LS4 Lec2 Final Exam 3/21/2002

____Key__________ Last name

_________________ First name

_________________ Student ID

________________ Disc. Section

1 ______________ 2 ______________ 3 ______________ 4 ______________ 5 ______________

6 ______________ 7 ______________ 8 ______________ 9 ______________ 10 _____________

11 _____________ 12 _____________ 13 _____________ 14 _____________ 15 _____________ Total

16 ______________ 17 ______________ 18 ______________ 19 ______________

__________________

Discussion

__________________

Midterm 1 ________

__________________

Midterm 2 ________

__________________

Midterm 3 ________

__________________

Quarter total score

__________________

Quarter grade Show All Your Work for Full Credit.

__________________

1. 15 pts A test cross of a tri-hybrid (the F1) gave these results (the F2): all wild type dumpy wings hooked bristles purple eyes dumpy wings & hooked bristles dumpy wings & purple eyes hooked bristles & purple eyes dumpy, hooked & purple 24 34 26 16 16 24 34 26 200

a. What were the genotypes of the purebred P generation parents that created the F1? Dp x hk pr

b. Determine the map of these traits and the distances that separate the markers. dp dp 41 m.u hk 41 m.u. pr + 24 16 16 26 82 c. What is the length of this linkage group? 82 m.u. 2. 10 pts. One in 10 males in the US has some form of X-linked recessive colorblindness. a. What is the colorblind allele frequency in the US population? 10% b. What is the expected proportion of females with normal color vision? 99% hk 26 16 16 24 82 pr + +

3. 15 pts. Flowers of a plant species can be scarlet, red, pink, coral or white. A series of crosses between plants produced the following results: Cross 1 2 a. b. c. d. e. f. g. h. i. j. k. Parental phenotypes scarlet x red scarlet x scarlet red x red scarlet x pink scarlet x scarlet scarlet x red scarlet x red pink x pink scarlet x red coral x coral pink x white white x white scarlet x white Progeny all scarlet 76 scarlet, 25 pink 86 red, 29 pink 49 scarlet, 52 pink 69 scarlet, 22 red 50 scarlet, 51 red 54 scarlet, 26 red, 25 pink all pink 49 scarlet, 25 red, 23 coral 60 coral, 29 pink, 31 white all coral all white all scarlet 1

a. How many genes are involved in the inheritance of flower color in this plant? (S > r > p = w) b. Indicate all possible genotypes for the following phenotypes, scarletredpink coralwhiteSS, rr, pp pw ww Sr, rp, Sp, rw Sw

4. 10 pts. Gene X has three alleles X1 , X 2 and X3 with frequecies of 0.6, 0.3 and 0.1 in the population, respectively. Given random mating, calculate the combined frequency of all heterozygotes in the population. 1 - (0.6)2 - (0.3)2 - (0.1)2 = 1 - 0.36 - 0.09 - 0.01 = 0.54 or 2 x 0.6 x 0.3 + 2 x (0.6) x 0.1 + 2 x 0.3 x 0.1 = 0.36 + 0.12 + 0.06 = 0.54

5. 15 pts. In the mushroom species kilumded, cap color is determined by four independently segregating alleles A, B, C, and D. Loss-of-function mutations in any of these genes result in the inability to synthesize pigment as diagramed below:

When both the red and blue pigments are produced, the mushroom caps are purple. Mushrooms with the genotype AaBbCcDd are crossed with those of genotype AaBbCcdd. a. What color are the caps of these parents? Purple, red b. For each phenotype below, determine what proportion of the progeny are expected to have each of the following cap colors: whiteyelloworangeredbluepurple1/4 3/16 9/128 27/128 9/128 27/128 (aa) (A - bb) (A - B - rrdd) (A - B - C - dd) (A - B - ccDd) (A - B - C - D -) (3/4 x 3/4 x 1/4 x 1/2) (3/4 x 3/4 x 3/4 x 1/2) (3/4 x 3/4 x 1/4 x 1/2) (3/4 x 3/4 x 3/4 x 1/2) 32/128 24 9 27 9 _ 27_____ 128

6. 15 pts. yellow body males with bar eyes were crossed with females with normal body color and normal eye shape. Their progeny were normal body color daughters with bar eyes and sons with normal body color and normal eyes. Crosses of F1 brothers x sisters gave these results in the F2: 400 bar eye, normal body females 400 normal eye, normal body females 200 bar eye, normal body males 200 bar eye, yellow body males 200 normal eye, yellow body males 200 normal eye, normal body males

a. An X chromosome and an autosome are shown below. Females have a pair of each. Males have an X and Y chromosome plus a pair of autosomes. Mark the appropriate chromosome below with a location for the yellow gene. Label it. Do the same for the bar gene. Below the figure provide an explanation. If you put the genes on different chromosomes state how why and how you chose each chromosome. If you put the genes on the same chromosome state why and how far apart they are on the chromosome.

