Sunteți pe pagina 1din 96

Metodologia cercetrii tiinifice

Metode de cercetare fundamental


n epoca genomicii i proteomicii




Genomul: aspecte structurale i funcionale
Secvenierea: date i consecine
Proteom i transcriptom
Aspecte etice i sociale
Genomica i Proteomica
Obiective
Metode de explorare genetic
Determinarea acizilor nucleici
In vitro n extracte tisulare: Northern blot, Southern blot, PCR
In vitro n celule: Hibridizare in situ, in situ PCR
In silica baze de date i programe de comparare de secvene (BLAST)

Determinarea proteinelor
In vitro n extracte tisulare: Western blot sau n celule: imunohistochimie, imunocitochimie
In vivo n produse biologice: (RIA, ELISA, Delphia)

Strategii de evaluare genetic in vivo
Organisme modificate
animale transgenice,
animale knockout
animale knockdown

Metode alternative
HPLC / MS
Alte metode

Selecteaza tehnica adecvat pentru scop
Modele experimentale
Analiza datelor
Genomul: aspecte structurale i funcionale
Secvenierea: date i consecine
Proteom i transcriptom
Aplicaii n endocrinopediatrie: Dg & Trat
Aspecte etice i sociale
Genomica i Proteomica
Structura ADN
From DNA to Chromosome organization
Gene
Exon (codes for mRNA)

Introns (spliced out during transcription)

Promoters (part of the gene which binds to
many transcription factor proteins that
promotes transcription)
Central theme of molecular biology
DNA to mRNA (transcription)
mRNA to protein (translation)
Genomul: aspecte structurale i funcionale
Secvenierea: date i consecine
Proteom i transcriptom
Aplicaii n endocrinopediatrie: Dg & Trat
Aspecte etice i sociale
Genomica i Proteomica
Genomul uman
Genomul uman
Structura: 3,2 * 10
9
BP (23 cr) + 15.000 BP (mitocondrial)
3*10
4
gene: 100..10.000, (2000), < 2%
Funcia: meninerea structurii cromozomiale (telomeri,
matrice histonica); replicare celulara (centromer)
Proteine (zona de gene structurale)
Secvene reglatorii (promoter, inhibitor, izolator)
Reglaj: Abunden a prot., timp, etap de dezvoltare, esut
Diversitate: 99,9% IDENTIC; 0,1% diferene, particulariti,
susceptibilitate la boli
Genomul uman
Variabilitate: polimorfism mononucleotidic (SNP), 1:1000
1,42 Mil. SNP, 60.000 n exoni (Science, 2001)
Inserii, deleii, polimorfism repetitiv.
Markeri: Polimorfism fr semnif. funcional.
Boli monogenice f. rare
- SAG, MEN, MODY, rezistena la androgeni
Diversitate: Boli poligenice DZ, dislipidemii, Cvasc,
cancer, boli infecioase: subsituii aa + F. risc
Genomul uman
Human Genome Project (1990 - 2001)
Secvena: 3,2 Mild. BP 447 vol x 1000 pag x 1000 cuv
Limbajul: Posibil 30.000 gene funcionale
Semne de carte: Sequence Taged Sites (STS)
1 cM = 1 Mb, 1% recombinare
1996: MEN1,11q13, markeri transmii la bolnavi
Localizare: locus susceptibil, izolare ADN, identificarea
genei, verificarea mutaiei la bolnavi
Algoritm: in silico screening pt cadru de citire,
promoteri, secvene omologe cunoscute (1,5%)
Genomul uman
MEN1
www.ncbi.nlm.nih.gov
MEN1 + links
Chandrasekharappa, Science 1997
Genomul: aspecte structurale i funcionale
Secvenierea: date i consecine
Proteom i transcriptom
Aplicaii n endocrinopediatrie: Dg & Trat
Aspecte etice i sociale
Genomica i Proteomica
Identification of genes - problems
Absence of co-linearity between genes and proteins

