frutos (mas) pr-tratadas (imerso em gua a 37C por 4 dias) inoculados com 20L de suspenso de esporos ou gua esterilizada; Isolamento RNA: - a partir de culturas de P. expansum cultivadas em pectina de ma
- a partir de cilindros (16x6mm) de tecido dos frutos infectados - a partir de cilindros (16x6mm) de tecido dos frutos sadios

Amplificaes DD: combinao entre 15 oligonucleotdeos Clonagem Dot-blot Nothern-blot Southern-blot TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS Genes expressos durante a interao fungo-planta DD RT-PCR Combinao de 15 primers => ~ 1450 bandas 98 bandas mais intensas ou exclusivamente presentes em mas infectadas Reamplificao Clonagem - Dot-blot - Nothern-blot => 26 genes provavelmente diferencialmente expressos. CARACTERIZAO

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS Caracterizao dos cDNAs selecionados


Seqenciamento dos 26 cDNAs 20 cDNAs - BLAST contra banco de dados no-redundante e dbEST EMBL:
- 9 no apresentaram qualquer homologia (P>0,0001) com seqncias do banco de dados (tanto de nucleotdeos como de aminocidos); - 7 apresentaram homologia com genes de fungos; - 4 apresentaram homologia com seqncias de plantas;

Validao dos 20 cDNAs como diferencialmente expressos => Nothern-blot


- 18 apresentaram maior nvel de expresso em mas infectadas do que nos controles; - 2 (similares manitol desidrogenase) apresentaram maior nvel de expresso em culturas de P. expansum.

Determinao da origem dos 18 cDNAs => Southern-blot


- Correlao perfeita com dados de homologia de seqncias; - Determinao da origem dos 8 transcritos que no apresentaram homologia com seqncias do banco de dados: 7 derivaram do fungo e 1 da ma.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS
Anlises das seqncias dos clones de ma e de P. expansum isolados por DD RT-PCR a partir de mas infectadas.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

CONCLUSES
Atravs de DD RT-PCR foi possvel identificar 12 genes diferencialmente expressos em resposta interao P. expansum-ma: - 8 genes associados com processo de infeco do fungo - 4 genes associados resposta de defesa dos frutos A maioria dos genes isolados do fungo estavam expressos tanto in planta como in vitro, entretanto, a expresso desses genes era muito maior durante o processo de infeco; Apenas um cDNA do fungo apresentou similaridade a genes de poligalacturonases (PG), enzimas extensivamente descritas como fatores de patogenicidade; A maioria dos outro genes apresentou similaridade com protenas provavelmente envolvidas na adaptao ao ambiente hospedeiro; Dois genes de mas expressos durante a interao fungo-planta correspondiam com putativos PP2C e -glucosidase (enzima envolvida na liberao de compostos txicos a partir de precursores glicosilados inativos). TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

OBJETIVOS Anlise dos perfis de expresso gnica simultaneamente, de arroz (hospedeiro) e Magnaporthe grisea (patgeno), pela tcnica de SuperSAGE; Avaliar e comparar a capacidade do estudo da expresso gnica por meio da tcnica de SuperSAGE.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

METODOLOGIA Fonte de inculo Folhas de Oryza sativa L. cv. Norin1 infectadas com fungo M. grisea raa 007. Material Vegetal: Dois cultivares de arroz, cv. Kakehashi (susceptvel) e cv. Himenomochi (resistente), foram inoculadas com fungo M. grisea raa 007. Folhas foram coletadas 10 dias aps a inoculao. SuperSage Anlise dos mRNAs extrados de folhas de arroz infectadas por M. grisea.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS

Perfil de expresso gnica em folhas de arroz infectadas


Obteno de 12.119 SuperSAGE tags ; 7.546 tags diferentes => correspondem a genes diferentes Identificao dos genes: blast das tags (26pb) contra banco de dados completo do GenBank (cDNAs, ESTs, genomas); Na maioria dos casos apenas uma seqncia se alinhou perfeitamente com a seqncia da tag (26pb) de SuperSage; Informao das tags suficiente para identificar o gene de origem
TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS

Perfil de expresso gnica em folhas de arroz infectadas


Genes relacionados com a fotossntese foram os mais expressos nas folhas de arroz.
Tabela 1. Os 10 genes que apresentaram maior expresso em folhas de arroz infectadas.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS

Perfil de expresso gnica em M. grisea


Blast das tags apenas contra genoma de M. grisea; 74 tags supostamente derivam de mensagens de M. grisea = 0,6% dos transcritos avaliados; 35 tags diferentes alinharam com genes putativos de M. grisea, sendo que no houve homlogos no genoma do arroz; Metade das tags referem-se ao gene hidrofobina; Os genes da nucleoside-diphosphate kinase e da protena ribossomal 60S contriburam com 2 tags cada.
TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS

Perfil de expresso gnica em M. grisea


Tabela 2. Alguns genes de M. grisea expressos em folhas de arroz infectadas.

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

RESULTADOS

Validao de genes expressos por M. grisea


RT-PCR
Amplificao dos genes de hidrofobina, nucleoside-diphosphate kinase e protena ribossomal 60S utilizando cDNA isolado de folhas infectadas dos seguintes cultivares: Norin1 (susceptvel); Kakehashi (susceptvel) e Himenomochi (resistente).

Figura 1. (A) RT-PCR dos genes hidrofonina, nucleoside-diphosphate kinase e protena ribossomal 60S, de M. grisea, a partir cDNA do cv. Norin1. (B) RT-PCR dos genes de M. grisea a partir do cDNA dos cv. Kakehashi e cv. Himenomochi, ambos falso inoculados (-) e inoculados com M. grisea raa 007 (+).

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

CONCLUSES

Genes relacionados com a fotossntese foram os mais expressos nas folhas de arroz. Os resultados mostraram que o gene da hidrofobina o mais expresso em M. grisea infectando folhas de arroz => hidrofobina necessria para formao de apressrio durante a infeco do fungo; Os dados gerados por SuperSAGE so compatveis com os dados do SAGE convencional e fornecem perfis de expresso gnica bastante confiveis; SuperSAGE abre a possibilidade de estudar diretamente a expresso gnica de dois organismos simultaneamente.
TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

CONSIDERAES FINAIS

Genmica Funcional
bioinformtica

Metaboloma
gentica

Transcriptoma
bioqumica

Funo

fisiologia

citologia

Proteoma
bioqumica estrutural
modificado de Vukmirovic & Tilghman, 2000

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

CONSIDERAES FINAIS
P FL A ADN H c S S DD

Mic r oar r anjo s R D SA A G E

TRANSCRIPTOMA

S SS MPS MP Ts Ts ES ES

BIOINFORMTICA

MELHORAMENTO

GENES CANDIDATOS
para anlise de ligao em cruzamentos experimentais

modificado de Camargo, 2006

TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA

Obrigada pela Ateno!


TCATCGAGTCGTAGAGTCAGTGACAATTCGAGTCGACGTAGCAGTGACACACATAGCTAGTTAGA