Sunteți pe pagina 1din 62

Clonarea si purificarea a două proteine

implicate în ansamblarea enzimei


multimerice KDH din Arthrobacter
nicotinovorans pAO1

Marius I. Mihasan

Teza de dizertatie

Conducător ştiinţific,
Prof. Dr. Vlad Artenie
Prof. Dr. Roderich Brandsch

Iaşi
2007
1
Cuprins
Abrevieri ......................................................................................................................................... 2
Introducere...................................................................................................................................... 4
Cap I. Particularităţi morfologice, fiziologice şi metabolice ale microorganismului Arthrobacter
nicotinovorans pAO1+ ................................................................................................................... 5
1.1. Încadrarea taxonomică a speciei Arthrobacter nicotinovorans pAO1+............................. 5
1.2. Particularităţile metabolice şi fiziologice ale genului Arthrobacter .................................. 6
1.3. Megaplasmidul pAO1 – organizare generală .................................................................... 7
1.3.1. Gene implicate în replicare ......................................................................................... 8
1.3.2. Gene implicate în conjugare ..................................................................................... 10
1.3.3. Gene implicate în fenomenele de transpoziţie ....................................................... 11
1.3.4. Gene implicate în rezistenţa la antibiotice ................................................................ 13
1.3.5. Gene implicate în utilizarea nicotinei ....................................................................... 13
A. Gene implicate în desfacerea inelului piridinic ................................................... 14
B. Gene implicate în clivarea şi metabolizarea catenei laterale ............................... 16
C. Gene implicate în sinteza cofactorului molibdenic ............................................. 19
D. Gene implicate în transportul nicotinei ............................................................... 21
E. Gene cu funcţie necunoscută................................................................................ 21
1.3.6. Apariţia şi evoluţia plasmidului .............................................................................. 22
Cap II. Proprietăţile teoretice ale proteinelor coxD şi coxE rezultate din analiza secvenţei celor 2
gene .............................................................................................................................................. 23
2.1. Metode de investigare şi analiză a secvenţelor de nucleotide şi aminoacizi .................... 23
2.2. Analiza secvenţei genei coxD........................................................................................... 25
a. Date derivate din analiza structurii primare a proteinei CoxD ...................................... 25
b. Domenii înalt conservate prezente în structura proteinei coxD ..................................... 25
c. Analiza structurii secundare a proteinei coxD ................................................................ 28
2.3. Analiza secvenţei genei coxE ........................................................................................... 29
a. Date derivate din analiza structurii primare a proteinei CoxE ....................................... 29
b. Domenii înalt conservate prezente în structura proteinei coxE ..................................... 29
c. Analiza structurii secundare a proteinei coxE ................................................................. 30
Cap. III. Material şi metode de cercetare ..................................................................................... 31
3.1. Tulpini bacteriene şi condiţii de creştere .......................................................................... 31
a. Tulpini bacteriene............................................................................................................ 31
b. Mediul de cultură: ........................................................................................................... 32
c. Condiţii de cultivare: ....................................................................................................... 33
3.2. Strategii de clonare şi verificare a clonelor utilizate ........................................................ 33
3.3. Purificarea proteinelor recombinate utilizând cromatografia de afinitate pentru metale
imobilizate ............................................................................................................................... 36
3.4. Analiza conţinutului proteic ............................................................................................. 38
3.5. Metode de determinare a activităţii ATP-azice utilizate ................................................ 39
3.6. Prepararea anticorpilor şi Western-Blot ........................................................................... 39
3.7. Re-plierea in vitro a corpilor de incluziune ...................................................................... 41
Cap IV. Rezultate şi discuţii ......................................................................................................... 43
4.1. Clonarea secvenţelor genelor coxD şi coxE şi expresia proteinelor recombinante ......... 43
4.2. Purificarea proteinei recombinante coxD ........................................................................ 45
4.3. Măsurarea activităţii ATP-azice a proteinei coxD ........................................................... 47

2
4.5. Expresia nicotin-dependentă si localizarea celulară a proteinei coxD ............................ 49
4.6. Replierea in vitro a corpilor de incluziune şi purificarea parţială a proteinei coxE ......... 51
Concluzii ...................................................................................................................................... 55
Bibliografie ................................................................................................................................... 56

Abrevieri

6HDNO - 6-hidroxi-D-nicotin oxidaza


6HLNO - 6-hidroxi-D-nicotin oxidaza
ADN - acid dezoxiribonucleic
ARN - acidul ribonucleic
ATP - adenozin trifosfat
BLAST - Basic Local Aligment Tool
CAT - ciclul acizilor tricarboxilici
CDD - conserved domain database
COG - Clusters of Orthologous Groups
CFE- cell free extract
DMF (dimetil-formamidă)
DHPONH - 2,6-dihidroxipseudooxinicotin-hidroxilaza
EMSA - electromobility gel shift assay
FAD - flavinadenindinucleotidul
GABA - acid gama-aminobutiric
GLIMMER - Gene Locator and Interpolated Markov ModelER
IMAC - imobilized metal affinity chromatography
IPTG - Isopropil β-D-1-tiogalactopiranosid
IR - inverted repeats
IS - insertion elements
kDa - kiloDaltoni
KDH - ketone-dehidrogenase (ceton-dehidrogenaza)
LB - Lauria-Bertani
MABO - metil-γ-N-aminobutirat oxidaza
MAO - monoamin-oxidază
MCD - molibdopterin-citozin-nucleotidul
MGD - molibdopterin-guanozin-nucleotidul
Moco - cofactorul molibdopterinic
MPT - molibdopterina
CDS - numărul de acces în Conserved-Domains Search
NAD - nicotin-adenin-dinucleotidul
NADP - nicotin-adenin-dinucleotidul
NDH – nicotin-dehidrogenaza
3
NTA - acidul nitrilotriacetic
NBT- nitro blue tetrazolium chloride
ORF – open reading frames
PCR – polymerase chain reaction
PEG - polietilen-glicol
RDB - ribosomal Database Project
ROS - reactive oxigen species
RT-PCR - reverse transcription polimerase chain reaction
SMART – Simple Modular Architecture Research Tool
SsaDH – succinic-semialdehid-dehidrogenaza
SDA- sodiu-dodecil-sulfat
pAO1 - plasmidul Arthrobacter oxidans 1
pb – perechi de baze
Tris – hidroximetil-aminometan

