Lecture 3 & 4: DNA, Genes, Chromatin Learning Objectives

Understand the structure of DNA, including the structure of the bases, nucleosides, nucleotides, and the structure of the DNA double helix Understand the significance of the specificity of base pairing and the complementarity of the DNA strands Understand the nature of the forces contributing to the stability of the DNA double helix Understand the process of DNA denaturation and the relationship between melting temperature and the base composition of DNA Understand the principles of the DNA reassociation reaction Understand the relationship between the rate of DNA reassociation and DNA complexity Understand what repetitive sequences are and how they are arranged in the human genome Understand the mechanism by which Alu sequences have affected the LDL receptor gene Understand basic gene structure and the basic characteristics of human nuclear and mitochondrial DNA Understand basic chromosome structure and how DNA is packaged into chromosomes Understand the significance of telomeres to aging and cancer and the use of telomerase in cancer diagnosis

GENETIC DOGMA
Genetic diseases occur because of mutations in DNA. Many of these mutations affect the repair of other mutations that occur during DNA replication or at other times, which in turn affect the flow of genetic information from DNA to RNA (transcription and processing) and from RNA to protein synthesis (translation). Many of these mutations also affect the structures of the resulting proteins, affecting their functions.
2

THE FLOW OF GENETIC INFORMATION

2 DNA 1 DNA RNA

3 PROTEIN

1. REPLICATION (DNA SYNTHESIS) 2. TRANSCRIPTION (RNA SYNTHESIS) 3. TRANSLATION (PROTEIN SYNTHESIS)

3

DNA Structure and Chemistry

a). Evidence that DNA is the genetic information i). DNA transformation know this term ii). Transgenic experiments know this process iii). Mutation alters phenotype be able to define genotype and phenotype b). Structure of DNA i). Structure of the bases, nucleosides, and nucleotides ii). Structure of the DNA double helix iii). Complementarity of the DNA strands c). Chemistry of DNA i). Forces contributing to the stability of the double helix ii). Denaturation of DNA

a) Evidence that DNA is the genetic information

i). DNA transformation know this term ii). Transgenic experiments know this process iii). Mutation alters phenotype be able to define genotype and phenotype

I. DNA transformation

Experiment:
Injecting mice with both: a heat-killed virulent strain + a non-heated, non-virulent strain Streptococcus.

Result and interpretation:

Something (DNA) from the heat-killed virulent strain of Streptococcus was able to alter the (still viable) non-virulent strain, converting some of the cells to virulent bacteria and killing the host.

I. DNA transformation.
DNA is the carrier of genetic information.
Experiment: Purified DNA from Type S (smooth colony) Strep cells is able
to be taken up by Type R (rough colonies) Strep cells - transformation DNA transformation: The process of getting functionally active DNA into cells . Result: Transformation by Type S DNA alters the "genotype" of host cells, since new genes are introduced into these cells thus altering their genetic constitution. The expression of this Type S DNA changes the "phenotype of the transformed cells, making their colonies look "smooth" instead of "rough. Genotype is an organisms genetic constitution. Phenotype is the observed characteristics of an organism as determined by the genetic makeup and the environment.

II. Transgenic experiments know this process DNA is the carrier of genetic information.
Transgenic mouse:Transfer of a specific gene into the nucleus of a fertilized egg. How to determine gene function and produce mouse models of human genetic disease? Produce mutation of specific genes in the mouse. knockout mutation : The mutation of a gene that eliminates the gene's function. knockout mouse : mouse carrying mutation that eliminates the gene's function.

III. Mutation alters phenotype DNA is the carrier of genetic information.

Phenotypic differences between individuals are due to differences between genes. One-third of our genes are polymorphic-differences in the nucleotide sequences Differences occurred by mutation of DNA Genetic differences between individuals can have many clinical implications.( aging , drug metabolism).

b). Structure of DNA

i). Structure of the bases, nucleosides, and nucleotides ii). Structure of the DNA double helix iii). Complementarity of the DNA strands

10

Structures of the bases

Purines Pyrimidines

Adenine (A)

Thymine (T)

5-Methylcytosine (5mC)

Guanine (G)

Cytosine (C)

11

5-Methylcytosine (5mC).
A common base modification in DNA results from the methylation of cytosine, giving rise to 5-methylcytosine (5mC). 5mC is highly mutagenic. It is believed that this methylation functions to regulate gene expression because 5methylcytosine (5mC) residues are often clustered near the promoters of genes in so-called "CpG islands. The problem that arises from these methylations is that subsequent deamination of a 5mC results in the production of thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites (or mCpG sites) are "hot-spots" for mutation, and when mutated are a common cause of cancer.
12

Nucleoside

[structure of deoxyadenosine]

Nucleotide
13

Nomenclature

Base Purines adenine guanine

hypoxanthine

Nucleoside +deoxyribose

Nucleotide +phosphate

adenosine guanosine
inosine

Pyrimidines thymine cytosine

+ribose uracil

thymidine cytidine uridine

14

ii). Structure DNA Structure of theof the DNA double helix polynucleotide chain

3 polynucleotide chain 3,5-phosphodiester bond

15

ii). Structure of the DNA double helix

The DNA double helix requires that the two polynucleotide chains be base-paired to each other.

