Sunteți pe pagina 1din 206

UNIVERSITATEADETIINEAGRICOLE

IMEDICINVETERINAR
IONIONESCUDELABRADIAI

LUCRRITIINIFICE
VOL.53(12)

MEDICINVETERINAR
PARTEA1

EDITURAIONIONESCUDELABRAD
IAI2010

COLEGIULDEREDACIE

Redactorresponsabil:
Prof.univ.dr.GheorgheSOLCAN

Redactoradjunct:
Prof.univ.dr.OctavianZaharieOPREAN

Membri:
Prof.univ.dr.CorneliuCOTEA
Prof.univ.dr.VasileVULPE
Prof.univ.dr.MihaiCARPCRARE
Prof.univ.dr.DanDRUGOCIU

COMISIADEREFERENITIINIFICI
Prof.univ.dr.OctavianZaharieOPREAN
Prof.univ.dr.AbdelfatahNOURUniversitatea Pudue,SUA
Prof.univ.dr.H.C.FrancoisCRESPEAUENVAlfort,France
Prof.univ.dr.GheorgheSOLCAN
Prof.univ.dr.LiviuMIRON
Prof.univ.dr.GheorgheSVUA
Prof.univ.dr.GabrielPREDOIFMVBucureti
Prof.univ.dr.IoantefanGROZAFMVClujNapoca
Prof.univ.dr.GheorgheDRBUFMVTimioara
Prof.univ.dr.CorneliuCOTEA
Prof.univ.dr.MihaiCARPCRARE
Conf.univ.dr.erbanMOROANINSERMParis
Prof.univ.dr.H.C.LiviuRUNCEANU
Prof.univ.dr.TudorPERIANU
Prof.univ.dr.IoanCOMAN
Prof.univ.dr.ElenaVELESCU

Volumulafosteditatcusprijinulfinanciaral
MinisteruluiEducaiei,Cercetrii,TineretuluiiSportului

ISSN:14547406


CURPINS

PARTEAI

ALINAANTON,GHEORGHESOLCAN,VASILEBOGHIAN,NICOLAEHAGIU
BIOCHEMICALANDHAEMATOLOGICALPROFILEINTHEADVANCEDGESTATION
PERIODOFCOPPERDEFICIENTHOLSTEINANDBROWNSWISSCATTLE

ATTIA,H.FANDMAZHER,K
HISTOLOGICALANDIMMUNOHISTOCHEMICALSTUDIESOFTHEBUCK'SPINEAL
GLANDDURINGLIGHTANDDARKPERIODS

S.BESCHEACHIRIAC
COMPARATIVESTUDYOFVASCULARARTERIALREACTIVITYATSEVERALMAMMAL
SPECIES:.THEREACTIVITYOFARTERIALSMOOTHMUSCLESATTHE
VASOCONSTRICTORAGENTSANTIDIURETICHORMONE(VASOPRESSIN)

BOGHIANV.,MLNCUR.N.,ACATRINEID.,PACAS.,ANTONALINA,SOLCANGH.
MORPHOCLINICALASPECTSOFBABESIOSISINHORSES

IOANABURCOVEANU,I.BURTAN,ROXANATOPAL,
L.C.BURTAN,M.FNTNARIU
KERATOPATHIESINCARNIVORES:CLINICALSIGNSANDLOCALPATHOLOGIC
RESPONSES

HLNEHUET,DELPHINEFRANKO,CHAKIBDJEDIAT,EVAPEREZ,FRANOIS
CRESPEAU,AMAURYDELUZE
PATHOLOGICALEFFECTSANDTISSUEDISTRIBUTIONOFMICROCYSTINLR(MCLR)
AFTER48HOURSNONINVASIVEEXPOSITIONOFNEWLYHATCHEDMEDAKA
(ORYZIASLATIPES)ELEUTHEROEMBRYOS

GH.DRBU,V.COZMA,K.IMRE,A.BEJAN,M.S.ILIE,MIRELAIMRE
PREVALENCEOFCRYPTOSPORIDIUMSPP.ANDOTHERENTEROPATHOGENS
INFECTIONSATCALVESINWESTERN,CENTRALANDNORTHWESTERNROMANIA

GALA.F.,CATOIC.,BABAAI,MICLAUSV.,BOLFAP.,TAULESCUM,TABARANF.,
NAGYA.,MOUSSAR.,COSMINACUC
ASPECTSREGARDINGVASCULOGENICMIMICRYINCANINEMAMMARYCANCER

GRECUMARIANA,NSTASV.,MAREM.,MORARURAMONA,HRICULUMINIA
DIANA,ILIECORNELIA
ASSESSMENTOFTHEANTIINFLAMMATORYACTIONOFTHECARPROFENBETA
CYCLODEXTRINSCOMPLEXONEXPERIMENTALINFLAMMATIONMODELINRATS

13

20

26

30

36

44

49

60

GROZAI.,GROZADARIA,PALLEMOKE,CENARIUM.,CIUPESIMONA,LAURA
PARLAPAN
EVALUATIONOFDEGREEOFENGRAFTMENTINMOUSEMODELOFSTEMCELLS
HARVESTEDFROMHUMANPLACENTA

IONELAHOTEA,GH.DARABUS,C.PACURAR,TATIANARUGEA,P.MUNTEAN,M.S.
ILIE,K.IMRE,MIRELAIMRE,DENISASORESCU,ADRIANBALINT,DINUINDRE
PRELIMINARYSTUDYONTHEPREVALENCEOFTOXOPLASMAGONDIIINFECTIONIN
WILDBOARSFROMTIMISCOUNTY

OLIMPIAC.IACOB,B.C.C
EPIDEMIOLOGICALINVESTIGATIONSONDIGESTIVEPARASITOSISINRACINGPIGEONS
ANDTHERISKOFRELEASINGPARASITICELEMENTSINFREEAREAS

MARIANAIONITA,D.K.HOWE,I.L.MITREA,B.STEVENSON,MICHELLEYEARGAN
PRELIMINARYDATACONCERNINGOPTIMIZATIONOFAPCRBASEDMETHODFOR
MOLECULARDETECTIONOFTICKBORNEPATHOGENS

ISMAIL,S.F;ABDALGALIL,A.S.AANDGEHAN,B.A.YOUSSEF
PROPOFOLANAESTHESIAINDONKEYSINCOMBINATIONWITHCHLORALHYDRATE

ADINAMARIAMANEA,S.E.GEORGESCU,STELIANAKEVORKIAN,SORINADINESCU,
MARIETACOSTACHE
GENOTYPINGESTROGENRECEPTORPOLYMORPHISMINPIGS,USINGTHEPCRRFLP
METHOD

MICLUV.,ANNECLAUDIATEFNU,ADRIANAMUREAN,C.OBER,V.RUS
COMPARATIVETESTINGOFSOMEEXPERIMENTALMODELSOFOXYGENINDUCED
RETINOPATHYINYOUNGRATS.HISTOLOGICALSTUDY.

MOUSSARAOUAD.,CCATOI.,BSEVASTRE.,MTAULESCU.,PBOLF.,AGAL.,,F.A
TABARAN.,A.LNAGY.,CCUC.
EXPRESSIONOFTHEVIMENTINMARKERINDOGMELANICCUTANEOUSTUMORS

S.OANCEA,G.PAVEL,A.V.OANCEA
ONTHESHAPEOFTHEERYTHROCYTESFROMSOMEHERBIVOREMAMMALS

S.OANCEA,S.PADUREANU,A.V.OANCEA
IDENTIFICATIONOFPATHOLOGICALSTATESBASEDONREDBLOODCELL
AGGREGATION

OPREANO.Z.,GHEBANDIANA,FORNANORINACONSUELA,INDILARE.V.,
GRMADS.
STRUCTURALMODIFICATIONSOFTHEORALMUCOSAANDTHEDENTALAPPARATUS
INDUCEDBYSOMEDRUGSINLABORATORYMICE

EMOKEPALL,GROZAI.,CENARIUM.,CRISTINAILEA,OLGASORITAU,CIPRIANT.,
BERCEC.
ISOLATION,CHARACTERIZATION,PHENOTYPIZATIONANDDIFFERENTIATIONOFSTEM
CELLSFROMRATPLACENTA

65

70

74

87

96

103

107

115

121

127

131

141


DUMITRIARUGINA,ADELAPINTEA,ANDREABUNEA,RALUCAPOP,SANDA
ANDREI
LUTEINPREVENTSHIGHGLUCOSEINDUCEDOXIDATIVESTRESSINHUMANRPECELLS

TRIFALEXANDRA,DUMITRESCUEUGENIA,PETROVICISNEJANA
ALUMINIUMSULPHATEIMPACTONFUNDAMENTALBIOMARKERSOFREPRODUCTIVE
FUNCTIONALITYINFEMALERATS(SUCKLINGPERIODEXPOSURE)

WAELM.ELDEEB,S.M.ELBAHR
IMPROVEMENTOFGLUCOSECONCENTRATION,LIPOPROTEINPROFILEAND
ANTIOXIDANTBIOMARKERSINBLOODOFNATURALLYDIABETICBITCHES
ADMINISTEREDINSULINWITHVITAMINCORVITAMINE

WAELM.ELDEEB,ABDELAZIZALMUJALLI,S.M.ELBAHR
INVESTIGATIONOFSELECTEDBIOCHEMICALINDICATORSOFEXERTIONAL
HABDOMYOLYSISINARABIANHORSES:PROINFLAMMATORYCYTOKINESAND
OXIDATIVESTRESSMARKERS

IHABEL_ZOGHBY,AHMEDKASSAB
THEPARSDISTALIS(ANTERIORPITUITARY)INONEHUMPEDCAMEL(CAMELUS
DROMEDARIUS) : AMORPHOLOGICALSTUDY

IHABM.ELZOGHBY
LIGHTANDELECTRONMICROSCOPESTUDIESOFTHEADRENALGLANDSOFTHE
EGYPTIANGEESE(ALOPOCHENAEGYPTIACUS)

PARTEAII

GEHANSAIDAHMEDAFIFY
DETERMINATIONOFSOMEANTIMICROBIALRESIDUESINCHICKENMEATAND
GIBLETS.

ADRIANAANI,DRAGOANI,GHEORGHESAVUA
RESEARCHESREGARDINGTHESEROPREVALENCEOFSWINEHEPATITISEVIRUS
INFECTIONINTHEEASTOFROMANIA
DRAGOCONSTANTINANI,ADRIANAANI,GHEORGHESAVUA
SEROEPIDEMIOLOGICALSTUDYREGARDINGINFECTIOUSBOVINERHINOTRACHEITIS
INCOUNTIESFROMNORTHOFMOLDOVAREGION

CRISTINABULBAA(PANAITE),D.DRUGOCIU,DANADRUGOCIU,PANAITEC.G.
USINGSOMATICCELLSCOUNTANDBACTERIALCOUNTTOEVALUATEMILK
PRODUCTIONINONEDAIRYFARMINIASSYCOUNTRY
PRIMIANIEDIANINGSIH,JANALEXSIWI
SELECTIONRESPONSESOFALABIODUCK(ANASPLATIRINCHOSBORNEO)
PRODUCTIONININTENSIVEMAINTENANCESYSTEM

145

153

158

170

183

195

213

219

222

226

230

ELKOMY.A.A.A,ELZOGHBY.R.R,ABDELAZEM.M.A.
TERATOLOGICALANDPATHOLOGICALSTUDIESOFCEFOPERAZONEINFEMALE
ALBINORATS
SERGIUEMILGEORGESCU,MARIAADINAMANEA,STELIANAKEVORKIAN,MARIETA
COSTACHE
ANEWMETHODFORANALYZINGTHEAGOUTILOCUSINVOLVEDINTHECOAT
COLOUROFHORSES
CRISTINAHORHOGEA,IVONALAIU,CRISTINARMBU,MIHAICARPCRARE
FELINEINFECTIOUSPERITONITISCASEPRESENTATION
STELIANAELVIRAMARIAKEVORKIAN,S.E.GEORGESCU,MARIAADINAMANEA,
MARIAGEORGIANAGAVRILA,G.HRINCA,MARIETACOSTACHE
THESPIDERLAMBSYNDROMEABSENCEINFIVEROMANIANSHEEPBREEDS

HENDRONOTOARNOLDUSWALEWANGKOLENGKEY,LOVITAADRIANI
IMPLICATIONEFFECTOFPROBIOTICBACTERIATOYOGHURTQUALITYANDENZYME
ACTIVITIES

LOVITAADRIANI,HENDRONOTOA.W.LENGKEY
PROBIOTICBACTERIAASYOGHURTSTARTERANDITSIMPLICATIONEFFECTTOTHE
PATHOGENICANDNONPATHOGENICBACTERIAINMICEGASTROINTESTINAL
INAIULIANAMACOVEI,S.MANOLESCU,CRISTINARMBU,S.PASCA,G.DRAGAN,
GH.SAVUA
STUDYOFANOUTBREAKOFFOWLTYPHOIDINPHEASANTS
CRISTINARMBU,ELEONORAGUGUIANU,GH.SOLCAN,CRISTINAHORHOGEA,
E.V.INDILAR,CTIN.PAVLI,C.CARPCRARE
CONSIDERATIONSONTHEASSOCIATIONOFPERIODONTALDISEASEWITHOTHER
ORGANICDISEASESINDOGSANDCATS

ROOSTITAL.B.,CISSYR.P.,ERICF.S.,SRIM.,HENDRONOTOA.W.L.
THEINFLUENCEOFSEASONALCHANGETOWARDSTHENUMBEROFOUTBREAKSAND
POULTRYDEATHRATECAUSEDBYAVIANINFLUENZAATBANDUNGDISTRICT

GH.SAVUA,IULIANAONI,ADRIANAANI,D.ANI,LUANDALUDU,
BEJANARIUANA
EPIDEMIOLOGICALINVESTIGATIONSINTHEEASTOFROMANIAREGARDINGTHE
SEROPREVALENCEOFINFLUENTZAATYPEVIRUSESINDIFFERENTSPECIESOF
ANIMALS
JANALEXSIWI,PRIMIANIEDIANINGSIHANDDUDUNGMULLIADI
PERFORMANSGENETICQUALITATIVEANDQUANTITATIVEOFTHINTAILSHEEPAND
PRIANGANSHEEP

N.STARCIUC.,NATALIAOSADCI.,I.SCUTARU.,T.SPATARU.
THEOUTBREAKSOFINFECTIOUSBRONCHITISOFCHICKENSINPRIVATEPOULTRY
FARM

236

246

249

254

259

262

267

271

278

282

286

294

OANARALUCASTRUGARU,FILIPPOTURRINI,ALESSANDRASCAGLIARINI,ELENA
VELESCU
THEDETECTIONOFORFVIRUSBYPCRATTHERUMINANSOFROMANIA

ALINAVLADSABIE,VIORELFLORITEAN,CARMENCREU,MIHAIOBAD,CTLIN
CARPCRARE,MIHAICARPCRARE
DETECTIONANDQUANTIFICATIONOFSALMONELLASPP.ANDCAMPYLOBACTER
JEJUNIONPOULTRYCARCASSES
BYREALTIMEPCR
MOHAMEDYOUSEFRAMADANANDABLADESOKYABDELMAGEID
EPIDEMIOLOGICALSTUDYOFECTOPARASITESINSTRAYDOGSINKALUBYIA
GOVERNORATEOFEGYPTWITHASPECIALREFERENCETOITSCONTROLINPUPPIES
BYDELTAMETHRINANDIVERMECTIN
MARIAZAMORNEA,D.ERHAN,.RUSU,NINATLMBU,O.CHIHAI,VIORICA
COAD
ESTIMATIONOFVEGETALEXTRACTSEFFICIENCYINDOMESTICBIRDS
ECTOPARASITOSESTREATMENTANDPROPHYLAXIS

297

300

307

318


BIOCHEMICALANDHAEMATOLOGICALPROFILEINTHE
ADVANCEDGESTATIONPERIODOFCOPPERDEFICIENTHOLSTEIN
ANDBROWNSWISSCATTLE
AlinaANTON,GheorgheSOLCAN,VasileBOGHIAN,NicolaeHAGIU
FacultyofVeterinaryMedicineIasi
AlleyMihailSadoveanunr.8;Iasi700489,Romania;antonclaraalina@yahoo.com
10 Holstein and 10 Brown Swiss cattle in advanced gestation period, clinically healthy, from a
farmfromRomaniaweredividedinto2groupsaccordingtobreed(group1=Holstein,group2=
Brown Swiss) with the aim of evaluating the copper status and correlating these status with
haematological and biochemical profiles.Ceruloplasmin concentrations (the primary Cu
containing component of the blood) have been considered as reliable indicators to copper
status.Duringtheprotocol,nostatisticallysignificantdifferenceswerenotedinthehematological
and biochemical parameters in Holstein versus Brown Swiss cattle, remaining within their
physiological adult reference range, except plasma ceruloplasmin.These were below cattle
referencerangeforall20cattles.
Inourstudy,thevaluesofplasmaceruloplasminweresignificantlyincreased(P<0,05)inBrown
Swiss cattle (54.97 15.62 mg/L) than Holstein cattle (40.60 5.18 mg/L), probably due to
geneticpredisposition.

Keywords:ceruloplasmin,copper,haematology,bloodbiochemistry,cattle

Copperistheratelimitingelementinthesynyhesisofceruloplasmin,aglycoproteinthatis
synthetizedintheliver.Ceruloplasminconcentrations(theprimaryCucontainingcomponent
oftheblood)havebeenconsideredasreliableindicatorstocopperstatus(Jain,1993).Close
correlationbetweenplasmaceruloplasmineandcopperconcentrationhavebeenreportedin
manyanimalspeciesincludingsheep,cattleandhorses(Arthingtonetal.,1996;Ceroneetal.,
1998).
Theaimofthepresentstudywastodeterminethecopperstatusandthecorrelationbetween
thesestatusandhaematologicalandbiochemicalprofiles.

MATERIALANDMETHODS

ThepresentstudywascarriedoutonaprivatefarmfromNordEastofRomania.
Blood samples were collected from 20 cattle in the advanced gestation period grouped by
breeds (group 1 = Holstein, group 2 = Brown Swiss). The animals were clinically normal and
free from any external, and internal parasites. They were fed with corn silage, concentrates
andhay.Theanimalsweresupplementedwith250g/dayofacommercialmineralandvitamin
mix.Thebasaldietwasanalyzedtocontain9mgofcopper/kgdrymatterintake.
Bloodsampleswerecollectedfromthecoccygealveinintoheparinizedvacutainersforplasma
and uncoated vacutainers for serum. The samples were analysed for glucose, urea nitrogen
(BUN), hydroxybutyrate (OHB), cholesterol, calcium (Ca), phosphorus (P), magnesium
(Mg), alkaline phosphatase (PA), total protein (Pt), albumin (Alb), globulin (Gb), plasma
ceruloplasmin(Cerlp)andplasmahaptoglobin(Hapt).Serumlevelsanalysisandplasmawere
performedinanautomaticbiochemicalCormayAccent200.

Lucrritiinificevol53seriaMedicinVeterinar
About2mlbloodwassampledintosmallvacutainerscontainingadriedanticoagulant(EDTA
K)andgentlymixedforhematologicalparameterdeterminations.
Haematologicalanalysesincludedredbloodcells(RBC),haematocrit(Htc),haemoglobin(Hb),
meancellvolume(VEM),meancellhaemoglobin(HEM),meancellhaemoglobinconcentration
(CHEM), white blood cells (WBC) andnumber of platelets. The samples were analysed in an
automated cell counter (Animal Blood Counter Vet) for complete blood count. Differential
leukocytecountwasperformedmicroscopicallyonGiemsastainedbloodfilm.
Statistical analysis was conducted using SPSS 16 for windows. Breeds effect was examined
usingStudent`stTest.Meanvaluesandstandarddeviationswerecalculatedfromindividual
values. The relationship between ceruloplasmin and haematological and biochemical
parameterswascalculatedthroughPearsoncorrelationtest.

RESULTSANDDISCUSSION

Thevaluesarediscussedinrelationwiththepublishedreferencerangesforadultcattle.The
mean(SE)valuesofRBC,Hb,Htc,VEM,HEMandCHEMatHolsteinandBrownSwisscattlein
advanced gestation are shown in table 1. Regarding RBC, Hb, Htc, VEM, the most elevated
values were observed in Brown Swiss cattle, but the differences were not statistically
significant (P > 0.05). Pregnancy causes minor changes in RBC and WBC concentrations. As
pregnancyadvanced,erythrocytenumberincreasedslightly(WoodandQuirozRocha,2010).
ThelowestvaluesofHEM(16,121,23pg)andCHEM(32,061,39%)havebeenobservedin
Brown Swiss cattle but the differences were not statistically significant (P > 0.05). The same
situation was observed at number of platelets when Holstein cattle showed elevated values
(315 118,21 x 10/L) compared with Brown Swiss cattle (227,4 91,84 x 10/L) but the
differenceswerenotstatisticallysignificant.
During the entire study, the RBC , Hb, Htc, VEM, HEM, CHEM and platelets at Holstein and
BrownSwisscattlewereplacedinphysiologicallimitsforadultcattle.
Inthepresentstudy,Pearsoncorrelationtestdidnotshowanassociation(P>0.05)between
ceruloplasminvaluesandRBC,Hb,Htc,VEM,HEMandCHEM.

Table1.
Mean(SE)valuesofRBC,Hb,Htc,VEM,HEMandCHEMatHolsteinandBrownSwisscattle
inadvancedgestation

Hb
Htc
VEM
HEM
CHEM
RBC
Cattle
(x106/L)
(g/dL)
(%)
(fL)
(pg)
(%)
Holstein
6,120,65 9,980,40 29,51,47 48,43,20 16,381,12 33,820,85
BrownSwiss 6,530,63 10,420,3 32,641,39 50,23,34 16,121,23 32,061,39
Normalvalues
forcattle
510
815
2446
4060
1117
3036
(afterKramer,
2000)

The mean (SE) values of WBC, Lymph (lymphocytes), Mon (monocytes), Neutroph
(neutrophils),Eos(eosinophils)atHolsteinandBrownSwisscattleinadvancedgestationare
showninfigure1.
In the present study, mean values of WBC were within the adult reference range (412 x
10/L)(Kramer,2000).
8

UniversitateadetiineAgricoleiMedicinVeterinarIai
Regardingthenumberofmonocytestherewereobservedhighervalues(0,380,14x10/L)
inHolsteincattle,comparedwithBrownSwisscattle(0,260,08x10/L),butthedifferences
werenotstatisticallysignificant.
Inthepresentstudy,themeanvaluesoflymphociteswerebelowcattlereferencerange2,5
7,5x10/L(Kramer,2000)forthe2groups,andthemeanvaluesofneutrophilswerehigher
than cattle reference range 0,64,12 x 10/L (Kramer, 2000). In the periparturient period,
cows typically have an stress leukogram characterized by a neutrophilia, lymphopenia,
eosinopenia, and monocytosis. Several studies have shown shifts in proportions of different
lymphocyte populations at the time of parturition. These changes may be partly related to
nutritional status and other health parameters, but pregnancy and lactation appear to have
theprimaryeffect(TorquistandRigas,2010)
Pearson correlation test did not show an association between ceruloplasmin values and the
valuesofleukogram.

Figure1.Mean(SE)valuesofWBC,lymphocytes,monocytes,neutrophilsandeosinophilsat
HolsteinandBrownSwisscattleinadvancedgestation

Table2.
Mean(SE)valuesofGGT,AST,PA,glucose,OHB,BUNandcholesterolat
HolsteinandBrownSwisscattleinadvancedgestation

Holstei
n
Brown
Swiss

GGT
UI/L
42,1212,3
9
30,3811,3
0

Normal
values
for
cattle

1538
(after
Smith,
2009)

Cattle

AST
UI/L

PA
UI/L

Glucose
mg/dL

81,0707

32,417,43

51,286,33

57,206,5
6

25,0410,2
3

55,1610,0
1

43127
(after
Smith,
2009)

0500
(after
Radostits,
2007)

4575
(after
Radostits,
2007)

OHB
mmol/L
0,820,1
8
0,980,2
8
0,35
0,47
(after
Smith,
2009)

BUN
mg/dL
13,483,0
7
8,733,31
627
(after
Radostits,
2007)

Cholesterol
mg/dL
138,9827,2
3
118,1232,5
3
65220
(after
Radostits,
2007)

InthepresentstudythelevelsofAST,PA,glucose,BUNandcholesterolwereconsistentwith
theamountsincattleandthedifferencesbetweenbreedswerenotstatisticallysignificant(P>
0.05).Themean(SE)valuesofGGT,AST,PA,glucose,OHB,BUNandcholesterolatHolstein
andBrownSwisscattleinadvancedgestationareshownintable2.ThehighervaluesofGGT

Lucrritiinificevol53seriaMedicinVeterinar
inHolsteincattleindicatedcholestasis.ThehighervaluesofOHBinHolsteincattleandlower
valuesofglucosemaysuggestasubclinicalketosis.
Inthepresentstudy,Pearsoncorrelationtestdidnotshowanassociation(P>0.05)between
ceruloplasminvaluesandGGT,AST,PA,glucose,OHB,BUNandcholesterol.

During the entire study, the total protein, albumin and globulin (figure 2) at Holstein and
Brown Swiss cattle were placed in physiological limits for adult cattle and the differences
betweenbreedswerenotstatisticallysignificant(P>0.05).
Inthepresentstudy,Pearsoncorrelationtestdidnotshowanassociation(P>0.05)between
ceruloplasminvaluesandPt,AlbandGb.

Figure2.Mean(SE)valuesoftotalprotein(Pt),albumin(Alb)angglobulin(Gb)at
HolsteinandBrownSwisscattleinadvancedgestation
Themean(SE)valuesofCa,PandMgatHolsteinandBrownSwisscattleinadvancedgestation
areshowninfigure3.InthepresentstudyphosphorusandmagnesiumatHolsteinandBrown
Swisscattlewereplacedinphysiologicallimitsforadultcattle.Themean(SE)valuesofcalcium
were lower for Holstein and Brown Swiss cattle, than reference values and the differences
between breeds were not statistically significant (P > 0.05).It has been shown that plasma
calciumof5mg/dLreduceabomasalmotilityby70%andthestrengthofthecontractionby
50%(Daniel, 1983).Clearly areductionin musclecontractilitywillleadtoadecreaseindry
matterintakesasrumenfunctiondecrease,leadingtoaseverenegativeenergybalance.Asa
consequence,there is an increase in fat mobilisation that may result in fatty liver syndrome
andketosis.Anexcessofketonebodiescanfurthersuppressappetite(Grummer,1996).Thin
cattle in a negative energy balance are unable to perform at maximum capacity in the herd
(Anton and Solcan, 2008). Hypocalcaemia occurs when the rate of calcium uptake into the
mammary gland for milk production is greater than that which is absorbed from the diet or
resorbedfrombone(Wilde,2006)
Inthepresentstudy,Pearsoncorrelationtestdidnotshowanassociation(P>0.05)between
ceruloplasminvaluesandCa,PandMg.
Haptoglobin (protein that increases in acute inflammation) (figure 4) was within the adult
referencerange00,4g/L(Radostits,2007).Plasmahaptoglobinshowedthesimilarvaluesat
HolsteinandBrownSwisscattle.Pearsoncorrelationtestdidnotshowanassociationbetween
ceruloplasminandhaptoglobinvalues.

10

UniversitateadetiineAgricoleiMedicinVeterinarIai

Figure3.Mean(SE)valuesofcalcium(Ca),phosphorus(P)andmagnesium(Mg)at
HolsteinandBrownSwisscattleinadvancedgestation

Figure4.Mean(SE)valuesofhaptoglobine(Hapt)at
HolsteinandBrownSwisscattleinadvancedgestation

Inthepresentstudy,plasmaceruloplasmin(figure5)werebelowcattlereferencerange120
200mg/L(Radostits,2007)forall20cattle.Thedietcontaining9mgofCu/kgofDM,wasnear
bytheinferiorcopperlimitsforadultdairycattle(918ppm)(NRC,2001).Theimprovementin
nutritionalstatusshouldimprovemilkproductionofthecattleaswellashealthperformance
oftheanimals(AntonandSolcan,2008).

*SignificantdifferencewithHolsteincattlesampling.
Figure5.Mean(SE)valuesofceruloplasmin(Cerlp)at
HolsteinandBrownSwisscattleinadvancedgestation
Dashedlinesrepresentreferencevaluesforadultcattle

Plasma ceruloplasmin activity is decreased by copper deficiency, the relative activity of this
enzymeincreasesduringinfectionandinflammation(Neveetal.1988).LargequantitiesofCu
aredepositedinthefetusduringlategestation,andthiscandecreaseCustatusofthedamif
dietary Cu is low (Gooneratne and Christensen, 1989). The lowest levels of plasma
ceruloplasmin were found in Holsteincattle 40,60 5,18 mg/L but thedifferenceswere not

11

Lucrritiinificevol53seriaMedicinVeterinar
statisticallysignificant(P >0.05)comparedtoBrownSwiss cattle. Thereductionofdigestive
capacityinadvancedgestationmaylimitcopperintakeforthecattleandfetusneeds.
Plasma ceruloplasmin may show a genetic difference in Cu absorption and metabolism
postabsorption between Holstein and Brown Swiss breeds. The genetic difference may be
relatedtotheefficiencyofdietaryCuabsorption,theexcretionofendogenousCu,oramount
offeedintake(Duetal.,1996).

CONCLUSIONS

1) Pearson correlation test did not show an association between ceruloplasmin and
biochemicalandhaematologicalmeasurementsintheadvancedgestation.
2) Copper deficiency in Holstein and Brown Swiss cattle was not sufficient to cause
hypochromicandmicrocyticanemia.
3)Thedietcontaining9mgofCu/kgofDM,didnotmeettherequirementsofHolsteinand
BrownSwisscattleinadvancedgestation.
4)Plasmaceruloplasminwerebelowcattlereferencerange120200mg/Lforall20cattle,but
thelowestlevelsofplasmaceruloplasminwereatHolsteingroup40,605,18mg/L.

REFERENCES
1.
2.

3.
4.
5.
6.
7.
8.
9.
10.

11.
12.
13.
14.

AntonA.,SolcanG.,2008BodyconditionscoringwithRomanianBlackPiedairycow,Scientific
works,Univ.ofAgr.Sci.AndVet.Med.Bucharest,Cseries,VeterinaryMedicine,53,p.1215.
Arthington J.D., Corah L.R., Blecha F., 1996 The effect of molybdenum induced copper
deficiency on acute phase protein concentrations, superoxide dismutase activity, leukocyte
numbersandlymphocyteproliferationnbeefheifersinoculatedwithbovineherpesvirus1,J.
Anim.Sci.,vol.74,p.211217.
Cerone S.I., Sansinanea A.S., Streitenberger S.A., Garcia M.C., Auza N.J., 1998 The effect of
copperdeficiencyontheperipheralbloodcellsofcattle,Vet.Res.Commun,22,p.4757.
DuZ.,HemkenR.W.,HarmonR.J.,1996CoppermetabolismofHolsteinandJerseycowsand
heifersfeddietshighincupricsulfateorcopperproteinate,J.DairySci.,vol.79,p.18731880.
GooneratneS.R.,ChristensenD.A.,1989Asurveyofmaternalcopperstatusandfetaltissue
copperconcentrationsinSaskatchewanbovine,Can.J.Anim.,vol.69,p.141150.
Grummer R.R., 1996 Closeup dry period: feeding management for a smooth transition. In:
ProceedingsWCDS,RedDeer,Alberta.
JainN.C.,1993Essentialsofveterinaryhematology,Ed.LeaandFebiger,Philadelphia,p.173
175.
Kramer J.W., 2000 Normal hematology of cattle, sheep and goats. In: Schalms veterinary
hematology.5thed.Philadelphia:LippincottWilliamsandWilkins,p.07584.
NationalResearchCouncil,2001Nutrientrequirementsofdairycattle.7threv.ed.Natl.Acad.
Sci.Washington,D.C.,p.236267
RadostitsO.M.,GayC.C.,BloodD.C.,HinchcliffK.W.,2007VeterinaryMedicine.Atextbookof
the diseasesof cattle,sheep, pigs, goats andhorses, Ed. Saunders W.B. Co.,Philadelphia,10th
ed.,p.17071732.
th.
SmithB.P.,2002Largeanimalinternalmedicine3 ed.Mosby,London,Philadelphia,Sydney,
Toronto,p.783786.
WildeD.,2006Influenceofmacroandmicromineralsintheperiparturientperiodonfertility
indairycattle,AnimalReproductionScience,vol.96,p.240249.
Wood D., QuirozRocha G.F., 2010 Normal hematology of cattle, In: Schalms veterinary
hematology.6thedition,BlackwellPublishing,Iowa,p.829835.
Tornquist S., Rigas J., 2010 Interpretation of ruminant leukocyte responses, In: Schalms
veterinaryhematology.6thedition,BlackwellPublishing,Iowa,p.307320.

12


HISTOLOGICALANDIMMUNOHISTOCHEMICALSTUDIESOFTHE
BUCK'SPINEALGLANDDURINGLIGHTANDDARKPERIODS

Attia,H.FandMazher,K
DepartmentofHistologyandCytology,FacultyofVeterinaryMedicine,
BenhaandBeniSuefUniversities
Correspondingauthor:HossamAttia,BenhaUniversity.Egypt.P.O.13736
Abstract:thepresentinvestigationwasconductedonthepinealorgansof12healthybucks.Sixth
samples collected during dark period (at mid night) while the other six collected during light
period (at noon).The samples were processed and prepared for light and electron microscopic
examination.Thepinealorganofbuckswassurroundedbyathinfibrouscapsule,thepiamatter,
while the parenchyma was supported by extensive reticular network.The parenchyma of the
glandwasformedofclustersorgroupsofpinealocytesintermingledwithastrogliacells.Bundles
of unmyelinated nerve fibers were noticed in the organ. During dark period the pinealocytes
were large in size with finely granular cytoplasm containing well developed rER, mitochondria
andmanysecretorygranules.Longbranchedcytoplasmicprocessesarisedfromthepinealocytes
toterminatenearbloodvesselsorsynapsewithanerve.Thepinealocytesreactedpositivelywith
antimelatoninantibodies.Duringthelightperiodthepinealocytesappearedsmallerinsizewith
clear non granular cytoplasm. The pinealocytes ahowed a very slight reaction to the
antimelatoninantibodies.
Keywords: buck, pineal gland, histology, immunostochemistry

INTRODUCTION
During the last few years, the study of the pineal gland (epiphysis cerebri) attracts the
attentionofmanyauthorsatdifferentaspectsofbiologicalsciencesspeciallythehistologists
andthephysiologists.
Historically,thelocationofthepinealglanddeepinthebrainsuggestedtothephilosophers
that it is a mystery gland with myth, superstition and metaphysical theories surrounding its
perceivedfunction.Descartes(2002&2003)calledittheseatofthesoul.Hebelievedthatthe
glandisthepointofconnectionbetweentheintellectandthebody.
Thepinealglandisoccasionallyassociatedwiththesixthchakra(alsocalledAjnaorthirdeye
chakra in yoga) or sometimes seventh chakra (crown). It is believed to be a dormant organ
thatcanbeawakenedtoenabletelepathiccommunications(Uz,etal,2003).
ArendtandSkene(2005)discoveredthatmelatonin,themostpotentcompoundthenknown
tolightenfrogskin,waspresentinhighestconcentrationinthepinealbodyanditsproduction
isstimulatedbydarknessandinhibitedbylight.
Histologically,thepinealglandofrat,pig,fish,bird,rabbitandhamsteristhoroughlystudied
byFerreiraMedeiros,etal(2007),PrzyblyskaGornowiczandLewczuk(1997),Hafeez(2005),
Ueck(1973),Romijn(1973)andmatsushima,etal(1990)respectivelywhilethatofgoatnot
yetinvestigated.
Ourstudyaimedtoelucidatethelightandelectronmicroscopicpicturesofpinealglandofthe
buckbesidetheimmunohistochemicallocalizationofmelatoninintheglandduringdarkand
lightperiods.

MATERIALSANDMETHODS
Twelvehealthybucksaging1012monthsoldweresubjectedtothepresentinvestigation.The
animalsweresubjectedtoaphotoperiodof12hoursdarkand12hourslightfromrearingup
tothetimeofslaughtering.Sixanimalsweresacrificedatmidnight(at12O'clock)while the
13

Lucrritiinificevol53seriaMedicinVeterinar

othersixweresacrificedatnoon(at12O'clock).Theskullisopenedcarefullyandthewhole
brain is taken, then the cerebral hemispheres were gently removed and excluded while the
remained part was sagitally sectioned through the pineal body then quickly put into 20%
neutralbufferedformalin.Afterfixationthespecimenswereprocessedtoobtainhistological
sections of about 46 micrometersthick to be stained with hematoxylin and eosin, Gomori
reticulin method, silver impregnation technique and indirect immunoperoxidase
antiperoxidase PAP unlabelled antibody method using STAT polyclonal kits from diagnostic
Products Corporation, Los Angelos, USA. The above mentioned methods were applied as
outlinedbyDruryandWallington(1980)andBancroftandSteven(1995).
For electron microscopic examination, small pieces 1mmX1mm of the collected specimens
werefixedin3%glutraldhydein1Mphosphatebuffer(pH=7.3)for24hoursthenpostfixedin
1Mcoldphosphatebuffered1%osmiumtetroxide(pH=7.3)for3hours,rinsedinphosphate
buffer then dehydrated (Hayat,1986). Ultra thin sections were obtained and mounted on
cupper grids then stained with uranyl acetate and lead citrate (Reynolds, 1965) to be
examinedbyJoel100CXtransmissionelectronmicroscopeintheunitofelectronmicroscopy,
AssuitUniversity.
RESULTS
Thepinealglandwascoveredbyathinfibrouscapsule,thepiamatter,fromwhichveryshort
septa penetrate the gland. Extensive network of reticular fibers were noticed among the
parenchymatouselements(Fig.1).Theparenchymalcellswerearrangedinclusters,columns,
rows or irregular groups permeated by many blood capillaries (Fig.2). Pineal sands, a small
calcifieddarkpatches,alsonoticedinthepinealparenchyma.Bundlesofunmyelinatednerve
fibers run in different directions in the parenchyma of the gland supported by glia cells
(Figs.3&4).
Theparenchymalcellstookdifferentcharacteristicfeaturesaccordingtolightordarkperiods.

Duringdarkperiod(atmidnight)
The gland appearedhighly vascularizedand the bloodvessels becameengorged with blood.
The pinealocytes appeared large polyhedral cells with faintly stained and finely granular
cytoplasm (Fig.5). The nuclei appeared large spherical, vesicular and somewhat eccentrically
situatedwithaprominentnucleolus.
The pinealocyte showed multiple (46) branched cytoplasmic processes which either
terminatedinflatteneddilatationsadjacenttobloodcapillariesorsynapseswithnervefibers
(Fig.6).
Thepinealocyteappearedlargeandslightlyelectrondensecellcontainingalargeeuchromatic
nucleus with a prominent nucleolus. The cytoplasm contained a well developed rough
endoplasmic reticulum, Golgi complex, many rounded and filamentous mitochondria and
numerous free ribosomes. Secretory granules of variable shapes and sizes as well as fat
dropletswerealsonoticed(Fig.7).
By using indirect immunoperoxidase technique the pinealocytes showed a strong positive
reactiontotheantimelatoninantibodies(Fig.8).
The astroglial cells appeared elongated or oval cells irregularly distributed between the
pinealocytes.Theyhadovaldarklystainedcentrallysituatednucleiinascantcytoplasm(Fig.5).
Thesecellspossessednumerousshortandbranchedcytoplasmicprocesses(Fig.6).

14

UniversitateadetiineAgricoleiMedicinVeterinarIai

Duringthelightperiod(atnoon)
The pinealocytes became smaller in size , polyhedral in shape and the cytoplasm became
lighter in stain and non granular (Fig.9). The nuclei remain spherical, vesicular and eccentric
with a prominent nucleolus. The blood vessels became smaller in caliper and not engorged
withblood.
Thepinealocytesappearedmoreelectronlucent,freefromsecretorygranulesandthenucleus
became slightly irregular in outline. The profiles of the other organelles remained as the
previousstage(Fig.10).
Byusingtheindirectimmunohistochemicaltechniquethepinealocytesshowedaveryfaintor
slightreactiontotheantimelatoninantibodies(Fig.11).

DISCUSSION

The epiphysis cerebri has a very interesting histological structure based on its unique
anatomical position. It is generally accepted that the pineal body develop as an upward
growthfromthediencephalontowhichitisconnectedbyashortstalk(FerreiraMedeiroset
al.2007andBorregonetal.1997).
The gland under investigation was covered by a thin fibrous capsule, the pia matter, from
whichshortseptapenetratetheglandasmentionedbyHafeez(2005);Kusetal.(2004)and
Reusetal.(1990).Theparenchymatouselementsoftheglandweresupportedbyanextensive
network of reticular fibers (Borregon et al. 1997). Beside its role as a protective coat, the
fibrousstromacarrybloodvessels,lymphandnervesupplyofthegland(Kusetal.2004).
There is a general agreement that the histological picture of the pineal parenchyma differs
according to light or dark period to which the individual exposed (FerreiraMedeiros et
al.2007; Kus et al. 2004 and Matsushima et al 1990). The authors stated that the gland
becomeswelldevelopedwithapronouncedproliferationandactivityofitsparenchymalcells
during dark period while during light, the activity of the gland is greatly decreased. In this
respect, our study revealed that the pinealocytes of the glands collected during dark period
showed a marked proliferation as they become larger in size with finely granular cytoplasm
together with a marked congestion of the pineal blood vessels. The above mentioned
histologicalsignsindicateahigheractivityoftheorgan(MacchiandBruce2004).Moreover,
the pinealocytes showed a well developed rough endoplasmic reticulum, Golgi complex as
wellasmanymitochondriaasmentionedbyUeck(1973)andOkscheetal.(1972).Theauthors
explainedtheroleofeachoftheseorganellesinthesecretoryactivityofthecell.Thepresence
ofelectrondensesecretorygranulesaswellaslipiddropletsinthecytoplasmofpinealocytes
ofbuckatdarkperiodsisanabsolutesignoftheincreasedsecretoryactivityoftheglandas
explained by Uria et al. (1992) and Owman and Rudeberg (1970). The pinealocytes of buck
showed long and branched cytoplasmic processes which either terminate in a flat dilatation
adjacenttobloodcapillariesorsynapseswithunmyelinatednerve.Similarobservationswere
alsoreportedbyReussetal.(1990)andOkscheetal.(1972).Thelatterexplainedtheroleof
cytoplasmicprocessesinthesecretionontheotherhandMutsushimaetal.(1990)explained
them as stimuli receivers. Both opinions could be met in the buck pineal where the
cytoplasmicprocessesjoiningbloodcapillariesplayaroleinsecretionwhilethatsynapseswith
nerveactasstimulireceivers.
The immunohistochemical reaction in our study augments the electron microscopic findings
and indicates that the buck pinealocytes produce considerable amount of melatonin during
darknessasstatedbymostresearchersstudyingthepinealgland.Alexandr(1970)andMoore
etal.(1967)mentionedthattheproductionofmelatoninbythepinealglandisstimulatedby
15

Lucrritiinificevol53seriaMedicinVeterinar

darknessandinhibitedbylight.Photosensitivecellsintheretinadetectlightanddirectlysignal
the suprachiasmatic nucleus and extending it to the 24 hours clock. Fibers from SCN to the
paraventricular nucleus which relay the circadian signals to the spinal cord and out via
sympathetic system to the superior cervical ganglia and from these to the pineal gland.
Barrenefxe et al. (2004) and Ekstron and Meissl (2003) stated that melatonin is synthesized
from amino acid tryptophan within the pinealocytes during darkness and it is said to have
neurologicalpropertiesforresynchronizationofsleepandcircadianrhythmsdisturbances.In
the periphery, melatonin is also involved in the regulation of several complex cycles as
seasonal reproduction, body weight and energy balance. Arendt and Skene (2005) decided
that exogenous melatonin has sleepinginducing and temperaturelowering effects during
biological daytime and when suitably timed it will shift the phase of human circadian clock
(sleep,endogenousmelatonin,corebodytemperatureandcortisol)toearlier(advancephase
shift)orlater(delayphaseshift)times.
As mentioned by Borregon et al. (1993) the astroglial cells appeared oval or elongated with
shortandbranchedcytoplasmicprocesses.Theauthorssuggestasupportiveroleoftheglial
cellswhileEkstronandMeissl(2003)explainedtheroleofthesecellsintransmissionofnerve
impulsesbetweenpinealocytes.
Thepresenceofcalcifieddarkpatchesofvariablequantitiesisalsorecordedinmostspecies
especiallyattheageofpubertytillsenilityandcalledcorporaarenacea(Baconnieretal.2002).
Chemical analysis of these patches shows that they are composed of calcium phosphate,
calcium carbonate, magnesium phosphate and ammonium phosphate (Bocchi and Valdre
1993).
Thepinealocytesofthesamplescollectedduringlightperiodsshowedamarkeddecreasein
cell size and absence of secretory granules which reflected on the very weak
immunohistochemicalreactionasstatedbyBarrenefxeetal.(2004),EkstronandMeissl(2003)
and Alexandr (1970). The latter refers to the pineal gland during light as a gland in resting
stage.Thesimilarityofthecytoplasmicorganellesbetweenthepinealocyteofdarkandlight
samples indicate that the pinealocyte in light is an active cell but wait a nerve stimulus to
synthesizeandsecretemelatonin(Matsushimaetal.1990).

REFERENCES

Alexandr,J.,1970:Thepinealgland.Endeavour.29(108):144148.
Arendt,J.andD.Skene,2005:Melatoninasachronobiotic.SleepMed.Rev.9(1):2539
Baconnier,S., S. Lang, M. Polomska, B. Hilczer, G. Bekcovic and G. Meshulam, 2002: Calcite
microcrystalsinthepinealglandofthehumanbrain(physicalandchemicalstudies).Bioelectromagneticc
23(7):488495.
BancroftandSteven,1996:Theoryandpracticeofhistologicaltechniques.4thEd.,ChurchillLivingstone,
Edinburgh,London,Melborne,NewYork
Barrenefxe,J.,P.DelagorangeandJ.Martinez,2004:Physiologicalandmetabolicfunctionsofmelatonin.
J.Physiol.Biochem.60(1):6172
Bocchi,G. and G.Valdre, 1993: Physical, chemical and mineralogical characterization of carbonate
hydroxyapatiteconcretionsofthehumanpinealgland.J.Inorg..Biochem.49(3):209220.
Borregon,A., J. Boya, L. Calvo and F. LopezMunoz, 1993: Immunohistochemical studies of the pineal
glialcellsinthepostnataldevelopmentoftheratpinealgland.J.PinealRes.14(2):7883
Descartes, R., 2002: The Passion of The Soul" excerpted from "Philosophy of The Mind" Chalmers, D.
NewYork:OxfordUniversityPress,Inc.
Descartes,R.,2003:TreatiseofMan.NewYork,Prometheusbooks.ISBN.
DruryR.andE.Wallington,1980:Carleton'shistologicaltechnique.4th Ed.OxfordUniv.Press. London,
NewYorkandToronto.
16

UniversitateadetiineAgricoleiMedicinVeterinarIai

Ekstrom,P. and H. Meissl, 2003: Evolution of photosensory pineal organs in new light: the
fateneuroendocrinephotosensors.Philos.trans.Soc.Lond.Biol.Sci.358(1438):16791700.
FerreiraMedeiros,M.,C.MandarimandE.CorreaGillieron,2007:Pinealglandpostnatalgrowthinrat
revisited.Anat.Histol.Embryol.36(4):284289.
Hafeez,M.,2005:Lightmicroscopicstudiesonthepinealorganinteleostfisheswithspecialregardtoits
function.J.Morph.134(3):281313
Hayat, M, 1986: Basic techniques for transmission electron microscopy. 1st Ed. Academic press, Inc.
Florida
Kus,I., M. Sarsilmaz, O.Ozen, A.Turkoglu, H.Pekmez, A. Songur and H. Kelestimur,2004: Light and
electronmicroscopicexaminationofpinealglandinratsexposedtoconstantlightandconstantdarkness.
Neuroendocrinol.Lett.25(2).
Macchi,M.andJ.Bruce,2004:Humanpinealphysiologyandfunctionalsignificanceofmelatonin.Front.
Neuroendocrinol.25(34):177195
Matsushima,S., Y. Sakia and Y. Hira, 1990: Effect of photoperiod on pineal gland volume and
pinealocytesizeinthechineasehamster(cricetulusgriseus).Am.J.Anat.187(1):3238
Moore,R., A. Heller, R. Wurtman and J. Axelrod 1967: Visual pathway mediating pineal response to
environmentalllight.Science,155(759):220223.
Osche,A., H. Kirschstein, H. kobayashi and D. Farner, 1972: Electron microscopic and experimental
studies on the pineal organ of white crowned sparrow, Zonotrichia leucophrys gambelii.
Z.Zellforsch.Mikrosk.Anat.124(2):247274
Owman,C. and C. Rrudeberg, 1970: light, fluorescence and electron microscopic studies on the pineal
gland of pike, Esox lucius L, with special regard to 5hydroxytryptaminase. Z.Zellforsch.Mikrosk.
Anat.107(4):522550.
PrzyblyskaGornowicz,B. and B. Lewezuk, 1997: cytoplasmic dense bodies in pig pinealocyte during
postnataldevelopment:Quantitativeandultrastructuralstudy.FoliaMorphol.(Warsz).56(1):1321.
Reus,S., C. Spies, H. Shroder and L. Vollrath, 1990: The aged pineal gland: reduction in pinealcyte
numberandadrenergicinnervationinmalerats.Exp.Gerontol.25(2):183188
Reynolds,E.,1965:TheuseofleadcitrateathighpHasanelectronopaqueinelectronmicroscopy.J.
CellBiol.,26:208215
Romijn,H., 1973: Structure and innervation of the pineal gland of the rabbit, An electron microscopic
investigation.Z.Zellforsch.Mikrosk.Anat.141(4):545560.
Ueck,M.,1973:fluorescenceandelectronmicroscopicstudiesofthepinealbodyindifferentspeciesof
birds.Z.Zellforsch.Mikrosk.Anat.137(1):3762
Uria,H.,I.Antolin,D.Tolivia,M.RodriguesandP.Menendes,1992:thepinealglandofthetrumpet
tailedrat(Octodondegus).J.pinealRes.13(4):174183.
Uz,T.,M.Akhisaroglu,R.AhmedandH.Manev,2003:Thepinealglandiscriticalforcircadianperiod1
expressioninstriatumandforcircadiancocainesensitizationinmice.Neuropsychopharmacology28(12):
211723.

LISTOFFIGURES
Figure(1) : Aphotomicrographofthepinealgland of a buckshowinga thincapsule and extensive
networkofreticularfiberssupportingthepinealparenchyma.Gomorireticulinmethod,X400
Figure(2):Aphotomicrographofthepinealglandofabuckshowingpinealocytesarrangedinclustersor
irregulargroupspermeatedbybloodvessels(V).Note,thepinealsand(arrow).Hx&Estain,X,200
Figure(3):Aphotomicrographofthepinealglandofabuckshowingbundlesofunmyelinatedfibers(F)
runindifferentdirections.Hx&Estain,X,200
Figure(4):Anelectronmicrographofthepinealglandofabuckshowingcrosssectionsofunmelinated
axons(F).Uranylacetateandleadcitratestain,X10000
Figure(5):Ahighermagnificationofthepinealglandofabuckduringdarkperiodshowingpinealocyte
(arrow) is large polyhedral cells containing large oval to spherical nucleus. The gland contains blood
vessels(V)engorgedwithblood.Hx&Estain,X1000
Figure(6):Aphotomicrographofthepinealglandofabuckduringdarkperiodshowingpinealocyte(P)
withitslongandbranchedcytoplasmicprocesseswhichterminateinbloodvessel(V)orsynapsedwitha

17

Lucrritiinificevol53seriaMedicinVeterinar

nerve (N). Note astroglia (A) with its short processes. Silver impregnation technique (Cajal's method).
X1000
Figure(7):Anelectronmicrographofthepinealocyteofabuckduringdarkperiodshowingnumerous
endoplasmic reticulum , mitochondria (M), secretory granules of variable shapes (arrow) and lipid
droplets(V).Uranylacetateandleadcitratestain,X10000
Figure(8):Aphotomicrographofthepinealglandofadultabuckdarkperiodshowingastrongreaction
(darkbrown)inthepinealocytes.Indirectimmunoperoxidasetechnique.X400
Figure(9):Aphotomicrographofthepinealglandofabuckduringlightperiodshowingpinealocytes
(arrow)withclearnongranularcytoplasm.Hx&Estain,X1000
Figure (10) :An electron micrograph of the pinealocyte of a buck during light period showing many
mitochondria (M), endoplasmic reticulum , and lipid vacuoles (V).Note the absence of secretory
granules.Uranylacetateandleadcitratestain,X10000
Figure (11) : A photomicrograph of the pineal gland of a buck during light period showing very faint
reactioninthepinealocyte.Indirectimmunoperoxidasetechnique.X400

18

UniversitateadetiineAgricoleiMedicinVeterinarIai

19


COMPARATIVESTUDYOFVASCULARARTERIALREACTIVITYAT
SEVERALMAMMALSPECIES:
1.THEREACTIVITYOFARTERIALSMOOTHMUSCLESATTHE
VASOCONSTRICTORAGENTSANTIDIURETICHORMONE
(VASOPRESSIN)

S.BescheaChiriac
UniversityofAgriculturalSciencesandVeterinaryMedicine, Iasi
FacultyofVeterinaryMedicine

Vascular reactivity is one of thethree pillars on which lies the regulation of arterial pressure in
livingorganisms.Arterialpressureisoneofthemaindeterminantsoftheactivitystateofvarious
organsandsystemsbothinhealthyandinpathologicallyalteredstates.Thepresentstudyaims
toward identifying similarities and differences between the resistance arteries belonging from
variousmammalspeciesthataremostinvolvedinveterinarypractice:rats,cats,dogsandhorses.
The arterial fragments prelevated from animals dead due to various clinical and traumatic
conditionsunrelatedtovascularpathologywerenormalizedusinganewlyintroducedsystemof
quantification,theforceindexsystem.Thishasbeencalculatedusingthewetweightparameter
and the force generated after administration of various pharmacological agents that cause
vasoconstriction. The artery fragments were fitted in organ baths using the KrebsHenseleit
saline, thermostated at 37 C and bubbled with a mixture of 95% O2 and 5%CO2. Vascular
endotheliumwaseitherkeptorremovedusinggentlerubbingwithmoistfilterpaper.Controlof
endothelial removal was made both functionally, using carbachol (synthetic derivative of
acetylcholine) and microscopically, after testing. The force generated was measured using
isometric force transducers coupled to a computerized acquisition system. The pharmacological
vasoconstricting agents used were phenylephrine (synthetic derivative of epinephrine), KCl
(potassiumchloride4080mM,asdepolarizingagent)angiotensinII,andvasopressin.Theresults
werestatisticallyinvestigatedusingthettestandANOVAtesting.Thepreliminaryresultsshowa
dependenceoftheforcegeneratedantheamountofmusclepresentinthevariousspeciesfrom
which the arteries were taken, a specifically increased response of felinederived arteries to
angiotensinandaspecificallyincreasedresponseofcaninederivedarteriestovasopressin.These
results will be used as controls for further testing in various pathological conditions and for
various other pharmacological agents used in the therapy of vascularlyinduced pathological
states.
Keywords:vascular,reactivity,arterial,vasoconstrictoragent

The aim of this study is to investigate the most common modifications encountered in the
veterinarypracticeinthevasculararterialreactivitythatcouldbeinvolvedinthepathogenesis
ofvariousanimalspecies.Wealsowishto makea comparativeinvestigationof thevascular
reactivity at the arterial segments collected from different mammal species the veterinary
pathologyhasmostfrequentlytodealwith,segmentswhicharehistologicallyandfunctionally
similar.
Theinvestigationofthemethodsthatareatthebasisofthearterialtonusadjustmentandof
themetabolismofthearterialsmoothmusclefiberreliedinthelasttwodecadesonthevery
wellknownisometrictransducerspatternandonthatoftheannularpreparationofdifferent
arteries.Thearterialductofelectionusedforthesetypesofinvestigationsistherataorta,as

20

Lucrritiinificevol53seriaMedicinVeterinar
it combines most of the stability, accessibility, disposability and controllability conditions
requiredforatrustworthyinvestigation.Thepriceisalsoanimportantcriterioninthismatter.
Although the above mentioned pattern is so very well known, still, the rat is not a perfect
modelinwhatthecardiovascularmodelingisconcerned;itisnotsimilarwiththehumanbeing
andevenlesswithothermammals.Thisexperimentalmodelwasusedinstudiesasfromhalf
centuryago[3].
Thus fragments of arteries collected from dogs, cats and horses were used as subject to an
experimental comparative investigation with standardized thoracic aorta rings taken from
Wistarrats.

MATERIALSANDMETHOD

Thereactivityofthearterialringswasmeasuredintermsofbothabsoluteforce,measuredas
force index (the force in mN of the preparation reported at its weight in mg) and relative
reaction towards a standardized witness. Also, where possible (considering the preparations
availability)curvesdose/effectweremade,involvingthe majorityof theknownvasorelaxing
andvasoconstrictorsubstancesthatarepharmacologicallywellcharacterized.
Thecomparativestudywasmadeonsimilararteriesinwhattheirdimensionsareconcerned,
being part of the resistance segment, in this situation branches from the gastric coronary
arteryorthesuperiormesenterywhichhadsimilardimensions:maximumlength:2mm, =1
mm, weight 1015 mg. The force of contraction was quantified in N/mg wet weight.(4) The
organpartsweretakenfromtheMedicalCliniqueandtheSurgeryCliniquefromtheFacultyof
Veterinary Medicine, from dead animals that were not subject of legal euthanasia nor had
affectionswithvascularimplications.[8]
After dissection the vessels were exsanguinated, washed in a solution of physiological salt,
sectioned in fragments of 510 cm and then put into KrebsHenseleit serum (prepared
according to the formula) and transported in maximum 30 minutes to the place of the
experiment.
The aorta fragments were fixated through a metallic serfina on the bottom of the isolated
organbaths,andtheringtensionedthroughtheverniersofthetensiometricalstampstoan
initialtensionof100mN.
The vascular endothelium was removed by gentle rubbing with damp filter paper whenever
the experimental characteristics required it. The presence of the functioning vascular
endotheliumwaspharmacologicallyverifiedusingcarbacholandthroughdirectmicroscopy.
Theaortaringsweresetinorganbathscontaining4mlofKrebsHenseleitphysiologicalsalt,
(composition(mN):NaCl118;KCl4.7;2.52;MgSO41.64;NaHCO324.88;KH2PO41.18;glucose
5.55), thermostated at 37C andbubbled withcarbogen (a mixture of 95% oxygenand 5%
carbondioxide).
Isometric force transducers connected to a computerized system for data acquisition were
usedfordetectingthecontractionsofthevascularsmoothmuscles...
The preparations wereallowed to equilibrate for 6090 minutes under a rest tension of 100
mN.
Theaortaringswereafterwardsprecontractatedwithphenylephrine(107106)MandK+(40
70 mM) and treated with carbachol (106M) for releasing endothelial NO [6]. The absolute
magnitudeofthecontractionswasof17525mNforthephenylephrine(106 M)andK+(40
70mM)

21

UniversitateadetiineAgricoleiMedicinVeterinarIai
RESULTANDDISCUTION

The effects of administering antidiuretic hormone (Vasopressin) on the contractility of the


arterialpreparations
The ADH hormone, also known as Vasopressin, is an essential neuropeptide for the
cardiovascular homeostasis. Vasopressin was among the first peptide hormones ever
described and it is clinically used for more than five decades, especially in treatment of
diabetes insipidus and of upper gastrointestinal bleeding due to esophageal varices.
Vasopressinisalsomoreandmoreoftenusedintherapeuticmanagementofshock,whether
itissepticorvasodilatorduetodifferentreasons.
The ADH is a nonapeptide having a disulfide bridge between twocysteinic amino acids. It is
synthesizedintheparaventricularandsupraopticnucleusesofthehypothalamus,transported
coupledtotheneurophysinsalongthehypothalamohypophysealtracttotheneurohypophysis
andstoredingranules.
Theeffectofthishormoneisachievedthroughtwotypesofreceptors,V1, foundintheblood
vessels (on the vascular smooth muscle)and which mediates the vasoconstriction througha
cascadeofmediatorsinvolvingphospholipaseCandreleaseofcalciumionsfromintracellular
storesthroughtheinositolphosphatesystem.
TheV2receptorsarelocatedinthedistalrenaltubuleandkidneycollectingtube.Theireffect
is to stimulate the expression of aquaporines (water channel proteins) in the tubule, thus
allowingreuptakeofwaterandantidiureticeffect.
In normal conditions, AHA has little effect on arterial pressure and the doses at which its
vasoconstrictoreffectbecomesnoticeableareatleast10timeshigherthannormalplasmatic
concentrations.However,inconditionsofhypotension,itsplasmaticconcentrationincreases
greatly and its vasoconstrictor effect allows keeping a high arterial pressure in the initial
period.
2000
1950

Forta (mgF)

1900
1850
1800
1750
1700
1650
1600
1550
1500
3300

3800

4300

4800

5300

timp (sec)

Figureno.1Characteristicaspectofvasopressincontractionontherataorta

ButastheADHneurohypophysealreserveslessen,itsplasmaticconcentrationdecreasesand
its benefic effects those of keeping the arterial pressure at quasiphysiological levels are
fading.

22

Lucrritiinificevol53seriaMedicinVeterinar
The administrations in isolated preparations were made using the Desmopressin Acetate
(Ferring)preparationinformofampoulesof4g/mL.Thepreparationisasyntheticanalogue
of the natural 8argininevasopressin hormone, under the form of argininevasopressin
monoacetatetrihydrate.Thedoseswereadministeredstartingfrom1012Mto108M.
Intherataortapreparationsandinsplanchnicarteriesfromcat,dogandhorse,vasopressin
producedatoniccontraction,withtheappearanceofadescendingplateauoveraperiodof
1015minutes(Fig.1).
TheforceindicesobtainedatthevasopressincontractionarepresentedinTableno.1

Tableno.1
ForceindexafteradministrationofADH108M
Animal
Rat
Cat
Dog
Horse

FI
3,91,25
4,10,75
6,51,5
7,10,89

Regarding the force produced, this is the most powerful of all preparations
administered,exceptforthe adrenergicagonistphenylephrine.Fromthedoseeffectcurve
configuration(Fig.no32)itcanbeseenthatverylowdoses(1012Mphysiological)produce
little contractile effects, while with higher (pharmacological) doses, from 1010 M, the
contractile effects are close to maximum, having a curve with biphasic aspect. The curve
aspectsuggeststhepresenceofquantumeffectsattheV1typereceptors.