4
Introducere

Una dintre cele mai de răsunet realizări ale biochimie a fost elucidarea
mecanismului de stocare a informaţie genetice şi de sinteză a celor mai importante
componente ale lumii vii, proteinele. Aceasta a deschis numeroase direcţii de cercetare
şi apariţia unor ramuri ale biochimiei cu totul noi, precum biologia moleculară şi
cristalografia proteinelor.
Deşi mecanismul de bază a fost explicat şi descris prin efortul unui număr mare
de cercetători între anii 1961 şi 1965, chiar şi la ora actuală există numeroase probleme
legate de mecanismul de sinteză a proteinelor care sunt încă acoperite de mister. Una
dintre acestea se referă la modul în care are loc edificarea structurilor superioare a
proteinelor. Este aceasta în totalitate coordonată de informaţia aflată în secvenţa de
nucleotide sau respectiv aminoacizi a proteinei care este produsă?
Problema devine şi mai complicată dacă ţinem cont de faptul că numeroase
proteine au o structură complexă, fiind alcătuite din subunităţi identice sau diferite sau
pot conţine cofactori variaţi. Apare astfel întrebarea cum se realizează în acest caz
ansamblarea tuturor acestor elemente cu formarea proteinei native, în stare activă.
Din ce în ce mai multe date vin să infirme această ipoteză şi să introducă în scenă
noi actori ce intervin în proces. Este vorba pe de o parte de enzime ce realizează
modificări postranslaţionale ale lanţului polipeptidic şi, pe de altă parte, de enzime
specializate în plierea proteinelor, numite chaperones. Acestea sunt proteine sunt
frecvente atât la eucariote cât şi la procariote, însă de departe cel mai bine studiate sunt
proteinele de şoc termic de la E. coli.
În lucrarea de faţă ne propunem să investigăm rolul a două cadre de citire plasate
pe megaplasmidul pAO1, în apropierea de o genă pentru subunitatea mare a ceton-
dehidrogenazei, enzimă cheie din calea de degradare a nicotinei. Aceste cadre de citire
sunt deosebit de interesante deoarece cadre asemănătoare ca secvenţă sunt sunt
ominprezente în operoanele ce codifică enzime multimerice ce au în structură cofactorul
molibdenic. Rolul lor nu a putut fi determinat încă în nici unul dintre microorganismele
ce le conţin, dar analiza secvenţei de aminoacizi demonstrază existenţa unor elemente ce
le fac candidaţi pentru funcţii asemănătoare unor chaperoni moleculari sau enzime ce
modifică postranslaţional secvenţa de aminoacizi.
5
Scopul cercetărilor este aşadar unul pur teoretic, acela de a elucida mecanismul
intim de sinteză a uneia dintre enzimele cheie a căii de degradare a nicotinei. Bineînţeles,
aplicaţiile practice nu au fost excluse, ele fiind legate în mod indirect de aceste cercetări.
Punerea în lumină a detaliilor mecanismului de ansamblare a acestei proteine ar putea
elimina problema instablităţii ei şi oferi căi de producere şi conservare a ceton-
dehidrogenazei în vederea unor eventuale aplicaţii industriale.

Cap I. Particularităţi morfologice, fiziologice şi metabolice ale


microorganismului Arthrobacter nicotinovorans pAO1+

1.1. Încadrarea taxonomică a speciei Arthrobacter nicotinovorans pAO1+

Conform serverului Taxonomy la NCBI , server pe care se află apoximativ


205000 organisme clasificate (68), specia este încadrată taxonomic astfel:
Regn Bacteria;
Filum Actinobacteria;
Clasa Actinobacteria;
Subclasa Actinobacteridae;
Ordinul Actinomycetales;
Subordinul Micrococcineae;
Familia Micrococcaceae;
Specia Arthrobacter nicotinovorans face parte din genul Arthrobacter. Iniţial s-a
numit A. oxidans însă a fost reclasifictă în 1992 de Kodama et. al.(34) şi a primit numele
actual, nume ce reflectă principala caracteristică metabolică, şi anume abilitatea de a
metaboliza nicotina.
La ora actuală pe plan internaţional este recunoscut faptul că, în cazul taxonomiei
bacteriilor împăţirea funcţie de coloraţie, metabolism şi componenţii chimici (alcătuind aşa
numita chemo-taxonomie) nu mai este suficient de precisă şi nu oferă informaţii referitoare la
relaţiile de evoluţie care există între specii. Una dintre noile tehnici utilizată este analiza
secvenţei ARN-ului 16S. Realizarea de colecţii de secvenţe precum Ribosomal Database
Project (RDB, Maidak et al. 1994) permite realizarea unei noi împărţiri, ce ţine cont atât de
relaţiile evolutive cât şi de proprietăţile chimice şi metabolice.
Conform (40), grupul Arthrobacter cuprinde subgrupul Microbacterium,
Clavibacter, Arthrobacter şi Dermatophilus. Împărţirea tradiţională pe genuri se face in
cadrul acestor subgrupuri, astfel subgrupul Arthrobacter cuprinde genurile
Arthrobacter, Brevibacterium, Micrococcus, Renibacterium şi Rothia. Împărţirea se face
funcţie de prezenţa sau absenţa ciclului morfologic bacil/coc, tipul de diaminoacid din
structura peretelui celular şi alte proprietăţi metabolice. Relaţiile de rudenie între speciile
aparţinând genului Arthrobacter pot fi observate în figura 1.

6
Fig 1. Arborii evolutivi şi
speciile înrudite cu Arthrobacter
nicotinovorans.

La ora actuală au fost descrise un număr


de 62 specii aparţinînd acestui gen care
au fost izolate în culturi pure şi sunt
catalogate în diferite colecţii de
microorganisme.

1.2. Particularităţile metabolice şi fiziologice ale genului Arthrobacter

Genul Arthrobacter conţine specii de gram positive, strict aerobe de bacterii


foarte frecvente în sol. Acestea fac parte din grupul actinomicetelor-corineforme
producătoare de catalază, cu un conţinut mare de G+C (40), în medie de 59-70% (67).
Specia A. nicotinovorans are un conţinut în G+C de 62%, ceea ce corespunde foarte bine
cu caracteristica genului.
Trăsătura distinctivă a acestui gen este variabilitatea formei celulei şi a reacţiei la
coloraţia Gram în timpul ciclului celular. Astfel, când culturile sunt tinere, în faza exponenţială,
celulele sunt bacilare şi gram negative. În timpul creşterii, după aproximativ 30 de ore, bacili
scad în dimensiuni şi îşi fac apariţia formele cocoide, gram pozitive. Bacili se pot asocia şi
forma structuri asemănătoare cu picioarele articulate ale artropodelor, de unde şi numele
genului.

Fig.2. Variabiliatea morfologică a speciilor


aparţinînd genului Arthrobacter (din Virginia
Polytechnic Institute and State University).

