RECOMBINANT DNA

TECHNOLOGY
D Newby
Recombinant DNA
technology
Recombinant DNAare:
DNA sequences that result from the use of laboratory methods
(molecular cloning) to bring together genetic material from
multiple sources, creatingsequences that would not otherwise be
found in biological organisms.

Recombinant DNA is possible because DNA molecules from all

organisms share the same chemical structure; they differ only in
the sequence ofnucleotideswithin that identical overall structure.

Consequently, when DNA from a foreign source is linked to host

sequences that can driveDNA replication and then introduced into
a host organism, the foreign DNA is replicated along with the host
DNA.
Recombinant DNA technology
Recombinant DNA technology makes manipulating genes possible.

It includes techniques for cutting and splicing together

different pieces of DNA.

When fragments of foreign DNA are transferred into

another cell or organism, the protein for which they code
may be produced along with substances coded for by the
native genetic material of the cell or organism.

These cells become "factories" for the production of the

protein coded for by the inserted DNA
 The major tools of recombinant DNA
technology are restriction enzymes
(nucleases)
Restriction enzymes (nucleases)

Enzymes are proteins

biological catalysts help drive biochemical
reactions
Enzyme names end with an ase (eg.,
endonuclease)
Bacteria have evolved a class of enzymes
that destroy foreign DNA (eg. Virus DNA).
protect bacteria from bacteriophages (Viruses).
Bacteriophages cannot multiply if their DNA
is destroyed by the host.
Discovery
1952-53: Luria and Human discovered the phenomenon of
restriction and modification

first discovered in the late 1960s

They work by cutting up the foreign DNA, a process called

restriction.

Most restriction enzymes are very specific

recognizing short, specific nucleotide sequences in DNA

molecules and cutting at specific points within these sequences.

There are hundreds of restriction enzymes and more than 150

different recognition sequences.
 Nucleases are further described by addition
of the prefix "endo" or "exo" to the name:

endonuclease applies to sequence specific

nucleases that break nucleic acid chains
somewhere in the interior, rather than at the
ends, of the molecule.

exonucleases function by removing nucleotides

from the ends of the molecule
 Restriction endonucleases RESTRICT
viruses
Viral genome is destroyed upon entry

Restriction endonuclease = Restriction

enzymes
Endo (inside), nuclease (cuts nucleic acid)

Restriction endonuclease recognizes a

short and specific DNA sequence and cuts
it from inside.

The specific DNA sequence is called

Biological Role of RE
Restriction Modification System -restriction
enzymes are paired with methylases.

Methylases are enzymes that add methyl groups

to specific nucleotides within the recognition
sequence. The methylation prevents recognition
by the restriction enzyme.

Therefore, the restriction enzyme within a cell

doesnt destroy its own DNA. However the
restriction enzyme can destroy foreign DNA
which enters the cell such as bacteriophage.
R-M System
Restriction-modification (R-M) system

Endonuclease activity: cuts foreign DNA at the

recognition site

Methyltransferase activity: protects host DNA from

cleavage by the restriction enzyme.

Methyleate one of the bases in each strand

Restriction enzyme and its cognate modification

system constitute the R-M system
Protection of Self DNA

Bacteria protect their self DNA from

restriction digestion by methylation of its
recognition site.

Methylation is adding a methyl group (CH3)

to DNA.

Restriction enzymes are classified based

on recognition sequence and methylation
pattern.
 Enzyme Activity
Scanning

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Recognition Sequence

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Cleavage
GGACGCTAGCTGATG AATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAA GCGTAGCCTAGGCTTAGGCGAGAAAGTT
Classification
Evolved independently rather than
diverging form a common ancestor

Broadly classified into four Types

Types of restriction Enzymes
Type I
Multi-subunit proteins
Function as a single protein complex
Contain
two R (restriction) subunits,
two M (methylation) subunits and
one S (specificity) subunit
Cleave DNA at random length from recognition site

Type I Recognise specific sequencesbut then track along DNA (~1000-

5000 bases) before cutting one of the strands and releasing a number of
nucleotides (~75) where the cut is made.

