Sunteți pe pagina 1din 22

SIMULADO MODELO UFRJ Disciplina: Biologia (Prova especfica) Nome: ___________________________________________________________

01. Em 1928, Alexander Fleming isolou a penicilina a partir de culturas de fungos do gnero Penicilium. Primeiro antibitico conhecido, a penicilina foi produzida em larga escala para o combate s infeces bacterianas. Desde ento, inmeros outros antibiticos foram isolados de seres vivos ou sintetizados em laboratrio. Cada um destes antibiticos interfere em uma via do metabolismo das bactrias. Os antibiticos, porm, so inteis no combate s infeces por vrus. Explique por que os antibiticos no tm efeito contra os vrus. 02. O crescimento da soja (Glycinia max) influenciada por bactrias fixadoras de nitrognio (do gnero Rhizobium), que vivem em associaes com suas razes. As plantas obtm nitratos das bactrias e, em troca, as bactrias recebem nutrientes teis para o seu crescimento. Pesquisadores formularam a hiptese de que as plantas s transfeririam nutrientes para as bactrias em resposta a obteno de nitratos. Para testar essa hiptese, os pesquisadores mantiveram as bactrias em associao com as razes de uma mesma planta de soja, mas em duas condies diferentes: Condio A: atmosfera com nitrognio suficiente para a multiplicao das bactrias, mas insuficiente para que nitratos fossem liberados; Condio B: atmosfera normal, com nitrognio suficiente para multiplicao das bactrias e para a liberao de nitratos. Os resultados obtidos mostraram que as bactrias na condio A se multiplicam com metade da eficincia daquelas na condio B. Esses resultados experimentais corroboram ou invalidam a hiptese testada? Justifique a sua resposta. 03. O diagrama abaixo mostra a degradao de um hidrocarboneto, tal e qual ocorre em microrganismos que utilizam derivados do petrleo para obteno de energia.

Atravs dessa via metablica, ento, o cido octanico degradado at acetil CoA. Na verdade, tais microrganismos so rotineiramente utilizados em casos de grandes vazamentos de petrleo, na tentativa de amenizar os efeitos nocivos desses desastres ecolgicos. Este processo denominado de biorremediao. Uma refinaria planejou limpar seus caminhes-tanque utilizando essas bactrias. A atmosfera dos tanques a serem limpos encontrava-se saturada com o gs nitrognio, para evitar exploses. As bactrias foram ento acrescentadas aos tanques. Nessas condies, o que ocorreria com os hidrocarbonetos? Justifique sua resposta.

04. A figura abaixo mostra um trecho da estrutura do cido desoxiribonuclico, ressaltando a interao entre as duas cadeias do polmero. Na figura, A, C, G & T representam as bases adenina, citosina, guanina e timina, respectivamente.

As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se de desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas seqncias de DNA abaixo e determine qual delas precisar de uma temperatura de desnaturao maior. Justifique a sua resposta. 1) ACTTTAAAGATATTTACTTAAA 2) GCTAGGCCGATGCGGCGTGGA TGAAATTTCTATAAATGAATTT CGATCCGGCCTACGCCGCACCT 05. A glicoquinase e a hexoquinase so duas enzimas que reagem com o mesmo substrato, a glicose. Ambas so enzimas intracelulares que fosforilam a glicose formando glicose 6-fosfato (G6P). Dependendo da enzima produtora, a G6P pode ou ser degradada na via da gliclise para gerar energia ou ento ser usada para sntese de glicognio. A gliclise ocorre nos tecidos em geral e a sntese de glicognio ocorre principalmente no fgado. A sntese do glicognio somente acontece quando existe excesso de glicose no sangue. Essa uma forma de armazenar esse acar. Observe a figura a seguir, que apresenta as velocidades de reao dessas duas enzimas em funo da concentrao da glicose. Nveis normais de glicose no sangue esto ao redor de 4 mM.

Qual das duas enzimas gera G6P para sntese de glicognio heptico? Justifique sua resposta. 06. A fenilcetonria uma doena que resulta de um defeito na enzima fenilalanina hidroxilase, que participa do catabolismo do aminocido fenilalanina. A falta de hidroxilase produz o acmulo de fenilalanina que, por transaminao, forma cido fenilpirvico. Quando em excesso, o cido fenilpirvico provoca retardamento mental severo. Por outro lado, o portador desse defeito enzimtico pode ter uma vida normal desde que o defeito seja diagnosticado imediatamente aps o nascimento e que sua dieta seja controlada. A fenilcetonria to comum que mesmo nas latas de refrigerantes dietticos existe o aviso: "Este produto contm fenilcetonricos!". Qual o principal cuidado a tomar com a dieta alimentar de um portador desse defeito enzimtico? Por qu?