Acidul gras predominant este, în cele mai multe


cazuri reprezentat de acidul 1,3-metilpentadecanoic,
diamino-acidul din structura peretelui celular este
reprezentat din lizină, peptidoglicanul fiind de tipul lys-ala-tre-ala.
În general speciile aparţinând acestui gen sunt extrem de versatile metabolic,
producând un număr variat de enzime care le permit ocuparea a numeroase nişe
ecologice şi utilizarea unui număr mare de substrate ca sursă de carbon şi azot. Astfel,
demn de remarcat este specia A. flavus izolată din Antarctica (50), specia A. russicus
izolată de pe staţia spatială Mir (69) sau specia A. koreensis rezistentă la valori mari de
pH (7-12) (37). Diferitele specii de Arthrobacter pot metaboliza un număr variat de
compuşi toxici pentru om sau animale, din acest punct de vedere ele constituind un

7
subiect foarte interesant de investigat. Astfel, speciile A. methylotrophus şi A.
sulfonivorans au capacitatea de a metaboliza dimetil-sulfona şi dimetil-sulfoxidul cu
ajutorul a două reductaze. Într-o primă etapă dimetil-sulfona este redusă cu ajutorul unei
reductaze NADPH-dependente la dimetilsulfoxid şi apoi dimetil-sulfide. Prin
monooxigernarea acestuia din urma se obţine metan-tiol şi formaldehidă, după schema:
(CH3)2SO2→(CH3)2SO→(CH3)2S→CH3SH+HCHO
Metan-tiolul este mai departe oxidat la formaldehida şi hidrogen-sulfurat:
CH3SH+0.5O2→HCHO+H2S, iar hidrogenul sulfurat este oxidat la sulfat
(6).
În acest fel aceste 2 specii au abilitatea de a utiliza metilsulfona, compus ce nu poate fi
degradat prin metode chimice, fiind foarte rezistent la atacul acizilor tari sau a agenţilor de
oxidare.
O altă specie cu un metabolism interesant ce face parte din acest gen este A.
chlorophenolicus, care după cum arată şi numele are capacitatea de a metaboliza 4-
clorofenol. Compusul este unul toxic şi rezultă din procesul de clorinare a apelor uzate,
din degradarea ierbicidelor sau din degradarea anaerobă a unor fenoli înalt-halogenaţi.
Toxicitatea lui este demonstrată şi de faptul că nu există decât câteva specii care pot
degrada acest compus, dar în cantităţi foarte mici, de ordinul 0,2-0,8 mM (67). Calea de
degradare nu a fost încă descrisă.
Cromul hexavalent este un alt compus extrem de toxic, a cărui inactivare ridică
numeroase probleme. Recent o specie încă incomplet descrisă, dar clasificată ca făcând
parte din genul Arthrobacter a fost izolată în culturi pure prin selecţie cu cantităţi mari
de crom. Nu numai că izolatul este capabil să crească la concentraţii mari de Cr(VI) dar
poate de asemenea să îl reducă la Cr(III), formă ce este de 100 de ori mai puţin toxică.
Potenţialul biotehnologic al acestei specii este deosebit de mare, poluarea cu Cr(VI) fiind
foarte frecventă datorită utilizării lui în industria coloranţilor şi pielăriei (44).
Alte substrate pe care speciile aparţinând acestui gen le pot metaboliza sunt:
metil-terţ-butil-eter, 2,4-diclorofenoxiacetat-4-nitrofenol, dimetilsilan-diol, fluoren,
ftalat, nitroglicerină. Această mare versatilitate metabolică poate fi explicată prin gama
largă de enzime pe care le produc. Recenta secvenţiere a genomului de la Arthrobacter
sp. FB24 (Gene Bank AAHG00000000), arată existenţa unui numar de 4576 de gene,
dintre care 4522 codifică proteine.
Genul nu cuprinde specii patogene, însă au fost semnalate şi cazuri în care au fost
izolate specii aparţinând acestui gen din diferitele fluide al corpului uman. Acestea
proveneau însă în general de la indivizi cu dereglări ale sistemului imunitar, de aceea au
fost catalogate drept patogeni oportunişti (66).

1.3. Megaplasmidul pAO1 – organizare generală

Capacitatea acestui microorganism de a degrada nicotina este legată de prezenţa


plasmidului catabolic pAO1 pe care se află genele ce codifică enzimele implicate în această
cale metabolică.
Plasmizii catabolici sunt în general de dimensiuni mari, peste 100 de kb şi, deşi nu conţin gene
esenţiale pentru supravieţuirea gazdei, oferă acesteia o înaltă versatilitate metabolică şi
capacitatea de a utiliza ca sursă de C şi N diferiţi compuşi naturali sau sintetici. Ei sunt de

8
asemenea responsabili de răspândirea pe linie orizontală, interspecifică a acestor proprietăţi.
Plasmidul pAO1 a fost izolat pentru prima dată în 1984 (7), iar în 2003 a fost
complet secvenţiat (31). Secvenţa a fost plasată în baza de date GenBank şi are
indicativul gi|25169022, iar în baza de date EMBL-EBI are indicativul AJ507836. Demn
de menţionat este faptul că, deşi au fost identificaţi numeroşi plasmizi catabolici numărul
celor complet secvenţiaţi este mic.
Analiza cantitativă a bazelor azotate arată un conţinut de G+C de 59,7%, mai scăzut
decât nivelul de G+C caracteristic speciei, dar încadrându-se în limitele caracteristicile genului.
Dacă se urmăreşte distribuţia conţinutului de G+C funcţie de poziţia pe secvenţă se poate
observa clar că, la fel ca majoritatea plasmizilor mari, pAO1 are o structură modulară, fiind
alcătuit din blocuri de gene achiziţionate pe parcursul evoluţiei prin transpoziţii succesive. Un
exemplu clar este porţiunea dintre Tn554 şi IS1473 conţinând ORF52 până la ORF96. Pe lângă
prezenţa elementului de inserţie şi factorului de transpoziţie, conţinutul de GC este de
aproximativ 56%, mai scăzut decât conţinutul mediu al plasmidului. Aceste trei elemente
demonstrează clar că acest fragment (şi deci implicit calea metabolică pe care o codifică) a fost
preluată de la un alt microorganism sau plasmid care avea un conţinut de GC diferit de pAO1.
Dimensiunea plasmidului este de 163127 pb şi se pare că 83,2% din secvenţă codifică
proteine. Astfel, au fost descrise un număr de 126 cadre de citire (ORF – open reading frames)
care sunt similare cu proteine caracterizate sau cu funcţie presupusă. Alte 39 de ORF-uri au fost
identificate manual, fără însă a avea un grad înalt de similitudine cu secvenţele din bazele de
date investigate. ORF-urile sunt distribuite aproximativ egal pe cele 2 catene cu 79 pe unul şi 85
pe celălalt. Pe baza similtudinii secvenţei cu diferite proteine cu funcţie cunoscută cadrele de
citire au fost împărţite funcţie de rolul lor în: proteine implicate în replicare, conjugare,
transpoziţie, rezistenţa la antibiotice şi utilizarea nutrienţilor. O prezentare generală a acestui
plasmid cu amplasarea cadrelor de citire se poate observa în figura 3.

