Sunteți pe pagina 1din 368

Marius Mihan Marius tefan

Zenovia Olteanu

BIOLOGIE MOLECULAR
Metode experimentale

Lucrare aprut cu sprijinul financiar al grantului CNCSIS-UEFISCSU


PN II-RU 337/2010, contract nr. 117/30.07.2010

Refereni tiinifici:
Prof.univ.dr. Emeritus Vlad Artenie, Universitatea Alexandru Ioan Cuza din Iai
apl. Prof. em. Dr. rer. nat. Roderich Brandsch, Institute of Biochemistry and
Molecular Biology, ZBMZ, Freiburg, Germania

Redactor: Oana BILAN


Coperta: Manuela OBOROCEANU
Tehnoredactor: Florentina CRUCERESCU
ISBN 978-973-703-816-6
Editura Universitii Alexandru Ioan Cuza, 2012
700109 Iai, str. Pinului, nr. 1A, tel./fax: (0232) 314947
http:// www.editura.uaic.ro
e-mail: editura@uaic.ro

Marius Mihan Marius tefan


Zenovia Olteanu

BIOLOGIE
MOLECULAR
Metode experimentale
Prefa de Gheorghe Benga

Editura Universitii Alexandru Ioan Cuza Iai

2012

Descrierea CIP a Bibliotecii Naionale a Romniei


MIHAN, MARIUS, TEFAN, MARIUS, OLTEANU, ZENOVIA
Biologie molecular: metode experimentale / Marius Mihan,
Marius tefan, Zenovia Olteanu; prefa de Gheorghe Benga. Iai:
Editura Universitii Al.I. Cuza, 2012
Bibliogr.
ISBN 978-973-703-816-6
I. Mihan, Marius
II. tefan, Marius
III. Olteanu, Zenovia
577.2

CUPRINS
PREFA de GHEORGHE BENGA ....................................................................... XI
INTRODUCERE ................................................................................................. 1
I. TEHNICI DE BAZ UTILIZATE N LABORATORUL DE BIOLOGIE
MOLECULAR .................................................................................................. 3
I.1Sticlriaiinstrumenteledinmaterialeplastice.....................................................3
Siliconareasticlrieiiainstrumentelordinmaterialeplastice....................................4
Splareaiuscareavaselordelaborator......................................................................5
I.2Msurareavolumelor............................................................................................6
Msurareavolumelorcuajutorulpipetelor..................................................................7
I.3Msurareamaselor.............................................................................................12
Instruciuniprivindutilizareabalaneielectroniceanalitice......................................14
I.4Centrifugarea......................................................................................................15
Instruciuniprivindutilizareacentrifugii.....................................................................16
I.5Tehnicidebazfolositepentrumanipulareamicroorganismelor..........................17
Msuridebiosecuritate..............................................................................................17
Tehnicidesterilizare...................................................................................................21

II. METODE DE CULTIVARE A BACTERIEI ESCHERICHIA COLI ....... 29


II.1MediiutilizatepentrucultivareabacterieiEscherichiacoli.................................30
Mediideculturminimale..........................................................................................31
Mediideculturcomplexe.........................................................................................33
Mediidecultursolide...............................................................................................36
Mediiminimalesolide............................................................................................36
Mediideculturcomplexesolide..........................................................................36
Agardeacoperire.......................................................................................................37
Agardeconservareprinnepare...............................................................................38
Antibioticeutilizatelapreparareamediilordecultur...............................................39

VI

Cuprins

II.2CultivareaE.colipemediisolide........................................................................41
nsmnarealasuprafaamediilordecultursolide................................................42
nsmnareanprofunzimeamediilordecultursolide..........................................44
II.3CultivareaE.colinmediilichide........................................................................47
Inoculareaicultivareafolosindvolumemicidemediu.............................................47
Inoculareaicultivareafolosindvolumemaridemediu............................................48
II.4MonitorizareacreteriibacterieiE.colinmediilelichide....................................48
Determinareadensitiiopticecuajutorulspectrofotometrului...............................49
Determinareadensitiiopticecuajutorulhemocitometrului...................................51
DeterminareanumruluidebacteriiprincultivarenplciPetri...............................52
II.5PstrareaculturilordeE.coli.............................................................................54
Pstrareaprincongelarela80oC................................................................................55

III. PLASMIDE I TULPINI DE ESCHERICHIA COLI UTILIZATE


FRECVENT N BIOLOGIA MOLECULAR ............................................... 57
III.1Vectoriplasmidialiutilizaifrecventningineriagenetic...................................59
Principalelecaracteristicialevectorilorplasmidialiutilizainingineriagenetic......61
VectorulpUC19c....................................................................................................61
VectorulpBlueScriptIISK(+/)...............................................................................62
VectorulpET21a....................................................................................................62
VectorulpMALc5x.................................................................................................62
III.2TulpinideEscherichiacoliutilizatefrecventningineriagenetic.......................63

IV. METODE I TEHNICI FOLOSITE PENTRU IZOLAREA I


PURIFICAREA ADNULUI ........................................................................... 73
IV.1IzolareaADNuluiplasmidial.............................................................................75
IzolareaADNuluiplasmidialfolosindmetodalizeialcaline........................................76
IzolareaADNuluiplasmidialutilizndmetodalizeiprinfierbere...............................81
IV.2IzolareaADNuluigenomic................................................................................84
IzolareaADNuluigenomicdinbacterii......................................................................85
IzolareaADNuluigenomicdinplante........................................................................90
IzolareaADNuluidinesuturianimale.......................................................................95
IV.3PurificareaADNuluidinsoluiiapoase...........................................................100

Cuprins

VII

IV.4IzolareaADNuluidingelurideagaroz...........................................................103
IV.5PstrareaADNuluipurificat...........................................................................107

V. AMPLIFICAREA ENZIMATIC IN VITRO A


ACIZILOR NUCLEICI .................................................................................. 111
V.1AmplificareaenzimaticinvitroaADNului sau PCR.........................................113
AmplificareaenzimaticinvitroafragmentelordeADNdepnla4kb................116
V.2Criteriipentrualegereaoligonucleotideloramors(primer)..............................126

VI. DETERMINAREA CONCENTRAIEI ACIZILOR NUCLEICI N


SOLUIE ........................................................................................................ 133
V.1DeterminareaconcentraieiacizilornucleiciprinspectroscopieUVVIS.............133
DeterminareaconcentraieiacizilornucleiciprinspectroscopieUV........................134
V.2.Determinareaconcentraieiacizilornucleiciprinfluorimetrie..........................138
Determinareaconcentraieiacizilornucleicifolosindbromuradeetidiu.................139
Determinareaconcentraieiacizilornucleici folosindmetodacufoliedinplastic....141
DeterminareacantitiideADNpegelurideagaroz..............................................143

VII. SEPARAREA ELECTROFORETIC A ADNULUI ......................... 147


VII.1Electroforezaclasicngelurideagaroz.......................................................150
VII.2.SeparareaADNprinelectroforezngeldepoliacrilamidcugradientdeagent
denaturant............................................................................................................157
VII.3DeteciaADNuluingelurideagaroz...........................................................168
DeteciaADNuluifolosindbromuradeetidiu.........................................................169
DeteciaADNuluingelurideagarozfolosindcoloranidetipSYBR.....................171
DeteciaADNuluingelurideagarozfolosindalbastruldemetilen......................173

VIII. PURIFICAREA PROTEINELOR PRIN CROMATOGRAFIE DE


AFINITATE FA DE METALE ................................................................. 177
VIII.1Strategiideclonareagenelornvectorideexpresie......................................181
VIII.2Identificareacondiiiloroptimedesupraexpresieaproteinelorrecombinate.186

VIII

Cuprins

VIII.3PurificareaprinIMACaproteinelorrecombinatencondiiinative................192
VIII.4PurificareaprinIMACaproteinelorrecombinatencondiiidenaturante.......198
VIII.5Determinareamaselormolecularenativeutilizndcromatografiadefiltrareprin
gel(GF)..................................................................................................................200
Determinareamaselormolecularenativeutilizndcromatografiadefiltrarepringel
..................................................................................................................................206
CalibrareacoloaneideGFicalculareamaselormolare..........................................208

IX. DETERMINAREA CONCENTRAIEI PROTEINELOR .................. 215


IX.1DeterminareaconcentraieiproteinelorprinspectroscopieUV........................216
IX.2Metodecolorimetricededeterminareaconcentraieiproteinelor...................219
MetodaLowry...........................................................................................................219
MetodaBradford......................................................................................................224
MicrometodaBradforddedozareaconcentraieiproteinelor............................227
Metodacuacidbicinchoninic(BCA).........................................................................229
MicrometodaBCAdedozareaproteinelor.........................................................231
MacrometodaBCAdedozareaproteinelor........................................................232
IX.3Realizareacurbelordeetalonareiprelucrareadatelor...................................234

X. SEPARAREA ELECTROFORETIC A PROTEINELOR ................... 241


X.1Electroforezanativaproteinelornsistemdiscontinuu...................................243
X.2Electroforezaproteinelorncondiiidenaturante(SDSPAGE)...........................253
X.3Deteciaproteinelorseparateprinelectroforezapegeluridepoliacrilamid.....257
Colorareagelurilordepoliacrilamidnvedereaevidenieriiproteinelor................257
ColorareacuComassieBrilliantBlueR250.........................................................259
Colorareacuargintagelurilordepoliacrilamid.................................................261
X.4Fotografiereagelurilorianalizaimaginilor.Stabilireamaseimolecularerelative
.............................................................................................................................264

XI. EVIDENIEREA IMUNOLOGIC A PROTEINELOR TEHNICA


WESTERNBLOT ......................................................................................... 273
XI.1Obinereaanticorpilorpoliclonali.Tehnicideimunizare..................................273

Cuprins

IX

ObinereaanticorpilorpoliclonalifolosindadjuvantulFreund.................................275
XI.2Imunoblotingul..............................................................................................278
Electrotransferulproteinelorpemembranensistemsemiuscat..........................279
Imunodeteciaproteinelortransferatepemembranedenitroceluloz...................282

XII. METODE COMPUTAIONALE DE STUDIU A PROTEINELOR . 285


XII.1FiiereFASTAioperaiisimplecusecvene....................................................286
XII.2Bazededatecuinformaiidespreproteine.....................................................290
Bazededatecusecveneproteice...........................................................................291
Bazededatecustructuriproteice............................................................................294
XII.3IdentificareafuncieiproteinelornecunoscutecuajutorulprogramuluiBLAST295
XII.4Modelareacomputaionalastructuriitridimensionaleaproteinelor............308
Programe,servereimetaservere............................................................................311
Aplicaiialemetodelordemodelareastructurilortridimensionaleaproteinelor..316
XII.5Modelareacomputaionalacomplecilorliganziproteine............................316
Problematicaandocriimoleculare..........................................................................317
Evaluarearezultatelorobinuteprinandocaremolecularcomputerizat..............324
Aplicaiialeandocriimoleculare.............................................................................324

ANEX ........................................................................................................... 335

PREFA
Biologia molecular poate fi definit cel mai simplu ca fiind un
concept de studiere a materiei vii prin prisma relaiei structur-funcie la
nivel molecular. Este un concept ce a revoluionat tiinele biologice i
medicale ncepnd cu a doua jumtate a secolului XX. Dar pe lng noile
cunotine teoretice, revoluia produs de biologia molecular a fost
posibil i datorit introducerii de noi metode i tehnici de laborator.
Toate lucrrile experimentale de biologie molecular implic utilizarea
unor astfel de metode i tehnici. De aici rezult i necesitatea unor cri
care s-i ajute pe cercettori n munca zilnic la masa de laborator
(bench). n Romnia nu cunosc s se fi scris o asemenea carte, care s
descrie toate metodele i tehnicile de biologie molecular la modul practic
de lucru.
Efortul tinerilor colegi Marius Mihan, Marius tefan i Zenovia
Olteanu de a redacta o astfel de carte mi se pare de aceea deosebit de
ludabil i rezultatul este o lucrare de mare valoare.
Merit subliniat c sunt descrise pe de o parte unele tehnici de
baz n laboratorul de biologie molecular (dar i n laboratoarele de
analize biomedicale, de biochimie i chimie clinic, de microbiologie, de
biofizic etc), precum: pregtirea sticlriei i a vaselor de laborator,
msurarea volumelor, a maselor, centrifugarea, tehnicile de baz folosite
pentru manipularea microorganismelor, metodele de determinare a
proteinelor, separarea electroforetic a proteinelor, tehnici de imunologie
(obinerea de anticorpi policlonali, imunodetecia proteinelor transferate
pe membrane de nitroceluloz) etc. Pe de alt parte sunt descrise metode
specifice biologiei moleculare: plasmide i tulpini de Escherichia coli
folosite frecvent n biologia molecular, izolarea ADN-ului, purificarea
proteinelor prin cromatografie de afinitate, metode computaionale de
studiu a proteinelor.
Descrierea metodelor i a tehnicilor este foarte bine fcut, de la
principiile teoretice, avantajele i limitele, pn la descrierea concret a
materialelor necesare i a modului de lucru.
n acest fel cartea este un valoros ghid pentru lucrul n laborator,
att pentru nceptori (studeni, masteranzi, doctoranzi), ct i pentru
avansai (cercettori postdoctorali, cadre didactice din nvmntul

Prefa

XII

superior, tehnicieni de laborator cu experien) i trebuie s se afle pe


masa de lucru din laborator (ori aproape de masa de lucru).
Fiind eu nsumi autor al unei cri pentru laboratoarele clinice (Ion
Manta, Mircea Cucuianu, Gheorghe Benga, Adriana Hodrnu, Metode
biochimice n laboratorul clinic, Editura Dacia, Cluj-Napoca, 1975) i al
unui ndrumtor pentru lucrrile practice cu studenii (Gh. Benga -Ed.ndrumtor pentru lucrrile practice de biologie celular i molecular,
Editura Carpatica, Cluj-Napoca, 1997) mi dau bine seama de dificultatea
scrierii unei astfel de cri i apreciez efortul foarte mare depus de autori.
Recomand clduros lucrarea scris de cei trei autori tuturor
categoriile de cititori (i utilizatori) menionai mai sus, dar i celor care
nu aplic sau nu vor aplica niciodat metodele i tehnicile de laborator ale
biologiei moleculare, dar care vor s se orienteze n metodele i tehnicile
laborator de biologie molecular, spre a nelege mai bine aplicaiile
acesteia n tiinele medicale i biologice.
Cluj-Napoca, 12 noiembrie 2012
Prof. Univ. Dr. Dhc. Gheorghe Benga
Membru corespondent al Academiei Romne
Membru Titular al Academiei de tiine Medicale din Romnia
Medic specialist de Laborator Clinic, Chimist,
Medic primar de Genetic Medical,
Laboratorul de Explorri Genetice I al Spitalului Clinic Judeean de Urgen Cluj-Napoca
Profesor Univ. Asociat, Disciplina de Biologie Celular i Molecular,
Universitatea de Vest Vasile Goldi din Arad
Preedinte al Filialei Cluj a C.R.I.F.S.T.
(Comitetul Romn pentru Istoria i Filosofia Stiinei i Tehnicii) al Academiei Romne
Honorary Associate, School of Molecular Biosciences,
University of Sydney, Australia
Past-President, Societatea Romn de Medicin de Laborator
Past-President, Balkan Federation of Clinical Laboratory
E-mail: gbgbenga@gmail.com

INTRODUCERE
Dac biologia clasic s-a dezvoltat i a atins nivelul de cunoatere
de astzi prin folosirea cu precdere a studiilor observaionale, biologia
modern se bazeaz n mod fundamental pe noiunea de experiment i
pe procesul de experimentare n scopul dobndirii de noi informaii i
cunotine. Experimentul are rolul de a verifica validitatea unei ipoteze
formulate n prealabil utiliznd pentru aceasta un ansamblu de tehnici i
metode. Reuita unui experiment, adic formularea fr echivoc a unei
concluzii legate de ipoteza de testat, depinde n mare msur de
capacitatea cercettorului de a concepe un model de studiu, de a alege i
de a utiliza n mod corect una sau mai multe metode de investigaie.
Majoritatea lucrrilor de profil din ultima decad, care descriu
metode i tehnici de laborator utilizate n biochimie, enzimologie,
biologie celular i molecular, au fost realizate cu precdere n scopuri
didactice, fiind utilizate ca suport pentru prelegerile teoretice. Metodele
experimentale sunt reduse frecvent la un set de indicaii simple i clare pe
care studenii s le poat urma cu uurin. Lipsa unor informaii generale
despre principiile teoretice i aplicabilitatea metodelor dau ns o fals
impresie de imuabilitate a protocoalelor experimentale, ceea ce face ca
experimentatorul s fie pus deseori n dificultate atunci cnd trebuie s
adapteze metoda n mod specific.
n acest context, lucrarea de fa se dorete a fi un ghid detaliat al
unor metode-cheie, utilizate frecvent n biologia molecular, concentrndu-se nu numai pe simpla formulare a unor protocoale experimentale, ci
i pe explicarea principiilor din spatele fiecrei metode n scopul
precizrii spectrului de aplicabilitate i a rezultatelor scontate. Fiecare din
metodele prezentate au fost testate i utilizate de ctre autori n cadrul
Laboratorului de Biochimie i Biologie Molecular al Facultii de
Biologie, Universitatea Alexandru Ioan Cuza din Iai. Modul de
prezentare este adaptat specificului fiecrei metode n parte, cuprinznd n
general cinci seciuni distincte:
1.
principiul metodei ofer informaii legate de bazele teoretice ale
metodei utilizate;
2.
avantaje furnizeaz informaii legate de domeniul de aplicabilitate al metodei, rezultatele ateptate corelate cu date legate de
sensibilitate, randament etc.;

Biologie molecular. Metode experimentale

3.

limitri prezint condiiile n care metoda nu poate fi aplicat,


dezavantajele sau inconvenientele sale n comparaie cu metode
similare;
4.
materiale necesare conine lista complet a reactivilor, materialelor, instrumentelor i aparaturii necesare, alturi de instruciuni
legate de prepararea reactivilor i indicaii privind potenialele
pericole care pot s apar n laborator;
5.
mod de lucru ofer indicaii simple i precise privind suita de
operaii care trebuie efectuate pentru obinerea rezultatelor finale.
Prin coninut i structur lucrarea se adreseaz cu precdere
studenilor care frecventeaz studiile masterale i de doctorat, cercettorilor post-doctorat, cadrelor didactice care coordoneaz lucrrile de
disertaie i doctorat, tinerilor angajai n activitatea de cercetare, care fac
primii pai n domeniul tiinelor vieii, precum i specialitilor din
domenii conexe. Prin aspectele teoretice abordate, prezenta lucrare poate
fi util i cercettorilor i tehnicienilor cu experien care au deprins i
utilizeaz aceste protocoale de ani buni, dar care nu au acordat suficient
importan cunotinelor teoretice care fundamenteaz metodele
respective. Puini vor fi cei care vor parcurge aceast lucrare de la un
capt la altul, dar sperm c o vom regsi pe masa de lucru a ct mai
multor cercettori, funcionnd ca un ghid pentru selecia, dezvoltarea i
adaptarea protocoalelor experimentare la nevoile specifice ale
experimentatorului.
Mesajul final pe care aceast lucrare dorete s l transmit este c
reproducerea n detaliu a fiecrei etape a unui protocol nu este suficient
pentru utilizarea cu succes a acestuia. Este mai important poate de
cunoscut cum funcioneaz, n ce condiii se poate utiliza, ce informaii
poate i ce informaii nu poate s ofere o anumit metod, precum i care
sunt parametrii critici de care trebuie s se in cont la utilizarea unei
tehnici experimentale.
Mulumim anticipat celor care vor transmite sugestii, observaii i
recomandri care s conduc la completarea acestei lucrri n scopul
mbuntiri unei viitoare ediii.
Autorii

I. TEHNICI DE BAZ UTILIZATE N


LABORATORUL DE BIOLOGIE
MOLECULAR
I.1 Sticlria i instrumentele din materiale
plastice
n laborator se prefer, n general, utilizarea instrumentelor i a
vaselor din sticl. Sticla utilizat pentru confecionarea vaselor de
reactivi, a flacoanelor i paharelor este una termorezistent care,
suplimentar, poate fi supus unui tratament special n vederea obinerii
unei suprafee cu aderen i reactivitate chimic ct mai reduse. Dei
exist numeroase denumiri sub care se comercializeaz sticla din care
sunt confecionate instrumentele i vasele de laborator, ea are la baz
acelai amestec de borosilicai de sodiu, magneziu, aluminiu i zinc
descris pentru prima dat de chimistul german Friedrich Otto Schott.
nainte de utilizare, indiferent de tipul de sticl din care sunt confecionate, toate instrumentele din sticl trebuie sterilizate.
Plasticul este un material care prezint o serie de avantaje majore
comparativ cu sticla. n primul rnd este mult mai uor, nu se sparge i
este mult mai ieftin de produs. Din aceste motive, instrumentele de
laborator din materiale plastice au reuit s le nlocuiasc aproape complet
pe cele din sticl. Unele instrumente din plastic pot fi sterilizate nainte de
utilizare, ns aceast operaie este posibil numai pentru anumite tipuri
de materiale plastice (pentru detalii, consultai sub-capitolul Tehnici de
sterilizare, pagina 21). De asemenea, dei recipientele din materiale
plastice (fie c este vorba despre polipropilen, policarbonat sau Teflon)
sunt inerte din punct de vedere chimic, nainte de a le pune n contact cu
acizi, baze tari sau solveni organici este absolut necesar verificarea
compatibilitii lor chimice cu aceste substane (Tabelul A8 din Anex
pentru o compatibilitate general, specificaiile productorului sau
site-ul web http://www.coleparmer.com/TechInfo/ChemComp.asppentru
compatibilitatea specific).

Biologie molecular. Metode experimentale

Siliconarea sticlriei i a instrumentelor din


materiale plastice
Toate operaiile de baz din laborator pot fi efectuate cu
instrumente i vase sterilizate, fr ca fenomenele de adsorbie la
suprafaa sticlei sau a plasticului s genereze probleme. n cazul
aplicaiilor sensibile, ce presupun manipularea unor cantiti foarte mici
de acizi nucleici sau proteine este ns necesar acoperirea suprafeelor cu
un strat subire de silicon. Pentru aceasta, se procedeaz dup cum
urmeaz:
1. se amplaseaz obiectele ce trebuie siliconate ntr-un exsicator de
dimensiuni mari; exicatorul se racordeaz la o pomp cu vid prin
intermediul unui tub prevzut cu robinet i a unei capcane de
vapori;
2. pe o sticl de ceas amplasat n interiorul exicatorului se pipeteaz
1 ml diclor-dimetil-silan;

Diclor-dimetil-silanul este toxic, volatil i foarte


inflamabil; toate operaiile se vor realiza n nia
chimic.
3. se pornete pompa i se aplic vid pn cnd diclor-dimetil-silanul
ncepe s fiarb; apoi se deconecteaz pompa prin rotirea
robinetului conector i se apas butonul de oprire; n interiorul
exsicatorului trebuie s se menin vid; este esenial ca pompa de
vid s fie deconectat n momentul n care diclor-dimetil-silanul
ncepe s fiarb; n caz contrar, vaporii pot ptrunde n pomp i
pot distruge iremediabil garniturile acesteia;
4. dup evaporarea complet a diclor-dimetil-silanului (1-2 ore) se
deschide exicatorul n nia chimic; instrumentele din sticl astfel
tratate se incubeaz apoi, timp de dou ore, ntr-o etuv la
temperatura de 180oC; instrumentele din materiale ce nu permit
sterilizarea se spal cu ap distilat.
n cazul instrumentelor sau vaselor de dimensiuni mari, acestea se
pot silicona prin imersarea sau splarea cu o soluie 5% de diclor-dimetilsilan n cloroform sau heptan. Dup evaporarea solventului, pe suprafee

Tehnici de baz

se depune un strat de diclor-dimetil-silan. n funcie de natura materialului


din care sunt confecionateinstrumentele astfel tratate vor fi apoi splate
foarte bine cu ap distilat sau vor fi incubate timp de dou ore ntr-o
etuv la temperatura de 180oC.

Splarea i uscarea vaselor de laborator


Rezultatele analizelor de laborator, n special ale celor analitice,
depind n mare msur de modul n care se cur vasele utilizate. Vasele
de laborator trebuie splate imediat dup utilizare pentru a se evita
evaporarea solvenilor, formarea crustelor i a depozitelor care
ngreuneaz mult procesul de splare.
n general, vasele din sticl se spal foarte bine cu ap cald i
detergent, dup care se cltesc din abunden (de cel puin trei ori) cu ap
de robinet i apoi de trei ori cu ap distilat nainte de a fi puse la uscat.
La final, dac vasul este bine splat, apa distilat se scurge ntr-un strat
continuu pe pereii acestuia, fr a lsa picturi sau dre. Dei utilizarea
detergenilor este indicat, acetia nu trebuie folosii n exces, deoarece
numeroase reacii chimice sau biologice sunt afectate de prezena lor.
n cazul n care sticlria prezint urme persistente de grsime,
acestea sunt ndeprtate cu ajutorul solvenilor organici (aceton, hexan
etc.), procedur urmat obligatoriu de splare i cltire cu ap distilat. n
cazul precipitatele aderente, acestea se ndeprteaz cu ajutorul unor perii
cu dimensiuni adecvate (nu se utilizeaz baghete, srme sau spatule care
pot zgria sticla), cu abur sau prin procedee chimice.
Splarea chimic se poate realiza cu diverse soluii precum: acid
azotic 1 M, aqua regia (o parte HNO3 concentrat i trei pri HCl
concentrat), acid fluorhidric concentrat sau amestec sulfocromic.
Amestecul sulfocromic se prepar prin dizolvarea a 90 g K2Cr2O7
n 100 ml ap distilat, la cald. Soluia rezultat se rcete, dup care se
adaug cu atenie, n fir subire, sub agitare 900 ml H2SO4 concentrat.
Amestecul sulfocromic se poate folosi la mai multe splri, pn cnd
culoarea se schimb sensibil, virnd spre verde.

Biologie molecular. Metode experimentale

Amestecul sulfocromic este extrem de coroziv.


Pipetele din sticl se spal prin umplerea lor complet cu soluie
coninnd detergent, urmat de cltirea de trei ori cu ap de robinet, apoi
cu ap distilat (de cel puin trei ori). Pentru ndeprtarea depunerilor de
pe pipete, acestea se introduc complet i se menin pentru cteva ore n
amestec sulfocromic, dup care se spal cu ap de robinet i se cltesc cu
ap distilat.
Dup splare, vasele se usuc, fie aezate cu gura n jos pe un
suport, fie n etuv. Vasele din sticl pot fi uscate n etuv, la temperaturi
cuprinse ntre 105oC i 110oC timp de cel puin o or. n trecut se
considera c vasele folosite n volumetrie nu trebuie uscate la temperatur
deoarece se pot decalibra. Diverse studii au demonstrat ns c acest lucru
nu se ntmpl.
Vasele nu vor fi terse n nici un caz n interior, deoarece rmn
scame sau pot fi murdrite din nou prin atingere cu mna; de asemenea,
este interzis uscarea vaselor la flacr. O modalitate utilizat pentru a
grbi uscarea este cltirea vaselor, dup splare, cu aceton, dup care
acestea sunt suflate cu aer cald. Acetona utilizat la splarea sticlriei
poate fi colectat i recuperat prin distilare.

I.2 Msurarea volumelor


Deoarece majoritatea reaciilor chimice i toate reaciile
enzimatice au loc n mediu apos, capacitatea de a msura corect un volum
de lichid este un element esenial, absolut necesar pentru realizarea
experimentelor i msurtorilor n laborator. Manipularea lichidelor este
preferat n detrimentul manipulrii substanelor solide deoarece are
cteva avantaje practice, dintre care amintim doar dou:
1. lichidele, spre deosebire de substanele solide, pot fi foarte uor
divizate n fragmente foarte mici, lucru ce permite dozarea i
msurarea lor precis;
2. reaciile chimice dintre dou lichide miscibile au loc n toat masa
amestecului, viteza de reacie fiind astfel foarte mare.

Tehnici de baz

Pentru realizarea soluiilor titrate i aplicarea metodelor de dozare


volumetric se utilizeaz o serie de vase din sticl cu rezistene chimic i
termic mare (baloane cotate, biurete, pipete gradate etc.) curate i perfect
uscate. Pentru pregtirea soluiilor de concentraii normale sau molare se
folosesc baloane cotate. Volumul marcat pe balon este atins atunci cnd
meniscul lichidului (soluiei) este tangent inferior la inelul marcat pe gtul
balonului. Pentru citire exact, balonul trebuie ridicat sau cobort, pn
privirea persoanei care face msurtoarea se afl n dreptul inelului de
marcaj. Poziia balonului trebuie s fie vertical.

Msurarea volumelor cu ajutorul pipetelor


Cel mai utilizat instrument pentru msurarea foarte precis a
volumelor de lichid n laborator este pipeta. Aceasta poate fi: mecanic
sau din sticl.
Pipetele mecanice care pot msura volume cuprinse ntre 0,2 i
1000 l poart numele de micropipete, iar cele care permit msurarea
volumelor mai mari poart numele de macropipete. De la inventarea lor n
anul 1960 de ctre dr. Hanns Schmitz (Marburg, Germania), a aprut un
numr foarte mare de tipuri de pipete mecanice, clasificarea lor fiind
extrem de dificil. Cele mai importante sisteme de clasificare in cont de
volumul msurat (pipete mecanice cu volum fix i pipete mecanice cu
volum variabil) sau de numrul de probe msurate simultan (pipetele
monocanal permit prelevarea i msurarea unei singure probe, pipetele
multicanal permit prelevarea i msurarea a 12 probe simultan).
Elementele care alctuiesc o pipet mecanic monocanal cu volum
variabil sunt prezentate n Figura 1.
Instruciuni generale privind manipularea pipetelor mecanice:
1. pipetele se menin n permanen cu vrful n jos pentru a
prentmpina ptrunderea lichidului n tija pipetei;

Biologie molecular. Metode experimentale

A
A1

F
A2
C

D
E
FIGURA 1. Pipet mecanic monocanal cu volum variabil.
A buton pentru pipetare cu trei poziii; A1 eticheta pipetei; A2 striaii pentru
manipularea prin rotire a butonului (doar la anumite modele); B ecran i buton
pentru stabilirea volumului msurat; C tij; D prghie pentru detaarea vrfului;
E vrf detaabil din material plastic; F buton de comand pentru detaarea
vrfului(dup Tropschung, 2008) (1).

2.

3.

vrful pipetei trebuie s fie bine fixat pe tija pipetei pentru a se


asigura etaneitatea; dup pipetare, vrfurile utilizate se detaeaz
prin apsarea butonului F (Figura 1) i se colecteaz n vase speciale;
vrfurile nu se arunc n chiuvet sau la coul de gunoi;
n cazul pipetelor cu volum variabil, volumul maxim este nscris n
partea superioar, pe butonul pentru pipetare (Figura 1, A1);
stabilirea volumului de pipetat se face prin rotirea butonului B
(Figura 1) ntr-un sens sau n cellalt pn la afiarea volumului dorit
pe ecranul pipetei (Tabelul 1); nu este permis rotirea butonului peste
volumul maxim admis, aceast operaiune putnd conduce la
decalibrarea pipetei;

Tehnici de baz

TABEL 1. Corespondena volum de pipetat vrf de utilizat i stabilirea volumului


de pipetat
Pipeta
Intervalul de volum utilizabil
(minim-maxim)

20
2-20 l

200
20-200 l

1000
200-1000 l

Culoarea vrfului de utilizat

galben

galben

albastru sau
alb

12,5 l

125 l

0,75 ml

Mod de citire

Pipeta poate fi utilizat n dou moduri distincte, dup cum


urmeaz.
a. Pipetarea obinuit presupune parcurgerea a ase etape distincte
(Figura 2):
1. amplasarea unui vrf convenabil n pipet (conform Tabelului 1)
se realizeaz prin aplicarea unei fore suficient de mari pentru a
realiza etaneitate perfect;
2. evacuarea aerului din pipet se realizeaz n afara lichidului,
prin apsarea pn la punctul 2 a pistonului pentru pipetare
(Figura 2, A);
3. aspirarea lichidului n pipet vrful pipetei se introduce n lichid
i pistonul pentru pipetare este eliberat lent pn la punctul 1
(Figura 2, B);
4. evacuarea lichidului din pipet vrful pipetei se lipete de
peretele vasului n care se face pipetarea (sau se introduce n
lichid) i pistonul pentru pipetare se apas lent pn la punctul 2
(Figura 2, C);
5. evacuarea complet a lichidului din pipet cu vrful pipetei n
lichid, pistonul pentru pipetare se apas lent pn la punctul 2
(Figura 2, D); lichidul a fost complet evacuat dac n vrful
pipetei apare o bul de aer;

Biologie molecular. Metode experimentale

10

6. vrful pipetei se scoate din lichid i pistonul pentru pipetare este


eliberat lent pn la punctul 1; se apas butonul pentru eliberarea
vrfului i ciclul se reia pentru o nou pipetare (Figura 2, E).

1
2
3

FIGURA 2. Msurarea volumelor cu ajutorul pipetelor mecanice


A evacuarea aerului din pipet; B aspirarea lichidului n pipet; C, D evacuarea
lichidului din pipet; E revenirea n poziia iniial

b. Pipetarea inversat se folosete la pipetarea soluiilor vscoase i


presupune parcurgerea acelorai ase etape, cu deosebirea c evacuarea
aerului se face apsnd pistonul pentru pipetare pn la punctul 3.

Tehnici de baz

11

Aspirarea lichidului se face prin eliberarea pistonului pentru pipetare pn


la punctul 1. n acest mod n pipet ptrunde o cantitate mai mare de
lichid dect volumul fixat. Evacuarea lichidului din pipet se face prin
apsarea pistonului pn la punctul 2, dup care vrful coninnd o
cantitate mic de lichid se scoate din vas i se arunc.
Pipetele din sticl permit msurarea volumelor mari, de ordinul
mililitrilor, ns, exist i modele ce permit msurarea volumelor sub 1
ml. Pipetele din sticl se mpart n dou tipuri distincte: pipete cotate i
pipete gradate.
Pipetele cotate permit transferarea unui volum fix de lichid prin
umplerea pn la semnul marcat n partea superioar i golirea lor sub
influena gravitaiei, fr a elimina ultima pictur din vrf. Acest tip de
pipete au, n partea superioar,marcat inscripia TD (engl. to deliver = a
elibera) i trebuie separate de cele care sunt inscripionate TC (engl. to
contain = a conine). n cazul acestora din urm, umplerea se face identic
dar golirea pipetei se realizeaz prin eliminarea complet a lichidului,
incluznd ultima pictur. Un tip intermediar de pipete, cu dou marcaje
de umplere n partea superioar, poate fi utilizat n ambele moduri
(marcajul superior modul TC, marcajul inferior modul TD).
Pipetele gradate permit transferarea unor volume variabile de
lichid prin umplerea lor pn la semn i golirea sub influena gravitaiei
pn la volumul dorit. n funcie de gradaiile din vrf, mai frecvent
utilizate sunt dou tipuri distincte de pipete gradate:
pipete serologice, gradate pe toat lungimea lor, inclusiv n
vrful pipetei; ultima gradaie este una intermediar fa de volumul
maxim al pipetei;
pipete Mohr, gradate pn aproape de vrf; ultima gradaie este
chiar volumul maxim al pipetei.
Indiferent de tipul pipetei gradate, n laborator este indicat
utilizarea tehnicii de pipetare prin diferen. Aceasta const n umplerea
pipetei pn la un volum mai mare dect cel care urmeaz a fi utilizat i
golirea pn la un semn intermediar. De exemplu, pentru pipetarea unui
volum de 10 ml se va folosi o pipet de 25 ml care se va umple pn la
diviziunea 15 i se va goli pn la diviziunea 5. Diferena ntre cele dou
diviziuni reprezint volumul dorit 10 ml.
Umplerea pipetelor se va efectua ntotdeauna folosind o par din
cauciuc sau un pipetor i niciodat gura. Pentru a msura cu pipeta un
anumit volum, se ataeaz para de cauciuc n captul pipetei, se apas

Biologie molecular. Metode experimentale

12

valva notat cu A i concomitent se evacueaz aerul din par prin


strngerea acesteia (Figura 3). Pentru a aspira lichid, vrful pipetei se
introduce n lichid i se apas valva S pn cnd lichidul depete
gradaia dorit. Se terge vrful pipetei cu hrtie de filtru, apoi se apas
valva E i se las s se scurg lichidul pn cnd marginea inferioar a
meniscului este tangent la semn. Se aduce apoi pipeta astfel nct vrful
ei s ating peretele inferior al vasului n care urmeaz s se introduc
lichidul msurat i se las s se scurg liber prin apsarea valvei E. La
cteva secunde dup golire se trage uor vrful pipetei de-a lungul
peretelui vasului. Dup utilizare, pipetele se spal i se aeaz n stative
speciale, cu vrful n jos.
Par de cauciuc

Valva A armare

Valva Ssuciune

10 ml

Pipet

E
Lichid de
msurat
Valva Eevacuare

FIGURA 3. Folosirea parei din cauciuc pentru msurarea unor volume de lichid
folosind pipete din sticl

I.3 Msurarea maselor


Balana i cntarul sunt unele dintre cele mai frecvent utilizate instrumente de laborator. Dei termenii de balan i cntar au devenit sinonimi, exist o serie de diferene de ordin tehnic ntre cele dou instrumente.

Tehnici de baz

13

Masa i greutatea. Atunci cnd se utilizeaz o balan sau un


cntar se are n vedere determinarea masei unui obiect sau a unei
substane. Termenul de mas se refer la cantitatea de materie dintr-un
obiect i se msoar n grame (cu multiplii i submultiplii corespunztori).
Greutatea unui obiect, se refer la fora gravitaional pe care o exercit
acel obiect i se msoar n newtoni (N). Deoarece fora gravitaional
este similar (dar nu identic) pe toat suprafaa Pmntului, un obiect de
o mas dat va avea aproape aceeai greutate indiferent de locaia unde
este msurat. Diferenele dintre mas i greutate sunt mult mai vizibile n
afara cmpului gravitaional al Pmntului. Dac acelai obiect este
msurat pe Terra i pe Lun, masa sa va fi constant, dar greutatea pe
Lun va fi doar 1/6 din greutatea sa pe Pmnt (2).
O balan mecanic funcioneaz prin compararea masei
obiectului cu cea a unei greuti calibrate. Aceasta face ca, indiferent unde
este cntrit obiectul, pe Lun sau pe Pmnt, o balan cu dou talere
ofer aceeai valoare a masei.
Un cntar prevzut cu un singur taler msoar fora pe care o
exercit un obiect asupra talerului. Cntarul msoar n mod direct
greutatea unui obiect dup care transform valoarea obinut n mas
printr-un simplu calcul matematic. Valoarea pentru masa unui obiect
msurat pe Pmnt cu ajutorul unei balane electronice va fi total diferit
de cea msurate pe Lun, diferena fiind dat de fora gravitaional.
Micile variaii ale forei gravitaionale ce pot aprea (de exemplu la
modificarea altitudinii) fac s fie absolut necesar calibrarea balanei
electronice n locaia unde se dorete a fi utilizat.
Balana electronic este un instrument electronic de msurare a
maselor, esenial n orice laborator. Balana electronic nu este propriu-zis
o balan, ci un cntar electronic performant care poate msura greutatea
unui obiect amplasat pe taler i transform valoarea n mas. Deoarece
denumirea de balan electronic este cea ncetenit, o vom utiliza ca
atare n cele ce urmeaz.
Datorit gamei largi de utilizare a balanelor, au fost inventate
numeroase tipuri constructive, fiecare adaptat la o aplicaie specific.
Pentru alegerea n mod judicios a tipului de balan util ntr-un laborator,
este absolut necesar cunoatere semnificaiei parametrilor de funcionare
ai acesteia. Dintre acetia, cei mai importani sunt:
1. capacitatea masa maxim ce poate fi amplasat pe taler;
2. precizia valoarea celei mai mici diviziuni ce poate fi citit de pe
ecranul balanei;

14

Biologie molecular. Metode experimentale

3. repetabilitatea (reproductibilitatea) capacitatea balanei electronice


de a afia aceeai valoare la amplasarea repetat a aceluiai obiect pe
taler.
n general, ntr-un laborator sunt necesare cel puin dou balane,
deoarece aceti parametri funcionali fac imposibil utilizarea unei
singure balane n toate situaiile n care se dorete msurarea maselor. Cel
mai frecvent este utilizat combinaia dintre o balan de capacitate mare
(600 g) i precizie mic (0,1 g) i o balan analitic cu capacitatea de
110 g i precizia de 0,0001 g.
Obiectele de cntrit nu se amplaseaz direct pe talerul balanei.
Din acest motiv, pentru msurarea maselor sunt necesare alturi de
balan i alte materiale, precum sticle de ceas, hrtie i vase de cntrire
de unic folosin. Acestea din urm sunt, n general, confecionate din
material plastic non-absorbant, care nu produce electricitate static,
proprietate extrem de important cnd se dorete cntrirea unor cantiti
foarte mici de substan.

Instruciuni privind utilizareabalanei


electronice analitice
Msurarea maselor cu ajutorul balanei electronice analitice se
realizeaz prin parcurgerea urmtoarelor etape:
1. se pornete balana i se ateapt pn cnd pe ecranul acesteia
este afiat 0,0000 g;
2. se deschide geamul de protecie al balanei i se amplaseaz vasul
de cntrire pe talerul balanei;
3. se nchide geamul de protecie al balanei i se ateapt pn cnd
semnul specific pentru atingerea echilibrului este afiat; acest
semn difer de la un productor la altul i din acest motiv se recomand consultarea manualului balanei pentru identificarea acestuia;
4. se apas butonul de 0 (TARE) pn cnd pe ecranul balanei este
afiat 0,0000 g;
5. se deschide geamul de protecie al balanei i se adaug cu atenie,
folosind o spatul de dimensiuni adecvate, substana de cntrit n
vasul de cntrire;

Tehnici de baz

15

6. se nchide geamul de protecie al balanei;


7. se ateapt pn cnd semnul specific pentru atingerea echilibrului
este afiat, dup care se citete valoarea masei;
8. se ia vasul de cntrire coninnd substana cntrit de pe taler;
dac se dorete utilizarea repetat a vasului de cntrire, este
indicat ca acesta s nu fie manipulat direct cu mna, deoarece
amprentele modific masa vasului.

I.4 Centrifugarea
Procesul care implic utilizarea forelor centrifugale pentru
sedimentarea amestecurilor neomogene poart numele de centrifugare i
se realizeaz cu ajutorul unui dispozitiv numit centrifug. Acionat n
general de un motor electric (dei exist modele care sunt acionate
manual), centrifuga rotete eprubetele de centrifug n jurul unui ax fix,
aplicnd o for perpendicular pe acesta. Datorit acceleraiei centripete
apare fenomenul de sedimentare, substanele mai dense migrnd spre
fundul eprubetei iar cele mai uoare spre gura acesteia. Centrifuga este un
echipament care nu trebuie s lipseasc din dotarea nici unui laborator.
Pentru a descrie corect operaia de centrifugare i pentru a asigura
repetabilitatea ei n orice laborator, este necesar precizarea forei de
cetrifugare (RCF, msurat n g). Aceast for corespunde unei anumite
viteze (n rotaii pe minut, rpm) pentru o centrifug dat i un anumit
rotor. Folosind o alt centrifug sau aceeai centrifug dar cu un alt rotor,
pentru aceeai vitez de rotaie se va obine o alt for de centrifugare.
Relaia care descrie legtura dintre fora de centrifugare i viteza de
rotaie este:

unde: RCF fora de centrifugare;


r distana de la axul rotorului pn la fundul eprubetei aflat n
poziie normal n timpul centrifugrii;
rpm viteza de rotaie a rotorului msurat n rotaii pe minut
(rpm).

16

Biologie molecular. Metode experimentale

O modalitate alternativ de transformare a vitezei de centrifugare


n for de centrifugare i viceversa este oferit de nomogramele din
Anex, Figurile A1i A2.
Toate centrifugrile descrise n acest manual presupun utilizarea
unor microeprubete de centrifug de tip Eppendorf i a rotoarelor
corespunztoare. n general, toate rotoarele construite pentru
microeprubetele de tip Eppendorf au valori apropiate pentru r (aprox.
9,2 cm). De asemenea, o centrifugare descris n acest manual ca fiind la
vitez maxim reprezint o centrifugare efectuat la 14.000rpm.

Instruciuni privind utilizarea centrifugii


Datorit numrului mare de modele i tipuri constructive de
centrifugi existente, formularea unor instruciuni universal valabile este
extrem de dificil. Din acest motiv, n cele ce urmeaz este prezentat
modul de utilizare a centrifugiiHettich Rotina 420R. Dei au caracter
particular, instruciunile pot fi uor aplicate la orice alt model de
centrifug prin simpla consultare a manualului de utilizare.
Pornirea se realizeaz prin operarea butonului ON/OFF plasat n
partea inferioar a corpului centrifugii, deschiderea capacului fiind
posibil prin apsarea butonului rou STOP/OPEN abia dup apariia
mesajului OPEN. nchiderea capacului se efectueaz prin apsarea uoar
a acestuia.
Stabilirea parametrilor de centrifugare:
1. timp se apas butonul TIME i apoi prin manevrarea butonului
rotativ se stabilete valoare dorit n minute; prin apsarea repetat
a butonului TIME se selecteaz unitile de msurare a timpului
(ore, minute, secunde); Apsarea butonului START conduce la
memorarea valorii stabilite;
2. viteza de rotaie se apas butonul RPM apoi, prin manevrarea
butonului rotativ, se stabilete valoarea dorit n rotaii pe minut;
apsarea butonului START duce la memorarea valorii stabilite;
dac se dorete stabilirea forei de centrifugare n rcf, se folosete
butonul RCF;

Tehnici de baz

17

3. Temperatura se apas butonul ToC apoi, prin manevrarea


butonului rotativ, se stabilete valoare dorit n grade Celsius;
apsarea butonului START conduce la memorarea valorii stabilite.
Centrifugarea se realizeaz:
1. numai dup echilibrarea corect a eprubetelor cu probe, plasate pe
diagonal; nu se accept diferene mai mari de 0,5 g ntre poziiile
diagonale (1-3, 2-4);
2. toate dispozitivele port-probe trebuie s fie prevzute cu adaptoare
pentru eprubete;
3. capacele galbene trebuie nfiletate pe dispozitivele port probe.

Capacele prezint o garnitur circular care poate fi


uor pierdut
Pornirea centrifugii:
1. se realizeaz prin apsarea butonului START; centrifugarea poate
fi oricnd oprit prin apsarea butonului rou STOP/OPEN;
2. la epuizarea timpului stabilit pentru centrifugare, centrifuga se
oprete automat; emiterea unui semnal sonor mpreun cu afiarea
mesajului OPEN indic faptul c poate fi deschis capacul prin
apsare butonul rou STOP/OPEN).

I.5 Tehnici de baz folosite pentru manipularea


microorganismelor
Msuri de biosecuritate
Utilizarea microorganismelor n laboratorul de biologie molecular
presupune respectarea unor reguli minime de biosecuritate. Aceste reguli se
refer la un set de msuri necesare att pentru protecia personalului care
lucreaz, ct i pentru prevenirea contaminrii culturilor microbiene,
mediilor de cultur i soluiilor stoc cu microorganisme nedorite. Deoarece
scopul oricrui cercettor este s cultive microorganisme (celule procariote

18

Biologie molecular. Metode experimentale

sau eucariote) fr introducerea altor organisme strine, aplicarea n


laborator a msurilor de biosecuritate este esenial pentru acurateea i
reuita experimentelor.
Trebuie avut n vedere de la nceput faptul c un mediu de lucru
complet steril nu exist (3). Cu toate acestea, pot fi aplicate o serie de msuri
simple care pot reduce riscul contaminrii cu microorganisme:
1. spaiile de lucru n condiii sterile trebuie plasate departe de
ferestre deschise, instalaii de aer condiionat, ventilatoare etc.;
2. depozitarea deeurilor biologice trebuie fcut n containere
speciale, nchise, depozitate n alte spaii dect cele n care se
lucreaz;
3. curarea i dezinfectarea suprafeelor de lucru nainte de
utilizare;
4. limitarea pe ct posibil a duratei de timp ct recipientele n care
se afl culturile microbiene sunt lsate fr dop sau capac;
5. pstrarea plcilor Petri cu capacul nchis atta vreme ct este
posibil;
6. sterilizarea eficient a anselor de nsmnare precum i a tuturor
instrumentelor care vin n contact cu microorganismele;
7. evitarea contactului instrumentelor i mediilor sterile cu aerul
expirat.
n principiu, aplicarea unor standarde nalte de curenie poate
elimina riscul contaminrii zonelor de lucru. Praful i murdria trebuie
ndeprtate cu regularitate; suprafeele de lucru trebuie splate imediat dup
utilizare cu soluie hipoclorit de sodiu 10% sau cu soluii speciale de
dezinfectare disponibile n comer; utilizarea dezinfectanilor organici
precum alcool etilic 70% este, n general, mai puin eficient din cauza
faptului c etanolul se poate evapora nainte de a steriliza suprafeele.
Persoanele care lucreaz n laborator trebuie s se spele pe mini de mai
multe ori pe zi, n special nainte de a efectua manipularea culturilor
microbiene; de asemenea trebuie s poarte halat de protecie, mbrcmintea
de exterior fiind pstrat n dulapuri situate n afara laboratorului.
Cel mai simplu mod de a crea un mediu relativ steril n laborator
presupune utilizarea
becului de gaz (arztorului Bunsen). Acest
echipament funcioneaz prin arderea continu a unui gaz inflamabil, de
obicei gazul metan. Principiul utilizrii sale const n crearea unei zone de
aer cald n jurul flcrii care reduce viabilitatea organismelor i suspend
particulele de praf, permind lucrul n condiii sterile. De asemenea,

Tehnici de baz

19

datorit flcrii ce degaj o temperatur de 1200-1500oC, becul de gaz poate


fi utilizat i pentru sterilizarea anselor de nsmnare, a gurii eprubetelor i
baloanelor din sticl, flambarea lamelor din sticl etc.
Prevenirea contaminrii culturilor microbiene sau a reactivilor se
poate realiza mult mai eficient prin utilizarea hotei cu flux de aer laminar.
Acest echipament furnizeaz o zon de lucru cu aer steril, mpiedicnd
ptrunderea aerului cu microorganisme i impuriti din laborator.
Sterilizarea aerului introdus n zona de lucru se realizeaz prin filtrare,
utiliznd filtre speciale HEPA (engl.High-Efficiency Particulate Air
filtre cu o eficien ridicat de filtrare), care pot reine 99,97% din
particulele de praf, polen, fungi, bacterii cu dimensiuni mai mari de 0,3 m
la un debit de 85 litri/min.
Aerul din ncpere este mai nti prefiltrat pentru a ndeprta
particulele cu dimensiuni mari care pot bloca filtrele HEPA dup care este
filtrat, ndeprtndu-se toate bacteriile. Dup filtrare, aerul ajunge n zona de
lucru sub forma unei perdele uniforme, la o vitez constant, mpiedicnd
ptrunderea microorganismelor din ncpere n interiorul hotei. n funcie de
orientarea perdelei de aer steril, hotele cu flux de aer laminar pot fi mprite
n dou tipuri constructive distincte:

hote cu flux de aer laminar orizontal (Figura 4, A), care


asigur o foarte bun protecie a obiectelor de pe suprafaa de lucru dar nu i
a operatorului, aerul potenial contaminat cu microorganismele manipulate
fiind direcionat ctre acesta;

hote cu flux de aer laminar vertical (Figura 4, B), ce asigur


o foarte bun protecie att a obiectelor de pe suprafaa de lucru ct i a
operatorului; n acest caz aerul potenial contaminat cu microorganismele
manipulate este filtrat i apoi eliminat.
Oricare ar fi tipul constructiv de hot, blocarea filtrelor HEPA sau
ntreruperea perdelei de aer filtrat permit introducerea de microorganisme
contaminante n interiorul zonei de lucru.

Biologie molecular. Metode experimentale

20

Filtru HEPA

Filtru HEPA

Filtru HEPA
Perete de
protecie din
sticl

Suprafaa de
lucru

Pre-filtru
Suprafaa de
lucru

FIGURA 4. Tipuri constructive de hote cu flux de aer laminar: orizontal (A) i


vertical (B)(dup Bykowski i Stevenson, 2008 (3))
Instruciuni de utilizare a hotei cu flux de aer laminar:
1. nainte de nceperea lucrului se recomand ndeprtarea bijuteriilor
de pe mini, legarea prului la spate i mbrcarea halatului de
protecie.
2. Se spal minile i se utilizeaz mnui de unic folosin; suprafaa
exterioar a mnuilor se acoper cu soluie dezinfectant i se
freac bine pentru o sterilizare eficient nainte de introducerea
minilor n hot.
3. Minile se pstreaz n interiorul zonei de lucru fr a atinge pe
ct posibil prul, faa sau hainele; pericolul de contaminare crete
de fiecare dat cnd se ating recipiente sau alte obiecte nesterile;
din acest motiv se recomand repetarea periodic a procedurii de
dezinfectare a mnuilor.
4. n vederea utilizrii, hota cu flux de aer laminar trebuie pornit cu
cel puin 30 de minute nainte de nceperea efectiv a lucrului.
5. nainte de utilizare, hota trebuie curat i dezinfectat; zona de
lucru se acoper cu alcool etilic 70% sau ali cu dezinfectani
disponibili n comer i se terge cu erveele care nu las puf.
6. Orice obiect ce urmeaz a fi introdus n zona de lucru, chiar i
recipiente din material plastic sau sticlrie considerate sterile

Tehnici de baz

21

trebuie dezinfectate prin tergerea suprafeelor exterioare cu alcool


etilic 70%; se ndeprteaz ntotdeauna ambalajele sau pungile n
care sunt mpachetate pipetele, ansele de unic folosin, plcile
Petri etc. la marginea zonei de lucru nainte de a fi introduse n hot.
7. Pentru reducerea contaminrii se pstreaz tot timpul n interiorul
hotei un set de pipete sau alte instrumente necesare cu care se
lucreaz exclusiv n aceast incint.
8. Se organizeaz spaiul de lucru astfel nct s se lase o zon liber
n centru i s existe acces la toate obiectele din interior; se evit
n acest fel pericolul producerii unor accidente precum i cel al
contaminrii recipientelor lsate deschise n interior.
9. n cazul scurgerii unor lichide contaminate se cur imediat zona
respectiv cu ap distilat steril i alcool etilic 70% sau cu ali
dezinfectani, dup care se reia lucrul.
10. Nu se plaseaz obiecte mari n dreptul orificiilor prin care iese
aerul filtrat n interiorul zonei de lucru; se evit astfel blocarea
fluxului de aer precum i contaminarea cu microorganisme.
11. La terminarea lucrului, se ndeprteaz toate obiectele inutile i se
cur suprafeele cu alcool etilic 70%.
12. Nu se pstreaz n interiorul hotei resturi, culturi vechi, cutii
goale, caiete, cri, pixuri etc.
13. Majoritatea hotelor cu flux de aer laminar sunt dotate cu lmpi UV
care pot fi pornite la sfritul lucrului n scopul sterilizrii
suprafeelor interioare; nu se las n acest timp culturi cu
microorganisme n interiorul hotei; se recomand ca pe toat
durata sterilizrii cu UV n ncpere s nu se afle nicio persoan.

Tehnici de sterilizare
Desfurarea experimentelor n condiii de asepsie presupune
sterilizarea distrugerea complet sau eliminarea tuturor organismelor
viabile de pe instrumentele sau din reactivii utilizai. Exist i reactivi care
nu necesit sterilizare: etanol, fenol, detergeni concentrai sau reactivi sterili
furnizai de ctre productori i care pot fi utilizai direct.
Exist mai multe tehnici de sterilizare care pot fi folosite cu succes
n laborator, bazate pe utilizarea temperaturilor sau presiunilor ridicate,

22

Biologie molecular. Metode experimentale

substanelor chimice (lichide sau gaze), radiaiilor sau pe ndeprtarea fizic


a microorganismelor.
Sterilizarea anselor de nsmnare se realizeaz prin nclzire la
rou n flacra unui bec de gaz (4). Se introduce firul metalic al ansei n
partea superioar a flcrii unde temperatura degajat este maxim i se
menine pn la nroire. nainte de utilizare trebuie avut n vedere rcirea
complet a ansei pentru a se evita distrugerea microorganismelor ce
urmeaz a fi nsmnate. Pentru rcire se pstreaz ansa n apropierea
becului de gaz; nu se sufl peste ans, nu se agit i nu se atinge de obiecte
sau suprafee nesterile, deoarece exist pericolul de contaminare. Ansa se
utilizeaz imediat dup sterilizare, iar dup folosire se sterilizeaz din nou.
Tehnica poate fi utilizat i pentru sterilizarea altor obiecte metalice:
spatule, ace de sering etc.
Flambarea se utilizeaz pentru sterilizarea unor obiecte din sticl
(gtul baloanelor i eprubetelor, lame din sticl etc.) i const n trecerea
rapid i repetat prin flacra becului de gaz.
Msuri de securitate
Deoarece exist riscul apariiei unor incendii sau al unor arsuri,
utilizarea becului de gaz impune o serie de msuri de siguran:
1. flacra becului se las aprins doar ct timp se lucreaz; uneori
flacra albastr este greu de observat, motiv pentru care se
recomand s nu se lase becul de gaz deschis, nesupravegheat;
2. deoarece arsurile reprezint cel mai frecvent accident care poate s
apar n laborator, se recomand ca faa, minile, prul i hainele
s fie inute departe de flacra becului de gaz;
3. temperatura flcrii atinge frecvent 1500oC, motiv pentru care
obiectele din sticl sau metalice introduse n flacr se nclzesc
foarte repede; toate aceste obiecte au nevoie de timp ca s se
rceasc, astfel nct s poat fi folosite n siguran;
4. este absolut necesar ca substanele inflamabile sau materialele
combustibile s fie inute departe de flacra becului de gaz;
5. se recomand dotarea laboratorului cu stingtoare de incendiu i
verificarea periodic a instalaiei de gaz.
Sterilizarea cu ajutorul etuvei
Etuva poate fi utilizat pentru sterilizarea unor obiecte din sticl

Tehnici de baz

23

(eprubete, plci Petri, pahare, baloane etc.), metalice sau alte obiecte care nu
se topesc la temperaturi cuprinse ntre 121oC i 180oC cldur uscat.
Deoarece cldura uscat are o putere mai mic de penetrare n celulele vii,
fiind necesar un timp mai mare de transfer, sterilizarea cu ajutorul etuvei se
realizeaz timp de dou ore la temperatura de 160oC sau o or la
temperatura de 180oC. Procedeul nu poate fi utilizat n cazul lichidelor sau
al obiectelor din cauciuc sau material plastic. Cu toate acestea, sterilizarea
cu ajutorul etuvei prezint unele avantaje: nu determin ruginirea obiectelor
metalice; inactiveaz enzimele care degradeaz ARN-ul (ARN-aze)
permind astfel sterilizarea sticlriei folosite n experimentele n care sunt
implicai acizii nucleici; poate fi utilizat pentru sterilizarea pulberilor sau
altor substane afectate de sterilizarea prin autoclavare.
Autoclavarea
Aceast tehnic de sterilizare se bazeaz pe aciunea vaporilor de
ap aflai sub presiune i presupune utilizarea autoclavului. Prin autoclavare
pot fi sterilizate rapid majoritatea obiectelor, mediilor de cultur i
substanelor care nu sunt termolabile. Vasele sau mediile de cultur care
conin solveni, substane chimice volatile sau corozive (fenol, acid
tricloracetic, eteri, cloroform) sau orice fel de izotopi radioactivi nu pot fi
autoclavate sub nicio form.
Autoclavarea se realizeaz la temperatura de 121oC, presiunea de
aproximativ 1 atm, timp de 20-30 minute, condiii care permit distrugerea
tuturor formelor de via, inclusiv a endosporilor bacterieni. Timpul i
temperatura de sterilizare pot varia n funcie de cantitatea i tipul
materialelor care urmeaz a fi autoclavate. Astfel, n anumite situaii
(obiecte cu suprafa care nu permite un transfer termic rapid sau cu o
capacitate mic de penetrare la vaporii de ap, volume de mediu mai mari
de un litru, tuburi de centrifug acoperite cu folie de aluminiu,
microorganisme patogene) se vor crete timpul, temperatura i presiunea de
autoclavare (30-60 min, 134oC, aproximativ 2 atm).
Prin aceast tehnic este posibil sterilizarea unor obiecte din
material plastic, mai precis a celor din polipropilen i policarbonat.
Obiectele din polietilen sau polietilen de nalt densitate nu pot fi
autoclavate. Pentru siguran se urmresc simbolurile de identificare a
materialului prezente pe obiectele respective: PP = polipropilen;
PC = policarbonat; PE = polietilen; HDPE = polietilen de nalt
densitate.

24

Biologie molecular. Metode experimentale

Modul de utilizare a autoclavului:


1. Se introduce n autoclav ap distilat pn la nivelul indicat.
2. Obiectele de sterilizat se introduc n coul din material inoxidabil, care
se acoper cu hrtie pentru a se evita umezirea lor de ctre apa de
condesare a vaporilor de pe capac; toate materialele trebuie ambalate n
pungi speciale de autoclavare sau n tuburi din oel inoxidabil;
materialele uscate se ambaleaz n folie de aluminiu pentru a se evita
umezirea i recontaminarea lor dup sterilizare; recipientele goale din
sticl se umplu cu ap, 3-5 cm, pentru a se evita spargerea fundului; nu
se aglomereaz interiorul autoclavului pentru a se permite o sterilizare
eficient.
3. Lichidele se sterilizeaz separat n recipiente din sticl; se recomand
utilizarea unor recipiente din sticl termorezistent (borosilicat) avnd
un volum dublu fa de volumul lichidului ce urmeaz a fi sterilizat, iar
capacul nu se strnge foarte tare; se evit astfel pericolul scurgerii sau
exploziei datorat presiunii ridicate din timpul autoclavrii.
4. Se nchide etan capacul autoclavului prin strngerea mnerului.
5. Se selecteaz temperatura i timpul de sterilizare (sau n cazul unui program presetat numrul acestuia) i se apas butonul Start; temperatura
din interior va ncepe s creasc, ceea ce duce la fierberea apei,
formarea de vapori i creterea presiunii interioare; temperatura i
presiunea sunt meninute la valori constante pe toat durata sterilizrii;
la finele autoclavrii nclzirea apei este oprit, temperatura din interior
scade ceea ce duce la condensarea vaporilor de ap i la scderea
presiunii interioare; cnd presiunea ajunge la 0 atm procesul de
sterilizare se ncheie.
6. Se ateapt semnalul sonor de sfrit al procesului de sterilizare i se
deschide cu grij capacul autoclavului.
Pentru optimizarea autoclavrii n laborator pot fi utilizate dou
tipuri de cicluri de evacuare a vaporilor de aer:
1. ciclu de evacuare rapid se utilizeaz pentru toate materialele
uscate cum ar fi sticlrie, vrfuri de pipete automate, tuburi de centrifug
etc.; n acest caz, la sfritul ciclului de sterilizare se deschide o valv
care permite evacuarea rapid a vaporilor de ap astfel nct presiunea
interioar se egalizeaz rapid cu cea atmosferic;
2. ciclu de evacuare lent se utilizeaz pentru lichide i previne

Tehnici de baz

25

riscul apariiei unor explozii sau al scurgerilor datorate fierberii; n acest


caz, la finele autoclavrii vaporii de ap sunt evacuai lent ceea ce permite
lichidelor foarte fierbini s se rceasc treptat.
Pentru a se verifica dac autoclavarea a decurs cu succes,
materialele sau recipientele se marcheaz cu o hrtie indicatoare special
care conine substane chimice ce i modific culoarea la o temperatur
egal cu cea la care are loc sterilizarea.
Msuri de securitate
Deoarece funcionarea autoclavului se bazeaz pe aciunea
vaporilor de ap aflai sub presiune, exist riscul apariiei unor explozii
sau a unor arsuri severe. Din aceste motive se impun anumite msuri care
s limiteze aceste riscuri:
1.
n timpul folosirii autoclavului se recomand utilizarea halatului de
protecie, ochelarilor de protecie i a mnuilor termorezistente;
2.
cele mai multe accidente pot apare n momentul deschiderii
capacului; din acest motiv, dup ncheierea sterilizrii, se ateapt
scderea presiunii la 0 atm nainte de deschidere;
3.
se recomand ca deschiderea capacului s fie fcut lent, lsnd
iniial o fant prin care s poat iei vaporii de ap;
4.
lichidele sterilizate sunt foarte fierbini, chiar dac autoclavarea s-a
ncheiat, existnd n continuare pericol de explozie sau de scurgere; se recomand lsarea capacului deschis timp de 10-20min
pentru o rcire adecvat i apoi scoaterea recipientelor.
Filtrarea
Mediile de cultur complexe i unii compui precum antibioticele,
glucidele, aminoacizii sau vitaminele nu pot fi sterilizate prin autoclavare
deoarece sufer procese de denaturare n prezena cldurii. Pentru a putea fi
sterilizate se apeleaz la filtrare, procedeu prin care se ndeprteaz fizic
organismele vii, sporii etc. Filtrarea nu este o metod de sterilizare perfect,
deoarece virusurile i chiar unele bacterii pot traversa pereii filtrelor. Cea
mai mare parte a organismelor vii este reinut de filtre cu dimensiuni medii
ale porilor de 0,45 m. Bacteriile pot trece prin astfel de filtre i, prin
urmare, pentru ndeprtarea lor este necesar utilizarea unor filtre cu
dimensiuni ale porilor de 0,22 m. Unele bacterii (de exemplu, speciile
genului Leptospira) pot strbate aceste filtre, ns ele necesit condiii
speciale de cultivare i din acest motiv nu prezint o problem din punct de
vedere al contaminrii n laboratorul de biologie molecular.

26

Biologie molecular. Metode experimentale

Pentru a uura filtrarea, n laborator se utilizeaz elemente filtrante


care pot fi ataate la seringile din material plastic (Figura 5). Astfel de filtre
de unic folosin, cu dimensiuni diferite ale porilor, sunt disponibile n
comer.
Filtrarea se realizeaz de obicei n hota cu flux de aer laminar sau n
apropierea flcrii becului de gaz pentru a se reduce riscul recontaminrii
lichidelor sterilizate.

FIGURA 5. Elemente filtrante de


unic folosin utilizate pentru
sterilizarea soluiilor
Sterilizarea cu radiaii ultraviolete
Radiaiile ultraviolete (UV) pot fi utilizate pentru distrugerea
microorganismelor prin alterarea ADN-ului, permind sterilizarea
suprafeelor de lucru precum i a atmosferei din camera n care se lucreaz.
Aceste radiaii nu pot penetra prin sticl, prin urmare nu pot fi utilizate
pentru sterilizarea coninutului unor recipiente din sticl.
Msuri de securitate
Lumina ultraviolet este duntoare pentru om, determinnd
orbirea sau arsuri ale pielii. Prin urmare, se recomand s nu se utilizeze
lmpile cu lumin UV cnd exist persoane n ncpere i s nu se
priveasc direct n lumina UV fr ochelari de protecie speciali.

Tehnici de baz

27

Bibliografie
1. Tropschung, M. (2008) Praktikum der Biochemie und Molekular
Biologie I&II, p. 6.
2. Guzy, M. (2008) Weight measurement in Current Protocols Essential
Laboratory Techniques (Gallagher, S., Wiley, E., Eds.), p. 1.2.11.2.11. John Wiley & Sons, Inc., Hoboken, NJ, USA.
3. Bykowski, T., Stevenson, B. (2008) Aseptic Techniques in Current
Protocols Essential Laboratory Techniques (Gallagher, S., Wiley,
E., Eds.). John Wiley & Sons, Inc., Hoboken, NJ, USA.
4. Dunca, S., Ailiesei, O., Nimian, E., Stefan, M. (2001) Microbiologie
aplicat, p. 300. Ed. Tehnopress, Iai.

II. METODE DE CULTIVARE A


BACTERIEI ESCHERICHIA COLI
Bacteria Escherichia coli este cel mai bine studiat microorganism,
fiind utilizat ca model experimental n diferite ramuri ale biologiei (1).
Descoperit n anul 1885 de ctre medicul Theodor Escherich, E. coli
(Figura 6) este un bacil Gram negativ, facultativ anaerob i nesporulat, cu
un cromozom circular format din trei milioane perechi de baze i cu
dimensiuni de aproximativ 2 m lungime i 0,5 m lime.

FIGURA 6. Escherichia coli imagine


electronomicroscopic
E. coli poate crete pe medii minimale care conin un compus cu
carbon (de exemplu glucoza care servete att ca surs de carbon ct i ca
surs de energie) i sruri care asigur necesarul de azot i fosfor. Bacteria
poate crete mai rapid pe medii mbogite care conin aminoacizi,
precursori ai nucleotidelor, vitamine sau ali metabolii pe care celulele ar
trebui s le sintetizeze n alte condiii.
Se dezvolt n intestin, fcnd parte din microbiota normal,
natural intestinal, jucnd roluri importante: surs de vitamine B12 i K;
mpiedic colonizarea intestinului cu bacterii patogene. Exist i situaii
cnd E. coli devine patogen: atunci cnd contamineaz tractul urinar
(este cea mai important bacterie n etiologia infeciilor urinare); cnd
trece prin peretele intestinal i ptrunde n abdomen; n situaia

30

Biologie molecular. Metode experimentale

ptrunderii n organism a unor tulpini virulente.


Aceast bacterie este utilizat n prezent att n laborator ct i la
nivel industrial pentru obinerea unor cantiti mari de ADN, proteine sau
metabolii datorit ritmului su rapid de cretere i a faptului c tehnicile
de manipulare genetic sunt foarte bine puse la punct. Un exemplu n
acest sens l constituie modificarea genetic realizat de compania Eli
Lilly n anul 1982 prin care gena uman care codific insulina a fost
introdus n genomul E. coli, permind obinerea i izolarea ntr-o
manier simpl a acestui hormon.
Cu foarte puine excepii, cea mai mare parte a tulpinilor de E. coli
utilizate n laboratoarele de biologie moleculare sunt derivate din tulpina
K-12 (2).

II. 1 Medii utilizate pentru cultivarea bacteriei


Escherichia coli
Mediile de cultur artificiale sunt substraturi nutritive (lichide sau
solide, organice sau anorganice) ce pot asigura dezvoltarea i multiplicarea
microorganismelor n condiii de laborator (3). Mediile se folosesc pentru
izolarea i pstrarea sub form de culturi pure a microorganismelor, precum
i pentru identificarea speciilor n funcie de proprietile lor fiziologice. Din
aceste motive, ele trebuie s fie ct mai asemntoare cu substraturile
naturale. Dac necesitile nutritive ale E. coli sunt bine cunoscute, cele ale
altor bacterii variaz foarte mult, fiind uneori necesare medii de cultur i
condiii de cretere care depind de fiecare specie n parte. Dei eforturile de
mai bine de un secol ale oamenilor de tiin s-au finalizat prin cultivarea in
vitro a mai multor bacterii de interes (n special cele patogene), se apreciaz
n prezent c doar 1% din totalul speciilor bacteriene pot fi cultivate n
laborator (1).
n funcie de compoziie, exist mai multe medii de cultur uzuale
folosite pentru cultivarea bacteriei E. coli:
1. medii minimale conin minimul de substane nutritive necesare
creterii celulelor n absena aminoacizilor; acest tip de medii au o
compoziie bine definit, ingredientele fiind adugate n concentraii precise;
ele conin n general o surs de carbon i energie care poate fi reprezentat
de un glucid (de exemplu glucoza) sau o surs mai srac n energie cum
este succinatul, diferite sruri care asigur necesarul de magneziu, azot,

Metode de cultivare a bacteriei Escherichia coli

31

fosfor, sulf, permind bacteriilor s sintetizeze proteine i acizi nucleici;


mediile minimale sunt folosite frecvent pentru studii privind metabolismul
sau pentru selecia tulpinilor recombinate.
n anumite situaii mediile minimale pot fi suplimentate cu un
compus folosit pentru selecie (de regul un aminoacid sau un glucid) n
scopul cultivrii selective a unor tulpini modificate genetic, auxotrofe pentru
compusul respectiv.
2. medii complexe conin ingrediente a cror compoziie nu poate
fi definit foarte precis; un exemplu l constituie mediul LB care conine
extract de drojdii alctuit din toate componentele unei celule levuriene;
aceste medii sunt folosite pentru cultivri uzuale ale bacteriilor deoarece
asigur un mediu bogat n nutrieni, bacteriile nefiind supuse unui stres
nutritiv i nu sunt forate s sintetizeze compuii de care au nevoie pornind
de la precursori.

Medii de cultur minimale


Ingredientele folosite pentru prepararea acestor medii se adaug n
ap, fiind nclzite i agitate pn la dizolvare complet. Ulterior se
repartizeaz n recipiente separate, se sterilizeaz prin autoclavare timp de
15 min la presiunea de 1 atm. Suplimentele nutritive sau antibioticele
sterilizate prin filtrare se adaug dup autoclavare, cnd mediul are o temperatur mai mic de 50oC. Dup rcire complet, capacul recipientelor se
strnge bine, iar mediile pot fi pstrate la temperatura camerei sau la 4oC
pe o perioad nedefinit. Pentru pstrare se pot aduga 50 ml cloroform care
are rol de conservant (cloroformul se separ sub forma unui strat la fundul
vasului astfel nct poate fi evitat utilizarea sa la prepararea mediului 1X).
nainte de utilizare, mediile concentrate 5X se dilueaz cu ap n
proporie de 1:5 i se adug urmtoarele soluii sterilizate prin filtrare:
1. MgSO4 x 7H2O 1 M 1 ml;
2. surs de carbon 20% (de obicei glucoz sau glicerol) 10 ml;
sursa de carbon se alege n funcie de necesitile tulpinii folosite
sau de natura experimentului.
n funcie de necesiti, n mediile minimale se pot aduga:
1. vitamina B1 (tiamin) 0,5% 0,1 ml;
2. amestec aminoacizi provenii prin hidroliza acid a cazeinei 20% 5 ml;
3. L-aminoacizi 40 g/ml;

Biologie molecular. Metode experimentale

32

4. DL-aminoacizi 80 g/ml
5. antibiotice (Tabelul 2, pagina 40)
n cele ce urmeaz sunt prezentate reetele unor medii de cultur
minimale folosite cel mai frecvent pentru cultivarea bacteriei E. coli n
laborator.
Mediu M9(stoc concentrat 5X)
Na2HPO4
KH2PO4
NH4Cl
NaCl
CaCl2 (opional)
Ap distilat

30 g
15 g
5g
2,5 g
0,015 g
pn la 1000 ml

Mediu M63(stoc concentrat 5X)


(NH4)2SO4
10 g
KH2PO4
68 g
2,5 mg
FeSO4 7H2O
Ap distilat
pn la 1000 ml
pH=7; se ajusteaz cu KOH
Mediu A (stoc concentrat 5X)
(NH4)2SO4
KH2PO4
K2HPO4
Citrat de sodiu X 2H2O
Ap distilat

5g
22,5 g
52,5 g
2,5 g
pn la 1000 ml

Metode de cultivare a bacteriei Escherichia coli

33

Medii de cultur complexe


Aceste medii se sterilizeaz de regul prin autoclavare la presiunea
de 1 atm, timp de 25 minute. Suplimentele nutritive sau antibioticele se
pot aduga dup rcirea prealabil a mediilor, consecutiv sterilizrii.
n continuare sunt prezentate cteva din cele mai folosite medii
complexe.
Bulion Lambda
Tripton
NaCl
Ap distilat

100 g
2,5 g
pn la 1000
ml

Tripton
NaCl
Ap distilat

10 g
5g
pn la 1000
ml

Tripton
NaCl
Ap distilat

10 g
8g
pn la 1000
ml

Tripton
Extract de
drojdii
NaCl
Ap distilat

10 g
5g

Bulion-tripton

Mediu H

Mediu LB (Luria-Bertani)

5g
pn la 1000
ml

pH=7; se corecteaz prin adugarea de soluie NaOH 1N. Se


sterilizeaz prin autoclavare, timp de 20 min, la presiunea de 1 atm.

34

Biologie molecular. Metode experimentale

Bulion NZC
N-Z-Amine A
(Sigma)
NaCl
MgCl2 X 6H2O
Ap distilat

10 g
5g
2g
pn la 1000
ml

Se autoclaveaz la presiunea de 1 atm timp de 30 minute dup care se


adaug 5 ml soluie amestec aminoacizi 20% provenii prin hidroliza
acid a cazeinei sterilizat prin filtrare.
Mediu NZCYCM
N-Z-Amine A (Sigma)
NaCl
Extract de drojdii
MgSO4 x 7H2O
Amestec aminoacizi
provenii din casein
Ap distilat

10 g
5g
5g
2g
1g
pn la 1000 ml

Se agit pn la dizolvare complet; se ajusteaz pH-ul la 7 cu NaOH 5N


(aproximativ 0,2 ml). Se sterilizeaz prin autoclavare timp de 20 minute
la la presiunea de 1 atm.
Mediu NZYM
N-Z-Amine A
(Sigma)
NaCl
Extract de drojdii
MgSO4 x 7H2O
Ap distilat

10 g
5g
5g
2g
pn la 1000
ml

Mediu NZM
N-Z-Amine A
(Sigma)
NaCl

10 g
5g

Metode de cultivare a bacteriei Escherichia coli

35

MgSO4 x 7H2O
Ap distilat

2g
pn la 1000
ml

Tripton
Extract de drojdii
NaCl
NaOH 1 N
Ap distilat

32 g
20 g
5g
5 ml
pn la 1000
ml

Tripton
Extract de drojdii
NaCl
Ap distilat

20 g
5g
0,5 g
pn la 980
ml

Mediu SB (super-bulion)

Mediu SOB

Amestecul se agit pn la dizolvare complet. Se adaug 10 ml soluie


KCl 250 mM (1,86 g KCl n 100 ml ap distilat). Se ajusteaz pH-ul la 7
cu NaOH 5 N (aproximativ 0,2 ml). Se sterilizeaz prin autoclavare timp
de 20 minute la presiunea de 1 atm. nainte de utilizare se adaug 5 ml
soluie MgCl2 2M (19 g MgCl2 n 90 ml ap distilat; se ajusteaz volumul
la 100 ml i se autoclaveaz timp de 20 minute la presiunea de 1atm).
Mediu SOC

Tripton
Extract de drojdii
NaCl 1 M
KCl 1 M
Ap distilat

20 g
5g
10 ml
2,5 ml
pn la 980
ml

Dup autoclavare se rcete mediul pn la temperatura de 45oC i


se adaug 10 ml soluie MgCl2 2M i 20 ml soluie glucoz 20% (w/v)
sterilizate n prealabil prin filtrare.