Genomic DNA sequence generally does not map
directly onto codons for amino acids in proteins

Failure of one gene one polypeptide dogma

Gene
mRNA
Protein
Consider genes with introns

nearly all protein-coding genes have introns
exceptions include histone genes
exon intron
Gene
Primary transcript
transcript processing
transcription
mRNA(s)
alternate splicing
One gene one mRNA does not hold in general
Translational frameshifting

also yields more than one protein per mRNA
mRNA
AAA UAU GGC UUU

AAA UAU UGG CUU
lys tyr gly phe
lys tyr trp leu
protein
100
50
0
70 50 90
Temperature
o
C
P
e
r
c
e
n
t

h
y
p
e
r
c
h
r
o
m
i
c
i
t
y

DNA melting curve
T
m
is the temperature at the midpoint of the transition
average base composition (G-C content) can be
determined from the melting temperature of DNA
T
m
is dependent on the G-C content of the DNA
50
70 60 80
Temperature
o
C
P
e
r
c
e
n
t

h
y
p
e
r
c
h
r
o
m
i
c
i
t
y

E. coli DNA,
which is 50% G-C,
has a T
m
of 69
o
C.
Types and rates of mutation

Type Mechanism Frequency________
Genome chromosome 10
-2
per cell division
mutation missegregation
(e.g., aneuploidy)

Chromosome chromosome 6 X 10
-4
per cell division
mutation rearrangement
(e.g., translocation)

Gene base pair mutation 10
-10
per base pair per
mutation (e.g., point mutation, cell division or
or small deletion or 10
-5
- 10
-6
per locus per
insertion generation

Mutation
Mutation rates* of selected genes
Gene New mutations per 10
6
gametes

Achondroplasia 6 to 40
Aniridia 2.5 to 5
Duchenne muscular dystrophy 43 to 105
Hemophilia A 32 to 57
Hemophilia B 2 to 3
Neurofibromatosis -1 44 to 100
Polycystic kidney disease 60 to 120
Retinoblastoma 5 to 12

*mutation rates (mutations / locus / generation) can vary
from 10
-4
to 10
-7
depending on gene size and whether
there are hot spots for mutation (the frequency at most
loci is 10
-5
to 10
-6
).
Polymorphisms exist in the genome

the number of existing polymorphisms is ~1 per 500 bp
there are ~5.8 million differences per haploid genome
polymorphisms were caused by mutations

New germline mutations

each sperm contains ~100 new mutations
a normal ejaculate has ~100 million sperm
100 X 100 million = 10 billion new mutations
~1 in 10 sperm carries a new deleterious mutation
at a rate of production of ~8 X 10
7
sperm per day,
a male will produce a sperm with a new mutation
in the Duchenne muscular dystrophy gene
approximately every 10 seconds.
Types of base pair mutations
CATTCACCTGTACCA
GTAAGTGGACATGGT
CATGCACCTGTACCA
GTACGTGGACATGGT
CATCCACCTGTACCA
GTAGGTGGACATGGT
transition (T-A to C-G) transversion (T-A to G-C)
CATCACCTGTACCA
GTAGTGGACATGGT
deletion
CATGTCACCTGTACCA
GTACAGTGGACATGGT
insertion
base pair substitutions
transition: pyrimidine to pyrimidine
transversion: pyrimidine to purine
normal sequence
deletions and insertions can involve one
or more base pairs
Mutation is perpetuated by replication
replication of C-G should give daughter strands each with C-G
tautomer formation C during replication will result in mispairing
and insertion of an improper A in one of the daughter strands
A
C
which could result in a C-G to T-A transition mutation in the next
round of replication, or if improperly repaired
C G C G
and
C G
C
G
C
A
and
C G
T A
Mismatched (post-replication) repair
5
3
CH
3
CH
3
CH
3
CH
3
the parental DNA strands are
methylated on certain
adenine bases
mutations on the newly
replicated strand are
identified by scanning
for mismatches prior to
methylation of the newly
replicated DNA
the mutations are repaired
by excision repair mechanisms
after repair, the newly
replicated strand is methylated
Infasurarea ADN
Recombinant DNA DNA from two
different sources joined together.
Cut the DNA and the plasmid
using the same restriction enzyme
(these enzymes recognize the
same base sequences.
Insert the foreign DNA into the
plasmid.
Replace the plasmid into the
bacterium
Allow the bacterium to reproduce
all future generations have the
new DNA
Collect the product it might be
insulin or growth hormone, or
some other molecule.