Fig.3. Cadrele de citire de pe plasmidul pAO1. Cu roşu sunt implicate în


transpoziţie, cu galben cele implicate în replicaţie, cu albastru închis utilizarea nicotinei,
albastru deschis în metabolizarea glucidelor, alb cu funcţie necunoscută (Brandsch şi
colab., nepub).

9
1.3.1. Gene implicate în replicare

Una dintre proprietăţile fundamentale ale tuturor plasmizilor, fără de care aceştia
nu au autonomie, este capacitatea lor de a se replica indepenedent de cromozomul
bacterian (10). Sinteza ADN-ului se realizează urmând regulile replicării
semiconservative a ADN-ului la care se adugă o serie de particularităţi ce rezidă din
structura de cerc - închis a plasmidului.
În general replicarea se realizează între un situs de iniţiere ori şi unul de terminare
ter, fragmentul de ADN dintre aceste 2 situsuri constituind o unitate de replicare, adică
un replicon. Plasmidul constitue un replicon independent de cromozomul bacterian, însă
poate fi legat de acesta prin enzimele necesare replicării (polimeraza, spre exemplu),
acestea fiind codificate de gene plasate pe cromozom.
Originea de replicare ori este o zonă bogată în A-T, pentru a fi uşor de desfăcut
cele 2 catene în vederea iniţierii. La E.coli există o singură origine de replicare pe
cromozom, origine ce a primit numele de oriC. Adăugarea în mod artificial a acestei
origini pe orice fragment ADN circular îl transformă într-un plasmid autoreplicabil în
E.coli. Secvenţa acestei origini a fost descrisă şi se constituie din 245 de nucleotide,
conţinând 7 secvenţe repetitive în tandem (3 secvenţe cu 13 baze şi 4 cu 9 baze)(61).
În general, numerotarea bazelor azotate din secvenţa plasmidului se face
începând de la ori. Caracteristic pentru pAO1 este faptul că nu au putut fi identificate
nici unul din elementele cheie ce marchează specific originea de replicare: secvenţele
repetitive în tandem (iteroni) sau genele rep. Poziţionarea originii rămâne deci
necunoscută şi din aceste motive numerotatea bazelor azotate începe de la situsul de
restricţie al enzimei BamH1.
O problemă care apare este însă împărţirea plasmizilor noi produşi între cele două
celule fiice. În cazul plasmizilor ce există într-un număr mare de copii în celulă, nu este
necesară existenţa unor sisteme speciale pentru a realiza acest lucru, simpla împărţire pe
baza unor legi probabilsitice fiind suficientă a asigura a frecvenţă a pierderilor
plasmidului mai mare de 10-6 (cifră calculată pentru 10 copii ale plasmidului pe celulă).
În cazul plasmizilor ce sunt menţinuţi într-o singură copie există un mecansim
specific prin care se asigură ca fiecare celulă fiică să primească un exemplar. Acest
sistem de partiţionare este reprezentat din 2 gene par ( parA şi parB) şi o secvenţă
specifică cu care acestea interacţionează (parS).
ParS joacă acelaşi rol pe care îl are centromerul pentru celula eucariotă. Odată ce
proteinele Par sunt legate de această secvenţă se formează o structură ce ancorează cele
2 plasmide fiice independent una de cealaltă. Modul exact în care se desfăşoară mai
departe deplasarea este încă necunoscut, dar nu este exclusă implicarea ParA (în special
datorită funcţiei ATP-azice) şi legarea de septul format în timpul diviziunii celulei
bacteriene.
Cateva clustere cu gene codificând posibile proteine implicate în replicare au fost
identificate în secvenţa plasmidului pAO1. Un prim asemenea cluster începe cu ORF-ul
7, 8 şi 9, proteine asemănătoare cu ParB, continuă cu ORF11, similar cu proteine ce se
leagă de ADN-ul monocatenar şi se termină cu ORF 18, similar cu un factor de control al
transcripţiei genelor implicate în partiţionare (kfrA).
Caracteristic pentru pAO1 gena similară cu parB pare a fi fragmentată în 3 ORF-
uri distincte iar ORF143, asemănător cu parA este plasată la aproximativ 28 kb de ParB,

10
într-un set de ORF-uri (142 până la 149) cu funcţie necunoscută. Caracteristic pentru
ParA şi omologii acesteia este o buclă numită P-loop, buclă ce poate fi identificată şi în
ORF143. O comparaţie între modul de aranjare a acestor gene în plasmidul P1 din E. coli
şi pAO1 este prezentat în figura 4.

Fig.4. Modul de
aranjare a celor 2
clustere de gene
posibil a fi
implicate în
replicarea
plasmidului pAO1.
Un al doilea
cluster posibil a fi
implicat în replicare
conţine cadrul de
citire numărul 43, cel
mai mare ORF identificat în pAO1, similar cu o helicază, şi ORF-urile 44, 45, 46. Funcţia
acestora este însă complet necunoscută, neavând nici un grad de homologie cu proteine
cunoscute.
Metilazele Dam joacă un rol important în iniţierea replicării şi asocierea originei de
replicare de membrana celulară. ORF23, similară cu o metil-transferază-S-adenozil-metionin-
dependentă ar putea fi şi el implicat în replicarea acestui plasmid.

1.3.2. Gene implicate în conjugare

Conjugarea este un fenomen frecvent în lumea bacteriilor, fenomen ce implică transferul