8
7

FI (mN/mg)

6
Rat

Cat

Dog

Horse

2
1
0
12

11

10

Vasopressin log dose

Figureno.2Vasopressindoseeffectcurveinendothelizedpreparations
fromvariousspecies

Vasopressincontractionhasanumberofparticularfeaturesconcerningthedynamic.
The contractile plateau lasts for only 1015 minutes and after that it ceases and a new
administrationnolongerproducestheoriginaleffect(possiblytachiphylacticphenomena).
23

UniversitateadetiineAgricoleiMedicinVeterinarIai

9
8
7
6
FI

Rat
5

Cat

Dog
Horse

3
2
1
0
1

Figureno.3Vasopressincontractionforceafteradministrationof1010Mdesmopresin.The
differencesbetweenendothelizedanddeendothelizedpreparationsdonotexhibitstatistic
significance
Italsoshouldbesaidthatindogscase,theeffectwassignificantlystronger,consideringthe
factthatthethicknessofthemuscularlayerwassmallerthanthatofthehorses,whichleads
totheassumptionthatdogshaveaparticularreactivityinwhatthevasopressinmediationis
concerned(Fig.no3).

CONCLUSION
1. Vasopressinreactivityproducesthehighestforce,exceptforthe adrenergicagonist
phenylephrine.
2. Fromthedoseeffectcurveconfigurationitcanbeseenthatverylowdoses(1012M
physiological)producelittlecontractileeffects,whilewithhigher(pharmacological)
doses,from1010M,thecontractileeffectsareclosetomaximum,havingacurvewith
biphasic aspect. The curve aspect suggests the presence of quantum effects at the
V1typereceptors.
3. In dogs case the effect was significantly stronger, considering the fact that the
thicknessofthemuscularlayerwassmallerthanthatofthehorses,whichleadsto
the assumption that dogs have a particular reactivity in what the vasopressin
mediationisconcerned.

BIBLIOGRAPHY
1.

2.
3.
4.

ArmsteadWM,LipptonHL,HymanAL,KadowitzPJ.,1984Analysisofadrenergicresponses
inthemesentericvascularbedofthecat;evidencethatvascularbeta2adrenoceptorsare
innervated.CanJPhysiolPharmacol.62(12):14708.
BecheaChiriacSorin,SerbanDN.,2001Mechanismsinvolvedinthevascularactionof
phenamyl,Lucr.St.vol.44.,USAMVIai,p.151159;
BeznakM.,1956Hemodynamicchangesfollowingaorticconstrictioninnormalandin
hypophysectomizedrats.CanJBiochemPhysiol.,34(4):7918.
GuimaresS.MouraD.,2001VascularAdrenoceptors:AnUpdatePharmacolRev.53:319
356.

24

Lucrritiinificevol53seriaMedicinVeterinar
5.

HaulicaI,BildW,MihailaCN,IonitaT,BoisteanuCP,NeaguB.,2003Biphasiceffectsof
angiotensin(17)anditsinteractionswithangiotensinIIinrataorta.JReninAngiotensin
AldosteroneSyst.4(2):1248
6. JiangH,HalaykoAJ,RaoK,CunninghamP,StephensNL.,1991Normalizationofforce
generatedbycanineairwaysmoothmuscles.AmJPhysiol.260(6Pt1):L5229.
7. MoncadaS.,PalmerR.M.J.,HiggsE.A.,1991Nitricoxide:physiology,pathophysiology,and
pharmacology.Pharmacol.Rev.,43:109142
8. RozenfeldV,ChengJW.,2000Theroleofvasopressininthetreatmentofvasodilationin
shockstatesAnnPharmacother.34(2):2504.
9. ***LEGEnr.471din9iulie2002BuletinulOficialalRomniei,privindaprobareaOrdonantei
Guvernuluinr.37/2002pentruprotectiaanimalelorfolositenscopuristiintificesaunalte
scopuriexperimentale.
10. HolmesCheryl,PatelB.M.,RussellJ.A.WalleyK.R.,2001PhysiologyofVasopressinRelevant
toManagementofSepticShockChest.120;9891002

25


MORPHOCLINICALASPECTSOFBABESIOSISINHORSES

BoghianV.,MlncuR.N.,AcatrineiD.,PacaS.,
AntonAlina,SolcanGh.
FacultyofVeterinaryMedicineIasi
AlleyM.Sadoveanuno.8
vboghian@yahoo.com

Abstract:
In7horseswithclinicalsignsofcorticalsyndromeintheinhibitionphase,subicteranddarkurine
were performed blood counts (HLG), cytomorphological examination of the blood smear (May
Grunwald Giemsa stained), biochemical profile and macroscopic examination of the internal
organs.Bloodcountrevealednormochromicnormocyticregenerativeanemiawithalownumber
of red blood cells (5.3 x103/mm3). Blood biochemical examination revealed hepatobiliary
insufficiency(ALT=88.9IU/L,ALP=222.7IU/L)andrenalinsufficiency(BUN=35.7mg/dl=
2.8mgCRTN/dL).
Disease has been confirmed by observing endoglobular merozoits of B. equi and in
morphopathologicalexaminationwerefoundbleedingpointsintheheartandsplenomegaly.
Keywords:babesiosis,equine,B.equi

Babesiosis is a hemosporidiosis also called piroplasmosis produced by sborozoa from


BabesiidaefamilydisseminatedbyhematophagousmitesfromIxodidaefamily,alsoknownas
tick.EachspeciesofBabesiaspeciescorrespondstoatick.InhorsesthediseaseiscausedbyB.
equi, B. cabali, Nutallia equi and newer by B. canis. The disease is characterized by the
modified general condition, anemia and nervous manifestations predominantly represented
bycorticalinhibition,whichleadstodeathunlessetiologicaltreatmentisapplied.(3,4).
Inthispaperwepresentsomemorphoclinicalaspectsofbabesiosisinhorsesthatareuseful
toguidediagnosis,soetiotropictreatmentcanbeapplied.

MATERIALANDMETHOD
Observationsweremadeonsevenhorses(4stallions,twomaresandahorse)agedbetween
twoandeightyearspresentedtotheMedicalClinicoftheFacultyofVeterinarySciencefrom
Iai. Diagnosis was established by collating data obtained at clinical examination with some
laboratory data. Such was performed blood counts (CBC), biochemical profile, and
cytomorphological blood smear examination using MayGrunwald Giemsa staining.Afterthe
performed treatment, 6 animals were cured and one died because of complications
(pulmonaryedema).Inthisanimalwasperformedamacroscopicexaminationoftheinternal
organs.

RESULTSANDDISCUSSION
Guideline the diagnosis to babesiosis started from a similar clinical environment in all seven
cases:lossofappetite,signsofcorticalinhibition(tolerance,adynamie,drowsiness)andrectal
temperatureexceedingtheupperlimitofreference(39.50C).Themucousmembraneshada
subictericcharacter,cyanoticappearanceandtheurinewasbrown(fig.1)

26

Lucrritiinificevol53seriaMedicinVeterinar

Fig.1.
Thesubictericmucousmembraneandbrownurine
HaematologicalexaminationresultsareshowninTable1and2.

Table1.

Blood
Paramet
ers
Measure
ment
units

Haematologicalparametersinhorseswithbabesiosis
Bloodsmear
Leu Mat You
Baz
Erythro
co
Eosi
ng
ure
Hb Ht
Mono
o
cytes
cyte neut neut no
cyte
phi
s
phils
ro
ro
ls
phils phils
mil/l

g/
dl

mii/
l

Referenc
e

612

10

18

32

48

6
12

30
75

Horses
with
babesios
is(n=7)

5,3

20
,4

49
,2

5,0

76,0

Limpho
cyte

01

110 03

18

2560

2,0

4,0

2,7

21,3

1,0

Table2.
Derivedbloodconstantinhorseswithbabesiosis
Blood
parameters
Measurement
units
Reference
Horseswith
babesiosis
(n=7)

VEM

HEM

CHEM

picograme(pg)

g/dl

3458

1319

3137

47,0

16,6

35,2

Haematological examination revealed the existence of an anemic syndrome, normochromic


normocyticregenerativeanemiawithalownumberofredbloodcells(5,3mil/l).
27

UniversitateadetiineAgricoleiMedicinVeterinarIai

Wealsoobservedalownumberofleucocytes(5.0thousand/ml).Increasedhemoglobin(Hb
=20.4g/dL)andhematocrit(Ht=49.2%)showedthepresenceofdehydration.
BiochemicalprofileresultsarepresentedinTable3.
Table3.
Biochemicalprofileinhorseswithbabesiosis
Biochemical
Profile
Measuremen
tunits

Hepaticprofile
TP
g/d
l

AST

ALT

ALP

UI/L UI/L

UI/L

GGT

TBIL
mg/d
UI/L
l

DBIL
mg/d
l

Renalprofile

BUN CRTN
mg/d mg/d
l
l

Reference

5,7
7,9

116

287

2,7
21

70
227

2,7
22

0,3
3,0

10,4
25,0

0,9
2,0

Horseswith
babesiosis
(n=7)

6,3

31,3

88,
9

222,
7

23,
9

3,3

0,5

35,7

2,8

AsseeninTable3thereexistsanhepatobiliaryfailure:ALT(alanineaminotransferase)=88.9
IU/L, ALP (alkaline phosphatase)=222.7 IU/L, GGT (gammaglutamyltransferase)=23.9 IU/L,
TBIL (total bilirubin)=3.3 mg/dL and renal failure: BUN (blood urea nitrogen)=35.7 mg/dL,
CRTN(creatinine)=2.8mg/dL.
Cytomorphological examination of the blood smear stained May Grunwald Giemsa revealed
theexistenceofBabesiaequiendoglobularmerozoitsandintensehemolysis(fig.2).

Fig.2.Babesiaequimerozoitsandhemolysis

Fig.3.Splenomegalyandbleedingpointsintheheartbase
28

Lucrritiinificevol53seriaMedicinVeterinar

Macroscopic examination of internal organs from an animal died due to complications


revealedsplenomegalyandbleedingpointsintheheartbase(Fig.3).
Cause of death was acutepulmonary edema and hemolytic anemia due to heavy parasitism
(Fig.4.)

Fig.4.Acutepulmonaryedemaandtickparasitism
FromtheperipheralbloodsmearstainedMayGrunwaldGiemsawereidentifiedendoglobular
parasitesinallcasesfactthatconfirmedthediagnosis.
ThetreatmentwithBerenilinadoseof0.0035g/kg7%extemporaneuspreparedsolutionor
Imizolinadoseof4ml/100kgledtoremissionofclinicalsignsstartingwiththesecondday
and clinical cure in 6 cases after about 3 days in which symptomatic treatment was also
performed.

CONCLUSIONS

1. Diagnosis of babesiosis has gone from a common hemosporidiosis clinical framework:


corticalsyndromecorticalininhibitionphase,subicteranddarkurine.
2.Bloodcountrevealednormochromicnormocyticregenerativeanemia,withalownumberof
redbloodcells(5.3x103/mm3).
3.Bloodbiochemicalexaminationrevealedhepatobiliaryinsufficiency(ALT=88.9IU/L,ALP=
222.7IU/L)andrenalinsufficiency(BUN=35.7mg/dl=2.8mgCRTN/dL).
4.Morphopatologicalwerefoundbleedingpointsintheheartandsplenomegaly.
5. The diagnosis of babesiosis was confirmed by eidentification of B. Equi endoglobular
merozoits.

BIBLIOGRAPHY

1. BOGHIAN V., SOLCAN GHE., LUMINIA DIANA HRICU, BECHEACHIRIAC S. I., 2003, Particulariti
morfoclinice ale babesiozei canine, al IXlea Congres Naional de Medicin Veterinar, Iai, Rev. Rom.
Med.Vet.,vol.13,nr.34,p.288iLucr.t.USAMVIasi,MedicinaVeterinara,vol.46,p.362364,ISSN
14547406.
2. MORAILLON R., FOURRIER P., LEGEAY Y., LAPEIRE C., 1997, Dictionnaire pretique de therapeutique
canineetfeline,4eed,Masson,Paris.
3. DULCEANUN.,CRISTINATERINTE,MITREAL.I.,CARMENPOLCOVNICU,2000,Dicionarenciclopedic
deparazitologie,Ed.AcademieiRomne,Bucureti.
4. DULCEANUN.,CRISTINATERINTE,1994,Parazitologieveterinar,vol.1,Ed.Moldova,Iai.
5. THE MERCK VETERINARY MANUAL, 1998, eighth edition, Merck & Co., Inc. Whitehouse Station, NJ
USA.

29


KERATOPATHIESINCARNIVORES:CLINICALSIGNSANDLOCAL
PATHOLOGICRESPONSES

IOANABURCOVEANU,I.BURTAN,ROXANATOPAL,
L.C.BURTAN,M.FNTNARIU
UniversityofAgriculturalSciencesandVeterinaryMedicine, Iasi
ioana.burcoveanu@gmail.com

The cornea is the perfectly transparent, avascular, anterior component of the fibrous,
outercoatoftheeye,alongwiththeopaque,posteriorsclera.Cornealpathologyvaries
from congenital disorders to tumors, primary or by extension. Keratitis define the
inflammationofthecornea,thatmayhavenumerouscauses,liketrauma,noninfectious
(physical, chemical) or infectious (bacterial, viral, fungal, parasitic) agents, immune
reactions. Acquired corneal pathology may be categorized as ulcerative or
nonulcerative,infectiousornoninfectious,orbycause,topography,depth,etc.
Clinicalsignscanalsovarygreatly.Generally,weobserveblepharospasm,photophobia,
hyperemic conjunctiva, epiphora, serous or mucopurulent discharge that clings to the
ocularsurface.Becauseofitscompactconstruction,pathologicreactionsinthecornea
tendtoevolvedifferently,regardingtheirspeedofonsetandrecovery.Themajorityof
clinically important keratopathies develop one or more of the following local signs:
edema, vascularisation, pigmentation, cellular infiltrates, accumulation of lipid or
mineralmaterialinthestromaandcornealfibrosis,withscarformation.
Optimalaetiologicdiagnosisandclinicalmanagementrequireknowledgeoftheclinical
signslistedabove.
Keywords:cornea,keratopathies,symptoms,carnivores

Thecorneaistheperfectlytransparent,anteriorcomponentoftheeye,playingtheroleofa
convexconcavelens. It has no blood vessels or pigments, its thickness varying in animals
from0,56to1mm(0.50.8mm)(5),becominglessthickerattheperiferyindogsandcats
(4).Theposteriorpartoftheouter,fibrouscoatoftheeyeisthesclera.Thepointatwhichthe
corneaandscleramergeiscalledthelimbus(1,3,4,5).Thecorneaplaysmanyroles,suchas:
mechanical,optical,immunologicalandtissuehealing.(4)
From outside to inside, the cornea has 5 layers: epithelium, its basement membrane
(Bowman),stroma,Descemetsmembrane,endothelium(posteriorepithelium).Itisavascular
andithasnopigments,butithasasensitiveinnervation,providedbynasociliarynervesofthe
ophthalmic branch of the trigeminal nerve (cranial nerve V) (3, 5). The density of terminal
nervesishigherinthecenterandlesserattheperipheryofthecornea.
The cornea is the first barrier of the globe, being exposed to exogenous disorders (trauma),
endogenousfactors(cornealdystrophies,whichareinherited)ortotheextensionfromother
oculartissues(anteriorlensluxation,uveitis,neoplasia).
The present paper resumes the symptoms of clinically important keratopathies:
blepharospasm,epiphora,conjunctivalhyperaemia,aswellasthemajorpathologicresponses:
corneal edema, vascularisation, fibrosis (scar formation), melanosis, accumulation of an
abnormalsubstancewithinthecornea(lipid,mineral),stromalmalacia.

30

Lucrritiinificevol53seriaMedicinVeterinar

MATERIALANDMETHOD

Researchhasbeenachievedonthenumberofcasespresentedforophthalmicexaminationat
theFacultyofVeterinaryMedicineinIasi,theSurgicalClinic,throughouttheyears20072010
and at the Alfort Veterinary University Hospital Centre (Centre Hospitalier Universitaire
VtrinaireAlfortEcoleNationaleVtrinaireAlfort(CHUVAENVA),MaisonsAlfort,France),
inmarsapril2010.Fromthetotalnumberofcarnivores,wecollectedthosepresentedforan
ophthalmicdisorder,especiallythatofthecornea.Arelevantandthoroughhistory,completed
byanorderlyandextendedocularexamination,giveacorrectdiagnosisandthepossibilityof
successfulclinicalresults.

RESULTSANDDISCUSSIONS

Thegeneralsymptomsofkeratopathies,thatfirstdrawtheownersattentionandafterthatof
theveterinarian,aretheocularpain,translatedbytheblepharospasm,photofobia,epiphora,
oculardischarge.Blepharospasmcanbepresentatoneeyeoratbotheyes,dependingonthe
nature oftheaetiologicalagent(virus,bacteria,immunecomplexes)(photos 13).Discharge
thataccompanydifferentcornealdiseasescanbeserousormucopurulent(photos46).

1.Bilateralblepharospasm2.Rightblepharospasm3.Rightblepharospasm

CHUVAENVA

4.Unilateralepiphora5.Mucopurulentdischarge6.Diffuseconjunctivalhiperaemia,
CHUVAENVA

mucopurulentdischarge

The healthy cornea is completley transparent, due to the lack of blood vessels or pigments,
butwhenpathologicdisordersappear,wecanobservesomelocalpathologicchangesthatare
importantfortheclinician.
Clinically,thelossofcornealtransparencyistranslatedbycornealedema.Normally,corneal
structures fight against water entry, especially the endothelium and the epithelium. The
endotheliumextractswaterformthestroma,maintainingarelativedehydration.Anylesionof
thosetwocomponentsofthecornearesultsinedema.
Accumulationofwaterbetweenthestromalcolagenfibersgivesthecorneaabluecoloration,
whichbecomesopaque.Cornealedemacanbelocalizedordiffuse,epithelialorendothelial,
thelatterbeingmoreintenseanddiffuse.(photos7,8).

31

UniversitateadetiineAgricoleiMedicinVeterinarIai

7.Diffusecornealedema
8.Localizedcornealedema

When it appears, corneal vascularization is always pathological. Blood vessels can be


superficial,deeporboth.Superficialneovascularisationaretreelikevesseles,originatingin
conjunctival circulation. They occur whenever there is a lesion in the epithelium or the
anterior stroma. Deep vessels are short, parallel, hedgelike, originating in the cilliary
circulation.Thedepthofnewformedvesselsisagoodindicatorofthedepthoftheinitiating
lesion. In cases of persistent or complicated lesions, a granulation tissue can occur. The
CHUVAENVA
dinamicofcornealneovascularisationispresentedinphotos914.

CHUVAENVA

9.Superficialneovascularisation,cat.10.Superficialvessels,cat.11.Superficialvessels,dog.
CHUVAENVA
CHUVAENVA

12.Granulationtissue,dog.13.Granulationtissue,cat14.Deepvascularisation,dog.
CHUVAENVA

Corneal vascularisation is generally beneficial in stromal repair. Blood vessels advance from
the limbus, until they invade the lesion, corneal healing and regain of transparency starting
from the limbus, as it can be seen in photo 9. Keeping in mind those facts, although blood
vesselscanresultininfluxofpigmentsandinflammatorycells,easingcornealfibrosis,control
ifneovascularisationwiththeuseofsteroidsisnotalwaysindicated.

Cornealpigmentationisalsocalledpigmentarykeratitis.Thesetermsignorethepossibilityof
other pigments, like hemoglobin or the soluble pigment in corneal sequestra in cats, than
melanintocausecornealopacity.Nevertheless,itmustnotbeusedasadiagnosis,foritisonly
a sign of chronic, persistent corneal irritation, that may have many causes, each with a
differenttreatment.Melaninisdepositedintheepitheliumandtheanteriorstroma,migrating
alongwithbloodvessels,duringtheinflammatoryprocess.
Cornealmelanosisisasignofchronicirritation,asseenincasesofeyeexposureduetofacial
nerveparalysis,lagophtalmos,frictionalirritation(distichiasis,entropion)(photo.15),tearfilm

CHUVAENVA

32

CHUVAENVA

Lucrritiinificevol53seriaMedicinVeterinar
abnormalities(keratocojunctivitissicca)(photo16),chronicimmunologicstimulation(pannus)
(photos17,18).

15.Ventralcornealpigmentation,dog.16.Diffusecornealpigmentation,dog.
CHUVAENVA

CHUVAENVA

17.Lateralcornealpigmentation,dog.18.Ventralandlateralcornealmelanosis,dog.

CHUVAENVA
Cornealfibrosisappearsasaconsequenceofthestromalrepairprocess,whencollagenfibrils
dont order themselves in a parrallel manner, thus interfering with light transmission. The
opacity is localised in the stroma, the epithelium being intact, with some new vessels being
abletopersist.Meanwhile,thescarcanbecomeclear,butwillnotdisappearcompletely.The
tendencytoclearisgreaterinyounganimalsandmoreoftenincats.Scarmelanosisandlipid
accumulationoftenoccursindogs.Asitdevelops,thescarcanbenamednubecula,macula,
albugoandleukoma.Ifirisfibersareattachedtothecornealendothelium,thescarisnamed
anadherentleukome,withananteriorsynechia(photos1923).

19.Macula,dog.20,21.Adherentleukoma,catprofile,face.

CHUVAENVA

CHUVAENVA

22,23.Adherentleukoma,cat,profileandface.

Lipid or mineral accumulations appear as sparkly, white deposits in the corneal stroma,
situatedunderneaththeepithelium.Thistypeoflesioncanbeaprimarydiseaseinbreedslike
Beagle,Boxer,AiredaleTerrier,Caniche,Cocker,Doberman(photos2426).

33

UniversitateadetiineAgricoleiMedicinVeterinarIai
CHUVAENVA

CHUVAENVA

24.Corneallipiddystrophy25.Lipidcalciumdegeneration,26.Lipidcalcium
inaBeagle.

dog.

degeneration,dog.

Lipiddystrophyevolvesbilaterally,itisnotpainful,withminimumimplicationsontheanimals
sightandrequiresnotreatment.Lipid degenerationis associatedwithsignsofinflammation
(keratitis,scleritis,uveitis),havingthepossibilitytobetheresultofcornealulcersorcorneal
traumatisms having scarred with lipid accumulation. In some animals, we may notice high
levels of cholesterol in the blood, or other metabolic disorders, such as diabetes mellitus,
hypothyroidism,hyperadrenocorticismorprimaryhyperlipidemia.

Stromal malacia or melting occurs when collagenase, the enzyme responsible of


collagenolysis,isliberatedbycells,especiallyneutrophils.Thecorneabecomessoft,duetoits
lossofrigidity(lossofcollagenstructure).Theprocessisfollowedbydevelopementofadeep
cornealulcerordescemetocele(photo27).

27.Stromalmelting,dog.

CONCLUSIONS
1. Thecorneaistheperfectlytransparent,anteriorcomponentoftheeye,playingtheroleof
aconvexconcave lens,havingnobloodvesselsorpigments.
2. The general symptoms of keratopathies, that first draw the owners attention and after
thatoftheveterinarian,aretheocularpain,translatedbytheblepharospasm,photofobia,
epiphora,oculardischarge.
3. The majority of keratopathies develop one or more of the following local signs: corneal
edema,vascularisation,pigmentation,cellularinfiltrates,accumulationoflipidormineral
materialinthestromaandcornealfibrosis,withscarformation.
4. Clinically, the loss of corneal transparency is translated by corneal edema, when water
accumulatesinthecornealstroma.Edemacanbediffuseorlocalised.
5. Corneal vascularization is always pathological. Blood vessels can be superficial, deep or
both.Ithascaracteristicaspects,indicatingthedepthoftheinitiallesion.
6. Corneal melanosis is not a diagnosis, but a sign of chronic irritation. Although it doesnt
require a treatment, we must determine the cause of irritation, to prevent further
extensionofpigmentation.

34

Lucrritiinificevol53seriaMedicinVeterinar
7. Lipidorcalciumcanaccumulateinthesuperficialpartofthestroma,withoutaffectingthe
cornealepithelium.
8. Corneal fibrosis appears as a consequence of the stromal repair process, when collagen
fibrilsdontorderthemselvesinaparrallelmanner,thusinterferingwithlighttransmission.
Cornealscarsarecalled:nubecula,macula,albugoandleukoma(simpleoradherent,with
irisparticipation).

REFFERENCES

1. BurtanI.,2000Chirurgieveterinarregional,ed.IonIonescudelaBrad,Iai;
2. CerneaP.,DumitracheL.,1986Fiziologieocular,ed.Medical,Bucureti;
3. CoteaC.,2003Histologiespecial,ed.Tehnopress,Iai;
4. IonacuIuliana,MicluI.,2009OftalmologieveterinardinTratatdeMedicinVeterinar,vol.V.,
coordonatorConstantinN.,ed.Tehnic,Bucureti;
5. Maggs D.J., Miller P.E., Ofri R., 2008 Slatters Fundamentals of Veterinary Ophthalmology, 4th
edition,ed.SaundersElsevier,Missouri;

35

PATHOLOGICALEFFECTSANDTISSUEDISTRIBUTIONOF
MICROCYSTINLR(MCLR)AFTER48HOURSNONINVASIVE
EXPOSITIONOFNEWLYHATCHEDMEDAKA
(ORYZIASLATIPES)ELEUTHEROEMBRYOS

HlneHuet1,DelphineFranko2,ChakibDjediat2,
EvaPerez2,FranoisCrespeau1,AmaurydeLuze2
1

EcoleNationaleVtrinairedAlfort(France)
2
MusumNationaldHistoireNaturelledeParis(France)

Abstract
Medaka fishes euletheroembryos were submitted at 48 hours period of immersion in MCLR
containingmediaat1,5,10,15and20g/mlconcentration.Significantmortality(>10%)isonly
observedforhigherMCLRconcentration(20g/ml)inmedium.
Microscopicpathologicaleffectsafter 48 hoursimmersioninMCLR solution were searched on
transverse sections of paraffin embedded embryos fixed in formaldehyde. Histopathologic
studiesofparaffinembeddedembryosshows,from10g/mlMCLRconcentration,withvariable
intensity,vacuolizationofenterocytesandhepatocytes,degenerativeandnecroticchanges.
Onsamematerial,immunolabelingwithspecificmonoclonalantibodiesagainstMCLRwasalso
performed and appeared constantly and strongly positive in intestine (enterocytes and lamina
propria), liver (hepatocytes and probably macrophagic cells along sinusoids border). A faint
labeling was also characterized in kidneys epithelial cells, pancreas and yolk vesicle epithelial
border. No labeling was observed in skin, gills, oral epithelium, esophagus and stomach, heart
andvascularsystem,muscles,nervouscentralsystem
Ultramicroscopic pathological effects after 48 hours immersion in MCLR solution were also
searched on ultrathin sections of embryos fixed in paraformaldehyde and embedded in resin.
From10g/mlMCLRconcentration,transmissionelectronicmicroscopyclearlyshowsdisruption
of intercellular junctions in enterocytes and hepatocytes, some cytoplasmic vacuolation of
enterocytes,alterationofhepatocytesmembranewithregressionofmicrovillouscellborderwith
reductionofDissespacelengthandabnormalbiliarycanaliculiborder.

INTRODUCTION

Microcystins (MCs) are a family of hepatotoxic cyclic heptapeptides comprising at least 80


variantsandcongeners.Alltoxicmicrocystinvariantscontainauniquehydrophobicaminoacid
3amino9methoxy10phenyl2,6,8trimethyldeca4(E)dienoic acid (ADDA) (kongsuwan et
al.,1988).TheprototypecompoundisMCLR,whichhaveLeucine(L)andarginine(R)atthe
two hypervariable positions in the ring structure (Rinehart et al., 1988; Carmichael, 1992).
Thesetoxinsareproducedbyawidevarietyofplanktoniccyanobacteria,whichareoneofthe
mostprimitiveandworldwidedistributedfamiliesofphotosyntheticorganisms(Brock,1973,
Uenoetal.,1998).
MCs represent potential environmental fresh water toxins, mainly when climatic conditions
promotebloomsofcyanobacteriainpools,pondorlakes.
Theprimarytoxiceffectofmicrocystinsisinhibitoryreversiblebindingatthecatalyticsiteof
protein phosphatases 1 and 2A. This interaction involved principally the ADDA group. The
presenceofthemethyldehydroalanine(Mdha)inductedanirreversibleinhibitionbycovalent
linkage to the cystein sulphur on the phosphatases PP1 and PP2A (MacKintosh et al., 1995;
Runnegar et al., 1995). Direct injection of MCLR in mammals induced protein phosphatases

36

Lucrritiinificevol53seriaMedicinVeterinar
inhibition, hyperphosphorylation of membrane cellular proteins including the hepatocellular
cytoskeleton and loss of cellcell contacts in intrahepatic necrosis and hemorrhage. Death is
duetohypovolemicshock(Hooseretal.,2000,Beasleyetal.,2000).Afteradministration,MCs
cellular uptake is performed via specific organic anion transport proteins (Runnegar et al.,
1991, 1995). MCs exhibit a predominantly hepatic organotropism, althought mesenteric and
evendermaleffectshavebeendemonstrated.
In fish as in mammals, gavage, intraperitoneal, intravascular or intravitellin injection of
purified MCLR are all invasive approaches corresponding to acute exposure and lethal toxic
effects (Phillips et al., 1985, Raberg et al., 1991, Tencalla et al., 1994, Bury et al., 1997).
HowevertherearefewindicationsofwhetherandhowfisharesensitivetopurifiedMCLRby
invivoimmersion(Oberemmetal.,1999).
Ourstudiesweredesignedinviewtodeveloparapidsublethalbioassayallowingnotonlya
general assessmentonuptakeandtissuedistributionofMCLR,but also indicatingpotential
whole body external MCLRinduced developmental abnormalities. Thus, our experimental
studieswasmainlyrealizedinviewtosetupalowcost,sensitiveandreproduciblebioassay
withsomedegreeofthecertaintyontheabsorption,distributionandeffectsofMCLRinfish
afternaturalexposure.Intheseanimals,thelessinvasiveexperimentalapproachtostudyMC
LR effects is after natural immersion and the duration of our experimental procedure
correspondtoashortandacuteexposureoftwodays.
Medaka fish eleutheroembryos (Balon, 1975) could be contaminated by MCLR only via
environmentalwaterintakeorbyabsorptionofthepurifiedtoxinbyskinorgills.Immersion
also represents the most current way of exposure among human and animal populations
havingcontactwithcyanobacterialcontaminatedwater(FunariandTestai,2008).

MATERIALANDMETHODS

Products
According to the recommendation of the manufacturer (Alexis, Switzerland), dissolution of
purified MCLR in water is always incomplete; in absolute ethanol dissolution of MCLR is
complete.Amixedprocedurewasusedinourstudy:MCLRwasfirstdissolvedinfourvolume
absoluteethanol,followedbyadditionof1volumeofwater.Ethanolwastotallyevaporatedin
a speedvac (37C) during 4 hours and the mixture completed with water at the end of the
procedure to a final concentration of 0.2 g/ml (stock solution). A control solvent stock
solutionwasperformedusingthesameprocedure.

Medakabreedingandexperimentalprocedure
Medaka(Oryziaslatipes)progenitorsoftheinbredcabstrainwerekeptin8Lglassaquariaat
2628C under artificial reproductive cycle (14h Light10h Dark cycle). Fertilized egg clusters
werecarefullyremovedfromthefemaleprogenitorsand100200postfertilized(pf)eggsof
medaka fishes were collected and gathered in Petri dishes containing Yamamotos embryo
rearing medium (Yamamoto, 1975). The embryosweremaintained in an incubator (XBR125,
France Etuve) at 25C with a photoperiod (L:12hD:12h). The rearing medium was changed
everydayuntilthehatchingperiod,beginningatthetenthday.

Eleutheroembryoexposuresandassessment
All embryos hatching during the 24 hours interval of the tenth and eleventh day post
fertilizationweretermedJ0embryoandusedforexperimentalpurposeinouracuteeleuthero
fishembryotest.Duringthisintervaloftimeandunderourrearingcondition,thepercentage
37

UniversitateadetiineAgricoleiMedicinVeterinarIai
of hatched embryos represented approximately 60% (45 to 75%) of the collected eggs. The
vesiculatedeleutheroembryosweretransferredin12wellsmicroplates(5eleutheroembryos
in 2ml medium/well). Negative controls and MCLR media were not changed during the 48
hoursexperimentalprocedure.Thevesiculatedfishlarvaebeingfullyautotrophic,nofoodwas
given during the time course of the 48h experimental period. Noninvasive observations of
eleutheroembryos behavior were performed and eleutheroembryos were handled in
accordance with European Union regulations concerning the protection of experimental
animals.

Histopathologyprocess
Attheendoftheimmersionexperiment,survivinghatchedembryostreatedornot(control)
with MCLR were fixed in buffered formaldehyde solution 10% (v/v) for 24h. Fixed embryos
werethenclarifiedanddehydratedinsuccessivebathsofethanol(70%and95%)andbutanol,
andfinallytransferredintobathsofliquidparaffinat56C.Theywereindividuallyorientedand
embeddedintoblocksofparaffinwax.Transversesections(3,5mthickness)werehydratedin
successivebathsofethanol(100%and95%)androutinelystainedwithHematoxylineEosine
Saffron(HES,SigmaAldrich,France).Microphotographobservationsofhistologicaltransverse
sectionswerecarriedoutwithanAxioImagerZ1Zeissmicroscopeatvariousmagnifications.
Theallembryobeingcut,anconstantanatomicallevelwaschoseninthepectoralfinregionto
performobservationsonintestineandliver.

Immunohistochemistryprocess
Sectionsofparaffinembeddedtissuesweredeparaffinedintolueneandhydratedgraduallyin
ethanol (100% and 95%), washed in distilled water and then in 10mM phosphate buffered
saline(PBS,SigmaAldrich,France).Tissuesectionsweremicrowavedin10mMcitratebuffer,
pH 6.0 for 30min (350w microwave oven). Two different primary antiMCLR monoclonal
antibodies (Alexis Biochemicals, Switzerland) were tested: AD4G2 which recognizes all
microcystins because of its Adda specification and MC10E7 which recognizes all 4Arg
microcystins. The immunoassay was routinely performed with the NexES system (Ventana,
Tucson,USA).Aspositivecontrol,wechooseanadultmedakafishliver,whichproceededfrom
a gavage experiment with MCLR (Mezhoud and al, 2008), and tissue sections proceeded
withoutprimaryantibodywerechosenasnegativecontrol.

Transmissionelectronmicroscopy
Embryos were preserved in 0.5% glutaraldehyde in 2% paraformaldehyde solution for
transmission electron microscopy study during 24 hours and then, washed three times in
Sorensen phosphate buffer (0.1M, pH 7.4) in three successive 10min baths; finally embryos
weredehydratedinethanol(50,70,90and100)bythreebathsateachstepofdehydration
andtheembeddedinaepoxymixture(Spur).Mediumandultrathinsectionswereslicedwith
diamondknives(Diatome)onaReichertJungUltracutmicrotome.Ultrathinsectionsongrid
were then observed by transmission electronic microscope (Hitachi H 700S) with a camera
(LCD,Hamamatsu)atvariousmagnifications.

38

Lucrritiinificevol53seriaMedicinVeterinar
RESULTS

1)PathologicaleffectsofMCLRineleutheroembryosmedakaafter48hourstoxicexposure
byimmersion
The intestine wall of control eleutheroembryo medaka fish is organized in folds lined by
simple columnar epithelium composed of enterocytes and not associated with any kind of
mucosalorsubmucosalglands;MCLRtreatmentappearstoinduceaslightreductionofthe
intestinalfoldsassociatedwithamoderateenlargementoftheintestinallumenandvariable
degree of vacuolization of enterocytes with, sometimes, focal cleavage between epithelium
andlaminapropria.
In liver, the normally dense network of hepatocytes and vascular sinuses is observed in
control. In treated embryos, degenerative more or less megalocytic hepatocytes with
sometimesanisocytosis,anisocaryosisandnucleuspycnosisareclearlyobserved;furthermore
somenecrotichepatocytesarealsoapparentin20gMCLR/mltreatedembryos.
In some embryos, vacuolization of kidney epithelial is sometimes observed. Another
happening modification concerns yolk vesicle seeming to have late regression without clear
lesionsofsyncytialepithelialcellsatphotonicmicroscopicobservationlevel.
No significantlesions are observed in other tissues or organs: skin, gills, oral and esophagus
mucous membrane, nervoussystem tissue, muscle, spleen, cardiovascular system, pancreas,
esophagus

1) ImmunolocalizationofMCLR
UsingMCLRspecificantibodiesasdescribedsupra,astronglabelingisobservedat48hoursin
eleutheroembryostreatedbyMCLRinintestinalmucousmembrane(enterocytesandlamina
propria) and liver (hepatocytes and probably sinusoidal border associated macrophages).
Labeling is more intense in 20g than in 10g MCLR/ml treated embryos. No labeling is
observed in other organic structures (nervous tissue, other mucous membranes, spleen,
muscle,skinandgills,cardiovascularorgans.)butinyolkvesicleepithelialmembranewhere
verylightlabelingissometimesobserved.

2) Ultrastructuralobservation
Ultrastructural analysis performed on surviving eleutheroembryos indicated in enterocytes
andhepatocytesoftreatedanimals,acomplexsetofchangesoncytoskeletalstructureswith
no clear changes of nuclear chromatin, Golgi apparatus or mitochondria. In the liver,
endothelial cells appeared normal but a reduction of length of Disse's space was noticed in
treated fishes, due to reduction of the microvillus border of hepatocyte vascular faces. A
reductionofmicrovillushepatocyteborderwasalsonoticedatthebiliarysurfaceofthesecells
(in biliary canaliculi). Disjunction between hepatocytes was also observed and some
vacuolization of the cytoplasm. In enterocytes, a clear dissociation of the apical junction
complexwasnoticed,associatedtovacuolizationofthecytoplasm.

39

UniversitateadetiineAgricoleiMedicinVeterinarIai

DISCUSSION

Immersionin elevated MCLRconcentrationshadapparentlynosignificant externaleffectin


fish and amphibian, in contrast to the lethal observations performed after intraperitoneal
injection and oral application (gavage) of MCLR (Phillips et al., 1995, Tencella et al., 1994,
Oberemm,1999).
However, in fish eleutheroembryos species transferred in toxinfree media after embryonic
development and hatching preexposure to MCs, usually malformations, embryonic growth
inhibitionandhepatocellulartoxicityoccurred(Zhangetal.,2008,ElGhazalietal.,2009)with
apparentlyweakdesireforfood(Zhangetbal.,2008).
Medakafishattheeleutheroembryostagearefullyautotrophduringthefirstfourdaysafter
hatching. In our experience, these vesiculated larvae expressed no significant external and
histopathologicaleffectswhenexposedbyimmersionduring48hoursinmediumcontaining1
to10gMCLR/ml.
Significant mortality (>10%) during the experimental period (48 hours) was only observed
whenvesiculatedembryoswereimmersedatthehighestconcentrationofMCLR(20g/ml).
OurobservationagreesOberemmetal.data(1999)whodidnotobservedanyeffectofMCLR
atconcentrationashighthan0.1,1and5g/mlinzebrafisheleutheroembryos(Daniorerio)
after48hoursexposure.However,thesameembryosshowed,atthedoseof10gMCLR/ml,
pectoraledemaandenlargedandopaqueyolkafter24hoursexposure.Similarly,noeffecton
morphological development or survival during 10 days exposure were noticed during larval
development(tailbudstage)inthetoad(Bufoarenarum)atconcentrationsof120mgMCLR
/l(Chernoffetal.,2002).Nevertheless,onestudyshowedduringembryonicandlarvalstages
of loach (Misgursuns mizolepis) a very high sensitivity to MCLR exposure, resulting in
pericardial edema and tubular heart, bradycardia, poor yolk absorption, small head, curved
bodyandtail,andabnormalhatching.HeartandliverwerefoundtobeprimarytargetsofMC
LRinthislaterstudy(Liuetal.,2002).Therefore,theloach(Misgurunsmizolepsis)appearsthe
mostsensitivefishspeciestested.
In our medaka eleutheroembryos toxic test, using available commercially monoclonal
antibodies, we could clearly immunolocalize MCLR, mainly in intestine and liver whereas
somefaintlocalizationofMCLRwasalsodetectedinpancreas,kidneyandyolkvesicle.
At histological examination (paraffin embedded tissue with trichromic stain), lesions of
enterocytesandhepatocyteswereclearlydetected;mainlyvacuolizationbutalsovariationof
size cells with anisocytosis and anisocaryosis and necrotic changes with pycnosis in
hepatocytes. At ultrastructural level, one of the main observed effects of MCLR was the
rupture of the junction systems on the lateroapical side of the enterocytes and between
hepatocytes;theseobservationsareingoodagreementwithWangspublication(Wangetal.,
2005)describinglossofblastomerecoherencebyinterferingthedistributionsofcateninand
cadherinesinzebrafishembryoafterMCLRmicroinjection.
During our 48 hours toxic assay, immunolocalization of MCLR could be obtained mainly in
intestineandliver,likelyindicatinguptakeandbindingofMCLRbyenterocytesandtransfer
andbioaccumulationintotheliver(hepatocytesandprobablylocalmacrophages).
MCLRwasalsolabeledwithlighterintensityinpancreasandkidneysepithelialcells.
Incontrast,oral,esophagusandstomachmucosadidnotshowanysignofMCLRfixationor
accumulation.Nootherlabelingwasobservedinskin,gills,heartandvascularsystem,central
nervoustissueormuscle.Furthermore,noruptureofintercellularjunctioncomplexorother
significantlesionswereobservedintheseorgansandtissues.
40

Lucrritiinificevol53seriaMedicinVeterinar
Nevertheless, we are interested in tracing MCLR in epithelial syncytia cells of yolk vesicle
(datanotshown)andsomefurtherstudiesarerequiredduringtheearlytimeofimmersionto
precisethetoxicodynamicofMCLRuptake.
Normal liver tissue in fish is organized in a tubulosinusoidal pattern and differs from the
lobular pattern characteristic of mammalian liver. Medaka liver consists of sheetlike
arrangementsofparenchymalcellswithinterlacingsinusoidsandfewbileductsandcaniculi
(Hinton and Couch, 1998; Boorman et al., 1997). The fenestrated endothelium of sinusoids
actsasasieve,preventingpassageofbloodcellsintheDissesspace,butallowingsomeblood
proteins and small lipoproteins to pass through. Indeed, microvilli of hepatocyte membrane
increasetheexchangesurfaceofthesecellsalongtheDissesspaceborderandalsoalongthe
bile canaliculi border. Ultrathin sections observations using microscopy approach indicated
that medaka fish embryos exposed to 10 or 20g MCLR/ml showed a clear reduction of
membrane hepatocyte microvilli on the Disses space and on the biliary canaliculi surfaces.
These clear ultrastructure changes certainly results in a reduced exchange efficiency in
hepatocyteofMCLRtreatedmedakaeleutheroembryos.Microcystinisknowntocauseliver
damagesinfish(Philippsetal.,1985,Raberghetal.,1991,TencallaandDietrich,1997)andto
affectthebileacidtransportsysteminvolvedinMCLRtransportinhepatocyte(Runnegaret
al.,1995).
Controversial data are found depending of the species in the literature concerning the
bioaccumulationofMCintheliverfollowinggillmembraneabsorptionofMC(Casenaveetal.,
2005, Xie et al., 2005) whereas others studies suggest that epithelia of gills and skin of
freshwater fish form a barrier to MC transport (Tencalla et al., 1994, Bury et al., 1995). In
contrasttoothersstudies(Gaeteetal.,1994,Buryetal.,1995,ZambranoandCanelo,1996)
no gills damaging was observed in our study whatever was MCLR concentrations of the
medium.
Finally, histopathological and immunohistopathological studies permit to have better
comprehension of MCs toxicity and better knowledge about ways of penetration, tissue
repartitionandpathologicaleffectofthisimportantclassofnaturalenvironmentaltoxins.

Bibliography

1.

2.
3.

4.
5.
6.
7.

8.
9.

Azevedo SM, Carmichael WW, Jochimsen EM, Rinehart KL, Lau S, Shaw GR, Eaglesham GK
(2002). Human intoxication by microcystins during renal dialysis treatment in CaruaruBrazil.
Toxicology.181182:4416.
Balon,E.K.JFishResBoardCanad1975,32,16631670
Beasley VR, Lovell RA, Holmes KR, Walcott HE, Schaeffer DJ, Hoffmann WE, Carmichael WW.
2000. MCLR decreases hepatic and renal perfusion, and causes circulatory shock, severe
hypoglycemia, and terminal hyperkalemia in intravascularly dosed swine. J Toxicol Environ
HealthA.61(4):281303
BrockTD.1973.LowerpHlimitfortheexistenceofbluegreenalgae:evolutionaryand
ecologicalimplications.Science.179(72):4803.
Bury,N.R.;McGeer,J.C.;Eddy,F.B.;Codd,G.A.JFishDiseases1997,20,209215.
Carbis,CR,Rawlin,GT,Grant,P,Mitchell,GF,Anderson,JW,McCauley,I(1997)Astudyofferal
carp, Cyprinus carpio L., exposed to Microcystis aeruginosaat Lake Mokoan, Australia, and
possibleimplicationsforfishhealth.JFishDis20:8191
Carmichael WW. 1992. Cyanobacteria secondary metabolitesthe cyanotoxins. J Appl
Bacteriol.72:44559
Carmichael WW, Azevedo SM, An JS, Molica RJ, Jochimsen EM, Lau S, Rinehart KL, Shaw GR,
Eaglesham GK. 2001. Human fatalities from cyanobacteria: Chemical and biological evidence
forcyanotoxins.EnvironHealthPerspect.109:66368

41

UniversitateadetiineAgricoleiMedicinVeterinarIai
10.
11.
12.
13.
14.
15.
16.
17.

18.
19.

20.

21.

22.

23.
24.
25.
26.

27.
28.
29.

30.

31.
32.
33.
34.

ChernoffN,HunterES3rd,HallLL,RosenMB,BrownieCF,MalarkeyD,MarrM,
HerkovitsJ.2002.LackofteratogenicityofmicrocystinLRinthemouseand
toad.JApplToxicol.22(1):137
DonnanGA,FisherM,MacleodM,DavisSM(2008)."Stroke".Lancet371(9624):161223.
FunariE,TestaiE.(2008)Humanhealthriskassessmentrelatedtocyanotoxinsexposure.Crit
RevToxicol..:38(2):97125
HindmanSH,Favero MS, Carson LA, PetersenNJ, Schonberger LB, Solano JT.1975. Pyrogenic
reactionsduringhaemodialysiscausedbyextramuralendotoxin.Lancet.2:73234
Hooser SB. 2000. Fulminant hepatocyte apoptosis in vivo following microcystinLR
administrationtorats.ToxicolPathol.28(5):72633
Kungsuwan A, Noguchi T, Matsunaga S, Watanabe MF, Watabe S, Hashimoto K. (1988)
Properties of two toxins isolated from the bluegreen alga Microcystis aeruginosa. Toxicon.
26(2):11925.
LiuY,SongL,LiX,LiuT.2002.ThetoxiceffectsofmicrocystinLRonembryolarvalandjuvenile
developmentofloach,MisgurunsmizolepisGunthe.Toxicon.40(4):3959
Magalhes VF, Soares RM, Azevedo SM. (2001) Microcystin contamination in fish from the
Jacarepagu Lagoon (Rio de Janeiro, Brazil): ecological implication and human health risk.
Toxicon,39(7):107785
MacKintosh RW, Dalby KN, Campbell DG, Cohen PT, Cohen P, MacKintosh C. 1995. The
cyanobacterial toxin microcystin binds covalently to cysteine273 on protein phosphatase 1.
FEBSLett.371(3):23640.
MezhoudK,BauchetAL,ChteauJoubertS,PraseuthD,MarieA,FranoisJC,FontaineJJ,Jaeg
JP, Cravedi JP, PuiseuxDao S, Edery M. (2008) Proteomic and phosphoproteomic analysis of
cellular responsesinmedakafish (Oryziaslatipes) following oral gavage with microcystinLR .
Toxicon.;51(8):14319
Mezhoud K, Praseuth D, PuiseuxDao S, Franois JC, Bernard C, Edery M. (2008) Global
quantitative analysis of protein expression and phosphorylation status in the liver of the
medaka fish (Oryzias latipes) exposed to microcystinLR I. Balneation study. Aquat Toxicol.;
86(2):16675.
MezhoudK,PraseuthD,FrancoisJC,BernardC,EderyM.(2008)Globalquantitativeanalysisof
proteinphosphorylationstatusinfishexposedtomicrocystin.AdvExpMedBiol;617:41926
Phillips,M.J.;Roberts,R.J.;Stewart,J.A.;Codd,G.A.J.FishDiseases1985,8,339344.
Rabergh,C.M.I.;Bylund,G.;Eriksson,J.E.AquatToxicol1991,20,131146
Rinehart KL, Harada KI, Namikoshi M, Chen G, Harvis C, Munro MHG, Blunt JW, Mulligan
PE,Beasley VR, Dahlem AM, Carmichael WW. 1988. Nodularin, microcystin and the
configurationofADDA.JAmChemSoc110:855758
Runnegar M, Berndt N, Kong SM, Lee EY, Zhang L. (1995a). In vivo and in vitro binding of
microcystintoproteinphosphatases1and2A.BiochemBiophysResCommun.216(1):1629
M.T. Runnegar, R.G. Gerdes and I.R. Falconer, The uptake of the cyanobacterial hepatotoxin
microcystinbyisolatedrathepatocytes,Toxicon29(1991),pp.4351.
M.Runnegar,N.BerndtandN.Kaplowitz,(1995b)Microcystinuptakeandinhibitionofprotein
phosphatases: effects of chemoprotectants and selfinhibition in relation to known hepatic
transporters,ToxicologyandAppliedPharmacology134(1995),pp.264272
Soares RM, Yuan M, Servaites JC, Delgado A, Magalhes VF, Hilborn ED, Carmichael WW,
AzevedoSM(2006).SublethalexposurefrommicrocystinstorenalinsufficiencypatientsinRio
deJaneiro,Brazil.EnvironToxicol.21(2):95103
Tencalla,F.G.,Dietrich,D.R.andSchlatter,C.(1994)ToxicityofMicroc~stisaeruginosapeptide
toxintorainbowtrout(Oncorhynchusmykiss).Aquatictoxic.30,215224.
Tencalla, F. and Dietrich, D., 1997. Biochemical characterization of microcystin toxicity in
rainbowtrout(Oncorhynchusmykiss).Toxicon35,pp.583595.
UenoY,NagataS,SuttajitM,MebsDandVisconcelosV.1998.Immunochemicalsurvey
ofmicrocystinsinenvironmentalwaterinvariouscountries.Eds.MMiragala,HvanEgmond,C
BreraandJGilbert.In.MycotoxinsandPhycotoxinsdevelopmentsinchemistry,toxicologyand

42

Lucrritiinificevol53seriaMedicinVeterinar

35.
36.
37.
38.

foodsafety.AlakenInc.FortCollins,Colorado.
WatanabeMF,OishiS.1985Effectsofenvironmentalfactorsontoxicityofa
cyanobacterium(Microcystisaeruginosa)undercultureconditions.AppEnviron
Microbiol.49:134244
Wiegand, C., Pflugmacher, S., Oberemm, A., Meems, N., Beattie, K.A., Steinberg, C.E.W. and
Codd, G.A., 1999. Uptake and effects of microcystinLR on detoxication enzymes of early life
stagesofzebrafish(Daniorerio).Environ.

43


PREVALENCEOFCRYPTOSPORIDIUMSPP.ANDOTHER
ENTEROPATHOGENSINFECTIONSATCALVESINWESTERN,
CENTRALANDNORTHWESTERNROMANIA

Gh.DRBU ,V.COZMA ,K.IMRE1,A.BEJAN2,M.S.ILIE1,MIRELAIMRE1


1
FacultyofVeterinaryMedicineTimioara,CaleaAradului,nr.119
2
FacultyofVeterinaryMedicineClujNapoca,CaleaMntur,nr.35
email:gheorghe.darabus@fmvt.ro
1

Summary:Theaimoftheresearchwastorevealthemostimportantenteropathogenagentsin
calvesinthefirstmonthsoflifeandtoestablishtheirprevalenceinWestern,CentralandNorth
Western Romania. The study was carried out on 370 calves, with or without diarrhea, in seven
Counties.
Based on the coproELISA test, infections with Cryptosporidium (41.4%), rotavirus (16.2%),
coronavirus (10.3%) and Escherichia coli F5 (K99) enteropathogen (1.08%), were identified. The
mostcommonassociationwassemnalatedbetweenCryptosporidiumspp.andcoronavirus(5.9%)
followedbyCryptosporidiumspp.rotavirus(5.4%)mixedinfection.
Higher prevalence observed in monoinfections (38.4%) compared with associated infections
(14.3%),maysuggestapossiblecompetitionforthesamebiotope.

Keywords:Cryptosporidiumspp;rotavirus;coronavirus;EscherichiacoliF5.

Discovered in 1907 by Tyzzer in the gastric glands of mice, protozoans to the genus
Cryptosporidiumarepresentinmanydomesticanimals,humansandothervertebrates,having
large host specificity. In the last decades, given the pathological and zoonotic implications,
interest in studying this parasite has increased enormously, many knowledge being
accumulatedonbiology,epidemiology,diagnosisandcontrolofthisparasitosis(3,4,10,11,
12,17,18,19,31).
In mammals, especially in calves, in uncomplicated infections with microbial agents,
cryptosporidiosiscausesanincreasedmorbiditybutgenerally,lowmortality.Calves,especially
duringthefirstmonthoflife,aremostfrequentlyaffectedbyCryptosporidium,whichisoneof
themajorenteropathogensinvolvedinneonataldiarrhea.InfectionwithCryptosporidiumspp.
isoftenassociatedwithcoronavirus,rotavirusandEscherichiacoliF5(K99)(1,8,9,13,14,27,
30).
Asthediarrhealdiseasesyndromeincalvesisveryimportant,conventionaldiagnosismethods
were improved with immunological methods, for detection of oocysts and other
enteropathogensinfaeces(22,28).Thesensitivityandspecificityofimmunologicalmethodsis
undoubtedly(21,22,26).
The aim of this study was to determine the prevalence of cryptosporidiosis and other
infectionswiththreeenteropathogenagents,incalves,inthefirstmonthoflife,usingELISA
testinWestern,CentralandNorthWesternRomania.

MATERIALSANDMETHODS

ThestudywascarriedoutinWestern,CentralandNorthWesternRomaniainsevenCounties
(Arad,Bihor,CaraSeverin,Timi,Cluj,MureandSatuMare).Anumberof370calves,aged

44

Lucrritiinificevol53seriaMedicinVeterinar
between 130 days, with or without diarrhea, were examined between January 2008 and
December 2009. Faecal samples were collected directly from the rectum in sterile plastic
bottles.Recipientswerestoredat4Candthesampleswereprocessedusingacoproantigen
ELISAtestwithin24hours.
TheELISAkitusedwere:BioXEasyDigest(BIOK151)andBioXDuoDigestiveELISAKit(BIOK
083)accordingtothemanufacturersinstructions.

RESULTSANDDISCUSSIONS

TheprevalenceofinfectionwithCryptosporidiumandotherenteropathogensincalves,inthe
firstmonthoflife,ininvestigatedareasfromRomania,aresummarizedintable1.

Table1
Infectionswithenteropathogensincalves,inthefirstmonthsoflife,inWestern,Centraland
NorthWesternRomania
Investigatedareas
Infectionwith

Cryptosporidiumspp.
Rotavirus
Coronavirus
E.coliF5(K99)
Negative

WesternRomania
(n=315)

CentralandNorth
WesternRomania
(n=55)

numberofpositivesamples(%)
140(44.4)
13(23.6)
52(16.5)
8(14.5)
33(10.5)
5(10)

Total
(n=370)

153(41.4)
60(16.2)
38(10.3)

4(1.3)

4(1.08)

86(27,3)

29(52.7)

115(31.08)

Legend:n=numberofanimalsinvestigated.

Onthewhole,theprevalenceofCryptosporidiumspp.infectionswas41.4%.Theinvestigations
carried out in Western Romania revealed a significant higher prevalence (p<0,05) for
CryptosporidiuminfectioncomparedwithCentralandNorthWesternRomania.
Rotavirus infections were located in the second place, as weight (16.2%). Infections with
coronavirushadaprevalenceof10.3%andE.coliF5(K99)wasfoundin1.08percent.Onthe
whole, in the investigated areas, 31.08% from the processed samples were negative for the
enteropathogenstested.
Inthetable2theprevalenceofCryptosporidiumspp.andotherenteropathogens,uniqueor
associated/concurrentinfectionsispresented.
Overall,infectionsdiagnosed(withCryptosporidium,rotavirus,coronavirusandE.coliF5 (K99)
had a prevalence of 52.7%. Monoinfections ordered by prevalence were Cryptosporidium
(27.8%),rotavirus(8.4%),coronavirus(1.9%)andE.coliF5 (K99)(0.3%).Cryptosporidiumwas
foundinassociatedinfectionsinaproportionrelativelyclose,withrotavirusandcoronavirus
althoughprevalencewashigherasasinglepathogen.
Theaimoftheresearchwastofindthemostimportantintestinalpathogensfromcalvesaged
betweenonedayand30days,andtodeterminetheirprevalence.
Itwasconcludedthat,inWestern,CentralandNorthWesternRomania,thecalvesagedupto
one month, the most important pathogen is Cryptosporidium followed by rotavirus,
coronavirus and E. coli F5 (K99). The prevalence of infection with Cryptosporidium (41.4%)
45

UniversitateadetiineAgricoleiMedicinVeterinarIai
found in calves in this study is close to that obtained from De la Fuente et al. (1998b) in
Central Spain (52.3%) which also made epidemiological investigations in young cattle in the
firstmonthoflife.Similarly,inGermany,Ottoetal.(1995),foundincalves,inthefirstthree
weeksoflife,aprevalenceofCryptosporidiuminfectionof52.5%.

Table2
Prevalenceofinfectionwithenteropathogensincalvesinthefirstmonthsoflifein
investigatedareasofRomania
Infection(s)with
Positivesamples(%)(n=370)
Cryptosporidiumalone
103(27.8)
Rotavirusalone
31(8.4)
Coronavirusalone
7(1.9)
E.coliF5(K99)alone
1(0.3)
Cryptosporidium+Coronavirus
22(5.9)
Cryptosporidium+Rotavirus
20(5.4)
Cryptosporidium+E.coliF5(K99
2(0.5)
Coronavirus+Rotavirus
3(0.8)
Cryptosporidium+Rotavirus+Coronavirus
5(1.3)
Cryptosporidium+Rotavirus+Coronavirus
1(0.3)
+E.coliF5(K99)
Total
195(52.7)
Legend:n=numberofanimalsinvestigated

The second enteropathogen agent, as prevalence (16.2%), was rotavirus. It is however less
prevalentthanreportedbyotherauthorsinIsrael(41.4%),Spain(42.7%),Ireland(38.9%)(6,
15, 16). Values close to those reported by us were reported by Abraham et al. (1992) in
Ethiopia(16.7%),Garciaetal.(2000)inSpain(20.4%)andPrezetal(1997)inCostaRica(7%).
Coronavirus infection prevalence in calves (10.3%) found in the investigated areas are
comparabletothatfoundbyAkametal.(2004)inAlgeria(7.5%).
Lower prevalence of E. coli F5 (K99) infection found in our study may be a consequence of
reduced sensitivity of tetravalent ELISAkit, fact reported in a paper by de Fuente et al.
(1998a).
Mixed infections were found in 14.3% of the investigated calves. The most common
association observed was between Cryptosporidium and coronaviruses (5.9%) followed by
Cryptosporidiumcoronavirusassociation(5.4%).Thisfactisincontradictionwiththeresults
publishedinthemajorityofstudiesworldwide,whosustainedthatthemostcommonmixed
infectioniswithCryptosporidiumandrotaviruses(6,13,16,20).
The four pathogen agents identified by ELISA, evoluated as unique infections and lass as
associated infections. This may suggest a competition between different enteropathogen
agentsforthesamebiotope.

CONCLUSIONS

The epidemiological screening carried out using ELISA doublesandwich technique at


young calves, in the first month of life, from Western, Central and NorthWestern Romania
revealed a prevalence of 41.4% for cryptosporidiosis, 10.3 for coronavirosis, 16.2% for
rotavirosisand1.08%forenterotoxigenE.coliF5infection.

46

Lucrritiinificevol53seriaMedicinVeterinar
The most common association was semnalated between Cryptosporidium spp. and
coronavirus(5.9%)followedbyCryptosporidiumspp.rotavirus(5.4%)mixedinfection.
Higher prevalence observed in monoinfections (38.4%) compared with associated
infections(14.3%),maysuggestapossiblecompetitionforthesamebiotope.

ACKNOWLEDGEMENTS

Thecurrentresearchwasbasedongrant(51034/2007PNIIParteneriate)obtainedbyProf.
DrbusfromCNMP.

REFERENCES

1. ABRAHAM, G., ROEDER, P.L., ROMAN, ZEWDU, 1992. Agents associated with neonatal
diarrhoeainEthiopiandairycalves.J.Trop.AnimalHealthandProduction.,24:15731589.
2. AKAM A., KHELEF, D., KAIDI R., LAFRI, M., RAHAL, KH., CHIRILA, F., COZMA V., 2004.
FrequencyofCryptosporidiumparvum,EscherichiacoliK99andSalmonellaspp.isolatedfrom
calvesinsixbreedingfarmsfromMitidja,Algeria,Bull.USAMVClujNapoca,Seria.MedVet.61:
287290.
3. AKIYOSHI,D.E.,FENG,X.,BUCKHOLT,M.A.,WIDMER,G.,TZIPORI,S.,2002.Geneticanalysisof
aCryptosporidiumparvumhumangenotype1isolatepassagedthroughdifferenthostspecies.
Infect.Immun.,70:56705675.
4. ALBRIKAN, F.A., SALEM, H.S., BEECHING, N., HILAL, N., 2008. Multilocus genetic analysis of
CryptosporidiumisolatesfromSaudiArabia.J.ofEgyptianSocietyofParasitol.,38:645658.
5. ANGUS, K.W., 1987. Cryptosporidiosis in domestic animals and humans. In Practice, March.,
4749
6. BRENNER, J., ELAD, D., MARKOVICS, A., GRINBERG, A., TRAININ, Z., 1993. Epidemiological
studyofneonatalcalfdiarrhoeainIsraelaoneyearsurveyoffaecalsamples.Isr.J.Vet.Med.,
48:113116.
7. CHERMETTE, R., BOUFASSA, S., 1988. Cryptosporidiose: une maladie animale et humaine
cosmopolite,O.I.E.,SrieTechnique,Nr.5
8. CHINSANGARAM,J.,SCHORE,C.E.,GUTERBOCK,W.,1995.PrevalenceofgroupAandgroupB
rotaviruses in the feces of neonatal dairy calves from California. Com. Immunol. Microbiol.
Infect.Dis.,18:93103.
9. CLARK,M.A.,1993.Bovinecoronavirus.Br.Vet.J.,149:5170.
10. CURRENT,W.L.,1988.ThebiologyofCryptosporidium.A.S.M.News.,54:605611.
11. DRBU, GH., 1996. Criptosporidioza: cercetri privind etiologia, epidemiologia, patogenia,
diagnosticulitratamentulninfeciilenaturaleiexperimentale.Tezdedoctorat,Facultatea
deMedicinVeterinarTimioara.
12. DRBU,GH.,1997.Criptosporidiozalaomianimale.Ed.Brumar,Timioara.
13. DE GRAAF, C.D., VANOPDENBOSCH, E., ORTEGAMORA, L.M., ABBASSI, H., PEETERS, J.E.,
1999. A review of the importance of cryptosporidiosis in farm animals. Int. J. Parasitol., 29:
12691287.
14. DE LAFUENTE, R.,GARCIA,A.,RUIZSANTAQUITERIA, J.A., LUZON, M.,CID, D.,GARCIA,S.,
ORDEN, J.A., GOMEZBAUTISTA, M., 1998. Proportional morbidity rates of enteropathogens
amongdiarrheicdairycalvesincentralSpain.Prev.Vet.Med.,36:145152.
15. DELAFUENTE,R.,LUZON,M.,RUIZSANTAQUITERIA,J.A.GARCIA,A.,CID,D.,ORDEN,J.A.,
GARCIA,S.,SANZ,R.,GOMEZBAUTISTA,M.,1998.Cryptosporidiumandconcurrentinfections
withothermajorenteropathogensin1to30ZileolddiarrheicdairycalvesincentralSpain.Vet.
Parasitol.,80:179185.
16. FAGAN, J.G., DWYER, P.J., QUINLAN, J.G., 1995. Factors that may affect the occurence of
enteropathogensinthefaecesofdiarrhoeiccalvesinIreland.IrishVet.J.,48:1721.