36

Biologie molecular. Metode experimentale

Medii de cultur solide


Mediile de cultur lichide pot fi solidificate cu ajutorul agarului.
n cazul mediilor minimale se recomand sterilizarea separat a agarului
n ap deoarece autoclavarea mpreun crete riscul apariiei unui
precipitat insolubil. Pentru mediile de cultur complexe se poate face
autoclavarea tuturor ingredientelor mpreun cu agarul. Dup sterilizare,
mediile cu agar pot fi turnate n plci Petri la o temperatur de 50oC; dac
temperatura scade sub 45oC agarul se solidific, iar turnarea mediului de
cultur devine dificil.
Se recomand ca plcile cu mediul proaspt turnat s fie uscate
nainte de nsmnare deoarece excesul de umiditate poate mpiedica etalarea sau dezvoltarea normal a bacteriilor. Pentru uscare plcile pot fi lsate
fr capac timp de 30 minute n hota cu flux de aer laminar sau cu capac,
la temperatura camerei, pe masa din laborator, timp de 2-3 zile. Plcile
uscate pot fi pstrate cu capacul n jos la temperatura de 4oC ambalate n
pungi din plastic.

Medii minimale solide


Se adaug 15 g agar n 800 ml ap i se autoclaveaz la presiunea
de 1 atm timp de 15 min. Dup rcire la temperatura de 50oC se adaug
mediul minimal concentrat, sursa de carbon, soluia de antibiotic i se
repartizeaz n plci Petri cte 15-20 ml/plac.

Medii de cultur complexe solide


Agar Lambda

Mediu H

Tripton
NaCl
Agar
Ap distilat

10 g
2,5 g
15 g
pn la 1000 ml

Tripton
NaCl
Agar
Ap distilat

10 g
8g
15 g
pn la 1000 ml

Metode de cultivare a bacteriei Escherichia coli

Mediu LB (Luria-Bertani)

Tripton
Extract de
drojdii
NaCl
Agar sau
agaroz
Ap distilat

37

10 g
5g
5g
15 g
pn la 1000 ml

n compoziia acestor medii se mai pot aduga n funcie de necesiti:


1. antibiotice ampicilin (50 g/ml), tetraciclin (12 g/ml), alte
antibiotice;
2. galactozide Xgal (20 g/ml), IPTG (0,1 mM), alte galactozide.

Agar de acoperire
Mediul se utilizeaz pentru a asigura repartiia uniform a fagilor
sau celulelor bacteriene ntr-un strat subire de agar la suprafaa altui
mediu de cultur. ntr-o astfel de aplicaie, agarul topit este amestecat cu
celulele, apoi este turnat deasupra mediului de cultur dintr-o plac Petri
i este lsat s se solidifice. Acest strat de celule se va dezvolta abundent,
formnd o plaj de colonii fuzionate.
Agarul de acoperire conine mai puin agar (0,75%) dect se
adaug n mod obinuit la prepararea mediilor de cultur solide, din acest
motiv poate rmne n stare topit mai multe zile dac este meninut la
temperatura de 45oC. n locul agarului se poate folosi i agaroza atunci
cnd aplicaiile vizeaz extracia direct a ADN-ului din fagii cultivai.
Mediul se prepar n recipiente de 1000 ml, se autoclaveaz timp
de 15 min la presiunea de 1 atm, se rcete la temperatura de 50oC, se
agit pentru omogenizare, se separ n recipiente de 100 ml i se
sterilizeaz, putnd fi ulterior pstrat la temperatura camerei. nainte de
utilizare se topete agarul prin nclzire pe o baie de ap sau ntr-un
cuptor cu microunde, apoi se rcete la temperatura de 45oC i poate fi
turnat n plci Petri.

Biologie molecular. Metode experimentale

38

Agar de acoperire H
Tripton
NaCl
Agar
Ap distilat

10 g
8g
7g
pn la 1000 ml

Tripton
Extract de
drojdii
NaCl
Agar
Ap distilat

10 g
5g
5g
7g
pn la 1000 ml

Tripton
NaCl
Agar
Ap distilat

10 g
2,5 g
7g
pn la 1000 ml

Tripton
NaCl
Agaroz
Ap distilat

10 g
8g
6g
pn la 1000 ml

Agar de acoperire LB

Agar de acoperire Lambda

Agaroz de acoperire

Agar de conservare prin nepare


Este folosit pentru pstrarea un timp mai ndelungat a culturilor
bacteriene la temperatura de 4oC.Cisteina se adaug n scopul creterii
timpului de conservare a bacteriilor prin aceast metod.
Nutrient Broth
NaCl
Agar
Cistein

10 g
5g
6g
10 mg

Metode de cultivare a bacteriei Escherichia coli

Tiamin
Ap distilat

39

10 mg
pn la 1000 ml

Antibiotice utilizate la prepararea mediilor de


cultur
Antibioticele sunt substane chimice care au capacitatea de a
distruge sau inhiba dezvoltarea microorganismelor procariote, fr a avea
efect toxic asupra organismelor eucariote. n general, se adaug ca
suplimente n mediile de cultur folosite pentru cultivarea E. coli n
scopul prevenirii dezvoltrii altor bacterii care nu conin genele rezistenei
la antibiotice i pentru a asigura stabilitatea plasmidelor n celulele
bacteriene (1).
Pentru a preveni alterarea lor, antibioticele se adaug n mediile de
cultur dup rcirea acestora, la temperaturi mai mici de 50oC. nainte de
adugare, soluiile care conin antibiotice se sterilizeaz prin filtrare,
folosind filtre de 0,22 m. Antibioticele n soluii alcoolice nu necesit
sterilizare. n situaii de urgen antibioticele pot fi adugate direct pe
mediile solide din plci n volume care s asigure concentraia final
dorit; se las plcile n repaus aproximativ o or, timp n care antibioticul
difuzeaz n mediul de cultur.
n mod obinuit se prefer prepararea unor soluii stoc de
antibiotice pentru a uura munca n laborator. n Tabelul 2 sunt prezentate
soluiile stoc, concentraiile de lucru precum i mecanismul de aciune al
principalelor antibiotice adugate n mediile de cultur folosite pentru
cultivarea bacteriei E. coli.
Se recomand ca soluiile concentrate de antibiotice s se pstreze
la temperatura de 4oC nu mai mult de o lun sau la temperatura de -20oC
nu mai mult de 6 luni. De asemenea, mediile de cultur care conin
antibiotice nu trebuie folosite dac au fost pstrate pentru mai mult de o
lun la frigider; mediile suplimentate cu antibiotice fotosensibile
(tetraciclin, rifampicin) trebuie pstrate la ntuneric sau nvelite n folie
de aluminiu.

Biologie molecular. Metode experimentale

40

TABEL 2. Principalele antibiotice folosite pentru cultivarea bacteriei Escherichia


coli
Antibiotic1

Concentraie
soluie stoc
(mg/ml)
5

Concentraie
soluie de lucru
(g/ml)
15

10 (n H2O)

50

Carbenicilin2

10 (n H2O)

50

Cloramfenicol

6 (n etanol
100%)

30

D-cicloserin3

10 (n 0,1 M
tampot fosfat
de sodiu,
pH=8)

200

Eritromicin

10 (n H2O)

50

Gentamicin

3 (n H2O)

15

Kanamicin

10 (n H2O)

50

Kasugamicin

10 (n H2O)

1000

Acidul nalidixic
(pH pn la 1 cu
NaOH)
Ampicilin (sare
de sodiu)

Mecanism de aciune
Bacteriostatic; inhib sinteza
ADN.
Bactericid; antibiotic lactamic care mpiedic
sinteza peretelui celular prin
inhibarea formrii legturilor
peptidoglicanice.
Acelai mecanism descris
pentru ampicilin.
Bacteriostatic;
mpiedic
sinteza
proteinelor
prin
inhibarea
translaiei
la
nivelul subunitii 50 S a
ribozomului datorit blocrii
reaciei de transpeptidare i
elongare a lanului de
aminoacizi.
Bactericid; inhib sinteza
peretelui
celular
prin
mpiedicarea
formrii
D-alaninei din L-alanin i
formarea
legturilor
peptidice
ce
presupun
D-alanin.
Bacteriostatic; antibiotic din
grupa macrolidelor care se
leag de subunitatea 50 S a
ribozomului
i
inhib
translaia
prin
blocarea
reaciei de transpeptidare.
Bactericid; antibiotic din
grupa aminoglicozidelor care
inhib sinteza proteinelor
prin legarea de subunitatea
30 S a ribozomului.
Bactericid; inhib sinteza
proteinelor.
Bactericid; inhib sinteza
proteinelor prin alterarea

Metode de cultivare a bacteriei Escherichia coli


Antibiotic1

Rifampicin4

Concentraie
soluie stoc
(mg/ml)

Concentraie
soluie de lucru
(g/ml)

20 (n metanol
sau DMSO)

100

Spectinomicin

20 (n H2O)

100

Streptomicin

10 (n H2O)

50

Tetraciclin4

2,5 (n etanol
50%)

12,5

41
Mecanism de aciune
reaciei de metilare a ARN
16 S.
Bactericid; inhib iniierea
transcripiei ARN prin legare
de ARN polimeraz.
Bactericid; antibiotic din
grupa aminoglicozidelor care
inhib sinteza proteinelor
prin legare de subunitatea
30 S a ribozomului.
Bactericid; antibiotic din
grupa aminoglicozidelor care
inhib sinteza proteinelor
prin legare de subunitatea
30 S a ribozomului.
Bacteriostatic; inhib sinteza
proteinelor prin legare de
subunitatea
30
S
a
ribozomului.

Toate antibioticele trebuie pstrate la temperatura de 4oC, cu excepia tetraciclinei care se pstreaz la -20oC.
Carbenicilina poate fi pstrat n soluie 50% etanol/50% ap la temperatura de -20oC.
3
Soluiile de D-cicloserin sunt instabile; din acest motiv trebuie utilizate imediat dup preparare.
4
Antibiotic sensibil la lumin; soluiile stoc se pstreaz la ntuneric.
Bactericid = omoar bacteriile.
Bacteriostatic = inhib creterea i multiplicarea bacteriilor.
2

II. 2 Cultivarea E. coli pe medii solide


Numeroase bacterii printre care i E. coli au capacitatea de a
forma colonii izolate atunci cnd sunt cultivate pe medii solide. Fiecare
colonie rezult prin creterea i multiplicarea unei singure celule;
deoarece E. coli se divide asexuat, toate celulele dintr-o colonie sunt
identice din punct de vedere genetic, fiind denumite clone. Deoarece
fiecare colonie reprezint o populaie de clone i fiecare colonie poate fi
diferit de celelalte colonii dintr-o plac, se recomand ca n cadrul
experimentelor s fie folosite doar colonii izolate. Studiul unor populaii
mixte de celule duce frecvent la obinerea unor rezultate neconcludente
(1).

42

Biologie molecular. Metode experimentale

nsmnarea la suprafaa mediilor de cultur


solide
Culturile de E. coli pot fi uor nsmnate la suprafaa mediilor de
cultur solide folosind o baghet de etalare n felul urmtor:
1. la mijlocul plcii se depune cu ajutorul unei pipete un volum din
cultura de nsmnat (50-500 l);
2. se sterilizeaz prin flambare bagheta de etalare dup care se rcete
atingnd poriuni ale mediului de cultur care nu se vor folosi;
3. se rspndete inoculul uniform pe toat suprafaa mediului de cultur;
4. dup finalizare se pune bagheta de etalare ntr-un pahar cu etanol;
5. se las mediul de cultur s se usuce;
6. se incubeaz la temperatura optim de cretere (n general 37oC).
Pentru inoculare se poate folosi i o ans de nsmnare, caz n
care procedeul se numete nsmnare prin descriere de striuri:
1. se sterilizeaz ansa prin nclzire la rou;
2. se preia cu ansa din cultura microbian de nsmnat (din
mediu lichid sau solid);
3. se traseaz cu ansa, la suprafaa mediului, o linie de 2-3 cm
lungime la o margine a plcii Petri (Figura 7);
4. se sterilizeaz ansa din nou i se rcete pe o poriune de
mediu;
5. se trece o dat, uor, ansa peste linia trasat iniial, apoi se
continu descrierea de striuri n zig-zag pe o parte din
suprafaa mediului de cultur, avnd grij s nu se suprapun
striurile descrise;
6. se sterilizeaz ansa din nou i se rcete;
7. se trece ansa o dat peste ultimul striu descris anterior, apoi se
continu n zig-zag descrierea unui nou set de striuri;
8. se repet aceti pai pn la descrierea a trei seturi de striuri;
9. la final se sterilizeaz ansa de nsmnare;
10. se incubeaz plcile astfel inoculate cu capacul n jos, la
temperatura optim dezvoltrii (37oC).

Metode de cultivare a bacteriei Escherichia coli

43

Incubare
Striuri

Colonie
izolat

FIGURA 7. nsmnarea bacteriei E. coli la suprafaa mediului de cultur prin


descriere de striuri.
Prin trasarea celor trei seturi de striuri se realizeaz o diluie a inocului bacterian
ceea ce permite obinerea de colonii izolate.

Mediile de cultur pot fi nsmnate i printr-un procedeu care


permite obinerea de replici ale unei plci Petri pe suprafaa creia sunt
deja dezvoltate colonii. Aceast tehnic permite transferarea coloniilor de
pe o plac Petri pe alt plac, meninnd paternul original al coloniilor.
Metoda are numeroase aplicaii n experimentele care se bazeaz pe ADN
recombinat, oferind avantajul testrii simultane a unui numr mare de
colonii din punct de vedere al capacitii lor de a se dezvolta n condiii
diferite de cultivare.
Pentru realizarea plcilor replic este necesar un dispozitiv alctuit
dintr-un bloc rotund de lemn sau metal care poate intra fix ntr-o plac
Petri, un inel metalic i o bucat de catifea steril (Figura 8).

44

Biologie molecular. Metode experimentale

plac Petri

catifea steril
inel metalic

bloc de metal sau lemn

FIGURA 8. Dispozitiv folosit pentru obinerea unei plci replic


Pentru inoculare, bucata de catifea steril este prins de bloc cu
ajutorul inelului metalic. Apoi placa Petri pe care se afl coloniile
dezvoltate se apas uor peste bucata de catifea; plcile care se utilizeaz
trebuie s conin un numr de 50-100 colonii izolate. Nu se apas foarte
tare pentru c este posibil transferul coloniilor n totalitate sau este
posibil desprinderea mediului de cultur. Placa Petri cu mediul steril se
aeaz peste bucata de catifea pstrnd orientarea plcii originale, astfel
nct s se realizeze transferul coloniilor. Prin acest procedeu se pot obine
pn la 10 replici ale plcii originale. La final, bucata de catifea poate fi
splat, sterilizat i refolosit.

nsmnarea n profunzime a mediilor de


cultur solide
nsmnarea n profunzimea mediilor solide se poate face prin
ncorporare sau prin nepare. Pentru nsmnarea prin ncorporare, mediile
de cultur se topesc i se rcesc la temperatura de 50oC. Se introduce apoi o

Metode de cultivare a bacteriei Escherichia coli

45

cantitate din cultura de nsmnat. Se omogenizeaz amestecul prin agitare,


fr a se introduce bule de aer, dup care mediile nsmnate sunt lsate s
se solidifice. nsmnarea prin nepare se efectueaz cu ajutorul ansei, aa
cum este prezentat n Figura 9.

FIGURA 9. nsmnarea mediilor de cultur solide prin nepare


Ca rezultat al manipulrilor genetice folosind E. coli (transformri
sau mutagenez) rezult populaii mixte de celule care trebuie separate. O
cultur saturat tipic poate avea o concentraie de 1 x 109 celule/ml. n
astfel de situaii, obinerea coloniilor izolate (clone) presupune inocularea
mediilor de cultur la suprafa folosind diluii ale culturilor de interes
(2). Obinerea unei serii de diluii se poate realiza n felul urmtor:
Materiale necesare
mediu LB lichid;
mediu LB solid repartizat n plci Petri cu diametrul de 10 cm;
eprubete sterile cu diametrul de 16 mm sau 18 mm;

Biologie molecular. Metode experimentale

46

Modul de lucru
1. cu ajutorul unei pipete se introduc cte 5 ml LB n trei eprubete
sterile care se noteaz cu 1, 2 respectiv 3;
2. se transfer 5 l din cultura bacterian n eprubeta 1 i se agit cu
ajutorul unui vortex timp de 5 secunde;
3. se nlocuiete vrful pipetei cu unul steril i se transfer 5 l lichid
din eprubeta 1 n eprubeta 2; se agit timp de 5 secunde folosind
vortexul;
4. se repet pasul 3 pn la obinerea unei serii de diluii n cele trei
eprubete: n eprubeta 1 proba iniial a fost diluat de 1 x 103 ori
(1.000 de ori), n eprubeta 2 de 1 x 106 ori (1.000.000 ori), iar n
eprubeta 3 de 1 x 109 ori.
5. se inoculeaz cte o plac Petri ce conine mediu LB cu cte
100 l din fiecare diluie i se etaleaz;
6. se incubeaz peste noapte la temperatura de 37oC;
7. se numr coloniile dezvoltate, inndu-se cont c n fiecare plac
s-au dezvoltat celulele prezente n 1/10 dintr-un mililitru provenit
din fiecare diluie n parte; prin urmare, pentru a afla numrul de
celule/ml trebuie nmulit numrul de colonii cu 10 i apoi cu
diluia utilizat pentru nsmnare; de exemplu, dac s-au
dezvoltat 69 de colonii din diluia 10-6, numrul de celule/ml va fi:
69 x 10 x 106 sau 6,9 x 108;
8. pentru c fiecare colonie izolat poate fi ulterior folosit, se
recomand pstrarea plcilor la temperatura de 4oC nvelite cu
Parafilm sau folie din plastic.
Pentru obinerea coloniilor izolate se poate utiliza i tehnica
descrierii de striuri prezentat anterior (Figura 7). Metoda este mai uor
de utilizat n comparaie cu cea care presupune obinerea de diluii, ns
nu permite i numrarea celulelor dintr-o cultur. n situaia n care se
dorete obinerea de colonii izolate din mai multe culturi bacteriene se
prefer, din motive practice, mprirea suprafeei unei plci Petri n 4, 6
sau 8 sectoare, inoculndu-se fiecare sector n parte.

Metode de cultivare a bacteriei Escherichia coli

47

II. 3 Cultivarea E. coli n medii lichide


Creterea bacteriei E. coli n medii de cultur lichide este stimulat
de prezena oxigenului, deoarece ciclul Krebs i reaciile de fosforilare
oxidativ necesit oxigen pentru catabolizarea complet a surselor
complexe de carbon pn la CO2(1). Din aceste motive culturile n
mediile lichide necesit agitare permanent pe durata incubrii (de regul
200 rpm). Pentru cultivarea unor volume mai mari de 50 ml se recomand
utilizarea unor baloane Erlenmeyer prevzute cu piedic ce au rolul de a
agita mediul de cultur i de a permite dizolvarea oxigenului. Pentru
culturi cu un volum mai mic de 10 ml se pot folosi eprubete de centrifug
cu capac sau eprubete cu dop; n comer sunt disponibile o varietate de
eprubete, baloane din sticl prevzute cu dopuri din plastic sau metal, care
pot fi folosite pentru cultivarea E. coli n medii lichide. Pentru a permite o
mai bun oxigenare se recomand ca volumul de mediu de cultur s nu
depeasc 1/3 din capacitatea maxim a recipientului n care se adaug.

Inocularea i cultivarea folosind volume mici de


mediu
O cultur cu un volum mai mic de 10 ml poate fi uor obinut
prin cultivare peste noapte n mediu LB pornind de la o singur colonie.
Inocularea unei singure colonii n volume mai mari de medii (100 ml) cu
o concentraie ridicat de nutrieni (mediul TB) permite de asemenea
creterea culturii peste noapte pn la faza staionar.
Pentru inoculare se procedeaz n felul urmtor (1):
1. se sterilizeaz ansa de nsmnare;
2. cu ajutorul ansei rcite (sau a unei scobitori sterile) se preleveaz o
poriune dintr-o colonie izolat;
3. se introduce ansa sau scobitoarea n mediul de cultur lichid,
descrcnd produsul microbian pe perei chiar deasupra lichidului i
se agit uor; inoculul va ptrunde n mediul de cultur imediat dup
agitare; nu este necesar s se poat observa celulele bacteriene n
mediul lichid, fiind necesare doar cteva celule pentru a se atinge,
dup incubare, o densitate ridicat; capacul tubului trebuie pus

48

Biologie molecular. Metode experimentale

imediat napoi astfel nct s se evite contaminarea mediului de


cultur cu aer nesteril;
4. se introduce cultura inoculat ntr-un termostat cu agitare, la
temperatura de 37oC i turaia de 200 rpm i se incubeaz peste
noapte; dup 6 ore se poate atinge o densitate optic ce indic
prezena a aproximativ 1-2 x 109 celule/ml (2); pentru incubare se pot
folosi i bi de ap termostatate, situaie n care apa trebuie s
prezinte acelai nivel ca mediul de cultur din recipientele inoculate.

Inocularea i cultivarea folosind volume mari de


mediu
Volume mari de culturi de E. coli se pot obine folosind drept
inocul pre-culturi cultivate peste noapte n volume mici (10 ml). Pentru
inoculare se dilueaz pre-cultura 1:100 i se introduce n baloane
Erlenmeyer cu un volum de cinci ori mai mare dect al culturii propriuzise. Se incubeaz apoi peste noapte la temperatura de 37oC cu agitare
(200 rpm).

II.4 Monitorizarea creterii bacteriei E. coli n


mediile lichide
Dezvoltarea unei populaii bacteriene ntr-un mediu de cultur
lichid presupune parcurgerea mai multor faze: lag (de ntrziere),
exponenial (logaritmic), staionar i de declin (Figura 10).
Faza de lag (de ntrziere) presupune o adaptare a celulelor
bacteriene la noul mediu de via, fiind caracterizat prin absena creterii.
Durata fazei de lag poate fi scurtat atunci cnd bacteriile sunt transferate
dintr-o cultur aflat n faza exponenial ntr-un mediu identic.
Consecutiv fazei de lag este faza exponenial n care celulele bacteriene
se divid, iar numrul lor crete logartimic. Ca urmare a creterii masive a
numrului de celule, nutrienii disponibili n mediul de cultur
diminueaz n paralel cu scderea concentraiei oxigenului dizolvat i cu
acumularea unor produi toxici de metabolism. Cultura intr n faza
staionar caracterizat prin meninerea unui numr relativ constant al

Metode de cultivare a bacteriei Escherichia coli

49

celulelor. La final apare moartea celular, numrul celulelor scznd pe


parcursul fazei de declin.
Evoluia unei culturi bacteriene i fazele creterii pot fi urmrite
prin determinarea numrului de celule folosind o serie de tehnici
prezentate n cele ce urmeaz.
Faz de cretere
exponenial

Faz
Faz de declin
staionar

log nr. celule

Faz
de lag

Timp (ore)

FIGURA 10. Curba de cretere a unei populaii bacteriene n medii de cultur


lichide

Determinarea densitii optice cu ajutorul


spectrofotometrului
O metod simpl i rapid de apreciere a creterii const n msurarea turbiditii unei culturi bacteriene cu ajutorul spectrofotometrului (1).
Principiul metodei
Creterea numrului de celule determin o intensificare a
turbiditii culturii care poate fi nregistrat prin msurarea cantitii de
lumin mprtiat de cultur la o lungime de und de 600 nm. Cu
ajutorul spectrofotometrului se msoar absorbana sau densitatea optic
(DO).

50

Biologie molecular. Metode experimentale

Limitri:
Turbiditatea culturii este determinat att de celulele vii, ct i de
cele moarte, respectiv de alte particule prezente n mediul de cultur.
Turbiditatea nu este influenat numai de numrul, ci i de forma,
dimensiunea i compoziia celulelor. n plus celulele bacteriene i pot
schimba forma i dimensiunile n diferite faze ale creterii i n diferite
medii de cultur. Toate aceste motive se pot constitui ca surse de erori la
stabilirea numrului de celule dintr-o cultur bacterian prin folosirea
spectrofotometrului.
Mod de lucru:
Se aduce spectrofotometrul la 0 folosind mediu de cultur steril.
Se msoar densitatea optic a probelor la lungimea de und de 600 nm:
valorile DO finale ar trebui s varieze ntr-un interval optim cuprins ntre
0,1 i 1. n situaia n care densitatea celulelor este prea mare (DO > 1),
pentru msurtori precise este necesar diluarea probelor cu mediu steril,
folosind o rat de diluie zecimal (1/10) pn cnd valorile DO se
ncadreaz n intervalul optim.
n general, se consider c pentru fiecare 0,1 uniti DO corespund
1 x 108 celule/ml. ns este important de reinut faptul c aceasta este doar
o estimare (4),(1). Pentru a determina mai precis numrul de celule
folosind spectrofotometrul este necesar construirea unei curbe standard
utiliznd alte metode de numrare a celulelor mai precise aa cum sunt
observarea folosind camera de numrare sau determinarea numrului de
celule viabile prin cultivare n plci Petri. Dup construirea curbei
standard, DO a culturii poate fi determinat cu ajutorul
spectrofotometrului iar numrul de celule poate fi citit de pe curb.
Deoarece diferitele specii i tulpini bacteriene au celule cu forme i
dimensiuni diferite este necesar ntocmirea de curbe standard pentru
fiecare specie sau tulpin.

Metode de cultivare a bacteriei Escherichia coli

51

Determinarea densitii optice cu ajutorul


hemocitometrului
Hemocitometrul sau orice alt tip de camer de numrare poate fi
utilizat pentru determinarea la microscop a densitii celulare a unei
culturi. Aceste dispozitive constau dintr-o lam de sticl prevzut cu o
reea fin de grile gravate i dintr-o lamel care se aeaz deasupra
(Figura 11). ntre cele dou lame se delimiteaz un spaiu cu un volum
cunoscut n care ptrunde prin capilaritate lichidul cu microorganismele
de numrat.
n vederea numrrii celulelor, se aeaz mai nti lamela pe lama
de sticl. Se adaug pe fiecare parte a lamei de sticl, sub lamel, cte
10 l din proba nediluat sau diluat (n funcie de densitatea celular a
culturii); datorit capilaritii, lichidul este atras ctre suprafaa de
numrat pe msur ce este adugat ncet pe margini. Se las apoi lama de
sticl n repaus cteva minute dup care se numr la microscop celulele
din 5 ptrate precum cele ilustrate n Figura 11. Pentru a determina
numrul de celule bacteriene/ml se utilizeaz urmtoarea formul:
Numr celule bacteriene/ml= numr de celule numrate x diluia (dac se
utilizeaz) x 50.000
unde 50.000 = 10 (adncimea de 0,1 mm) x 5.000 (5 ptrate
numrate x 1.000 mm3), 1.000 mm3 = 1 ml
Se recomand ca n funcie de modelul camerei de numrare
utilizate s se citeasc nainte instruciunile de utilizare.

Biologie molecular. Metode experimentale

52

Lamel de sticl
Lam de sticl

Reea de grile

FIGURA 11. Camer de numrat Brker-Trk folosit pentru determinarea


numrului de celule cu ajutorul microscopului

Determinarea numrului de bacterii prin


cultivare n plci Petri
O alt metod comun de determinare a numrului de celule
const n nsmnarea mediului de cultur lichid pe medii de cultur
solide aflate n plci Petri, incubarea i numrtoarea coloniilor
dezvoltate(3). Aceast tehnic poate fi uor realizat n orice laborator de
microbiologie conferind avantajul determinrii numrului de celule
viabile din totalul celulelor (vii i moarte) prezente n mediul de cultur.
Principiul metodei
Fiecare celul bacterian viabil prezent n mediul de cultur
lichid formeaz o colonie, astfel nct numrul total de colonii dezvoltate
pe placa Petri indic numrul de microorganisme coninute n mediul
iniial, capabile s creasc n condiiile de cultivare folosite.

Metode de cultivare a bacteriei Escherichia coli

53

Limitri:
Un dezavantaj major al acestei metode const n presupunerea c
fiecare colonie are la origine o celul. n realitate aceast situaie este
rareori valabil, deoarece mai multe celule se pot agrega, ducnd la
formarea unei singure colonii. Din acest motiv se recomand diluarea
probei, utilizarea unui volum mic de inocul i etalarea ct mai corect a
acestuia pe suprafaa mediului de cultur. Un alt dezavantaj este dat de
timpul de incubare, de la momentul inoculrii i pn la momentul
numrrii fiind necesare aproximativ 18-24 ore. n situaia n care este
necesar s se cunoasc densitatea celular a unei culturi bacteriene ntr-un
timp mai scurt se recomand utilizarea celorlalte tehnici de numrare
prezentate anterior.
Mod de lucru:
1.

efectuarea diluiilor proba de analizat este diluat n scopul


obinerii pe o plac Petri a unui numr de colonii cuprins ntre 30 i
300; n acest scop se utilizeaz o serie de diluii zecimale (Figura 12);
1 ml

1 ml

1 ml

1 ml

1 ml

Cultur de
E. coli n LB

Fiecare eprubet
conine 9 ml LB
steril
0,1 l
0,1 l

0,1 l
10-3
Etalare
FIGURA 12. Tehnica efecturii diluiilor zecimale

10-4

10-5

54

Biologie molecular. Metode experimentale

2.

nsmnarea din diluiile efectuate se fac nsmnri, introducnd


volume mai mici de 0,1 ml din fiecare diluie ntr-o plac cu mediu
topit i rcit la temperatura de 45oC; plcile se rotesc uor pentru
distribuirea uniform a inoculului n mediu; pentru fiecare diluie se
recomand s se nsmneze cte 2-3 plci, fcndu-se apoi media
numrului de colonii dezvoltate;

3.

Incubarea plcile nsmnate se incubeaz la temperatura de 37oC;

4.

numrarea coloniilor coloniile bacteriene se numr obinuit dup


24 ore, cu ochiul liber sau cu ajutorul lupei; pentru determinarea
numrului de celule/ml se utilizeaz formula:
   10




unde:
UFC = uniti formatoare de colonii (se folosete n
loc de celule/ml);
a = numr mediu al coloniilor dezvoltate dup
nsmnare;
10n = diluie folosit pentru nsmnare (cu semn
schimbat);
V = volum (n ml) de suspensie folosit la nsmnare
Utilizarea acestei tehnici presupune realizarea cu atenie a
diluiilor i nsmnrilor astfel nct s se evite eventualele erori care
pot aprea. Pentru siguran se recomand numrarea coloniilor provenite
prin nsmnarea i incubarea a dou diluii diferite; valoarea final
obinut n cele dou situaii ar trebui s indice concentraii celulare
similare. Rata de cretere a diverselor tulpini de E. coli este diferit, prin
urmare timpul de incubare trebuie ajustat n funcie de fiecare tulpin
utilizat n cadrul experimentelor.

II. 5 Pstrarea culturilor de E. coli


Culturile de E. coli pot fi pstrate n laborator intervale variabile
de timp, de la cteva zile pn la perioade nedefinite. O importan
deosebit trebuie ns acordat modalitii de pstrare pe termen lung, n

Metode de cultivare a bacteriei Escherichia coli

55

special n cazurile n care tulpinile respective sunt recombinate genetic


(1). Tulpinile de E. coli pstrate n plci Petri sunt viabile pn la 2
sptmni pstrate la temperatura de 4oC dac plcile au fost sigilate cu
Parafilm. Nu se recomand ns pstrarea culturilor n medii lichide mai
mult dect este necesar atingerea unei densiti celulare ridicate. n plus,
n cazul acestor culturi, este important n multe situaii ca celulele s nu
ating faza staionar, deoarece poate fi afectat stabilitatea ADN-ului
recombinat.
Pstrarea culturilor un timp ndelungat n laborator se poate realiza
prin congelare la temperatura de -80oC sau prin utilizarea unor containere
speciale cu azot lichid.

Pstrarea prin congelare la -80oC


Materiale necesare:
1. medii de cultur lichide complexe (bulion LB sau TB);
2. tuburi de criostocare;
3. glicerol 50% (v/v): 50 ml glicerol se dizolv n 50 ml ap distilat
i se sterilizez prin filtrare.
Mod de lucru:
1. cu o zi nainte de criostocare se inoculeaz tulpina de E. coli n 5
sau 10 ml bulion LB sau TB n care se adaug antibioticul
corespunztor;
2. se incubeaz la temperatura de 37oC cu agitare, peste noapte;
3. n cultura dezvoltat se adaug glicerol 50 % (v/v) n raport 1:1
(concentraie final de glicerol este de 25%); glicerolul este o
substan crioprotectoare care are rolul de a preveni leziunile
celulare provocate de ngheare; n locul glicerolului se poate
utiliza i o soluie dimetilsufoxid 7% care ofer avantajul unei
pipetri mai uoare (2);

Biologie molecular. Metode experimentale

56

4. se agit bine amestecul i se transfer n eprubete de criostocare


(dou sau mai multe microeprubete pentru tulpinile mai
importante);
5. se nghea rapid eprubetele mpreun cu coninutul lor prin
aezare pe o baie cu ghea uscat/etanol sau prin utilizarea
azotului lichid, dup care se introduc n congelator la temperatura
de -80oC; alternativ, eprubetele de criostocare pot fi introduse
direct n congelator;
6. stocurile de glicerol pot fi pstrate la temperatura de -80oC o
perioad nedefinit de timp.
Pentru a re-activa tulpinile bacteriene, se scot eprubetele de
criostocare din congelator i, cu ajutorul unei anse, se preleveaz din
coninutul acestora o parte care se inoculeaz pe un mediu de cultur
proaspt. Stocurile de glicerol se introduc imediat n congelator. Nu se
recomand dezghearea complet deoarece ciclurile nghe-dezghe
succesive pot afecta semnificativ viabilitatea culturii.
Bibliografie
1.

2.

3.
4.

Riley, S. P., Woodman, M. E., Stevenson, B. (2008) Culture of


Escherichia coli and Related Bacteria in Current Protocols
Essential Laboratory Techniques (Gallagher, S. R., Wiley, E. A.,
Eds.), p 806. John Wiley & Sons.
Elbing, K., Brent, R. (2003) Escherichia coli, in Current
Protocols in Molecular Biology (Ausubel, F. A., Brent, R.,
Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl,
K., Eds.), p 4755. John Wiley & Sons.
Dunca, S., Ailiesei, O., Nimian, E., Stefan, M. (2004)
Microbiologie aplicat, p 300. Ed. Tehnopress, Iai.
Sambrook, J., Fritsch, E., Maniatis, T. (1989) Molecular Cloning
A Laboratory Manual, p 1.21-1.53. Cold Spring Harbour
Laboratory Press.

III. PLASMIDE I TULPINI DE


ESCHERICHIA COLI UTILIZATE
FRECVENT N BIOLOGIA
MOLECULAR
Cteva descoperiri din domeniul geneticii au condus la elaborarea
unor tehnici de laborator care au permis cercettorilor s analizeze i s
manipuleze moleculele de ADN ntr-o manier fr precedent, realiznd o
adevrat revoluie n toate domeniile biologiei. Organismele modificate
genetic i terapia genic sunt doar dou dintre aplicaiile ingineriei
genetice domeniu cu o dezvoltare deosebit ce nu ar fi fost posibil fr
implicarea microorganismelor.
Ingineria genetic i are nceputurile n anii '60 (1), cnd a fost
descoperit o nou clas de enzime bacteriene numite endonucleaze.
Acestea au rolul de a recunote ADN-ul strin care ptrunde n celul pe
diverse ci i de a-l inactiva prin clivare. Important este c mecanismul de
clivare al moleculelor de ADN nu se realizeaz la ntmplare, ci are loc n
locaii precise dictate de o secven specific de 4-6 nucleotide. De la
izolarea primei enzime de restricie - HindIII n anul 1970 (2) i pn n
prezent au fost descrise nu mai puin de 4000 enzime de restricie (3),
fiecare clivnd ADN-ul ntr-un situs specific unic. Cercettorul are astfel
posibilitatea de a utiliza aceste enzime pentru a cliva ADN-ul n mod
specific asemenea unui foarfece molecular foarte precis.
Deoarece moleculele de ADN au aceleai proprieti indiferent
dac provin de la plante, animale, fungi sau microorganisme, fragmente
din surse foarte variate pot fi unite pentru a forma o molecul nou.
Astfel, nu cu mult timp dup izolarea primelor enzime de restricie,
acestea au fost utilizate pentru obinerea primei molecule de ADN
recombinat creat de om (4),(5),(6). Obinerea acesteia a implicat izolarea
i clivarea a dou fragmente de ADN din dou surse diferite, proceduri
urmate de utilizarea ADN-ligazei pentru lipirea celor dou fragmente i
obinerea unei molecule noi (Figura13).

Biologie molecular. Metode experimentale

58

Sursa 1

HindIII

Sursa 2

HindIII

Fragmentele se ''amestec'' i se ''lipesc'' cu ADN-ligaza


Molecul ADN
recombinat
FIGURA 13. Obinerea unei molecule ADN recombinate.
Prin clivarea ADN-ului din dou surse diferite cu aceeai enzim de restricie
(HindIII) se formeaz capete coezive compatibile, ce faciliteaz procesul de ligare.

Un alt punct cheie n dezvoltarea ingineriei genetice este apariia


procesului de clonare. Dei termenul este utilizat i pentru a descrie
producerea de celule sau organisme identice din punct de vedere genetic,
n sensul su strict clonarea reprezint producerea de copii identice ale
unei molecule de ADN n numr foarte mare.
Procesul de clonare const din 4 etape distincte (7) Figura 14:
1. izolarea fragmentelor de interes i clivarea lor cu enzime de restricie;
2. ligarea celor dou fragmente i obinerea moleculei recombinate;
3. transfecia (transformarea) celulelor (cel mai frecvent de Escherichia
coli) cu noile molecule recombinate;
4. selecia celulelor ce au fost transformate cu succes i care conin noua
molecul de ADN recombinat.
Pentru a putea parcurge cele 4 etape n scopul clonrii unei gene
sunt necesare cel puin dou elemente:
1. un vector reprezentat de o molecul de ADN purttoare capabil
s se autoreplice; secvena de clonat este inserat n interiorul
vectorului i se replic odat cu acesta;

Plasmide i tulpini de Escherichia coli

59

2. un organism gazd n care vectorul urmeaz s se replice; cel mai


frecvent utilizate fiind tulpinile de E. coli.
Vector

Fragmentul ADN
de interes
Digestie cu enzime de restriie

Ligare
Vector recombinat
Transformare

Celul bacterian Replicarea vectorului


gazd
Multiplicare
bacterian
FIGURA 14. Clonarea genelor.
Fragmentele de ADN clivate cu ajutorul enzimelor de restricie sunt inserate ntr-un
vector clivat cu aceleai enzime. Molecula recombinat este introdus n celula
bacterian unde se replic i duce la multiplicarea numrului de copii.

III.1 Vectori plasmidiali utilizai frecvent n


ingineria genetic
Principalele caracteristici necesare unui vector pentru a se propaga
n celulele de E. coli sunt:
1.
capacitatea de autoreplicare independent de cromozomul bacterian;
vectorul trebuie s conin o origine de replicare compatibil cu
celula gazd; pentru plasmidele replicabile n E. coli cel mai
frecvent se folosete originea OriC;

60

Biologie molecular. Metode experimentale

2.

s prezinte dimensiuni mici pentru a putea fi simplu de izolat,


manipulat i transferat n celula gazd;
s conin un marker selectabil pentru a putea diferenia uor
celulele ce conin vectorul de cele care nu l conin; cel mai frecvent
acest marker este reprezentat de rezistena la antibiotice codificat
de gene aflate pe plasmid; cnd celulele bacteriene sunt etalate pe
medii de cultur care conin antibiotice, doar celulele ce conin
plasmidul care codific rezistena vor supravieui, realizndu-se
astfel o selecie;
s conin o singur copie dintr-un situs specific de restricie.

3.

4.

Primii vectori plasmidiali utilizai au fost o serie de vectori simpli,


ce conineau o origine de replicare, o gen a unui marker selectabil i
cteva situsuri de restricie amplasate aleator. Folosirea acestora n
clonarea genelor a fost dificil i prin urmare au fost dezvoltai vectori de
clonare specializai, care conineau, pe lng elementele amintite, i o
zon redus ca dimensiuni cu numeroase situsuri de restricie foarte
frecvent utilizate. Zona respectiv a primit numele de situs multiplu de
clonare (engl.Multiple Cloning Site MCS), ea uurnd mult procesul de
clonare.
n vederea expresiei genelor clonate n E. coli sunt necesare alte
tipuri de vectori denumii vectori de expresie. Acetia trebuie s permit
att clonarea genelor ct i expresia lor, motiv pentru care conin
suplimentar, pe lng elementele enumerate la vectorii de clonare i
elemente necesare expresiei reprezentate prin:
1. promotor puternic sub controlul cruia este pus gena de interes, cel
mai frecvent fiind utilizai promotorul bacteriofagului PL,
promotorul trp-lac sau promotorul bacteriofagului T7; nainte de
promotor se afl MCS;
2. operatorul specific promotorului utilizat;
3. situs-ul de legare al ribozomului, (engl.Ribosome Binding Site RBS);
4. zona de semnalizare a sfritului transcripiei.
Situsul multiplu de clonare este amplasat ntotdeauna dup situsul de legare al ribozomului, n aa fel nct prin clonarea genei de interes
aceasta s fie pus sub controlul promotorului (Figura 15). Vectori de
expresie mai pot conine, de asemenea, i alte sisteme de control strict al
expresiei. De exemplu, n cazul sistemului de expresie care utilizeaz
promotorul bacteriofagului T7, n plasmid este i gena pentru lisozim din

Plasmide i tulpini de Escherichia coli

61

fagul T7, un inhibitor al ARN-polimerazei T7 care elimin expresia


constitutiv a acesteia.
RBS

MCS

Secven
terminatoare

Operator

Promotor

Marker selectabil
ORI
FIGURA 15. Vector plasmidial de expresie tipic
RBS situs-ul de legare a ribozomului; MCS situs multiplu de clonare;
ORI origine de replicare

Principalele caracteristici ale vectorilor


plasmidiali utilizai n ingineria genetic
Vectorul pUC19c
vector de clonare de dimensiuni mici (2,7 kb). Un vector similar pUC18
ce difer de pUC19c doar prin secvena situsului de clonare;
secvena complet a plasmidului se gsete n baza de date
GeneBank/EMBL cu indicativul L09137;
numr mare de copii n celul;

62

Biologie molecular. Metode experimentale

conine gena responsabil de rezistena la ampicilin;


permit realizarea seleciei alb/albastru prin complementare alfa folosind
plci cu Xgal;
comercializat de New England Biolabs;
harta situsurilor de restricie este prezentat n Anex, Figura A3.

Vectorul pBlueScript II SK (+/-)


vector de clonare plasmidial a crui origine de replicare provine de la un
fag;
codific rezistena la ampicilin;
comercializat de Stratagene;
harta situsurilor de restricie este prezentat n Anex, Figura A4.

Vectorul pET-21a
vector de clonare i expresie avnd dimensiunea de 5,4kb;
expresia proteinei se induce prin adugarea n mediu a lactozei sau a
unui derivat al acesteia (IPTG);
proteina produs este recombinat avnd la captul N terminal 6 resturi
de histidin i o coad T7; resturile de histidin permit purificarea
proteinei produse prin cromatografie de afinitate pentru metale, iar coada
T7 permite purificarea proteinei prin tehnici imuno-cromatografice.
comercializat de Novagen;
harta situsurilor de restricie este prezentat n Anex, Figura A5.

Vectorul pMAL-c5x
vector de clonare i expresie;
proteina clonat este pus sub controlul promotorului tac, expresia
putnd fi indus prinadugarea n mediu a lactozei sau a unui derivat al
acesteia (IPTG);
proteina produs este fuzionat cu MBP (engl.Maltose Binding
Protein), protein cu afinitate pentru maltoz din E. coli, oferind astfel o
modalitate simpl de purificare prin cromatografie de afinitate
comercializat de NewEngland Biolabs;
harta situsurilor de restricie este prezentat n Anex, Figura A6.

Plasmide i tulpini de Escherichia coli

63

III.2 Tulpini de Escherichia coli utilizate frecvent


n ingineria genetic
Tehnicile de manipulare ale ADN-ului au folosit microorganismul
Eschericia coli nc de la nceputul utilizrii lor, indiferent de domeniul n
care au fost aplicate. Din acest motiv, de-a lungul timpului a aprut un
numr mare de tulpini de E. coli derivate de la tulpina slbatic, special
selectate pentru a funciona ca celul gazd i a realiza funcii specifice,
precum replicarea ADN-ului recombinat sau expresia de proteine. Aceste
tulpini au fost n mod artificial modificate i adaptate la condiiile oferite
de mediile de cultur folosite n laborator. Ele i-au pierdut abilitatea de a
coloniza intestinul gros, fiind n marea lor majoritate auxotrofe pentru
diferii compui i neputndu-se dezvolta n afara laboratorului.
Majoritatea tulpinilor utilizate n laborator provin din dou tulpini
principale: E. coli K-12 i E. coli B. Aceste dou tulpini difer n
principal prin comportamentul lor fa de ADN-ul exogen. Tulpina E. coli
K-12 conine sistemul de metilare-restricie codificat de genele
hsdRMS(EcoKI) i va distruge ADN-ul care nu este metilat la adenina din
secvena AA*C[N6]GTGC sau GCA*C[N6]GTT. ADN-ul izolat din
aceast tulpina va fi n consecin metilat n aceste poziii. Tulpina E. coli
B conine sistemul de metilare-restricie codificat de genele
hsdRMS(EcoBI) i va distruge ADN-ul nemetilat la nivelul adeninei din
secvenele TGA*[N8]TGCT sau AGCA*[N8]TCA.
Plecnd de la aceste dou tulpini, cercettorii au creat numeroase
tulpini cu utilizare precis, aducnd modificri specifice la nivelul genelor
cromozomiale sau introducnd material genetic extra-cromozomial
suplimentar. Pentru a putea caracteriza fiecare din aceste tulpini este
necesar precizarea n mod explicit a modificrilor i mbuntirilor
aduse la nivelul genomului. Pentru aceasta, se consider c toate genele
din celule sunt normale, exceptnd pe cele care sunt n mod explicit
precizate ca fiind mutante. Semnul nainte unei gene indic lipsa genei
respective (deleie). Notaiile standard pentru cele mai frecvente mutaii i
manifestrile lor fenotipice la tulpinile de E.coli cu utilizare n laborator
sunt prezente n Tabelul 3.

Biologie molecular. Metode experimentale

64

TABEL 3. Notaii standard pentru cele mai frecvente mutaii i manifestrile lor
fenotipice la tulpini de E. coli cu utilizare n laborator
Notare

Manifestare fenotipic

nu conine plasmidul conjugativ F

conine plasmidul conjugativ F; celulele pot realiza procesul


de conjugare i transfera plasmidul la celulele F-

F'[ ]

conine un plasmid conjugativ F n care au fost integrate


gene cromozomiale; celulele pot realiza procesul de
conjugare i pot transfera plasmidul la celulele F-; genele
cromozomiale integrate n plasmid sunt reprezentate ntre
paranteze ptrate.

rB/K+/-

indic linia celular; semnele +/- indic faptul c tulpina


prezint sau nu sisteme active de restricie specifice pentru
E. coli

mB/K+/-

indic linia celular; semnele +/- indic faptul c tulpina


prezint sau nu sisteme de metilare active ale ADN-ului
specifice pentru E. coli

hsdS

sisteme de metilare i restricie inactivate pentru anumite


secvene; transferul ADN-ului izolat din aceast tulpin n
tulpini slbatice de E. coli va duce la degradarea acestuia

hsdR

indic transformarea eficient cu ADN ne-metilat, obinut


de exemplu prin reacia de amplificare in vitro (PCR)

INV( )

inversare la nivel cromozomial ntre locaiile indicate

ahpC

mutaie la nivelul genei alchil-hidroperoxid reductazei ce


confer enzimei i capacitatea de a reduce legturile
disulfidice

ara-14

tulpina nu poate metaboliza arabinoza

araD

mutaie la nivelul genei pentru L-ribulozo-4-fosfat


epimeraza ce blocheaz metabolismul arabinozei

cycA

mutaie la nivelul sistemului de transport al alaninei; tulpina


nu poate utiliza alanina ca surs de carbon

dapD

mutaie la nivelul genei care codific succinil-

Plasmide i tulpini de Escherichia coli

Notare

65

Manifestare fenotipic
diaminopimelat-transferaza care conduce la inactivarea
acesteia; tulpina are nevoie de acid succinic sau lizin i
metionin n mediu pentru a se dezvolta

( )

deleia la nivel cromozomial a genelor cuprinse ntre


poziiile dintre paranteze

dam

metilarea adeninei din secvena GATC este activ; sistemul


de reparaie a ADN-ului este activ

dcm

metilarea carbonului din poziia a doua n secvena


CCWGG este activ; n general, cele doua proprieti, dam
i dcm, sunt prezente i nu sunt precizate n mod explicit;
lipsa lor este ns ntotdeauna precizat sub forma notaiilor
dam- i dcm-

deoR

expresia constitutiv a genelor responsabile de sinteza


deoxiribozei; permite transformarea celulelor cu plasmide
de dimensiuni mari (8)

dut1

activitatea dUTP-azic este inactivat, ducnd la creterea


concentraiei de dUTP i ncorporarea U n loc de T n ADN

endA 1

endonucleaza I este inactivat, ceea ce permite o mai uoar


izolare a ADN-ului

galE

mutaie asociat, n general, cu o competen crescut i


rezisten la 2-deoxi-galactoz (9)

galk

tulpina nu poate metaboliza galactoza i este rezistent la


2-deoxi-galactoza

galU

tulpina nu poate metaboliza galactoza

gor

mutaie la nivelul glutation-reductazei; mbuntete


formarea legturilor disulfidice

gyrA96

mutaie la nivelul genei ce codific ADN giraza; rezisten


la acid nalidixic

gyrA462

mutaie la nivelul genei ce codifica ADN giraza; rezisten


la toxina colicina ccdB

(lac)X74

deleia ntregului operon lac i a zonelor adiacente (10)

Biologie molecular. Metode experimentale

66

Notare

Manifestare fenotipic

lacIq
sau
lacIQ

supraproducia proteinei represor lac; regiunea -35 n


promotorul din faa lacI este modificat din GCGCAA n
GTGCAA

lacIQ1

supraproducia proteinei represor lac; conine o deleie de 15


pb pentru a crea o regiune -35 optim n promotorul din faa
lacI

lacY

tulpina este deficient n transportul i metabolizarea


lactozei datorit deleiei genei pentru lactoz-permeaz

lacZM15

deleia parial a genei lacZ, ceea ce permite alfa


complementarea genei pentru -galactozidaz; necesar
pentru realizarea seleciei alb/albastru pe baza fenomenului
de complementare alfa folosind plci cu Xgal

leuB

necesit leucin n mediu pentru dezvoltare

lon

deleia proteazei lon

malA

tulpina nu poate metaboliza maltoza

mcrA

mutaie ce elimin sistemul de restricie a ADN-ului metilat


la nivelul secvenei CmCGG

mcrB

mutaie ce elimin sistemul de restricie a ADN-ului metilat


la nivelul secvenei RmC

metB

necesit metionin n mediu pentru dezvoltare

metC

necesit metionin n mediu pentru dezvoltare

mrr

mutaie ce elimin sistemul de restricie al ADN-ului metilat


la nivelul secvenei CmAG sau GmAC

mtlA

nu poate metaboliza manitolul

mutS

mutaie ce inhib procesul de reparaie al ADN-ului

nupG

vezi deoR

ompT

mutaie la nivelul genei ce codific proteaza extracelular


VII, reducnd astfel proteoliza proteinelor supraexprimate

(P1)

conine profagul P1; tulpina exprim sistemul de restricie


P1

Plasmide i tulpini de Escherichia coli

67

Notare

Manifestare fenotipic

(P2)

conine profagul P2

PlysS

conine plasmidul pLysS ce codific rezistena la


cloramfenicol i atenueaz activitatea T7 RNA-polimerazei

proA/B

necesit prolin n mediu pentru cretere i dezvoltare

recA1

tulpin sensibil la radiaii UV; sistemul de reparaie al


ADN-ului este deficitar

recBCD

mutaii la nivelul exonucleazei V; mutaia la nivelul genelor


RecB sau RecC ce reduce frecvena proceselor
recombinatorii de 100 de ori; tulpin sensibil la radiaii
UV; sistemul de reparaie al ADN-ului este deficitar

relA

fenotip relaxat, sinteza ARN-ului este permis n lipsa


sintezei proteice

rha

metabolismul ramnozei este blocat

rnc

conine ribonucleaz III

rne

codific ribonucleaz E

rpsL

mutaie la nivelul proteinei ribozomale S12 ce duce la


rezisten pentru streptomicin

sr1

metabolismul sorbitolului este blocat

supE

glnV

supF

tyrT

thi

necesit tiamin n mediu pentru cretere i dezvoltare

thyA

necesit timin n mediu pentru cretere i dezvoltare

Tn10

conine transpozonul 10 ce codific n mod normal i


rezistena la tetraciclin

Tn5

conine transpozonul 5 ce codific n mod normal i


rezistena la kanamicin

tonA

mutaie le nivelul unei proteine din membrana extern ce


confer rezisten la fagii T1 i T5

traD

mutaie ce inactiveaz factorul de transfer, celulele nu pot


iniia sau accepta transferul plamidului F

Biologie molecular. Metode experimentale

68

Notare

Manifestare fenotipic

trxB

mutaie la nivelul tioredoxin reductazei, mbuntete


formarea punilor disulfidice n citoplasm

tsx

mutaie le nivelul unei proteine din membrana extern ce


confer rezisten la T6 i la colicina K

ung1

permite ncorporarea uracilului n ADN-ul plasmidial

xyl-5

metabolismul xilozei este blocat

SmR

rezisten la streptomicin

n cele ce urmeaz sunt prezentate succint principalele tulpini de


E. coli utilizate n laborator alturi de genotipul acestora i utilizrile
specifice.
Tulpina E. coli BL21
F-dcm ompT hsdS(rB- mB-) gal [malB+]K-12(S);
regiunea "malB" a fost transferat de la tulpina K-12 (11).
TulpinaE. coli BL21(DE3)
F-ompT gal dcm lon hsdSB(rB-mB-) (DE3 [lacI lacUV5-T7 gene1 ind1
sam7 nin5]);
tulpin derivat din E. coli B ce conine DE3 un profag cu genele
pentru ARN polimeraza T7 i lacIq;
utilizat n special drept gazd pentru expresia de proteine recombinate
clonate n vectori plasmidiali specifici i puse sub controlul promotorului
bacteriofagului T7; prin adugarea n mediul de cultur a lactozei sau a
unui compus similar cu aceasta (de exemplu IPTG), ARN polimeraza T7
este activat i va duce la transcripia genelor aflate sub controlul
promotorului bacteriofagului T7, supraexprimandu-le (12);
ntregul genom al acestei tulpini a fost secveniat (13).
Tulpina E. coli BL21 (DE3) pLysS
F-ompT gal dcm lon hsdSB(rB-mB-) (DE3) pLysS(cmR);
este identic cu tulpina E. coli BL21(DE3), dar conine suplimentar
plasmidul pLysS;
plasmidul pLysS confer tulpinii rezisten la cloramfenicol i de

Plasmide i tulpini de Escherichia coli

69

asemenea conine gena pentru lizozim din fagul T7, un inhibitor al ARNpolimerazei T7; acesta elimin expresia constitutiv a ARN-polimerazei
T7, aspect extrem de util n clonarea genelor toxice pentru E. coli;
nu poate fi utilizat drept gazd pentru propagarea vectorilor, deoarece
plasmidul deja existent interfer cu izolarea acestora.
TulpinaE. coliDH1
endA1 recA1 gyrA96 thi-1 glnV44 relA1 hsdR17(rK-mK+) -;
derivat din tulpina Hoffman-Berling 1100;
permite transformarea eficient a plasmidelor de dimensiuni mari (4060 kb);
rezistent la acid nalidixic (14).
Tulpina E. coliDH5
F-endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG 80dlacZM15
(lacZYA-argF)U169, hsdR17(rK-mK+), -;
derivat din tulpina E. coliDH1;
rezistent la acid nalidixic;
una dintre cele mai utilizate gazde pentru vectori.
Tulpina E. coliRosetta(DE3)pLysS
F-ompT hsdSB(RB-mB-) gal dcm (DE3 [lacI lacUV5-T7 gene 1 ind1
sam7 nin5]) pLysSRARE (CamR);
tulpin derivat din E. coli B ce conine DE3, un profag cu genele
pentru ARN-polimeraza T7 i lacIq;
utilizat n special drept gazd pentru expresia de proteine recombinate
clonate n vectori plasmidiali specifici i puse sub controlul promotorului
bacteriofagului T7; prin adugarea n mediul de cultur a lactozei sau a
unui compus similar cu aceasta (de exemplu IPTG), ARN polimeraza T7
este activat i va duce la transcripia genelor aflate sub controlul
promotorului bacteriofagului T7, supra-exprimandu-le (12);
rezistent la cloramfenicol;
conine plasmidul pLysSRARE; acesta permite utilizarea n E. coli a
codonilor rari AGG, AGA, AUA, CUA, CCC i GGA, deoarece codific
genele ARNt pentru argU, argW, ileX, glyT, leuW, proL, metT, thrT, tyrU,
i thrU;
plasmidul pLysSRARE conine, de asemenea, gena pentru lizozim din

70

Biologie molecular. Metode experimentale

fagul T7, un inhibitor al ARN-polimerazei T7; aceasta elimin expresia


constitutiv a ARN-polimerazei T7, comportarea fiind extrem de util n
clonarea genelor toxice pentru E. coli;
util pentru supraexprimarea unor gene ce conin codoni rari pentru E.
coli, cum ar fi gene din eucariote de exemplu;
nu poate fi utilizat drept gazd pentru propagarea vectorilor, deoarece
plasmidul deja existent interfer cu izolarea acestora.
Tulpina E. coli XL1-Blue (Stratagene)
endA1 gyrA96(nalR) thi-1 recA1 relA1 lac glnV44 F'[::Tn10
proAB+lacIq(lacZ)M15] hsdR17(rK-mK+);
rezistent la acid nalidixic i la tetraciclin;
folosit drept gazd pentru propagarea i izolarea plasmidelor, dar i
pentru expresia de proteine.
Tulpina E. coliXL2-Blue (Stratagene)
endA1 gyrA96(nalR) thi-1 recA1 relA1 lac glnV44 F'[::Tn10
proAB+lacIq(lacZ)M15 Amy CmR] hsdR17(rK-mK+);
rezistent la acid nalidixic i la tetraciclin;
rezistent la cloramfenicol n concentraii mai mici de 40 mg/ml;
sensibil la cloramfenicol n concentraii mai mari de 100 mg/ml;
folosit drept gazd pentru propagarea i izolarea plasmidelor, dar i
pentru expresia de proteine.
Tulpina XL1-Red (Stratagene)
F- endA1 gyrA96(nalR) thi-1 relA1 lac glnV44 hsdR17(rK-mK+) mutS
mutT mutD5 Tn10;
rezistent la acid nalidixic i la tetraciclin;
tulpin ce acumuleaz foarte frecvent mutaii; ADNul transferat este
foarte instabil.
Tulpina XL10-Gold (Stratagene)
endA1 glnV44 recA1 thi-1 gyrA96 relA1 lac Hte (mcrA)183 (mcrCBhsdSMR-mrr)173 tetRF'[proAB lacIqZM15 Tn10(TetRAmy CmR)];
rezistent la acid nalidixic, tetraciclin i cloramfenicol;
fenotipul hte permite transformarea cu plasmide de dimensiuni foarte
mari.

Plasmide i tulpini de Escherichia coli

71

Bibliografie:
1. Arber, W., Linn, S. (1969) DNA modification and restriction, Annual
Review of Biochemistry,38, 467-500.
2. Roberts, R. J. (2005) How restriction enzymes became the
workhorses of molecular biology, Proceedings of the National
Academy of Sciences of the United States of America, 102, 5905-8.
3. Roberts, R. J., Vincze, T., Posfai, J., Macelis, D. (2010) REBASE--a
database for DNA restriction and modification: enzymes, genes and
genomes, Nucleic Acids Research, 38, D234-6.
4. Jackson, D. A. (1972) Biochemical Method for Inserting New
Genetic Information into DNA of Simian Virus 40: Circular SV40
DNA Molecules Containing Lambda Phage Genes and the
Galactose Operon of Escherichia coli, Proceedings of the National
Academy of Sciences, 69, 2904-2909.
5. Cohen, S. N., Chang, A. C., Boyer, H. W., Helling, R. B. (1973)
Construction of biologically functional bacterial plasmids in vitro,
Proceedings of the National Academy of Sciences of the United
States of America, 70, 3240-4.
6. Lobban, P. (1973) Enzymatic end-to-end joining of DNA molecules,
Journal of Molecular Biology, 78, 453-460.
7. Brown, T. A. (2010) Gene Cloning and DNA Analysis: An
Introduction (Brown, T., Ed.) 6th ed. Wiley&Blackwell.
8. Durfee, T., Nelson, R., Baldwin, S., Plunkett, G., Burland, V., Mau, B.,
Petrosino, J. F., Qin, X., Muzny, D. M., Ayele, M., Gibbs, R. A.,
Csrgo, B., Psfai, G., Weinstock, G. M., Blattner, F. R. (2008)
The complete genome sequence of Escherichia coli DH10B:
insights into the biology of a laboratory workhorse, Journal of
Bacteriology, 190, 2597-606.
9. Hanahan, D., Jessee, J., Bloom, F. R. (1991) Plasmid transformation
of Escherichia coli and other bacteria, Methods in Enzymology,
204, 63-113.
10. Ferrndez, A., Garci, J. L., Daz, E. (1997) Genetic characterization
and expression in heterologous hosts of the 3-(3hydroxyphenyl)propionate catabolic pathway of Escherichia coli
K-12, Journal of Bacteriology, 179, 2573-81.
11. Studier, F. W., Daegelen, P., Lenski, R. E., Maslov, S., Kim, J. F.
(2009) Understanding the differences between genome sequences

72

Biologie molecular. Metode experimentale

of Escherichia coli B strains REL606 and BL21(DE3) and


comparison of the E. coli B and K-12 genomes, Journal of
Molecular Biology, 394, 653-80.
12. Studier, F. W., Moffatt, B. A. (1986) Use of bacteriophage T7 RNA
polymerase to direct selective high-level expression of cloned
genes, Journal of Molecular Biology, 189, 113-30.
13. Jeong, H., Barbe, V., Lee, C. H., Vallenet, D., Yu, D. S., Choi, S.-H.,
Couloux, A., Lee, S.-W., Yoon, S. H., Cattolico, L., Hur, C.-G.,
Park, H.-S., Sgurens, B., Kim, S. C., Oh, T. K., Lenski, R. E.,
Studier, F. W., Daegelen, P., Kim, J. F. (2009) Genome sequences
of Escherichia coli B strains REL606 and BL21(DE3), Journal of
Molecular Biology, 394, 644-52.
14. Meselson, M., Yuan, R. (1968) DNA Restriction Enzyme from E.
coli, Nature, 217, 1110-1114.

IV. METODE I TEHNICI FOLOSITE


PENTRU IZOLAREA I
PURIFICAREA ADN-ULUI
Capacitatea de a izola molecule de acizi nucleici din diverse surse
reprezint un punct de plecare pentru dezvoltarea unor experimente foarte
variate precum digestia cu enzime de restricie, amplificarea in vitro,
secvenierea, clonarea de fragmente sau dezvoltarea unor biblioteci de
secvene. Din aceste motive protocoalele care au n vedere purificarea
acizilor nucleici au devenit deosebit de comune n laboratoarele de
cercetare.
Purificarea ADN-ului din esuturi i celule presupune parcurgerea
a cel puin dou etape mai mult sau mai puin separate:
1. liza celulelor n scopul eliberrii acizilor nucleici;
2. separarea acizilor nucleici de moleculele contaminante.
Liza celulelor i esuturilor se realizeaz prin aciunea combinat
a detergenilor, enzimelor litice, agenilor chimici sau fizici.
Detergenii au capacitatea de a solubiliza membranele celulare,
ducnd la eliberarea coninutului celular. Cel mai frecvent utilizai sunt
SDS (dodecil sulfat de sodiu sau lauril sulfat de sodiu), Triton X-100 i
CTAB (bromur de cetil trimetil amoniu). CTAB poate precipita ADN-ul
genomic i are de asemenea avantajul c elimin polizaharidele din
extractele vegetale i bacteriene (1).
Enzimele litice sunt, n general, adugate ntr-o soluie tampon de
liz ce conine detergeni. Lizozimul este utilizat pentru liza bacteriilor
Gram pozitive. Zimolaza i murienaza sunt utilizate pentru producerea de
protoplati din drojdii. Proteinaza K lizeaz glicoproteinele i inactiveaz
parial nucleazele.
Agenii denaturani precum ureea sau srurile de guanidin pot fi
utilizai ntre anumite concentraii pentru liza celulelor fr a afecta
moleculele de ADN. n cazul celulelor cu perei celulari duri se apeleaz
la procedeul de sonicare.
Mojararea n azot lichid sau mcinarea cu ajutorul morilor cu bile
sunt cteva dintre metodele mecanice ce pot fi utilizate pentru liza
nveliului celular dur.

74

Biologie molecular. Metode experimentale

Separarea acizilor nucleici de moleculele contaminante implic


dou etape:
separarea acizilor nucleici de moleculele de alta natur
(proteine, lipide, glucide, compui fenolici);
separarea moleculelor de acizi nucleici de interes de celelate
molecule de aceeai natur.
Separarea acizilor nucleici de moleculele de alta natur se poate
realiza prin:
1. precipitare selectiv a proteinelor i polizaharidelor prin saltingout, metod utilizat n special n purificarea ADN-ului
plasmidial;
2. precipitare cu ageni chaotropici i extracie cu solveni organici
cea mai utilizat metod pentru izolarea ADN-ului genomic din
diverse specii;
3. metode ce utilizeaz rini de siliciu acizii nucleici au
capacitatea de a se lega de rinile de siliciu prin intermediul
interaciilor hidrofobe; tria acestor legturi crete n condiii
denaturate (de exemplu n prezena clorurii de guanidin) (2), iar
eliminarea agenilor denaturani duce la dispariia legturilor i
recuperarea acizilor nucleici;
4. metode ce utilizeaz schimbtorii de ioni datorit sarcinii
negative de -1/nucleotid (respectiv -2/pereche nucleotide) acizii
nucleici se leag puternic de suporturile cromatografice ncrcate
pozitiv. Dup splri repetate cu soluii de concentraii reduse n
sruri pentru eliminarea contaminanilor, moleculele de acizi
nucleici sunt eluate cu soluii tampon cu concentraii mari de
sruri;
5. metode bazate pe hidroxiapatit acizii nucleici au capacitatea de
a se lega de fosfatul de calciu cristalin prin interaciunea dintre
ionii Ca2+ i resturile fosfat din structura nucleotidelor.
Separarea moleculelor de acizi nucleici de interes de celelalte
molecule de aceeai natur se relizeaz prin diferite proceduri:
1. pentru izolarea ADN dintr-un amestec ce conine ADN i ARN se
utilizeaz tratamente cu RN-aze;
2. pentru izolarea ARN-ului dintr-un amestec ce conine ADN i
ARN se utilizeaz tratamente cu DN-aze;
3. pentru izolarea ADN-ului plasmidial de ADN-ul genomic se
utilizeaz proprietatea plasmidelor de a se renatura mult mai rapid

Izolarea i purificarea ADN-ului

75

dect ADN-ul genomic; cele mai utilizate metode sunt liza


alcalin (3) sau liza prin fierbere (4); o alt metod mai puin
utilizat pentru separarea ADN-ului plasmidial este centrifugarea
n gradient de CsCl;
4. pentru izolarea ADN-ului de o anumit dimensiune se utilizeaz
electroforeza n geluri de agaroz sau poliacrilamid.
Dezvoltarea diverselor tehnici de manipulare in vitro a acizilor
nucleici a condus la necesitatea ca, pe lng sursele tradiionale de izolare
precum celule sau esuturi bacteriene, fungice, vegetale sau animale s se
dezvolte protocoale de izolare i purificare a acizilor nucleici din soluiile
apoase rezultate n urma reaciilor de amplificare in vitro, digestie
enzimatic, fosforilare sau defosforilare, marcare radioactiv etc. n
general, aceste din urm tehnici utilizeaz filtrarea prin gel sau membrane
de siliciu (5).
n ultima perioad se poate constata diminuarea frecvenei
utilizrii metodelor tradiionale de izolare a acizilor nucleici n favoarea
folosirii diverselor truse (kit-uri) specifice. Acestea conin toate
materialele necesare pentru a izola acizii nucleici de un anumit tip i au
avantajul rapiditii de realizare a experimentului. Vom ncerca pe ct
posibil ca la fiecare din metodele de izolare a ADN-ului prezentate n
continuare s precizm att trusele ce pot fi utilizate ct i firmele ce le
furnizeaz.

IV.1 Izolarea ADN-ului plasmidial


Pentru izolarea ADN-ului plasmidial trebuie depit o problem
destul de dificil reprezentat de separarea plasmidelor de alte molecule
de aceeai natur (ADN-cromozomial). Radloff (6) a reuit s izoleze
pentru prima dat ADN-plasmidial folosind o metod care se bazeaz pe
absorbia difereniat a bromurii de etidiu. De atunci au fost descrise
diverse alte metode, ce se bazeaz pe gel-filtrare, cromatografie cu
schimbtori de ioni sau precipitare difereniat (7). Dintre acestea, cele
mai utilizate metode, datorit simplitii i randamentului mare, sunt cele
ce folosesc precipitarea difereniat. Aceste metode se bazeaz pe
proprietatea ADN-ului plasmidial de a se renatura mult mai rapid dect
ADN-ul genomic, acesta din urm fiind precipitat mpreun cu
moleculele proteice. Dou metode de izolare a ADN-ului plasmidial au

76

Biologie molecular. Metode experimentale

devenit clasice n biologia molecular: liza alcalin (3) i liza prin fierbere
(4). Acestea se pot utiliza numai pentru plasmidele de dimensiuni mici
(pn la 10 kb), pentru cei de dimensiuni mari utilizndu-se metode mai
puin invazive, precum centrifugarea n gradient de CsCl (8). Sambrook
(7) descrie un numr foarte variat de protocoale pentru prepararea ADNului plasmidial, protocoale ce se pot adapta uor condiiilor i dotrii
existente n orice laborator.
Truse (kit-uri) comerciale disponibile pentru prepararea ADN-ului
plasmidial:
QIAprep Spin Miniprep Kit, Qiagen;
Strataprep Plasmid Miniprep Kit, Stratagene;
Quantum Prep Plasmid Miniprep Kit, Biorad;
Illustra plasmidPrep Mini Spin Kit, Amersham Biosciences.

Izolarea ADN-ului plasmidial folosind metoda


lizei alcaline
Metoda a fost descris pentru prima data de Birnboim i Doly,
(1979) (3) i const n dou etape distincte, liza celular i precipitarea
selectiv a ADN-ului plasmidial, urmate de precipitarea ADN-ului cu
solveni organici.
Prima etap, cea de liz celular i precipitare selectiv a ADN-lui
plasmidial se bazeaz pe faptul c plasmidele au dimensiuni mici i sunt
puternic supra-spiralizat, pe cnd ADN-ul genomic are dimensiuni mari i
este mai puin rsucit. Aceast diferen de topologie permite precipitarea
selectiv a ADN-ului genomic mpreun cu proteinele, ADN-ul plasmidial
i ARN-ul rmnnd n soluie.
Celulele sunt lizate n condiii de alcalinitate, iar ADN-ul i
proteinele se denatureaz. Soluia este apoi neutralizat prin adugare de
acetat de potasiu, crendu-se astfel condiii n care proteinele i ADN-ul
cromozomial nu se pot renatura i precipit. ADN-ul plasmidial, datorit
dimensiunilor mici se poate renatura i rmne solubil. Prin centrifugare
se separ precipitatul, alctuit din proteine i ADN cromozomial, de
sepernatantul care conine ADN plasmidial.

Izolarea i purificarea ADN-ului

77

Precipitarea cu solveni organici


Din supernatantul rezultat, ADN-ul este precipitat n vederea
eliminrii compuilor micromoleculari cu ajutorul unor solveni organici
cum ar fi izopropanol (concentraie final 40-50%) sau etanol (75-80%)
(8). Solvenii organici au proprietatea de a induce, n prezena unor
concentraii mari de cationi monovaleni (0,1-0,5 M), o serie de
modificri structurale la nivelul moleculelor de acizi nucleici,
determinnd agregarea i precipitarea acestora. Deoarece majoritatea
srurilor i compuilor micromoleculari sunt solubili n etanol 70%,
aceast etap asigur i eliminarea moleculelor de acest tip. Izopropanolul
are avantajul c poate fi utilizat n volume mici, ns prezint i
dezavantajul c srurile au o solubilitate mai mic n acest alcool,
precipitnd odat cu ADN-ul (1).
Un aspect foarte important n realizarea etapei de precipitare cu
solveni organici a ADN-ului l reprezint concentraia de sare, deoarece
cationii din structura srurilor intervin n mod direct n proces. Cationii
ecraneaz gruprile fosfat, elimin forele de respingere i permit astfel
mpachetarea strns a moleculelor i ca urmare precipitarea. n general,
pentru precipitarea ADN-ului, se prefer acetatul de amoniu deoarece este
volatil i prin urmare uor de eliminat (5).
Pentru precipitare se pot utiliza i ali compui precum:
1. PEG (polietilen-glicol) are dezavantajul de a fi deosebit de greu
de eliminat din reacie, iar precipitarea nu se poate realiza dect cu
soluii n care ADN-ul are o concentraie mai mare de 10 mg/ml(9);
2. TCA (acid tricloracetic) precipit molecule de dimensiuni mici
dar acizii nucleici recuperai nu sunt funcionali(5).
Principiul metodei
Celulele bacteriene sunt lizate prin aciunea NaOH (denatureaz
ADN-ul) i SDS-ului (denatureaz proteinele) n vederea eliberrii
coninutului celular. Soluia obinut este neutralizat rapid, ceea ce face
ca ADN-ul cromozomial, proteinele i SDS-ul s precipite. Componentele
insolubile sunt eliminate prin centrifugare. Datorit dimensiunilor mici
ADN-ul plasmidial se renatureaz i i pstreaz solubilitatea, fiind astfel
separat de componentele celulare. ADN-ul plasmidial este recuperat din
supernatant prin precipitare cu etanol.

Biologie molecular. Metode experimentale

78

Avantaje:
1. separarea moleculelor de ADN dublu catenar nchise, cu
dimensiuni mai mici de 10 kDa; pentru plasmidele de dimensiuni
mai mari se recomand utilizarea altor metode de liz (8);
2. uor de scalat ntre volume de 1 ml (mini-prep) i 1 L (maxi-prep)
mediu de cultur, permind obinerea unor cantiti mari de
ADN-plasmidial;
3. timpul de lucru este de sub o or pentru 12 probe, fiind o metod
mai rapid dect metoda prin fierbere, dar mai lent dect metoda
care folosete litiu (10);
4. randamentul de recuperare tipic este de 3-5 g ADN/ml mediu de
cultur, folosind plasmizi ce se replic n numr mare (precum
Xf3 sau pUC); cantitatea de ADN-plasmidial rezultat depinde de
numrul de copii n care plasmidul exist n celul; pentru
creterea randamentului recuperrii este recomandat s se utilizeze
medii de cultur mbogite (de exemplu Terrific Broth, TB) sau s
se efectueze un tratament cu cloramfenicol a culturilor bacteriene;
cloramfenicolul are capacitatea de a inhiba sinteza de proteine
ceea ce conduce la oprirea diviziunii celulare, dar nu afecteaz
multiplicarea plasmidelor (8); dei acest tratament nu mai este
necesar pentru vectorii plasmidiali moderni, el este totui utilizat
n ideea reducerii balastului proteic.
Limitri:
1. expunerea prelungit la valori mari de pH poate duce la
denaturarea ireversibil (11) sau chiar ruperea catenelor ADN-ului
plasmidial (12);
2. calitatea preparatului depinde de tulpina ce conine plasmidul, cele
mai bune rezultate obinndu-se cu tulpini cu activitate redus a
endonucleazei A care produc puine poliglucide (C600, DH1,
LE392).

Izolarea i purificarea ADN-ului

79

Materiale necesare:
1. mediu Luria-Bertani (LB) 10 g NaCl, 5 g extract de drojdii i
10 g pepton se dizolv n 800 ml ap, se corecteaz pH-ul la 7 i
se autoclaveaz; mediul steril este stabil la temperatura camerei
timp nelimitat;
2. soluie glucoz-Tris-EDTA (GTE) glucoz 50 mM, Tris 25 mM,
EDTA 10 mM, pH 8; soluia nesteril nu este stabil la
temperatura camerei; dac se prepar cantiti mai mari, soluia se
repartizeaz n flacoane de 100 ml, se sterilizez i se pstreaz la
temperatura de 4oC;
3. soluie Tris-HC1 1 M, pH 8,0; soluia se filtreaz i se
autoclaveaz;
4. soluie EDTA 0,5M se cntrete cantitatea de EDTA i se
dizolv n aproximativ 70% din volumul de ap; se adaug NaOH
solid pn cnd soluia se clarific, dup care se verific pH-ul;
dac este necesar se adaug NaOH pn cnd pH-ul se situeaz n
intervalul
7-8 dup care soluia se filtreaz i se autoclaveaz; se pstreaz la
frigider;
5. soluie tampon TrisCl-EDTA (TE) 10 mM TrisCl, 1 mM EDTA,
pH 8; pentru prepararea a 100 ml, ntr-un cilindru gradat de
100 ml se introduc 1 ml Tris-HCl 1 M pH 8,0, 0,2 ml EDTA 0,5 M
i se completeaz la semn cu ap distilat;
6. soluie NaOH/SDS SDS 1% n NaOH 0,2 N,
7. Acetat de potasiu 3 M se prepar prin combinarea a 60 ml acetat
de potasiu 5 M, 11,5 ml acid acetic concentrat, 28,5 ml ap
distilat;
8. etanol 95% i 70%;
9. microeprubete de 1,5 ml;
10. microcentrifug;
11. facultativ: RN-az 10 mg/ml (enzima trebuie s fie lipsit de
activitate DN-azic), concentrator cu vacuum centrifugal
(SpeedVac concentrator, Eppendorf).