SIMULADO MODELO UFRJ Disciplina: Espanhol (Prova especfica) Nome: ___________________________________________________________

El PVC nos invade


Si aceptamos lo que un ecologista nos dice todos los das sobre los males del PVC, (plstico con el que estn hechos objetos de uso diario), tendramos que cambiar mucho nuestros hbitos de vida. Desde que toca el despertador hasta acostarnos, vivimos rodeados de PVC. Este material se ha convertido en imprescindible en la sociedad actual, pero puede hacer mal a la salud, segn los cientficos. La recomendacin es que dejemos de lado todo aquello que est hecho com ese material. Pero a la mayora de la gente le resulta difcil conseguirlo. Las botellas de aceite y agua, los juguetes de los nins, los plsticos para envolver alimentos, el envase de la mantequilla, la manguera del jardn , las ventanas y as una lista casi interminable... Tendramos que hacer prcticamente una casa nueva. Para los ecologistas, la existencia del PVC causa muchos problemas en la naturaleza y los seres humanos. El peligro del PVC abarca todo su ciclo til, tanto en el proceso de produccin, como durante su vida til, pero los riesgos aumentan en el momento de su eliminacin, amenazando la atmsfera, el medio acutico y la tierra. Algunas de las caractersticas de este material son su estabilidad y su gran resistencia a incorporarse a los ciclos de la naturaleza. Presenta alta toxicidad para los seres vivos. Los daos se centran en el sistema inmunitario, reproductor, endcrino y nervioso, adems de una amplia variedad de cnceres debido a la gran cantidad de aditivos txicos que tiene. Pero los industriales no reconocen los efectos nocivos de la produccin del PVC o sus efectos negativos como desecho, denunciado por los ecologistas. As seguimos en medio a la oferta masiva de PVC. Hasta cundo?
Publicado en Cambio 16 No. 1395,24 (Adaptacin)

En Portugus 01. Explique o significado desta orao: Tendramos que hacer prcticamente una casa nueva. 02. Que significa a pergunta final do texto?

03. Explique em que momentos do seu ciclo o PVC perigoso.


En Espaol 04. Trancriba del texto la frase a que se refiere la palabra destacada. Pero a la mayoria de la gente le resulta difcil conseguirlo. 05. Describa los peligros que el PVC causa al medio ambiente y a los seres vivos. 06. Transcriba del texto dos caractersticas del PVC.

SIMULADO MODELO UFRJ Disciplina: Fsica (Especfica) Nome: ___________________________________________________________

01. Um mtodo possvel para medir a acelerao da gravidade g consiste em lanar uma bolinha para cima num tubo onde se fez vcuo e medir com preciso os instantes t1 e t2 de passagem (na subida e na descida, respectivamente) por uma altura z conhecida, a partir do instante do lanamento. Mostre que:

g=

2z t1t2

02. Um barco deve cruzar um rio com forte correnteza. O arraz amador, ainda sem muita experincia, aponta a proa do barco exatamente na direo perpendicular s margens, isto , deixa o barco com seu eixo fazendo um ngulo de 90 com a direo da correnteza. O motor do barco imprime uma velocidade de 5,0 m/s, em relao s guas, que se movem com certa acelerao. Sabendo que no instante t = 4,0 s, o arraz amador j est desesperado porque a trajetria do barco foi uma parbola muito fechada, a ponto de nesse momento a velocidade do barco j ser de 13 m/s, responda aos quesitos abaixo. a) Determine a acelerao da correnteza. b) Calcule a equao da parbola descrita pelo barco, tomando como origem o ponto de onde o barco iniciou o movimento. (Isso equivale a calcular a componente vertical do vetor posio em funo de sua componente horizontal) c) O gravssimo acidente que obviamente ocorreu foi seguido de uma exploso, que teria matado o gnio incompreendido que pilotava o barco, se ele ainda no tivesse morrido durante a coliso da embarcao numa pedra, onde ele sangrou at a morte com as ferragens que amputaram suas duas pernas e perfuraram seus pulmes. J na companhia de Al, analisando com mais paz de esprito o movimento, resolveu calcular o raio do crculo que tangente trajetria no instante t = 4,0 s. Qual foi o raio calculado por ele? 03. Sabemos que no vero, sob sol a pino, a temperatura da areia da praia fica muito maior do que a da gua. Para avaliar quantitativamente este fenmeno, um estudante coletou amostras de massas iguais de gua e de areia e cedeu a cada uma delas a mesma quantidade de calor. Verificou, ento, que enquanto a temperatura da amostra de areia sofreu um acrscimo de 50C, a temperatura da amostra de gua sofreu um acrscimo de apenas 6C. Calcule, portanto, o calor especfico da areia. Considere o calor especfico da gua 1,00 cal/g C. 04. Em casa, tarefa da filha encher os recipientes de fazer gelo. Ela ps 100 g de gua, inicialmente a 20C, em um dos recipientes e o colocou no freezer, regulado para manter a temperatura em seu interior a 19C, sempre que a porta estiver fechada. No entanto, a porta ficou tanto tempo aberta que a temperatura do ar dentro do freezer chegou a 3C. Sabendo que a presso atmosfrica local 1 atm, e considerando que o ar no interior do freezer um gs ideal, determine:

