Section J Analysis and uses

of cloned DNA

Animal cell

Plant cell

Contents
J1 Characterization of clones

Characterization, Restriction mapping, Partial digestion, Labeling

nucleic acid, Southern and Northern blotting

J2 Nucleic acid sequencing

DNA sequencing, RNA sequencing, Sequence databases, Analysis

of sequences, Genome sequencing projects

J3 Polymerase of cloned genes

PCR, the PCR cycle, Template, Primers, Enzymes, PCR optimization,

PCR variations

J4 Organization of cloned genes

Organization, Mapping cDNA on genomic DNA, S1 nuclease

mapping, Primer extension, Gel retardation, DNase footprinting,
Reporter genes

J5 Mutagenesis of cloned genes

Deletion mutagenesis, Site-directed mutagenesis, PCR mutagenesis

J6 Applications of cloned genes

Applications, Recombinant protein, Genetically modified organisms,

DNA fingerprinting, Medical diagnosis, Gene therapy

J1 Characterization of clones

Characterization
Preparation of pure DNA is the first step of any
characterization.
Plasmid DNA: from bacterial colonies
Bacteiophage DNA:
Plaque purified phage infecting a bacterial culture
cell lysis phage particles phenol-chloroform, ethanol
precipitate Bacteiophage DNA

J1 Characterization of clones

Restriction mapping
Example1

Digests

Resultant
Fragments

EcoRI

3 kb, 5 kb

HindIII

2 kb, 6 kb

EcoRI + HindIII 2 kb, 1 kb, 5 kb

The most common application of restriction mapping is presented:

Determining the orientation of a cloned insert. This method requires
that restriction maps of the cloning vector and the insert are already
available.

J1 Characterization of clones

Restriction mapping
HindIII (8)

Example2

PstI (21)
BamHI (35)
AvaI (40)
XmaI (40)
SmaI (42)
EcoRI (53)

ApaLI (2332)
ApaLI (589)

pG E M -1
2865 bp

ApaLI (1835)

J1 Characterization of clones

Partial digestion
3kb

1kb

Complete
digestion

2kb

4kb

10 kb insert

Partial
digestion

10 kb
7 kb
6 kb
4 kb
3 kb
2 kb
1 kb

Can not delineate

the restriction sites.

Delineate the restriction sites by partial digested

end-labeled radioactive DNA.

*
**
*

3kb

1kb

3 kb

2kb

4 kb

4kb

10 kb insert

6 kb

End-labeled radioactive DNA

Partial digestion
Agarose electrophoresis
Autoradiography

10 kb
6 kb
4 kb
3 kb

J1 Characterization of clones

Labeling nucleic acid

Radioactive labeling: display and/or magnify
the signals by radioactivity
Non-radioactive labeling: display and/or
magnify the signals by Biotin and digoxin etc
1.End labeling: put the labels at the ends

2.Uniform labeling: put the labels internally

1.End labeling
1Single stranded DNA/RNA

5-end labeling: dephosphorylation polynucleotide

kinase
3-end labeling: terminal transferase

2Double stranded DNA/RNA

Fill in the recessive 3-ends 3- by
DNA polymerase.
Labeled at both ends
5pAATTC ---------------------G
G ---------------------CTTAAp5

For restriction mapping, cut the DNA

with another enzyme

2. Uniformly labeling of DNA/RNA

1Nick translation
:
DNase I to introduce
random nicks DNA Pol I
to remove dNTPs from 5 to
3 and add new dNTP
including labeled nucleotide
at the 3 ends.

2Hexanucleotide
primed labeling(

random labeling
:
Denature DNA add
random hexanucleotide
primers and DNA pol
synthesis of new strand
incorporating labeled
nucleotide.

3. Specific probes
1Strandspecific DNA
probes:
e.g.M13 DNA
as template the
missing strand
can be resynthesized by
incorporating
radioactive
nucleotides.

