Rapid Identification of Insect Species of Agricultural Importance through DNA Barcoding

Dr A P Singh

Associate Professor in Zoology (Entomology), SGGS College (affiliated to Panjab University), Chandigarh 160 019 E-mail: apsingh_60@yahoo.co.in

INTRODUCTION Insect species of agricultural importance include insect pests, insect biocontrol agents and insect pollinators; and these are of great economic and environmental significance. Correct identification of them is necessary for their utilization (as biocontrol agents and pollinators), control (of insect pests) and research on any aspect. Identification of insects through traditional taxonomy has several limitations - slow and complex, low species resolution capabilities, dearth of taxonomic expertise, limited identification services by insect repositories, generally based on adults (therefore, eggs and immature stages are required to be reared to get adults for identification), fail to identify damaged insect specimens and inability to resolve cryptic/sibbling species complexes and account for phenotypic plasticity (polyphenism). On account of these limitations, many instances of mistakes in species identification in the history of biocontrol and failure of introduced biocontrol agents are known (Crawley, 1989). There is urgent need for improving identification services through induction of more taxonomists and adopting some additional means of rapid identification, for timely knowledge of - insect pest outbreak, invasive insect species, and candidates among diversity of insect biocontrol agents and insect pollinators. DNA barcoding (Hebert, et.al., 2003) and automated species identification method carry tag of being rapid species identification procedures. Automated species identification, mainly based on photographs, has several limitations; but DNA barcoding - a molecular taxonomic tool, has already proved its mettle in species identification and rapid assessment of insect biodiversity (Smith, et. al., 2009). Two hour express barcode generation procedure has already been developed for speed identification (Ivanova, et. al., 2009). Hand held barcoder is in the testing stage for instantaneous identification. In view of high potential for speed identification and resolution of species complexes (Maitland, et. al., 2009 ), DNA barcoding, if properly adopted and patronized for insects of agricultural importance, may prove to be a boon for agricultural scientists and farmers. Rapid Identification of species through DNA barcoding requires prior establishment of reference database from well identified voucher specimens. Therefore, all the existing insects of agriculture importance are required to barcoded from their complete distributional limits, followed by regular updating to authenticate database. DNA barcoding of insects of agricultural importance is based on mitochondrial cytochrome-c oxidase subunit 1 (COI) gene; but for further authentication, mitochondrial 16sr RNA gene and cyt b gene can also be employed. BOLD, the barcode of life data systems is a public workbench for assembly and analyses of barcode records and collateral information. The information is then submitted to one of the three interlinked public global databases of gene sequences GenBank (NCBI), European Molecular Biology Laboratory (EMBL) and DNA Data Bank of Japan (DOBJ). AIMS To highlight document National Bureau of Agriculturally Important Insects (NBAII) Vision 2030 : - Requirement for documenting staggering diversity of insects of agricultural importance of India - To harness rich biodiversity of useful insects to enhance agricultural productivity of India - To strengthen the traditional and molecular taxonomic base for effective identification of insects of agricultural importance - Employ molecular and information technology to document biodiversity of insects of agricultural importance

To highlight DNA barcoding as a reliable taxonomic tool for rapid identification of insects of agricultural importance To sensitize agricultural scientists, teachers and students about DNA Barcoding technology, for effective utilization/management of insects of agricultural importance. To highlight need for rapid identification : - To monitor pest status of insects, - To timely detect insect pest outbreaks and invasive insect species, - To effectively utilize available biodiversity of insect biocontrol agents and insect pollinators in agriculture To highlight importance of development of comprehensive DNA barcode reference library (based on COI gene) dedicated to insects of agricultural importance for subsequent rapid identification Exposure to a cheap (just 50 US dollars) handheld DNA barcoder for instantaneous identification of species, including insects of agricultural importance MATERIAL (DNA BARCODING) DNA barcoding - a molecular taxonomic technique comprises the material for the present poster. It is a standard molecular taxonomic tool which employs short DNA sequences (belonging to one gene), often derived from mitochondrial genome. Mitochondrial genome shows maternal lineage, lacks recombinations and indels (therefore, highly conserved) and has higher mutation rates (due to fast nucleotide substitution; confer interspecific diversity and serve as phylogenetic signals). For animals, including insects, 658bp (the Folmer region) long mitochondrial gene called cytochrome-c oxidase subunit 1 (COI) is generally employed. It shows great interspecific diversity at 5 end. COI barcode gene of unknown specimens is extracted with the help of primers by PCR technique is sequenced and is submitted to global barcode database to identify the species. Gene sequences are analyzed by distance method to identify specimens as belonging to specific taxon. METHODOLOGY OF BARCODING Specimens for insect species of agricultural importance are collected from different areas to cover their distributional limits; eggs and immature stages are reared to get adults. Identification of adults and immature stages are carried out following the keys, descriptions and direct comparisons with types available in insect repositories. Identified specimens serve as voucher specimens; from which two right legs are removed for DNA extraction (voucher specimen are tagged with yellow labels and marked legs away for DNA) DNA is extracted and purified by following standard protocols (e.g., Spin-column protocol with DNeasy Blood and Tissue kit by Qiagen). The extracted purified DNA is quantitated by agarose gel (0.8%) electrophoresis through UV transillumination. The COI gene in the extracted purified DNA is amplified by PCR using specific primers. DNA amplification check is done by Agarose gel electrophoresis.
Name of Primer LCO1490 HCO2198 LepF1 LepR1 MLepF1 MLepR1 Enh_LepR1 Cocktail Name Folmer/ Universal Primers Primer Sequence 5- 3 GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA ATTCAACCAATCATAAAGATATTGG TAAACTTCTGGATGTCCAAAAAATCA GCTTTCCCACGAATAAATAATA (use with LepR1 ) CCTGTTCCAGCTCCATTTTC (use with LepF1) CTCCWCCAGCAGGATCAAAA (use with LepF1 ) Reference Folmer et.al., 1994 Hebert et. al., 2004a Hajibabaei et. al., 2006