A second molecule of the endonuclease is required to cut the 2nd strand

of the DNA
 Type II
Most useful for gene analysis and cloning
More than 3500 REs
Recognize 4-8 bp sequences
Need Mg 2+ as cofactor
Cut in close proximity of the recognition site
Homodimers
ATP hydrolysis is not required

Type II Recognise a specific target sequence in DNA, and then

break the DNA (both strands), within the recognition site

Type II restriction enzymes are separate from their

methylases. These enzymes cleave DNAs at specific sites
within the recognition sequence.
Type III
Large enzymes
Combination restriction-and-modification
Cleave outside of their recognition sequences
Require two recognition sequences in opposite
orientations within the same DNA molecule
No commercial use or availability

Type III Intermediate properties between type I and

type II. Break both DNA strands at a defined distance
from a recognition site. Type III enzymes cleave DNA
from 24 to 26 bp away from the recognition site.
Type IV
Cleave only modified DNA (methylated,
hydroxymethylated and glucosyl-
hydroxymethylated bases).
Recognition sequences have not been well
defined
Cleavage takes place ~30 bp away from one of
the sites.
Sequence similarity suggests many such systems
in other bacteria and archaea.
Enzyme Organism from which derived Target sequence (cut at *) 5' -3'

Bam HI Bacillus amyloliquefaciens G* G A T C C

Bgl II Bacillus globigii A* G A T C T
Eco RI Escherichia coli RY 13 G* A A T T C
Eco RII Escherichia coli R245 * C C A/T G G
Hae III Haemophilus aegyptius GG*CC
Hind III Haemophilus inflenzae Rd A* A G C T T
Hpa I Haemophilus parainflenzae G T T * AAC
Kpn I Klebsiella pneumoniae G G TAC * C
Pst I Providencia stuartii C T G CA* G
Sma I Serratia marcescens CCC*GGG
SstI Streptomyces stanford GAG C T * C
Sal I Streptomyces albus G G * T C GAC
Taq I Thermophilus aquaticus T*CGA
Xma I Xanthamonas malvacearum C*CCGGG

Note: Only one strand of the target DNA is shown

Restriction Endonucleases
The first endonucleases discovered was from
Escherichia coli EcoRI
A restriction endonuclease functions by
"scanning" the length of a DNA molecule.

Once it encounters its particular specific

sequence (recognition site), it will bond to the
DNA molecule and makes one cut in each of the
two sugar-phosphate backbones of the double
helix.
Once the cuts have been made, the DNA
molecule will break into fragments.
 Restriction Endonucleases
The positions of these two cuts, both in relation to
each other, and to the recognition sequence itself,
are determined by the identity of the restriction
endonuclease

The length of the recognition site for different

enzymes can be four, five, six, eight or more
nucleotide pairs long.

Restriction endonucleases that cleave recognition

sites of four and six nucleotide pairs are used for
most of the protocols for molecular cloning since
these restriction sites are common in DNA.
Restriction Endonucleases

Different endonucleases yield different sets of

cuts, but one endonuclease will always cut a
particular base sequence the same way.

Some restriction endonucleases digest DNA leaving

5-phosphate extensions(protruding ends, sticky
ends)

Some leave 3-hydroxyl extensions

Some cut the backbone of both strands within a

recognition site to produce blunt-ended (flush-
ended) DNA molecules.
Sticky End Cutters
Most restriction enzymes make staggered
cuts
Staggered cuts produce single stranded
sticky-ends
DNA from different sources can be spliced
easily because of sticky-end overhangs.
5 P
- OH -
3
HindIII
P 5
-
-
H
3 O

EcoRI
Blunt End Cutters
Some restriction enzymes cut DNA at
opposite base
They leave blunt ended DNA fragments
These are called blunt end cutters

AluI

HaeIII
Use of Restriction Enzymes in
recombinant DNA Technology
How Restriction Enzymes are named

generally have names that reflect their origin

The first letter of the name (capitalized ) comes from
the genus of the bacteria

the second two letters (lower case) come from the

species

Roman numerals following the nuclease names

indicate the order in which the enzymes were isolated
from that strain of bacteria.

For example EcoRI comes from Escherichia coli RY13

 Type II restriction enzyme nomenclature

Why the funny names?

EcoRI Escherichia coli strain R, 1st enzyme

BamHI Bacillus amyloliquefaciens strain H, 1st enzyme
DpnI Diplococcus pneumoniae, 1st enzyme
HindIII Haemophilus influenzae, strain D, 3rd enzyme
BglII Bacillus globigii, 2nd enzyme
PstI Providencia stuartii 164, 1st enzyme
Sau3AI Staphylococcus aureus strain 3A, 1st enzyme
KpnI Klebsiella pneumoniae, 1st enzyme
Restriction Enzyme Use

Discovery of enzymes that cut and paste

DNA make genetic engineering possible.