47

UniversitateadetiineAgricoleiMedicinVeterinarIai
17. FAYER, R., 2008. The general biology of Cryptosporidium, p. 141. In R. Fayer, L. Xiao, (ed),
Cryptosporidiumandcryptosporidiosis.CRCPress,Inc.,BocaRaton,Fla.
18. FAYER,R.,MORGAN,U.,UPTON,S.J.,2000.EpidemiologyofCryptosporidium:transmission,
detectionandidentification.Int.J.Parasitology.,30:13051322.
19. FAYER, R., UNGAR, B.L.P., 1986. Cryptosporidium spp. and Cryptosporidiosis. Microbiol. Rev.,
50:458483.
20. GARCIA, A., RUIZSANTAQUITERIA, J.A., ORDEN, J.A., CID, D., SANZ, R., GOMEZBAUTISTA,
M., FUENTE, R., 2000. Rotavirus and concurrent infections with other enteropathogens in
neonataldiarrheicdairycalvesinSpain.Comp.Immun.Microbiology&inf.Diseases.,23:175
183.
21. GRACZYK, T.K., CRANFIELD, M.R., FAYER, R., 1996. Evaluation of commercial enzyme
immunoassay (EIA) and immunofluorescent antibody (IFA) test kits for detection of
Cryptosporidium oocysts of species other than Cryptosporidium parvum. Am. J. Trop. Med.
Hyg.,54:274279.
22. IMRE, K., DRBU, GH., ILIE, M.S., MIRELA PALCA, TAMASY L., 2008. Evaluation of some
diagnosis methods in cryptosporidiosis. Scientific Works Veterinary Medicine C Series., 53:
269276.
23. IMRE,K.,MATOSOLGA,DRBU,GH.,NARCISAMEDERLE,OPRESCU,I.,MORARIU,S.,ILIE,
M.,IONELAHOTEA,MIRELAIMRE,2009.FirstgeneticidentificationofCryptosporidiumspp.in
cattleinRomania.LucrritiinificeMedicinVeterinar,52:2630.
24. OTTO,V.P.,ELSCHNER,M.,GNTHNER,H.,SCHULZE,F.,1995.VergleichendeUntersuchungen
yum nachweis von Rotaviren, Coronaviren, Kryptosporidien und enterotoxigen E. coli im Kot
durchfallkrankerKlber.TierrztlUmschau.,50:8086.
25. PREZ,E.,KUMMELING,A.,JANSSEN,M.M.H.,JIMNEZ,C.,ALVARADO,R.,CABALLERO,M.,
DONADO, P., DWINGER, R.H., 1997. Infectious agents associated with diarrhoea of calves in
thecantonofTilrn,CostaRica.Prev.Vet.Med.,33:195205.
26. RODAK, L., BABIUK, L.A., ACRES, S.D., 1982. Detection by radioimmunoassay and
enzymelinked immunosorbent assay of coronavirus antibodies in bovine serum andlacteal
secretions.JClinMicrobiol.,16:3440.
27. SCHLAFER,D.H.,SCOTT,F.W.,1979.Prevalenceofneutralizingantibodytothecalfrotavirusin
NewYorkcattle.Cornell.Vet.,69:26271.
28. SMITH, H.V., 2007. Diagnostics p. 173203. In Fayer, R., Xiao, L. (ed.), Cryptosporidium and
cryptosporidiosis.SecondEdition.CRCPressandIWAPublishing.,BocaRaton,Fla.
29. SNODGRASS,D.R.,TERZOLO,H.R.,SHERWOOD,D.,CAMPBELL,I.,MENZIES,J.D.,SYNGEB.A.,
1986.Aetiologyofdiarrhoeainyoungcalves.TheVeter.Record.,119:3134.
30. TORRESMEDINA,A.,SCHLAFER,D.H.,MEBUS,C.A.,1985.Rotaviralandcoronaviraldiarrhea.
Vet.Clin.North.Am.Food.Anim.Pract.,1:47193.
31. XIAO,L.,FENG,Y.,2008.Zoonoticcryptosporidiosis.FEMSImmunologyandMedicalMicrobiol.,
52:309323.

48


ASPECTSREGARDINGVASCULOGENICMIMICRYINCANINE
MAMMARYCANCER

GALA.F.1,CATOIC.1,BABAAI1,MICLAUSV.2,BOLFAP.1,
TAULESCUM1,TABARANF.1,NAGYA.1,MOUSSAR.1,CosminaCUC
1
DepartmentofPathology,NecropsyandForensicMedicine
2
DepartmentofHistology
FacultyofVeterinaryMedicineClujNapoca,35MnturStreet,Romania,
AGAL_77_2001@yahoo.com.

Abstract: This article describes and investigates intratumor angiogenesis in canine


mammary tumors, respectively the presence of vasculogenic mimicry pattern of
angiogenesisincaninemammarycancer.Vasculogenicmimicrysupposetheformingof
blood flowing channels in continuation of existing vessels especially in fast growing
tumors with extended hypoxic areas. The channels are lined directly by tumoral cells
that generate a PAS positive material to the inner part of thevessel. Mammary
tumors had been provided by corps or tumor biopsies originated from different dog
breedsandage.Detectionandmonitoringofintratumorangiogenesisandespeciallyof
blood flowing channels was evaluated using immunohistochemical LSAB reaction
or/and double reaction, respectively immunohistochemical and PAS reactions.
Elaboratedworkanalyzedeightcaninemammarytumors,respectivelyonebenignand
sevenmaligntumors.Theoccurrenceofbloodflowingchannelswashigherinvicinityof
intratumornecroticareas, knowing that hypoxia stimulate angiogenesis. Vasculogenic
mimicry was notified more frequent in tumors with reduced stroma and numerous
cancerous cells (compact mammary cancer), and in poorly differentiated canine
mammarycancers.Somepeculiaritiesofsomebloodflowingchannelswasrepresented
bydiscreetimmunohistochemicalreactionthatoftenwasrestrictedonlytoaregionof
vascularwallnottoallvesselscircumference.

Keywords:angiogenesis,immunohistochemistry,PASreaction,vasculogenicmimicry.

INTRODUCTION

Vasculogenesis is a complex multistage process characterized by formation of new vessels


frompreexistingones(1,5,7).Angiogenesisisessentialfortumoralgrowingandmetastasis,
thats why in more aggressive tumors the angiogenesis is more intense due to increased
demands for newly formed structure. There are three main theories regarding intratumor
angiogenesis,respectively(I)Thetheoryofmultistageangiogenesis,(II)Thetheoryofcooption
ofpreexistingvesselsbythetumor,and(III)Thetheoryofvasculogenicmimicry(1).
Angiogenesisisacomplexprocessthatleadstogenerationofnewcapillariesfrompreexisting
vascularnetwork(multistageangiogenesis),orbyformingofbloodflowingchannelsdelimited
directly by tumoral cells (vasculogenic mimicry). Endothelial cell proliferation is 3040 folds
higherintumorstructurecomparingfromnormaltissues.Multistageangiogenesisbeginwith
degradingofthebasalmembrane,followedbyproliferationandmigrationofendothelialcells
outsidefromthevesselstructure.Thesecellsareorganizingintoatubularstructurethatforms

49

Lucrritiinificevol53seriaMedicinVeterinar
somevascularbudsoriginatedinexistingvessels.Finally,thereitisformedanewbloodvessel
that supply a territory from tumor. Regarding the second theory of angiogenesis, the tumor
entitysubduepreexistingvessels,especiallythatonesfromtheperipheryoftumor(1).
The vasculogenic mimicry pattern of angiogenesis shows the plasticity and increased
adaptability of tumoral cells to some injurious conditions such as hypoxia. This model is
characterizedbytheformationofsomePASpositivechannels lineddirectlybytumoral cells
not by endothelial cells, contributing in this manner to intratumor blood flow. Vasculogenic
mimicry was firstly described in uveal melanoma, malignant astrocytoma, breast cancer,
osteosarcoma,etc(21).
There are many reports concerning intratumor angiogenesis and its importance in cancer
progression and development. The vasculogenic mimicry pattern of tumor angiogenesis was
andisaninterestingideathatsuggeststheabilitiesoftumoralcellstoavoidnecrosisdueto
hypoxia. Vasculogenic mimicry was noticed also in cell cultures originated from aggressive
melanomas;thecellshadtheabilitiestoformPASpositivechannelswithoutendothelium(4).
Furthermore, some studies proved that presence of vasculogenic mimicry is related with
unfavorable prognosis. Initially was thought that blood flowing channels are generated by
stromalcellsoriginatedinfibrovascularsepta(3,6,18),butsubsequentwasnoticedthatthe
channelsarebordereddirectlybytumoralcells,whichgeneratePASpositivematerialtothe
channelslumen(19).

MATERIALANDMETHODS

Mammarytumorformationshadbeenprovidedbycorpsortumorbiopsiesreachedto
Pathology department from the University of Agricultural Science and Veterinary Medicine,
Faculty of Veterinary Medicine ClujNapoca, Romania. There were utilized 7 malign and 1
benign tumors provided by different bitch breeds, such as: Cocker (3 subjects), Teckel (2
subjects),Amstaff(1subject),GermanSheppard(1subject)andMioriticSheppard(1subject).
Themammarytumorsarefrom8bitches,withtheageof213years.
Had been recorded several dates from anamnesis and tumoral characteristics (tumor
size,consistence,grosssectionaspect,lymphnodesstate).Fromthetumorsandlymphnodes
were harvested samples for histological exam avoiding tumoral necrotic or cystic areas,
samples being immersed in buffered 10% formalin, and then process by paraffin technique.
Slideswerestainedbyusualtechniques,respectivelytricromMassonandhematoxylineosin.
Mammary tumors were framed conformal to WHO classification for mammary tumors and
graded into three types (from grade Iless aggressive, to grade IIIhigh aggressivity). To
establish histological grading was quantified the following: nuclear grade, mitotic index and
extendingoftubularstructuresintumoralmass.
Detection and monitoring of intratumor angiogenesis and especially of blood flowing
channels was evaluated using immunohistochemical LSAB reaction or/and double reaction,
respectively immunohistochemical and PAS reactions. Immunohistochemical reaction used
CD31 monoclonal antibody (Dako clone JC70A, izotype IgG1 kappa). Histological slides had
about 5 m thicknesses and were fixed on silanized slides (Dako) during 24 hours in 37C,
followed by deparaffination in xylen. Antigen retriever had been made using a pressurized
cooker in citrate solution, pH=6.0 (Dako); endogenous peroxidase was inactivated by
peroxidaseblockingreagent(DakoPeroxidaseandPAblockingreagent3%)during5minutes
at the room temperature. Primary monoclonal antibodies (antiCD31) were maintained
overnight, during 18 hours at 4C, using a dilution of 1:30 (Dako antibody diluent). The
visualization of immunological reaction was performed using Universal LSAB+Kit/HRP,
50

Lucrritiinificevol53seriaMedicinVeterinar
Rb/Mo/Goat (DAB+) system (Dako); the counterstaining was performed by Mayer
hematoxylin. To evaluate the antibody specificity were used negative control (replacing the
primaryantibodywithantibodydiluent)andinternalpositivetissuecontrol(immunolabelof
largevessels).UsingPASreactionmaybehighlightedmucopolysaccharides,whicharepresent
toward the inner part of the blood flowing channels. Double staining procedure
(immunohistochemical and PAS reactions) had been realized at the end of
immunohistochemical staining, before staining with Mayer hematoxylin. The slides were
immersed in periodic acid (aqueous solution 0,5%) and Schiff reactive (30 minutes). Slides
wererinsedwithtapwaterandcounterstainedwithMayerhematoxylin.
To evaluate the microvessel number, perimeter and aria, we used a semiautomatic
computerizedanalysistechnique(OlympusSoftimagingsolutionsCellB).Therewereanalyzed
5 microscopic fields on every tumor, magnified of 200x. The microscopic images were
obtainedbyOlympusBX51microscope,connectedtoaphotodigitalcamera(OlympusDP25).
Total vascular aria (total intratumor area expressed in m2/image area, and its percentage;
averagevesselareaforeachtumor),totalvascularperimeter(averageperimeterexpressedin
m/image area), and the microvessel number were related to microscopic image area
(144352,00 m2). Any isolated but immunohistochemically labeled endothelial cell (vessels
withoutlumen)wasquantifiedasdistinctmicrovessel.
PASpositivebloodflowingchannelsfromdifferentcaninemammarytumortypeswere
examined by monitoring all clear spaces bordered PAS positive material and/or directly by
tumoral cells. The occurrence of vasculogenic mimicry pattern was evaluated as follow:
relativelyfrequentencountered(++),rarelymetbutpresent(+),andabsent().

RESULTSANDDISCUSSIONS

In1948inhumanpathologyWillisetal.(1948)showedthatsometumorswithafast
growing rate presents some channels similarly in structure with blood vessels but without
endothelium(20).Theauthormentionstheborderingofthechanneldirectlybytumoralcells.
Laterthisfeaturewastermedvasculogenicmimicry,beingencounteredinseveralaggressive
tumors (1, 3, 4, 6, 14, 19, 21). Nasu et al. (1999) describe a similar type of intratumor
angiogenesis,describingsomenonendothelialchannelswhereendothelialcellsarescattered
and without PAS positive material. The author considers these nonendothelial channels
something different from vasculogenic mimicry (15). Elaborated work analyzed eight canine
mammarytumors,respectivelyonebenignandsevenmaligntumorsoriginatedfromdifferent
dogbreedsofdifferentage(213years).Tumorsizevariedfrom0,35cmuntilto20cm.There
were elected several histologic types of malignant tumors, such as: more differentiated
mammary tumors and highly aggressive mammary tumors; it is known that vasculogenic
mimicryismorefrequentinpoorlydifferentiatedcancers.
Regarding intratumor angiogenesis, there were studied the main parameters which
indicate angiogenic profile of a tumor, such as: microvessel number/microscopic field area,
total vascular area and perimeter, average vascular area and perimeter, the structure of
vascular walls, intensity of immunohistochemical reaction in vessels wall. All of these were
monitored to detect blood flowing channels and to debate intratumor angiogenesis. Double
staining procedure (immunohistochemical and PAS reaction) made possible evidence of
aspectsregardingvasculogenicmimicryalmostinallpoorlydifferentiatedtumors(cases1,2,
4,5,6,7).Bloodflowingchannelsweremoreobvioususingthismethodcomparingwiththe
other CD31immunolabeling method. There should be mentioned that numerous blood

51

Lucrritiinificevol53seriaMedicinVeterinar
flowing channels without endothelium were noticed in vicinity of intratumor necrotic areas
(case5),beingknownthathypoxiaisastimulusforangiogenesis.
Thelocationofbloodflowingchannelsoccurinboth,connectivetissuestroma(cases
2,4,7)andbetweenneoplasticcellsinthecaseofcompacttumorswithscatteredsustaining
stroma and numerous tumoral cells (cases 5, 7). In blood flowing channels without
endothelium from sustentacular connective tissue, the misinterpretation of some empty
spaces to be considered blood channels is minimal using double staining procedure. Also,
there can be noticed blood flowing channels in which immunohistochemical reaction is
discreet or more often restricted to a limited portion of the vessel wall not to all vessel
circumferencehowisnormalinbloodvesselswithcontinuousendothelium(cases4,5,6,7).
This aspect was also encountered by Nasu et al. (15). The PAS reaction highlights
mucopolysaccharidicstructurethatlinethesechannels,whichdonthaveendothelium(4,14,
21).Inmanysituationsredbloodcellscanbeseenintothechannelslumenaidingwiththeir
notification.

Fig.1.Carcinomainbenignmixedtumor,gradeII(case8);doublestainingIHC
antiCD31andPASreactions,counterstainingwithMayershematoxylinx400.

52

Lucrritiinificevol53seriaMedicinVeterinar

Fig.2.Compactcarcinoma,gradeII(case1.);bloodvesselwithdiscreetimmunohistochemical
reaction(arrow),labelingbeingnotpresenttoallcircumferenceofthevessel;IHCreaction
antiCD31,counterstainingwithMayershematoxylinx400.

Fig.3.Cysticpapillarymammarycarcinoma,gradeI(case4)presenceofbloodflowing
channel(arrow),discreetIHCreactionantiCD31(blackarrow);counterstainingwithMayers
hematoxylinx400.

53

Lucrritiinificevol53seriaMedicinVeterinar

Fig.4.Cysticpapillarymammarycarcinoma,gradeI(case4)presenceofbloodflowing
channelincontinuityofbloodvesselpositivetoIHCantiCD31;counterstainingwithMayers
hematoxylinx200.

Fig.5.Solidanaplasticmammarycarcinoma,gradeIII(case7)presenceofbloodflowing
channelwithredbloodcellsinlumen(lightarrow)andofbloodvesselswithintenseIHC
reaction(blackarrows);IHCreactionantiCD31;counterstainingwithMayershematoxylin
x400.

54

Lucrritiinificevol53seriaMedicinVeterinar
In tumors with reduced sustaining connective tissue, vasculogenic mimicry pattern
may be easily recognized. In this tumor types, between malignant cells are obvious PAS
positive channels from which some of them presents a discreet immunolabel of the wall,
during some others have only mucopolysaccharides that line the channel (cases 5, 7). There
arescatteredfibroblasts(whichcanalsoproducethesemucopolysaccharides),indicatingthis
material is generated directly by tumoral cells lining the sanguine vessels without
endothelium. Described aspect is known in the literature as vasculogenic mimicry, showing
onceagaintheplasticityandadaptabilityofmalignantcells.Thisfeaturerevealstheabilityof
malignanttumortofindsolutionstominimizeortoavoidintratumornecrosis.
The presence or not of vasculogenic mimicry was correlated with histologic grade,
and also with vascular parameters (intratumor microvessel density, average microvascular
area and perimeter). The presence of blood flowing channels was directly related with
histologic grade, such as: the pattern is more frequent encountered (++) in grade II and III
caninemammarycancers(cases5,6,7),andlessextendedin(+)ingradeImammarytumors
(cases 2, 4) and in some of poorly differentiated (grade II) mammary tumors (case 1);
vasculogenic mimicry wasnt encountered in benign mammary tumor (case 3) and
interestingly in one grade II malign mammary cancer (case 8). Described aspects show that
vasculogenic mimicry is more prevalent in poorly differentiated canine mammary cancers
(gradeIIandIIItumors)andlessfrequentorabsentinmoredifferentiatedonesorinbenign
tumors.
Regarding the incidence of vasculogenic mimicry depending of histologic type of
caninemammarytumor,theprevalenceishigherinsolidcarcinomas(cases1,5,737,5%),
followed by carcinoma in benign mixed tumor (case 2 12,5%), simple tubulepapillary
carcinoma(case612,5%),andpapillarycysticcarcinoma(case412,5%).

Fig.6.Solidmammarycarcinoma,gradeIII(case5)presenceofnumerousbloodflowing
channelswithPASpositivematerialtowardthelumenmissingIHCreaction(lightarrow),and
numerousisolatedIHCpositiveendothelialcellsintotumormass(blackarrows);double
stainingIHCantiCD31andPASreactions,counterstainingwithMayershematoxylinx200.

55

Lucrritiinificevol53seriaMedicinVeterinar

Fig.7.Solidmammarycarcinoma,gradeIII(case5)presenceofnumerousbloodflowing
channelswithPASpositivematerialtowardthelumenmissingIHC(arrows);tumoralcells
borderdireclythechannels;doublestainingIHCantiCD31andPASreactions,counterstaining
withMayershematoxylinx400.

Bycomparingtherelationbetweenvasculogenicmimicryandintratumormicrovessel
density(IMD),bloodflowingchannelshaveahigheroccurrenceintumorswithanincreased
number of microvessels/microscopic field (cases 1, 6). Thus, blood flowing channels without
endotheliumweremorefrequentprevalentinmalignanttumorswithIMDbetween18,249,2
(cases1,2,4,5,6,7).Thebibliographyrapportsindicateanassociationbetweenanincreased
intratumormicrovesseldensityandafasterdevelopmentofthetumor,beingalsocorrelated
to a reduced survivor rate (13, 16, 17). On the other hand there are some reports where,
statistically,werentfindcorrelationsbetweenIMDandtumoralaggressivity(811).
Regarding the other vascular parameters (total microvascular area and perimeter),
there werent established interrelations with vasculogenic mimicry. Despite of that, a quite
interestingthingwasnoticedasfollow:inmammarycancersthathadnumerousvesselswith
reduced perimeter and area (average vascular perimeter and area) vasculogenic mimicry
occurrence is higher. Also, it was observed that mammary tumors where predominate
microvesselswithsmallcaliber(implicitlywithreducedvascularperimeterandarea)hadthe
mostnumerousbloodflowingchannelswithoutendotheliallining(cases5,6,7).Byincreasing
the values of average vascular area and perimeter, the frequency of vasculogenic mimicry
pattern is rarely encountered (cases 1, 2, 4). Domination of newly formed microvessels of
reduced caliber indicates an increased intratumor angiogenesis and, on the other hand, an
increasedriskfortumoralgrowing.

56

Lucrritiinificevol53seriaMedicinVeterinar
Table1.Generalaspectsregardingintratumorangiogenesisindifferentcaninemammary
tumors.
Cas
e
nr.
1
2

Histologic
diagnose
Solid
carcinoma
Tubule
papillary
carcinoma in
benign mixed
tumor
Adenoma

Histologi
cgrade

Mitoti
c
index

Intratumorangiogenesis
IMD

II

19

27

TM
A
(%)
5.81

18.2

5.36

14.8

2.26

V
M

MP
Sum

Averag
eMA

Averag
eMP

2492.5
9
2013.4
6

310.93

92.32

425.89

110.63

221.20

77.08

1140.7
5
2250.7
5

Cystic
I
14
22.6 6.07
388.17 99.59
+
papillary
carcinoma
5
Solid
III
24
24.4 2.34 1540.1 166.76 63.12
++
carcinoma
6
6
Tubulopapillar
II
33
49,2 5,40 3085,6 158,72 62,72
++
ycarcinoma
8
7
Solid
III
13
22.3 3.28 1760.9 212.56 78.85
++
anaplastic
3
4
carcinoma
8
Carcinoma in
II
12
18,8 4,10 1876.2 314,96 99,80

benign mixed
8
tumor
IMD:Intratumormicrovesseldensity(microvesselnumber)/areaofmicroscopicimage.
TMA: Total microvascular area (%)/area of microscopic image average value obtained by
monitoringfivemicroscopicfieldsmagnifiedofmedia200x.
MA:Microvasculararea(m2)averagevalueobtainedbymonitoringfivemicroscopicfields
magnifiedofmedia200x.
MP: Intratumor microvessel perimeter (m) average value obtained by monitoring five
microscopicfieldsmagnifiedofmedia200x.

Thenewfindingsregardingangiogenesisdeliversomeimportantandusefuldatesnot
onlyaboutgrowingrateandprognosis,butalsotoimproveantitumoraltherapeuticprotocols
someoftheminvolvingthedestructionofbloodvesselswhichsupplytheneoformation.Anti
angiogenic therapies may be realized using natural or synthetic inhibitors of angiogenesis,
such as angiostatin, endostatin, tumtatina, etc. Endothelial cells were and are considered,
genetically, more stable structure than cancerous cells. This genomic stability confers an
advantageinelaborationofantitumoraltherapiesthathaveastarget endothelial cellsusing
antiangiogenic agents. Because of that, endothelial cells may represent ideal targets for
antitumor therapy. Nevertheless, antitumor therapheutic protocols using antiangiogenic
agents (targeting vascular endothelium) may be useles for cancerous areas where the
vascularisationoccurusingvasculogenicmimicry,whichdonthaveendothelium.
57

Lucrritiinificevol53seriaMedicinVeterinar
CONCLUSIONS

1. Utilizing either double staining procedure (immunohistochemical antiCD31 and PAS


reactions) or single immunohistochemical antiCD31 technique made possible notification of
vasculogenic mimicry in highly aggressive tumors, such as grade II and III canine mammary
cancer. Nonendothelial blood channels were less extended to differentiated tumors,
practicallybeingabsentinbenigntumor.
2.Theoccurrenceofbloodflowingchannelswashigherinvicinityofintratumornecroticareas
knowingthathypoxiastimulateangiogenesis.
3. Vasculogenic mimicry was notified less frequent in sustaining connective tissue and more
frequent in tumors with reduced stroma and numerous cancerous cells, such as compact
carcinomasandsimplecarcinomas.
4. Some peculiarities of some blood flowing channels were represented by discreet
immunohistochemicalreactionthatoftenwasrestrictedonlytoaregionofvascularwallnot
toallcircumferenceofthevessel.Thisindicatesthatsomevesselsareincompletelylinedby
endothelialcells,therestofthevesselslumenbeingborderedbytumoralcells.Furthermore,
PASreactionhighlightedmucopolysaccharideswhichlinedthechannelswithoutendothelium.
5. Occurrence of blood flowing channels was higher in tumors with increased microvessel
density/microscopic field, and in tumors that had numerous microvessels with reduced
caliber,bothfeaturesindicatingincreasedintratumorangiogenesisandalerttumorgrowth.

BIBLIOGRAPHY

1. BabaA.I.,CtoiC.,2007ComparativeOncology,RomanianAcademyEd,pg.423447.
2. Blood C.H., Zetter B.R., 1990 Tumor interaction whit the vasculature: angiogenesis and tumor
metastasis.Biochim.Biophys.Acta.,1032,89118.
3. ClarijsR.,OtteHollerI.,RuiterD.J.,deWaalR.M.,2002Presenceofafluidconductingmeshworkin
xenograftedcutaneousandprimaryhumanuvealmelanoma.InvestOphthalmolVisSd.;43:912918.
4. FolbergR.,HendrixM.J.C.,ManiotisA.J.,2000VasculogenicMimicryandTumorAngiogenesis,Am.
J.ofPathology,vol.156,No.2.
5. FolkmanJ.,1995Angiogenesisincancer,vascular,rheumatoidandotherdisease.NatMed,1:2731.
6. Foss A.J., AlexanderR.A.,HungerfordJ.L., Harris A.L., Cree I.A., Lightman S., 1997 Reassessment of
thePASpatternsinuvealmelanoma.BrJOphthalmol,81:240246.
7. FoxS.B.,GatterK.C.,HarrisA.,1996Tumourangiogenesis.J.Pathol.,179,232237.
8. Gal A., C. Ctoi,I.IuliaRobu,BabaA.I., Miclaus V., Rus V., Taulescu M., BolfP., 2009 Correlation
between intratumor microvessel density and Ki67 malignancy marker in bitch mammary cancer,
BuletinUSAMVCN,66(1)/2009,ISSN18435270:5562.
9. GalA.,C.Ctoi,I.Rus,M.Taulescu,P.Bolf,I.Lakatos,A.I.Baba,2008Thestudyofvascularisationin
bitchmammarytumors,BuletinUSAMVCN,65(1)/2008,ISSN18435270:388394.
10. GalA.,C.Ctoi,I.,A.I.Baba,V.Miclaus,DanielaCerbu,I.Lakatos,2009RelationshipbetweenPCNA
proliferating markerandAngiogenesisin bitchmammary cancer, Buletin USAMVCN,66 (1)/2009,
ISSN18435270:490.
11. Gal A., Hener Adriana, A.I. Baba, C. Catoi, I. Rus, 2007 Prognosis significance of intratumor
microvesseldensityinbitchandcatmammarytumors,BulletinUSAMVCN,vol.64(12):151,print
ISSN18435270,electronicISSN18435378.
12. Hashizume H., Baluk P., Morikawa S., McLean J.W., Thurston G., Roberge S., Jain R.K., McDonald
D.M., 2000 Openings between defective endothelial cells explain tumor vessel leakiness. Am J
Pathol,156:13631380.
13. Luong R.H., Baer K.E., Craft D.M., Ettinger S.N., Scase T.J., Bergman P.J., 2006 Inttratumoral
microvesseldensityandcanineSTS,Vet.Pathol.,543.

58

Lucrritiinificevol53seriaMedicinVeterinar
14. ManiotisA.J.,FolbergR.,HessA,SeftorE.A.,GardnerL.M.,PerJ.,TrentJ.M.,MeltzerP.S.,Hendrix
M.J.,1999Vascularchannelformationbyhumanmelanomacellsinvivoandinvitro:vasculogenic
mimicry.AmJPathol,155:739752.
15. Nasu R., Kimura H., Akagi K., Murata T., Tanaka Y., 1999 Blood flow influences vascular growth
duringtumourangiogenesis.BrJCancer,79:780786.
16. Page D., Jensen R., 1995 Angiogenesis in human breast carcinoma; what is the question? Hum.
Pathol.,26:11731174.
17. RestucciB.,DeVicoG.,MaiolinoP.,2000Evaluationofangiogenesisincaninemammarytumorsby
quantitative platelet endothelial cell adhesion molecule immunohistochemistry. Vet. Pathol.,37:
297301.
18. Ruiter D., Bogenried T., Elder D., Herlyn M., 2002 Melanomastroma interactions: structural and
functionalaspects.LancetOncol.3:3543.
19. WeiYing Y., ZhongPing C., 2005 Does Vasculogenic Mimicry Exist in Astrocytoma?, J Histochem
Cytochem53:9971002.
20. WillisR.A.,1948PathologyofTumours.London,Butterworth&Co.,Ltd.,p136.
21. Zhenhong X.; Yongwei J.; Xuansong C.; Jiong M.; Liming C.; Guangrong Y., 2008 Vasculogenic
Mimicry in Osteosarcoma : Histomorphologic Studies in Vivo and in Vitro; Tang Ruyong
BioinformaticsandBiomedicalEngineering,Page(s):915918.

59


ASSESSMENTOFTHEANTIINFLAMMATORYACTIONOFTHE
CARPROFENBETACYCLODEXTRINSCOMPLEXONEXPERIMENTAL
INFLAMMATIONMODELINRATS

GRECUMariana ,NSTASV.1,MAREM.1,MORARURamona1,
HRICULuminiaDiana1,ILIECornelia2
1
USAMV Iassy, Faculty of Veterinary Medicine
2
Institute of Physical Chemistry Ilie Murgulescu Bucharest
marianagrecu_drd@yahoo.com

Abstract:The main aim was the comparative testing of the carprofen and carprofen
cyclodextrin using an experimental inflammation model in rats. The improvement of carprofen
bioavailability was tested by complexing it with cyclodextrin, as carrier molecules, in the
conditions of dosage reduction to limit the side effects that are common in NSAIDs therapy
(dyspepsia, gastritis, ulcerations etc.). The obtained results sustain a higher therapeutical
efficacy/noninferiorityofcarprofenbetacyclodextrinsovercarprofenonly.

Keywords:carprofen,cyclodextrin,experimentalmodel,inflammation,rat

INTRODUCTION

Theefficacyofmanyactiveingredientsislimitedbytheircapacitytoreachthetarget
site. In most of the cases, only a small quantity of the administered dose reaches this site,
while the rest of the dosage is distributed throughout the body, depending on the physico
chemicalandbiochemicalpropertiesofthemolecule(2).
Most of the molecules in the active ingredient, such as: non steroidal anti
inflammatories (NSAIDs), antifungals, antiparasitic drugs etc., are insoluble in a aqueous
environment, which leads to a major problem in their conveyance and absorption.
Furthermore,thesemoleculesareshowingahightoxicitydegreetowardsthemajorstructures
of the body (especially towards the digestive system, liver and kidney). To avoid these
drawbacks, the use of some carrier molecules, that can improve the bioavailability of the
active ingredients and reduce the side effects, has been considered necessary. Therefore,
during the last years, there has been a rise in interest towards the interactions between
differentactivesubstancesandciclodextrinesnaturalpolymers(1,3,4),thatcouldenhance
thedrugstherapeuticalproperties,loweringasmuchaspossibletheirtoxicityandrisingtheir
efficiency.
Inthisstudy,wehaveobservedandevaluatedtheeffectivenessofthecombination
carprofen cyclodextrin compared to the administering of carprofen, in a model of
experimentalinflammation.

60

UniversitateadetiineAgricoleiMedicinVeterinarIai
METHODSANDEQUIPMENT

Thestudyused18youngmalewhiterats,Wistar,weighting20010grams,acquired
from the Cantacuzino Institute, Bucharest, that have been bred in a germfree environment
andtowhomhasbeeninducedaplantarinflammation,inthehindrightpaw,byinjectingan
aqueous suspension of kaolin 10%, intraplantary, 0.15ml per rat. The animals were then
dividedin3groups,with6ratsineverygroup(n=6),groupAthecontrolgroup,groupB,in
which carprofen has been administered per os, in a dose of 5mg/kg, and group C whose
individualswereadministered,peros,2.5mg/kgofthecarprofencyclodextrinecomplex,
both substances being administered once a day, with a feeding tube, for two days. The
carprofen cyclodextrine complex has been prepared at the Macromolecular Chemistry
InstitutePetruPoniinIassy,throughlyophillization.
Before inducing the inflammatory process, every rats hind right paw has been
markednearthepointwherethepawwascompletelyimmersedinthemeasuringcell.After
marking, the paw diameter has been measured and calculated, using pletysmography; the
procedurewasrepeatedafterinducingtheinflammationafter1,3,6,9,12,24and48hours,
following thedynamicsoftheinflammatoryprocessandevaluatingthroughpletysmography
thedifferencesbetweenthegroups.
After912hourssincetheinducingoftheinflammation,bloodwascollectedinvials
containingclotactivators,fordeterminingtheCreactiveprotein(CRP),animportantmarkerin
acute inflammatoryprocesses. The samples havebeen placed in thecentrifuge at 8000 rpm
for2minutesandthenwereplacedintherefrigeratoratatemperatureof+4Cfor48hours,
becausetheanalyzeofCRPrequiresstableserumsamples.
All the experimental procedures used in this study have been in accordance to
international ethical regulations regarding the manipulation and use of laboratory animals,
using the method recommended by OECD guidelines for the Testing of Chemicals
425/17.12.2005.

RESULTS
Whenmeasuringthepawdiameter,beforeadministeringthesubstances,thevalues
obtainedwere1.01.1cm3,withminorvariationsbetweentheratsfromthe3groups.
Theinflammationhadarapidonsetandcourse,sothat9hoursaftertheexposureto
theinflammatorystimulus,consideredthepeakmomentofinflammation,pawdiametershad
increasedgreatlyin thecontrolgrouprats andthosetreatedwithcarprofenand lessin rats
treatedwithcarprofen+cyclodextrincomplex(image1).

61

UniversitateadetiineAgricoleiMedicinVeterinarIai

Figure1.Dynamicoftheinflammatoryprocessat9hours

c
Figura2.Diameter ofpath at 9 hours:a) control; b)group treated with
carprofen;c)group treated with cucarprofen+ciclodextrin

Thesevaluesweremaintainedinaplateauperiodofseveralhoursbetween9and
12hourssincetheexposurethentheinflammatoryedemabeganregressingwithease,ata
slow pace, in comparisonwith its appearance speed, immediately after the stimulus trigger.
Clinicalsymptomsweremanifestedbymarkedcongestionofthepaws,thelocaltemperature
and increased pain sensitivity, keeping a suspended position of the member, functional
impotence,andwerecorrelatedwithmarkedimpairmentofgeneralstatusofrats(image2).
At 24 hours after induction of inflammation in group C treated with carprofen +
cyclodextrin,whenmeasuringthepawdiameterthroughpletysmography,theresultshoweda
significantregressionoftheedemaandalsoadecreaseincongestion,thelocaltemperature
and pain sensitivity, animals resumed their daily activities grooming, food and water

62

UniversitateadetiineAgricoleiMedicinVeterinarIai
consumption. In group B, treated with carprofen, the rate of the edema reduction was
moderate, but significantly faster compared to the rats in the control group, where paw
edemawasprominentandhadaslowregression(Figure2).
After 48 hours, the inflammation was still present in the control group, the
pletysmographicmeasurementsshowinga60%decreaseoftheedema(Figure2).

Figure2.Dynamicoftheinflammatoryprocessat48hours

Theresultsshowedasignificantdifferencebetweencontrolgroupandgroupsofrats
treatedwithNSAIDs,especiallyforthegrouptreatedwithcarprofen+cyclodextrin,where
the complex efficacy was observed through the rapid inhibition of paw edema. Anti
inflammatory effect of the complex was found to be maximum at 68 hours after
administration, producing an inhibition of the occurrence of the inflammation in
approximately 40% of the individuals, compared to 20% of rats showing a response in the
grouptreatedwithcarprofenandnoevidentresponseinthecontrolgroup.
For detecting C reactive protein (CRP), the latex agglutination test was used.
DeterminationofproteinCresultsinourstudyshowedpositiveresultsinasmallnumberof
animalsfromthethreebatches(onlyeightpositivesamplesfromatotalof18rats),especially
in the control group where there was evidence of serum agglutination in all six rats. In the
group treated with carprofen, positive results were evident only in two rats, the remaining
samples being negative, and in group C which received carprofen complexed with
cyclodextrin,inall12ratstheCRPresultswerenegative.
Serum samples that gave positive results in qualitative screening evidencing
agglutination presence after two minutes since the homogenization of the mixture, were
takentodeterminetitres,takingthequantitativevariantofthetest.Thus,insamplesfromthe
ratsincontrolgrouptheagglutinationwasobservedasfarasthedilution,thetiterbeing24
mg/l CRP, and the positive samples from the rats in group treated with carprofen,
agglutination was observed as far as the dilution , value titer being 12 mg/l CRP. Thus,

63

UniversitateadetiineAgricoleiMedicinVeterinarIai
elevated titres in test detectable CRP is an argument towards the presence of high
concentrationsofproteinspertainingtheinflammatoryprocessinserum.
Thepletysmographymeasurementsusedinourexperimentalstudieshaveallowed,
as much as possible, accurate and sensitive measurements of plantar edema. Using this
modern method has particularly proved the influence that carprofen complexed with
cyclodextrinhaveonacropodiumedemainratsafterintraplantaryinjectionswithkaolin,10%
aqueous suspension. The results are consistent with literature data (5), which is considered
encouraging for using this protocol in order to validate the test method inflammatory
products.

CONCLUSIONS
1. Experimental models of inflammation induction gave significant results to assess
theeffectivenessofNSAIDs,bothcomplexedwithbetacyclodextrinandsimple.
2. It was noted that in this model of plantar inflammation, rats have a clear local
reactionthatissignificantfrompharmacokineticandpharmacodynamicpointofview.
3. Experimental studies have confirmed the efficacy of carprofen cyclodextrin
complex,evenifthedosewaslower(2.5mg)comparedwiththegroupthatwastreatedwith
carprofenatadoseof5mg/kgcorp.

BIBLIOGRAPHY

1. FuAn Chen, AnBang Wu and ChauYang Chen, 2003 Inclusion Complex of Carprofen with
Hydroxypropylcyclodextrin Journal of Inclusion Phenomena and Macrocyclic Chemistry 46:
111115.
2. GoodmanandGilman's,2006"ThepharmacologicalBasisofTherapeutics",11thed.,(Laurence
L.Brunton,JohnS.Lazo,KeithL.Parker);McGrawHill,NewYork,SaintLouis,SanFrancisco,p.
671685,687705.
3. JicsinszkyL.,PetrikovicsI.,PetroM.,HorvathG.,SzejtliJ.,WayJL.,2007Improveddrugdelivery
by conjugation with cyclodextrins. Proceedings of 14th European Carbohydrate Symposium,
September27,Lubeck,Germany.
4. Thorsteinn Loftsson, Dominique Duch, 2007 Cyclodextrins and their pharmaceutical
applications.InternationalJournalofPharmaceutics329,111.
5. Vlase E., Coman C., Szegli G., Lupu AndreeaRoxana, Cremer Lidia, Barzu Natalia Simona,
Badulescu MariaMihaela, Calugaru Ana, Ionescu G., 2008 Pletismometria computerizat
metod performant de msurare a edemului inflamator acut indus la oarece prin injectarea
intraplantar de Carrageenan, Sepsis Granada, Spania, 1922 Nov.2008 si Sesiunea de
ComunicariStiintificeaINCDMICantacuzino,ianuarie2009.

64


EVALUATIONOFDEGREEOFENGRAFTMENTINMOUSE
MODELOFSTEMCELLSHARVESTED
FROMHUMANPLACENTA

GrozaI.,GrozaDaria,PallEmoke,CenariuM.,CiupeSimona,Laura
Parlapan
UniversityofAgriculturalScienceandVeterinaryMedicine,
ClujNapoca,35Manasturstreet,ClujNapoca,
isgroza@yahoo.com

Abstract:Recentinterestinstemcellbiologyanditstherapeuticpotentialhasledtothesearch
foraccessiblenewsourcesofstemcells.Fetalstemcellsfromumbilicalcordbloodandplacenta
are less ethically contentious than embryonic stem cells and their differentiation potential
appears greater than adult stem cells. Fetal stem cells represent powerful tools for exploring
many aspects of cell biology and hold considerable promise as therapeutic tools for cell
transplantation. In this study, we established a mouse model for in utero transplantation of
humanplacentalmesenchymalstemcells(hPMCs)toinvestigateifthesecellswouldaffectlong
term,organspecificengraftment.

KEYWORDS:placenta,mesenchymalstemcells,engraftment,prenataldiagnosis

Early prenatal diagnosis and in utero therapy of certain fetal diseases have the
potential to reduce fetal morbidity and mortality. The intrauterine transplantation of stem
cells provides in some instances a therapeutic option before definitive organ failure occurs.
Clinicalexperiencesshowthatcertaindiseases,suchasimmunedeficienciesorinbornerrors
of metabolism, can be successfully treated using stem cells derived from bone marrow.
However, a remaining problem is the lowlevel of engraftment thatcan be achieved. Efforts
aremadeinanimalmodelstooptimizethegraftandstudytherecipientsmicroenvironment
to increase longterm engraftment levels. It is known that some diseases, such as
haemoglobinopathies (Fanconis anaemia, thalassaemia), immunological defects (SCID) or
certaininbornerrorsofmetabolismcanbetreatedbytransplantationofstemcells(ShapiroE.
et al., 2000). If the stem cell transplantation is performed before symptoms of the disease
occur, organ function can be preserved (Newsome P.N. et al., 2003). However, if
transplantation is performed after delivery of the baby, intensive immunosuppression and
myoablationhavetobeusedtominimizetheriskofGraftversushostdiseaseandtoempty
thebonemarrow.
Cellsofdifferentoriginshavebeenusedforinuterotransplantationinanumberof
models.Humanbonemarrowderivedmesenchyamalstemcellshavebeentransplantedinto
fetal sheep and shown to persist for as long as13 months with multilineage differentiation
potential(Liechtyetal.,2000).
In this study, we established a mouse model for in utero transplantation of human
placentalmesenchymalstemcellstoinvestigateifthesecellswouldaffectlongterm,organ
specificengraftment.

65

Lucrritiinificevol53seriaMedicinVeterinar
MATERIALSANDMETHODS

Biological material, clinically normal human term placentas (37 40 weeks of


gestation,n=3)werecollectedafterCesareansection.Placentaswereobtainedafterinformed
consent of the women, and all experiments were approved by the ethics committee of the
University of Medicine and Pharmacy Iuliu Hatieganu ClujNapoca. Term placentas from
healthy donor mothers were obtained with informed consent approved according to the
procedures of the institutional review board. The harvested pieces of tissue were washed
several times in phosphatebuffered saline (PBS) and then mechanically minced and
enzymatically digested with 0.25% trypsinEDTA (Gibco) for 30 min at 37 C. After
centrifugationthecellsuspensionwasfilteredtoeliminateundigestedfragments.Forlysisthe
erythrocytes, cells suspensions were treated with FACS Lysing Solution 10x (BD Biosciences)
for 15 min. The suspension pelleted by centrifugation (1500 rpm/7 min) and suspended in
propagation medium, which consist of Dulbeccos Modified Eagles medium (Gibco)
supplementedby10%fetalcalfserum(FCS),100U/mlpenicillinstreptomycin(Gibco).
CulturesweremaintainedinDMEMwith10%fetalbovineserum(FBS;Hyclone,USA)

at37 Cwith5%CO2.Approximately23weekslater,somecoloniesconsistingoffibroblast
likecellswereobserved.Thesecellsweretrypsinizedandreplatedforexpansion.Inorderto
obtainsinglecellderivedhPMCclones,cellswereseriallydilutedin96wellcultureplates(BD
Biosciences)atafinaldensityof60cells/plate.Coloniesthatgrewwithhomogeneousbipolar
morphologywereexpanded.
IdentificationofcellphenotypicmarkersbyFACS(FluorescenceActivatedCellSorter)
passage5.Afterthesecondpassage,thecellsweretrypsinised(0.25%trypsineEDTA),washed
twice with PBS and stained according to the recommendation of the manufacturer with the
monoclonal antibodies, FITCCD44, examined with a FACS CantoII Apparatus (Becton
Dickinson). For in utero transplantation of mesenchymal stem cells from placentas, were
preparedsinglecellsuspensions.Onday13.5aftermating,pregnantmicewereanesthetized
withavertin.Underasepticconditions,theuterinehornswereexposed,anddonorcellswere
injected through a glass micropipette (inserted through the uterine wall and into the
peritoneal cavity of each fetus under direct visualization. The injection consisted of 1 x 106
hPMCsin5lofPBS.Theabdominalincisionwasclosedintwolayersusing40silk,andthe
micewereallowedtocompletepregnancytoterm.
OnE20,alowabdominalmidlineincisionwasmadeandthenumberoflivefetusesin
eachuterinehornwasrecorded.Then,placenta,fetalbloodandfetalorgansincludingbrain,
heart,lung,liver,spleenandbonemarrowwerecollected.Toobtainsinglecellsuspensionas
choppedtissueswereprocessedbytheMedimachinedevice.Forevidenceofplacentalstem
cellsinmiceorgansthesamplesweretreatedwith20lfluorescentantibody(antihuman
CD45 PECy5 antibody (PECy5: phycoerythrinCy5), (FITC: fluorescein isothiocyanate), anti
humanCD34FITCantibody(FITC:fluoresceinisothiocyanate)andantihumanCD44antibody).
Have prepared two samples for each antibody in the study: a sample and a sample labeled
withantibodyasblankunmarked.ForpositivecontrolwereusedMSCsisolatedfromplacenta
andCD34+cellsfromcordblood.

RESULTSANDDISCUSSION

ToshowthathPMCsinjectedinuteroonE13.5engraftedinfetalorgans,wecollected
fetal organ samples at E20. Most fetal tissues had demonstrable hPMC engraftment at E20.
Although the distribution pattern and numbers of cells in individual fetuses varied, hPMCs

66

UniversitateadetiineAgricoleiMedicinVeterinarIai
weredetectableinmorethan60%ofthefetus.Thefirstexperimentconductedfetallossrate
was high: 93.75% most likely due to lack of experience in producing labor in utero
transplantation. Engraftment analysis was done using FACS Diva software and results are
presentedashistograms.WeassessedthepresenceofhPMCsinvariousfetalmousetissues
(fig.1,2,3,4).

Figure1FlowcytometricanalysisofhPMCsinthemousefetusafterinuterotransplantation
ofhPMCs

Figure2Histogramrepresentationofengraftment

67

Lucrritiinificevol53seriaMedicinVeterinar

Figure3Histogramrepresentationofengraftmentofhumanmesenchymalstemcells

Figure4Histogramrepresentationofengraftmentinnegativeandpositivecontrol

Trans species animal models have been widely used in the study of stem cell
migration and engraftment (Liechty et al., 2000; Saito et al., 2002). It has been shown that
humancordbloodderivedcellscandifferentiateintohepatocytesinthemouseliverwithout
evidence of cellular fusion (Newsome et al., 2003). Human microchimerism was observed in
various organsandtissuesat4monthsaftertransplantationofhumanamnionandchorion
mesenchymal progenitors in neonatal swine and rats (Bailo et al., 2004). Human
mesenchymalstemcellscolonizedmultiplefetalsheeptissuesforaslongas13monthsafter
in utero transplantation (Liechty et al., 2000). Differences observed in cell numbers may be
duetocolonizationefficiencyindifferenttissueenvironmentsortherateofcellturnoverin
each organ (Krause et al., 2001). Our study adds to this body of work by establishing an in
utero(E13.5)modelofxenogeneichPMCtransplantationinimmunocompetentmice.

68

UniversitateadetiineAgricoleiMedicinVeterinarIai
CONCLUSIONS

Mesenchymal stem cells (MSCs) are widely distributed in a variety of tissues in the
adulthumanbody(e.g.,bonemarrow,kidney,lung,andliver).Thesecellsarealsopresentin
thefetalenvironment(e.g.,blood,liver,bonemarrow,andkidney).However,MSCsarearare
population in these tissues. The most well studied and accessible source of MSCs is bone
marrow,althougheveninthistissuethecellsarepresentinalowfrequency.
Thehumanplacentaisanattractivenewsourceofmesenchymalstemcells(MSCs),
but the biological characteristics of placentaderived MSCs have not yet been characterized.
Our results show that mesenchymal stem cells are present in the human term placenta and
may be a potential source of cells for transplantation therapy. Using routine cell culture
techniques, placental derived mesenchymal stem cells can be successfully isolated and
expandedinvitro.
Mesenchymal stem cells are mainly derived from bone marrow (Orlic et al., 2001),
but it may be difficult to obtain sufficient autologous cells from some patients, particularly
thosewhoareolderorwhohavemalignancies.Therefore,alternativesourcesareneeded.It
appears that hPMCs from an allogeneic donor might constitute such a source. A further
potentialbenefitistheexposureofthefetustoallogeneiccells,inducingtolerancesuchthat
futuretreatment.

BIBLIOGRAPHY

1.

2.

3.

4.

5.

6.

7.
8.
9.

BailoM,SonciniM,VertuaE,SignoroniPB,SanzoneS,LombardiG,ArientiD,CalamaniF,ZattiD,
PaulPetal.Engraftmentpotentialofhumanamnionandchorioncellsderivedfromtermplacenta.
Transplantation2004;78:14391448:
CarolynTroegera,DanielSurbeka,AndreinaSchberleina,StephanSchatt,LisbethDudlera,Sinuhe
Hahna, Wolfgang Holzgreve, In utero haematopoietic stem cell transplantation, SWISS MED
WKLY2006;136:498503
KrauseDS,TheiseND,CollectorMI,HenegariuO,HwangS,GardnerR,NeutzelS,SharkisSJ.Multi
organ, multilineage engraftment by a single bone marrowderived stem cell. Cell 2001;105:369
377
Liechty KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW.
Humanmesenchymalstemcellsengraftanddemonstratesitespecificdifferentiationafterinutero
transplantationinsheep.NatMed2000;6:12821286:
Liechty KW,MacKenzie TC,Shaaban AF, Radu A,Moseley AM, Deans R, Marshak DR, Flake AW.
Humanmesenchymalstemcellsengraftanddemonstratesitespecificdifferentiationafterinutero
transplantationinsheep.NatMed2000;6:12821286.
NewsomePN,JohannessenI,BoyleS,DalakasE,McAulayKA,SamuelK,RaeF,ForresterL,Turner
ML,HayesPCetal.Humancordbloodderivedcellscandifferentiateintohepatocytesinthemouse
liverwithnoevidenceofcellularfusion.Gastroenterology2003;124:18911900;
Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, NadalGinard B,
BodineDMetal.Bonemarrowcellsregenerateinfarctedmyocardium.Nature2001;410:701705;
SaitoT,KuangJQ,BittiraB,AlKhaldiA,ChiuRC.Xenotransplantcardiacchimera:immunetolerance
ofadultstemcells.AnnThoracSurg2002;74:
Shapiro E, Krivit W, Lockman L, et al. Longterm effect of bonemarrow transplantation for
childhoodonsetcerebralXlinkedadrenoleukoldystrophy.Lancet2000;356:7138.

69

PRELIMINARYSTUDYONTHEPREVALENCEOFTOXOPLASMAGONDII
INFECTIONINWILDBOARSFROMTIMISCOUNTY

IonelaHOTEA,Gh.DARABUS,C.PACURAR,TatianaRUGEA,P.MUNTEAN,M.S.ILIE,K.IMRE,
MirelaIMRE,DenisaSORESCU,AdrianBALINT,DinuINDRE

FacultyofVeterinaryMedicine,No.119,CaleaAradului,Timisoara,Romania
DSVSATimis,No.4,SurorileMartireCaceu,Timisoara,Romania
hotea_ionela@yahoo.com

Abstract: 52 blood samples from wild boars were studied to determine the seroprevalence of
Toxoplasma gondii infection. The animals came from different animals hunting areas from Timis
County.Serum samples were examined by ELISA method. Of the 52 samples from wild boars, 49 of
them(94.23%)hadantiToxoplasmaIgGantibodies.

Keywords:Toxoplasmagondii,wildboars,prevalence,TimisCounty

Toxoplasmosis is one of the most common parasitosis in humans and animals, it being
placed on the top three global spread (4). The cat is the key element in the epidemiology of
toxoplasmosis (6). For toxoplasmosis transmission, a very important role it have raw meat
consumption.Inpigs,infectionoccursbyeatingkitchenscrapsunsterilizedorrodents.Incertain
circumstances,pigsbecomecannibals biting their tails or ears. T. gondiitissuecysts of wild boar
meatareconsideredsourcesofinfectionforhumans(9).
Necropsy diagnosis in the slaughterhouse, it is very difficult to done, because very small
necrotic lesions are difficult to observe. Serological diagnosis is possible to made in the
slaughterhouse,butisnotwarrantedinoureconomicCountry'sconditions(3).
Reporting an increased incidence of toxoplasmosis in humans and animals worldwide and
thesmallnumberofbibliographicdatainourCountryaboutToxoplasmainfection,motivatesour
study.

MATERIALSANDMETHODS

The52bloodsamplescollectedfromwildboars,between20082009,weresentbyAJVPS
representatives(CountyAssociationofHuntersandFishermenSports)TimisatDSVSA(Department
VeterinaryandFoodSafety)forothertypesofanalysis.TheanimalswerehuntedinTimisCounty,
indifferentlocalities(FVhuntingareas),asfollows:
3wildboarsBuzias,
3wildboarsBrestovat,
5wildboarsSurduc,
4wildboarsBuzias,
3wildboarsOhabaLunga,
4wildboarsPaniova,
6wildboarsSacosuMare,
5wildboarsCheveresuMare,
3wildboarsRacovita,
4wildboarsSecas,
4wildboarsCulina,

70

Lucrritiinificevol53seriaMedicinVeterinar

5wildboarsZolt,
3wildboarsTopolovatuMare.
Collected blood was left to express serum and it was kept in a freezer until the month of
November 2009 when samples were processed in the laboratory of Parasitology and Parasitic
DiseasesofFacultyofVeterinaryMedicineofTimisoara.
Serum samples were examined by indirect ELISA method using ID Screen Multispecies kit
(ID.VET., France) for antiToxoplasma specific Ig G antibodies, resulting from infection with
Toxoplasmagondii.KitcanbeusedfordeterminationofantiToxoplasmaspecificIgGantibodies
fromseraofruminants,pigsandcats.Werespecttechnologymanufacturingindicatesbyproducer
company.
The S/P values above 200% were considered strongly positive, between 50 and 200%
sampleswereconsideredpositive,between40%and50%weredoubtful,whilevaluesbelow40%
wereconsiderednegative.

RESULTSANDDISCUSSIONS

FromTimisCountywerecollectedandexamined52serologicalsamplesfromwildboars.
Ofprocessedserumsamplesfromwildboars,49ofthem(94.23%)hadantiToxoplasmaIg
G antibodies. Antibody titre values were between 36.24 and 133.18, and the positive samples
valueswerebetween68.25and133.18(Table1).
ForstudiedCounties,informationobtainedareparticularlyimportantastheyarethefirst
reporteddataonToxoplasmainfectioninthearea.
High prevalence, approaching 100%, obtained from wild boar shoot the alarm on the
infestationdegreeoftheenvironmentwithoocystsandmassiveinfestationofwildanimals(Fig.1).
Thisshouldscareusmoreconsideringtoconsumption,quitefrequently,ofgamemeat,especially
wildboarsmeat.
Thestudyfoundtheabsoluteneedtobestpracticeanimalhusbandryandfoodtoreduce
theriskoftransmissionofinfectionwithT.gondiiinhumansandotheranimals.
By indirect immunofluorescence, the Czech Republic has a prevalence of 26.2% in wild
boarsandtheSlovakRepublic,8.1%(1,2).InSpain,theprevalenceofToxoplasmagondiiinfection
inwildboarswas38.4%andinJapanrangedfrom5.6%in1999to0%in2006(5,7,8).
ToxoplasmainfectionofpigsinTimisCountymattersbothbecauseofneonataldeathcan
occurinpigs,andthepossibilitiesofdiseasetransmissiontohumansthroughinadequatelycooked
meat.
Insufficiently cooked pork meat is an important source for the T. gondii infection
transmission to humans. It would be necessary to implement programs for disease control as
amonganimals,fromcatsandcontinuingwithfarmanimalstoreducetheinfestationdegreeofthe
environmentandthus,economiclossesinanimalproductsandinpeople,especiallythoseengaged
inthehighestriskcategory,iepregnantwomenandimmunosuppressedpersons.

CONCLUSIONS

WildboarsshowedToxoplasmaseroprevalenceof94.23%,withvariationsbetween50and100%.
Not having sufficient information about examined animals can't refer to the distribution of
prevalencebyageorgender.

ACKNOWLEDGMENTS
ThisworkwassupportedbyCNCSIS,Bd,grantNo.87/2008obtainedbyIonelaHoteaand
byCNMP,grantPCNo.51013/2007.

71

UniversitateadetiineAgricoleiMedicinVeterinarIai

Brestovat
100%

Secas
100%

Ohaba
Lunga 100%

Paniova 50%
Culina
100%

Topolovatu
Mare 100%

Surduc
100%

Zolt 100%

Racovita 100%

Cheveresu
Mare100%

Buzias 100%

Sacosu Mare
83.33%

Fig.1.GeographicaldistributionofToxoplasmagondiiinfectionpositivewildboars,in
TimisCounty

Table1.
PrevalenceofToxoplasmagondiiinfectioninwildboarsinTimisCounty

No.

Noexaminatedwildboars

1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.

3wildboars Buzias
3wildboars Brestovat
5wildboars Surduc
4wildboars Buzias
3wildboars OhabaLunga
4wildboars Paniova
6wildboarsSacosuMare
5wildboars CheveresuMare
3wildboars Racovita
4wildboars Secas
4wildboars Culina
5wildboars Zolt
3wildboarsTopolovatu
Mare
52

13.
Total

3(100%)
3(100%)
5(100%)
4(100%)
3(100%)
2(50%)
5(83.33%)
5(100%)
3(100%)
4(100%)
4 (100%)
5(100%)

Theminimumand
maximumtitres
values
124.87133.18
112.39126.86
80.01103.26
95.0699.22
89.45129.75
36.2498.67
31.0592.81
101.64130.71
68.2599.41
75.68121.72
96.35127.27
92.08110.85

3(100%)

120.38132.40

No.positive
samples(%)

49

72

Total
prevalence

94.23%

Lucrritiinificevol53seriaMedicinVeterinar
REFERENCES:

1. Antolova D, Reiterova K, Dubinsky P., 2007. Seroprevalence of Toxoplasma gondii in wild


boars(Susscrofa)intheSlovakRepublic.Ann.Agric.Environ.Med.,14,7173.
2. Bartova E., Sedlak K., Literak I., 2006. Prevalence of Toxoplasma gondii and Neospora
caninumantibodiesinwildboarsintheCzechRepublic.VeterinaryParasitology,142,150
153.
3. Chitimia,Lidia,Cosoroaba,I.,Cozma,V.,2007.Toxoplasmoza.Prevenireatransmiteriilaom
prinalimentedeoriginealimentara,Rev.Rom.Med.Vet.,3,1130.
4. Darabus,Gh.,Oprescu,I.,Morariu,S.,Mederle,Narcisa,2006.Parazitologiesiboliparazitare,
Ed.Mirton,Timisoara.
5. GaussCB,DubeyJP,VidalD,RuizF,VicenteJ,MarcoI,LavinS,GortazarC,AlmeraS.,2005.
Seroprevalence of Toxoplasma gondii in wild pigs (Sus scrofa) from Spain. Veterinary
Parasitology,131,151156.
6. Hotea Ionela, Darabus Gh., Mederle Narcisa, Ilie M.S., Imre K., Balint A., Indre D., 2009.
PrevalentainfectieicuToxoplasmagondiilapisiciinjudetulArad.LucraristiintificeIasi,52,
587592.
7. NogamiS.,TabataA.,MorimotoT.,HayashiY.,1999.PrevalenceofantiToxoplasmagondii
antibody in wild boar (Sus scrofa riukiuanus) on Iriomte Island. Japan, Veterinary Research
Communications,23,211214.
8. Omata, Y, Murata, K., Ito, K., Ishiguro, N., 2005. Antibodies to Toxoplasma gondii in free
ranging wild boar (Sus scrofa leucomystax) in Shokoku, Japan. Japan. J. of Zoo and Wild.
Med.,10,99102.
9. Tenter, A.M., Heckeroth, A.R., Weiss, L.M., 2000. Toxoplasma gondii: from animals to
humans,Internat.J.forParas.,30,12171258.

73


EPIDEMIOLOGICALINVESTIGATIONSONDIGESTIVEPARASITOSIS
INRACINGPIGEONSANDTHERISKOFRELEASINGPARASITIC
ELEMENTSINFREEAREAS

OlimpiaC.IACOB,B.C.C
FacultyofVeterinaryMedicineIasi
Abstract
Investigations were conducted during March 2008 May 2009 on some lofts of racing pigeons
(464pigeons)fromsixprivatepropertyholdings,locatedindifferentlocations(fourinareaBand
twoinareaI),inordertostudythedigestiveparasitosisandtorevealtheepidemiologicalroleof
racing pigeons in dissemination and transmission of parasitic diseases in free areas during
trainingorcompetitionflights.
Farms have optimal growth conditions ensuring the comfort of pigeons to achieve maximum
resultsincompetitions.Excessivesensitivityof pigeonsinstressconditionscallsattentionfrom
pigeonfancierstoensurehousingconditions,feedingandwaterconsumption,administrationof
medicinalpreparations,sanitaryandmedicalpreventivemeasures,aspecialistbeingrequiredin
exceptional cases; sometimes the faulty intervention led to expensive loss by death or by
compromisingpigeonsnextflyingseason.
Regularinvestigationsrevealedthatdigestiveparasitosiswerewithin10%ofallillnesses.Among
the digestive parasitosis that developed were trichomonosis, ascaridiosis in adult birds and
intestinal Eimeriosis in squabs confirming the source of invasive elements (Eimeria oocysts,
Trichomonas trofozoits, Ascaridia and Capillaria eggs), not only for pigeons from other
geographicareasbutalsoforothersusceptiblebirds,giventheimpressivedistancestraveledby
pigeonsduringtrainingandracing.Incasesofsevereepisodesofillnessintheloftofpigeons,the
pigeonfancierspracticethestampingoutmethodthuslimitingthediffusibilityoftheillnesses.

