Documente Academic
Documente Profesional
Documente Cultură
Remember when mobile banking meant visiting your local branch? Today it means being able to make balance inquiries, deposits and account transfers with just a few taps on your smartphone. And thats just the beginning.
However, transferring such sensitive data over the airwaves involves risk, and you should heed the dangers before you dive in. Heres what you need to know about mobile banking and how to protect yourself.
OVERVIEW OF CONTENTS
What is cryptography?
What is DNA?
DNA Computing What is DNA cryptography? Biological Operations involved
Processes Involved
Conversion of English alphabet into nucleotide sequences Encryption methods algorithms
Insertion method
Complementary method
Substitution method
WHAT IS CRYPTOGRAPHY?
Science of transforming information into an unintelligible form while it is being transmitted or stored so that unauthorized users cannot access it.
}COMPLEMENT
PAIR
DNA COMPUTING
Molecular computing or biological computing
used instead of digital logic circuits four amino acid bases - A, T, C, and G, are used as operators, as the binary digits 0 and 1 are used in computers DNA molecules encoded - induced to recombine, resulting in trillions of calculations simultaneously
DNA CRYPTOGRAPHY
Information carrier DNA Implementation tool - Modern
biological technology PROCESS INVOLVED: Encoding a message using encryption with nucleotide sequences Data implemented into the genetic code of the messenger Implanting into the body of the messenger Receiver will know where to look for this particular message and decrypts
OF DNA MOLECULE AND WATSON- CRICK RULES. Few biological operations involved:
1. Hybridisation:
The double stranded DNA is formed by combining single stranded DNA sequences. In this process A always pairs with T and G always pairs with C according to Watson crick complement condition
2. Denaturation:
Reverse process of hybridisation. The double stranded DNA molecule can be heated up to 90 degree Celsius, so that it is resolved into two single stranded DNA.
3. Ligation:
One DNA sequences combines with other Sequence by means of some enzyme to produce new DNA sequences.
1. 2.
3.
4.
sequences:
sequences using cipher-based techniques. The two types of ciphers that can be primarily used for this purpose are 1. Simple cipher 2. Vigenere Cipher
1. Simple cipher:
Easiest method
Each English letter corresponds to a sequence of
four nucleotides.
A B C D
Simple form of
polyalphabetic substitution.
receiver are kept secret. 1. binary coding scheme which transforms alphabets A, C, G and T into binary codes and vice versa. Here, we assume A(0) 00; C(1) 01; G(2)10; T(3)11. 2. complementary pair rule. Assign each base x a complement C(x) such that C(C(x))X Here, we assume ((A T) (C A) (G C) (T G)). Let, Secret message be M (binary sequence) Reference sequence be S
1. INSERTION METHOD
Let, M = 01001100; S = ACGGTTCCAATGC. Steps: code S into a binary sequence by using the binary coding scheme. Thus S becomes 00011010111101010000111001. Divide S into segments of k bits. Suppose k is 3. Then we have the following segments: 000, 110, 101, 111, 010, 100, 001, 110, 01 Insert bits from M, once at a time, into the beginning of segments of S. The result is as follows: 0000, 1110, 0101, 0111, 1010, 1100, 0001, 0110, 01. Concatenate as 00001110010101111010110000010110 use the binary code scheme S=AATGCCCTGGTAACCG
2. COMPLEMENTARY METHOD
complementary substrings :
ATCTGAATGCTTGTCTATTGCATCAAT
complementary substrings. Assume L=ACGGTCTCATCAATGCTTCAGT. Divide M. Here 01-C and 10G. Generate two complementary strings as (AAGCT TTCAG) and (ACCTG TAAGC). The sequence L now becomes L= ACG AAGCT GTCT TTCAG CAT ACCTG CAAT TAAGC GCTTCAGT.
alphabet before each complementary string. The string becomes: L= ACCG AAGCT GTCT TTCAG CAGT ACCTG CAAT TAAGC GCTTCAGT. Randomly generate two +ve integers j and i. Assume j=2 and i=4. Insert substrings S[j,j+i]=S[2,6]= CGGTC and S[2j,2j+i]=S[4,8]=GTCTC one alphabet after the first and second complementary substrings. L becomes: L=ACCGAAGCTGTCTTTCAGCCGGTCAGTACCTGCAAT TAAGCGGTCTCCTTCAGT.
SUBSTITUTION METHOD
Let S=ACGGAATTGCTTCAG, M=0111010, length(M) = p. length(S) > length(M) Steps:
Thus S=GCCATGCCAACTAGG
The receiver would not need to generate the set A.There are only three possible cases: (1) Si is the same with Si (mj is equal to 0). (2) Si is C(Si) (mj is equal to 1). (3) Si is C(C(Si)). If there exists one j such that Sj and Sj are not of the above three cases, it means that the sequence should be ignored.
// Procedure of hiding words of the message into the DNA file using two restriction enzymes S := Read from D (DNA file) Target1 := The target substring of Enzyme1 Target2 := The target substring of Enzyme2 S_before := "" for i := 1 to NumberOfWords position1 := The position of Target1 position2 := The position of Target2 while (position2 > position1) S_before := S_before + S to position1 S := S from position1 to End position1 := The position of Target1 position2 := The position of Target2 end while S := S from position2 to End Msg := S_before and DNAword and Target2 // Test if the message contains one of the targetsubstrings if (!TestMessage(Msg)) then do Error Message Break else Write to NewD (the new DNA File) end do next i End Algorithm.
CONCLUSION
generation security mechanism, storing almost a million gigabytes of data inside DNA. In this paper we have pointed out that the DNA sequences have the special properties which we can utilize for encryption purposes. Three encryption methods are all based upon a reference sequence known only to the sender and the receiver. This reference sequence can be selected from any web-site associated with DNA sequences. Since there are many web-sites and roughly around 56 million publicly available DNA sequences, it is virtually impossible to guess this sequence.
ANY QUESTIONS?