Restriction enzyme cuts DNA and

generates fragments

Ligase joins different DNA fragments

DNA fragments from different species can

be ligated (joined) to create Recombinant
DNA
RECAP: TYPE II Restriction enzymes are the
most utilized enzymes in molecular biology
Type II Restriction Enzymes
Many Type II restriction endonucleases recognise PALINDROMIC

sequences
Symmetrical sequences which read in the same order of nucleotide bases on

each strand of DNA (always read 5' to 3')

Examples of palindromic sentences

Rats live on no evil star

No trace; not one carton
Was it Eliot's toilet I saw?
Murder for a jar of red rum

For example, EcoRI recognises the sequence

5'-G A A T T C-3'
3'-C T T A A G-5 '
 The high specificity for their recognition site means that DNA
(target sequence and cloning vector) will always be cut
reproducibly into defined fragments (important for molecular
cloning)

Restrction enzymes cleave 2 DNA strands at positions that are

symmetrically staggered about the center of the palindromic
sequence.

Yields restction fragments with complementary single-stranded

ends (1-4 nt in length called sticky ends).

The sticky ends can associate by complementary base pairing

with other fragments generated by the same restriction enzyme.
Enzyme Organism from which derived Target sequence (cut at *) 5' -3'

Bam HI Bacillus amyloliquefaciens G* G A T C C

Bgl II Bacillus globigii A* G A T C T
Eco RI Escherichia coli RY 13 G* A A T T C
Eco RII Escherichia coli R245 * C C A/T G G
Hae III Haemophilus aegyptius GG*CC
Hind III Haemophilus inflenzae Rd A* A G C T T
Hpa I Haemophilus parainflenzae G T T * AAC
Kpn I Klebsiella pneumoniae G G TAC * C
Pst I Providencia stuartii C T G CA* G
Sma I Serratia marcescens CCC*GGG
SstI Streptomyces stanford GAG C T * C
Sal I Streptomyces albus G G * T C GAC
Taq I Thermophilus aquaticus T*CGA
Xma I Xanthamonas malvacearum C*CCGGG

Note: Only one strand of the target DNA is shown

Frequency of cutting
Because of their restriction site
specificity, the restriction endonucleases
cut DNA into fragments whose average
length is determined by the number of
base pairs in the restriction site (and to a
lesser extent by the ratio of bases in the
DNA).

For DNA that has equal amounts of all

four bases, each base has a probability
of 1/4 at any particular position in the
DNA strand.
Frequency of cutting
For a restriction site of 4 base pairs, the
probability of random occurrence of that
sequence is (1/4)(1/4)(1/4)(1/4) = 1/256.

For 6 base pairs, the probability is

1/4,096, and for 8 base pairs it is
1/65,536.
Frequency of cutting
Thus, a restriction endonuclease with a 6
base pair restriction site would generate
fragments whose average length is
4,096 base pairs.

Such fragments are large enough to

contain a complete gene (provided that
there are no cut sites within the gene for
the restriction endonuclease that is
used).
Frequency of cutting
Effect of base composition:
For DNA whose base composition differs
from 50% GC it is necessary to calculate
the probability of a site as the product of
the probabilities of each of its components.

For example, if a DNA is 66.7% GC (2/3 of

its base pairs are GC) and one assumes
random orientation of the base pairs, A and
T will each have probabilities of 1/6 and G
and C will have probabilities of 1/3 each.
Frequency of cutting
Effect of base composition contd. :
Thus the probability of GAATTC would be:
(1/3)(1/6)(1/6)(1/6)(1/6)1/3) = 1/11,664
as opposed to 1/4096 when all four
bases are present in equal amounts.

Thus, the average fragment length

generated by Eco RI would be longer in a
DNA with a higher GC content.
What Does It Mean: To
Clone?
Clone: a collection of molecules or cells, all identical
to an original molecule or cell

To "clone a gene" is to make many copies of it - for

example, by replicating it in a culture of bacteria.
Cloned gene can be a normal copy of a gene (=
wild type).
Cloned gene can be an altered version of a gene (=
mutant).
Recombinant DNA technology makes manipulating
genes possible.
Steps in creating recombinant DNA

1. Choice of host organism and cloning vector

Although a very large number of host organisms and molecular
cloning vectors are in use, the great majority of molecular
cloning experiments use the bacteriumE. coli(Escherichia coli)
and aplasmid cloning vector.