16

A-T base pair

Hydrogen bonding of the bases

G-C base pair

Chargaffs rule: The content of A equals the content of T, and the content of G equals the content of C in double-stranded DNA from any species

17

Double-stranded DNA
Double-stranded DNA, is composed of two base-paired, complementary polynucleotide chains.
Base-pairing between the complementary strands is required for two important functions of DNA: 1) DNA replication involves an unwinding of the double helix (right) followed by synthesis of a complementary strand from each of the unpaired template strands, and 2) RNA synthesis DNA serves as a template for by utilizing the information in one strand to code for a complementary RNA strand.

18

 DNA in the "B" form has - a major groove and a minor groove, -and has 10 base pairs per one turn of the double helix. Supercoiled" DNA that is overwound or underwound, with fewer than or more than 10 base pairs per turn. Antiparallel with respect to each other. Each polynucleotide chain has a 5' end and a 3' end.

19

 Deoxyribonucleases (or DNases) are enzymes that cleave phosphodiester bonds. Some are used for constructive purposes, such as proofreading during DNA replication, whereas others are used to degrade DNA. There are two basic classes of DNases: exonucleases and endonucleases. Exonucleases remove only the terminal nucleotide, whereas endonucleases cleave anywhere within the DNA double helix.
20

Double-stranded DNA
5 3

Major groove Minor groove

B DNA
3 5 3 5
21

Chemistry of DNA
Forces affecting the stability of the DNA double helix

hydrophobic interactions - stabilize - hydrophobic inside and hydrophilic outside stacking interactions - stabilize - relatively weak but additive van der Waals forces hydrogen bonding - stabilize - relatively weak but additive and facilitates stacking electrostatic interactions - destabilize - contributed primarily by the (negative) phosphates - affect intrastrand and interstrand interactions - repulsion can be neutralized with positive charges (e.g., positively charged Na+ ions or proteins)

22

Stacking interactions Charge repulsion Charge repulsion

23

Model of double-stranded DNA showing three base pairs

24

Denaturation of DNA
Double-stranded DNA Strand separation and formation of single-stranded random coils

Extremes in pH or A-T rich regions high temperature denature first

Cooperative unwinding of the DNA strands

25

Electron micrograph of partially melted DNA

Double-stranded, G-C rich DNA has not yet melted

A-T rich region of DNA has melted into a single-stranded bubble

A-T rich regions melt first, followed by G-C rich regions

26

Hyperchromicity
Absorbance maximum for single-stranded DNA Absorbance Absorbance maximum for double-stranded DNA

220

260

300

The absorbance at 260 nm of a DNA solution increases when the double helix is melted into single strands.
27

DNA melting curve

Percent hyperchromicity 100

50

0 50 70 Temperature oC 90

Tm is the temperature at the midpoint of the transition

28

Tm is dependent on the G-C content of the DNA

Percent hyperchromicity

50

E. coli DNA is 50% G-C

60

70 Temperature oC

80

Average base composition (G-C content) can be determined from the melting temperature of DNA
29

Genomic DNA, Genes, Chromatin

a). Complexity of chromosomal DNA i). DNA reassociation ii). Repetitive DNA and Alu sequences iii). Genome size and complexity of genomic DNA b). Gene structure i). Introns and exons ii). Properties of the human genome iii). Mutations caused by Alu sequences c). Chromosome structure - packaging of genomic DNA i). Nucleosomes ii). Histones iii). Nucleofilament structure iv). Telomeres, aging, and cancer
30

Complexity of chromosomal DNA: DNA reassociation (renaturation)

First step is a slower, rate-limiting Nucleation" Second-order rate constant, k2. The complexity of a DNA is a function of how many base pairs it has. In low complexity = few hundred High complexity = millions of base pairs. Low complexity sequences are able to find each other much faster during a renaturation reaction, than are high complexity sequences, since the low complexity sequences have to make fewer collisions to find a base-pairing partner. Thus, the rate of a renaturation reaction is a function of the complexity of the DNA. Or in other words, the complexity of a DNA can be determined by measuring its second-order reassociation rate constant.