Keywords:racingpigeons,digestiveparasites,flights,epidemiologicalrisk

INTRODUCTION

The beauty, gentleness and delicacy of the pigeons and also their sports skills have
definitelycapturedman.Greatinterestintotheracingpigeons,theirmovementandsporting
events,callsforgreaterattentionfromthepigeonfanciersandanincreasedwarinessonthe
partofveterinarymedicalpersonnel(1,4).
Digestive based parasitosis (Trichomonosis, Eimeriosis, Toxoplasmosis,
Echinostomosis, Cestodosis, Ascaridiosis, Capillariasis, Trichostrongyliasis, Tetramerosis,
Acuariosisetc..)affectsbothyoungandadultpigeons,giventhelocationofmanyspeciesof
parasitesfromthemouthuptocloaca.Epidemiologicalsurveillancepreventstransmissionof
parasitosis both to the loft of pigeons and to other susceptible birds and not least, the
transmissionofdiseasetoman(Toxoplasmosis,Psittacosis,Pseudotuberculosis,Salmonellosis,
Paramyxovirosis,etc.).(2)
The emergence and evolution of parasitosis in pigeons are conditioned by
environmentalfactors,interrelationsbetweenecosystems,microorganismsandparasites,the
interdependence between them, the emergence of new bacterial, viral or parasitic strains.
Adultpigeonscontractsgenerallymildforms,asymptomatic,thatsometimespassunnoticed,
thusbecomingcarriersandeliminatorsofinvasiveelementstransportedoverlongdistancesin

74

Lucrritiinificevol53seriaMedicinVeterinar
free areas. Squabs and the young pigeons are extremely vulnerable to failure to the
antiparasiticandantiinfectousprophylaxicmeasuresandoftenendindeath.(3,5).
Racingpigeons, throughalltheirqualities,continuetoprovideservicestohumanity
even in the century of cosmic flights, maintaining their quality of outstanding carrier under
certaincircumstances.(1,4)
Theaimofthepaper
Investigations were conducted in order to study the digestive parasitosis in racing
pigeons and to reveal the epidemiological role in the transmission and dissemination of
parasiticelementsinthefreeareasand/ortheircontaminationwithnewinvasiveelements
attheirreturntothefarmaftersportingevents.

MATERIALANDMETHOD

The epidemiological study was conducted during March 2008 May 2009, through
investigationofsixracingpigeonsfarmssituatedindifferentlocationsandlongdistance(four
located in city B and 2 located in the city I). Number of pigeons in these farms was of 434
pigeons in peak season, including all age groups (from 10 days to 18 to 20 years) and both
sexes, pairs and unpaired. Since pigeons are highly sensitive to stress, access to farms was
periodicallyoronlywhentheownershaveannouncedcasesofdisease.
The epidemiological investigation recorded: theplacement of the farm, thehousing
spaces, the material used to build shelters, the surface reported to the pigeons density, the
divisionofhousingspace,thelightingandventilationlevelthateachsheltergives.
Therehavebeenanalyzedtheepidemiologicalhistoryregardingtheemergenceand
evolution of diseases in farms of racing pigeons, their incidence, morbidity and mortality,
immunestatus,thepresenceofaregisterorrecordbookwhereisrecordedthesituationof
pairs, spawns date, the hatching, squabs in nests, effectively applied immunoprophylaxis
measures,etc.
Therehavebeeninvestigatedtheadministrationoffood,quantityandcontentofthe
diet, how the food is stored (in warehouses or storage), watering system used in farming,
watersourceandfrequencyofitsuse,methodofmanuredisposalanddischargefrequency,
collection and disposal of residues resulting from mechanical cleaning, the conduct of
decontaminationandthematerialsusedforthispurposeineachfarm.
If participating in competitions, the investigations recorded the pigeons training
mode, the frequency of competitions, transportation to the place of shipment, the vehicle
used, mode of shipment and transportation to launch site, food rations and structure. The
recovery protocol has also been analyzed for the pigeons returning home after 34 days of
flight,periodoftimetheyhavebeenexposedtocontaminationwithinfectiousandparasitic
elements.
Ithasbeenalsoinvestigatedthespecializedveterinaryassistanceandtheprophylaxia
measures adopted, looking at the mode of administration and dosage of medicinal
preparations, the time of treatment and results, immunological situation of the loft,
mandatory vaccinations (Influenza, Pseudopesta, Paramixovirosis, Salmonellosis etc.). and
more.Themodeofvaccination,typeofvaccineused(fluid/oil,liveattenuated/inactivated)
typeofstrain,thedateofvaccinationandtrainingprotocolthatprecededtheoperationhas
alsobeeninvestigated.
Theresultswereclassifiedintablesandexpressedgraphically,andtheimageswere
takenwithadigitalcamera.

75

UniversitateadetiineAgricoleiMedicinVeterinarIai
RESULTSANDDISCUSSIONS

Monitored farms are organized on pigeon fanciers principles, built and equipped
properlytoprovideoptimumcomfortconditionstotheloftsofpigeons(80100pigeonseach).
Thedimensionsofthesheltersarevariableandbetween412mlong,24mwideand3.2m
high. Some farms have shelters suspended at a height of 23 m above the ground (Fig. 1),
othersareontheground,facingsouthorsouthwest.Theroofisnormalymadefromasbestos
ortiles,andthewallsofwoodorhardboard.Thefacadeconsistsofwindows,netaccessdoor
and flap doors for pigeons entering and leaving. Access is through a system of needles,
metal rods sliding towards the entrance or exit. In general, the shelters present aviaries in
front.

Fig.1.Farm
1pigeonsinaviaries

Inside, the shelters are divided for each age: squabs, young pigeons, for flight,
breeding,ensuringfeedingandwateringdevices,accommodationandrecreationornests(Fig.
2,3,4).
Feedingiscarriedbyeachpigeonfancierregardingtheposibilitiesandgoal,basedon
a mixture of grain, to varying degrees depending on the period of growth and training,
supplemented with vitamins and minerals. Breeding material is domestic or from import:
Janssen,Aarden,WimMuller,vanRoy,vanderWeggen.Predominantcolorsarered,scalyand
black, dark, genetically dominant. In most farms pigeons have performance results in fond,
semifond or marathon competitions. Prevention measures are applied rigorously, since on
theiroutcomedependstheparticipationincompetitions.Onreturnfromtheracepigeonsare
receiving vitaminmineral supplements purchased from specialized companies, antiparasitic
treatmentsandpreventiveantiinfectousdrugs.

76

Lucrritiinificevol53seriaMedicinVeterinar

Fig.2.Farm1.Flyingpigeonscompartmentwithpigeonsinboxesandpaired

Fig.3.Farm2.Youngpigeonscompartment

77

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.4.Farm6.Flyingpigeonscompartments

The incidence of diseases in racing pigeons from the six farms has been analyzed
periodically,revealingthe differentaspects.Pigeonsexaminationresults from January 2008
arelistedinTable1.

Table1.
ThestructureoftheflockofpigeonsandthesuspectedcasesofilnessinJanuary2008
Examined
Suspectedofilness
Numberof
Farm
Numberof

adult
(F)
squabs
pigeons
Adults
Squabs
Adults
Squabs
1.
28
0
4
0
0
0
2.
70
0
2
0
0
0
3.
62
0
6
0
0
0
4.
110
4
8
4
0
2
5.
72
0
6
0
0
0
6.
66
0
8
0
0
0
Total

408

34

Analyzing the data in Table 1, note that in January, the loft of pigeons in the study
totalizeanumberof408pigeons,ofwhichfourweresquabsthatappearedaccidentallyinF
4.Clinicallyexaminedwere34adultsandfoursquabssuspectedwithTrichomonascolumbae
infestation.Ofthefoursquabs,twowerepositiveinfestatedwithT.columbae(F4).

78

Lucrritiinificevol53seriaMedicinVeterinar
Allspecimensexaminedshowedsignsofirregularity,mildlossofappetiteandthe4
squabsmanifestedadditionalsymptomsasdiarrhea,prostration,anddifficultyinswallowing
orhoriplumation.ThedynamicsofdiseaseincidencewithinthesesixfarmsinJanuary2008is
showninFig.5.

Fig.5.ThedynamicsofpigeonsilnesswithinthesixstudiedfarmsinJanuary2008

PigeonsexaminationresultsinApril,2008areincludedinTable2.

Table2.
ThestructureoftheflockofpigeonsandthesuspectedcasesofilnessinApril2008
Examined
Suspectedofilness
Numberof
Farm
Numberof

adult
(F)
squabs
pigeons
Adults
Squabs
Adults
Squabs
1.
28
16
2
6
0
2
2.
70
32
6
12
1
4
3.
60
45
12
16
0
2
4.
104
36
8
4
0
1
5.
72
26
6
12
1
2
6.
62
27
2
8
0
0
Total

396

182

36

58

11

Analyzing the data in Table 2, it is observed that in April breeding is already


underway,withatotalof182offspring,thustotaling578actualspecimensolderthan10days.
Clinically examined were 36 adult pigeons two of them being suspected of disease
and58squabs,ofwhich11weresuspected,totalizing13pigeonswithalteredstate.Pigeons
had diarrhea, irregularity, mild loss of appetite, the clinical signs being more pronounced in
79

UniversitateadetiineAgricoleiMedicinVeterinarIai
squabs,inadditionbeingfoundanddullplumage.Itisnotedthatthenumberofbirdsaffected
is higher in F 2 (5 pigeons, about 39% of total), where pigeon fancier started breeding first
fromallothersixfanciers(March6).Thedynamicsofdiseaseincidenceinpigeonswithinthe
sixstudiedfarmsinAprilisdepictedinFig.6.

Fig.6.ThedynamicsofpigeonsilnesswithinthesixstudiedfarmsinApril2008

PigeonsexaminationresultsinAugust2008isincludedinTable3.

Table3.
The structure of the flock of pigeons and the suspected cases of ilness in August
2008
Numberof
adult
pigeons

Numberof
squabs

1.
2.
3.
4.
5.
6.

18
52
48
68
64
52

Total

302

Farm(F)

Examined

Suspectedofilness

29
46
34
42
32
34

Adults
4
6
12
10
9
8

Squabs
12
16
10
8
6
5

Adults
1
1
2
2
1
0

Squabs
2
4
3
5
2
1

217

49

57

17

In Table 3 it can be observed the decrease in the number of adults because the
competionseasonisinfullswing,andtheincreaseinthenumberofyoungpigeonsseekingto
balancetheloft.Therewereclinicallyexamined106specimensfromtheageof10daysand

80

Lucrritiinificevol53seriaMedicinVeterinar
wereidentifiedassuspiciousofdisease24pigeons.Symptomsweretypicalfornematodosis
and intestinal trichomonosis characterized by digestive syndrome, weakness, difficulty in
swallowing, the presence of fibrinous deposits in the mouth, prostration, left wing. The
dynamicsofdiseaseincidenceinpigeonswithinthesixstudiedfarmsinAprilisdepictedinFig.
7.

Fig.7.ThedynamicsofpigeonsilnesswithinthesixstudiedfarmsinAugust2008

PigeonsexaminationresultsinDecemberisincludedinTable4.

Table4.
ThestructureoftheflockofpigeonsandthesuspectedcasesofilnessinDecember
2008
Farm
(F)

Numberof
adult
pigeons

Numberof
squabs

1.
2.
3.
4.
5.
6.

22
54
50
54
60
48

Total

288

Examined

Suspectedofilness

16
22
20
18
22
24

Adults
6
10
16
12
18
9

Squabs
6
8
12
8
6
8

Adults
0
1
0
0
1
0

Squabs
0
2
1
0
0
2

122

71

48

InTable4isobservedthatthenumberofadultbirdsdecreasedcomparedwiththe
summer season: in August, adult birds were sorted through competitive stages (marathon,
national contests), through sales, or losses and youth has also been sorted through training
flightsandsquabstrials.

81

UniversitateadetiineAgricoleiMedicinVeterinarIai
Therehavebeen119pigeonsclinicallyexaminedofwhichfivepigeonshaddigestive
disorders.Thesymptomspresentedbythesickpigeonsweresimilartothosedescribedabove,
specifyingthatinthiscasetheyhadacommoncharacterregardlessofpigeonsage.Reduced
incidence of cases of disease can be explained because there were applied prevention
measuresinfarmsinSeptemberOctoberandtheyouththroughgrowthhavestrengthened
theirimmunestatus,theloftsreachinganimmunologicaluniformity.
ThedynamicsofdiseaseincidenceinpigeonsinDecember2008isdepictedinFig.8.

Fig.8.ThedynamicsofpigeonsilnesswithinthesixstudiedfarmsinDecember2008

ExaminationresultfortheflocksofpigeonsinMarch2009iscontainedinTable5.

Table5.
The structure of the flock of pigeons and the suspected cases of ilness in March

2009

1.
2.
3.
4.
5.
6.

Number
ofadult
pigeons
38
74
72
70
94
69

TOTAL

417

Farm
(F)

Numberof
squabs

Examined

Suspectedofilness

0
0
0
0
0
12

Adults
4
2
6
2
7
10

Squabs
0
0
0
0
0
8

Adults
0
0
1
0
0
3

Squabs
0
0
0
0
0
2

12

35

In Table 5 can be observed that in March 2009 pigeons examination included a


reduced number of pigeons, 35 adults four of them being suspected of disease and eight
squabs in which two suspected. During this time most farms applied spring prophylactic

82

Lucrritiinificevol53seriaMedicinVeterinar
measureswithpositiveresultsonloftsofpigeonsandreducecasesofdisease.Thedynamics
ofdiseaseinloftsofpigeonsinMarch2009isdepictedinFig.9.

Fig.9.ThedynamicsofpigeonsilnesswithinthesixstudiedfarmsinMarch2009

Followingfurtherdemandsexpressedbyotherpigeonfanciers,wasconductedclinical
examination of pigeons with impaired health who presented polymorphic symptoms. Note
thatinJuneandSeptember2008wereexamined20cases,inApril2009,34casesandinMay
2009,12cases(Table6).

Table6.
Theincidenceofthesupplementerydemandsofexaminationforthepigeonsthatexpressed
impairedhealthfromthesixstudiedfarms,March2008May
Examinedpigeons(March2008May2009)

Pigeon
sFarm

Mar

May

Jun

Jul

Sep

Oct

Nov

Jan

Feb

Apr

May

1.
2.
3.
4.
5.
6.

2
0
0
0
0
4

0
4
0
0
6
0

0
0
8
12
0
0

0
0
0
0
0
0

6
0
14
0
9
0

0
0
0
6
0
0

0
11
0
0
0
0

0
0
0
0
0
0

5
0
0
0
0
0

0
9
0
0
13
12

5
0
0
7
0
0

TOTAL

10

20

20

11

34

12

InTable6itappearsthatfollowingtheadditionalclaimsarisedfromtheoccurrence
ofmorbidstates,wereclinicallyexaminedanumberof124racingpigeonsofallagesandboth
sexes stressing that regular examinations were not sufficient. The dynamics of disease in
pigeonswithpolymorphicsymptomsindicatedbyadditionalrequestsin20082009isshownin
Fig.10.

83

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.10.Thedynamicsofthesupplementaryexaminationsinpigeonsfromthesix
studiedfarmsinMarch2008May2009

The incidence of digestive parasitic diseases detected in pigeons that were


supplemetaryexaminedduringMarch2008May2009iscontainedinTable7.

Table7.
Theincidenceofthedigestiveparasitosissuspectedcasesafterthesupplementary
examinationsofpigeonsinMarch2008May2009
Pigeonssuspectedofdigestiveparasitosis

Pigeon
sFarm

Mar

May

Jun

Jul

Sep

Oct

Nov

Jan

Feb

Apr

May

1.
2.
3.
4.
5.
6.

0
0
0
0
0
2

0
0
0
0
0
0

0
0
1
2
0
0

0
0
0
0
0
0

1
0
2
0
0
0

0
0
0
0
0
0

0
0
0
0
0
0

0
0
0
0
0
0

1
0
0
0
0
0

0
0
0
0
2
0

1
0
0
3
0
0

TOTAL

In Table7isobservedthe incidenceofdiseasecasesinpigeonsexaminedfollowing
additionalrequestsand,basedontheclinicalpictureweresuspectedofanongoingdigestive
parasitosis, the ratio beetween the number of examined pigeons (124) and the number of
suspects(15)beingrelativelylow.Thedynamicsofdigestiveparasitosissuspectedinthelofts
ofpigeonsexaminedfollowingadditionalrequestsisdepictedinFig.11

84

Lucrritiinificevol53seriaMedicinVeterinar

Fig.11.Thedynamicsofthedigestivediseasesincidenceinpigeonsfromthesixstudied
farmsinMarch2008May2009

Themonitoringofthesixfarmsofracingpigeonshasbeenregularlymadeandadded
the supplementary investigations for defining the intensivity and extensivity of the invasive
elementsandtheirtransmissiontofreeareasorcontaminationofpigeonsduringtrainingand
competitionswithnewparasiticelementsandtheirdisseminationatthereturn tonest.The
medicalhistoryrevealsthatfourofthesixpigeonfanciersusethestampingout''methodin
caseofseveredisease,removingthespecimensfromthefarmorisolatingtheminquarantine
boxesandapplyingappropriatetreatmentmeasuresinordertoreduceorblockthehorizontal
transmissionofdisease.Housingspacesforgroundholdings(andthosesuspendeduncleaned
andunsanitized),areasporestartingfavorableenvironmentforthe oocystsofEimeria,and
preservation of eggs of Ascaridia, and Capillaria eliminated by adult carrier pigeons and the
infestationofthesquabsoryoungpigeons.Anyparasiticaggressionexertedonthedigestive
tubehasdirectconsequencesfortheharmoniousdevelopmentofpigeons,flightcapacityand
alsoreducesportsperformance.Permanentepidemiologicalsurveillancerepresentsthebasis
topreventtheoccurrenceofmorbidstatesofparasitic,infectious,nutritionalorigininloftsof
pigeonsandtolimittheriskoftransmissionofzoonosesinhumans.

CONCLUSIONS

Epidemiological investigations were conducted during January 2008 May 2009 on


some lofts of racing pigeons from six private farms to highlight the presence of invasive
parasiticelementsandtheriskoftheirdisseminationduringflightinfreeareas.
Ofallcasesstudied(464pigeons),80%weresuspectedasbacterialorviraldiseases,
10%weresuspectedasdigestiveparasitosis(46pigeons)and10%asotherdisorders.
TheclinicalexpressionofthemorbidstateswasreducedduringJanuaryMarch2008,
thenfromApriluntilAugust,therewasanupwardcurveofdiseasewhichpeakedinJune.

85

UniversitateadetiineAgricoleiMedicinVeterinarIai
In the monitored farms the flight was performed and the pigeons were selected
based on their sports performance and not their phenotypic characters; the studies have
shown that following sports season, several pigeons are lost or suffering from the insidious
naturediseasesthatdetermineadecreaseinresistancetostressandsustainedexercise.
It was noted the important role of hygiene, proper nutrition, preventive measures
and compliance with density, but above all, vigilance and knowledge of the most common
parasitic diseases to intervene in time and to minimize the future economic and emotional
losses.
Duringtrainingandsportscompetitionspigeonsflyhugedistances(thousandsofkm)
increasing the risk of disseminating invasive elements (and not only) in areas free of
infestationfollowedbytheinfestationofotherloftsofpigeonsorresponsivegallinaceaeand
also their contamination when travelling endemic areas and infestation of the loft at their
return.
Pigeonsaremeanttoflyfreeandforracingpigeonstoreturntotheirnestregardless
of where they are released, requiring constant epidemiological surveillance and a real
collaborationbetweenfanciersandveterinaryservice.

BIBLIOGRAPHY

1.Bilius,M.,2000,,Paranormalsauintuiielaporumbelulcltor,RevistaVoiajorul.
2.Iacob,Olimpia,2002ParazitologieiclinicabolilorparazitareProtozooze.Ed.IonIonescu
delaBradIaipag.6669;102;135143.
3.IacobOlimpia,2006ParazitologieiclinicabolilorparazitarelaanimaleHelmintoze.Ed.Ion
IonescudelaBradIaipag.;344347;396398;402407
4.Iftode,Ghe.,GeorgianaIftode,CristinaIftode,MirelaIftode,2006Porumbeiideagrementi
sportdinRomnia.Ed.Lidana,Suceava
5.Severeanu,I.,F.I.,Ivana,1991,,BolileporumbeilorEd.Ceres,Bucuretipag.177206

86


PRELIMINARYDATACONCERNINGOPTIMIZATION
OFAPCRBASEDMETHODFORMOLECULARDETECTION
OFTICKBORNEPATHOGENS

MarianaIONITA1,D.K.HOWE2,I.L.MITREA1,B.STEVENSON3,MichelleYEARGAN2
1
UASVMBucharest,FacultyofVeterinaryMedicine,SplaiulIndependentei105,sector5,
050097,Bucharest,Romania,ionitamvet@yahoo.com
2
DepartmentofVeterinaryScience,GluckEquineResearchCenter,UniversityofKentucky,
Lexington,KY405460099,USA;3DepartmentofMicrobiology,Immunology,andMolecular
Genetics,CollegeofMedicine,UniversityofKentucky,Lexington,KY405360298,USA

Tickbornezoonoticinfectionsareamongthemostdiffusevectorbornediseases.Approximately
10% of the currently known 867 tick species act as vectors of a broad range of pathogens
(protozoa,rickettsia,spirochaetesandviruses)ofdomesticanimalsandhumans,andasignificant
numberofthesepathogensareagentsofemerginginfectiousdiseases.Oneofthefirststepfor
tickborneriskassessmentisthedetectionofthesepathogensintheirvectors.PCRamplification
of pathogen DNA using speciesspecific primers is now the standard for pathogen detection in
ticks.
In this paper are presented some preliminary data of our trials on optimizing the general and
particularconditionsofaPCRbasedRLBassayformoleculardetectionofBorreliaburgdorferi
theagentofLymedisease,oneofthemostimportanttickbornezoonoticdisease.Weusedthe
23S5SrRNAspacerregionofB.burgdorferisensulatoasthetargetforPCRanddeterminedthe
genomicgroupofB.burgdorferisensustricto(B31strain)byhybridizationofthePCRproductto
fourgenomicspecificoligonucleotideprobesimmobilizedonamembrane.ThePCRwasshown
tobespeciesspecific;inRLBassaytheanticipatedgenomicgroupB.burgdorferisensustricto
was identified in all positive samples. No cross hybridization with other genomic group were
registered in RLB assay. The genomic group was confirmed also by DNA sequencing, and in
consequencesthemethodwasvalidated.

Keywords:ticks,pathogens,detection,Borreliaburgdorferi,PCR,RLBhybridization

Vectorborne diseases are currently considered a major health risk, not only in
tropicalandsubtropicalregions,butintemperateregionsaswell,whereclimatechangecould
create conditions suitable for outbreaks of a such diseases. Predicting the effects of global
warmingonhealthrequiresanexaminationofthecurrentincidenceanddistributionofmajor
vectorbornediseases.Ticksareconsidered,aftermosquitoes,themostimportantvectorsfor
infectiousdiseasesworldwide.Tickstransmitagreatervarietyofpathogenicmicroorganisms
(protozoa,rickkettsiae,spirochaetesandviruses)thananyotherarthropodvectorgroup,and
asignificantnumberofthesepathogensareagentsofemerginginfectiousdiseases(Jongegan
andUilenberg,2004).
Tickborne zoonotic infections are among the most diffuse vector borne diseases
(Sambrietal.,2004).Approximately10%ofthecurrentlyknown867tickspeciesactasvectors
of a broad range of pathogens of domestic animals and humans (Jongejan and Uilenberg,
2004), which cause diseases such as anaplasmosis, babesiosis, ehrlichiosis, Lyme borreliosis,
and rickettsiosis (EstradaPena and Jongegan, 1999). Lyme borreliosis is the most significant
vectorbornediseaseinEuropeandtheUnitedStates.Oneofthefirststepfortickbornerisk
assessmentisthedetectionofthesepathogensintheirvectors.PCRamplificationofpathogen

87

Lucrritiinificevol53seriaMedicinVeterinar
DNAusingspeciesspecificprimersisnowthestandardforpathogendetectioninticks(Parola
andRaoult,2001;Sparaganoetal.,1999).
Tickborne pathogens (protozoa, rickettsia or viruses) can coexist in the same tick
vectororbecarriedbydifferenttickspecies,anditisdifficulttoidentifyapathogenincarrier
animals or ticks which are carrying low level of infection. In this situation, molecular tools,
particularlyamplificationofspecificmarkersusingthepolymerasechainreaction(PCR)have
revolutionizeddetectionandidentificationofpathogenicorganisms(Sparaganoetal.,1999).
Although many useful speciesspecific PCR assays have been developed to detect a
particulartickbornepathogen,however,PCRassayscanbetimeconsuming,laborintensive
andexpensive,particularlywhentestingformultiplepathogensinalargenumberofsamples.
Forthis purpose,itis recommendedtheuseofatestwhereitispossibleto simultaneously
detectanddifferentiateallprotozoanandehrlichialparasitesthatcouldpossiblybepresentin
a vector ticks or in the blood of an infected host (Sparagano et al., 1999). Reverse line blot
(RLB) hybridization, where multiples samples can be analyzed against multiple probes to
enablesimultaneousdetection,fulfilsthesecriteria.
In this paper we presented some preliminary data of the trials on optimizing the
generalandparticularconditionsofthePCRbasedRLBassayformoleculardetectionofsome
tickborne pathogens, such as Borrelia burgdorferi the agent of Lyme disease. Borrelia
burgdorferi sensu lato, the causative agent of the zoonosis Lyme borreliosis (LB), is
transmittedbyticksofthegenusIxodes(Burgdorferetal.,1982).Theinfectionmayaffectthe
nervoussystem,causearthritis,orresultinachroniccutaneousmanifestation,acrodermatitis
chronica athrophicans (Steere, 1989). B. brugdorferi sensu lato has been divided into three
groupsonthebasisofDNArelatedness:B.burgdorferisensustricto,B.garinii,andB.afzelii
(Barantonetal.,1992,Canicaetal.,1993).
In the study described here, we used the spacer region between the 5S23S rRNA
genes (rDNA) of Borrelia burgdorferi sensu lato as the target for PCR. The 23S and 5S rRNA
genesaretandemlyduplicatedintheorder23s5S23S5SinB.burgdorferisensulato,andthis
arrangementhasnotbeenfoundinothermembersofthegenusBorreliaorothereubacteria
(Schwartzetal.,1992).Inthesecondstep,wedeterminedthegenomicgroupofB.burgdorferi
sensu stricto (B31 strain) by hybridization of the PCR product to four genomicspecific
oligonucleotideprobesimmobilizedonamembrane,testingdifferentconditions,inorderto
optimizethemethodforfurthermolecularstudies.

MATERIALSANDMETHODS

Ticks and bacterial strains. Ixodes ricinus ticks were collected from natural infested
cattle from some regions in NorthEast of Romania. Immediately after collection, the ticks
wereimmersedin70%ethanolandstored.
ThegenomicgroupofBorreliaburgdorferisensustrictoB31strainwasusedfortesting
thespecificityofPCRandRLBhybridization,inordertooptimizetheparticularconditionsforthe
methods.
PreparationofDNAextractsfromticks.TickswereprocessedasdescribedSchoulset
al.(1999).Briefly,theticksweretakenfromthe70%ethanolsolution,airdried,andboiledfor
20minin100lof0.7MammoniumhydroxidetofreetheDNA.Aftercooling,thevialwith
thelysatewasleftopenfor10minat90Ctoevaporatetheammonia.Theticklysateeither
wasuseddirectlyforPCRorwasstoredat20Cuntiluse.
PCRamplification.Thepolymerasechainreaction(PCR)amplificationwascarriedout
ina25lreactionvolumes.FortheamplificationofBorreliaburgdorferisensulatoDNA,each

88

UniversitateadetiineAgricoleiMedicinVeterinarIai
reactionmixturecontainedtheprimers23SN2and5SCB(Table1),and5laliquotsoftheB.
burgdorferis.s.DNAandtickextracts.TominimizenonspecificamplificationatouchdownPCR
programwasused:3minat94C,twocyclesof20sat94C,30sat67C,and30sat72C,and
then two cycles with conditions identical to the previous cycles but with an annealing
temperature of 65C. During subsequent two cycles sets the annealing temperature was
loweredby2Cuntilitreached57C.Then,anadditional40cycleseachconsistingof20sat
94C,30sat57C,and20sat72C,followedthetouchdownprogram,wereperformed.The
PCRwasendedbyanextraincubationfor7minat72C.
ReverseLineBlotHybridization.Thereverselineblottingtechniquewasperformed
as described by Schouls et al. (1999). For species identification, Borrelia PCR product were
hybridizedwithprobesforB.burgdorferisensulato,B.burgdorferisensustricto,B.afzelii,B.
garinii.
DNA sequencing. The PCR products from samples with positive signal in RLB assay
wereused forDNAsequencinginorderto confirmthegenotypeofBorreliaburgdorferiand
implicitforvalidationofmethods.

RESULTSANDDISCUSSIONS

For determining the specificity of PCR were tested range of B. burgdorferi sensu
stricto(B31strain) DNAconcentrations:twosamplesdilutedinwater,onepooledwithtick
lysate. The last one samples was added in order to check the potential presence of tick
inhibitors for PCR amplification. In the PCR were included also three different samples with
ticklysatesfromIxodesricinus,whichwerenotpositiveinpreviouslyPCRs.

89

Oligonucleo
tidename
Primer
5SCB
5biotinGAGAGTAGGTTATTGCCAGGG
23SN2
ACCATAGACTCTTATTACTTTGACCA
Probes
5aminoCTTTGACCATATTTTTATCTTCCA
SL
5aminoAACACCAATATTTAAAAAACATAA
SS
5aminoAACATGAACATCTAAAAACATAAA
GA
5aminoAACATTTAAAAAATAAATTCAAGG
AF

453430
322299
322298
305278
23S5Sspacer
23S5Sspacer
23S5Sspacer
23S5Sspacer

Borreliaburgdorferisensulato
Borrelia burgdorferi sensu
stricto
B.garinii
B.afzelii

243263
469444

Nucleotid
position

Borreliaburgdorferisensulato 23S5Sspacer
Borreliaburgdorferisensulato 23S5Sspacer

OligonucleotideprimersandprobesusedinPCRandhybridizationassay

Oligonucleotidesequence
Targetorganism
Targetgene

Rijpkema
etal,1995

Rijpkema
etal,1995

Reference

Table1
Lucrritiinificevol53seriaMedicinVeterinar

90

UniversitateadetiineAgricoleiMedicinVeterinarIai
From each PCR reactions, 5 l were subjected to electrophoresis on ethidium
bromidestained1%agarosegelandvisualizedunderUVtransillumination(fig.1).
InallsampleswithB.burgdorferiDNA(B31strainnondiluted,dilutedinwater)the
intergenic23S5Sspacergenewasamplified,obtainingavisiblebandof226bp(Fig.1).Noany
differencesofPCRamplificationfordilutedsamplewereregistered.Also,thesamplewithB.
burgdorferiDNApooledwithticklysatewasamplifiedinthePCR.Thisfinding,emphasizesthat
therewerenottickinhibitorswhichcouldaffecttheamplificationreactionsinthePCR.
ThethreeticklysatesampleswerenotamplifiedbyPCRtheB.burgdorferiintergenic
23S5Sspacergene.

MW 4
2
3
1
5
6
7
8

226

bp

Fig.1.Amplificareaspecific(PCR)aspaiatoruluiintergenic23S5SarDNA(226bp)
Borreliaburgdorferi:1,2,3ticklysate;MWmolecularweightmarker;4B.burgdorferiDNA
nondiluted;5B.burgdorferiDNAdilutedinwater;6B.burgdorferipooledwithticklysate;7
negativecontrol(water)

Onlytheintergenic23S5SampliconsweresubjectedtotheRLBassay.Foroptimizing
the conditions for RLB assay, different oligonucleotidic probe concentrations were used,
ranging from 10 pmol to 800 pmol (Table 2). In the RLB hybridization, a negative control
(water), was included, too. Hybridization of PCR products to speciesspecific probes was
revealedbychemiluminescenceusingSuperSignalsubstrate(Pierce,Rockford,IL),andimages
weredocumentedwithaFluorChem8800imagingsystem(AlphaInnotech,SanLeandro,CA).

91

Lucrritiinificevol53seriaMedicinVeterinar
Table2
OligoprobefinalconcentrationstestedintheRLBassay

Oligoprobes
B.burgdorferiSL(sensulato)
B.afzelii(AF)
B.garinii(GA)
B.burgdorferiSS1(sensustricto)
B.burgdorferiSS2(sensustricto)
B.burgdorferiSS3(sensustricto)
B.burgdorferiSS4(sensustricto)

Finalconcentration
(cpmol)
100
800
800
100
50
25
10

References
Schoulsetal.,1999
Schoulsetal.,1999
Schoulsetal.,1999
Schoulsetal.,1999
Schoulsetal.,1999
Schoulsetal.,1999
Schoulsetal.,1999

OLIGONUCLEOTIDE PROBES

B. afzelii

B. garinii

B. burgdorferi SS4
B. burgdorferi SS3

B. burgdorferi SS2

B. burgdorferi SS1

B. burgdorferi SL

12 3456

PCR Products

Fig.2.ReverselineblothybridizationassayanalysesforthedetectionandidentificationofB.
burgdorferi.Theoligonucleotideprobesareattachedtothemembraneinthehorizontal
direction.andthePCRsamplesappliedperpendicularlyintheverticaldirection.ThePCR
ampliconsderivedfrom:1B.burgdorferinondilutedDNA;2B.burgdorferiDNAdilutedin
water;3negativecontrol(water);46B.burgdorferipooledwithticklysate

92

UniversitateadetiineAgricoleiMedicinVeterinarIai
ThePCRwasshowntobespeciesspecific,andinRLBassaytheanticipatedgenomic
groupB.burgdorferisensustrictowasidentifiedinallpositivesamples.
TheoptimalconcentrationoftheB.burgdorferiSSoligoprobewas10pmol.Nocross
hybridizationwithothergenomicgroupwereregisteredinRLBassay.
ThreeofthePCRampliconswhichhaveshownpositivehybridizationintheRLBassay
were subjected to DNA sequence analysis, in order to confirm the genomic group, and to
validatethemethod.Sequencesweredeterminedinbothdirections(usingthesameprimers
individually as for the PCR).Sequenceswere subjected to National Center for Biotechnology
Information (NCBI) BLAST analysis for the homology. NCBI BLAST analysis revealed 99%
homologywithBorreliaburgdorferi(strainB31)sensustrictointernaltranscribedspacerDNA
sequencesavailableinGenbank(accessionnumbers:L30127.1GI:508388)(fig.3).
Therefore,resultsofthetrialsdescribedinthisstudy,confirmedthegenomicgroup,
andvalidatedtheoptimalconditionsofthePCRbasedRLBhybridizationmethod,forfurther
studiesformoleculardetectionoftickbornepathogensinRomania.
RLB was originally developed for the identification of Streptococci serotypes
(Kaufhold et al., 1994). The assay has been used also for molecular identification of some
parasitessuchasequinesmallstrongylespecies(Traversaetal.,2007,Cernaskaetal.,2009,
Ionitaetal.,2010).
ThefirstapplicationofRLBforthedetectionanddifferentiationofpathogensinticks
was developed for Borrelia spirochetes (Rijpkema, 1995), for simultaneously identify the
genomicgroupsofB.burgdorferisensulatointickscollectedinthefield.Theresultsshowed
that 10 to 35% of the Ixodes ricinus ticks from The Netherlands were infected with B.
burgdorferigenospecies.Subsequently,RLBwascombinedwithEhrilichiaspp.(Schoulsetal.,
1999), confirming the previously findings; on the other hand, it showed, also a high rate of
infectionwithEhrlichiaspecies(45%),andcoinfectionwithEhrlichiaandtwogenospeciesofB.
burgdorferi
RLB was then successfully applied for the detection and differentiation of all known
Theileria and Babesia species (Gubbels et al., 1999), for the characterization of Babesia
divergensinhumans(CentenoLimaetal.,2003),andnovelTheileriaandBabesiaspecieswere
discoveredthroughtheapplicationofRLB(Nijhovetal,2003).Furthermore,RLBwasusedfor
detection and differentiation of many Babesia and Theileria spp. occurring in small ruminants
(Schnittgeretal.,2004).PCRandRLBwereused,alsotodetectandidentifyB.burgdorferisensu
lato, Anaplasma and Ehrlichia species, and spotted fever group rickettsiae in ticks from
SoutheasternEurope(Christovaetal.,2003).Prevalencedataforpathogensintickscanbeused
toassesstheriskoftickbornediseasesforpublichealth.
Inconclusion,RLBisaversatilediagnostictool,whichsensitivelyandsimultaneously
detectsanddifferentiatespathogensinticks,bloodortissue.RLBcombinePCRamplification
followedbyahybridizationstep,resultinginsensitivityupto100foldorhigherthanPCRonly.

CONCLUSIONS

1.TheoptimalconditionsofaPCRbasedRLBassayformoleculardetectionofBorrelia
burgdorferitheagentofLymedisease,oneofthemostimportanttickbornezoonoticdisease,
wereestablished.
2.Amplificationandhybridizationofthe23S5SrDNAintergenicspacerregionprovidean
accurateandrapidmethodofdeterminingthepresenceofthegenomicgroupsofB.burgdorferi
sensulato.

93

Lucrritiinificevol53seriaMedicinVeterinar
3. The PCR was shown to be species specific; in RLB assay the anticipated genomic
groupB.burgdorferisensustrictowasidentifiedinallpositivesamples.Nocrosshybridization
withothergenomicgroupwereregisteredinRLBassay.
4.ThegenomicgroupwasconfirmedbyDNAsequencing;theoptimalconditionsfor
the PCRbased RLB hybridization method were validated for further studies for molecular
detectionoftickbornepathogensinRomania.

ACKNOWLEDGEMENT

This work was supported by CNCSIS UEFISCSU, project number PNII IDEI code
729/2007,directorMarianaIonita,Lecturer,PhD,DVM.

REFERENCES

1. BarantonG,PosticD,SaintGironsI,BoerlinP,PiffarettiJC,AssousM,GrimontPA.,1992.
DelineationofBorreliaburgdorferisensustricto,Borreliagariniisp.nov.,andgroupVS461
associatedwithLymeborreliosis.IntJSystBacteriol.;42(3):37883.
2. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP., 1982. Lyme
diseaseatickbornespirochetosis?.Science.18;216(4552):13179.
3. Canica M.M., Nato F., du Merle L., Mazie J.C., Baranton G., Postic D., 1993. Monoclonal
antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous
manifestationsofLymeborreliosis.ScandJInfectDis.;25(4):4418.
4. CentenoLimaS,doRosrioV,ParreiraR,MaiaAJ,FreudenthalAM,NijhofAM,Jongejan
F., 2003. A fatal case of human babesiosis in Portugal: molecular and phylogenetic
analysis.TropMedIntHealth.;8(8):7604.
5. Cernaska, D., Paoletti, B., KralovaHromadova, I., Iorio, R., Cudekova, P., Milillo, P.,
Traversa, D., 2009. Application of a reverse line blothybridisation assay for the species
specific identification of cyathostomins (Nematoda, Strongylida) from benzimidazole
treatedhorsesintheSlovakRepublic.Vet.Parasitol.160,171174.
6. Christova I, Van De Pol J, Yazar S, Velo E, Schouls L., 2003. Identification of Borrelia
burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group
RickettsiaeinticksfromSoutheasternEurope.EurJClinMicrobiolInfectDis.;22(9):53542
7. EstradaPena A., Jongejan F., 1999. Ticks feeding on humans: a review of records on
humanbiting Ixodoidea with special reference to pathogen transmission. Exp Appl
Acarol.;23(9):685715.
8. EstradaPena A., 2009. Tickborne pathogens, transmission rates and climate change.
FrontBiosci.,1;14:267487
9. GubbelsJM,deVosAP,vanderWeideM,ViserasJ,SchoulsLM,deVriesE,JongejanF.,
1999.SimultaneousdetectionofbovineTheileriaandBabesiaspeciesbyreverselineblot
hybridization.JClinMicrobiol.;37(6):17829.
10. IonitaM,HoweDK,LyonsET,TolliverSC,KaplanRM,MitreaIL,YearganM.,2010.Useofa
reverse line blot assay to survey small strongyle (Strongylida: Cyathostominae)
populations in horses before and after treatment with ivermectin. Vet Parasitol.;168(3
4):3327
11. Jongejan F, Uilenberg G., 2004. The global importance of ticks. Parasitology. 2004;129
Suppl:S314

94

UniversitateadetiineAgricoleiMedicinVeterinarIai
12. Kaufhold A., Podbielski A., Baumgarten G., Blokpoel M., Top J., Schouls L., 1994. Rapid
typingofgroupAstreptococcibytheuseofDNAamplificationandnonradioactiveallele
specificoligonucleotideprobes.FEMSMicrobiolletters;119(12):1925
13. NijhofA.M.,PenzhornB.L.,LynenG.,MollelJ.O.,MorkelP.,BekkerC.P.,JongejanF.,2003.
Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tickborne parasites associated
withmortalityintheblackrhinoceros(Dicerosbicornis).J.ClinMicrobiol,41(5):224954
14. ParolaP,RaoultD.,2001.TickbornebacterialdiseasesemerginginEurope.ClinMicrobiol
Infect.;7(2):803.Review.
15. Rijpkema S.G., Molenboer M.J., Schouls L.M., Jongejan F., Schellekens J.F., 1995.
Simultaneousdetection andgenotyping ofthree genomic groups of Borrelia burgdorferi
sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic
spacerregionbetween5Sand23SrRNAgenes.J.ClinMicrobiol,33(12):30915
16. SchnittgerL,YinH,QiB,GubbelsMJ,BeyerD,NiemannS,JongejanF,AhmedJS.,2004.
Simultaneous detection and differentiation of Theileria and Babesia parasites infecting
smallruminantsbyreverselineblotting.ParasitolRes.;92(3):18996
17. SchoulsL.M.,VanDePolI.,RijpkemaS.G.,SchotC.S.,1999.Detectionandidentificationof
Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus
ticks.JClinMicrobiol.,37(7):221522
18. SchwartzJJ,GazumyanA,SchwartzI.,1992.rRNAgeneorganizationintheLymedisease
spirochete,Borreliaburgdorferi.JBacteriol.;174(11):375765.
19. Sparagano OA, Allsopp MT, Mank RA, Rijpkema SG, Figueroa JV, Jongejan F., 1999.
MoleculardetectionofpathogenDNAinticks(Acari:Ixodidae):areview.ExpApplAcarol.;
23(12):92960.
20. SteereAC.,1989.,Lymedisease.NEnglJMed.;321(9):58696.
21. Traversa,D.,Iorio,R.,Klei,T.R.,Kharchenko,V.A.,Gawor,J.,Otranto,D.,Sparagano,O.A.,
2007. New method for simultaneous speciesspecific identification of equine strongyles
(Nematoda, Strongylida) by reverse line blot hybridization. J. Clin. Microbiol. 45, 2937
2942.

95


PROPOFOLANAESTHESIAINDONKEYSINCOMBINATION
WITHCHLORALHYDRATE

Ismail,S.F;AbdAlGalil,A.S.AandGehan,B.A.Youssef
Dept.ofSurgery,AnaesthesiologyandRadiology,FacultyofVeterinaryMedicine
BenhaUniversity.Egypt

Abstract
The anesthesia characterized by bad quality induction with strong nervous manifestation after
chloralhydrateinjection.Nearlyallbodyreflexesdisappearedafterpropofolinfusion..
Complete analgesia and sedation was achieved at 4 minutes after injection where the animals
showednoresponsestoanypainfulstimuli.
The heart rate in this group showed gradual increase while the respiratory rate and body
temperaturewereshowedsignificantdecrease.
Therecoveryoftheanimalscharacterizedbybothofthepedalandanalreflexesappearedat39
minutesafterpropofolinjection.Completerecoveryoftheanimalsoccurredat95minuteswith
tinnysmoothrecoverywithoutanysignsofnervousmanifestation

INTRODUCTION

Propofol is an alkyl phenol derivatives ( 2, 6 diisopropylphenol). Only slightly


solubleinwaterandcommerciallypresentasanaqueousemulsioncontainingpropofol(10mg
/ml ), glycerol (100mg/ml), soyabean oil ( 22.5 mg/ml),egg lecithin (12mg/ml) and sodium
hydroxidetoadjustPH.(BransonandGross,1994).
Propofolis non barbiturate and relatively non cumulative intravenous anesthetic agent with
rapid onset and recovery. It produce smooth induction with possibility of maintenance by
intermittentinjection(Muiretal.,2007)
Its effects are similar to that of Sodium Pentothal. It provides no analgesia. Yet in some
studies, when patients receive propofol compared to inhalation agents for anesthesia, post
operativepainislessafterpropofol.
Propofolisapotenthypnoticcurrentlyformulatedasoilinwateremulsion.Propofolisashort
acting, rapidly metabolized intravenous agent characterized in man by virtual lack of any
cumulative effect and by rapid recovery after its administration in a bolus dose or by
continuousinfusion(BransonandGross,1994)
Propofolishighlyproteinboundinvivoandismetabolizedbyconjugationintheliver.Itsrate
ofclearanceexceedshepaticbloodflow,suggestinganextrahepaticsiteofeliminationaswell
as It has several mechanisms of action, (Vanlersberghe and Camu ,2008) both through
potentiation of GABAA receptor activity, thereby slowing the channel closing time, (
Krasowski,Hong,HopfingerandHarrison,2002)andalsoactingasasodiumchannelblocker
(HaeselerandLeuwer,2003)
(Haeseler,Karst,Foadi,Gudehus,Roeder,Hecker,DenglerandLeuwer,2008)
Recentresearchhasalsosuggestedtheendocannabinoidsystemmaycontributesignificantly
topropofol'sanestheticactionandtoitsuniqueproperties.(Fowler,2004)
Propofol is a short acting hypnotic unrelated to other general anesthetic agents. Propofol is
provided in sterile glass ampoule contains no preservatives; there fore the formulation will
supportmicrobialgrowthandendtoxinproduction(Arduino,BlandandAllister,1991).Those

96

Lucrritiinificevol53seriaMedicinVeterinar

authorsaddedthat,becauseofthemicrobialgrowthandtheriskofinfectionandsepsisany
unusedpropofolshouldbediscardedattheendoftheanestheticprocedure.
Propofolisoilatroomtemperatureandinsolubleaqueoussolution.Theconcentrationof
propofolis10%each1mlcontainingl0mgoftheactiveprinciple.HuiChnlin,RamandTom
(1997).Chloralhydratepresentedascolorlesstranslucentcrystalsandhaspenetratingodor.It
metabolized by liver into (trichloroethyl alcohol), which in a less potent hypnotic. Chloral
hydrate is a good hypnotic but a poor anesthetic and the amount needed to produce
anesthesia approach the minimal lethal dose (Reid , Nolan and Welsh (1993) . ElSayad
(2006),stated thatthe injection ofchloral hydratein donkeys followedby propofol infusion
lead to rapid induction of anesthesia. also added that chloral hydrate followed by propofol
inducelongtimeanesthesiaandsmoothrecovery.

MATERIALSANDMETHODS

The present study was carried out on 20 donkeys. Collected from the suburban of
kalyobiagovernorateswereusedasexperimentalmodel.Theanimalswereapparentlyhealthy
and their ages and body weights were ranged from 34 years and 120150 kg respectively.
These animals were collected to investigate the pilot efficacies of propofol alone as well as
propofol combination with other anesthetic drugs, according to their physiological,
hematological,andneuromusculareffects.
All animals were fasted for about 12 hours and freely given water before being
investigated.Theseinvestigationswereclassifiedintotwomainparts
Beforeeachinjection,thejugularvienwascannulatedondisinfectedclippedskin,theweight
oftheanimalwasestimatedandthedoseofeachanestheticdrugwascalculated.
The clinical signs of the anesthetic regimen including: assessments of its analgesic effect,
durationofitsactionaswellasthetimeofitsrecoverywererecorded.
Theeffectoftheregimenontheheartandrespiratoryratesaswellasthebodytemperature
werealsomeasuredandtabulated.Theywererecordedbeforeeachinjection(0.0time)and
at5,10,20,30,60,120,180minutesafterinjection.
Theanesthesiaofeachregimenwasmaintainedfor30minutesandtheanimalswere
put under observation recording the physiological and the clinical changes until the animals
becomeinthesternalandtheninthestandingposition.
Acatheterwasinsertedintheotherjugularveinforbloodsampling.Thebloodsampleswere
obtainedbeforeinjectionofeachregimen(0.0time)andat15,30,60minutesandat24hours
fortheestimationofbloodpicture,aswellasforliverandkidneyfunctiontests.
Theanimalswereinjectedslowlywith10%chloralhydratesolutioninadoseof5mg/
50 kg body weight then the anesthesia was maintained by intravenous infusion of 0.2mg /
kg/minutepropofoldilutedin5%dextroseinaratioof1:4respectively.

RESULTS

The anesthesia characterized by bad quality induction, all animals of this group
showed strong nervous manifestation after chloral hydrate injection (5 mg/ 50 kg body
weight)withtremorsinthemusclesofthelimbs,head,neckandthebackoftheanimals.The
animalsletdownontheground3minutesafterinjection.
Nearlyallbodyreflexesdisappearedafterpropofolinfusion.Noanalorperennialreflexesby
usingstrongstimuli.Theeyereflexesdisappearbuttheeyepupilreflexpersistfor4minutes

97

UniversitateadetiineAgricoleiMedicinVeterinarIai
then disappeared.Complete analgesia and sedationwasachievedat 4minutesafter injection
wheretheanimalsshowednoresponsestoanypainfulstimuli.
The heartrateinthisgroupshowedgradual increasefromthe preanestheticvalue upto 20
minutes(Peak)thenreturnedtonormal2hourafterinjectionasshownintable(1)
The respiratory rate showed significant decrease 20 minutes after injection (without apnea)
thenreturnedback3hourafterinjectionasshownintable(1)
The body temperature showed significant decrease throughout the time of the anesthesia,
thisdecreaseofthebodytemperaturewasevidencedbyshiveringofthe animals especially
duringtherecumbancyperiodasshownintable(1)
The recoveryofthe animals ofthisgroup characterizedbyshiveringof theanimals, bothof
thepedalandanalreflexesappearedat39minutesafterpropofolinjection,longrecumbancy
period, the animal raise its head but still recumbent and finally the animal became in the
standingpositionafterseveraltrailstostand,thencompleterecoveryoftheanimalsoccurred
at95minuteswithtinnysmoothrecoverywithoutanysignsofnervousmanifestation.

Bloodanalysis:
Bloodanalysisoftheanimalsgivenpropofol/chloralhydratewasshownintable2and3.

Haemogram:
The red blood cells (RBCs) in this group showed non significant changes (7.70 1.82) when
compared to the base line value (7.75 1.75) while the white blood cells (WBCs) showed
gradualdecrease(7.870.90)whencomparedtothebaselinevalue(8.300.92),asshownin
table8andfigure36and37respectively.
The hemoglobin (Hb) showed non significant changes (12.34 0.85) when compared to the
base line value (12.78 1.11) while the packed cell volume (PCV) showed gradual decrease
(44.672.08)whencomparedtothebaselinevalue(46.332.52),asshownintable(2).
GPT showed gradual decrease (64.33 11.15) when compared to the base line value (69.00
11.14)whileGOTshowednonsignificantchanges(64.0038.97)whencomparedtothebase
linevalue(64.0043.59),asshownintable(3)
The cholesterol showed sudden increase 15 minutes after injection then gradual decrease
(143.0015.87)whencomparedtothebaselinevalue(148.6715.53)andthetotalprotein
showed gradual decrease (5.87 0.78) when compared to the base line value (6.03 0.80)
whiletheglucoselevelshowedabruptincrease15minutesafterinjectionthenreturnedback
to gradual increase (99.67 2.89) when compared to the base line value (73.33 10.97), as
shownintable(3)
Thecreatinineshowedgradualdecrease(1.440.25)whencomparedtothebaselinevalue
(1.520.36)whiletheureaconcentrationshowedincrease(24.675.13)whencomparedto
thebaselinevalue(22.675.03),asshownintable(3)
The albumin showed non significant changes (2.64 0.36) when compared to the base line
(2.760.30)whiletheA/Gshowedgradualincrease(0.910.10)whencomparedtothebase
line(0.850.04),asshownintable(3)

98

99

7.64 1.58
7.93 1.01
12.51 0.71
46.00 1.00

7.75 1.75

8.30 0.92

12.78 1.11

46.33 2.52

15

Table(2):Effectonbloodpicturesamples(RBCs,WBCs,HbandPCV)

RBCs
(million/cmm)
WBCs
(cell/cmm)
HB
(gm/dl)
PCV%

44.67 2.08

12.34 0.85

7.87 0.90

7.70 1.82

30

15.67 1.53
36.57 0.31

14.67 1.15
36.23 0.25

43.67 3.21

12.11 0.88

8.20 0.66

7.47 1.39

60

66.67 13.32

60

64.67 13.80

30

47.00

12.00

8.40

7.64

3.61

0.66

0.70

1.68

24h

36.6 0.69

15.67 2.08

58.33 6.81

120

36.77 0.49

16.33 0.58

58.67 7.64

180

Time

Parameters

Time

0
5
10
20
parameters
Heartrate

63 5.29
64.67 18.15
67 18.36
68 16.82
Respiratory

18.67 2.08
14 2.65
13 2.65
12.67 2.52
Temperature

37.47 0.64
36.07 0.12
36.2 0.52
36.17 0.38

Table(1):Showingthechangesintheheart,respiratoryrateandbodytemperature

Lucrritiinificevol53seriaMedicinVeterinar

100

62.33 35.28

64.00 43.59

5.85 0.75
101.67 11.02
24.67 3.79
2.66 0.40
0.83 0.07

6.03 0.80

73.33 10.97

22.67 5.03

2.76 0.30

0.85 0.04

1.48 0.33

154.33 14.36

148.67 15.53

1.52 0.36

66.00 12.49

69.00 11.14

15

30

0.84 0.06

2.64 0.36

24.67 5.13

99.67 2.89

5.78 0.78

1.44 0.25

64.00 38.97

143.00 15.87

64.33 11.15

Table(3):effectonliverandkidneyfunctionsofanimalsgivenpropofol/chloralhydrate

Creatinin
(mg/dl)
Totalprotein
(mg/dl)
Glucose
(mg/dl)
Urea
(mg/dl)
Albumin
(gm/dl)
A/G%

Time

Parameters
GPT
(u/L)
GOT
(u/L)
Cholesterol
(mg/dl)
60

0.91 0.10

2.76 0.33

25.67 5.13

86.33 12.70

5.81 0.86

1.25 0.16

63.00 40.71

147.67 16.04

61.67 9.50

66.00

0.79

2.59

23.67

94.33

5.90

1.39

0.11

0.38

4.16

10.26

0.79

0.02

59.00 36.39

13.89
128.33 11.85

24h

UniversitateadetiineAgricoleiMedicinVeterinarIai

UniversitateadetiineAgricoleiMedicinVeterinarIai
DISCUSSION

In this group we avoid the adverse effect of high induction dose of propofol by
injection of chloral hydrate for induction of anesthesia, and then the maintenance of
anesthesiawasdonebypropofolinfusionatrateof0.2mg/kg/minute.
Chloral hydrate was relatively good hypnotic but poor analgesic as stated by Reid , et al.
(1993)andthisshowedagreementwithourresults.
Theinductionofanesthesiainthisgroupafterinjectionofchloralhydratewasrapid
withseverenervousmanifestationasvigorousstruggling,tremorsandstiffnessinhead,neck
andlimbs.ThesefindingwereagreedwiththatrecordedbySilvermanandMuir(1993),Field
(1993)andElSayad(2006).
Inthisgroup,theinductionofanesthesiawithchloralhydrateproducedabadquality
induction,sotheuseofsedativetranquilizertoimprovethebadconditionoftheinductionof
anesthesiaasreportedby(SilvermanandMuir(1993).
Theanesthesiawasdeepinallanimalsofthatgroupandthedurationofanesthesia
waslongerthanthatofpropofolalone.ThisresultsupportedbySilvermanandMuir(1993),
Field(1993)andElSayad(2006).
The adverse effect of high induction dose of propofol was avoided by injection of chloral
hydrate, so the marked changes in cardio respiratory parameters were not observed, as the
heartrateshowednonsignificantincreaseinthisgroup.Thisfindingwassimilartothatstated
byElSayad(2006)indonkeys.
Therespiratoryrateinthisgroupshowedsignificantdecreaseatthefirst20minutes
then returned back by time to the base line level. This result showed agreement with Field
(1993)whoaddedthattherespiratorydepressionoccurredinhorsesanesthetizedwithchloral
hydrate.
The body temperature in this group showed significant decrease and this decrease
wasevidencedbyshiveringofallanimalsofthisgroup,thissimilartothefindingofElSayad
(2006)indonkeys.

In this group the recovery from combination of chloral hydrate and propofol was
prolonged than that of propofol alone and this showed agreement with the results of
Silverman and Muir (1993), Field (1993) and ElSayad (2006) in horses and donkeys
respectively.
Thoseauthorsaddedthatthemaindisadvantageofchloralhydrateisthatthedoserequired
forinducinggeneralanesthesiacausesprolongedrecovery.
The duration of recovery in this group was 95 minutes. The animal take long
recumbancy time then begin to response to external stimuli, then raise the head but still
recumbent, then attend to stand and complete recovery at 95 minutes. No nervous signs
recorded. This was augmented by Silverman and Muir (1993), Field (1993) and ElSayad
(2006)inhorsesanddonkeysrespectively.

The use of chloral hydrate as induction drug with propofol infusion in donkeys
produce bad quality induction anesthesia, but the anesthesia was deep with prolonged
recovery.Howevertheusesofchloralhydratereducethehighinductiondoseofpropofol,so
reducetheadverseeffectandthehighcostofusingpropofol.

101

Lucrritiinificevol53seriaMedicinVeterinar

REFERENCES

ArduinoM.J.,BlandL.A.andMcAllisterS.K.(1991):Microbialgrowthandendotoxinproductionintheintravenous
anaestheticofpropofol.IntecControlHospEpidem,12:535539.
BransonK,RandM,E.Gross(1994):Propofolinveterinarymedicine;J.Am.Vet.Med.Assoc,;1292
1246.204(12):18881890.
ElSayad,A.M.M.(2006):Usingofpropofolasageneralanestheticinequineincomparisonwithother
anesthetics.M.V.Sc.Thesis.Tantauniv.KafrElsheikhbranch
Field, Sc. (1993): Cardiovascular and respiratory effects of propofol administration in hypovolemic dogs.
Am.J.Vet.Res.;53:23232327.

Fowler, CJ.(2004): "Possible involvement of the endocannabinoid system in the actions of three
clinicallyuseddrugs."TrendsPharmacol.Sci.Feb;25(2):5961.
Haeseler G, Karst M, Foadi N, Gudehus S, Roeder A, Hecker H, Dengler R, Leuwer M.(2008): High
affinityblockadeofvoltageoperatedskeletalmuscleandneuronalsodiumchannelsbyhalogenated
propofolanalogues.BritishJournalofPharmacology.Sep;155(2):26575.
HuiChuLin.;Ram,BC,AndTom,TA.(1997):Anesthesiainsheepwithpropofolorwithxylazineketamine
followedbyhalofhane.VeterinarySurgery;26:247252.
HaeselerG,LeuwerM.(2003):HighaffinityblockofvoltageoperatedratIIAneuronalsodiumchannels
by 2,6 ditertbutylphenol, a propofol analogue. European Journal of Anaesthesiology.
Mar;20(3):2204.
Krasowski , Hong X., Hopfinger A.J, Harrison N.L. (2002): Analysis of a set of propofol analogues:
mapping binding sites for an anesthetic phenol on the GABA(A) receptor. Journal of Medicinal
Chemistry.Jul18;45(15):321021.
MuirW.W.,HubellJ.A.,BednarskiR.M.andShardaR.T.(2007):HandBookofVeterinaryAnesthesia:4th
Edn.Chap3.Mosby.AnAffiliateofElsevierInc.Usa,PP:140163.ISBN:(139780323046787),(10:
03230467899).DOI.987654321.URL.WWW.elsevier.com.
Reid, J.; Nolan AM. and Welsh, E. (1993): Propofol as induction agent in the goat: a pharmacokinetic
study.J.Vet.Pharmacol.Ther.16(4):488493.
Silverman,K.andMuir,M.(1993):Complicationsassociatedwithgeneralanesthesiaofthehorses.Vet.
Clin.NorthAm;3:4560.
VanlersbergheC,CamuF.(2008):Propofol.HandbookofExperimentalPharmacology.;(182):22752.

102


GENOTYPINGESTROGENRECEPTORPOLYMORPHISMINPIGS,
USINGTHEPCRRFLPMETHOD

AdinaMariaMANEA,S.E.GEORGESCU,StelianaKEVORKIAN,
SorinaDINESCU,MarietaCOSTACHE
UniversityofBucharest,DepartmentofBiochemistryandMolecularBiology,Spl.
Independentei9195,sector5,Bucharest

Abstract
The efficiency of livestock production is highly influenced by reproductive success, especially in
multipara species. In the case of the pig, litter size is a basic economic factor. Estrogen is
intimately involved with pregnancy and its function is mediated through the estrogen receptor,
therefore,ERwaschosenasacandidategenetostudylittersizeinpigs.Thegoalofourstudywas
togenotypetheT1665CpolymorphisminLandrace,LargeWhite,PietranandMangalitzabreeds
usingthePCRRFLPmethod.Ourresultsshowedthat,byusingthistechnique,itiseasytoidentify
thehomozygous(TTorCC),andheterozygousswine.Themethodpresentedaboveisreliable,fast
andcosteffective,andcanbesuccessfullyappliedinthemarkerassistedselectionofthepigs.

Keywords:swine,estrogenreceptorgene,polymorphism,PCRRFLP.