E. coliand plasmid vectors are in common use because they are

technically sophisticated, versatile, widely available, and offer
rapid growth of recombinant organisms with minimal equipment

If the DNA to be cloned is exceptionally large (hundreds of

thousands to millions of base pairs), then abacterial artificial
chromosome (BAC) or yeast artificial chromosomevector (YAC)
is often chosen.
Cloning vectors and hosts
Cloning host must:
be easy to handle and propagate
have a defined genotype
accept a range of vectors

Examples of Hosts
bacteria (E. coli)
yeast (S. cerevisiae)
insects (D. melanogaster)
plants (Arabadopsis thaliana)
mammals (Mus musculus) mouse
 Characteristics of cloning vectors:
Must be small in size
Have a origin of replication
Have a selectable marker
Have unique cloning sites (polylinker)
 Steps in creating recombinant DNA

2. Preparation of DNA to be cloned

For cloning of genomic DNA, the DNA to be cloned is
extracted from the organism of interest. Virtually any
tissue source can be used
.The DNA purified during extraction by removing proteins,

RNA and other smaller molecules

.PCR methods are often used for amplification of specific

DNA

. DNA for cloning experiments may also be obtained from

RNA using reverse transcriptase this PCR is called reverse
transcriptase PCR or RT-PCR (not to be confused with RT-
PCR which is known as real time PCR)
 Steps in creating recombinant DNA

2. Preparation of DNA to be cloned

. Reverse transcriptase is an enzyme mostly found in

viruses which synthesises DNA from RNA eg. HIV in PCR
the resulting DNA ie DNA made from RNA is called
cDNA(complementary DNA)

. The purified DNA is then treated with a restriction enzyme

to generate fragments with ends capable of being linked
to those of the vector. If necessary, short double-stranded
segments of DNA (linkers) containing desired restriction
sites may be added to create end structures that are
compatible with the vector
Steps in creating recombinant DNA

3. Preparation of vector DNA

The cloning vector is treated with a restriction endonuclease to

cleave the DNA at the site where foreign DNA will be inserted.

The restriction enzyme is chosen to generate a configuration at

the cleavage site that is compatible with that at the ends of the
foreign DNA (i DNA that was previously cloned)

Typically, this is done by cleaving the vector DNA and foreign

DNA with the same restriction enzyme, for exampleEcoRI.

4.
Steps in creating recombinant DNA

4. Creation of recombinant DNA with DNA ligase

The creation of recombinant DNA is in many ways the

.

simplest step of the molecular cloning process. DNA

prepared from the vector and foreign source are simply
mixed together at appropriate concentrations and
exposed to an enzyme (DNA ligase) that covalently links
the ends together.

This joining reaction is often termedligation. The

.

resulting DNA mixture containing randomly joined ends

is then ready for introduction into the host organism.
Steps in creating recombinant DNA

4. Creation of recombinant DNA with DNA ligase

. The creation of recombinant DNA is in many ways the simplest step of

the molecular cloning process. DNA prepared from the vector and
foreign source are simply mixed together at appropriate
concentrations and exposed to an enzyme (DNA ligase) that
covalently links the ends together.

. This joining reaction is often termedligation. The resulting DNA

mixture containing randomly joined ends is then ready for introduction
into the host organism.
 Steps in creating recombinant DNA
Introduction of recombinant DNA into host organism
5.

The DNA mixture, previously manipulated in vitro, is moved back into a

.

living cell, referred to as the host organism.

The methods used to get DNA into cells are varied, and the name
.

applied to this step in the molecular cloning process will often depend
upon the experimental method that is chosen
(e.g.transformation,transduction,transfection,electroporation).

When microorganisms are able to take up DNA from their local

.

environment, the process is termedtransformation, and cells that are in

a physiological state such that they can take up DNA are said to
becompetent.
In mammalian cell culture, the analogous process of introducing DNA
.

into cells is commonly termedtransfection.

Both transformation and transfection usually require

preparation of the cells through a special growth regime

and chemical treatment process that will vary with the
specific species and cell types that are used.

