Sunteți pe pagina 1din 108

In the Name of Allah, the Most

Gracious, the Most Merciful


Miracles of Knowledge Found in The
Noble Qur’an and The Teachings of
Prophet Mohammad Peace Be Upon
Him

Dr. Zaid Kasim Mohammad Ghazzawi


Website: www.quran-miracle.com
How to learn Cell Sciences
from the Noble Qur’an?
The Noble Qur’an
A Book which contains The Knowledge of ِ
Everything
The Knowledge of Creation from The Creator
The Noble Qur’an
In The Name of Allah (God) Almighty The Most Gracious The Most
Merciful
38. Allah (God) Almighty did not leave anything out from the Noble Qur’an,
then people will be gathered to their Lord.

 The knowledge of all


branches of knowledge can
be found in the Noble Qur’an
 The optimal research
methodology can be found
in the Noble Qur’an
 The terminology to describe
all branches of knowledge
can be found in the Noble
Qur’an
In The Name of Allah (God) Almighty The Most Gracious The Most
Merciful

2. A messenger from Allah (God) reciting purified


pages
3. Which contain valuable books
The Noble Qur’an (98: 2-3)

Purified Pages The Noble Qur’an

Containing valuable The books that contain the


books knowledge of everything
Derivation of All Cell Sciences
from the Noble Qur’an
In the Name of Allah (God) Almighty The Most Gracious The Most
Merciful

The Noble Qur’an (27: 88)


88. And you see the mountains and think them solid without movement, but they
pass away as the passing away of the clouds. The manufacturing of Allah (God)
Almighty, Who perfected all things, verily! He is Well-Acquainted with what you do.

The Mountains A created being of Allah (God) Almighty

Allah (God) Almighty describes


A manufacturing process
that it is created by a process of
needs a factory
manufacturing
Manufacturing process needs the
following:

Factory
What are the factories in the
?creation of Allah (God) Almighty
The Cell The cell (The
factory in the
creation of Allah
(God) Almighty)
How is it concluded that that the cells are the
factories in the creation of Allah (God) Almighty?

Raw materials needed


The product for creation
The factory (Elements found in the
(Collagen molecule) ((The Cell soil)
Optimal Specifications for A Factory
 That there should be a large number of factories which
produce the same product:
 In the case that if there is damage to a number of factories the
remaining ones can produce the required products
 That the product should not be harmful to the creature
 The optimal specifications for the structure to contain
the factory:
 It should have light weight
 It should have high stiffness and strength
 It should be stable
Cell structure
Cell cytoskeleton
The Cell The cell (The
factory in the
creation of Allah
(God) Almighty)
How to know the design that
satisfies the optimal
?requirements for a structure
The answer can be found in the Noble Qur’an
In the Name of Allah (God) Almighty The Most Gracious The Most
Merciful

68. And your Lord inspired the bee, saying: "Take you habitations
in the mountains and in the trees and in what they erect.
The Noble Qur’an (16: 68)

Why does Allah (God) Almighty mention certain creatures in


?(.The Noble Qur’an (like for example, camels, bees, etc

To encourage people to think and ponder about these creatures and


to learn from their design and function
Bees
A Living System
Bee hives handle the
following:
2. The weight of the
bees
3. Vibrations produced
http://ag.arizona.edu/pubs/insects/ahb/inf3.html
by the bees
Stiff material (wax) Hexagonal arrangement of
bee hives

Soft material
(Honey)

http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm
The Miracles of Knowledge Found in
the Hexagonal Design of Structures
 The hexagonal structure is the optimal design for
the distribution of matter
 Covering maximum volume with minimum amount of
material
 The hexagonal structure is the optimal design to
construct structures with, which ensures the
following:
 Complete stability
 Prevention of structural failure
Cell cytoskeleton
HIV virus
Structure of Ice water

http://www.sbu.ac.uk/water/ice1h.html
HIV virus
Manufacturing process needs the
following:
Factory