de gene între 2 celule aflate în contact. Cel mai frecvent acest transfer implică un plasmid însă,
în anumite condiţii, fragmente sau chiar întreg cromozomul bacterian poate fi transferat.
Există două condiţii distincte ce trebuie îndeplinite pentru ca fenomenul de conjugare să
aibă loc. Prima este ca celulele să fie capabile să intre în contact în mod specific (în principal
prin formare de pili), iar a doua condiţie este ca în interiorul acestor celule să existe molecule de
ADN mobilizabile. Incapacitate de a îndeplini oricare din aceste 2 condiţii duce la
imposibilitatea realizării transferului.
Foarte bine studiat este mecanismul conjugării în cazul factorului F la E. coli,
mecanism descoperit în 1946 de Laderberg şi Tatum. În acest proces este implicat un
plasmid de aproximativ 100 kb pe care se află toate genele necesare transferului.
Celulele de E.coli care nu au acest plasmid nu pot realiza conjugare şi poartă numele de
F-. În interiorul celulelor, plasmidul poate exista în trei stări distincte: ca entitate
autoreplicativă, independentă de cromozom (celule F+), integrat în cromozom (caz în
care celulele realizează conjugări foarte frecvent, Hfr) sau ca entitate replicativă
independentă conţinând însă şi gene preluate de pe cromozomul bacterian (plasmid
F`)(61).
Factorul F conţine trei grupări distincte de gene (61): inc,rep responsabilă de
11
replicare, o regiune cu 4 elemente transpozabile şi regiunea tra responsabilă de transferul
propriu-zis. Această ultimă regiune masoară aproximativ 33 kb şi conţine 40 de gene
(38), numite tra şi trb. Grupul traY până la traI formează o unitate de transcripţie, traM
şi traJ fiind exprimate separat. Reglarea activităţii este realizată de traJ, care activează
atât traY-I cât şi traM. Dintre toate aceste gene numai 4 sunt direct responsabile de
transferul ADN-ului, restul sunt implicate în realizarea şi menţinerea contactului între
celule.
Analiza cadrelor de citire aflate pe pAO1 indică ce genele ar putea fi implicate în
realizarea transferului plasmidului de la o celulă la alta. În primul rând ORF124 a fost
descrisă în 2003 de către (31) ca având similitudini cu o proteină membranară TrsK,
implicată în procesul conjugativ. Un nou BLAST arată că similitudinea are scorul de
40.4 biţi, şi un E value de 0,25, însă noi proteine descoperite au un grad de omologie mai
mare. Astfel, ORF124 pare a fi înrudită cu VirD4, proteină aparţinând sistemului de
excreţie transmembranar de tip IV, realizând un scor de 59,3 şi un E value de 5e-07.
ORF127 ar putea fi asociat şi el cu conjugarea, fiind asemănător cu gena trbL,
produsul căreia face parte din complexul implicat în transferul conjugativ al ADN-ului la
Rhodococcus equi. ORF126 are similitudini cu o proteină membranară, iar ORF125 cu o
proteină ce leagă ATP-ul. Toate aceste gene sunt plasate în aceeaşi direcţie şi par a
formă un bloc cu alte ORF-uri cu funcţie total necunoscută. În sens opus se află ORF134
care se aseamănă cu un presupus factor de reglare a transcripţiei din C. glutamicum
ATCC 13032, un bun candidat pentru reglarea activităţii întregului operon descris mai
sus. O reprezentare grafică a modului de dispoziţie a acestor gene este prezentată în
figura 5:

Fi
g.5.
Modul de
aranjare a
celor 4
cadre de
citire şi a
posibilulu
i factor de
reglaj al transcripţiei implicate în conjugare
Pe lângă acestea, demn de menţionat este şi ORF 162 care este similară pe toată
lungimea ei cu dprA (echivalentă cu sfm din E.coli), genă esenţială în competenţa
speciilor de Haemophilus sau Helicobacter. Mai mult decât atât, o secvenţă de 376 bp de
la capătul 5´ al ORF162 este repetată la capătul 5´ al ORF164. Prezenţa acestor 2
fragmente repetitive la ambele capete al ORF162 ar putea sugera implicarea în
evenimentele de recombinare ce pot avea loc în timpul acceptării ADN-ului plasmidial.
Prezenţa tuturor acestor cadre de citire ar indica că plasmidul pAO1 este unul
conjugativ. Practic, acest lucru a fost demonstrat de Igloi şi colab.(31) prin utilizarea a
două tulpini de Arthrobacter nicotinovorans: una tip sălbatic, capabile să degradeze
nicotina) şi a doua fără plasmid şi având rezistenţă la cloramfenicol (rezistenţă introdusă
cu ajutorul unu transpozon pe cromozom). După punerea celor două tulpini în comun în
vederea realizării conjugării, celulele au fost selectate pe plăci conţinând nicotina şi

12
cloramfenicol. Coloniile rezistente la cloramphenicol capabile să degradeze nicotina sunt
identificate datorită culorii albastre pe care o formează în prezenţa nicotinei. Frecvenţa
lor de apariţie a fost de 10-3 – 10-2.

1.3.3. Gene implicate în fenomenele de transpoziţie

Evoluţia genomului se realizaeză prin două modalităţi esenţiale, şi anume prin


achiziţia de noi secvenţe şi rearanjarea celor preexistente (38). Modul de realizare a
acestor fenomene a constituit mult timp o necunoscută, considerându-se ca doar
recombinarea homoloagă singură este responsabilă de modificările materialului genetic.
Descoperirea de către B. McClintock a elementelor transpozabile din porumb a uimit
lumea stiinţifică şi a cauzat numeroase dispute.
La ora actuală este pe deplin acceptată existenţa acestor elemente atât la eucariote
cât şi procariote şi, de asemenea, importanţa deosebită pe care acestea o au în evoluţie.
Prin definiţie, elementele transpozabile sunt elementele genetice capabile să îşi schimbe
poziţia în cadrul moleculei de ADN prin transpoziţie şi integrare, independent de
fenomenele de recombinare omoloagă (61). Caracteristic pentru fenomenele de
transpoziţie este lipsa oricărei legături între secvenţa donor şi cea acceptor. Mobilizarea
se poate realiza direct ca ADN sau printr-un intermediar ARN, din acest punct de vedere
transpozomii se clasifică în 2 mari clase (38).
În ordinea în care au fost numerotate primele elemente transpozabile ce apar pe
secvenţă sunt ORF97 şi ORF98, care alcătuiesc IS1473. Acest element de inserţie este
întâlnit într-o singură copie pe plasmid, între gena ndhM şi moaD, şi nu apare pe
cromozomul acestei specii. Însă a fost demonstrată existenţa lui în ADN-ul total al
speciilor înrudite, Arthrobacter globiformis, Arthrobacter ramosus, şi Arthrobacter
ureafaciens. Cele 2 orf-uri codifică 2 proteine ce au un mare grad de similitudine cu
fragmente din transpozaze şi integraze întâlnite în IS481 şi IS1002 din Bordetella, IS476
din Xanthomonas campestris. Cele două peptide sunt suprapuse, şi, este foarte probabil
ca, prin realizarea unui salt programat -1 a cadrului de citire în poziţia 97833, ele să
fuzioneze pentru a forma transpozaza activă. Acest gen de mecanism este comun pentru
elementele de inserţie aparţinând clasei 1 (45).
Al doilea set de IS prezente pe pAO1 sunt reprezentate de ORF 140 şi 141.
Acestea au un grad mare se homologie cu IS1473, şi, la fel ca acesta conţine două
peptide care ar putea fuziona printr-un salt -1 a cadrului de citire în poziţia 142519 (31).