31

Types of human DNA

The human genome consists of three populations of DNA: the fast and intermediate fractions make up about 10% and 15% of the genome, respectively, and the slow fraction makes up about 75% of the genome. Most of the genes in the human genome are in the single-copy fraction. As shown in the next slide, repeated sequences can be of two types: those that are interspersed throughout the genome or those that are tandemly repeated satellite DNAs. Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about 300 base pairs in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to the occasional disruption of genes. The interspersed repetitive sequences also include VNTRs (variable numbers of tandem repeats), which are comprised of short repeated sequences of only a few base-pairs, but of variable lengths. They, too, are interspersed throughout the genome, and are quite useful as landmarks for mapping genes because they are highly polymorphic (they differ in length or number of repeats from individual to individual).
32

Type of DNA Single-copy (unique) Repetitive Interspersed

% of Genome ~75% ~15%

Features Includes most genes 1 Interspersed throughout genome between and within genes; includes Alu sequences 2 and VNTRs or mini (micro) satellites Highly repeated, low complexity sequences usually located in centromeres and telomeres Alu sequences are about 300 bp in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes in introns or nontranslated regions.
2

Satellite (tandem)

~10%

1 Some

genes are repeated a few times to thousands-fold and thus would be in the repetitive DNA fraction

33

Classes of repetitive DNA

Interspersed repeats are sequences that are repeated many times and scattered throughout the genome. In contrast, tandem repeats are sequences that are repeated many times adjacent to each other. They are usually found in the centromeres and telomeres of chromosomes (the sequence above TTAGGG comprises human teleomeric DNA
34

Classes of repetitive DNA

Interspersed (dispersed) repeats (e.g., Alu sequences) GCTGAGG GCTGAGG GCTGAGG

Tandem repeats (e.g., microsatellites)

TTAGGGTTAGGGTTAGGGTTAGGG

35

Human Genome Project

Knowing the complete sequence of the human genome will: allow medical researchers to more easily find disease-causing genes. understand how differences in our DNA sequences from individual to individual may affect our predisposition to diseases and our ability to metabolize drugs. Because the human genome has ~3 billion bp of DNA and there are 23 pairs of chromosomes in diploid human cells, the average metaphase chromosome has ~130 million bp DNA.

36

Genome sizes in nucleotide pairs (base-pairs)

plasmids viruses bacteria fungi

plants algae
insects mollusks bony fish amphibians reptiles

The size of the human genome is ~ 3 X 109 bp; almost all of its complexity is in single-copy DNA.

birds
The human genome is thought to contain ~30,000 to 40,000 genes. 104 105 106 107 mammals 108 109 1010 1011

37

Gene Structure

Next slide shows the structure of a typical human gene and its corresponding messenger RNA (mRNA). Most genes in the human genome are called "split genes" because they are composed of "exons" separated by "introns." The exons are the regions of genes that encode information that ends up in mRNA. The transcribed region of a gene (double-ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all of the exons and introns (initiation of transcription is regulated by the promoter region of a gene, which is upstream of the +1 site). RNA processing (the subject of a another lecture) then removes the intron sequences, "splicing" together the exon sequences to produce the mature mRNA. The translated region of the mRNA (the region that encodes the protein) is indicated in blue. Note that there are untranslated regions at the 5' and 3 ends of mRNAs that are encoded by exon sequence but are not directly translated.

38

Gene structure
promoter region exons (filled and unfilled boxed regions)

+1 introns (between exons) transcribed region mRNA structure

5
translated region

39

The (exon-intron-exon)n structure of various genes introns can be very long, while exons are usually relatively short.
Next figure shows examples of the wide variety of gene structures seen in the human genome. Some (very few) genes do not have introns. One example is the histone genes, which encode the small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. Shown here is a histone gene that is only 400 base pairs (bp) in length and is composed of only one exon. The beta-globin gene has three exons and two introns. The hypoxanthine-guanine phosphoribosyl transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually relatively short. An extreme example of this is the factor VIII gene which has numerous exons (the blue boxes and blue vertical lines).