PCRPolymerase Chain Reaction


Used to amplify make large
amounts of a specific piece of
DNA from a very small sample.

1. Heat a starting quantity
of DNA to separate the
double helix.

2. Add a collection of all four
nucleotides, and DNA
polymerase to copy the
DNA, and some primers,
and cool the sample.

Sequence
Analiza clonalitatii
Western Blot
Secventializare proteica
Secventializare proteica
Mutageneza tintita
Genotype:
An organisms genetic constitution.

Phenotype:
The observed characteristics of an organism,
as determined by the genetic makeup
(and the environment).

DNA from Type S cells (thus conferring the Type S genotype)
transformed Type R cells into cells having the Type S phenotype
Transgenic animals
Plasmid DNA carrying the
growth hormone gene
Injected into nucleus
of a fertilized mouse egg
Egg implanted into uterus
of surrogate mother mouse
Mother mouse gives
birth to transgenic mouse
Transgenic animals
Mouse with growth
hormone transgene
Normal mouse
Transgenic animals
Mutation alters phenotype
Phenotypic differences between individuals
are due to differences between their genes
These differences have arisen by mutation of DNA
over many thousands of years

To make an exact genetic copy of; can be a
gene, a cell, or an entire organism.
Cloning


International Laboratory Directory

~600 Clinical and research laboratories

~1050 Inherited diseases
~700 clinical tests
~350 research only

Genetics in Specialty Care
: Feature Search*
*Clinical laboratories
Deafness (122)
Craniofacial (184)
Connective Tissue
(34)
Cancer (82)
Skeletal Bone (216)
Blood (97)
Behavior Disorder (15)
Dental (32)
Ear (11)
Endocrine (91)
Heart (162)
Genitourinary (99)
Gastrointestinal (90)
Eye (259)
Limb Malformation
(76)
Renal (86)
Immune (36)
Growth (119)
Vascular (40)
Skin (210)
Neurologic (All) (907)
Mitochondrial (16)
Metabolic (225)
Pulmonary (49)
Liver (62)
Premature Aging
(5)
Genomica funcional
Gene: Determinarea tuturor secvenelor ce se exprim
Mecanismele de reglaj genetic, SNP ca factori
predispozani, genetica populaional
Proteine: Polimorfism cu semnificaie funcional:
PROTEOM, TRANSCRIPTOM (esut, funcie).
Produi diferii de degradare (POMC)
Diversitate: Reglarea expresiei, specificitate tisular
Experimental: oareci transgenici, knockout /knockdown
DNA microarray, electroforeza 2D & Mass Spect
Genomul: aspecte structurale i funcionale
Secvenierea: date i consecine
Proteom i transcriptom
Aplicaii n endocrinopediatrie: Dg & Trat
Aspecte etice i sociale
Genomica i Proteomica
Diagnosticul genetic; screening genetic
-Men1, SAG, DI central
Terapie: tehnologia genic (insulina, rhGH,
IGF1, rhPTH)
terapia genic n neoplazii
Medicina personalizat
Aplicaii
Aplicaii
MEN