a) a quantidade de calor que a gua do recipiente deve perder para que se converta totalmente em gelo a 0C; b) a presso no interior do freezer imediatamente aps a filha ter fechado a porta. 05. Juquinha, querendo brincar de fsica, colocou uma lupa (lente convergente) em uma mesa (num ponto determinado por ele como ponto "zero") e empurrou um carrinho sua esquerda, saindo com velocidade inicial v0 = 0 m/s e acelerao a = 2 cm/s2. Sabendo que a distncia focal da lente de 30 centmetros e que a distncia inicial entre o carrinho e a lupa de 15 centmetros, qual a distncia entre o carrinho e sua imagem no tempo t=3s? 06. O mesmo Juquinha coloca o mesmo carrinho dessa vez na frente de um espelho esfrico a uma distncia de 25 centmetros dele. A altura do carrinho de dois centmetros. Sabendo que ele deseja projetar a imagem do carrinho em uma parede a seis metros de distncia, determine o tipo de espelho e o tamanho da imagem.

SIMULADO MODELO UFRJ Disciplina: Geografia (Prova Especfica) Nome: ___________________________________________________________

01. Desde as ltimas dcadas, as economias capitalistas desenvolvidas passam por uma profunda reestruturao. A acumulao capitalista de base fordista vem sendo substituda por um modelo de acumulao ps-fordista, fazendo emergirem significativas mudanas scio-espaciais. Apresente duas diferenas entre a forma de organizao da produo do tipo fordista e aquela denominada ps-fordista. 02. O mundo marcado pela instantaneidade da informao globalizada, representada pelos sistemas de computadores, telefonia e satlites. A tecnologia da informtica possibilita a disperso geogrfica, assim como a integrao simultnea de muitas atividades e acontecimentos. Decorrem da novas aes decisrias no campo econmico, social, cultural e poltico, definidoras das realidades espaciais. Explique duas mudanas econmicas resultantes desse processo mundial e seus efeitos na reestruturao espacial das cidades. 03.

Em pesquisas recentes, um grupo de cientistas definiu os 25 pontos considerados crticos para a ecologia (hot spots). Um desses pontos a Mata Atlntica, que contm 20 mil espcies de plantas, sendo oito mil exclusivas desse ecossistema, 261 espcies de mamferos, 620 de aves, 200 de rpteis e 280 de anfbios. Hoje restam apenas 7,5% da sua flora original. Nos mapas acima, verificase o grau de devastao da Mata Atlntica no estado do Rio de Janeiro. Aponte duas conseqncias ambientais do desmatamento dessa cobertura florestal.

04. A histria recente da humanidade nos mostra um dinamismo intenso, difuso e desigual da populao mundial. O mapa a seguir nos mostra a distribuio da populao por continentes em 2000 e a projeo para 2050. Caracterize a tendncia demogrfica a partir da projeo apresentada no mapa.

05. Moradores da cidade do rio de Janeiro expressam vises do morar numa grande cidade: Dona Antonia mora em rua alta da Rocinha e defende que para viver na favela e ser feliz preciso fechar os olhos para a imponncia das manses da Gvea, vistas da laje de sua casa, toda erguida junto com o marido Sr. Antonio, que faz bicos como marceneiro. Dona Antonia completa a renda familiar de trs filhos e um neto, costurando para fora. O neto dela, de 5 anos se satisfaz na piscina de plstico que Dona Antonia comprou h um ms, enquanto a av observa as piscinas semi-olmpicas das manses. Aqui no h lazer, no tem praas, nem lugar para a criana andar de bicicleta Dona Vera tem um apartamento de 3 quartos na parte baixa da Gvea, onde vive h 10 anos. Adoro viver aqui. No me mudo por nada. Tem bons restaurantes, escolas, teatros, rea de lazer e fica a um pulo da praia, contou a mdica. Ela tem 3 filhos e o bairro oferece opes de lazer para todos. A mais velha, de 18 ano, freqenta o Shopping da Gvea. Os mais novos de 15 e 9 anos se divertem no ptio do edifcio, que tem um campo de futebol. ... fico tranquila conclui dona Vera A partir da leitura dos relatos, explique o processo espacial caracterizado nas duas formas de morar na cidade do Rio de Janeiro.