Lepidoptera Primers

The PCR product is cleaned of unwanted dNTPs, residual primers and any ssDNA produced during PCR amplification, through Exosap-IT treatment (PCR cleanup Step). This is followed by Post sequence PCR cleanup to remove unused fluorescent dyes and precipitation of DNA The cleaned up air dried PCR product is sequenced in ABI 3730 DNA analyzer (Applied Biosystems) The sequenced DNA is edited to remove ambiguous base calls and primer sequences, and analyzed by using Geneious (5.4) software. The edited sequence is saved

The edited sequence is checked for consensus sequences; which are extracted and analyzed by BLAST; obtained results exhibit name of closest species, % age identity, accession no, e-value and score Phylogenetic tree is created for BLAST results through multiple alignment and neighbor Joining (NJ) method. Sequence information is entered in the Barcode of Life Database (BOLD, www.barcodinglife.org) along with an image and collateral information (like date of collection, locality, taxonomy, sex, GPS coordinates, etc.) for each voucher specimen in project files. All sequences are submitted to GenBank (which is published as supporting information on the PNAS web site). For each species, on an average 8 barcodes are submitted covering distributional limits of species, so as to ascertain intraspecific variations to delimit species. RESULTS & CONCLUSIONS Success of rapid identification through DNA barcoding is highly dependent on comprehensive DNA barcode library; therefore, building of comprehensive DNA barcode library should be considered as primary goal; for this traditional taxonomy comprises the backbone. Widely distributed species show high intraspecific divergence; and some turn out to be cryptic species complexes Low interspecific divergence (< 1.26 %), though rare, can be due to interspecies hybridization, as known in many butterflies; in that case other genes have to be considered Intraspecific mitochondrial DNA variations in insects are also known to be caused by Wolbachia infections; in such instances, we can use body part devoid of infection, eggs ; or design primer specific to COI gene of insect to weed out variations. DNA barcoding based on mitochondrial COI gene can help in rapid identification of insects of agriculture importance from any stage of development, circumventing need for rearing immature stages to get adults for identification COI sequence diversity can successfully resolve cryptic and sibbling species complexes and species exhibiting phenotypic plasticity; can establish identity of the species and discover novel and invasive species Helps in monitoring distributional and migration pattern changes of insect species Cases exhibiting shared barcodes due to parallel/convergent evolution are resolved through use of additional genes. ACKNOWLEDGEMENTS My sincere thanks are due to Rajiv Gandhi Center of Biotechnology, Trivandrum (for my 21 days training in barcoding), Dr Virash Gupta (for finer exposure to barcoding) and SGGS College (being my base institute) for respective reasons. REFERENCES
1. 2. Crawley, M.J (1989). Annu Rev Entomol, 34: 531-562. Folmer, O., Black, M., Hoch, W., Lutz, R. and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit 1 from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 3: 294 - 299 Hajibabaei , M, Janzen, D.H., Burns, J.M., Hallwachs, W, Hebert, P.D.N. ( 2006). DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of United States of America. 103: 968-971. Hebert, P.D.N., Cywinska, A., Ball, S.L. and deWaard, J.R (2003). Biological identifications through DNA barcodes. Proceedings of Royal Society of London Series B. 270: 313-321 Ivanova, N. V., Borisenko, A. V. and Hebert, P.D.N. (2009). Express barcodes: racing from specimen to identification. Molecular Ecology Resources, 9 (1): 35-41 Kapoor, V. C. (2008). Theory and Practice of Animal Taxonomy. Oxford and lbh Publishing Company Pvt. Pp 272. Kumar, N.K.K. (2011). NBAII Vision 2030. Director, National Bureau of Agriculturally Important Insects, pp 32; (http://www.nbaii.res.in)

3. 4. 5. 6. 7.

8.

Maitland, C. D. and Hanner, R.H. (2009). DNA barcoding: an efficient means of identifying agricultural pests and biological control agents. http://www.bolnet.ca/symposium07/posters/Christa%20Maitland%20%20Agricultural%20Pests.pdf. Poster. 9. Miller, S. E. (2007). DNA Barcoding and the renaissance of taxonomy. PNAS, 104 (12): 4775-4776 10. Smith, M. A. and Brain, L. F. (2009). Invasions, DNA barcodes and rapid biodiversity assessment using ants of Mauritius. Frontiers in Zoology, 6 (31): 1-12 11. Waugh, J. (2007). DNA barcoding in animals: progress, potentials and pitfalls. BioEssays, 29: 188-197