MEN1: PTR Ad, Enteropancreatic, Pit ad, Adrenal, carcinoid
11q13: 10 exoni, 1830 bp, 610 aa (menina)
MEN1 mutant: n evaluare pt indicaii
MEN2: AD, (ret)
MTC n 90%, Feocromocitom 50%, PTR 30%
Exonii RET 10, 11, 13, 14, 15,16
Tiroidectomie profilactic
Clasa 3- risc maxim: 883, 918, 922 la 6 luni
Clasa 2- risc mare: 611, 618, 620, 634 la 5 ani
Clasa 1- risc mediu: 609,768,,804,891 10 ani
Clasa 0 risc mic:790,791 calcitonina periodic
DNA microarray
DNA microarray method
Thyroid Hormone Regulation of
Hepatic Genes in Vivo Detected by
Complementary DNA Microarray
A Representative Portion of the Microarray Used to Detect Hepatic Genes Regulated byT3
A microarray was hybridized to total RNA from hypothyroid mouse liver (green
fluorochrome) and hyperthyroid mouse liver after 6 h treatment with thyroid hormone (red
fluorochrome). RNA from the hypothyroid mouse liver was used to prepare cDNA labeled
with Cy3-deoxyuridine triphosphate (dUTP), and mRNA hyperthyroid mouse liver was
used to prepare cDNA labeled with Cy5-dUTP. The two cDNA probes were mixed and then
simultaneously hybridized to the microarray. Xu et al, Mol. Endocrinol, 14(7), 947.

Protein microarray method
Determinarea hormonilor i
receptorilor
Teste biologice
Separare, purificare i caracterizare chimic
Metode imunologice (RIA, IRMA, FIA, LIA)
Competitive
Sandwich
Metode chimice alternative: HPLC, MS
Localizarea la nivel tisular
imunohistochimia
imuno electronomicroscopia
tehnici de histomorfometrie cantitativ
Metode de genetic molecular
tehnici de determinare a acizilor nucleici
Teste biologice
Model experimental care verific aciunea
unui extract biologic, fa de control
Cri t eri i pent ru ut i l i zarea t est el or bi ol ogi ce
Sensibilitate mare
Relaie liniar doz - rspuns
Reproductibilitate n cadrul aceluiai test i n teste
repetate
Cel puin patru puncte de determinare, cu doze
randomizate

Purificarea peptidelor
Precipitat - se arunc
RIA AVP / OT Teste biologice
Testul muschiului uterin
Secventa proteica
HPLC
Evaporare
Sep-Pack Precipitat - se arunc
Ultracentrifugare
10.000 g x 12 min
Supernatant - Denaturare proteic
5% Acid percloric
Ultracentrifugare
10.000 g x 12 min
Tesut de interes
Omogenizare (10 mM HAc)
Badiu et al, unpublished, 1998
Metode imunologice de msurare
Principii: reacia Ag-Ac
competitiva sau necompetitiva
specificitatea determinat de Ac.
Metode radioactive: RIA i IRMA
Metode neradioactive
Imunoanaliza enzimatic ELISA (EIA)
Amplificarea cu ABC
Imunoanaliza fluorimetric (FIA i IFMA)
Imunoanaliza de chemiluminiscen (LIA, ICMA)

Concentratii fiziologice ale hormonilor
Structura unui anticorp
Obtinerea de anticorpi policlonali: stiinta, arta, noroc
Ag + adjuvant Iepure (R. imun) ser purificare Ac
> epitopi, > sanse de semnal (specific?)
Ac. monoclonali
Reacia antigen-anticorp
Ag + Ac
*
Ag Ac
*

Reacii in sisteme competitive
Reacii in sisteme necompetitive
Ag voluminos Ac. de captura Ac. de semnal
Specificitatea anticorpilor i reactivitatea
ncruciat
Anticorp / efect biologic
Situsuri Ag diferite (epitopi de 5-10 aa)
Efectul biologic dependent de regiunea de legare cu
receptorul
Receptorul recombinant folosit in loc de anticorp !
Radioimunoanaliza (RIA)
2Ac + Ag + Ag* AcAg + AcAg*