2Strand-specific
RNA probes

J1 Characterization of clones

Southern and Northern blotting

1. Southern blotting, for detecting DNA ;
2. Northern blotting, for detecting RNA;
3. Western blotting, for detecting protein.
Blot type

Target

Probe

Applications

Southern

DNA

DNA or RNA mapping genomic clones

estimating gene numbers

Northern

RNA

DNA or RNA RNA sizes, abundance,

and expression

Western

Protein

Antibodies

protein size, abundance

1.Genomic DNA
preparation
2.Restriction
digestion
3.Denature with
alkali
4.Agarose gel
electrophoresis
5.DNA blotting/
transfer and
fixation
6.Probe labeling
7.Hybridization
(temperature)
8.Signal detection
(X-ray film or
antibody)

Southern analysis

Northern blotting

J2 Nucleic acid sequencing

DNA sequencing
Three main methods:
1. Maxam and Gilbert chemical method
2. Sanger`s enzymatic method
3. Sequencing by hybridization (SBH)

1. Maxam and Gilbert chemical method

The end-labeled DNA is subjected to basespecific cleavage reactions prior to gel
separation.
Modification of bases:

Methylation by dimethyl sulfate G (DMS)

Formic acid: Purines A & G

Hydrazine : hydrolyze T & C

Hydrazine + high salt: only C

A A A G A T T A A G C C

*
Dimethyl sulfate

Formic acid

Hydrazine

A+G

C+T

Hydrazine+high salt

2. Sanger`s enzymatic method

Uses
dideoxynucleotides
as chain terminators
to produce a ladder
of molecules
generated by
polymerase
extension of primer

Sangers method

A C G T

Template
+primer (15-17nt)
+dNTPs
+ddNTPs
+[35S]dATP
+T7 DNA pol
PAGE
Autoradiography
3GTGACTACTCAGGCACTTGCTTTGCC5

Automatic sequencer

3. Sequencing by hybridization
(SBH)

J2 Nucleic acid sequencing

RNA sequencing
By base-specific cleavage of 5-endlabeled RNA using RNases that cleave
3 to a particular nucleotide. Partial
digestion is required to generate a
ladder of cleavage products which are
analyzed by PAGE.

RNase T1: cleaves after G

RNase U2: after A
RNase Phy M: after A and U

Bacillus cereus RNase: after U and C

J2 Nucleic acid sequencing

Sequence databases
DDBJ()
http://www.ddbj.nig.ac.jp
EMBL-EBI () :
http://www.ebi.ac.uk/Databases/index.html
Genbank at NCBI
:
http://www.ncbi.nlm.nih.gov

J2 Nucleic acid sequencing

Analysis of sequences

Using computers and software packages,

such as GCG sequence analysis package.
1. Identify important sequence features such
as restriction sites, open reading frames,
start and stop codons, as well as potential
promoter sites, intron-exon junctions, etc.

ORF #2
ORF #1
100

200

300

400

500

600

700

Sequence analysis of a cloned

DNA sequence revealed some
important features

2. Homology search by BLAST (NCBI)

or FASTA (EBI):
Compare new sequence with all

other known sequences in the

databases, which can determine
whether related sequences have been
obtained before.

J2 Nucleic acid sequencing

Genome sequencing projects

With the development of automated DNA
sequencers and robotic workstations to
prepare samples for sequencing, the entire
genome sequence of several organisms have
been determined.
Many phages and viruses
Several Bacteria (E. coli, 4 x 106)
Plant (Arabidopsis 6.4 x 107 , rice)
Human 3.3 x 109

J3 Polymerase of cloned genes

PCR

The polymerase chain reaction (PCR)

To amplify a sequence of DNA using
a pair of primers each complementary
to one end of the DNA target sequence.

J3 Polymerase of cloned genes

the PCR cycle

Denaturation : The target DNA (template) is
separated into two stands by heating to 95
Primer annealing : The temperature is
reduced to around 55 to allow the primers
to anneal.
Polymerization (elongation, extension): The
temperature is increased to 72 for optimal
polymerization step which uses up dNTPs and
required Mg++.

J3 Polymerase of cloned genes

Template

Single-or double-stranded form;

The size of the template DNA is not critical;
In the case of mammalian or plant genomic DNA,
up to 1.0 ug of DNA is utilized per reaction. The
typical amounts of yeast, bacterial, and plasmid
DNAs used per reaction are 10 ng, 1ng, and 1pg,
respectively;
Template DNA is dissoved in 10 mM Tris-Cl (pH
7.6) containing a low concentration of EDTA
(<0.1 mM).