80

Biologie molecular. Metode experimentale

Mod de lucru:
1. 5 ml mediu LB steril coninnd antibioticul corespunztor se
inoculeaz cu o colonie bacterian purttoare a plasmidului de
interes. Cultura se incubeaz n vederea creterii bacteriei pn la
atingerea fazei staionare, urmnd protocolul specific pentru
microorganismul cu care se lucreaz (pentru E. coli, 37oC, 190 rpm,
peste noapte, ntr-un agitator termostatat).
2. 1,5 ml cultur bacterian se centrifugheaz timp de 20 secunde la
13000 rpm n vederea recuperrii celulelor. Supernatantul reprezentat
de mediul de cultur clar se arunc. Centrifugarea se poate realiza la
temperatura camerei sau la temperatura de 4oC.
3. Depozitul se resuspend n 100 l soluie GTE i se incubeaz timp de
5 minute la temperatura camerei. Dac depozitul nu este complet
resuspendat i dislocat (sunt vizibile fragmente n masa lichidului),
randamentul izolrii scade foarte mult.
4. Se adaug 200 l soluie NaOH/SDS, se amestec prin rsturnarea
microeprubetei i se incubeaz pe ghea timp de 5 minute. Lizatul
obinut trebuie s fie clar.
5. Peste lizat se adaug 150 l soluie acetat de potasiu i se agit imediat
prin rsturnarea microeprubetei. Pentru precipitare complet se
menine microeprubeta pe ghea timp de 5 minute.
6. Precipitatul este colectat pe fundul eprubetei prin centrifugare timp de
3 minute la 13.000rpm.
7. Supernatantul este transferat ntr-o microeprubet nou, se adaug
0,8 ml etanol 95% i se incubeaz timp de 2 minute la temperatura
camerei pentru precipitarea acizilor nucleici.
8. ADN-ul i ARN-ul sunt recuperai prin centrifugare timp de 1 minut la
13.000rpm
9. Supernatantul este nlturat, iar depozitul este resuspendat n etanol
70%. Acizii nucleici sunt recuperai prin centrifugare timp de 1 minut
la
13.000rpm. Aceast etap de splare are rolul de a elimina srurile
precipitate n prima etap.

Izolarea i purificarea ADN-ului

81

10. Precipitatul este apoi uscat la temperatura camerei sau folosind


SpeedVac-ul. Dac uscarea nu este complet, etanolul va interfera cu
enzimele de restricie i polimerazele.
11. Depozitul se resuspend n ap dac se utilizeaz imediat sau n
tampon TE, dac se dorete pstrarea ADN-lui.
n cazul n care preparatul este contaminat cu RNA se adaug 1 l
soluie RN-az, 10 mg/ml.
5 l din preparatul obinut pot fi utilizai pentru efectuarea
reaciilor de clivare cu enzime de restricie.
Metoda poate fi scalat pentru volume de pn la 1 L mediu de
cultur prin mrirea corespunztoare a volumului componenilor utilizai.
Metode ce descriu producerea de ADN plasmidial din volume mari de
cultur sunt de asemenea descrise n literatura de specialitate (8).

Izolarea ADN-ului plasmidial utiliznd metoda


lizei prin fierbere
Metoda a fost descris i utilizat pentru prima dat de Holmes (4)
i const, ca i metoda descris anterior, dintr-o etap de liz i denaturare
a componentelor celulare, realizat prin aciunea cldurii, o etap de
precipitare difereniat a componentelor celulare i o etap de recuperare
a ADN-ului plasmidial.
Principiul metodei
Celulele bacteriene coninnd plasmidul de interes sunt lizate prin
aciunea lizozimului i a cldurii. Temperatura ridicat realizeaz, n plus,
denaturarea proteinelor i acizilor nucleici. Prin rcirea lizatului,
moleculele de dimensiuni mari (proteine i ADN cromozomial) nu se pot
renatura i devin insolubile, precipitnd. Dup eliminarea precipitatului
prin centrifugare, ADN-ul plasmidial renaturat, solubil, este recuperat prin
precipitare cu etanol.

Biologie molecular. Metode experimentale

82

Avantaje:
1. metoda este foarte asemntoare cu cea care folosete liza
alcalin, avnd aceleai avantaje i aplicaii;
2. este mai simpl i mai economic dect metoda prin liz alcalin,
necesitnd mai puini reactivi.
Limitri:
1. cantitatea de ADN obinut este, n general, mai mic prin
comparaie cu metoda care folosete liza alcalin;
2. calitatea preparatului depinde de tulpina ce conine plasmidul;
tulpinile derivate de la HB101 sau TG1 au un coninut ridicat de
poliglucide i de aceea este indicat utilizarea metodei prin liz
alcalin(1);
3. observaiile privind cantitatea de ADN recuperat n cazul lizei
alcaline sunt valabile i n cazul lizei prin fierbere.
Materiale necesare:
1. mediu LB 10 g NaCl, 5 g extract de drojdii i 10 g pepton se
dizolv n 1000 ml ap, se corecteaz pH-ul la 7 i se
autoclaveaz; mediul steril este stabil la temperatura camerei timp
nelimitat;
2. soluie Tris-HC1 1 M, pH 8; soluia se filtreaz i se autoclaveaz;
3. soluie NaCl 5 M 29 g NaCl se dizolv ntr-un volum final de
100 ml ap distilat; soluia obinut se filtreaz i se autoclaveaz;
4. soluie EDTA 0,5 M se cntrete cantitatea de EDTA i se
dizolv n aproximativ 70% din volumul de ap; se adaug NaOH
solid pn cnd soluia se clarific, dup care se verific pH-ul;
dac este necesar se adaug NaOH pn cnd pH-ul atinge o
valoare situat n intervalul 7-8, dup care soluia se filtreaz i se
autoclaveaz; soluia obinut se pstreaz la frigider;
5. soluie STET (Sare/Tris/EDTA/Triton X-100) 0,1 M NaCl,
10 mM TrisCl, 1 mM EDTA, 5% Triton X-100, pH 8; pentru a

Izolarea i purificarea ADN-ului

83

prepara 100 ml, se introduc ntr-un cilindru gradat de 100 ml 2 ml


NaCl 1 M, 1 ml Tris-HCl pH 8,0, 0,2 ml EDTA 0,5 M, 5 ml Triton
X-100 i se completeaz la semn cu ap distilat;
6. lizozim;
7. izopropanol, rece;
8. etanol 80%, facultativ;
9. tampon TE 10 mM TrisCl, 1 mM EDTA, pH 8; ntr-un cilindru
gradat de 100 ml se introduc 1 ml Tris-HCl 1 M pH 8,0, 0,2 ml
EDTA 0,5 M i se completeaz la semn cu ap distilat.
10. soluie RN-az 10 mg/ml;
11. microeprubete de 1,5 ml;
12. baie de ap.
Mod de lucru:
1. 5 ml mediu LB steril coninnd antibioticul corespunztor se
inoculeaz cu o colonie bacterian purttoare a plasmidului de
interes; cultura se incubeaz n vederea creterii bacteriei pn la
atingerea fazei staionare, urmnd protocolul specific pentru
microorganismul cu care se lucreaz (pentru E. coli, 37oC, 190 rpm,
peste noapte);
2. 1,5 ml cultur bacterian se centrifugheaz timp de 20 secunde la
13.000rpm n vederea recuperrii celulelor; supernatantul reprezentat
de mediul de cultur clar se arunc; centrifugarea se poate realiza la
temperatura camerei sau la temperatura de 4oC;
3. depozitul coninnd celulele bacteriene se resuspend prin pipetare n
300 l soluie STET coninnd 200 g lizozim; suspensia poate fi
vortexat pentru a resuspenda foarte bine celulele;
4. microeprubetele se incubeaz pe ghea timp de 10 minute;
5. se incubeaz pe baia de ap la fierbere (100C) 1-2 minute;
6. lizatul obinut se centrifugheaz timp de 30 minute la 13.000rpm
pentru separarea componentelor insolubile;
7. supernatantul se transfer ntr-o microeprubet nou, fr a se disloca
depozitul;

84

Biologie molecular. Metode experimentale

8. se adaug 200 l izopropanol rece i se incubeaz la temperatura de


-20C timp de 30 minute; ADN-ul plasmidial precipitat este recuperat
prin centrifugare la 13.000 rpm timp de 5 minute;
9. dac preparatul este contaminat cu sruri (ADN-ul nu este clivat de
enzimele de restricie) se poate introduce o etap de splare cu etanol
80%;
10. supernatantul se arunc i depozitul se usuc la temperatura camerei
sau folosind concentratorul centrifugal SpeedVac (Eppendorf);
11. depozitul se resuspend n ap dac se utilizeaz imediat sau n
tampon TE dac se dorete pstrarea ADN-lui.

IV.2 Izolarea ADN-ului genomic


Pentru izolarea ADN-ului cromozomial din diverse surse au fost
descrise o serie de metode, alegerea uneia sau alteia depinznd de
aplicaia n care preparatul va fi utilizat. Unele aplicaii, cum ar fi reaciile
de digestie enzimatic, necesit cantiti relativ mari de ADN de puritate
foarte mare. n aceste cazuri se parcurg etape mai elaborate de purificare,
ce sunt descrise n continuare. Alte aplicaii, precum cele care au la baz
amplificarea in vitro a moleculelor de acizi nucleici sunt mult mai
permisive n privina cantitii i calitii, motive pentru care este posibil
utilizarea unor metode mai simple i mai rapide de izolare a ADN-ului,
precum cele descrise pentru bacterii (13).
Toate metodele prezentate n cele ce urmeaz au la baz metoda
clasic de extracie cu fenol/cloroform/alcool izoamilic descris pentru
prima dat de Chomczynski (14). Lizatul celular coninnd acizi nucleici
este pus n contact cu un amestec organic nemiscibil cu apa, alctuit din
fenol, cloroform i alcool izoamilic. Fiecare dintre cele 3 componente ale
fazei organice are un rol bine stabilit n sensul c:
- fenolul realizeaz denaturarea proteinelor i solubilizarea lor parial n
faza organic;
cloroformul asigur o mai bun separare ntre faza apoas i cea
organic, reducnd cantitatea de ap reinut de aceasta din urm
(15),(16);
alcoolul izoamilic prentmpin formarea spumei ajutnd la separarea
celor dou faze i mrind randamentul extraciei (1).

Izolarea i purificarea ADN-ului

85

Proteinele denaturate se separ la interfaa dintre faza organic i


faza apoas, iar ADN-ul rmne n cea din urm. Din faza apoas ADN-ul
este izolat prin precipitare cu alcooli (etanol, izopropanol), urmnd
principiile descrise anterior (pentru detalii, consultai protocolul Izolarea
ADN-ului plasmidial folosind metoda lizei alcaline, pagina 76).

Izolarea ADN-ului genomic din bacterii


Metodele tradiionale, precum cele descrise de Meade et al., 1982
(17) se bazeaz pe liza celulelor cu ajutorul lizozimului, proteazelor i
detergenilor, urmate de extracia acizilor nucleici cu ajutorul sistemului
de solveni fenol/cloroform. Aceste metode permit eliminarea foarte
eficient a moleculelor proteice, dar nu pot fi utilizate pentru tulpini care
produc cantiti mari de exopoliglucide precumPseudomonas,
Agrobacterium, Rhizobium, Myxococcus i Brudyrhizobium.
O mbuntire evident a acestor metode a fost realizat deKate
Wilson (1) prin introducerea unei etape de precipitare cu CTAB (bromur
de cetil-trimetil-amoniu), compus care elimin exopoliglucidele din
extract. Metoda, descris n cele ce urmeaz, permite izolarea ADN-ului
genomic bacterian utilizabil direct pentru digestia enzimatic folosind ca
surs un spectru foarte larg de bacterii Gram-negative sau Gram-pozitive.
Truse (kit-uri) disponibile:

GenElute Bacterial Genomic DNA Kit (SigmaAldrich);


AxyPrep Bacterial Genomic DNA Miniprep Kit (Axygen);
Illustra bacteria genomic Prep Mini Spin Kit (Amersham);
ChargeSwitch gDNA Mini Bacteria Kit (Invitrogen).

Principiul metodei
Celulele bacteriene sunt lizate i proteinele distruse prin aciunea
proteinazei K. Fragmentele din peretele celular, poliglucidele i restul de
proteine sunt precipitate selectiv cu CTAB, iar ADN-ul cu mas
molecular mare este recuperat prin precipitare cu izopropanol.

Biologie molecular. Metode experimentale

86

Avantaje:
1. randamentul este n general de 5-20 g/ml cultur bacterian.
Limitri:
1. unul dintre elementele cheie al metodei este coninutul de NaCl,
care nu trebuie s depeasc 0,5 M; dac se depete aceast
concentraie, ADN-ul cromozomial precipit(18);
2. toate operaiile trebuie realizate la temperaturi mai mari de 15oC
deoarece sub aceast temperatur se produce precipitarea CTAB.
Materiale necesare:
1. soluie Tris-HC1 1 M, pH 8 soluia se filtreaz i se
autoclaveaz;
2. soluie EDTA 0,5 M se cntrete cantitatea de EDTA i se
dizolv n aproximativ 70% din volumul de ap; se adaug NaOH
solid pn cnd soluia se clarific, dup care se verific pH-ul;
dac este necesar se adaug NaOH pn cnd pH-ul se ncadreaz
n domeniul 7-8, dup care soluia se filtreaz i se autoclaveaz;
soluia se pstreaz la frigider;
3. soluie tampon TE 10 mM TrisCl, 1 mM EDTA, pH 8; pentru a
preparara 100 ml, ntr-un cilindru gradat de 100 ml se introduc
1 ml Tris-HCl 1 M pH 8, 0,2 ml EDTA 0,5 M i se completeaz la
semn cu ap distilat;
4. soluie SDS 10% 10 g SDS se dizolv n 90 ml ap distilat;
5. proteinaz K 20 mg/ml 20 mg proteinaz K se dizolv n 1 ml
ap distilat; soluia obinut se repartizeaz n microeprubete,
cte4 L/microeprubet i se pstreaz la temperatura de -20C;
nu se recongeleaz;
6. soluie NaCl 5 M 29 g NaCl se dizolv ntr-un volum final de
100 ml ap distilat;
7. soluie CTAB/NaCl 10% CTAB n NaCl 0,7 M pentru
prepararea a 100 ml soluie, ntr-un cilindru gradat se introduc

Izolarea i purificarea ADN-ului

87

10 g CTAB, 14 ml NaCl 5 M i 60 ml ap distilat; Se agit


amestecul i se nclzete la temperatura de 65oC pn la
dizolvarea complet a detergentului, dup care se aduce la semn;
soluia se pstreaz la temperatura camerei, fiind stabil civa ani;
8. 8-hidroxichinolin;
9. soluie TRIS baz 50 mM, pH 10,5, neajustat 6,05 g Tris baz se
dizolv n 1000 ml ap distilat;
10. soluie Tris-HCl 50 mM, pH 8 6,05 g Tris baz se dizolv n
800 ml ap; se corecteaz pH-ul cu HCl i se aduce la 1000 ml cu
ap distilat;
11. cloroform;
12. alcool izoamilic;
13. fenol lichid
Fenolul este toxic i coroziv, cauznd arsuri ale pielii i
materialelor textile. Este obligatoriu s se poarte
echipament de protecie (mnui, ochelari i halat, iar
manipularea fenolului se face numai sub ni. Pentru unele
aplicaii se poate folosi fenol 88% fr a fi necesar
purificarea acestuia. Dac fragmentele ADN care se
purific vor fi utilizate pentru clonare, este indicat ca
fenolul s fie redistilat deoarece compuii de oxidare ai
fenolului introduc leziuni n catenele de acizi nucleici.
Fenolul redistilat este disponibil de la diveri furnizori, la
fel ca i soluia fenol/cloroform/alcool izoamilic 25:24:1
(v/v/v).
14. fenol tamponat pH 8 ntr-un pahar din sticl cu capacitatea de
2 L se introduc 5 g 8-hidroxichinolin i, cu atenie, 500 ml fenol
lichid (lichefiat sau topit pe o baie de ap la temperatura de 65C);
soluia va deveni galben datorit 8-hidroxichinolinei, care are rol
antioxidant; se adaug 500 ml Tris baz 50 mM i se menine sub
agitare pe un agitator magnetic timp de 10 minute la temperatura
camerei; se oprete agitarea i se separ faza apoas prin decantare
sau cu ajutorul unei pipete; se adaug 500 ml TrisCl 50 mM, pH 8;
se repet operaia de agitare timp de 10 minute dup care se
incubeaz fr agitare i se separ faza apoas; pH-ul soluiei se
verific cu ajutorul hrtiei indicatoare; dac pH-ul nu este 8,
tratamentele cu TrisCl, pH 8 se reiau pn la obinerea pH-ului

Biologie molecular. Metode experimentale

88

necesar; dup atingerea pH-ului dorit se adaug 250 ml TrisCl


50 mM, pH 8; soluia obinut este stabil la temperatura de 4C,
n sticle brune, pentru mai mult de 2 luni;
15. soluie fenol/cloroform/alcool izoamilic 25:24:1 (v/v/v) se
amestec 25 ml fenol tamponat (faza galben a soluiei meninut
la temperatura de 4oC) cu 24 volume cloroform i 1 volum alcool
izoamilic; amestecul obinut se pstreaz la frigider n sticle brune
i este stabil pentru cel mult 2 luni;
16. soluie cloroform/alcool izoamilic 24:1(v/v) 24 ml cloroform se
combin cu 1 ml alcool izoamilic;
17. isopropanol;
18. soluie etanol 70%.
Mod de lucru:
1. 5 ml mediu LB steril coninnd antibioticul corespunztor se
inoculeaz cu o colonie bacterian purttoare a plasmidului de
interes; cultura se incubeaz n vederea creterii bacteriei pn la
atingerea fazei staionare, urmnd protocolul specific pentru
microorganismul cu care se lucreaz (pentru E. coli, 37oC,
190 rpm, peste noapte);
2. 1,5 ml cultur bacterian se centrifugheaz timp de 20 secunde la
13.000 rpm n vederea recuperrii celulelor; supernatantul
reprezentat de mediul de cultur clar se arunc; centrifugarea se
poate realiza la temperatura camerei sau la temperatura de 4oC;
3. depozitul format se resuspend n 567 l tampon TE prin pipetri
repetate; se adaug 30 l SDS 10% i 3 l proteinaz K 20 mg/ml
(concentraia final 100 g/ml proteinaz K n SDS 0,5%); se agit
cu atenie i se incubeaz timp de o or la temperatura de 37C;
soluia nu se vortexeaz, aceast operaiune putnd conduce la
fragmentarea moleculelor ADN;
4. peste lizat se adaug 100 l NaCl 5 M i se agit prin pipetri
repetate; aceast etap este deosebit de important deoarece
complexele CTAB-acizi nucleici vor precipita n condiiile n care,
la temperatura camerei, concentraia n sruri scade sub 0,5 M;

Izolarea i purificarea ADN-ului

89

5. se adaug 80 l soluie CTAB/NaCl, se agit i se incubeaz timp


de 10 minute la temperatura de 65C;
6. se adaug un volum aproximativ egal de cloroform/alcool
izoamilic (0,7-0,8 ml), se agit energic i se centrifugheaz timp de
4-5 minute ntr-o microcentrifug;
7. supernatantul vscos, reprezentat de faza apoas se transvazeaz
ntr-o alt microeprubet i se adaug un volum egal de
fenol/cloroform/alcool izoamilic; se agit energic i se
centrifugheaz n aceleai condiii ca n etapa anterioar;
8. supernatantul rezultat se transfer ntr-o microeprubet nou i se
adaug 0,6 volume izopropanol n scopul precipitrii aciziilor
nucleici; microeprubeta se agit prin rsturnare pn cnd apare un
precipitat sub forma unui fir foarte fin care reprezint ADN; acesta
se recupereaz printr-o centrifugare scurt la 4.000 rpm; se poate
ntmpla ca precipitatul format s nu prezinte aspect de fir,
deoarece ADN-ul cromozomial a fost fragmentat, caz n care acesta
mai poate fi folosit doar pentru anumite aplicaii (digestie
enzimatic, Southern blot);
9. precipitatul se spal cu etanol 70% pentru eliminarea CTAB
rezidual, dup care se centrifugheaz timp de 5 minute la
temperatura camerei; supernatantul se arunc, iar depozitul se
usuc la temperatura camerei, ntr-un SpeedVac sau liofilizator;
10. depozitul se resuspend n 100 l tampon TE timp de o or.

90

Biologie molecular. Metode experimentale

Izolarea ADN-ului genomic din plante


Metodele de izolare a acizilor nucleici din plante constau n liza
celulelor, separarea acizilor nucleici prin centrifugare n gradient de CsCl
(1) sau precipitarea cu CTAB, extracia cu amestec cloroform/octanol i
precipitare cu izopropanol (19). Metoda descris n continuare se bazeaz,
n principiu, pe solubilitatea diferit a complexului CTAB-acizi nucleici
n soluii de clorur de sodiu de concentraii diferite i a fost utilizat
iniial pentru izolarea acizilor nucleici din bacterii (20).
Materialul biologic folosit pentru izolarea ADN-ului poate fi
reprezentat de semine, semine germinate, frunze, calus, endosperm,
embrioni sau polen n stare proaspt sau uscat. Datorit numrului mare
de endonucleaze, trebuie acordat o atenie deosebit pregtirii i pstrrii
materialului vegetal n vederea extraciei. Este indicat ca imediat dup
colectare, materialul biologic s fie congelat sau pstrat pe ghea uscat.
Metoda cea mai indicat de uscare a materialului biologic este liofilizarea.
Pentru probe de material vegetal se mai poate recurge la uscarea peste
noapte la temperatura de 65oC sau sub vacuum (19). n general, aceste
ultime dou metode de uscare conduc la diminuarea randamentului de
izolare i la fragmentarea acizilor nucleici.
Truse (kit-uri) disponibile pentru izolarea ADN-ului din plante:
ChargeSwitch gDNAPlant Kit (Invitrogen);
DNeasy Plant Mini Kit (Qiagen);
AquaPure Genomic DNA Isolation Kits (BioRad);
GenomicPrep Cells and Tissue DNA Isolation Kit
(Amersham).
Principiul metodei
Metoda descris se bazeaz pe proprietatea detergentului CTAB de
a precipita difereniat moleculele de acizi nucleici. La concentraii mai
mari de 0,5 M NaCl complexul CTAB-acizi nucleici este solubil, iar la
concentraii mai mici de 0,5 M devine insolubil.
Materialul biologic este solubilizat cu ajutorul CTAB ntr-o soluie
tampon cu un coninut mare de NaCl, dup care pigmenii clorofilieni i

Izolarea i purificarea ADN-ului

91

proteinele sunt extrase cu amestec cloroform/octanol. Prin scderea


concentraiei NaCl, acizii nucleici sunt precipitai, iar supernatantul
coninnd poliglucide i compui fenolici este ndeprtat. Depozitul
insolubil CTAB-acizi nucleici este resolubilizat ntr-o soluie al crei
coninut de NaCl este mare. Pentru eliminarea detergentului, acizii
nucleici sunt supui unei precipitri cu izopropanol, urmate de splare cu
etanol 80%. Depozitul obinut, coninnd ADN i ARN este dizolvat n
tampon TE.
Avantaje:
1. n general, se obin 100-500 g ADN din 1 g esut proaspt;
2. dimensiunile fragmentelor obinute sunt mai mari de 50 kb dac se
acord o atenie deosebit manipulrii soluiilor ce conin acizi
nucleici (nu se vortexeaz, pipetarea soluiilor se realizeaz
utiliznd pipete cu vrf larg) i se elimin nucleazele (prin
rehidratarea sau dezghearea probelor numai n prezena soluiilor
de CTAB);
3. metoda poate fi utilizat i pentru cantiti mai mici de esut
vegetal (minipreparate din rondele cu dimensiunea de 1 cm2) (1);
4. metoda este mai rapid dect cea care utilizeaz centrifugarea n
gradient de CsCl
Limitri:
1. n protocolul descris toate componentele celulare sunt lizate, astfel
nct ADN-ul izolat este alctuit din ADN cromozomial (n cea
mai mare parte, dar i din ADN mitocondrial i ADN plastidial) o
metod de separare a ADN-ului cromozomial de cel mitocondrial
i plastidial a fost descris de Watson si Thomson, 1986 (21).
Materiale necesare:
1. tampon 1 M Tris-HC1, pH 8 soluia se filtreaz i se autoclaveaz;

92

Biologie molecular. Metode experimentale

2. NaCl 5 M 29 g NaCl se dizolv ntr-un volum final de 100 ml


ap distilat; soluia obinut se filtreaz i se autoclaveaz;
3. EDTA 0,5 M se cntrete cantitatea de EDTA i se dizolv n
aproximativ 70% din volumul de ap. Se adug NaOH solid pn
cnd soluia se clarific, dup care se verific pH-ul; dac este
necesar se adaug NaOH pn cnd pH-ul se situeaz n intervalul
7-8, dup care soluia se filtreaz i se autoclaveaz; se pstreaz
n frigider;
4. tampon de extracie CTAB 2% (w/v), EDTA 20 mM, NaCl 1,4 M
nTris-HCl 0,1 M, pH 8 pentru prepararea a 100 ml tampon de
extracie, ntr-un cilindru gradat de 100 ml se introduc 4 ml EDTA
0,5 M, 28 ml NaCl 5 M, 10 ml Tris-HC1 0,1 M, pH 8, 30 ml ap
distilat i 2 g CTAB; soluia se agit i se nclzete la
temperatura de 65oC pn la dizolvarea complet a detergentului,
dup care se aduce la semn; soluia se pstreaz la temperatura
camerei, fiind stabil timp de civa ani;
5. soluie CTAB/NaCl CTAB 10% n NaCl 0,7 M pentru
prepararea a 100 ml soluie, ntr-un cilindru gradat se introduc
10 g CTAB, 14 ml NaCl 5 M i 60 ml ap distilat; amestecul se
agit i se nclzete la temperatura de 65oC pn la dizolvarea
complet a detergentului, dup care se aduce la semn; soluia se
pstreaz la temperatura camerei, fiind stabil timp de civa ani;
6. soluie de precipitare CTAB 1% (w/v), EDTA 10 mM, Tris-HCl
50 mM, pH 8; pentru prepararea a 100 ml soluie de precipitare,
ntr-un cilindru gradat de 100 ml se introduc 2 ml EDTA 0,5 M,
5 ml Tris-HC11 M, pH 8, 80 ml ap distilat i 1 g CTAB; soluia
se agit i se nclzete la temperatura de 65oC pn la dizolvarea
complet a detergentului, dup care se aduce la semn; soluia se
pstreaz la temperatura camerei, fiind stabil timp de civa ani;
7. mercaptoetanol;
8. tampon TE/NaCl NaCl 1 M, EDTA 0,1 mM, Tris-HCl 10 mM,
pH 8 pentru prepararea a 100 ml, ntr-un cilindru gradat de
100 ml se introduc 20 ml NaCl 5M, 1 ml Tris-HCl 1 M pH 8,
0,2 ml EDTA 0,5 M i se completeaz la semn cu ap distilat;
soluia este stabil la temperatura camerei timp de civa ani;
9. tampon TE EDTA 0,1 mM, Tris-HCl 10 mM, pH 8 pentru
prepararea a 100 ml, ntr-un cilindru gradat de 100 ml se introduc
20 ml NaCl 5 M, 1 ml Tris-HCl 1 M pH 8, 0,2 ml EDTA 0,5 M i

Izolarea i purificarea ADN-ului

93

se completeaz la semn cu ap distilat; soluia este stabil la


temperatura camerei timp de civa ani;
10. cloroform/octanol 24:1 (v/v) sau cloroform/alcool izoamilic
24/1 (v/v) 24 ml cloroform se combin cu 1 ml octanol sau cu
1 ml alcool izoamilic; soluia rezultat se pstreaz la temperatura
camerei, la ntuneric;
11. etanol 80%;
12. omogenizator mojar cu pistil, blender de laborator (Waring),
omogenizator cu lame (Polytron, Brinkmann), omogenizator cu
bile (Precellys 24, PeqLab) sau echivalent;
13. eprubete rezistente la solveni organici;
14. baie de ap termostatat;
15. centrifug;
16. SpeedVac;
17. azot lichid sau ghea uscat.
Mod de lucru:
Extracia acizilor nucleici:
1. nainte de utilizare, 1 ml de 2-mercaptoetanol se introduce n 100 ml
tampon de extracie cu CTAB, iar soluia obinut se nclzete la
temperatura de 65oC; pentru procesarea a 1 g esut vegetal proaspt
sunt necesare aproximativ 4 ml tampon de extracie cu CTAB i
0,5 ml soluie TAB/NaCl; dac se utilizeaz esut liofilizat sau
semine uscate, tamponul de extracie cu CTAB trebuie diluat n
proporie de 1:1;
2. 1 g esut vegetal proaspt (sau echivalent n esut liofilizat) se
introduce ntr-un mojar curat, rcit n prealabil i se mojareaz cu
azot lichid pn la obinerea unei pulberi fine; n loc de mojar se pot
utiliza diverse omogenizatoare (cu lam, cu bile), cazuri n care
trebuie acordat o atenie deosebit eliminrii posibilitilor de
contaminare ntre probe (vasul n care se realizeaz omogenizarea
trebuie foarte bine curat dup fiecare prob, prin utilizarea unor
perii i a aerului sub presiune (19); atunci cnd se lucreaz cu frunze
se recomand eliminarea nervurilor proeminente, deoarece acestea
sporesc coninutul de carbohidrai (19); o soluie const n utilizarea

94

Biologie molecular. Metode experimentale

de frunze tinere sau prelevarea probei de analizat sub form de


rondele recoltate din zonele dintre nervuri;
3. pulberea obinut se transfer ntr-o eprubet rezistent la solveni n
care se mai adaug 4 ml tampon de extracie nclzit care conine
CTAB i 2-mercaptoetanol; amestecul se omogenizeaz prin agitare
lent i se incubeaz timp de 30 minute la temperatura de 65C,
agitnd ocazional; mrirea timpului de incubare la o or conduce la
creterea cantitii de acizi nucleici izolate; dac randamentul nu este
important, este suficient o incubare timp de 10 minute; compuii
fenolici prezeni n multe plante pot fi eliminai prin tratarea
amestecului cu 1% (v/v) polivinilpirolidon (1);
Nu se folosete vortexul deoarece agitarea energic
poate conduce la ruperea moleculelor de acizi
nucleici
4. omogenatul este supus extraciei cu un volum egal (4 ml) de
cloroform/alcool izoamilic; microeprubeta se agit prin rsturnare,
dup care se centrifugheaz timp de 5 minute la turaia de 7500 x g i
temperatura de 4C; dup centrifugare, se separ dou faze, la
interfaa crora se afl resturi celulare insolubile; faza apoas se
separ prin transvazare sau pipetare ntr-o eprubet curat; dac
transvazarea se realizeaz prin pipetare, este absolut necesar s se
utilizeze pipete cu vrf larg, pentru a se elimina pericolul
fragmentrii moleculelor de ADN; unii cercettori prefer extracia
cu cloroform/octanol care conduce la un randament de extracie mai
bun (21);
5. peste faza apoas recuperat se introduc 110 volume (0,4 ml)
CTAB/NaCl nclzit la temperatura de 65oC i se agit prin
rsturnare;
6. soluia este supus unei noi extracii cu un volum egal (4,4 ml)
cloroform/alcool izoamilc; eprubeta se agit dup care se recupereaz
faza organic, procednd ca n etapa 4.

Izolarea i purificarea ADN-ului

95

Precipitarea acizilor nucleici:


1. peste faza apoas obinut n etapa anterioar se introduce un volum
(4,4 ml) de soluie de precipitare CTAB, dup care microeprubeta se
agit prin rsturnare; dac se constat apariia unui precipitat, se trece
la etapa urmtoare; dac nu, amestecul se incubeaz timp de
30 minute la temperatura de 65oC;
2. se centrifugheaz amestecul timp de 5 minute la 500 x g i
temperatura de 4C; dac nu apare un precipitat se adaug mai mult
soluie de precipitare CTAB (pn la 0,9 ml) i se incubeaz la
temperatura de 37oC, peste noapte;
3. supernatantul obinut se transfer ntr-o nou microeprubet, dar nu
se arunc. Precipitatul coninnd acizii nucleici se dizolv n soluie
tampon TE/NaCl (0,5-1 ml pentru 1 g material vegetal luat n lucru);
uneori este dificil de resuspendat depozitul, operaiunea necesitnd
incubare timp de 30 minute la temperatura de 65C; se citete
extincia supernatantului la 260 nm (pentru detalii consultati capitolul
VI. Determinarea concentraiei acizilor n soluie, pagina 133) i,
dac nu sunt prezeni acizi nucleici, acesta se arunc;
4. ADN-ul dizolvat n tampon TE/NaCl este precipitat prin adugarea a
0,6 volume izopropanol (0,6 ml izopropanol pentru 1 ml tampon
TE/NaCl); amestecul se agit i se centrifugheaz timp de 15 minute
la 7500 x g i temperatura de 4C;
5. precipitatul se spal cu etanol 80%, se usuc la temperatura camerei
sau n SpeedVac i se resuspend ntr-un volum minim de tampon
TE; dac preparatul obinut este contaminat cu ARN se poate realiza
un tratament cu RN-az, iar dac este contaminat cu proteine se poate
realiza un tratament cu proteinaz K (1).

Izolarea ADN-ului din esuturi animale


n cazul celulelor animale ADN-ul este organizat sub form de
cromozomi cu dimensiuni de 12-60 ori mai mari dect cromozomul de la
Escherichia coli (22). n procesul de izolare a ADN-ului cromozomial
eucariot de cele mai multe ori acesta este fragmentat, gradul de
fragmentare avnd o importan deosebit asupra aplicaiilor n care poate

Biologie molecular. Metode experimentale

96

fi utilizat preparatul. Metodele care utilizeaz manipulri agresive au


tendina de a fragmenta lanul dublu catenar al moleculelor de ADN n
fragmente mai mici de 50 kb, ce pot fi utilizate pentru reacii de
amplificarea in vitro sau Southern blotting, dar nu pot fi utilizate pentru
aplicaii mai pretenioase precum realizarea de biblioteci genomice (22).
Metoda descris n cele ce urmeaz a fost utilizat pentru prima
dat de Blin si Stafford n 1976 (23) fiind apoi modificat i adaptat de
Garner (22) pentru a permite obinerea de fragmente de ADN cu
dimensiuni de peste 200 kb. Sursa de ADN este esutul solid dar, cu
modificri minime, metoda poate fi utilizat i pentru snge sau culturi de
celule. Protocoale care utilizeaz asemenea materiale biologice sunt
descrise de Garner (22).
Kit-uri (truse) disponibile:
DNeasy Blood & Tissue Kit (Qiagen),
AquaPure Genomic DNA Isolation Kits (Biorad);
GenomicPrep Cells and Tissue DNA Isolation Kit
(Amersham);
DNA IQ System (Promega).
Principiul metodei
esutul animal mojarat este tratat cu proteinaz K ce cliveaz
nespecific proteinele, determinnd liza celulelor. Lizatul obinut este
supus unor extracii succesive cu fenol, ADN-ul din faza apoas fiind n
final precipitat cu etanol.
Avantaje:

atunci cnd metoda se utilizeaz cu atenie, dintr-un gram de esut


animal se obin aproximativ 2 mg ADN cu dimensiuni de cel puin
100 kb; ADN-ul este uor tiat de enzimele de restricie, fr a fi
necesare operaii suplimentare.

Izolarea i purificarea ADN-ului

97

Limitri:

procedura este destul de laborioas, necesitnd incubare ndelungat


pentru liza esutului precum i utilizarea de reactivi toxici; o metod
mai rapid ce poate fi utilizat pentru extracia ADN-ului din snge
este cea descris de Lahiri i Nurnberger, 1991 (24), metod care nu
face uz de extracii cu fenol sau de enzime; cantitatea de ADN
obinut prin aceasta ultim metod este mai mare, dar dimensiunile
fragmentelor sunt mai mici;
pentru obinerea de fragmente de ADN cu dimensiuni mari se vor
avea n vedere trei factori: 1. manipularea cu foarte mare atenie a
soluiilor care conin ADN pentru a minimiza forele ce ar putea
conduce la ruperea macromoleculelor de ADN; 2. izolarea, nghearea
i pulverizarea foarte rapide a esutului pentru a se elimina aciunea
DN-azelor; 3. utilizarea dializei pentru eliminarea srurilor din
preparat.

Materiale necesare:
1.
2.
3.
4.
5.

azot lichid;
mojar cu pistil, rcite la temperatura de -20C;
spatule;
pahare de laborator cu capacitatea de 600 ml;
soluie tampon Tris-HC1 1 M, pH 8; soluia se filtreaz i se
autoclaveaz;
6. soluie EDTA 0,5 M, pH 8 se cntrete cantitatea de EDTA i se
dizolv n aproximativ 70% din volumul necesar de ap; se adaug
NaOH solid pn cnd soluia se clarific, dup care se verific
pH-ul; dac este necesar se adaug NaOH pn cnd pH-ul se
ncadreaz n domeniul 7-8, dup care soluia se filtreaz i se
autoclaveaz; soluia se pstreaz la frigider;
7. soluie tampon TE Tris-HCl 10 mM, EDTA 1 mM, pH 8
pentru prepararea a 100 ml, ntr-un cilindru gradat de 100 ml se
introduc, 1 ml Tris-HCl 1 M pH 8, 0,2 ml EDTA 0,5 M i se
completeaz la semn cu ap distilat; soluia se autoclaveaz i
este stabil la temperatura camerei timp nelimitat;

Biologie molecular. Metode experimentale

98

8. soluie fenol saturat cu TE se prepar la fel cu soluia fenol


tamponat pH 8 numai c soluia Tris pH 8 este nlocuit cu TE
(pentru detalii consultai protocolul Izolarea ADN-ului genomic
din bacterii, pagina 85);
9. NaCl 5 M 29 g NaCl se dizolv ntr-un volum final de 100 ml cu
ap distilat; soluia obinut se filtreaz i se autoclaveaz;
10. soluie SDS 10% 10 g SDS se dizolva n 90 ml ap distilat;
11. tampon de extracie EDTA 0,1 M, NaCl 0,2 M, Tris-HC1 0,05 M
pH 8, SDS 0,5%, RN-az 50 g/ml pentru prepararea a 100 ml
tampon de extracie, ntr-un balon cotat se introduc 5 mg RN-aza,
20 ml EDTA 0,5 M pH 8, 5 ml NaCl 5M i 5 ml Tris-HC1 1 M pH
8; dup dizolvare se completeaz volumul la semn cu ap distilat;
nainte de utilizare soluia se fierbe pentru inhibarea activitii
DN-azei;
12. soluie proteinaz K 20 mg/ml n ap steril; dac se prepar
cantiti mai mari, acestea se distribuie n microeprubete pentru o
singur utilizare i se pstreaz la temperatura de -20oC; nu se
recongeleaz;
13. membrane de dializ acestea se fierb nainte de utilizare ntr-o
soluie EDTA 1 mM dup care se cltesc cu ap distilat;
14. acetat de sodiu 3M pH 6 24,6 g acetat de sodiu se dizolv ntr-un
volum minim de ap distilat; se corecteaz pH-ul cu acid acetic la
valoarea de 6 i se completeaz pn la 100 ml cu ap distilat;
15. etanol absolut;
16. etanol 70%;
17. pipete Pasteur ataate la o pomp de vid.
Mod de lucru:
1. fragmentul de esut proaspt excizat este imediat congelat prin
scufundare n azot lichid; organele de dimensiuni mari trebuie tiate
n fragmente mici de 1 cm3; extracia se poate realiza din orice organ;
n cazul izolrii de ADN din ficat este necesar ca animalul de
experiment s fie nfometat timp de 24 ore; odat ngheat, proba de
esut poate fi utilizat imediat sau poate fi pstrat la temperatura de
-70C timp de civa ani;

Izolarea i purificarea ADN-ului

99

2. se toarn azot lichid n mojarul rcit dup care se introduce imediat


poba (aproximativ 1 cm3) i se mojareaz pn la obinerea unei
pulberi; dac este necesar, se mai adaug azot lichid pentru a menine
proba rece;
3. dup mojarare, se ateapt evaporarea azotului i cu ajutorul unei
spatule se tranfer esutul pulverulent peste 20 ml tampon de
extracie, se agit cu atenie, se adaug 100 l proteinaz K
(concentraia final 100 g/ml) i se incubeaz la temperatura de
37C peste noapte; dup incubare soluia trebuie s fie clar i s
prezinte o consisten vscoas;
4. se adaug 20 ml fenol echilibrat cu TE i se amestec prin rsturnare
timp de 10-15 minute; este recomandat ca n aceast etap suprafaa
de separare s fie ct mai mare; dup agitare trebuie s se formeze o
suspensie; amestecul se omogenizeaz cu atenie, fr vortexare,
pentru a reduce ruperea macromoleculelor de ADN;
5. amestecul se transfer ntr-o eprubet din plastic cu capacitatea de
50 ml i se centrifugheaz la l500 x g timp de 10 minute;
6. faza fenolic inferioar se aspir cu ajutorul unei pipete Pasteur
conectat la vacuum sau prin intermediul unei pipete obinuite; se va
acorda atenie deosebit la introducerea pipetei n soluie pentru a se
evita amestecarea celor dou faze;
7. etapele 3-6 se repet de cel puin trei ori; faza apoas obinut n final
trebuie s fie clar.
8. pentru recuperare sunt posibile dou modaliti:
a) faza apoas se dializeaz fa de 1000 volume tampon TE; dializa
se realizeaz la temperatura camerei timp de 30 minute, dup care se
menine peste noapte la temperatura de 40oC;
b) peste faza apoas se adaug acetat de sodiu pn la concentraia
final 0,3 M; se agit uor i se adaug dou volume etanol absolut;
ADN-ul va precipita treptat sub forma unor fire fine de culoare alb;
cu ajutorul unei pipete Pasteur ndoit la vrf se culeg firele obinute,
se scufund n etanol 70%, dup care se usuc la temperatura camerei;
ADN-ul precipitat obinut se dizolv cu atenie n tampon TE;

Biologie molecular. Metode experimentale

100

9. se verific puritatea preparatului prin msurarea raportului


absorbanelor la 260/280 nm; dac raportul este mai mic de 1,8 se
repet etapele 3-9; soluia poate fi pstrat la temperatura de 4C.

IV. 3 Purificarea ADN-ului din soluii apoase


n urma diverselor reacii realizate in vitro(amplificare, digestie
enzimatic), rezult fragmente de ADN dizolvate ntr-o soluie cu o
compoziie relativ simpl, care conine cel mai frecvent tampon de
reacie, nucleozid trifosfai, 1-2 enzime i compui cu mas molecular
mic. Deseori concentraia n acizi nucleici sau compoziia soluiei
tampon nu sunt compatibile cu etapele ce urmeaz a fi efectuate i de
aceea este necesar izolarea din amestec a moleculelor de interes.
Metoda utilizeaz extracia clasic cu fenol/cloroform/alcool
isoamilic i a fost descris pentru prima dat de Chomczynski (14).
Kit-uri (truse) disponibile:
QIAquick PCR Purification Kit (Qiagen);
PCR Kleen Spin Columns (Biorad);
Wizard SV Gel and PCR Clean-Up System (Promega);
SpinPrep PCR Clean-up Kit (Novagen).
Principiul metodei
Soluia de ADN este supus extraciei cu un amestec de
fenol/cloroform/alcool isoamilic. ADN-ul rmne n faza apoas de
unde este apoi precipitat cu etanol 100%.
Avantaje:
1. simplitate, rapiditate;
2. randament de extracie i puritate a preparatelor mai bune dect n
cazul utilizrii metodelor bazate pe membrane de siliciu (1);
3. concentraia ADN n soluia de purificat trebuie s fie 1 mg/ml.

Izolarea i purificarea ADN-ului

101

Limitri:
1. expunerea ndelungat la fenol poate duce la degradarea ADN-ului
(1);
2. toxicitate deosebit a fenolului;
3. timp de procesare a probelor mai mare comparativ cu metodele
bazate pe membrane de siliciu.
Materiale necesare:
1. fenol/cloroform/alcool izoamilic 25:24:1 (v/v/v) (pentru detalii
privind prepararea acestui reactiv,c onsultai protocolul Izolarea
ADN-ului genomic din bacterii, pagina 85)
2. acetat de sodiu 3 M pH 5,2 408 g acetat de sodiu x 3H2O se
dizolv n 800 ml ap distilat; pH-ul se ajusteaz la 5,2 cu acid
acetic 3M i apoi se completeaz balonul cotat la semn, 1000 ml,
cu ap distilat;
3. etanol 100%, rcit;
4. etanol 70%, la temperatura camerei;
5. tampon TE pH 8 Tris-HCl 10 mM, EDTA 1 mM pH 8;
6. desicator sau concentrator centrifugal (Speedvac sau echivalent).

Mod de lucru:
1. ntr-o microeprubet se pipeteaz soluia care conine ADN-ul de
purificat (un volum cuprins ntre 200 i 400 l) i se adaug un
volum egal de fenol/cloroform/ alcool izoamilic;
2. amestecul se agit energic (prin utilizarea unui vortex) i se
centrifugheaz timp de 15 secunde ntr-o microcentrifug la vitez
maxim; fazele organic i cea apoas trebuie s se separe foarte clar;
uneori, datorit coninutului mare de sare din prob (mai mare de
0,5 M), cele dou faze se pot inversa, faza organic putnd fi uor
identificat datorit culorii galbene; dac separarea ntre faze nu este

102

Biologie molecular. Metode experimentale

perfect, sau faza apoas care conine ADN-ul este vscoas, se


repet centrifugarea pentru nc 1-2 minute.
3. faza apoas (de deasupra) se transfer, cu atenie, prin intermediul
unei pipete de 200 l ntr-o nou microeprubet; dac aceast faz
conine un precipitat alb se repet etapele anterioare;
4. se adug 1/10 volume acetat de sodiu 3 M, pH 5,2 peste soluia
coninnd ADN i se agit prin rsturnarea microeprubetei de cteva
ori; dac soluia iniial conine concentraii mari de NaCl aceast
etap nu este necesar;
5. se adaug 2,5 volume etanol 100%, rece, se agit energic prin
vortexare i se incubeaz pe ghea timp de 5-10 minute;
6. se centrifughez timp de 5 minute la viteza maxim a
microcentrifugii (14.000 rpm) iar supernatantul rezultat se arunc;
7. precipitatul format se spal cu 1 ml etanol 70%; microeprubeta se
agit prin rsturnare de cteva ori i precipitatul se separ prin
centrifugare timp de 5 minute la 14.000 rpm; dac moleculele de
ADN sunt mai mici de 200 pb, se utilizeaz etanol 95%;
8. supernatantul este eliminat i precipitatul se usuc ntr-un desicator
sau n Speedvac; dup splarea cu etanol 70% precipitatul nu ader
foarte bine la pereii microeprubetei, de aceea eliminarea
supernatantului trebuie s se realizeze cu mare atenie;
9. ADN-ul din precipitatul rezultat se dizolv ntr-un volum de ap (de
obicei 20-40 l) dac va fi utilizat imediat sau n acelai volum de
tampon TE dac se dorete pstrarea pentru un timp mai ndelungat;
Pentru a facilita dizolvarea precipitatului, concentraia final a
ADN-ului trebuie pstrat sub 1 mg/ml. Cantiti mici de ADN (mai puin
de 25 g) se dizolv relativ uor, ns pentru dizolvarea unor cantiti mai
mari ar putea fi necesar ncalzirea (5 minute la temperatura de 65C) (1).
Fragmentele de ADN genomic de dimensiuni mari nu trebuie vortexate,
iar dizolvarea lor necesit incubarea sub agitare uoar timp de 1-2 zile.

Izolarea i purificarea ADN-ului

103

IV. 4 Izolarea ADN-ului din geluri de agaroz


Electroforeza n geluri de agaroz nu este doar o metod de
vizualizare a fragmentelor de ADN izolat, ci este, n principal, o metod
de separare a fragmentelor de ADN n funcie de dimensiuni (pentru
detalii privind electroforeza n geluri de agaroz consultai capitolul VII
Separarea electroforetic a ADN-ului, pagina 147). Pentru ca fragmentul
de interes separat prin electroforez s poat fi utilizat ulterior n alte
aplicaii (ligri, transformri, fosforilri) este necesar izolarea lui din
gelul de agaroz i solubilizarea ntr-o soluie tampon convenabil. De-a
lungul timpului au fost dezvoltate mai multe metode de izolare a
ADN-ului din geluri de agaroz, metode ce utilizeaz electroeluia
(25), transferul prin electroforez a ADN-ului din gel pe un fragment de
hidroxiapatit (26), dizolvarea agarozei cu ajutorul iodurii de potasiu (27)
sau a agarazei. Protocoale de lucru pentru izolarea ADN-ului utiliznd
metodele enumerate mai sus sunt prezentate de Ausubel et al. (1) i de
Sambrook et al. (7). Metoda descris n cele ce urmeaz se bazeaz pe
observaiile lui Vogelstein i Gillespie (28) legate de proprietatea sticlei
de a lega fragmentele de ADN (1).
Kit-uri (truse) disponibile:
QIAquick Gel Extraction Kit (Qiagen);
Wizard SV Gel and PCR Clean-Up System (Promega);
PureLink Quick Gel Extraction Kit (Invitrogen) ;
SpinPrep Gel DNA Kit (Novagen).
Principiul metodei
Fragmentul ADN de interes este tiat din gel cu ajutorul unui
bisturiu. Agaroza este apoi topit la temperatura de 50oC n prezena
agentilor chaotropici (compui ce distrug structurile macromoleculelor),
iar ADN-ul este izolat utiliznd coloane cu membrane de siliciu. Acestea
au capacitatea de a lega fragmentele de ADN la concentraii mari de
sruri, eluarea realizndu-se prin modificarea triei ionice i a pH-ului.

Biologie molecular. Metode experimentale

104

Avantaje:

simplitate, rapiditate;
utilitate pentru izolarea fragmentelor mai mari de 500 pb; fragmentele
mai mici se leag practic ireversibil de membran (5).

Limitri:

eluia nu este ntotdeauna complet, existnd ADN neeluat, cu att


mai mult cu ct dimensiunea fragmentelor este mai redus;
randament de extracie mai redus (60%-80%) comparativ cu metodele
bazate pe electroeluie sau cu cele care folosesc agaroza cu punct de
topire sczut (1).

Materiale necesare:
1. soluie NaI 6 M se introduc 89,93 g NaI ntr-un balon cotat de
100 ml care se aduce la semn cu ap distilat; soluia se filtreaz
prin hrtie de filtru i este stabil pn la 3 luni dac este
meninut la ntuneric i temperatura de 4C;
2. soluie tampon de legare 0,75 g Na2SO3 i 57,3 g clorur de
guanidin se dizolv n 35 ml ap distilat; se completeaz cu ap
distilat pn la 100 ml i se sterilizeaz; soluia este stabil timp
de 3-4 luni la frigider, n sticl brun i nvelit n folie de
aluminiu; dac se observ formarea unui precipitat, soluia nu mai
poate fi utilizat;
3. soluie Tris-HCl 10 mM, pH 7,5 1,21 g Tris baz se dizolv n
800 ml H2O i se ajusteaz pH-ul la 7,5 cu HCl concentrat; se
completeaz la 1000 ml cu ap distilat; important: pH-ul soluiei
variaz semnificativ cu temperatura (aproximativ 0,028 uniti de
pH/oC) i de aceea este indicat ca stabilirea valorii pH-ului necesar
s se realizeze la temperatura la care se va lucra; deoarece pKa
pentru Tris este 8,08, aceast soluie tampon nu poate fi utilizat
pentru valori de pH mai mici de 7,2 sau peste 9; soluia este
stabil timp nelimitat;

Izolarea i purificarea ADN-ului

105

4. soluie NaCl 100 mM 58,4 g NaCl se dizolv ntr-un balon cotat


de 1000 ml dup care se aduce la semn cu ap distilat;
5. tampon de splare se prepar prin combinarea a unei pri de
Tris-HCl 10 mM, pH 7,5, o parte NaCl 10 mM i patru pri etanol
(concentraia final de etanol 80%);
6. tampon TE Tris-HCl 10 mM, EDTA 1 mM pH 8 pentru
prepararea a 100 ml, ntr-un cilindru gradat de 100 ml se introduc
1 ml Tris-HCl 1 M pH 8, 0,2 ml EDTA 0,5 M i se completeaz la
semn cu ap distilat; soluia se autoclaveaz i este stabil la
temperatura camerei timp nelimitat;
7. microeprubete de centrifug Eppendorf de 1,5 ml;
8. baie de ap termostatat (45C - 50C);
9. bisturiu;
10. coloane cu membrane de siliciu pentru microcentrifug (produse
de Qiagen, Promega, Invitrogen sau Novagen).
Mod de lucru:
1. dup terminarea separrii electroforetice (pentru detalii privind
separarea electroforetic a ADN-ului n geluri de agaroz consultai
capitolul VII Separarea electroforetic a ADN-ului, pagina 147) se
excizeaz din gel poriunea care conine fragmentul de interes cu
ajutorul unui bisturiu; fragmentul de gel se plaseaz ntr-o
microeprubet de centrifug cntrit n prealabil i i se determin
masa; dac excizia se realizeaz sub lampa de ultraviolete este
obligatoriu echipamentul de protecie: mnui de nitril (dac gelul
conine bromur de etidiu) i masc sau ochelari de protecie;
2. peste fragmentul de agaroz se pipeteaz 2,5 pn la 3 volume de
NaI 6 M (de exemplu dac masa gelului este 200 mg se adaug
500-600 l soluie); aceast metod ce folosete NaI drept agent
chaotrop nu este indicat pentru geluri care au fost migrate n tampon
TBE (TRIS-borat-EDTA, pentru detalii, consultai capitolul VII
Separarea electroforetic a ADN-ului, pagina 147), deoarece TBE
poate inhiba legarea moleculelor de ADN de membrana de siliciu; n
acest caz este indicat utilizarea percloratului de sodiu sau a
izotiocianatului de sodiu ca ageni chaotropi, iar pH-ul trebuie
meninut la valoarea de 6,5;

106

Biologie molecular. Metode experimentale

3. se incubeaz timp de 5 minute la temperatura de 45C - 50C pn la


dizolvarea agarozei; dac dup 5 minute agaroza nu este complet
dizolvat, se poate continua nclzirea pentru nc 1-2 minute, dar nu
mai mult dect este necesar pentru dizolvarea gelului;
4. peste soluia cu agaroz dizolvat se adaug 2 volume soluie tampon
de legare i se agit foarte bine;
5. supernatantul se aplic pe o coloan cu membran de siliciu care se
plaseaz n microeprubeta colectoare corespunztoare i se
centrifugheaz timp de 1 minut la viteza maxim (14.000 rpm) a
centrifugii; aplicarea supernatantului trebuie realizat cu atenie
pentru a nu atinge cu vrful pipetei membrana, aceasta putnd fi uor
perforat; lichidul se arunc, iar coloana se introduce n aceeai
eprubeta colectoare;
6. membrana se spal prin aplicarea a 750 l tampon de splare i se
centrifugeaz timp de un minut la vitez maxim; lichidul de splare
se arunc, iar coloana se reintroduce n microeprubeta de colectare;
7. se centrifugheaz din nou timp de un minut la vitez maxim a
centrifugii, pentru eliminarea etanolului rezidual; etapa este
important n special dac ADN-ul produs trebuie utilizat n reacii de
restricie sau n ligri;
8. coloana se transfer ntr-o microeprubet de centrifug de 1,5 ml i se
adaug 75-100 l tampon TE sau ap distilat (tratat pentru
eliminarea nucleazelor); se incubeaz timp de 2-10 minute la
temperatura camerei i apoi se centrifugheaz timp de un minut la
viteza maxim a centrifugii;
9. ADN-ul colectat se pstreaz la temperatura de 4C dac se utilizeaz
n termen de cteva zile sau la temperatura de -80oC dac se dorete
pstrarea lui timp ndelungat.

Izolarea i purificarea ADN-ului

107

IV. 5 Pstrarea ADN-ului purificat


Integritatea moleculelor de ADN n soluie poate fi compromis de
factori precum prezena nucleazelor, valori de pH mai mici de 6 i mai
mari de 9, prezena metalelor grele, radiatii UV i prezena radicalilor
liberi (5). Din aceste motive, atunci cnd se dorete pstrarea soluiilor ce
conin ADN este necesar eliminarea acestor factori. Nu este indicat
pstrarea ADN-ului izolat direct n ap, ci n soluii tampon. Cea mai
indicat soluie tampon este soluia TE, deoarece Tris-ul asigur un sistem
de tamponare foarte eficient n intervalul de pH 7-8 i nu are proprietatea
de a genera radicali liberi aa cum se ntmpl n cazul tamponul fosfat
salin (PBS) (29). n plus, EDTA-ul chelateaz ioni bivaleni reducnd
astfel activitatea nucleazelor i efectul negativ al metalelor grele.
Temperaturile sczute sunt de asemenea un factor important care
asigur o mai bun stabilitate a ADN-ului n soluii. Pstrarea soluiilor
coninnd ADN la temperaturi de 4oC este recomandat doar pentru
perioade scurte de timp (de ordinul zilelor). O mai bun stabilitate se
obine prin nghearea i pstrarea probelor la temperatura de -80oC. Dac
nu este disponibil un congelator care s asigure asemenea temperaturi
joase, ADN-ul purificat poate fi pstrat i la temperatura de -20oC, pentru
protejare fiind necesar adugarea de ADN-transportor (30).
Bibliografie:
1. Ausubel, M. F., Brent, R., Kingston, E. R., Moore, D. D., Seidman, J. G.,
Smith, A. J., Struhl, K. (2002) Short Protocols in Molecular
Biology, p 1.23-1.27. John Wiley & Sons Inc.
2. Neudecker, F., Grimm, S. (2000) High-throughput method for isolating
plasmid DNA with reduced lipopolysaccharide content.,
BioTechniques, 28, 107-9.
3. Birnboim, H. C., Doly, J. (1979) A rapid alkaline extraction procedure
for screening recombinant plasmid DNA., Nucleic Acids Research, 7,
1513-23.
4. Holmes, D. S., Quigley, M. (1981) A rapid boiling method for the
preparation of bacterial plasmids., Analytical Biochemistry, 114, 1937.

108

Biologie molecular. Metode experimentale

5. Gerstein, A. S. (2001) Molecular Biology Problem Solver: A Laboratory


Guide (Gerstein, A. S., Ed.), p 167-197.
6. Radloff, R., Bauer, W., Vinograd, J. (1967) A dye-buoyant-density
method for the detection and isolation of closed circular duplex
DNA: the closed circular DNA in HeLa cells., Proceedings of the
National Academy of Sciences of the United States of America, 57,
1514-21.
7. Sambrook, J. (2001) Molecular Cloning: A Laboratory Manual, p 1.311.59. Spring Harbor Laboratory Press.
8. Sambrook, J., Fritsch, E., Maniatis, T. (1989) Molecular Cloning - A
Laboratory Manual, p 1.21-1.53. Cold Spring Harbour Laboratory
Press.
9. Lis, J. T., and Schleif, R. (1975) Size fractionation of double-stranded
DNA by precipitation with polyethylene glycol., Nucleic Acids
Research, 2, 383-9.
10. He, M., Wilde, A., Kaderbhai, M. A. (1990) A simple single-step
procedure for small-scale preparation of Escherichia coli plasmids.,
Nucleic Acids Research, 18, 1660.
11. Vinograd, J., Lebowitz, J. (1966) Physical and topological properties of
circular DNA., The Journal of General Physiology, 49, 103-25.
12. Liou, J. T., Shieh, B. H., Chen, S. W., Li, C. (1999) An improved
alkaline lysis method for minipreparation of plasmid DNA.,
Preparative Biochemistry & Biotechnology, 29, 49-54.
13. Chachaty, E., Saulni, P. (2000) Isolating ChromosomalDNA from
Bacteria inThe Nucleic Acid Protocols Handbook (Ralph, R., Ed.).
Humana Press.
14. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction., Analytical Biochemistry, 162, 156-9.
15. Palmiter, R. D. (1974) Magnesium precipitation of ribonucleoprotein
complexes. Expedient techniques for the isolation of undergraded
polysomes and messenger ribonucleic acid., Biochemistry, 13, 3606-15.
16. Penman, S. (1966) RNA metabolism in the HeLa cell nucleus, Journal
of Molecular Biology, 17, 117-IN4.
17. Meade, H. M., Long, S. R., Ruvkun, G. B., Brown, S. E., Ausubel, F. M.
(1982) Physical and genetic characterization of symbiotic and
auxotrophic mutants of Rhizobium meliloti induced by transposon
Tn5 mutagenesis., Journal of Bacteriology, 149, 114-22.
18. Murray, M. G., Thompson, W. F. (1980) Rapid isolation of high

Izolarea i purificarea ADN-ului

109

molecular weight plant DNA., Nucleic Acids Research, 8, 4321-5.


19. Stacey, J., Isaac, P. G. (2000) Isolation and Purificationof DNA from
Plants in The Nucleic Acid Protocols Handbook (R., R., Ed.), p 1317. Humana Press.
20. Jones, A. S. (1953) The isolation of bacterial nucleic acids using
cetyltrimethylammonium bromide (cetavlon)., Biochimica et
Biophysica Acta, 10, 607-12.
21. Watson, J., Thompson, W. (1986) Purification and restriction
endonuclease analysis of plant nuclear DNA, Methods in
Enzymology, 118, 57-75.
22. Garner, I. (2000) Isolation of High-Molecular-Weight DNA from
Animal Cells in The Nucleic Acid Protocols Handbook (Rapley, R.,
Ed.), p 3-9. Humana Press.
23. Blin, N., Stafford, D. W. (1976) A general method for isolation of high
molecular weight DNA from eukaryotes., Nucleic Acids Research, 3,
2303-8.
24. Lahiri, D. K., Nurnberger, J. I. (1991) A rapid non-enzymatic method
for the preparation of HMW DNA from blood for RFLP studies.,
Nucleic Acids Research, 19, 5444.
25. Wienand, U., Schwarz, Z., Feix, G. (1979) Electrophoretic elution of
nucleic acids from gels adapted for subsequent biological tests.
Application for analysis of mRNAs from maize endosperm., FEBS
Letters, 98, 319-23.
26. Tabak, H. F., Flavell, R. A. (1978) A method for the recovery of DNA
from agarose gels., Nucleic Acids Research, 5, 2321-32.
27. Blin, N., von Gabain, A., Bujard, H. (1975) Isolation of large
molecular weight DNA from agarose gels for further digestion by
restriction enzymes., FEBS Letters, 53, 84-6.
28. Vogelstein, B., Gillespie, D. (1979) Preparative and analytical
purification of DNA from agarose., Proceedings of the National
Academy of Sciences of the United States of America, 76, 615-9.
29. Mller, J., Janz, S. (1993) Modulation of the H2O2-induced SOS
response in Escherichia coli PQ300 by amino acids, metal chelators,
antioxidants, and scavengers of reactive oxygen species.,
Environmental and Molecular Mutagenesis, 22, 157-63.
30. Halfon, P., Khiri, H., Gerolami, V., Bourliere, M., Feryn, J. M., Reynier,
P., Gauthier, A., Cartouzou, G. (1996) Impact of various handling
and storage conditions on quantitative detection of hepatitis C virus
RNA., Journal of Hepatology, 25, 307-11.

V. AMPLIFICAREA ENZIMATIC IN
VITRO A ACIZILOR NUCLEICI
Folosind oricare din metodele descrise n capitolul anterior,
purificarea acizilor nucleici din diverse surse devine o sarcin relativ
simpl, ADN-ul obinut putnd fi folosit direct n aplicaii diverse. n
unele cazuri ns, metodele descrise duc la obinerea unor cantiti mici,
inutilizabile de ADN. Un exemplu n acest sens l constituie
disponibilitatea unei cantiti foarte limitate de material biologic sau cnd
coninutul de ADN al acestuia este extrem de redus. n asemenea situaii
se face uz de o alt tehnic deosebit de important n laboratorul de
biologie molecular amplificarea enzimatic in vitro a acizilor nucleici.
Aceast tehnic permite copierea fidel de pn la 105 ori a unei molecule
de ADN dintr-o prob dat (1), realizndu-se astfel o amplificare masiv a
cantitii disponibile de ADN .
Extrem de important este faptul c simultan cu mrirea numrului
de molecule ADN disponibile dintr-o prob, tehnica realizeaz i o izolare
a fragmentelor de ADN care au o secven dat. Tehnicile de purificare
ale ADN-ului total enunate anterior permit obinerea ADN-ului genomic
total (sau plasmidial, dup caz) sub forma unor fragmente de dimensiuni
variabile. Amplificarea enzimatic in vitro a acizilor nucleici permite ns
izolarea unui fragment ADN specific a crui dimensiune i secven pot fi
controlate de ctre cercettor, detaliu esenial n procesul declonare.
n esen, tehnica de amplificarea in vitro a acizilor nucleici
folosete acelai mecanism bazat pe o ADN-polimeraz ADN-dependent
ntlnit i n cazul replicrii in vivo a ADN-ului. Dei principiul i
mecanismul amplificrii in vitro au fost formulate nc din anul 1971 de
Kleppe et al.(2), tehnica n sine a fost descris abia n anul 1986 de dou
echipe de cercettori, Mullis et al.(3) i Saiki et al.(4). Atunci a primit i
numele cu care s-a consacrat: Polymerase Chain Reaction, sauprescurtat
PCR, notaie ce va fi utilizat n cele ce urmeaz.
Metoda presupune folosirea unei polimeraze ADN-dependente i
parcurgerea unui ciclu care implic trei etape desfurate la temperaturi
diferite: 1. denaturarea moleculelor de acizi nucleici; 2. legarea
oligonucleotidelor amors (primer) i 3. sinteza propriu-zis a noilor
molecule de acizi nucleici.

112

Biologie molecular. Metode experimentale

Acest ciclu a fost realizat iniial prin utilizarea a trei bi de ap


reglate la trei temperaturi diferite (94oC, 54oC respectiv 72oC) i
transferul amestecului de reacie de pe o baie de ap pe alta. n vederea
obinerii unor cantiti suficiente de ADN, ciclul trebuia repetat de cteva
zeci de ori. Expunerea ADN-polimerazei la temperatura de 94oC
determin inactivarea ei i din acest motiv, protocolul iniial presupunea
adugarea enzimei n amestecul de reacie la fiecare nou ciclu pentru a
nlocui enzima degradat. ntreaga procedur era astfel nu doar foarte
laborioas, ci i extrem de costisitoare.
Identificarea n anul 1988 (5) i apoi izolarea n anul 1989 (6) a
polimerazei termostabile Taq din microorganismul Thermus aquaticus,
alturi de introducerea termo-cicloarelor moderne cu elemente Peltier au
fcut ca aceast tehnologie s devin aplicabil pe scar larg,
revoluionnd biologia molecular i nu numai. La ora actual,
majoritatea tehnicilor de investigare pe baz de acizi nucleici, fie c este
vorba despre studii de metagenomic, obinerea unei proteine
recombinate, identificarea unor mutaii, secvenierea, clonarea sau
cuantificarea expresiei unei gene au la baz diverse variante ale tehnicii
de amplificare enzimatic in-vitro a ADN-ului.
Simplitatea i robusteea deosebite ale acestei tehnici permit ca i
o persoan fr prea multe cunotine de biologie molecular s poat
pune la punct o reacie de amplificare PCR cu un minimum de efort (7).
Popularitatea deosebit i faptul c a fost aplicat ntr-o sumedenie de
domenii variate atrag n mod paradoxal i o serie de dezavantaje,
principalul fiind multitudinea de variante i modificri care au fost aduse
acestei tehnici. Cercettorul nceptor se va afla astfel n dificultate atunci
cnd, n funcie de rezultatul ateptat, va trebui s aleag o variant sau
alta. Datorit diversitii deosebite n ceea ce privete dimensiunea i
secvena fragmentului de ADN ce se dorete a fi amplificat, sursa de ADN
folosit ca matri i tipul polimerazei utilizabile, nu exist la ora actual
un protocol standard care s funcioneze n orice condiii. Din acest motiv,
n acest capitol este prezentat un protocol general de amplificare a
ADN-ului alturi de o serie de indicaii legate de parametrii eseniali ai
amplificrii, constituindu-se astfel ca punct de plecare n dezvoltarea unor
metode adaptate specific secvenei de amplificat.

Amplificarea enzimatic in vitro a ADN-ului

113

V.1 Amplificarea enzimatic in vitro a ADNuluisau PCR


Procesul de amplificare enzimatic in vitro a ADN-ului const n
repetarea ciclic a trei etape (Figura 16).

1. Denaturare

ADN-ul este denaturant prin


nclzire la 94oC

2. Legare

3. Sintez
Un ciclu
PCR complet
ADN-polimeraza extinde
oligonucleotidele amors (primer)
i sintetizeaz noi catene de ADN

Oligonucleotidele amors (primer)


se leag de ADN-ul int

FIGURA 16. Schema simplificat a unui ciclu PCR.


Prima etap a reaciei PCR const n incubarea amestecului de
reacie alctuit din sursa de ADN-matri, polimeraza Taq,
oligonucleotidele amors (primer) i cele 4 deoxiribonucleozide-trifosfat
la temperatura de 94oC timp de un minut. Parcurgerea acestei etape
conduce la separarea catenelor ADN-ului dublu-catenar din amestec,
adic la denaturarea ADN-ului.
A doua etap presupune incubarea amestecului de reacie la o
temperatur dictat de temperatura de topire a oligonucleotidelor amors
(primer). n aceast etap are loc legarea oligonucleotidelor amors
(primer) de ADN-ul monocatenar obinut n etapa anterioar, pe baz de
complementaritate la nivel de secven.

114

Biologie molecular. Metode experimentale

A treia etap implic incubarea amestecului din etapa anterioar la


temperatura de 72oC pentru un interval de timp variabil, cuprins ntre
20 secunde pn la 2 minute. Enzima Taq devine activ i adaug
nucleotide la captul 3`-OH al oligonucleotidelor amors legate,
extinzndu-le. Nucleotidele sunt adugate n ordinea dictat de
complementaritatea cu ADN-ul matri. n acest mod are loc sinteza unei
noi molecule de ADN dublucatenar. Una dintre catenele acestei molecule
este catena original, matri, iar a doua este catena nou sintetizat, care
ncorporeaz oligonucleotida amors (primer).
Cele trei etape alctuiesc un ciclu care este repetat n mod obinuit
de 30-35 ori, ntregul proces durnd n jur de 3-4 ore. n etapa de legare a
primului ciclu, oligonucleotidele amors (primer) se leag doar de
catenele separate ale ADN-ului surs, iar catenele nou sintetizate sunt clar
definite doar la captul 5` (cel reprezentat de oligonucleotida amors).
Poziia captului 3` depinde de durata etapei de sintez i poate fi
variabil. Dup primul ciclu PCR se obine un amestec de molecule de
ADN surs i ADN nou sintetizat de dimensiuni variabile. n ciclurile
urmtoare sunt utilizate ca matri i catenele nou sintetizate, ceea ce face
ca pe msur ce procesul nainteaz, moleculele nou sintetizate s
ncorporeze treptat, la ambele capete, oligonucleotidele amors (primer).
Faptul c la fiecare ciclu nou se utilizeaz ca matri i catenele
sintetizate n etapele anterioare face ca sinteza ADN-ului pornind de la
noile catene s fie un proces exponenial, nlnuit. Sinteza ADN-ului
pornind de la catenele originale decurge ns liniar astfel nct, la sfritul
celor 30-35 cicluri, produsul rezultat n urma amplificrii (numit
amplicon) va fi format predominant din catene sintetizate n ultimele
cicluri (1). Acestea au capetele clar definite de cele dou oligonucleotide
amors (primer). Astfel, n cursul unei reacii de amplificare enzimatic in
vitro a ADN-ului (PCR), are loc multiplicarea exponenial, nlnuit a
fragmentului de ADN cuprins ntre cele dou oligonucleotide amors
(primer) (Figura 17).

Amplificarea enzimatic in vitro a ADN-ului

115

Ciclul 1

Ciclul 2

Ciclul 3

FIGURA 17. Reprezentarea grafic a ciclurilor succesive n reacia de amplificare


in vitro a ADN-ului.

De notat faptul c, dei catenele ADN-ului matri (reprezentate cu negru) sunt


copiate de-a lungul ntregului proces, numrul catenelor nou sintetizate
(reprezentate cu gri) crete exponenial, deoarece ele nsele pot funciona ca
matri.

116

Biologie molecular. Metode experimentale

Cele 3 etape obligatorii ale reaciei PCR pot fi la ora actual


completautomatizate prin intermediultermocicloarelor. Acestea sunt
dispozitive termice cu unul sau mai multe elemente Peltier care au
capacitatea de a modifica n mod controlat, cu precizie i vitez mare
temperatura unui bloc de incubare n care este amplasat amestecul de
reacie. n mod curent, la programarea unui termociclor, pe lng cele trei
etape obligatorii pentru realizarea amplificrii in vitro a ADN-ului, se
adaug trei etape suplimentare care nu se repetat:
1. denaturarea iniial const n meninere timp de 5 minute a
amestecului PCR la temperatura de 95oC pentru denaturarea
complet a ADN-ului matri sau a celulelor, atunci cnd acestea
sunt utilizate direct ca surs de ADN;
2. finalizarea sintezei dup realizarea celor 30-35 cicluri,
meninerea timp de 10 minute la temperatura de 72oC are rolul de
a permite finalizare sintezei tuturor catenelor la care s-a nceput
extensia;
3. meninerea amestecului de reacie la temperatura de 4-12oC este
etapa final, n general fr limit de timp, care are rolul de a
pstra probele la o temperatur optim pn la intervenia
operatorului.

Amplificarea enzimatic in vitro a fragmentelor


de ADN de pn la 4 kb
Principiul metodei
Amplificarea enzimatic in vitro a ADN-ului sau PCR-ul este o
reacie de replicare enzimatic n lan a ADN-ului matri mediat de
oligonucleotidele amors (primer). Reacia are la baz:
1. proprietatea oligonucleotidelor amors (primer) de a se lega, la o
anumit temperatur de molecula ADN matri, expunnd astfel
un capt 3`-OH;
2. proprietatea polimerazei termostabile Taq de a ncorpora
nucleotide pe baz de complementaritate n direcia 5`-3`,
ncepnd cu captul 3`-OH al oligonucleotidelor amors (primer).

Amplificarea enzimatic in vitro a ADN-ului

117

Aplicaii:
1. izolarea unui fragment specific de ADN dintr-o prob de ADN
genomic; secvena i dimensiunea fragmentului izolat sunt
controlate prin intermediul celor dou oligonucleotide amors
(primer) (Figura 18);
2. amplificarea specific a unor fragmente de pn la 4 kb cuprinse
ntre cele dou oligonucleotide amors (primer); ADN-ul de
amplificat poate fi de orice provenien (animal, vegetal, bacterian
sau viral); moleculele de ARN (ARN total, mesager, viral, de
transfer sau ribozomal) pot funciona ca matri doar dup ce au
fost convertite n aa numitul ADN complementar (ADNc) prin
utilizarea unei revers-transcriptaze (8),(9); n general, n urma unei
reacii PCR se obin 0,25-0,5 g (sau 105 copii) ADN amplificat
(1);
3. oligonucleotidele amors (primer) trebuie s fie perfect
complementare cu secvena de amplificat doar la captul 3`; la
cellalt capt acestea pot conine, de exemplu, situs-uri de
restricie pentru enzime ce vor fi ncorporate n secvena
amplificat;
4. dei n principiu reacia poate avea loc pornind chiar de la o
singur molecul ADN matri, n practic, proba de amplificat
trebuie s conin minimum 105 molecule ADN cu secvena de
amplificat, sau o cantitate de ADN genomic de ordinul
microgramelor.
Limitri:
1. dei permite izolarea unui fragment specific de ADN, acest lucru nu
este echivalent cu purificarea acestuia; metoda nu elimin complet
ADN-ul contaminant dintr-o prob dat ci, prin multiplicarea
extensiv a fragmentului de interes acesta devine predominant; pentru
eliminarea complet a ADN-ului contaminant din prob este necesar
utilizarea unor tehnici suplimentare (electroforez n geluri de
agaroz urmat de izolarea fragmentului de interes din gel);

118

Biologie molecular. Metode experimentale

2. dei ADN-ul matri nu trebuie s fie foarte pur, procesul de


amplificare se desfoar cu dificultate sau deloc n cazul n care
acesta este puternic fragmentat.
ADN genomic

Secvena ADN de amplificat

Oligonucleotidele amors (primer) se leag de cte una din catenele de


ADN i flancheaz secvena de amplificat

FIGURA 18. Localizarea oligonucleotidelor amors (primer).

Acestea trebuie s flancheze fragmentul de ADN de amplificat i permit izolarea


acestuia dintr-o prob complex, precum ADN-ul genomic.