Anticorp Antigen Antigen marcat radioactiv
R. S. Yallow, S. A. Berson Nature (London),184, 1648, 1959
Radioimunoanaliza (RIA)
Avantaje
Sensibilitate mare (10
-9
- 10
-12
g)
Portabilitate (pot fi obinute kituri in house)
Standardul de referin pentru alte sisteme
Dezvantaje
Specificitate medie, (anticorpi policlonali)
Deeuri radioactive (securitate a radiaiilor (
125
I)
Durat limitat in timp a kitului (T
1/2
, radioliza)

Radioimunoanaliza (RIA)
2Ac + Ag + Ag* AcAg + AcAg*
Hormoni liberi / legati
Tiroidieni
Steroizi
Cortizol
Testosteron
estradiol
Separarea formei legate
gel filtrare
Dializa
Determinarea H total + proteina (Ex: T
4
/ TBG)
Ac. pt forme usoare (nelegate) i ligand marcat care satureaza
cap.de legare
Ac. marcat care leaga preferential forma libera
Hook effect / Ac. heterofili
Excesul de Ag. blocheaza Ac.semnal Ac. HAMA interfera
Metode chimice alternative pentru
msurarea hormonilor
Metode electrochimice
Imunoanaliza enzimatic / detecie electrochimic.
Voltametrie ciclic (electroliza compusului cu variaii
ale potenialului de electrod).
Metode cromatografice
HPLC, cromatografie de afinitate, cromatografia de
excluziune sterica.
Metode spectroscopice
Spectrometrie de masa cuplata la un HPLC
Spectrometria UV-Vis
(Metode mixte care combina diferite sisteme, uitilizate
mai ales experimental).
Standarde HPLC
AVT
9,3
AVP
10,2
OT
11,5
Badiu et al, unpublished, 1998
Cromatografia standardelor
AVT AVP
OT
Badiu et al, unpublished, 1998
Mass Spect OT
OT H
+
OT Na
+
Badiu et al, unpublished, 1998
Mass Spect AVT
AVT

Badiu et al, unpublished, 1998
Localizarea la nivel tisular a
hormonilor si receptorilor
(metode histologice)
Imunocitochimia
Microscopia electronica si
imunoelectronomicroscopia
Hibridizarea in situ si in situ PCR
Metode de cuantificare: analiza de imagini
Imunocitochimia (ICC)
Introdusa in 1941 ( Coons et al) identificare de
immunoglobuline prin marcare fluorescenta
a infirmat conceptul o celula = un hormon
a permis identificarea tipurilor celulare secretorii si
corelatii intre imunoreactivitate, aspectul clinic si
comportamentul biologic al tumorii
a invalidat clasificarea tinctoriala a tumorilor - o
noua clasificare

Principiul metodei ICC

determinarea unui antigen tisular ( hormon, receptor, factor de
transcriptie, etc.) pe baza unei reactii Ag-Ac
Ac este marcat:
- cu o enzima in prezenta careia cromogenul (ex: DAB) se
coloreaza specific (brun)
- cu fluorocrom - microscop cu fluorescenta

Antigen tisular
Anticorp primar
Metoda avidina-biotina
sensibilitate si stabilitate crescuta
Ac secundar
marcat cu
biotina
B A
Complex avidina-
biotina-peroxidaza
B
B
B
Metode de colocalizare a antigenelor la nivel
de microscopie optica
acelasi sistem de marcare dar cu sisteme
enzimatice diferite (ex: PAP + APAAP)

mai muli cromogeni cu acelai sistem enzimatic
(ex DAB + cloronaftol)

combinatii de sisteme de marcare (ex: ABC cu
imunofluorescenta; ABC cu PAP)
Vasotocin immunohistochemistry
AVT fibers








AVT cell
Badiu et al, Cell Tissue Res, 1999
Oxytocin immunohistochemistry
OT fibers
OT cell
Badiu et al, J.Pin. Res., 2001
lipsa corelatiei intre prezenta peptidului si rata de
sinteza si eliberare

nu permite distingerea celulelor normale interpuse
printre cele patologice

nu ofera detalii de structura celulara

nu diferentiaza tumorile benigne de cele maligne
Limitele metodei ICC
Hibridizarea in situ (ISH)
Tehnica dezvoltata in 1969 Pardue & Gall si
John et al

