Human Genome Project

Vince Garcia
Stephen Tamayo
Nathan Tarcelo
Mia Pangilinan
Theresa Camille Tobillo
Aveline Ylanan
 HGP: Primary Goals
*from US DoE POV

• identify all the approximately 20,000-25,000 genes

in human DNA
• determine the sequences of the 3 billion chemical
base pairs that make up human DNA
• store this information in databases
• improve tools for data analysis
• transfer related technologies to the private sector
• address the ethical, legal, and social issues (ELSI)
that may arise from the project
 HGP: Basic Details
• Public Sector: A 13-year project
conducted by the US Dept. Of Energy
and the National Institutes of Health
• Start: 1990, headed by James D. Watson
• 2000: release of working draft
• 2003: complete version
• Private Sector: John Craig Venter
(initially at Celera Genomics, now at J.
Craig Venter Institute)
 ELSI
• Fairness in usage – court, military,
schools, adoption agencies
• Confidentiality of genetic information
• Reproductive decision-making
• Clinical issues (regulation for accuracy,
reliability, utility)
• Conceptual and philosophical implications
• Health and environmental issues (safety
of GM foods)
• Intellectual property rights
 The issue of patents
• In general, raw products of nature are not patentable. DNA products usually
become patentable when they have been isolated, purified, or modified to
produce a unique form not found in nature.
• "first to invent" principle: whoever made the invention first (and can prove
it) is awarded property rights for the 20-year period
• Celera initially filed for patents for 6,500 whole/partial genes
• March 2000: Clinton announced genome sequence must be made available
to everyone
• Patents could impede the development of diagnostics and therapeutics by
third parties because of the costs associated with using patented research
data.
• Researchers are rewarded for their discoveries and can use monies gained
from patenting to further their research
 Polymerase Chain
Reaction
• a reaction that can characterize,
analyze and synthesize any
specific piece of DNA or RNA

3 steps:
1. Denaturation
2. Hybridization or Annealing
3. DNA synthesis
 PCR and HGP
• A tiny amount of DNA can be
amplified using the PCR to make
sufficient quantities available for
DNA sequencing analysis.
• DNA sequencing requires isolating
and duplicating the DNA segments
for nucleotide analysis.
2 Types of DNA
Sequencing:

1)chromosome
walking
 Chromosome walking
• used to move systematically along a
chromosome from a known location
• clones overlapping genomic clones that
represent progressively longer parts of a
particular chromosome
• used to find adjacent genes, or parts of a
gene which are missing in the original clone
process
 *It is necessary to
use DNA probes
whose sequences
are single-copy; if
the probe used is a
repeated sequence,
several unrelated
combinants could
be identified.

1) A small segment of DNA from one end of the genomic clone is used
as a probe to isolate the clones containing this sequence, and
adjacent sequences encoding the next portion of the gene.
2) A restriction fragment isolated from the end of the positive clones
is
used to reprobe the genomic library for overlapping clones
3) The end sequence of the second clone is used to isolate a third
clone and so forth
until a series of overlapping clones are isolated. This process is
 Shotgun Method
• DNA is randomly divided into fragments either
via sonication or narrow-gauge syringe
• DNA fragment is loaded onto gel; Agarose with
embedded DNA is isolated
• Fragment is cloned and sequenced. (This
process is done repetitively.)
• Computer analyzes ‘reads’ and using
overlapping sequences, puts these together.
 Strand Sequence

Original AGCATGCTGCAGTCATGCTTA
GGCTA
First shotgun sequence AGCATGCTGCAGTCATGCT----
---
-------------------TAGGCTA

Second shotgun AGCATG--------------------

sequence ------
CTGCAGTCATGCTTAGGCTA

Reconstruction AGCATGCTGCAGTCATGCTTA
GGCTA
 Significance
• Better understanding of life as a whole,
especially the human being
• Advances in medicine and biotechnology
(as seen in detection of diseases via
genetic tests)
• New avenues in the study of evolution