Electroporation : uses high voltage electrical pulses to

translocate DNA across the cell membrane (and cell wall, if

present).

Transductioninvolves the packaging of DNA into virus-

derived particles, and using these virus-like particles to

introduce the encapsulated DNA into the cell through a
process resembling viral infection.

Although electroporation and transduction are highly

specialized methods, they may be the most efficient

methods to move DNA into cells.
 Steps in creating recombinant DNA

6. Selection of organisms containing vector

sequences

. Whichever method is used, the introduction of

recombinant DNA into the chosen host organism
is usually a low efficiency process; that is, only a
small fraction of the cells will actually take up
DNA.

. Selection is done using artificial genetic selection,

in which cells that have not taken up DNA are
selectively killed, and only those cells that can
actively replicate DNA containing the selectable
 Steps in creating recombinant DNA

Selection of organisms containing vector sequences

6.

When bacterial cells are used as host organisms,

.

theselectable markeris usually a gene that confers

resistance to anantibioticthat would otherwise kill the
cells.

TypicallyAmpicillin is used
.

Cells harbouring the vector will survive when exposed to

.

the antibiotic, while those that have failed to take up

vector sequences will die.
 Steps in creating recombinant DNA
7. Screening for clones with desired DNA inserts and biological properties

The total population of individual clones obtained in a molecular

.

cloning experiment is often termed aDNA library. Libraries may

be highly complex (as when cloning complete genomic DNA from
an organism) or relatively simple (as when moving a previously-
cloned DNA fragment into a different plasmid), but it is almost
always necessary to examine a number of different clones to be
sure that the desired DNA construct is obtained. This may be
accomplished through a very wide range of experimental
methods, including the use ofnucleic acid
hybridizations,antibody probes, polymerase chain
reaction,restriction fragment analysisand/orDNA sequencing.
Summary- creating recombinant DNA

The DNA (insert, cloned DNA, target

DNA, foreign DNA) from a donor
organism is extracted

. Then DNA is enzymatically cleaved

(cut, digested) and joined (ligated) to
another DNA entity (cloning vector) to
form a new recombined DNA
molecule (cloning vector-insert DNA
construct, DNA construct).
Steps in creating recombinant DNA

The cloning vector-insert DNA construct

is transferred into and maintained within
a host cell, a process called
transformation.

The host cell that takes up the DNA

construct (transformed cells) are
identified (by screening) and selected
(separated, isolated) from those that do
not.
Transformation
Many cells lack the ability to take up DNA from
their surroundings and are hence not
competent

The cell membranes of such cells have to be

made porous to make them competent.

Competence can be achieved by treatment of

cells with low temperature and calcium chloride.

Heat shock treatment during transformation

closes these pores.
Cloning vectors
Cloning vectors
plasmids
bacteriophage and derivatives
artificial chromosomes
transposable elements
Transformation

Transformation is an inefficient process (1

cell in 1000).

Furthermore a few cells will be transformed

by recircularized plasmid DNA

others by nonplasmid DNA

while a few by plasmid-insert DNA construct.

Desirable features of cells used in
Transformation exercises

To ensure that the plasmid-insert DNA

construct is in its original form the E. coli
cells used:

must lack Restriction Enzymes

must also be incapable of homologous

recombination.
Screening of Transformants
After transformation, it is
necessary to identify the cells that
contain the plasmid-cloned DNA
constructs

This procedure is called screening

The screening method used will

depend on the plasmid system
used in the transformation
pBR322
Screening when a pBR322 system is used

In a pBR322 system in which the target

sequence was inserted into the BamH1
site, the identification is accomplished in
two steps:

First the cells from the transformation

mixture are plated onto medium that
contains ampicillin.

Only those cells that contain either the

pBR322 or pBR322-cloned DNA construct
(both of which have an intact ampicillin
resistance gene) can grow under these
conditions.
pBR322
 The nontransformed cells are sensitive to
ampicillin.

The BamH1 gene of pBR322 is within the

tetracycline resistance gene, so insertion
of DNA into this gene disrupts the coding
sequence and tetracycline resistance is
lost.

Cells transformed with the pBR322-

cloned DNA construct are resistant to
ampicillin but sensitive to tetracycline.
 Cells transformed with the recircularized
plasmid are resistant to both ampicillin
and tetracycline

Hence cells that grow on ampicillin

containing medium are transferred to a
tetracycline containing medium.