06. Observe o climograma e o mapa a seguir.

Descreva as principais caractersticas do clima representado no grfico e identifique qual das trs cidades assinaladas no mapa apresenta as caractersticas do climograma acima.

SIMULADO MODELO UFRJ Disciplina: Histria (Prova especfica) Nome: ___________________________________________________________

01. Os pintores representam s vezes o Cristo sobre um arco-ris com uma espada saindo de sua boca (...). Mas os pintores no deveriam representar uma vara com flores e sim um basto. E tanto o basto quanto a espada deveriam se dirigir para o mesmo lado, para abater os danados: 'que se quebre o brao do mpio, que se persiga sua iniquidade e sua maldade no deixar traos'. Estas palavras nos ensinam que desta maneira que a autoridade do Papa, inspirada pelo AntiCristo, ser destruda. A palavra do Cristo que o sopro, o basto e a espada que saem de sua boca, manifestar plenamente para o mundo a tirania e a seduo desta Igreja.
(Trecho do opsculo .Sincera admoestao a todos os cristos para que seguardem de toda revolta., escrito em 1522, por Martinho Lutero.)

O trecho acima parte do relatrio que dez mensageiros de Montezuma levaram ao Cazonci (rei) dos Tarascos da regio de Michoacn, para pedir-lhe ajuda nas lutas contra os espanhis. a) Identifique no texto dois fatores que auxiliaram a rpida conquista do Mxico pelos espanhis. b) Explique como os fatores identificados no item anterior ajudam a compreender a rapidez atravs da qual Hernn Cortz e seus comandados conquistaram o Imprio Asteca. 03. (...) Assim, antes de partir de Frana, Villegagnon prometeu a alguns honrados personagens que o acompanharam, fundar um puro servio de Deus no lugar em que se estabelecesse. E depois de aliciar os marinheiros e arteses necessrios, partiu em maio de 1555, chegando ao Brasil em novembro, aps muitas tormentas e toda a espcie de dificuldades. A aportando, desembarcou e tratou imediatamente de alojar-se em um rochedo na embocadura de um brao de mar ou rio de gua salgada a que os indgenas chamavam Guanabara e que (como descreverei oportunamente) fica a 23 abaixo do equador, quase altura do Trpico de Capricrnio. Mas o mar da o expulsou. Constrangido a retirar-se avanou quase uma lgua em busca de terra e acabou por acomodar-se numa ilha antes deserta, onde, depois de desembarcar sua artilharia e demais bagagens, iniciou a construo de um forte, a fim de garantir-se tanto contra os selvagens como contra os portugueses que viajavam para o Brasil e a j possuem inmeras fortalezas.
IN: LRY, Jean. De Viagem Terra do Brasil. Rio de Janeiro, Bibliex, 1961, pp. 51

No texto, Lutero ataca duramente a Igreja Catlica e o Papa, comparado por ele ao Anti-Cristo. Apresente duas crticas formuladas pelo luteranismo Igreja Catlica. 02. O Mestre de Mxico, Montezuma, nos envia, a ns e a alguns outros nobres, com a ordem de contar a nosso irmo o Cazonci tudo o que diz respeito gente estranha que chegou [em Tenochtitln]. Ns os enfrentamos no campo de batalha e matamos aproximadamente duzentos dos que vinham montados em cervos e duzentos dos que andavam a p. Os cervos so protegidos por armaduras de couro retorcido e carregam algo que ressoa como as nuvens, que produz um rudo de trovo e que mata todos os que encontra em seu caminho, at o ltimo. Romperam completamente nossa formao e mataram muitos dos nossos. A gente de Tlaxcala os acompanha, pois voltou-se contra ns.
Adaptado de Todorov, Tzevetan. A conquista da Amrica (a questo do outro). So Paulo: Martins Fontes, 1988, p. 91.

(...) Por esse tempo, agitava-se importante controvrsia entre os dirigentes da Companhia (Cia. Das ndias Ocidentais), a qual se travou principalmente entre as

cmaras da Holanda e da Zelndia. Versava sobre se seria proveitoso Companhia franquear o Brasil ao comrcio privado, ou se devia competir a ela tudo o que se referisse ao comrcio e s necessidades dos habitantes daquela regio. Cada um dos dois partidos sustentava o seu parecer. Os propugnadores do monoplio escudavam-se com o exemplo da Cia. Oriental, usando o argumento de que se esperariam maiores lucros, se apenas a Cia. comerciasse, porque, com o trfico livre, dispersar-se-ia o ganho entre muitos, barateando as mercadorias pela concorrncia.

vida [...]. Posteriormente, os Estados Gerais dos Pases Baixos a levaram as suas armas e conquistaram a melhor parte, no tendo sido poupadas as devastaes e saques, companheiros da guerra.
Fonte: Moreau, Pierre. Histria das ltimas lutas no Brasil entre holandeses e portugueses. Belo Horizonte:Itatiaia; So Paulo: Edusp, 1979