40

The (exon-intron-exon)n structure of various genes

introns can be very long, while exons are usually relatively short.

histone total = 400 bp; exon = 400 bp

b-globin
total = 1,660 bp; exons = 990 bp HGPRT (HPRT) total = 42,830 bp; exons = 1263 bp

factor VIII total = ~186,000 bp; exons = ~9,000 bp

41

Properties of the human genome

Nuclear genome the haploid human genome has ~3 X 109 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from <100 to >2,300,000 bp Alu sequences are present throughout the genome Mitochondrial genome circular genome of ~17,000 bp contains <40 genes
42

Alu sequences can be mutagenic

familial hypercholesterolemia (FH): autosomal dominant disease,, is caused by mutations in the LDL (low density lipoprotein) receptor gene . Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the LDL receptor on liver cells and is internalized. Normal plasma cholesterol levels average below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have approximately double this amount, and those with two defective genes (homozygous) have approximately four times this amount. Heterozygous individuals are predisposed to cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50. There are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal. As shown in the next figure, one mechanism has involved Alu sequences.
43

Alu sequences can be mutagenic

Familial hypercholesterolemia autosomal dominant LDL receptor deficiency

44 From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

LDL Receptor Gene

Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu sequences are present within three of the introns and two of the exons. Because of the close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing over can occur during meiosis. Crossing over (the topic of a future lecture) requires homologous sequences, which base pair with each other during the process of meiosis. The homologous sequences can be provided by the Alu repeats, which can cause an out-of-register misalignment and subsequent crossing over deleting exon 5 from one of the two products of crossing over. This exon 5 in-frame deletion can be inherited and is currently a cause of FH. This deletion affects the LDL binding region of the receptor. Thus, while Alu sequences have no known function in our genomes, there are a lot of them scattered throughout our genomes, within and around genes, and they can be quite disruptive.

45

LDL receptor gene Alu repeats present within introns

4 unequal crossing over

5 6

Alu repeats in exons

4 Alu 5 Alu 6

X
4 Alu 5 Alu 6

one product has a deleted exon 5

4 Alu 6
(the other product is not shown)
46

Chromatin Structure
The appearance of a "beads on a string" structure is due to regularly spaced nucleosomes (see next slide). "Chromatin" is the biochemical term for DNA-protein complexes that are isolated from eukaryotic chromosomes.

47

Chromatin structure

EM of chromatin shows presence of nucleosomes as beads on a string

48

Nucleosome Structure
Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A, H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative supercoiling as a consequence of being wound around the core histones. Histones are positively charged proteins and thus interact with the negatively charged phosphates along the backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.

49

Nucleosome structure

Nucleosome core (left) 146 bp DNA; 1 3/4 turns of DNA DNA is negatively supercoiled two each: H2A, H2B, H3, H4 (histone octomer) Nucleosome (right) ~200 bp DNA; 2 turns of DNA plus spacer also includes H1 histone
50

51

52

53

54

Histones (H1, H2A, H2B, H3, H4)

Histones are small, positively charged proteins that can be extensively modified posttranslationally, in general to make them less positively charged. Histone deacetylases (HDACs) are associated with transcriptional repression because they make histones better able to bind DNA, thus making DNA less accessible to the transcription machinery. Histone deacetylases are recruited to the chromosome by transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of another lecture). Histone acetylases are recruited to chromosomes by transcription factors (TFs). Histone acetylases reduce the positive charges on histones, causing them to loosen their grip on the DNA to allow transcription factors to bind.

55

Histones (H1, H2A, H2B, H3, H4) small proteins arginine or lysine rich: positively charged interact with negatively charged DNA can be extensively modified - modifications in general make them less positively charged
Phosphorylation Poly(ADP) ribosylation Methylation Acetylation Hypoacetylation by histone deacetylase (facilitated by Rb) tight nucleosomes assoc with transcriptional repression Hyperacetylation by histone acetylase (facilitated by TFs) loose nucleosomes assoc with transcriptional activation
56

Nucleofilament Structure
The orderly packaging of DNA in the cell is essential for the process of DNA replication, as well as for the process of transcription. Packaging of DNA into nucleosomes is only the first step, foreshortening chromosomal DNA needs to be packaged in higher-order structures first into closely packed arrays of nucleosomes called nucleofilaments, which are then coiled into thicker and thicker filaments.
57

58

59

Telomeres and Aging

Metaphase chromosome

Telomeres are protective caps on chromosome ends consisting of short 5-8 bp tandemly repeated GC-rich DNA sequences, that prevent chromosomes from fusing and causing karyotypic rearrangements.

telomere

centromere

telomere

telomere structure

<1 to >12 kb
(TTAGGG)many (TTAGGG)few senescent young

telomerase (an enzyme) is required to maintain telomere length in germline cells Tumor cells also have telomerase and thus are immortal and can grow indefinitely most differentiated somatic cells have decreased levels of telomerase and therefore their chromosomes shorten with each cell division
60

61

The kinetochore is the point where microtubules of the spindle apparatus attach. Replicated chromosomes consist of two molecules of DNA (along with their associated histone proteins) known as chromatids. The area where both chromatids are in contact with each other is known as the centromere the kinetochores are on the outer sides of the centromere. Remember that chromosomes are condensed chromatin (DNA plus histone proteins).

62

63