13
Fig.6. Elementele genetice transpozabile plasate pe pAO1 (A) şi modul de
aranjare al cadrelor de citire în presupusl transpozon Tn554 (B).
Alături de aceste elemente transpozabile simple în secvenţa acestui plasmid
au fost identificaţi şi 2 transpozoni compuşi, ambii asemănându-se cu elemente
transpozabile din Stapylococcus aureus. O primă indicaţie în acest sens este ORF48, care
prezintă asemănari cu numeroase domenii înalt conservate implicate în procesele de
tranpoziţie şi recombinare (precum cd01194, cd00798,cd01182). Proteina codificată de
această genă se aseamănă cu transpozaza A (TpnA) din Tn554 (scorul 205 evalue 2e-
51
).
ORF 50 şi 51 pe de altă parte sunt similare cu TpnB şi respectiv TpnC din Tn544.
Acest transpozom este alcătuit din cele trei gene (TpnA, TpnB, TpnB) urmate de
determinanţii pentru rezistenţă la eritromicină şi spectomicină. O privire mai atentă
asupra genelor din această regiune arată că între ORF48 şi ORF50 se interpune o genă cu
funcţie necunoscută şi este deosebit de tentant a specula că aceasta codifică un factor de
rezistenţă necunoscut. Cel de-al doilea presupus transpozon compozit se aseamănă cu
Tn552 din S.aureus (53). Acesta se poate integra urmând mecanismul replicativ, cu
formarea unui cointegrat şi presupune deci existenţa unei transpozaze şi a unei rezolvaze.
De asemenea elementul mai conţine şi o genă ce mediază rezistenţa la antibioticele beta-

14
lactamice. Asemănător cu acesta, şi presupusul transpozon din pAO1 este alcătuit din
ORF152 înrudit cu o proteina ce leagă ATP-ul întâlnită şi în Tn552, ORF151 înrudit cu
transpozaza din Tn552, ORF153 asemătoare cu recombinază din Tn552. O beta-
lactamază nu a putut fi descrisă şi de asemenea, plasată 5´ de cadrele menţionate se află
ORF150 codificând de asemenea o recombinază. Surprinzător, ORF 158 reprezintă o
copie a acesteia, lipsită de codonul start şi de situsul de legare a ribozomului. Deoarece
ORF 157 şi 156 sunt ambele similare cu aceeaşi proteină cu funcţie necunoscută, este
posibil ca la acest nivel să se fi petrecut un fenomen de duplicare ca urmare a unei
excizii incorecte a unui transpozon (din care a rămas doar recombinaza trunchiată).

1.3.4. Gene implicate în rezistenţa la antibiotice

Rezistenţa la antibiotice este o componentă frecvent întâlnită pe diferiţi plasmizi,


oferind acestora o serie de avantaje selective. Pe pAO1 au fost descrise o serie de cadre
de citire posibil implicate în rezistenţa la antibiotice. Astfel ORF19 pare a codifica
rezistenţa la vancomicină, iar ORF60 şi ORF61 sunt cele 2 componente ale unei pompe
de eflux cu specific foarte larg. Cu toate acestea nu au putut fi observate diferenţe între
tulpinile de Arthrobacter nicotinovorans cu şi fără plasmid în privinţa rezistenţei la
vancomicină, sărurile de amoniu, bromură de etidiu şi metale grele (31).

1.3.5. Gene implicate în utilizarea nicotinei

De departe cea mai bine studiată cale metabolică plasată pe plasmidul pAO1 este
cea a degradării nicotinei, aceasta fiind şi cea mai interesantă proprietate metabolică a
acestei tulpini. Primii paşi au fost făcuţi de echipa condusă de Sydney C. Rittenberg şi au
fost descrişi în o serie 8 articole apărute din 1958 până în 1971 şi K. Decker (1961)
(8).Aceşti autori descriu aproape toţi intermediarii ce apar pe parcursul procesului de
degradare fără însă a descrie în detaliu enzimele implicate şi căile de realizare a
reglajului. Această temă este abordată utilizând metodele moderne pe care le oferă
biologia moleculară de către colectivul condus de R. Brandsch, acesta reuşind să pună
sub lumină o mare parte din aspectele pe care degradarea acestui compus le presupune.
Capacitatea de a folosi nicotina ca sursă de carbon şi oxigen nu este specifică doar
acestei tulpini, ci a fost descrisă şi la alte specii de bacterii precum Bacillus,
Achromobacter, Microsporum şi de asemenea la fungi (8).
Degradarea acestui compus de către microorganisme se poate realiza pe 3 căi: printr-un
atac la inelul piridinic, unul la inelul pirimidinic sau prin demetilare. În cazul speciei luate în
discuţie atacul se realizează printr-o hidroxilare la inelul piridinic ceea ce activează molecula şi
face posibilă etapele următoare. Acestea pot fi grupate în reacţii ce au ca scop desfacerea
inelului piridinic, alcătuind o aşa numită cale metabolică superioară, şi reacţii de asimilare a
catenei laterale, alcătuind aşa numita cale inferioară (8).

A. Gene implicate în desfacerea inelului piridinic


Capacitatea extractelor totale de Arthrobacter nicotinovorans de a oxida aerob
15
nicotina atunci când celulele sunt crescute pe medii conţinând acest compus a fost pentru
prima dată semnalată de Hochstein în 1958 ((27); (36)). Acelaşi autor reuşeşte şi izolarea
primului produs a acestei căi sub forma unor cristale albe cu punctul de topire de 120-
1220C, atât din reacţia in vitro cât şi din mediul de cultură. Proprietăţile fizico-chimice
ale compusului obţinut au indicat că este 6-hidroxinicotina ((26)).
Enzima care realizează această primă reacţie a fost purificată abia în 1988 de către
Freudenberg şi colab. Este alcătuită din 3 subunităţi, una mare de 82kDa conţinând
cofactorul molibdenic, una mijlocie de 30 kDa cu FAD legat necovalent şi una mică de
15 Da cu 2 clusteri 2Fe-S. Masa moleculară în forma nativă a complexului este de 120
kDa (19), ceea ce corespunde cu o asamblare de forma (αβγ)2 (8). Numele enzimei este
deci nicotin-dehidrogeaza (NDH, nicotin:acceptor oxidoreductaza (hidroxilantă)) şi este
codificată de 3 gene plasate pe pAO1 în aceeaşi direcţie, după cum se poate vedea în
figură.

Fig.7. Primele
etape în calea
metabolică de
degradare a nicotinei
(A) şi modul de
aranjare a genelor
implicate (B).

