RESOURCES OF INHABITANS WHO LIVE IN LEPROSY ENDEMIC AREA OF EAST JAVA
INTRODUCTION
Leprosy remains a health problem in Indonesia ,
where many enclaves leprosy still persists , especially in the eastern part of the country . Although the WHO program - Multidrug Therapy ( MDT ) regiment has been done elsewhere since the 1980s , only the prevalence can be reduced but not the incidence of new cases of leprosy .
GOAL OF STUDY
to find a correlation between the presence of
these bacteria in the environment with the presence of leprosy patients living in the area, to study its role in disease transmission .
MATERIAL AND METHOD
1.
Collection of water samples
about 300 ml of water sample was collected from
each well and stored at room temperature . Prior to PCR , water 50 ml samples were filtered using Millipore 0.22um membrane filter . Membrane washed with PBST1. 5ml and vortexes 10 minutes . The suspension is then centrifuged at 13,000 rpm , 4 C for 20 minutes and the pellets are formed is used to make a smear for Ziehl Neelsen ( ZN ) staining and DNA extraction.
2. DNA extraction
The Qiagen Miniprep kit ( Research Biolabs Co. )
was used for DNA extraction from the pellet , following the manual , to get a PCR template .
3. examination PCR PCR
is done using a nested primer : LPF - LPR ( LPF
: 5'TATCGATGCAGGCGTGAG TGT3 ' , LPR : 5'CTAACACGATACTGCTGCAC3 ' ) and LP3 - Lp4 ( LP3 : 5'TGAGGTGTCGGCGTGGTC3 ' , Lp4 : 5'CAGAAATGGTGCAAGGGA3 ' ) . PCR procedure modifying of Donoghue and Spigelman (2001 ) for detecting M.leprae of the specimen. Products that are amplified electrophoresis on 3 % Agarose gel and stained with ethidium bromide 0.1 ug / ml . The positive results presented by the band at 99 bp , as shown by the positive control ( M.leprae Thai 53 obtained from cultures of nude mice in Leprosy Research Centre of Japan ) .
RESULT
All sediment from water samples showed positive
for AFB ( AFB ) after staining with ZN method . Some of the bacilli found in the " amoeba - like" protozoa , some of them moving microorganisms . Positive results were found in 22 out of a total of 90 water samples ( 24 % ) , consisting of 11/48 ( 23 % ) of water that is often used by leprosy cases and 11/42 ( 26 % ) of water from wells once used by leprosy patients .
DISCUSSION
Leprosy is still endemic in the three big
countries, namely India , Brazil and Indonesia. It is known that M.leprae as the causative agent of leprosy , can survive in the soil up to 40 days. This bacterium is an obligate intra - cellular microorganisms , which only grow if a live agent within the host cell . special primer is needed , because LP1 - LP2 and LP3 - Lp4 coding M.leprae 18 kDa antigen in the region RLEP3 recurring elements ( X17153 )
The first report about the existence M.leprae in
public water resources in North Maluku , reported by Matsuoka et al . (1999 ) . Using PCR method , he found the 21/44 public resources water contaminated by M.leprae . Agusni et al ( 2004 ) reported the detection of M.leprae in some of the ponds that are used as the water source of people living in the endemic area of leprosy in the north coast of East Java .
Interestingly , positive result swere found deeper
water than the plant roots in water collected from the center of the pond site . These findings came to the suspicion that the bacilli living protozoa that lives in the roots of many plants of water . Leprosy cases are often used for both their everyday activities can make the water contaminated with M.leprae . Therefore, if the bacteria came to water , PCR will be positive . Most cases of leprosy who live in this area has been treated with MDT regimens ; some of them are already Release of Treatment ( RFT )
The results of this study showed that 11 of the 48
water samples ( 23 % ) of the wells used by leprosy patient after swere positive PCR test to detect M.leprae .But Interestingly , M.leprae also positive in 11 of 42 ( 26 % ) water samples collected from wells that were never used by leprosy cases . Statistically , there was no significant difference in the PCR positive results for M.leprae .
CONCLUSION
M.leprae existence in source water daily
population in endemic areas where leprosy is not affected with the presence of leprosy patients living in the same area. More investigation is needed to determine the role M.leprae environment in the transmission of leprosy .