IN: BARLU, Gaspar. Histria dos Feitos recentemente praticados durante oito anos no Brasil. So Paulo, Ed. Itatiaia, 1974, pp.90

A descrio acima foi escrita por Pierre Moreau, sobre quem se conhece pouco alm do fato de ter vivido no Brasil em meados da dcada de 1640. Dentre outras coisas, o trecho mostra que, no raro, os pases europeus questionavam os termos em que o Tratado de Tordesilhas dividira a Amrica. a) Identifique no texto dois exemplos concretos deste questionamento. b) Explique uma caracterstica das sociedades indgenas, presente no texto, que tenha sido utilizada por pases europeus nas aes concretas de questionamento ao Tratado de Tordesilhas. 05. Cada ano, vm nas frotas quantidade de portugueses e de estrangeiros, para passarem s minas. Das cidades, vilas e recncavos e sertes do Brasil, vo brancos, pardos e pretos, e muitos ndios, de que os paulistas se servem. A mistura de toda a condio de pessoas: homens e mulheres, moos e velhos, pobres e ricos, nobres e plebeus, seculares e clricos, e religiosos de diversos institutos, muitos dos quais no tm no Brasil convento nem casa.
(Andr Joo Antonil, Das pessoas que andam nas minas e tiram ouro dos ribeiros., in Cultura e opulncia do Brasil, 1a edio 1711)

Ao longo dos sculos XVI, XVII e incio do XVIII, vrias potncias europias invadiram a Amrica Portuguesa. Houve breves invases e atos de pirataria ao longo do litoral no incio do sculo XVI. Posteriormente, outras invases iriam adquirir caractersticas diferenciadas. As formas de invaso e ocupao, assim como estratgias e interesses econmicos seriam diversos. a) Aponte duas razes para a invaso e o estabelecimento colonial de franceses (a Frana Antrtica) no litoral do Rio de Janeiro entre 1555 e 1567. b) Identifique o principal interesse da Cia. das ndias Ocidentais na invaso de Pernambuco, em 1634. 04. Os livros dos descobridores deste outro hemisfrio do-nos a conhecer suficientemente o que este Brasil, em que paralelo est situado, de que maneira os brasilianos, tupinambs e tapuias, os povos desse pas, se guerreavam antigamente e devoravam os vencidos; como os portugueses, subjugando estes miserveis, se fizeram assinalar por horrveis efuses de sangue; como, tambm os franceses, tendo-se tornado senhores de uma parte do pas por meio de sangrentas expedies, os portugueses lha fizeram abandonar com a

A corrida do ouro s minas brasileiras, ocorrida nas primeiras dcadas do sculo XVIII, proporcionou significativas mudanas na economia e na sociedade coloniais. Identifique duas importantes transformaes ocorridas na sociedade colonial a partir do ciclo do ouro, em Minas Gerais, no sculo XVIII.

06. Movimento da alfndega da cidade de So Paulo de Assuno de Luanda entre 1785 e 1794 (em ris) reas rea A: Portugal e outras regies europias. rea B: Brasil e ndia. Total Importaes Valores Tecidos e 2:187:975$370 gneros agrcolas e industriais. Tecidos, gneros agrcolas e demais produtos. 2:680:897$560

Fonte: Adaptado de SANTOS, Corcino. O Rio de Janeiro e a conjuntura atlntica. Rio de Janeiro, Expresso e Cultura, 1993, p. 156.

4:868:872$930

A tabela acima reproduz o movimento de importaes da alfndega de Luanda em fins do sculo XVIII. Indicam-se aqui as fontes provedoras de mercadorias que serviam aquisio sobretudo de escravos, mas tambm de cera e marfim nesta parte do imprio portugus. comum afirmar-se que o comrcio colonial lusitano tinha por objetivo principal o enriquecimento da metrpole e, por meio dele, do restante da Europa, em transio para o chamado capitalismo industrial. Da derivam, dentre outras idias, a da fragilidade dos circuitos mercantis intercoloniais no mbito do imprio portugus. a) Identifique a rea mencionada na tabela que se constitua na principal parceira comercial de Luanda no perodo considerado. b) Explique como a resposta dada questo anterior pode questionar a noo de Antigo Sistema Colonial.