INTRODUCTION
Reproductivetraitsareofprimaryinterestinlivestockbecausetheyplayamajorroleinthe
efficiency of production. Selection for increased number of offspring has been employed in
modelspecieslikemice(Nielsen,1994),pigs(OllivierandBolet,1981;Lambersonetal.,1991;
Bidaneletal.,1994)andsheep(Elsenetal.,1994)withonlylimitedsuccessbecauseofthelow
heritabilityandthesexlimitednatureofreproductivetraits.
Steroid hormones and their receptors play an important role in reproductive processes
(O'Malley, 1990). Cells in target tissues have receptor proteins that specifically bind the
hormoneduringtheinitialstageinitsaction.Estrogenisintimatelyinvolvedwithpregnancy
anditsfunctionismediatedthroughtheestrogenreceptor(ER).Mutationsinthisproteinhave
beenimplicatedinspontaneousabortionandinhumanbreastcancer(Lehreretal.,1990).It
has been recently shown that transgenic mice containing a nonfunctional ER gene have
considerable phenotypic changes in the reproductive system (Korach, 1994). Therefore, ER
waschosenasacandidategenetostudylittersizeinpigs.
The first association between the estrogen receptor gene and litter size was established by
Rothschildetalin1996.Hehighlightedarestrictionfragmentlengthpolymorphism(RFLP)in
the estrogen receptor gene, T1665C, a polymorphism associated with reproductive traits,
mainlylittersize.TheresultsobtainedbyRothschildetalwerelaterconfirmedbyShortetal
(1997) and Chen et al (2000). In all three studies a positive association between allele B
(C1665C)andlittersizewashighlighted.
Our goal was to genotype this polymorphism in the Landrace, Large White, Pietran and
MangalitzabreedsusingthePCRRFLPmethod.

MATERIALSANDMETHODS
We used blood samples from 75 pigs of the Landrace, Large White, Pietran and Mangalitza
breeds,(S.C.RomsuintestPeri,S.C.SuinprodS.A.Roman),preservedinEDTAanticoagulant.

103

Lucrritiinificevol53seriaMedicinVeterinar
The isolation of genomic DNA from fresh blood was performed with Wizard Genomic DNA
ExtractionKit(Promega).
The PCR was performed using a GeneAmp 9700 PCR System (AppliedBiosystems). The
reactionswerecarried outin 25lfinal volumecontainingPCRBuffer, MgCl2,800M dNTP,
0.48 M of each primer (FCCCTCTATGACCTGCTGCTG; RTCAGATTGTGGTGGGGAAGTC), 0.5
units of AmpliTaq Gold DNA Polymerase, diluted DNA and nucleasefree water. PCRs were
performed in 0.2 ml tubes by 40 cycles with denaturation at 95C (30s), annealing at 59C
(30s)andextensionat72C(60s).Thefirstdenaturationstepwasof10minutesat95Cand
thelastextensionwasof10minutesat72C.
PCR products were detected by electrophoresis in 2% agarose gel stained with ethidium
bromideandthendigestedwithrestrictionendonucleaseAvaIat37Cfor3hours.Restricted
productswereanalyzedbyelectrophoresisin3.2%agarosegelstainedwithethidiumbromide.
Forsequencing,weusedthesameconditionsasinthecaseofPCR.Theamplifiedfragments
weresequencedbyABIPrism310GeneticAnalyzer,usingtheABIPrismBigDyeTerminator
Cycle Sequencing Reaction Kit after purification with the Wizard System Kit (Promega). The
sequences were processed using DNA Sequencing Analysis 5.1 Software (AppliedBiosytems)
andthenucleotidesequenceswerealignedwiththeBioEditprogram(Hall,1999)andrefined
manually.

RESULTSANDDISCUSSIONS
For the identification of the T1665C SNP we used the PCRRFLP method. The set of primers
was designed to amplify only a 185bp fragment from the estrogen receptor gene that
contains the T(1665)C SNP. This polymorphism creates a new recognition site for AvaI
restriction endonuclease (C(T/C)TG(A/G)C(T/C)CG(A/G)). The 185pb contains another
restrictionsiteforenzymeAvaI,atthissitethereisnootherpolymorphismandtheenzyme
willbecutatthislevelregardlessoftheanimalgenotype.Weconsiderthissiteasadigestion
controlsite.
ThePCRconditionswereselectedinsuchawaythatthetwoprimerscouldamplifytheDNA
fromhomozygote(TTorCC)andheterozygoteanimals.
SuccessfulamplificationanddigestionwithAvaIyieldedone,two,threeorfourfragmentsof
47,60,78and107bpdependingonthehomozygoteandheterozygoteanimalsanalyzed.For
homozygoteTT pigs in the 1665 position we obtained two bands of 107 and 78bp and for
homozygoteCCpigsweobtainthreebandsof47,60and78bp.Inthecaseofaheterozygote
animal,afterthedigestionwithAvaIrestrictionendonucleaseandelectrophoresis,weobtain
fourbandsof47,60,78and107pb.
In our study we identified homozygote (TT and CC) and heterozygote animals for the SNP
T1665C(Figure1).

Figure1:Electrophoresispatternofestrogenreceptorgenefragmentafterdigestionwith
theAvaIenzyme.Lines1,3,5,6twofragmentsof78and107pb,indicatehomozygousTT
pigs;Line2fourfragmentsof47,60,78and107pbindicateheterozygouspigs;Line4
threefragmentsof47,60and78pbindicatehomozygousCCpigs;Line7uncutPCRproduct;
Line8molecularsizemarker50bp(Promega).
104

UniversitateadetiineAgricoleiMedicinVeterinarIai
Toconfirmourresultswesequencedthe185bpfragmentfromtheestrogenreceptorgene.
Figures2and3illustratetheprofilesofthehomozygousTTandCCpigfromtheregionthat
containstheT1665CSNP.

Figure2:ThesequenceoftheregionfromthePCRproductthatcontainstheSNPT1665C
insidetherecognitionsiteforAvaIforahomozygousTTpig.

Figure3:ThesequenceoftheregionfromthePCRproductthatcontainstheSNPT1665C
insidetherecognitionsiteforAvaIforahomozygousCCpig.

The sequence alignment between a region of the estrogen receptor gene and our PCR
productsfromthehomozygous(TTandCC)pigs(figure4)wasdoneusingBioEditprogramme.

Figure4:BioEditfragmentsequencealignmentofaregionoftheestrogenreceptorgeneand
ourPCRproductsfromhomozygous(TTandCC)pigs.

CONCLUSIONS

The major focus of this study was to genotype the T1665C polymorphism from estrogen
receptorgeneintheLandrace,LargeWhite,PietranandMangalitzabreedsusingthePCRRFLP
method.Thismethodcouldhelpbreedersintheirforwardselectionstrategyespeciallyinthe
markerassistedselection.
Ourresultsshowedthat,byusingthistechnique,itiseasytoidentifytheanimalswhichhave
thefavorablealleleforreproduction.Themethodpresentedaboveisreliable,fastandcost
effective, and can be successfully applied in the widescale screening of different pig
populations.

105

Lucrritiinificevol53seriaMedicinVeterinar
REFERENCES

Nielsen MK (1994) Selection experiments for reproductive rate in mice Proceedings of the 5th World
CongressonGeneticAppliedtoLivestockProduction(Univ.ofGuelph,Guelph,ON,Canada),19:219
225.
Ollivier L and Bolet G (1981) La slection sur la prolificit chez le porc: Rsultats d'une exprience de
slectionsurdixgnrations.J.Rech.PorcineFrance13:261268.
Lamberson WR, Johnson RK, Zimmerman DR and Long TE (1991) Direct responses to selection for
increasedlittersize,decreasedageatpuberty,orrandomselectionfollowingselectionforovulation
rateinswine.J.Anim.Sci.69:31293143.
BidanelJP,GruandJandLegaultC(1994)Anoverviewof20yearsofselectionforlittersizeinpigusing
hyperprolific scheme Proceedings of the 5th World Congress on Genetic Applied to Livestock
Production(Univ.ofGuelph,Guelph,ON,Canada),Vol.17,pp.512515.
ElsenJM,BodinL,FrancoisD,PoiveyJPandTeyssierJ(1994)Geneticimprovementoflittersizeinsheep
Proceedingsofthe5thWorldCongressonGeneticAppliedtoLivestockProduction(Univ.ofGuelph,
Guelph,ON,Canada),Vol.19,pp.237243.
O'Malley B (1990) The steroid receptor superfamily: more excitement predicted for the future. Mol.
Endocrinol,.4,363369.
LehrerS,SanchezM,SongHK,DaltonJ,LevineF,SavorettiP,ThungSN.&SchachterB(1990)Oestrogen
receptor region polymorphism and spontaneous abortion in women with breast cancer. Lancet
335,622624.
KorachKS. (1994)Insightsfromthestudyofanimalslackingfunctionalestrogenreceptor.Science266,
15241527.
ChenKF,HuangLS,LiN,ZhangQ,LuoM,WuCX(2000)Thegeneticeffectofestrogenreceptor(ESR)on
littersizetraitsinpig.YiChuanXueBao27:853857.
ShortTH,RothschildMF,McLarenDG,SouthwoodOI,DevriesAG,VanderSteenA,TuggleCK,HelmJ,
VaskeDA,MilehamAJ,PlastowGS(1997)Effectoftheestrogenreceptorlocusonreproductionand
productiontraitsinfourcommercialpiglines.JournalofAnimalScience75:31383142.
RothschildMF,JacobsonC,VaskeD,TuggleC,WangL,ShortTH,EckardtG,SasakiS,VincentA,McLaren
D,SouthwoodO,VanderSteenH,MilehamSandPlastowG(1996)Theestrogenreceptorlocusis
associatedwithamajorgeneinfluencinglittersizeinpigs.Proc.Natl.Acad.Sci.USA93:201205
Hall TA. (1999) BioEdit: a userfriendly biological sequence alignment editor and analysis program for
Windows95/98/NT.Nucl.Acids.Symp.Ser.41:9598.

106


COMPARATIVETESTINGOFSOMEEXPERIMENTALMODELSOF
OXYGENINDUCEDRETINOPATHYINYOUNGRATS.
HISTOLOGICALSTUDY.

MicluV1.,AnneClaudiatefnu2,AdrianaMurean3,
C.Ober1,V.Rus1
1
FACULTYOFVETERINARYMEDICINECLUJNAPOCA
2
CLINICEMERGENCYHOSPITALCLUJNAPOCA
3
UNIVERSITYOFMEDICINEANDPHARMACY
IULIUHAIEGANUCLUJNAPOCA,vmiclaus@usamvcluj.ro

Abstract:TheinfluenceofO2concentrationonthedevelopmentandmaturationoftheretinawas
tested on two groups of newborn rats, one group subjected to hyperoxia and the other to
variationsoftheconcentrationofO2(hyperoxia/hypoxia).Resultswereassessedonhistological
sections. The occurrence of retinal cytoarchitectural changes in both experimental groups was
observed,butwithbigdifferencesbetweenthem.Incaseofgroupwithhyperoxia,theyappeared
onlyinsomeanimals(22%)andhadregionalcharacter,whileingroupwithhyperoxia/hypoxia,
theprocentwas100%andtendedtogeneralize.Theseaspectsdemonstratethenegativeeffects
of inadequate concentration of O2 on retinal development, variable concentration being more
harmfulthanaconstanthyperoxia.
Keywords:rat;retinopathy;histology

INTRODUCTION
Thenewbornratshaveanimmaturevisualsystemandtheeyesareclosed.Afterbirth,therat
visual system gradually matures, the eye opening can be done after 14 days. Stage of
development of retinal vascularization in newborn rat is comparable to that of an human
premature L45 month of gestation (Gyllensten and Hellstrm, 1954) and the retina is
extremely immature at birth, comparable with that of a human fetus of 26 weeks . (Ricci,
1990). Retinal vascularization of newborn rats matures in the first two postnatal weeks
(Cairns,1959).Postnatalmaturationofthevisualsysteminrats,makethatitcanbeusedasan
experimentalmodelfordiseasesthatcanoccurduringthefinalperiodofretinalmaturation.
Maturationofhumanprimaryvisualsystemisnormallyrealisedonintrauterinelife(Dorfman
etal.2008).Butinprematurenewborn,thefinalpartofretinaldevelopmentandmaturation
takes place extrauterine (in incubator) in circumstances that are sometimes different from
thoseoptimal,necessarytocarryoutthisdelicateprocess.Insomecases,prematurehumans
receiving high levels of O2 in order to compensate an unstable pulmonary status. But
increasedlevelsofoxygen,cancauseseverevasoconstrictionandvasoobliteration,followed
by an abnormal proliferation of retinal vessels when it returned to normoxia, with the
occurrenceofoxygeninducedretinopathy(OIR).DirectrelationshipbetweenoxygenandOHR
was supported by several authors (Michaelson, 1948, Campbell 1951, Ashton et al., 1954).
Dorfman et al. (2008), confirmed the anterior studies that demonstrated increased
susceptibility of the retina to hypoxemia in the first week of life, saying that in addition to
vascular changes which may be reversible, cytoarchitectural irreversible retinal changes can
occur. As in human subjects, exposure of young rats to postnatal hyperoxia can cause

107

Lucrritiinificevol53seriaMedicinVeterinar
apparitionofOIR(Smithetal.,1994;Reynaudetal.,1994;MadanandPenn2003,Hardyetal.,
2005). Some authors have argued that variation of oxygen concentration produces more
severe retinopathy than just exposure to hyperoxia (Pennet al., 1993, Penn et al. 1995).
Althoughtherehavebeennumerousinvestigationsthathaveattemptedtoclarifythecauses
fortheappearanceofOIR,therearestillmanyquestionsrelatedtotheetiologyofthissevere
disease.

MATERIALSANDMETHODS
Animals used in this study were white rats, Wistar race, female with newborns, witha birth
weightofabout10g.ExperimentalstudywasperformedattheDepartmentofPhysiologyfrom
University of Medicine and Pharmacy ClujNapoca. Three groups were realised: a control
groupandtwoexperimentalgroups.Thecontrolgroupwascomposedfromafemaleratand
hernewbornrats(7),whichwereplacedinanincubatortogetherwithitsmother,at4hours
afterbirth,inconditionsofnormoxiafor21days.Conditionsofincubation:temperature23
24OC, cyclic exposure 12 day/12 darkness, using white artificial light 200 lux, feeding of
newbornratsbeingensuredthroughmaternallactation,adlibitumfromthemother.Thefirst
experimental group (hyperoxia group), consisting from a female rat and its 9 newborn rats,
were placed in an incubator in conditions of normoxia for 7 days, then 5 days of hyperoxia
(80%) and the last 9 days, in normoxia conditions again.The second experimental group
(hyperoxia/hypoxiagroup),formedfromafemaleratandits7newbornrats,wereplacedin
conditionsofnormoxiafor7days,thanthenfivedaysinalternatingdailyperiodsofhyperoxia
(80%for22,5ore)withhypoxia(10%for1hr),andforhygieneoftheincubatorandmother
feedingwereused0.5hours.Toachievehyperoxia,amobileoxygenconcentratoradaptedto
the incubator was used, and hypoxia was achieved by placing the incubator in baroroom.
Slaughteroftheratswasperformedonday21,afterasedationwithketamine6mg/kgc(Oana
et al. 2006). The eye globes were enucleated for histopathological examinations. An
aproximatively 3 mm incision was made in the central area of the cornea (to facilitate
penetrationoffixative),theneyeglobeswerefixedinStievemixturefor24hours.Thenthe
eye globes were sectioned at limbus, under microscopic control, carefully removing the
cornea,lensandvitreous.Thepieceswerethendehydratedwithethylalcohol,clarifiedwith
butyl alcohol (nbutanol) and included in paraffin. Serial sections of 5 thick were obtained,
thenitswerestainedwithGoldnerstrichromemethod.Examinationofstainedsectionswas
madeatanOlimpusBX41microscope.

RESULTSANDDISSCUTIONS

Young rats from the control group, showed after 21 days from starting the experiment a
normallydevelopedretina,withtypicallayoutinlayersandnormalvascularization(Fig.1).In
noneoftheanimalsfromcontrolgroupwerenotidentifiedstructuralchanges,suggestingthat
maintenace the rats under normoxia conditions, ensure appropriate conditions for normal
development of the retina. In case of rats from experimental group with hyperoxia, retinal
structuralchangeswereobservedintwoofthenineratsstudied.Changeswerepresentinthe
photoreceptorcelllayerandhadregionalcharacter.Werealsoobservedareaswhere,because
of proliferation of photoreceptor cells, extern nuclear layer presents regional thickening,
resultinginzonalretinalthickening,whichappearsprotrudingintotherespectivearea(Fig.2).
Inotherareas,groupsofphotoreceptorcellsmigratedintotheinternalnuclearlayer(Fig.3),
ortowardthepigmentedlayer(Fig.4)havebeenidentified

108

UniversitateadetiineAgricoleiMedicinVeterinarIai
Anothersituationwasobservedinthesecondexperimentalgroup,thegroupwithalternation
hyperoxia / hypoxia. In this group retinal structural changes in all animals studied were
identified.They are different regarding the extension from an animal to another, observing
fromchangeswithregionalcharactertothetendencytogeneralize.Foldsmoreorlessdeep
werealsoobserved,sometimescoveringhalfofthethicknessoftheretina(Fig.5).Theyare
formed through zonal separation of photoreceptor cells, from the pigmented layer. In other
areas,polymorphicrossetesbothinshapesandsizeswereobserved.(Fig.6.).Insomeareas,
structuraldisorganisationissoimportant,sothatstructuralcomponentsappearmixed,with
almostcompletedisappearanceofthecharacteristicdispositiononthelayers(Fig.7).Thevast
majorityofstructuralchangesareirreversible.Itseemsthat,largely,thesestructuralchanges
areduetoabnormalproliferationofbloodvesselswhichappearlargeorverylargeinoptical
fibers layer (Fig. 8). Smaller vessels are detached from these large vessels, which penetrate
deeper, where branched and appears to participate in structural disorganization, beginning
withthephotoreceptorcelllayer,whichispartialdetachedfromthepigmentedlayer.
Resultsobtainedinthis experimentrevealthatprolongedexposuretohyperoxiacausedthe
apparitionofregionalstructuralchanges,mildormoderateinintensityinsomeanimalstaken
in the experiment. Beauchamp et al. (2004) stated that continuous exposure to hyperoxia
favors vasoconstriction with obliteration and stop developing vessels towards the retinal
peripheryinresponsetoincreasedlevelsofO2.Afterreturningtoconditionsofnormoxia,an
exaggeratedneovascularizationisunleashed,asaresultofinadequatebloodflow,ahypoxic
one. (Moore, 1990, Patz and Payne, 1998). Comparing with hyperoxia, hyperoxia/hypoxia
alternationinducedseverecytoarchitecturalchanges havingtendencyofgeneralization,that
seemstobelargelydeterminedbyanexcessiveneovascularization.Somewhatsimilarresults
werereportedbyPennetal.(1993)whosaidfirstthatvariationsofO2concentration,produce
a more consistent retinopathy compared with constant concentrations (hyperoxia). In his
experimental model (40/80 O2 concentrations), he obtained retinopathy in 66% of animals
studied. By alternating exposure to O2, 50% one day, next day 10% in the first 14 days and
thennormoxiauntilday20,neovascularizationwasobtainedin100%ofanimalstakeninstudy
(Pennetal.1994,Berkowitz1996).SimilarresultswereobtainedbyCumminghametal.(2000)
intheirexperimentalmodelinwhichratswereexposed14daysatalternatingconcentrations
of O2, followed by normoxia, with apparition of retinopathy in 100% of animals used in
experiments. Dorfman (2008) argued that vascular changes may be reversible, but
cytoarchitecturalandfunctionalretinalchangesareirreversible.
The aspects observed, confirmed that an inadequate concentration of O2 can negatively
influence the development and maturation process of the retina.But these changes are
dependent on oxygen concentration and especially on its concentration variation, aspects
good highlighted in the two experimental models studied. In the group with hyperoxia,
structural changes occurred only in some animals in the study, but these had a regional
character and were not very severe. In case of model hyperoxia/hypoxia, retinal
cytoarchitectural changes occurred in 100% of animals studied, although there were
differences between them in terms of extention and severity of injuries. By comparing the
resultsobtainedintwoexperimentalmodels,thefactthatchangesinoxygenconcentrationis
moreharmfulthanhyperoxiaisconfirmed.

109

Lucrritiinificevol53seriaMedicinVeterinar
CONCLUSIONS
1. Results obtained in this experiment confirm that an inadequate O2 concentrations may
adversely influence the development and maturation process of newborn rats retina, with
appearance of cytoarchitectural changes, whose extension and severity are dependent on
oxygenconcentrationandespeciallyitsconcentrationvariations.
2.Incaseofgroupexposedtoconstanthyperoxia,onlyin22%ofanimalsstudiedmoderate
severity structural changes occurred, with regional character, affecting only a small part of
photoreceptorcells.
3. In case of group exposed to hyperoxia/hypoxia, in 100% of animals studied appeared
cytoarchitectural bilateral retinal changes, severe and in most cases with tendency of
generalizationandirreversibletrend,withsomedifferencesfromoneanimaltoanother.
4.Bycomparingtheresultsobtainedintwoexperimentalmodels,isconfirmedthefactthat
variation of oxygen concentration is more harmful than hyperoxia, causing severe and
irreversiblecytoarchitecturalabnormalities,withretinalfunctionalfailure.

Fig.1.Controlgroupnormalstructure(GoldnersTrichromeob.40X)

Fig.2.Hyperoxiagroup(GoldnersTrichromeob.40X)
1.
Regionalthickeningofphotoreceptorcellslayer
2.
Regionalthickeningoftheretina

110

UniversitateadetiineAgricoleiMedicinVeterinarIai

1.

Fig.3.Hyperoxiagroup(GoldnersTrichromeob.40X)
Groupofphotoreceptorcellsmigratedininternalnuclearlayer

1.

Fig.4.Hyperoxiagroup(GoldnersTrichromeob.40X)
Groupofphotoreceptorcellsmigratedtowardpigmentedlayer

111

Lucrritiinificevol53seriaMedicinVeterinar

2
1

Fig.5.Hyperoxia/hypoxiagroup(GoldnersTrichromeob.40X)
1. Deepfolds,2.Regionalthinnessoftheinternalnuclearlayer

Fig.6.Hyperoxia/hypoxiagroup(GoldnersTrichromeob.40X)
1.
Polymorphrossetes
2.
Regionaldisasapearanceoftherodsandcones
3.

Fig.7.Hyperoxia/hypoxiagroup(GoldnersTrichromeob.40X)
1.
Structuraldisorganizationofthe15layers
2.
Regionalthinnessoftheinternalnuclearlayer

112

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.8.Hyperoxia/hypoxiagroup(GoldnersTrichromeob.40X)
1.
Exaggeratedangiogenesis
2.
Polymorphrossetes
3.
Regionaldisasapearanceoftherodsandcones

REFERENCES
1. AshtonN,WardB,SerpellG.,Effectofoxygenondevelopingretinalvesselswithparticular
referencetotheproblemofretrolentalfibroplasia.BrJOphthalmol1954;38:397432.
2. BeauchampMH,SennlaubF,SperanzaG,etal.Redoxdependenteffectsofnitricoxideon
microvascular integrity in oxygeninduced retinopathy. Free Radic Biol Med. 2004;37(11):1885
1894.
3. BerkowitzBA.Adultandnewbornratinnerretinaloxygenationduringcarbogenand100%
oxygenbreathing.InvestOphthalmolVisSci.1996;37:20892098.
4. Cairns J.E., Normal development of the hyaloid and retinal vessels in the ratBrit. J.
Ophthal.195943,385
5. Campbell K., Intensive oxygen therapy as a possible cause of retrolental fibroplasia; a
clinicalapproach.MedJAust1951;2:4850.
6. CunninghamS,McColmJR,WadeJ,SedowofiaK,McIntoshN,FleckB.,Anovelmodelof
retinopathyofprematuritysimulatingpretermoxygenvariabilityintherat.InvestOphthalmolVis
Sci2000;41:427580.
7. Dorfman A, Dembinska O, Chemtob S, Lachapelle P., Early manifestations of postnatal
hyperoxia on the retinal structure and function of the neonatal rat. Invest Ophthalmol Vis Sci,
2008,49:458466
8. Gyllensten LJ, Hellstrom BE., Experimental approach to the pathogenesis of retrolental
fibroplasia.I.Changesoftheeyeinducedbyexposureofnewbornmicetoconcentratedoxygen.
ActaPaediatrSuppl1954;43:13148.
9. Hardy P, Beauchamp M, Sennlaub F, et al. New insights into the retinal circulation:
inflammatorylipidmediatorsinischemicretinopathy.ProstaglandinsLeukotEssentFattyAcids.
2005;72(5):301325.
10. Madan A, Penn JS. Animal models of oxygeninduced retinopathy. Front Biosci 2003;
8:d103043.
11. Michaelson I. The mode of development of the vascular system of the retina with some
observations on its significance for certain retinal disorders. Trans Ophthalmol Soc UK
1948;68:13780.
113

Lucrritiinificevol53seriaMedicinVeterinar
12. Moore,A. (1990) Retinopathyof prematurityTaylor, D eds. Pediatric Ophthalmology 365
375 Blackwell Scientific Boston.Patz A.The effect of oxygen on immature retinal vessels. Invest
OphthalmolVisSci1965;6:4:988999.
13. Oana L., A. Timen, Fl. Beteg, Anesteziologie i propedeutic chirurgical veterinar, Ed.
Risoprint,2006,ClujNapoca.
14. Patz A, Payne, JW, Retinopathy of prematurity (retrolental fibroplasia) Tasman, W Jaegen,
EA eds. Duanes Foundations of Clinical Ophthalmology , (1998) 119 Lippincott Williams &
WilkinsPhiladelphia.
15. Penn JS, Tolman BL, Lowery LA., Variable oxygen exposure causes preretinal
neovascularizationinthenewbornrat.InvestOphthalmolVisSci1993;34:57685.
16. Penn JS, Tolman BL, Henry MM., Oxygeninduced retinopathy in the rat: relationship of
retinalnonperfusiontosubsequentneovascularization.InvestOphthalmolVisSci1994;35:3429
35.
17. Penn JS, Henry MM, Tolman BL. Exposure to alternating hypoxia and hyperoxia causes
severe proliferative retinopathy in the newborn rat. Pediatr Res 1994; 36:72431. Erratum in:
PediatrRes1995;37:353.
18. Reynaud X, Dorey CK., Extraretinal neovascularization induced by hypoxic episodes in the
neonatalrat.InvestOphthalmolVisSci.1994;35(8):31693177.
19. RicciB.,Oxygeninducedretinopathyintheratmodel.DocOphthalmol.1990;74(3):171177.
20. Smith LE, Wesolowski E, McLellan A, Kostyk SK, D'Amato R, Sullivan R, D'Amore PA.,
Oxygeninducedretinopathyinthemouse.InvestOphthalmolVisSci1994;35:10111.

114

EXPRESSIONOFTHEVIMENTINMARKERINDOGMELANIC
CUTANEOUSTUMORS

MoussaRaouad.,CCatoi.,BSevastre.,MTaulescu.,
PBolf.,AGal.,,F.ATabaran.,A.LNagy.,CCUC.

PathologyDepartment,FacultyofVeterinaryMedicine,
UniversityofAgriculturalSciencesandVeterinaryMedicine,ClujNapoca,Romania,
Email:raouadmoussa@yahoo.com.

Vimentin is an intermediate filament that is expressed by mesenchymal and neuroectodermal


cells in normal tissues.(4) Melanoma showed positive staining of intermediate filaments with
antibodiesto vimentin, with cells containing large numbers of melanosomes being stained less
stronglyingeneral.Vimentinistypeofintermediatefilamentscandistinguishmelanomafrom
undifferentiatedcarcinoma,butnotfromlymphomaorsarcoma.(2)
Methods: We investigated the immunohistochemical expression Vimentin marker , in tumour
tissues of 4 dog cutaneous melanomas and 2 dog cutaneous melanocytomas as possible
evidence of marked cells by vimentin . In addition we investigated the relationship between
vimentinexpressionandmacroscopic,microscopicaspect.
6 cases were positive (2 melanocytoma, 4 melanomas), , 6 cases were positive
(2melanocytoma,4melanoma).Percentag of marked cells by vimentin were between (65.18%
97.40%).The high percentages of marked cells were in melanotic tumors no have connective
activity.
thehighpercentageswereinmelanotictumorsthatlocalizedinglobaleyeandperinealregion
and moderate in a buccal region. I did,nt find legation between percentage of vimentin and
tumortypes(benignormalignant).
Conclusions: the high percentage of vimentin immunoreactivity is in perineal and global eye
regionandinmelanotictumorsnohaveconnective.themoderatepercentageisinbuccalregion
and melanic tumors have a connective activity, and nu exist legation between tumor type and
percentageofmarkedcells.
Keywords:Immunohistochemistry,Vimentin,MelanicTumors,Dog.

INTRODUCTION

Vimentin (57 kDa) is the most ubiquituos intermediate filament protein and the first to be
expressedduringcelldifferentiation.Allprimitivecelltypesexpressvimentinbutinmostnon
mesenchymal cells it is replaced by other intermediate filament proteins during
differentiation.(13)
Vimentinisexpressedinawidevarietyofmesenchymalcelltypesfibroblasts,endothelialcells
etc., and in a number of other cell types derived from mesoderm, e.g., mesothelium and
ovarian granulosa cells. However, in nonvascular smooth muscle cells, vimentin is often
replacedbydesmin.Instriatedmuscle,vimetinis also replacedbydesmin.However, during
regeneration,vimentinisreexpressed.Cellsofthelymfohaemopoieticsystem(lymphocytes,
macrophagesetc.)alsoexpressvimentin,sometimesinscarceamounts.(3)
Vimentin is also found in mesoderm derived epithelia, e.g. kidney (Bowman capsule),
endometriumandovary(surfaceepithelium),inmyoepithelialcells(breast,salivaryandsweat
glands),aninthyroidglandepithelium.Inthesecelltypes,asinmesothelialcells,vimentinis
coexpressedwithcytokeratin.Furthermore,vimentinisdetectedinmanycellsfromtheneural

115

Lucrritiinificevol53seriaMedicinVeterinar
crest. Particularly melanocytes express abundant vimentin. In glial cells vimentin is
coexpressedwithglialfilamentacidicprotein(GFAP).(3)
Vimentin is present in many different neoplasms but is particulary expressed in those
originatedfrommesenchymalcellsSarcomase.g.,fibrosarcoma,maligntfibroushistiocytoma,
angiosarcoma,andleioandrhabdomyosarcoma,aswellaslymphomas,malignantmelanoma
andschwannoma.(567)
Melanoma showed positive staining of intermediate filaments with antibodies to vimentin,
withcellscontaininglargenumbersofmelanosomesbeingstainedlessstronglyingeneral.(4)
This type of intermediate filaments can distinguish melanoma from undifferentiated
carcinoma,butnotfromlymphomaorsarcoma.(4)
Theaimofthepresentthispaperistousecomputerized imageanalysistomeasurevimentin
antibody in a series of canine melanocytic tumors to assess density of marked cells by
vimentin, and to correlate percentage of marked cells by vimentin with macroscopic and
microscopicaspect.

MATERIALSANDMETHODS

The material of our investigation was constituted of cadavers from the discipline of
morphopathology and necropsy diagnostic, and also as samples sent from the surgery clinic
and private practitioners, for diagnostic purpose. From all cadavers and samples examined
between 2001 2010, 6 cases were diagnosed with 4 dog cutaneous melanomas and 2
melanocytomas.
Thesampleswereformalinfixed,thentissuesectionswerestainedwithhematoxylinand
eosinforhistologystudy.
For Immunohistochemistry (IHC), tissue sections of test samples were stained for CD31
(monoclonal Mouse AntiVimentin Clone Vim 3B4, CodeNr.m7020, Dako Denmark A/S) and
developedwiththediaminobenzidine(DAB)chromogen.
Percentageofmarkedcellswasassessedrandomlybychoosing immunolabeledvesselsona
400x field (40x objective and 10x ocular) and using an automated image analysis system
(OlympuscellB).300cellspertumorwereexamined.
Images were captured by using a microscope (Olympus BX51) connected to a video camera
(OlympusDP25),storedinthedigitalmemory,andshownonthemonitor.Manual outliningof
pecentangeofmarkedcellswerethencalculatedbasedonimageanalysis.

RESULTSANDDISCUSSIONS

In the period 2001 2010 in the Pathology Department, were diagnosed 4 dog cutaneous
melanoma and 2 dog cutaneous melanocytoma histological and with vimentin
immunoreactionseeto(Table1)

116

UniversitateadetiineAgricoleiMedicinVeterinarIai

Table1:Resultsofdogcutaneousmelanotictumors(histological,CD31immunoreaction)

Number
81958 81693
78773
81783
81084
75688
HISTOL Date
0402
159
01.07.
0311
1511
2504
GY
2010
2009
2005
2009
2008 2001

Breed
Irish
Doberm
Metis
Tickle
Giant

Setter
an
schnauzer
M/F
F13
M9
F6years
F7years M9years

age
years
yeas
Region
Buccal Mandibu Cutaneous
Eye
Neckin
Knee
cavity lar
sacral,
global dorsal
face
amelano Hyperplas Amelano
dermal
Diagnosti Amelano Junctoin
tic
ia
amelanotic tic
al
c
tic
melanocy melano
Melanocyto melano
dermal
melano
ma
tes
ma
ma
amelano
ma
(lentigo)
tic
benign
melano
ma
Epithelio Spindle
Epithelio
Epithelio
Cells
idtype
cells
id
microsco idtype
Epithelio Spindle
pictype
idtype
type
Nrof
3
14
3
7
No
4
mitosis
Lymphoc
yte
infiltrate

Necrosis

Vimenti
n

intense

intense

intense

reduced

moderat
e

No

reduced

intense

reduced

reduced

No

reduced

Connecti
ve
activity

Yes

Yes

No

No

Yes

Yes

Clark's
Clasificati
on

Percenta
geof
marked
cell

69.18%

64.012%

93,67%

117

97.40%

65.18%

77.54%

Lucrritiinificevol53seriaMedicinVeterinar

Figure(1):Amelanoticmelanocmaimmunoreactivetywithvimentinthatstainedalotofcells
inhighpowerField,blackarrowindicatestomarkedcellsbyvimentinandwhitearrow
indicatetofibroblastcellnomarkedbyvimentin.(400x)

Figure(2)vimentinimmunoreactivitywithepithelioidmelanomathatstainedamoderate
percentageofcellsYellowarrowsindicatetomarkedcellsandwhitearrowindicatetocellsno
marked(400x).

Figure(3):melanocytomaimmunorecativitywithvimentinthatmarkedaspindletypecells,
arrowindicatestothesecells.(400x)

118

UniversitateadetiineAgricoleiMedicinVeterinarIai

Figure(4)vimentinimmunoreactivitywithepithelioidmelanomacells,yellowarrowindicate
tomarkedcellswhilewhitearrowindicatetofibroblastnomarked.(1000x).

6caseswerepositive(2melanocytoma,4melanoma)
Percentagofmarkedcellsbyvimentinwerebetween(65.18%97.40%).
The high percentages of marked cells were in melanotic tumors no have connective
activity(fig1), but the moderate percentages were in melanotic tumors that have connective
activity(fig2).
The high percentages were in melanotic tumors that localized in global eye and perineal
region(fig1)Butthemoderatepercentagewereinmelanotictumorsthatlocalizedinbuccal
region.(fig2)
Vimentin did,nt stain fibroblast cells and this is inverse what he said (refer3): Vimentin is
expressedinawidevarietyofmesenchymalcelltypesfibroblasts,endothelialcellsetc.(3)fig
4.
Idid,ntfindlegationbetweenpercentageofvimentinandtumortypes(benignormalignant).

CONCLUSIONS

1. In the interval 2001 2010 six dogs were diagnosed with cutaneous melanocytic
tumours.
2. Theaffecteddogswerebetween6and14yearsold.
3. 6caseswerevimentinpositive(2melanocytoma,4melanoma).
4. Thehighpercentageofvimentinimmunoreactivityisinperinealandglobaleyeregion
andthemoderatepercentageisinbuccalregion.
5. The high percentage of vimentin immunoreactivity is in melanotic tumors no have
connective(2 cases) activity and the moderate percentage is in melanic tumor have
connectivetissue(4cases)
6. Vimentindoesntstainfibroblast
7. Itisntexistlegationbetweentumortypeandpercentageofmarkedcellsbyvimentin.

119

Lucrritiinificevol53seriaMedicinVeterinar
REFERENCES

1Azumi,N.,Battifora,H.1987Thedistributionofvimentinandkeratininepithelialandnonepithelial
neoplasms. A comprehensive immunohistochemical study on formalin and alcoholfixed tumors. Am J
ClinPathol;88:28696.
2CaselitzJ,MJnner,EBreitbart,KWeber,MOsborn.,1983Malignantmelanomascontainonlythe
vimentintypeofintermediatefilaments.VirchowsArchAPatholAnatHistopathol400:4351.
3KatsumotoT.,MitsushimaA.,KurimuraT.1990"Theroleofthevimentinintermediatefilamentsin
rat3Y1):57984.
7RamaekersFCS,VroomTM,MoeskerO,etal.1985Theuseofantibodiestointermediatefilament
proteinsinthedifferentialdiagnosisoflymphomaversusmetastaticcarcinoma.HistochemJ.;17:57.cells
elucidated by immunoelectron microscopy and computergraphic reconstruction". Biol Cell 68 (2): pp.
13946.
4koenig a, j.wojcieszyn,b.r. weeks, AND J.F. MODIANO.,2001Expression of S100a, Vimentin, NSE,
and Melan A/MART1 in Seven Canine Melanoma Cell Lines and Twentynine Retrospective Cases of
CanineMelanomaVetPathol38:427435
5LangSH,HydeC,ReidIN,HitchcockIS,HartCA,BrydenAA,VilletteJM,StowerMJ,MaitlandNJ..2002
Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and
metastaticprostatecarcinoma.ProstateSep1;52(4):25363.
6Niveditha SR, Bajaj P., 2003 Vimentin expression in breast carcinomas. Indian J Pathol Microbiol
Oct;46(4).

120

ONTHESHAPEOFTHEERYTHROCYTESFROM
SOMEHERBIVOREMAMMALS

S.OANCEA1,G.PAVEL1,A.V.OANCEA2
1UniversityofAgriculturalSciencesandVeterinaryMedicine,Iasi,
lioancea@univagroiasi.ro
2
Al.I.CuzaUniversity,Iasi

Theshapeofa normalerythrocyteisa biconcavedisc(discocyte)whichrepresentsan


equilibriumstate.Redcellscaneasilyundergoshapetransformationsinvitrounderthe
influence of certain agents and these changes are reversible by removal of causative
agents by the addition of antagonists. On the other hand, there are some mammals
whichhaveellipticalerythrocytesasanadaptationtotheenvironmentandwayoflife.
In this work the analysis of the erythrocyte shape for some herbivore mammals is
presented.Ourresultshowsthatllamahasonlyellipticalerythocytes,thecowandthe
sheep have discocytes but goat has a percent of 7.3% and goat kid 17.5% as
elliptocytes.Inadditiontheerythrocyteeccentricityhasbeencomputedanditis0.87for
llama,0.73forgoatand0.77forgoatkid.
Keywords:mammalblood,RBCs,erythrocyteshape

INTRODUCTION

Theshapeofanormalerythrocyteisabiconcavedisc(discocyte)whichrepresentsan
equilibrium state. Red cells can easily undergo shape transformations in vitro under the
influenceofcertainagentsandthesechangesarereversiblebyremovalofcausativeagentsby
the addition of antagonists. The mechanism by which mature red blood cells change their
shape under physiological and pathological conditions has been the subject of considerable
interest.Thedominatinginterpretationofshapechangesisexplainedbydifferentialincrease
insurfaceareaofthetwoleafletsoferythrocytemembrane.
Several groups have reported that druginduced shape changes of erythrocytes as
elliptocytes are accompanied by alterations in their flow properties [1]. These alterations in
theerythrocytescouldbethroughdirectmodificationofthecellgeometry(surfacetovolume
ratio)orthroughassociatedalteration of themembraneskeleton.Thusaninterrelationship
exists between the capacity of the cell for the shape change and the deformability of its
membrane [2]. Erythrocytes in clinical conditions are associated with altered morphology
leading to abnormal rheological behaviour, as observed in several hematological disorders.
Theinabilityoftheerythrocytetoshapealterationcontributestoitsearlyremovalfromthe
circulation. Elliptocytes can be seen in hereditary disorders, such as hereditary elliptocytosis
[3], or in acquired disorders, such as iron defiency anemia, infectious anemias, thalassemia,
and in newborn babies. Hereditary elliptocytosis and its variants arecongenital hemolytic
disorders in which erythrocytes are either elongated into a cigar or oval shape or are
poikilocytic and bizarrely shaped. Its transmission has usually been described asautosomal
dominant.
Ontheotherhand,thereareanimalswhichhavenormalerythrocyteswithadifferent
shapefromdiscocytes.Thereforebirdbloodandfishbloodcontainellipticalerythrocytes[4].

121

Lucrritiinificevol53seriaMedicinVeterinar
Theelliptocytosiswasdetecteda5yearolddogduringtheevaluationoflameness.
The dog's erythrocytes had reduced cellular deformability and erythrocyte membranes had
decreased mechanical stability. Analysis of erythrocyte membrane spectrin revealed an
increasedamountofspectrindimmersandDNAanalysisdetectedaspectrinmutation[5].
Other mammals have elliptocytesas an adaptation tothe environment andway of
life. Therefore it is theorized that the size, shape and hemoglobin concentration of camelid
erythrocytes play a role in increasing the oxygencarrying capacity as well as the ability of
erythrocytes to exchange oxygen. Camelid erythrocytes have a lower MCV than most other
species, but a higher RBC count. PCVs are similar to or slightly lower than other herbivores
andtotalhemoglobinconcentrationinllamabloodishighascomparedtocattle.Thisisdueto
the combination of a higher concentration of hemoglobin in individual erythrocytes and the
highertotalRBCcounts.Thehighhemoglobinconcentrationincreasestheabilityofthecellto
carryoxygenwhilethesmallsizeandflattenedshapeprovideincreasedmembranesurfacefor
oxygen exchange (higher surface/volume ratio). In addition, it appears that camelid
hemoglobin has characteristics that allow a higher saturation with hemoglobin at lower
atmosphericoxygenpressure(leftshiftintheoxygendissociationcurve).Theellipticalshape
of the camelid erythrocytes also makes them much more resistant to changes in blood
osmolality.Inthisworktheanalysisoftheerythrocyteshapeforsomeherbivoremammalsis
presented.

MATERIALSANDMETHOD

SamplesfromperipheralmammalsbloodwereoperatedusingMayGrwaldGiemsa
colorature. With the aid of the microscope we obtained the photos and using erythrocyte
planar images, we count the normal erythrocytes and the elliptocytes. After that the
eccentricityoftheseelliptocyteshasbeendeterminedusingthewellknownformula:

b2
e = 1

a2
whereaandbaretheellipsesemiaxes.
Fig.1,2,3,4,5 shows the morphology of RBCs under normal conditions for blood of
someherbivoremammals.Wecanseethatcawandsheephavenormaldiscocytes,llamahas
elliptocytesandgoatandgoatkidhaveerythrocytesofvariousshapesintheirblood.

Fig.1Erythrocytesfromcowblood

122

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.2Erythrocytesfromsheepblood

Fig.3Erythrocytesfromllamablood

Fig.4Erythrocytesfromgoatblood

123

Lucrritiinificevol53seriaMedicinVeterinar

Fig.5Erythrocytesfromgoatkidblood

RESULTSANDDISCUSSION

Fig.6showsthepercentageofnormalerythrocytes,elliptocytesandothershapeofRBCsfrom
someherbivoremammals.
120
100
80
%

discocytes

60

elliptocytes
other shape

40
20
0
cow

sheep

llama

goat

goat kid

Fig.6ThepercentageofdifferentshapeofRBCsfromherbivoremammals
0.95
0.9
0.85
llama

0.8

goat
0.75

goat kid

0.7
0.65
0.6

Fig.7Theeccentricityofelliptocytesfromllama,goatandgoat
kidErrorbarsare95%confidenceintervalsandn=20
124

UniversitateadetiineAgricoleiMedicinVeterinarIai

Our results are in good accordance with the other authors for llama blood [6], as
figure8and9show.

Fig.8Erythrocytesfromllamablood(Azwaietal.)

1
0.95
0.9
0.85
0.8
llama-personal results

0.75

llama-literature

0.7
0.65
0.6
0.55
0.5

Fig.9Comparisonoftheelliptocyteeccentricityfromllama.Errorbarsare95%confidence
intervalsandn=20

Ourresultsshowedthatthecowerythrocytesandsheeperythrocyteshavediscoidal
shape,forllamatheRBCareelliptocytesandforgoatandgoatkidbloodappearelliptocytes
and other different shapes. From aur samples resulted that goat blood has a percentage of
7,3%fromcellsaselliptocytesand27%othershape,therestof65,7%beingnormaldiscocytes.
Forgoatkidweobtainedahigherpercentageforelliptocytes(17,5%)thanforgoat,theother
shapesbeing11,3%,anddiscocytes71%.
From figure 7 we can see that the eccentricity of llama elliptocytes is 0.87 and it
higher than the other animals (0.73 for goat and 0.77 for goat kid). The mean elliptocyte
eccentricity for our samples is in accordance with the literature data (for these data we
obtainedamainelliptocyteeccentricity0.901)

125

Lucrritiinificevol53seriaMedicinVeterinar
CONCLUSION

Llamoiderythrocytesareellipticalandtheelliptocyteeccentricityishigherthanthose
in other domestic animals studied in this work. The unique morphological features of llama
erythrocytes play a vital role in their ability to transportoxygen to the tissue adequately on
environmental conditions of high altitude. The goats and goat kids have also elliptical
erythrocytes they being adapted to the special way of life by comparison with the other
mammals.

REFERENCES

1.

2.

3.

4.
5.

6.

SuwalskyaM.,GonzlezaR.,FernandoVillenabF.,AguilarcL.F.,SotomayorC.P,BolognindS.,
Zatta P., (2009), Structural effects of tetrachloroauric acid on cell membranes and molecular
models,CoordinationChemistryReviews253,15991606
MaedaN,NakajimaT.,IzumidaY.,SuzukiY.,TateishiN.,SeiyamaA.,Decreaseddeformability
of red cells refractory anemia and the abnormality of the membrane skeleton,(1994),
Biorheology,31(4),395405.
Debray F.G. , Ilunga S. , Brichard B. , Chantrain C. , Scheiff J.M., Vermylen C., (2005), Une
forme particulire danmie constitutionnelle chez un nourrisson de deux mois :
lelliptocytose.Aparticularhereditaryanemiainatwomontholdinfant:elliptocytosis,Archives
depdiatrie,12,163167
Nash,GB., EggintonS.,(1993),Comparative rheology of human and trout redblood cells, J.
Exp.Biol.,174,109122.
DiTerlizziR.,GallagherP.G.,MohandasN.,SteinerL.A.,DolceK.S.,GuoX.,WilkersonM.J.,
Stockham S.L., (2008), Canine elliptocytosis due to a mutant spectrin, Veterinary Clinical
Pathology,38(1),5258
Azwai S.M., Abdouslam O.E., AlBassam L.S., Al Dawek A.M., AlIzzi S.A.L., (2007),
Morphological characteristics of blood cells in clinically normal adult llamas (Lama glama),
VeterinarskiArhiv,77(1),6979

126


IDENTIFICATIONOFPATHOLOGICALSTATESBASEDONRED
BLOODCELLAGGREGATION

S.OANCEA1,S.PADUREANU1,A.V.OANCEA2
UniversityofAgriculturalSciencesandVeterinaryMedicine,Iasi,
lioancea@univagroiasi.ro
2
Al.I.CuzaUniversity,Iasi

InthepresentstudytheaggregationpropertiesofcowRBCswereinvestigated.Forcow,
in physiological conditions, the aggregation is not present but in pathological cases a
hyperaggregationprocesscanbeseen.InordertoappreciatetheRBCaggregationthe
AggregateShapeParameterhasbeencomputedusingAUTOCADsoft
Keywords:RBCaggregability,cowblood,AUTOCADsoft
1

INTRODUCTION

Inhumanbloodandforalmostallmammals,RBCsarebiconcavedisksundernormal
physiologicalconditions, whereastheirmeansizemaydifferbetweenspecies.RBCsinstatic
humanbloodformlargeaggregatesresemblingastackofcoinsbutaggregationcharacteristics
ofmammalianRBCexhibitawiderangeamongvariousspecies.Moreinvestigatorsareplaying
agooddealofattentionofresearchonbloodviscositytoclinic,theaggregationofredblood
cell may beamore useful parameter of hemorheology from point of view ofpathology and
diagnostic [1]. Comparative animal studies showed the wide variation of whole blood and
erythrocyteaggregationamongdifferentmammalianspecies[2].HorseRBCsaggregationwas
reportedbymanyauthors[3]anditisgreaterthanfortheothermammalianspecies.Popeletal.
data [4] showed that athletic species exhibit a consistently higher degree of red blood cell
aggregation than their sedentary counterparts. There are different methods to evaluate this
complex process of RBC aggregation [5], [6]. In [7] the fractal analysis was used to make a
quantitativeevaluationofaggregabilityforhorsebloodbycomparisonwiththehumanbloodand
in[8]thesamemethodwasusedforbovinebloodfrompathologicalpointofview.Traditional
mechanicalandmathematicalmethodsalsoprovedtobeinsufficientindescribingtheaggregation
process[9].
In this work the aggregation process of cow RBCs was investigated. In order to
appreciate the RBC aggregation the Aggregate Shape Parameter has been computed using
AUTOCADsoft.

MATERIALSANDMETHOD

Samples from peripheral bovine blood were operated using MayGrwald Giemsa
colorature.Withtheaidofthemicroscopeweobtainedthephotos.Usingerythrocyteplanar
imagesoftheclusters,obtainedwithaNikonmicroscope,theRBCAggregateShapeParameter
wascomputedusingtheformula[10]:

K = 4

A
P2

(1)

127

Lucrritiinificevol53seriaMedicinVeterinar
HereAistheprojectedareaoftheaggregateandPisitsperimeter.Thesequantities
werecomputedbymeansofAUTOCAD2007soft.

RESULTSANDDISCUSSION

Fig.1showsthemorphologyofRBCs undernormalconditionsforcow blood when theRBCs


arenotaggregatedandFig.2showsaggregatederthrocytes.

Fig.1Erythrocytesfromcowblood

Fig.2Aggregatederythrocytesfromcowblood
Our measurements for 5 aggregates (from 5 photos) on the Aggregate Shape
Parameteraregiveninthetable1.

128

UniversitateadetiineAgricoleiMedicinVeterinarIai

aggregation shape parameter

Table1AggregateShapeParameterforcowblood

Nr
A
P
K
1
149974.62
1978.21
0.4813
2
155554.0
2663.97
0.2753
3
159709.67
2471.86
0.3283
4
68678.54
1112.6
0.6968
5
193315.05
2815.65
0.3062
Mean
0.4176
Standarddeviation
0.1751
Standarderror
0.0783
Confidenceinterval
0.2174

TheAggregateShapeParameterforcowbloodinthispathologicalstateishigherthan
theotheranimalsstudiedintheearlierwork[11],asfigure3shows.

0.7

0.6

0.5

horse
0.4

pig

0.3
cow

0.2

0.1

variants

Fig.3Comparativeaggregationforthreemammals

Fig.3TheAggregateShapeParameterforsomemammalsblood.Errorbarsare95%confidence
intervalsandn=5

CONCLUSION

WecansupposethatifwedevelopaneasymethodtomeasuretheRBCaggregation
in pathological states for some mammals and we could perform standardization, we could
obtainamethodtofindthestageofthedisease.

129

Lucrritiinificevol53seriaMedicinVeterinar
REFERENCES

1.

Rampling,M.W.,Meiselman,H.J.NeuB.,BaskurtO.K,(2004),Influenceofcellspecificfactors
onredbloodcellagregation,Biorheology,41,91112.
2. Kumavarel,M.,SinghM.,(1995),Sequentialanalysisofaggregationprocessoferytrocytesof
human,buffalo,cow,horse,goatandrabbit,ClinicalHemorheology,15,291304.
3. Baskurt O.K., Farley R.A., Meiselman H.J., (1997), Erythrocyte aggregation tendency and
cellularpropertiesinhorse,humanandrat:acomparativestudy,Am.J.,Physiol.,273,H2604
H2612.
4. Popel A.S., Johnson P.C., Kameneva M.V., Wild M.A., (1994), Capacity for red blood cell
aggregation is higher in athletic mammalian species than in sedentary species, J. Appl.
Physiology,77,17901794.
5. MartonZ.,KesmarkyG.,VekasiJ.,CserA.,RussaiR.,HorvathB.,TothK.,(2001),Redblood
cell aggregation measurements in whole blood and in fibrinogen solutions by different
methods,ClinicalHemorheologyandMicrocirculation,24,7583.
6. RapaA.,OANCEAS.,(2006),Hemoreologiecomparata,EdituraTEHNOPRESS
7. RapaA.,OANCEAS.,CREANGAD.,(2005),Fractaldimensioninredbloodcell,J.ofVeterinary
andAnimalScience,29,12471253.
8. Oancea, S., (2007), A quantitative analysis of red blood cell aggregation from bovine blood,
RomanianJournalofBiophysics,17(3),205209.
9. SkalakR.,ZHUC.,(1990),RheologicalAspectsofRedBloodCellAggregation,Biorheology,27,
309325.
10. Foresto P., DArrigo M., Carreras L., Cuezzo R.E., Valverde J., Rasia R., (2000), Evaluation of
red blood cell aggregation in diabetes by computarized image analysis, Medicina (Buenos
Aires),60,570572.
11. Oancea S., Oancea A.V., (2010), Erythrocyte aggregation for two species of mammals,
RomanianJournalofBiophysics,inprint

130

STRUCTURALMODIFICATIONSOFTHEORALMUCOSAANDTHE
DENTALAPPARATUSINDUCEDBY
SOMEDRUGSINLABORATORYMICE

OPREANO.Z.1,GHEBANDIANA2,FORNANORINACONSUELA2,
INDILARE.V.1,GRMADS.1
1
VeterinaryMedicineFaculty,Iai
2
DentalMedicineFaculty,Iai
email:ozoprean@uaiasi.ro

Abstract

Theauthorsaimtoverifyandstudytheinformationmentionedinspecialityliteratureoninducedside
effects,(inmammals)intheoralcavity,of3drugs:Phenytoin,Cyclosporin,Nifedipine.
Theresearchwasconductedon36whitelaboratorymice(subfamilyMurinae)distributedingroupsof
12animalseachforeachproduct,andacontrolgroupof5animals,towhichnoactionwastaken.
The fundamental pathological process observed in histological examination, with no significant
differencesinthegroups,wasfibrocellularhyperplasia.
No relevant tissue reaction differences were observed in animals injected with Azithromycin, well
knownantitoxinforthethreedrugstested.
Keywords:experiment,Phenytoin,Cyclosporin,Nifedipine,fibrocellularhyperplasia.

The research performed on experience animals suggest side effects of some drug
compounds,veryoftenusedinhumanpathology,consistingofimportantstructuralalterationsof
the oral mucosa and of the dental apparatus. We intend to verify and deepen the information
available in the litterature concerining side effects induced to the oral cavity by the
overdose/prolongedutilisationofthreechemicalcompounds:Phenytoin,Cyclosporin,Nifedipine
Phenytoin has as main therapeutic indications the treatment of major epileptic crises
(generalised lonicodonic crises) and of partial crises, especially jacksonian ones, but also in the
prophylaxyofepilepticcrisessecondarytoneurosurgery.(1,5,9)
Cyclosporine (also known as Cyclosporine A) is a cyclic polypeptide, consisting of 11
aminoacids, well known as a strong immunosupressive agent, which in animals leads to a
prolongementofthesurvivalofallogenicskin,heart,kidney,pancreas,bonemarrow,intestinor
lungtransplants,thushavingtherapeuticalindicationsintransplantprotectionandinautoimmune
disease.(2,4,10)
Nifedipine is a slow calcium channels blocker; it has an inhibitor effect on calcium ions
flows,especiallyinmyocardiccellsandinthecellsofthesmoothmuscleinthewallsofcoronary
artheriesandperiphericbloodvessels.Itisrecommendedinthetreatmentofpectoralanginaand
inthechronictreatmentoftheessentialandsecondaryhypertension.(3,6,7,8)
Side effects of these three drugs, more serious in children, consist of dysfunctions of the
maininternalorgans,skinandblood.

1.

MATERIALANDMETHOD

36whitelaboratorymiceweredividedingroupsof12(6+6)animalsforeachtesteddrug,
andmarkedcromaticallyaccordingtoTable1.

131

Lucrritiinificevol53seriaMedicinVeterinar

Table1
Repartisationofexperienceanimalsingroupsandexperimentaccomplishment

F1

Activesubstance
administered*
F

F2

F+Azy

C1

C2

C+Azy

N1

Group

Administrationperiod
(days)
55

35
7
13
7

N2

N+Azy
13

Dose
(mg/kg/day)
20
F20
Azy10
10
C10
Azy10
150
250
N150
Azy10
N250
Azy10

*F=Phenytoin;C=CyclosporineA;N=Niphedipine;Azy=Azytromicine

For each of the drugs, we also formed one group in which the drug was administered in
association with Azytromicine, that has a well known role as a moderator (antitoxic) for the 3
testeddrugs.
Wealsohadawitnessgroup,with5congenereanimalsthatdidnotsufferanyintervention.
Experimental animals were all 20 days old males weighing 30 g each, that had their
digestive flora supressed through two daily administrations per os of 0,1ml peniciline solution
40.000UI/ml,preceedingtheexperiment.
The drugs were administered through gavage, Phenytoine and Niphedipine as aquous
solution2mg/ml,CyclosporineAsolubilisedinsalinesolution2mg/ml.
MiceinLotF1wereadministeredPhenytoine20mg/kg/day,for55days,andLotF2were
added10mg/kg/dayAzytromicine.
LotC1received10mg/kg/dayCyclosporineA,andLotC210mg/kg/dayCyclosporineAand
10mg/kg/dayAzytromicine.
LotN1wasadministeredNiphedypine150mg/kg/day,for7daysand250mg/kg/day,for13
days.
LotN2receivedNiphedypinethesamewayasN1,associatedto10mg/kg/dayAzytromicine.
onoimportant onoticethatinLotC1oneanimaldied,inapparenthealth,inday10of
theexperiment.
Allanimalswereeuthanisedattheendoftheexperiment,usingT61aseuthanasiaagent.

2. RESULTSANDDISCUSSIONS

Interpretationofthedifferentdeviationsfromthemorphologicalnormal,inducedbythe3
drugspreviouslydescribedwasdoneaccordingl;ytothenormalaspectoftheoralmucosanoticed
inthemiceinthewitnessgroup.Transversesectionsthroughlateralwallsoftheoralcavity(cheek
area) seveals, on the internal side, the structure of the oral mucosa, covered with a keratinised
stratified pavimentous epithelium, resembling the one on the exterior side of the cheeks. The
anterior segment of the oral cavity is less developped and the muscular support of the area is
representedbyisolatedfasciclesofscheleticalmusclefibers.(Fig.1,Fig.2).

132

UniversitateadetiineAgricoleiMedicinVeterinarIai
Thesuperficialepitheliumoftheoralmucosaontheinternalsideofthelips,cheeksandat
gingivallevelisamediumkeratinisedpavimentousepithelium,withareportcornouslayer/Malpighi
layerofabout1/3(Fig.3).
Theprofoundareaoftheoralcavity,thesubmucosaisdevelopped,consistingoffasciclesof
nonorientedcolagenfibers(Fig.4).
Toward the pharyngian area, the musculosa is very well developped and reaches
sometimesthesubepithelialspace(Fig.5).
Lingual mucosa presents onits dorsal side several papiliform papillae, and the musculosa
obviously predominates in the structure of the tongue, being made of scheletic muscle fibers
(Fig.6,Fig.7,Fig.8).
Thetoothismadeoftwomacrostructuralsegments:thecrownisthefragmentprojectedin
theoralcavityandprotectedmyanenamellayer;therootistheportionimplantedinthedental
alveolaandisprotectedbyacementlayer.
2.1.Changesoftheoralmucosa
Inall3drugsstudiedwenoticedreactiveinflammatoryhyperplasia,withsubacutechronic
evolution.
Necropsic examination does not evidentiate relevant modifications, histopathological
examinationevidentiatefibrocellularprolifferationsinallstructuralsegmentsoftheoralmucosa.
SuperficialepitheliumsuffersfromamoderatehyperplasiaoftheMalpighilayer,thereport
keratine/spinouslayersbecomingabout1/6(Fig.9).
Insomeareas,thehyperplasiaofthespinouslayerisproducedinacentripetedirection,as
papillaethatprotrudeinthelaminapropria(Fig.10).
In some cases of mice injected with Cyclosporine and Niphedypine proliferation of the
submucosa and of the superficial epithelium is associated in the form of micropollipes that
proeminateonthesurfaceoftheoralmucosa(Fig.11).
One animal in Lot N1 has a hyperplasiated mucosa that sticks to the dental surface, as
papillaereachingthetopofthedentalcrown(Fig.12,Fig.13).
Thepapillaeofthemucosaareanchoredtothesurfacethroughawidebase,onwhichthe
reportkeratine/spinouslayersisabout1/8(Fig.14).
The oral submucosa is affected by the same fundamental pathological process. The
hyperplasia, initally vasculoconjunctive, becomes predominantly fibrous in time, towards the
pharyngian area of the oral cavity The local mesenchyme prolifferates as thick unoriented
colagenicfascicles(Fig.15,Fig.16).
In 2 cases we noticed tissular reactions with accutesubacute evolution, due to local
irritations or oportunistic bacteria. In one case we described edematous peridontal infiltrations,
andsubepithelialnecroticfoci(Fig.17,Fig.18).
2.2.Alterationsofthedentalapparatus
Moderatehyperplastictissularreactionsalsoextendtothedentalapparatus.
Dentalalveolaeshowafibroushyperplasiafinalisedinabandofconjunctivetissue,dense
andwellvascularisedthatseparatestherootfromthebonesupportofthedentalarcade(Fig.19).
Theproximalsegmentoftherootshowareasofdentinevacuolisation,whereasinthedistal
area of tooth anchoration shows a conjunctive hyperplasia and a disjunction of the root from the
bonestructures(Fig.20,Fig.21).
Structuralcomponentsof the toothalsoshowdeviations fromthemorphological normal:
thedentineandthecementappearstriatedbyvoidcanalicles,whiledentalpulpistheplaceofa
lymphohistiocyticandlaterfibroushyperplasia(Fig.22,Fig.23).
2.3.Alterationsoftheinternalorgans
OnemouseofdinLotC1diedinapparenthealthinday10oftheexperiment.Histological
examinationoftissularfragmentsprelevatedfromthemaininternalorgansrevealchangesdued
toacutesubacutetoxicosis.
133

Lucrritiinificevol53seriaMedicinVeterinar
Lowresolutionmicroscopicalexaminationofthelungevidentiatestheectasyandhematic
overload of small and medium blood vessels and tissular densifications lodged in interalveolar
interstitium(Fig.24).
Thickening of the interalveolar septum is accompanied by hyperplasia of the distal
airwaves,thatpresent34rowsofcells(Fig.25).
The heart is the place of changes with two structural localisations: interstitial (vascular)
andparenchimatous.
Vascular,wenoticeperiartheriolaredematousinfiltrationsthatdissociatethebloodvessels
from the cardiac muscle fibers and enterthe vascularwall, dissectig the vascular adventice. The
leyocites in the parietal media are thick with inflated vacuolised nuclei; vascular endothelium
appears tumefected, and the nuclei of the endothelial cells are bigger and hyperchromatic,
proeminatinginthevascularlumen(Fig.26).
Theparenchymeistheplaceofintracellulardepositsofcaliumions,withtypicalaspectsof
localisedcalcification:intracellularamorpheoussurfaces,intenselyhaematoxylinicinHEAstaining;
calcificationsarefocalisedonoxyfilemyocardicareas,specifictotissulardevitalisation(Fig.27).
The liver is affected by circulatory disorders and dismethabolies pretty unspecific, but
which,inassociation,leadtoacommontoxicetiology:passivelivercongestionandgranulolipidic
hepatosis.
Passivelivercongestionistranslatedthroughtheectasyandoverloadofcentrolobularvenulae
and dilatation of sinusoidal capillaries through erythrocytes partially hemolised and conglomerates
(Fig.28).
Granulolipidichepatosisconsistsononehandofthetumefactionofhepatocytesandthe
trubledaspectoftheircytoplasms,andontheotherhandofthespongeousaspectandeventhe
apparitionofwellcircumscribedintracitoplasmaticvaluolae(Fig.29).
Cellular sufference is also suggested by the aspect of the nuclei of the hepatocytes:
raspberry aspect, corical hyperchromatosis, chromatine condensation in hyperchromatic blocks
(Fig.30,Fig.31).
The cortical of the kidneys show tumefaction and intumescence of the renoepitheliums that
leads to the anullation of the urinifer tubes, changes of granulas nephrosis; we also noticed the
hyperplasia of vascular areas of Malpighi corpuscles, that completely anullate glomerular cavities.
(Fig.32).

