Sunteți pe pagina 1din 4

Genetica microorganismelor şi inginerie genetică microbiană

Note de curs şi tehnici de laborator

CAP.1.3.3. TRANSDUCŢIA

Transducţia genetică reprezintă transferul de material genetic de la o bacterie donor la o bacterie


receptor, prin intermediul unui fag temperat.
Virusurile bacteriene - denumite bacteriofagi (fagi) - sunt clasificate în:
a) fagi virulenţi - toate celulele bacteriene infectate sunt omorâte, având loc morfogeneza
fagică completă şi eliberarea de particule fagice mature;
b) fagi temperaţi – în celula bacteriană infectată fagul prezintă două posibilităţi de evoluţie:
- evoluţie litică (în care are loc morfogeneza fagică, liza bacteriană şi eliberarea
particulelor fagice mature);
- evoluţie lizogenă (în care genomul fagic, denumit profag, se integrează în cromozomul
bacterian replicându-se odată cu acesta). Trecerea de la ciclul lizogen la ciclul litic
presupune excizia genomului fagic din cromozomul bacterian, proces ce se poate realiza
corect (genom fagic intact) sau eronat (caz în care genomul fagic preia gene bacteriene
adiacente situsului de ataşare).
Au fost descrise 2 tipuri de transducţie genetică:
a) transducţie specializată - genomul fagic se integrează în situsuri specifice din cromozomul
bacterian şi, în consecinţă, nu poate transducta decât anumite gene;
b) transducţie generalizată - genomul fagic se poate integra în orice situs din cromozomul
bacterian şi, ca atare, fagul transductor poate transmite orice genă bacteriană.

Transducţia specializată. Relaţia E.coli - fagul λ


1. Biologia şi genetica fagului λ
Fagul λ este un fag cu simetrie icozaedrică. Genomul fagic este format dintr-o moleculă ADN dublu
catenar (d.c.) lineară, cu lungimea de 48 kpb, prezentând capete 5’ monocatenare coezive (12-20
nucleotide neîmperecheate). In timpul infecţiei fagice, în celula bacteriană pătrunde numai genomul
fagic care se circularizează la nivelul capetelor coezive sub acţiunea ADN ligazei gazdei bacteriene.

ORPR Genomul λ cuprinde gene implicate în


CI PRM replicare, recombinare şi evoluţia
PLOL cro litică/lizogenă (vezi Fig.1.34.). Funcţie de
N perioada în care sunt transcrise, genele
cII
fagului λ se împart în:
cIII
tR1 - gene cu transcriere timpurie (genele N, cro,
O cI) - se stabileşte intrarea în ciclul litic sau
xis P lizogen;
Q - gene cu transcriere mijlocie (genele int, xis,
Pint red, cIII, cII, O, P) - se realizează replicare şi
int tR2 recombinare
Tint - gene cu transcriere târzie (genele Q, S, R şi
attP PR’
S genele capsidei şi cozii) - se realizează
R morfogeneză fagică.
Z cos In funcţie de cascada litică sau ciclul lizogen,
A în transcrierea timpurie se exprimă fie genele
genele pentru
sinteza cozii
genele pentru
sinteza capsidei
N (anti-terminator timpuriu) şi cro (produsul ei
J
este represor pentru gena cI), fie, respectiv,
F
gena cI (produsul ei represează exprimarea
tuturor genelor fagice).
Fig.1.32. Structura moleculara a genomului fagului λ

Gena cI-λ este transcrisă de la un promotor propriu notat PRM (Repression Maintenance). Acest
promotor se suprapune parţial peste OR . Gena cI codifică pentru un represor ce face parte din familia
proteinelor helix-turn-helix cu afinitate pentru ADN, active doar în forma dimerică (Fig.1.33.). Fiecare
monomer proteic este format din 2 domenii: domeniul carboxi-terminal, de asociere cu alte proteine
(interacţiune represor-represor) şi domeniul amino-terminal, de legare ADN (la un situs format din 17
pb) – Fig.1.34. Structura dimerică este esenţială pentru menţinerea lizogeniei, iar în momentul
represiei, molecula funcţionează ca tetramer.

