Pharmacogenetics

and its importance in drug development

 Genetic diversity contributes to both disease susceptibility and variability in response to drug therapy.
Human genome: variation between individuals.

 Monogenic: due to allelic variation at a single gene(Sickle cell, CYP2D6, Cystic fibrosis)
Polygenic: due to variations at two or more genes(Alzheimers disease) Polymorphic: frequently occurring monogenic variants occurring at a frequency >1% variations in genome account for individual responses to drugs. Therefore, Optimized medicines for individuals Reduction in adverse drug reactions Expedient development of new drugs

Pharmacogenomics
The science of how genes affect the way people respond to drugs How genes affect
the way our body processes drugs (pharmacokinetics) the interaction of drugs with receptors (pharmacodynamics) the treatment efficacy and adverse side effects

particular emphasis on improving drug safety

Pharmacogenetics
A subset of pharmacogenomics

The study of how inherited variation affects drug response and metabolism
Enables physicians to know which medications will be safe and effective for which patients, based on their genotype

Ideal situation is when Candidate genes associated with response and side effects/toxicity are known

Pharmacogenetic approaches
Makes researchers enable to: Identify genes involved in disease Understand how genes and the proteins they produce are affected by various drug candidates Effectively choose target populations to be used in clinical trials

Why is this a good approach?

Drugs can be dangerous
Many people have severe adverse reactions to drugs Many people respond to drugs at different doses Many drug treatments are horribly unpleasant, painful

Drugs are expensive (to take and to make)

Ineffective drugs are a waste of money to take Drug development needs to account for response variability

Genetics provide a priori information

Genetics dont change (except in cancer) Genetics can point to the cause not just the symptom

History
1959 - Freidrich Vogel coined the term pharmacogenetics after discovering polymorphic enzymes Fast increase in awareness of the interaction of drug and drug response First observation of genetic variation in drug response in 1950s - muscle relaxant metabolised by N-acetyltransferase(NAT)
- variant of enzyme_less efficient - slow and fast acetylers

 Cytochrome P450 oxidases (CYPs)__in drug metabolism Part of innate system for clearing the body of xenobiotics Genetic variations in CYP family isoenzymes (CYP2D6, CYP2C9 etc) affect large populations Highly polymorphic (58 in CYPs) Variants encode for nonfunctional enzymes, poor metabolisers, and ultra rapid metabolisers

CYP2D6 1975 Smith and colleagues ingest a drug they are testing

He had a bad reaction but his colleagues did not

Family studies revealed genetic inheritance

Enzyme discovered and characterized

Enzyme cDNA sequenced and variants found (1990) gene important for many drugs (is monogenic) Over 75 known allelic variations

A brief aside into modern genetics

SNPs
Most common and well studied form of variation Gene mutations are rare, <1% of population Gene polymorphisms exist in >1% population frequency SNPs exists about every 1000 bases, ie. ~3,000,000/genome

SNPs and Pharmacogenetics

use of SNPs to measure drug Responses_ SNP linkage disequilibrium profiles SNP can be identified by Genome sequencing of individuals

. G G T A A C T G . G G C A A C T G ...

Patients with efficacy in clinical trials

Patients without efficacy in clinical trials

Predictive of efficacy

Predictive of no efficacy

14

Thiopurines and TPMT

Thiopurine methyl transferase(TPMT) metabolises thiopurine drugs(e.g., mercaptopurine, azathiopurine etc.) TPMT activity is polymorphic(3 allels) If Variation in TPMT_other pathway__metabolite toxic in high conc.(bone marrow suppression) By determining TPMT activity in patients before they receive thiopurines, enzyme efficacy can be determined ethnic differences in TPMT activity
6-mercaptopurine
SH N

6-methylmercaptopurine
SCH3

TPMT
SAH

N H

N H

SAM

The Technology: Genotyping

Uses a microarray to measure a limited predefined set of SNPs Very fast Excellent coverage of common variation(SNP) Relies on Linkage Disequilibirum Genome scans with genotyping chips that are used in GWAS studies and provide customers with a write-up of individual risk for various traits and diseases and testing for 500,000 known SNPs. Costs range from $995 to $2500