Amplificarea enzimatic in vitro a ADN-ului

119

Materiale necesare:
1.

sursa de ADN ce conine fragmentul care urmeaz a fi amplificat


cu o concentraie de ordinul g ADN/l; puritatea preparatului de
ADN utilizat ca surs nu este esenial, putnd fi utilizat cu succes fie
ADN-ul purificat prin una din metodele descrise n capitolul IV
Metode i tehnici folosite pentru izolarea i purificarea ADN-ului,
pagina 73, fie amestecul de reacie n care s-a realizat reverstranscripia,
sau chiar o suspensie celular; n cursul realizrii amestecului pentru
PCR, sursa de ADN trebuie s fie ns suficient de diluat pentru a
prentmpina eventualul efect inhibitor al contaminanilor;
2.
setul de oligonucleotide amors (primer) complementare cu
secvena de amplificat; pentru detalii privind modul de selecie a
secvenei acestora, consultai subcapitolul V.2 Criterii pentru
alegerea oligonucleotidelor amors (primer), pagina126); n general,
oligonucleotidele amors se livreaz sub form liofilizat; nainte de
utilizare, n fiecare microeprubet cu oligonucleotid se adaug ap
distilat steril astfel nct s se obin o concentraie final de
10 picomoli/l;
3.
ap distilat steril;
4.
ADN polimeraz la ora actual, un numr foarte mare de
furnizori pun la dispoziie o gam variat de polimeraze
termorezistente (Tabel 4); selecia uneia sau alteia trebuie s se fac
innd cont de fidelitatea enzimei, adic de abilitatea acesteia de a
insera cu precizie nucleotide pe catena ADN nou sintetizat, n strns
complementaritate cu catena veche; dei problema fidelitii
polimerazelor este una deosebit de complex (10), ea a fost redus
strict la prezena activitii exonucleazice 3'-5' prin care enzima are
capacitatea de a corecta eventualele greeli de inserie; cum activitatea
exonucleazic atrage dup sine un randament mai mic al vitezei de
amplificare, utilizarea unui anumit tip de polimeraze depinde de
cantitatea de ADN necesar la sfritul reaciei i de utilizrile
ulterioare ale ADN-ului; n aplicaiile comune, care nu necesit o
precizie foarte mare, se utilizeaz frecvent enzime cu fidelitate redus,
n principal datorit costului de achiziie mai redus; n aplicaiile n
care secvena fragmentului amplificat este esenial (clonarea unei
gene sau secvenierea acesteia), se vor utiliza enzime cu fidelitate
crescut (de exemplu PfuUltra);

Biologie molecular. Metode experimentale

120

TABEL 4. Principalele caracteristici ale diverselor tipuri de polimeraze ADNdependente utilizate n PCR
Denumire
comercial

Activitate
Fidelitate
Stabilitate
exonucleazic
termic (timp de
3'-5'
njumtire)

Vitez
de
sintez
(kb/min)

Taq DNA
polymerase

Absent

Foarte
mic

40-60 minute la
95oC

3-10

Fragmentul
Stoffel

Absent

Foarte
mic

21 minute la
97,5oC

Tth DNA
polymerase

Absent

Foarte
mic

1,5

rTth XL

Foarte slab

Redus

UlTma DNA
polymerase

Prezent, dar
slab

Redus

50 minute la
97,5oC

Pfu DNA
polymerase

Prezent

Mare

1140 minute la
95oC

Pfu DNA
polymerase
(Exo-form)

Absent

Foarte
mic

1140 minute la
95oC

Pfu DNA
polymerase
Deep Vent

Prezent

Mare

1380 minute la
95oC

>5

Tli Pol (Vent)

Prezent

Mare

402 minute la 95oC

Tbr DNA
polymerase
(Dynazyme)

Absent

Mic

150 minute la 96 C

Platinum Pfx

Prezent

Mare

720 minute la 95oC

6-18

Platinum Taq

Absent

Mic

96 minute la 95oC

4-10

Taq Pol

Prezent

Mare

30 minute la 75oC

Amplificarea enzimatic in vitro a ADN-ului

121

Metoda general propus folosete rTaq polimeraza (GE Healthcare),


o protein recombinat de 94 kDa a crei gen a fost izolat din Thermus
aquaticus i exprimat sub form recombinat n E. coli. Activitatea
polimerazic 5'-3' maxim este n intervalul de temperatur de 70-80C.
Enzima este foarte termostabil, cu un timp de njumtire de
35-40 minute la 95C, adic echivalentul a 100 cicluri PCR. Productorul
livreaz enzima ntr-o soluie tampon cu 50% glicerol care conine 5 U/l.
5. soluie tampon PCR 10X Tris-HCl 100 mM, pH 8,3, KCl
500 mM, MgC12 15 mM, albumin seric bovin (BSA) 0,01%
(w/v) (11); 1 ml soluie tampon PCR se prepar prin amestecarea a
100 l Tris-HCl lM, pH 8,3, 500 l KCl 1 M, 15 l MgC12 1 M,
10 l BSA 1% i 375 l ap distilat, dup care se sterilizeaz prin
autoclavare; coninutul acestei soluii poate varia n funcie de
enzima utilizat, motiv pentru care fiecare productor livreaz i
aceast soluie;
6. soluie stoc deoxiribonucleozide-trifosfat (dNTP) n general,
acestea se achiziioneaz sub forma unui set de 4 fiole, fiecare
coninnd o soluia 100 mM a unui deoxiribonucleozid-trifosfat;
100 l soluie stoc se prepar prin pipetarea ntr-o microeprubet a
cte 10 l soluie 100nM din fiecare dNTP (ATP, dTTP, dGTP,
dCTP) i 60 l ap distilat steril;
7. soluie MgCl2 25 mM (facultativ) poate fi utilizat atunci cnd
este necesar mbuntirea randamentului reaciei; n general,
creterea concentraiei de Mg2+ duce la scderea specificitii
amplificrii; concentraia optim este dependent de concentraia
de dNTP i oligonucleotide primer utilizat, dar i de concentraia
ADN-ului matri; acesta este motivul pentru care acest parametru
trebuie particularizat pentru fiecare amplificare n parte; gama de
concentraie n care se utilizeaz n mod curent MgCl2 este
1-10 mM concentraie final;randamentul reaciei sau
specificitatea amplificrii pot fi de asemenea modificate prin
utilizarea diverilor aditivi, efectul fiecruia fiind prezentat n
Tabelul 5;

Biologie molecular. Metode experimentale

122

TABELUL 5. Principalii aditivi utilizai pentru mbuntirea randamentului reaciei


de amplificare in-vitro a ADN-ului
Aditiv

Mod de aciune

Concentraie final n
amestecul PCR la care
se manifest efecte

Etanol

Uoar mbuntire la
10%

Uree

Scade Tm*-ul
oligonucleotidelor amors

Uoar mbuntire la
10%, efecte inhibitorii la
1M

DMSO

Scade Tm*-ul
oligonucleotidelor amors

mbuntire la 10%

Formamid

Scade Tm*-ul
oligonucleotidelor
amors; crete
specificitatea amplificrii

mbuntire la 1,5-10%,
efecte inhibitorii la peste
15%

SDS

Previne agregarea enzimei

Efecte inhibitorii la peste


0,01%

Glicerol

Scade Tm*-ul
oligonucleotidelor amors
i mrete rezistena la
temeratur a polimerazei

mbuntire la 5-20%

Tween
20/NP40

Tween
20
0,05%(v/v),
0,05%(v/v)

Triton X-100 Previne agregarea


polimerazei

0,01%(v/v)

Albumin
Neutralizeaz muli din
seric bovin compuii ce inhib
amplificarea

10-100 g/ml

Betain

0,5-1 M

0,1NP40

Amplificarea enzimatic in vitro a ADN-ului

123

Aditiv

Mod de aciune

Concentraie final n
amestecul PCR la care
se manifest efecte

PEG 6000

5-15%

Spermidin

Reduce reacia nespecific


dintre polimeraz i ADN

5-15% (w/v)

Tm temperatura de topire a oligonucleotidelor amors (engl. Melting temperature)

8. microeprubete sterile pentru PCR microeprubete de tip


Eppendorf cu pereii subiri, care permit schimbul rapid de
cldur; n mod curent se utilizeaz microeprubete de 0,2 ml dar
reacia se poate realiza i n vase cu volume mai mari (0,5 ml) sau
mai mici (microplci);
9. termociclor Biometra T Gradient sau echivalent aparatul este
esenial pentru buna desfurare a reaciei de amplificare i de
aceea la achiziia acestuia trebuie luai n considerare o serie de
parametri funcionali, precum:
viteza de nclzire/rcire n general, timpul necesar pentru
ca blocul s ajung de la 55oC la 94oC este de 30 secunde sau mai
mult; cu ct timpul este mai mic, cu att durata unei reacii de
amplificare va fi mai mic;
blocul termic pentru probe dimensionat la volumul
micro-eprubetelor PCR utilizate;
capac cu nclzire n lipsa acestuia, amestecul de reacie
condenseaz n interiorul eprubetei (sau microplcii); n cazul
utilizrii unui termociclor fr capac nclzit, peste amestecul de
reacie se adaug un strat de ulei mineral;
capacitate de a realiza gradient de temperatur permite
realizarea unui gradient de temperatur de-a lungul blocului
termic, n aa fel nct probele amplasate n diverse poziii vor fi
incubate la temperaturi diferite; acest lucru poate uura foarte mult
procesul de identificare a temperaturii optime de legare a
oligonucleotidelor amors (primer);
capacitate de a programa aparatul i de a salva programul n
memoria acestuia n vederea utilizrii ulterioare.

Biologie molecular. Metode experimentale

124

Mod de lucru:
n mod ideal, n vederea diminurii contaminrii cu ADN exogen,
toate operaiile necesare pentru realizarea reaciei de amplificare in vitro a
ADN-ului trebuie realizate ntr-o camer dedicat acestui scop, folosind
reactivi i echipamente rezervate numai pentru PCR. Aceasta este de cele
mai multe ori greu de realizat, dar totui pot fi luate cteva msuri de
prevedere pentru minimizarea contaminrii. Astfel, utilizarea unor reactivi
doar pentru reacia PCR este esenial. Rezervarea unor pipete strict
pentru aceast operaie i utilizarea de vrfuri cu filtru pentru pipete sunt
de asemenea dou msuri ce pot micora nivelul de contaminare.
Utilizarea mnuilor de protecie este obligatorie pe toat perioada
manipulrii reactivilor PCR.
Etapele realizrii unei reacii standard de amplificare in vitro a
ADN-ului sunt:
1. prepararea amestecului de reacie (master mix) prin pipetarea ntr-o
micro-eprubet steril a reactivilor, conform indicaiilor de mai jos;
Cantitate pentru o
prob

Cantitate pentru 10
probe

10 pmoli din fiecare

100 pmoli din fiecare

Tampon PCR 10X

5 l

5 l

stoc dNTP 10 mM

1 l

10 l

pn la 48 l*

pn la 480 l*

Oligonucleotide
amors (primer)

Ap steril

* volumul de ap poate varia n funcie de volumul de enzim sau


ADN-matri utilizat.
n general, orice reacie de amplificare a unei probe necunoscute
trebuie nsoit de un control pozitiv (n care ADN-ul matri este prezent)
i un control negativ (n care ADN-ul matri lipsete, util pentru detecia
eventualei contaminri); mai multe detalii despre necesitatea celor dou
tipuri de probe control pot fi identificate n lucrarea lui Gerstein i Aoyagi
(7);
2. cte 48 l din amestecul de reacie se transvazeaz n numrul
corespunztor de eprubete PCR sterilizate i notate n prealabil;

Amplificarea enzimatic in vitro a ADN-ului

125

3. se pipeteaz cu atenie cte 1,5 l soluie ce conine ADN-ul de


amplificat;
4. se programeaz termociclorul urmnd indicaiile productorului pentru
a realiza etapele necesare amplificrii, dup cum urmeaz:
Temp.
(oC)

Timp
(min.)

1 Denaturarea
iniial,Hot-Start*

95

2 Denaturare

95

variabil

Etap

3 Legarea
oligonucleotidelor
amors (primer)
4 Sintez

72

Observaii

Temperatura
depinde
de
valoarea temperaturii de
topire (Tm) specifice fiecrei
pereche de oligonucleotide
amors (primer)

variabil Timpul alocat depinde de

dimensiunea fragmentului de
ADN amplificat i de viteza
de sintez a enzimei utilizate;
o bun aproximare a vitezei
de sintez este de 1 kb/min.

Etapele 2-4 se repet de 30 de ori


5 Finalizarea sintezei

72

10

6 Finalizarea reaciei

are rolul de a pstra probele


la o temperatur optim pn
la intervenia operatorului

* etapa de Hot-Start este necesar doar n cazul utilizrii polimerazei Taq; pentru detalii
consultai etapa 6 din protocol

5. se amplaseaz micro-eprubetele PCR nchise n locaele blocului


termic al termociclorului i se pornete programul presetat n etapa
anterioar;
6. la atingerea temperaturii de 95oC din etapa de denaturare iniial, se
adaug cte 2,5 U enzim (0,5 l) i se omogenizeaz prin pipetare susjos; aceast etap, n care enzima este introdus dup ce amestecul de
reacie a ajuns la temperatura de 95oC poart numele de Hot-Start;
Necesitatea etapei de Hot-Start apare datorit faptului c, n

126

Biologie molecular. Metode experimentale

general, amestecul de reacie se prepar pe ghea. Aceasta poate duce la


legarea nucleotidelor amors (primer) n situs-uri nespecifice. Unele
polimeraze (printre care i Taq) au activitate polimerazic rezidual la
temperaturi mici, fapt ce conduce la nceperea amplificrii din momentul
adugrii enzimei n amestecul de reacie. Prin adugarea enzimei dup
atingerea unor temperaturi la care ADN-ul este denaturat se mpiedic
apariia unor asemenea reacii de amplificare nespecifice; n cazul
utilizrii unor enzime care nu necesit etapa de Hot-Start (de exemplu
Pfu) acestea pot fi adugate direct n amestecul de reacie (master mix);
7. dup finalizarea programului PCR, microeprubetele se scot de pe
blocul termic i pot fi pstrate pentru perioade scurte la temperatura de
4oC; randamentul reaciei de amplificare se evalueaz prin electroforez
n geluri de agaroz (pentru detalii, consultai capitolul VII Separarea
electroforetic a ADN-ului, pagina 147).

V.2 Criterii pentru alegerea oligonucleotidelor


amors (primer)
ntregul proces de amplificare in vitro a ADN-ului se bazeaz pe
capacitatea oligonucleotidelor amors (primer) de a se lega de ADN-ul
matri i din acest motiv alegerea corect a secvenei acestora este
elementul cheie ce poate face diferena dintre un PCR reuit i un eec
total. Specificitatea i randamentul reaciei PCR nu depind doar de un
singur factor, ci sunt controlate att de compoziia amestecului de reacie
(coninutul de Mg2+) ct i de temperatura i durata fiecrei etape a
ciclului de amplificare. Aceasta uureaz procesul de selecie a
oligonucleotidelor amors (primer) i face posibil formularea unor reguli
specifice de selecie. Cunoscnd secvena ADN-ului de amplificat i
respectnd cele cteva reguli simple exemplificate mai jos, este posibil
n principiu alegerea unor oligonucleotide amors (primer) pentru
amplificarea oricrei secvene ADN cu dimensiuni cuprinse ntre
200-400 pb. Pentru fragmente de dimensiuni mai mari, procesul de
selecie a secvenei optime se complic i de aceea este indicat s se
utilizeze programe computerizate specifice (Tabelul 6) (12).

Amplificarea enzimatic in vitro a ADN-ului

127

TABELUL 6. Cele mai utilizate programe computerizate accesibile on-line utile n


procesul de selecie a oligonucleotidelor amors (primer)
Program

Adres web

Primer3

http://biotools.umassmed.edu/bioapps/primer3_www.cgi

GeneFisher2

http://bibiserv.techfak.unibielefeld.de/genefisher2/

Primer3Plus
(13)

http://www.bioinformatics.nl/cgibin/primer3plus/primer3plus.cgi

Oligo Calc
(14)

http://www.basic.northwestern.edu/biotools/oligocalc.html

PrimerBLAST

http://www.ncbi.nlm.nih.gov/tools/primerblast/index.cgi?LINK_LOC=NcbiHomeAd

Dup identificarea secvenei celor dou nucleotide amors


(primer) necesare pentru amplificarea secvenei ADN de interes, acestea
pot fi sintetizate n laborator (acolo unde exist dotarea necesar) sau pot
fi cumprate direct de la distribuitorii specializai. n general, preul este
exprimat pe nucleotid i depinde de puritatea necesar, oligonucleotidele
fiind furnizate n stare liofilizat.
Reguli generale pentru alegerea oligonucleotidelor amors
1. Complementaritatea i unicitatea secvenei oligonucleotidelor amors
(primer). Cel mai important parametru pentru selecia secvenei celor
dou oligonucleotide amors (primer) este, bineneles, capacitatea
acestora de a se lega pe baz de complementaritate de secven de
molecula ADN de amplificat i de a forma un duplex stabil cu aceasta.
Situs-urile de legare trebuie s flancheze regiunea ADN de amplificat, s
fie specifice pentru fiecare oligonucleotid i, de asemenea, s fie unice
(s nu se repete n molecula de ADN matri). Dei probabilitatea ca o
secven de dimensiunea unei oligonocleotide amors (primer) s se
repete n fragmentele de 2-3 kb amplificate n mod obinuit prin PCR este
destul de mic, odat cu creterea dimensiunii fragmentului de amplificat,
probabilitatea crete drastic. Din acest motiv, pentru ampliconi de
dimensiuni mari este indicat s se utilizeze programe precum BLAST

128

Biologie molecular. Metode experimentale

pentru verificarea unicitii secvenei setului de oligonucleotide amors


(primer) alese.
Complementaritatea de secven cu molecula ADN-matri este
esenial la captul 3'. Faptul c la captul 5' exist una pn la trei baze
care nu sunt complementare cu secvena de amplificat nu modific
randamentul reaciei de amplificare. Acest lucru poate fi exploatat n
sensul modificrii specifice a secvenei de amplificat. Prin introducerea
unor situs-uri de restricie pentru enzime n secvena oligonucleotidelor
amors (primer), acestea vor fi ncorporate n secvena amplificat.
2. S aib o lungimea cuprins ntre 18 i 28 nucleotide. Cu ct lungimea
unei oligonucleotide este mai mare, cu att specificitatea reaciei PCR
este mai mare, ns legarea la ADN-ul matri este mai puin eficient i
n consecin cantitatea de ADN obinut n urma reaciei de amplificare
este mai mic.
3. S prezinte temperatura de topire cuprins ntre 52C i 60C.
Temperatura de topire (Tm) reprezint temperatura la care jumtate din
moleculele de oligonucleotid amors (primer) sunt asociate cu
ADN-matri i sunt o indicaie a triei duplexului oligonucleotid-ADN
format. Tm este un parametru care se calculeaz pentru fiecare
oligonucleotid amors (primer) n parte i este influenat de secvena
specific a acestuia. Au fost descrise mai multe modaliti de calcul ale
valorii Tm, cea mai corect folosind noiunile de entalpie i entropiefuncii de stare ale unui sistem termodinamic. n mod obinuit, o
modalitate simpl care permite aproximarea rapid a valorii Tm pentru o
oligonucleotid dat folosete formula:

unde G, C, A, T reprezint numrul de G, C, A i respectiv T din


secvena oligonucleotidei amors (primer).
n general, valoarea optim pentru Tm este cuprins ntre 52C i
60C i trebuie s aib valori apropiate pentru ambele oligonucleotide
amors (primer) utilizate. Valoarea lui Tm este util pentru stabilirea
temperaturii optime din etapa de legare a ciclului PCR. Aceasta trebuie s
fie mai mic cu cteva grade dect cea mai mic temperatur Tm a celor
dou oligonucleotide amors (primer).

Amplificarea enzimatic in vitro a ADN-ului

129

4. Coninutul de GC trebuie s fie ntre 40% i 60%.


5. S formeze o aa-zis clem GC. Prezena de pn la trei nucleotide G
sau C printre ultimele cinci nucleotide de la captul 3' duce la asocierea
mai puternic a oligonucleotidului amors cu ADN-ul matri,
formndu-se o aa-numit clem GC, ceea ce conduce la creterea
randamentului reaciei de amplificare. Mai mult de trei nucleotide GC n
ultimele cinci face foarte dificil disocierea duplexului rezultat, ceea ce
scade randamentul reaciei.
6. S nu formeze structuri secundare specifice. Prezena n
oligonucleotidele amors a structurilor secundare produse prin legturi
inter- sau intra-moleculare ntre nucleotide poate duce la scderea drastic
a randamentului de amplificare sau chiar la stoparea complet a reaciei.
Cele mai importante tipuri de structuri secundare care trebuie evitate sunt:
a) ace de pr, precum cel exemplificat mai jos;
5'AGGCCTGACGGCCTAC
|||||||
G
3'ACTGCCGTCAC
b) auto-dimeri se formeaz prin asocierea pe baz de
complementaritate a dou molecule ale unui oligonucleotid de
acelai tip;
5'AGGCCTGACAGGCCATGC3'
|||||| ||||||
3'CGTACCGGACAGTCCGGA5'
c) hetero-dimeri se formeaz prin asocierea pe baz de
complementaritate a dou molecule ale celor dou
oligonucleotide utilizate pentru amplificare;
5'AGGCCTGACAGGCCATGC3'
||| ||||
3'ACTTTCCGAGCATCACT5'

130

Biologie molecular. Metode experimentale

7. S nu conin repetiii. O repetiie este o grupare de dou nucleotide


care se repet succesiv, precum ATATATATAT. Numrul maxim de
repetiii acceptat este patru.
8. S nu conin mai mult de patru repetiii ale aceleiai baze, de forma:
GCGGGGGATGGGGGG
Bibliografie
1. Theophilus, B. D. M. (2008) Principles and Medical Applications of
the Polymerase Chain Reaction, in Molecular Biomethods
Handbook (Walker, J. M., Rapley, R., Eds.), p 29-39. Humana
Press.
2. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G.
(1971) Studies on polynucleotides. XCVI. Repair replications of
short synthetic DNAs as catalyzed by DNA polymerases., Journal
of Molecular Biology56, 341-61.
3. Mullis, K. B., Faloona, F. A., Scharf, S. J., Saiki, R. K., Horn, G. T.,
Erlich, H. A. (1986) Specific enzymatic amplification of DNA
sequences in vitro: The polymerase chain reaction, Cold Spring
Harbor Symp. Quant. Biol.51, 263-273.
4. Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B., Erlich, H. A.
(1986) Analysis of enzymatically amplified beta-globin and HLADQ alpha DNA with allele-specific oligonucleotide probes.,
Nature, 324, 163-6.
5. Saiki, R., Gelfand, D., Stoffel, S., Scharf, S., Higuchi, R., Horn, G.,
Mullis, K., Erlich, H. (1988) Primer-directed enzymatic
amplification of DNA with a thermostable DNA polymerase,
Science, 239, 487-491.
6. Lawyer, F., Stoffel, S., Saiki, R., Myambo, K., Drummond, R.,
Gelfand, D. (1989) Isolation, characterization, and expression in
Escherichia coli of the DNA polymerase gene from Thermus
aquaticus, The Journal of Biological Chemistry, 264, 6427-6437.
7. Gerstein, A. S., Aoyagi, K. (2001) PCR in Molecular Biology Problem
Solver: A Laboratory Guide (Gerstein, A. S., Ed.), p 291-329. John
Wiley & Sons, Inc., New York, USA.

Amplificarea enzimatic in vitro a ADN-ului

131

8. Myers, T. W., Gelfand, D. H. (1991) Reverse transcription and DNA


amplification by a Thermus thermophilus DNA polymerase.,
Biochemistry, 30, 7661-6.
9. Myers, T. W., Sigua, C. L. (1995) 5 - Amplification of RNA: HighTemperature Reverse Transcription and DNA Amplification with
Thermus thermophilus DNA Polymerase in PCR Strategies (Innis,
M. A., Gelfand, D. H., Sninsky, J. J., Eds.), p 58-68. Academic
Press, San Diego.
10. Kunkel, T. A. (2004) DNA replication fidelity., The Journal of
Biological Chemistry, 279, 16895-8.
11. Delidow, B. C., Lynch, J. P., Peluso, J. J., White, B. A. (1993)
Polymerase Chain Reaction in PCR Protocols (White, B. A., Ed.),
p 1-29. Humana Press.
12. Rychlik, W. (1993) Selection of Primers for Polymerase Chain
Reaction in PCR Protocols (White, B. A., Ed.), p 31-40. Humana
Press, New Jersey.
13. Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R.,
Leunissen, J. A. M. (2007) Primer3Plus, an enhanced web
interface to Primer3., Nucleic Acids Research, 35, W71-4.
14. Kibbe, W. A. (2007) OligoCalc: an online oligonucleotide properties
calculator., Nucleic Acids Research, 35, W43-6.

VI. DETERMINAREA
CONCENTRAIEI ACIZILOR
NUCLEICI N SOLUIE
Determinarea corect a concentraiei de acizi nucleici (ADN sau
ARN) este un aspect esenial pentru buna desfurare a etapelor ulterioare
n cadrul unui experiment ce are n vedere manipularea acestor molecule
(clonare, transformare). Alegerea i utilizarea unei metode de dozare
depinde, n principal, de necesitile specifice ale experimentului,
necesiti exprimate de trei parametri: specificitate, sensibilitate i
prezena compuilor care interfer.
n scopul dozrii acizilor nucleici au fost propuse dou abordri
majore:
dac proba este pur (fr cantiti semnificative de proteine, fenol sau
ali acizi nucleici) metoda ce trebuie utilizat este determinarea direct a
concentraiei prin spectroscopie UV.
dac proba conine cantiti mici de ADN sau cantiti semnificative de
impuriti, concentraia poate fi estimat folosind metode care presupun
cuplarea acizilor nucleici cu diveri derivai, complecii rezultai fiind
evaluai spectrofotometric sau fluorimetric.

V.1 Determinarea concentraiei acizilor nucleici


prin spectroscopie UV-VIS
Pentru determinarea concentraiei acizilor nucleici prin
spectroscopie UV-VIS se pot utiliza dou metode mai importante:
1. msurarea direct a concentraiei acizilor nucleici prin
spectrometrie UV metod simpl i sigur care poate fi folosit
numai pentru soluii pure i concentrate;
2. metoda Burton este specific pentru ADN i presupune liza
acizilor nucleici i determinarea coninutului de deoxiriboz din
prob; metoda are avantajul c poate fi utilizat pentru dozarea

134

Biologie molecular. Metode experimentale

direct a acizilor nucleici din lizate celulare; Watterborg i


Mathews (1) realizeaz o descriere amnunit a acestei metode.

Determinarea concentraiei acizilor nucleici


prin spectroscopie UV
Att ADN-ul ct i ARN-ul absorb n UV, avnd un maxim la
260 nm datorit bazelor azotate purinice i pirimidinice. Experimentele au
artat c o valoare a absorbanei (A) citit la spectrofotometru la lungimea
de und de 260 nm egal cu unitatea corespunde unei soluii care conine
aproximativ 50 g/ml ADN dublu-catenar, 40 g/ml ADN (ARN)
monocatenarsau33 g/ml polinucleotide monocatenare (2).
Prin urmare, determinarea concentraiei acizilor nucleici s-ar putea
realiza direct prin msurarea absorbanei soluiilor la lungimea de und de
260 nm i aplicarea direct a legii Lambert-Beer. Acizii nucleici nu sunt
ns singurii compui care absorb la aceast lungime de und. Spectrul de
absorbie a principalilor contaminani (proteine i fenol) arat c i acetia
absorb la lungimea de und de 260 nm, prezentnd, de asemenea, maxime
la 230 nm (fenolul i urea) (3) i 280 nm (proteinele). n cazul unei soluii
pure de ADN i ARN, raportul dintre valorile nregistrate la 260 nm i
280 nm se situeaz ntre 1,8 i 2. Dac acest raport este mai mic dect 1,6
valoarea reprezint o indicaie a contaminrii cu proteine iar dac este mai
mare dect 2 nseamn c proba este contaminat cu fenol, alcooli sau
nucleotide. n oricare din cele dou situaii metoda nu va furniza rezultate
precise.
Dei o simpl citire a absorbiei la lungimea de und de 260 nm ar
putea fi utilizat pentru estimarea concentraiei unei soluii de ADN,
aceast abordare este foarte sensibil la prezena contaminanilor. Din
acest motiv se prefer msurarea concentraiei acizilor nucleici la mai
multe lungimi de und. n practic, cea mai folosit pereche de lungimi de
undeste260-280 nm care furnizeaz informaii legate de contaminarea cu
proteine. Absorbana soluiilor la 230 nm ofer indicaii legate de
contaminarea cu fenol, iar evalurile la 325 nm indic prezena unor
substane particulare.

Determinarea concentraiei acizilor nucleici

135

Principiul metodei
Metoda se bazeaz pe capacitatea acizilor nucleici de a absorbi
radiaii UV. Soluia de analizat se dilueaz corespunztor n tampon i se
msoar absorbana la 260 nm. Concentraia de ADN se calculeaz n
funcie de tipul de prob, innd cont c valoarea 1 corespunde unei
concentraii de 50 g/ml ADN dublu-catenar, 40 g/ml ADN (ARN)
monocatenar sau 33 g/ml polinucleotide monocatenare.
Avantaje:
1. simplitate nu sunt necesare dect un spectroforometru UV i
cuve din cuar;
2. costuri reduse practic nu se utilizeaz nici un material consumabil;
3. nu se utilizeaz reactivi toxici i nu se genereaz deeuri toxice;
4. dup determinarea concentraiei, proba se poate recupera i utiliza.
Limitri:
1. poate fi cuantificat numai ADN-ul purificat, lipsit de contaminani;
2. pot fi cuantificate numai soluii concentrate, intervalul de detecie
fiind unul relativ ngust, 1-50 g/ml;
3. valorile nregistrate pot varia mult n funcie de condiiile locale,
n principal de pH-ul i tria ionic a soluiei (4);
4. metoda nu poate face distinie ntre ADN i ARN.
Materiale necesare:
1. soluie tampon TNE 10X Tris baz 100 mM, NaCl 1 M, EDTA
10 mM, pH 7,4: 1,21 g TRIS baz, 0,371 g EDTA i 11,68 g NaCl
se dizolv n 75 ml ap distilat i se corecteaz pH-ul la 7,4 cu
HCl concentrat; se completeaz volumul la 100 ml cu ap distilat
i se pstreaz la temperatura camerei;

Biologie molecular. Metode experimentale

136

2. soluie tampon TNE 1X se prepar prin diluarea a 1 ml tampon


TNE 10X cu 9 ml ap distilat;
3. dou cuve pentru spectrofotometru, din cuar, mperecheate, cu
drumul optic de 1 cm; pot fi folosite cuve de diverse volume,
indicate sunt cele semi-micro (800 l), deoarece permit utilizarea
unor volume mici (de pn la 400 l);
4. spectrofotometru UV.
Mod de lucru:
1.

se pipeteaz soluie tampon TNE 1X n cuva de spectofotometu i


se plaseaz n aparat;

2.

se fixeaz lungimea de und la 260 nm i se stabilete punctul de


zero al aparatului cu proba martor;

3.

soluia de analizat se dilueaz n tampon TNE n aa fel nct


concentraia final s fie 1X (de exemplu, 100 l TNE 10X, 500 l
prob i 400 l ap distilat); este foarte important ca proba de
analizat s fie msurat n aceeai soluie ca i martorul;

4.

proba de analizat n soluie TNE 1X se introduce n cuva


spectrofotometrului i se fac msurtori succesive la 280 nm, 260 nm
i 230 nm nainte de a trece la urmtoarea prob.
Cel mai frecvent aceast determinare poate fi realizat cu ajutorul
programelor specializate pentru analiza acizilor nucleici cu care sunt
dotate spectrofotometrele (Multi-wavelenght). Dac aparatul nu are
pre-setat un astfel de program, se modific lungimea de und dup
fiecare msurtoare, verificndu-se de fiecare dat martorul;

5.

se determin concentraia n acizi nucleici la 260 nm i se


calculeaz cu una din ecuaiile:

ADN
dublucatenar:
ADN
dublucatenar:
ADN
monocatenar:

Determinarea concentraiei acizilor nucleici

137

ADN
monocatenar:
ARN
monocatenar:
Oligonucleoti
de:
unde: S este mrimea moleculei de ADN n kpb
N reprezint numrul de resturi de adenin
(A), citozin (C), guanin (G) i timin (T)
(Gallagher, 2007 (5)
7. Se estimeaz gradul de puritate al probei de acizi nucleici folosind
raportul A260/A280 i valorile A230 i A325; n general, raportul
A260/A280 trebuie s se situeze n intervalul 1,8-2; valori mai mici
de 1,8 semnaleaz contaminare cu proteine, valori mai mari
semnaleaz contaminare cu fenol sau nucleotide libere; n Tabelul 7
sunt prezentate valori obinuite ale unei probe de ADN pure.
TABEL 7.Valori ale absorbanei unei probe de ADN nalt purificat cu concentraia
25 g/ml n tampon TNE 1X
Lungime de und
(nm)

Absorban

Observaii

325

0,01

valori
mai
mari
semnaleaz
contaminare cu fenol sau uree

280

0,28

260

0,56

230

0,3

valori mai mari indic prezena materiei


particulate (proba este tulbure)

138

Biologie molecular. Metode experimentale

V.2. Determinarea concentraiei acizilor nucleici


prin fluorimetrie
Utilizarea fluorimetriei pentru msurarea concentraiei soluiilor
de ADN a devenit din ce n ce mai popular datorit simplitii i mai ales
sensibilitii foarte mari. Pentru cuantificarea soluiilor sunt utilizai trei
compui care au capacitatea de a se cupla cu moleculele de acizi nucleici:
bromura de etidiu (EtBr), colorantul HOECHST 33258 i colorantul
fluorescent ultrasensibil PicoGreen.
Metoda descris n continuare folosete bromura de etidiu.
Principalul dezavantaj se refer la efectul cancerigen al bromurii de
etidiu, ceea ce face necesar inactivarea tuturor deeurilor rezultate. De
asemenea, metoda nu deceleaz ntre ADN i ARN.
De-a lungul timpului au aprut diferite variante ale metodei cu
bromur de etidiu, cele mai cunoscute fiind cele ce folosesc electroforeza
n geluri de agaroz sau metoda mult simplificat bazat pe utilizarea
foliei de plastic.
HOECHST 33258 este un fluorocrom care are afinitate mic
pentru ARN, motiv pentru care este specific pentru ADN. Compusul
poate fi folosit pentru determinarea concentraiei ADN-ului n extracte
brute sau n soluii purificate, cu o sensibilitate de 0,01-15 g/l (6).
Legarea HOECHST 33258 de ADN este dependent de secvena de ADN,
manifestnd afinitate pentru zonele bogate n AT. Mai multe detalii despre
aceast metod se pot gsi n colecia Current Protocols - Essential
Laboratory Techniques (6).
PicoGreen este un alt fluorocrom care se leag de molecula de
ADN ntr-o manier independent de secvena de ADN. Cu ajutorul lui se
pot detecta cantiti de pn la 25 pg/ml ADN dublu-catenar, ceea ce
nseamn o sensibilitate de 400 ori mai mare dect n cazul HOECHST
33258. Dei nu exist indicaii referitoare la faptul c acest compus este
toxic, el trebuie manipulat cu atenie, nefiind nc suficient testat cu
privire la gradul de toxicitate. O descriere mai n detaliu a avantajelor i
dejavantajelor utilizrii colorantului picogreen, alturi de metodologia de
lucru, poate fi gsit n manualul de lucrri de laborator editat de
Sambrook et al.(2).

Determinarea concentraiei acizilor nucleici

139

Determinarea concentraiei acizilor nucleici


folosind bromura de etidiu
Dei bromura de etidiu este frecvent folosit pentru evidenierea
acizilor nucleici n geluri, compusul poate fi utilizat i la determinarea
concentraiei acestor macromolecule n soluie (5). La baza metodei de
dozare st acelai principiu ca i n cazul protocolului de evideniere a
ADN-ului pe geluri, care se refer la proprietatea bromurii de etidiu de a
se cupla cu moleculele de ADN sau ARN conducnd la dezvoltarea unei
fluorescene pronunate.
Pentru cuantificarea propriu-zis este necesar realizarea unei
curbe de etalonare cu ajutorul unei soluii de ADN de concentraie
cunoscut. Fluorescena probelor dezvoltate n prezena bromurii de etidiu
este apoi msurat cu ajutorul unui fluorimetru, la lungimi de und de
302 nmsau 546 nm pentru excitaie i 590 nm pentru emisie i vor
reprezenta puncte pe curba de etalonare,
Avantaje:
1. metoda poate fi utilizat pentru soluii parial purificate de ADN i
ARN;
2. metoda are o sensibilitate 1-5 ng, mai mare dect metoda care
folosete spectrometria UV (7);
3. metoda nu este influenat de secvena moleculei (ADN sau ARN)
cum se ntampl n cazul utilizrii fluorocromului HOECHST
33258 (6).
Limitri:
1. metoda nu poate decela ntre ADN i ARN;
2. toxicitate mare a compusului utilizat pentru dozare, generare de
deeuri toxice care trebuie atent inactivate;
3. intensitatea coloraiei variaz n funcie de tipul de acizi nucleici:
moleculele de ADN monocatenar i ARN-ul ribozomal dau un
semnal redus la jumtate fa de ADN-ul dublucatenar, ADN-ul

Biologie molecular. Metode experimentale

140

circular leag mai puin EtBr dect ADN-ul liniar; comentarii


detaliate privind parametrii care influeneaz intensitatea
semnalului n aceast metod pot fi gsite n lucrarea scris de Le
Pecq (7).
Materiale necesare:
1. soluie tampon TNE 10X TRIS baz 100 mM, EDTA 10 mM,
NaCl 1 M, pH 7,4 1,21 g TRIS baz, 0,371 g EDTA, 11,68 g
NaCl se dizolv n 75 ml ap distilat i se corecteaz pH-ul la 7,4
cu HCl concentrat; se completeaz la 100 ml cu ap distilat si se
pstreaz la temperatura camerei;
2. soluie stoc bromur de etidiu 1 mg/ml 100 mg bromur de
etidiu se dizolv n 100 ml ap distilat; soluia se pstreaz la
temperatura de 4oC, protejat de lumin;
Bromura de etidiu (EtBr) se intercaleaz ntre catenele de
ADN i poate fi transformat de enzimele din ficat n
derivai cu puternic efect mutagen i posibil carcinogen
(15). La concentraii mari substana are efect iritant pentru
ochi, piele i tractul respirator. Manipularea soluiilor i
obiectelor contaminate cu bromur de etidiu se realizeaz
numai cu mnui de protecie cu nitril. Soluiile i
materialele contaminate nu trebuie amestecate cu reziduuri
obinuite deoarece necesit msuri speciale pentru
decontaminare.
3. soluie bromur de etidiu de lucru 10 ml soluie tampon TNE
10X se dilueaz cu 89,5 ml ap distilat; soluia obinut se
filtreaz printr-un filtru cu porozitatea de de 0,45 m i apoi se
adaug 0,5 ml soluie bromur de etidiu 1 mg/ml; soluia se
pstreaz la temperatura de 4oC, protejat de lumin;
4. soluie standard ADN;
5. cuve pentru fluorimetrie.

Determinarea concentraiei acizilor nucleici

141

Mod de lucru:
1. 2 ml soluie bromur de etidiu de lucru se pipeteaz n cuva
fluorimetrului i se fixeaz lungimile de und pentru determinarea
excitaiei la 302 nm (cuv din cuar) sau 546 nm (cuv din sticl)
i emisiei la 590 nm; se stabilete zero pe aparat sau se citete
cantitatea de lumin emis, dup caz;
2. se adaug 2 l soluie ADN standard n cuva din camera
fluorimetrului i se agit fie prin pipetare, fie prin acoperirea cuvei
cu parafilm i rsturnarea ei; se citete i se noteaz cantitatea de
lumin emis la toate probele cu soluie standard, amestecnd
soluia standard de fiecare dat cu soluie de bromur de etidiu de
lucru proaspt;
3. probele de analizat se msoar n aceeai manier ca i probele
standard notndu-se extincia; concentraia final de bromur de
etidiu n cuva de msurare este suficient pentru determinarea unei
concentraii de ADN de pn la 1000 ng/ml; creterea
concentraiei de bromur de etidiu la 10 g/ml va mri spectrul de
aplicabilitate al metodei pn la 10 g/ml ADN; n cei 2 ml soluie
bromur de etidiu de lucru se pot aduga pn la 10 l soluie de
analizat;
4. concentraiile probelor necunoscute se determin cu ajutorul
curbei de etalonare.

Determinarea concentraiei acizilor


nucleicifolosind metoda cu folie din plastic
Aceast metod deriv din cea descris anterior, fiind ns mult
mai simpl i necesitnd o dotare minim, putnd fi realizat n orice
laborator care are n dotare o lamp UV sau un transiluminator.
Proba de analizat este plasat pe o folie din plastic sub forma unei
picturi alturi de o pictur de soluie standard. Peste ambele probe se
adaug aceeai cantitate de bromur de etidiu i se apreciaz cantitatea de
ADN sub lumin ultraviolet.

Biologie molecular. Metode experimentale

142

Avantaje:
1. simplitate deosebit;
2. nu necesit aparatur special;
3. utilizeaz o cantitate minim de reactivi i n consecin
reziduurile periculoase sunt relativ reduse;
4. n loc de soluie de bromur de etidiu se poate folosi colorantul
SYBR Gold (6).
Limitri:
1. nu se poate decela ADN de ARN;
2. precizie mic, aprecierea concentraiei fcndu-se vizual.
Materiale necesare:
1.
2.
3.
4.

folie din plastic transparent pentru UV;


transiluminator sau lamp UV;
soluie de ADN de concentraie cunoscut;
soluie bromur de etidiu 2 g/ml n tampon TE (TRIS-HCl
10 mM i EDTA 1 mM) pH 7,6.

Mod de lucru:
1. o bucat de folie din plastic transparent se aeaz pe suprafaa

transiluminatorului; dac se va folosi o lamp UV, folia se aeaz pe o


hrtie de culoare neagr;
2. pe folia din plastic se pipeteaz 1-5 l prob de analizat;
3. alturi se pipeteaz, n ordine, volume egale dintr-o serie de soluii cu

concentraii cunoscute de ADN (0; 1; 2,5; 5; 10 i 20 g/ml);


4. n fiecare pictur se adaug volume egale de bromur de etidiu de

concentraie 2 g/ml i se agit prin pipetri repetate sus-jos;

Determinarea concentraiei acizilor nucleici

143

5. spoturile obinute se vizualizeaz sub lumin UV i se apreciaz

concentraia probei necunoscute n funcie de intensitatea fluorescenei


comparativ cu probele standard.
Pentru acuratee, folia astfel pregtit poate fi fotografiat i concentraia probei necunoscute poate fi estimat cu ajutorul unui program de
densitometrare, precum programul ImageJ (8).

Determinarea cantitii de ADN pe geluri de


agaroz
Electroforeza pe geluri de agaroz a ADN-ului reprezint nu doar
o metod eficient de separare a ADN-ului, ci i o modalitate simpl de a
cuantifica cantitatea de ADN. Probele necunoscute se ncarc ntr-un gel
de agaroz alturi de un set de probe standard, ce conin cantiti
cunoscute de ADN. Gelul este migrat n condiiile obinuite pentru
electroforeza n geluri de agaroz descrise n capitolul VII Separarea
electroforetic a ADN-ului, pagina 147. Dup separarea electroforetic,
gelul este fotografiat, iar cantitatea de ADN din proba necunoscut este
evaluat n funcie de intensitatea benzilor rezultate n cazul probelor
standard.
Avantaje:
1. se realizeaz o separare net prin electroforez a ADN-ului de ARN,
eliminndu-se astfel interferena acestuia din urm;
2. se pot cuantifica exact fragmentele de interes i nu cantitatea de ADN
total ca n celelalte metode.
Limitri:
1. este o metod mai laborioas, care necesit utilizarea electroforezei n
geluri de agaroz;
2. limita de detecie este mai mic dect a metodei cu bromur de etidiu.

144

Biologie molecular. Metode experimentale

Mod de lucru:
Proba de analizat se separ pe gel de agaroz mpreun cu probele
standard cu concentraii cunoscute de ADN, urmnd protocolul descris n
capitolul capitolul VII Separarea electroforetic a ADN-ului, pagina
147). La finalizarea migrrii propriu-zise, gelul se coloreaz (dac este
necesar) n vederea evidenierii fragmentelor de ADN, urmnd unul din
protocoalele prezentate n subcapitolul VII.3 Detecia ADN-ului n
geluri de agaroz, pagina168, dup care se fotografiaz. De pe fotografie
sau prin vizualizare direct se poate aprecia, prin comparaie cu probele
standard, cantitatea de ADN din proba de interes. Pentru acuratee
fotografia obinut poate fi utilizat pentru densitometrare cu ajutorul unei
aplicaii precum ImageJ (8), urmnd paii descrii n cazul gelurilor de
poliacrilamid (subcapitolul X.3 Detectia proteinelor separate prin
electroforeza pe geluri de poliacrilamid, pagina 257).
Bibliografie:
1. Waterborg, J. H., Matthews, H. R. (1984) The Burton Assay for DNA,
Nucleic Acids, 2, 1-3.
2. Sambrook, J. (2001) Molecular Cloning: A Laboratory Manual
(Sambrook, J., Ed.) third., p. 2.13-2.19. Spring Harbor Laboratory
Press.
3. Stulnig, T. M., Amberger, A. (1994) Exposing contaminating phenol
in nucleic acid preparations., BioTechniques, 16, 402-4.
4. Wilfinger, W. W., Mackey, K., Chomczynski, P. (1997) Effect of pH
and ionic strength on the spectrophotometric assessment of nucleic
acid purity., BioTechniques, 22, 474-6, 478-81.
5. Gallagher, S., Wiley, E. (Eds.). (2008) Current Protocols Essential
Laboratory Techniques. John Wiley & Sons, Inc., Hoboken, NJ,
USA.
6. Ausubel, M. F., Brent, R., Kingston, E. R., Moore, D. D., Seidman, J.
G., Smith, A. J., Struhl, K. (2002) Short Protocols in Molecular
Biologyed. 5, p 10.1-10.31. John Wiley & Sons.
7. Glick, D., Le Pecq, J.-B. (1971) Use of Ethidium Bromide for
Separation and Determination of Nucleic Acids of Various

Determinarea concentraiei acizilor nucleici

145

Conformational Forms and Measurement of Their Associated


Enzymes, in Methods of Biochemical Analysis (Glick, D., Ed.), p
41-86. John Wiley & Sons, Inc., Hoboken, NJ, USA.
8. Abramoff, D. M., Magelhaes, J. P., Ram, J. S. (2004) Image
processing with ImageJ, Biophotonics International, 11, 36-42.

VII. SEPARAREA
ELECTROFORETIC A ADN-ULUI
Separarea electroforetic a moleculelor de ADN este una din
metodele care au stat la baza dezvoltrii foarte rapide a biologiei
moleculare. Tehnica permite nu numai separarea fragmentelor de ADN, ci
i izolarea, evidenierea i caracterizarea acestora. Rapiditatea metodei,
simplitatea aparaturii utilizate i nu n ultimul rnd rezoluia deosebit au
fcut ca electroforeza s nlocuiasc tehnicile bazate pe ultracentrifugare
n gradient de sucroz (zaharoz) nc din momentul descrierii primelor
protocoale de separare de ctre Thorne (1) i de evideniere a
fragmentelor de ADN de ctre Aaij i Borst (2) i Sharp (3).
Suporturile pentru separarea i evidenierea ADN-ului (agaroza
sau poliacrilamida) pot fi utilizate ntr-un numr foarte variat de sisteme
de separare care difer prin dimensiunea porilor, amplasarea gelului,
prezena diverilor aditivi n gel sau tamponul de separare utilizat.
Alegerea unui anumit sistem depinde, n principal, de dimensiunile
fragmentelor care urmeaz s fie separate.
Poliacrilamida este deosebit de eficient n separarea fragmentelor
de dimensiuni mici, 50 pb-500 pb (4). Rezoluia este foarte bun, putnd
fi separate fragmente ce difer n lungime doar printr-o pereche de baze
(5). Din acest motiv, gelurile de poliacrilamid au fost intens utilizate
pentru reacii de secveniere manual. Acest suport prezint dezavantajul
c este mai dificil de preparat i manipulat, iar fragmentele separate sunt
mai dificil de preluat din gel. Mai multe informaii legate de avantajele i
dezavantajele utilizrii gelurilor de poliacrilamid sunt prezentate n
excelentele manuale de laborator ale lui Sambrook (4) i Ausubel (6).
Utilizarea agarozei duce la micorarea puternic a rezoluiei,
avnd ns avantajul unui cost de exploatare mai mic i a simplitii
deosebite n prepararea i manipularea gelului. Au fost descrise, de
asemenea, numeroase metode de extragere a fragmentului separat din
gelurile de agaroz pentru utilizare n alte aplicaii. Gelul de agaroz este
suportul cel mai frecvent utilizat pentru separarea fragmentelor de ADN.
Sistemul cel mai comun permite separarea de fragmente cu dimensiuni
cuprinse ntre 0,5 kb-25 kb, ns diverse mbuntiri au condus la mrirea
domeniului de uzabilitate pn la fragmente de ordinul mpb.

148

Biologie molecular. Metode experimentale

Structura agarozei i mecanismul de migrare al ADN-ului.


Agaroza este un poliglucid natural extras din alge marine, alctuit
din uniti repetitive ale diglucidului agarobioz. Agarobioza este
compus dintr-un rest de D- galactoz i unul de L-3,6-anhidrogalactoz
legate -1,4. Lanurile de agaroz formez fibre spiralate care se agreg n
structuri supraspiralate cu diametrul de 20-30 nm. Sub form de gel,
agaroza formeaz o reea tridimensional cu pori avnd diametrul cuprins
ntre 50-200 nm (7), (8).
ADN-ul este un polimer puternic ncrcat negativ care sub
influena curentului electric se va deplasa ctre polul pozitiv. Viteza de
migrare este invers proporional cu dimensiunea fragmentelor i direct
proporional cu tensiunea aplicat (9). Porii gelului au un efect de sit,
astfel nct moleculele mici trec mult mai rapid prin porii gelului dect
moleculele mari.
Aceste relaii sunt valabile pn la o valoare limit a dimensiunilor
fragmentelor de ADN, dimensiune care este definit de compoziia
gelului i de tensiunea cmpului electric aplicat (10). Atunci cnd se
depete aceast valoare limit, efectul de filtrare al gelului dispare iar
fragmentele de ADN se orienteaz n sensul minimizrii rezistenei la
naintare. Fragmentele se orienteaz n aa fel nct unul dintre capete
ptrunde prin pori, restul moleculei urmndu-l (11). Pentru a descrie
comportarea ADN-ului n timpul electroforezei n geluri de agaroz au
fost dezvoltate diverse modele. Cel mai simplu model este cel n care
moleculele de ADN erpuiesc printre porii gelului (12) (Figura 19). i n
acest caz moleculele mici vor migra mai rapid dect cele mari, deoarece
creterea dimensiunii moleculei duce la creterea forelor de frecare dintre
molecul i gel. Pe lng ntrzierea cauzat de dimensiuni, moleculele
mari se pot de asemenea, nnoda n gel, conducnd la un proces
suplimentar de ntrziere. Moleculele mari de ADN vor migra mult mai
puin prin gel dect ne-am atepta innd cont doar de dimensiunile lor,
deoarece fenomenul de nnodare este att de puternic nct elimin
complet erpuirea (4). Dimensiunea limit la care procesul de nnodare
acoper total erpuirea este de 30 kb. Astfel, fragmente de 30 kb, 40 kb
sau 120 kb vor migra perfect identic i nu vor putea fi separate prin
metodele clasice.

Electroforeza ADN

149

Direcia de migrare

Molecule de ADN

FIGURA 19. Migrarea prin erpuire i nnodarea moleculelor de ADN (dup Reece,
2004 (5)

Pentru a elimina acest dezavantaj al electroforezei clasice n geluri


de agaroz, Schwartz i Castor (13) au introdus electroforeza n cmp
pulsatoriu (engl.Pulsed Fieled Gel Electrophoresis, PFGE) care permitea
iniial separarea unor fragmente cu dimensiuni de pn la
2000 kb. mbuntirile aduse ulterior acestei tehnici au permis separarea
de fragmente mai mari de 6000 kb, domeniul de aplicabilitate al
electroforezei n geluri de agaroz lrgindu-se mult.
Oricare ar fi tipul de electroforez utilizat, procesul de separare i
evideniere a moleculelor de ADN const n:
1. prepararea gelului i electroforeza propriu-zis;
2. colorarea gelului n vederea evidenierii ADN-ului;
3. fotografierea gelului.

150

Biologie molecular. Metode experimentale

VII. 1 Electroforeza clasic n geluri de agaroz

Mecanismul de separare a fragmentelor de ADN prin electroforeza


n geluri de agaroz a fost prezentat n introducerea acestui capitol. n
funcie de condiiile specifice utilizate, se pot descrie 2 tipuri de
electroforez n geluri de agaroz:
1. electroforeza nativ, cel mai frecvent utilizat, la care ne vom
referi n cele ce urmeaz;
2. electroforeza denaturant, realizat la valori mari de pH,
descris pentru prima dat de McDonell et al., 1977 (14), este
utilizat pentru separarea n funcie de dimensiunea catenelor
de ADN; mai multe detalii legate de aceast metod pot fi
gsite n manualul de laborator al lui Sambrook et al., 2001
(4).
Indiferent de tipul de electroforez utilizat, viteza de migrare a
fragmentelor de ADN depinde de o serie de factori, precum:
dimensiunea i topologia moleculelor de ADN. Un exemplu ce
demonstreaz foarte bine acest lucru este comportamentul ADN-ului
plasmidial bacterian ce poate migra sub 3 forme (Figura 20):
1. atunci cnd este puternic spiralizat, masa aparent este
redus astfel nct ADN-ul migreaz cu vitez mare la
aplicarea unui curent electric;
2. dac doar una dintre catene este clivat, molecula va
adopta o conformaie relaxat i de aceea viteza de migrare
va diminua mult;
3. dac ambele catene sunt clivate, molecula se comport
normal i migreaz cu o vitez intermediar.
Dup cum se poate observa i n Figura 20, moleculele circulare
migreaz diferit de cele liniare, din acest motiv masa molecular a
plasmizilor circulari nu poate fi apreciat prin comparare cu markeri de
mas alctuii din fragmente liniare.

Electroforeza ADN

151

ADN liniar

Direcia de migrare

ADN circular

ADN
supraspiralizat

FIGURA 20. Influena topologiei moleculei de ADN asupra separrii


electroforetice (dup Reece, 2004) (5)
concentraia i tipul agarozei diveri productori ofer tipuri variate
de agaroz, cu proprieti diferite n ceea ce privete punctul de gelificare,
punctul de topire, lungimea lanurilor poliglucigdice, gradul de
contaminare cu alte poliglucide sau cu proteine; exist dou tipuri mari de
agaroz: agaroza standard i agaroza cu temperatur de topire sczut
(engl. low-melting); o a treia clas, care ncepe s fie din ce n ce mai
mult utilizat prezint proprieti intermediare.
O prezentare mai detaliat a diverselor tipuri de agaroz este
realizat de Sambrook et al., 2001 (4). n Tabelul 8 sunt prezentate
domeniile de utilizare pentru fiecare tip de agaroz.

Biologie molecular. Metode experimentale

152

TABEL 8. Domenii de utilizarea ale diverselor tipuri de agaroz n funcie de


concentraie (dup Sambrook et al., 2001) (4)
Concentraie
(%)

Agaroz standard

Agaroz cu temperatur de
topire sczut

0,5

700 pb -25 kb

0,8

500 pb - 15 kb

800 pb - 10 kb

250 kb - 12 kb

400 pb - 8 kb

1,2

150 pb - 6 kb

300 pb - 7 kb

1.5

80 pb - 4 kb

200 pb - 4 kb

100 pb - 3 kb

50 pb - 1 kb

tensiunea aplicat la valori mici ale tensiunii aplicate, viteza de


migrare a ADN-ului este proporional cu voltajul aplicat pe gel; totui,
odat cu creterea tensiunii aplicate, mobilitatea moleculelor de
dimensiuni mari crete difereniat astfel c rezoluia gelului scade odat
cu creterea voltajului; pentru fragmentele mai mari de 2 kb este
recomandat aplicarea unei tensiuni care s nu depeasc 5-8 V/cm gel.
soluia tampon de electroforez n absenta ionilor conductivitatea
apei este minim motiv pentru care migrarea electroforetic a moleculelor
de ADN se realizeaz foarte lent; odat cu creterea triei ionice (prin
mrirea concentraiei de ioni dizolvai) conductibilitatea soluiei crete, n
acelai timp crescnd i cantitatea de cldur generat; din acest motiv
concentraia soluiilor tampon utilizate pentru electroforez este crucial
pentru buna desfurare a separrii; cele mai folosite soluii tampon
utilizate pentru separarea electroforetic a acizilor nucleici sunt Trisacetat EDTA pH 8 (TAE), Tris-Borat EDTA (TBE) sau Tris-fosfat EDTA
(TPE); TAE are capacitate mai mic de tamponare i de aceea n cazurile
unor migrri prelungite zona anodic devine puternic acid, nefiind
recomandat utilizarea acestei soluii tampon; TBE si TPE au capacitate
de tamponare mai mare, n TBE un fragment dublu-catenar liniar de ADN
migreaz cu pana la 10% mai repede dect n TAE.

Electroforeza ADN

153

Principiul metodei
Moleculele de ADN, ncrcate negativ datorit resturilor de fosfat,
plasate ntr-un cmp electric vor migra spre electrodul pozitiv. ntr-un gel
de agaroz viteza de migrare a moleculelor de ADN la aplicarea unui
cmp electric va depinde pe de o parte de sarcina moleculelor i, pe de
alt parte, de dimensiunea moleculelor datorit efectului de sit al gelului.
n acest fel are loc separarea fragmentelor de ADN n funcie de lungimea
lor, respectiv n funcie de masa molecular.
Avantaje:
1. permite separarea fragmentelor de acizi nucleici cu dimensiuni de
pn la 25 kb;
2. este utilizat pentru aprecierea maselor moleculare a fragmentelor
separate, dar i pentru cuantificarea cantitii de ADN;
3. prezint uurin n exploatare, rapiditate i simplitate a
materialelor i reactivilor necesari.
Limitri:
1. nu poate fi utilizat pentru separarea fragmentelor mai mari de
25 kb;
2. prezint rezoluie mai mic dect elecroforeza n geluri de
acrilamid.
Materiale necesare:
1. tampon electroforez TBE 10X, soluie stoc: 109,8 g Tris, 55 g acid
boric, 7,5 g EDTA n 5 L ap distilat;
2. soluie bromur de etidiu 0,5 mg/ml (facultativ, necesar doar n cazul
n care se adaug bromur de etidiu n gel) se dizolv 50 mg bromur de
etidiu n 100 ml ap distilat; soluia se pstreaz la ntuneric timp nelimitat;

Biologie molecular. Metode experimentale

154

Bromura de etidiu (EtBr) se intercaleaz ntre catenele de


ADN i poate fi transformat de enzimele din ficat n
derivai cu puternic efect mutagen i posibil carcinogen
(15). La concentraii mari substana are efect iritant pentru
ochi, piele i tractul respirator. Manipularea soluiilor i
obiectelor contaminate cu bromur de etidiu se realizeaz
numai cu mnui de protecie cu nitril. Soluiile i
materialele contaminate nu trebuie amestecate cu reziduuri
obinuite deoarece necesit msuri speciale pentru
decontaminare.
3. agaroz pentru electroforez;
4. soluie tampon concentrat pentru probe 0,25% albastru de
bromfenol, 0,25% xilen cianol FF (albastru acid 147), 30% glicerol n
ap;
5. markeri de mas molecular (New England Biolab, Biorad) este
indicat s existe 2 seturi de markeri, unul ntre 1-20 kb i unul ntre
100-1000 pb (4);
6. baie de ap sau cuptor cu microunde;
7. sistem orizontal de elecroforez i sistem de turnare al gelului diveri
productori (Biorad, Hoefer, Apelex) pun la dispoziie o gam larg de
cuve cu dimensiuni variate; Sambrook (16) descrie o metod de realizare
n laborator a unei cuve de electroforez, dar cuvele dedicate au avantajul
unui sistem de turnare al gelului foarte simplu i fiabil;
8. piepteni pentru formarea godeurilor;
9. surs de curent.
Mod de lucru:
1. se asambleaz modulul de turnare al gelului urmnd indicaiile
productorului;
2. se prepar soluie tampon TBE 1X prin diluarea 1:10 a soluiei
stoc, n cantitate suficient pentru a umple cuva de electroforez i pentru
a pregti gelul;

Electroforeza ADN

155

3. se cntrete cantitatea de agaroz necesar pentru realizarea


volumului de gel de concentraie dorit; agaroza se transvazeaz ntr-un
flacon Erlenmeyer i se adaug volumul corespunztor de soluie tampon
pentru electroforez; volumul final nu trebuie s depeasc 50% din
volumul flaconului;
4. amestecul obinut se nclzete pe baie de ap sau n cuptorul cu
microunde pn la topirea complet a granulelor de agaroz; n cazul
utilizrii cuptorului cu microunde la putere maxim, pentru a prepara
50 ml gel sunt suficiente dou reprize de nclzire de cte un minut i
jumtate, cu agitare dup prima repriz i la final;
5. facultativ, n funcie de sistemul de colorare utilizat, soluia se
rcete pn la aproximativ 60oC dup care se adaug bromur de etidiu
pn la concentraia 0,5 g/ml i se agit (pentru un volum de 50 ml gel
se adaug 50 l soluie bromur de etidiu);
6. soluia cald astfel preparat se introduce n modulul de turnat
geluri al cuvei i se insereaz pieptenele; n general, cuvele achiziionate
de la productori consacrai sunt prevzute cu ghidaje sau piciorue
pentru aezarea pieptenelui; dac acestea nu exist, pieptenele trebuia
plasat la aproximativ 1 cm de captul gelului n aa fel nct s rmn o
distan de 0,5-1 mm de la vrful dinilor pieptenelui pn la fundul
modulului de turnare;
7. se las s se rceasc soluia timp de 30-45 minute, la temperatura
camerei; dac se utilizeaz agaroz cu punct de topire sczut sau dac
gelul are o concentraie mai mic de 0,5%, rcirea se efectueaz prin
introducere la frigider, la temperatura de 4oC.
8. dup rcire, gelul se plaseaz n cuva pentru electroforez i se
adaug o cantitate suficient de soluie tampon TBE 1X pentru a acoperi
complet gelul;
9. probele coninnd acizi nucleici de analizat se amestec cu un
volum corespunztor de soluie tampon de ncrcare; cantitatea maxim
de ADN posibil a se ncrca pe gel variaz n funcie de tipul probei; dac
proba conine populaii simple de molecule (1-2 dimensiuni diferite), se
ncarc maximum 500 ng ntr-un godeu cu lungimea de 0,5 cm; dac
proba conine un numr mare de fragmente de dimensiuni diferite, se pot
ncrca pn la20-30 g ntr-un godeu; volumul maxim care se poate
ncrca depinde de dimensiunea godeului; dimensiunile clasice pentru

156

Biologie molecular. Metode experimentale

godeuri (0,5 cm x 0,5 cm x 0,15 cm) permit ncrcarea unui volum de


maximum 37,5 l (16); nu se recomand ncrcarea complet a godeurilor
deoarece apare pericolul contaminrii probelor; de asemenea, trebuie
acordat o atenie deosebit la ncrcarea probelor cu ajutorul pipetelor
automate, vrful acestora putnd distruge uor peretele inferior al
godeului; soluia tampon de ncrcare are dou roluri: glicerolul mrete
densitatea probei i face ca soluia de ADN s rmn pe fundul godeului
iar coloranii au rate diferite de migrare n gel i permit supravegherea
procesului; albastrul de bromfenol migreaz prin gel cu o vitez
aproximativ egal cu a unui fragment ADN de 300-500 pb, iar xilencianolul FF cu o vitez aproximativ egal cu a unui fragment ADN dublucatenar de 4 kb;
10. se nchide capacul cuvei i se conecteaz la sursa de curent n aa
fel nct probele s fie plasate spre catod (firul negru) i s migreze ctre
anod (firul rou); tensiunea aplicat trebuie s fie ntre 1-5 V/cm gel
pentru fragmente de dimensiuni mari (>5 kDa), sau de maxim 10 V/cm
pentru fragmente de dimensiuni mici (500 pb) (15);
11. n timpul migrrii, dup ce se ntrerupe alimentarea cuvei, gelul
poate fi scos i analizat pe transiluminator de cte ori este necesar, pn se
obine nivelul dorit al rezoluiei; unii productori ofer cuve de
electroforez din materiale plastice transparente pentru ultraviolet care pot
fi plasate direct n lumina ultraviolet, fr a mai fi necesar scoaterea
gelului din cuv;
12. dup terminarea migrrii, se ntrerupe alimentarea cuvei, gelul se
scoate din cuv i se plaseaz pe transiluminator pentru analiz i
fotografiere.
Soluiile tampon de electroforez pot fi utilizate de cteva ori fr
efecte vizibile asupra rezoluiei separrii. n timpul migrrii, bromura de
etidiu migreaz invers fa de moleculele de ADN i prsete gelul. Din
acest motiv soluiile tampon de migrare conin acest compus i n
consecin trebuie decontaminate. Cteva metode de decontaminare a
soluiile sunt descrise de Sambrook (16).

Electroforeza ADN

157

VII. 2. Separarea ADN prin electroforez n gel de


poliacrilamid cu gradient de agent
denaturant
Electroforeza ADN n gel de poliacrilamid cu gradient denaturant
(engl.Denaturing Gradient Gel Electrophoresis DGGE) este folosit
frecvent n scopul analizei compoziiei, diversitii i dinamicii
comunitilor microbiene. Pornind de la izolarea ADN-ului comunitar,
metoda permite generarea unui profil genetic folosit n identificarea
taxonomic a populaiilor predominante ntr-un mediu natural (20). Prin
DGGE se pot separa produi PCR molecule de ADN dublu catenar cu
aceeai lungime dar cu secvene diferite. Separarea se realizeaz n
funcie de mobilitatea diferit a moleculelor ADN determinat de
comportamentul deosebit al legturilor de hidrogen dintre perechile de
baze azotate la denaturare, legturile triple dintre guanin i citozin fiind
mai puternice dect legturile duble dintre adenin i timin. Denaturarea
fragmentelor ADN dublu catenar se realizeaz n timpul electroforezei
prin crearea unui gradient de concentraie al agenilor denaturani, de
obicei uree i formamid. Pentru a mpiedica denaturarea complet a
moleculelor de ADN n urma creia ar rezulta fragmente monocatenare ce
pot migra n afara gelului, n timpul procesului de amplificare prin PCR
se adaug un fragment GC cu o lungime de 40 pb la fiecare fragment
amplificat. Aceasta se realizeaz prin ataarea fragmentului GC la captul
5' al primer-ului utilizat pentru amplificare.
Metoda ofer avantajul prelucrrii simultane, ntr-un timp relativ
scurt i cu costuri mici a unui numr mare de probe n comparaie cu
metodele clasice de secveniere.
Principiul metodei
Separarea electroforetic a fragmentelor amplificate prin PCR se
realizeaz n funcie de diferenele de mobilitate a moleculelor de ADN
denaturate precum i ale secvenei diferite n baze azotate
(guanin/citozin) a acestora. Pe msura denaturrii, viteza de migrare a
moleculelor scade semnificativ comparativ cu cea a moleculelor dublu

158

Biologie molecular. Metode experimentale

catenare, nedenaturate de ADN, ceea ce permite separarea unor fragmente


corespunztoare unor populaii bacteriene predominante.
Aplicaii:
Utilizarea DGGE n domeniul ecologiei microorganismelor a fost
introdus de Gerard Muyzer i colaboratorii (21). Acetia au realizat
pentru prima dat caracterizarea unor comuniti microbiene complexe
prin PCR-DGGE utiliznd genele care codific ARN-ul ribozomal.
Aplicaiile practice ale DGGE se bazeaz pe caracteristicile acestor gene
referitoare la prezena lor n genomul tuturor organismelor cunoscute i la
faptul c sunt alctuite din secvene nalt conservate (servesc pentru
ataarea primer-ilor utilizai) alturi de secvene variabile (specifice
anumitor tipuri de organisme, avnd rol n identificarea filogenetic).
DGGE este utilizat pentru investigarea comunitilor de
microorganisme ntr-o varietate larg de aplicaii ce includ:
1. evaluarea proceselor de bioremediere;
2. tratamentul apelor reziduale;
3. tratamentul apei potabile;
4. formarea biofilmelor;
5. coroziunea indus de microorganisme;
6. identificarea microorganismelor contaminante n diferite produse
comerciale/industriale.
Limitri:
Metoda prezint limitri practice inerente. De exemplu, Muyzer i
colaboratorii (1993) sugereaz ca regul general faptul c orice ADN
int care este prezent ntr-un procent mai mic de 1% n ADN-ul
comunitar izolat nu poate fi detectat prin DGGE. n aceste cazuri pot
aprea benzi discrete care nu pot fi decelate. Din acest motiv se
recomand utilizarea DGGE doar pentru identificarea organismelor sau
filotipurilor predominante ntr-o comunitate. La acest neajuns se adaug i
altele: co-migrarea unor molecule ADN cu secvene diferite, apariia unor
benzi multiple derivate dintr-un singur organism care prezint mai muli
operoni variabili n zona genelor pentru ARNr 16S. La aceste dezavantaje

Electroforeza ADN

159

se adaug desigur i cele ale tehnicii PCR pe care se bazeaz DGGE.


Cu toate c DGGE este eficient pentru analiza probelor cu
diversitate relativ mic n organisme, exist numeroase studii care
demonstreaz c metoda poate fi folosit cu succes i n analiza unor
comuniti complexe de organisme cum sunt cele din diferitele tipuri de
sol (20). Pentru a trece peste o parte din neajunsurile metodei se pot
utiliza primeri specifici care s permit amplificarea fragmentelor ADN
corespunztoare unor populaii care se gsesc ntr-un procent mai mic de
1% n comunitatea analizat (Tabel 9).
TABEL 9. Primeri specifici utilizai pentru amplificarea PCR a fragmentelor ADN
16S n vederea realizrii separrii electroforetice prin DGGE
Primer

Grup
taxonomic

F243

Actinomic
ete
Actinomic
ete

R513GC

Poziia
fragmentelor
ADN 16S
int*
226-243
513-528

Secven (5' 3')

Ref.
bibl.

GGATGAGCCCGCGGCCTA

(22)

GC.CGGCCGCGGCTGCTGGCACG
TA
GC.-ACGCGAAGAACCTTAC

(22)

F984GC

Bacteria

968-984

R1378

Bacteria

1378-1401

CGGTGTGTACAAGGCCCGGG
AACG

(22)

F27

Bacteria

8-27

AGAGTTTGATC(A/C)TGGCTC
AG

(22)

R1492

Bacteria

1492-1513

(22)

F203

Proteobact
eria

174-203

TACGG(C/T)TACCTTGTTACG
ACTT
CCGCATACGCCCTACGGGGG
AAAGATTTAT

F948

Proteobact
eria
Archaea

931-948

CGCACAAGCGGTGGATGA

(23)

344-363

(24)

Archaea

934-915

GC.ACGGGGYGCAGCAGGCGCG
A
GTGCTCCCCCGCCAATTCCT

FARC34
4 GC
RARC9
15

(22)

(23)

(24)

Biologie molecular. Metode experimentale

160
Primer

Grup
taxonomic
Fungi

Poziia
fragmentelor
ADN 16S
int*
20-38

NS1

Secven (5' 3')

GTAGTCATATGCTTGTCTC

(25)

FR1 GC

Fungi

1665-1648

GC.-AICCATTCAATCGGTAIT

(25)

Euk1A
REuk51
6 GC
GC.

Eukarya
Eukarya

4-20
563-548

CTGGTTGATCCTGCCAG
GC.-ACCAGACTTGCCCTCC

5'CGCCCGGGGCGCGCCCCGG
GCGGGGCGGGGGCACGGGG
GG-3'
F oligonucleotid amors (primer) forward
R oligonucleotid amors (primer) reverse
*
poziie corespunztoare n genomul bacteriei E. coli

Ref.
bibl.

(26)
(26)
(22)

Materiale necesare:
1. acrilamid, soluie 40% (acrilamid-bisacrilamid 37,5:1): se
cntresc 194,8 g acrilamid i 5,2 g bis-acrilamid i se adaug ap
distilat pn la 500 ml volum final; soluia se pstreaz la temperatura de
4oC.
Acrilamida i bisacrilamida monomere se absorb prin piele
i sunt neurotoxine deosebit de puternice, fiind de asemenea
suspectate de efecte cancerigene. Cntrirea i prepararea
soluiilor se realizeaz cu atenie, manevrarea fcndu-se cu
mnui i purtnd masc de protecie. Dei poliacrilamida
este considerat inofensiv, este indicat ca manipularea
gelurilor s se realizeze tot cu mnui, datorit resturilor de
acrilamid nepolimerizat.
2. uree.
3. formamid deionizat: se introduc 12,5 g rin schimbtoare
de ioni (de exemplu AG 501-X8, Bio-Rad) n 250 ml formamid 100%;
amestecul se agit timp de o or la temperatura camerei; se filtreaz

Electroforeza ADN

161

folosind hrtie de filtru obinuit i se pstreaz la ntuneric, la


temperatura de 4-6oC.
4. tampon TRIS/Acid acetic/EDTA (TAE) 50X: se cntresc 242 g
TRIS baz i se dizolv n aproximativ 750 ml ap deionizat; se adaug
cu grij 57,1 ml acid acetic glacial i 100 ml soluie 0,5 M EDTA (pH 8
corectat cu KOH); se ajusteaz volumul final la 1 L; pentru a prepara 5L
TAE 1X, 100 ml TAE 50X se aduc la un volum final de 5 L cu ap
distilat.
5. glicerol.
6. APS (persulfat de amoniu), soluie 10% (w/v): se dizolv 0,1 g
persulfat de amoniu n 900 l ap distilat; soluia se pstreaz la
temperatura de -20oC.
7. TEMED(N,N,N,N-tetra-metil-etilendiamin).
8. tampon ncrcare 6X: se amestec 1,5 ml glicerol, 12,5 mg
albastru de bromfenol i 5 ml ap distilat deionizat; soluia se pstreaz
la temperatura de 4oC.
Mod de lucru
Realizarea DGGE presupune parcurgerea urmtoarelor etape:
1. curarea i asamblarea sistemului de electroforez;
2. prepararea soluiilor i turnarea gelurilor n gradient de concentraie;
3. ncrcarea probelor;
4. separarea electroforetic propriu-zis a probelor;
5. evidenierea fragmentelor separate prin coloraii specifice i
fotografierea gelului.
n prezent exist mai multe tipuri de sisteme folosite pentru
DGGE furnizate de diferii productori (Bio-Rad, Ingeny, CBS Scientific,
Scie Plas etc.). Din acest motiv, modul de pregtire al sistemului precum
i volumul soluiilor folosite variaz n funcie de modelul utilizat precum
i de dimensiunile gelurilor. n cele ce urmeaz este prezentat realizarea
DDGE folosind sistemul TV400 produs de Scie Plas, UK (Figura 21).

Biologie molecular. Metode experimentale

162

pieptene

cuv
modul
migrare
gel

distanier
controler
temperatur

suport
turnare
gel

FIGURA 21. Elementele componente ale sistemului pentru DGGE TV400 (Scie
Plas)
1. Curarea i asamblarea sistemului de electroforez
Componentele sistemului DGGE (plcile din sticl, cele dou
distaniere, pieptenul) trebuie splate bine cu ap nainte de utilizare. n
cazul plcilor din sticl trebuie ndeprtat orice urm de grsime prin
splare cu ap i spun. Dup uscare, plcile din sticl se cur cu etanol
96% folosind un erveel din hrtie, n scopul ndeprtrii ncrcrii
electrostatice i pentru a asigura omogenitatea gelului. Dei este suficient
curarea plcilor din sticl doar pe o parte, se recomand curarea
ambelor fee. Pentru manipularea plcilor din sticl se recomand purtarea
mnuilor.
Pentru asamblarea sistemului de electroforez n scopul turnrii
gelului se procedeaz n felul urmtor:
1. se aeaz plcile din sticl pe hrtie de filtru curat;
2. distanierele se fixeaz pe prile laterale ale plcii din sticl
mai lungi dup care se suprapune cea de-a doua plac din
sticl, mai scurt;
3. ansamblul astfel rezultat se prinde n modulul de migrare al
gelului i se fixeaz cu ajutorul uruburilor; se ntoarce modulul
pentru a se verifica dac plcile din sticl i distanierele sunt

Electroforeza ADN

163

perfect aliniate; dac este necesar se reajusteaz poziia lor


pn la aliniere complet;
4. se aeaz modulul de migrare al gelului pe suportul de turnare
i se rotesc uruburile n sensul acelor de ceasornic pn la o
fixare etan;
5. se verific etaneitatea sistemului turnnd 2 ml ap distilat
ntre plcile din sticl; dac nu se observ scurgere, apa poate
fi ndeprtat i se poate trece la turnarea gelurilor.
2. Prepararea soluiilor i turnarea gelurilor n gradient de
concentraie
Gelurile utilizate pentru DGGE sunt geluri de poliacrilamid de
concentraie constant. Valoare specific a concentraiei de poliacrilamid
depinde de dimensiunile produilor PCR ce urmeaz a fi separai prin
electroforez: 6% pentru fragmente cu o lungime de 300-1000 pb, 8%
pentru fragmente de 200-400 pb i 10% pentru produii de 100-300 pb
(20).
Specific pentru gelurile DGGE este faptul c acestea conin un
gradient de concentraie de agent denaturant dispus pe lungimea gelului.
Gradientul se realizeaz de la 0% pn la 80% agent denaturant, unde
100% agent denaturant reprezint 7M uree i 40% formamid deionizat.
Uneori este necesar optimizarea prealabil a condiiilor de gradient; n
aceste situaii se pornete de la un gradient mai mare de concentraie,
urmnd ca ulterior acesta s fie ngustat n vederea creterii rezoluiei.
3. Prepararea soluiilor de acrilamid i agent denaturant:
n vederea preparrii gelului n gradient de agent denaturant este
necesar prepararea a dou soluii:
o soluie de concentraie mic de agent denaturant (notat cu L
engl. Low);
o soluie de concentraie mare de agent denaturant (notat cu H
engl. High).
De exemplu, dac se utilizeaz un gradient de 30-60% agent
denaturant, atunci este necesar prepararea unei soluii de 30% (L) i a
unei soluii de 60% (H) agent denaturant. Volumul fiecrii soluii depinde
de dimensiunea gelului de preparat. Sistemul n format maxi descris n

Biologie molecular. Metode experimentale

164

continuare utilizeaz un gel cu volumul de 30 ml, ceea ce presupune


prepararea a 15 ml din soluia H i 15 ml din soluia L.
Pentru uurin se prepar soluii stoc n eprubete de centrifug cu
capacitatea de 50 ml (Tabelul 10). Opional, dup preparare, soluiile pot
fi filtrate sau degazificate. n scopul creterii flexibilitii gelului se poate
aduga 1 ml glicerol la 50 ml soluie stoc (se reduce astfel riscul ruperii
gelului n timpul manipulrilor ulterioare). Soluiile astfel preparate se pot
pstra protejate de lumin la temperatura de 4oC timp de pn la o lun.
TABEL 10. Prepararea soluiilor stoc necesare pregtirii gelurilor DGGE 6%
poliacrilamid
Reactivi
0%

Concentraie agent denaturant


20%
30%
40%
60%

Poliacrilamid
40% (37,5:1) 7,5 ml 7,5 ml
TAE 50X
1 ml
1 ml
Uree
0g
4,2 g
Formamid
0 ml
4 ml
pn la pn la
H2O distilat 50 ml 50 ml

7,5 ml
1 ml
6,3 g
6 ml
pn la
50 ml

70%

7,5 ml 7,5 ml 7,5 ml


1 ml
1 ml
1 ml
8,4 g
12,6 g 14,7 g
8 ml
12 ml
14 ml
pn la pn la pn la
50 ml
50 ml
50 ml

Pentru a prepara geluri de poliacrilamid cu concentraii mai mari


de 6% se poate crete volumul de poliacrilamid 40% n soluiile stoc
pn la 10 ml (pentru geluri 8%), respectiv pn la 12,5 ml (pentru geluri
10%).
Pentru turnarea gelurilor se utilizeaz un mixer de gradient care
are rolul de a realiza gradientul de concentraie dorit. Acesta prezint dou
compartimente legate printr-un canal prevzut cu un robinet. Mixerul de
gradient se conecteaz la o pomp peristaltic (Figura 22) i se
procedeaz n felul urmtor:
1. se introduce un magnet pentru agitare n compartimentul n
care se va turna soluia H;

2. se aeaz mixerul de gradient pe un agitator magnetic i se


spal bine cu ap distilat; se verific modul de funcionare i
etaneitatea tuburilor pornind pompa peristaltic i evacund
apa folosit pentru splare;

Electroforeza ADN

compartiment soluie L

165

pomp peristaltic

tub terminal

mixer de
gradient

agitator magnetic
FIGURA 22. Asamblarea sistemului de turnare a gelurilor n gradient de
concentraie de agent denaturant utilizate n DGGE
3. se oprete pompa peristaltic i se nchide robinetul dintre cele
dou compartimente precum i robinetul final;
4. se introduce tubul terminal ntre cele dou plci din sticl;
5. se introduc 15 ml soluie L n compartimentul din stnga
(Figura 22); se deschide i se nchide robinetul dintre cele
dou compartimente astfel nct o cantitate foarte mic de
soluie L s treac n cellalt compartiment; n acest fel se
mpiedic blocarea cu aer a canalului dintre cele dou
compartimente; se scoate soluia L din compartimentul din
dreapta cu o pipet i apoi se adaug 15 ml soluie H; volumul
soluiilor introduse variaz n funcie de dimensiunile plcilor
din sticl precum i de grosimea distanierelor folosite; n
general, se utilizeaz un volum final al soluiilor H i L care s
permit turnarea gelului pn la distana de 1 cm fa de
pieptenele inserat;
6. se pornete agitatorul magnetic;
7. se adaug soluia APS 10% (40-100 l) i TEMED

166

Biologie molecular. Metode experimentale

(7,5-10 l/10 ml); din acest moment ncepe polimerizarea


soluiei de poliacrilamid, motiv pentru care se recomand
turnarea gelului fr ntrziere;
8. se pornete pompa peristaltic la o vitez de 10 ml/min;
nivelul soluiei H va scdea puin, mpiedicnd trecerea ei n
cellalt compartiment nainte de efectuarea pasului urmtor;
9. se deschide robinetul dintre cele dou compartimente; dac
nivelul soluiei L nu scade, canalul dintre cele dou
compartimente este blocat;
10. se toarn gelul ncet ntre cele dou plci din sticl pn la
1-2 cm sub pieptene, evitndu-se ptrunderea aerului;
11. dup turnarea gelului se nchide pompa peristaltic, se scoate
tubul dintre cele dou plci din sticl i se adaug ap distilat
n ambele compartimente ale mixerului de gradient; se
repornete pompa pentru a spla bine tot sistemul n vederea
nlturrii soluiei de poliacrilamid ce poate polimeriza;
12. se ateapt timp de aproximativ o or n vederea polimerizrii
complete a acrilamidei i obinerea gelului de poliacrilamid;
13. se spal suprafaa gelului cu TAE 1X dup care soluia tampon
se ndeprteaz cu ajutorul unei pipete;
14. se prepar aproximativ 3 ml dintr-o soluie 0% denaturant
(Tabelul 10, pagina 164) n care se adaug 30 l soluie 10%
APS i 3 l TEMED; aceast soluie se toarn, cu ajutorul unei
pipete, deasupra gelului obinut anterior;
15. se introduce cu grij pieptenul astfel nct s se evite formarea
bulelor de aer dedesubt; dac acestea apar se scoate pieptenul
i se reia operaia;
16. se las n repaus cel puin 2 ore pentru polimerizare;
17. se prepar aproximativ 5 L TAE 1X; 4,3 L TAE 1X se introduc
n cuva pentru electroforez; folosind sistemul de nclzire a
cuvei se nclzete soluia tampon pn la temperatura de 65oC
(timp necesar aproximativ 2 ore); 0,7 L TAE 1X se pstreaz
pentru mai trziu;
18. cnd temperatura a ajuns la 50oC, se scoate uor pieptenele din

Electroforeza ADN

167

gel i se transfer modulul de migrare al gelului n cuv; la


introducere pot aprea bule de aer la partea inferioar a
modulului care pot influena procesul de migrare; acestea pot
fi scoase cu ajutorul unei seringi; se umple camera interioar a
modulului cu cei 0,7 L TAE 1X pstrai;
19. se spal bine godeurile cu TAE 1X pentru a ndeprta resturile
de acrilamid nepolimerizat; n caz contrar se formeaz
godeuri cu dimensiuni inegale;

20. se continu nclzirea pn la temperatura de 65oC; nu se


recomand introducerea modulului de migrare al gelului la
temperaturi mai mari de 50oC deoarece plcile din sticl se pot
deteriora.
4. ncrcarea probelor
Pentru ncrcarea probelor se poate utiliza o pipet automat
prevzut cu vrfuri speciale sau, dup caz, o sering Hamilton. Se
recomand ncrcarea probelor n godeurile centrale, evitndu-se
utilizarea celor din margine (n aceast regiune poate apare mai frecvent
fenomenul de migrare inegal a probelor aa numitul gel smiling).
n fiecare godeu se poate introduce un volum de 40-50 l produs
PCR mpreun cu tampon de ncrcare. Volumul probei de ncrcat poate
varia n funcie de dimensiunile pieptenelui utilizat, de randamentul
procesului de amplificare prin PCR i de numrul probabil al produilor
obinui. De exemplu, probele de sol vor genera prin amplificare un
numr mai mare de produi, prin urmare se recomand ncrcarea unor
volume ct mai mari. n cazul analizei produilor PCR ai unui singur
izolat se recomand ncrcarea unor volume foarte mici (civa l).
Pentru a uura ncrcarea probelor se recomand introducerea n
godeuri, la nceput, a unor volume mici de tampon de ncrcare (albastru
de bromfenol). n acest fel godeurile devin mult mai vizibile i nu
interfer cu procesul de migrare.
Drept standarde n timpul migrrii se pot folosi amestecuri de
produi PCR generai din benzi excizate din alte geluri. Nu se recomand
utilizarea drept standarde a unor markeri de greutate ca cei folosii pentru
electroforeza n gel de agaroz.