Următoarea
etapă constă dintr-o
oxidare realizată de 6-
hidroxi-nicotin-
oxidaza. Produsul
acestei reacţii este 6-
hidroxi-metilmiosmina
care este însă instabilă
şi reacţionează spontan cu apa cu formare de 6-hidroxi-pseoudooxinicotina . Aşa se
explică de ce Hochstein şi colab. reuşesc să prepare o fracţie proteică care poate
transforma 6-hidroxinicotina în 6-hidroxipseudooxinicotină(36).
Interesant este un anumit aspect al acestei reacţii, şi anume stereospecificitatea. În
condiţii normale planta de tutun produce L-nicotină şi doar cantităţi foarte mici de D-
nicotină. Racemizarea poate avea loc în timpul descompunerii plantei, şi de asemenea
prin încălzire. Dacă NDH nu manifestă stereospecificitate, convertind atât L cât şi D-
nicotina la 6-hidroxi-L şi respectiv -D-nicotină, nu acelaşi lucru se poate spune şi despre
etapa următoare. Pentru oxidarea celor 2 izomeri D şi L există 2 enzime care diferă
fundamental una de alta. Enzima ce transformă izomerul L este o flavoproteină dimeră
cu masa moleculară de 46 kDa (69) ce face parte din clasa amin-oxidazelor, notată

16
6HLNO. Gena care o codifică este plasată, după cum se poate vedea în figură, în aceeaşi
direcţie cu ndhLSM alcătuind aparent un operon.
Echivalentul ce transformă izomerul D este o enzimă monomeră ce conţine un
FAD legat covalent de un rest de histidină. Modul de legare este însă mai puţin obişnuit,
implicând atomul de N1 şi nu atomul N3.
Avem aşadar două enzime cu 2 substrate diferite şi ne-am aştepta ca mecanismul
de reglare al expresie să ţină cont de faptul că substratele sunt diferite. În mod paradoxal
nu este aşa. Adăugarea în mediu a D-nicotinei duce la activarea ambelor enzime. Multă
vreme s-a considerat că aceasta reprezintă o indicaţie a existenţei unei racemaze. Până în
prezent o asemenea activitate nu a fost demonstrată (4).
Mecanismul de reglaj a fost însă în parte elucidat prin descoperirea unei proteine
capabile să se lege în mod specific de o secvenţă plasată în amonte de 6hdno.
Capacitatea extractelor proteice de a realiza o întârziere la migrarea prin gel a 2
fragmente specifice de ADN a fost raportată pentru prima dată de către Bernauer şi
colab. în 1992 (4). Aceste 2 fragmente sunt reprezentate de 2 zone cuprinzând repetiţii
inversate ce se suprapun cu regiunea promotorului genei 6hdno (IR1) şi o zonă plasată
în amonte de aceasta (IR2). Abia după secvenţierea completă a plasmidului poziţionarea
genelor a fost clară ceea ce a permis şi realizarea unor speculaţii privitoare la cadrele de
citire implicate în reglaj. După cum se poate vedea în figura 9, 6hdno este plasată într-un
operon diferit de cel al 6hlno, având şi direcţie opusă. Aproape de aceasta, despărţită prin
cadrul de citire orf113 se află un ORF ce se aseamănă cu regulatori ai transcripţiei din
familia TetR. Acest cadru de citire a fost clonat în vectorul de expresie pH6EX3 iar
proteina recombinantă cu o coadă de 6 His a fost purificată la omogenitate utilizând
IMAC. Masa moleculară este de aproximativ 19 kDa, iar experimentele de cross-linking
au arătat că în soluţie proteina este dimeră (59).
Testată pentru legarea de ADN utilizând fragmente menţionate mai sus proteina a
dovedit că se leagă în mod specific şi dependent de concentraţie. Gena a primit numele
de hdnoR (59).
Caracterizarea acestui represor şi a secvenţelor de care acesta se leagă au permis
realizarea unor vectori de expresie utilizabili în Arthrobacter şi specii înrudite, care ar
putea rezolva problemele ce apar în mod normal cu supraexpresia proteinelor în alte
gazde (58). De asemenea s-a demonstrat posibilitatea utilizării acestui represor într-un
sistem de control al expresiei proteinelor în celulele eucariote (41).
După hidroxilarea realizată de 6HDNO şi 6HLNO 6-hidroxipseudooxinicotina
este supusă unei alte activări prin o nouă hidroxilare realizată la C2, etapă catalizată de o
enzimă înrudită cu NDH. Enzima are numele sistemic 6-
hidroxipseudooxinicotin:acceptor oxidoreductază (hidroxilantă) şi este cunoscută ca
ceton-dehidrogenaza (KDH). Ca şi NDH şi KDH este trimeră cu o subunitate mică de 17
kDa şi conţinând 2 clusterii (2Fe-S), o subunitate mijlocie de 30 kDa cu FAD şi o
subunitate mare de 85 kDa conţinând cofactorul molibdenic. Produsul format este 2,6-
dihidroxi-pseudooxinicotina, şi este instabil, transformându-se în vitro în 2,6-dihidroxi-
metil-miosmină, acest compus fiind pentru prima dată evidenţiat ca intermediar în calea
de degradare a nicotinei de către Richardson şi Rittenberg (51).
Deosebit de intrigant este modul de aranjare al genelor corespunzătoare celor 3
subunităţi ale KDH. După cum se poate vedea în figura 8, subunitatea mare (kdhL) este
plasată în direcţie opusă şi la aproximativ 4 kb depărtare de subunităţile mijlocii (kdhM)

17
şi mici (kdhS), care par a forma un operon.
Fig.8. Aranjarea genelor responsabile de producerea subunitaţilor M, S şi L a
enzimei KDH.
Cei 4 kb
cuprind 4 cadre de
citire, dintre acestea
doar funcţia dhponH
fiind conoscută (va fi
luată în discuţie mai
jos). ORF84 este un
cadru mic, codificând
doar 116 aminoacizi ce alcătuiesc o proteină asemănătoare cu o enzimă implicată în
utilizarea etanolaminei la C. perfringens, iar orf 85 şi 87 codifică proteine asemănătoare
cu proteine reglatoare ai transcripţiei (31).
Modul în care se realizează reglarea transcripţiei genlor kdhL, kdhM, kdhS este
încă necunoscut, fiind foarte posibil ca cele 2 cadre de citire dintre ele să fie implicate.
Datorită unor probleme de solubilitate produşii lor de transcripţie nu au putut fi purificaţi
şi caracterizaţi (8).