Raw materials needed for products


(Earth (The Soil
‫بسم ال الرحمن الرحيم‬

‫سورة الحج‬
Analysis of Elements Found in The Soil

 Hydrogen (H)  Iodine (I)


 Nitrogen (N)  Ferrous (Fe)
 Oxygen (O)  Copper (Cu)
 Carbon (C)  Silicon (Si)
 Calcium (Ca)
 Phosphorus (P)
 Potassium (K)
 Sulfur (S)
 Sodium (Na)
 Chlorine (Cl)
 Magnesium (Mg)
Elements Comprising The Basic Building Blocks of the
Human Body
(i.e. Amino Acids)

 Elements in The Soil  Elements Comprising


Amino Acids
 Hydrogen (H)  Hydrogen (H)
 Nitrogen (N)  Nitrogen (N)
 Oxygen (O)  Oxygen (O)
 Carbon (C)  Carbon (C)

http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
The Use of the Elements Found in The Soil In the
Physiological Functions of The Human Body

 Sodium (Na) and Potassium (K) are used in the transmission


of neural signals
 Calcium (Ca) is used in cell signaling and muscle function
 Ferrous (Fe) is used in mass bio-transport in the human body
 Phosphorus (P) is used in the construction of bone material
 Iodine (I) is needed for healthy functioning of glands
 Chlorine (Cl) is used to maintain fluids balance
 Copper (Cu) is used in the transmission of electrical signals
 Silicon (Si) is a constructional material in the human body
 Sulfur (S) is used in muscular proteins
 Magnesium (Mg) is used in the construction of bone material
Perfect Constructional Material (Amino Acids)
correlation
between the
 Hydrogen (H)
elements found  Nitrogen (N)
in the soil and
those found in  Oxygen (O)
the human body
 Carbon (C)
Functional Material
 Calcium (Ca)
 Phosphorus (P)
 Potassium (K)
 Sulfur (S)
 Sodium (Na)
 Chlorine (Cl)
 Magnesium (Mg)
 Iodine (I)
 Ferrous (Fe)
 Copper (Cu)
 Silicon (Si)
Amino acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
Alanine

Proline

Valine
Manufacturing process needs the
following:
Factory

Raw materials
Supply Lines needed for
products

To take factory To supply the


products factory with raw
materials
Blood Circulatory
System
Delivering amino acids to the
(cells (factories
Projections that
absorb water and
nutrients in humans
Inside the Cells
((Factory
?What is needed there
Manufacturing process needs the
following:
Factory

Raw materials
needed for
products

Supply Lines

Information that contains the engineering


design for the products to be manufactured
What is the word in
?the cell
Storing of information using a
geometrical code
The word of Allah (God)
Almighty for creation is found in
the DNA molecule

Storing information using a


geometric code
In the Name of Allah (God) Almighty The Most Gracious The Most
Merciful

The Noble Qur’an (82: 8)

8. In whatever form Allah (God) Almighty willed He assembled you together

Thus there is a need for the


Allah (God) Almighty describes
information which
that the human body is made in
describes the sequence and
a process of assembly
number of the basic units to
be assembled

This information is the word of Allah (God) Almighty for


creation (Be and it is)
DNA molecule Tortora and Grabowski, 1996
Amino acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
Every three geometrical units codes for one amino acid

DNA
Molecule

Amino Acids
The word for the creation of collagen protein
(Storing of Information using a geometrical code)

Assembly of amino acids in a


specific type, number, and sequence
to create proteins
The Manufacturing of Proteins within the Human Body
Collagen type V sequence
The Word of Allah (God) Almighty to
create The Collagen Protein
Start
codon

 AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG
GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT
CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA
CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT
GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG
AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC
CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC
GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC
The production of
collagen proteins within
the human body