Biologie molecular. Metode experimentale

168

5. Migrarea probelor
Timpul de migrare i tensiunea electric sunt variabile cheie ale
separrii electroforetice. n general, geluri de calitate superioar se obin
folosind timpi mai mari de migrare i valori mai mici ale tensiunii
electrice (16 ore la 100 voli n comparaie cu 3 ore la 250 voli) (20). n
cazul sistemului DGGE TV400 (Scie Plas) se menine constant
temperatura la 60oC i se realizeaz mai nti o migrare timp de 10 minute
la 20 voli, urmat de o migrare de 5 ore la 200 voli.
La final se dezasambleaz modulul de migrare, se scoate cu grij
gelul i se poate trece la etapele de colorare i vizualizare. Dac la
asamblare, pe suprafaa intern a uneia din cele dou plci din sticl, se
ataeaz o folie de celofan, dup migrare gelul poate fi mai uor manipulat.

VII.3 Detecia ADN-ului n geluri de agaroz


Evidenierea ADN-ului n geluri de agaroz se bazeaz pe
capacitatea acestuia de a intercala ntre baze diverse molecule colorate sau
fluorescente. n cele ce urmeaz sunt prezentate trei modaliti distincte
de evideniere a ADN-ului, fiecare cu avantajele i dezavantajele ei.
Vizualizarea fragmentelor de ADN se face cu ajutorul unui
transiluminator. Caracteristic gelurilor de agaroz este faptul c trebuie
vizualizate imediat dup terminarea separrii electroforetice, deoarece n
timp benzile separate difuzeaz i diminueaz rezoluia. Prin urmare, este
absolut necesar ca aceste geluri s fie fotografiate imediat dup separare.
Aceasta se poate realiza cu o camer foto digital obinuit, ns calitatea
fotografiilor nu este foarte bun i timpul de expunere la lumina ultraviolet
este mare. n comer exist sisteme speciale pentru fotografierea gelurilor
alctuite dintr-un transiluminator, o incint ntunecat nchis plasat
peste transiluminator i o camer foto. Sistemul poate fi comandat direct
sau prin intermediul unui computer. Fotografia este vizualizat pe ecranul
camerei, pe un monitor ataat acesteia sau pe monitorul computerului,
putnd fi salvat i printat. Principalii productori de sisteme de achiziie
a imaginilor pentru laborator (Alpha Innotech Corp., UVP, Biorad, VilberLourmat) propun soluii tehnice diverse cu numeroase aplicaii
(fotografiere geluri agaroz, plci TLC, geluri SDS-PAGE, fluorescen)
la costuri variate. Pentru vizualizarea i fotografierea gelurilor de agaroz

Electroforeza ADN

169

n condiii optime, sistemul cel mai indicat din punct de vedere al


raportului cost/performan cuprinde: transiluminator UV, incint
ntunecat cu u pentru amplasarea gelului i manipulare uoar, camer
foto CCD dedicat cuplat la monitor i un sistem de salvare a
fotografiilor pe medii de stocare (carduri sau memorii USB).

Detecia ADN-ului folosind bromura de etidiu


Cea mai utilizat metod de evideniere a ADN-ului pe gelurile de
agaroz este cea care folosete colorantul bromur de etidiu (3), compus
care conine un sistem heterociclic plan care are proprietatea de a se
intercala ntre nucleotidele ADN-ului.
Principiul metodei:
Intercalarea bromurii de etidiu ntre catenele de ADN este aproape
independent de secvena de nucleotide, cantitatea de colorant fiind
dependent doar de lungimea fragmentului de ADN (o molecul de
bromur de etidiu la 2,5 pb (17). Compusul se aeaz perpendicular pe
axul dublului helix, realiznd legturi de tip van der Walls cu bazele
azotate de deasupra i de dedesubtul planului sistemului heterociclic.
Aceast poziie fix n zona hidrofob dintre perechile de baze ale
ADN-ului face ca bromura de etidiu legat de ADN s manifeste
fluorescen crescut fa de cea aflat n stare liber n soluie. Radiaia
UV cu lungimea de und de 254 nm este absorbit de ADN, iar cea cu
lungimea de und de 302 nm i 366 nm de ctre colorantul legat. Energia
absorbit este apoi emis sub form de radiaie la lungimea de und de
590 nm, n zona rou-portocaliu a spectrului (18).
Bromura de etidiu poate fi folosit att pentru detecia moleculelor
dublu catenare, ct i a celor monocatenare (ADN monocatenar sau
ARN). Intensitatea fluorescenei este mai mic n cazul moleculelor
monocatenare.
Exist dou abordri diferite referitoare la tehnica de colorare cu
bromur de etidiu:

Biologie molecular. Metode experimentale

170

a) introducerea bromurii de etidiu n gel sau n tamponul de


migrare ofer posibilitatea vizualizrii procesului de separare n timpul
electroforezei;
b) imersarea gelului de agaroz ntr-o soluie de bromur de etidiu.
Avantaje:
1. simplitate deosebit a metodei, costuri reduse;
2. limit de detecie bun.
Limitri:
contaminare puternic cu bromur de etidiu; colorantul se va regsi la
sfritul experimentului n geluri, n soluiile tampon folosite i va
contamina camerele de electroforez i transiluminatoarele utilizate.
Materiale necesare:
1. transiluminator UV cu lungimea de und de aproximativ 300 nm;
productorii consacrai (UVP, Bio-Rad, Stratagene) ofer incinte
speciale prevzute cu camere foto pentru vizualizarea i
fotografierea facil a gelului;
2. bromur de etidiu 10 mg/ml, soluie stoc se dizolv 1 g bromur
de etidiu n 100 ml ap distilat; soluia se pstreaz la ntuneric
timp nelimitat;
3. bromur de etidiu, soluie de lucru se diluez soluia stoc pentru
a obine o concentraie de 1 g/ml (15);
4. agitator orbital.

Electroforeza ADN

171

Mod de lucru:
Pentru evidenierea ADN-ului folosind bromura de etidiu, n
condiiile n care colorantul nu este ncorporat n gel, se parcurg
urmtoarele etape:
1. colorare dup finalizarea separrii electroforetice, gelul se
incubeaz sub agitare timp de 30 minute n 100 ml bromur de etidiu
(soluie de lucru);
2. decolorare gelul se menine timp de 30 minute n ap distilat,
sub agitare;
3. vizualizare gelul se amplaseaz pe transiluminator i se
fotografiaz.
Dac bromura de etidiu a fost ncorporat n gel, se poate trece
direct la etapa de vizualizare i fotografiere.
Expunerea pielii i ochilor la radiaii ultraviolet trebuie
redus la minimum, de aceea este obligatorie purtarea
ochelarilor de protecie (protecie complet pentru fa), a
mnuilor i a halatului n cazul n care se lucreaz cu
transiluminator deschis. De asemenea, n timpul
manipulrii gelului este indicat s se reduc timpul de
procesare a acestuia i s se evite atingerea altor suprafee
cu mnuile contaminate. Foarte frecvent sunt contaminate
tastatura computerului sau butoanele sistemului de
achiziie a imaginilor. Dac se urmrete izolarea unui
fragment de ADN din gel, este indicat s se reduc timpul
de expunere a acestuia la radiaii UV, reducndu-se riscul
de apariie a unor mutaii.

Detecia ADN-ului n geluri de agaroz folosind


colorani de tip SYBR
Datorit principalului inconvenient al bromurii de etidiu s-a ncercat
identificarea unor alternative mai puin periculoase. Astfel, au fost testai
o serie de colorani de tipul SYBR, care au capacitatea de a lega ADN-ul

Biologie molecular. Metode experimentale

172

dublu sau monocatenar, complexul format fiind fluorescent i permind


astfel vizualizarea ADN-ului pe geluri de agaroz sau chiar poliacrilamid.
Cei mai cunoscui colorani din aceast familie sunt:
SYBR Green I (SG) (comercializat de firma Invitrogen) prezint
un maximum de absorbie n lumin albastr (max = 497 nm) i emite
lumin verde (max = 522 nm);
SYBR Green II, (comercializat de firma Invitrogen) prezint un
maximum de absorbie la 497 nm i emite la 513 nm;
SYBR Gold (comercializat de firma Invitrogen) prezint un
maximum de absorbie la 495 nm i emite la 537 nm;
YO (Oxazole Yellow);
TO (Thiazole Orange);
PG (PicoGreen).
Avantaje:
principalul avantaj al coloranilor din familia SYBR este faptul
c sunt lipsii de efectele cancerigene;
coloranii din familia SYBR prezint o sensibilitate superioar
bromurii de etidiu; SYBR Green I este de 25-100 ori mai sensibil dect
bromura de etidiu pentru ADN dublucatenar, dar nu poate fi utilizat
pentru vizualizarea ARN-ului; SYBR Green II este de 5-10 ori mai
sensibil dect bromura de etidiu pentru ARN; SYBR Gold poate detecta
pn la 25 pg de ADN sau ARN (15).
Limitri:
-

cost mare de achiziie.

Mod de lucru:
Utilizarea acestor colorani presupune incubarea gelului dup
migrare n soluii diluate (1:10000) n soluie tampon de migrare timp de

Electroforeza ADN

173

15-40 minute. Nu este necesar decolorarea gelului. Valoarea maxim a


sensibilitii se atinge doar prin utilizarea unor filtre fotografice speciale.
Pentru vizualizri uzuale pot fi utilizate transiluminatoarele obinuite ce
funcioneaz la o lungime de und de 300 nm.

Detecia ADN-ului n geluri de agaroz folosind


albastrul de metilen
Dei colorarea cu bromur de etidiu genereaz cantiti mari de
deeuri periculoase, aceasta este preferat, n principal, datorit simplitii
i rapiditii. O metod alternativ de colorare, mai puin periculoas dar
mai elaborat i din acest motiv mai puin utilizat este metoda care
utilizeaz albastru de metilen. Acest colorant permite vizualizarea
fragmentelor de ADN direct n lumin vizibil, eliminnd astfel un alt
dezavantaj al bromurii de etidiu i anume necesitatea utilizrii radiaiilor
UV.
Avantaje:
1. albastrul de metilen nu este toxic;
2. gelul este vizualizat direct n spectrul vizibil evitndu-se astfel
pericolul arsurilor la care este expus cercettorul sau al mutaiilor
la nivelul ADN-ului manipulat;
3. simplitate i costuri reduse.
Limitri:
1. timp mai lung de incubare;
2. sensibilitate mai mic dect bromura de etidiu (250 ng/cm band)
(19);
3. unele tipuri de agaroz comercializate sunt incompatibile cu acest
sistem datorit colorrii intense a fondului.

Biologie molecular. Metode experimentale

174

Materiale necesare:
1. soluie tampon TAE 0,1X Tris 4 mM pH 8,3 corectat cu acid
acetic, EDTA 0,1 mM;
2. soluie albastru de metilen 0,002% n tampon TAE 0,1X;
3. agitator orbital;
4. transiluminator VIS i/sau sistem de fotografiere.
Mod de lucru:
1. datorit sensibilitii mai reduse, n gel trebuie ncrcat o
cantitate de 2 5 ori mai mare de ADN;
2. electroforeza se desfoar n condiiile obinuite descrise
anterior, pn cnd raportul dintre nivelurile colorantului inferior
i a celui superior indic separarea complet a fragmentelor de
interes;
3. dup ncheierea electroforezei gelul se transfer ntr-o cuv de
colorare coninnd cel puin cinci volume albastru de metilen
0,002% (pentru un gel de 50 ml sunt necesari aproximativ 250 ml
soluie albastru de metilen); se incubeaz la temperatura camerei
timp de 1-4 ore sau peste noapte la temperatura de 4oC;
4. decolorarea se realizeaz n soluie tampon TAE 0,1X, prin agitare
uoar pn se atinge nivelul dorit; tamponul trebuie schimbat cu
unul nou dup fiecare 30-60 minute;
5. gelul se plaseaz pe transiluminator sau pe o suprafa de culoare
alb i se fotografiaz.
Bibliografie:
1. Thorne, H. (1966) Electrophoretic separation of polyoma virus DNA
from host cell DNA, Virology, 29, 234-239.
2. Aaij, C. (1972) The gel electrophoresis of DNA, Biochimica et
Biophysica Acta (BBA) - Nucleic Acids and Protein Synthesis, 269,
192-200.

Electroforeza ADN

175

3. Sharp, P. A., Sugden, B., Sambrook, J. (1973) Detection of two


restriction endonuclease activities in Haemophilus parainfluenzae
using analytical agarose--ethidium bromide electrophoresis.,
Biochemistry, 12, 3055-63.
4. Sambrook, J. (2001) Molecular Cloning: A Laboratory Manual
(Sambrook, J., Ed.) third. ed, p 2.13-2.19. Spring Harbor
Laboratory Press.
5. Richard, R. J. (2004) Analysis of Genes and Genomes, p 89-98. John
Wiley&Sons.
6. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D., Seidman, J. G.,
Smith, J. A., Struhl, K. (2003) Current protocols in Molecular
Biology (Frederick M. Ausubel Roger Brent, et. al, Ed.), p 2.5-2.7.
John Wiley & Sons, Inc.
7. Norton, I. T., Goodall, D. M., Austen, K. R. J., Morris, E. R., Rees, D.
A. (1986) Dynamics of molecular organization in agarose
sulphate, Biopolymers, 25, 1009-1029.
8. Hirkpareik, F. H. (1990) Overview of agarose gel properties, Curr.
Commun. Cel. Mol. Biol, .1, 9-22.
9. Calladine, C. R., Collis, C. M., Drew, H. R., Mott, M. R. (1991) A
study of electrophoretic mobility of DNA in agarose and
polyacrylamide gels., Journal of Molecular Biology, 221, 981-1005.
10. Hervet, H., Bean, C. P. (1987) Electrophoretic mobility of lambda
phage HIND III and HAE III DNA fragments in agarose gels: a
detailed study., Biopolymers, 26, 727-42.
11. Slater, G. W., Mayer, P., Drouin, G. (1996) Migration of DNA
through gels, Methods in Enzymology,270, 272-295.
12. Lalande, M., Noolandi, J., Turmel, C., Rousseau, J., Slater, G. W. (1987)
Pulsed-field electrophoresis: application of a computer model to
the separation of large DNA molecules., Proceedings of the National
Academy of Sciences of the United States of America, 84, 8011-5.
13. Schwartz, D. C., Cantor, C. R. (1984) Separation of yeast
chromosome-sized DNAs by pulsed field gradient gel
electrophoresis., Cell, 37, 67-75.
14. McDonell, M. W., Simon, M. N., Studier, F. W. (1977) Analysis of
restriction fragments of T7 DNA and determination of molecular
weights by electrophoresis in neutral and alkaline gels., Journal of
Molecular Biology, 110, 119-46.
15. Armstrong, J. A., Schulz, J. R. (2008) Agarose Gel Electrophoresis
in Current Protocols Essential Laboratory Techniques (Gallagher,

176

Biologie molecular. Metode experimentale

S., Wiley, E., Eds.), p 00:7.2.1-7.2.20. John Wiley & Sons, Inc.,
Hoboken, NJ, USA.
16. Sambrook, J., Fritsch, E., Maniatis, T. (1989) Molecular Cloning - A
Laboratory Manual, p 6.3-6.6. Cold Spring Harbour Laboratory
Press.
17. Waring, M. J. (1965) Complex formation between ethidium bromide
and nucleic acids, Journal of Molecular Biology, 13, 269-282.
18. LePecq, J. B., Paoletti, C. (1967) A fluorescent complex between
ethidium bromide and nucleic acids. Physical-chemical
characterization., Journal of Molecular Biology, 27, 87-106.
19. Ogden, R. C., Adams, D. A. (1987) Electrophoresis in agarose and
acrylamide gels., Methods in Enzymology, 152, 61-87
20. Green, S.J., Leigh, M.B., Neufeld, J. D. (2009) Denaturing gradient
gel electrophoresis (DGGE) for microbial community analysis, in
Microbiology of Hydrocarbons, Oils, Lipids, and Derived Compounds
(Timmis, K. N., Ed.), p 4137-4158. Springer, Heidelberg, Germany.
21. Muyzer, G., de Waal, E. C., Uitterlinden, A. G. (1993) Profiling of
complex microbial populations by denaturing gradient gel
electrophoresis analysis of polymerase chain reaction-amplified
genes coding for 16S rRNA., Appl. Envir. Microbiol., 59, 695-700.
22. Muyzer, G., Smalla, K. (1998) Application of denaturing gradient gel
electrophoresis (DGGE) and temperature gradient gel
electrophoresis (TGGE) in microbial ecology, Antonie van
Leeuwenhoek. Springer Netherlands.
23. Gomes, N. C. M., Heuer, H., Schnfeld, J., Costa, R., MendonaHagler, L., Smalla, K. (2001) Bacterial diversity of the rhizosphere
of maize (Zea mays) grown in tropical soil studied by temperature
gradient gel electrophoresis, Plant and Soil. Springer Netherlands.
24. Casamayor, E. O., Schafer, H., Baneras, L., Pedros-Alio, C., Muyzer,
G. (2000) Identification of and Spatio-Temporal Differences
between Microbial Assemblages from Two Neighboring Sulfurous
Lakes: Comparison by Microscopy and Denaturing Gradient Gel
Electrophoresis, Applied and Environmental Microbiology, 66,
499-508.
25. Vainio, E. J., Hantula, J. (2000) Direct analysis of wood-inhabiting
fungi using denaturing gradient gel electrophoresis of amplified
ribosomal DNA, Mycological Research, 104, 927-936.
26. Dez, B., Pedrs-Ali, C., Marsh, T. L., Massana, R. (2001)
Application of denaturing gradient gel electrophoresis (DGGE) to
study the diversity of marine picoeukaryotic assemblages and
comparison of DGGE with other molecular techniques., Applied
and Environmental Microbiology,67, 2942-2951.

VIII. PURIFICAREA PROTEINELOR


PRIN CROMATOGRAFIE DE
AFINITATE FA DE METALE
nc de la nceputul dezvoltrii biochimiei ca tiin, unul dintre
domeniile fundamentale a fost izolarea i purificarea principiilor active.
Dintre acestea, proteinele i n special enzimele s-au bucurat de un interes
cu totul deosebit, purificarea lor fiind atractiv nu doar din punct de
vedere teoretic, ci i din punct de vedere practic, enzimele fiind privite ca
o alternativ simpl i extrem de eficient a catalizei chimice.
Proteinele se caracterizeaz printr-o variabilitate mare att a
structurii, ct i a proprietilor specifice. Din acest motiv a fost imposibil
pn acum s se realizeze un protocol de purificare valabil fr echivoc
pentru orice molecul proteic. Cunotinele acumulate n domeniul
purificrii proteinelor au permis cel mult conturarea unor reguli i
principii generale de urmat n scopul adaptrii unei metode de purificare
la proprietile fizico-chimice ale proteinei de interes.
Revoluia produs de tehnicile ADN-recombinat n biologia
molecular s-a resimit n domenii extrem de variate, printre care i cel al
purificrii proteinelor. Tehnicile de manipulare a ADN-ului permit acum
cercettorului s modifice secvena i implicit structura proteinei de
purificat pentru a-i conferi proprieti specifice care s faciliteze
purificarea. n acest sens, una dintre cele mai utilizate tehnici este cea care
se bazeaz pe ataarea la unul din capetele C sau N terminale ale proteinei
de interes a unei cozi cu afinitate pentru suporturi imobilizate. Aceast
coad are dimensiuni variate, putnd fi reprezentat fie de un ntreg
domeniu proteic, fie doar de un fragment de civa aminoacizi. Proteina
recombinat obinut va prezenta aceiai afinitate ca i coada pe care o
conine, putnd fi astfel purificat prin tehnici specifice (Tabelul 11).
Foarte intens utilizat pentru purificarea proteinelor este aa
numita coad poli-His, reprezentat printr-o polipeptid coninnd 6-8
reziduuri de histidin cu afinitate foarte mare pentru Ni2+ sau Co2+. Fa
de celelalte cozi proteice sau polipeptidice, polipeptida poli-His are
marele avantaj al dimensiunilor deosebit de mici.
Aceasta face ca modificrile aduse structurilor secundare i

Biologie molecular. Metode experimentale

178

teriare ale proteinei de purificat s fie minime i, drept urmare,


modificrile activitii enzimatice native a proteinei purificate s fie
extrem de reduse. Au fost semnalate i cazuri foarte rare n care coada are
un efect benefic, mrind activitatea proteinei (3). Dei nu foarte frecvent,
au fost raportate i situaii n care efectul este unul negativ, ducnd la
diminuarea activitii biologice (4).
TABEL 11. Domenii proteice i cozi polipeptidice de fuziune utilizate frecvent n
purificarea proteinelor recombinate (dup Terpe, 2003 i LaVallie,
2001) (1) (2)
Cozi de fuziune

Metod de purificare

Domenii proteice de fuziune


MPB1

Afinitate fa de amiloz

Glutation S-transferaza

Afinitate fa de glutation

Proteina A

Afinitate fa de IgG

Represorul lac

Afinitate fa de operatorul lac

GBP2

Afinitate fa de galactoz

Cozi polipeptidice de fuziune


Poli-His

IMAC3

Poli-Asp

Cromatografie pe rini anionice

Poli-Arg

Cromatografie pe rini cationice

Poli-Cys

Afinitate pentru grupri tiolice

Strep-tag II

Afinitate
pentru
streptavidin

avidin

sau

1MBPengl.

Maltose-Binding Proteine
GBP engl. Galatose-Binding Protein
3 IMAC cromatografie de afinitate pentru metale imobilizate (engl.
Immobilized Metal Affinity Chromatography)
2

Tehnica de purificare care se bazeaz pe coada polipeptidic


poli-His a fost descris pentru prima dat n anul 1975 de Porath et al.(5)
i se bazeaz pe afinitatea pentru metalele tranziionale pe care aceast
coad o confer proteinelor recombinate. Denumirea metodei este este

Purificarea proteinelor prin IMAC

179

cromatografie de afinitate pentru metale imobilizate (engl.Immobilized


Metal Affinity Chromatography IMAC). ntreaga separare
cromatografic are la baz o matrice inert pe care sunt imobilizai ionii
unor metale tranziionale (Co2+, Cu2+, Zn2+ sau cel mai frecvent Ni2+).
Matricea suport este confecionat dintr-un material puternic hidrofil,
inert din punct de vedere chimic i rezistent la atacul microorganismelor.
Materialele cel mai frecvent utilizate pentru suportul cromatografic sunt
agaroza i Sephadex-ul sub forma unor fragmente sferice, rigide i
uniforme cu diametrul de 5-50 m. Pe acest suport se fixeaz covalent o
grupare ce are proprietatea de a chelata ionul metalic. Prima grupare
chelatant descris a fost acidul nitrilotriacetic (NTA), grupare ce este
utilizat foarte frecvent i astzi. NTA are 4 situsuri de coordinare i poate
astfel lega foarte puternic ionii metalelor tranziionale. Suportul
cromatografic cunoscut comercial sub denumirea de Ni-NTA se obine
prin imobilizarea ionilor Ni2+ pe NTA. Prin legarea sa de matricea inert,
ionul Ni2+ i ocup patru din cele ase valene, celelalte dou valenele
rmase libere putnd interaciona cu inelul imidazolic al resturilor de
histidin de pe catena polipetidic sau de pe coada poli-His. Modul n
care au loc interaciunile specifice prin care polipeptida se fixeaz de
ionul metalic, iar acesta de matrix, este prezentat n Figura 23. De notat
este faptul c aceste interaciuni sunt independente de structura
tridimensional a proteinei recombinante, astfel nct tehnica permite
purificarea proteinelor att n form nativ ct i a n form denaturat.
Mecanismul prin care are loc purificarea propriu-zis a proteinelor
de fuziune cu His-tag presupune contactul extractului acelular ce conine
proteina recombinat cu Ni-NTA. n mod natural, proteinele native au
afinitate relativ redus pentru nichel i nu se vor lega de Ni-NTA, pe cnd
proteina cu His-tag care are afinitate puternic pentru ionii acestui metal
se va lega foarte puternic. Complexul matrice-Ni-NTA-protein
recombinat este unul destul de stabil, ceea ce permite splarea succesiv
cu soluii tampon pentru eliminarea tuturor impuritilor de pe coloan.
Prin aplicarea unei soluii coninnd chelatani puternici ai Ni2+ (precum
imidazolul), complexul matrice-Ni-NTA-protein recombinat este
destabilizat prin ruperea legturilor metal-protein recombinat, astfel
nct aceasta din urm este eluat de pe coloana cromatografic n stare
pur.

Biologie molecular. Metode experimentale

180

Protein

Ni-NTA

Matrice
inert
FIGURA 23. Interaciunile dintre partenerii complexului matrice-Ni-NTA-protein
ce stau la baza cromatografiei de afinitate pentru metale imobilizate (IMAC)
Spacer

Purificarea unei proteine recombinate prin IMAC presupune


parcurgerea a trei etape distincte:
1. clonarea genei care codific proteina de interes n vectori de expresie
specifici permite nu doar modificarea secvenei de aminoacizi a
proteinei
de
interes
n
scopul
introducerii
cozii
poli-His, ci i expresia ei controlat n organisme gazd specifice
(cel mai frecvent E. coli);
2. identificarea condiiilor optime de supraexpresie a proteinei
recombinate n organismul gazd i testarea solubilitii acesteia
supraexpresia n organisme gazd, altele dect cel din care provine
proteina de interes, permite acumularea acesteia i obinerea unui un
randament de purificarea bun; dezavantajul este c, uneori, pot aprea
probleme privind stabilitatea i mai ales solubilitatea proteinei de
interes; din acest motiv este esenial o etapa de selecie a condiiilor
optime de expresie;
3. expresia i purificarea propriu-zis nfuncie de solubilitatea
proteinei int, purificarea prin IMAC se poate realiza n condiii
native sau n condiii denaturante; n acest ultim caz, dup purificare,
este necesar introducerea unei etape suplimentare de repliere a
proteinei n forma sa nativ.
n cele ce urmeaz sunt prezentate fiecare dintre aceste trei etape,
fiind detaliat ns doar metoda de purificare propriu-zis.

Purificarea proteinelor prin IMAC

181

VIII.1 Strategii de clonare a genelor n vectori de


expresie
Dup Twyman, 1999 (6), procesul de clonare reprezint, n sens
larg, o tehnic ce are drept scop producerea mai multor copii dintr-un
fragment ADN de interes. Aceast amplificare se poate realiza n dou
moduri, in-vitro prin sintez chimicenzimaticutiliznd reacia PCR i
in-vivo utiliznd sistemele enzimatice ale unor organisme gazd specifice
(7).
Dup unii autori ns termenul de clonare implic introducerea
unui fragment de ADN dintr-o surs ntr-o molecul acceptoare care
provine dintr-o alt surs cu obinerea unei molecule ADN recombinate
(8). De aceea, n mod uzual, noiunea de clonare este mai degrab
rezervat pentru desemnarea procesului desfurat in-vivo n urma cruia
se obine o molecul de ADN-recombinat, iar cea de amplificare este
utilizat pentru procesul enzimatic desfurat in-vitro.
Clonarea unui fragment de ADN (ADN genomic, ADN
complementar rezultat prin revers-transcrierea ARN-ului mesager sau un
fragment sintetizat chimic) este un proces care const n parcurgerea a
patru etape distincte (6):
1. construirea unui vector recombinat ce conine fragmentul ADN de
interes;
2. introducerea vectorului recombinat ntr-o gazd potrivit;
3. propagarea selectiv a vectorului recombinat;
4. extracia i purificarea ADN-ului plasmidial.
Indiferent de sursa din care provine fragmentul ADN care trebuie
clonat, principiul ce guverneaz obinerea de molecule recombinate este
acelai i se refer la fragmentarea moleculei ADN n vederea separrii
regiunii de interes i introducerea ei n molecula acceptor. Fragmentarea
se poate realiza mecanic, chimic sau enzimatic. Primele dou metode nu
ofer un control strict asupra dimensiunilor fragmentelor obinute,
utilizarea enzimelor de restricie fiind preferat datorit specificitii
foarte mari a acestora.
Enzimele de restricie sunt endonucleaze produse de bacterii care
au capacitatea de a cliva ambele catene ale moleculei de ADN la nivelul
unor secvene specifice de patru pn la opt perechi de baze (numite situsuri de restricie) (9). Nu numai situs-ul de clivare, dar i modul de clivare

182

Biologie molecular. Metode experimentale

este specific i aceasta duce la apariia a dou tipuri de capete. n situaia


n care clivarea se realizeaz pe ambele catene n aceeai poziie dini
nteriorul situs-ului de restricie, cele dou catene se vor sfri la acelai
nivel, iar captul rezultat poart numele de capt drept. Dac clivarea se
realizeaz n situs-uri diferite pe cele dou catene, capetele formate vor
avea cele dou catene de lungimi diferite. Una dintre catene va fi mai
lung i va expune deci nucleotide nemperecheate spre exterior. Dac
dou fragmente de ADN au la capt o caten mai lung cu aceeai
secven, fragmentele se pot asocia prin formarea unor legturi de
hidrogen. Din acest motiv capetele poart numele de capete coezive.
Legturile formate menin moleculele n contact i permit aciunea
ligazelor. Aceste enzime au capacitatea de a reface legtura
fosfodiesteric i continuitatea catenelor. n acest fel, fragmentul de
interes este sudat n molecula acceptoare, obinndu-se molecula
recombinat.
Aceste dou tipuri de enzime sunt foarte importante n procesul de
clonare, procedur ce este imposibil fr un control foarte bun al tierii
i refacerii catenei polinuclotidice. Poate la fel de important este i
alegerea judicioas a unei molecule n care s se cloneze fragmentul de
interes. Cel mai frecvent pentru aceasta se utilizeaz vectori de clonare ce
trebuie s ndeplineasc cel puin patru condiii:
1. s nu se integreze n genomul gazdei astfel nct s poat fi uor
separat de cromozomul bacterian;
2. s se replice autonom de cromozomul bacterian ntr-un numr
mare, facilitnd astfel amplificarea moleculei pe care o poart;
3. s permit selecia uoar a celulelor care conin vectorul prin
comparaie cu cele care nu l conin;
4. s conin situs-uri de restricie care s uureze procesul de
clonare (10).
O lista cu cei mai importani vectori plasmidiali care pot fi utilizai
n clonarea i expresia genelor, alturi de proprietile specifice ale
acestora, sunt prezentate n sub-capitolul III.1 Vectori plasmidiali
utilizai frecvent n ingineria genetic, pagina 59.
Avnd la dispoziie aceste elemente, cea mai simpl strategie de
clonare const din digestia vectorului i fragmentului de interes cu aceeai
enzim de restricie, ceea ce duce la obinerea de capete coezive
compatibile care pot fi ligate. Abordarea poart numele de clonare oarb,
deoarece nu ofer un control foarte strict al orientrii fragmentului n
vector i de asemenea, vectorul se poate foarte uor re-circulariza fr a

Purificarea proteinelor prin IMAC

183

prelua fragmentul de clonat. Clonarea oarb este una dintre primele


strategii de clonare dezvoltat i foarte intens utilizat care, treptat, prin
identificarea unui numr din ce n ce mai mare de enzime de restricie a
fost nlocuit de aa-numita clonare direcionat. Aceasta presupune
utilizarea a cel puin dou enzime pentru digestia fragmentului i
vectorului (10). Prin digestia vectorului cu dou enzime de restricie
diferite care genereaz capete incompatibile, recircularizarea vectorului
este mpiedicat. Deoarece fragmentul este tiat cu aceleai dou enzime,
el va putea fi ligat n vector i doar astfel se poate realiza recircularizarea
acestuia i obinerea moleculei ADN recombinate. Legarea este de aceast
dat strict coordonat prin alegerea enzimelor de restricie.
O metod foarte frecvent utilizat pentru izolarea fragmentului
ADN de clonat este amplificarea prin reacia PCR. Pe lng rapiditate i
simplitate, aceast metod are de asemenea avantajul c permite
introducerea de situs-uri de restricie noi prin folosirea deprimeri
degenerai.Alegerea enzimelor de restricie i localizarea acestor situs-uri
de restricie pe primer trebuie s se fac innd cont de urmtoarele
elemente:
6. enzima s fie plasat n situs-ul de clonare multiplu al
plasmidului;
7. gena de clonat trebuie sa fie amplasat n situsul multiplu de
clonare n aa fel nct s respecte cadrul de lectur specific
vectorului pentru a permite expresia unei proteine recombinate;
8. s nlture ct mai mult din situs-ul multiplu de clonare pentru ca
proteina recombinat s fie ct mai puin modificat;
9. s taie o singur dat n fragmentul de clonat, n situs-ul dorit; un
program extrem de util pentru a analiza situs-urile de restricie
existente ntr-un fragment ADN dat i pentru a alege judicios
enzimele de restricie este NEBCutter (11).
Dup obinerea moleculei recombinate, aceasta trebuie introdus
n celula gazd. Dei exist specii care pot s accepte molecule de ADN
exogen n mod natural, E. coli nu este una dintre acestea (10). De aceea,
celulele de E.coli trebuie aduse ntr-o stare artificial de competen prin
aplicarea unui tratament chimic. Cea mai simpl metod a fost
descoperit n anul 1970 i const n utilizarea clorurii de calciu (7). Dup
realizarea transformrii, celulele care conin vectorul sunt selectate, cel
mai frecvent, prin utilizarea unor proprieti specifice codificate de ctre
acesta (de exemplu rezistena la antibiotice).

Biologie molecular. Metode experimentale

184

Principiul metodei
Fragmentul ADN este clivat n mod specific cu enzime de
restricie i ligat n vectorul de expresie pH5EX3. Amestecul de ligare
este n continuare folosit pentru transformarea celulelor competente de E.
coli. Celulele ce conin vectorul recombinat sunt selectate pe baza
rezistenei dobndite pentru ampicilin.
Avantaje:
1. clonarea unor fragmente cu dimensiuni de pn la 5 kb;
2. daca genele clonate sunt amplasate n cadrul de citire specific al
plasmidului, ele pot fi exprimate sub forma unor proteine
recombinate cu coada poli-His.
Limitri:
vectorul este utilizabil doar n E. coli; pentru clonare n alte
organisme gazd trebuie selectat un alt vector.
Materiale necesare:
1. vector plasmidial pH6EX3 purificat purificarea se poate
realizare prin utilizarea protocolului specific descris nsubcapitolul
IV.1 Izolarea ADN-ului plasmidial la pagina 75.
2. fragment ADN de clonat acesta trebuie s conin situs-urile de
restricie pentru enzimele de restricie ce urmeaz s fie utilizate;
dac fragmentul a fost izolat prin PCR este necesar purificarea lui
din amestecul de reacie folosind una din metodele descrise n
subcapitolul IV. 4 Izolarea ADN-ului din geluri de agaroz la
pagina 103 sau IV. 3 Purificarea ADN-ului din soluii apoase la
pagina 100;
3. ap distilat steril;

Purificarea proteinelor prin IMAC

185

4. enzime de restricie i tampon specific de reacie numeroi


distribuitori precum NEB sau Fermentas pun la dispoziie o gam
variat de enzime de restricie recombinate cu proprieti variate;
ideal este ca cele dou enzime de restricie alese s foloseasc
aceeai soluie tampon de reacie pentru a permite realizarea
simultan a reaciei de restricie; pentru mai multe detalii, se recomand manualul de utilizare disponibil pe site-ul productorului;
5. albumin seric bovin 10 g/l;
6. celule competente de E.coli XL1Blue pot fi obinute n laborator
folosind metoda cu CaCl2 descris de Sambrook (12) sau kit-ul
Roti-Transform, (Roth, Germania); exist de asemenea numeroi
distribuitori (Roth, NEB) care pun la dispoziie tulpini de E. coli
nalt competente;
7. kit de ligare rapid DNA ligation Kit (Roche) sau echivalent;
8. plci cu mediu LB suplimentat cu ampicilin 50 mg/ml;
9. hot steril cu flux de aer laminar.
Mod de lucru:
1. n dou microeprubete Eppendorf se prepar amestecurile de reacie n
vederea digestiei fragmentului de clonat i a vectorului plasmidial
pH5EX3, urmnd indicaiile de mai jos:
Reactiv
Tampon de reacie specific, livrat cu enzima de
restricie
Albumin seric bovin 10 g/l
Soluie ADN (fragment de clonat sau vector, dup caz)
Enzim 1*
Enzim 2*
Ap steril

Volum
2,5 l
2,5 l
10-20 l
1 l
1 l
pn la 25 l

* n cazul n care cele dou enzime au condiii optime de reacie diferite, se


realizeaz o digestie secvenial; dup aciunea primei enzime, fragmentul tiat
este purificat prin electroforez n gel de agaroz i este supus unei noi reacii de
restricie cu cea de-a doua enzim.

186

Biologie molecular. Metode experimentale

2. se incubeaz amestecul de reacie timp de patru ore la temperatura


indicat de productor (n general, 37oC);
3. se separ fragmentul de clonat i respectiv vectorul liniarizat din
amestecul de reacie prin electroforez n geluri de agaroz, dup care se
purific prin extragerea din gel urmnd protocolul descris n subcapitolul
IV. 4 Izolarea ADN-ului din geluri de agaroz la pagina 103;
4. urmnd indicaiile productorului trusei de reactivi pentru ligare Rapid
DNA ligation Kit (Roche), se realizeaz ligarea fragmentului n vector;
este indicat ca raportul dintre concentraia fragmentului de clonat i a
vectorului s fie de 1:3;
5. dup ligare, amestecul de reacie poate fi utilizat direct pentru
transformare; astfel, 200 l celule preparate dup indicaiile
productorului (Roti-Transform, Roth, Germania) se combin cu 10 l
amestec de ligare i se incubeaz pe ghea timp de 30 minute;
6. amestecul de transformare se etaleaz pe plcile cu mediu LB i
ampicilin prenclzite la 37oC; dup uscarea complet a mediului n
exces, se incubeaz peste noapte la 37oC; prezena plasmidului pH6EX3
va determina rezistena microorganismului la antibioticul mai sus
menionat, astfel nct doar celulele care poart plasmidul se vor dezvolta;
7. coloniile obinute se verific prin secveniere pentru a confirma
prezena fragmentului inserat n mod corect n situsul multiplu de clonare.

VIII.2 Identificarea condiiilor optime de


supraexpresie a proteinelor recombinate
De departe cel mai folosit sistem pentru supraexpresia i obinerea
proteinelor recombinate este bacteria E. coli, datorit faptului c necesit
pentru cultivare o dotare foarte simpl i medii de cultur relativ ieftine.
Supraexpresia unei proteine recombinate n E. coli este strict
dependent de vectorii plasmidiali de expresie. Gena clonat n aceti
vectori este pus sub controlul unui promotor puternic ce permite o
verificare foarte strict a intensitii i momentului expresiei. Cei mai
importani promotori utilizabili n Escherichia coli sunt lac, taci lacUV5
din sistemul T7 (13); mai multe detalii legate de avantajele i
dezavantajele fiecruia pot fi gsite n lucrarea lui Makrides (1996) (14).

Purificarea proteinelor prin IMAC

187

Un promotor corespunztor este absolut necesar, dar i suficient


pentru a asigura un nivel bun de expresie al unei proteine exogene. Ali
factori ce influeneaz nivelul de expresie al unei proteine recombinate n
E. coli sunt:
1. existena unui semnal de terminare a transcripiei eficient, ce
asigur o mai mare stabilitate a ARN-ului mesager;
2. procesele de proteoliz. E. coli prezint numeroase sisteme
proteazice localizate n citoplasm, periplasm sau asociate cu
membranele extern i intern care au rolul de a inactiva proteinele
exogene (15). Utilizarea unor tulpini de E. coli modificate genetic precum
BL21, alturi de cultivarea la temperaturi sczute, fuzionarea cu o
protein cunoscut ca fiind stabil, fuzionarea cu o secven ce dirijeaz
proteina de interes spre spaiul periplasmic unde exist un numr mai mic
de proteaze sunt cteva abordri care pot fi utilizate pentru a diminua
neajunsurile fenomenelor de proteoliz (8).
E. coli este un organism procariot i din acest motiv utilizarea sa
pentru producerea de proteine exogene prezint o serie de dezavantaje.
Celulele de E. coli nu pot procesa introni, nu pot realiza modificri
post-transcripionale complexe, precum glicozilarea, miristilarea,
fosforilarea, nu pot forma un numr mare de puni disulfidice i nu
prezint sistemele specifice de tip chaperones necesare asamblrii
moleculelor multimere (14). ansele de obinere a unei proteine cu
structur tridimensional normal, nativ atunci cnd este supraexprimat
n E. coli cresc dac:
1. organismul din care provine gena clonat este mai apropiat
filogenetic de E. coli;
2. proteina are mas molecular redus, mai mic de 70 kDa;
3. nu are resturi de cistein libere;
4. nu are mai mult de 3-4 puni disulfidice intramoleculare;
5. nu necesit modificri posttranscripionale pentru activitate sau
solubilitate (16).
n general, pentru a mri randamentul de purificare i pentru a
obine rapid cantiti mari de protein pur este de dorit ca gena clonat s
fie exprimat ct mai puternic. Prin utilizarea unor promotori puternici
precum tac sau lac, nivelul de expresie atins este ridicat i poate duce la
destabilizarea ntregului mecanism de sintez proteic a celulei
bacteriene. Ca msur de aprare, celulele de E. coli depoziteaz proteina
supraexprimat sub forma unor aa numii corpi de incluziune. Acetia
reprezint aglomerri masive cuprinznd, n general, o singur protein

188

Biologie molecular. Metode experimentale

inactiv, depliat (17). Recent s-a demonstrat c, de fapt, deplierea nu este


total, ci proteina pstreaz un anumit grad de organizare a structurii
secundare (18).
Esenial pentru producerea proteinelor recombinate n E. coli este
realizarea unui echilibru ntre intensitatea expresiei i solubilitatea
acestora. Acest echilibru poate fi controlat prin variaia unor parametri de
cultivare a microorganismului precum:
temperatura de cultivare temperaturi mai joase frneaz
metabolismul microorganismului i asigur nivele de expresie mai
reduse; n general, se pornete de la temperatura de 35oC i se
coboar gradual cu cte 2-3oC pn la valoarea de 20oC; odat cu
reducerea temperaturii perioada de incubare va trebui prelungit;
nivelul de agitare n timpul cultivrii agitarea poate s
influeneze solubilitatea proteinei supraexprimate prin nivelul de
aerare al culturii care, la rndul su, influeneaz viteza sintezei
proteice; n general, se utilizeaz o vitez de rotaie de 190 rpm
care poate fi diminuat, dup caz, pn la 90 rpm;
nivelul de inducere a expresiei este controlat prin concentraia de
agent inductor adugat n mediu; pentru promotorii lac i tac
agentul inductor este un derivat artificial al lactozei, izopropil
-D-1-tiogalactopiranozid sau prescurtat IPTG (19); cel mai
frecvent, concentraia de IPTG utilizat n mediul de cultur este
1 mM, dar aceasta poate fi redus pn la 10 M;
compoziia mediului de cultur adugarea n mediul de cultur a
unor ageni care produc stres osmotic precum sorbitol sau betain
poate conduce n unele cazuri la mbuntirea solubilitii unor
proteine exprimate sub form de corpi de incluziune (20); de
asemenea, s-a demonstrat c utilizarea unui mediu autoinductibil
poate mbunti foarte mult nivelul de expresie i solubilitatea
unor proteine dificil de exprimat (21)(22).
tulpina de E. coli utilizat distribuitori precum NEB, Fermentas
sau Roche ofer o gam variat de tulpini de E. coli modificate
special pentru a permite expresia proteinelor exogene; astfel,
tulpinaBL21 (DE3) este recunoscut ca fiind mai indicat pentru
producerea de proteine recombinate dect XL1 Blue.

Purificarea proteinelor prin IMAC

189

Principiul metodei:
Tulpina purtnd vectorul de expresie recombinat este cultivat
pn n faza de cretere exponenial, dup care se adaug IPTG n mediu
pentru inducerea expresiei genei clonate. Dup patru ore de cultivare,
celulele sunt separate de mediul de cultur prin centrifugare i lizate prin
sonicare. Lizatul celular, alturi de extractul proteic acelular obinut prin
centrifugare sunt apoi analizate prin SDS-PAGE pentru evaluarea
nivelului de solubilitate a proteinei exprimate. Lipsa benzii
corespunztoare proteinei recombinate n extractul proteic acelular indic
faptul c aceasta este insolubil.
Avantaje:
1. permite evaluarea nivelului de supraexpresie a unei proteine
recombinate;
2. permite evaluarea solubilitii unei proteine recombinate n
condiii de cultivare date.
Limitri:
sistemul de detecie descris n metoda prezentat nu este
aplicabil pentru proteine al cror nivel de expresie este extrem de sczut
(proteina recombinat nu este vizibil pe geluri SDS-PAGE); n acest caz
se recomand utilizarea unui alt sistem de detecie de exemplu tehnica
Western-Blot (pentru detalii consultai capitolul XI. Evidenierea
imunologic a proteinelor tehnica Western-Blot, pagina 273).
Materiale necesare:
1. plac Petri coninnd tulpina E. coli BL21 n care a fost introdus
plasmidul pH6EX3 cu gena clonat;
2. mediu LB steril cu ampicilin 50 mg/ml, 2 flacoane Erlenmeyer

Biologie molecular. Metode experimentale

190

3.
4.

5.
6.
7.
8.
9.

de 500 ml cu cte 100 ml mediu i o eprubet de 50 ml cu 10 ml


mediu;
IPTG 1 M steril se cntresc 2,38 g IPTG i se dizolv n 10 ml
ap distilat; soluia se sterilizeaz prin filtrare, se mparte n
volume de cte 1 ml i se pstreaz la temperatura de -20oC;
soluie tampon HEPES 40 mM, NaCl 500 mM, pH 7,4 pentru
prepararea unui litru de soluie tampon, ntr-un cilindru gradat de
1L se dizolv n 500 ml ap distilat 9,52 g HEPES i 29,2 g
NaCl; se ajusteaz pH-ul la 7,4 dup care se aduce la 1000 ml cu
ap distilat; se pstreaz la temperatura de 4oC termen nelimitat;
hot steril cu flux de aer laminar;
incubator termostatat cu agitare, GFL Mini Incubator 4010 sau
echivalent;
sonicator Sonics Vibra Cell V505 sau echivalent;
centrifug cu rcire;
spectrofotometru i cuve de spectrofotometrie.

Mod de lucru:
1. se inoculeaz cei 10 ml mediu LB care conine ampicilin 50
mg/ml cu o singur colonie de E. coli de pe placa Petri;
2. eprubeta cu mediu inoculat se incubeaz peste noapte la 37oC sub
agitare (190 rpm);
3. 1 ml din cultura bacterian obinut se folosete pentru inocularea
celor dou flacoane Erlenmeyer cu 100 ml mediu LB suplimentat
cu ampicilin 50 mg/ml; flacoanele se incubeaz la 37oC i 190
rpm pn cnd densitatea optic a culturii la 600 nm atinge o
valoare cuprins n intervalul 0,7-1; n general, aceast condiie
este ndeplinit dup 2-3 ore de cultivare;
4. se induce expresia proteinei clonate prin adugarea n unul din
flacoane a 100 l IPTG 1 M; cantitatea de IPTG poate varia, fiind
unul dintre parametrii care trebuie stabilii pentru optimizarea
expresiei; cel de-al doilea flacon rmne neindus i reprezint
controlul procesului de expresie;

Purificarea proteinelor prin IMAC

191

5. flacoanele se incubeaz timp de 1-4 ore la 35oC i 190 rpm; timpul


de incubare i temperatura i viteza de agitare pot fi variate pentru
mbuntirea expresiei proteinei;
6. celulele se separ din mediul de cultur prin centrifugare la
4400xg, timp de 10 minute, la temperatura de 4oC dup care se
resuspend n cte 10 ml soluie tampon HEPES 40 mM, NaCl
500 mM, pH 7,4; dac celulele nu sunt procesate imediat, ele pot
fi pstrate la temperatura de -20oC pentru o perioad
nedeterminat;
7. celulele se lizeaz prin sonicare, de dou ori cte 2 minute, puls o
secund, pauz o secund, putere 40%;
8. din lizatul celular obinut se pstreaz 100 l i restul se clarific
prin centrifugare la 14.000rpm, 30 min, 4oC; extractul clar obinut
reprezint extractul proteic acelular;
9. att lizatul celular ct i extractul proteic acelular se analizeaz
prin SDS-PAGE pentru cuantificarea nivelului de expresie i
solubilitii proteinei supraexprimate; pentru detalii privind SDSPAGE i cuantificarea gelurilor consultai metodele prezentate n
cadrul capitolului X. Separarea electroforetic a proteinelor,
pagina 241; n general, proteina supraexprimat este uor de
identificat datorit nivelului de expresie foarte mare (Figura 24);
n cazul n care nu este uor reperabil, se vor analiza comparativ
fraciile proteice din lizatul celular corespunztor culturii induse
cu IPTG i a celei neinduse.

Biologie molecular. Metode experimentale

192

M 1

A
B

FIGURA 24. Evaluarea expresiei i solubilitii unor proteine recombinate n


Escherichia coli.

A proteina recombinat este puternic exprimat, dar se acumuleaz sub form


de corpi de incluziune; B proteina recombinat este puternic exprimat i este
solubil; M marker de mas molar; 1 lizat celular neindus cu IPTG; 2 extract
proteic acelular neindus cu IPTG; 3 lizat celular indus cu IPTG; 4 extract
proteic acelular indus cu IPTG

VIII.3 Purificarea prin IMAC a proteinelor


recombinate n condiii native
Principiul metodei
Proteinele recombinate coninnd 6-8 resturi consecutive de
histidin la unul din capete (C sau N terminal) sunt supra-exprimate n
Escherichia coli i purificate folosind un suport cromatografic ce conine
ioni Ni2+ imobilizai.

Purificarea proteinelor prin IMAC

193

Avantaje:

permite purificarea unor cantiti de protein de ordinul


miligramelor;

permite obinerea unui nivel de puritate foarte mare (90-95%) prin


aplicarea unei singure etape de cromatografie;

proteinele purificate au structura tridimensional nativ i funcia


intacte.

Limitri:
1. pentru a mri afinitatea cozii poli-His fa de Ni2+, faza mobil
are un coninut relativ mare de NaCl ceea ce poate duce la
precipitarea unor proteine solubile prin fenomenul de saltingout(23);
2. eluia se realizeaz cu imidazol n concentraii relativ mari
(200-500 mM) ceea ce poate duce la precipitarea proteinei
izolate; de asemenea, imidazolul este un puternic inhibitor al
unor enzime precum monoamin-oxidazele (24); datorit
capacitii sale de absorbie la 280 nm, imidazolul nu permite
msurarea concentraiei proteinelor prin spectrofotometrie
UV-VIS.
Materiale necesare:
1. plac Petri coninnd tulpina E. coli BL21 n care a fost introdus
plasmidul pH6EX3 cu gena clonat;
2. mediu LB steril suplimentat cu ampicilin 50 mg/ml, dou
flacoane Erlenmayer de 5L cu 1000 ml mediu i o eprubet de
50 ml cu 10 ml mediu;
3. IPTG 1 M steril se cntresc 2,38 g IPTG i se dizolv n 10 ml
ap distilat; soluia se sterilizeaz prin filtrare, se mparte n
volume de cte 1 ml i se pstreaz la temperatura de -20oC;
4. soluie tampon HEPES 40 mM, NaCl 500 mM, pH 7,4; pentru

194

Biologie molecular. Metode experimentale

prepararea unui litru de soluie tampon, ntr-un cilindru gradat de


1L se dizolv n 500 ml ap distilat 9,52 g HEPES i 29,2 g
NaCl; se ajusteaz pH-ul la 7,4 dup care se aduce la 1000 ml cu
ap distilat; se pstreaz la 4oC timp nelimitat;
5. hot steril cu flux de aer laminar;
6. incubator termostatat cu agitare GFL Mini Incubator 4010 sau
echivalent;
7. sonicator Sonics Vibra Cell V505 sau echivalent;
8. centrifug cu rcire;
9. spectrofotometru i cuve de spectrofotometrie;
10. suport cromatografic Ni-NTA Fast Flow sau High Performance Ni
Sepharose (Amersham Biosciences); suportul se pstreaz sub
forma unei suspensii 50% n etanol 20%. n general, suportul
cromatografic este livrat de productor gata de utilizare (culoare
verde) i poate fi reutilizat de cteva zeci de ori; nainte de
reutilizare, este recomandat eliminarea complet a ionilor de
nichel i rencrcarea cu nichel (regenerarea suportului
cromatografic); unii distribuitori pun la dispoziie coloane
cromatografice pre-mpachetate care pot fi utilizate fie manual, fie
cuplate la sisteme FPLC de genul AKTA (Amersham Biosciences,
Germania);
11. soluii pentru regenerarea i ncrcarea suportului cromatografic
cu Ni:
soluie EDTA 0,05 mM, NaCl 0,5 M se dizolv 1,4 g EDTA i
2,92 g NaCl n ap distilat i se aduc la 100 ml ntr-un balon
cotat;
soluie NaCl 0,5 M se dizolv 2,92 g NaCl n ap distilat i
se aduc la 100 ml ntr-un balon cotat;
soluie NaCl 1 M se dizolv 11,6 g NaCl n ap distilat i se
aduc la 100 ml ntr-un balon cotat;
soluie NaOH 1 M se dizolv 4 g NaOH n ap distilat i se
aduc la 100 ml ntr-un balon cotat;
soluie NiCl2 150 mM se dizolv 1,95 g NiCl2 (sau 3,5 g
NiCl2 x 6H2O) n ap distilat i se aduc la 100 ml ntr-un balon
cotat;
10. colonie din plastic sau sticl pentru cromatografie;
11. soluie stoc imidazol 1 M n HEPES 40 mM, NaCl 500 mM, pH
7,4 se dizolv 6,87 g imidazol n 50 ml HEPES 40 mM, NaCl
500 mM, pH 7,4; se corecteaz pH-ul dac este necesar i se aduce

Purificarea proteinelor prin IMAC

195

la 100 ml cu HEPES 40 mM, NaCl 500 mM, pH 7,4;


12. soluii pentru splri i eluie imidazol 10 mM, 40 mM, 80 mM,
200 mM i 500 mM n HEPES 40 mM, NaCl 500 mM, pH 7,4
soluiile pot fi preparate n prealabil, dar i extemporaneu, urmnd
indicaiile de mai jos:
Concentraie
imidazol
(mM)

Volum soluie
imidazol 1 M
(ml)

Volum HEPES
40 mM, NaCl
500 mM, pH
7,4.
(ml)

Volum final
(ml)

10

0,6

59,4

60

40

2,4

57,6

60

80

4,8

55,2

60

200

0,8

9,2

10

500

10

facultativ pomp peristaltic sau seringi din plastic de volum


mare (25-50 ml).

Mod de lucru:
I. Obinerea extractului proteic acelular:

se inoculeaz cei 10 ml mediu LB, 50 mg/ml ampicilin cu o


singur colonie de E. coli de pe placa Petri;

eprubeta se incubeaz peste noapte la 37oC i 190 rpm;

cultura bacterian obinut se folosete pentru inocularea


flaconului Erlenmayer cu 1L mediu LB, (50 mg/ml ampicilin);
flaconul se incubeaz la 37oC i 190 rpm pn cnd densitatea
optic a culturii la 600 nm atinge o valoare cuprins ntre 0,7-1; n
general aceast condiie este ndeplinit dup 2-3 ore de cultivare;

se induce expresia proteinei clonate prin adugarea n unul din


flacoane a 1 ml IPTG 1 M (sau cantitatea stabilit n etapa
anterioar);

Biologie molecular. Metode experimentale

196

flaconul se incubeaz timp de 1-4 ore la 35oC i 190 rpm;


celulele se separ din mediul de cultur prin centrifugare la
4400 x g timp de 10 minute la 4oC, dup care se resuspend n
50 ml soluie tampon HEPES 40 mM, NaCl 500 mM, pH 7,4; dac
celulele nu sunt procesate imediat, ele pot fi pstrate la
temperatura de -20oC pentru o perioad nedeterminat;
celulele se lizeaz prin sonicare de dou ori cte 2 minute, puls o
secund, pauz o secund, putere 40%; adugarea n etapa
anterioar a DN-azei I sau a benzoazei (1 g/ml) n soluia tampon
de resuspensie diminueaz foarte mult vscozitatea lizatului
celular;
lizatul celular obinut se clarific prin centrifugare la 14.000 rpm,
30 min, 4oC; supernatantul clar obinut reprezint extractul proteic
acelular.

II. Pregtirea coloanei cromatografice


Coloana cromatografic este reprezentat de o coloni din plastic sau
sticl n care este amplasat suportul cromatografic. n general, colonia are
dimensiuni mult mai mari dect volumul de suport cromatografic.
Splrile coloanei i separarea cromatografic propriu-zis se pot realiza
sub influena cmpului gravitaional sau, mai rapid, prin conectarea la
captul de evacuare a coloniei a unei pompe peristaltice sau a unei
seringi. Pentru pregtirea coloanei cromatografice se parcurg urmtoarele
etape:
se pipeteaz n colonia din sticl sau plastic un volum de 2 ml ap
i se marcheaz nivelul; volumul de 2 ml reprezint volumul
coloanei cromatografice (CV, engl. Column Volume). Capacitatea
de legare a Ni-NTA este de 5-10 mg protein/ ml Ni-NTA, deci un
volum de 2 ml permite purificarea unei cantiti de pn la 20 mg
protein;

dup evacuarea apei, se pipeteaz un volum de suspensie de rin


Ni-NTA suficient pentru ca, dup scurgerea etanolului 20%, rina
s se afle la nivelul marcat n etapa anterioar;

dac rina Ni-NTA este reutilizat, aceasta trebuie regenerat prin


splri succesive cu reactivii specificai n schema urmtoare:

Purificarea proteinelor prin IMAC

197

Soluie

Volum

EDTA 0,05 M, NaCl 0,5M*

10 x CV (20 ml)

NaCl 0,5M

2-3 x CV (4-6 ml)

NaCl 1 M**

1 x CV (2 ml)

NaOH 1 M

10 x CV (20 ml)

Etanol 70%

10 x CV(20 ml)

Ap distilat

10 x CV (20 ml)

NiCl2 150 mM

4 x CV (8 ml)

*suportul cromatografic trebuie s devin alb


soluie este meninut n contact cu coloana timp de 15-20 minute la
temperatura camerei
***suportul cromatografic trebuie s devin verde-albstrui la finalizarea acestei
etape
**aceast

11. dup regenerare sau dac rina este nou, aceasta se spal cu un
volum de 10 x CV (20 ml) ap distilat i se echilibreaz cu
aceeai soluie tampon n care au fost resuspendate celulele.
III. Separarea cromatografic propriu-zis:
1. este indicat ca toate operaiile descrise n cele ce urmeaz s fie
realizate la temperatura de 4oC. Dac acest lucru nu este posibil,
soluiile utilizate pentru purificare i cele ce conin proteina de
purificat vor fi meninute pe ghea.
2. extractul proteic acelular se pipeteaz n colonia din plastic, peste
rina Ni-NTA; viteza de curgere prin coloan trebuie s fie redus
i de aceea, dac se utilizeaz o pomp peristaltic, aceasta se
deconecteaz;
3. coloana se spal pentru eliminarea proteinelor legate nespecific
urmnd indicaiile din schema urmtoare:
Soluie

Volum

HEPES 40 mM, NaCl 500 mM, pH 7,4

30 x CV (60 ml)

Imidazol 10 mM n HEPES 40 mM, NaCl 500


mM, pH 7,4

30 x CV (60 ml)

Biologie molecular. Metode experimentale

198

Imidazol 40 mM n HEPES 40 mM, NaCl 500


mM, pH 7,4

30 x CV (60 ml)

Imidazol 80 mM n HEPES 40 mM, NaCl 500


mM, pH 7,4*

10 x CV (20 ml)

*este indicat colectarea i fracionarea efluentului din aceast etap deoarece


unele proteine mai slab legate sunt eluate la aceast concentraie de imidazol

4. eluarea proteinelor se realizeaz prin splarea cu 10 x CV


imidazol 200 mM i apoi 500 mM n HEPES 40 mM, NaCl 500
mM, pH 7,4; Efluentul se colecteaz n fraciuni de cte 1 ml i se
analizeaz n vederea determinrii coninutului de proteine prin
SDS-PAGE.
n mod obinuit o splare cu imidazol 200 mM este suficient pentru a
elua majoritatea proteinelor recombinate cu coad poli-His. Pentru a
prentmpina precipitarea i a facilita crio-conservarea probelor, este
indicat adugarea n eprubetele de colectare glicerol ntr-o concentraie
final de aproximativ 1%. Dac proteina purificat este instabil la
concentraii mari de sruri, imidazolul i NaCl din soluia tampon pot fi
eliminate prin dializ, utiliznd dispozitive centrifugale de tip Centricon,
sau cromatografie de filtrare prin gel. De asemenea, este indicat ca pe
parcursul purificrii s fie prelevate probe pentru a fi evaluate prin
SDS-PAGE.

VIII.4 Purificarea prin IMAC a proteinelor


recombinate n condiii denaturante
Principiul metodei
Proteinele recombinate ce conin 6-8 resturi consecutive de
histidin la unul din capete (C sau N terminal) supra-exprimate n
Escherichia coli sub form de corpi de incluziune sunt separate iniial
prin centrifugare i splri succesive dup care sunt solubilizate prin
folosirea unor ageni denaturani precum ureea. Chiar i n aceast form
denaturat, moleculele proteice recombinate au afinitate fa de Ni i pot

Purificarea proteinelor prin IMAC

199

fi purificate folosind un suport cromatografic ce conine ioni Ni2+


imobilizai.
Avantaje:
1. permite purificarea unor cantiti mari de protein, de ordinul
zecilor de miligrame;
2. permite obinerea unui nivel de puritate foarte ridicat (90-95%)
prin aplicarea unei singure etape de cromatografie.
Limitri:
1. proteinele purificate n aceste condiii sunt denaturate,
structura lor secundar este alterat i nu mai prezint funciile
fiziologice normale; aceste proteine pot fi utilizate pentru
obinerea de anticorpi sau pot fi repliate in-vitro; pentru mai
multe detalii despre acest proces recomandm consultarea
lucrrilor lui Li et al. (25), Surinder et Amulya (26) i Tsumoto
et al. (27).
Materiale necesare:
1. materiale de le punctele 1-12 din protocolul anterior;
2. soluie tampon de denaturare HEPES 40 mM, NaCl 500 mM,
guanidin-HC l6 M pentru prepararea a 1 L, ntr-un cilindru
gradat de 1 L se dizolv 9,52 g HEPES, 29,2 g NaCl i 570 g
guanidin-HCl; soluia se pstreaz la temperatura camerei timp
nelimitat; ca alternativ, drept agent denaturant se poate utiliza
ureea de concentraie 8 M.
3. reactivii de la punctele 13-14 din protocolul anterior se prepar n
acelai mod, dar n soluie HEPES 40 mM, NaCl 500 mM,
guanidin-HCl 6 M;
4. HEPES 40 mM, NaCl 500 mM, Triton X 10%.

200

Biologie molecular. Metode experimentale

Mod de lucru:
I. Solubilizarea corpilor de incluziune:
Se urmeaz etapele 1-8 din protocolul anterior. Supernatantul din
ultima etap se arunc, iar depozitul se spal cu n HEPES 40 mM, NaCl
500 mM, Triton X 10% de trei ori. Depozitul obinut dup ultima splare
se resuspend n soluie tampon de denaturare HEPES 40 mM, NaCl
500 mM, guanidin-HCl 6 M. Denaturarea proteinei duce la solubilizarea
corpilor de incluziune. Este indicat ca procesul s se realizeze lent, sub
agitare continu timp de cel puin patru pn la 24 ore. Dup solubilizare,
se centrifugheaz la 14.000rpm, 30 min. Supernatantul obinut conine
proteina recombinat solubilizat.
II. Pregtirea coloanei cromatografice i III. Separarea
cromatografic propriu-zis se realizeaz identic ca i n metodologia
descris pentru IMAC n condiii native, cu observaia c soluia tampon
HEPES 40 mM, NaCl 500 mM pH 7,4 este nlocuit cu soluia tampon
HEPES 40 mM, NaCl 500 mM, guanidin-HCl 6M n absolut toi
reactivii.

VIII. 5 Determinarea maselor moleculare native


utiliznd cromatografia de filtrare prin gel
(GF)
Datorit condiiilor denaturante folosite n SDS-PAGE, metoda de
determinare a masei moleculare relative descris n subcapitolul
Fotografierea gelurilor i analiza imaginilor. Stabilirea masei moleculare
relative, pagina 264, permite precizarea dimensiunilor unei catene de
aminoacizi. Deoarece, de cele mai multe ori o caten de aminoacizi este
n mod direct asociat cu o protein, masa molecular relativ a devenit
un parametru obligatoriu pentru caracterizarea unei asemenea molecule.
Masa molecular relativ nu surprinde ns moleculele proteice n
forma lor nativ, fiziologic normal. Mai mult dect att, unele proteine
au o structur multimer, fiind alctuite din dou sau mai multe catene
identice (proteine homomere) sau diferite (proteine heteromere) de

Purificarea proteinelor prin IMAC

201

aminoacizi. n cazul SDS-PAGE, aceste molecule sunt denaturate n


catenele componente i vor migra sub forma uneia (proteinele hemomere)
sau a mai multor benzi (proteinele heteromere). Masa molecular nativ
este un parametru care ncearc s surprind dimensiunile moleculelor
proteice n forma lor normal, nativ, putnd astfel s precizeze i starea
de oligomerizare a acestora. De-a lungul timpului a fost utilizat un numr
variat de metode de msurare a masei moleculare native, metode care au
la baz ultracentrifugarea, cromatografia sau metode de spectrometrie.
Cea mai simpl este ns metod cromatografic care are la baz
principiul de separare care presupuneexcluderea din gel n funcie de
dimensiuni(engl. size-exclusion). n funcie de mas, moleculele de
dimensiuni diferite vor fi reinute difereniat la traversarea unui gel cu
pori de dimensiuni fixe, astfel nct moleculele mari, care nu pot ptrunde
prin pori, vor avea un grad mai mic de reinere, n timp ce moleculele
mici vor ptrunde prin porii gelului i se vor ,,pierde, fiind astfel foarte
mult ntrziate. Dei discutm despre cromatografia de excludere din gel
n funcie de mas n strns corelaie cu moleculele proteice, tehnica este
aplicabil pentru o gam larg de molecule de dimensiuni variate. Pe
lng msurarea maselor, cromatografia de excludere din gel permite de
asemenea i desalinizarea i fracionarea extractelor proteice. Mai multe
detalii legate de aceste aplicaii pot fi gsite n excelenta lucrare
coordonat de Wu, 1999 (28).
Dac faza mobil este reprezentat de soluii apoase,
cromatografia de excludere din gel n funcie de dimensiuni poart
numele de filtrare prin gel (engl. Gel Filtration, GF), aceasta fiind
denumirea sub care metoda s-a consacrat n domeniul determinrii
maselor proteinelor.
Dotarea tehnic necesar pentru GF
n principiu, determinarea masei moleculare a unei proteine
utiliznd metoda de filtrare prin gel presupune aplicarea proteinei pe o
coloan cromatografic de gel-filtrare calibrat n prealabil i msurarea
timpului (sau volumul de faz lichid) necesar pentru ca proteina s
strbat coloana. Momentul elurii din coloan este detectat prin
fracionarea eluentului i analiza coninutului de proteine al fiecrei
fracii.
ntr-o coloan cromatografic de gel-filtrare, faza mobil parcurge
coloana sub influena gravitaiei, colectarea fraciilor fcndu-se manual.
Analiza coninutului de proteine a fiecrei fracii se realizeaz prin una

Biologie molecular. Metode experimentale

202

din metodele cunoscute (Bradford, Lowry sau spectrofotometrie


UV-VIS).
n ultimul timp se prefer ns conectarea coloanei cromatografice
la un sistem dedicat ce permite un control mult mai bun al debitului fazei
mobile i ofer de asemenea un sistem de detecie mult mai precis i mai
rapid. Cel mai simplu sistem cromatografic este alctuit din (Figura 25):
Pomp

Injector

Rezervor cu soluie M
faz mobil

C Coloan

Detector

R
Recorder

F
Colector de fracii
FIGURA 25. Sistem cromatografic automat utilizat pentru gel-filtrare (dup Hagel,
2001) (29)
1. rezervor cu soluie reprezentnd faza mobil (M) capacitatea
minim a rezervorului este dat de dimensiunile coloanei
cromatografice, fiind necesar ca acesta s conin suficient faz

Purificarea proteinelor prin IMAC

203

mobil pentru a permite echilibrarea coloanei i separarea


cromatografic propriu-zis;
2. pomp (P) are rolul de a asigura un debit constant n timpul
separrii; pentru GF este suficient o pomp peristaltic simpl,
deoarece presiunile atinse n coloan sunt mici; aplicaiile mai
complexe necesit o pomp cu piston sau chiar un sistem format
din dou sau patru pompe cu piston;
3. injector (I) este alctuit dintr-o valv i un rezervor de capacitate
cunoscut (cel mai frecvent sub forma unei spirale din tub transparent); proba de analizat se introduce n rezervor la nceputul separrii
i este injectat n coloan la momentul stabilit de utilizator;
4. coloana cromatografic (C) este elementul n care se realizeaz
propriu-zis separarea; coloanele cromatografice pentru gel-filtrare
pot fi achiziionate prempachetate i gata de utilizare sau pot fi
pregtite n laborator utiliznd suportul cromatografic dorit; n
alegerea suportului cromatografic i coloanei trebuie s se in
cont, n primul rnd, de intervalul de dimensiuni n care se afl
proteina investigat (Tabelul 12).
TABEL 12. Tipuri de suporturi cromatografice i coloane ce pot fi utilizate n gel
filtrare i intervalul de dimensiuni pe care pot fi utilizate (dup Hagel,
2001) (29)
Interval de
aplicabilitate (Da)

Productor/Distribuitor

Toyopearl HW 40S

100-10.000

Toso Haas

Superdex 30 prep grade

200-10.000

Amersham Pharmacia Biotech

Toyopearl HW 50S

500-80.000

Toso Haas

Sephacryl S-100 HR

1.000-100.000

Amersham Pharmacia Biotech

Toyopearl HW 55S

1.000-700.000

Toso Haas

Superdex 75 prep grade

3.000-70.000

Amersham Pharmacia Biotech

Sephacryl S-200 HR

5.000-250.000

Amersham Pharmacia Biotech

Superose 6 prep grade

5.000-5.000.000

Amersham Pharmacia Biotech

Superdex 200 prep grade

10.000-600.000

Amersham Pharmacia Biotech

Sephacryl S-300 HR

10.000-1.500.000

Amersham Pharmacia Biotech

Tip de suport
cromatografic/coloan
Suport cromatografic

Biologie molecular. Metode experimentale

204

Tip de suport
cromatografic/coloan

Interval de
aplicabilitate (Da)

Productor/Distribuitor

Sephacryl S-400 HR

20.000-8.000.000

Amersham Pharmacia

Sephacryl S-500 HR

20.000-30.000.000

Amersham Pharmacia Biotech

Toyopearl HW 65S

50.000-5.000.000

Toso Haas

HiLoad Superdex 30
prep grade

200-10.000

Amersham Pharmacia Biotech

TSK SW 2000

500-60.000

Toso Haas

HiLoad Sephacryl
S-100 HR

1.000-100.000

Amersham Pharmacia Biotech

TSK SW 3000

1.000-300.000

Toso Haas

Protein-Pak 60

2.000-30.000

Waters

Superdex 75 HR 10/30

3.000-70,.000

Amersham Pharmacia Biotech

HiLoad Superdex75
prep grade

3.000-70.000

Amersham Pharmacia Biotech

Bio-Sil SEC 125

5.000-100.000

Bio-Rad

G2000SWXL

5.000-150.000

Toso Haas

HiLoad Sephacryl
S-200 HR

5.000-250.000

Amersham Pharmacia Biotech

TSK SW 4000

5.000-1.000.000

Toso Haas

Superose 6 HR 10/30

5.000-40.000.000

Amersham Pharmacia Biotech

Protein-Pak 125

10.000-80.000

Waters

Glass GF-250

10.000-250.000

DuPont

Bio-Sil SEC 250

10.000-300.000

Bio-Rad

G3000SWXL

10.000-500.000

Toso Haas

Superdex 200 HR
10/30

10.000-600.000

Amersham Pharmacia Biotech

HiLoad Superdex
200 prep grade

10.000-600.000

Amersham Pharmacia Biotech

HiLoad Sephacryl
S-300 HR

10.000-1.500.000

Amersham Pharmacia Biotech

Coloane prempachetate

Purificarea proteinelor prin IMAC

205

Tip de suport
cromatografic/coloan

Interval de
aplicabilitate (Da)

Productor/Distribuitor

G4000SWXL

20.000-10.000.000

Toso Haas

Glass GF-450

25.000-900.000

DuPont

5.

6.

7.

detector (D) permite monitorizarea n timp real a concentraiei


de proteine din faza mobil la ieirea din coloana cromatografic
i detecia momentului n care proteina investigat este eluat;
sistemele mai vechi (ex. Pharmacia LKB) au un detector care
funcioneaz la o singur lungime de und (280 nm); sistemele
mai noi (ex. AKTA, Amersham Biosciences) permit monitorizarea
fazei mobile simultan la un numr mai mare de lungimi de und i
pot conine i sisteme de detecie suplimentare care evalueaz
indicatori precum conductibilitatea sau indicele de refracie;
colector de fracii (F) permite colectarea fracionat automat n
eprubete separate a eluentului de pe coloan; n funcie de
specificaiile colectorului, acesta poate realiza fracionarea n
raport cu volumul (de exemplu 1 ml/eprubet) sau timpul, n acest
ultim caz volumul colectat fiind dependent de debitul fazei
mobile; sistemele cromatografice moderne prezint un grad foarte
mare de automatizare, n sensul c se activeaz i colecteaz, de
exemplu, doar un anumit vrf (peak);
aparat de nregistrare (recorder (R)) are rolul de a prelua i
prezenta grafic valorile nregistrate de ctre detector; informaiile
sunt prezentate sub forma unui grafic numit cromatogram, pe
abscis (axa Ox) fiind reprezentat timpul (sau volumul), iar pe
ordonat (axa Oy) extincia fazei mobile; n cazul sistemelor
moderne de cromatografie, sistemul de nregistrare este nlocuit de
software-ul de control al ntregului sistem cromatografic; acesta
permite nu doar monitorizarea, ci i ajustarea n timp real a
parametrilor separrii.