SIMULADO MODELO UFRJ Disciplina: Ingls (Prova Especfica) Nome: ___________________________________________________________ TEXTO I SCIENCE Two modern gumshoes think theyve solved the ancient mystery of the boy Kings untimely death By JEFFREY KLUGER and ANDREA DORFMAN The tomb of the boy King Tutankhamen created a sensation from the moment it was uncovered in 1922. One of the few royal burial chambers that survived the centuries relatively intact, it was by far the richest filled with gold, ivory and carved wooden treasures, including what may be the worlds most famous funerary mask. But there was also something troubling about the way King Tut was buried hints and omissions that suggested foul play. Tut was barely 18 when he died young for Pharaohs, who always enjoyed the best nutrition and medical care in what was one of the ancient worlds most civilized kingdoms. Whats more, he is thought to have been the son of a controversial in some quarters, hated leader, which would have made Tut controversial too. But more than anything it was the state of the boys tomb its diminutive size, its unfinished condition that suggested he had died unexpectedly. All of this raised suspicions that his demise may have been an unnatural, even violent one. And now a new case is being made that supports those who have long surmised that he was, in fact, murdered.
TIME, September 16, 2002, p. 36.

RESPONDA S QUESTES 1 E 2 EM PORTUGUS, COM BASE NO TEXTO I.


Que objeto encontrado no tmulo de Tutancmon tornou-se muito conhecido?

Questo 1

Questo 2 Como caracterizado o pai de Tutancmon? RESPONDA QUESTO 3 EM INGLS, COM BASE NO TEXTO I. Questo 3 Find in the text: a) a synonym for the word death; b) the complete expression that describes the place where Tut lived.
TEXTO II Music SOUND DIDNT ALWAYS TRAVEL at the speed of light. A century ago, every people and every place had distinctive musical idioms, crafted and passed down from generation to generation. That was before the planets circumference was shortened to a shouts distance by radios, recordings, transistors, satellites and the Web. As the decades passed, some traditional genres mutated, hybridized and spread like viruses. Many others were left for dead on their home soil. In the United States, where the descendants of African slaves dreamed up jazz and the blues, sounds emerged that would conquer the world. A few returned home transfigured. In the 1960s, for example, a British quartet in love with Chuck Berry and Little Richard reinvented American music. Before the Beatles, rock and roll was a phase the world might eventually have outgrown. Afterward, rock was the mainstream.
NEWSWEEK, July 19, 1999:38

RESPONDA S QUESTES 4 E 5, EM PORTUGUS, COM BASE NO TEXTO II.

Questo 4 O que caracterizava as expresses musicais h cem anos? Questo 5 Qual foi a dupla contribuio dos Beatles para o rock and roll ?

SIMULADO MODELO UFRJ Disciplina: Lngua Portuguesa e Literatura Brasileira (Prova Especfica) Nome: ___________________________________________________________

TEXTO II TEXTO I Sonho Ter nascido homem outro, em outros dias, No hoje, nesta agitao sem glria, Em traficncias e mesquinharias, Numa apagada vida merencria Ter nascido numa era de utopias, Nos ureos ciclos picos da Histria, Ardendo em generosas fantasias, Em rajadas de amor e de vitria: Campeo e trovador da Idade Mdia, Heri no galanteio e na cruzada, Viver entre um idlio e uma tragdia; E morrer em sorrisos e lampejos, Por um gesto, um olhar, um sonho, um nada, Traspassado de golpes e de beijos! (BILAC, Olavo. Olavo Bilac: obra reunida. RJ: Nova Aguilar, 1996. p. 284.) VOCABULRIO: merencria ( verso 4 ) melanclica 01. Do verso 2 ao verso 6, o poema caracteriza o TEMPO, recriando a ambincia romntica. Justifique essa afirmao, com suas palavras, e exemplifique com adjetivos presentes nesses versos. 02. Os tercetos do poema "Sonho" definem o SUJEITO, acentuando-lhe dois aspectos que recriam, tambm, a atmosfera romntica. Justifique essa afirmao com suas palavras e exemplifique com dois substantivos retirados do primeiro terceto do poema. Cano do Violeiro Passa, vento das campinas, Leva a cano do tropeiro. Meu corao st deserto St deserto o mundo inteiro Quem viu a minha senhora Dona do meu corao? Chora, chora na viola, Violeiro do serto Ela foi-se ao pr da tarde Como as gaivotas do rio. Como os orvalhos que descem Da noite dum beijo frio, O cau canta bem triste, Mais triste meu corao Chora, chora na viola, Violeiro do serto E eu disse: a senhora volta Com as flores da sapucaia. Veio o tempo, trouxe as flores, Foi o tempo, a flor desmaia. Colhereira, que alm voas, Onde est meu corao? Chora, chora na viola, Violeiro do serto No quero mais esta vida, No quero mais esta terra. Vou procur-la bem longe, L pelas bandas da serra. Ai! triste que sou escravo! Que vale ter corao? Chora, chora na viola, Violeiro do serto
(ALVES, Castro. Obra completa. a a 2 ed./3 impresso. Rio de Janeiro: Ed. NovaAguilar, 1997).