‫مركب‬
‫الكولجين‬

Tortora and Grabowski, 1996


Sequence for Elastin Molecule
The Word of Allah (God) Almighty to create The Elastin Protein
 1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg
121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca
ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc
tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg
gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca
ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac
aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781
gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg
901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt
gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc
tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag
gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga
ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc
cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561
gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt
ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg
gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc
ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga
tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc
tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221
gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct
ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag
acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc
aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt
aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc
catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881
ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc
3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg
ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca
cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct
ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc
cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga
ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta
taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg
In the Name of Allah (God) Almighty The Most Gracious The Most
Merciful

The Noble Qur’an (18: 109)


109. Say (O Muhammad peace be upon Him to mankind). "If the sea were
ink for (writing) the Words of my Lord, surely, the sea would be exhausted
before the Words of my Lord would be finished, even if we brought (another
sea) like it for its aid."
The human body is created in a process of assembly
The Manufacturing (Creation)
of The Human Body
The Manufacturing (Creation) of The Human Body

Basic units needed for the manufacturing process

Allah (God) Almighty links them together and products


are created (products needed for the assembly of the
human body)
The Basic Units needed for
The Manufacturing (Creation)
of The Human Body

Amino Acids
Amino Acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
DNA molecule Tortora and Grabowski, 1996
The Words of Allah (God) Almighty
for the Creation of The Human Body
Information
needed for the
assembly of
collagen protein

The rope that contains the


information for the assembly of
each component of the human
body

Information
needed for the
assembly of
elastin protein
DNA Molecule

DNA
Molecule

Amino Acids
The word for the creation of collagen protein
(Storing of Information using a geometrical code)

Assembly of amino acids in a


specific type, number, and sequence
to create proteins
Manufacturing process needs the
following:
Factory

Raw materials
needed for
products

Supply Lines
Information that contains the
engineering design for the DNA Molecule
products to be manufactured
The Cell
Manufacturing process needs the following:

Information that contains the Factory


engineering design for the
products to be manufactured Raw materials
needed for
products

Supply Lines

Assembly Line
Assembly Line in the Cell
Manufacturing process needs the following:

Information that contains the Factory


engineering design for the
products to be manufactured Raw materials
needed for
products
Assembly Line
Supply Lines

Workers to transport raw


materials to the assembly line
Workers in the Cell
Manufacturing process needs the following:

Information that contains the Factory


engineering design for the
products to be manufactured Raw materials
needed for
products

Assembly Line Supply Lines

A messenger to transport information to the


assembly line
The Cell
Manufacturing process needs the following:
Information that contains the Factory
engineering design for the
products to be manufactured Raw materials
needed for
products
Assembly Line
Supply Lines
A messenger to transport
information to the assembly line

Energy to activate the


assembly line
The Cell
Carbon Dioxide Oxygen

Heat
Water Glucose (Sugar)
The manufacturing process needs:

Assembly Line

To take factory To supply the


products factory with raw
materials
Transporting Factory Products

Using Blood Circulatory


System
Transporting Carbon
Dioxide to the Lungs
Transporting Excess Water to the Kidneys
Transporting Heat from The
Cells to The Skin

Using Blood Circulatory


System
Wind flow on
human skin
Human
Skin

http://www.chem.boun.edu.tr/FacultyStaff/TerezaVarnali/TVFolder/Deri/skinsec.h
Hexagonal
arrangement of hair
on human skin
Hair

Human
Skin
Hexagonal arrangement of hair on human skin

Hair The pattern wind makes on


human skin with hair
The Importance of The Hexagonal
Arrangement of Hair

 Produces a pattern of wind flow


exactly like the flow of water
waves
 It generates turbulence on the
surface of the skin
 Removal of heat with maximum
efficiency
The manufacturing process follows the following steps:

Information is read by a messenger to assemble the products

Basic raw materials needed for assembly are selected

Assembly line is activated

Workers start to carry raw materials to the assembly line

Raw materials are assembled together to create the product


Collagen type V sequence
The Word of Allah (God) Almighty to
create The Collagen Protein
Start
codon

 AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG
GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT
CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA
CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT
GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG
AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC
CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC
GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC
The Manufacturing of Proteins within the Human Body
The production of
collagen proteins within
the human body