Biologie molecular. Metode experimentale

206

Determinarea maselor moleculare native


utiliznd cromatografia de filtrare prin gel
Principiul metodei
Proteina de analizat este aplicat la un debit constant pe o coloan
cromatografic de gel filtrare calibrat n prealabil. Timpul de retenie
(sau volumul de retenie) necesar pentru ca proteina s strbat coloana
este msurat i comparat cu valorile obinute pentru o serie de proteine
standard ale cror mase native sunt cunoscute.
Avantaje:
1. permite stabilirea maselor moleculare native ale proteinelor;
2. dac exist informaii legate de masa molecular relativ, metoda
poate fi utilizat pentru stabilirea gradului de oligomerizare a
proteinelor multimere;
3. poate fi utilizat i ca etap final n purificarea unei proteine.
Limitri:

necesit cantiti relativ mari de protein; cantitatea minim de


protein care trebuie aplicat pe coloan depinde de tipul de
coloan i de sistemul de detecie utilizat.

Materiale necesare:
1. soluie tampon HEPES 40 mM, NaCl 100 mM, pH 7,4 pentru
prepararea unui litru de soluie tampon, ntr-un balon cotat de 1000 ml
se dizolv n 500 ml ap distilat 9,52 g HEPES i 5,84 g NaCl; se
ajusteaz pH-ul la 7,4 dup care soluia se aduce la 1000 ml cu ap
distilat; pentru prelungirea duratei de via a coloanei cromatografice

Purificarea proteinelor prin IMAC

207

este foarte important ca soluia s se filtreze printr-un filtru de 22 m i


s fie degazificat; soluia se pstreaz la 4oC timp nelimitat;
2. coloan HiLoadSuperdex 200 PrepGrade 16/20 (Amersham, Elveia)
sau echivalent; volumul coloanei menionate este de 128,8 ml (CV);
3. sistem cromatografic FPLC LKB Pharmacia sau echivalent echipat cu
injector cu rezervor de 0,5 ml, sistem de detecie UV-VIS (280 nm) i
sistem de nregistrare (recorder);
4. 1 ml soluie coninnd proteina de analizat la o concentraie de 3
mg/ml.
Mod de lucru:
1. este indicat ca toate operaiile descrise n cele ce urmeaz s fie
realizate la temperatura de 4oC; din acest motiv sistemul
cromatografic se amplaseaz ntr-o camer termostatat la 4oC sau
ntr-o vitrin frigorific; dac nu este posibil, rezervorul cu faza
mobil va fi meninut pe ghea;
2. se conecteaz coloana cromatografic la sistemul cromatografic,
urmnd indicaiile productorului; pentru mrirea duratei de via
a coloanei este indicat ca racordarea s se realizeze cu atenie, n
aa fel nct s nu ptrund bule de aer n coloan;
3. se spal coloan cu 2 x CV ap distilat la un debit de 2 ml/ min;
4. se programeaz sistemul cromatografic pentru o aplicaie care s
conin etapele din schema care urmeaz:
Etap

Lungime

Debit(ml/min)

Echilibrare coloan

1 CV

Injectare prob pe coloan

600 l

Eluie izocratic

1 CV

5. se injecteaz cu atenie 1 ml prob (concentraie 3 mg/ml) n


rezervorul injectorului;

208

Biologie molecular. Metode experimentale

6. se pornete aplicaia dezvoltat anterior; dac sistemul este


complet automatizat, injectarea probei se va realiza automat fr a
fi necesar intervenia utilizatorului; n cazul sistemelor mai vechi,
injecia se realizeaz manual prin operarea valvei de injecie n
momentul finalizrii etapei de echilibrare;
7. dup finalizarea separrii cromatografice se identific de pe
cromatogram timpul (sau volumul) de retenie al proteinei
investigate care va fi utilizat pentru calcularea masei moleculare
native utiliznd curba de calibrare (pentru detalii consultai
subcapitolul Calibrarea coloanei de GF i calcularea maselor
molare, pagina 200);
8. coloana cromatografic se spal cu 2 x CV ap distilat; Pentru
perioade scurte, de ordinul zilelor, coloana poate fi pstrat n ap
distilat la temperatura de 4oC; pentru perioade mai ndelungi de
depozitare, este indicat splarea i echilibrarea coloanei cu etanol
20%.

Calibrarea coloanei de GF i calcularea maselor


molare
nainte de utilizare, coloana i sistemul cromatografic trebuie
calibrate folosind un set de proteine standard. Unii distribuitor pun la
dispoziie seturi de proteine standard utilizabile pentru anumite intervale
de mas.
Calibrarea propriu-zis se realizeaz prin injectarea a 600 l
soluie coninnd 3 mg/ml din fiecare protein standard n coloana
cromatografic i realizarea unei curbe de etalonare. Dei unii autori
indic utilizarea direct a volumului de eluie pentru realizarea curbei de
etalonare (30), cel mai frecvent se folosete unu parametru derivat, Kav
(fracia din faza staionar care este disponibil pentru difuzia speciei
date) (31), calculat dup formula:

Purificarea proteinelor prin IMAC

209

unde: Ve volumul de eluie


Vo volumul liber
Vt volumul fazei imobile
Valorile parametrului derivat Kav se reprezint ntr-un sistem de
axe semilogaritmic. Pe axa OY (normal) este plasat parametrul Kav i pe
axa OX (logaritmic) masele moleculare ale proteinelor standard utilizate
(32).
n Tabelul 13 i Figura 26 sunt prezentate o serie de rezultate
tipice obinute ntr-o separare cromatografic folosind coloana
HiLoadSuperdex 200 PrepGrade 16/20 conectat la un sistem
cromatografic AKTA Explorer i proteinele standard din trusa de calibrare
pentru GF produs de Amersham Biosciences, Elveia.
TABELUL 13. Rezultate tipice obinute la calibrarea coloanei de GF folosind
diverse standarde proteice
Protein standard
Blue-Dextran
Feritin
Catalaz
Aldolaz
Albumin
Ovalbumin
Ribonucleaz
*

Mas molecular Volum de eluie


(kDa)
(ml)

44,8500
440
46,1690
232
48,3200
158
54,5600
67
64,7000
43
80,4980
17.4
96,2200

Kav
Vo*
0,0173325
0,0455979
0,1275953
0,2608410
0,4684363
0,6750329

Blue-dextran-ul are masa molecular de 200000 kDa i a fost utilizat pentru determinarea
volumului liber Vo

Biologie molecular. Metode experimentale

210

1000

y =314.44e-4.4433x

kDa

100

10

0,2

Kav

0,4

0,6

0,8

FIGURA 26. Curb de etalonare tipic obinut pentru coloana HiLoadSuperdex


200 PrepGrade 16/20 conectat la un sistem cromatografic AKTA
Explorer folosind valorile din Tabelul 13.
Bibliografie
1. Terpe, K. (2003) Overview of tag protein fusions: from molecular and
biochemical fundamentals to commercial systems., Applied
microbiology and biotechnology, 60, 523-33.
2. LaVallie, E. R. (2001) Production of recombinant proteins in
Escherichia coliinCurrent Protocols in Protein Science(John E.
Coligan Ed.), Wiley,
3. Janknecht, R., de Martynoff, G., Lou, J., Hipskind, R. A., Nordheim,
A., Stunnenberg, H. G. (1991) Rapid and efficient purification of
native histidine-tagged protein expressed by recombinant vaccinia
virus., Proceedings of the National Academy of Sciences of the
United States of America, 88, 8972-6.
4. Knapp, J. E., Carroll, D., Lawson, J. E., Ernst, S. R., Reed, L. J.,
Hackert, M. L. (2000) Expression, purification, and structural
analysis of the trimeric form of the catalytic domain of the
Escherichia coli dihydrolipoamide succinyltransferase., Protein
Science, 9, 37-48.

Purificarea proteinelor prin IMAC

211

5. Porath, J., Carlsson, J., Olsson, I., Belfrage, G. (1975) Metal chelate
affinity chromatography, a new approach to protein fractionation,
Nature, 258, 598-599.
6. Twyman, R. (1999) Advanced Molecular Biology: A Concise
Reference, p 499. BIOS Scientific Publishers.
7. Griffiths, A. J., Miller, J. H., Suzuki, D. T., Lewontin, R. C., Gelbart,
W. M. (2000) An Introduction to Genetic Analysis, p 250-375. W.
H. Freeman.
8. Reece, R. J. (2004) Analysis of Genes and Genomes, p 490. Wiley.
9. Lodish, H., Berk, A., Matsudaira, P., Kaiser, C. A., Krieger, M., Scott,
M. P., Zipursky, L., Darnell, J. (2003) Molecular Cell Biology, p
361-380. W. H. Freeman.
10. Twyman, R. (1998) Advanced molecular biology: a concise
reference. Bios Scientific Publishers, Oxford UK.
11. Vincze, T., Posfai, J., Roberts, R. (2003) NEBcutter: a program to
cleave DNA with restriction enzymes, Nucleic Acids Research, 31,
3688-3691.
12. Sambrook, J., Fritsch, E., Maniatis, T. (1989) Molecular Cloning - A
Laboratory Manual, p 1.21-1.53. Cold Spring Harbour Laboratory
Press.
13. de Boer, H. A., Comstock, L. J., Vasser, M. (1983) The tac promoter:
a functional hybrid derived from the trp and lac promoters.,
Proceedings of the National Academy of Sciences of the United
States of America, 80, 21-5.
14. Makrides, S. C. (1996) Strategies for achieving high-level expression
of genes in Escherichia coli., Microbiological reviews, 60, 512-38.
15. Gottesman, S. (1996) Proteases and their targets in Escherichia coli.,
Annual review of genetics, 30, 465-506.
16. Higgins, S. J., Hames B.D. (1999) Protein Expression: A Practical
Approach (Practical Approach Series), p 304. Oxford University
Press, USA.
17. Creighton, T. E. (1999) Encyclopedia of Molecular Biology (Wiley
Biotechnology Encyclopedias), p 2878. Wiley-Interscience.
18. Khan, R. H., Rao, K. B., Eshwari, A. N., Totey, S. M., Panda, A. K.
Solubilization of recombinant ovine growth hormone with
retention of native-like secondary structure and its refolding from
the inclusion bodies of Escherichia coli., Biotechnology progress,
14, 722-8.

212

Biologie molecular. Metode experimentale

19. Hansen, L. H., Knudsen, S., Sorensen, S. J. (1998) The Effect of the
lacY Gene on the Induction of IPTG Inducible Promoters, Studied
in Escherichia coli and Pseudomonas fluorescens, Current
Microbiology, 36, 341-347.
20. Blackwell, J. R., Horgan, R. (1991) A novel strategy for production
of a highly expressed recombinant protein in an active form, FEBS
Letters, 295, 10-12.
21. Studier, F. W. (2005) Protein production by auto-induction in high
density shaking cultures., Protein expression and purification, 41,
207-34.
22. Mihasan, M., Ungureanu, E., Artenie, V. (2007) Optimum
parameters for overexpression of recombinant protein from tac
promotors on autoinducible medium, Romanian Biotechnological
Lettters, 12, 3473-3482 .
23. Miller, S. A., Dykes, D. D., Polesky, H. F. (1988) A simple salting
out procedure for extracting DNA from human nucleated cells.,
Nucleic acids research, 16, 1215.
24. Ozaita, A., Olmos, G., Boronat, M. A., Lizcano, J. M., Unzeta, M.,
Garca-Sevilla, J. A. (1997) Inhibition of monoamine oxidase A
and B activities by imidazol(ine)/guanidine drugs, nature of the
interaction and distinction from I2-imidazoline receptors in rat
liver., British Journal of Pharmacology, 121, 901-12.
25. Li, M., Su, Z.-G., Janson, J.C. (2004) In vitro protein refolding by
chromatographic procedures., Protein expression and purification,
33, 1-10.
26. Singh, S. M., Panda, A. K. (2005) Solubilization and refolding of
bacterial inclusion body proteins., Journal of bioscience and
bioengineering, 99, 303-10.
27. Tsumoto, K., Ejima, D., Kumagai, I., Arakawa, T. (2003) Practical
considerations in refolding proteins from inclusion bodies, Protein
Expression and Purification, 28, 1-8.
28. Williams, A., Hagel, L. (1999) Column Handbook for Size Exclusion
Chromatography in Column Handbook for Size Exclusion
Chromatography (Chi-san, W., Ed.), p 27-74. Elsevier.
29. Hagel, L. (2001) Gel-filtration chromatography., Current protocols
in protein science, John E. Coligan et al.Chapter 8, Unit 8.3.
30. Scopes, R. (2000) Protein Separation in Encyclopedia of Separation
Science - Level II: Methods and Instrumentation (Wilson, I., Ed.), p
405-410. Academic Press.

Purificarea proteinelor prin IMAC

213

31. Ranadive S.A., Pipkin J.D., Varia S.A., N. H.C., Barry E.P., Porubcan
M., Unger S.E., McCormick T.J. (1995) Formation, isolation and
identification of oligomers of aztreonam, European Journal of
Pharmaceutical Sciences. Elsevier 3, 11.
32. Dondos, A. (2006) Applicability of the modified universal
calibration of gel permeation chromatography on proteins., Journal
ofchromatography, 1127, 183-6.

IX. DETERMINAREA
CONCENTRAIEI PROTEINELOR
Gradul de reuit al oricrui experiment ce implic lucrul cu
moleculele proteice depinde, de cele mai multe ori, de specificitatea i
sensibilitatea metodelor utilizate pentru cuantificarea proteinelor (1). Pn
la momentul actual au fost descrise numeroase metode de msurare a
concentraiei proteinelor dintr-o soluie, metode ce utilizeaz proprietatea
acestora de a absorbi n domeniul UV, de a participa la reacii de culoare
sau de a ncorpora diferii compui radioactivi. Alegerea metodei de
utilizat depinde, n general, de proprietile moleculei proteice de interes
i de compoziia soluiei tampon n care se afl aceasta.
Proteina de interes sau compoziia probei sunt parametri
importani, deoarece o protein bogat n arginin, spre exemplu, va
reaciona foarte puternic cu reactivul Bradford, ceea ce va duce la
obinerea unei concentraii mari n mod eronat. Pentru aceste proteine este
indicat metoda Lowry sau BCA. De asemenea, o protein bogat n
cistein va conduce la rezultate anormal de mari prin folosirea metodei cu
BCA, metodele Bradford sau Lowry putnd fi utilizate fr nici o
problem.
Compoziia soluiei tampon n care se afl proba de analizat poate
avea o influen foarte mare asupra rezultatelor, prin interferenele pe care
le introduce. De exemplu, metoda Lowry, dei are o sensibilitate foarte
bun, nu permite utilizarea unor compui comuni precum EDTA (acid
diaminotetracetic). Metoda cu BCA este susceptibil la interferene din
partea agenilor reductori, iar reactivul Bradford d reacie de culoare cu
o list lung de detergeni. O prezentare destul de explicit a compuilor
care interfer cu metodele comune de dozare a proteinelor este realizat
de Coligan (1).
Alegerea metodei optime de dozare a proteinelor trebuie, de
asemenea, s in cont de: volumul de prob disponibil, domeniul de
concentraie preconizat, specificitatea dorit i uurina n realizarea
msurtorilor (aparatur disponibil, timp necesar).

Biologie molecular. Metode experimentale

216

IX.1 Determinarea concentraiei proteinelor prin


spectroscopie UV
Aceast metod de determinare a concentraiei proteice se bazeaz
pe proprietatea proteinelor de a absorbi n domeniul UV, cu dou maxime
distincte, unul la 200 nm i cellalt la 280 nm.
Maximumul de absorbie la 200 nm se datoreaz legturilor
peptidice. Moleculele proteice conin un numr mare de legturi de acest
tip i n consecin absorb foarte puternic la aceast lungime de und. Din
pcate ns, orice alt compus care conine legturi de tipul C=N, C=O,
C=C absoarbe n acest domeniu, ceea ce face dificil utilizarea lungimii
de und de 200 nm pentru cuantificarea proteinelor. Metoda este ns
aplicabil cu anumite constrngeri n cazul proteinelor care absorb slab la
280 nm i poart numele de metoda Scopes (2).
Maximul de la 280 nm se datoreaz resturilor de aminoacizi
aromatici (triptofan, fenilalanin, tirozin, histidin) prezeni n structura
primar a moleculelor proteice. Proteinele cu numr mic de aminoacizi
aromatici (cum este cazul gelatinei) vor absorbi puin la aceast lungime
de und, iar proteinele cu numr mare de resturi de aminoacizi aromatici
vor absorbi deosebit de puternic. De asemenea, absorbia la 280 nm
depinde de structura teriar i cuaternar a proteinelor (3). Dei exist
aceast mare variabilitate a cantitii de radiaie UV absorbit de diversele
tipuri de molecule proteice, 280 nm este lungimea de und cel mai
frecvent utilizat pentru cuantificarea direct a proteinelor deoarece exist
relativ puine substane care absorb n acest domeniu.
Principiul metodei
Metoda const n msurarea absorbanei n UV a soluiei proteice
i exprimarea direct a concentraiei conform legii Lambert-Beer.

unde:

,
A absorbana soluiei;
l lungimea drumului parcurs de lumin;
c concentraia soluiei;
coeficientul de absorbie molar a proteinei de interes.

Determinarea concentraiei proteinelor

217

Coeficientul de absorbie molar este un parametru specific


proteinei de interes. Pentru evaluarea exact a concentraiei unei soluii
proteice este necesar ca acest parametru s fie cunoscut. El poate fi
calculat atunci cnd numrul de aminoacizi aromatici i legturi
disulfidice din molecula proteic este cunoscut. Estimarea se realizeaz
dup formula descris de Pace (4):
,
unde:
280 coeficientul de extinctie molar la 280 nm (mol-1cm-1)
nTrp numrul de resturi de triptofan;
nTyr numrul de resturi de tirozin;
nSS numrul de legturi disulfurice.
Metoda poate fi de asemenea utilizat pentru estimarea
coninutului proteic al unui extract brut (un amestec de proteine). n acest
caz se folosete un coeficient de absorbie mediu, estimat de ctre Pace
(4), conform cruia o soluie de concentraie 1% are o valoare a
absorbanei la 280 nm egal cu 13.
Avantaje:
1. simplitate deosebit (metoda nu necesit incubare, i nici reactivi
speciali);
2. proba proteic nu este denaturat i poate fi recuperat;
3. dependena dintre absorban i concentraie este liniar;
4. utilizabil pe un interval larg de concentraii: 20-3000 g/ml.
Limitri:
1. metoda nu poate fi utilizat cnd proteinele de interes conin
grupri prostetice care absorb ntre 200 i 300 nm;

Biologie molecular. Metode experimentale

218

2. moleculele de acizi nucleici absorb puternic n domeniul


200-300 nm i de aceea extractele brute (ce conin i ADN i
ARN) vor absorbi deosebit de puternic la 280 nm;
3. dac nu este cunoscut coeficientul de absorbie molar, metoda
ofer doar o estimare a coninutului proteic i nu permite stabilirea
exact a concentraiei.
Materiale necesare:
1. cuve din quartz cu drumul optic de 1 cm;
2. spectrofotometru cu lamp UV.
Mod de lucru:
1. se pornete spectrofotometrul i se menine astfel timp de
15-30 minute;
2. se fixeaz lungimea de und la 280 nm i se face 0 cu controlul
reactivilor (ap distilat sau soluie tampon n care se afl
proteina);
3. cuva se usuc dup care se introduce proba proteic i se msoar
absorbana; valorile nregistrate trebuie s se situeze ntre 0,2 i
1,0; dac acest interval este depit, este necesar prepararea unei
alte soluii proteice prin concentrare sau diluare;
4. se calculeaz concentraia proteic folosind una din formulele
corespunztoare, dup caz:
a. dac sunt cunoscute coeficientul de absorbie molar i masa molecular:

unde:
c concentraia proteic n mg/ml
A280 absorbana la 280 nm determinat anterior;
M masa molecular a proteinei de interes (Da);
280 coeficientul de absorbie molar (mol-1cm-1);

Determinarea concentraiei proteinelor

219

b. dac coeficientul de absorbie nu este cunoscut, se poate realiza o


apreciere a coninutului proteic utiliznd formula:
(1)
unde:
c concentraia proteic n mg/ml
A280 absorbana la 280 nm determinat anterior;
Aceasta este o estimare ce are la baz un coeficient de absorbie
mediu i nu reprezint concentraia real a proteinei sau extractului
proteic.
c. dac apar interferene datorit coninutului ridicat de acizi nucleici,
acestea pot fi eliminate prin msurarea densitii optice la 260 nm,
calculul concentraiei realizndu-se dup formula:

unde:
c concentraia proteic n mg/ml
A280,260 absorbana la 280 nm sau respectiv 260 nm;

IX.2 Metode colorimetrice de determinare a


concentraiei proteinelor
n cazul acestor metode nu se msoar direct concentraia
proteinelor, ci intensitatea culorii rezultate prin reacia grupelor
funcionale proteice cu diveri reactivi.

Metoda Lowry
Aceast metod a fost una dintre cele mai utilizate tehnici de
dozare a proteinelor, lucru demonstrat de faptul c lucrarea original
publicat de Lowry et al.n 1951 (5) este cea mai citat lucrare din istoria
biochimiei.

Biologie molecular. Metode experimentale

220

Principiul metodei
Metoda are la baz dou reacii distincte. Pe de o parte, n condiii
alcaline, ionii Cu2+ reacioneaz cu legturile dipeptidice din componena
proteinelor i formeaz Cu+ n aa numit reacie a biuretului (6). Pe de
alt parte, resturile de triptofan, tirozin i cistein, mpreun cu ionii Cu+
particip la a doua reacie n care reactivul Folin-Cioclteau
(fosfomolibdat i fosfotungstenat) este convertit la un compus de culoare
albastr, care absoarbe n domeniul 500-750 nm. Intensitatea culorii la
660 nm este direct proporional cu cantitatea de protein.
Avantaje:
1.
2.

interval de linearitate 1-100 g protein;


posibilitate de a msura la diverse lungimi de und (ntre
500-750 nm) pentru a se elimina posibilele interferene;
3.
existena unui numr mare de variante derivate de la
aceast metod, variante care au ca scop mrirea spectrului de
concentraii (7), scderea numrului de substane ce interfer cu
aceast determinare (8)sau precipitarea iniial a proteinelor
pentru eliminarea contaminanilor (9).

Limitri:
1. foarte muli dintre reactivii comuni utilizai pentru prepararea
soluiilor tampon interfer cu dezvoltarea culorii (ageni
reductori, ageni chelatani ai cuprului (EDTA), detergeni,
carbohidrai, glicerol, tricin, TRIS, compui cu potasiu, derivai
sulfhidril, majoritatea fenolilor, acid uric, xantin, guanin, ionii
de Mg2+ i Ca2+);
2. intensitatea culorii depinde i de numrul de resturi de tirozin,
triptofan i cistein din proteina de interes;
3. este o metod relativ complicat, datorit reactivilor care trebuie
preparai extemporaneu.

Determinarea concentraiei proteinelor

221

Materiale necesare:
1. soluie Na2CO3 2 % n soluie de NaOH 0,1N;
2. soluie CuSO4 x 5H2O 1 %;
3. tartrat de sodiu sau potasiu 2 %;
4. soluie de lucru se prepar extemporaneu prin amestecarea a
50 ml reactiv 1 cu 0,5 ml reactiv 2 i 0,5 ml reactiv 3;
5. reactiv Folin-Cioclteupoate fi achiziionat sub form de soluie
de concentraie 2 N (Sigma-Aldrich) sau poate fi preparat n laborator;
pentru aceasta, se dizolv, ntr-un balon cu fundul rotund prevzut cu
refrigerent ascendent, 20 g Na2WO4 x 2H2O (wolframat de sodiu) i
5 g Na2MoO4(molibdat de sodiu) n 140 ml ap distilat; se adaug
1 ml H3PO4 85 % i 20 ml HCl concentrat i se fierbe moderat
amestecul, sub reflux, timp de aproximativ 10 ore; dup acest interval
de timp se oprete fierberea, se adaug 30 g Li2SO4 i cteva picturi
de Br2, dup care amestecul se mai fierbe timp de aproximativ
15 minute fr refrigerent, pentru a se elimina excesul de brom; dup
rcire, se aduce volumul reactivului la 200 ml cu ap distilat i se
filtreaz; reactivul trebuie s aib culoarea galben (10); nainte de
utilizare, reactivul se dilueaz cu ap distilat;
6. reactiv Folin-Cioclteu diluat se prepar prin diluarea unui ml
reactiv concentrat cu 2 ml ap distilat;
7. soluie standard de albumin seric bovin (BSA) 0,1 mg/ml se
cntresc la balana analitic 10 mg BSA i se transfer cantitativ
ntr-un balon cotat de 100 ml; se dizolv proteina standard n 50 ml
ap distilat, dup care se aduce la semn; dizolvarea se realizeaz cu
atenie, pentru a prentmpina formarea spumei (aceasta conine
protein denaturat i modific concentraia final a soluiei standard)
Mod de lucru:
Un volum de pn la 1 ml prob coninnd 10-100 g protein se
amestec cu 5 ml soluie de lucru. Dac volumul de prob este mai mic de
1 ml se completeaz cu ap distilat pn la 6 ml, dup care se incubeaz
timp de 10 minute la temperatura camerei. Amestecul obinut se trateaz
cu 0,5 ml reactiv Folin-Cioclteu diluat, se agit foarte bine amestecul,

Biologie molecular. Metode experimentale

222

dup care se las n repaus timp de 30 minute. Se citete extincia probei


la 660 nm fa de controlul reactivilor (1 ml ap distilat, 5 ml soluie de
lucru, 0,5 ml reactiv Folin-Cioclteu diluat).
Pentru construirea curbei de etalonare, se realizeaz diluii ale
soluiei standard BSA (Tabelul 14), dup care se dozeaz concentraia
proteinelor, ca i n cazul probei, dup metoda descris anterior.
Extinciile obinute se folosesc pentru trasarea curbei de etalonare cu
ajutorul creia se vor determina concentraiile probelor de analizat
(necunoscute).
TABEL 14. Construirea curbei de etalonare pentru dozarea proteinelor prin
metoda Lowry
BSA
(g)

Soluie standard BSA 0,1 mg/ml


(ml)

Ap distilat
(ml)

0,0

1,0

10

0,1

0,9

20

0,2

0,8

30

0,4

0,6

40

0,6

0,4

60

0,8

0,2

80

1,0

0,0

O metod alternativ, derivat din cea descris anterior este


metoda prezentat de Stoscheck(3). Aceasta utilizeaz reactivul FolinCioclteu mult mai diluat, are sensibilitate mai mare i este mai puin
influenat de compui care interfer cu metoda clasic.
Materiale necesare:
1.

reactiv cupric se dizolv 20 g Na2CO3 n 260 ml ap distilat, 0,4 g


CuSO4 x 5H2O n 20 ml ap distilat i 0,2 g tartrat dublu de sodiu i
potasiu n 20 ml ap distilat; soluiile obinute se amestec i se
obin 300 ml reactiv cupric;

Determinarea concentraiei proteinelor

2.
3.
4.

5.
6.

223

dodecil sulfat de sodiu (SDS) 1 % se dizolv 10 g SDS n 100 ml


ap distilat;
soluie NaOH 1 M se dizolv 4 g NaOH n ap distilat i se aduce
soluia la 100 ml, ntr-un balon cotat;
reactiv Lowry se prepar extemporaneu, prin amestecarea a 3 pri
reactiv cupric cu o parte SDS 1 % i o parte NaOH 1 M; reactivul
este stabil timp de 2-3 sptmni, dar poate aprea un precipitat alb
care dispare prin nclzire la temperatura de 37oC; dac precipitatul
format este de culoare neagr, reactivul nu mai poate fi utilizat;
reactiv Folin-Cioclteu 0,2 N se prepar reactivul Folin-Cioclteu
dup metoda descris anterior i se dilueaz n proporie de 1/10;
soluie standard de albumin seric bovin (BSA) 0,5 mg/ml se
cntresc la balana analitic 50 mg BSA i se transfer cantitativ
ntr-un balon cotat de 10 ml; se dizolv proteina standard, cu atenie
pentru a se prentmpina formarea spumei, n 50 ml ap distilat,
dup care se aduce la semn.

Mod de lucru:
1. se amestec400 l reactiv Lowry cu cel mult 400 l prob;
2. se completeaz volumul pn la 800 l cu ap distilat;
3. amestecul se incubeaz la temperatura camerei timp de cel puin
10 min;
4. se adaug 200 l reactiv Folin-Cioclteu diluat i se agit energic.
Agitarea este necesar deoarece reactivul se descompune repede.
Operaiunea este considerat corect atunci cnd nu se mai observ
gradient de culoare n interiorul microeprubetei;
5. amestecul se incubeaz la temperatura camerei timp de 30 minute.
Culoarea rezultat este relativ stabil pentru perioade de ordinul orelor,
astfel nct, n cazul mai multor probe acestea pot fi spectrofotometrate
la distane de pn n 10 minute una de cealalt.
Cuantificarea probelor se realizeaz la un spectrofotometru VIS
utiliznd cuve din sticl sau plastic la lungimea de und de 660 nm fa de
un control al reactivilor (400 l reactiv Lowry, 400 l ap distilat, 200 l
reactiv Folin-Cioclteu diluat). Dac absorbana la 660 nm este prea mare,
se poate utiliza i lungimea de und 500 nm.

Biologie molecular. Metode experimentale

224

Concentraia proteinelor se calculeaz n raport cu o curb de


etalonare. Pentru realizarea acesteia, n microeprubete Eppendorf se
pipeteaz soluie standard BSA 0,5 mg/ml i ap distilat, conform
Tabelului 15, dup care se procedeaz identic ca n cazul probei de
analizat. Extinciile obinute se folosesc pentru trasarea curbei de
etalonare cu ajutorul creia, prin interpolare, se determin concentraiile
probelor de analizat (necunoscute).
TABEL 15. Construirea curbei de etalonare pentru dozarea proteinelor prin
metoda alternativ Lowry
BSA
(g)

Soluie standard BSA


0,05 mg/ml (l)

Ap distilat
(l)

400

10

20

380

20

40

360

30

60

340

40

80

320

60

120

280

80

160

240

100

200

200

Metoda Bradford
Introdus de Bradford n 1976 (11), metoda se bazeaz, n
principiu, pe legarea direct a colorantului Briliant Blue G250 de resturile
de aminoacizi bazici i aromatici (12). Metoda a devenit deosebit de
popular datorit simplitii, sensibilitii i rapiditii, fiind folosit n
special pentru cuantificarea concentraiei proteinelor din extracte brute
sau n vederea electroforezei.

Determinarea concentraiei proteinelor

225

Principiul metodei
Metoda se bazeaz pe proprietatea colorantului Brilliant Blue
G250 de a-i modifica spectrul de absorbie n urma interaciunii cu
resturile de arginin, triptofan, tirozin i fenilalanin din moleculele
proteice. n forma liber, colorantul are un maximum de absorbie la
470 nm (maro). dar prin interaciunea cu proteinele are loc o schimbare a
maximumului de absorbie la 595 nm (albastru), intensitatea culorii fiind
direct proporional cu concentraia proteic.
Avantaje:
1. sensibilitate bun sensibilitatea variaz ntre 1-20 g protein
(micrometoda descris de Coligan et al. 2007 (1) sau 20-140 g
(macrometoda descris de Rosenberg (12)); metoda descris n
cele ce urmeaz are o sensibilitate intermediar;
2. simplitate, rapiditate se utilizeaz un singur reactiv care este
stabil mult timp;
3. numr mai mic de compui care interfer, comparativ cu metoda
Lowry.
Limitri:
1. lipsa de linearitate dintre intensitatea culorii i cantitatea de
protein, care fac necesar acordarea unei atenii deosebite n
realizarea curbelor de etalonare;
2. colorantul format este deosebit de aderent de suprafee i de aceea
este greu de ndeprtat;
3. detergenii frecvent utilizai (Triton, Tween) dau reacii de culoare
cu reactivul Bradford astfel nct prezena lor n soluiile tampon
interfer cu msurtoarea;
4. albumina seric bovin are o reacie de dou ori mai puternic
dect media cu reactivul Bradford (3), de aceea nu este indicat
utilizarea sa pentru construirea curbelor etalon; unii autori
recomand utilizarea lizozimului sau imunoglobulinei G.

Biologie molecular. Metode experimentale

226

Materiale necesare:
1. etanol 96 %;
2. H3PO489 %;
3. reactiv Bradford poate fi achiziionat gata preparat de la
furnizori consacrai precum Sigma, Biorad sau Roth; pentru
prepararea n laborator, 10 mg colorant Brilliant Blue G-250 se
dizolv n 10 ml etanol 96 % i 9,8 ml acid fosforic 89 % i se
completeaz cu ap distilat pn la 100 ml; Soluia obinut se
pstreaz la frigider n sticl de culoare brun, fiind stabil cteva
sptmni;
4. NaOH 1 M (opional) se dizolv 4 g NaOH n ap distilat i se
aduce la semn ntr-un balon cotat de 100 ml;
5. soluie standard BSA 0,05 mg/ml se cntresc la balana
analitic 5 mg albumin seric bovin i se transfer cantitativ
ntr-un balon cotat de 100 ml; se dizolv proteina standard n
50 ml ap distilat, dup care se aduce la semn; dizolvarea se
realizeaz cu atenie, pentru a prentmpina formarea spumei.
Mod de lucru:
1. proba, n cantitate de maximum 500 l (400 l n cazul utilizrii
soluiei de NaOH), se pipeteaz ntr-o eprubet curat i uscat;
2. dac este necesar, peste prob se pipeteaz 100 l NaOH 1 M;
soluia are rolul de a prentmpina formarea de precipitat prin
reacia dintre reactivul Bradford i extractul proteic i de a
solubiliza proteinele membranare;
3. peste prob se pipeteaz cantitatea corespunztoare de ap
distilat, pn la un volum final de 500 l;
4. se adaug 1,5 ml reactiv Bradford i se agit imediat;
5. dup 5 minute, se citete absorbana la 595 nm fa de controlul
reactivilor (n care proba este nlocuit cu acelai volum de
tampon de lucru); culoarea este stabil, dar este recomandat ca
citirea extinciilor s se realizeze nu mai trziu de 30 minute de la
introducerea reactivului Bradford n soluia proteic;

Determinarea concentraiei proteinelor

227

6. cantitatea de protein se calculeaz utiliznd o curb de etalonare;


pentru realizarea acesteia, n eprubete curate i uscate se pipeteaz
soluie standard BSA 0,05 mg/ml i ap distilat urmnd
indicaiile din Tabelul 16) dup care se adaug cte 1,5 ml reactiv
Bradford; eprubetele se agit energic i se incubeaz la
temperatura camerei timp de 5 minute; se citete extincia i se
traseaz curba de etalonare.

TABEL 16. Construirea curbei de etalonare pentru dozarea proteinelor prin


metoda Bradford
BSA
(g)

Soluie standard BSA


0,05 mg/ml
(l)

Ap distilat
(l)

0,0

500

2,5

50

450

5,0

100

400

7,5

150

350

10,0

200

300

12,5

250

250

15,0

300

200

20,0

400

100

Micrometoda Bradford de dozare a concentraiei proteinelor


Alturi de metoda descris mai sus, pentru determinarea
concentraiei proteinelor utiliznd Brilliant Blue G-250 se poate utiliza i
o metoda alternativ ce are avantajul unui volum de reacie mic (dozarea
poate fi efectuat n microeprubete Eppendorf) n detrimentul ns al unui
interval de linearitate mai redus (2-20 g).

Biologie molecular. Metode experimentale

228

Materiale necesare:
1.
2.
3.
4.
5.

reactiv Bradford (reactivul 3, Metoda Bradford, pagina 226);


NaOH 1 M;
microeprubete Eppendorf de 1,5 ml;
cuve cu volum redus pentru spectrofotometru;
soluie standard BSA 0,05 mg/ml (reactivul 5, Metoda Bradford,
pagina 226).

Mod de lucru:
1. ntr-o microeprubet Eppendorf se pipeteaz maximum 700 l prob
cu un coninut de 2-20 g protein; dac proba are un volum mai mic,
se completeaz cu ap distilat pn la 700 l;
2. peste prob se introduc 100 l NaOH 1 M; adugarea soluiei NaOH
este facultativ, ea avnd rolul de a prentmpina formarea de
precipitat i solubilizarea proteinelor membranare;
3. n amestecul de reacie se adaug 200 l reactiv Bradford;
4. se agit energic microeprubeta, se menine la temperatura camerei
timp de 5 minute dup care se citete extincia la 595 nm fa de un
control al reactivilor (proba este nlocuit de tamponul de lucru);
5. cantitatea de protein se calculeaz n raport cu o curb de etalonare
pentru realizarea creia se pipeteaz n microeprubete curate i uscate
volume de soluie standard BSA 0,05 mg/ml i ap distilat nscrise n
Tabelul 17; n fiecare microeprubet se introduc, n continuare, 200 l
reactiv Bradford i 100 l soluie NaOH; amestecul se agit energic i
se incubeaz la temperatura camerei timp de 5 minute; se citesc
extinciile i se traseaz curba de etalonare, de pe care se vor exprima
prin interpolare concentraiile probelor necunoscute.

Determinarea concentraiei proteinelor

229

TABEL 17. Construirea curbei de etalonare pentru dozarea proteinelor prin


micrometoda Bradford
BSA
(g)

Soluie standard BSA 0,05


mg/ml
(l)

Ap distilat
(l)

0,0

700

2,5

50

650

5,0

100

600

7,5

150

550

10,0

200

500

12,5

250

450

15,0

300

400

20,0

400

300

Metoda cu acid bicinchoninic (BCA)


Aceasta metod tinde s nlocuiasc metodele Lowry i Bradford
datorit numrului foarte mic de substane care interfer, simplitii i
sensibilitii mari. A fost descris pentru prima dat de Smith et. al., 1985
(13) i are la baz reacia biuretului la fel ca i metoda Lowry. Reactivul
Folin-Cioclteau utilizat n metoda Lowry este nlocuit cu o soluie
puternic bazic de acid bicinchoninic. Acesta din urm are proprietatea de
achelata2 ioni de Cu+(14), conducnd la formarea unui complex colorat
(purpuriu) cu maximum de absorbie la 562 nm.
Mult vreme s-a considerat c mecanismul care st la baza acestei
reacii este asemntor celui pe care se bazeaz metoda Lowry. Ulterior sa stabilit c de fapt au loc dou reacii distincte n care sunt implicai ioni
Cu2+ (15). Prima reacie are loc la temperaturi sczute i implic resturile
de cistein, cistin, triptofan i tirozin din molecula proteic, care
transform Cu2+ n Cu+. n a doua reacie, ce se desfoar la temperaturi
mari, sunt implicate legturile dipeptidice care realizeaz aceeai reacie
de reducere a Cu2+. Cantitatea de Cu2+ redus este proporional cu
cantitatea de protein din soluia de analizat. Dac intensitatea primei

Biologie molecular. Metode experimentale

230

reacii este dependent de coninutul n aminoacizi ai proteinei, cea de-a


doua reacie depinde doar de dimensiunile moleculelor proteice.
Desfurarea reaciei de dozare la temperaturi mari (37oC sau 60oC) are
avantajul unei sensibiliti mrite i de asemenea reduce variaia
rspunsului colorantului la compoziia n aminoacizi a proteinei.
Principiul metodei
n mediu alcalin i la temperaturi nalte, ionii de Cu2+ sunt redui
de legturile peptice i grupele funcionale (resturile de cistein, cistin,
triptofan i tirozin) din structura proteinelor la Cu+. Ionii Cu+ sunt
complexai de ctre acidul bicinchoninic rezultnd un chelat puternic
colorat n purpuriu, cu maximumul de absorbie la 562 nm. Intensitatea
culorii este direct proporional cu concentraia proteinei.
Avantaje:
1. sensibilitate foarte bun, comparabil cu cea a metodei Lowry;
2. linearitate bun (1-100 g);
3. simplitate deosebit deoarece este necesar manipularea unuia sau
a doi reactivi;
4. reactivii sunt stabili n timp;
5. compatibilitate foarte bun cu compuii utilizai n mod frecvent
pentru prepararea tampoanelor de extracie; Rosenberg (12)ofer o
bun descriere a compuilor i concentraiilor n care acetia sunt
compatibili cu metoda BCA;
6. deoarece n dezvoltarea culorii sunt implicate majoritar legturile
peptidice, coninutul de aminoacizi al proteinei are o importan
mai mic, metoda fiind astfel mai puin influenat de secvena
proteinei de analizat.
Limitri:
-

ageni de chelatare ai ionului Cu+ (EDTA, EGTA) sau agenii

Determinarea concentraiei proteinelor

231

reductori (DTT, beta-mercaptoetanol) interfer n dezvoltarea


culorii.

Micrometoda BCA de dozare a proteinelor


Materiale necesare:
1. soluie bicinchoninat de sodiu ntr-un balon cotat de 100 ml se
dizolv 8 g Na2CO3 x H2O i 1,6 g tartrat de sodiu n 70 ml ap
distilat; se ajusteaz pH-ul la 11,25 cu NaOH 10M dup care se
aduce la semn cu ap distilat; soluia este stabil pn la un an la
temperatura camerei;
2. soluie 4% BCA se dizolv 4 g BCA n 100 ml ap distilat;
soluia este stabil pn la un an la temperatura camerei;
3. soluie 0,4% CuSO4 se dizolv 0,4 g CuSO4 x 5H2O n 10 ml ap
distilat; soluia este stabil pn la un an la temperatura camerei;
4. soluie de lucru (se prepar extemporaneu) se amestec reactivii
1, 2, 3 n proporie de 25:25:1 (v/v/v);
5. soluie standard BSA 0,05 mg/ml (vezi metoda Bradford, reactiv 5);
6. baie de ap sau termostat la temperatura de 60oC.
Mod de lucru:
1. proba de analizat, coninnd 2-20 g proteine ntr-un volum de
maximum 500 l, se pipeteaz n microeprubete Eppendorf; dac volumul
probei este mai mic de 500 l se completeaz pn la acest volum cu ap
distilat;
2. peste prob se introduc 500 l soluie de lucru, se agit energic i se
incubeaz timp de 15 minute la temperatura de 60oC;
3. microeprubetele se rcesc ntr-o baie de ap pn la temperatura
camerei (nu se va folosi ghea sau ap foarte rece);
4. dup agitare se citete absorbana la 562 nm;
5. cantitatea de protein se calculeaz utiliznd o curb de etalonare;
pentru realizarea acesteia, se pipeteaz, n eprubete curate i uscate,
volumele de soluie standard BSA 0,05 mg/ml i ap distilat prezentate
n Tabelul 18; n continuare se procedeaz urmnd etapele 2-4; valorile

Biologie molecular. Metode experimentale

232

extinciilor se utilizeaz pentru trasarea curbei de etalonare cu ajutorul


creia se calculeaz concentraiile probelor necunoscute.
TABEL 18. Construirea curbei de etalonare pentru dozarea proteinelor prin
micrometoda BCA
BSA
(g)

Soluie standard
BSA 0,05 mg/ml
(l)

Ap distilat
(l)

0.0

500

2,5

50

450

5,0

100

400

7,5

150

350

10,0

200

300

12,5

250

250

15,0

300

200

20,0

400

100

Macrometoda BCA de dozare a proteinelor


Materiale necesare:
1. soluie bicinchoninat de sodiu 1 g bicinchoninat de sodiu, 2 g
Na2CO3 x H2O, 0,16 g tartrat de sodiu, 0,4 g NaOH, 0,95 g NaHCO3
se introduc n 70 ml ap distilat; se ajusteaz pH-ul la 11,25 cu
NaOH 10M i se aduce la 100 ml; reactivul este stabil timp de un an
la temperatura camerei;
2. soluie 0,4% CuSO4 se cntresc 0,4 g CuSO4 i se dizolv n
99,6 ml ap distilat; reactivul este stabil timp de un an la temperatura
camerei;

Determinarea concentraiei proteinelor

233

3. soluie de lucru se amestec reactivii 1 i 2 n proporie de 50:1


(v/v); reactivul se prepar extemporaneu;
4. soluie standard BSA 1 mg/ml se cntresc la balana analitic
100 mg BSA i se transfer cantitativ ntr-un balon cotat de 100 ml; se
dizolv proteina standard n 50 ml ap distilat, dup care se aduce la
semn; dizolvarea se realizeaz cu atenie, pentru a se prentmpina
formarea spumei.
Mod de lucru:
1. probele, coninnd pn la 100 g protein ntr-un volum de
maximum 100 l se pipeteaz n microeprubete Eppendorf; dac
volumul probei este mai mic de 100 l se completeaz cu ap pn
la acest volum;
2. se adaug 2 ml reactiv de lucru i se agit energic;
3. probele se incubeaz timp de 15 minute la temperatura de 60oC,
dup care se rcesc la temperatura camerei ntr-o baie de ap;
4. probele se citesc la 562 nm fa de un control al reactivilor (proba
proteic este nlocuit cu tampon de extracie);
5. cantitatea de protein se calculeaz cu ajutorul unei curbe de
etalonare; pentru realizarea acesteia, n microeprubete curate i
uscate se pipeteaz volume de soluie standard BSA 1 mg/ml i
ap distilat precizate n Tabelul 19; n continuare se procedeaz
urmnd etapele 2-4; cu valorile extinciilor se traseaz curba de
etalonare cu ajutorul creia se calculeaz concentraiile probelor
necunoscute.

Biologie molecular. Metode experimentale

234

TABEL 19. Construirea curbei de etalonare pentru dozarea proteinelor prin


macrometoda BCA

BSA
(g)

Soluie standard
BSA 1 mg/ml
(l)

Ap distilat
(l)

100

10

10

90

20

20

80

30

30

70

40

40

60

60

60

40

80

80

20

100

100

IX.3 Realizarea curbelor de etalonare i


prelucrarea datelor

Indiferent de metoda de dozare utilizat, pentru cuantificarea


concentraiei proteinelor este necesar utilizarea curbelor de etalonare.
Din acest motiv, este absolut necesar precizarea unor detalii legate de
realizarea acestora.
Curbele de etalonare se realizeaz cu ajutorul unor proteine
standard. Rspunsul unui standard este diferit de la o metod de
cuantificare la alta i de asemenea rspunsul diverselor proteine standard
este diferit n cadrul aceleiai metode. De exemplu,10 pg gelatin vor
determina numai 69% din absorbana produs de aceeai cantitate de
albumin seric bovin (BSA) prin utilizarea metodei Lowry (3). Din
aceste motive, pentru a obine rezultate comparabile este absolut necesar
precizarea metodei i a standardului utilizat pentru cuantificare.
Albumina seric bovin (BSA) este proteina cel mai frecvent

Determinarea concentraiei proteinelor

235

utilizat ca standard, n special datorit uurinei n utilizare i costului


mic. BSA are unele dezavantaje, principalul fiind acela c ader de alte
molecule, ceea ce face dificil obinerea repetat, cu o mare fidelitate, a
unor preparate nalt purificate (1). Divei productori pun la dispoziie i
alte molecule proteice care pot fi utilizate drept standard, cum ar fi
imunoglobulina G.
Un alt aspect care trebuie avut n vedere la realizarea curbelor de
etalonare esteobservaia conform creiaconcentraia proteinei poate varia
linear sau non-liniar cu absorbana. Determinarea concentraiei
proteinelor prin msurarea absorbiei la 280 nm este o metod mai puin
sensibil, dar liniar pe un domeniu larg, pe cnd metoda Bradford este
sensibil, dar neliniar, necesitnd construirea unor curbe de etalonare pe
intervale nguste (1).
Realizarea propriu-zis a curbelor de etalonare
n general, pentru realizarea unei curbe de etalonare se aleg cinci
sau ase concentraii din interiorul domeniului de uzabilitate a metodei.
Prin diluarea reactivului standard se obin soluii de anumite concentraii
care se prelucreaz conform cu metoda utilizat n vederea obinerii unor
valori de extincie. Se recomand minimum trei determinri pentru fiecare
concentraie din domeniul utilizat pentru trasarea curbei de etalonare.
Curba de etalonare se poate realiza automat prin utilizarea
funciilor grafice din cadrul programelor de calcul tabelar precum Excel,
OpenOffice sau Mathlab.
n cazul metodelor Lowry i BCA care au un rspuns relativ liniar
(se respect legea Lambert-Beer adic punctele din sistemul de
coordonate extincie concentraie se nscriu pe o dreapt), datele se
reprezint pe un grafic de tip scatter, se traseaz dreapta de regresie i se
calculeaz ecuaia dreptei i coeficientul de regresie.
n cazul metodei Bradford, rspunsul intensitii colorantului la
concentraia proteinei este unul neliniar. Curba de regresie nu mai este o
dreapt, ci descrie o funcie polinomial.
Pentru simplificarea procedurii de obinere a ecuaiei care exprim
dependena concentraiei proteinei de extincie, unii autori sugereaz
reprezentarea datelor pe un grafic tip scatter i inversarea coordonatelor;
astfel pe axa OY se vor nscrie datele referitoare la cantitatea de BSA n
micrograme, iar pe axa OX extinciile. Aceast reprezentare elimin
necesitatea prelucrrii ecuaiei curbei de calibrare i permite utilizarea

Biologie molecular. Metode experimentale

236

direct a aceseia pentru exprimarea concentraiei proteice n proba


necunoscut. Avantajul este evident n cazul metodei Bradford, unde
curba de calibrare este descris de o funcie polinomial. Pentru
exemplificare, vom considera un set de date reale obinute folosind
micrometa Bradford cu BSA drept standard (Tabelul 20). Cu ajutorul
acestor date, reprezentnd pe axa OX concentraia de proteine i pe axa
OY absorbana se obine o curb de regresie descris de urmtoarea
funcie (Figura27, A):

unde:
x cantitatea de protein;
y extincia.
Se poate observa c pentru a determina concentraia n proteine a
unei probe necunscute este necesar rezolvarea unei ecuaii de gradul doi.
Dac valorile se nscriu pe acelai tip de grafic doar c se
inverseaz axele de coordonate n aa fel nct pe axa OY se vor afla
concentraiile de proteine i pe axa OX extinciile corespunztoare, curba
de calibrare polinomial are forma din Figura 27, B i este descris de
ecuaia:

unde:
y concentraia de proteine;
x extincia.
n aceast reprezentare exprimarea concentraiei unei probe
necunoscute se poate realiza direct prin utilizarea formulei, fr a fi
necesar prelucrarea ei.

Determinarea concentraiei proteinelor

237

TABEL 20. Valori ale extinciilor utilizate pentru construirea unei curbe de
etalonare folosind micrometoda Bradford cu etalon BSA 0,05 mg/ml
(pentru fiecare concentraie au fost efectuate trei determinri)
BSA
(g)

Soluie standard
BSA 0,05 mg/ml (l)

Ap distilat
(l)

Extincie
0,001

500

0,001
0,003
0,100

40

460

0,095
0,129
0,204

80

420

0,182
0,183
0,256

120

380

0,227
0,234
0,290

160

340

0,281
0,290

10

0,336

200

300

0,315
0,335
0,374

12
14

240

260

0,358
0,359
0,399

280

220

0,379
0,390
0,435

18

360

140

0,436
0,431
0,467

20

400

100

0,464
0,476

238

Biologie molecular. Metode experimentale

A. Reprezentare clasic, concentraia BSA pe axa OX

B. Reprezentarea sugerat de Coligan (1), concentraia BSA pe axa OY


FIGURA 27. Exemple de curbe de calibrare folosind metoda Braford i BSA
0,05 mg/ml drept soluie standard (datele utilizate pentru generarea curbelor sunt
prezentate n Tabelul 18)
Exprimarea concentraiei proteice din probe necunoscute
Pentru exprimarea concentraiei proteice necunoscute de pe curba
de calibrare se utilizeaz metoda interpolrii. Pentru aceasta este absolut
necesar ca extincia probei necunoscute s fie plasat n intervalul dintre
extincia maxim i minim de pe curba de etalonare. Este de asemenea

Determinarea concentraiei proteinelor

239

recomandat s nu se utilizeze extremele curbelor, n aa fel nct de o


parte i de alta a valorii extinciei nregistrat pentru proba necunoscut s
existe cel puin dou concentraii pentru care s-a determinat extincia cu
ajutorul standardului. O greeal frecvent este aceea de a extrapola
rezultatele, respectiv exprimarea concentraiei unei probe necunoscute cu
extincia mai mare sau mai mic dect valoare maxim, respectiv minim
utilizat pentru realizarea curbei de etalonare. Aceast abordare poate
duce la rezultate eronate n special n cazul metodei Bradford, unde
rspunsul este neliniar.
Pe lng obligativitatea ca probele s aib extincii cuprinse n
intervalul descris de curba de etalonare, este indicat de asemenea
realizarea de diluii seriate ale probei necunoscute. Acestea trebuie s
urmeze comportamentul descris de curba de etalonare. n caz contrar,
comportarea indic prezena unor compui care interfer ceea ce
nseamn c metoda aleas i soluiile utilizate pentru determinarea
concentraiei proteinelor trebuie revizuite.
Un alt aspect, de cele mai multe ori neglijat, este necesitatea
realizrii curbei de etalonare la fiecare determinare (sau cel puin la
prepararea reactivilor de culoare). Operaia este obligatorie n cazul
metodelor Lowry i BCA i recomandat n cazul metodei Bradford.
Bibliografie:
1. Coligan J. E et. al.. (2007) Current Protocols in Protein Science (J.E.,
C., Ed.), p 3.0.13.0.2, 3.1.5, 3.1.8,. John Wiley & Sons Inc.
2. Scopes, R. (1974) Measurement of protein by spectrophotometry at
205 nm, Analytical Biochemistry, 59, 277282.
3. Stoscheck, C. M. (1990) Quantitation of protein, Methods in
Enzymology, 182, 5068.
4. Pace, C. N., Vajdos, F., Fee, L., Grimsley, G., Gray, T. (1995) How to
measure and predict the molar absorption coefficient of a protein.,
Protein science, 4, 241123.
5. Lowry, O. H., Rosebrough, N. J., Farr, A. L., Randall, R. J. (1951)
Protein measurement with the Folin phenol reagent., The Journal
Of Biological Chemistry, 193, 26575.

240

Biologie molecular. Metode experimentale

6. Gornall, A. G., Bardawill, C. J., David, M. M. (1949) Determination


of serum proteins by means of the biuret reaction., The Journal of
biological chemistry177, 75166.
7. Hartree, E. F. (1972) Determination of protein: a modification of the
Lowry method that gives a linear photometric response., Analytical
biochemistry, 48, 4227.
8. Dulley, J. R., Grieve, P. A. (1975) A simple technique for eliminating
interference by detergents in the Lowry method of protein
determination., Analytical biochemistry, 64, 13641.
9. Bensadoun, A., Weinstein, D. (1976) Assay of proteins in the presence
of interfering materials, Analytical Biochemistry, 70, 241250.
10. Artenie, V., Tanase, E. (1981) Practicum de Biochimie Generala.
Editura Univ. Al. I. Cuza Iasi.
11. Bradford, M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of proteindye binding., Analytical biochemistry, 72,
24854.
12. Rosenberg, I. M. (2004) Protein Analysis and Purification: Benchtop
Techniques (Rosenberg, I. M., Ed.), p 128136. Birkhauser Boston.
13. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F.
H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B.
J., Klenk, D. C. (1985) Measurement of protein using
bicinchoninic acid., Analytical biochemistry, 150, 7685.
14. Dennison, C. (1999) A Guide to Protein Isolation (Dennison, C.,
Ed.). Springer.
15. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. (1988)
Investigation of the bicinchoninic acid protein assay: identification
of the groups responsible for color formation., Analytical
biochemistry, 175, 2317.

X. SEPARAREA ELECTROFORETIC
A PROTEINELOR
Electroforeza este o metod de separare care se bazeaz, n
principiu, pe capacitatea particulelor coloidale sau moleculelor ncrcate
electric de a migra, sub influena unui cmp electric generat de doi
electrozi, n direcia electrodului purttor al sarcinii opuse. Viteza de
migrare depinde n principal de dimensiunea sarcinii electrice i din acest
motiv moleculele cu sarcini diferite vor avea o mobilitate electroforetic
diferit, separndu-se n fracii. n principiu, aceast metod poate fi aplicat tuturor macromoleculelor ncrcate electric, separarea realizndu-se
fie n soluii apoase libere, fie pe medii cu rol stabilizator (plci cu
silicagel, filme, geluri) (1).
n general electroforeza este folosit pentru separarea proteinelor,
peptidelor, glucidelor i acizilor nucleici. Utilitatea acestei metode de
separare se refer, n special, la caracterizarea din punct de vedere
calitativ a unui amestec i aprecierea puritii unui compus. Dac se ine
cont de o serie de precauiuni, tehnica poate fi utilizat i n scopul unor
separri cantitative i preparative. Domeniul n care electroforeza i
gsete cea mai mare aplicabilitate este studiul proteinelor, domeniu
denumit proteomic (termen ce desemneaz ansamblul de tehnici i
metode folosite pentru studiul expresiei, localizrii, structurilor, funciilor
i interaciunii proteinelor, introdus pentru prima dat de Wasinger n anul
1995) (1).
Una dintre primele metode de separare electroforetic a fost pus
la punct de Arne Tiselius n anul 1937 (1). Metoda se refer la separarea
fraciilor proteice n interiorul unui tub de forma literei U plin cu
electrolit, fraciile proteice fiind identificate densitometric. Datorit
sensibilitii reduse a acestei tehnici, s-a preferat dezvoltarea metodelor
care folosesc medii stabilizatoare. Electroforeza pe hrtie, utilizat de
acelai Tiselius n anul 1951 pentru separarea proteinelor din ser (2), a
fost urmat de apariia unor medii suport din ce n ce mai complexe:
acetat de celuloz (Kohn, 1957) (3), amidon (Smithies, 1955) (4), plci de
silica-gel pentru analiza poliglucidelor (Scherz, 1990) (5), agaroz i
poliacrilamid. O prezentare mai detaliat a avantajelor, dezavantajelor i
aplicaiilor acestor medii suport este realizat de ctre Dennison, 1999 (6).

242

Biologie molecular. Metode experimentale

De-a lungul timpului au fost adoptate dou soluii tehnice pentru


realizarea separrii electroforetice. Un prim sistem este reprezentat de
electroforeza orizontal, tehnic folosit atunci cnd se utilizeaz
suporturi inerte fa de oxigen (hrtie, plci de silicagel, amidon,
agaroz). Aceast soluie are avantajul simplitii i robusteii aparaturii
utilizate, ea devenind standard pentru electroforeza pe geluri de agaroz.
Al doilea sistem este electroforeza n sistem vertical, tehnic utilizat cu
suporturi care trebuie ferite de oxigen, precum poliacrilamida. n acest
caz, suportul este turnat ntre dou plci din sticl etaneizate lateral,
comunicarea cu electrozii realizndu-se prin prile inferioar i superioar. Aceast soluie tehnic este mai complex deoarece ridic probleme
de etaneizare a compartimentelor electrozilor dar, cu toate acestea, a
devenit standard pentru electroforeza n geluri de poliacrilamid.
Amidonul, agaroza i poliacrilamida nu sunt doar medii suport ci,
datorit structurii i organizrii lor sub form de gel, pot avea un rol activ
n procesul de separare. n cazul n care concentraia gelului este att de
mic nct nu interfer cu migrarea, este vorba despre un gel permisiv,
separarea moleculelor realizndu-se n funcie de ncrcarea electric a
acestora. Prezentarea aplicaiilor practice a acestor tipuri de geluri este
realizat de ctre Westermeier (1). Cnd concentraia gelului este att de
mare nct influeneaz migrarea printr-un efect de filtrare a moleculelor
n funcie de dimensiunea lor (efect de filtrare molecular), ne referim la
geluri restrictive. n acest caz migrarea se realizeaz n funcie att de
sarcina electric a moleculelor ct i de dimensiunile lor. La ora actual
gelurile restrictive cel mai frecvent utilizate n laboratoarele de cercetare
sunt gelurile de agaroz pentru separarea acizilor nucleici (pentru detalii
consultai capitolul VII Separarea electroforetic a ADN-ului, pagina
147) i cele de poliacrilamid pentru separarea proteinelor.
n funcie de scopul separrii i de condiiile de migrare,
moleculele proteice pot fi separate fie n stare nativ (prin realizarea aa
numitei electroforeze native (engl. Native-PAGE), fie n stare denaturat.
Denaturarea proteinelor n catene polipeptidice componente se realizeaz,
cel mai frecvent, prin tratamente cu dodecilsulfat de sodiu (SDS), caz n
care electroforez n condiii denaturante se noteaz SDS-PAGE. Oricare
ar fi sistemul utilizat, dup realizarea separrii propriu-zise, moleculele
proteice trebuie evideniate pe gel prin tehnici specifice de colorare.
Separarea electroforetic a proteinelor se realizeaz, prin urmare, n dou
etape distincte:

Electroforeza proteinelor

243

1. separarea propriu-zis (electroforez nativ sau denaturant, n


funcie de scopul urmrit);
2. evidenierea fraciunilor proteice de interes prin colorare,
autoradiografie sau tehnici imunologice.

X.1 Electroforeza nativ a proteinelor n sistem


discontinuu
Metoda are la baz sistemul de tampon discontinuu propus de
Ornstein, 1964 (7) i Davis, 1964 (8). Iniial, autorii au utilizat pentru
realizarea gelului tuburi n care proteinele se separ sub form de discuri,
motiv pentru care metoda mai poart numele i de disc-electroforez.
Discontinuitatea se refer la 4 parametri (1):
1.

porozitatea gelului gelul conine dou zone de concentraii


diferite, una n zona superioar de concentraie mic (pori de
dimensiuni mari, gel de concentrare) i una n zona inferioar de
concentraie mare (pori de dimensiuni mici, gel de separare);

2.

pH-ul gelului gelul de concentrare are pH-ul 6,8 iar cel de


migrare are pH-ul 8,8;

3.

tria ionic a soluiilor tampon din interiorul gelului gelul de


concentrare conine 0,125 mol/l TRIS-HCl, iar gelul de separare
0,375 mol/l TRIS-HCl;

4.

natura ionilor din gel i din tamponul de electrod; gelul conine


ioni Cl- iar tamponul de migrare glicin.

Principiul metodei
Separare proteinelor n sistemul discontinuu are loc n dou etape,
corespunztoare celor dou geluri:
1. Etapa de concentrare a fraciilor proteice sau etapa de izotachoforez (1)
Probele reprezentate de soluia proteic sunt plasate n gelul de
concentrare, al crui pH este de 6,8. La aceast valoare a pH-ului, glicina
(punctul izoelectric, pI=6,7) este practic lipsit de sarcin electric, iar

244

Biologie molecular. Metode experimentale

clorul este ncrcat negativ. La aplicarea curentului electric, glicina va


avea o mobilitate redus (datorit lipsei sarcinii) iar clorul va avea
mobilitate maxim. Proteinele cu punctul izoelectric (pI) diferit de 6,8, cu
grade diferite de ncrcare vor avea mobiliti intermediare, plasndu-se
ntre frontul glicinei i cel al clorului, realiznd legtura ntre aceste dou
fronturi. Apare astfel o zon n care moleculele proteice se grupeaz, se
concentreaz i se ordoneaz n funcie de sarcin. n aceast zon apar
grupe de proteine ce difer una de cealalt prin sarcin, aceste grupe fiind
ns strns legate una de cealalt i formnd aa-numitul tren de ioni
(1). ntre grupele de proteine nu pot aprea goluri, deoarece aceste goluri
ar duce la ntreruperea circuitului electric. Ca urmare a acestui fapt, n
etapele trzii ale procesului toate moleculele migreaz cu aceeai vitez,
de unde i denumirea de izotachoforez (izo egal, tacho vitez). Cnd
acest tren al ionilor ajunge n zona de contact dintre gelul de concentrare
i cel de migrare, rezistena datorat porilor mici ai gelului de migrare
crete, ceea ce duce la concentrarea proteinelor sub forma unei singure
benzi foarte fine.
2. Etapa de separare a fraciilor proteice.
n gelul de separare, la pH 8,8, glicina este ncrcat negativ i,
datorit masei moleculare mici, continu s migreze mpreun cu frontul
clorului cu o vitez relativ mare, depind frontul proteic ntrziat la
intrarea n acest gel. Proteinele se desprind din trenul ionilor i se separ
n funcie de masa molecular i sarcina electric.
Avantaje:
Acest tip de separare electroforetic este util n experimentele n
care se dorete pstrarea intact a structurii tridimensionale a proteinelor
precum:
1. separarea de enzime n scopuri preparative;
2. identificarea de izoenzime.

Electroforeza proteinelor

245

Limitri:
O atenie deosebit n cazul acestui tip de separare trebuie
acordat punctului izoelectric al proteinelor de interes. n sistemul
discontinuu descris nu pot fi separate proteine al cror pI este mai mare
de 6,8 (la pH-ul gelului de concentrare aceste proteine sunt ncrcate
pozitiv i migreaz spre anod) (1). n general, pentru o bun separare,
sistemul tampon folosit trebuie s fie cu dou uniti de pH mai bazic
dect pI-ul proteinelor de separat. O prezentare detaliat a unor alternative
de sisteme tampon de migrare i aplicaiile lor este realizat de
Chrambach i Jovin, 1983 (9).
Acest tip de electroforez nu poate fi utilizat pentru aprecierea
maselor moleculare relative ale proteinelor, deoarece migrarea se
realizeaz i n funcie de sarcinile acestora. Pentru a nltura acest dezavantaj Niepmann (2006) (10) descrie o metod de separare electroforetic
care utilizeaz colorantul Serva Blue G. Acesta ecraneaz sarcinile native
ale proteinelor i confer acestora sarcini negative. Autorul utilizeaz
aceast metod pentru a aprecia gradul de oligomerizare a proteinelor ns
precizeaz c modul de migrare al moleculelor proteice pe gelurile de
poliacrilamid depinde i de forma acestora.
Materiale necesare:
1. soluie stoc de acrilamid se prepar prin dizolvarea a 29 g
acrilamid i 1 g N-N'-metilen-bisacrilamid (puritate pentru
electroforez) n 100 ml ap distilat; se verific pH-ul soluiei
care trebuie s fie mai mic de 7 i se pstreaz n sticle brune, la
ntuneric, la temperatura de 4oC; este indicat, de asemenea, ca
soluia s fie degazificat sub vid, n vederea eliminrii oxigenului
solvit; soluiile preparate n laborator au o durat de via limitat,
deoarece acrilamida i bisacrilamida se dezamineaz i formeaz
acizii corespunztori, procesul fiind catalizat de lumin i alcalii;
Prezena acidului acrilic n soluia de acrilamid duce la
diminuarea rezoluiei i apariia unor benzi difuze. Soluia de
acrilamid preparat n laborator se poate folosi timp de cteva
luni, dup care trebuie refcut (11); soluia stoc de acrilamid

246

Biologie molecular. Metode experimentale

poate fi achiziionat gata preparat de la productori precum


Biorad, Amersham-Biosciences, Roth; aceste soluii reduc
pericolul contaminrii cu poliacrilamid i au o mai mare
stabilitate n timp datorit aditivilor pe care i conin (un an
flaconul nedesfcut, 6 luni flaconul desfcut) (12).
Acrilamida i bisacrilamida monomere se absorb prin
piele i sunt neurotoxine deosebit de puternice, fiind de
asemenea suspectate de efecte cancerigene. Cntrirea i
prepararea soluiilor se realizeaz cu atenie,
manevrarea fcndu-se cu mnui i purtnd masc de
protecie. Dei poliacrilamida este considerat
inofensiv, este indicat ca manipularea gelurilor s se
realizeze tot cu mnui datorit resturilor de acrilamid
nepolimerizat.
2. tampon TRIS 1,5M, pH 8,8 se dizolv 18,166 g Tris-baz n
80 ml ap distilat i se ajusteaz pH-ul la 8,8 cu HCl, dup care
se completeaz la 100 ml cu ap distilat;
3. tampon TRIS 1 M, pH 6,8 se dizolv 12,114 g Tris-baz n
80 ml ap distilat i se ajusteaz pH-ul la 6,8 cu HCl, dup care
se completeaz la 100 ml cu ap distilat; nu este recomandat
utilizarea TRIS-HCl sau Trisma datorit coninutului mare de
sruri ceea ce conduce la obinerea unor benzi difuze (11); soluia
se pstreaz n sticle bine nchise, la temperatura camerei;
4. TEMED N,N,N',N'- tetrametiletilendiamin;
5. persulfat de amoniu 10% (APS) se prepar prin dizolvarea a
0,1 g persulfat de amoniu n 1 ml ap distilat; soluia se poate
pstra la temperatura de 4oC timp de o sptmn; persulfatul de
amoniu se descompune lent n soluie, motiv pentru care se
recomand utilizarea soluiei proaspt preparate;
6. tampon de electroforez TRIS-glicin (25 mM Tris-base, 250 mM
glicin) se prepar prin dizolvarea a 3,02 g TRIS-baz, 18,8 g
glicin n 1000 ml ap distilat; n cazul utilizrii frecvente se pot

Electroforeza proteinelor

247

prepara soluii de pn la zece ori mai concentrate, efectundu-se


diluarea n momentul folosirii;
7. soluie tampon pentru probe 4X Tris-HCl 200 mM (pH 6,8),
albastru de bromfenol 0,4%, glicerol 40%; soluia se poate prepara
din soluia Tris 1 M pH 6,8; pentru prepararea a 10 ml soluie
tampon pentru probe se dizolv 0,04 g albastru de bromfenol n 4
ml ap distilat, se adaug 2 ml tampon Tris 1 M pH 6,8 (pentru
gelul de concentrare) i 4 ml glicerol; soluia se poate pstra la
temperatura camerei sau la frigider.
Mod de lucru
A. Turnarea gelului de poliacrilamid presupune parcurgerea
mai multor etape.
1. asamblarea plcilor din sticl n vederea turnrii gelului de
poliacrilamid se realizeaz urmnd indicaiile productorului cuvei de
electroforez (Biorad, Apelex etc.). Este necesar s se cunoasc volumul
de gel necesar i dac acesta nu este indicat de productorul cuvei poate fi
determinat prin msurarea cantitii de ap dintre plcile din sticl
montate n vederea turnrii gelului.
ntr-un pahar Erlenmeyer curat se prepar volumul necesar de gel
de migrare urmnd indicaiile din Tabelul 19, exceptnd soluia de SDS
10%. Concentraia gelului depinde de proba de analizat; n general, o
concentraie de 10-12% este un bun nceput pentru analiza unei probe
necunoscute. Componentele trebuie adugate n ordinea nscris n
Tabelul 21 (pagina 250) pentru a mpiedica polimerizarea accidental a
acrilamidei. Coninutul flaconului se agit dup care se trece la etapa
urmtoare.
2. acrilamida se toarn cu atenie n spaiul dintre cele 2 plci din
sticl. Nivelul de umplere se stabilete n aa fel nct pieptenul s poat
fi introdus, iar de la captul acestuia s rmn un spaiu de 1 cm pentru
gelul de concentrare. Peste soluia de acrilamid proaspt turnat se
adaug cu grij etanol, care are rolul de a elimina eventualele bule de aer
care se pot forma la suprafaa soluiei de acrilamid, de a asigura
formarea unei margini superioare drepte i de a nu permite difuzia

248

Biologie molecular. Metode experimentale

oxigenului n soluia de acrilamid (oxigenul inhib procesul de


polimerizare);
3. dup polimerizare (procesul dureaz aproximativ 30 minute sau
mai mult dac APS-ul nu este are calitatea corespunztoare), se elimin
etanolul din partea superioar a gelului, se spal cu ap distilat spaiul
dintre plcile de sticl i se ndeprteaz apa n exces cu hrtie de filtru.
4.ntr-un pahar Erlenmeyer se prepar volumul necesar de gel de
concentrare urmnd indicaiile din Tabelul 22 (pagina 252), exceptnd
soluia de SDS. Componentele se amestec i se trece la punctul 5; etapa
de mogenizare a componentelor nu trebuie s dureze foarte mult timp,
deoarece polimerizarea gelului de concentrare are loc mult mai repede
dect n cazul gelului de separare.
5. soluia se toarn cu atenie peste gelul de separare i imediat se
insereaz pieptenii; acetia trebuie introdui n aa fel nct s nu apar
bule de aer; polimerizarea este complet dup aproximativ 30 minute.
Gelurile pot fi utilizate imediat dup expirarea acestui interval. nainte de
utilizare se scoate pieptenul, se spal godeurile pentru probe cu ap
distilat i se elimin apa n exces. Plcile din sticl ntre care se afl gelul
se asambleaz n cuva de electroforez urmnd indicaiile productorului
iar cuva se umple cu soluie tampon de migrare.
B. Pregtirea probelor
Cantitatea de proteine ce pot fi separate pe un gel depinde de
dimensiunile acestuia. Ca punct de reper, pe un gel n format mini, cu
dimensiunile de 8 x 10 cm i grosimea de 0,1 cm se pot separa amestecuri
de proteine de pn la 25-30 g i proteine purificate pn la 5 g.
ntr-o microeprubet Eppendorf se repartizeaz 5 L tampon
pentru probe 4X n care se adaug soluia de analizat coninut ntr-un
volum X (de maximum 15 l). Se completeaz cu ap distilat pn la
20 l i apoi, cu o sering Hamilton, se ncarc probele n godeurile din
gel.
C. Separarea electroforetic propriu-zis
Cuva de electroforez se conecteaz la o surs de curent i se
seteaz intensitatea curentului ca parametru constant. Valorile variaz n
funcie de dimensiunile gelului utilizat. Pentru un gel n format mini, se
aplic 10 mA/gel pn cnd frontul colorantului atinge limita de separare

Electroforeza proteinelor

249

dintre cele dou geluri, dup care se aplic 15 mA/gel pn cnd frontul
colorantului atinge limita inferioar a gelului.
Dup finalizarea migrrii, plcile din sticl se scot din cuv, se
aeaz pe o foaie de hrtie de filtru i se desfac cu atenie, n vederea
recuperrii gelului. Acestuia i se marcheaz colul din dreapta jos n
vederea orientrii ulterioare. Gelul este apoi plasat ntr-un vas pentru
colorare. Pericolul ruperii gelului la mutarea lui de pe placa de sticl n
vasul de colorare este mult diminuat dac operaia se realizeaz prin
antrenarea gelului cu un jet de ap dintr-o piset.

10%

8%

6%

1,0
1,3
0,05
0,05
0,004
2,3
1,3
1,3
0,05
0,05
0,003
1,9

Acrilamid 30%

Tris 1,5M pH 8,8

SDS 10%*

APS 10%

TEMED

Ap distilat

Acrilamid 30%

Tris 1,5M pH 8,8

SDS 10%*

APS 10%

TEMED

Ap distilat
3,3
2,5

Tris 1,5M, pH 8,8 1,3

4,0

0,006

0,1

0,1

2,5

2,7

4,6

0,008

0,1

0,1

2,5

2,0

5,3

3,8

5,0

5,9

0,009

0,15

0,15

3,8

4,0

6,9

0,012

0,15

0,15

3,8

3,0

7,9

10 ml 15 ml

1,7

Acrilamid 30%

2,6

5 ml

5,0

6,7

7,9

0,012

0,2

0,2

5,0

5,3

9,3

0,016

0,2

0,2

5,0

4,0

10,6

20 ml

6,3

8,3

9,9

0,015

0,25

0,25

6,3

6,7

11,5

0,020

0,25

0,25

6,3

5,0

13,2

25 ml

7,5

10,0

11,9

0,018

0,3

0,3

7,5

8,0

13,9

0,024

0,3

0,3

7,5

6,0

15,9

10,0

13,3

15,9

0,024

0,4

0,4

10,0

10,7

18,5

0,032

0,4

0,4

10,0

8,0

21,2

30 ml 40 ml

12,5

16,7

19,8

0,03

0,5

0,5

12,5

13,3

23,2

0,04

0,5

0,5

12,5

10,0

26,5

50 ml

Volumul fiecrei componente (ml) pentru obinerea volumului


final de:

Ap distilat

Concentraia final Component


a gelului

TABEL 21. Componentele necesare preparrii gelului de separare utilizat n electroforeza nativ sau n SDS -PAGE (dup
Sambrook et al.1989 ) (11)

250
Biologie molecular. Metode experimentale

0,05
0,002
1,6
2,0
1,3
0,05
0,05
0,002
1,1
2,5
1,3
0,05
0,05
0,002

APS 10%

TEMED

Ap distilat

Acrilamid 30%

Tris 1,5M pH 8,8

SDS 10%*

APS 10%

TEMED

Ap distilat

Acrilamid 30%

Tris 1,5M pH 8,8

SDS 10%*

APS 10%

TEMED

0,004

0,1

0,1

2,5

5,0

2,3

0,004

0,1

0,1

2,5

4,0

3,3

0,004

0,1

0,1

0,006

0,15

0,15

3,8

7,5

3,4

0,006

0,15

0,15

3,8

6,0

4,9

0,006

0,15

0,15

10 ml 15 ml

0,008

0,2

0,2

5,0

10,0

4,6

0,008

0,2

0,2

5,0

8,0

6,6

0,008

0,2

0,2

20 ml

0,01

0,25

0,25

6,3

12,5

5,7

0,01

0,25

0,25

6,3

10,0

8,2

0,01

0,25

0,25

25 ml

*component care trebuie eliminat dac se are n vederea realizarea unei electroforeze native

15%

12%

0,05

5 ml

0,012

0,3

0,3

7,5

15,0

6,9

0,012

0,3

0,3

7,5

12,0

9,9

0,012

0,3

0,3

0,016

0,4

0,4

10

20,0

9,2

0,016

0,4

0,4

10,0

16,0

13,2

0,016

0,4

0,4

30 ml 40 ml

0,02

0,5

0,5

12,5

25,0

11,5

0,02

0,5

0,5

20,0

20,0

16,5

0,02

0,5

0,5

50 ml

Volumul fiecrei componente (ml) pentru obinerea volumului


final de:

SDS 10%*

Concentraia final Component


a gelului

Electroforeza proteinelor
251

0,17

0,13

0,01

0,01

0,001

Acrilamid 30%

Tris 1 M pH 6,8

SDS 10%*

APS 10%

TEMED

0,002

0,02

0,02

0,25

0,33

1,4

2 ml

0,003

0,03

0,03

0,38

0,5

2,1

3 ml

0,004

0,04

0,04

0,5

0,67

2,7

4 ml

0,005

0,05

0,05

0,63

0,83

3,4

5 ml

*component care trebuie eliminat dac se are n vederea realizarea unei electroforeze native

0,68

1 ml

0,006

0,06

0,06

0,75

1,0

4,1

6 ml

0,008

0,08

0,08

1,0

1,3

5,5

8 ml

Volumul fiecrei componente (ml) pentru obinerea volumului final de:

Ap distilat

Component

0,01

0,1

0,1

1,25

1,7

6,8

10 ml

TABEL 22. Componentele necesare preparrii gelului de concentrare utilizat n electroforeza nativ sau n SDS-PAGE
(dup Sambrook et al.1989) (11)

252
Biologie molecular. Metode experimentale

Electroforeza proteinelor

253

X.2 Electroforeza proteinelor n condiii


denaturante (SDS-PAGE)
Metoda de separare electroforetic n condiii denaturante propus
este una derivat de la sistemul de separare discontinuu al lui Ornstein i
Davis (7) discutat anterior. A fost introdus pentru prima dat de Laemmli
(13), diferena ntre acest sistem i cel nativ constnd n faptul c
proteinele sunt supuse denaturrii prin aciunea dodecil-sulfatului de
sodiu (SDS), -mercaptoetanolului i temperaturii. SDS-ul este un
detergent ncrcat negativ care are proprietatea de a se lega de catenele
polipeptidice ntr-un raport de 1,4 g detergent / 1 g protein (11). Acest
sistem de separare mai este cunoscut i sub numele de Glicin-SDSPAGE.
Principiul metodei
Separarea n acest caz se realizeaz dup aceleai principii ce
guverneaz i electroforeza nativ. Diferenele apar datorit faptului c,
sub aciunea temperaturii, SDS-ului i -mercaptoetanolului, structura
tridimensional a moleculelor proteice este alterat. Astfel, proteinele sunt
transformate n catenele liniare de aminoacizi. Suplimentar, SDS-ul se
fixeazn pe catenele polipetidice ntr-o cantitate proporional cu
lungimea lor i acraneaz sarcinile datorate ncrcrii aminoacizilor. Toate
proteinele vor fi, prin urmare, ncrcate negativ, dimensiunea sarcinii fiind
direct proporional cu cantitatea de SDS fixat, adic cu lungimea
catenei. n aceast situaie separarea se realizeaz n funcie de un singur
parametru i anume de dimensiunea catenelor polipeptice.
Avantaje:
Metoda este utilizat n scopuri analitice calitative (n vederea
aprecierii gradului de puritate a unui preparat), dar i cantitative (cu o
bun standardizare). Aplicaia cea mai cunoscut este ns aprecierea

Biologie molecular. Metode experimentale

254

maselor moleculare ale proteinelor. n acest caz trebuie fcute urmtoarele


precizri:
1. pentru aprecierea masei moleculare este necesar ca amestecul de
proteine marker (cu mase moleculare cunoscute) s fie supus
electroforezei simultan cu proba de analizat;
2. separarea proteinelor n funcie de masa molecular nu este una
liniar, de aceea se pot aprecia corect masele moleculare doar
pentru proteinele din zona central a gelului;
3. masa molecular relativ a proteinelor poate varia n funcie de
starea de reducere a legturilor disulfidice; prezena legturilor
disulfidice nereduse duce la scderea masei moleculare relative cu
2-4 kDa (14), iar prezena legturilor incomplet reduse duce la
apariia a dou benzi apropiate ca mas; analiza comparativ a
aceleiai proteine tratate i netratate cu ageni reductori poate
oferi informaii legate de prezena punilor disulfidice.
Limitri:
Folosind acest sistem de separare, glicoproteinele migreaz foarte
ncet. Aceast comportare se datoreaz faptului c partea glucidic din
structura glicoproteinelor leag foarte slab SDS-ul. Pentru mbuntirea
vitezei de separare se poate folosi sistemul tampon propus de Poduslo
(1981), care folosete Tris-borat-EDTA ca tampon de migrare (15).
Sistemul de separare al lui Laemmli (Glicin-SDS-PAGE) permite
separarea proteinelor cu mas molecular mai mare de 15 kDa. Pentru
proteinele cu masele moleculare mai mici dect aceast limit este
indicat utilizarea sistemului Tricin-SDS-PAGE descris de Schagger
(2006) (14). Acest sistem nu ofer informaii legate de gradul de
oligomerizare a proteinelor i nu permite aprecierea masei moleculare
native, pentru rezolvarea acestor aspecte fiind necesar utilizarea altor
tehnici precum cromatografia de filtrare prin gel (pentru detalii, consultai
subcapitolul VIII 5 Determinarea maselor moleculare native utiliznd
cromatografia de filtrare prin gel (GF), pagina200).

