Sunteți pe pagina 1din 19

Generarea primerilor

 https://www.youtube.com/watch?v=c-
f1H07D_70
 Primer Blast
 Primer 3
Elongare
5’
Telomeraza = complex TTAGGGTTAGGGTTAGGGTTAG
AATCCAA CAAUCCAAUC TERC

nucleoproteic cu funcție de ADN


polimerază ARN - dependentă TERT
3’

Translocare

2 componente 5’
TTAGGGTTAGGGTTAGGGTTAG
•TERT = Telomerase Reverse AATCCAA CAAUCCAAUC TERC

Transcriptase - componentă de natură


proteică cu funcție de revers-transcriptază. TERT
3’
•TR/ TERC - componentă ARN
Elongare
funcțională, cu rol de matriță pentru
sinteza de ADN telomeric TTAGGGTTAGGGTTAGGGTTAGGGTTAG 5’
AATCCAA CAAUCCAAUC TERC

TERT
3’

Genele pentru telomerază Extinderea telomerelor sub acţiunea telomerazei

hTERT - 5p15.33; >40 kb, 16 exoni hTR/hTERC - 3q, 451 pb


mTERT - 13; >23 kb, 18 exoni mTR/mTERC - 3, 397 pb
Testarea primerilor
 mTERC F: 5’ – TCCAGCGGGCCAGGAAAGTCC -3’
 mTERC R: 5’- CTCAGGTAAGACACCGAACAC – 3’
https://eu.idtdna.com/calc/analyzer

1. Analyze
(dimensiune, GC%, Tm)
2. Hairpin – interactia intramoleculara intre nucleotidele aceluiasi primer -
ΔG – energia necesare ruperii hairpin-urilor
Hairpin la 3’ - ΔG of -2 kcal/mol/ Hairpin intern - ΔG of -3 kcal/mol - ok
Valori mai negative – probleme de imperechere cu matrita
3. Self Dimer – interactia intermoleculara a 2 primeri identici –interactie forward-
forward/reverse-reverse- legaturi de hidrogen intre bazele complementare
ΔG – energia necesare ruperii self dimerilor
Self dimer la 3' - ΔG -5 kcal/mol/self dimer intern - ΔG -6 kcal/mol – ok
Valori mai negative – probleme de imperechere cu matrita
4. Heterodimeri – interactia intermoleculara intre 1 primer forward si 1 primer
reverse - in zonele de complementaritate- punti de hidrogen
ΔG – energia necesare ruperii hairpin-urilor
Self dimer la 3' - ΔG of -5 kcal/mol/self dimer intern - ΔG of -6 kcal/mol – ok
Valori mai negative – probleme de imperechere cu matrita
Testarea atasarii primerilor la genomul de interes/gena de
interes
1. NCBI Blast
2.Blast genome - mouse
Se introduc primerii pe rand - blast
1. http://www.ncbi.nlm.nih.gov/gene
2. Gene-mTERC (componenta ARN a telomerazei murine)
FASTA
5. http://www.ncbi.nlm.nih.gov/tools/primer-blast/

SE INSERA SECVENTA DE NUCLEOTIDE A GENEI SI SECVENTELE PRIMERILOR –


GET PRIMERS
Primer 3 –
http://bioinfo.ut.ee/primer3-0.4.0/
Gena hTERC (componenta ARN a
telomerazei umane)
 hTERC R: 5’ - GTTTGCTCTAGAATGAACGGTGGAAG-3’
 hTERC F: 5’-GAAGGGCGTAGGCGCCGTGCTTTTGC- 3’