Documente Academic
Documente Profesional
Documente Cultură
Vince Garcia
Stephen Tamayo
Nathan Tarcelo
Mia Pangilinan
Theresa Camille Tobillo
Aveline Ylanan
HGP: Primary Goals
*from US DoE POV
3 steps:
1. Denaturation
2. Hybridization or Annealing
3. DNA synthesis
PCR and HGP
• A tiny amount of DNA can be
amplified using the PCR to make
sufficient quantities available for
DNA sequencing analysis.
• DNA sequencing requires isolating
and duplicating the DNA segments
for nucleotide analysis.
2 Types of DNA
Sequencing:
1)chromosome
walking
Chromosome walking
• used to move systematically along a
chromosome from a known location
• clones overlapping genomic clones that
represent progressively longer parts of a
particular chromosome
• used to find adjacent genes, or parts of a
gene which are missing in the original clone
process
*It is necessary to
use DNA probes
whose sequences
are single-copy; if
the probe used is a
repeated sequence,
several unrelated
combinants could
be identified.
1) A small segment of DNA from one end of the genomic clone is used
as a probe to isolate the clones containing this sequence, and
adjacent sequences encoding the next portion of the gene.
2) A restriction fragment isolated from the end of the positive clones
is
used to reprobe the genomic library for overlapping clones
3) The end sequence of the second clone is used to isolate a third
clone and so forth
until a series of overlapping clones are isolated. This process is
Shotgun Method
• DNA is randomly divided into fragments either
via sonication or narrow-gauge syringe
• DNA fragment is loaded onto gel; Agarose with
embedded DNA is isolated
• Fragment is cloned and sequenced. (This
process is done repetitively.)
• Computer analyzes ‘reads’ and using
overlapping sequences, puts these together.
Strand Sequence
Original AGCATGCTGCAGTCATGCTTA
GGCTA
First shotgun sequence AGCATGCTGCAGTCATGCT----
---
-------------------TAGGCTA
Reconstruction AGCATGCTGCAGTCATGCTTA
GGCTA
Significance
• Better understanding of life as a whole,
especially the human being
• Advances in medicine and biotechnology
(as seen in detection of diseases via
genetic tests)
• New avenues in the study of evolution