X chromosome Explanation:

Autosome

Yellow and Bar are X linked, but for enough apart to assort independently.

b. Propose allele symbols and show the genotypes of the P and F1. Draw the Punnet square for the F1 x F1 cross.

7. 15 pts. Androgen insensitivity in humans is a rare X-linked recessive trait that causes XY chromosome individuals to develop as females. Sparse facial hair is a rare but different X linked recessive trait that can only be detected in males. The interval separating the Sparse hair and androgen insensitivity markers is 12 cM. a. Jane, a woman whose father has sparse hair gives birth to an XY child who displays androgen insensitivity. Draw the pedigree for this family.

b. What is Janes mothers genotype? Heterozygous for androgen insensitive. c. What is the chance Jane's child has both the androgen insensitivity and the sparse hair traits? a + _______ + s

a + a +

+ s s +

0.44 0.44 0.06 0.06

as = ____0.6 _____ 0.44 + 0.06 = 12%

d What is the chance Janes next child will have sparse facial hair? 0.44 x 1/2 = 0.22

8. 15 pts. Three Hfr strains in E.ucla gave these gene orders: first transferred last transferred HfrA his HfrB pen HfrC lys gal cys thi lys bio bio thi thi cys bio lys pen cys gal his pen his gal

a. Draw the map of E.ucla.

b. You suspect pro is in the his to lys interval. Which Hfr strain is the best to map pro if it is in that location? Hfr A Design the genotype for your Hfr strain. Write the markers and the alleles you need for the Hfr strain in this cross. Include the marker for pro. his+ gal+ lys + pro+ pens c. Design the genotype of the F- strain. Write the markers and the alleles you need for the Fstrain in this cross. Include the marker for pro. His- gal- lys - pro- penr d. Design the media for your master plate. Glucose, added lysine, proline and penicillin e. Design the media for replica plates to determine the number of pro recombinants. Glucose, added lysine (withhold proline)

9. 15pts. Transduction mapping: compare the results of the 2 experiments to answer the questions. Arg a and arg b are allelic arg auxotrophs. Experiment 1. Donor arg a lac+ gal+ recipient arg b lac- gal-

select 100 transductants on minimal glucose media replica plate on lactose media: get 40 colonies replica plate on galactose media: get 6 colonies Experiment 2. Donor arg b lac+ gal+ recipient arg a lac- gal-

select 100 transductants on minimal glucose media replica plate on lactose media: get 4 colonies replica plate on galactose media: get 60 colonies a. what is the selected marker genotype for experiment 1? b. what is the order of the lac, gal, arg a and arg b mutants? arg+

c. which is closer to arg, lac or gal?

gal

10. 10 pts. The partial sequence of a messenger RNA below contains a nonsense mutation that prematurely terminates protein translation. Give the sequence of a mutation in the tRNATyr anticodon that would result in suppression of the bacterial mutation and determine the amino acid sequence of the suppressed peptide.

AUGGUCAGAACUUAGGCCAGCUUCAUA Met Val Arg Ser Tyr Ala Ser Phe Ile

11. 10 pts. Two spontaneous Drosophila mutants with apricot colored eyes were identified independently and the mutant eyecolor genes were sequenced. Both mutants were found to carry a mutation at position 38 that changed the identity of the wild type Gly to either Arg or Glu. The mutants were mutagenized and their progeny screened for revertants to the wild-type eyecolor. Four revertants for mutant one and three revertants for mutant two were recovered and for each mutant, the eyecolor gene was sequenced. Based on the diagram below and using the attached genetic code, determine the sequence at codon 38 for each, mutant and revertant fly and the wild type sequence.

12. 10 pts. Eleven genomic clones, each containing DNA from chromosome 5 of C. elegans, were tested for cross hybridization in all pairwise combinations. Using the hybridization data below, determine how many contigs are defined by BAC clones A-K and draw a map of the contig(s) showing the order of overlapping clones within a given contig. In the table below, + = hybridization, - = no hybridization.