Each location of inoculating cells on a

tetracycline-agar plate corresponds to the
site of a colony on an original ampicillin-
agar plate.
Screening when a pUC 19 vector
system is used in transformation

Belongs to the pUC series of plasmids.

They are all based on pBR322 from which 40%

of the DNA has been deleted, including the
tetracycline gene.

All their cloning sites are also clustered into

one site called a multiple cloning site (MCS).

pUC vector contain the pBR322 ampicillin

resisitance gene to allow selection for bacteria
that have received a copy of the vector.
pBR322
 The MCS lies within the DNA sequence
coding for the amino terminal portion of
the enzyme -galactosidase.

The bacteria used with the pUC vectors

carry a gene fragment that encodes the
carboxyl portion of -galactosidase.

The two polypeptides by themselves have

no activity.
 When clones containing the plasmid are
plated on medium containing the
galactoside
X- gal, colonies with non-recombinant
pUC plasmid will turn blue.

-galactosidase cleaves the X-gal.

 This cleavage releases galactose plus an
indigo dye that stains the bacterial colony
blue.

IPTG is also added to the growth medium

to induce the expression of the lacZ
gene

Recombinant transformants will produce

white colonies on this medium since the
galactosidase gene is disrupted by the
insert.
Defining a Gene Library

A gene library is a collection of host

cells that contain all of the genomic DNA
of the source organism.

A gene library is also called a clone

bank, or a gene bank.
Creating a gene Library

The source organisms genomic DNA is

digested (cut) into clonable elements
and inserted into host cells.

Conditions of the digestion reaction are

set to give a partial, not a complete,
digestion
Screening a Gene Library
After a library is created, the clone (s) (cell
lines) with the target sequence must be
identified.

Three popular methods of identification are

used:

Colony hybridization with a labeled DNA

probe followed by screening for the probe
label

immunological screening for the protein

product
 Screening by Colony Hybridization
Genomic DNA libraries are often screened
by plating out cells from each cell line on to
a master plate

Samples of each colony are then

transferred to a solid matrix such as a
nitrocellulose.

The colonies from the master plate that

correspond to samples containing
hybridized DNA are then isolated and
cultured.
 The cells on the membrane are lysed
and the target DNA is denatured by
alkali treatment

The single strands of DNA are then

irreversibly bound to the matrix , this
process is often carried out at a high
temperature.

Then, the DNA probe, which is labeled

with either a radiosotope or another
tagging system, is incubated with the
bound DNA sample.

If the sequence of nucleotides in the

DNA probe is complementary to a
 The hybridization can be detected by
autoradiography or other visualization
procedures, depending on the nature of
the probe label.

If the nucleotide sequence of the probe

does not base pair (bind) with a DNA
sequence in the sample, then no
hybridization occurs and the assay gives
a negative result.
 General probes range in length from 100 to
more than 1,000 bp, although both larger
and smaller probes can be used.

Stable binding requires a greater than 80%

match within a segment of 50 bases.
There are at least two possible sources
of probes for screening a genomic
library:

First, cloned DNA from a closely related

organism can be used (a heterologous
probe).
Second, a probe can be produced by
Probe detection
Isotopic detection of hyridization is done
when the probe is labelled with radioactive
isotope.

The nitrocellulose membrane with bound

DNA hybridized to probe is overlaid with X-
Ray film (autoradiography). Darkened
areas on the film indicate positions of the
DNA probe hybrid.

For nonisotopic detection of hybridization,

biotin (or similar nonradioactive label) can
be attached to one of the four
deoxyribonucleotides that is incorporated
Isotopic detection
 When a probe with this kind of tag (label)
hybridizes to the sample DNA, detection is
based on the binding of an intermediary
compound (e.g., streptavidin) that carries an
appropriate enzyme.

Depending on the assay system, the enzyme

can be used for the formation of either a
chromogenic (colored) molecule that can be
visualized directly or a chemiluminescent
response that can be detected by
autoradiography
Nonisotopic detection
Analysing hybridization results

Because most libraries are created from

partial digestions, a number of colonies
(clones) may give a positive response to the
probe.

The next task is to determine which clone, if

any, contains the complete sequence of the
target gene.