CHARTI

Fig.1.Transversesectionincheekarea.
Mouse.HEA,x100

134

Fig.2.Oralmucosa.Mouse.HEA,x400

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.3.Oralmucosa,Pavimentous
stratifiedkeratinizedepithelium.HEA,x400

Fig.5.Oralcavity,pharingealarea.
Musculosa.HEA,x400

Fig. 4. Oralcavity.Submucosa.
Musculosa.HEA,x400

Fig. 6.Lingualmucosa,ventralside.
HEA,x400

Fig.7.Lingualmucosa,dorsalside.
FiliformpapillaeHEA,x400

Fig. 8. Lingualmusculosa.Rabdocytes.
HEA,x400

CHARTII

Fig. 10.Superficialepithelium.Centripete
papillarhyperplasiaofthespinouslayer.
HEA,x400

Fig.9.Superficialepithelium.
Hyperplasiaofthespinouslayer.Ration
eratinised/spinouslayersof1/6.HEA,x400

135

Lucrritiinificevol53seriaMedicinVeterinar
CHARTIII

Fig. 12.Periodontalhyperplasiaofthe
mucosa.Premolar.HEA,x40

Fig.11.Hyperplasiaofthesubmucosa
andofthespinouslayer.HEA,x400

Fig.13.Periodontalpollipe.HEA,x100

Fig.15.Colagenisedvasculated
submucosa.HEA,x100

Fig. 14.Baseoftheperiodontalpolipe.
Hyperplasiaofthespinouslayer.HEA,x400

Fig. 16.Colagenisedsubmucosa,
Pharyngealareaoftheoralcavity.HEA,x400

136

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.18.Subepithelialnecrosis.
HEA,x400

Fig.17.Periodontaledematous
infiltrations.Col.HEA,x100

Fig.20.Molar.Bifideroot.Transverse
section.Dentinevacuolisation.HEA,x100

Fig.19.Molar.Bifideroot.Longitudinal
section.Colagenizationofthedentalalveola.
HEA,x100

Fig.21.Molar.Bifideroot,profound
area.Transversesection.Alveoladecolation.
HEA,x100

Fig.22.Premolar.Dentalcrown,Cement
canalisation.HEA,x400

Fig.23.Premolar.Fibroushyperplasia
ofdentalpulp.HEA,x400

Fig.24.Lung.Tissularcondensationwith
septalhyperplasiaHEA,x100

137

Lucrritiinificevol53seriaMedicinVeterinar

CHARTIV

Fig.25.Lung.Hyperplasiaofbronchiolar
epithelium.HEA,x400

Fig. 26.Heart.Artheriole.Leyocite
tumefactionandofthevascularendothelium.
HEA,x1000

Fig.27.Heart.Dystriphiccalcification
area.
HEA,x400

Fig. 28.Liver.Passivecongestion.HEA,
x100

Fig.29.Liver.Granulolipidicdystrophy.
HEA,x100

Fig. 30.Liver.Hyperchromaticnuclei.
HEA,x1000

138

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.31.Liver.Nuclearhyperchromatosis.
Spongiouscytoplasm.HEA,x1000

Fig. 32.Kidney.Hyperplasiaofrenal
glomerules.HEA,x400

3.CONCLUSIONS
The testing of secondary effects with oral localisation of the three drugs: Phenytoin,
Cyclosporin,Nifedipine,onwhitelabmicerevealedthefollowingconclusions:
1.Necropsicexaminationdidnotrevealmacroscopicallesions.
2.The fundamental pathological process noticed histologically was the fibrocellular
hyperplasia,forallgroupsandatalllevelsoftheoralcavity.
3. The access of the pathogen factor on the circulatory way leads to the hyperplasia of
profoundand median structures of theoral mucosa,while the superficial keratinized layer stays
thesame.Thespinouslayeroftheepitheliumthickensuptoaratioof1/6.Laminapropriaandthe
submucosa are the place of a predominantly fibrous hyperplasia, finalised by the thickening of
affected areas and replacement of glandular tsructures through dense and well irrigated
connectivetissue.Mucosalhyperplasiamayleadtoformationofpollipesadherrenttothelateral
surfacesofthetooth.
4.The dental apparatus is moderately affected by the same predominantly prolifferative
phenomena.Thedentalalveolaiscolagenised,leading,inprofoundareasofthedentalroot,toits
disjunctionfromthebonesupportoftheregion.Thedentineandthecementaremarkedoffine
canallicles,whiledentalpulpsuffersahyperplasia(predominantlycellular,thenfibrous).
5.WedidnotnoticeanyrelevantdifferencesintheanimalsinjectedwithAzytromicine.
6.In one case that was administered CyclosporinaneA (no Azytromicine) and died in
apparenthalhinday10oftheexperiment,wenoticedchangesduetoanacutesubacutetoxicosis,
andlocalcirculatorydisordersduetomyocardiccalcification.
7. In 2 of the cases we described edematous periodontal infiltrations and subepithelial
necroticfoci,duetolocalirritationsoropportunisticbacteria.

BIBLIOGRAPHY

1. BalajiS(October2004)."Medicaltherapyforsuddendeath".Pediatr.Clin.NorthAm.51
(5):137987;
2. BorelJF(2002)."Historyofthediscoveryofcyclosporinandofitsearlypharmacological
development". Wien. Klin. Wochenschr. 114 (12): 4337. PMID 12422576;Cohn, J.N.,
Ziesche,S.M.,Loss,L.E.,Anderson,G.F.,siVHeFTStudyGroup,Effectoffelodipineon
shorttermexerciseandneurohormoneandlongtermmortalityinheartfailure:results
ofVHeFTIII(rezumat),Circulation,1995,92(supl.I),I143;
4. Dewick,P.(2001)MedicinalNaturalProducts.JohnWiley&Sons,Ltd.2nded.;

139

Lucrritiinificevol53seriaMedicinVeterinar
5. Dreyfus, Jack (1998). A Remarkable Medicine Has Been Overlooked: Including an
Autobiography and the Clinical Section of the Broad Range of Use of Phenytoin.
ContinuumInternationalPublishingGroup.ISBN0826410693;
6. Furberg,C.D.,Psaty,B.M.,Mejer,J.V.,Nifedipine.Doserelatedincreaseinmortalityin
patientswithcoronaryheartdisease,Circulation,1995,92,13261331;
7. Lewis, B.S., Emmott, S.N., Smyllie, J., MacNeil, A.B., Lubsen, J., Left ventricular systolic
anddyastolicfunction,andexercisecapacitysixtoeightweeksafteracutemyocardial
infarction,AmJCardiol,1993,72,149153;
8. Maisch,B., Brilla,C.,siKruse, T.,Directions inantihypertensivetreatment ourfuture
fromthepast,EurHeartJ,1995,16(supl.C),7483;
9. Man CB, Kwan P, Baum L, et al. (May 2007). "Association between HLAB*1502 allele
and antiepileptic druginduced cutaneous reactions in Han Chinese". Epilepsia 48 (5):
10158.;
10. StarzlTE,KlintmalmGB,PorterKA,IwatsukiS,SchrterGP(1981)."Livertransplantation
with use of cyclosporin a and prednisone". N. Engl. J. Med. 305 (5): 2669. PMID
7017414.

140


ISOLATION,CHARACTERIZATION,PHENOTYPIZATIONAND
DIFFERENTIATIONOFSTEMCELLSFROMRATPLACENTA

EmokePall1,GrozaI.1,CenariuM.1,CristinaIlea1,
OlgaSoritau2,CiprianT2.,BerceC1.
1.UniversityofAgriculturalScienceandVeterinary
Medicine,ClujNapoca,35CaleaMntur,ClujNapoca,
pallemoke@gmail.com
2.OncologyInstituteProf.Dr.IoanChiricuta,ClujNapoca

Abstract:Mesenchymalstemcellshavebeensuccessfullyisolatedfromhuman,cat,dog,rabbit,
rat,chicken,sheep,goatandpigbonemarrowsthankstotheirplasticadherenceproperty.In
recentyears,stemcellbiologyhassparkedconsiderableinterestworldwideinthescientific
world,andrecentdevelopmentsinstemcellresearchhaveopenednewperspectivesbyusing
theminregenerativetherapy.Inthisstudywesuccessfullyisolated,culturedandexpandedrat
placentaderivedmesenchymalstemcellsusingroutinemethods.Aftertheinitial3daysof
primaryculture,ratplacentalmesenchymalstemcellsadheredtoaplasticsurfaceandpresented
asmallpopulationofsinglecellswithspindleshape.Toinvestigatethemesenchymalmaturewe
differentiatedthecellsintotheosteoblasticlineageandalsotheexpressionofcertainsurface
marker.

KEYWORDS:placenta,mesenchymalstemcells,cultureexpansion,differentiation

Stemcellresearchhasbecomeanimportantfieldofstudyformolecular,cellular,and
clinicalbiologyaswellaspharmacotoxicology.Indeed,stemcellshaveastrongproliferative
andunlimitedselfrenewalpotentialandaremultipotent(1,4,6,7)
The mesenchymal stem cells (MSC) are multipotent cells present in the bone marrow and
othertissue(3).Theplasticityofthesecellsallowsthemtobeusedincelltherapyoncethey
havethepotencialtoreplicateasundifferentiatedcellsandcouldbeinducedtodifferentiate
to mesenchymal lineages (bone, fat, cartilage, tendon, muscle, marrow stroma etc.) as
endodermalandectodermallineages,replacingtissuesandorganswhosefunctionhadbeen
harmed.Allthespeciescouldbebenefiedusingthecelltherapy(2,5).
Rat mesenchymal stem cells from placenta offer significant promise asa multipotentsource
for cellbased therapies and could form the basis for the differentiation and cultivation of
tissue grafts to replace damaged tissue. Placental derived MSC therefore represent an
alternativeandmoreeasilyobtainableandabundantsourceofMSCthanbonemarrow.
The aim of this study was to isolate and evaluate the differential potential of
mesenchymal stem cells from rats placentas. Our data demonstrate that we successfully
isolated,cultureexpandedmesenchymalstemcellsfromratplacentas.

MATERIALSANDMETHODS

Biologicalmaterialplacentaswereobtainedaftercaesareansectionfromnormalterm
pregnancies (1921D) Pieces of placenta were excised and washed in PBS to remove excess
blood. Tissue was then incubated in trypsin EDTA. After enzymatic digestion, a cell strainer
wasusedtoobtainasinglecellsuspension.Theresultingcellswerewashedandcentrifugedon

141

Lucrritiinificevol53seriaMedicinVeterinar
PBS. Cells were then cultured in DMEM with 10% FCS, 1% antibiotics, 1%NEA (non essential
aminoacid)After48hours,nonadherentcellswereremovedandtheremainingcellscultured
untilalmostconfluent beforepassage.Mediawaschangedevery34days.After twoormore
passages,thecellswereanalysed.
Osteogenic differentiation was induced by two different culture medium: basal
mediumcomposedofDMEM(Gibco)supplimentedwith10%FCS,107dexamethasone,10mM
glicerophosphate,1g/mlinsulin,50g/mlascorbicacid,10ng/mlBMP2,2ng/mlTGFand
specificmediumforosteoblastsPromoCellOsteoblastGrowthMedium.
To identify differentiated cells was performed immunohistochemical analysis of cell
culturesattheendoftheexperiment.Accordingtotheimmunohistochemicalprotocol,initial
patency was achieved by treating cells for their intracellular antigens with a solution 0.1%
TRITON X100 for 5 minutes and added lock patency 10% BSA solution. After 24 hours of
keeping in contact, at 4C were performed three successive washes with PBS solution and
addedprimaryantibodies:antiosteopontin(IgM)antiosteonectin(IgG2a).

RESULTSANDDISCUSSION

The cultures were observed daily by phase contrast invert microscopy to examine
adheretntcellmorphology.Intheearlydays,individualadherentcellsappearedinabout60%
of the wells, 40% of the wells having no adherent cells. After examining cultures have
identifiedtwodifferenttypesofcells,somewerefibroblasticlikeandtheotherswereround
with dark centers and transparent peripheries. After 4 days some fibroblastic cells
proliferated, giving rise to colonies of fibroblastic cells. At the end of day 8, generally 1012
fibroblastic colonies appeared. By the end of week 2 the number of floating cells increased
withintheculturemedium(Fig.1).Passageswasmadeata80%confluencetoavoidcontact
inhibition.Aftereachpassagespartofthecellsuspensionwerefrozenforfutureexamination
so as to investigate multilineage differentiation, proliferation potential and the presence of
certainsurfacemarkers.

Figure1Microscopicanalysisofcellularmorphology20x

142

UniversitateadetiineAgricoleiMedicinVeterinarIai
Inosteoinductivecultures,afewcellsbecamedetachedandfloatedinthemedium
duringthecultureperiod(Fig.2).

Figure2Cellularmorphologyafterosteogenicinductionanddistinctcellular
colonieswithosteogenicnodules

In some areas of the culture dish, nodulelike structures of different sizes were
observed. In cultures treated with basal medium after 8 days were observed emergence of
cells with morphology similar to that of adipocytes namely cell cytoplasm filled with lipid
droplets(Fig.3).

Figure3Apparitionofadipocytesinculture40x

Differentiation was further demonstrated by immunohistochemical staining for


osteopontine and osteocalcin. After 21 days induction period, the level of osteocalcin and
osteopontine slightly increased (Fig.4). This marker did not express in the undifferentiated
mesenchymalstemcells,buthasbeenproducedinthecellsafterthethirdweekofinduction.

143

Lucrritiinificevol53seriaMedicinVeterinar

Figure4Immunohistochemicalassayofosteopontinand
osteocalcininculturesdifferentiatedonosteogenicline20x

After several passages the cells did not lose multipotential differentiation potential,
fibroblasticmorphologywasmaintainedduringthesubcultureperiod.

CONCLUSIONS

In the present investigation, pure fibroblastic cells with multilineage differentiation


capabilitywereisolatedfromratplacenta.Theisolationonplacentalcellsisfarmoredifficult
thanofotherspeciesduetotheunwantedgrowthofnonmesenchymalcellsinbothprimary
and passaged cultures. Certain features of the cells having been isolated via our approach
convincedusthattheyweremesenchymalstemcells.Themostimportantpropertiesofthese
cellsweretheirmultilineagemesenchymaldifferentiationinculturemediumandtheirability
tomaintainthispotentialuntopassage8.

BIBLIOGRAPHY
1.

2.
3.
4.
5.
6.
7.

MarkF.P.,AlastairM.M.,StephenC.B.,RamaK.Jaiswal,RobinD.,JosephD.M.,MarkA.M.,Donald
W. S., Stewart C., Daniel R. M., 1999, Multilineage Potential of Adult Human Mesenchymal Stem
Cells,Science,Vol.284.no.5411,pp.143147;
Mauro K., Massimo F., Giovanni P., Giuseppe A., 2007, Mesenchymal stem cells: from biology to
clinicaluse,BloodTransfus,5(3):120129.
Ppokratis Pountos, Peter V.Giannoudis, Biology of mesenchymal stem cells, Injury,Int.J.CareInjured
(2005)36S,S8S12
SarahSnykers, TamaraVanhaecke, VeraRogiers, 2006, Isolation of Rat Bone Marrow Stem Cells,
CytochromeP450Protocols,SecondEdition,MethodsinMolecularBiology
ShengkunSun,ZikuanG,XurenX.,BingL.,XioaodanL.,PeiHsienTang,NingMao,2003,Isolationof
mousemarrowmesenchymalprogenitorbyanovelandreliablemethod,StemCells,21:527535
YumiF.,HideakiN.,DaisukeS.,ImikoHirose,ToshioK.,KohichiroT.,2004,HumanPlacentaDerived
CellsHaveMesenchymalStem/ProgenitorCellPotential,Volume22Issue5,Pages649658;
Zongning M., Jun J., Lei C., Jianzhong Z., Wei H., Jidong Z., Hanguang Q., Xueguang Z., 2006,
Isolationofmesenchymalstemcellsfromhumanplacenta:Comparisonwithhumanbonemarrow
o
mesenchymalstemcellsCellbiologyinternational,vol.30,n 9,pp.681687;

144

LUTEINPREVENTSHIGHGLUCOSEINDUCEDOXIDATIVE
STRESSINHUMANRPECELLS

DumitriaRUGINA,AdelaPINTEA,AndreaBUNEA,RalucaPOP,SandaANDREI

UniversityofAgriculturalSciencesandVeterinaryMedicineClujNapoca,Departmentof
ChemistryandBiochemistry,Mnstur35ClujNapoca,400372,Romania
Email:apintea@usamvcluj.ro

Abstract
Human retina accumulates two dietary carotenoids: lutein and zeaxanthin. The
carotenoidpigmentsinretinaactasscreeningpigments,byabsorbingthedamagingbluelight,
butitissupposedthattheycanalsocontributetotheantioxidantdefenceofretinalstructures.
Lutein was identified in several anatomic structures of the retina, including the retinal
pigmentedepithelium(RPE).Theaimofthisstudywastoinvestigatetheeffectofluteinonthe
oxidative status of RPE cultured cells in oxidative stress conditions induced by high glucose
concentrationinculturemedium.
D407RPEcellswerecultivatedinDMEMmediumwith10%FCS.Thecellsviabilitywas
estimated by the MTT assay and the cytotoxicity by LDH leakage assay. The generation of
intracellularreactiveoxygenspecies(ROS)wasdeterminedbyusingafluorescentprobeDCF
DA, TBARs by a fluorimetric method and reduced glutathione by an enzymatic assay.
Antioxidantenzymes:glutathioneperoxidase(GPx).Superoxidedismutase(SOD)andcatalase
activitiesweredeterminedusingcommercialkits
Highglucoseconcentrationinducedmodificationofoxidativestressmarkers:changes
inantioxidantenzymesactivity,increasedlipidperoxidationandintracellularROSgeneration.
Lutein did not show any cytotoxic effect on RPE cells up to 10 M in culture medium and
protectthemagainstinducedoxidation.LuteinprotectsRPEcellsbyquenchingtheintracellular
ROSgeneration,byreducingthelipidperoxidationandbyenhancingtheactivityofsuperoxide
dismutase and glutathione peroxidase. Addition of lutein did not significantly influenced
reduced glutathione concentration and catalase activity. Increased concentration of lutein in
RPEcellscancontributetoantioxidantdefenceinoxidativestressconditions.

Keywords:Lutein,RPEcells,highglucose,oxidativestress

INTRODUCTION

TheRetinalPigmentEpithelium(RPE)isamonolayerofcellsrepresentingthebarrier
betweenthephotoreceptorsandthechoriocapillaris.Itprovidesoxygenandnutrientstothe
photoreceptorsbutalsoremovetheirdebrisandmetabolites.ThelossofRPEcellsisrelatedto
several eye diseases, including age related macular degeneration (AMD). Retina and retinal
pigment epithelium (RPE) represent an ideal environment for the generation of reactive
oxygenspecies(ROS)andoxidativedamages.TherearethreemainsourcesofROSgeneration
in the RPE: high metabolic rate and oxygen consumption, high level of irradiation,
phagocytosis of photoreceptors outer segments and the presence of photosensitizers
(lipofuscin)(Micelietal.,1994;Beattyetal.,2000;Winkleretal.,1999;Luetal.,2006;Qinet
al., 2007). The vision loss in AMD results from photoreceptor damages in the centralretina,

145

Lucrritiinificevol53seriaMedicinVeterinar

and it is accepted that degeneration ofRPE is involved in first stages of AMD (Qin, 2007). It
was demonstrated that oxidative stress plays an important role in the pathology of AMD
(Kopitzetal.,2004;Qin,2007;Colemanetal.,2008).Hyperglycemiawhichoccursindiabetes
reducesthelevelofantioxidantsanddeterminesanincreaseofreactiveoxygenspecieswhich,
inturnproduceoxidativedamagesindifferenttissues,includingretina.RPEcellsrespondto
acute high glucose level in culture medium by modification of antioxidant and proteolitic
enzymesactivity.CulturedRPEcellsexposedtohighglucoseconcentrationshowedelevated
level of glutathione peroxidase, cathepsin B and heat shock protein 27, while the activity of
Cu/Zn SOD was decreased compared to control (Yokoyama et al., 2006). High glucose
concentrationalsodeterminedareductionofpermeabilityinRPEculturedcells(Villarroelet
al., 2009). Lutein and zeaxanthin are the only dietary carotenoids accumulating in the
anatomic structures of human retina, including the retinal pigmented epithelium (RPE)
(Khachiketal.,1997;Snodderlyetal.,1984a).Xanthophyllsactprimarilyasscreeningpigments
in the retina by absorbing the damaging blue light but they can also contribute to the
antioxidantdefenceofretinalstructures(Beattyetal.,2000;Wronaetal.,2004;Krinskyand
Johnson,2005).Serumcarotenoids,includingxanthophyllsluteinandzeaxanthin,areinversely
associatedwithtypeIIdiabetesandimpairedglucosemetabolism(Coyneetal.,2005).Inthis
context it is important to know how retinal cells respond to acute exposure to high
concentrationsofglucose,withorwithoutadditionofantioxidants.
Theaimofthisstudywastoinvestigatetheeffectofluteinontheoxidativestatusof
RPEculturedcellsinoxidativestressinducedbyhighglucoseconcentrationinculturemedium.

MATERIALANDMETHODS

Cell culture and treatment. Human adult retinal pigment epithelial cells line D407 were
maintained in Dulbeccos Modified Eagle Medium supplemented with 10% fetal bovine
serum, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 g/ml streptomycin, and 2.5 g/ml
amphotericinB,at37C,5%CO2,and95%relativehumidity.Thecellswereseededin25cm3
flask at a concentration of 6 x 105. After reaching 90% confluence, growth medium was
removedandreplacedwithmediumcontaining10Mxanthophyllsduring24hours.
Exposure of cells to high glucose concentration. During the first experiment cells were
cultivatedinincreasingconcentrationofglucoseinmedium:25mM(controlcells),40mM,50
mM, 70 mM and 100 mM. After 24 h treatmentwithcarotenoids, the culture medium was
removed, the cells were washed and with PBS and specifically lysed for each enzyme
determination.
Viabilityassay.MTTassaywasusedtoassesthecellviability(Mossman,1983).Thismethod
uses the property of viable cells to reduce MTT reagent into a coloured formazan which is
detectedbyreadingtheabsorbanceat550nm.Cellviabilitywasexpressedasapercentageof
control(cellsincubatedinnormalmediumonly).
Antioxidantenzymesactivity.Glutathioneperoxidase(GPx),superoxidedismutase(SOD)and
catalase(Cat)activitiesweredeterminedusingcommercialkitsprovidedbyCaymanChemical
Company, Michigan, USA. The enzymes activity was expressed as IU/mg protein and the
proteinweredeterminedwithbicinchoninicacidassay(Sigma,St.Louis,USA).
Glutathione assay. The GSH assay was performed using an optimized enzymatic recycling
method with glutathione reductase (Cayman Chemical Company, Michigan, USA). Standard
curvewasmadewithGSSGstandard,havingtheequivalentGSHconcentrationbetween016
M.ResultsareexpressedasmolesGSH/mgproteinincellpellet.
Intracellularreactivespeciesassay.Thedeterminationofintracellularreactiveoxygenspecies

146

UniversitateadetiineAgricoleiMedicinVeterinarIai

(ROS) is based on the oxidation of 2,7dichlorodihydrofluorescein (DCHF) by intracellular


peroxides, forming the fluorescent compound 2,7dichlorofluorescein (DCF) (Lebel et al.,
1992).
TBARS concentration was determined after the reaction with thiobarbituric acid by using a
calibrationcurveandafluorimetricmethod.AmicroplatereaderHTBioTekSynergy(BioTek
Instruments,USA)wasusedforallphotometricandfluorimetricassays.
Statisticalanalysiswas doneusingOnewayanalysisofvarianceANOVA,Dunnett'sMultiple
Comparison Test of Graph Pad Prism version 5.00. Significant differences are designated by
p<0.05 and notation ***extremely significant, **very significant, *significant. The points or
barsrepresentthemeanSD,calculatedfromthreeexperimentalvalues

RESULTSANDDISCUSSION

D407 RPE cells are usually cultivated in medium containing 25 mM glucose, which
representsahighconcentration.Inthefirstpartofthis studyweevaluatedtheinfluenceof
different higher glucose concentration in culture medium, mimicking hyperglycemia that
occursindiabetes,ontheviabilityandintracellularreactiveoxygenspeciesgeneration(ROS).
As can be observed in Fig. 1 (a) and (b), the increase of glucose concentration had positive
effects on cells viability up to 70 mM but determined a decrease of viability at 100 mM
glucose. Very high concentration of glucose (70 and 100 %) increased significantly the ROS
generation,ascanbeseenfromthetimecourseincreaseoffluorescence.Glucoseat50mM
waschosenforthefurtherexperiments,basedonthefactthatithaspositiveeffectonthecell
viabilitybutsignificantlyincreasetheROSgenerationcomparedwithcontrol.

**
ns

0.3

2500

ns

25 mM
DCF fluorescence

Absorbance (nm)

0.4

ns

0.2

0.1

2000

40 mM

1500

50 mM
70 mM
100 mM

1000
500

m
M

m
M

10
0

70

M
m
50

m
M
40

25

m
M

0.0

Glucose concentration (mM)

35

70

105

140

Time (min)

175

210

245

(a)(b)

Fig.1.ViabilityofD407cellstreatedwithdifferentconcentrationofglucose(a)andintracellular
ROSgeneration(b).Statistic:onewayANOVAanalysisofvariance,Dunnettest,comparingall
columnswithcontrolcolumn(25mM),p<0.05,**verysignificant.

147

Lucrritiinificevol53seriaMedicinVeterinar
150

ns

ns

100

50

Tg

LU

LU
T

on
tr
o

on
tr
ol
g

0
l

LDH citotoxicity (% form control)

Fig.2.LactatedehidrogenaseleakageinD407cellsculturemedium.
Control;Controlg50Mglucose;LUTLutein10M;LUTgLutein10m+50Mglucose

***

40

**

30
20
10

CAT nmoli/min/mg protein

50

80

ns
ns

60
40
20

LU
Tg

on
tr
ol
-g

C
on
tr
ol

g
T
LU

LU
T

on
tr
ol
-g

LU
T

0
on
tr
ol

Activity GPx nmol/min/mg protein

100

(a)(b)
Fig.3.Glutathioneperoxidase(a)andcatalaseactivity(b)inD407cells.
Control;Controlg50Mglucose;LUTLutein10M;LUTgLutein10m+50Mglucose
Statistic:onewayANOVAanalysisofvariance,Tukeytest,p<0.05,*significant,**very
significant,***extremelysignificant.

148

UniversitateadetiineAgricoleiMedicinVeterinarIai

InapreviousstudywedemonstratedthatculturedRPEcellsareabletouptakelutein
andzeaxanthinintherangeof110M(Pinteaetal.,2007).Luteinat10Mconcentration
didnotaffecttheRPEcellsviabilityincontrolorhighglucosetreatedcells(datanotshown)
anddidnotshowanycytotoxiceffectinbothexperimentalconditions(Fig.2).Cellstreatment
with 50 mM glucose induced a small but not significant increase of GPx activity but a small
decrease of catalase activity. Treatment with lutein for 24 h resulted in a very significant
increaseofGPxactivityinbothcontrolandhighglucosecondition.Catalaseactivitywasnot
significantly changed by addition of glucose or glucose and lutein (Fig. 3). It is known that
catalaseactsathighconcentrationofhydrogenperoxidewhileglutathioneperoxidaseactsat
lower level of peroxides. High glucose concentration induced a small but not statistically
significantdecreaseofSODactivity.ThepositiveinfluenceofluteinonSODactivitywasmore
evident in control cells that in high glucose treated cells (Fig. 4a). Lutein in culture medium
determinedaninhibitionoffluorescenceinROSassay,significantinthecaseofhighglucose
treatedcells, demonstrating the ability ofcarotenoids to neutralize the intracellular reactive
oxygenspecies(Fig.4b).TheseresultsarecorrelatedwithadecreaseofMDAconcentrationin
cells treated with lutein at high glucose concentration (Table 1). Reduced glutathione
concentrationwaslowerinhighglucosetreatedcellsthatincontrolcellsbuttherewerenot
significantchangesafteradditionoflutein,bothinnormalandhighglucosesamples(Table4).
Similarresultswereobtainedwerexanthophylls(lutein,zeaxanthinandcryptoxanthin)were
testedinoxidativestressinducedbyadditionofhydrogenperoxideinculturemedium(Pintea
etal,unpublisheddata).

20
SOD U/ mg protein

*
15

ns

10
5

DCF fluorescence

1400
1200
1000

ns

800

600
400
200

g
T
LU

tr
o
on
C

LU
T

l
on
tr
o

Tg
LU

lg
C

on
tr
o

T
LU

l
on
tr
o
C

l-g

0
0

(a)(b)
Fig.4.Superoxidedismutaseactivity(a)andROSgenerationinD407cells.
Control;Controlg50Mglucose;LUTLutein10M;LUTgLutein10m+50Mglucose;
Statistic:onewayANOVAanalysisofvariance,Tukeytest,p<0.05,*significant,**very
significant,***extremelysignificant.

Table1.Lipidperoxidation(TBARS)andreducedglutathione(GSH)

Control
Lutein
Highglucose
Luteinhigh
glucose
TBARS
0.630.09
0.610.07
0.760.12
0.710.07
(nmol/mg
protein)
GSH (nmol/mg
21.23.4
21.53.0
18.42.4
19.42.9
protein)
Valuesaremeanstandarddeviation
149

Lucrritiinificevol53seriaMedicinVeterinar

Diabetes isachronicmetabolicdisordermanifestedbya complexsymptomatology.


Oxidativedamageshavebeenreportedtobeinvolvedinthepathogenesisofdiabetesandof
otherneurodegenerativediseases.Hyperglycemiawhichoccursindiabetesreducesthelevel
ofantioxidantsanddeterminesanincreaseofreactiveoxygenspecieswhich,inturnproduce
oxidativedamagesindifferenttissues,includingretina.Oneofthecomplicationsofdiabetesis
diabetic retinopathy, caused by inefficient control of blood glucose levels. Manifestations of
diabetic retinopathy occur when the retina is exposed to prolonged high glucose level.
DiabeticretinopathyaffectsvirtuallyallsubjectswhosufferfromtypeIdiabetesbyatleast20
yearsand80%ofthosewithtypeIIdiabetesforthesameperiod.Mostoftheeffectsofhigh
glucoseconcentrationareactuallyrelatedtoincreasedmetabolism.Thus,thereisanincrease
in glycolysis, in pyruvate production, and in oxidative phosphorylation. Oxidative
phosphorylationis oneofthephysiologicalprocessesthatgeneratereactiveoxygenspecies.
Furthermore, reactive oxygen species are also produced outside mitochondria, in part by
sorbitol oxidation. It is also considered that oxidative degradation of proteins contributes to
damageofbloodvessels,involvedinthepathogenesisofdiabeticmicroangiopathy(Yokoyama
et al., 2006). Several in vivo studies showed that progression of diabetic retinopathy is
inhibitedbytheuseofantioxidants,byloweringtheleveloflipidperoxidation,ofoxidatively
modified DNA, nitrotyrosine and other markers of oxidative stress (MartinGallan, P., et al.,
2005, Kowluru, RE et al., 2008). However, zeaxanthin did not prevent the decrease in GSH
content intheretinaofdiabeticrats(Kowluru et al.,2008).Luteintreatmentofhealthyand
diabetic mice prevented the oxidative stress induced changes on the lipid peroxidation and
GPxactivityinretinaandhippocampus(Muriachetal.,2006).Luteinwasrecentlyreportedto
prevent cortex lipid peroxidation in streptozotocininduced diabetic rats (Arnal et al., 2010).
Administrationofhigh concentrationsofglucoseintheculturemediumofRPEcells (33mm)
led to an increase of cathepsinB expression, glutathione peroxidase and heat shock protein
27.ForCu/ZnSODtheisoelectricpointshiftedtowardacidicregioninresponsetohighglucose
concentration.Unlikeforotherenzymes,SODactivitywaslowercomparedwithcontrolcells.
TheauthorsconcludedthatRPEcellsrespondtoacutepathologicallyhighglucosebyelevated
expression of antioxidant enzymes (GPX, Hsp27) and proteolytic enzymes (Yokoyama et al.,
2006).Cellsresponddifferentlytoelevatedglucoseconcentrations.CulturedhumanSchwann
cells exposed to high glucose showed an increase in superoxide dismutase and catalase
activity,butadecreaseinreducedglutathioneconcentration(Askwithetal.,2009).

CONCLUSIONS
Weexaminedtheeffectofhighdosesofglucoseontheviabilityandoxidativestatus
ofculturedretinalpigmentepithelialcellsandtheeffectofluteinadditionontheantioxidant
statusofcellscultivatedinnormalandhighglucosemedium.
LuteindidnotshowanycytotoxiceffectonRPEcellsupto10Minculturemedium
and protect them against induced oxidation. Lutein protects RPE cells by quenching the
intracellularROSgeneration,byreducingthelipidperoxidationandbyenhancingtheactivity
of superoxide dismutase and glutathione peroxidase. Addition of lutein did not significantly
influencedreducedglutathioneconcentrationandcatalaseactivity.Increasedconcentrationof
luteininRPEcellscancontributetoantioxidantdefenceinoxidativestressconditions.

Acknowledgements
This work was supported by CNCSISUEFISCSU, PNII IDEI code ID_854, 414/2007. We
gratefullyacknowledgetoProf.Dr.HorstA.DiehlforprovidingtheD407RPEcells.

150

UniversitateadetiineAgricoleiMedicinVeterinarIai

1.

2.

3.

4.
5.

6.

7.

8.
9.

10.
11.

12.

13.
14.

15.

16.
17.

REFERENCES

Arnal, E., Miranda, M., Barcia, J., BoschMorell, F., Romero, F.J., Lutein and
docosahexaenoic acid prevent cortex lipid peroxidation in streptozotocininduced
diabeticratcerebralcortex,Neuroscience,2010,166,271278
Asckwith,T.,Zeng,W.,Eggo,MC,Stevens,MJ,Oxidativestressanddysregulationof
the taurine transporter in highglucoseexposed human Schwann cells: implications
for pathogenesis of diabetic neuropathy, Am J Physiol Endocrinol Metab, 2009,
297(3),620628
BeattyS.,KohH.H.,PhilM., HensonD.,BoultonM.,Theroleofoxidativestressin
the pathogenesis of agerelated macular degeneration, Survey of Ophtalmology,
2000,45,115134
Coleman, H. R., Chan, C. C., Ferris, F. L., 3rd and Chew, E. Y., Agerelated macular
degeneration,2008,Lancet,372(9652):18351845
Khachik F., Bernstein P.S., Garland D.L., Identification of lutein and zeaxanthin
oxidation products in human and monkey retinas, Invest Ophthalmol Vis Sci., 1997,
38(9),18021811.
Kopitz,J.,Holz,F.G.,Kaemmerer,E.,Schutt,F.,Lipidsandlipidperoxidationproducts
in the pathogenesis of agerelated macular degeneration, Biochimie, 2004, 86, 825
831
Kowluru, R.A., Menon, B., Gierhart, D.L., Beneficial Effect of Zeaxanthin on Retinal
MetabolicAbnormalitiesinDiabeticRats,InvestOphthalmolVisSci.,2008,49,1645
1651
Krinsky, N.I., Johnson, E.J., Carotenoid actions and their relation to health and
disease,Molec.Asp.Medicine,2005,26,459516
LeBel C.P., Ischiropoulos, H., Bondy, S.C., Evaluation of the probe 2',7'dichloro
fluorescinasanindicatorofreactive oxygen speciesformationandoxidativestress,
ChemResToxicol,1992,5(2),227231
Lu L., Hacket S.F., Mincey, A., Lai H., Capochiaro P.A., Effects of different types of
oxidativestressinRPEcells,J.CellPhysiol.,2006,206(1),119125
MartnGallan, P., Carrascosa, A., Gussinye, M., Domnguez, C., Estimation of
lipoperoxidativedamageandantioxidantstatusindiabeticchildren:relationshipwith
individualantioxidants,2005,FreeRadic.Res.,39,933942
Miceli M.V., Liles M.R., Newsome, D.A., Evaluation of oxidative processes in human
pigmentepithelialcellsassociatedwithretinaloutersegmentphagocytosis,ExpCell
Res,1994,214(1):242249
MosmannT.,Rapidcolorimetricassayforcellulargrowthandsurvival:applicationto
proliferationandcytotoxicityassays,JImmunolMethods,1983,65(12),5563
Muriach, M., BoschMorell, F., Alexander, G., Blomhoff, G., Barcia, J., Arnal, E.,
Almansa, I., Romero, F.J., Miranda, M., Lutein effect on retina and hippocampus of
diabeticmice,FreeRadicalBiology&Medicine,2006,41,979984
PinteaAdela,DumitriaPreda,CorneliaBraicu,AndreaBunea,CarmenSocaciu,H.A.
Diehl, Lutein and Zeaxanthin uptake in cultured retinal pigmented epithelial cells,
BulletinUSAMVClujNapocaseriesMV,2007,64(12),238243
Qin,S.,Oxidativedamageofretinalpigmentepithelialcellsandagerelatedmacular
degeneration,DrugDevRes,2007,68,213225
Snodderly D.M., Brown P.K., Delori F.C., Auran J.D., The macular pigment. I.
Absorbance spectra, localization and discrimination from other yellow pigments in

151

Lucrritiinificevol53seriaMedicinVeterinar

primateretinas.Invest.Ophtalmol.Vis.Sci.,1984a,25,660673
18. Villarroel,M.,GarciaRamirez,M.,Corraliza,L.,Hernandez,C.,Simo,R.,Effectsofhigh
glucose concentration on the barrier function and the expression of tight junction
proteinsinhumanretinalpigmentepithelialcells,Exp.EyeRes.,2009,89,913920
19. Winkler,B.S.,Boulton,M.E.,Gottsch,J.D.,Sternberg,P.,Oxidativedamageandage
relatedmaculardegeneration,MolVis,1999,5:32
20. Wrona,M.,Rozanowska,M.,Sarna,T.,Zeaxanthinincombinationwithascorbicacid
or alphatocopherol protects ARPE19 cells against photosensitized peroxidation of
lipids,FreeRadic.Biol.Med.,2004,36,10941101
21. Yokoyama, T., Yamane, K., Minamoto, A., Tsukamoto, H., Yamashita, H., Izumi, S.,
Hoppe, G., Sears, J.E., Mishima, H.K., High glucose concentration induces elevated
expressionofantioxidantandproteolyticenzymesinculturedhumanretinalpigment
epithelialcells,Exp.EyeRes.,2006,83,602609

152


ALUMINIUMSULPHATEIMPACTONFUNDAMENTAL
BIOMARKERSOFREPRODUCTIVEFUNCTIONALITYINFEMALE
RATS(SUCKLINGPERIODEXPOSURE)
TRIFALEXANDRA1,DUMITRESCUEUGENIA1,PETROVICISNEJANA1
Correspondingauthor:AlexandraTrif,BanatsUniversityofAgriculturalSciencesand
VeterinaryMedicine,FacultyofVeterinaryMedicine,CaleaAradului,119,300645Timisoara,
Romania,tel.0040256277076,
emai:al_trif@yahoo.coml

Recentresearchesareemphasizingmoreandmoreobvioustheperturbanceofthe
health of the reproductive process, the causes including substances with toxic
potential(industrialcontaminants,pesticides,organicsolvents,etc.)(3).
The studies in the field of reproductive toxicology are of opportunity because in
Romaniathereisprimaryandsecondaryaluminiumindustry,thatrepresentsareal
riskfortheenvironment,animalsandhumanshealth(2).
The aim of the study was the evaluation of aluminium toxic impact on the femele
reproductivesystemintegrity,functionalityandperformancesbiomarkers.
The objectives of the study were evaluation of the reproductive functionality
fundamental biomarkers (duration of sexual cycle and sexual cycle regularity) at
sexual maturity of female offspring exposed to aluminium sulphate only during
sucklingperiod.
Keywords:aluminiumrats,sexualcycles.

MATERIALANDMETHODS

Thestudywascarriedouton32adultfemalerats(90days)exposedtoaluminium
sulphateduringsucklingperiodasfollows:E1:200ppbAl(theexceptionaladmittedlimitin
drinking water according to the Law 485/2002); E2: 400 ppb Al; E3: 1000 ppb Al (values
representing concentrations found out in water sources destinated for animals and,
sometimes, for people, in areas exposed to the risk of aluminium based industrial
contamination).
The exposure to aluminium sulphate was stopped from weaning until sexual
maturity.Controlgroupreceivedtapwater.
Theforagesandwaterhavebeenassuredadlibitum.
Duration of sexual cycle and of sexual cycle stages regularity were appreciatedby
examination of vaginal smear cytological characteristics (stained MayGrunnwaldGiemsa
method,examinatedbyopticmicroscope.X20).
TheresultshadbeenprocessedbyANOVAmethodandStudenttest.
All assays with animals were conduced in accordance with present laws regarding
animalwelfareandethicsinanimalexperiments(5,6,7,8,9,10).

153

Lucrritiinificevol53seriaMedicinVeterinar
RESULTSANDDISSCUSIONS
Theresultsarepresentedintable1,2,andfigures1,2.
Table1.
Meansexualcycleduration(days)
Grou
p
C
E1
E2
E3

XSx

D.S.

C.L.95%

4.890.09
5.610.12
5.960.08
6.140.12

0.23
0.32
0.22
0.31

0.21
0.21
0.21
0.21

Fig.1.Dynamicsofsexualcycleduration(days)

In C group, sexual cycle was in physiological limits 45 days (4), but in exposed
groups,thedurationwassignificantly(p<0.01)higherthanthephysiologicallimits,directly
correlated with the exposure level: E1/C: +14.72%; E2/C: +21.88%; E3/C: +25.56; E2/E1:
+6.23%,p<0.05;E3/E2:+3.02%,p>0.05;E3/E1:+9.44%,p<0.01
InCgroupallsexualcyclestagesrangedinphysiologicallimitsasduration.
Percentage of proestrus in physiological limits was significantly (p<0.01) lower
comparative to C group: E1/C: 1.89%, p<0.05; E2/C:5.24%, p<0.01; E3/C: 6.12%, p<0.01,
and inversely correlated with the exposure level (E2/E1: 3.41%, p<0.01; E3/E2: 0.92%,
p>0.05;E3/E1:4.3%,p<0.01).
Nosexualcyleswithabsentproestruswerereported.
Exposuretoaluminiumdeterminedtheappearanceofsexualcycleswithprolonged
proestrus, increasing significantly (p<0.01), in direct correlation with the exposure level:
E1/C: +93%; E2/C:+257%; E3/C: +300%; E2/E1: +84.97%, p<0.01; E3/E2: 12.04%, p>0.05;
E3/E1:+107.25,p<0.01%.
The percent of sexual cycles with estrus in physiological limits was in E group
significantly(p<0.01)lowerthaninCgroup.inversely.significantly(p<0.01)correlatedwith
theexposurelevel:E1/C:5.57%;E2/C:10%;E3/C:11.43%;E2/E1:4.69%,p>0.05;E3/E2:
1.58%,p>0.05;E3/E1:6.20,p<0.01%.
Exposure to aluminium determined the appearance of sexual cycles with absent
estrusinEgroups:E1/C:5.57%/0%;E2/C:10%/0%;E3/C:11.43%/0%;increasingsignificantly,

154

UniversitateadetiineAgricoleiMedicinVeterinarIai

indirectcorrelationwiththeexposurelevelE2/E1:+79.53%,p<0.01;E3/E2:+14.3%,p<0.05;
E3/E1:+105.2%,p<0.01.
The percent of sexual cycles with diestrus I in physiological limits significantly
decreased (p<0.01) in exposed groups comparative to C group: E1/C: 4%; E2/C:10.54%;
E3/C:13.43%,inverselly,significantly(p<0.01)correlatedwiththeexposurelevel:E2/E1:
6.84%,p<0.01;E3/E2:3.19%,p<0.05;E3/E1:9.82%,p<0.01).
NosexualcyleswithabsentdiestrusIwerereported.
Exposure to aluminium determined the appearance of sexual cycles with
prolonged diestrus I, increasing significantly (p<0.01), in direct correlation with the
exposure level: E1/C: 4%/0%; E2/C:10.57%/0%; E3/C: 13.43%/0%; E2/E1: +164.25%; E3/E2:
+27.05%;E3/E1:+235.75%.
The percent of sexual cycles with diestrus II in physiological limits significantly
decreased (p<0.01) in exposed groups, comparative to C group: E1/C: 6.71%; E2/C:11%;
E3/C: 14.14%, inverselly, significantly (p<0.01) correlated with the exposure level E2/E1:
4.59%;E3/E2:3.52%;E3/E1:7.96%.
NosexualcyleswithabsentdiestrusIIwerereported.
TheprecentofsexualcycleswithprolongeddiestrusIIwassignificantly(p<0.01)
higher in E groups than in C group: E1/C: 6.71%/0%; E2/C:11%/0%; E3/C: 14.14%/0%;
directly, significantly (p<0.01) correlated with exposure level: E2/E1: +63.93%; E3/E2:
+28.54%;E3/E1:+110.73%.

Figure.2.Sexualcyclestagesdynamics

Appearance of anormal sexuale cycles was mentioned by Agrawald et al., (1)


consecutivefemaleexposurefrominuteroperioduntilsexualmaturity.
No data regarding the influence of exposure period, and/ or duration (month,
generations)onsexualecyclecharacteristicswerefound.

155

Lucrritiinificevol53seriaMedicinVeterinar
Table2.Sexualcyclestages(%oftotalsexualcycles)

Nphysiological(asduration)stage
absentstage
Sexualcyclestage
C

Proestrus

Estrus

DiestrusI

DiestrusII

XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L
XSx
S.D.
C.L
XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L:
XSx
S.D.
C.L:

980.44
1.15
0.76
0.000.00
0.00
0.76
2.000.44
1.15
0.76
1000.00
0.00
1.18
0.000.00
0.00
1.18
0.000.00
0.00
1.18
1000.00
0.00
0.89
0.000.00
0.00
0.89
0.000.00
0.00
0.89
1000.00
0.00
0.93
0.000.00
0.00
0.93
0.000.00
0.00
0.93

E1

E2

96.140.51
1.35
0.76
0.000.00
0.00
0.76
3.860.01
0.01
0.76
94.431.57
4.16
1.18
5.570.13
0.13
1.18
0.000.00
0.00
1.18
96.000.53
1.41
0.89
0.000.00
0.00
0.89
4.000.49
1.29
0.89
93.290.68
1.80
0.67
0.000.00
0.00
0.67
6.710.42
1.11
0.67

92.860.63
1.68
0.76
0.000.00
0.00
0.76
7.140.26
0.69
0.76
90.000.79
2.08
1.18
10.000.44
1.15
1.18
0.000.00
0.00
1.18
89.431.11
2.94
0.89
0.000.00
0.00
0.89
10.570.37
0.98
0.89
89.000.31
0.82
0.67
0.000.00
0.00
0.67
11.000.53
1.41
0.67

E3
92.000.44
1.63
0.76
0.000.00
0.00
0.76
8.000.49
1.29
0.76
88.570.87
2.30
1.18
11.430.37
0.98
1.18
0.000.00
0.00
1.18
86.570.53
1.40
0.89
0.000.00
0.00
0.89
13.430.48
1.27
0.89
85.860.40
1.07
0.67
0.000.00
0.00
0.67
14.140.40
1.07
0.67

Pprolongedstage
E1200ppbAl
E2400ppbAl
E31000ppbAl
NB:28supervisedsexualcycles/group(7individuals/groupx4supervisedsexualcycles)

156

UniversitateadetiineAgricoleiMedicinVeterinarIai

CONCLUSIONS

Exposuretoaluminiumsulphateduringsucklingperioddeterminedinfemaleratsat
sexualmaturity:
9 Significantincreaseofsexualcycledurationcomparativetocontrolgroup,over
thephysiologicallimits,andindirectcorrelationtoexposurelevel;
9 Modificationofsexualstagesregularity:
o significantdecreaseofsexualcyclespercentagewithproestrus,estrus,diestrusI
and diestrus II in physiological limits as duration comparative to control group and
inverselycorrelatedwiththeexposurelevel;
o appearance of sexual cycles with absent estrus, directly correlated with the
exposurelevel;
o appearance of sexual cycles with prolonged proestrus, diestrus I and II, directly,
significantlycorrelatedwithexposurelevel.

REFERENCES

1. Agarwal,S.K.,Ayyash,L.,Gourlet,C.S.,Levy,L.,Faber,K.,Hughes,C.L.JR.
Evaluation of the developmental neuroendocrine and reproductive
toxicologyofaluminium.FoodChemToxicol.1996,34:1:4953.
2. Drug Mrioara Aluminiul. Potenialul poluant al industriei de prelucrare
primar i secundar. Impactul asupra organismelor vii, Tez de
doctorat,2005,USAMVBTimioara.
3. GuptaC.Ramesh.,VeterinaryToxicology,2007,Ed.AcademicPressU.S.A.
4. KeiIchiro Maeda., Satoshi Ohkura., Hiroko Tsukamura., Physiology of
Reproduction,AcademicPress,Japan,2000,pp.145456;
5. ***Directiva86/609Din24.11.1986privindproteciaanimalelorutilizaten
scopuri
experimentale
i
n
alte
scopuri
tiinifice,
http://ec.europa.eu/food/fs/aw/aw_legislation/scientific/86609
eec_en.pdf;
6. ***Legea 205/26.05.2004 privind protecia animalelor, M. O. nr.
531/14.06.2004;
7. ***Legea 206/27.05.2004 privind buna conduit n cercetarea tiinific,
dezvoltareatehnologiciinovare,M.O.nr.505/4.06.2004;
8. ***Legea 471/9.07.2002 privind aprobarea O.G. nr. 37/2002 pentru
protecia animalelor folosite n scopuri tiinifice sau n alte scopuri
experimentale,M.O.nr.535/23.07.2002;
9. ***Legea 9/11.01.2008 pentru modificarea i completarea Legii nr.
205/2004privindproteciaanimalelor,M.O.nr.29/15.01.2008;
10. ***Ordin 143/400 pentru aprobarea instruciunilor privind adpostirea i
ngrijirea animalelor folosite n scopuri tiinifice sau n alte scopuri
experimentale,M.O.nr.697/24.09.2002;

157


IMPROVEMENTOFGLUCOSECONCENTRATION,LIPOPROTEIN
PROFILEANDANTIOXIDANTBIOMARKERSINBLOODOF
NATURALLYDIABETICBITCHESADMINISTEREDINSULINWITH
VITAMINCORVITAMINE
a

WaelM.ELDeeb ,S.M.El Bahr

(Correspondingauthor)
Departmentofclinicalstudies,CollegeofVeterinaryMedicineandanimalResources,King
FaisalUniversity,SaudiArabia,AlAhsa,31982
P.O.Box:1757
email:drwaeleldeeb@yahoo.com
b
DepartmentofPhysiology,BiochemistryandPharmacology,CollegeofVeterinaryMedicine
andanimalResources,KingFaisalUniversity,SaudiArabia,AlAhsa,31982

Abstract
ThepresentworkaimedtodetermineifvitaminCorEhasanyadvantageoverinsulintherapy
on glucose concentration, lipoprotein profile, antioxidant activity and lipid peroxidation in
naturallydiabeticbitches.Therefore,fortybitchesweredividedintofourgroups(10bitchesin
each). The first and second groups were served as non diabetic and diabetic control group,
respectively. Dogs of group 2 were divided to 3 groups (10 animals each) and subjected to
differentthreetreatmentprotocolsnamelygroup3,4and5whichtreatedwithinsulin,insulin
andascorbicacid,andinsulinandvitaminE,respectively.Valuesofbloodglucose,serumtotal
cholesterol,lowdensitylipoproteincholesterol(LDLc)andhighdensitylipoproteincholesterol
(HDLc) were determined. In addition, the enzymatic activities of superoxide dismutase (SOD),
catalase(CAT)andglutathioneperoxidase(GPX)andthevaluesofmalondialdehyde(MDA)were
measured in erythrocyte hemolysate as biomarkers of antioxidation. Results revealed that, in
diabetic bitches, the values of glucose, total cholesterol, LDLc and MDA were significantly
increasedascomparedtonondiabeticbitches.SOD,CAT,andGPXactivitiesandHDLcvaluesof
diabeticbitchesweresignificantlydecreasedascomparedtonormalbitches.Indiabeticbitches,
supplementation of examined dose of vitamin C or vitamin E with insulin was effective in
inhibiting hyperglycaemia, hypercholesterolemia, oxidative stress and lipid peroxidation than
insulinalone.Theseeffectswerealmostthesamewhateverthevitaminused.
Keywords:Diabetesmellitus,lipoproteins,oxidativestress,vitaminC,vitaminE,bitches

1.

INTRODUCTION

Diabetes mellitus (DM) is the most common metabolic disease. It is more likely that
longterm,uncontrolledDMwithsustainedhighbloodglucoselevelsisthecauseofglucose
autooxidation with increased oxidative stress (Sozmen et al., 2005). Overproduction of
reactiveoxygenspecies(ROS)throughtheelectrontransportchainhasbeendemonstratedin
DM.Lipidperoxidationisanimportantbiologicalconsequenceofoxidativecellulardamagein
patientswithDM.Serumlipoperoxidationproductssuchasmalondialdehyde(MDA)reflects
oxidativestress.

158

Lucrritiinificevol53seriaMedicinVeterinar
The increase in ROS causes nonspecific modification of nucleic acids, proteins, and
phospholipids leading to DNA, RNA, and protein damage and alterations in antioxidant
enzymelevels.Alltheseeventsresultincellularandtissuedamage.Tissuedamageinduced
by free radicals is thought to be an important factor in the pathogenesis of DM and its
complications (Annunziata et al., 2005). Experimentally, streptozotocin (STZ) induces DM,
probably through the generation of ROS, leading to islet cell destruction (Tavridou et al.,
1997). Living organisms possess antioxidant defense systems against ROS. These defense
systemsincludeendogenantioxidants,whichcanbeclassifiedasenzymatic(SOD,GSH)and
nonenzymatic(vitaminE,vitaminC,uricacid,bilirubin)defensesystem.OnceROSformed,it
depletes antioxidant defense systems, rendering the affected cells and tissues more
susceptibletooxidativedamage.
Dogsarebecominganimportantmedicalresearchmodelbecauseitsharesthesame
environmentashumansanddevelopsmanyofsimilarchronicdiseases(Kearnsetal.,1999,
andAdamsetal.,2000).Muchoftheirbiochemicalandendocrinemechanismsaresimilarto
humans (Kararli, 1995, and Felsburg, 2002). DM is one of the most frequently diagnosed
endocrinopathies in cats and dogs. Type 1 diabetes mellitus (insulin dependent diabetes) is
most common in dogs (Expert Committee on the Diagnosis and Classification of Diabetes
Mellitus,1997).Atpresent,therearenointernationallyacceptedcriteriafortheclassification
ofcaninediabetes.Nolaboratorytestisreadilyavailabletoidentifytheunderlyingcauseof
diabetes in dogs, and diagnosis is generally made late in the disease course. If the criteria
establishedforhumandiabetesareappliedtodogs,atleast50%ofdiabeticdogswouldbe
classifiedastype1,becausethisproportionhasbeenshowntohaveantibodiesagainstcells
(HoenigandDawe,1992;Davisonetal.,2003).
Thebalancebetweenoxidantandantioxidantspecieshasbeenproposedtohavean
importantroleinpreventingdiabeticcomplications.Dietaryantioxidantsplayamajorrolein
the maintenance of the oxidative balance. Vitamin C, vitamin E, and other micronutrients
protect humans DM (Schwedhelm et al., 2003). Numerous studies have demonstrated that
antioxidantvitaminsandsupplementscanhelplowerthemarkersindicativeofoxidantstress
and lipid peroxidation in diabetic subjects and animals. A number of studies have reported
vitamin C, vitamin E and betacarotene deficiency in diabetic patients and experimental
animals(Penckofer,etal.,2002;NazirogluandButterworth2005).
To our knowledge, up till now, the publications concerning the effect of insulin
combined with vitamin C or E in diabetic bitches are not available. Therefore, the present
studyaimedtodeterminetheeffectofcombinedadministrationofinsulinwithvitaminCor
vitamin E on glucose concentration, lipoproteins profile and oxidative stress markers in
naturallydiabeticbitches.

2. MATERIALSANDMETHODS

2.1.Animals
A total of 40 bitches (58 years old) were used in the present study. They were
maintained as performed by national guidelines and protocols, approved by the University
AnimalEthicsCommittee.Theyweredividedintofourgroups.Bitchesofthefirstgroup(10
animals) were non diabetic and served as a control non diabetic group (positive control;
group1).Bitchesofthesecondgroup(30animals)werediagnosedasdiabeticandservedas
control diabetic group (negative control; group II). This group (group 2) was divided to 3
groups (10 animals each) and subjected to different three treatment protocols. For simple
presentation these groups were named group 3, 4 and 5. Bitches of the third group were
159

UniversitateadetiineAgricoleiMedicinVeterinarIai
treated with insulin in a dose rate of 0.5 unite/kg body weight twice daily. Bitches of the
fourthgroupweretreatedwithinsulininadoserateof0.5unite/kgbodyweighttwicedaily,
and ascorbic acid supplementation in a dose rate of 30 mg/kg body weight and once daily
(Morgan, 2008). Bitches of the fifth group were treated with insulin in a dose rate of 0.5
unit/kgbodyweightandvitaminEsupplementationinadoserate800IUoncedaily(Morgan,
2008). The insulin dose was stabilized over the time of the experiment. All experimental
groupswerepresentedinFigure1.
2.2.Samplingprotocol
Fastingbloodsamplewascollectedonemonthposttreatmentfromthecephalicvein
from all groups in fresh heparinized vials containing sodium fluoride for the estimation of
glucose.Somebloodsampleswereusedforpreparationofserumfordeterminationoftotal
cholesterol, LDLc and HDLc. In addition, the activities of super oxide dismutase (SOD),
Catalase (CAT), Glutathion peroxidase (Gpx) and Malondialdehyde (MDA) in erythrocyte
hemolysatewerealsodetermined.
From ethical point of view, samples were taken from 10 animals of the group II and
served as a diabetic control samples. Afterwards all group II as mentioned before were
treated by different examined drugs. This has been done to run the experiment without
deprivinganydogsoftreatment.

2.3.Preparationofhemolysate
Aftercollectingbloodsamplesinheparinizedtubes,centrifugationwasperformedat
1000g for 15 min to remove the buffy coat. The packed cells obtained at the bottom were
washedthricewithphosphatebuffersaline(0.9%NaClin0.01Mphosphatebuffer,pH7.4).
Erythrocyteswerelysedwithhypotonicphosphatebuffer.Thehemolysatewasobtainedafter
removingthecelldebrisbycentrifugationat3000gfor15minandusedfordeterminationof
super oxide dismutase (SOD), Catalase (CAT), Glutathion peroxidase (Gpx) and
Malondialdehyde(MDA).

2.4.Determinationofglucoseandlipoproteinprofile
BloodglucosewasestimatedbythemethodofDubowskiasmodifiedbySasakietal.,
(1972).Bloodwastreatedwith10%trichloroaceticacid,mixedandcentrifugedat1000gfor
10min;theproteinfreesupernatantwasthentreatedwithorthotoludinereagentandkeptin
aboilingwaterbathfor10min.Thecolordevelopedwasreadusingspectrophotometeratan
absorbance of 640 nm. Enzymatic method of spinreact kits was used for colorimetric
determination of serum total cholesterol (Zak et al., 1954) according to the manufacturer
instructions. Briefly, the spectrophotometer was adjusted to zero by distilled water.
Afterwards,incleananddryseparatetesttubes,10lofserumandstandardofcholesterol
wereaddedto1mloftheirworkingsolutions.However,theblankwaspreparedbyadding1
mloftheworkingsolutioninaseparatetube.Aftermixing,themixturewasincubatedfor5
minutes at 37 C and the developed colour was measured colorimetrically against blank at
wavelengthof505nm.Thevalueofcholesterol(mg/dl)werecalculatedbydividingthevalue
oftheabsorbanceoftheserumsampleonthatofthestandardandtheresultantvaluethen
multiplied by 200 (Standard concentration). Detection limit was ranged from 0.6 to 600
mg/dl.However,thesensitivitywas1mg/dl.Enzymaticmethodofspinreactkitwasusedalso
forcolorimetricdeterminationofserumHDLc(LopesVirellaetal.,1977).Briefly,1mlofthe
serumwasaddedto100loftheprecipitatingreagent.Aftermixing,themixtureallowedto
stand for 10 minutes at room temperature. After centrifugation (3000g/20 minutes), the
supernatant was collected and the cholesterol value was estimated as mentioned above.
160

Lucrritiinificevol53seriaMedicinVeterinar
Detection limit was ranged from 1.57 to 275 mg/dl and the sensitivity was 1 mg/dl. VLDLc
wascalculatedbydivisionofTAG/5mg/dlwhiletheLDLcwascalculatedastotalcholesterol
(HDLc+VLDLc)=mg/dl(Bauer,1982).

