Documente Academic
Documente Profesional
Documente Cultură
Eukaryotic Translation
PROKARYOTIC
Since the first codon is always AUG, therefore the first amino acid in the peptide chain is always Methionine. In prokaryotes this is f-methionine. In most cases this f-met is cut off so that it does not form part of the protein molecule.
EUKARYOTIC
Since the first codon is always AUG, therefore the first amino acid in the peptide chain is always Methionine. In prokaryotes this is f-methionine. In most cases this f-met is cut off so that it does not form part of the protein molecule. Eukaryotic RNA differs from prokaryotic RNA in that it has a 7-methyl GTP cap and a poly A tail
I.
Initiation
NO Shine-Dalgarno sequence The 5 cap tells where ribosomal binding and where the initiation sequence will form
Initiation factors:
IF-1 function not clear;binds to both IF-2 & IF-3 IF-2 binds GTP; also selects the initiator tRNA (f-metfmet tRNA ) IF-3 binds mRNA to the 30s ribosomal sub-unit (specifically 16s rRNA)
Formation of 43s pre-initiation complex (43s PIC) Met-tRNA forms a complex with GTP & eIF2; this and other Ifs bind with the 40s ribosomal sub-unit. The PIC binds with the 5 cap of the mRNA; moves downstream to find the correct AUG (start codon). The AUG in the Kozak sequence 5 7 methyl GTP GGCAAUGCCGACCAUGG 3 The AUG upstream of a hairpin loop 5 7 methyl GTP GGCAUGCCCACUAUGACGCU hair pin loop 3 Formation of an 80s initiation complex (60s ribosome bind to PIC; GTP is hydrolyzed; initiation factors dissociate)
Formation of 70s initiation complex 50s ribosome binds to 30s sub-unit after the IF-1, IF-2, IF-3 & GTP were released
EUKARYOTIC
II. ELONGATION Same mechanism as in prokaryote 40s and 60s sub-units are used Inhibited by diphtheria toxin by decreasing the activity of eEF2
ELONGATION
The 50s ribosomal sub-unit has 3 binding sites; A (aminoacyl) site, P (peptidyl) site & E (exit site) Inhibited by chloramphenicol by binding to A site & inhibiting peptidyl ttransferase activity Ribosome is bound to AUG on the mRNA Aminoacyl tRNA binding 1st tRNA (aminoacyl-f-Met-tRNA fmet) binds to the P site the 2nd aminoacyl tRNA enters the ribosome and binds to the A site. GTP and EFTu (elongation factor) help bind the 2nd aminoacyl-tRNA to the A site and sees to it that the anticodon (e.g., 3 UUC 5) on the tRNA matches with the codon (e.g. 5 AAG 3) on the mRNA Peptide bonding Peptidyl transferase facilitates the peptide bonding of f-methionine to the 2nd amino acid Translocation 2nd peptidyl-tRNA translocates to the P site; the empty 1st tRNA binds to the E site & leaves the ribosome GTP & EF-Tu dissociates Ribosome moves to read the 3rd codon; 3rd aminoacyl tRNA binds to the A site; the dipeptide binds to the amino acid of the 3rd tRNA; 3rd tRNA moves to the P site; 2nd tRNA binds to the Esite & leaves the ribosome
Ribosome is bound to AUG on the mRNA Aminoacyl tRNA binding 1st tRNA (aminoacyl-f-Met-tRNA fmet )binds to the P site The 2nd aminoacyl tRNA enters the ribosome and binds to the A site. GTP and eEF (eukaryotic elongation factor) help bind the 2nd aminoacyl-tRNA to the A site and sees to it that the anticodon (e.g. 3 UUC 5) on the tRNA matches with the codon (e.g. 5 AAG 3) on the mRNA Peptide bonding Peptidyl transferase facilitates the peptide bonding of f-methionine to the 2nd amino acid Translocation 2nd peptydil-tRNA translocates to the P site; the empty 1st tRNA binds to the E SITE 7 leaves the ribosome GTP & eEF dissociates Ribosome moves to read the 3rd codon; 3rd aminoacyl tRNA binds to the A site; the dipeptide binds to the amino acid of the 3rd tRNA; 3rd tRNA move to the P site; 2nd tRNA binds to the E site & leaves the ribosome
EUKARYOTIC
TERMINATION
The ribosome reads a stop codon (UAA, UAG UGA). No tRNAs can read these. RF-1 (release factor), RF-3 & GTP bind to A site Dissociation of tRNA, mRNA, 30s & 50s ribosomal sub-units
The ribosome reads a stop codon (UAA, UAG, UGA). Normally tRNAs do not recognize these codons. (But a suppressor tRNA can read these. These tRNAs are use by cells to repair errors due to mutation) RF (release factor) & GTP bind to A site. Only one RF is needed to bind to the stop codon Dissociation of tRNA, mRNA, 40s & 60s ribosomal sub-units