Detectarea si localizarea secventelor de acizi nucleici
in celule si a genelor specifice in cromozomi
Principiul metodei
Proba de acid nucleic complementara secventei tinta este
marcata si cuplata pe o sectiune de tesut unde recunoaste
ARNm /ADN complementar si formeaza un duplex proba-
ARNm/ADN

procesare prin autoradiografiere sau histochimic
S
35
ARN tesut ARN tesut
Secventa proba
complementara
marcata cu S
35

Principiul metodei
Tipuri de ISH (in functie de sistemul de detectie):


Radioactiva

Non-radioactiva detectie cu cromogeni
- detectie cu aur
- detectie prin fluorescenta
Etape:
Tratamente pre-hibridizare - permeabilizare membrane , inactivare
enzime endogene

marcare nucleotide - cu radioizotopi (S
35
, P
32
P
33
, I
125
)
- cu biotina
- cu digoxigenina (DIG)
Denaturare ADN tinta (termica sau prin enzime de restrictie)
Hibridizare
Detectie
Etapele metodei ISH
Gena Arginin-Vasopresinei
Exon A Exon B Exon C
Intron I Intron II
mRNA
PS AVP Neurofizina Glicopeptid
1 611
420 546 105
Poly A
Bos Taurus, cf. Rehbein et al, 1986
ATG
49 132 142
Sonda AVP
mRNA
PS AVP Neurofizina Glicopeptid
1 611
420
546 105
Poly A
49 132 142
502
45 NUCLEOTIDE
Sonda AVP:CGCCCCCGCGGCCTAGGGCGCCTCGGGCGGGTCGGGCCGCAGATG
Secventa :gcgggggcgccggatcccgcggagcccgcccagcccggcgtctac

84% CG, MW 13865, OD of 1 = 2238 pM, Tm 85C

Limitele ISH

sensibilitate scazuta in detectarea unor cantitati mici de
acizi nucleici

sensibilitate scazuta a sistemelor de detectie
nonizotopica

metodele radioactive mai sensibile necesita timp lung
de prelucrare si obtinere a rezultatelor

localizarea ARNm in celula nu este o dovada a sintezei
proteice locale
Aplicatii ISH

Identificarea expresiei genice corelatii
comportament biologic tumoral

Analizarea distributiei tisulare a transcriptiei

Urmarirea modificarilor in ARNm specific

Determinarea mapei cromozomiale ( boli genetice,
anomalii cromozomiale)
Aplicatii in situ PCR


Terapia genica investigarea diferentierii, proliferarii si
localizarii celulelor transfectate; localizarea genelor
transfectate in cromozomi

Detectarea unor mutatii genice sau translocari
cromozomiale sub influenta unor factori de mediu

Interpretarea expresiei genice si evaluarea expresiei celulare
a unui anumit tip de ARNm
Cuantificarea rezultatelor morfologice

numararea si masurarea structurilor imunoreactive fara
considerarea intensitatii imunoreactivitatii


estimarea sau discriminarea diferentelor in intensitatea
imunoreactivitatii ( care reflecta densitatea de epitopi
reactivi) - Microdensitometrie
Validarea metodelor
Comparare interassay i intraassay (CV)
Precizie
Linearitate
Limite de detectie
Interferente analitice
Interval de referinta
Stabilitatea kitului
Tip de proba biologica (plasma, ser, saliva,
LCR, urina)
Stabilitate proba biologica (T
1/2
)
Etica genomicii funcionale
Ai dori sa tii ansa de boal (DZ, cancer) pentru copilul Dvs?
Teste de susceptibilitate la intrarea n colectiviti (Rscopie,HIV)
dar i genetice sau profil imunologic?