‫مركب‬
‫الكولجين‬

Tortora and Grabowski, 1996


The human body is created in a process of assembly
Sequence for Elastin Molecule
The Word of Allah (God) Almighty to create The Elastin Protein
 1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg
121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca
ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc
tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg
gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca
ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac
aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781
gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg
901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt
gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc
tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag
gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga
ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc
cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561
gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt
ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg
gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc
ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga
tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc
tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221
gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct
ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag
acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc
aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt
aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc
catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881
ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc
3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg
ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca
cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct
ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc
cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga
ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta
taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg
‫كلم ال عز و جل لخلق‬
‫المركبّات في نحلة‬
tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg
ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag
ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc ‫يقرأ كلم ال عز و جل لخلق‬
aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg
1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg ‫المركّب‬
agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct
ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801
ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt
ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc
ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc
tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg
1981 gagctggagc agtacctgga tcgctggctg catccaaagc
tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga
ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101
ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct
gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc
agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg
actgggggcc ggtggactgg gagccggtgg actgggagct
ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg
gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc
tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc
2401

http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm
Every manufacturing
process needs:

A signal to start and


stop production
How does the cell know when to start producing
?proteins
‫)و ترى الرض هامدة فإذا أنزلنا عليها الماء اهتزت و ربت( صدق‬
‫ال العظيم‬
 Need a stimulating signal which can be:
 Mechanical: by deformations of the cytoskeleton of
the cell
 Electrical: AC electric current
 Magnetic: Varying magnetic field
 Fluidic: Oscillating flow
 Hormonal: proteins that work on the surface of the
cell stimulating the production of a certain protein
Mechanical and electrical stimulation of cells
Electrical
Mechanical stimulation
stimulation

Electrons
Mechanical and electrical stimulation of cells
Hormonal
Fluidic stimulation stimulation
Hormone

Ca flux
Every manufacturing process needs:
A signal to start and stop production

How is the signal for starting and


stopping production generated?
How is the signal for starting and stopping
production generated?

Staring signal is generated when


there is a need for the product

When there is a need for new


collagen and hydroxy apatite for
example
Osteocytes
Monitoring bone displacements

Internal Design of Bone


Increase in bone
displacements due to an
increase in muscle tension

Stimulation
signal to start
bone production

An increase in the magnetic field


generated from collagen molecules
Vibratory magnetic field is the
stimulation signal for osteoblasts
cells

Production of new collagen and


hydroxy apatite crystals
How is the signal for starting and stopping
production generated?

Stopping signal is generated when


there is no need for the product

When there is no need for new


collagen and hydroxy apatite for
example
Decrease in bone
displacements due to increase
bone mass

Stopping signal
to stop bone
production

A decrease in the magnetic field


generated from collagen molecule
Reduction in vibratory signal seen by
bone cells

Stopping the production of new bone


material
Every manufacturing
process needs:

Quality Control
Manufacturing collagen
molecule by reading of
Allah (God) Almighty
words

‫مركب‬
‫الكولجين‬

Tortora and Grabowski, 1996


In the Name of Allah (God) Almighty The Most Gracious The Most
Merciful

282. So be afraid of Allah (God); and Allah (God) teaches you. And Allah
(God) is the All-Knower of each and everything.
The Noble Qur’an (2: 282)

And Allah (God) will teach you


Be a God fearing person i.e. Allah (God) Almighty will increase you
from His knowledge and the knowledge of
Allah (God) Almighty is found in the
Noble Qur’an

Allah (God) Almighty did not mention a source


of knowledge besides the Noble Qur’an
In The Name of Allah (God) The Most Compassionate The Most Merciful

The Noble Qur’an (17: 82)

82. Allah(God) sends down the Qur’an that is


healing and mercy to those who believe and it
increases the wrong-doers nothing but loss.
Dr. Zaid Kasim Ghazzawi
For detailed information please visit my
Website at:

www.quran-
miracle.com
E-mail:
zaidquran@yahoo.co
m

S-ar putea să vă placă și