2.

Genomic DNA, Genes , Chromatin

a). Complexity of chromosomal DNA i). DNA reassociation ii). Repetitive DNA and Alu sequences iii). Genome size and complexity of genomic DNA b). Gene structure i). Introns and exons ii). Properties of the human genome iii). Mutations caused by repetitive sequences c). Chromosome structure - packaging of genomic DNA i). Nucleosomes ii). Histones iii). Nucleofilament structure and chromosome condensation iv). Telomeres and aging

a). Complexity of chromosomal DNA DNA reassociation (renaturation)

Double-stranded DNA

Denatured, single-stranded DNA

k2
Slower, rate-limiting, second-order process of finding complementary sequences to nucleate base-pairing

Faster, zippering reaction to form long molecules of doublestranded DNA

DNA reassociation kinetics (for a single DNA species)

Cot1/2 = 1 / k2 k2 = second-order rate constant Co = DNA concentration t1/2 = time for half reaction log Cot
% DNA reassociated 0

50

100

Cot1/2

Ideal second-order DNA reassociation curve (Cot curve)

Complexity expressed as base-pairs (bp)

100 101 102 103 104 105 106 107 108 109 1010

Cot1/2

10-6 10-5 10-4 10-3 10-2 10-1 100

101

102

103

104

1 = poly(dT)-poly(dA) 2 = purified human satellite DNA 3 = T4 bacteriophage DNA 4 = E. coli genomic DNA 5 = purified human single-copy DNA

Cot

There is a direct relationship between Cot1/2 and complexity

DNA reassociation kinetics for a mixture of DNA species

Cot1/2 = 1 / k2 k2 = second-order rate constant Co = DNA concentration t1/2 = time for half reaction
fast (repeated) intermediate (repeated)
Cot1/2

% DNA reassociated

50

Cot1/2

Kinetic fractions: fast intermediate slow

slow (single-copy)

Cot1/2

100

I I I log Cot

human genomic DNA

10,000

k2 >>>>>>>>>> k2

Type of DNA Single-copy (unique) Repetitive Interspersed

% of Genome ~75%

Features Includes most genes 1

~15%

Interspersed throughout genome between and within genes; includes Alu sequences 2 and VNTRs or mini (micro) satellites Highly repeated, low complexity sequences usually located in centromeres and telomeres

Satellite (tandem) 0

~10% fast ~10%

intermediate ~15%
50 slow (single-copy) ~75% 100
1 Some

Alu sequences are about 300 bp in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes in introns or nontranslated regions.

genes are repeated a few times to thousands-fold and thus would be in the repetitive DNA fraction

Classes of repetitive DNA

Interspersed (dispersed) repeats (e.g., Alu sequences)

GCTGAGG GCTGAGG GCTGAGG

Tandem repeats (e.g., microsatellites) TTAGGGTTAGGGTTAGGGTTAGGG

Genome sizes in nucleotide pairs (base-pairs)

plasmids viruses bacteria fungi

plants algae
insects mollusks bony fish amphibians reptiles

The size of the human genome is ~ 3 X 109 bp; almost all of its complexity is in single-copy DNA.

birds
The human genome is thought to contain ~30,000 to 40,000 genes. 104 105 106 107 mammals 108 109 1010 1011

b). Gene structure

promoter region exons (filled and unfilled boxed regions)

+1 introns (between exons) transcribed region mRNA structure

5
translated region

(exon-intron-exon)n structure of various genes histone total = 400 bp; exon = 400 bp

b-globin
total = 1,660 bp; exons = 990 bp HGPRT (HPRT) total = 42,830 bp; exons = 1263 bp

factor VIII total = ~186,000 bp; exons = ~9,000 bp

Properties of the human genome

Nuclear the haploid human genome has ~3 X 109 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from <100 to >2,300,000 bp Alu sequences are present throughout the genome Mitochondrial circular genome of ~17,000 bp contains <40 genes

Familial hypercholesterolemia autosomal dominant LDL receptor deficiency

LDL receptor gene Alu repeats present within introns

4 unequal crossing over

5 6

Alu repeats in exons

4 Alu 5 Alu 6

X
4 Alu 5 Alu 6

one product has a deleted exon 5

4 Alu 6
(the other product is not shown)

EM of protein-depleted human metaphase chromosome

There are 23 pairs of chromosomes in diploid human cells. The average metaphase chromosome has ~1.3 X 108 bp DNA.

Chromatin structure

EM of chromatin shows presence of nucleosomes as beads on a string

Nucleosome structure

Nucleosome core (left) 146 bp DNA; 1 3/4 turns of DNA DNA is negatively supercoiled two each: H2A, H2B, H3, H4 (histone octomer) Nucleosome (right) ~200 bp DNA; 2 turns of DNA plus spacer also includes H1 histone

Histones (H1, H2A, H2B, H3, H4) small proteins arginine or lysine rich: positively charged interact with negatively charged DNA can be extensively modified - modifications in general make them less positively charged
phosphorylation poly(ADP) ribosylation methylation acetylation hypoacetylation by histone deacetylase (facilitated by Rb) tight nucleosomes assoc with transcriptional repression hyperacetylation by histone acetylase (facilitated by TFs) loose nucleosomes assoc with transcriptional activation

Nucleofilament structure

Condensation and decondensation of a chromosome in the cell cycle

Telomeres and aging

Metaphase chromosome

Telomeres are protective caps on chromosome ends consisting of short 5-8 bp tandemly repeated GC-rich DNA sequences, that prevent chromosomes from fusing and causing karyotypic rearrangements.

telomere

centromere

telomere <1 to >12 kb (TTAGGG)many

telomere structure

young

(TTAGGG)few

senescent

telomerase (an enzyme) is required to maintain telomere length in germline cells

most differentiated somatic cells have decreased levels of telomerase and therefore their chromosomes shorten with each cell division