03. a) O romntico, ao mesmo tempo em que rejeita o que est prximo, projeta o seu desejo no que est distante. Do texto 2, transcreva integralmente a seqncia de trs versos que melhor comprove a afirmao acima. b) O texto 2 se organiza na forma de um dilogo, tendo a cada momento um interlocutor distinto. Aponte 1 (uma) funo sinttica e 1 (um) aspecto morfolgico presentes no texto que evidenciem a presena de interlocutores. TEXTO III Cantadores do Nordeste Anteontem, minha gente, Fui juiz numa funo De violeiros do Nordeste Cantando em competio. Vi cantar Dimas Batista, Otaclio, seu irmo, Ouvi um tal de Ferreira, Ouvi um tal de Joo. Um, a quem faltava um brao, Tocava cuma s mo; Mas, como ele mesmo disse, Cantando com perfeio, Para cantar afinado, Para cantar com paixo, A fora no est no brao: Ela est no corao. Ou puxando uma sextilha Ou uma oitava em quadro, Quer a rima fosse em inha, Quer a rima fosse em o Caam rimas do cu, Saltavam rimas do cho! Tudo muito bem medido No galope do serto. A Eneida estava boba; O Cavalcanti, bobo, O Lcio, o Renato Almeida; Enfim, toda a comisso. Sa dali convencido Que no sou poeta no; Que poeta quem inventa Em boa improvisao, Como faz Dimas Batista

E Otaclio, seu irmo; Como faz qualquer violeiro Bom cantador do serto, A todos os quais, humilde, Mando a minha saudao!
(BANDEIRA, Manuel. Estrela da vida inteira. 20 ed. Rio de Janeiro: Nova Fronteira, 1993)
a

04. No poema Cantadores do Nordeste (texto 3), a msica caracterizada como manifestao da interioridade do sujeito. Verifique se essa afirmao pode ser aplicada tambm ao texto 2, Cano do Violeiro. Justifique sua resposta, comprovando-a com elementos do texto. 05. Aponte o trao que, segundo o eu do poema (texto 3), caracteriza os cantadores do Nordeste como os verdadeiros poetas. 06. Apesar do seu carter popular do poema Cantadores do Nordeste (texto 3), o autor recorre, em alguns momentos, inverso sinttica. Transcreva dois versos consecutivos que estejam na ordem inversa. Justifique sua resposta, apontando a funo sinttica que sofreu deslocamento.

SIMULADO MODELO UFRJ Disciplina: Matemtica (Especfica) Nome: ___________________________________________________________

01. Um clube oferece aulas de trs esportes: natao, tnis e futebol. Ningum pode inscrever-se em tnis e futebol, pois as aulas acontecem no mesmo horrio. Encerradas as inscries, verificou-se que: dos 85 inscritos em natao, 50 s faro esse esporte; houve 17 inscritos em tnis e 38 em futebol; o nmero de inscritos s em futebol excede em 10 o nmero de inscritos s em tnis. A partir destes dados, responda aos dois itens a seguir, JUSTIFICANDO SUAS RESPOSTAS: a) Quantas pessoas natao e futebol? inscreveram-se em

03. Dentro de um ngulo agudo inscrevemse circunferncias cada vez menores a partir da mais externa, que fazem contato uma com a outra (figura abaixo). Os raios dessas circunferncias formam uma progresso geomtrica. a) Qual a razo da PG? b) Qual a soma de todos os raios, sabendo que o primeiro raio R0? c) Qual a soma das reas de todos os crculos?

b) Quantas pessoas inscreveram-se em futebol ou tnis? 02. Pode-se calcular a massa ideal do corpo humano adulto pela frmula a seguir: m = (a 100) [(a 150) : k], onde: m = massa corporal ideal (expressa em kg) da pessoa; a = altura (expressa em cm) da pessoa; k = 4, para homens; k = 2, para mulheres. A partir destes dados, responda aos dois itens a seguir, JUSTIFICANDO SUAS RESPOSTAS: a) Com massa corporal de 54 kg, Ana tem 3 kg a menos que seu peso ideal. CALCULE A ALTURA DE ANA. b) Rui e Eva tm a mesma altura e ambos esto com suas respectivas massas corporais ideais. Sabendo que ele tem 2 kg de massa corporal a mais que ela, CALCULE A MASSA CORPORAL DE CADA UM DELES DOIS.

04. Em um dos seus famosos trotes, Seu Aristarco se depara com uma atendente eletrnica, que manda digitar no telefone um ramal de trs algarismos. Ele, j velho, no percebe que as teclas 2 e 5 do telefone esto quebradas. Sabendo que o primeiro algarismo do ramal no pode ser um zero, quantas so as possibilidades em que Seu Aristarco digitar um ramal errado? 05. A grande sensao da ltima ExpoArte foi a escultura O.I.T.U., de 12 metros de altura, composta por suas circunferncias, que reproduzimos abaixo com exclusividade:

Para poder passar por um corredor de apenas 9 metros de altura e chegar ao centro do salo principal, ela teve de ser inclinada. A escultura atravessou o corredor tangenciando o cho e o teto, como mostra a figura a seguir.