Microarray

ATCGAAATGCATGACCTTTGATATGATCGGC TGCAGTCAGC TTCGAAGTGCATGACTTTTGACATGAGCGGCGGCCCACAGC

Common Variation Rare Variation No Recorded Variation

The Technology: DNA Sequencing

Captures every base pair in the genome (3,000,000,000) (Currently) low throughput (slow) Captures common, rare, and personal variation A disposable DNA sequencing device _under $900 portable and easy to use

Sequencer

ATCGAAATGCATGACCTTTGATATGATCGGC TGCAGTCAGC TTCGAAGTGCATGACTTTTGACATGAGCGGCGGCCCACAGC

Common Variation Rare Variation No Recorded Variation

Utility of pharmacogenetics
Determining appropriate dosing Avoiding unnecessary toxic treatments Ensuring maximal efficacy Reducing adverse side effects Developing or choosing novel treatments Can also explain variable response to illicit drugs

Warfarin: dosage
Most widely used anticoagulant in the world
A blood thinner

Prescribed doses vary widely(1-40mg / day)

Therapuetic index is very low

High risk of bleeding early in treatment

Two genes involved in warfarin metabolism: CYP2C9 and VKORC1(vitamin K oxide reductase)
Warfarin is metabolized by CYP2C9, and exerts its anticoagulant effect by inhibiting the (VKORC1).

 CYP2C9 (3 defective alleles with 2 & 3 causing reduced activity) person has normal *1/*1 one polymorphism *1/*2 both polymorphisms *2/*3

CYP2C9 genotype *1/*1 extensive(normal) metabolizer *1/*2 intermediate metabolizer

Time to stable dose 4 - 5 days 8 -10 days 12-15 days

*1/*3, *2/*2, *3/*3 intermediate or poor metabolizer

 In the VKORC1 SNP G allele is replaced by the A allele people with A allele (or "A haplotype") produce less VKORC1. Thus lower warfarin doses are needed to inhibit VKORC1 in this case (i.e., to produce an anticoagulant effect in carriers of A allele. It means Dose can be predicted based on genetic variations identified by DNA tests.

Homozygous wild-type CYP2C9 and VKORC1

Carrier of CYP2C9 mutant allele

Carrier of VKORC1 mutant allele

Plavix: effectiveness
Anti-clotting drug Prescribed for coronary artery disease and those who have suffered a heart attack or stroke or have a stent A pro-drug Acts when Converted to active form(active metabolite) in the liver by CYP2C19 Poor metabolizers treated with Plavix show more cardiovascular events than those with normal CYP2C19 function.

CYP2C19 mutant carriers had reduced presence of the active ingredient (pharmacokinetics) and reduced thinning (pharmacodynamics)
Alleles of CYP2C19 making up patients genotype Allele 1__fully functional metabolism Allele2,3__no functional metabolism Allele 4,5,6,7,8 and others__reduced(or no) functional metabolism

2 loss of functional alleles= Poor metabolizers (thus alternative treatment)

Hepatitis C
Peg-Interferon -2a
Interferons are proteins made in response to virus

Treatment for Hepatitis C Virus alonwith Ribavirin Highly toxic treatment Highly variable response, in different ethnic populations Very expensive

 One mutation near IL28B gene (encoding interferon lambda 3) increased efficacy of treatment two-fold This mutation is different in and explains half of the ethnic variability in treatment in different ethnicities Treatment response can be predicted

Personalized Medicine
There is an emerging goal among translational scientists to make medical practice more personalized Pharmacogenetics is an important step towards that goal

Pharmacogenetics_ Advantages
The genotype of an individual is essentially invariable and remains unaffected by the treatment itself. Pharmacogenetics is a very useful and important tool in predicting which drugs will be effective in various patients

Molecular biology techniques provide an accurate assessment of the genotype of an individual (means more accurate drug).
Increasing amount of genomic information available. This provides the necessary data for comprehensive studies of individual genes and broad investigation of genome-wide variation.

The ease of accessibility to genotype information through peripheral blood or saliva sampling and advances in molecular techniques has increased the feasibility of DNA collection and genotyping in large-scale clinical trials.

The use of personalized medicine if widely adopted, it will make medical trials more efficient.
The use of personalized medicine will also lower the costs that come about due to adverse drug side effects and prescription of drugs that have been proven ineffective in certain genotypes

With pharmacogenetics, it is possible to develop and license a drug specifically intended for those who are not genetically at risk for adverse side effects.

Thankyou