Electroforeza proteinelor

255

Materiale necesare:
Se utilizeaz aceleai materiale folosite n cazul electroforezei n
condiii native, la care se adaug:
1. tampon de electroforez Tris-Glicin-SDS (Tris-baz, 25 mM
glicin 250 mM, SDS 0,1%) se prepar prin dizolvarea a 3,02 g
Tris-baz, 18,8 g glicin, 10 ml SDS 10% n 1000 ml ap distilat;
n cazul utilizrii frecvente se pot prepara soluii de pn la 10X
mai concentrate, acestea necesitnd diluare nainte de folosire;
2. soluie 10% SDS; aceasta se prepar prin dizolvarea a 10 g SDS n
90 ml ap distilat; pentru dizolvare complet poate fi necesar
nclzirea; soluia se pstreaz la temperatura camerei;

SDS-ul se prezint sub forma unei pulberi fine, uor


antrenat de curenii de aer. Inhalat, pulberea produce
iritarea mucoasei nazale, din acest motiv cntrirea i
manipularea acestui compus trebuie s se realizeze numai
purtnd masca de protecie.

3. soluie tampon pentru probe 4X TRIS-HCl 200 mM (pH 6,8),


albastru de bromfenol 0,4%, glicerol 40%, SDS 8% pentru
prepararea a 10 ml soluie tampon se dizolva 0,04 g albastru de
bromfenol i 0,8 g SDS n 4 ml ap distilat, se adaug 2 ml
tampon TRIS-HCl 1 M pH 6,8 (pentru gelul de concentrare) i
4 ml glicerol; soluia se poate pstra la temperatura camerei sau la
frigider;
4. soluie stoc ditiotreitol (DTT) 1 M se dizolv 0,154 g DTT n
1 ml ap distilat; soluia se pstraz la congelator; n calitate de
agent reductor se poate utiliza i beta-mercaptoetanol n aceeai
concentraie.

Biologie molecular. Metode experimentale

256

Mod de lucru
A. Turnarea gelului de poliacrilamid
Operaia se realizeaz identic ca n cazul electroforezei n condiii
native, cu observaia c n compoziia gelurilor intr i SDS-ul, urmnd
indicaiile din Tabelul 21 (pagina 250) i Tabelul 22 (pagina252).
Concentraia gelului de separare se alege n funcie de dimensiunea
proteinei de interes, urmnd indicaiile din Tabelul 23. De precizat c
rezoluia n limitele superioar i inferioar este redus.
Tabel 23. Dependena dintre concentraia gelului de separare i masele
proteinelor posibil a fi separate (dup Ausubel, 2002) (16)
Concentraie gel de separare
(%)

Limite mase proteine


(kDa)

60 -200

30-95

10

16-70

12

12-60

15

12-45

B. Pregtirea probelor
Cantitatea de proteine ce pot fi separate pe un gel depinde de
dimensiunile acestuia. Ca punct de reper, pe un gel n format mini, cu
dimensiunile de 8 x 10 cm i grosimea de 0,1 cm se pot separa amestecuri
de proteine cu un coninut de pn la 25-30 g i proteine purificate cu un
coninut de pn la 5 g.
ntr-o microeprubet Eppendorf se repartizeaz 5 l tampon pentru
probe 4X n care se adaug soluia de analizat coninut ntr-un volum X
(de maximum 15 l). Se completeaz amestecul cu 2 l soluie DTT 1 M
i ap distilat pn la volumul final de 20 l, dup care se nclzete la
95oC timp de 5 minute. Dup rcire probele se ncarc cu o sering
Hamilton, n godeurile din gel.

Electroforeza proteinelor

257

C. Separarea electroforetic propriu-zis


Se procedeaz identic c i n cazul separrii n condiii
nedenaturante. Gelurile se scot dintre plcile din sticl, se cltesc cu ap
distilat i se prelucreaz n vederea deteciei proteinelor separate dup
una din metodele descrise n continuare.

X.3 Detecia proteinelor separate prin


electroforeza pe geluri de poliacrilamid
Proteinele separate prin electroforez (nativ sau denaturant) pot
fi detectate folosind dou metode distincte:
A. colorarea gelurilor de poliacrilamid,
B. electro-transferul lor pe membrane i identificarea proteinelor utiliznd
tehnici imunologice (pentru detalii consultai capitolul XI Evidentierea
imunologic a proteinelor Tehnica Western-Blot, pagina 273).

Colorarea gelurilor de poliacrilamid n vederea


evidenierii proteinelor
Pentru evidenierea proteinelor separate pe gelurile de
poliacrilamid au fost descrise numeroase protocoale ce pot fi mprite n
doua categorii mari:
1.
coloraii specifice cu care sunt evideniate doar anumite fraciuni
din toate proteinele separate; aceste coloraii se folosesc n special
pentru evidenierea unor enzime; metode specifice, adaptate pentru
diferite tipuri de enzime sunt prezentatate de Manchenko (2002) (17);
2.
coloraii nespecifice care realizeaz colorarea uniform a tuturor
proteinelor separate.
Diversele metode de colorare difer ntre ele prin nivelul de
sensibilitate i prin complexitatea procedurii, aceste dou elemente fiind
eseniale n alegerea protocolului de colorare de urmat (Tabel 24).
Avantajele i dezavantajele fiecrei metode, precum i alte metode de
colorare ce nu sunt menionate n lucrarea curent sunt prezentate de
Westermeier et al. (2008) (18).

Biologie molecular. Metode experimentale

258

TABEL 24. Metode de colorare a gelurilor de poliacrilamid n vederea


evidenierii fraciunilor proteice (dup Gerstein 2001,(12) cu modificri)
Metod de colorare
Coomassie
brilliant blue R-250

Sensibilitate
0,3-1 g/band

Observaii
Simpl, tradiional, cu
sensibilitate
redus.
Recomandat
pentru
gelurile SDS-PAGE, dar
poate fi folosit i pentru
gelurile native (n acest caz
proteinele se coloreaz mai
slab i sensibilitatea scade)

Coomassie brilliant
blue G-250 (coloidal)

100 ng/band

Recomandat pentru toate


tipurile
de
geluri,
sensibilitate
bun
dar
necesit un timp mai
ndelungat de colorare.

Coloraie cu argint

10 ng/band

Sensibilitate foarte bun,


dificil de realizat, necesit o
calitate deosebit de bun a
reactivilor utilizai

Coloraie cupric

10-100 ng/band

Rapid i uor de realizat,


nu poate fi aplicat dect
pentru gelurile cu SDS.

Coloraie cu Zn

10-100 ng/band

Rapid i uor de realizat,


nu poate fi aplicat dect
pentru gelurile cu SDS.

1-8 ng/band

Rapid i uor de realizat,


aplicabil tuturor tipurilor
de geluri, necesit sistem de
achiziie a imaginilor n UV

Colorani
luminescenti
SYPRO
.

tip

Electroforeza proteinelor

259

Colorarea cu Comassie Brilliant Blue R-250


Principiul metodei:
Colorarea cu Comassie Brilliant Blue R-250 este cea mai utilizat
metod de evideniere a proteinelor pe gelurile de poliacrilamid datorit
simplitii sale. Proteinele sunt simultan fixate i colorate utiliznd o
soluie metanolic de Comasssie Briliant Blue R-250 (colorant textil
cunoscut sub numele comercial de Acid Blue 38 (11). Colorantul are
proprietatea de a se lega specific de moleculele proteice, astfel nct
acestea vor aprea colorate n albastru pe un fond transparent. Colorantul
se leag de toate proteinele colorndu-le uniform.
Materiale necesare:
1. soluie pentru colorare se prepar prin dizolvarea a 0,25 g
Comassie Brilliant Blue R250 n 100 ml amestec metanol:acid
acetic:ap distilat 45:10:45 (v/v). colorantul se dizolv n metanol
dup care se adaug apa i acidul acetic;
Metanolul este deosebit de toxic pentru organismul uman.
Ingestia, inhalarea sau absorbia cutanat a unei cantiti
de metanol (> 20 mg%) determin simptome primare
precum depresia sistemului nervos central, cefalee, vertij,
grea, pierderea echilibrului, confuzie, scderea acuitii
vizuale etc., iar dup aproximativ zece ore apar
distrugerea nervului optic i acidoza. Doza letal este de
1-2 ml metanol pur/kg corp.Pentru a se evita intoxicarea
cu metanol se recomand manipularea cu grij a
acestuia, utiliznd echipamente de protecie (halat,
mnui, masc de protecie).
2. soluie pentru decolorare metanol:acid acetic: ap 45:10:45 (v/v);
3. soluie pentru fixare acid acetic 10%;
4. agitator orbital de laborator;

Biologie molecular. Metode experimentale

260

5. vas de colorare cu capac, din material plastic sau sticl.


Mod de lucru
Dupa separarea electroforetic, gelul de poliacrilamid este cltit,
dac este cazul, cu ap distilat pentru ndeprtarea SDS-ului, dup care
este plasat ntr-un vas cu aproximativ 5 volume de soluie pentru colorare
(sau o cantitate suficient pentru a acoperi complet gelul). Se incubeaz
sub agitare timp de aproximativ dou ore, dup care se
ndeprteazcolorantul. Gelul se cltete cu ap distilat pentru
ndeprtarea excesului de colorant, dup care se imerseaz n soluia de
decolorare unde se menine timp de 4-8 ore. n acest timp, soluia de
decolorare se schimb de 3-4 ori, dup ce devine puternic colorat.
Decolorarea este considerat finalizat cnd fundalul devine transparent.
Uneori, dup decolorare, benzile pot fi uor difuze, iar fundalul uor
colorat. Meninerea gelului n soluia de fixare timp de 10-20 ore
conduce la rezolvarea acestor probleme. Timpii de incubare variaz n
limite destul de largi n funcie de dimensiunea gelului, valorile
menionate fiind valabile pentru un gel de format mini.
Odat decolorarea finalizat, gelul poate fi supus analizei prin
fotografiere, scanare, densitometrare(pentru detalii consultai subcapitolul
Fotografierea gelurilor i analiza imaginilor. Stabilirea masei moleculare
relative, pagina 264) sau poate fi pstrat n soluia de fixare pentru
perioade mari de timp. O modalitate mai simpl de pstrare a gelurilor
este uscarea lor, folosind dispozitive specifice. Prin uscare rezoluia
gelului scade, motiv pentru care este indicat ca gelul sa fie mai nti
fotografiat i apoi uscat.
Viteza de decolorare poate fi mrit prin:
a. folosirea unei soluii de metanol 30% i acid acetic 10%;
meninerea prelungit a gelurilor n aceast soluie duce la scderea
intensitii benzilor corespunztoare fraciilor proteice;
b. nclzirea soluiei de decolorare la temperaturi mai mari de
o
45 C; operaia trebuie s se realizeze ns cu atenie deosebit datorit
prezenei metanolului inflamabil i toxic.
Un protocol alternativ de decolorare, care elimin necesitatea
utilizrii metanolului, folosete pentru colorare o soluie de Comassie

Electroforeza proteinelor

261

Brillant Blue R-250 0,25% n isopropanol:acid acetic:ap 25:10:65 (v/v)


iar pentru decolorare etanol:acid acetic:ap 10:10:80 (v/v).

Colorarea cu argint a gelurilor de poliacrilamid


Metodele care folosesc argintul pentru evidenierea proteinelor pe
geluri de poliacrilamid descrise n literatur pot fi mprite n dou
categorii: metode care folosesc argint amoniacal i metode care utilizeaz
nitratul de argint (11). Sunt preferate metodele din ultima categorie,
deoarece soluiile de nitrat de argint sunt mai uor de preparat i nu
genereaz subprodui potenial explozivi. Metoda de colorare prezentat
mai jos a fost descris de Sammons et al. (1981)(19) i modificat de
Schoenle et al. (1984) (20). Metode alternative de colorare utiliznd
argintul sunt descrise i de Ausubel et al. (2004) (16).
Principiul metodei
Metoda se bazeaz pe reducerea difereniat a ionilor de argint
legai de catenele laterale ale aminoacizilor. Gelul este impregnat cu ioni
de argint, care sunt supui apoi unei reacii de reducere sub influena unei
aldehide. Reacia este iniiat de molecule proteice care se vor colora, n
timp ce gelul va rmne incolor.
Avantaje:
-

sensibilitatea neegalat de nici o alt modalitate de evideniere a


proteinelor

poate fi utilizat att pentru geluri obinute prin electroforez n condiii


denaturante, ct i pentru cele obinute prin electroforez n condiii
native, prin izoelectrofocusare sau electroforez bidimensional.

Biologie molecular. Metode experimentale

262

Limitri:
-

sensibilitatea deosebit atrage dup sine o serie de dezavantaje care


se refer n special la uurina cu care o serie de factori interfer cu
procesul de colorare. Respectarea timpilor de incubare, calitatea
reactivilor i curenia ustensilelor utilizate sunt eseniale pentru
obinerea unor rezultate reproductibile.
colorarea proteinelor nu este uniform, ci depinde de compoziia n
aminoacizi a proteinelor luate n studiu. Legarea Ag de moleculele
proteice i prin urmare colorarea sunt dependente de prezena
diverselor grupe funcionale (carbonil, sulfhidril) de pe catena
polipeptidic.

Materiale necesare
1. soluie de fixare etanol:acid acetic: ap 30:10:60 (v/v);
2. etanol 30% n ap deionizat (sau bidistilat);
3. soluie stoc AgNO3 20% n ap deionizat (sau bidistilat); se
pstreaz la temperatura camerei, n vase de culoare brun, bine
nchise; nainte de utilizare se prepar o soluie 0,1% prin diluare
cu ap deionizat (sau bidistilat);
4. soluie carbonat de sodiu 2,5%, formaldehid 0,02% se prepar
extemporaneu prin dizolvarea a 2,5 g carbonat de sodiu i
0,054 ml formaldehid 37% n 97,48 ml ap deionizat (sau
bidistilat);
Vaporii de formaldehid sunt toxici, motiv pentru care
soluia trebuie pregtit sub ni.
5. soluie de stopare acid acetic 1% n ap deionizat (sau
bidistilat)
6. agitator orbital de laborator;
7. vas pentru colorare;
Eventual, dup caz sunt sunt necesare de asemenea i:

Electroforeza proteinelor

263

8. soluie A se prepar prin dizolvarea a 37 g NaCl i 37 g CuSO4


n 850 ml ap deionizat (sau bidistilat); se adaug NH4OH
concentrat pn se formeaz un precipitat albastru care apoi se
dizolv;
9. soluie B se dizolv 436 g Na2S2O3 n 900 ml ap deionizat
(sau bidistilat); se aduce soluia la 1000 ml cu ap deionizat (sau
bidistilat).
Mod de lucru:
1. dup terminarea electroforezei (marcat de momentul n care
frontul colorantului prsete gelul) se desprinde gelul dintre plcile din
sticl i se menine n cel puin cinci volume soluie de fixare timp de
4-12 ore sub uoar agitare; datorit sensibilitii deosebite a metodei este
absolut necesar ca toate etapele de manipulare a gelului s se realizeze
doar cu mnui.
2. se ndeprteaz soluia de fixare, apoi gelul este splat de dou
ori n cel puin 5 volume etanol 30% timp de 30 minute sub agitare:
3. se spal gelul din nou de dou ori n cel puin zece volume ap
deionizat (sau bidistilat) timp de 10 minute, la temperatura camerei, sub
agitare; n aceast etap de rehidratre gelul se va umfla uor.
4. se iniiazcolorarea propriu-zisprin incubarea gelului timp de
30 minute n cel puin cinci volume soluie 0,1% AgNO3 preparat
extemporaneu din soluia stoc.
5. soluia de AgNO3 se arunc i se spal fiecare fa a gelului
timp de 20 minute cu ajutorul unei pisete cu ap deionizat (sau
bidistilat); nu trebuie permis uscarea nici uneia dintre feele gelului,
deoarece aceasta va duce la apariia de artefacte.
6. n vederea dezvoltrii culorii, gelul se incubeaz n soluie
proaspt preparat de carbonat de sodiu 2,5% i formaldehid 0,02%, la
temperatura camerei, sub uoar agitare; n general, benzile vor deveni
vizibile n doar cteva minute; reacia se ntrerupe n momentul n care
benzile prezint intensitatea dorit; aceast etap nu trebuie prelungit
foarte mult timp pentru a se preveni colorarea gelului; reacia se oprete
prin splarea gelului cu acid acetic 1% timp de cteva minute; gelul este
apoi splat de cteva ori cu ap deionizat timp de cte 10 minute;
7. dac pe suprafaa gelului apare un film strlucitor de argint,

264

Biologie molecular. Metode experimentale

acesta poate fi ndeprtat prin splare cu o soluie reductoare preparat


prin combinarea unor volume egale din soluiile A i B i diluarea
amestecului cu trei volume de ap deionizat.
Dup colorare, gelul poate fi imediat fotografiat i pstrat prin
uscare.

X.4 Fotografierea gelurilor i analiza imaginilor.


Stabilirea masei moleculare relative
Gelul rezultat, coninnd fraciunile separate, poate fi analizat prin
vizualizare direct. Realizarea de operaii mai complicate, precum
cuantificarea benzilor, aprecierea maselor moleculare relative sunt dificil
de efectuat i sunt susceptibile de erori doar prin simpla observare cu
ochiul liber. Din aceste motive este preferat utilizarea unor metode
standard, care elimin erorile introduse de subiectivismul operatorului.
O astfel de metod const n fotografierea gelurilor i analiza lor
cu ajutorul programelor specializate. Aceast abordare ofer i avantajul
c imaginea gelului poate fi pstrat pe termen nelimitat i reprodus ori
de cte ori este nevoie.
Achiziia imaginilor gelurilor de poliacrilamid sau de agaroz,
indiferent de coloraia utilizat (vizibil sau cu fluorescen), se poate
realiza fie prin utilizarea unor camere video, fie prin utilizarea unor
scanere.
Camerele video CCD (engl.Charge-Coupled Device) sunt n
general plasate n interiorul unei incinte obscure i permit fotografierea
gelurilor de dimensiuni mici. Ele prezint avantajul c pot achiziiona
semnalul luminos o perioad mai ndelungat de timp, oferind astfel o
sensibilitate mai mare. Camerele cu sensibilitate foare mare au, n
general, senzorul de lumin rcit n mod activ. n comer exist
numeroase soluii de achiziie a imaginilor oferite de productori precum
Bio-RaD (sistemele GelDoc) UVP (sistemele GelDoc IT, BioDoc IT) sau
Vilber-Lourmat (sistemele Bio-Vision).
Scanerele (fie c este vorba de scanere speciale pentru aplicaii de
laborator sau de scanere obinuite de birou) trebuie s fie rezistente la
umezeal i s poat scana n transmitan. Scanerele de birou nu pot fi
utilizate pentru geluri fluorescente (gelurile de agaroz colorate cu
bromur de etidiu). Amersham Biosciences comercializeaz o gam foarte

Electroforeza proteinelor

265

variat de scanere, cu aplicaii multiple.


Dup ce se realizeaz achiziia imaginilor, acestea pot fi prelucrate
i analizate folosind diverse pachete software. n general, productorul
sistemului de achiziie a imaginilor pune la dispoziie aceste programe de
analiz (VisionWorks LS, UVP; Photo-Capt, Vilber-Lourmat; Quantity
One 1-D, Bio-RAD). Exist, de asemenea, soluii independente de
sistemul de achiziie precum ImageQuant TL propus de Amersham
Biosciences. Preurile de achiziie sunt destul de ridicate, ns ofer o
foarte mare uurin de utilizare.
O soluie mai puin costisitoare, dar care cere mult mai multe
cunotine i experien din partea operatorului este ImageJ (21).
Programul, dezvoltat de National Institute of Health (NIH), USA,
folosete tehnologia Java, fiind astfel independent de sistemul de operare.
Gama de operaii pe care o poate realiza este uor de mrit prin
dezvoltarea de plug-in-uri. Acestea, ca i aplicaia n sine, sunt disponibile
gratuit pe site-ul web oficial: http://rsbweb.nih.gov/ij/.
Avantaje:
Programul ImageJ poate fi utilizat pentru aprecierea masei
moleculare relative, Rf-ului, stabilirea concentraiei unei probe
necunoscute folosind fotografia unui gel (indiferent dac este vorba ADN
sau proteine) sau fotografia unei plci de cromatografie n strat subire.
Limitri:
Aplicaia ImageJ nu este foarte uor de utilizat, presupunnd
realizarea i respectarea unor suite de aciuni foarte stricte. Din aceste
motive, procesarea de geluri complexe, cu un numr mare de fraciuni
dureaz foarte mult timp. Programele specializate, menionate anterior, au
avantajul c realizeaz toate aceste etape automat.
Densitometrarea gelurilor nu este cea mai indicat metod pentru
determinarea concentraiei unei proteine dintr-un amestec. Operaia se
poate realiza, dar este necesar utilizarea i raportarea foarte precis la un
set bine stabilit de proteine etalon. Astfel, pentru a obine valori absolute
(mg protein) este necesar ca fiecare gel s conin probe standard cu

266

Biologie molecular. Metode experimentale

concentraii cunoscute. Cele mai indicate sunt standardele care conin


chiar proteina de interes, n lipsa acesteia putndu-se utiliza i proteine
purificate comune (de exemplu albumina seric bovin, BSA). Gama de
concentraii a standardelor trebuie s fie aleas n aa fel nct proba
necunoscut s aib o concentraie intermediar. n acest caz, cantitile
obinute vor fi exprimate ca mg BSA.
Mod de lucru:
n continuare sunt prezentate etapele necesare aprecierii masei
moleculare i concentraiei unei probe pe un gel SDS-PAGE. Trebuie
menionat c aceste etape sunt identice i n cazul cuantificrii unui gel
ADN sau a unei plci cromatografice.
Aprecierea concentraiei unei probe necunoscute se realizeaz
parcurgnd urmtorii pai:
1. se separar electroforetic proba de interes simultan cu
standardele i amestecul de proteine cu mase moleculare cunoscute,
urmnd protocolul descris anterior; Dup separare, gelul este colorat i
fotografiat n format .tif sau .jpeg (Figura 28);

FIGURA 28. Imaginea unui gel SDS-PAGE


cu godeurile marcate n aplicaia ImageJ
1 marker de mas molecular, 2 prob de
concentraie necunoscut, 3,4,5 standarde
coninnd 9; 2,5; 0,5 g protein

Electroforeza proteinelor

267

2. se lanseaz aplicaia imageJ i din meniul File se selecteaz


comanda Open; se indic calea ctre fotografia de interes;
3.se selecteaz Rectangular Selection i se marcheaz primul godeu;
Dreptunghiul ce selecteaz godeul trebuie s fie suficient
de mare astfel nct s poat fi mai apoi mutat pe fiecare
lane n parte; dimensiunea lui nu poate fi modificat dup
selecia primului godeu
Se apas Ctrl+1 (sau se acceseaz Analyze Gels Select first
lane) ceea ce va duce la marcarea i numerotarea primului godeu;
dreptunghiul de selecie este apoi mutat pe urmtorul godeu, i se apas
Ctrl+2 (Analyze Gels Select next lane); se procedeaz astfel cu toate
godeurile de interes, dup care se apas Ctrl + 3 (Analyze Gels Plot
lanes); se va deschide o nou fereastr care va conine densitograma
gelului, fiecare godeu fiind reprezentat pe orizontal; Fraciunile separate
se transform n peak-uri a cror arie este dependent de concentraia
proteinei corespunztoare; n acest punctimaginea de pe ecranul
monitorului este asemntoare cu cea prezentat n Figura 29.

Biologie molecular. Metode experimentale

268

C
FIGURA 29. Interfaa de utilizare a programului ImageJ.

A fereastra principal cu bara de instrumente; B fereastra pentru marcarea


godeurilor: C fereastra cu densitograma gelului

4. se selecteaz Straight line selection i prin trasarea de linii se


stabilete linia de baz pentru fiecare peak; pentru etapa urmtoare este
absolut necesar ca fiecare peak s delimiteze un perimetru nchis;
5. se selecteaz Wand (tracing) tool i se face click pe fiecare peak
corespunztor unei fraciuni care trebuie cuantificat; va aprea o nou
fereastr, n care sunt prezentate ariile peak-urilor msurate; aceste arii
vor fi utilizate pentru aprecierea cantitii de proteine, prin trasarea
unei curbe de etalonare; operaia se poate realiza direct pe hrtie
milimetric sau folosind programe specializate (Ex. Microsoft Excel);
Un exemplu de arii i curb de etalonare (realizat cu standardele 3; 4; 5)
este prezentat n Figura 30.

Electroforeza proteinelor

269

FIGURA 30. Rezultate tipice obinute prin densitometrarea unui gel SDS-PAGE
(A) i trasarea curbei de etalonare (B).
Utiliznd dreapta de etalonare obinut din ariile probelor 3, 4 i 5 se
poate calcula cantitatea de protein din proba necunoscut (proba 2,
mg protein = (5513,820 - 27.94)/688.59 = 7,96 mg.
Pentru aprecierea masei moleculare relative este necesar migrarea
n paralel a unor proteine cu mas molecular cunoscut (n cazul gelului
din Figura 28, godeul 1, Sigma Wide Range Protein Markers). Etapele
care trebuie parcurse sunt identice cu cele folosite pentru aprecierea
concentraiei pn la punctul 3, dup care se procedeaz astfel:
1. se nchide fereastra coninnd densitograma i se rspunde da la
ntrebarea dac se dorete salvarea imaginii; din meniul File se
selecteaz comanda Open i se indic calea ctre imaginea salvat;
2. se selecteaz Straight line selections i cu ajutorul cursorului,
innd tasta Shift apsat se traseaz o linie orizontal de la captul
din stnga al densitogramei pn la vrful peak-ului de interes;
3. se apas Ctrl+M (sau se acceseaz meniul Analyze Measure)
pentru a msura distana marcat; se va deschide o fereastr care
ne arat rezultatul msurtorii (lungimea poriunii marcate i
unghiul); Valoarea unghiului trebuie s fie zero la toate msurtorile;
4. etapele 7 i 8 se repet pentru toate fraciunile (peak-urile)
standard i pentru prob; se msoar de asemenea distana de la
captul din stnga al desitogramei pn la peak-ul corespunztor
frontului colorantului (sau pn la captul din dreapta, dac
colorantul nu este vizibil); rezultatele obinute pot fi salvate n
format .cvs i importate n Microsoft Excel; se mparte distana
obinut pentru fiecare peak la distana corespunztoare

Biologie molecular. Metode experimentale

270

colorantului pentru a obine valoarea mobilitii relative a fraciei


respective (Rf) (22); se construiete o curb de calibrare prin
plasarea pe un sistem de coordonate a valorilor Rf i a valorilor
logaritmului maselor moleculare ale proteinelor standard; de pe
dreapta obinut, prin extrapolare, se poate determina masa
molecular a probei necunoscute.
Bibliografie
1. Westermeier, R. (2005) Electrophoresis in Practice: A Guide to
Methods and Applications of DNA and Protein Separations
(Westermeier, R., Ed.). Wiley-VCH.
2. Kunkel, H. G., Tiselius, A. (1951) Electrophoresis of proteins on filter
paper., The Journal of General Physiology, 35, 89-118.
3. Kohn, J. (1957) An Immuno-electrophoretic Technique, Nature, 180,
986-987.
4. Smithies, O. (1955) Zone electrophoresis in starch gels: group
variations in the serum proteins of normal human adults., The
Biochemical Journal, l61, 629-41.
5. Scherz, H. (1990) Thin-layer electrophoretic separation of
monosaccharides, oligosaccharides and related compounds on
reverse phase silica gel., Electrophoresis, 11, 18-22.
6. Dennison, C. (1999) A Guide to Protein Isolation, p 122-133.
Springer.
7. Ornstein, L. (1964) Disc electrophoresis I. Background and theory,
Annals of the New York Academy of Sciences, 121, 321-49.
8. Davis, B. J. (1964) Disc electrophoresis II. Method and application to
human serum proteins., Annals of the New York Academy of
Sciences, 121, 404-27.
9. Chrambach, A., Jovin, T. M. (1983) Selected buffer systems for
moving boundary electrophoresis on gels at various pH values,
presented in a simplified manner, Electrophoresis, 4, 190-204.
10. Niepmann, M., Zheng, J. (2006) Discontinuous native protein gel
electrophoresis., Electrophoresis, 27, 3949-51.
11. Sambrook, J., Fritsch, E., Maniatis, T. (1989) Molecular Cloning - A
Laboratory Manual, p. 18.47-18.58. Cold Spring Harbour
Laboratory Press.

Electroforeza proteinelor

271

12. Gerstein, A. S. (2001) Molecular Biology Problem Solver: A


Laboratory Guide (Gerstein, A. S., Ed.), p 331-373. Wiley-Liss.
13. Laemmli, U. K. (1970) Cleavage of Structural Proteins during the
Assembly of the Head of Bacteriophage T4, Nature, 227, 680-685.
14. Schgger, H. (2006) Tricine-SDS-PAGE., Nature protocols, 1, 16-22.
15. Poduslo, J. F. (1981) Glycoprotein molecular-weight estimation
using sodium dodecyl sulfate-pore gradient electrophoresis:
comparison of tris-glycine and tris-borate-EDTA buffer systems.,
Analytical Biochemistry,114, 131-9.
16. Ausubel, M. F., Brent, R., Kingston, E. R., Moore, D. D., Seidman, J.
G., Smith, A. J., Struhl, K. (2002) Short Protocols in Molecular
Biology, p 10.1-10.31. John Wiley & Sons.
17. Manchenko, G. P. (2002) Handbook of Detection of Enzymes on
Electrophoretic Gels, Second Edition. CRC Press.
18. Westermeier, R., Naven, T., Hamppker, H. R. (2008) Proteomics in
Practice: A Guide to Successful Experimental Design
(Westermeier, R., Ed.), p 19-27. Wiley-VCH.
19. Sammons, D. W., Adams, L. D., Nishizawa, E. E. (1981)
Ultrasensitive silver-based color staining of polypeptides in
polyacrylamide gels, Electrophoresis2, 135-141.
20. Schoenle, E. J., Adams, L. D., Sammons, D. W. (1984) Insulininduced rapid decrease of a major protein in fat cell plasma
membranes., The Journal of Biological Chemistry, 259, 12112-6.
21. Abramoff, D. M., Magelhaes, J. P., Ram, J. S. (2004) Image
processing with ImageJ, Biophotonics International, 11, 36-42.
22. Garfin, D. (1990) One-dimensional gel electrophoresis, Methods in
Enzymology, 182, 425-441.

XI. EVIDENIEREA IMUNOLOGIC


A PROTEINELOR TEHNICA
WESTERN-BLOT
Tehnicile imunologice i-au gsit un numr foarte mare de utilizri
n proteomic, avnd aplicaii diverse, de la identificarea proteinelor cu
ajutorul anticorpilor pn la purificarea proteinelor prin imunoprecipitare
sau cromatografie de imunoafinitate (1). n cele ce urmeaz sunt
prezentate tehnicile ce stau la baza metodei cunoscute sub numele general
de Western-blot, metod ce are ca scop evidenierea i identificarea
specific a moleculelor proteice transferate pe membrane: producerea
anticorpilor policlonali i imunobloting-ul.

XI.1 Obinerea anticorpilor policlonali. Tehnici


de imunizare
Anticorpii sunt proteine serice care apar n organism ca rspuns la
ptrunderea antigenelor i au capacitatea de a reaciona specific att in
vivo ct i in vitro cu antigenele care le-au indus apariia. Anticorpii
policlonali sunt molecule de imunoglobuline (Ig) produse de diferite
tipuri de limfocite B ca urmare a stimulrii cu un antigen specific ce
prezint mai muli epitopi diferii. Spre deosebire de anticorpii
monoclonali produi de un singur tip de limfocit B fa de un singur
epitop specific, cei policlonali reprezint un amestec de anticorpi, fiecare
fiind determinat i capabil s reacioneze specific cu un anumit epitop din
structura antigenului.
n mod obinuit anticorpii apar n serul sanguin al indivizilor sau
pacienilor care au intrat n contact cu antigenele; cu toate acestea,
anticorpii pot fi obinui i n laborator prin imunizarea unor animale cu
antigene purificate sau parial purificate (2). Cele mai utilizate antigene n
acest sens sunt proteinele sau peptidele, dar se pot folosi i glucide, acizi
nucleici, celule sau esuturi.
Obinerea anticorpilor policlonali depinde n mare msur de

274

Biologie molecular. Metode experimentale

calitatea, cantitatea i puritatea antigenului, precum i de specificitatea i


sensibilitatea reaciei (2). n cazul utilizrii ca antigen a proteinelor,
acestea trebuie s fie pure, putnd fi folosite att formele denaturate ct i
cele native. De asemenea trebuie s se in cont de faptul c eventualii
contaminani care se pot administra mpreun cu antigenul pot declana o
reacie imun mult mai puternic, ceea ce duce la sinteza unor anticorpi
cu o specificitate mai mare pentru contaminant dect pentru proteina de
interes.
Anticorpii policlonali pot fi obinui prin metode mai simple i
ntr-un timp mai scurt n comparaie cu cei monoclonali. Metodele de
obinere necesit echipamente relativ ieftine i disponibile n orice
laborator de biologie molecular. n plus, anticorpii policlonali obinui
prin imunizarea animalelor de laborator ofer i avantajul utilizrii directe
ntr-o serie de tehnici ca imunoprecipitarea, imunobloting-ul sau ELISA
(engl. Enzyme-Linked Immunosorbent Assays).
Alegerea animalelor ce urmeaz a fi imunizate trebuie s in cont
de cteva criterii:
1. specificitatea anticorpilor ce urmeaz a fi obinui: de ex. pentru
obinerea anticorpilor cu o nalt specificitate se prefer utilizarea
unor animale transgenice;
2. relaia dintre specia donor a antigenului i cea a productorului de
anticorpi: cu ct distana filogenetic ntre cele dou organisme
este mai mare cu att potenialul de producere al anticorpilor este
mai ridicat.
3. cantitatea anticorpilor necesar: n funcie de cantitatea de ser
dorit pot fi imunizai oareci i obolani de laborator, hamsteri
sau iepuri; de pild imunizarea iepurilor permite obinerea unui
volum de 25 ml ser la fiecare sngerare fr a pune n pericol viaa
acestuia; pentru experimente la scar mai mic sau pentru
obinerea unor anticorpi cu o specificitate ridicat se pot utiliza i
linii inbred de oareci; utilizarea oarecilor are i un alt avantaj:
datorit taliei mai mici, volumul suspensiei de antigen necesar
pentru imunizare este de asemenea mai mic; n cazul oarecilor la
o singur sngerare se pot obine 0,5 ml ser, dar prin sngerri
succesive se poate ajunge pn la un volum de aproximativ 5 ml (2).
4. este extrem de important ca pentru imunizarea animalelor n
scopul obinerii de anticorpi s se aleag metoda potrivit n
funcie de natura antigenului ce va fi folosit (3).

Western-blot

275

Obinerea anticorpilor policlonali folosind


adjuvantul Freund
Adjuvantul Freund reprezint o emulsie a soluiei care conine
antigenul n ulei mineral de parafin. Amestecul adjuvant-antigen se
administreaz prin injectare avnd rolul de a intensifica rspunsul imun
specific fa de antigenul respectiv (4). n prezena adjuvantului Freund,
proteina-antigen de interes este injectat intramuscular, intradermic sau
subcutanat unui animal de laborator n scopul declanrii unui rspuns
imun i al sintezei anticorpilor specifici. Dac n compoziie se adaug
celule inactivate i deshidratate de micobacterii (de obicei Mycobacterium
tuberculosis), se obine adjuvantul Freund complet. Efectul stimulator al
adjuvantului Freund este foarte intens pentru dozele mici de antigen, fiind
foarte eficient n asociaie cu antigenele proteice, stimulnd sinteza IgG.
Consecutiv primei imunizri, se practic imunizri ulterioare la
4-8 sptmni, continundu-se la intervale de 2-3 sptmni (1). La
intervale regulate se practic sngerarea animalului n scopul obinerii
serurilor imune.
Materiale necesare
1.
2.

animale de imunizat: iepuri, obolani, oareci sau hamsteri;


adjuvantul Freund complet;

3.
4.
5.
6.

Adjuvantul Freund complet este un agent inflamator


extrem de puternic, n special n situaia n care este
injectat intradermic sau ptrunde n ochi; poate cauza
descuamarea profund a pielii sau pierderea vederii;
injectarea poate determina o reacie pozitiv la testul
pentru tuberculoz i poate duce la reacii granulomatoase;
se recomand utilizarea mnuilor i a ochelarilor de
protecie atunci cnd se manipuleaz acest reactiv.
proteina-antigen de interes purificat;
adjuvantul Freund incomplet;
tuburi centrifug de 50 ml;
seringi de 3 ml cu ace sterile.

276

Biologie molecular. Metode experimentale

Modul de lucru
1. nainte de prima imunizare se practic sngerarea animalului i se
colecteaz snge n tuburi de centrifug de 50 ml; pentru obinerea serului
sanguin pre-imun se procedeaz dup cum urmeaz:
se las tuburile de centrifug ce conin sngele recoltat 4 ore la
temperatura camerei pn la coagulare, apoi se pstreaz peste noapte la
4oC.
se deprind cu atenie cheagurile de pe pereii tubului de centrifug
i se ndeprteaz cu ajutorul unui aplicator de lemn;
se transfer serul ntr-un tub de centrifug curat;
se centrifugheaz 10 minute la 4000 rpm i 4oC i se pstreaz
supernatantul;
se stocheaz serul n alicote la -20oC (unele seruri i pierd
activitatea prin cicluri succesive congelare-decongelare; altele sunt
instabile la 4oC).
Serul preimun este utilizat ca un control pentru a avea certitudinea
c anticorpii detectai la sngerrile ulterioare se datoreaz imunizrii i
nu unui contact anterior al animalului cu antigenul (element extrem de
important n special dac proteina de imunizat provine de la bacterii
potenial patogene).
2. se agit adjuvantul Freund complet pentru dispersia celulelor
inactivate de Mycobacterium tuberculosis; se adaug 2 ml din adjuvantul
Freund complet n 2 ml soluie ce conine 0,25-0,5 mg protein-antigen;
aceste volume sunt suficiente pentru imunizarea a 4 iepuri sau 80 de
oareci (1);
3. amestecul adjuvant Freund complet protein este introdus ntr-o
sering de 3 ml, nlturndu-se excesul de aer; cu ajutorul unui conector
se leag aceast sering de o alt sering steril de volum asemntor;
dispozitivul obinut se utilizeaz pentru omogenizarea amestecului
adjuvant Freund complet protein care este forat s treac dintr-o
sering n alta n mod repetat; cnd amestecul este omogen i alb se
deconecteaz dispozitivul i se verific stabilitatea emulsiei obinute prin
depunerea unei picturi la suprafaa apei, dintr-un pahar Berzelius: o
emulsie bun va rmne la suprafaa apei sub forma unei picturi; dac
pictura disperseaz pe suprafaa apei se repet operaiunea de

Western-blot

277

omogenizare pn la formarea unei emulsii stabile. Emulsionarea se poate


realiza i prin vortex-area puternic a amestecului.
4. se transfer toat emulsia adjuvant-protein ntr-o sering
prevzut cu ac steril i se ndeprteaz excesul de aer;
5. se injecteaz animalul de experien cu emulsia adjuvant-protein
intramuscular, intradermic sau subcutanat n locuri diferite;
6. se produce sngerarea animalului la 10-14 zile dup prima
imunizare n scopul obinerii serului imun; acest ser se caracterizeaz
printr-un titru sczut i o afinitate redus a anticorpilor.
7. pentru imunizrile ulterioare se prepar din nou proteina-antigen
de interes repetnd paii 2-4; dac la prima imunizare s-a utilizat
adjuvantul Freund complet, pentru toate imunizrile ulterioare se va
utiliza numai adjuvant Freund incomplet;
8. se practic o nou imunizare la 4-8 sptmni de la prima
imunizare; dup 7-14 zile se produce sngerarea animalului i se
recolteaz sngele n vederea obinerii serului imun; n unele cazuri se
poate realiza a doua imunizare la 2 sptmni dup prima, ns ideal ar fi
ca distana n timp s fie de cel puin 19 zile (1);
9. ulterior se pot realiza alte imunizri la intervale de 2-3 sptmni;
dup 10-14 zile de la fiecare imunizare se recolteaz sngele i se prepar
serul imun; dup a treia imunizare se obine primul ser cu un titru ridicat
al anticorpilor; dac titrul anticorpilor specifici este mai mic de 1 mg/ml,
se recomand imunizri ulterioare.
Trebuie avut n vedere faptul c imunizrile repetate prin injectare
intradermic pot produce ulceraii ale pielii; din acest motiv se recomand
ca prima imunizare intradermic s fie urmat de imunizri ulterioare prin
injectare intramuscular (1).
Evoluia rspunsului imun este similar la iepuri, obolani, oareci
i hamsteri. n cazul majoritii antigenelor solubile de natur proteic
sinteza anticorpilor specifici debuteaz dup 5-7 zile de la prima
imunizare. Titrul anticorpilor continu s creasc pn n ziua a 12-a dup
care ncepe s scad. n cazul rspunsului imun secundar generat de
imunizrile ulterioare, vrful produciei de anticorpi se nregistreaz la
7-14 zile de la injectarea antigenului, cnd se realizeaz i sngerarea
animalului. Datorit existenei limfocitelor B cu memorie se poate obine

278

Biologie molecular. Metode experimentale

un rspuns specific pn la 6 luni sau un an de la ultima imunizare.


Afinitatea i gradul de specificitate al anticorpilor crete odat cu
numrul de imunizri efectuate.
Serurile imune obinute pot fi utilizate direct pentru analizele
ulterioare Western blot.

XI.2 Imunobloting-ul
Tehnicile de imunobloting sau Western bloting-ul se utilizeaz n
scopul identificrii unor proteine recunoscute specific de anticorpi
monoclonali sau policlonali. Termenul de Western bloting a fost folosit
pentru prima dat de Burnette (5) cu referire la metoda imobilizrii
proteinelor pe membrane dezvoltat de Towbin i colab (6).
n scopul identificrii, proteinele sunt separate electroforetic
folosind SDS-PAGE (pentru detalii consultai capitolul X Separarea
electroforetic a proteinelor, pagina 241), dup care sunt transferate pe
membrane de nitroceluloz, nailon sau difluorur de poliviniliden.
Proteinele transferate se leag de suprafaa membranei utilizate, furniznd
suprafaa de reacie cu reactivii de imunodetecie.
Imuno-detecia propriu-zis const n tratarea membranei cu un
anticorp primar care se leag specific de proteina de interes. Situsurile de
legare rmase libere sunt apoi blocate prin imersarea membranei ntr-o
soluie ce conine un agent de blocare (o protein sau un detergent inert
din punct de vedere imunologic). Membrana este splat i apoi tratat cu
un anticorp secundar anti-IgG ce se va lega de anticorpul primar.
Anticorpul secundar este modificat n mod specific, n sensul c este
cuplat cu o enzim ce poate genera n prezena unui substrat cromogen,
produs colorat ce marcheaz prezena proteinei de interes.
O variant mai simpl de imunobloting este reprezentat de dot
blot. n acest caz proteinele de interes nu mai sunt separate electroforetic,
ci sunt depuse direct pe membran sub forma unui spot. Dot blot-ul este o
tehnic preliminar folosit pentru identificarea antigenului ntr-o prob.

Western-blot

279

Electro-transferul proteinelor pe membrane n


sistem semi-uscat
O metod eficient de transfer a majoritii proteinelor din gelul
de poliacrilamid pe membrane diverse este reprezentat de blot-ul semiuscat. n acest caz, gelul de poliacrilamid este plasat orizontal, peste
membran, ntre foi de hrtie de filtru saturate cu soluie tampon (Figura
31). Electrozii sunt pui n contact direct cu foile de hrtie de filtru, foarte
aproape unul de cellalt. Prin aplicarea unui curent de la o surs de curent
standard precum cea utilizat pentru electroforez, proteinele ncarcate
negativ vor migra rapid din pe gelul de poliacrilamid pe membrana(7).
Catod

Hrtie de filtru mbibat


n soluie tampon
Gel
Membran de
nitroceluloz
Hrtie de filtru mbibat
n soluie tampon

Plac anod

Anod
FIGURA 31. Schema sistemului de electrotransfer semi-uscat al proteinelor pe
membrane

280

Biologie molecular. Metode experimentale

Principiul metodei
Identificarea unei proteine prin imunobloting se bazeaz pe reacia
specific antigen-anticorp. Proteinele separate electroforetic sunt
transferate de pe geluri pe membrane datorit proprietii lor de a migra n
cmpurile electrice n funcie de ncrcarea lor. Ulterior membranele sunt
incubate n prezena unui anticorp primar care se leag specific de
proteina de interes. Anticorpul primar ofer situsuri de recunoatere
pentru un anticorp secundar care este cuplat cu o enzim ce permite
vizualizarea uoar printr-o reacie cromogen.
Avantaje:
Tehnicile de imunobloting se utilizeaz n principal pentru studiul
expresiei, purificrii i modificrilor proteinelor avnd numeroase
aplicaii n cercetare i diagnosticul clinic (8). Dei iniial a fost folosit
doar pentru identificarea unor proteine din amestecuri migrate
electroforetic, ulterior imunobloting-ul a fost combinat cu electroforeza
bidimensional i spectrometria de mas permind studiul isoformelor cu
reactivitate ncruciat ale aceleai proteine rezultate prin modificri posttranslaionale sau clivaje proteolitice (9).
Aplicaiile n diagnosticul de laborator se bazeaz pe identificarea
unor antigene de natur proteic asociate cu diferii patogeni, alergeni sau
tumori, folosind ca surs de anticorpi primari serul pacientului.
Limitri:
Metoda se bazeaz pe reacia specific dintre un anticorp i
proteina corespunztoare. Deoarece pe parcursul electroforezei proteinele
sufer un proces de denaturare, recunoaterea acestora de ctre anticorpii
specifici poate avea de suferit. Din acest motiv eficiena unui anumit
anticorp de a se lega specific de proteina corespunztoare trebuie
determinat mai nti empiric. Frecvent anticorpii diponibili comercial
sunt caracterizai de productori din punctul de vedere al eficienei lor n
diferite aplicaii (Western blot, imunoprecipitare).

Western-blot

281

Materiale necesare:
1. gel SDS-PAGE pe care a fost separat amestecul proteic
2. membran de transfer din nitroceluloz (0,45 m); se manipuleaz
doar cu mnui.
3. tampon transfer: 25 mM TRIS-HCl, 150 mM glicin, 0,02% SDS,
20% (v/v) metanol; nu se ajusteaz pH-ul, acesta fiind 8,2-8,4;
4. hrtie Watmann
Modul de lucru:
Separarea electroforetic
Prima etap const n separarea amestecului de proteine folosind
electroforeza SDS-PAGE, ceea ce permite o ordonare a proteinelor n
funcie de masele moleculare (Pentru detalii privind realizarea acestei
etape consultai capitolul X Separarea electroforetic a proteinelor,
pagina 241).
Electro-transferul proteinei de interes pe membrane de nitroceluloz
1. se aeaz 4 foi de hrtie de filtru saturate cu soluie tampon de
transfer peste placa anod;
2. peste acestea se aeaz membrana de nitroceluloz echilibrat n
prealabil 5 minute n soluie tampon de transfer; se ndeprteaz
bulele de aer cu ajutorul unei eprubete care se ruleaz peste
ansamblul format din hrtia de filtru i membrana de
nitroceluloz;
3. se aeaz gelul de poliacrilamid peste membran; se ruleaz cu
grij eprubeta peste gel pentru ndeprtarea eventualelor bule de
aer i asigurarea un contact intim ntre aceasta i membran;
4. se adaug 4 foi de hrtie de filtru saturate cu soluie tampon de
transfer peste gel i se ndeprteaz bulele de aer; deasupra se
amplaseaz placa catod, iar ntreg ansamblul format se strnge cu
ajutorul unor uruburi;
5. se conecteaz aparatul la o surs de electroforez i se realizeaz
electro-transferul timp de o or la 250 mA;

Biologie molecular. Metode experimentale

282

Imunodetecia proteinelor transferate pe


membrane de nitroceluloz
Materiale necesare
1. soluie Ponceau S: 0.2% (w/v) Ponceau S n 10% (w/v) acid
acetic;
2. tampon TBS: 20 mM TRIS-HCl, 500 mM NaCl, pH 7,5;
3. tampon TTBS: tampon TBS, 0,5 ml Tween 20/L;
4. tampon blocare (10X): 500 mM TRIS-HCl, 1,5M NaCl, pH 7,5; la
prepararea soluie 1X se adaug Tween 20 0,5%;
5. tampon carbonat: 0,1 M NaHCO3, 1 mM MgCl2, pH 9,8;
6. anticorp primar se poate utiliza direct serul imun obinut prin
sngerarea animalului imunizat cu proteina de interes;
7. anticorp secundar cuplat cu fosfataz alcalin;
8. tampon pentru developare: 20 ml tampon carbonat, 60 l clorur
de nitroblue tetrazoliu, soluie 1,5% 5-bromo-indolil-fosfat
(substrat pentru fosfataza alcalin);
Mod de lucru:
1. dup realizarea electrotransferului se desface aparatul, se scoate
membrana i se spal cu ap distilat;
2. se coloreaz membrana de nitroceluloz pentru 5 minute cu soluie
Ponceau S; dup evidenierea benzilor se noteaz cu un creion
poziia marker-ilor de mas molecular folosii la electroforeza
SDS-PAGE;
3. se decoloreaz membrana 5 minute cu ap distilat;
4. se introduce membrana n soluie tampon de blocare i se
pstreaz pentru 30 minute;
5. se introduce membrana 5 minute n soluie tampon TBS;
6. se incubeaz membrana la temperatura camerei pentru 2 ore n
soluie tampon TBS n prezena serului imun care conine

Western-blot

283

anticorpul primar, specific pentru proteina de interes (20 ml TBS +


10 l ser imun);
7. dup incubare se spal membrana n soluie tampon TTBS pentru
30 minute;
8. se incubeaz membrana la temperatura camerei pentru o or n
soluie tampon TBS n prezena anticorpului secundar cuplat cu
fosfataza alcalin (20 ml TBS + 10 l soluie anticorp secundar);
9. se spal membrana n soluie tampon TBS 10 minute;
10. se spal membrana n soluie tampon TTBS 10 minute;
11. se menine 10 minute n soluie tampon carbonat;
12. se developeaz membrana n soluie tampon de developare agitnd
uor timp de 2-3 minute;
13. imediat dup apariia benzilor se spal cu ap distilat i se usuc
membrana ntre dou foi de hrtie de filtru.
Bibliografie
1.

2.

3.
4.
5.

Smith, J., A. (2003) Immunology - Introduction in Current


Protocols in Molecular Biology (Ausubel, F. A., Brent, R.,
Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl,
K., Eds.), p 11.0.1-11.0.3. John Wiley & Sons.
Cooper, H. E., Paterson, Y. (2003) Preparation of Polyclonal
Antisera in Current Protocols in Molecular Biology (Ausubel, F.
A., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith,
J. A., Struhl, K., Eds.), p 11.12.1--11.12.9. John Wiley & Sons.
Burns, R. (2005) Immunization Strategies for Antibody
Production in Immunochemical Protocols (Burns, R., Ed.), p 317.
Humana Press Inc., Totowa, New Jersey.
Mihaescu, G. (2001) Imunologie si imunochimie, p 456. Editura
Universitatii din Bucuresti.
Burnette, W. N. (1981) Western Blotting: Electrophoretic
transfer of proteins from sodium dodecyl sulfate-polyacrylamide
gels to unmodified nitrocellulose and radiographic detection with

284

6.

7.

8.
9.

Biologie molecular. Metode experimentale

antibody and radioiodinated protein A, Analytical Biochemistry,


112, 195-203.
Towbin, H. (1979) Electrophoretic Transfer of Proteins from
Polyacrylamide Gels to Nitrocellulose Sheets: Procedure and Some
Applications, Proceedings of the National Academy of Sciences,
76, 4350-4354.
Gallagher, S., Winston, S. E., Fuller, S. A., Hurrel, J. G. R. (2003)
Immunoblotting and Immunodetection in Current Protocols in
Molecular Biology (Ausubel, F. A., Brent, R., Kingston, R. E.,
Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., Eds.), p
10.8.1--10.8.24. John Wiley & Sons, Inc.
Negritto, M. C., Manthey, G. M. (2008) Overview of Blotting in
Current Protocols Essential Laboratory Techniques (Gallagher, S.
R., Wiley, E. A., Eds.), p 806. John Wiley & Sons.
Magi, B., Liberatori, S. (2005) Immunoblotting Techniques in
Immunochemical Protocols (Burns, R., Ed.) Third Edit., p 227-265.
Humana Press Inc., Totowa, New Jersey.

XII. METODE COMPUTAIONALE DE


STUDIU A PROTEINELOR
Dezvoltarea metodelor moderne de investigare a proprietilor
acizilor nucleici, precum PCR, clonarea i secvenierea au condus la
acumularea unor cantiti uriae de informaii sub form de secvene de
nucleotide i, bineneles, la dezvoltarea unor metode i tehnici specifice
de analiz i prelucrare a acestora. Dac pn acum singura modalitate de
identificare a secvenei de aminoacizi a unei proteine era degradarea
Edman, la momentul actual stabilirea structurii primare a unei proteine
din secvena de nucleotide a genei ce o codific a devenit o operaie
simpl, accesibil oricrui cercettor. Mai mult, se poate spune chiar c
asistm la o adevrat revoluie n domeniul metodelor de studiu a
proteinelor (1), revoluie ce permite deducerea att a structurii ct i a
funciei unei proteine din secvena genei codificatoare.
Toate metodele care manipuleaz sau analizeaz secvene de
aminoacizi sau nucleotide folosesc puterea de calcul a computerului. Prin
analogie cu denumirile in-vivo i in-vitro i datorit faptului c principala
component a computerului implicat n calcule este procesorul
confecionat din siliciu, aceast clas de metode computaionale a primit
denumirea generic de metode in-silico. Pe parcursul acestui capitol vom
prezenta un set de metode care permit stabilirea nu doar a structurii
primare i secundare a unei proteine de interes, ci i obinerea de
informaii valoroase legate de funcia acesteia plecnd doar de la secvena
de nucleotide a genei ce o codific.
n momentul n care secvena unei proteine a fost stabilit, fie prin
secvenierea proteinei izolate, fie prin secvenierea genei codificatoare i
realizarea translrii in-silico, se ncearc identificarea de secvene
similare din alte organisme folosind programul BLAST. n acest fel
obinem informaii care pot indica dac gena/proteina vizat este suficient
de interesant din punct de vedere tiinific i dac merit continuarea
experimentelor. Dac de exemplu, secvena identificat este similar cu o
secven a unei proteine cunoscute care denot clar o contaminare, studiul
poate fi oprit din stadiul incipient, economisind astfel timp, energie i
resurse.

286

Biologie molecular. Metode experimentale

Metode mai sofisticate de analiz pot fi utilizate ulterior pentru a


calcula structura secundar i teriar a proteinei de interes utiliznd
tehnici de modelare in-silico. Dei aceste metode nu sunt nc foarte
precise, rata lor de succes nu este deloc de neglijat (60-80%), iar
informaiile obinute sunt utilizabile pentru a formula ipoteze sau pentru a
schia un anumit plan de realizare a experimentelor (1). Scopul final al
oricrei investigaii este acela de a preciza rolul proteinei de interes i de a
nelege relaia dintre structura acesteia i funcia pe care o realizeaz,
obiective care pot fi realizate prin experimente de docking in-silico.
Pentru exemplificarea metodelor i programelor care pot fi
folosite, vom utiliza secvena de nucleotide a unei gene amplasate pe
megaplasmidul pAO1 din Arthrobacter nicotinovorans (2). Secvena
ntregului plasmid este disponibil n GenBank cu ID-ul AJ507836.1.
Gena selectat este orf388, care ncepen poziia 39724, se termin n
poziia 40893, are ID-ul CAD47898.1 i codific o xiloz-dehidrogenaz.

XII.1 Fiiere FASTA i operaii simple cu secvene


Secvena de nucleotide a genei de interes (sau a unui fragment din
aceasta) poate fi obinut fie experimental, prin secvenierea ADN-ului,
fie prin descrcarea acesteia dintr-o baz de date specializat (precum
GeneBank (3); pentru detalii consultai subcapitolul XII.2 Baze de date
cu informaii despre proteine, pagina290). n ambele cazuri, aa-numita
secven este reprezentat de un fiier care conine succesiunea specific
de nucleotide alturi de, eventual, alte informaii. Exist numeroase tipuri
de fiiere cu secvene de nucleotide sau aminoacizi, ns fiierele tip
FASTA tind s devin un standard datorit simplitii lor deosebite. Un
fiier FASTA(Figura 32) poate conine o secven de aminoacizi sau de
nucleotide i este de fapt un simplu fiier text. Primul rnd de text, marcat
cu >conine o serie de informaii cu caracter opional, precum numrul
de ordine n GeneBank, specia sau denumirea genei (proteinei).
Urmtoarele rnduri conin secvena propriu-zis, n care
nucleotidele/aminoacizii sunt reprezentai folosind codul standard IUPAC
cu o singur liter (pentru detalii, consultai Tabelul A6 ce conine codul
pentru nucleotide i Tabelul A7 ce conine codul pentru aminoacizi, aflate
n anex). Un fiier de tip FASTA poate conine mai multe secvene care
sunt desprite una de cealalt printr-un rnd care ncepe cu semnul >.

Metode computaionale

287

FIGURA 32. Structura fiierului FASTA coninnd secvena megaplasmidului


pAO1 (GI. 25169022)
Dup obinerea secvenei de nucleotide a genei de interes n
format FASTA, aceasta poate fi folosit direct pentru a obine o serie de
informaii legate de secvena proteinei codificate, masa molecular sau
punctul izoelectric. Exist numeroase programe care pot conduce la
obinerea acestor informaii. Cel mai simplu de utilizat este programul
Sequence Manipulation Suite (SMS) care reprezint o suit de programe
scrise n Java ce permit generarea, formatarea i analiza secvenelor de
ADN i proteine de dimensiuni mici. SMS poate fi accesat din browser-ul
web la adresa http://www.bioinformatics.org/sms2/index.html sau poate fi
rulat local, fiind compatibil cu orice sistem de operare.
Folosirea acestei suite de programe se rezum la deschiderea
paginii mai sus menionate n browser-ul web. n partea dreapt a paginii
accesate (Figura 33) se regsesc listate toate funciile disponibile.
Accesarea oricrei funcii va conduce la deschiderea unei csue n care se
scrie sau se copiaz secvena de interes n format FASTA. n Tabelul 25
sunt prezentate cele mai utilizate operaii pe care le poate realiza SMS.

Biologie molecular. Metode experimentale

288

A
FIGURA 33. Utilizarea SMS pentru a realiza translarea secvenei de nucleotide a
genei orf388 n secven de aminoacizi
A funcii selectabile n SMS conform Tabelului 27, B csu text n care a fost
inserat secvena genei orf388 n format FASTA

TABELUL 25. Principalele operaii cu secvene care pot fi realizate cu suita de


programe SMS
Denumire
operaie*

Descriere

Convertire ntre diverse formate


Combine FASTA

permite combinarea a dou sau a mai multe


secvene n format FASTA i obinerea unei
singure secvene

Metode computaionale

Denumire
operaie*

289

Descriere

EMBL to FASTA

permite convertirea unei secvene din formatul


EMBL n formatul FASTA; funcia este util n
situaia n care se dorete eliminarea rapid a
informaiilor care nu au legtur cu secvena de
ADN dintr-un fiier EMBL

Filter DNA

elimin caracterele care nu corespund codului


standard IUPAC pentru ADN-ul dintr-o secven
(inclusiv spaii, numere, etc)

Filter Protein

elimin caracterele ce nu corespund cu codul


standard IUPAC de o liter pentru aminoacizi
dintr-o secven (inclusiv spaii, numere etc.)

GenBank to
FASTA

permite convertirea unei secvene din formatul


GenBank n formatul FASTA; funcia este util
n situaia n care se dorete eliminarea rapid a
informaiilor care nu au legtur cu secvena de
ADN dintr-un fiier GenBank

One to Three

permite convertirea unei secvene de


aminoacizi din codul standard IUPAC de o liter
n cel de trei litere

Analiza secvenelor
Codon Plot

analizeaz frecvena de utilizare a codonilor


dintr-o secven de ADN i genereaz un grafic
cu aceste frecvene

Codon Usage

analizeaz frecvena de utilizare a codonilor


dintr-o secven de ADN i poate fi utilizat
pentru a identifica preferina pentru un anumit
codon sinonim

DNA Molecular
Weight

calculeaz masa molecular a uneia sau a mai


multor secvene de ADN

DNA Stats

calculeaz frecvena fiecrei nucleotide ntr-o


secven dat, rezultatele fiind exprimate n
procente

Biologie molecular. Metode experimentale

290

Denumire
operaie*

Descriere

PCR Primer Stats

analizeaz i calculeaz proprietile specifice


ale unui set indicat de primeri, inclusiv
temperatura de topire i procentul de GC

PCR Products

realizeaz amplificarea virtual prin PCR a


unei secvene date folosind un set de primeri
indicat de utilizator

Protein Isoelectric
Point

calculeaz valoarea teoretic a punctului


izoelectric pentru o secven dat

Protein Molecular
Weight

calculeaz valoarea teoretic a masei


moleculare pentru una sau mai multe secvene
de aminoacizi

Protein Stats

calculeaz frecvena fiecrui aminoacid ntr-o


secven dat, rezultatele fiind exprimate n
procente

Translate

realizeaz translaia i transcripia virtual a


unei secvene de ADN date, utilizatorul avnd
posibilitatea de a alege cadrul de citire specific

Reverse Translate

realizeaz procesul invers fa de Translate,


acceptnd o secven de aminoacizi i genernd
secvena ADN corespunztoare

* corespunztoare cu denumirea din suita de programe SMS

XII.2 Baze de date cu informaii despre proteine


n aceast er a informaticii i internetului, bazele de date
accesibile on-line conin informaii variate precum secvene, structuri sau
articole tiinifice, devenind un instrument esenial pentru cercettorii care
activeaz n domeniul biologiei moderne n general i al biologiei
moleculare n particular. n proteomic, cantitatea uria de informaii

Metode computaionale

291

generate zilnic legate de rolul, structura i secvena macromoleculelor


proteice nu poate fi organizat dect cu ajutorul bazelor de date
computerizate. Interogarea bazelor de date trebuie s constituie prima
etap din orice studiu, deoarece altfel de informaii cunoscute despre
subiectul studiat ar putea fi trecute cu vederea, unele experimente ar putea
fi repetate inutil sau chiar realizate eronat.
Dei bazele de date referitoare la proteine sunt destul de bine
cunoscute, exploatarea lor este se realizeaz sub nivelul optim. Din acest
motiv, n subcapitolul de fa sunt prezentate o selecie a bazelor de date
disponibile on-line, ncercnd s aducem n atenie aspecte elementare
legate de explorarea lor n vederea dezvoltrii abilitilor utilizatorilor de
a folosi aceste resurse informatice. O list cu principalele baze de date
existente i adresele la care pot fi accesate este prezentat n Tabelul 26.

Baze de date cu secvene proteice


Proiectul de secveniere a ntregului genom uman a fost urmat de o
adevrat avalan de proiecte care vizeaz secvenierea genomului i a
altor specii de eucariote i procariote. Acestea au generat i continu s
genereze un numr enorm de secvene de ADN care codific sute de mii
de proteine. Au aprut numeroase baze de date care au ca scop
organizarea acestor secvene, fiecare cu specificul ei. nainte de a prezenta
cteva baze de date, trebuie precizat faptul c una din problemele cu care
se confrunt acestea este redundana datelor. Deoarece secvenele pot fi
nregistrate n baza de date de ctre o multitudine de utilizatori, frecvent
apar mai multe intrri pentru aceeai secven (aceeai protein de la
autori diferii sau aceeai protein izolat de la specii diferite).
TABEL 26. Principalele baze de date cu informaii despre proteine, adresa web i
dimensiunea acestora
Baz de date

Site web

Dimensiune *

Baze de date cu secvene


INSDC

http://www.insdc.org/

DDBJ

http://www.ddbj.nig.ac.jp

135.440.924 secvene
Aceste baze de date sunt

Biologie molecular. Metode experimentale

292

Baz de date

Site web

Dimensiune *

EMBL
Nucleotide
Sequence
Database

http://www.ebi.ac.uk/embl/

sincronizate zilnic ntre ele i


conin aceleai secvene.

GenBank

http://www.ncbi.nlm.nih.gov/
genbank/

European
Nucleotide
Archive
(ENA)

http://www.ebi.ac.uk/ena/

KEGG

http://www.genome.jp/kegg/

7.913.359 secvene

nr

http://blast.ncbi.nlm.nih.gov

17.919.084 secvene

UniProtKB/ http://www.uniprot.org/
Swiss-Prot

535.698 secvene

UniProtKB/ http://www.uniprot.org/
TrEMBL

21.552.793 secvene

Baze de date cu structuri

RCSB PDB http://www.rcsb.org


PDBe

http://www.ebi.ac.uk/pdbe/

PDBj

http://www.pdbj.org/

BMRB

http://www.bmrb.wisc.edu/

80.850 secvene
Aceste baze de date sunt
sincronizate
ntre
ele
alctuind wwPDB; conin
aceleai intrri

Alte tipuri de informaii funcionale

BRENDA

http://www.brendaenzymes.org/

ReLiBase

http://relibase.ccdc.cam.ac.uk Conine

* n Aprilie 2012.

Conine strict informaii


cinetice
i
referine
bibliografice despre enzime
informaii despre
compleci proteine-liganzi

Metode computaionale

293

Aceast redundan nu este de dorit, interfernd cu procesul de


interogare a bazei de date i diminund calitatea rezultatului obinut.
O baz de date este cu att mai bun cu ct are redundana mai mic.
UniProtKB/SwissProt (4) este o baz de date accesibil on-line
care se evideniaz prin faptul c toate secvenele coninute sunt foarte
atent notate, iar nivelul de redundan este minim. Adugarea unei noi
secvene n SwissProt este un proces care implic prelucrarea manual a
datelor corespunztoare secvenei respective, ceea ce face ca procesul s
fie de durat i n consecin, SwissProt s nu fie foarte la zi. Pentru a
remedia aceast problem a fost dezvoltat un supliment la aceast baz de
date i astfel a aprut UniProtKB/TrEMBL (4) care conine toate
secvenele de nucleotide din EMBL(5) translate n secvene de
aminoacizi.
O alt baz de date cu secvene proteice este Protein Identification
Resource sau prescurtat PIR (6) care i propune s asigure o colecie
complet de secvene caracterizat n special prin non-redundan. Acest
obiectiv se realizeaz prin gruparea secvenelor identice sau foarte
similare ntr-o singur intrare n baza de date. Fiecare intrare din PIR
conine alturi de secvena de aminoacizi i notaii legate de denumire,
funcie precum i referine bibliografice.
Baza de date nr se dorete a fi o baz de date non-redundant
complet, cuprinznd intrri din GenBank (3), SwissProt, PIR, Protein
Research Foundation (PRF) i Protein data Bank (PDB). n nr sunt aadar
un numr foarte mare de secvene dar, numai secvenele perfect identice
sunt grupate ntr-o singur intrare n baza de date, din acest motiv nivelul
de redundan fiind mai mic.

294

Biologie molecular. Metode experimentale

Baze de date cu structuri proteice


Structura tridimensional a proteinelor ofer informaii eseniale
nu doar n direcia identificrii funciei i mecanismeleor de aciunea
proteinelor, ci i n direcia identificrii de noi substante biologic active,
medicamente etc. Aceeai tendin din lumea tiinific ce a condus la
secvenierea complet a genomului uman a ptruns i n lumea biologiei
structurale, existnd din ce n ce mai multe voci care susin necesitatea
stabilirii structurii tuturor proteinelor dintr-o celul. Dei acest obiectiv
este nc practic nerealizabil datorit unor probleme de ordin tehnic, noile
metode de cristalizare i identificare a structurii 3D a proteinelor au dus la
acumularea unei cantiti din ce n ce mai mari de date.
Baza de date de referin n domeniul structurii proteinelor este
fr doar i poate World Wide Protein Data Bank (wwPDB) (7). Alctuit
prin comasarea a trei baze de date principale (RCSB PDB din USA,
PDBe din Europa i PDBj din Japonia), wwPDB conine la ora actual nu
mai puin de 80.000de structuri proteice. Fiecare protein are n wwPDB
un cod unic de identificare (PDB ID) alctuit din 4 caractere, primul fiind
ntotdeauna un numr (ex. 1cau sau 256b). Informaiile legate de structura
unei proteine sunt organizate sub forma unor fiiere, cel mai frecvent n
format PDB (8) (un alt format acceptat este i mmCIF) (9). Un fiier PDB
conine trei seciuni distincte, cu:
1. informaii despre proteina respectiv numele proteinei, data
cnd a fost depus n PDB, autorul, sursa;
2. coordonatele 3D propriu-zise ale atomilor;
3. legturile dintre atomi.
Cele trei seciuni conin toate informaiile ce permit utilizatorului
ca, folosind programe specializate precum RasMol (10), Chime sau
PyMol, s poat vizualiza i interaciona cu structura tridimensional a
proteinei respective. Un exemplu de reprezentare grafic a unei molecule
proteice mpreun cu interfaa grafic specific a programului PyMol este
prezentat n Figura 34.

Metode computaionale

295

FIGURA 34. Fisierul 2DHB.pdb pentru hemoglobin vizualizat cu ajutorul


aplicaiei PyMol.

XII. 3 Identificarea funciei proteinelor


necunoscute cu ajutorul programului BLAST
Este acceptat faptul c toate proteinele au evoluat din alte proteine
(11) prin mutaia aleatoare a aminoacizilor din secvena primar. Analiza
frecvenei cu care un aminoacid dintr-o protein este nlocuit cu altul a
demonstrat ns c procesul nu este ntotdeauna aleator i c, n funcie de
poziie i rol, aminoacizii au grade diferite de conservare n structurile
proteice. Astfel, cei mai nalt conservai sunt aminoacizii din situsul
catalitic, urmai, n ordine descresctoare, de aminoacizii implicai n
realizarea structurilor secundare i teriare, cei mai puin conservai fiind
aminoacizii de la suprafaa proteinei. Secvenele de aminoacizi ale
proteinelor nu au caracter randomic, ci prezint mai degrab un anumit

296

Biologie molecular. Metode experimentale

grad de similaritate (1) ceea ce permite compararea lor. Gradul de


similaritate a dou proteine la nivel de secven este dictat, pe de o parte,
de distana evolutiv i, pe de alt parte, de structurile lor tridimensionale
i de funciile specifice pe care cele doua proteine le ndeplinesc.
Aceste observaii au permis dezvoltarea unor metode
computaionale complexe de investigare i analiz a secvenelor de
aminoacizi ale proteinelor necunoscute. Programul de cutare i
cuantificare a similaritii dintre dou secvene BLAST (engl.Basic Local
Aligment Search Tool, (12) face parte din aceast categorie. Dezvoltat n
anul 1991, programul compar o secven de interes cu o bibliotec de
secvene dintr-o baz de date. Prin identificarea n baza de date a
secvenelor cunoscute care prezint un nalt grad de similaritate cu
secvena de interes, poate fi precizat funcia acesteia din urm.
nainte de a ncepe prezentarea metodologiei de realizare a unei
investigaii BLAST, este absolut necesar s definim civa termeni
utilizai frecvent. Alinierea a dou sau mai multe secvene este una dintre
cele mai simple operaii de analiz a secvenelor. ntr-o aliniere a dou
secvene, fiecare aminoacid (nucleotid) din secvena A este comparat cu
aminoacidul (nucleotidul) corespunztor din secvena B. O coresponden
ntre doi aminoacizi (nucleotide) din aceeai poziie pe cele dou secvene
poart numele de identitate, iar o neconcordan se numete substituie.
Alinierea local este utilizat pentru a identifica subregiunile similare
dintre dou secvene fiind util pentru compararea de secvene de
dimensiuni diferite, puin nrudite. Alinierea global compar dou
secvene pe toat lungimea lor fiind utilizat, n special, pentru a compara
secvene de dimensiuni similare, foarte apropiate evolutiv. Aceste tipuri
de alinieri nu surprind ns zonele mici de identitate (13).
Foarte frecvent, termenii de similar i omolog sunt utilizai greit
cnd se face referire la compararea a dou proteine. Similaritatea la nivel
de secven (structur) se refer la dou secvene care prezint asemnri
una n raport cu cealalt datorit unui numr mai mare sau mai mic de
aminoacizi identici. Similaritatea are diverse grade exprimate, n general,
sub form de procente de identitate. Omologia se refer la faptul c dou
secvene (structuri) similare se aseamn una cu cealalt datorit evoluiei
dintr-un strmo comun. Nu exist grade pentru msurarea nivelului de
omologie.

Metode computaionale

297

Principiul metodei
ProgramulBLAST identific, dintr-o baz de date, secvenele
similare cu o secven int. Aceste secvene poart numele de secvene
subiect iar identificarea lor se bazeaz pe aa numitele alinieri locale.
Dup identificarea tuturor secvenelor subiect din baza de date,
programul BLAST cuantific nivelul de similaritate dintre acestea i
secvena int realiznd un clasament.
O aliniere local const dintr-o pereche de secvene de aceeai
dimensiune ntre care exist potrivire perfect. Cu ajutorul unui algoritm
special (Smith-Waterman modificat) (14) programul BLAST identific
rapid poriunile din secvena int i secvena subiect, realizeaz
alinierile locale i pornind de aici suprapune cele dou secvene de
dimensiuni diferite. n acest fel, secvenele comparate vor fi alctuite din
zone perfect aliniate i zone nealiniate (aa numitele GAPs) care
formeaz bucle ntre o aliniere local i urmtoarea aliniere local.
Pentru a cuantifica gradul de similaritate dintre dou secvene,
programul calculeaz un punctaj care are la baz diverse tipuri de matrici
de substituie. Cel mai frecvent utilizate sunt matrici de tip PAM (15) sau
de tip BLOSUM62 (16)(Figura 35), ambele tipuri fiind construite
inndu-se cont de observaiile experimentale legate de frecvena cu care
un aminoacid este nlocuit de un alt aminoacid. n general, matricele PAM
sunt utilizate pentru compararea unor secvene apropiate evolutiv, n timp
ce matricele de tip BLOSUM au o utilizare mai general.
Evenimentele mutaionale pot duce nu doar la schimbarea unui
aminoacid din secven, dar i la inserarea sau deleia unuia sau mai
multor aminoacizi. n acest caz dou fragmente adiacente de pe o
secven se ntlnesc i pe cealalt, ntre ele interpunndu-se o alt
secven n care o baz nu are corespondent pe cealalt, aceast secven
reprezentnd o pereche aminoacid-nimic. O asemenea potrivire
aminoacid-nimic poart numele de GAP. Punctajul pentru GAP este
negativ. Deoarece se pot insera sau terge unul sau mai muli aminoacizi,
nu intereseaz foarte mult dimensiunea spaiului (GAP), ci doar existena
lui.

Biologie molecular. Metode experimentale

298

FIGURA 35. Exemplu de matrice


BLOSUM.

Cu litere mari sunt reprezentai aminoacizii.