2.5.DeterminationofAntioxidantenzymes
ActivityofsuperoxidedismutaseSOD(inhibitionratepercent)wasassayedintheRBC's
cellasdescribedbyNishikimietal.(1972)usingcommercialavailablekits(Biodiagnostic,Kit
numberSD2520).TheactivityofcatalasewasassayedintheRBC'scellbythemethodofAebi,
(1984)usingcommercialavailablekits(Biodiagnostic,KitnumberCA2516).Theactivityofthe
enzyme was expressed as units/mg of haemoglobin. Glutathione peroxidase (GPx)
(EC.1.l1.1.l9) was assayed by the method of Rotruck et al. (1973). The hemolysate were
preparedinTrisHClbuffer(pH7.0,0.4M).TheassaymixturecontainedEDTA,sodiumazide
(10 mM), reduced glutathione (GSH 0.2 mM), and H2O2 (0.2 mM) and the appropriately
diluted enzyme preparation. A system devoid of enzyme served as the control. The activity
wasdeterminedbymeasuringtheamountofGSHconsumedaftercarryingoutthereaction
for10minutes.

2.6.Determinationoflipidperoxidation
Lipid peroxidation was assayed by the measurement of MDA levels on the base of
MDA reacted with thiobarbituric acid at 532 nm, according to Ohkawa et al. (1979) using
commerciallysuppliedkits(Biodiagnostic,KitnumberMD2529).

2.7.Statisticalanalysis
Theobtaineddataofbiochemicalparameterswerecomparedbetweengroupswithin
different concentrations by using computer package of the statistical analysis system (SAS,
1997).Alldataarepresentedasmeansstandarddeviation(SD).

3. RESULTS

ThedatasummarizedinTable1showedthelevelofbloodglucose,totalcholesterol,
LDLcandHDLcinthecontrolandexperimentalBitches.Bloodglucoselevelininsulintreated
bitches (Groups 3) was significantly increased than the normal value noted in the control
bitches whereas its concentration in insulinvitamin C and insulinvitamin E treated bitches
(Groups4and5respectively)werecomparabletothecontrolgroup.However,bloodglucose
levelindiabeticbitches(Group2)wassignificantly(p<0.01)higherthancontrolandtreated
groups.Administrationofinsulin,insulinwithvitaminCandinsulinwithvitaminEtodiabetic
bitches decreased blood glucose level significantly compared to the diabetic animals not
getting either compound. Administration of insulin with vitamins (C or E) was found to be
moreeffectiveinloweringbloodglucoselevelthaninsulinadministeredalone.
Serum total cholesterol values in insulin, insulinvitamin C and insulinvitamin E
(Groups3,4and5respectively)treatedbitchesweresignificantlyincreasedthanthenormal
values noted in the control bitches whereas its concentration in diabetic bitches (Group 2)
wassignificantly(p<0.01)higherthancontrolandtreatedgroups.Administrationofinsulin,
insulin with vitamin C and insulin with vitamin E to diabetic bitches decreased the levels of
total cholesterol concentrations significantly compared to the diabetic animals not getting
eithercompound.AdministrationofinsulinwithvitaminCwasfoundtobemoreeffectivein
lowering total cholesterol value followed by administration of insulin with vitamin E and
finallyinsulinadministeredalone.
161

UniversitateadetiineAgricoleiMedicinVeterinarIai
LDLc level in insulin treated bitches (Groups 3) was significantly increased than the
normalvaluenotedinthecontrolbitcheswhereasitsconcentrationininsulinvitaminCand
insulinvitamin E treated bitches (Groups 4 and 5 respectively) were comparable to the
controlgroup.However,LDLclevelindiabeticbitches(Group2)wassignificantly(p<0.01)
higherthancontrolandtreatedgroups.Administrationofinsulin,insulinwithvitaminCand
insulinwithvitaminEtodiabeticbitchesdecreasedLDLclevelsignificantlycomparedtothe
diabeticanimalsnotgettingeithercompound.Administrationofinsulinwithvitamins(CorE)
wasfoundtobemoreeffectiveinloweringLDLclevelthaninsulinadministeredalone.
The concentration of serum HDLc in bitches treated with insulin (Groups 3) was
significantly (p < 0.01) lower than that of the control bitches whereas the concentration in
insulinvitamin C and insulinvitamin E treated bitches were comparable with the control
group.TheconcentrationofserumHDLcindiabeticbitches(Group2)wassignificantly(p<
0.01)lowerthanthatofthecontrolandtreatedgroups.Administrationofinsulin,insulinwith
vitamin C and insulin with vitamin E to diabetic bitches increased the levels of HDLc
concentrations significantly compared to the diabetic animals not getting either compound.
Administration of insulinwith vitamins (Cor E) was found tobe moreeffective in elevating
HDLclevelthaninsulinadministeredalone.
ThedataofTable2includedtheactivitiesofSOD,CAT,GpxandvalueofMDAinthe
erythrocytehemolysateofcontrolandexperimental Bitches.TheactivitiesofSOD,CATand
Gpxinbitchestreatedwithinsulin,insulinwithvitaminCandinsulinwithvitaminE(Groups3,
4and5respectively)werelowerthanthecontrolbitches.TheactivitiesofSOD,CATandGpx
in the hemolysate were lowered significantly (p < 0.01) in diabetic bitches (Group 2)
compared to the control (Group 1). Administration of insulin, insulin with vitamin C and
insulinvitamin E simultaneously elevated the activities of these enzymes in the erythrocyte
hemolysate of the diabetic bitches. However, insulin administered either with vitamin C or
vitaminEwasfoundtobemoreeffectiveinelevatingthevaluesofexaminedenzymesthan
thatofinsulinadministeredalone.
ThevalueofMDAininsulintreatedbitches(Groups3)wassignificantlyincreasedthan
thenormalvaluenotedinthecontrolbitcheswhereasitsconcentrationininsulinvitaminC
andinsulinvitaminEtreatedbitches(Groups4and5respectively)werecomparabletothe
controlgroup.However,MDAvalueindiabeticbitches(Group2)wassignificantly(p<0.01)
higherthancontrolandtreatedgroups.Administrationofinsulin,insulinwithvitaminCand
insulinwithvitaminEtodiabeticbitchesdecreasedMDAvaluesignificantlycomparedtothe
diabeticanimalsnotgettingeithercompound.Administrationofinsulinwithvitamins(CorE)
wasfoundtobemoreeffectiveinloweringMDAvaluethaninsulinadministeredalone.

4. DISCUSSIONANDCONCLUSION

Several features appear in DM including an increase in lipid peroxidation (Naziroglu


andSqimsek2004;Gumieniczek,2005),alterationoftheglutathioneredoxstate,adecrease
in the content of individual natural antioxidants, and finally a reduction in the antioxidant
enzyme activities. These changes suggest an oxidative stress caused by hyperglycemia
(Chaudhry et al., 2007). Many defense mechanisms are involved in against oxidative stress.
Among these mechanisms, antioxidants such as ascorbic acid (vitamin C) and atocopherol
(vitamin E) play the role of a freeradical scavenger (Karaoz et al., 2002; Naziroglu and
Sqimsek2004;TuckerandTownsen2005).
Thepresentresultsshowedthat,administrationofinsulin,insulinwithvitaminCand
insulin with vitamin E resulted in significant changes in the concentration of blood glucose,
162

Lucrritiinificevol53seriaMedicinVeterinar
totalcholesterol,LDLc,HDLc,SOD,CAT,GpxandMDA.Literatureinformationindicatesthat
naturaldiabeticdogsarehyperglycemicandhaveincreasedoxidativestress(Comazzietal.,
2002). Observations in this study also correlate well with the previous research findings, in
that the blood glucose levels were elevated significantly in diabetic bitches (Comazzi et al.,
2002). There were marked fall in the blood glucose concentration of diabetic bitches
administered insulin alone or in combination with either vitamin C or E. The better
hypoglycaemiceffectofinsulinadministeredwithvitaminsthanthatofinsulinaloneperhaps
attributedtooneoftwopossibilities.Thefirstpossibilityisthat,supplementationofvitamins
increased the antioxidant enzymes expressions and/or activities. Although pancreatic beta
cell loss in diabetes is probably due to an autoimmune response, ROS produced during
inflammation are considered as a predisposing factor, and increased mitochondrial ROS
production during hyperglycemia may be central to much of the pathology of diabetes
(KowluruRenuetal.,2006;Nobuyoetal.,2006;Wagneretal.,2007).Thesecondpossibilityis
that,supplementationofvitaminsinactivatesthecirculatingfreeradicalsthatquenchnitrous
oxidebeforeitreachespancreaticbetacells,whereinducedtheirdamageand/ordeath(Vina
etal.,2006).
ThereportedincreasedleveloftotalcholesterolandHDLcindiabeticbitchescomesin
agreement with previous studies (Betteridge, 1994; Naziroglu, et al., 2004). Studies have
shown that increased plasma triglyceride and cholesterol levels may be a risk factor for
vasculardisease(KamataandYamashita1999;Kamataetal2001;Shaharetal.,2003).Also
oxidative modification of LDL is an important step in the development of atherosclerosis
(Felmeden et al., 2003). This oxidation is initiated and propagated by free radicals where
antioxidantsbecomedepleted(YoungandWoodside,2001;Kaviarasanetal.,2005).
Inthisstudy,vitaminCorEwhensupplementedwithinsulinsignificantlyreducedlipid
profileindiabeticbitchescomparedtoinsulintreateddiabeticbitches.Thisimprovementin
lipidprofileinthepresentstudyissupportedbypreviousstudiesthatvitaminC(Andersonet
al., 1999; Kurowska et al., 2000) prevents oxidation of LDLcholesterol; decreases total and
LDLcholesterol and triglyceride; and also raises HDLcholesterol level. The superiority of
administration of insulin with vitamins than insulin alone reflected the protective effect of
vitamins against atherogenic properties of insulin. This was underlined by the reported
incrementofHDLcintherespectivegroups.
ThepossibleexplanationforthehypocholesterolaemiceffectofvitaminCandvitamin
E is that they prevents LDLcholesterol from oxidative damage and aids in degradation of
cholesterol.Secondly,ithasbeensuggestedthatthesevitaminsareneededbytheenzymein
the first step of bile acid synthesis (cholesterol 7hydroxylase) by directing cholesterol
towardsbileacidsynthesisandreducesitslevelinserum(Whiteetal.,1994).Kaviarasanet
al.(2005)reportedthatleveloftotalcholesterol,triglyceride,lipidperoxidationandglucose
increased in hyperlipidemic patients with DM whereas there was decreased plasma
concentration of vitamin C, E and other antioxidants. Taking the above evidence together
suggestthatvitaminCandEsupplementationimprovesthelipidprofileofdiabeticbitchesby
acting through cholesterol 7hydroxylase to direct cholesterol into bile synthesis.
Furthermore, by scavenging free radicals it decreases oxidative damage to oxidized LDL
cholesterol.
Thesignificant(p<0.01%)decreaseintheactivityofantioxidantenzymes,SOD,CAT
andGpxindiabeticbitches(Table2)areagreewiththepreviousresultsinrats(Kedziora,et
al.,2000;Vessby,etal.,2002).Theauthorsreportedthat,antioxidantcapacityinplasmaof
type 1 diabetic rats was shown to be lower than that of the normal animals, and they
returnedthisreductiontodecreasedactivityofantioxidantenzymes.
163

UniversitateadetiineAgricoleiMedicinVeterinarIai
The present work demonstrated a potential and beneficial effect of combined
administration of insulin either with vitamin C or E in attenuating oxidative stress and
enhancingthebodysownantioxidantdefensesindiabeticbitcheswithestablishedoxidative
stress. As tabulated in the result section, most of the evaluated parameters exhibited a
significantrestorationwhichwascomparabletothatofnormalcontrol.Inthecontrary,the
enzymatic antioxidants and cell damages as reflected on MDA value in erythrocyte
hemolysateremainedsignificantlyalteredinthediabeticcontrolbitches.
The antioxidant enzymes Gpx, CAT and SOD are known to be inhibited in diabetes
mellitus as a result of nonenzymatic glycosylation and oxidation. The positive impact of
treatment of DM using vitamins (C and E) on these enzymes observed in the present study
couldbeexplainedbytwopossiblemechanisms.First,theantioxidativeeffectofvitaminsC
or E perhaps prevent further glycosylation and peroxidation of proteins by interacting with
freeradicalsminimizingtheirseriouseffects.Second,vitaminCorEmayinducetheprotein
synthesis of these enzymes, which explains the observed elevated activity after treatment.
The present results come in accordance with the previous researches (Vina et al., 2006;
Borrasetal.,2005;PawlowskaGoraletal.,2002;VimalandDevaki2004).Theauthorsfound
that polyphenolic substances such as estrogens, flavonoids and vitamins increased the
expressionofSODandGPXenzymesatthetranscriptionallevel.Inconclusionofthissection,
treatmentofdiabeticbitchesinthisstudywithvitaminsCor Ewiththemaindrug(insulin)
showedasignificantrestorationinthelevelsofSOD,CAT,andGPXactivity.
Although several criteria are without doubt required to adequately describe a
biomarker,theentirebasisofthebiomarkeristhemeasurementofcompoundthatdirectly
reflects certain biological events related to pathogenesis of a disease or condition
(Lykkesfeldt,2007).ThustherationalofMDAasabiomarkerreliesboththatitisderivedfrom
lipid peroxide, that changes in lipid oxidation levels reflects the changes in MDA
concentration.
Thesignificant(p<0.01%)increasedlevelofMDAindiabeticbitches(Table2)inthis
studyreflectedtheincreasedlipidperoxidationduetodiabetes.Thisprinciplewaspreviously
observed by Rahimi et al. (2005) who approved the increases in lipid peroxidation were
usuallyaccompanieddiabeticpatient.Numerousstudieshavedemonstratedthatantioxidant
vitaminsandsupplementscanhelpinloweringthemarkers indicativeofoxidantstressand
lipidperoxidationindiabeticsubjectsandanimals(Nazirogluetal.,2005andPenckofer,etal.,
2002).
In the present study, we observed that vitamin C or vitamin E supplementation to
diabeticbitchesimprovedthelipidperoxidationprocessascomparedwithdiabeticcondition
asappearedinthesignificant(p<0.01%)reductioninthelevelsofMDAasoxidativedamage
biomarker(Table2).AlsoweobservedthemoreobviousreductionofMDAlevelsininsulin
vitaminstreatedgroupthaninsulingroup.Theseresultscouldbeexplainedbytheprevious
observationofNazirogluetal.,(2005)whofoundthat,vitaminCisshowntobeanimportant
antioxidant, to regenerate vitamin E through redox cycling, and to raise intracellular
glutathione levels. Thus vitamin C plays an important role in protein thiol group protection
againstoxidation.Ithasbeenproposedthat,VitaminCrecyclesVitaminEbyanonenzymatic
reaction. AdditionalinteractionshavebeenalsoreportedbetweenvitaminCandvitaminE.
VitaminCisassociatedwiththerecyclingofanimportantcellularantioxidant,theglutathione
andfunctionswithitasaredoxcouple(Winkleretal.,1994).Glutathioneisalsoinvolvedin
therecycling of VitaminEbyanenzymaticmechanism (McCay,1985; Chan,1993).Another
possibilityisthat,supplementationofvitamin(CandE)inactivatesthecirculatingfreeradicals

164

Lucrritiinificevol53seriaMedicinVeterinar
thatquenchNObeforeitreachespancreaticbetacells,whereinducedtheirdamageand/or
death(Vinaetal.,2006).
The current study indicated that, administration of the examined dose of either
vitamin C or vitamin E with insulin were effective in inhibiting hyperglycaemia,
hypercholesterolemia,oxidativestressandlipidperoxidationthaninsulinalone.Theseeffects
werealmostthesamewhateverthevitaminused.

5.REFERENCES

5. Adams,B.,Chan,A.,Callahan,H.,Siwak,C.,Tapp,D.,IkedaDouglas,C.,Atkinson,P.,Head,E.,
Cotman, C.W., Milgram, N.W., 2000. Use of a delayed nonmatching to position task to
modelagedependentcognitivedeclineinthedog.Behav.Brain.Res.108,4756.
6. Aebi,H.,1984.MethodsEnzymol105,121126.
7. Anderson J W, Gowri M S and Turner J. 1999. Antioxidant supplementation effects on low
densitylipoproteinoxidationforindividualswithtype2diabetesmellitus;J.Am.Coll.Nutr.
18,451461
8. Annunziata L, Domenico F, Pietro T. 2005. Glycooxidation in diabetes and related diseases.
ClinChimActa;2:23650.
9. Bauer, J.D., 1982, Clinical laboratory methods 9th ed, The C.V. Company II 1830, Westline
industrial,Missouri,Chap.33.
10. BetteridgeD.J.1994.Diabeticdyslipidemia;Am.J.Med.(Suppl.6A)96,255315.
11. BorrasC.,GambiniJ.,GomezCabreraM.C.,SastreJ.,PallardoF.V.,MannG.E.,etal.2005.
17oestradiol upregulates longevityrelated, antioxidant enzyme expression via the ERK1
andERK2[MAPK]/NFkBcascade.AgingCell;4:1138.
12. Chan A.C. 1993. Partnersindefense, vitmian E and vitamin C. Can. J.Physiol. Pharmacol.
71:725731
13. Chaudhry J, Ghosh NN, Roy K, Chandra R. 2007. Antihyperglycemic effect of a
thiazolidinedione analogue and its role in ameliorating oxidative stress in alloxaninduced
diabeticrats.LifeSci.;80:113542.
14. Comazzi, S., Paltrinieri, S., Spagnolo, V., Sartorelli, P. 2002. Some aspect of erythrocyte
metabolismininsulintreateddiabeticdogs.ResearchinveterinaryScience,72.2327
15. Davison,L.J.,Herrtage,M.E.,Steiner,J.M.,Williams,D.A.&Catchpole,B.,2003.Evidence
ofantiinsulinautoreactivityandpancreaticinflammationinnewlydiagnoseddiabeticdogs.
J.Vet.Intern.Med.17:395(abs.).
16. ExpertCommitteeontheDiagnosisandClassificationofDiabetesMellitus.1997.Reportof
the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes
Care20:11831197.
17. Felmeden D C, Spencer C G, Blann A D, Beevers D G and Lip G Y 2003 Lowdensity
lipoproteinsubfractionandcardiovascularriskinhypertension:Relationshiptoendothelial
dysfunctionandeffectsoftreatment;Hypertension41,528533.
18. Felsburg,P.,2002.Overviewofimmunesystemdevelopmentinthedog:comparisonwith
humans.HumanExp.Toxicol.21,487492.
19. Gumieniczek A. 2005. Effects of pioglitazone on hyperglycemiainduced alterations in
antioxidative system in tissues of alloxantreated diabetic animals. Exp Toxicol Pathol;
56:3216.
20. Hoenig, M. & Dawe, D., 1992. A qualitative assay for beta cell antibodies. Preliminary
resultsindogswithdiabetesmellitus.Vet.Immunol.Immunopathol.32:195203.
21. KamataK.andYamashitaK.1999.Insulinresistanceandimpairedendotheliiumdependent
renalvasodilationinfructosefedhypertensiverats;Res.Commun.Mol.Pathol.Pharmacol.
103,195200

165

UniversitateadetiineAgricoleiMedicinVeterinarIai
22. Kamata K., Kanie N, and Inose A. 2001. Mechanisms underlying attenuated conntractile
respoonse of aortic rings to noradrenaline in fructosefed mice; Eur. J. Pharmacol. 428,
241249
23. KaraozE,GultekinF,AkdoganM,OncuM,GokcimenA.2002.Protectiveroleofmelatonin
andacombinationofvitaminCandvitaminEonlungtoxicityinducedbychlorpyrifosethyl
inrats.ExpToxicolPathol.;54:97108.
24. Kararli,T.,1995.Comparisonofthegastrointestinalanatomy,physiology,andbiochemistry
ofhumansandcommonlyusedlaboratoryanimals.Biopharm.DrugDispos.16,351380.
25. Kaviarasan K., Arjunan M. M., and Pugalendi K. V. 2005. Lipid profile, oxidantantioxidant
statusandglycoproteincomponentsinhyperlipidemicpatientswith/withoutdiabetes;Clin.
Chim.Acta362,4956.
26. Kearns,R.,Hayek,M.,Turek,J.,Meydani,M.,Burr,J.,Greene,R.,Marshall,C.,Adams,S.,
Borgert,R.,Reinhart,G.,1999.Effectofage,breedanddietaryomega6(n6):omega3(n
3) fatty acid ratio on immune function, eicosanoid production, and lipid peroxidation in
youngandageddogs.Vet.Immunol.Immunopathol.69,165183.
27. KedzioraKornatowska KZ, Luciak M, Paszkowski J. Lipid peroxidation and activities of
antioxidantenzymesinthediabetickidney:Effectoftreatmentwithangiotensinconvertase
inhibitors.IUBMBLife2000;49:30330.
28. Kowluru Renu A, Kowluru Vibhuti, Xiong Ye, Ho YeShih. 2006. Overexpression of
mitochondrial superoxide dismutase in mice protects the retina from diabetesinduced
oxidativestress.FreeRadicBiolMed.;41:11916.
29. KurowskaE.M.,SpenceJ.D.,JordanJ.,WetmoreS.,FreemanD.J,PicheLAandSerratore
P. 2000. HDLcholesterolraising effect of orange juice in subjects with
hypercholesterolemia;Am.J.Clin.Nutr.72,10951100
30. LopesVirella,M.F.,Stone,P.,Ellis,S.,andColwell,J.A.,1977."Cholesteroldeterminationin
highdensitylipoproteinsseparatedbythethreedifferentmethods,"Clin.Chem.,23(5),pp.
882884.
31. Lykkesfeldt, J., 2007. Malondialdehyde as biomarker of oxidative damageto lipids caused
bysmoking.ClinicaChimicaActa380,5058.
32. McCayP.B.1985.VitaminE:interactionswithfreeradicalsandascorbate.Annu.Rev.Nutr.
5:323340,27.
33. MorganV.2008.HandbookofSmallAnimalPractice.The5thedition.SAUNDERS,Printedin
theUnitedStatesofAmerica.
34. NazirogluM,SqimsekM.2004.Effectsofhormonereplacementtherapywithoralvitamin
CandEonplasmathyroidhormonelevelsinpostmenopausalwomenwithtype2diabetes.
BiomedPharmacother.
35. Naziroglu M, Butterworth P., 2005. Protective effects of moderate exercise with dietary
vitamin C and E on blood antioxidative defense mechanism in rats with streptozotocin
induceddiabetes.CanJApplPhysiol.30(2):17285.
36. Nishikimi, M., Appaji N., and Yogi. K. 1972. The occurrence of superoxide anion in the
reaction of reduced phenazine methosulfate and molecular oxygen. Biochem. Bioph. Res.
Commn.46(2),849854.
37. Nobuyo, M., Frei Balz, Heinecke Jay W. Vitamin C fails to protect amino acids and lipids
fromoxidationduringacuteinflammation.FreeRadicBiolMed2006;40:1494501.
38. Ohkawa,H.;Ohishi,w.andYagik,1979.Annal;.Biochem.;95,351
39. PawlowskaGoralK.,KuszE.,WardasM.,DamekE.andWardasP.2002.Theresultsofthe
interference of nitrates and vitamin E in the metabolism in the connective tissue of rats
liver.ExpToxicolPathol.;54:14750.
40. Penckofer,S.,Schwertz,D.,Florczak,K.,2002.Oxidativestressandcardiovasculardiseasein
type2diabetes:theroleofantioxidantsandprooxidants.JCardiovascNurs.16(2):6885.
41. Rahimi R., Nikfar S., Larijani B. and Abdollahi M. 2005. Dossier: Antioxidants in the
preventionofhumandiseases.Areviewontheroleofantioxidantsinthemanagementof
diabetesanditscomplications.Biomedicine&Pharmacotherapy,59,365373.

166

Lucrritiinificevol53seriaMedicinVeterinar
42. RotruckJ.T.,PopeA.L.andGantherH.E.1973.Selenium:Biochemicalroleasacomponent
ofglutathioneperoxidase.Science179:588590.
43. SAS, 1987. Statistical Analysis System, Users Guide: Statistics, SAS Institute Cary , North
Carolina.
44.
Sasaki
T,
MatsyS,SonaeA(1972)Effectofaceticacidconcentrationonthecolourreactionintheo
toluidineboricacidmethodforbloodglucoseestimation.Rinshokagaku1:346353.
45. Schwedhelm E., Maas R., Troost R. and Boger R. H. 2003. Clinical pharmacokinetics of
antioxidantsandtheirimpactonsystemicoxidativestress.ClinPharmacokinet;42:43759.
46. ShaharE,ChamblessL.E,RosamondW.D.,BolandL.L.,BallantyneC.M.,McGovernP.G.
andSharnettA.R.2003.Atherosclerosisriskincommunitystudy,plasmalipidprofileand
incidentischaemicstroke:theatherosclerosisriskincommunities(ARIC)study;Stroke34,
623631
47. SozmenEY,SozmenB,DelenY.andOnatT.2001.Catalase/superoxidedismutase(SOD)
and catalase/paraoxonase (PON) ratios may implicate poor glycemic control. Arch Med
Res;4:2837.
48. Tavridou A, Unwin NC, Laker MF, White M, Alberti GK. 1997. Serum concentrations of
vitaminAandEinimpairedglucosetolerance.ClinChimActa;266:12940.
49. TuckerJ.MandTownsenD.M.2005.Alphatocopherol:rolesinpreventionandtherapyof
humandisease.BiomedPharmacother;59:3807.
50. Vessby, J., Basu, S., Mohsen, R., Berne, C. and Vessby B. (2002). Oxidative stress and
antioxidantstatusintype1diabetesmellitus.J.InternalMed.251:6976.
51. Vimal V and Devaki T. 2004. Linear furanocoumarin protects rat myocardium against
lipidperoxidation and membrane damage during experimental myocardial injury. Biomed
Pharmacother;58:393400.
52. VinaJ,BorrasC.,GomezCabreraM.C.andOrrW.C.2006.Roleofreactiveoxygenspecies
and (phyto)oestrogens in the modulation of adaptive response to stress. Free Radic Res;
40:1119.
53. WagnerJamesG,JiangQing,HarkemaJackR,IllekBeate,PatelDhavalkumarD,AmesBruce
N,etal.2007.Ozoneenhancementoflowerairwayallergicinflammationispreventedbyg
tocopherol.FreeRadicBiolMed.;43:117688.
54. Winkler, B. Stephen M., and Tonia S. 1994. The redox couple between glutathione and
ascorbicacid:Achemicalandphysiologicalperspective.FreeRadicalBiologyandMedicine,
17,333349.
55. White,A.,HandlerP.,SmithE.L.,HillRLandLehmanI.R.1994.Principlesofbiochemistry
7thedition(Tokyo:McGrawHillKogakushaLtd)pp619630
56. Young,I.S.andWoodsideJ.V.2001.Antioxidantsinhealthanddisease;J.Clin.Pathol.54,
176186
57. Zak,B.,Dickenman,R.,Whitsee,E.,Burnett,H.,andCherney,P.,1954."Rapidestimationof
freeandtotalcholesterol,"Am.J.Clin.Path.,24(1),pp.13071315.

167

UniversitateadetiineAgricoleiMedicinVeterinarIai

Group1contained10non
Group2contained30diabetic

diabeticbitchesservedasnon
bitches

diabeticcontrol
Samplesof10ofeachservedas

diabeticcontrolbeforetreatedwith

Figure1:Diagrammaticrepresentationofexperimentalprotocol

Group3(10animal)
Group4(10animal)
Group5

Treatedwithinsulin
Treatedwithinsulin
(10

animal)
andascorbicacid

Treated

with
Atotalof40bitcheswereusedinthe
experiment

168

Lucrritiinificevol53seriaMedicinVeterinar

Table1:lipidprofileandbloodglucoselevelincontrol,diabetic,diabetictreatedbitches

SignificantDifferenceatP<0.01
Meanswithinthesamecolumnwithdifferentlettersaresignificantlydiffered.
Note:a,isthehighestvalue,decreasedviab,c,dtoe.
Parameters

Glucose
Cholesterol
LDL
HDL(mol/dl)
(mg/dl)
(mg/dl)
(mol/dl)
c
e
Group1
86.62.63
126.38.9
25.30.59c
264.71.8a
Group2
286.95.20a
277.32.9a
35.00.47a
222.97.3c
Group3
99.82.35b 192.02.3b
32.20.33 b
240.04.4b
Group4
88.82.33c
170.02.5d
26.60.37c
263.82.3a
c
c
c
Group5
87.5 2.21 184.0 4.0
27.60.37
262.44.4a
Group1:Controlnondiabeticbitches
Group2:Diabeticuntreatedbitches
Group3:Insulintreatedbitches
Group4:InsulinvitaminCtreatedbitches
Group5:InsulinvitaminEtreatedbitches

Table 2: Levels of SOD, CAT, GPx and MDA in erythrocyte hemolyste of control,
diabetic,diabetictreatedbitches

SOD
CAT
GPx
MDA
Parameters
(units/mgHb)
(units/mgHb)
(mg/dl)
(mol/l)
a
a
a
Group1
0.070.005
0.080.002
22.00.5
16.90.3b
Group2
0.020.002d
0.050.002d
14.00.5d
28.40.5a
Group3
0.030.002c
0.060.003c
16.20.4c
24.50.5a
Group4
0.050.002b
0.070.003b
19.20.3b
17.30.3b
b
b
b
Group5
0.050.002
0.070.002
19.60.4
18.40.4b

SignificantDifferenceatP<0.01
Meanswithinthesamecolumnwithdifferentlettersaresignificantlydiffered.
Note:a,isthehighestvalue,decreasedviab,c,dtoe.
Group1:Controlnondiabeticbitches
Group2:Diabeticuntreatedbitches
Group3:Insulintreatedbitches
Group4:InsulinvitaminCtreatedbitches
Group5:InsulinvitaminEtreatedbitches

169


INVESTIGATIONOFSELECTEDBIOCHEMICALINDICATORSOF
EXERTIONALRHABDOMYOLYSISINARABIANHORSES:PRO
INFLAMMATORYCYTOKINESANDOXIDATIVESTRESSMARKERS
WaelM.ELDeeba,AbdELAzizAlmujallib,S.M.ElBahrc
a

(Correspondingauthor)
Departmentofclinicalstudies,CollegeofVeterinaryMedicineandanimalResources,King
FaisalUniversity.
SaudiArabia,ALAhsa,31982.
email:drwaeleldeeb@yahoo.com

b
Departmentofclinicalstudies,CollegeofVeterinaryMedicineandanimalResources,King
FaisalUniversity.
SaudiArabia,ALAhsa,31982.
c
DepartmentofPhysiology,BiochemistryandPharmacology,CollegeofVeterinaryMedicine
andanimalResources,KingFaisalUniversity,SaudiArabia,ALAhsa,31982.

Abstract
Atotalof30horsesweredividedintotwogroups,oneservedasacontrolwhereasotherwas
exertionalrhabdomyolysis(ER)diseasedhorses.Afterbloodcollection,theresultedserawere
used for estimation of the activities of creatin kinase (CK), aspartate transaminase (AST),
lactate dehydrogenase (LDH), lactic acid, total triacylglycerol, glucose, total protein, albumin,
globulin, urea, creatinine, Triiodothyronine (T3), calcium, sodium, potassium, phosphorus,
chloride,vitaminE,interleukin6(IL6)andtumornecrosis(TNF).Inaddition,wholeblood
was used for determination of selenium, reduced glutathione (GSH) and prostaglandin F2
(PGF2). The erythrocyte hemolysates were used for the determination of the activities of
superoxidedismutase(SOD),catalase(CAT),totalantioxidantcapacity(TAC),nitricoxide(NO)
andmalondialdehyde(MDA).Thepresentfindingsrevealedasignificant(p0.05)increasein
thevaluesofCK,AST,LDH,glucose,lactate,TAG,urea,creatinine,phosphorus,MDA,TNF,
IL6andPGF2indiseasedhorseswhencomparedwiththecontrol.Inaddition,thevaluesof
calcium,SOD,CAT,TAC,NOandGSHindiseasedhorsesweresignificantly(p0.05)lowerthan
thecontrol.Theotherexaminedparametersremainedunchanged.Inconclusion,theexamined
proinflammatory cytokines could be added to old biomarkers for the diagnosis of ER in
Arabian horses. In the future, efforts should be made to confirm this in other breed. If this
could be achieved, it would open up new perspectives in research fieldsdealing with ER not
onlyinanimals,butalsoinhumans.

Keywords:Rhabdomylosis,horse,IL6,oxidativestress,TNF,PGF2.

1.INTRODUCTION

Muscledisordersareacommoncauseofsuboptimalperformanceorevendisability
to perform. In comparison to human medicine, the etiology of muscle disorders in equine
medicine islessexplored.TyinguporER waspreviouslyknownasMondaymorningdisease
(Zentek, 1991). Monday morning disease was associated with work horses that was given a
170

Lucrritiinificevol53seriaMedicinVeterinar

dayofrestafteraweekofhardwork.Whenthehorsesweresupposedtoreturntoworkon
thefollowingMonday,theydevelopedstiffnessandpaininthehindquartermusculature,and
reluctancetomove(Jones,2003).Arabianshorsesareoneoftheaffectedbreed(Valentineet
al.,2000;McKenzieetal.,2003).
The underlying cause of this metabolic disorder is not yet known but is thought to
involvecarbohydratemetabolism(Valbergetal.,1997).ClinicalsignsofER,includingmuscle
pain, cramping, stiffness, sweating, exercise intolerance,weakness, and reluctance tomove
maybeobserved,withthehindquartersmostfrequentlyaffected(Firshmanetal.,2003).In
ordertoconfirmadiagnosisofERbloodsamplesshouldbeobtainedtodetermineserumCK
andAST.Theirelevationindicatesmuscledamageandconfirmsthediagnosisofthedisease.
Inaddition,ASTactivitymaybeheightenedinasymptomatichorseswithchronicER.
Exercise has been shown to induce tissue damage by oxidation of cellular
components, such as membrane lipids, proteins, carbohydrates and DNA (Clarkson and
Thompson, 2000). The main sources of reactive oxygen species (ROS) that are generated
during exercise are the mitochondria (respiratory chain), although activated phagocytes
(respiratoryburst)andseveralenzymessuchasoxidasesperhapscontributetoanincreased
ROS release (Leeuwenburgh and Heinecke, 2001). Living organisms possess antioxidant
defensesystemsagainstROS.Thesedefensesystemsincludeendogenantioxidants,whichcan
beclassifiedasnonenzymatic(vitaminE,vitaminC,uricacid)andenzymaticdefensesystem.
ThemostimportantantioxidantenzymesareSODandCAT(Fridovich,1995).Iftheprooxidant
burden overwhelms the endogenous antioxidant defenses of the organism, the arising
imbalance between pro and antioxidants is resulted whichdefined asoxidative stress (Sies,
1991).Exerciseinducedoxidativestressisbelievedtocontributetoacceleratedmusclefatigue
andmusclefiberdamage,leadingtoexerciseintoleranceand poorperformanceindifferent
animal species (Sen and Packer, 2000), as well as to a decreased immune defense of the
organism (Nieman, 1997). If the importance of antioxidant deficiencies for exerciseinduced
oxidative stress and exercise intolerance has been clearly established, thereby that
supplementationofantioxidantsmightimproveperformance,remainstobeproven(Clarkson
andThompson,2000;Jenkins,2000).
ElectrolyteimbalanceswerebelievedtohaveanimportantroleincausingERinsome
pleasure and racehorses. Studies by Harris and Snow (1991) in the United Kingdom have
focused on determining electrolyte balance in horses with tyingup. Commercial diets were
foundtobetoolowinsalt(sodiumchloride)andmosthorsesneededanadditional12ounces
of salt to maintain proper balance. While some horses improved dramatically by adding
electrolytesintheformoftablesalt(sodiumchloride),litesalt(potassiumchloride),orEpsom
salt (magnesium chloride), other horses showed no improvement. Traceelements, such as
selenium(Se),zinc(Zn),copper(Cu)andmanganese(Mn)playanimportantcatalyticrolefor
theenzymaticactivityofSOD(Maughan,1999;Mates,2000).

Strenuous exercise induced a transient endotoxemia and a proinflammatory


conditioninthehorsethatpersistsforapproximately2hafterexercise(Douglasetal.,2007).
IL6 is an important mediator of inflammation. The pleiotrophic cytokine IL6 is involved in
directingthe innateimmuneresponsetoacquiredimmunity(reviewedbyJones(2005),and
has been described as a regulatory cytokine in osteoarthritis (Goldring, 2000). It stimulates
productionofmetalloproteinaseinhibitors(Shinguetal.,1993,1995),butalsopotentiatesthe
cataboliceffectsofIL1andTNFonproteoglycanmetabolism(Jikkoetal.,1998;Flanneryet
al., 2000). According to authors knowledge there is no data concerning the oxidant
antioxidantbalanceorproinflammatoryresponseincasesofERinArabianhorses.Therefore,

171

UniversitateadetiineAgricoleiMedicinVeterinarIai

the present study aimed to investigate new biomarkers, oxidative stress markers and pro
inflammatorycytokinesfordiagnosisofERinArabianhorses.

2.MATERIALANDMETHODS

2.1.Animals
Atotalof30horses(46yearsold)wereusedinthepresentstudy.Theyweredivided
intotwogroups.Horsesofthefirstgroup(10horses)wereclinicallyhealthyandservedasa
controlgroup.Horsesofthesecondgroup (20horses)wereERdiseasedhorses.Theywere
selectedonthebasisofclinicalexaminationandlaboratoryfindingsandtheyhadahistoryof
overexerciseafteraperiodofrestandoverfeedingofnonstructuralcarbohydrates(grains).
2.2.Samplingprotocol
Bloodsampleswerecollectedfromtheearveinfromallgroupsinfreshplainvialfor
serum collection and heparinized vials for whole blood, serum and erythrocyte hemolysate
preparations.SerawereusedforestimationoftheactivitiesCK,AST,LDH.Inaddition,lactic
acid,totaltriglycerides,glucose,totalprotein,albumin,globulin,ureaandcreatininewerealso
determined. Sera samples were also used for the determination of T3, calcium, sodium,
potassium,phosphorus,chloride,vitaminE,IL6andTNF.However,wholebloodwasused
forthedeterminationofselenium,GSHandPGF2.Theerythrocytehemolysateswereused
forthedeterminationoftheactivitiesofSOD,CAT,TAC,NOandMDA.

2.3.Preparationofhemolysate
Aftercollectingbloodsamplesinheparinizedtubes,centrifugationwasperformedat
1000g for 15 min to remove the buffy coat. The packed cells obtained at the bottom were
washedthricewithphosphatebuffersaline(0.9%NaClin0.01Mphosphatebuffer,pH7.4).
Erythrocyteswerelysedwithhypotonicphosphatebuffer.Thehemolysatewasobtainedafter
removingthecelldebrisbycentrifugationat3000gfor15min.

2.4.Determinationofselectedbiochemicalparameters
EnzymaticmethodsofBiodiagnostickitswereusedforcolorimetricdeterminationof
serum glucose concentration (Trinder, 1969), TAG (Young et al., 1972), total protein (Henry,
1984), albumin (Doumas et al., 1981), globulin (Coles, 1974), AST (EC 2.6.1.1; Reitman and
Frankel, 1957), urea (Tabacco et al., 1979) and creatinine (Henry, 1984) according to
manufacturinginstructions.Inaddition,theactivitiesofCK(FaulkerandMeites1982),LDH(EC
1.1.1.27;WroblewskiandDuean1955),andvalueofLactate(Donawicketal.,1975)werealso
determinedintheserumbyusingcommercialavailablekits(Biodiagnostickits).
SerumconcentrationofT3 hormonewasdeterminedusingasolidphasecompetitive
chemiluminescence immunoassay system (Elecsys 2010, Roche, Diagnostic, Mannheim).
Concentrations were determined using kits, controls, monoclonal mouse antibodies and
reagent supplied by Roche, Diagnostic, 2005 .The intra and inter assay coefficients of
variation (C.V. %) were 3.6 and 5.4%.`The minimum detectable levels of the assay were
0.195ng/ml.
2.5.DeterminationofelectrolytesandvitaminE
SerumcalciumwasdeterminedcolorimetricallybyusingcommercialthekitofInvitro
ScientificaccordingtothemethoddescribedbyMooreheadandBriggs,(1974).Calciumreacts
with cresolphthalein complexone to form purple color complex in alkaline medium. The
intensityofthecolormeasuredphotometricallybetweenwavelength540and600nmwiththe
maximum absorbance at 575 nm is directly proportional to calcium concentration in the
172

Lucrritiinificevol53seriaMedicinVeterinar

specimen.Theseruminorganicphosphatewasdeterminedaccordingtothemethodcitedin
Wootton,(1982).ThesubstitutedphenolwasusedasareducingagentandpHwasadjusted
byanacetatebuffer.Thecolordevelopmentwashastenedbycopperpresentinthebuffer.
The blue color was stable at least for 30 minutes. Sodium, potassium, and chloride were
analyzedusingthesamecommercialavailabletestkitsaccordingtothemethodsdescribedby
FriedmanandYoung(1997)andTietz,(1995).
However, whole blood selenium was measured using the Unicam 939 AA
spectrometerandAAShydride technique.SerumvitaminE wasmeasuredbyHPLC(Kontron
Instruments, Rotkreuz, Switzerland) using acetate of alpha tocopherol as internal standard
(Paolisso et al., 1993). Chromatographic separation was performed using a reversed phase
silica gel column (Alltech, Templeuvre, France) and an isocratic elution with acetonitrile.
Detectionwasperformedphotometricallyat292nm.

2.6.Determinationofoxidativestressmarkersandproinflammatorymediators
Activity of SOD (inhibition rate percent) was assayed in erythrocyte hemolysate as
describedbyNishikimietal.(1972)usingcommercialavailablekits(Biodiagnostic,Kitnumber
SD2520). The activity of CAT was assayed in the erythrocyte by the method of Aebi, (1984)
using commercial available kits (Biodiagnostic, Kit number CA2516). The activity of the
enzyme was expressed as units/mg of hemoglobin. Whole blood GSH was determined
spectrophotometrically using the Biodiagnostic kit (GR2510). Intra and interassayCV were
1% and 3%, respectively. TAC was assayed in erythrocyte hemolysate as described by
koracevicetal.(2001)usingcommercialavailablekits(Biodiagnostic,KitnumberTA2512).NO
wasassayedinhemolysateasdescribedbyMontgomeryandDymock(1961)usingcommercial
available kits (Biodiagnostic, Kit number NO2532). Lipid peroxidation was assayed by the
measurementofMDAlevelsonthebaseofMDAreactedwiththiobarbituricacidat532nm,
accordingtoOhkawaetal.(1979)usingcommerciallysuppliedkits(Biodiagnostic,Kitnumber
MD2529).
Serum concentrations of TNF were determined using an ELISA assay developed
with commercially available reagents, and an equine recombinant TNF standard. Standard
ELISAplates(96well,flatbottoms,Immulon4HBX,Milford,MA)werecoatedwithpolyclonal
antibody recognizing equine TNF (PETFNAI, Endogen, ThermoFisher Scientific, Pittsburg,
PA).Theantibodywasdiluted1:333incarbonatebufferatpH9.6and100lofantibodywas
added to each well. The microtiter plates were incubated overnight at 4C, after which the
antibodywasremovedandthewellswerefilledwith100lofblockingbuffer(1%BSAin1X
PBS). The plates were incubated for 1h at room temperature. Then the plates werewashed
threetimeswithPBScontaining0.05%Tween20(PBST).Afterwards,100lofeachsampleor
standard was added to triplicate wells, and the plates were incubated at 37 C for 2h. The
plateswerewashed three times with PBST. Biotin labeled polyclonalantibodyagainst TNFa
(PETNFABI,Endogen)wasdiluted1:277inPBST,and100lwasaddedtoeachwell.Theplates
were incubated at 37 C for 90 min, after which they were washed three times with PBST.
Next,100lofavidinhorseradishperoxidaseconjugate,(Pharmingen,BD,FranklinLake,NJ)
diluted 1:5000 in PBST containing 0.5% bovine serum albumin, (Sigma, St. Louis, MO) was
addedtoeachwellandincubatedfor1hatroomtemperature.Theplateswerethenwashed
fivetimeswithPBST.Finally,100lofsubstrate(2,20azinodi(3ethylbenzthiazolinesulfonic
acid),SigmaA1888,ABTS)wasaddedtoeachwell.Theplateswereincubatedfor30minat
roomtemperatureinthedark,andthenreadat405nmonanautomatedmicroplatereader
(DynexMRXII,DynexTechnology,Inc.,Chantilly,VA).

173

UniversitateadetiineAgricoleiMedicinVeterinarIai

SerumIL6valuesweredeterminedbyusingELISAkitssuppliedbyAbazyme,LLC,USA
(Catalog Number EL10023). This IL6 enzyme linked immunosorbent assay (ELISA) applies a
techniquecalledaquantitativesandwichimmunoassay.Themicrotiterplateprovidedinthis
kithasbeenprecoatedwithamonoclonalantibodyspecifictoIL6.Standardsorsamplesare
then added to the appropriate microtiter plate wells with a biotinconjugated polyclonal
antibody preparation specific for IL6 and incubated. IL6 if present, will bind and become
immobilized by the antibody precoated on the wells and then be sandwiched by biotin
conjugate. The microtiter plate wells are thoroughly washed to remove unbound IL6 and
other components of the sample. In order to quantitatively determine the amount of IL6
present in the sample, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each
microplate well and incubated. Avidin is a tetramer containing four identical subunits that
eachhasahighaffinitybindingsiteforbiotin.Thewellsarethoroughlywashedtoremoveall
unbound HRPconjugated Avidin and a TMB (3,3',5, 5' tetramethylbenzidine) substrate
solution is added to eachwell. The enzyme (HRP)and substrate are allowed to react over a
short incubation period. Only those wells that contain IL6, biotinconjugated antibody and
enzymeconjugated Avidin will exhibit a change in colour. The enzymesubstrate reaction is
terminated by the addition of a sulphuric acid solution and the colour change is measured
spectrophotometrically at a wavelength of 450nm 2 nm. The concentration of IL6 in the
samples (pg/mL) is then determined by comparing the O.D. of the samples to the standard
curve.Theminimumdetectablelevelwas2pg/ml.Interandintraassaycoefficientswere5.8
and6%,respectivelyandtherecoverywas95%.
Blood was collected intosterile microcentrifuge tubes containing a solution of EDTA
and sodium meclofenamate (final concentration: 10 mM, Sigma, St. Louis, MO) for the
determination of prostaglandin concentrations. The samples were placed on ice for 10 min,
afterwhichtheywerecentrifugedat1000gfor20minat4C.Theplasmawasthenharvested
and stored frozen at 80 C until analysis. On the day, the assay was performed, 100 l of
plasma was added to 900l of methanol, vortexed for 30 seconds and then dried down by
evaporation. Concentrations of prostaglandins (13, 14dihydro15keto prostaglandin F2)
wereevaluatedusingtheACETMcompetitiveenzymeimmunoassay(CaymanChemical, Ann
Arbor,MI).

2.8.Statisticalanalysis
The obtained data of the examined acute phase proteins were compared between
groups within different concentrations by using computer package of the statistical analysis
system(SAS,1997).Alldataarepresentedasmeansstandarderror(S.E.)ofthemeans.

3.RESULTS

3.1.Clinicalsigns
The observed clinical signs were in the form of pronounced sudden muscular
weakness and stiffness, depression, reluctant or unable to move, colic, anorexia, muscle
tremorsandmyoglobinuria.Allclinicalsignswererecordedshortlyafterexercise.Inaddition,
rectalpalpationofthediseasedgrouprevealedhighlydistendedbladderin14horses.

3.2.Selectedbiochemicalindicatorsincontrolanddiseasedhorses
The data summarized in Table 1 included the activities of CK, AST and LDH. In
addition the table also contains the values of glucose, lactate, TAG, urea and creatinine in
control and diseased horses. The present findings (Table 1) revealed a significant (p 0.05)
174

Lucrritiinificevol53seriaMedicinVeterinar

decreaseintheactivitiesofCK,ASTandLDHwhereasthevaluesofglucose,lactate,TAG,urea
and creatinine were significantly (p 0.05) increase when compared with the control group.
Valuesoftheotherexaminedparameters(Table1)remainedunchangedsignificantly(p0.05)
indiseasehorseswhencomparedwithcontrolgroup.

3.3.ElectrolytesandvitaminElevelsincontrolanddiseasedhorses
ThedataofTable3includedthevaluesofcalcium,sodium,potassium,phosphorus,
chloride, vitamin E and selenium in control and diseased horses. The value of calcium in
diseasedhorses(Groups2)weresignificantly(p0.05)lowerthanthecontrolhorses.Inthe
contrary, the value of phosphorus in diseased horses (Groups 2) were significantly (p 0.05)
higherthanthecontrolhorses.Valuesoftheotherexaminedparameters(Table3)remained
unchangedsignificantly(p0.05)indiseasehorseswhencomparedwithcontrolgroup.

3.4.Oxidativestressmarkersandproinflammatorymediators
ThedataofTable2includedtheactivitiesofSODandCATinadditionthetablealso
containsthevaluesofGSH,TAC,NO,TNF,IL6andPGF2andMDAincontrolanddiseased
horses.TheactivitiesofSOD,CATandTACindiseasedhorses(Groups2)weresignificantly(p
0.05)lowerthanthecontrolhorses.ThevaluesofMDA,TNF,IL6andPGF2indiseased
horseweresignificantly(p0.05)higherthanthecontrolhorseswhereasthevaluesofNOand
GSH were significantly (p 0.05) lower in diseased horses when compared with the control
group.

Table1:Selectedbiochemicalindicatorsincontrolanddiseasedhorses
Parameters
Control
Diseased
CK(IUL_1)

202.69.9

25.45086.76

AST(IUL_1)

275.346.6

30.990.069.6

LDH(IUL_1)

501.458.9

24.540.058.6

Glucose(mmolL_1)

5.61.2

9.5 1.4

T3(ng/dl)

0.260.02

0.250.03

Lactate(mmolL_1)

1.00.12

8.8 1.01

TotalProtein(g/L)

66.8 1.45

65.91.66

Albumin(g/L)

28.881.21

29.780.56

Globulin(g/L)

34.451.87

35.321.98

TAG(mmolL_1)

1.00.04

15.20.56

Urea(mmol/l)

7.320.52

11.541.22

Creatinine(mol/l)

118.432.67

203.346.45

*Meansaresignificantlydifferentatthelevel(p0.05).
175

UniversitateadetiineAgricoleiMedicinVeterinarIai

Table 2: Oxidative stress markers and proinflammatory mediators in control and diseased
horses
Parameters
Control
Diseased
MDA(mol/L)
1.00.12
8.20.12
CAT(U/mL)
1480.66543
612.32348.76
GSH(mg/dL)
2.81.94
1.560.22
TAC(mmol/l)
0.530.39
0.230.12
SOD(U/ml)
1106.26
66.233.56
NO(mol/L1)
4.110.66
3.120.12
TNF(pg/ml_1)
95.415.22
310.632.43
PGF2(pg/ml_1)
22.542.13
357.639.59
IL6(pg/ml_1)
1.40.65
5.622.32
*Meansaresignificantlydifferentatthelevel(p0.05).
Table3:ElectrolytesandvitaminElevelsincontrolanddiseasedhorses
Parameters
Control
diseased
(n=10)
(n=20)
Calcium(mmol/L)
3.120.23
2.130.21
Sodium(mmol/L)
144.87.23
143.86.45
Phosphorus(mmol/L)
1.30.11
1.90.12
Potassium(mmol/l)
4.160.12
4.20.13
Chloride(mmol/L)
107.58.21
106.686.66
Selenium(g/l)
109.65.42
107.877.91
VitaminE(mol/l)
6.771.32
6.671.52
*Meansaresignificantlydifferentatthelevel(p0.05).
4.DISCUSSION

In the current study, ER represented as when a conditioned horse is not worked and
kept on full feed high insoluble carbohydrates (such as grain), the horse will accumulate
carbohydrates in the muscles. If there is a sudden demand for work, the body cannot
adequately remove the rapidly accumulating lactic acid in the muscles. This in turn causes
vasospasmsandischemiawhichmeansessentiallythatthesurroundingbloodvessels"clamp
down"sothatthelacticacidwasteproductcannotberemoved.Asaresult,intracellularpH
drops;thedisrupted,hardandcrampymusclewasobservedwhenahorsetiesup.Inaddition,
ER is often seen following strenuous muscular exercise and is a response to intensive and
severeexercise.Itisassociatedwithdamagetothemusclegrouppredominantlyinvolvedin
the activity. The clinical signs observed in the present study are agree with previous
researches (Clarkson, 2002; Hamer, 1997; Knochel, 1990; 1993; Line and Rust, 1995;
WalsworthandKessler,2001)
ThesignificantincreaseinserumCK,ASTandLDHvaluessuspectedERwithrespective
muscle damage (Valentine et al., 2001; Sjaastad et al., 2004). The present results come in
accordancewithpreviousstudies(Hosieetal.,1986;Whitwelletal.,1988;Brandtetal.,1997;
PalenciaandRivero,2007;Votionetal.,2007).Phosphocreatineisrelativelyshortlivedpower
sourcethatiseffectiveatgeneratingATPrapidly.Ithasahighenergyphosphategroupthatis
donatedtoADPtoproduceATP.ItisusedatthebeginningofexercisetomaintainhighATP
levelsduringmusclecontraction.Creatinekinaseistheenzymethatcatalyzestheconversion
ofphosphocreatineandADPtocreatineandATP.Phosphocreatinestoresaredepletedmore
quicklyinfasttwitchmusclefiberssincetheyhaveahigherrateofATPutilization(Ivyetal.,
176

Lucrritiinificevol53seriaMedicinVeterinar

1981). In the horse Phosphocreatine levels are decreased about 50 to 70% during high
intensityexercise(ValbergandEssenGustavson,1987).
Elevated AST levels are also an indicator of muscle damage associated with
recumbence (Skenderi et al., 2006; Valentine & Lhr, 2007). Elevated levels of AST are also
thoughttobeindicativeofliverdamage(Nyblometal.,2004).Inthecell,ASTisinvolvedin
formation of adenosine triphosphate (ATP; Pesch et al., 2006). The reported significant
increaseinglucose,lactateandtriglycerideslevelsindiseasedhorsesthanthatofthecontrol
perhaps attributed to increase the rate of glycogenolysis, glycolysis and lipogenesis,
respectively.Feedinghighinsolublecarbohydratestohorsesduringrestincreasedtherateof
glycogenstorage.Afterrestperiodandwhentheanimalexercisedtheanimalgettheenergy
through mobilization of glucose from glycogen storage site (glycogenolysis) followed by
oxidationoftheobtainedglucose(glycolysis).Inaddition,gluconeogenesismaybeactivated.
Thesemechanismswereenoughtosupplyenergy.Moreover,theexcessglucoseperhapswas
used in synthesis of triacylglycerol (lipogenesis). This interpretation underlined by the
reported significant increase in triacylglycerol of diseased horse in the present study. The
reported increase in glucose, lactate and triacylglycerol was reported previously in horse
(Westermann et al., 2007). The significant increase in urea and creatinine level in diseased
horses (Table1) indicated renal damage. These findings disagree with those obtained by
Clarkson(2006)whoreportedthat,therenalsystemmaynotbeaffectedindiseasedhorse.
Electrolytes are body salts that maintain an electrical gradient across muscle cell
membranes. During exercise, muscles contract when nerves stimulate a change in the
electricalgradientandelectrolytesmoveacrossthecellmembrane.Musclecellscontainhigh
concentrations of the electrolytes potassium and phosphate and low concentrations of
sodium, chloride, and calcium (Radostits, et al., 2007). If the ion pumps (sodium/potassium,
calcium/magnesiumandcalcium/ATPase)inthemembranesurroundingthemusclecellwhich
movesubstratesinandoutofthecellaredisrupted,theinteriorenvironmentofthemuscle
cells either cannot get rid of waste products of metabolism or has too much of a metabolic
substrate to be able to function or can't get enough of a metabolic substrate to be able to
function. Therefore, the muscle cell simply shuts down. When muscle cells shut down, they
don'tdosointherelaxedposition,theyfreezeupinthecontractedposition,whichresultedin
rockhardmuscles.Biochemically,it'snotallthatdifferentfromrigormortis.
ThereportedhypocalcemiainthepresentstudyperhapssharedingenerationofER.
ThehypocalcemiaasasuggestingcauseofERwasreportedbefore(Assmannetal.,1933and
Jacobsonetal.,1991).
It was suggested that, similar to other species, a dietary vitamin E and selenium
deficiency might cause muscle damage in ER horses. Vitamin E and selenium act to protect
musclesfromoxygenfreeradicalsthatcanbegeneratedwithexercise.However,thepresent
studydidnotreportedchangesinvitaminEandseleniumlevelbetweendiseasedandhealthy
controlhorses.Therefore,eithervitaminEorseleniumdeficiencieswereavoidedasacauseof
ER in the present work. Documented cases of a seleniumresponsive muscle disease were
reported in foals from several countries with low selenium soil content in the 1970s. The
association with muscle disease led to the recommendation that horses with ER should be
given a selenium and vitamin E supplement. Although selenium deficiency may not be the
primary cause for ER, manypractitioners report adecrease in the severity of tyingupwhen
horses receive vitamin E and selenium supplementation. This may be due to the fact that
horsesgeneratemoretoxicfreeradicalswiththeERsyndromeandthereforehaveagreater
need for supplementation. Another possibility is enzymatic antioxidant activity might be

177

UniversitateadetiineAgricoleiMedicinVeterinarIai

higherinhorsesandprotectthenonenzymaticsystemfromdepletion.Thisunderlinedbythe
reporteddecreaseinSODandCATofdiseasedhorses(Nathalieetal.,2008).
ThesignificantdecreaseofSOD,CAT,TAC,GSHandNOindiseasedhorseattributed
tothedepletionofantioxidantsystemtocounteracttheoxidativestressandreactiveoxygen
species. In the equine species, an exerciseinduced imbalance in favor of oxidants has been
described in several experimental studies (Mills et al., 1997; Art et al., 1999; Deaton et al.,
2002;Kirschvinketal.,2002)aswellasinfieldinvestigations(Baloghetal.,2001;Whiteetal.,
2001;Hargreavesetal.,2002;Marlinetal.,2002).TheproductionofNOplaysavitalrolein
the regulation of physiologic processes, and both proinflammatory and antiinflammatory
effects have been described for this molecule. NO is a biologic gas produced by almost all
tissues.RecentlyithasbeendemonstratedthatNOhasanimportantroleinmusclephysiology
(Balon et al., 1994) and may influence both contractile function and muscle metabolism. A
physiologicroleasavasodilatoryregulatorinskeletalmusclehasbeenestablishedforNO,and
inthatwayitincreasesO2andnutrientsupplytothemuscle.
The significant decrease in the above discussed antioxidant system was underlined
by the significant increase of MDA, TNF , IL6 and PGF2 in diseased horse indicated lipid
peroxidationresultedfromER.Proinflammatorymolecules(TNF,IL6)havebeenreported
toincreasewithstrenuousexercise(LeeandClarkson2003).Furthermore,tissuedamageand
repairprocessesmayinvolvetheexpressionofinflammatorycytokines(TNF,IL6).Cytokines
canactdirectlyontargetcellsortheymaystimulatethecreationofsecondarymediatorssuch
asothercytokines,PGF2orfreeoxygenradicals.
Since some exerciserelated pathologic conditions are considered inflammatory
processes (Lee and Clarkson, 2003), the present work designed to examine some pro
inflamatorycytokinesandprostaglandininERcases.Totheauthorsknowledgethisisthefirst
study to demonstrate the use of proinflammatory cytokines (IL6 and TNF ) and PGF2
concentrationsasbiomarkersofER.SimilarsignificantincreasesinTNF,IL6andPGF2in
horseofERwerereportedincaseofequineosteoarthritis(Leyetal.,2009),equinelaminitis
(Stewart,2009),strenuousexerciseinequine(Donovanetal.,2007)andothers(fordetailssee
ArtandLekeux,2005).

5.CONCLUSION
Interestingly, the examined proinflammatory cytokines (TNF , IL6) and PGF2
concentrationscouldbeaddedtoothertraditionalbiomarkers(CK,ASTandLDH)usedforthe
diagnosisofERinArabianhorses.Inthefuture,effortsshouldbemadetoconfirmthisinother
breed.Ifthiscouldbeachieved,itwouldyieldavaluabletooltodiagnoseERandwouldopen
upnewperspectivesinresearchfieldsdealingwithERnotonlyinanimals,butalsoinhumans.

6.Bibliography
1.
2.

3.
4.

Aebi,H.1984.Catalaseinvitro.MethodsEnzymol.105,121126.
Art,T.,Kirschvink,N.,Smith,N.,Lekeux,P.,1999.Indicesofoxidativestressinbloodand
pulmonary epithelium lining fluid in horses suffering from recurrent airway obstruction.
EquineVeterinaryJournal31,397401.
Assmann H, Bielenstein H, Hobs H. 1933. Beobachtungen und untersuchungen bei der
haffkrankheit.DtschMedWochenschr59,1226.
Balogh,N.,Gaal,T.,Ribiczeyne,S.,Petri,A.,2001.Biochemicalandantioxidantchangesin
plasma and erythrocytes of pentathlon horses before and after exercise. Veterinary
ClinicalPathology30,214218.

178

Lucrritiinificevol53seriaMedicinVeterinar

5.
6.
7.
8.
9.
10.
11.

12.

13.

Balon,T.,Nadler,L.,1994.Nitricoxidereleaseispresentfromincubatedskeletalmuscle
preparations.JournalAppliedPhysiology77,25192521.
Brandt,K.,Hinrichs,U.,Glitz,F.,Landes,E.,Schulze,C.,Deegen,E.,Pohlenz,J., Coenen,
M.,1997.Atypischemyoglobinuriederweidepferde.Pferdeheilkunde13,2734.
Clarkson,M.,2002.Exertionalrhabdomyolysis:mythsandmadness.TheAmericanJournal
ofSportsMedicine4,155156.
Clarkson,M.,Thompson,S.,2000.Antioxidants:whatroledotheyplayinphysicalactivity
andhealth?AmericanJournalofClinicalNutrition72,637S646.
Clarkson,P.,2006.Casereportofexertionalrhabdomyolysisina12yearoldboy.
MedicineandScienceinSportsExercise38,197200.
Coles, H., 1974. Veterinary Clinical Pathology. W.B. Saunders Co., Philadelphia, London,
Toronto.
Deaton, M., Marlin, J., Roberts, A., Smith, N., Harris, A., Kelly, J., Schroter, C., 2002.
Antioxidant supplementation and pulmonary function at rest and exercise. Equine
VeterinaryJournal34,5865.
Donawick,J.,Ramberg,F.,Paul,R.Hiza,A.,1975.Thediagnosticandprognosticvalueof
lactatedeterminationsinhorseswithacuteabdominalcrisis.JournaloftheSouthAfrican
VeterinaryAssociation466,127.
Donovan,D.,Jackson,C.,Colahan,P.,Norton,N.,andHurley,D.,2007.Exerciseinduced
alterationsinproinflammatorycytokinesandprostaglandinF2inhorses.Veterinary
ImmunologyandImmunopathology118,263269.

14. DouglasC.ChristieA.,PatrickT.,NatalieN.,andDavidJ.,2007.Exerciseinduced
alterationsinproinflammatorycytokinesandprostaglandinF2ainhorses.Veterinary
ImmunologyandImmunopathology118,263269.
15. Doumas,T.,Bayson,D.,Carter,J.,Peters,T.,Schaffer,R.,1981.Estimationoftotalserum
protein.ClinicalChemistry,27,16421643.
16. Faulker,R.andMeites,S.,1982.SelectedMethodofclinicalchemistry9,185.