13. 15 pts. 6 auxotrophic Neurospora strains were crossed to each other to determine complementation and linkage relations. Growth of the heterokaryons on minimal media was recorded for each pair (+ or -). Then 1000 meiotic spores from each cross were germinated on minimal media. The number of spores that grew into colonies is shown in the table listing the crosses. proA proB proA ---50 (+) proB --proC proD proE proF proC 250 (+) 200 (+) --proD 100 (+) 50 (+) 150 (+) --proE 250 (+) 200 (+) 0 (-) 150 (+) --proF 50 (+) 0 (+) 200 (+) 50 (+) 200 (+) --5

a. How many genes are identified in this sample of mutants?

b. Determine the map locations of these genes. Show distances between the genes in map units.

c. 3 intermediate compounds (I, II, III) were tested to see if they support growth in the absence of proline. The results are that compound I supports growth for none the mutants, compound II supports growth only of strains A and D, and compound III supports growth only of strains A, B, D and F. What is the biosynthetic order of these compounds and proline? Assume they are all involved. Indicate which mutants block which steps.

d If you know that only 1 enzymatic activity separates compounds II and III, what is the minimum number of polypeptide chains forming the enzyme that catalyses the conversion of compound II to compound III? Explain. 2. Two genes (B, F) act at this step. Each produces a polypeptide chain. Likely protein is heterodimer or multiple. 10

14. 15 pts. Mutants at the trpA gene in 4 strains were examined for their effects on the polypeptide chain. The table lists what was found. Strain # 23 36 78 109 mutant change at the indicated amino acid position Gly to Arg at amino acid 211 Glu to Val at amino acid 49 Gly to Cys at amino acid 234 Lys to stop at amino acid 15 del 1 + + del 2 +

a. What is the map of the mutant changes in the trp A gene? Identify each mutant location by its strain number.

The chromosome map has the genes mal and pro nearby and on opposite sides of the trp gene. A large deletion (del 1) removes the mal gene and part of the trp gene, while another large deletion (del 2) removes the pro gene and part of the trp gene. Recombination tests with the mutant strains and deletions 1 and 2 were carried out with the results shown in the table above. + means some wild type recombinants formed, - means no recombinants formed. b. Show the locations of the mal and pro genes and the del 1 and del 2 deletions on your map above. c. Draw an arrow under your map above indicating the direction of transcription for the trp A gene. 15. 15 pts Below is the partial sequence of a yeast gene encoding a homodomain protein. The sequence is derived from the central portion of a single exon and contains an open reading frame. a. Indicate which DNA stand serves as the template strand during RNA synthesis. Top stand is template b. Determine the amino acid sequence encoded by the open reading frame, indicating the amino and carboxyl ends of the partial protein. c. What is the predicted function of the full length protein? Transcription factor, binds DNA 5'CAATGTGAGTAAGTTTACTTTCGACTAGTCCAGGGTTAGCAT3' 3'G,TTA,CAC,TCA,TTC,AAA,TGA,AAG,CTG,ATC,AGG,TCC,CAA,TCG,TA5' COOH Ile His Thr Leu Lys Ser Glu Val Leu Gly Pro Asn Ala - NH2 11

16. 15 pts One region of a chromosome has 5 possible restriction sites. Which sites are actually present determines the different alleles that are segregating in this family, as indicated by hybridization to a probe from part of the region.

a. How many different alleles can you find in this family?

b. Below is the map of the potential restriction sites. Draw a map for each of the alleles, showing which sites are present in that allele.

c. One of the possible restriction fragments is used as the probe. Which one is it? The 4 kb piece between R2 and R4 sites. 17. 10 pts In wild type C. elegans, low X-chromosome to autosome ratios result in high levels of Xol-1, the first component of the sex determination pathway. Using this information and the sex determination diagram below, predict the effects of expressing a transgene that results in high levels of Xol-1 on the activity of the tra-2 gene in hermaphrodites, and explain the how this expression will affect sex determination.

a. tra2 expression

__off __

b. sex determination __male_ differentiation 12

18. 15 pts. The probe G8 is 4 map units from the Huntington disease gene, a rare late onset neural degeneration disease. Shaded individuals have this disease. Southern blots with the G8 probe are shown for this family.

a. Is the Huntington disease dominant or recessive? Explain. Dominant, (rare) affected son has affected parent. b. Which children in generation III are at high risk (25% or greater) to get the Huntington disease gene? III1 & III3 c. What can you advise the youngest daughter (Sue) about her risk of getting the Huntington disease gene?

19. 10 pts pts Progeny resulting from the cross of a Class A mutant of Arabidopsis (aaBBCC) with a Class C mutant (AABBcc) are allowed to self fertilize. In what percent of the F2 progeny do you expect to see expression of Class C genes in whorls 1 and 2 of the flower?

13