Preliminary analyses that use the results of

gel electrophoresis and restriction
endonuclease mapping reveal the length of
each insert and identify those inserts that
are the same and those that share
 If an insert in any one of the clones is
large enough to include the full gene,
then the complete gene can be
recognized after DNA sequencing

(because it will have start and stop

codons and a contiguous set of
nucleotides that code for the target
protein).
 If the search for an intact gene fails,
then another library can be created with
a different restriction endonuclease and
screened with either the original probe
or probes derived from the first library.
Screening by Immunological
Assay
Used if a DNA probe is not available

If a cloned DNA sequence is transcribed and

translated, the presence of the protein, or even part
of it, can be determined by an immunological assay.

First use a primary antibody that is raised against

the protein. Then wash with a secondary antibody.

In many assay systems, the secondary antibody has

an enzyme, such as alkaline phosphatase, attached
to it.
 After washing the matrix, a colorless
substrate is added.

If the secondary antibody has bound to

the primary antibody, the colorless
substrate is hydrolyzed by the attached
enzyme and produces a colored
compound that accumulates at the site
of the reaction.
Cloning DNA Sequences That Encode
Eukaryotic Protein in prokaryotic cells

Prokaryotic organisms do not have the

ability to express eukaryotic genes since
they do not have the machinery to
remove introns.

If Eukaryotic genes are to be expressed in

prokaryotic hosts their introns must first
be removed.

To achieve this cDNA is made and used

for the transformation of prokaryotes
cDNA Synthesis
cDNA synthesis is preceded by
extraction of mRNA from the eukaryotic
cells

The poly (A) tail of the mRNA can be

used to separate the mRNA fraction of a
tissue from the ribosomal and transfer
RNAs.
mRNA extraction

Extracted cellular eukaryotic RNA is

passed through a column packed with
cellulose beads to which is bound short
chains of thymidine residues, each about
15 nucleotides long (oligo-dT15).

The poly (A) tails of the messenger RNA

molecules bind by base pairing to the
oligo-dT chains.
cDNA Synthesis
The process is divided into two steps:
1. First Strand Synthesis
After the mRNA fraction is purified the
following are added:

i. short (unbound) sequences of oligo-dT

molecules
ii. the enzyme reverse transcriptase
iii. the four deoxyribonucleotides (dATP, dTTP,
dGTP, dCTP).

The oligo-dT molecules base pair with the

poly (A) tail regions and provide an available
2. Second Strand Synthesis

The second DNA strand is synthesized by

the addition of the Klenow fragment of E.
coli DNA polymerase I:

The polymerase uses the first DNA strand

as a template and adds
deoxyribonucleotides to the growing
strand, starting from the end of the
hairpin loop.
After the reaction is complete, the sample is
treated
with:

the enzyme Rnase H, which degrades the

mRNA molecules and

S1 nuclease, which opens the hairpin loops

and degrades single-stranded complementary
DNA (cDNA) copies of the more prevalent
mRNAs in the original sample.
Restriction Mapping
is the process of obtaining structural
information about a piece of DNA by the use of
restriction enzymes
involves digesting DNA with a series of
restriction enzymes
then separating the resultant DNA fragments
by agarose gel electrophoresis.
the distance between restriction enzyme sites
can be determined by the patterns of
fragments that are produced by the restriction
enzyme digestion.
In this way, information about the structure of
an unknown piece of DNA can be obtained.
Restriction Mapping
Restriction Mapping
Restriction Endonucleases Cleave DNA
at specific DNA sequences
Restriction Mapping
http://wps.prenhall.com/esm_klug_essen
tials_5/17/4576/1171606.cw/content/ind
ex.html
 Basics of type II Restriction
Enzymes

No ATP requirement.
Recognition sites in double stranded DNA have a
2-fold axis of symmetry a palindrome.
Cleavage can leave staggered or "sticky" ends or
can produce "blunt ends.
DNA cloning requires
restriction endonuclease
and DNA ligase
Consider a plasmid with a unique EcoRI
site:

5'NNNNGAATTCNNNN3'
3NNNNCTTAAGNNNN5'

An EcoRI restriction fragment of foreign

DNA can be inserted into a plasmid
having an EcoRI cloning site by:
a) cutting the plasmid at this site with
EcoRI,
b) annealing the linearized plasmid with
the EcoRI foreign DNA fragment, and,
c) sealing the nicks with DNA ligase.

5'NNNNGAATTCNNNN3'
3'NNNNCTTAAGNNNN5