1
Cap. 1.3.3. Transducţia

Represorul
dimeric

Represorul
monomeric

ARNm cI

O /P O /P
R R
ARN polimeraza Represorul impiedica
Represorul impiedica Gena cI leaga P si transcrie legarea ARN polimerazei Fig.1.33. Transcrierea genei cI-λde la
legarea ARN polimerazei gena cI
RM
la PR promotorul PRM
la P
L

C
236 Domeniu de dimerizare C C
132
Conector
92
Domeniu de legare la ADN N N
11
Fig.1.34. Structura represorului cI-λ N

ARNm N Celelalte gene cu


ARN polimeraza nu poate transcriere timpurie, precum şi
initia transcrierea de la P RM ARN polimeraza genele cu transcriere mijlocie, sunt
in absenta represorului initiaza transcrierea transcrise de la alţi 2 promotori - PL
de la PR
(left) şi PR (right) situaţi de o parte şi
de alta a genei cI. Aceşti 2 promotori
au în structura lor operatori (OL şi,
respectiv, OR) multipli, ce cuprind
ARN polimeraza
initiaza transcrierea
mai multe situsuri (OR1, OR2, OR3 şi
de la LP OL1, OL2, OL3) la care se poate ataşa
represorul (cI) sau anti-represorul
ARNm cro (cro) (Fig.1.35, Fig.1.36).
Fig.1.35. Transcrierea genelor timpurii de la promotorii PL si PR

Situsul de leagare al ARN-polimerazei


RM
la P In cazul evoluţiei lizogene,
ARNm cI OR3 OR2 OR1
represorul cI se ataşează în forma
TTTCTTTTTTGTGCTCATACGTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATG
tetramerică la situsurile OR1 şi OR2 (şi la
OL1 - OL2) : un dimer complexează OR1 şi
interacţionează cu un al doilea dimer,
Situsul de leagare al ARN-polimerazei la P
R
care complexează situsul OR2. Atunci
când concentraţia represorului cI se
ARNm cro situează la nivel constitutiv, acesta nu
OL3 OL2 OL1 se ataşează şi la situsul OR3. ARN
CAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCA
polimeraza se ataşează la PRM
(suprapus parţial pe OR3) interacţionând
cu moleculele cI ataşate la OR1 şi OR2.
Situsul de leagare al ARN-polimerazeiLla P
Deci, în această situaţie, cI funcţionează
ARNm N
ca un reglator pozitiv al propriei
transcrieri.
Fig.1.36. Organizarea moleculara a operatorilor OR si OL

2
Genetica microorganismelor şi inginerie genetică microbiană
Note de curs şi tehnici de laborator

Menţinerea lizogeniei
presupune blocarea transcrierii LIZOGENIE: se INDUCTIA LITICA:
genelor plasate de o parte şi de stabileste un echilibru cl iva re a monomeri lor
intre monomeri si modifica echilibrul dintre
alta a genei cI prin complexarea dimeri; dimerii se m on o me ri si d im e ri ;
represorului la secvenţele OR şi leaga la ADN dimerii disociaza de ADN
OL.
Dacă represorul este
clivat în zona de joncţiune dintre
capătul carboxi- şi cel CLIVARE
aminoterminal (prin acţiune
proteolitică, de ex. proteina Rec
A în sistemul SOS) sau dacă
balanţa dintre monomeri şi
dimeri înclină în favoarea
monomerilor (situaţie întâlnită la
concentraţii scăzute ale lui cI)
zona operatoare în regiunea OR3
este complexată cu proteina cro
(antirepresor) împiedicând ARN
polimeraza să transcrie de la
PRM. In acest caz, ARN
polimeraza leagă promotorul PR
iniţiând transcrierea genei cro şi
a genelor situate adiacent în
partea dreaptă (Fig.1.37.), Fig.1.37. Inducţia litică se realizează prin clivarea represorului
declanşându-se astfel evoluţia
litică.

Trecerea de la transcrierea timpurie la transcrierea mijlcie se realizează prin intervenţia


proteinei N cu funcţie de anti-terminator al transcrierii. Iniţierea transcrierii genelor târzii se realizează
de la promotorul PR’prin intervenţia anti-terminatorului Q.
Transcrierea genelor fagice se opreşte la secvenţe terminator: tL (în partea stânga) şi tR1, tR2
(în partea dreaptă).