Cel mai mare punctaj au identitile, iar
funcie de frecvena de substituie (observat
practic n laborator) primesc un anumit
punctaj i substituiile. Se poate observa i
existena unor punctaje negative, alocate
pentru substituiile cel mai puin ntlnite.

Utiliznd sistemul descris mai sus, programul aloc fiecrei


secvene comparate un scor. BLAST calculeaz mai multe tipuri de
punctaje. Aa numitul punctaj brut (engl. Raw score) notat cu S, este
calculat prin nsumarea punctelor pentru fiecare pereche aminoacidaminoacid, amionacid-nimic i penalizrilor pentru GAP. Calcularea
punctajului brut este schematizat n Figura 36.
Aliniere local

Substituie

GAP

S = (identiti, substituii) - (penalizri GAP)


FIGURA 36. Calcularea punctajului brut pentru o aliniere dintre dou secvene.
Scorul brut nu permite ns compararea a dou alinieri, el fiind
echivalentul unei uniti de lungime care nu are specificat unitatea de
msur. Din aceste motive, se prefer utilizarea unui alt tip de punctaj i
anume scorul n bii notat cu S. Acesta se calculeaz prin normalizarea
lui S n funcie de diverse variabile statistice care depind, la rndul lor, de

Metode computaionale

299

tipul de matrice utilizat. Cu ct punctajul S obinut este mai mare cu att


asemnarea dintre cele dou secvene este mai mare (17).
Principalul pericol cu care se confrunt o asemenea comparaie
este ca, n cazul bazelor de date de dimensiuni mari, s apar alinieri
datorit ansei i nu datorit unei legturi reale. Din acest motiv, alturi de
cele aceste dou scoruri S i S', programul BLAST ofer i o serie de date
statistice legate de gradul de semnificaie a acestor alinieri. O
comparaie se caracterizeaz astfel i printr-un parametru statistic, notat
E, care se definete ca numr de potriviri care apar doar datorit ansei
ntr-o baz de date de o anumit dimensiune. Cu ct valorile lui E sunt
mai mici, cu att rezultatele sunt considerate ca avnd un nalt grad de
semnificaie (alinierea fiind deci statistic semnificativ).
Avantaje:
1. permite predicia funciei unei proteine pornind doar de la
secvena complet, fr alte informaii suplimentare;
2. simplitate deosebit, nu necesit cunotine aprofundate de
bioinformatic, toate operaiile efectundu-se n fereastra
browser-ului web;
3. server-ul BLAST este accesibil gratuit;
4. aplicaia BLAST poate fi descrcat i utilizat independent, pe o
baz de date specificat de utilizator; aplicaia nu are interfa
grafic i poate fi descrcat sub forma unor executabile
compatibile cu Windows, MacOS X i diverse variante de Linux;
detalii suplimentare privind utilizarea avansat a BLAST pot fi
accesate la adresa http://www.ncbi.nlm.nih.gov/books/NBK1762/.
Limitri:
1. rezultatul furnizat de BLAST este strict dependent de baza de date
utilizat; cu ct baza de date este mai mare cu att rezultatele sunt
mai precise; n prezent, baze de date precum GenBank sau
UniProtKB/SwissProt acumuleaz secvene noi cu o rat foarte
mare, cel mai frecvent prin ncrcarea automat a secvenelor
rezultate din proiectele de secveniere complet a genomului

Biologie molecular. Metode experimentale

300

diverselor specii; secvenele ncrcate automat nu sunt ns


complet caracterizate din punct de vedere funcional; din acest
motiv rezultatul unei interogri BLAST este foarte precis cnd se
utilizeaz o baz de date mare dar, n acelai timp, total
neconcludent dac nici una din secvenele identificate nu are
funcie descris experimental; n asemenea cazuri se prefer
utilizarea unor baze de date mai mici precum The Protein Data
Bank (PDB (18) care conin doar secvene cu funcii cunoscute;
2. corectitudinea i ncrederea n predicia funciei unei proteine
necunoscute realizat prin BLAST depinde foarte mult de
secvena int n sine, mai precis de nivelul de identitate dintre
secvena de interes i secvena int pe baza creia se face
predicia; astfel, un nivel de identitate mai mare de 25% implic
funcii similare, un nivel cuprins ntre 18-25% poate indica funcii
similare, iar un nivel mai mic de 18% nu permite formularea nici
unei concluzii; de altfel, intervalul de identitate de 15-25% poart
numele de zon de crepuscul(19), n care rezultatele fals
pozitive sunt foarte frecvente i legtura secven-funcie este slab
conturat;
3. rezultatele obinute au caracter de predicii i, nainte de a stabili
clar rolul unei proteine, trebuie s fie obligatoriu sprijinite de
dovezi experimentale.
Resurse necesare:
1. secvena de interes n format FASTA; dac este disponibil
secvena de nucleotide a genei care codific proteine de interes,
aceasta poate fi transformat n secven de aminoacizi folosind
suita de programe SMS (pentru detalii consulta subcapitolul
XII.1 Fiiere FASTA i operaii simple cu secvene, pagina 286);
2. computer dotat cu conexiune Internet i browser compatibil;
opional poate fi necesar, un editor text (WordPad, Gedit) pentru
modificarea/ajustarea secvenei proteice.

Metode computaionale

301

Mod de lucru:
1. se copie secvena proteinei de interes n format FASTA; pentru
exemplificare vom investiga rolul proteinei necunoscute ORF388depe
megaplasmidul pAO1 din Arthrobacter nicotinovorans (2);secvena de
aminoacizi a fost obinut din secvena de nucleotide a genei codificatoare
folosind suita de programe SMS (pentru detalii consultapitolul XII.1
Fiiere FASTA i operaii simple cu secvene, pagina 286) sau informaia
poate fi descrcat direct din GenBank, indicativul CAD47898.1;
secvena de aminoacizi a fost editat i a fost formatat pentru a respecta
standardul FASTA (Figura 37);

FIGURA 37. Secvena de aminoacizi a ORF388 n format FASTA


2. se deschide navigatorul web i se acceseaz serverul BLAST
oferit de National Center for Biotechnology Information (NCBI), (20) la
adresa http://blast.ncbi.nlm.nih.gov; n pagina care se deschide, de sub
titlul Basic BLAST, se selecteaz protein blastpentru a compara o
secven de aminoacizi cu o alt secven de aminoacizi; pagina permite
i selecia unor tipuri de BLAST, specilalizate (cum ar fi de exemplu,
BLAST cu secvene provenind doar de la o anumit specie);
3. pe pagina care se deschide, n csua text de sub Enter Query
Sequence (Figura 38) se copie sau se scrie secvena de aminoacizi a
proteinei de interes n format FASTA; opional se poate preciza i un
nume specific pentru investigaia dorit; Aceast pagin permite, de
asemenea, stabilirea unor parametri care au drept scop limitarea spaiului
de cutare, dup cum urmeaz:

302

Biologie molecular. Metode experimentale

Query subrange se utilizeaz pentru a reduce secvena


investigat doar la un anumit fragment precizat prin poziia
de nceput i de sfrit;
Or, upload file permite ncrcarea unui fiier text n format
FASTA; n acest caz nu mai este necesar precizarea
secvenei n csua text;
Database permite selecia bazei de date unde se va realiza
investigarea; funcia este util pentru a restrnge
investigarea n diverse direcii; cea mai mare baz de date
utilizabil este non-redundant protein sequences (nr); cea
mai mic este Protein Data Bank proteins (pdb) care are
avantajul de a fi alctuit doar din proteine cu structur
determinat experimental i funcie cunoscut;
Algorithm permite selectarea diverilor algoritmi de
identificare i aliniere a secvenelor similare; de asemenea,
tot n aceast pagin, apsnd semnul + din faa textului
Algorithm parameters, se pot modifica o serie de
parametri ai algoritmului de cutare, precum:
Max target sequences numrul maxim de secvene subiect ce
va fi luat n calcul;
Expect vor fi afiate doar rezultatele care au o valoare a lui E
mai mic dect cea specificat;
Matrix tipul de matrice care va fi utilizat pentru calcularea
punctajului similaritii (BLOSUM62, PAM70 etc.)
Gap Costs schema de punctaj corespunztoare prezenei unui
GAP.

Metode computaionale

303

C
D
FIGURA 38. Pagina NCBI de accesare i stabilire a parametrilor unei investigaii
BLAST.
A csua text n care a fost inserat secvena de aminoacizi a proteinei ORF388 n
format FASTA; B zona cu parametrii utilizai pentru restrngerea spaiului de cutare;
C buton pentru lansarea investigrii; D zona cu parametrii algoritmului de cutare

Mai multe informaii legate de utilitatea fiecrui tip de matrice pot


fi gsite n cartea publicat de membrii NCBI exclusiv on-line (21) i
accesibil la adresa: http://www.ncbi.nlm.nih.gov/books/NBK21101/
4. apsarea butonului BLAST din josul paginii va conduce la
nregistrarea cererii pe server i alocarea unui numr unic de identificare
(RID), dup care se trece la pagina de ateptare a rezultatelor; n funcie
de gradul de solicitare a serverelor NCBI i de parametrii de cutare,
timpul de ateptare variaz de la cteva secunde la cteva minute; dup
finalizare, pagina de afiare a rezultatelor apare automat i cuprinde
(Figura 39):

304

Biologie molecular. Metode experimentale

a. date privitoare la investigaia realizat (ID-ul investigrii, descrierea


din fiierul FASTA, baza de date utilizat, versiunea programului
utilizat i referina bibliografic de utilizat n eventualitatea n care
rezultatele sunt publicate);
b. domeniile nalt conservate identificate (Figura 39, B);
c. rezultatul propriu-zis prezentat grafic; secvena int este reprezentat
de bara roie numerotat din partea de sus a figurii, iar secvenele
similare identificate n baza de date sunt reprezentate prin linii de
culori diferite de dedesubt; rezultatele sunt ordonate n funcie de
gradul de similaritate, acesta fiind indicat att de culoarea liniei (codul
de culori este prezentat deasupra secvenei int), ct i de poziia
acesteia; la trecerea mouse-ului peste una din linii vor fi afiate datele
de identificare ale secvenei respective (Figura 39, C);
d. rezultatele investigaiei prezentate sub forma unui tabel ce cuprinde:
numrul de identificare a secvenei, descrierea, scorul normalizat (S'),
gradul de suprapunere n procente, valoarea lui E i procentul maxim
de identitate (Figura 39, D).

Metode computaionale

305

E
FIGURA 39. Pagin cu rezultate ale unei interogri BLAST.

A informaii privind interogarea realizat; B domeniile nalt conservate identificate;


C prezentarea grafic de ansamblu a rezultatelor; D tabel cu secvenele identificate;
E exemplu de aliniere ntre secvena de interes i o secven subiect identificat prin
BLAST.

306

e.

Biologie molecular. Metode experimentale

alinierea fiecrei secvene identificate cu secvena int. Fiecare


aliniere este nsoit de o serie de informaii ce caracterizeaz
alinierea respectiv scorul nomalizat S' i scorul brut S,
valoarea lui E, numrul de aminoacizi identici i procentele,
numrul de substituii i procentul, i numrul de GAPs (Figura
39, E).

Mai multe detalii privind utilitatea fiecrui parametru al unei


investigaii BLAST pot fi gsite n cartea publicat de membrii NCBI
exclusiv
on-line
(21)
i
accesibil
la
adresa:
http://www.ncbi.nlm.nih.gov/books/NBK21101/
n cazul interogrii folosind secvena genei ORF388, pe primul loc
ca similaritate este CAD47898.1 putative oxidoreductase [Arthrobacter
nicotinovorans], adic chiar secvena de interes. Acest rezultat era de
ateptat dac inem cont de faptul c aceast secven provine din baza de
date n care se face interogarea. ncepnd cu poziiile urmtoare din
tabelul cu rezultatele investigaiei (Figura 39, D) sunt listate celelalte
secvene similare cu ORF388. Pentru a obine informaii suplimentare
privind rolul acestora, se acceseaz legtura din numrul de identificare a
fiecrei secvene (coloana numit Accesion din tabel). Aceasta va duce
la deschiderea unei pagini suplimentare corespunztoare intrrii
respective din baza de date general NCBI. Analiza n detaliu a tuturor
secvenelor din tabel indic faptul c ORF388 codific probabil o enzim
cu funcie oxido-reductazic. Utilitatea acestei concluzii este ns foarte
redus deoarece nu este sprijinit i de date experimentale, nici una din
proteinele identificate neavnd funcie cunoscut (Figura 40, A i B din).
Pentru a identifica proteine cu funcie demonstrat practic, adic o situaie
similar cu cea prezentat n figura 40, C), este necesar o nou
investigaie BLAST, folosind de aceast dat PDB ca baz de cutare.
Proteina cu funcie demonstrat experimental cea mai
asemntoare cu ORF388 a fost identificat ca fiind 1,5-anhidro-Dfructoz-reductaza NADP+ dependent din Sinorhizobium morelense
(Score = 65.1 bits (157), Expect = 1e-11). Rolul dedus computaional
pentru ORF388 este de a funciona ca o reductaz NADP+ dependent
acionnd asupra glucidelor, n bun concordan cu rolul demonstrat
experimental (xiloz-dehidrogenaz NADP+ dependent, Mihasan et al.,
2012, n curs de publicare).

Metode computaionale

307

308

Biologie molecular. Metode experimentale

C
FIGURA 40. Evaluarea utilitii rezultatelor BLAST pe baza referinelor
bibliografice.
A secvena YP_002488236.1, nepublicat n reviste de specialitate; B secvena
YP_002541450, publicat ntr-un articol ce raporteaz secvenierea genomului a trei
specii de Agrobacterium; C secvena 2GLX_A publicat ntr-un articol care descrie
structura teriar a ,5-anhidro-D-fructoz-reductaza NADP+ dependent din Sinorhizobium
morelense.

XII.4 Modelarea computaional a structurii


tridimensionale a proteinelor
Cunoaterea structurii tridimensionale (3D) a moleculelor proteice
poate asigura informaii extrem de preioase legate de funcia i evoluia
acestor molecule. Dei la ora actual sunt cunoscute secvenele de
aminoacizi a peste 108 milioane proteine (22), doar 80.000 dintre acestea
au structura tridimensional determinat experimental (23). Acest decalaj
apare datorit complexitii deosebite a metodelor experimentale de
stabilire a structurii tridimensionale a proteinelor, precum cristalografia cu
raze X sau tehnicile de rezonan magnetic nuclear (NMR).

Metode computaionale

309

Ipoteza termodinamic a lui Anfinsen (1973) postuleaz c


mpachetarea lanului de aminoacizi ai unei proteine n structura
tridimensional caracteristic este un proces guvernat strict de reguli
fizice, depinznd aadar doar de secvena de aminocizi (24). Acest lucru
ar permite, cel puin teoretic, stabilirea structurii tridimensionale a unei
proteine pornind doar de la secvena sa de aminoacizi. Ideea de a calcula,
pornind de la secvena de aminoacizi, structura tridimensional a unei
proteine a fascinat lumea tiinific nc din momentul lansrii sale n anii
'70, fiind considerat un adevrat Sfnt Graal al biologiei moleculare (25).
Studiul principiilor care guverneaz mpachetarea proteinelor n
forma lor nativ se poate realiza folosind dou abordri distincte:
1. folosind strict legile fizicii cuantice;
2. prin prisma teoriei evoluiei.
Din aceste motive, metodele computaionale de modelare a
structurii tridimensionale au fost mprite n dou clase mari: modelarea
pe baz de omologie i metode ab-initio (26). Diferenierea clar dintre
aceste dou clase de metode a nceput s fie din ce n ce mai puin net
odat cu apariia unui al treilea tip de metode, bazate pe recunoaterea
structurilor secundare (engl. fold-recognition). Nici una dintre cele trei
clase de metode nu s-a impus pe plan tiinific n detrimentul alteia,
experimentatorul fiind nevoit s aleag ntre o metod sau alta n funcie
de secvena de interes i de rezultatul preconizat. Din aceste motive, n
cele ce urmeaz sunt prezentate pe scurt avantajele, dezavantajele i
aplicaiile fiecrui tip de metod computaional de modelare a structurii
proteinelor.
Modelarea pe baz de omologie sau modelarea comparativ (MC) a
structurii proteinelor este o clas de metode care se bazeaz pe observaia
conform creia catenele de aminoacizi cu secvene similare adopt
structuri similare (19). MC este facilitat i de faptul c n cadrul aceleiai
familii de proteine structura 3D este mult mai bine conservat din punct
de vedere evolutiv dect secvena de aminoacizi (27). Aceasta face ca
structurile 3D a unui numr mare de membri ai aceleiai familii de
proteine s poat fi uor modelate dac structura unui singur membru a
fost determinat experimental.
Modelarea structurii unei proteine int necunoscute folosind MC
este un proces care cuprinde cinci etape distincte:
1. identificarea proteinelor nrudite din punct de vedere evolutiv
cu proteina de interes i care au structura tridimensional determinat

310

Biologie molecular. Metode experimentale

experimental; acestea vor fi folosite ca ablon pentru calcularea structurii


proteinei de interes;
2. alinierea pe baz de omologie a secvenei proteinei int cu
secvena proteinelor ablon n scopul identificrii zonelor cu structur
nalt conservat;
3. modelarea zonelor cu structur nalt conservat pe secvena
int;
4. calcularea poziiei spaiale a lanurilor laterale ale aminoacizilor
i a zonelor mai puin conservate;
5. mbunatirea i evaluarea modelului tridimensional obinut (28).
Acurateea acestui tip de metode depinde n mod direct de
similaritatea la nivel de secven dintre proteina int i cea ablon. Cnd
identitatea dintre cele dou secvene este mai mare de 40%, mai mult de
90% dintre atomii catenei de aminoacizi pot fi modelai cu o eroare medie
de aproximativ 1 (29). Modelele realizate sunt de calitate foarte bun,
concurnd n acuratee cu structurile determinate experimental prin
cristalografie cu raze X la rezoluie mic (30).
Cnd identitatea dintre secvena int i cea ablon se situeaz n
intervalul 30-40%, obinerea de alinieri corecte devine dificil iar calitatea
modelului obinut scade. 80% dintre atomii catenei de aminoacizi pot fi
modelai cu o eroare medie de aproximativ 3,5 , restul cu erori mult mai
mari (29).
Cnd identitatea dintre secvene este mai mic de 30%,
identificarea de structuri omoloage devine problematic. Chiar dac se
identific posibile structuri ablon i se pot genera modele ale structurii
tridimensionale a proteinei int, utilitatea lor este ndoielnic, de unde i
denumirea de zona de crepuscul a alinierilor secvenelor proteice (19).
Din punct de vedere al utilizatorului, dificultatea MC rezid aadar
din identificarea ablonului optim pe care s se construiasc structura
tridimensional a proteinei de interes i aceasta deoarece probabilitatea de
a identifica o protein cu structur cunoscut similar cu o secven
randomic variaz n intervalul 30-65%(29). Procentul este n continu
cretere deoarece proiecte precum Protein Structure Initiative promit s
determine n urmtoarea decad nici mai mult nici mai puin de
16.000 proteine (31), numr care va acoperi n proporie de 90% din
numrul total de tipuri de proteine estimat (32).
Metodele bazate pe identificarea computaional a structurilor
secundare au ca punct de plecare observaia c secvene similare implic

Metode computaionale

311

i structuri similare. Afirmaia invers nu este ns valabil, existnd


proteine similare ca structur dar care nu au nici cea mai mic similaritate
de secven (33). Aceasta nseamn c numrul de structuri secundare
ntlnite n structura proteinelor este mult mai redus dect numrul de
secvene existente (28) ceea ce permite realizarea unor biblioteci cu
structuri proteice model complete. Metodele sunt bazate pe identificarea
poriunilor din secvena de interes care au similariti la nivel de secven
cu structurile model dup care se asambleaz aceste fragmente n
structura tridimensional final.
Principalul dezavantaj al acestui tip de metode este faptul c
necesit o putere de calcul foarte mare. La ora actual banca de date
pentru proteine (PDB) conine suficient de multe structuri proteice pentru
a permite utilizarea cu succes a acestor metode pentru proteine de pn la
100 aminoacizi (34).
Metodele ab-initiopleac strict de la premisa c structura tridimensional
a unei proteine corespunde unui nivel energetic minim i ncearc s
identifice acest minim prin evaluarea tuturor conformaiilor posibile ale
respectivului lan de aminoacizi. Dei aceste metode necesit o putere de
calcul enorm i nu au nc un nivel de acuratee foarte mare (26), ele
reprezint un subiect foarte fierbinte. n cazul unor proteine noi care nu
prezint similaritate cu nici o alta protein, nici una din metodele de mai
sus nu poate fi folosit, metodele ab-initio fiind singura alternativ.

Programe, servere i metaservere


Din punct de vedere computaional, instrumentele disponibile n
domeniul prediciei structurii tridimensionale a proteinelor pot fi
clasificate n programe independente, servere sau metaservere.
Programele independente au fost intens utilizate nc de la nceputul
dezvoltrii acestui domeniu, ns au dezavantajul c utilizarea lor
eficient necesit n primul rnd accesul la computere cu putere mare de
calcul i n al doilea rnd cunotine temeinice de informatic (limbaje de
programare, scripturi, linie de comand etc.), ceea ce reduce mult
aplicabilitatea lor. Pe de alt parte serverele web elimin aceste
dezavantaje, ele oferind utilizatorului o interfa simpl n care acesta
introduce un minimum de informaie necesar pentru generarea unei

312

Biologie molecular. Metode experimentale

structuri (de exemplu secvena de aminoacizi). Dezavantajul acestor


instrumente este legat de faptul c un server folosete o anumit metod
de modelare a structurii tridimensionale a proteinelor. Dou servere
diferite, bazate pe dou metode diferite vor produce rezultate diferite
pentru aceeai secven de aminoacizi. Din aceste motive au aprut aa
numitele metaservere care genereaz structura unei proteine plecnd de la
secvena sa de aminoacizi, folosind un ansamblu de metode distincte.
n Tabelul 27 sunt listate cele mai importante programe, servere i
metaservere care pot fi accesate gratuit pentru a genera modele de
structuri proteice 3D, mpreun cu metoda de modelare utilizat. Alegerea
tipului de metod ce poate fi folosit pentru o secven dat se face innd
cont de similaritatea acesteia cu proteine cunoscute. Dac proteina de
interes are cel puin 40% similaritate la nivel de secven cu o protein
cunoscut, sunt indicate metodele bazate pe MC. Pentru procente mai
mici sunt indicate metodele bazate pe identificarea computaional a
structurilor secundare, iar pentru cazul n care proteina de interes nu
prezint similaritate cu nici o protein de interes, sunt de preferat
metodele ab-initio. Diverse detalii legate de avantajele i dezavantajele
programelor de modelare a structurii 3D a proteinelor disponibile pot fi
gsite n lucrarea publicat n 2011 de Mihan M. (35).

Comentarii

(51)

(52)

(53)

www.biocomp.chem.uw.edu.pl/servi
ces.php

http://foldx.crg.es/

www.salilab.org/modeller/

http://swift.cmbi.ru.nl/whatif
http://biskit.pasteur.fr/

Program comercial, poate fi utilizat gratuit timp


de 15 zile, necesit nregistrarea pe site-ul
productorului, disponibil si ca server

Program n linie de comand, dar sunt


disponibile o interfa i un server
Sisteme de operare: Windows, Mac, Linux

Program comercial

O colecie de scripturi n python


Sisteme de operare: Linux, Windows

Fold-X

Modeller

What If

Biskit

Ref.
bibl.

Folosete MC dar i metode ab-initio; face parte


din Selvita Protein Modeling Platform
Sistem de operare: Linux

Adres web

CABS

MC

Programe independente

Nume

TABEL 27. Instrumente utilizate frecvent pentru modelarea structurii tridimensionale a proteinelor

Metode computaionale
313

Comentarii

Adres web

Server complet automat, structura


tridimensional a modelului este construit cu
ajutorul programului MODELLER

Poate genera modele pentru secvene de pn la


500 aminoacizi

Server complet automat, poate fi accesat i din


cadrul programului DeepView (Swiss PdbViewer)

ESyPred3D

Geno3D

Swiss-Modell

(41)

(42)
(43)

http://www.fundp.ac.be/sciences/bio
logie/urbm/bioinfo/esypred/
http://geno3d-pbil.ibcp.fr
http://swissmodel.expasy.org/

3D-PSSM

Din anul 2004 acest server nu a mai fost

http://www.sbg.bio.ic.ac.uk/~3dpss

(44)

(40)

(39)

Ref.
bibl.

www.bmm.icnet.uk/~3djigsaw/

http://supfam.org/SUPERFAMILY/

Metode bazate pe identificarea computaional a structurilor secundare

Server complet automat care poate fi folosit i n


mod intereactiv

3D-JIGSAW

CM

Servere

SUPERFAMILY

Metode bazate pe identificarea computaional a structurilor secundare

Nume

314
Biologie molecular. Metode experimentale

Succesorul serverului 3D-PSSM

Phyre

(48)

(49)
(50)

http://www.cs.bgu.ac.il/~dfischer/pr
edictprotein/submit_meta.html

http://meta.bioinfo.pl/submit_wizar
d.pl
http://robetta.bakerlab.org/

Secvena de interes este trimis la doisprezece


servere, printre care dou bazate pe identificarea
computaional a structurilor secundare i dou
pe CM

Folosete pn la zece servere diferite, printre


care 3D-PSSM i ESyPred3D

MC i ab initio, dar poate utiliza i dateNMR

3D-JURY

Robetta

Meta-PP

(47)

Necesit nregistrare pe site

GeneSilico

(45)

http://www.sbg.bio.ic.ac.uk/~phyre/

http://zhanglab.ccmb.med.umich.ed
u/LOMETS/

(46)

(45)

Ref.
bibl.

http://modbase.compbio.ucsf.edu/m
odloop/

http://www.sbg.bio.ic.ac.uk/~phyre/

m/index2.html

Adres web

www.genesilico.pl/meta2/

Genereaz modele 3D folosind opt programe


diferite

Lomets

Metaservere

Modelarea automat a buclelor din structurile


proteice, bazat pe MODELLER

Succesorul serverului 3D-PSSM

modificat/dezvoltat.

Comentarii

ModLoop

Ab-initio

Phyre

Nume

Metode computaionale
315

316

Biologie molecular. Metode experimentale

Aplicaii ale metodelor de modelare a


structurilor tridimensionale a proteinelor
n general, prin utilizarea unui server, meta-server sau program
independent se obine un model al structurii 3D a proteinei de interes sub
forma unui fiier PBD. Utilitatea acestui model depinde foarte mult de
calitatea sa i aplicaia n care va fi utilizat. n general, metodele CM
conduc la obinerea unor modele de calitate foarte bun, similare cu cele
obinute prin difracie cu raze X. n cazul modelelor care au 50%
similaritate la nivel de secven cu abloanele n baza crora au fost
realizate, calitatea este foarte bun i au un numr foarte mare de aplicaii,
precum docking-ul, proiectarea i mbuntirea liganzilor (36), crearea de
mutaii la nivel de secven (37) i identificarea aminoacizilor din situsurile active ale enzimelor (38).
Modele de rezoluie medie generate prin CM sau prin metode
bazate pe identificarea computaional a structurilor secundare au fost
utilizate cu succes pentru identificare localizrii spaiale a aminoacizilor
importani din punct de vedere funcional (aminoacizi din situsul catalitic,
aminoacizi implicai n legarea unui modulator).
Modelele de rezoluie mic obinute prin metodele ab-initio sunt
utile pentru stabilirea topologiei unei proteine

XII.5 Modelarea computaional a complecilor


liganzi-proteine
Moleculele proteice sunt implicate ntr-o multitudine de procese
eseniale pentru funcionarea celulei vii, ncepnd cu cataliza enzimatic
i terminnd cu reglarea expresiei genelor (54). Majoritatea acestor funcii
se bazeaz pe proprietatea proteinelor de a interaciona cu liganzi de
dimensiuni variate (de la substrate enzimatice, cofactori, efectori pn la
alte proteine, ADN sau ARN). Cunoaterea mecanismelor moleculare pe
baza crora se realizeaz complexul protein-ligand sunt deosebit de
importante n domenii precum selecia de noi inte terapeutice, proiectarea
raional de medicamente noi sau ingineria enzimatic. Acumularea de
cunotine legate de activitatea biologic, structura proteinelor i
fenomenele de alosterie permit la ora actual deducerea computerizat a

Metode computaionale

317

conformaiei unui complex de tip protein-complex pornind de la


structura celor dou componente (protein i ligand), procesul fiind numit
andocare molecular (engl. molecular docking). Dei necesare iniial n
special n domeniul farmaceutic (55), pentru identificarea de noi
medicamente, programele folosite la andocarea molecular au nceput s
fie utilizate de un numr din ce n ce mai mare de cercettori, n special
pentru a selecta poteniale substraturi enzimatice sau pentru a valida date
experimentale.

Problematica andocrii moleculare


Termenul de andocare molecular in-silico desemneaz schemele
computerizate care ncearc s deduc structura unui complex format din
dou sau mai multe molecule constituente, un receptor i un ligand (56).
Receptorul este reprezentat cel mai frecvent de o protein, n timp ce
ligandul este fie o protein, fie o molecul de acid nucleic sau o molecul
de dimensiuni mici (potenial medicament, substrat, inhibitor etc.).
Coordonatele atomice ale ligandului i receptorului pot proveni din:
1. structura nativ obinut prin cristalografie cu raze X sau NMR;
2. structura pseudo-nativ (structura unui complex obinut prin
cristalografie cu raze X sau rezonan magnetic nuclear (NMR)
din care unul dintre componente a fost eliminat);
3. structur modelat computaional (57).
Problema pe care andocarea molecular trebuie s o rezolve este:
dac se cunosc structurile tridimensionale a dou molecule, care este
structura corect a complexului rezultat din interaciunea dintre cele dou
molecule. Rezolvarea acestei probleme este dificil, n special, datorit
faptului c pentru a explora toate gradele de libertate pe care le are
ligandul este necesar o putere de calculfoarte mare.
De exemplu, considernd o molecul cu doar dou legturi care se
pot roti i care trebuie amplasat ntr-un situs catalitic sub forma unui cub
de 103 3, timpul necesar pentru a evalua din punct de vedere energetic
toate cela 6 x 1014 conformaii este de aproximativ 20.000 ani (58). Este
lesne de neles c n practic o asemenea abordare sistematic nu poate fi
folosit i de aceea sunt utilizai diveri algoritmi matematici i diferite
aproximri pentru a reduce numrul de conformaii care trebuie analizate

318

Biologie molecular. Metode experimentale

transformnd procesul ntr-unul fezabil din punct de vedere computaional


(56).
Programele care realizeaz andocarea molecular conin dou
componente distincte (59):
1. o metod pentru generarea i explorarea tuturor conformaiilor
posibile protein-ligand;
2. o metod de evaluare i ordonare a acestor conformaii n
funcie de energia de legare.
Deoarece au fost publicate numeroase lucrri care trateaz n
detaliu metodele i tehnicile de andocare molecular (59),(60),(61),(62),
n cele ce urmeaz ne vom concentra asupra evalurii programelor
disponibile din punct de vedere al utilizatorului nespecialist n
bioinformatic, comentnd aspecte precum uurina utilizrii, puterea de
calcul necesar i evaluarea rezultatelor.
Tipuri de andocare molecular. Primul program de andocare
molecular a fost DOCK, dezvoltat de cercettori de la UCSF (63).
Programulfolosea o reprezentare foarte simplist a structurii ligandului i
receptorului, similar cu modelul lact i cheie din enzimologie,
complexul optim fiind identificat pe baza complementaritii de form
dintre ligand i receptor. Aceast abordare presupune c att ligandul ct
i receptorul au structuri imobile, metoda primind numele de andocare cu
corpuri rigide.
Procesul de formare a complecilor macromoleculari biologic
activi este ns mult mai corect descris de teoria conformaiei optime
induse care se refer la faptul c ligandul se leag de receptor ntr-o
conformaie mai puin favorabil, induce o serie de modificri structurale
ce conduc la atingerea nivelului energetic minim (64) i contribuie astfel
la obinerea unui complex stabil. Aceast observaie este sprijinit de
constatarea c n structurile complecilor protein-ligand determinate prin
difracie cu raze X 70 100% dintre atomii liganzilor sunt ngropai n
interiorul proteinei, comportare ce nu ar fi posibil dect dac receptorul
ar fi flexibil. Mai mult dect att, 85% dintre proteinele depuse n PDB
conin unul pn la trei reziduuri flexibile(65). Majoritatea programelor
de andocare molecular (Tabelul 28) iau ncalcul nu numai cele ase
grade de libertate n spaiu ale moleculelor,ci i flexibilitatea liganzilor i
lanurilor de aminoacizi din structura receptorilor proteici, realiznd ceea
ce se numete andocare flexibil. Andocarea molecular a unui ligand
flexibil ntr-un receptor rigid este o funcie standard n majoritatea

Metode computaionale

319

programelor de andocare existente la ora actual. Introducerea


flexibilitii la nivelul receptorului mai pune nc probleme, n special
datorit puterii de calcul necesare dei, exist cteva implementri
utilizabile.
Astfel, cea mai simpl abordare este cea numit andocarea
relaxat,n care se permite un anumit grad de suprapunere a atomilor
ligandului peste atomii receptorului prin relaxarea modului de calcul a
forelor van der Walls. Metoda este foarte eficient din punct de vedere
computaional, dar nu permite modelarea modificrilor conformaionale
mai ample, cum ar fi, de exemplu, micarea unui aminoacid n situsul
catalitic al unei enzime (66).
Modelarea flexibilitii catenelor lateraleeste o alt metod care
utilizeaz un algoritm de calcul ce ine cont de diversele conformaii ale
catenelor laterale ale aminoacizilor.
O a treia metod ce permite att modelarea flexibilitii catenelor
laterale ct i un anumit grad de mobilitate spaial a catenei proteice are
la baz relaxarea molecular (61).
Andocarea molecular n general i cea n care se ine cont de
mobilitate spaial a catenei proteice n special este o aplicaie dependent
de un numr mare de variable, necesitnd prin urmare o putere de calcul
foarte mare i timpi lungi de ateptare pentru obinerea unui rezultat.
Pentru a grbi procesul, foarte frecvent, sunt utilizate informaii
suplimentare, cel mai adesea obinute prin diverse abordri experimentale.
Prin indicarea exact a situsului de legare a ligandului n structura
receptorului (cum ar fide exemplu o sfer cu raza de 20 n jurul unui
reziduu cunoscut ca fiind implicat n cataliz) se realizeaz ceea ce se
numete o andocare direcionat (67).
Cnd nu se cunosc informaii legate de receptor sau ligand este
utilizat o metod brut, care evalueaz extensiv toate posibilele
conformaii ale complexului, metod numit andocare nedirecionat.

(88)

Aplicaie comercial, disponibil pentru Linux i


Windows; face parte din pachetul LeadIT;
interfa grafic foarte bun; poate s in cont i
de prezena metalelor n structura receptorului
Program gratuit, doar n linie de comand,
disponibil pentru Unix, Linux, Windows i OSX;
pentru pregtirea ligandului i a receptorului,
precum i pentru vizualizarea rezultatelor este
indicat programul UCSF Chimera
Programul poate utiliza simultan pn la ase
molecule diferite ntr-o rund de experimente de
andocare molecular; gratuit, dar trebuie trimis

http://www.biosolveit.de/Flex
X/

CR, FL

CR, FL, AN, http://dock.compbio.ucsf.edu/


DOCK_6/index.htm
AD

Poate utiliza http://www.nmr.chem.uu.nl/ha


ddock/
i date

FlexX

Dock 6

HADDock

(89)

(63)

(87)

Aplicaie comercial, disponibil pentru Linux i


Windows

CR, FL, AN https://www.schrodinger.com/

Glide
products/14/5/

(86)

Ref.
bibl.

Gratuit, doar n linie de comand, disponil pentru


Linux, OSX, Windows, Solaris; o interfa grafic
foarte bun este pus la dizpoziie de ctre autori,
AutoDockTools (ADT)

Observaii

CR, FL, FR, http://autodock.scripps.edu/


AD, AN

Pagin web

AutoDock 4

Programe

Program/Server Tipuri de
andocare*

TABEL 28. Instrumente utilizate frecvent pentru experimente de andocare in-silico

320
Biologie molecular. Metode experimentale

(73)

Program comercial cu o bun interfa grafic,


disponibil pentru Linux, Windows i OSX;
conine un algoritm de detecie automat a
cavitilor din interiorul receptorului permind
astfel identificarea potenialelor situs-uri active
Program doar n linie de comand, disponibil
pentru Linux (numai Red Hat) OSX, Solaris; poate
andoca att proteine, ct i ADN i ARN; permite

http://www.molegro.com/mvd
-product.php

http://www.sdsc.edu/CCMS/D
OT/

Molegro Virtual FL, FR, AD


Docker

DOT

CR, PP

(74)

(72)

Program oferit gratuit pentru cercettorii din


mediul academic; dezvoltat n special pentru a
realiza andocarea moleculelor de ADN; disponibil
pentru Windows, Linux i OSX avnd o interfa
grafic bine pus la punct; fiierele pdb pot fi
utilizate direct ca input

CR, AN

http://hex.loria.fr/

HEX Protein
docking

(91)

Program comercial disponibil pentru Windows,


Linux, SGI, OSX

FL, FR, AN, http://www.molsoft.com/dock


ing.html
PP

ICM

(90)

Program comercial disponibil pentru Linux i


Windows

oducts/life_sciences/gold/

CR, FL, AD http://www.ccdc.cam.ac.uk/pr

Ref.
bibl.

GOLD

Observaii
autorului un acord de utilizare; nu are interfa
grafic; programul este disponibil sub forma unei
colecii de scripturi

Pagin web

experimental
e pentru a
mri
acurateea

Program/Server Tipuri de
andocare*

Metode computaionale
321

Pagin web

ZDOCK Server CR, LD, PP

http://zdock.bu.edu/

Dezvoltat n special pentru andocare proteinprotein, poate utiliza direct fiiere .pdb

Program comercial, conine un algoritm de


detecie automat a cavitilor din interiorul
receptorului permind astfel identificarea
potenialelor situs-uri active

http://simbiodasys.ca

FL, AN

eHiTs

Servere

(78)

Program comercial cu interfa grafic bazat pe


utilizarea unui browser web, ceea ce permite
folosirea n orice sistem de operare

http://fitted.ca/

FL, FR

Fitted

(80)

(79)

(77)

Gratuit pentru cercettorii din mediul academic,


disponibil pentru Windows i Linux

http://gemdock.life.nctu.edu.t
w/dock/

FL, FR

(76)

GEMDOCK

disponibil

Programul are o interfa grafic,


pentru SGI i Linux

http://dockvision.com/

(75)

Ref.
bibl.

FL, AD

Program open-source doar n linie de comand,


disponibil pentru Linux, OSX i Windows; pentru
pregtirea fiierelor necesare andocrii i pentru
vizualizarea rezultatelor se poate utiliza
AutoDockTools (ADT)

pregtirea automat a fiierelor necesare pornind


de la fiiere .pdb

Observaii

DockVison

AutoDock Vina CR, FL, FR, http://vina.scripps.edu/


AD, AN

Program/Server Tipuri de
andocare*

322
Biologie molecular. Metode experimentale

Folosete programele DOCK 3 i PocketPickker


pentru andocare i baza de date ZINC pentru
selecia liganzilor

* CR andocare cu corpuri rigide, FL andocare cu liganzi flexibili, FR andocare cu receptor flexibl, AN andocare
nedirecionat, AD andocare direcionat, PP andocare proteinprotein

CR, FL, AN http://blaster.docking.org/

DockBlaster

(84)

Serverul folosete direct structurile n format pdb

http://hexserver.loria.fr

CR

Hex Server

(83)

Bazat pe programul RosettaDock

http://rosettadock.graylab.jhu.
edu

CR, FL, PP

RosettaDock
Server

Conceput exclusiv pentru andocarea proteinprotein

http://vakser.bioinformatics.k
u.edu/resources/gramm/gram
mx

LB, BD, PP

GRAMM-X

(85)

(82)

(81)

Fiierele input pot fi n coordonate 3D n format


.pdb sau direct codurile acestor fiiere

http://cluspro.bu.edu

Ref.
bibl.

ClusPro Server CR, PP

Observaii

Pagin web

Program/Server Tipuri de
andocare*

Metode computaionale
323

324

Biologie molecular. Metode experimentale

Evaluarea rezultatelor obinute prin andocare


molecular computerizat
Rezultatul final al experimentelor de andocare molecular
computerizat nu este o structur unic a complexului ligand-receptor, ci
o colecie de posibile orientri ale ligandului n situsul de legare al
receptorului. n general, succesul unui asemenea experiment se msoar
cu ajutorul abaterii de la rdcina ptrat medie (engl. Root-Mean-Square
Deviation, RMSD) dintre orientarea ligandului observat experimental i
cea dedus computaional. Orientri cu RMSD < 2 sunt considerate
foarte bune, iar cele cu RMSD n intervalul 2-3 sunt considerate un
succes parial (68). Valoarea RMSD este utilizabil doar n cazul n care
structura tridimensional a complexului investigat a fost elucidat
experimental. n majoritatea cazurilor, acest lucru nu este posibil i de
aceea o serie de autori implementeaz n programele lor funcii specifice
de evaluare a rezultatelor. O metod complet automat care s permit
selecia corect a celei mai bune orientri a ligandului n situsul de legare
a receptorului nu exist nc, acest rol fiind ndeplinit de ctre utilizator.

Aplicaii ale andocrii moleculare


Experimentele in-silico de andocare molecular au o gam larg
de utilizri, ncepnd cu studiul interaciunilor protein-protein i
terminnd cu ingineria enzimatic. Dei legile fizicii care descriu
interaciunile la nivel molecular sunt aceleai, fiecare aplicaie a andocrii
moleculare are un set specific de algoritmi de calcul, special conceput
pentru a mri viteza de calcul i corectitudinea rezultatelor. Pe baza
tipului de ligand utilizat se pot distinge cteva tipuri diferite de aplicaii
ale andocrii moleculare, fiecare cu propriile avantaje i dezavantaje.
1. Andocarea proteine-molecule mici. Scopul acesteiaplicaii este
de a identifica situsul de legare i/sau modul de legare al unei molecule de
dimensiuni mici ntr-o molecul proteic. Ligandul este reprezentat prin
coordonatele tridimensionale ale ntregii molecule, coordonate obinute n
general dintr-o baz specific de date precum ZINC (69) sau PubChem

Metode computaionale

325

(70). Acest tip de andocare a fost utilizat cu succes pentru a elucida


mecanismul
inhibiiei
monoamin-oxidazei
umane
de
ctre
1,4-naftochinon sau pentru validarea datelor experimentale legate de
proprietile cinetice ale unei -amidaze din Arthrobacter nicotinovorans
pAO1 (71).
O limitare important a experimentelor de andocare ce folosesc
liganzi de dimensiuni mici este structura receptorului. Rezoluia la nivel
atomic se obine la mai puin de 1,2 , dar majoritatea structurilor
modelelor 3D din PDB au o rezoluie ntre 1,5 i 2,5 . Ca regul
general, se consider c un model 3D al unei proteine la o rezoluie de
cel puin 2,2 permite obinerea de rezultate acceptabile n majoritatea
aplicaiilor, cu observaia c amplasarea atomilor de hidrogen nu poate fi
precizat n acest caz.
O alt limitare a acestei aplicaii este faptul c majoritatea
programelor de andocare nu iau n calcul i rolul jucat de diveri
cofactori, inhibitori sau ioni metalici.
2. Identificarea de noi liganzi este util n special n industria
farmaceutic pentru a identifica noi medicamente sau generarea unui
farmacofor. Pentru aceasta, se pleac de la o colecie de liganzi de
dimensiuni mici despre care se tie c se leag de un receptor proteic dat.
Metoda presupune c legarea lor se datoreaz unui set comun de
proprieti geometrice i chimice. Astfel, liganzii sunt tratai ca fragmente
i sunt andocai n situsul de legare al receptorului. Prin combinarea lor i
ligarea diverselor grupe de atomi se obine o nou molecul care se va
lega de receptor mai puternic dect oricare dintre liganzii de la care s-a
pornit.
Principalul punct slab al acestei aplicaii este faptul c n mod
paradoxal reduce diversitatea structural disponibil cercettorului. Dac
un compus se leag ntr-un situs de legare dat, este de ateptat ca toate
moleculele cu structur analoag s se comporte la fel. Cnd se ordoneaz
potenialii liganzi n funcie de energia de legare, liganzii similari vor fi
plasai n apropiere, cercettorul ignornd involuntar liganzii structural
diferii, dar cu anse s se lege de proteina dat.
3. Andocarea protein-protein ncearc s simuleze mecanismele
de recunoatere molecular. Dimensiunile mari ale celor doi parteneri
(ligandul i receptorul sunt dou proteine diferite) alturi de faptul c
legile care guverneaz interaciunile moleculare la acest nivel nu sunt
foarte bine cunoscute face ca aceast aplicaie s fie una dintre cele mai
dificile sarcini, att din punct de vedere computaional ct i metodologic.

Biologie molecular. Metode experimentale

326

Bibliografie:
1. Xu, D. (2009) Computational methods for protein sequence
comparison and search., Current protocols in protein science,
Chapter 2, Unit2.1.
2. Igloi, G. L., Brandsch, R. (2003) Sequence of the 165-kilobase
catabolic plasmid pAO1 from Arthrobacter nicotinovorans and
identification of a pAO1-dependent nicotine uptake system, J
Bacteriol, 185, 1976-1986.
3. Benson, D. A., Karsch-Mizrachi, I., Lipman, D. J., Ostell, J., Sayers, E.
W. (2011) GenBank, Nucleic Acids Research, 39, D32-7.
4. Bairoch, A., Apweiler, R. (1999) The SWISS-PROT protein sequence
data bank and its supplement TrEMBL in 1999., Nucleic Acids
Research, 27, 49-54.
5. Rodriguez-Tome, P., Stoehr, P. J., Graham, N. C., Flores, T. P. (1996)
The European Bioinformatics Institute (EBI) databases, Nucleic
Acids Research, 24, 6-12.
6. Barker, W. C., George, D. G., Mewes, H. W., Tsugita, A. (1992) The
PIR-International Protein Sequence Database., Nucleic Acids
Research, 20 Suppl, 2023-6.
7. Berman, H. M., Kleywegt, G. J., Nakamura, H., Markley, J. L. (2012)
The Protein Data Bank at 40: Reflecting on the Past to Prepare for
the Future, Structure, 20, 391-396.
8. Bernstein, F. C., Koetzle, T. F., Williams, G. J., Meyer, E. F., Brice, M.
D., Rodgers, J. R., Kennard, O., Shimanouchi, T., Tasumi, M.
(1977) The Protein Data Bank: a computer-based archival file for
macromolecular structures., Journal of Molecular Biology, 112,
53542.
9. Bourne, P. E., Berman, H. M., McMahon, B., Watenpaugh, K. D.,
Westbrook, J. D., Fitzgerald, P. M. D. (1997) Macromolecular
Crystallography Part B, Methods in Enzymology, 277, 571-590.
10. Sayle, R. A., and Milner-White, E. J. (1995) RASMOL:
biomolecular graphics for all., Trends in biochemical sciences, 20,
374.
11. Doolittle, R. F. (1981) Similar amino acid sequences: chance or
common ancestry?, Science, 214, 149-59.

Metode computaionale

327

12. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J.
(1990) Basic local alignment search tool, Journal of Molecular
Biology, 215, 403-10.
13. Pizzi, E., Attimonelli, M., Liuni, S., Frontali, C., Saccone, C. (1992)
A simple method for global sequence comparison., Nucleic Acids
Research, 20, 131-6.
14. Smith, T. F., Waterman, M. S. (1981) Identification of common
molecular subsequences., Journal of Molecular Biology, 147, 1957.
15. Dayhoff, M., Schwartz, R., Orcutt, B. (1978) A model of
evolutionary change in proteins, Atlas of protein sequence and
structure, 5, 345-352.
16. Henikoff, S., Henikoff, J. G. (1992) Amino acid substitution matrices
from protein blocks., Proceedings of the National Academy of
Sciences of the United States of America, 89, 10915-9.
17. McGinnis, S., Madden, T. L. (2004) BLAST: at the core of a
powerful and diverse set of sequence analysis tools., Nucleic Acids
Research, 32, W20-5.
18. Berman, H., Westbrook, J., Feng, Y., Gilliand, G., Bhat, T., Weissig,
H., Shindyalov, I., Bourne, P. (2000) The Protein Data Bank,
Nucleic Acids Res, 28, 235-242.
19. Rost, B. (1999) Twilight zone of protein sequence alignments.,
Protein engineering, 12, 85-94.
20. Sayers, E. W., Barrett, T., Benson, D. A., Bolton, E., Bryant, S. H.,
Canese, K., Chetvernin, V., Church, D. M., Dicuccio, M.,
Federhen, S., Feolo, M., Geer, L. Y., Helmberg, W., Kapustin, Y.,
Landsman, D., Lipman, D. J., Lu, Z., Madden, T. L., Madej, T.,
Maglott, D. R., Marchler-Bauer, A., Miller, V., Mizrachi, I., Ostell,
J., Panchenko, A., Pruitt, K. D., Schuler, G. D., Sequeira, E.,
Sherry, S. T., Shumway, M., Sirotkin, K., Slotta, D., Souvorov, A.,
Starchenko, G., Tatusova, T. A., Wagner, L., Wang, Y., John Wilbur,
W., Yaschenko, E., Ye, J. (2010) Database resources of the
National Center for Biotechnology Information., Nucleic acids
Research, 38, D5-16.
21. Madden, T. (2002) The BLAST Sequence Analysis Tool in The
NCBI Handbook (McEntyre, J., Ostell, J., Eds.). National Center
for Biotechnology Information (US).
22. Benson, D. A., Karsch-Mizrachi, I., Lipman, D. J., Ostell, J., Sayers,
E. W. (2010) GenBank, Nucleic Acids Research, 38, D46-51.

328

Biologie molecular. Metode experimentale

23. Dutta, S., Burkhardt, K., Young, J., Swaminathan, G. J., Matsuura, T.,
Henrick, K., Nakamura, H., Berman, H. M. (2009) Data
deposition and annotation at the worldwide protein data bank.,
Molecular Biotechnology, 42, 1-13.
24. Anfinsen, C. B. (1973) Principles that govern the folding of protein
chains., Science, 181, 223-30.
25. Kolata, G. (1986)Trying to crack the second half of the genetic code.,
Science, 233, 1037-9.
26. Fiser, A. (2004) Protein structure modeling in the proteomics era.,
Expert review of proteomics, 1, 97-110.
27. Lesk, A. (1980) How different amino acid sequences determine
similar protein structures: The structure and evolutionary dynamics
of the globins, Journal of Molecular Biology, 136, 225-230.
28. Floudas, C. A. (2007) Computational methods in protein structure
prediction., Biotechnology and Bioengineering, 97, 207-13.
29. Xiang, Z. (2006) Advances in homology protein structure modeling.,
Current Protein & Peptide Science, 7, 217-27.
30. Kopp, J., Schwede, T. (2004) Automated protein structure homology
modeling: a progress report., Pharmacogenomics, 5, 405-16.
31. Zhang, Y. (2009) Protein structure prediction: when is it useful?,
Current Opinion In Structural Biology, 19, 145-55.
32. Vitkup, D., Melamud, E., Moult, J., Sander, C. (2001) Completeness
in structural genomics., Nature structural biology, 8, 559-66.
33. Floudas, C. A., Fung, H. K., McAllister, S. R., Mnnigmann, M.,
Rajgaria, R. (2006)Advances in protein structure prediction and
de novo protein design: A review, Chemical Engineering Science,
61, 966-988.
34. Zhang, Y., Skolnick, J. (2005) The protein structure prediction
problem could be solved using the current PDB library.,
Proceedings of the National Academy of Sciences of the United
States of America, 102, 1029-34.
35. Mihan, M. (2010) Basic protein structure prediction for the
biologist: A review, Archives of Biological Sciences, 62, 857-871.
36. Ring, C. S. (1993) Structure-Based Inhibitor Design by Using
Protein Models for the Development of Antiparasitic Agents,
Proceedings of the National Academy of Sciences, 90, 3583-3587.
37. Vernal, J., Fiser, A., Sali, A., Mller, M., Cazzulo, J. J., Nowicki, C.
(2002) Probing the specificity of a trypanosomal aromatic alpha-

Metode computaionale

329

hydroxy acid dehydrogenase by site-directed mutagenesis.,


Biochemical and biophysical research communications, 293, 633-9.
38. Sheng, Y., Sali, A., Herzog, H., Lahnstein, J., Krilis, S. A. (1996)
Site-directed mutagenesis of recombinant human beta 2glycoprotein I identifies a cluster of lysine residues that are critical
for phospholipid binding and anti-cardiolipin antibody activity.,
Journal of Immunology, 157, 3744-51.
39. Wilson, D., Pethica, R., Zhou, Y., Talbot, C., Vogel, C., Madera, M.,
Chothia, C., Gough, J. (2009) SUPERFAMILY--sophisticated
comparative genomics, data mining, visualization and phylogeny.,
Nucleic Acids Research, 37, D380-6.
40. Bates, P. A., Kelley, L. A., MacCallum, R. M., Sternberg, M. J. (2001)
Enhancement of protein modeling by human intervention in
applying the automatic programs 3D-JIGSAW and 3D-PSSM.,
Proteins, 5, 39-46.
41. Lambert, C., Leonard, N., De Bolle, X., Depiereux, E. (2002)
ESyPred3D: Prediction of proteins 3D structures, Bioinformatics,
18, 1250-1256.
42. Combet, C., Jambon, M., Deleage, G., Geourjon, C. (2002) Geno3D:
automatic comparative molecular modelling of protein,
Bioinformatics, 18, 213-214.
43. Arnold, K., Bordoli, L., Kopp, J., Schwede, T. (2006) The SWISSMODEL workspace: a web-based environment for protein structure
homology modelling., Bioinformatics, 22, 195-201.
44. Kelley, L. A., MacCallum, R. M., Sternberg, M. J. (2000) Enhanced
genome annotation using structural profiles in the program 3DPSSM., Journal Of Molecular Biology, 299, 499-520.
45. Kelley, L. A., Sternberg, M. J. E. (2009) Protein structure prediction
on the Web: a case study using the Phyre server., Nature protocols,
4, 363-71.
46. Fiser, A., Sali, A. (2003) ModLoop: automated modeling of loops in
protein structures., Bioinformatics, 19, 2500-1.
47. Kurowski, M. A., Bujnicki, J. M. (2003) GeneSilico protein structure
prediction meta-server., Nucleic Acids Research, 31, 3305-7.
48. Eyrich, V. A., Rost, B. (2003) META-PP: single interface to crucial
prediction servers., Nucleic Acids Research, 31, 3308-10.
49. Ginalski, K., Elofsson, A., Fischer, D., Rychlewski, L. (2003) 3DJury: a simple approach to improve protein structure predictions,
Bioinformatics, 19, 1015-1018.

330

Biologie molecular. Metode experimentale

50. Chivian, D., Kim, D. E., Malmstrm, L., Bradley, P., Robertson, T.,
Murphy, P., Strauss, C. E. M., Bonneau, R., Rohl, C. A., Baker, D.
(2003) Automated prediction of CASP-5 structures using the
Robetta server., Proteins, 53, 524-33.
51. Kolinski, A. (2004) Protein modeling and structure prediction with a
reduced representation, Acta Biochimica Polonica, 51, 349-371.
52. Schymkowitz, J., Borg, J., Stricher, F., Nys, R., Rousseau, F., Serrano,
L. (2005) The FoldX web server: an online force field., Nucleic
Acids Research, 33, W382-8.
53. Fiser, A., Sali, A. (2003) Modeller: generation and refinement of
homology-based protein structure models., Methods in enzymology,
374, 461-91.
54. Ritchie, D. W. (2008) Recent progress and future directions in
protein-protein docking., Current Protein & Peptide Science, 9, 1-15.
55. B-Rao, C., Subramanian, J., Sharma, S. D. (2009) Managing protein
flexibility in docking and its applications., Drug Discovery Today,
14, 394-400.
56. Sousa, S. F., Fernandes, P. A., Ramos, M. J. (2006) Protein-ligand
docking: current status and future challenges., Proteins, 65, 15-26.
57. Halperin, I., Ma, B., Wolfson, H., Nussinov, R. (2002) Principles of
docking: An overview of search algorithms and a guide to scoring
functions., Proteins, 47, 409-43.
58. Plewczynski, D., aniewski, M., Augustyniak, R., Ginalski, K.
(2011) Can we trust docking results? Evaluation of seven
commonly used programs on PDBbind database., Journal Of
Computational Chemistry, 32, 742-55.
59. Huang, N., Shoichet, B. K., Irwin, J. J. (2006) Benchmarking sets for
molecular docking., Journal Of Medicinal Chemistry, 49, 6789-801.
60. Huang, S.-Y., Zou, X. (2010) Advances and challenges in proteinligand docking., International Journal of Molecular Sciences, 11,
3016-34.
61. Huang, S.-Y., Grinter, S. Z., Zou, X. (2010) Scoring functions and
their evaluation methods for protein-ligand docking: recent
advances and future directions., Physical Chemistry Chemical
Physics: PCCP,12, 12899-908.
62. Dias, R., de Azevedo, W. F. (2008) Molecular docking algorithms.,
Current Drug Targets, 9, 1040-7.

Metode computaionale

331

63. Kuntz, I. D., Blaney, J. M., Oatley, S. J., Langridge, R., Ferrin, T. E.
(1982)A geometric approach to macromolecule-ligand
interactions., Journal Of Molecular Biology, 161, 269-88.
64. Wang, Q., Pang, Y.P. (2007) Preference of Small Molecules for Local
Minimum Conformations when Binding to Proteins, PLoS ONE, 2,
e820.
65. Najmanovich, R., Kuttner, J., Sobolev, V., Edelman, M. (2000) Sidechain flexibility in proteins upon ligand binding., Proteins, 39, 261-8.
66. Ferrari, A. M., Wei, B. Q., Costantino, L., Shoichet, B. K. (2004)
Soft docking and multiple receptor conformations in virtual
screening., Journal of Medicinal Chemistry, 47, 5076-84.
67. Fitzjohn, P. W., Bates, P. A. (2003) Guided docking: first step to
locate potential binding sites., Proteins, 52, 28-32.
68. Cole, J. C., Murray, C. W., Nissink, J. W. M., Taylor, R. D., Taylor, R.
(2005) Comparing protein-ligand docking programs is difficult.,
Proteins, 60, 325-32.
69. Irwin, J. J., Shoichet, B. K. (2005) ZINC--a free database of
commercially available compounds for virtual screening., Journal
of Chemical Information and Modeling, 45, 177-82.
70. Wang, Y., Xiao, J., Suzek, T. O., Zhang, J., Wang, J., Bryant, S. H.
(2009) PubChem: a public information system for analyzing
bioactivities of small molecules., Nucleic Acids Research, 37,
W623-33.
71. Cobzaru, C., Ganas, P., Mihasan, M., Schleberger, P., Brandsch, R.
(2011) Homologous gene clusters of nicotine catabolism,
including a new -amidase for -ketoglutaramate, in species of
three genera of Gram-positive bacteria., Research In Microbiology,
162, 285-91.
72. Ritchie, D. W., Ritchie, D. W., Kemp, G. J. L. (1999) Protein
Docking Using Spherical Polar Fourier Correlations, Proteins, 39,
178-194.
73. Thomsen, R., Christensen, M. H. (2006) MolDock: a new technique
for high-accuracy molecular docking., Journal Of Medicinal
Chemistry,49, 3315-21.
74. Mandell, J. G., Roberts, V. A., Pique, M. E., Kotlovyi, V., Mitchell, J.
C., Nelson, E., Tsigelny, I., Ten Eyck, L. F. (2001) Protein
docking using continuum electrostatics and geometric fit, Protein
Engineering Design and Selection, 14, 105-113.

332

Biologie molecular. Metode experimentale

75. Trott, O., Olson, A. J. (2010) AutoDock Vina: improving the speed
and accuracy of docking with a new scoring function, efficient
optimization, and multithreading., Journal of Computational
Chemistry, 31, 455-61.
76. Hart, T. N., Read, R. J. (1992) A multiple-start Monte Carlo docking
method, Proteins: Structure, Function, and Genetics, 13, 206-222.
77. Yang, J.M., Chen, C.C. (2004) GEMDOCK: a generic evolutionary
method for molecular docking., Proteins, 55, 288-304.
78. Corbeil, C. R., Englebienne, P., Moitessier, N. (2007) Docking
Ligands into Flexible and Solvated Macromolecules. 1.
Development and Validation of FITTED 1.0, Journal of Chemical
Information and Modeling,47, 435-449.
79. Zsoldos, Z., Reid, D., Simon, A., Sadjad, B. S., Johnson, A. P. (2006)
eHiTS: an innovative approach to the docking and scoring
function problems., Current Protein Peptide Science, 7, 421-435.
80. Chen, R., Li, L., Weng, Z. (2003) ZDOCK: An initial-stage proteindocking algorithm, Proteins: Structure, Function, and Genetics, 52,
80-87.
81. Comeau, S. R., Gatchell, D. W., Vajda, S., Camacho, C. J. (2003)
ClusPro: an automated docking and discrimination method for the
prediction of protein complexes, Bioinformatics, 20, 45-50.
82. Tovchigrechko, A., Vakser, I. A. (2006) GRAMM-X public web
server for protein-protein docking., Nucleic Acids Research, 34,
W310-4.
83. Lyskov, S., Gray, J. J. (2008) The RosettaDock server for local
protein-protein docking., Nucleic Acids Research, 36, W233-8.
84. Macindoe, G., Mavridis, L., Venkatraman, V., Devignes, M.D.,
Ritchie, D. W. (2010) HexServer: an FFT-based protein docking
server powered by graphics processors, Nucleic Acids Research,
38, W445-W449.
85. Irwin, J. J., Shoichet, B. K., Mysinger, M. M., Huang, N., Colizzi, F.,
Wassam, P., Cao, Y. (2009) Automated docking screens: a
feasibility study., Journal of Medicinal Chemistry,52, 5712-20.
86. Morris, G. M., Goodsell, D. S., Halliday, R. S., Huey, R., Hart, W. E.,
Belew, R. K., Olson, A. J. (1998) Automated docking using a
Lamarckian genetic algorithm and an empirical binding free energy
function, Journal of Computational Chemistry, 19, 1639-1662.
87. Friesner, R. A., Murphy, R. B., Repasky, M. P., Frye, L. L.,
Greenwood, J. R., Halgren, T. A., Sanschagrin, P. C., Mainz, D. T.

Metode computaionale

333

(2006) Extra precision glide: docking and scoring incorporating a


model of hydrophobic enclosure for protein-ligand complexes.,
Journal of Medicinal Chemistry, 49, 6177-96.
88. Rarey, M., Kramer, B., Lengauer, T., Klebe, G. (1996) A fast flexible
docking method using an incremental construction algorithm,
Journal of Molecular Biology, 261, 470-489.
89. de Vries, S. J., van Dijk, A. D. J., Krzeminski, M., van Dijk, M.,
Thureau, A., Hsu, V., Wassenaar, T., Bonvin, A. (2007)
HADDOCK versus HADDOCK: new features and performance of
HADDOCK2.0 on the CAPRI targets., Proteins, 69, 726-33.
90. Verdonk, M. L., Cole, J. C., Hartshorn, M. J., Murray, C. W., Taylor,
R. D. (2003) Improved protein-ligand docking using GOLD.,
Proteins, 52, 609-23.
91. Abagyan, R., Totrov, M. (1994) Biased Probability Monte Carlo
Conformational Searches and Electrostatic Calculations for
Peptides and Proteins, Journal of Molecular Biology, 235, 9831002.

ANEX

TABEL A1. Multipli i submultipli ai unitilor de msur


Prefix

Factor de multiplicare

Abreviere

Atto

10-18

Femto

10-15

Pico

10-12

Nano
Micro

-9

-6

-3

10
10

Mili

10

Centi

10-2

Deci

10-1

Deca

10

da

Hecto
Kilo

10
10

Myria

10

my

Mega

106

Giga

109

Tera
Peta
Exa

12

15

18

10
10
10

Biologie molecular. Metode experimentale

336

TABEL A2. Tabel de conversie a celor mai utilizate uniti de volum


Pentru a converti:

n:

se multiplic cu:

Centimetri cubi (cm3)

Microlitri (l)

103

Mililitri (ml)

Litri (l)

10-3

Galoane (US)

2.641 x 10-4

Metri cubi (m3)

10-6

Picioare cubice (cubic feet, 3,531 x 10-5


ft3)

Litri (L)

Inchi cubici (cubic inches


(in.3)

6,102 x 10-2

Microlitri (l)

106

Mililitri (ml)

103

Galoane (US)

0,2642
3

Centimetri cubi (cm )

103

Metri cubi (m3)

10-3

Picioare cubice (engl.cubic 3,531 x 10-2


feet, ft3)

Mililitri (ml)
Microlitri (l)

Inchi cubici (engl.cubic


inches (in.3)

61.02

Litri (l)

10-3

Microlitri (l)

103

Mililitri (ml)

10-3

Litri (l)

10-6

Anex

337

TABEL A3. Tabel de conversie a celor mai utilizate uniti de msur


Pentru a converti din:

n:

se multiplic cu:

Concentraia
Miligrame per litru (mg/l) Pri pe milion (ppm)

Distana
Centimetri (cm)

Inchi (in)

Milimetri (mm)

Angstromi ()

Picioare (engl.feet, ft)

3,281 x 10-2

Inchi (in.)

0,39

Metri (m)

10-2

Milimetri (mm)

10

Yarzi (yd)

1,094 x 10-2

Centimetri (cm)

2,54

Picioare (engl.feet, ft)

8,333 x 10-2

Metri (m)

2,540 x 10-2

Milimetri (mm)

25,4

Yarzi (yd)

2,778 x 10-2

Centimetri (cm)

0,1

Picioare (engl.feet, ft)

3,281 x 10-3

Inchi (in.)

3,937 x 10-2

Metri (m)

10-3

Nanometri (nm)

0,1

Metri (m)

10-10

Picometri (pm)

100

Amperi pe inci ptrai


(A/in2)

6,45

Amperi pe metru patrat


(A/m2)

104

Curentul i sarcina
electric
Amperi pe centimetru
ptrat (A/cm2)

Biologie molecular. Metode experimentale

338

Pentru a converti din:

n:

se multiplic cu:

Amperi pe inci ptrai


(A/in2)

Amperi pe centimetru
ptrat (A/cm2)

0,16

Amperi pe metru patrat


(A/m2)

1,55 x 103

Coulombi (C)

3,6 x 103

Faraday (F)

3,731 x 10-2

Coulombi(C)

Faraday (F)

1,036 x 10-5

Coulombi pe centimetru
ptrat (C/cm2)

Coulombi pe inci ptrat 64,52


(C/in2)

Amperi or (A-hr)

Coulombi pe metru
patrat (C/m2)
Coulombi pe inci ptrat
(C/in2)

Faraday (F)

104

Coulombs pe centimetru 0,16


ptrat (C/cm2)
Coulombs pe metru
patrat (C/m2)

1,55 x 103

Amperi-or (A-hr)

26.,8

Coulombs (C)

9,649 x 10-4

Bari

1,01

Presiunea
Atmosfere (atm)

Milimetri coloana de Hg 760


(mmHg) sau torri
Bari (bar)

Milimetri coloana de Hg
(mmHg) sau torri

Atmosfere (atm)

0,99

Kilograme pe metru
ptrat (kg/m2)

1,020 x 104

psi

14,5

Atmosfere (atm)

1,316 x 10-3

Kilograme pe metru
ptrat (kg/m2)

136

Anex

339

Pentru a converti din:

n:

se multiplic cu:

Pascali (P)

Newtoni pe metru ptrat 1


(N/m2)

Rezistena electric
Ohmi ()

Megaohmi (M)

106

Microhmi ()

10-6

Ore (hr)

24

Minute (min)

1,44 x 103

Secunde (sec)

8,64 x 104

Grade Celsius (oC)

K-273,13

Grade Fahrenheit (oF)

[(K 273,13)
95] + 32

Grade Kelvin (oK)

Grade Fahrenheit (oF)

1,8 x oC + 32

Grade Celsius (oC)

(F -32)/1,8

Picioare pe minut
(ft/min)

1,2

Picioare pe secund
(ft/sec)

3,281 x 10-2

Timp
Zile

Temperatura
Grade Kelvin (K)

Grade Celsius (oC)


Grade Fahrenheit (oF)

C + 273,13

Viteza
Centimetri pe secund
(cm/s)

Kilometri pe or (km/hr) 3,6 x 10-2


Metri pe minut (m/min) 0,6
Mile pe ora (miles/hr)

2,237 x 10-2

Mile pe minut
(miles/min)

3,728 x 10-4

Biologie molecular. Metode experimentale

340

TABEL A4. Date generale privind concentraia aproximativ a diverilor


constitueni intracelulari dup Ausubel et al., 2002 (1)
Macromolecule (proteine, acizi nucleici, poliglucide)

22% (w/w)

Molecule mici
Ap

70% (w/w)

Monoglucide

3% (w/w)

Lipide

2% (w/w)

Aminoacizi liberi

0,4% (w/w)

Nucleotide

0,4% (w/w)

Ioni anorganici

1% (w/w)

Na+

5-15 mM

K+

140 mM

Mg2+
Ca
Cl

2+

pH

30 mM
1-2 mM
4 mM
7,4

Anex

341

TABEL A5. Factori de conversie utilizai frecvent n studiul proteinelor i acizilor


nucleici
Masa molar medie a unei perechi de baze = 649 Da
1 kb de ADN codifica 333 amino-acizi, adic 36.000 Da
1 fragment de 1 kB este echivalentul a 6,5 x 105 Da ADN dublu catenar,
3,3 x 105 Da ADN mono catenar sau 3,4 x 105 Da ARN monocatenar
1 g/ml ADN conine 3,08 M fosfat
1 g/ml ADN cu dimensiunea de 1 kb conine 3,08 nM capete 5
1mol pBR322 (4363 bp) este echivalent a 2,83 g
Masa molar medie a unui aminoacid = 110 Da
10 kDa dintr-o protein conine 91 aminoacizi i este codificat de 273
nucleotide

Biologie molecular. Metode experimentale

342

TABEL A6. Modul de notare prescurtat a nucleotidelor


Prescurtare

Nucleotid

Adenin

Citozin

Guanin

Timin

Uracil

Adenin sau Citozin

Adenin sau Guanin

Citozin sau Guanin

Citozin sau Timin

Guanin sau Timin

Adenin, Citozin sau Guanin (oricare, exceptnd


Timina)

Adenin, Citozin sau Timin (oricare, exceptnd


Guanina)

Adenin, Guanin sau Timin (oricare, exceptnd


Citozina)

Citozin, Guanin sau Timin (oricare, exceptnd


Adenina)

Oricare din cele cinci nucleotide

Prescurtarea
cu trei litere

Ala

Arg

Asn

Asp

Cys

Glu

Gln

Gly

His

Ile

Leu

Lys

Met

Aminoacid

Alanin

Arginin

Asparagin

Acid aspartic

Cistein

Glutamat

Glutamin

Glicin

Histidin

Isoleucin

Leucin

Lizin

Metionin

149.2

146.2

131.2

131.2

155.2

75.1

146.2

147.1

121.2

133.1

132.1

174.2

89.1

Prescurtarea cu o Mas
litera
molar
(g/mol)

TABEL A7. Principalele proprieti fizico-chimice ale aminoacizilor

185

200

170

175

195

75

180

190

135

150

160

225

115

Aria
suprafeei
accesibilea

1.02

-0.67

1.22

1.25

-0.64

-0.67

-0.91

-1.22

0.17

-1.31

-0.92

-0.59

-0.4

94

56

40

96

66

49

93

102

20

106

134

65

100

HidroMutabilitate
b
fobicitate relativ c

Anex
343

Pro

Ser

Thr

Trp

Tyr

Val

Prolin

Serin

Treonin

Triptofan

Tirozin

Valin

117.1

181.2

204.2

119.1

105.1

115.1

165.2

Prescurtarea cu o Mas
litera
molar
(g/mol)

155

230

255

140

115

145

210

Aria
suprafeei
accesibilea

0.91

1.67

0.5

-0.28

-0.55

-0.49

1.92

74

41

18

97

120

56

41

HidroMutabilitate
fobicitateb relativ c

Aria suprafeei accesibile este exprimat n i este calculat pentru fiecare aminoacid ca parte a unui schelet polipeptidic (2)
Hidrofobicitatea este exprimat n uniti arbitrare folosind scala OMH descrisa de Sweet i Eisenberg (1983) (3)
c
Mutabilitatea relativ este exprimat nuniti arbitrare(alanina fiind aleas ca referin) i reprezint probabilitatea ca un aminoacid s sufere o mutaie ntr-un timp
dat (4)

Phe

Fenilalanin

Prescurtarea
cu trei litere

Aminoacid

344
Biologie molecular. Metode experimentale

A
N/A
A
C
D
C
A

D
D
D
D
D
D
D
D

Benzen

Cloroform

Diclorbenzen

Hexan

Nitrobenzen

Fenol

Toluen

Dicloretan
A
A
A
A
A

A
D
N/A
B
D

Alcool amilic

Alcool benzilic

Alcool izopropilc

Etanol

Metanol

Alcooli

N/A

Acrilonitril
A

Acetal

Aceton

Sloveni organici

ABS

CPVC

N/A

LDPE

N/A

PC

PEEK

PP

TABEL A8. Compatibilitate chimic a diverselor tipuri de materiale plastice utilizate n laborator:

PTFE

PVC

N/A

N/A

PVDF

Anex
345

B
A
D
C
D
N/A
N/A
D
D
D

D
D
D
C
A
B
N/A
N/A
C
D
D

Aqua Regia (HCl 80%, HNO3


20%)

Acid citric

Acid formic

HF pn la 75%

HCl 37%

H2SO4 10-75%

H2SO4 98%

Acid tricloracetic, TCA

HNO3 pn la 50%

HNO3

H3PO4 mai concentrat de 40%)


D
A
A

D
B
A

Amoniac

Mg(OH)2

KOH

Baze

Acetal

Acid acetic glacial

Acizi

ABS

N/A

CPVC

LDPE

N/A

PC

N/A

PEEK

PP

PTFE

PVC

PVDF

346
Biologie molecular. Metode experimentale

A
A
D
D
A
A
D

B
B
A
D
B
B
A

Detergeni

Formaldehid

H2O2

Iod

AgNO3

Uree

NaOCl pn la 20%

CPVC

LDPE

N/A

PC

PEEK

PP

PTFE

PVC

PVDF

A = compatibilitate excelent, B = compatibilitate bun, efecte mici o uoar decolorare sau coroziune, C = compatibilitate relativ
bun, efecte mai pronunate, nu se recomand pentru utilizarea continu; pot aprea fenomene de nmuiere sau umflare, D = efecte
severe, nu se recomand utilizarea, N/A = nu exist informaii despre compatibilitate

Acetaldehid

Altele

NaOH pn la 80%

Acetal

ABS

Anex
347

348

Biologie molecular. Metode experimentale

FIGURA A1. Nomogram pentru conversia forei centrifuge (g) n vitez de rotaie
(rpm).
Pentru a identifica pe nomogram o valoare necunoscut se traseaz o dreapt
descris de dou puncte de pe celelalte dou coloane. Valoarea dorit se citete la
intersecia dreptei cu coloana de interes. Pentru centrifugri la viteze mai mari se
folosete nomograma din figura A2. Pentru valori precise, se utilizeaz ecuaia
prezentat n subcapitolul dedicat centrifugarii, pagina 15.

Anex

349

FIGURA A2. Nomogram pentru conversia forei centrifuge (g) n vitez de


rotaie (rpm).
Pentru a identifica o valoare necunoscut folosind nomograma reprezentat n figura se
traseaz o dreapt descris de dou puncte de pe celelalte dou coloane. Valoarea
dorit se citete la intersecia dreptei cu coloana de interes. Pentru valori precise, se
utilizeaz ecuaia prezentat n n subcapitolul dedicat centrifugarii, pagina 15

Biologie molecular. Metode experimentale

350

FIGURA A3. Harta situs-urilor de restricie a plasmidului pUC19c


A. organizarea general a plasmidului (mcs situs multiplu de clonare; lacZ
fragmentul Nterminal al genei ce codific galactozidaza din calea metabolic a
lactozei; Ori originea de replicare provenind din plasmidul pMB1; bla(AmpR) confer
rezisten la ampicilin) B. Secvena n zona MCS

Anex

351

FIGURA A4. Harta situs-urilor de restricie a plasmidului pBluescript II SK


A. organizarea general a plasmidului (mcs situs multiplu de clonare; f1 ori originea
de replicare provenind din fag; lacZ fragmentul Nterminal al genei ce codific
galactozidaza din calea de metabolic a lactozei; Plac promotorul sub controlul cruia
este pus gena clonat; pUC ori originea de replicare provenind de la plasmidul pUC;
bla(ApmR) gena ce confer rezisten la ampicilin) B. Secvena n zona MCS.

352

Biologie molecular. Metode experimentale

FIGURA A5. Harta situs-urilor de restricie a plasmidelor pET21a;

A. organizarea general a plasmidului (mcs situs multiplu de clonare; f1 ori


originea de replicare provenind din fag lacZ fragmentul Nterminal al genei ce codific
galactozidaza din calea metabolic a lactozei; face posibil selecia alb/albastr prin
complementare alfa pe plci cu Xgal; ori originea de replicare provenind de la
plasmidul pUC; lacI represorul din operonul lac cu rol n controlul expresiei genei
clonate; bla(ApmR) gena ce confer rezisten la ampicilin) B. Secvena n zona
MCS.

Anex

353

FIGURA A6. Harta situs-urilor de restricie a plasmidului pMAL-c5X


A. organizarea general a plasmidului (mcs situs multiplu de clonare;
bla(ApmR) gena ce confer rezisten la ampicilin; ori originea de replicare
provenind de la plasmidul pBlueScript; lacIq represorul din operonul lac cu rol n
controlul expresiei genei clonate; P tac promotorul sub controlul cruia este pus gena
clonat; malE maltose binding protein, proteina cu afinitate pentru maltoz din E.coli,
rrnBT1T2 zona de semnalizare a sfritului transcripiei B. Secvena n zona MCS.

354

Biologie molecular. Metode experimentale

Bibliografie:
1. Ausubel, M. F., Brent, R., Kingston, E. R., Moore, D. D., Seidman, J.
G., Smith, A. J., Struhl, K. (2002) Short Protocols in Molecular
Biology, p. A2-1,. John Wiley & Sons Inc.
2. Chothia, C. (1976) The nature of the accessible and buried surfaces in
proteins, Journal of Molecular Biology, 105, 1-12.
3. Sweet, R. M., Eisenberg, D. (1983) Correlation of sequence
hydrophobicities measures similarity in three-dimensional protein
structure, Journal of Molecular Biology, 171, 479-88.
4. Dayhoff, M., Schwartz, R., Orcutt, B. (1978) A model of evolutionary
change in proteins, Atlas of Protein Sequence and Structure, 5, 345352.