Determine o ngulo de inclinao indicado na figura. 06. Quinze toras de madeira de 1,5m de dimetro so empilhadas segundo a figura a seguir.

A partir disto, calcule: a) A altura da pilha. b) A rea da figura, sabendo que a rea de cada crculo vale r.

SIMULADO MODELO UFRJ Disciplina: Qumica (Prova especfica) Nome: ___________________________________________________________

01. Em geral, molculas cuja massa aproximadamente igual a da molcula gua, encontram-se no estado gasoso nas condies ambientes de temperatura e presso. Diz-se que o fato de encontramos a gua no estado lquido em nosso planeta praticamente um milagre. gua a) apresente a frmula molecular da

a) Determine a massa de nitrato de amnio, em quilogramas, que o agricultor dever empregar para fertilizar sua cultura, de acordo com a recomendao do fabricante. b) O nitrognio pode ser obtido pela decomposio trmica do nitrato de amnio. NH4NO3 N2 + 2 H2O + O2

b) explique, atravs dos conceitos das foras intermoleculares, o estado lquido natural da gua. 02. Considere os elementos que se encontram nas famlias dos halognios e calcognios e pertencem ao 2 e ao 3 perodos. a) D a nomenclatura do hidrcido formado com o elemento de maior raio atmico, mostrando tambm sua frmula molecular. b) D a nomenclatura de todos os cidos formados com o elemento de segundo maior raio atmico, dentre os quatro considerados, mostrando tambm sua frmula molecular. 03. Um fertilizante de larga utilizao o nitrato de amnio, de frmula NH4NO3. Para uma determinada cultura, o fabricante recomenda a aplicao de 1 L de soluo de nitrato de amnio de concentrao 0,5 mol.L1 por m2 de plantao. A figura abaixo indica as dimenses do terreno que o agricultor utilizar para o plantio.

Calcule o volume de nitrognio obtido, nas condies normais de presso e de temperatura (CNTP), pela decomposio de 16g de nitrato de amnio (NH4NO3), supondo que o rendimento da reao seja de 80% (em massa). (massas atmicas: H = 1; N = 14; O = 16). 04. A portaria n1469, do ministrio da saude, estabelece padres da gua potvel pata consumo humano. A tabela a seguir d os valores mximos permitidos para algumas substncias que apresentam riscos a sade.

Uma anlise dessas substncias em uma amostra de 200 mL de gua indicou a presena de 0,25 x10 -7 mol do composto de formula molecular C2H2Cl2. a) D o nome do composto de formula molecular C2H2Cl2. b) Verifique, apresentando os clculos, se a concentrao desse composto est abaixo do valor mximo permitido.

Leia o texto abaixo para responder s questes 5 e 6:

O olfato dos seres humanos e de outros animais depende da existncia de receptores sensoriais que respondam presena de molculas de substncias odorantes no ar respirado. Os receptores olfativos (RO) esto localizados na cavidade nasal em um tecido denominado epitlio olfativo. A tabela a seguir apresenta resultados obtidos de estudo realizados com uma seo do epitlio olfativo de ratos para trs famlias de compostos orgnicos. Na tabela, as quadrculas assinaladas em preto indicam a existncia de resposta positiva de um determinado RO a uma substncia odorante.

05. D os nomes IUPAC do lcool e do composto halogenado que apresentam os maiores nmeros de respostas positivas do RO.

06. Escreva as frmulas estruturais, na representao em basto, do lcool que apresenta o menor nmero de respostas positivas dos RO.

SIMULADO MODELO UFRJ Disciplina: Redao Nome: ___________________________________________________________

Os fragmentos abaixo poderiam ter sido publicados em jornais na seo de Cartas dos leitores. Esses textos apresentam vises distintas a respeito dos elementos que caracterizam a msica brasileira atual.

inquestionvel que a msica brasileira afirma sua identidade apenas quando capaz de preservar suas razes culturais, revelando-se como legtima expresso da alma do nosso povo. Nossa msica no precisa importar outras culturas para marcar sua riqueza e seu valor. uma grande perda de tempo, nos dias de hoje, identificar como msica brasileira exclusivamente aquela que se apresenta como expresso pura, autntica e genuna de nossas razes. Mais do que nunca, a msica brasileira o resultado da fuso de diversas culturas. E isto no tem volta. A partir das idias expressas nesses dois fragmentos, elabore um texto dissertativo argumentativo, em que voc apresente seu posicionamento acerca da identidade da msica brasileira nos dias de hoje.