Integrarea genomului λ în cromozomul bacterian


Integrarea genomului λ în cromozomul celulei
bacteriene se realizează între genele gal
(galactoza) şi bio (biotina), la nivelul unui situs ADN fagic
specific specific (attB) de ataşare, cu secvenţă
echivalentă cu situsul att din genomul λ (attP). attP

Situsurile de ataşare attB şi attP prezintă (Fig. POP’


1.38.): BOB’
- o secvenţă O comună la attB şi attP ADN bacterian
(numită secvenţă core) la nivelul căreia se
realizează procesul de recombinare; Integrarea necesita
- 2 regiuni flacante numite B, B’ şi, prezenta Int si IHF
respectiv, P, P’, cu secvenţă diferită pentru cele 2
regiuni att.
In urma integrării, genomul fagic va fi flancat de 2
regiuni att: attL (left) şi attR (right). Procesul de
integrare se realizează sub acţiunea a 2 proteine:
- produsului genei fagice int care este o
recombinază situs-specifică;
- proteina bacteriană IHF (Integration
Host Factor) Excizia necesita
prezenta Int, Xis si IHF
Genomul fagului λ este menţinut în stare
integrată prin represie determinată de cI, BOP’ POB’

replicându-se odată cu cromozomul bacterian. attL Profag attR

Fig.1.38. Integrarea genomului λ în cromosomul bacterian

3
Cap. 1.3.3. Transducţia

Excizia genomului λ (profag) din cromozomul bacterian (inducţia fagică)


Excizia profagului din cromozom se realizează în cazul în care represorul cI este inactivat. Procesul
de excizie este realizat de 3 proteine:
- excizionaza (produsul genei fagice xis);
- integraza (produsul genei fagice int)
- IHF (produsul genei bacteriene ihf)
Odată excizat din cromozomul bacterian, genomul fagic se replică succesiv, proces urmat de
morfogeneza fagică - formare de particule fagice mature. Această evoluţie litică are drept consecinţă
liza celulei bacteriene şi eliberarea particulelor fagice mature.
Excizia profagului din cromozomul bacterian se poate realiza în 2 moduri:
- corect, cu generare de particule fagice mature cu genom intact
- eronat, cu generare de particule fagice defective ce preiau şi gene din cromozomul bacterian
(genele adiacente profagului - bio şi /sau gal), rezultând fagi transductori.
Fagii transductori pot infecta alte celule bacteriene, iar în evoluţia lizogenă pot conferi proprietăţi noi
bacteriilor respective (de ex. o celulă bacteriană bio− poate deveni bio+).

Replicarea genomului λ
Dupa infecţie sau după eliberarea genomului λ în celula gazdă, molecula lineară de ADN se
circularizează şi se replică în prima fază pe model bidirecţional (Fig.1.41.), rezultând dimeri circulari.
Această formă replicativă dimerică este resolvată în monomeri circulari sub acţiunea recombinazei
Red (produsul genei red).

Ulterior, (dupa 30 min de la Genom λ linear


infecţie) se declanşează un al doilea tip de
replicare - pe model cerc rotativ - în care Circularizare Proteina Red
monomerii circulari sunt folosiţi ca matriţă
şi sunt generate molecule concatemere cos

lineare. In acest mecanism replicarea este


iniţiată în situsul ori al genomului λ prin
incizia uneia din catenele ADN de către
Dimer
endonucleaza A; catena intactă va fi
folosită ca matriţă pentru sinteza primei Replicare pe modelul
catene noi, în timp ce cealaltă catenă 3’
cercului rotativ

veche este dislocată din dublu helix 5’


3’
(Fig.1.39.). Replicarea continuă a catenei 3’ 5’
3’
5’

vechi circulare generează o monocatenă 5’

multimerică, care pe masură ce este


dislocată din dublu helix, este la rândul ei
replicată, generându-se astfel o moleculă
d.c. multimerică (concatemeri). A cos R A cos
Concatemerii rezultaţi sunt apoi resolvaţi în
monomeri lineari sub acţiunea Concatemeri
endonucleazei A care taie molecula ADN la
situsurile cos generând capete coezive.
Monomerii sunt incluşi în capside
A R A R A
preformate rezultând particule fagice
mature. După aproximativ 60 min de la Rezolvarea multimerilor in monomeri
infecţie, celula gazdă “explodează” şi si impachetare in capside fagice
eliberează circa 100 particule fagice ce îşi
reiau ciclul de evoluţie.

Fig.1.41. Replicarea genomului fagului λ