J3 Polymerase of cloned genes

Primers

PCR primersabout 18 to 30 nt long

and with similar G+C contents.
Tm=2(a+t)+4(g+c): determine
annealing temperature. If the primer is
18-30 nt, annealing temperature can be
Tm-5oC.

If the target DNA is not known,there is only

limited amino acid sequence available.

Degenerate primers
An oligo pool derived from protein sequence.
E.g. His-Phe-Pro-Phe-Met-Lys can generate a
primer
CAU(CAC)-UUU(UUC)-CCU(CCC,CCA,CCG)- UUU(UUC)-AUG-AAA(AAG)

2x2x4x2x2 =64

J3 Polymerase of cloned genes

Enzymes

The most common is Taq polymerase from

Thermus aquaticus. It has no 3 to 5

proofreading exonuclease activity. Accuracy
is low, not good for cloning.
Pfu (Pyrococcus furiosus, Promega &
Stratagene),

J3 Polymerase of cloned genes

PCR optimization
PCR cycle
Enzymes

Template DNA
Mg++

J3 Polymerase of cloned genes

PCR variations
1. Inverse PCR, IPCR
2. Anchored PCR, APCR
3. asym metric PCR
4. Reverse transcription RT-PCR
5. PCR
6. Nest PCR
7. multiplex PCR
8. PCR
9. differential PCR, d-PCR
10. quantitative PCR, qPCR
11. in situ PCR
12. immuno-PCR
13. Thermal Asymmetric Interlaced PCRTAIL-PCR

J4 Organization of cloned genes

Organization
The absent sequences are usually
introns and sequences upstream of the
transcription start site and down
stream of the 3-processing site.
Start and stop sites for transcription
regulatory sequences.

J4 Organization of cloned genes

Mapping cDNA on genomic DNA

The genomic clone is digested on a gel and then

subjected to Southern blot using all or part of the
cDNA as a probe. Show which genomic restriction
fragments contain cDNA sequences
Using a probe from one end of a cDNA can show the
polarity of the gene in the genomic clone.

Some of the restriction sites will be common in both

clones but may be different distances apart.

J4 Organization of cloned genes

S1 nuclease mapping
Determines the precise 5- and 3- ends of
RNA transcripts. Sequence ladder is required
to determine the precise position.

J4 Organization of cloned genes

Primer extension
A primer is extended by a polymerase until the end of
the template is reached and the polymerase dissociated.
The length of the extended product indicates the 5end of
temple.

J4 Organization of cloned genes

Gel retardation
Mixing a protein extract with a labeled
DNA fragment and running the mixture
on a native gel will show the presence
of DNA-protein complex as retarded
bands on the gel.

J4 Organization of cloned genes

DNase footprinting
The footprint of a protein bound
specifically to a DNA sequence can be
visualized by treating the mixture of endlabeled DNA plus protein with small
amounts of DNase I prior to running the
mixture on a gel.
The footprint is a region with few bands in
a ladder of cleavage products.

J4 Organization of cloned genes

Reporter genes
To study the function of a control
element of a gene like HSP70 (promoter
and regulatory elements). Reporter
genes such as -galactosidase or
luciferase to report the promoter
action.

J5 Mutagenesis of cloned genes

Deletion mutagenesis
In the cDNA clones,it is common to
delete progressively from the ends of
the coding region to discover which
parts of the whole protein have
particular properties.

Exunuclease III
Unidirectional

deletion using
exonuclease III.

J5 Mutagenesis of cloned genes

Site-directed mutagenesis
Formerly, single-stranded templates
prepared using M13 were usedPrimer
oligonucleotide with desired mutation,

extension by DNA polymerase, then

ligation.

Now PCR techniques are now preferred

J5 Mutagenesis of cloned genes

PCR mutagenesis
By making forward and reverse mutagenic
primers and using other primers that anneal to
common vector sequence, two PCR reactions
are carried out to amplify 5- and 3- portions of
the DNA to be mutated.
The tow PCR products are mixed and used for
another PCR using the outer primers only-Part
of this product is then subcloned to replace the
region to be mutated in the starting molecule.

J6 Applications of cloned genes

Applications

Recombinant protein production

Genetically modified organisms
DNA fingerprinting
Diagnostic kits
Gene therapy

J6 Applications of cloned genes

Recombinant protein
Recombinant proteins Growth
hormone, insulin for diabetes
interferon in some immune disorders
blood clotting factor VIII in for
hemophilia.