17. Firshman, M., Valberg, S., Bender, J., Finno, C., 2003. Epidemiologic characteristics and
management of polysaccharide myopathy in Quarter Horses. American Journal of
VeterinaryResearch64,13191327.
18. Flannery, R., Little, C., Hughes, C., Curtis, C., Caterson, B., Jones, S., 2000. IL6 and its
soluble receptor augment aggrecanasemediated proteoglycan catabolism in articular
cartilage.JournalofBiology19,549553.
19. Fridovich, I., 1995. Superoxide radical and superoxide dismutase. Annual Review of
Biochemistry64,97112.
20. Friedman,B.etal.,1980.Clinicalchemistry,26:1D.
21. Friedman,B.,Young,D.,1997.EffectsofDiseaseonClinicalLaboratoryTests,3rdEdition,
AACCPress,Washington,D.C.
22. Goldring, B., 2000. Osteoarthritis and cartilage: the role of cytokines. Current
RheumatologyReports2,459465.
23. Hamer,R.,1997.Whenexercisegoesawry:exertionalrhabdomyolysis.SouthernMedical
Journal90,548551.
24. Hargreaves,J.,Kronfeld,S.,Waldron,N.,Lopes,A.,Gay,S.,Saker,E.,Cooper,L.,Sklan,J.,
Harris, A., 2002. Antioxidant status and muscle cell leakage during endurance exercise.
EquineVeterinaryJournal34,116121.

179

UniversitateadetiineAgricoleiMedicinVeterinarIai

25. Harris, A., and Snow, H., 1991. Role of electrolyte imbalances in thepathophysiologyof
theequinerhabdomyolysissyndrome.In:EquineExercisePhysiology3ed.SGBPersson,A
LindholmandLBJeffcott.ICEEPPublications,DavisCA,pp435442.
26. Henry, B., 1984. Clinical Diagnosis and management, 17th edition, Saunder Publisher.
Elecsys triiodothyronine (11731360122) and thyroxine (12017709122), Cobas, 2005,
Roche,Diagnostics,GmbH,D,68298,Mannheim.
27. Hosie,D.,Gould,W.,Hunter,R.,Low,C.,Munro,R.,Wilson,C.,1986.Acutemyopathyin
horsesatgrassineastandsoutheastScotland.VeterinaryRecord119,444449.
28. Ivy J.L., D.L. Costill, P.J. Van Handel, D.A. Essig, and R.W. Lower. 1981. Alteration in the
lactatethresholdwithchangesinsubstrateavailability.Int.J.SportsMed.2,139.
29. JacobsonH,StrikerG,KlahrS.,1991.Biochemicalalterationsinadvanceduremicfailure.
In: Jacobson H, Striker G, Klahr S, editors. The principles and practice of nephrology.
Philadelphia(BC):Decker;p.682689.
30. Jenkins,R.,2000.Exerciseandoxidativestressmethodology:acritique.AmericanJournal
ofClinicalNutrition72,670S674.
31. Jikko,A.,Wakisaka,T.,Iwamoto,M.etal.,1998.Effectsofinterleukin6onproliferation
andproteoglycanmetabolisminarticularchondrocytecultures.CellBiologyInternational
22,615621.
32. Jones,S.,2005.Directingtransitionfrominnatetoacquiredimmunity:definingarolefor
IL6.Journalofimmunology175,34633468
33. Jones, W., 2003. Nutritional Support for Rhabdomyolysis. Journal of Equine Veterinary
Science,23,325326.
34. Kirschvink,N.,Art,T.,deMoffarts,B.,Smith,N.,Marlin,D.,Roberts,C.,Lekeux,P.,2002.
Relationship between markers of blood oxidant status and physiological variables in
trainedandheavesaffectedhorsesafterexercise.EquineVeterinaryJournal34,159164.
35. Knochel, P., 1990. Catastrophic medical event with exhaustive exercise: white collar
rhabdomyolysis.KidneyInternational38,709719.
36. Lee,J.,Clarkson,M.,2003.Plasmacreatinekinaseactivityandglutathioneaftereccentric
exercise.Medicine&ScienceinSports&Exercise35,930936.
37. Leeuwenburgh, C., Heinecke, J.W., 2001. Oxidative stress and antioxidants in exercise.
CurrentMedicinalChemistry8,829838.
38. Ley,C.,Ekman,S.,Ronus,B.,ElorantaL.,2009.Interleukin6andhighmobilitygroupbox
protein1 in synovial membranes and osteochondral fragments in equine osteoarthritis
ResearchinVeterinaryScience86,490497
39. Line, L. and Rust, S., 1995. Acute exertional rhabdomyolysis. American Family Physician
52,502506.
40. Marlin, J., Fenn, K., Smith, N., Deaton, D., Roberts, A., Harris, A., Dunster, C., Kelly, J.,
2002. Changes in circulatory antioxidant status in horses during prolonged exercise.
JournalofNutrition132,1622S1627S.
41. Mates, M., 2000. Effects of antioxidant enzymes in the molecular control of reactive
oxygenspeciestoxicology.Toxicology153,83104.
42. Maughan, J., 1999. Role of micronutrients in sport and physical activity. British Medical
Bulletin55,683690.
43. McKenzie,C.,Valberg,J.Godden,S.,Pagan,D.,MacLeay,M.,Geor,J.,Carlson,P.,2003.
Effect of dietary starch, fat and bicarbonate content on exercise responses and serum
creatine kinase activity in equine recurrent exertional rhabdomyolysis. Journal of
VeterinaryInternalMedicine17,693701.

180

Lucrritiinificevol53seriaMedicinVeterinar

44. Mills, C., Smith, C., Harris, C., Harris, P., 1997. Effect of allopurinol on the formation of
reactive oxygen species during intense exercise in the horse. Research in Veterinary
Science62,1116.
45. Montgomery,C.,andDymock,J.,1961.Thedeterminationofnitriteinwater.Analyst86,
414416.
46. Nathalie, K., Brieuc, M., Pierre, L., 2008. The oxidant/antioxidant equilibrium in horses.
TheVeterinaryJournal,177,178191.
47. Nieman,C.,1997.Immuneresponsetoheavyexertion.JournalofAppliedPhysiology82,
13851394.
48. Nishikimi, M., Appaji N., and Yogi. K., 1972. The occurrence of superoxide anion in the
reaction of reduced phenazine methosulfate and molecular oxygen. Biochemistry and
BiophysicsResearchCommnication46,849854
49. Nyblom H., Bergren, U., Balldin, J., Olsson, R., 2004 High AST/ALT ratio may indicate
advanced alcoholic liver disease rather than heavy drinking. Alcohol & Alcoholism 39,
336339.
50. Ohkawa, H., Ohishi, W. and Yagi, k., 1979. Assay for lipid peroxides in animal tissues by
thiobarbituricacidreaction.AnalyticalBiochemistry.95,351358.
51. Palencia,P.,Rivero,L.,2007.AtypicalmyopathyintwograzinghorsesinnorthernSpain.
VeterinaryRecord161,346348.
52. Paolisso G, DAmore A, Giugliano D, Ceriello A, Varrichio M, DOnofrio F. 1993.
Pharmacologic doses of vitamin E improve insulin action in healthy subjects and non
insulindependentdiabeticpatients.AmericanJournalofClinicalNutrition57,6506.
53. Pesch,S.,Bermann,M.&Bostedt,H.2006.Determinationofsomeenzymesandmacro
and microelements in stallion seminal plasma and their correlations to semen quality.
Theriogenology66,307313.
54. Radostits, M., Blood, C., Gay, C., 2007. Veterinary Medicine, A Textbook of disease of
cattle, sheep,pigs, goat and horses. 10thEd., SAUNDERS, ELSEVIER, Edinburgh, London,
NewYork,Oxford,Philadelphia,StLouis,Sydney,Toronto.
55. Reitman, M., and Frankel, S., 1957. A colorimetric method for determination of serum
glutamic oxaloacetic and glutamic pyruvic transaminase. American Journal of Clinical
Pathology28,56.
56. SAS,2001.Statisticalanalysissystem.In:UsersGuide:Statistics.SASInstitute.
57. Shingu, M., Nagai, Y., Isayama, T., Naono, T., Nobunaga, M., and Nagai Y., 1993. The
effectsofcytokinesonmetalloproteinaseinhibitors(TIMP)andcollagenaseproductionby
humanchondrocytesandTIMPproductionbysynovialcellsandendothelialcells.Journal
ofClinicalExperimentalImmunology94,145149.
58. Shingu,M.,Miyauchi,S.,Nagai,Y.etal.,1995.TheroleofIL4andIL6inIL1dependent
cartilagematrixdegradation.BritishJournalofRheumatology34,101106.
59. Sies,H.,1991.Oxidativestress:introduction.In:Sies,H.(Ed.),OxidativeStress:Oxidants
andAntioxidants.AcademicPress,London,pp.XVXXII.
60. Sjaastad,V.,Hove,K.,Sand,O.,2004.PhysiologyofDomesticAnimals.Oslo,Scandinavian
VeterinaryPress.266267.
61. Skenderi,K.,Kavouras,S.,Anastasiou,C.,Yiannakouris,N.&MatalasL.,2006.Exertional
Rhabdomyolysisduringa246kmcontinuousrunningrace.Medicine&Scienceinsports
andexercise38,10541057.
62. StewartJ.,PettigrewA,CochranA.,andBelknapJ.,2009.Indicesofinflammationinthe
lung and liver in the early stages of the black walnut extract model of equine laminitis.
Veterinaryimmunologyandimmunopathology129,254260.
181

UniversitateadetiineAgricoleiMedicinVeterinarIai

63. Tabacco, A., Meiathini, F., Moda, E., Tarli, P., 1979. Simplified enzymic / colorimetric
serumureanitrogendetermination.ClinicalChemistry25,336337.
64. Tietz,N.,1995.ClinicalGuidetoLaboratoryTests,3rdEdition,W.B.Saunders,Philadelphia,
PA).
65. Trinder,P.,1969.Determinationofglucoseinbloodusingglucoseoxidasewithalternative
oxygenacceptor.AnalyticalClinical.Biochemistry6,24.
66. Valberg, S., and B. EssenGustavsson. 1987. Metabolic responseto racing determined in
pools of type I, IIA, and IIB fibers. In: Gillespie JR, Robinson, NE, eds. Equine Exercise
Physiology2.p.290.Davis,CA.ICEEPpublications.
67. Valberg, J., MacLeay, M., Mickelsen, R., 1997. Exertional rhabdomyolysis and
polysaccharide storage myopathy in horses. Compendium on Continuous Education for
thePracticalVeterinarian19,10771085.
68. Valentine, A., and Lhr, V., 2007. Myonecrosis in three horses with colic: evidence for
endotoxicinjury.TheveterinaryRecord161,786789.
69. Valentine, A., McDonough, P., Chang, F., Vonderchek, A., 2000. Polysaccharide storage
myopathyinMorgan,Arabian,andStandardbredrelatedhorsesandWelshcrossponies.
VeterinaryPathology37,193196.
70. Valentine,A.,VanSaun,J.,Thompson,N.,Hintz,F.,2001.Roleofdietarycarbohydrate
and fat in horses with equine polysaccharide storage myopathy. American Veterinary
MedicalAssociation219,15371544.
71. Votion, M., Linden, A., Saegerman, C., Engels, P., Erpicum, M., Thiry, E., Delguste, C.,
Rouxhet,S.,Demoulin,V.,Navet,R.,Sluse,F.,Serteyn,D.,VanGalen,G.,Amory,H.,2007.
History and clinical features of atypical myopathy in horses in Belgium (20002005).
JournalofVeterinaryInternalMedicine21,13801391.
72. Walsworth, M., and Kessler, T., 2001. Diagnosing exertional rhabdomyolysis: a brief
reviewandreportoftwocases.MilitaryMedicine166,275277.
73. Westermann,M., De SainvanderVelden, M., VanderKolk,H.,Berger,R.Wijnberg, D.,
Koeman, P., Wanders, A., Lenstra, A., Testerink, N. Vaandrager, B., VianeySaban, C.,
AcquavivaBourdain, C., Dorland L., 2007. Equine biochemical multiple acyl CoA
dehydrogenasedeficiency(MADD)asacauseofrhabdomyolysis.MolecularGeneticsand
Metabolism91,362369.
74. White,A.,Estrada,M.,Walker,K.,Wisnia,P.,Filgueira,G.,Valdes,F.,Araneda,O.,Behn,
C., Martinez, R., 2001. Role of exercise and ascorbate on plasma antioxidantcapacity in
thoroughbred race horses. Comparative Biochemistry and Physiology. Part A: Molecular
andIntegrativePhysiology128,99104.
75. Whitwell,E.,Harris,P.,Farrington,G.,1988.Atypicalmyoglobinuria:anacutemyopathyin
grazinghorses.EquineVeterinaryJournal,20,357363.
76. Wootton,P.,1982.MicroanalysisinMedicalBiochemistry6 thEd.Churchill,LTD.London
pp.107.
77. Wroblewski,F.,andDuean,S.,1955.BestimmungderAktivitalderlactatedehydrogenase.
ProceedingsofSocietyofExperimentalBiology,90,210214.
78. Young, S., Thomas, W., Friedman, B., Pestaner, C., 1972. Effects of drugs on clinical
laboratorytests.ClinicalChemistry18,10411303.
79. Zentek,J.,1991.Myopathiesinaridinghorsestable.TierarztlPrax.19,1679.

182

THEPARSDISTALIS(ANTERIORPITUITARY)INONEHUMPED
CAMEL(CAMELUSDROMEDARIUS) : AMORPHOLOGICALSTUDY

IHABEL_ZOGHBY1*, AHME DKASSAB2

2
1
DepartmentofHistologyandCytology, DepartmentofAnatomyand
Embryologyand,FacultyofVeterinaryMedicine(Moshtohor),BenhaUniversity,Egypt;
*Correspondingauthor:1
Email:ihabyara@yahoo.com

Abstract:Fourteenparsdistalis of onehumped camels (Camelus dromedarius) were studied


using light,scanningandtransmission electron microscopes. Camels (9 malesand 5 females)
rangedfromthreetofiveyearsofagewereusedinthisstudy.Theparsdistaliswereprincipally
composedofclustersoftightlypackedcellsintheformofanastmosingcords.Thecellswere
separatedfromeachotherbycollagenfibersandsinusoidsofvarioussizes.Theparsdistalisof
camels included the following cells: mammotrophs, somatotrophs, gonadotrophs,
corticotrophs,thyrotrophs andfolliculostellate cells. Somatotrophs were themost abundant
secretory cells and were readily identifiable by their large homogeneously dense secretory
granules. The gonadotrophs contain small secretory granules. Corticotrophs were angular in
outline and occasionally possessed fingerlike projections. Thyrotrophs were few in number
and contain small scattered secretory granules. The folliculostellate cells were small and
containednosecretorygranules.
Thepresentstudyshowedthatthecamelparsdistalishasfivesecretoryandonenonsecretory
celltypes,whichcouldbeeasilydifferentiatedfromeachotherbythenumberandsizeoftheir
secretorygranules.
Keywords:Parsdistalis;Camel;Scanning;TransmissionElectronMicroscope.

INTRODUCTION

Itiswellknownthatthemammalianpituitaryglandconsistsoftwostructurallydistinct
lobes, the adenohypophysis and the neurohypophysis. The adenohypophysis consists of the
parsdistalis,parsintermediaandparstuberalis(Hanstrom,1966;DanielandPrichard,1975).
Theparsdistalisformsthemainbodyofthepituitaryglandandconsistsofseveraltypes
of endocrine cells that secrete at least six trophic hormones (Webb, 1982). The
histomorphologyoftheparsdistalishasbeenstudiedinvariousdomesticspecies(Delmann,
1971); in horse (Harrison and Sharyock, 1940; Webb, 1982); in bovine (Dawson, 1948;
Bassett, 1951; Cupps et al., 1954; Jubb and McEntee, 1955); in buffaloes (Roy, 1970; Das,
1979); in small ruminants (Trautmann and Fiebiger, 1957; Webb, 1981); in the goat (Singh,
1971;KhatraandNanda,1981;Gomezetal.,1989)andinthedogandcat(Das,1971;Girod
andLheritier,1986).However,therearenoavailablereportsthatdescribetheparsdistalisin
thecamel.
Thesecretory cellsof parsdistalis secretat least six hormones:growth hormone (GH),
prolactin, adrenocorticotrphic hormone (ACTH), thyroidstimulating hormone (TSH),

183

Lucrritiinificevol53seriaMedicinVeterinar
luteinizing hormone (LH) and folliclestimulating hormone (FSH). Each hormone, with the
exceptionofLHandFSH,isproducedbyseparatecelltype(Moriarity,1973;Nakane,1975).
Each cell type appears to be similar in many mammalian species (Foster, 1971; Farquhar,
Skutelsky and Hopkins, 1975). Many of the different cell types can be identified by their
ultrastructuralmorphology;particularlybythesizeoftheirsecretorygranules(Webb,1981).
Buttherearenostudiesthatdealtwiththeidentificationofcelltypesintheparsdistalisof
thedromedarycamel(Camelusdromedarius)
Thetwoobjectivesofthisstudywere:firstly,toelucidateadetaileddescriptionofthe
pars distalis in the hypophysis of dromedary camel (Camelus dromedarius) by Scanning
electronmicroscopy(SEM)andtransmissionelectronmicroscopy(TEM).Secondly,tocompare
thecamelsparsdistaliscelltypeswithparsdistaliscellsinotherdomesticanimals.

MATERIALSANDMETHODS

Nineadultmaleandfivefemalecamels(Camelusdromedarius)rangedfromthreeto
five years of age were used in this study. Samples were obtained from Benha and Toukh
slaughterhouses in Egypt. Each pituitary gland was quickly removed from its fossa. The pars
distaliswereisolatedfromeachpituitaryglandandwascutinto1mmblocks.
Forlightmicroscopy,thetissueswerefixedin10%neutralbufferedformalinsolution
thendehydrated,cleared,embeddedandcutat45microns.ThetissuesstainedwithH&Eand
Crossmons trichrome stain according to the methods described by Crossman (1937) and
Bancroft,Cook,Stirling,andTurner(1994).
The scanning electron microscopy study was made in Faculty of Agriculture, Alazhar
University,Egypt.Thespecimensweredehydratedinascendinggradesofalcohols,isopentyl
acetatefor23days,criticalpointdriedwithcarbondioxide,mountedonaluminumholders
and coated with gold in a sputtering device. Finally, the structures were examined using a
JEOLJSM5500LVSEM.
ThetransmissionelectronmicroscopywasmadeinAlmasaMilitaryVeterinaryHospital
in Egypt. Small pieces of camel pars distalis were fixed in 2.5% gluteraldehyde solution with
0.1 M phosphate buffer (pH 7.4) for 2448 hours, post fixed in 2% osmic acid for 2 hours,
dehydrated in ascending grades of alcohols and immersed in propylene oxide. Finally, they
were embedded in Epoxy resin. The block was polymerized for 24 hours at 70C. semithin
sections (0.4 m) were cut with glass knives on an ultramicrotome and stained with 0.3 %
toludineblueforlightmicroscopytodeterminetheorientationofthespecimen.Theultrathin
sections (70 nm) were cut, mounted on copper mesh grids (No. 200) and stained with
saturated solution of uranyl acetate dihydrate. Then, the sections were examined with SEO
ElectronMicroscope.ThesizesofgranulesweredeterminedusingtheSemAforesoftware.

RESULTS

Theparenchymalcellsoftheparsdistaliswereappearedinclustersoftightlypacked
cells. The cells were arranged in anastmosing cell cords of (Fig. 1) with variable thickness.
Thesecellswerecoveredexternallybyconnectivetissuecapsule(Fig.2)andwereseparated
from each other by collagen fibers and sinusoids of various sizes which were lined with
endothelium(Fig.3).

184

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.1.Photomicrographofcamelparsdistalisillustratingcordlikearrangementofcells(C)and
inbetweensinusoidalvessels(S).Theacidophil(A)canbedistinguishedeasilyfrombasophil
(B).Theparsdistalisfacescavumhypophysis(H).H&E.X200.

Fig.2.Scanningelectronmicrographofcamelparsdistalisshowingconnectivetissuecapsule
(arrows)thatsurroundingtheparenchymalcells(C)andsinusoids(S).

Fig. 3. Photomicrograph of camel pars distalis stain with Crossmans trichrome showing the
distributionofthecollagenfiber(arrows)amongthecellclusters(C)andbloodsinusoids(S).
X400.

185

Lucrritiinificevol53seriaMedicinVeterinar
Therewerebloodvessels(Fig.4)betweenthesecretorycellsofparsdistalis.Thewall
ofthebloodvesselswasreinforcedwithatoughcollagenfiberandfinescatteredfibrilswere
also observed (Fig. 5). The cells were a mixture of secretory with typical details of protein
secreting cells and nonsecretory cell types. The clusters were surrounded by a network of
capillaries. The pars distalis of camels included the following cells: mammotrophs,
somatotrophs,gonadotrophs,corticotrophs,thyrotrophsandfolliculostellatecells.

Fig. 4. Scanning electron micrograph showing a blood vessel (BV) in the camel pars distalis
containingbloodcells(b)whichadjacenttosecretorycells(C).

Fig.5.HighmagnificationScanningelectronmicrographoflargebloodvessels.Collagenfibrils
(c) are randomly distributed along its longitudinal axis. Secretory granules (G) were seen
adjacenttothebloodvesselandbloodcells(b).
Mammotrophsandsomatotrophs
The mammotrophs and somatotrophs were difficult to distinguish from each other
becauseoftheirsimilarity.Somatotrophswerethemostabundantsecretorycellsandtended
tobefoundingroupswithinacluster.Theywerereadilyidentifiablebecausetheycontained
large homogeneously dense secretory granules. The granules were generally round to ovoid
and were scattered either throughout the cytoplasm or concentrated near that part of the
186

UniversitateadetiineAgricoleiMedicinVeterinarIai
peripheralcellmembrane(Fig.6&7).Theyweredistributedthroughoutthegland,butwitha
relativelyhigherconcentrationintheanteroventralarea.Lowerconcentrationofthesecells
wasfoundedinthedorsoposteriorarea.Thediameterofthecellsvariedandthesizesofthe
secretorygranulesrangedfrom4001100nm(Fig.8).

Fig.6.Transmissionelectronmicrographofmammotrophsorsomatotrophsfromcamelpars
distalis.Notethenucleus(N)andthedensesecretorygranules(G)areconcentratednearthe
peripheralcellmembrane.Abloodvessel(BV)wasseenwithbloodcells(b).Scalebar:5m.

Fig.7.Scanningelectronmicrographfromcamelparsdistalisshowingvariousshapeandsize
ofsecretorygranules.

187

Lucrritiinificevol53seriaMedicinVeterinar

Fig.8.Transmissionelectronmicrographofsecretorygranules
insomatotrophsofcamelsparsdistalis.Notethegranules
areofhighnumber,largesizeanddensitypacked.Scalebar:2m

Gonadotrophs
The shape of gonadotrophs varied from angular to ovoid and may be irregular in
shape (Fig. 9). Their size and secretory granule number were varied according their activity.
The secretory granules were smaller, rounder and their diameters were ranged between
about 250 to 850 nm in diameter. Thesecells were often larger than the somatotrophs and
mammotrophs.Thecellshadavariablenumberofmitochondriaandattachedwithneighbor
cellsbyjunctionalcomplex.Thenumberofsecretorygranuleswasquitevariablebetweenone
cellandanother.
The secretory granules in gonadotrophs of camel's pars distalis were darker and
denserthanthoseofthesomatotrophsandmammotrophs(Fig.10).Theroughendoplasmic
reticulumwassparselydistributed.Thecytoplasmcontainedmanyfreeribosomes.

Fig.9.Transmissionelectronmicrographofgonadotrophsfromcamelparsdistaliscontaining
smallscatteredsecretorygranules(G).Junctionalcomplexes(arrows)wereseenbetween
cells.Thenucleus(N)andmitochondria(M)areseen.Scalebar:5m.

188

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.10. Transmissionelectronmicrograph ofsecretorygranulesingonadotrophsofcamels


parsdistalis.Notethegranulesareoffewinnumberandsmallinsize.Scalebar:2m

Corticotrophs
Corticotrophswerefewinnumberandvariableinsize.Theywereusuallyangularin
outline and occasionally possessed fingerlike projections (Fig. 11). The projections, which
extendedbetweenadjacentcells,containedfeworganellesotherthansecretorygranules.The
corticotrophs contained variable numbers of secretory granules scattered throughout the
cytoplasm.Thegranuleswereusuallyround,withdiametersrangingbetween150to300nm.

Fig.11.Transmissionelectronmicrographofcamelparsdistaliscontainingcorticotrophs(Co)
surrounded by somatotrophs (So) and gonadotrophs (Go). The corticotrophs has angular

189

Lucrritiinificevol53seriaMedicinVeterinar
profilewithsmallsecretorygranules.Sinusoid(S)isalsoseen.Scalebar:5m

Thyrotrophs
The thyrotrophs were few in number. They were usually found between
gonadotrophsandsomatotrophs.Theshapeofthyrotrophswasangular,ovoidorirregularin
outline. They contained variable numbers of small secretory granules and their sizes varied
from 100 to 250 nm (Fig. 12). The secretory granules were scattered throughout the
cytoplasm.Thenucleuswasroundandeccentricallylocated.

Fig.12.Transmissionelectronmicrographofthyrotrophs(Th)inthecamelparsdistalis.The
nucleus(N)iseccentricovoid.Somatotrophs(So)andgonadotrophs(Go)areseen.Scalebar:
5m.

Folliculostellatecells
The folliculostellate cells were small cells contained no secretory granules (Fig. 13)
and were distributed between the secretory cells. They possessed long slender cytoplasmic
processeswhichextendedbetweenadjacentcells.The nucleuswaselongatedovoidorpear
shape.Thecytoplasmofthefolliculostellatecellswasdenseandfrequentlycontainedmany
free ribosomes, little rough endoplasmic reticulum, small Golgi complexes and few
mitochondria. The cells were either found alone, giving them a stellate appearance, or in
groups.Wheningroupstheycommonlyformedfollicleswithjunctionalcomplexesjoiningone
celltoanotherneartheluminalsurface.Thefolliclesvariedinsizeandwereusuallyfoundin
thecentreofcellclusters.Nosecretorycellswereobservedliningthefollicles.

190

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig.13.Transmissionelectronmicrographoffolliculostellatecells(F)inthecamelpars
distalis.Thenucleus(N)iselongated.Corticotrophs(Co),gonadotrophs(Go)andJunctional
complexes(arrows)areseen.Scalebar:5m

DISCUSSION

The pars distalis of the camel was composed of glandular cells enclosed by connective
tissue and surrounded by a capillary network, like other mammals as in cattle (Gasse et al.
1986; Fumagalli and Zanini, 1985); in goat (Khatra,et al., 1981) and in small ruminants
(TrautmannandFiebiger,1957andDellmann,1971).Theseobservationsalsosupportsimilar
findingsindogandpig(Das,1971).
Theresultofthepresentstudyshowedthatthedensityofsolitaryfibrilssurroundingthe
innersurfaceofvesselsseemedtochangeaccordingtothesize.Theyaredenserinthelarge
vessel and are sparser in the small vessels or sinusoids. It may be related to the structural
strengthofvessels.ThesefindingisagreementwithNishimuraetal2004inthegoat.Alsothe
sinusoidsaregenerallydistributedbetweentheclusteraccordingtotheendocrinefunctionof
theglandwhichalsowithagreementwithMurrayetal.(1997)inhumanandTownsendetal.
(2004)inequine.
Mammotrophs and somatotrophs were the easiest secretory cells to identify. Their
secretorygranuleswerelagreandsectteredovertheircytoplasm,similartothatdescribedby
Parry,McMillen,Robinson&Thorburn(1979)insheep.
Our result revealed that the mammotrophs and somatotrophs are the most abundant
secertorycellsinthecamelsparsdistalis.WhileFarquharetal.(1975)inratandFoster(1971)
inrabbitsobservedthatmammotrophsonlywerethemostabundantsecretorycelltype.Such
cells were readily identifiable due to they were the largest of any pars distalis cell type and
theirsecretorygranulesareverylarge.
Thegonadotrophsvariedfromangulartoovoidandmaybeirregularinshape,similarto
that mentioned by Nakane (1975).The aforementioned author observed that the shape of
gonadotrophs were large round or angular. Moriarty (1976) found that there were three
distinctcelltypeswhichcontainedLHand/orFSHandthattheirshapesvariedfromangularor
stellate to large and ovoid. Moreover, as secretory activity was increased and a cell lost its
populationofgranules,itbecamemoreangularorsatellite.

191

Lucrritiinificevol53seriaMedicinVeterinar
Thepresentstudyshowedthatsomatotrophsandgonadotrophsarecompletelydifferent
bytheirsizeandsecertorygranules.Ontheotherhand,Farquharetal.(1975)recordedthat
somatotrophs and gonadotrophs could not be differentiated and proved indistinguishable
fromeachotherusingmorphologicalcriterionofgranulesize.
Corticotrophswerealsoidentifiedinthisstudy.Thecellsexhibitedallthecharacteristics
described by many authors following morphological and immunocytochemical studies in
several species (Siperstein & Allison, 1965; Foster, 1971; Moriarty, 1973; Farquhar et al.,
1975). The corticotrophs were not numerous, which is in agreement with the results of
Nakane, Setalo & Mazurkiewicz (1977), who found that the number of corticotrophs in rat
pituitarysectionsrepresentedapproximately15%ofthetotalsecretorycellpopulation.
The secretory granules of the thyrotrophs of the camel pars distalis are spherical,
numerousanddistributedthroughoutthecytoplasm,inthewaydescribedbyShirasawaetal.
(1985)inthegoat.Thesecretorygranulesshowtheircharacteristicallysmallsize,givingvalues
similartothosefoundbyShirasawaetal.(1985)especiallyinthefemalegoat.Theseresults
suggestthatthesizeofthesecretorygranulesinthecamelstendtobelargerthaninother
specieso f mammals.Thegranulecontentisofaveryvariabledensity,whichcoincidestoa
certain extent with the diversity which appears in other species. However Shirasawa et al.
(1985)observedthemasbeingelectrodenseinthegoat.
The folliculostellate cells of the camel pars distalis that were described in this study
characterizedbytheirshape,agranularity,relativelyfewmitochondriaandpoordevelopment
of RER. On the other hand, Smith (1963) was the first to describe large stellate cells with
prominent cytoplasmic fibrillae in the guineapig pituitary. Cells with similar ultrastructural
features have been described in the rabbit (Young, et al., 1965; Foster, 1971), in the rat
(Farquhar, 1971; VilaPorcile, 1972; Farquhar, Skutelsky & Hopkins, 1975) and in the deer
(Young&Chaplin,1975).
Foster (1971) found the cells in the rabbit pituitary with numerous microfilaments and
microtubules. He speculated that the cells might be capable of movement and might be
concerned in the circulation of intracellular fluid. A phagocytic role has been disscused by
Youngetal(1965)andFarquhar(1971).
Theresultsforcamelparsdistalisdemonstratethatspecificidentificationtechniques(e.g.
immunocytochemistry) are required to help identify or verify certain of the pars distalis cell
types.

REFERENCES
1. Bancroft, J. D.; Cook, H. C.; Stirling, R. W. and Turner, D. R. (1994): Manual of
histological techniques and their diagnostic application. 2nd. Churchill Livingston,
Edinburgh,London,Madrid,Melbourne,NewYork,andTokyo.
2. Bassett, E. G. (1951): The anterior lobe of cattle pituitary. I. Quantitative cell type
variationinvariousnormalandabnormalsexualconditions.J.Endocr.7:203214.
3. Crossman, G. (1937): A modification of Mallory connective tissue stain with a
discussionoftheprincipalsinvolved.Anat.Rec.69:3383.
4. Cupps, P. T.; Laben, R. C. and Mead, S. W. (1954): Histology of the pituitary, testis
andadrenalinrelationtoreproductioninthebull.DairySci.37:10741087.
5. Daniel, P.M. and Prichard, M.M.L. (1975) Studies of the hypothalamus and the
pituitary gland with special reference to the effects of transaction of the pituitary
stalk.ActaEndocrinologica,Suppl.201.
6. Das,L.N.(1971):Quantitativeandhistochemicalstudiesonagecorrelatedchanges
incanineandporcinehypophysis.Ph.D.Dissertation.IowaUniversityLibraryAmes.

192

UniversitateadetiineAgricoleiMedicinVeterinarIai
7.

Das, L. N. (1979): Observation on subgross morphology of the hypophysis and


histomorphology of the neurohypophysis of Indian buffalo. Indian J. Anim. Sci. 49:
531542.
8. Dawson,A.B.(1948):Therelationshipoftheparstuberalistotheparsdistalisinthe
hypophysisoftherhesusmonkey.Anat.Rec.102:103122.
9. Dellmann,H.D.,(1971):Veterinaryhistology.LeaandFebiger,Philadlphia.
10. DellmannH.D.andJ.Eurell(1998)TextbookofVeterinaryHistology5thEdition,pp
289291,LippincottWilliamsandWilkins,Philadelphia.

11. Farquhar,M.G.(1971):Processingofsecretoryproductsbycellsofanteriorpituitary
gland.Memoirsofthesocietyforendocrinology.19,79122.
12. Farquhar,M.G.;Skutelsky,E.H.;andHopkins,C.R.(1975):Structureandfunctionof
the anterior pituitary and dispersed cells. In vitro studies. In ultrastucture in
bioologicalsystems.Vol.7theanteriorpituitary,pp83135.EdsA.TixierVidal&M.G.
Farquhar.AcademicPress,NewYork.
13. Foster, C. L. (1971): Relationship between ultrastructure and function in the
adenohypophysisoftherabbit.Mem.Soc.Endocr.19,125146.
14. Fumagalli, G. and Zanini, A. (1985): In cow anterior pituitary, growth hormone and
prolactincanbepackedinseparategranulesofthesamecell.J.cellBio.100:2019
2024.
15. Gasse H. and Schwarz R.(1986): Chromophobe cells and their significance as
folliculostellate cells in the pars distalis adenohypophysis in cattle. Dtsch Tierarztl
Wochenschr.7;93(5):2248.
16. Girod,C.;andLheritier,M.;Trouillas,S.and Dubois,M.P.(1986):Celltypesofthe
parsdistalisofthehedgehog(ErinaceuseuropaeusL.)adenohypophysis:cytological,
immunocytochemicalandultrastructuralstudies.4thyrotropiccells.ActaAnat.127,
4852.
17. Gomez, M.A.; Navarro, J. A.; Gomez, S.; Camara, P.; Gomez, J. C. and Bernabe, A.
(1989): Cytological, immunocytochemical and ultrastructural study of the
adenohypophyseal pars distalis of the kid (Capra hircus): The TSH cell. Anat. Histol.
Embryol.18:305315.
18. Hanstrom,B.(1966):Grossanatomyofthehypophysisinmammals>inthepituitary
gland,Vol.1pp.157.EdsG.W.Harris&B.T.Donovan.Butterworth,London.
19. Harrison, B. and Sharyock, H. (1940): Cytogenesis in the pars distalis of the horse.
Anat.Rec.78:449471.
20. Jubb, K. V., and McEntee, K. (1955): Observations on the bovine pituitary gland. II.
Architectureandcytologywithspecialreferencetobasophilcellfunction.CornellVet.
45:593641.
21. Khatra,G.S.andNanda,B.S.(1981):Agerelatedchangesinthehistomorphologyof
theadenohypophysisofthegoat.Anat.Histol.Embryol.10:238245.
22. Moriarity,G.C.(1973):Adenohypophysis:utltrastructuralcytochemistry(areview).
J.Histochem.Cytochem.21:855894.
23. Moriarty,G.C.(1976):Immunocytochemistryofthepituitaryglycoproteinhormones.
JournalofHistochemistryandCytochemistry,24,846863.
24. Murray,K.;DeLera,J.M.;Astudillo,A.andMcNicol,A.M.(1997):Organizationof
basementmembranecomponentsinthehumanadultandfetalpituitaryglandandin
pituitaryadenomas.VirchowsArch431:329335.

193

Lucrritiinificevol53seriaMedicinVeterinar
25. Nakane, P. F. (1975): Identification of anterior pituitary cells by immuneelectron
microscopyin:theanteriorpituitary(A.TixierVidalandM.G.FARQUHAR,eds.),PP.
4561.AcademicPress,NewYork.
26. Nakane,P.K.;Setalo,G.andMazurkiewicz,J.E.(1977):TheoriginofACTHcellsin
ratanteriorpituitary.Ann.N.Y.Acad.Sci.297:201204.
27. Nishimura, S.; Tabata, S.; Nakamura, Y.; Okano, K. and Iwamoto, H. (2004): Three
dimension architecture and distribution of collagen components in the goat
hypophysis.Anat.Rec.I,277:275286.
28. Parry, D. M.; McMillen, I. C.; Robinson, J. S. and Thorburn, G. D. (1979):
immunocytochemical localization of prolactin and growth hormone in the prenatal
sheeppituitary.Amorphologicalandquantitativestudy.CellTiss.Res.197,501514.
29. Roy, M. K. (1970): Histological and certain histochemical studies on the endocrine
glandsofbuffalo.M.V.ScthesisAgrauniversitylibrary,Agra.
30. Shirasawa, N.; Kihara, H. and Yoshimura, F (1985): Fine structural and
immunohistochemicalstudiesofgoatsadenohyopohysialcells.CelltissueRes.240,
315321.
31. Singh, Y. (1971): Morphogenesis of the pituitary gland in goat. Ph. D. Dissertation.
HaryanaAgriculturalUniversityLibrary,Hissar.
32. Siperstein,E.R. andAllison,V.F. (1965): Finestructureofthecellsresponsiblefor
secretion of Adrenocorticotrophin in the adrenalectomized rat. Endocrinology, 76,
7079.
33. Smith,R.E.(1963):Anelectronmicroscopicstudyoftheadenohypophysisofguinea
pig(abstract).Anat.Rec.154:352.
34. Townsend, J.; Sneddon, C. L. and Tortonese, D. J. (2004): Gonadotroph
heterogeneity,DensityandDistribution,andGonadotrophLactotrophAssociationin
the Pars Distalis of the Male Equine Pituitary Gland. J. neuroendocrinology 16:432
440.
35. Trautmann,A.andFiebiger,J.(1957):Fundamentalofhistologyofdomesticanimals.
Translated and revised by Habel, R. E., and E. L. PIPERSTEIN, Cumstock publishing
associate,Ithaca.
36. VilaPorcile, E. (1972): Lraseau des cellules folliculostellaires et nes follicules d
Iadenohypophysedurat(parsdistalis).Z.Zellforsch.129:328369.
37. Webb, P. D. (1981): The pars distalis (anterior pituitary) sheep: an ultrastructural
study.J.devl.Physiol.3:319332.
38. Webb, P. D. (1982): Ultrastructural study of the development of the pars distalis
(anteriorpituitary)inthefoal.J.Reprod.Fert.Suppl.32:583588.
39. Young, P. A., and Chaplin, R. E. (1975): Some observations on the ultrastructure of
theadenohypophysisofcertaincervidae.J.Zoo.175:493508.
40. Young P. A.; Foster, C. L. and Cameron, E. (1965): Some observations on the
ultrastructureoftherabbit.J.Endocrinology.31:279287.

194

LIGHTANDELECTRONMICROSCOPESTUDIESOFTHEADRENAL
GLANDSOFTHEEGYPTIANGEESE
(ALOPOCHENAEGYPTIACUS)

IhabM.ELZoghby
DepartmentofHistologyandCytology,
FacultyofVeterinarymedicine(Moshtohor),BenhaUniversity,Egypt.
Email:ihabyara@yahoo.com

ABSTRACT:TwentymatureandimmaturemaleandfemaleEgyptiangeese,rangedinagefrom
threetoeighteenmonths,wereusedinthisstudy.TheadrenalglandsoftheEgyptiangeese
werepairedorgansweighingapproximately200250mg(7.5mg/100gbodyweight)andwere
situatedanteriortothekidneysoneachsideofthedorsalaortaandinferiorvenacava.Each
adrenal gland was surrounded from outside by a connective tissue capsule. The interstitial
tissue was rich in blood vessels, collagen, and reticular fibers. The parenchyma cells of the
adrenal gland were arranged in cords especially at subcapsular zone (SCZ). Thin layers of
connective tissue separated these cords and there were two types of cells: acidophilic and
basophilic cells, which intermingle with each other and are separated by sinusoids. The
acidophilic cells were large, polyhedral to columnar in shape, with a highly vacuolated and
lightlystainedacidophiliccytoplasm;whilethecellsofinnercordswerelargecolumnarandare
less vacuolated. Ultrastructurally, these cells could be classified into two types, according to
the amount of lipid droplets and mitochondria: cells that contained numerous lipid droplets
withfewsomewhatlargeglobularmitochondria,andtheothertypewerecellscontainingfew
lipid droplets. Basophilic cells were bluish islets or scattered groups found inbetween the
acidophilic cells. According to the shape of the secretory granules, these cells could be
classified into two types: cells that contained homogenous, polymorphic electron dense
secretory granules, and cells that contained secretory granules of electron dense core
surrounded by hallow electron lucent coat. With the increasing the age of the geese, the
connective tissue capsule became thick and the interstitial tissue was increased. The
acidophilic cells of the inner zone were more vacuolated and less acidophilic and slightly
numerousintheperipheral,acidophilic cellsthan inthoseofthe inner zones.The basophilic
cellsappearedlessvacuolatedandweresmaller.
Keywords:EgyptianGeese,Adrenalgland,LightandTransmissionElectronMicroscope.

INTRODUCTION

The role of the adrenal gland is more difficult to be evaluated in geese than in
mammals.Thedifficultiesarepartlyrelatedtotheinterminglingofthecorticalandmedullary
tissues.Itisgenerallyacceptedthatthecortexofthegeeseadrenalglandcannotbedivided
intothethreedistinctzones(zonaglomerulosa,zonafasciculata,andzonareticularis)asinits
mammalian counterparts (Gulmez, Kocamis, Liman and Kukner, 2004). The adrenal gland is
an indispensable endocrine organ; it is a complex organ concerned with the production of
multiplehormonesandperformsmanykindsofphysiologicalfunctions.Theadrenalglandis
as important in birds as it is in mammals; and the removal of the adrenal gland in birds
eventuallyleadstodeath(Peng,ChenandLiang,2005).Morphologicalstudiesoftheadrenal
glandhavebeenreportedinpigeon
( Bhattacharyya, 1975), Canadian goose (Gulmez et al., 2004), and in Wanxi white geese
195

Lucrritiinificevol53seriaMedicinVeterinar
(Wang, Zhu and Jin, 1999), in fowl (Siller, Teague and Mackenzie, 1975), in quail (Basha,
Vijayaragavan and Ramesh, 2004), in duck (Pearce, Cronshaw and Holmes, 1978) and in
African ostrich chicks (Li Tang, Peng, Wang, Luo, Cheng, Zhang, Sun, Liu, and Song, 2009).
However, little attention was paid especially to the morphology of the adrenal glands in
Egyptiangeese,andtheglandsultrastructureremainsobscure.
Thepurposeofthisstudywastoprovide aconciseaccountofgeneralmorphology,
the cellular and sub cellular structures of the adrenal glands in Egyptian geese, and to
comparethemwiththoseobservationsinotherbirds.Thiswouldhopefullycontributetothe
understandingofthefeaturesoftheadrenalglandinbirdsingeneral,andofadrenalglandsof
Egyptiangeesemorphology,inparticular.

MATERIALSANDMETHODS

TwentymatureandimmaturemaleandfemaleEgyptiangeesewerecollectedfrom
ELQaliubiyaProvinceinEgypt.Eachsexwasrepresentedbytenbirdsthatrangedinagefrom
threetoeighteenmonths.Thebirdswereanaesthetizedusing10%urethane,(1g/kgbody
weight),andweresacrificed.Thepairedadrenalglandswerecarefulldissectedandremoved
fromeachsampleandthencutinto1mm blocks.Tissuesforlightmicroscopywerefixedin
10% neutral buffered formalin solution and Bouins solution for 72 h, then dehydrated,
cleared, and embedded in paraffin. Sections (5 6 microns) were cut and stained with
haematoxylin and eosin and Crossmans trichrome stain and Gomeris reticulin and Periodic
acidSchiffaccordingtothemethodsgivenby(Crossman,1937;Bancroft,Cook,Stirling,and
Turner1994).
The transmission electron microscopy evaluation was conducted at Science collage of
AinShamsUniversityinEgypt.Smallpiecesofadrenalglandwerefixedin2.5%gluteraldehyde
solutionwith0.1Mphosphatebuffer(pH7.4)for2448hours,postfixedin2%osmicacidfor
2hours,dehydratedinascendinggradesofalcoholsandimmersedinpropyleneoxide.Finally,
they were embedded in Epoxy resin. The block was polymerized for 24 hours at 70C. The
ultrathinsections(70nm)werecut,mountedoncoppermeshgrids(No.200)andstainedwith
saturatedsolutionofuranylacetatedihydrateandleadcitrateasdescribedbyChiu,Schmidt
and Prasad (1993). Then, the sections were examined with Jeol JEM 100S Transmission
electronmicroscope(70KV).

RESULTS

TheadrenalglandsoftheadultEgyptiangeesewerepairedorgansweighingapproxi
mately200250mg(7.5mg/100gbodyweight)andweresituatedanteriortothekidneyson
eachsideofthedorsalaortaandinferiorvenacava.Theglandsmeasuredapproximately7.5
mmin lengthand5mminwidth, and intransversesection,itappearedeithertriangularor
ovalwithathicknessrangingfrom3.5to4.5mm.
Theadrenalglandwassurroundedfromoutsidebyconnectivetissuecapsule
(Fig. 1) that contained mainly collagen fibers (Fig. 2), reticular fibers, with very few elastic
elements,bloodvesselsandfibroblasts.Delicateseptawerearisingfromthecapsuleandwere
ramifyingbetweenparenchymatissuesformtheinterstitialtissue.Theinterstitialtissuewas
rich in blood vessels, reticular fibers (Fig. 3) which surrounded both types of cells and
sinusoids. Groups of ganglionic cells are found both outside (Fig. 4) and inside the glands
parenchyma.

196

UniversitateadetiineAgricoleiMedicinVeterinarIai
The parenchyma cells of adrenal gland were arranged in cords especially at
subcapsular zone, two cells wide (Fig. 5), and the cells were orientated so that their
longitudinalaxesweretransversetothecordandthenucleusineachcellwassituatedtoward
theoutermargin.Thinlayersofconnectivetissueseparatedthesecordsandthereweretwo
typesofcells(Fig.5):acidophilicandbasophiliccells.Thesecellsintermingledwitheachother
andwereseparatedbysinusoids(Fig.6).
Thefirsttypeofcells,theacidophiliccells,wasarrangedintwocellswidecordsthat
rested on PAS positive membrane (Fig. 7&7a). At peripheral (subcapsular) zone, these cells
were arranged in clumps forming loops directed opposite to the capsule. These cells were
large,polyhedraltocolumnarwithhighlyvacuolatedandlightlystainedacidophiliccytoplasm.
The cells of inner cords were large columnar cells and are less vacuolated. The nuclei of
acidophiliccellswererounded,apicallylocatedandcontainedoneortwoprominentnucleoli.
Ultrastructurally,theacidophiliccellsappearedcolumnarinshape,theircytoplasmcontained
numerousglobularmitochondria,andmanyribosomes,lipiddroplets(Fig.8),andsmoothand
rough endoplasmic reticulum and their nuclei were spherical, large contained prominent
nucleoliandcoarsechromatin.Thesecellscouldbeclassifiedintotwotypes,accordingtothe
amount of lipid droplets and mitochondria, cells contained numerous lipid droplets (Fig. 8)
withfewsomewhatlargeglobularmitochondriaandtheothertypewerecellscontainingfew
lipiddroplets(Fig.9).
The second type of cells, the basophilic cells, were found in the form of islets that
appeared, with general stain, as bluish islets or scattered groups in between the acidophilic
cells(Fig.10).Theywerepolygonalorroundedinshapewithbasophiliccytoplasmandlarge
sphericalcentrallylocatednucleithatcontainedtwooreventhreenucleoli.Accordingtothe
affinity of the cytoplasm to the stain, the basophilic cells could be differentiated into two
types:cellswithdeeplystainedbasophiliccytoplasmicgranules,andcellswithlightlystained
basophilic cytoplasmic granules (Fig. 10a). The blood sinusoids were found between the cell
cords and islets, and were numerous and wider in the center of the gland than in the
peripheralzoneofthegland.Theperipheralzonewereformedmainlyfromthefirsttypeof
cellswhere,theinnerzonesformedoflargeamountofsecondtypeofcellsandafewoffirst
typeofcells.
TEM revealed that the cytoplasm of the basophilic cells contained rod shaped
mitochondria with tubular cristea, ribosomes, a few rough endoplasmic reticulum, lipid
dropletsandsecretorygranules.Accordingtotheshapeofthesecretorygranules,thesecells
could be further classified into two types: cells that contained homogenous, polymorphic
electron dense secretory granules (Fig. 11), and cells that contained secretory granules of
electrondensecoresurroundedbyhallowelectronlucentcoat(Figs.12&13).
With the increasing the age of the gees, the connective tissue capsule became
thicker, and the amount ofthe interstitialtissues increased (Fig. 14). The acidophiliccells of
the inner zone were more vacuolated and less acidophilic, and the vacuoles were slightly
numerous in the peripheral acidophilic cells than in those cells of the inner zones. The
basophiliccellsappearedlessvacuolatedandsmaller.

FIGURELEGENDS
Fig. 1. Photomicrograph in geese adrenal gland of three months old female showing the
capsule(c),bloodvessel(bv),parenchymaofthegland(p),acidophiliccells(a)andbasophilic
cells(b)H&E.X100.
Fig. 2. Photomicrograph in geese adrenal gland of seven months old female showing the
collagenfibers(cf),bloodsinusoids(bs)andbloodvessels(bv).Crossmanstrichromestain.X
100.

197

Lucrritiinificevol53seriaMedicinVeterinar
Fig. 3. Photomicrograph in geese adrenal glands of seven months old female with Gomoris
reticulin methods showing the distribution of the reticular fiber (rt) among the of the gland
parenchymaX400.
Fig.4.Photomicrographingeeseadrenalglandsoftenmonthsoldfemaleshowingthecapsule
(c),parenchyma(p)andganglioniccells(arrows).H&E.X200.
Fig. 5. Photomicrograph in geese adrenal glands of ten months old female showing the two
cellswidthformingthecordsalso,bloodsinusoid(bs),acidophiliccells(a)andbasophiliccells
(b).H&E.X600
Fig. 6. Transmission electron micrograph from eleven months male of geese adrenal gland
showing blood sinusoid (bs) and thin layer of connective tissue between the cells of the
glands.X2000.
Fig.7.Photomicrographingeeseadrenalglandsofsevenmonthsoldmaleshowingthesepta
betweenthecell(s)and&Fig.7a.showingthepositivemembrane(arrows)ofthesameage
andsex.PAStechniqueX100and1000respectively.
Fig. 8. Transmission electron micrograph from eleven months male of geese adrenal gland
showing the subcapsular columnar cells with the nucleus (s), cell membrane (cm),
mitochondria(m)andlargenumberoffatdroplet(f)intheircytoplasm.X4000.
Fig. 9. Transmission electron micrograph from eleven months male of geese adrenal gland
showingtheothersubcapsularcolumnarcellswithlowfatdroplet(f)intheircytoplasmand
mitochondria(m).X3000.
Fig. 10. Photomicrograph in geese adrenal glands of twelve months old male showing the
distributionofbasophiliccells(b)ininnerzoneoftheglandbetweentheacidophiliccells(a)
alsobloodsinusoids(bs).Fig.10a.Showingthetwotypesofbasophilic,onedeeplystain(d)
andotherlightlystains(l)ofthesameageandsex.H&E.X100and600respectively.
Fig.11.Transmissionelectronmicrographingeeseadrenalglandsoftwelvemonthsoldmale
showing the basophilic cells containing nucleus (n), cell membrane (cm), mitochondria
(arrows)andsecretorygranules(sg).X1000.
Fig.12.Transmissionelectronmicrographingeeseadrenalglandsoftwelvemonthsoldmale
showing the distribution of the two types cells of basophilic cells. Cells contained
homogenous,polymorphicelectrondensesecretorygranules(1)andcellscontainedsecretory
granulesofelectrondensecoresurroundedbyhallowelectronlucentcoat(2).X3000.

198

UniversitateadetiineAgricoleiMedicinVeterinarIai

199

Lucrritiinificevol53seriaMedicinVeterinar

200

UniversitateadetiineAgricoleiMedicinVeterinarIai

Fig. 13. High magnification transmission electron micrograph in geese adrenal glands of
twelvemonthsoldmaleshowingthedifferenceofthesecretorygranulesofbasophiliccells,
homogenous, polymorphic electron dense secretory granules (1) and secretory granules of
electrondensecoresurroundedbyhallowelectronlucentcoat(2)
Fig.14..Photomicrographingeeseadrenalofeighteenmonthsoldfemaleshowingthethick
capsule(c),bloodvessel(bv),subcapsularzone(scz)containingacidophiliccells.H&E.X1000.

DISCUSSION

Thebirdsarequitedifferentfromthemammalsinthattheiradrenalglandsaredistinctly
dividedintoanoutercortex,andamedullathatliesinthecenterofthegland,becauseofthe
scatteredchromaffintissuepervadedwithislandsbetweenthecorticalcells(Luo,1983;and
Li,Luan,YueandZh,2003).Forgeeseinthisstudy,theparenchymatissuewasintermingled
witheachother,whichgenerallyagreeswiththedescriptionofavianadrenalglandprovided
byUnsicker(1973),Aire,(1981)andCronshaw,Holmes,Ely,andRedondo(1989)formallard
duck.
The present study also revealed that the parenchyma of adrenal gland of Egyptian geese
consisted of two types of cells intermingled with eachother. These cells are acidophilic and
basophilic cells. The former cells is largely found in the outer zone of the gland, while the
latter type is concentrated in the center of the gland. These results are in agreement with
SinhaandGhosh(1961)inpigeon,Ghosh(1962)inavian,andwithVyasandJacob(1976)in
Indianavianspecies.
In ostrich chicks, the interrenal tissues and t h e t i s s u e o f t h e medulla
intermingle with eachother,whichgenerallyagrees with the descriptionof other
avian species. Beesides,the adrenalglandsof ostrich chicks appearedto show
largeramount of interrenaltissue(Lietal.,2009)thanotheravianspecies.
Theperipheral zoneoftheadrenalglandisarrangedinclumpsformingloopsreverseto
the capsule, which is lined by columnar cells which are highly vacuolated lightly acidophilic
while those of the inner cords were large and less vacuolated but more acidophilic. As
observedbyT.E.M,therearetwotypesofcellsaccordingtotheamountoflipiddropletsand
mitochondria, these finding are similar to those described by Gulmez, Kocamis, Liman and
Kukner(2004)ingoose(AnserAnser);whileinparakeet,quail,andmynaadrenalitwasthat
the subcapsular zone cells in quail continued inside the gland as a double layered central

201

Lucrritiinificevol53seriaMedicinVeterinar
cords(BhattcharyyaandGhosh,1972).Thecentralcordsconsistedofhighcolumnarcellswith
nucleithatwerelocalizedinadjacentlayerofcells.Inparakeets,theyfoundthatsubcapsular
zone cells were vacuolated and their nuclei were localized adjacent to the basement
membrane. Also, the cytoplasm of internal zone cells consisted of columnar epithelium that
wasdenseandbasophilic.InWanxiwhitegeese,thecellcordsinSCZwerearrangedtightly,
parallel to each other, and were perpendicular to the capsule, which consisted of high
columnarcellswithalightlystainedcytoplasmandacentralnucleus(Wangetal.,1999).The
arrangementofthesecellcordsissimilartothoseofthefascicularzoneinmammalianadrenal
gland.The two types of cells, found in the center of the gland, could be differentiated
according to the affinity of their cytoplasm to the stain: cells with deeply stained basophilic
cytoplasmic granules, and cells with lightly stained basophilic granules. Hodges (1974) has
related the variation of the basophilia of medullary cells to the physiological activity of the
cells.Inthisrespect,TelfordandBridgman(1990)showedthattherearetwocellpopulations
in the medulla of adrenal gland of mammals, about 80% of theswe cells synthesize
epinephrineandtheremainderofthecellsproducenorepinephrine.Inbirds,theinterrenalor
cortical tissue is of mesodermal origin and secretes the corticosteroid hormones, while the
chromaffin or medullary tissue is of ectodermal origin and secretes adrenaline and
noradrenaline(Assenmacher,1972;andMoriandGeorge,1978).Medullarycellsinduckare
characterized by a large population of electron opaque neurosecretory granules. These cells
contain fewer mitochondria and cisternae of endoplasmic reticulum than the cortical cells
Cronshaw,HolmesandLoeb(1974).InJapanesequails,medullarycellshavepolyhedralshape
andcentrallylocatednucleus.Closetothecentrallylocated nucleus,amoderatenumberof
mitochondria, endoplasmic reticulum and well developed Golgi complex can be found.
Catecholaminecontaining secretory granules in both Epinephrine and Norepinephrine cells
are enveloped by a continuous membrane and granules of Epinephrine are much smaller in
sizeandmoreinnumberthanthatinNorepinephrine,induck(Klingbeil,Holmes,Pearce,
and Cronshaw, 1979), in avian (Manna and Ghosh, 1979) and in quail Cigankova, Zibrin,
Boda,andHolovska,2005).
TheresultsofthepresentstudyforAdrenalglandsofEgyptiangeesedemonstratedthat
theusesofspecificidentificationtechniques(e.g.immunocytochemistry)arerequiredtohelp
identifyorverifycertainofcelltypes.

REFERENCES

1. Aire,T.A.(1981):Morphometricstudyoftheavianadrenalgland.J.Anat.131,1923
2. Assenmacher, I. (1972): The peripheral endocrine glands; in I Farner and King, Avian
biology,vol.3,pp.184J287,AcademicPress,NewYork.
3. Bancroft,J.D.;Cook,H.C.;Stirling,R.W.andTurner,D.R.(1994):Manualofhistological
techniquesandtheirdiagnosticapplication.2nd.ChurchillLivingston,Edinburgh,London,
Madrid,Melbourne,NewYork,andTokyo.
4. Basha,S.H.,Vijayaragavan,C.,Ramesh,G.,(2004):Lightandelectronmicroscopicstudies
on the interrenal tissue of the adrenal gland in Japanese quail (Coturnix coturnix
japonica).IndianJ.Anim.Sci.74,10211023.
5. Bhattacharyya,T.K.,(1975):Finestructureoftheinterrenalcellinthequailandthe
pigeon.Anat.Embryol.(Berl.)146,301310.
6. Bhattacharyya,T.K.,&Ghosh,A.(1972):Cellularmodificationofinterrenaltissueinduced
bycorticoidtherapyandstressinthreeavianspecies.Am.J.Anat,133,483494.

202

UniversitateadetiineAgricoleiMedicinVeterinarIai
7. Chiu, W.; Schmidt, M. F., and Prasad, B. V. V. (1993): Teaching electron diffraction and
imagingofmacromolecules.Biophys.J.,64:16101625.
8. Cigankova, V., Zibrin, M., Boda, K., Holovska, K., (2005): Effect of longterm
experimental hypodynamy on the adrenal glands of Japanese quails: an ultrastructural
study.B.Vet.I.Pulawy49,449453.
9. CronshawJ,Holmes,W.N.,Ely,J.A.andRedondo,J.L.(1989):Prenataldevelopmentof
the adrenal gland in the mallard duck (Anas platyrhynchos). Cell Tissue Res. 258(3):593
601.
10. Cronshaw,J.,Holmes,W.N.,Loeb,S.L.,(1974):Finestructureoftheadrenalglandinthe
duck(Anasplatyrhynchos).Anat.Rec.180,385405.
11. Crossman,G.(1937):Amodificationofmalloryconnectivetissuestainwithdiscussionof
theprincipleinvolved.Anat.Rec.69,3338.
12. Ghosh, A. (1962): A comparative study of the histochemistry of the avian adrenals. In
Progressincomparativeendocrinology.Gen.Comp.Endocrinol.Suppl.1:7580.
13. Gulmez, N., Kocamis, H., Liman, N., Kukner, A., (2004): Interrenal cell zonation in the
adrenalglandofthegoose(Anseranser).GrowthDev.Aging68,1118.
14. Hodges,R.D.(1974):Thehistologyofthefowl.(Endocrinechapter,pp464:474).Academic
Press.London,NewYork,SanFrancisco.
15. Klingbeil, C.K., Holmes, W. N., Pearce, R. B., and Cronshaw, J. (1979): Functional
significance of interrenal cell zonation in the adrenal gland of the duck (Anas
platyrhynchos).CellTissueRes.2;201(1):2336.
16. Li,D.X.,Luan,W.M.,Yue,Zh.P.,(2003):AnimalHistologyandEmbryology.JilinPeoples
Press,Changchun,pp.230231(inChinese).
17.
LiTang,Peng,k.,Wang,J.Luo,H.,Cheng,J.,Zhang,G.,Sun,Y.,Liu,H.andSong,H.
(2009):The morphologicalstudyon the adrenalglandof Africanostrich chicks.
Tiss.Andcell41:231238.
18.
Luo, K ., (1983): Anatomy and Histology of Domestic Fowls. Fukien
SciencePublishersPress,Foochow,pp.187189.
19. Manna, C. K, and Ghosh, A. (1979): Comparative cytomorphology of the avian
adrenocorticaltissue.ZMikroskAnatForsch.93(1):10412.
20. Mori,J.G.andGeorge,J.C.(1978):Seasonalhistologicalchangesinthegonads,thyroid
andadrenaloftheCanadagoose(Brantacanadensisinterior).Actaanat.101:304324.
21. Pearce,R.B.,Cronshaw,J.,Holmes,W.N.,(1978):Evidenceforthezonationofinterrenal
tissueintheadrenalglandoftheduck(Anasplatyrhynchos).CellTissueRes.192,363379.
22. Peng, K.M., Chen, Y.X., Liang, Z.S. (2005) Anatomy of the Domestic Animals and Fowls.
HigherEducationPress,Beijing,pp.286.
23. Siller,W.G.,Teague,P.W.andMackenzie,G.M.(1975):Theadrenalcorticomedullary
ratiointhefowl.BrPoultSci.16(4):33542.
24. Sinha, D. and Ghosh, A. (1961): Some aspects of adrenocortical cytochemistry in the
domesticpigeon.Endkrinologie40:270280.
25. Telford,R.I.andBridgman,F.C.(1990):Introductiontofunctionalhistology.1stEd.Harper
andEow,Publishers,NewYork.
26. Unsicker, K. (1973): Fine structure and innervation of the avian adrenal gland. Non
cholinergicnervefibers.Z.Zellforsch.145,557575
27. Vyas, D. K., Jacob, D. (1976): Seasonal study of the adrenal gland of some Indian avian
species.ActaAnat(Basel).95(4):51828.
28. Wang, J., Zhu, L.L., Jin, G.M., (1999): Study on adrenal glands of Wanxi white geese.
J.AnhuiAgric.Techn.Teach.Coll.13,14.

203