J6 Applications of cloned genes

Genetically modified organisms

Introducing a foreign gene into an
organism which can propagate creates
a genetically modified organism.
Transgenic sheep have been crested ro
produce foreign proteins in their milk.
Cloned genes are introduced into germ
cells.

J6 Applications of cloned genes

DNA fingerprinting

Hybridizing southern blots of genomic DNA with

probes that recognize simple nucleotide repeats
gives a pattern that is unique to an individual and
can be used an a fingerprint.
This has applications in forensic science, animal and
plant breeding and evolutionary studies.
Simple nucleotide repeats vary in number between
individuals but are inherited.

J6 Applications of cloned genes

Medical diagnosis
The sequence information derived from
cloning medically important genes has
allowed the design of many diagnostic test

kit which can help predict and confirm a wide

range of disorders.
By using sequence information to screen
patients.

J6 Applications of cloned genes

Gene therapy
Attempts to correct a genetic disorder
by delivering a gene to a patient are
described as gene therapy.
To treat some genetic disorders by
delivering a normal copy of the
defective gene to patients. The gene
can be cloned into a virus that can
replicate but not cause infection.

Multiple choice questions

1. A linear DNA fragment is (100%) labeled at one end and has 3
restriction sites for EcoRI. If it is partially digested by EcoRI
so that all possible fragments are produced how many of
these fragments will be labeled and how many will not be
labeled?
A 4 labeled; 6 unlabeled.
B 4 labeled; 4 unlabeled.
C 3 labeled: 5 unlabeled.
D 3 labeled; 3 unlabeled.
2. Which of the following are valid methods of labeling duplex
DNA?
A 5'-end labeling with polynucleotide kinase.
B 3'-end labeling with polynucleotide kinase.
C 3'-end labeling with terminal transferase.
D 5'-end labeling with terminal transferase.
E nick translation.

3. Which one of the following statements about nucleic acid sequencing

is correct?
A. the Sanger method of DNA sequencing involves base specific
cleavages using piperidine.
B. the Maxam and Gilbert method of DNA sequencing uses a DNA
polymerase and chain terminating dideoxynucleotides.
C. enzymatic sequencing of RNA uses RNases A, T1, Phy M and B.
cereus RNase.
D enzymatic sequencing of DNA uses a primer which is extended by an
RNA polymerase.
E enzymatic sequencing of RNA uses RNases T1, U2, Phy M and B.
cereus RNase.
4 Which one of the following statements about peR is false?
A the PCR cycle involves denaturation of the templateannealing of the
primers and polymerization of nucleotides.
B PCR uses thermostable DNA polymerases.
C ideally PCR primers should be of similar length and G+C content.
D PCR optimization usually includes varying the magnesium
concentration and the polymerization temperature.
E if PCR was 100% efficient, one target molecule would amplify to 2n
after n cycles.

5. Which two of the following statements about gene mapping

techniques are true?
A. S1 nuclease mapping determines the nontranscribed regions of a gene.
B. primer extension determines the 3'-end of a transcript.
C. gel retardation can show whether proteins can bind to and retard the
migration of a DNA fragment through an agarose gel.
D. DNase I footprinting determines where on a DNA fragment a protein binds.
E the function of DNA sequences in the promoter of a gene can be determined
if they are ligated downstream of a reporter gene and then assayed for
expression.
6. Which one of these statements about mutagenesis techniques is false?
A. exonuclease III removes one strand of DNA in a 5' to 3' direction from a
recessed 5'-end.
B. exonuclease III removes one strand of DNA in a 3' to 5' direction from a
recessed 3'-end.
C. mutagenic primers can be used in PCR to introduce base changes.
D. mutagenic primers can be used with a single stranded template and DNA
polymerase to introduce base changes.
E. deletion mutants can be created using restriction enzymes.

7. Which one of these statements about the

applications of gene cloning is false?
A large amounts of recombinant protein can be produced
by gene cloning.
B DNA fingerprinting is used to detect proteins bound to
DNA.
C cloned genes can be used to detect carriers of diseasecausing genes.
D gene therapy attempts to correct a disorder by delivering
a good copy of a gene to a patient.
E genetically modified organisms have been used to
produce clinically important proteins.

THANK YOU !