B. Gene implicate în clivarea şi metabolizarea catenei laterale

Pentru multă vreme modul în care se realizează clivarea catenei laterale a


constituit un mister. Produşii rezultaţi au fost evidenţiaţi de către Gherna şi colab. încă
din 1965 (21), dar factorul ce catalizează această reacţie a constituit multă vreme o
necunoscută. În 2005 enzima care realizează această reacţie a fost indicată de către
Sachelaru şi colab., oferind posibilitatea indicării etapelor ulterioare din această cale.
Enzima care realizează această etapă este produsul cadrului de citire 83, are masa
moleculară de 43,5 kDa şi este sub formă de monomer în soluţie. Substratul, după cum
se poate observa şi în figura 9, este reprezentat de 2,5-dihidroxipseudooxinicotina, iar
produşii de reacţie sunt 2,6-dihidroxipiridina şi acidul metil-γ-N-aminobutiric. Enzima
a fost numită 2,6-dihidroxipseudooxinicotin-hidroxilaza (DHPONH) (54).
Fig. 9. Schema reacţiilor implicate în clivarea şi degradarea catenei
laterale.

18
Soarta celor 2 produşi de reacţie este diferită, fiind pentru prima dată indicată de
Holmes şi colab.(29); (30)). Astfel, 2,6-dihidroxipiridina suferă o nouă hidroxilare şi este
eliminată în mediu, ducând la formarea pigmentului albastru caracteristic, iar acidul
metil-γ-N-aminobutiric este integrat în calea acizilor tricarboxilici.
Această integrare este realizată tot de cadre de citire plasate pe plasmidul pAO1 şi
se poate face în două moduri. Genele implicate sunt plasate între transpozonul Tn554 şi
o gena trunchiată a unei transpozaze din C. glutamicum, părând a fi organizate în 3
operoane a cărui funcţionare este reglată de produsul cadrului de citire 67. Modul de
dispoziţie este prezentat în figura următoare.

Fig. 10. Modul de aranjarea al cadrelor de citire implicate în metabolizarea


acidului metil-γ-N-aminobutiric
O primă modalitate de integrare este prin deaminare oxidativă a acidului metil-γ-
N-aminobutiric cu formare de metilamină şi acid γ-aminobutiric (GABA). Enzima care
realizează această reacţie este produsul cadrului de citire 63 şi a primit numele de metil-
γ-N-aminobutirat oxidază demetilantă (MABO). Are o masă moleculară relativă de 90
de kDa şi conţine în calitate de cofactor FAD (11).
A doua cale de integrare este deschisă de produsul cadrului de citire 56 care
codifică o proteină de 421 aminoacizi. Masa moleculară a proteinei determinată prin
SDS-PAGE este de 46 kDa, iar cromatografia de filtrare prin gel a demonstrat că
proteina este monomeră în soluţie (13). Enzima este o monaminoxidază flavinilată
(MAO) care utilizează ca substrat acidul metil-γ-N-aminobutiric, produşii de reacţie
fiind semialdehida acidului succinc şi metil-amina. Enzima poate de asemenea utiliza şi
GABA, însă cu o eficienţă mai mică.
Metabolizarea GABA nu este dependentă de prezenţa plasmidului pAO1 deoarece
şi celule ce nu posedă acest plasmid pot utiliza acest compus ca unică sursă de C şi N
(13). Pe plasmid se află însă un cadru de citire ce asigură racordarea produsului de
deaminare la ciclul acizilor tricarboxilici. Este vorba despre cadrul de citire 58, plasat în
direcţie opusă faţă de MAO, al cărui produs este o dehidrogenază a semialdehidei
acidului succinic (SaD). Gena a fost clonată şi proteina purificată prin IMAC, în soluţie
fiind homodimeră, monomerul având masa moleculară de 51 kDa. Enzima poate utiliza
atât NAD+ cât şi NADP+, însă cu NAD reacţia este de 25 de ori mai lentă (13).
Toate aceste trei gene sunt plasate, după cum am văzut, între 2 elemente ce par a
marca un eveniment recombinaţional, şi anume Tn554 la un capăt şi gena trunchiată a
unei recombinaze la celălalt capăt. Între aceste graniţe ar fi de aşteptat să existe şi un

19
factor de reglare a expresiei. ORF 67 manifestă un grad mare de identitate cu o proteină
implicată în reglaj la S. coelicolor ( 45% identitate şi un scor de 4e-022) fiind un foarte
bun candidat. Gena a fost clonată în vectorul de expresie pH6EX3 şi produsul purificat.
Proteina are o masă moleculară de 50 kDa, în soluţie formînd probabil tetrameri cu o
masă moleculară de 190 kDa (13).
Mao are aceeaşi direcţie cu orf54, care codifică o proteină înrudită cu
NADPH:chinon oxidoreductaze, fiind probabil transcrise pe aceeaşi moleculă de ARN.
Produsul purificat al cadrului de citire 67 a fost testat pentru capacitatea de a se
lega de ADN utilizând tehnica întârzierii în gel (EMSA, electromobility gel shift assay).
Au fost testate fragmente plasate la capătul 5´ al genelor purU şi perm, proteina
legându-se doar de fragmentul din faţa lui purU. Aceasta arată o posibilă implicare a
acestui factor în reglarea operonului purUmabOfolD, dar nu şi a perm, în concordanţă cu
datele obţinute prin analiza ARN-ului. Darorită acestui fapt proteina a primit numele
de pmfR(12).
Celălalt produs rezultat în urma reacţiei de clivare a catenei laterale este 2,6-
dihidroxipiridina care este supus unei hidroxilări în urma căreia se formează 2,3,6-
trihidroxipiridina. Reacţia şi produsul ei au fost evidenţiate pentru prima dată de
Holmes şi colaboratorii ((21); (30)). Mai mult decât atît ei reuşesc să purifice parţial şi
enzima responsabilă de această transformare, utilizând un ansamblu de metode ce
implică precipitarea cu sulfat de amoniu şi cromatografia de schimbători de ioni pe
DEAE-celuloză. Pentru eliminarea proteinelor contaminante neflavinilate, probele
conţinând enzima au fost trecute pe o coloană de hidroxiapatită după care au fost
concentrate cu polietilenglicol (29), obţinându-se un randament al recuperării de 15% şi
creştere de 50 de ori a gradului de purificare.
Identificarea cadrului de citire ce codifică această enzimă a fost realizată abia în
2001, fiind vorba despre ORF-ul 79, plasat în acelaşi sens cu kdhL şi probabil pe acelaşi
operon. Acest presupus operon conţine o serie de gene a căror funcţie este complet
necunoscută, dar care se întâlnesc frecvent în preajma proteinelor din aceeaşi clasă cu
KDH.
Gena 79 a fost clonată în vectorul pH6EX3 şi exprimată ca o proteină
recombinantă ce manifestă afinitate pentru Ni2+. Masa moleculară determinată pe geluri
de poliacrilamidă denaturante este de 45 kDa, în stare nativă enzima fiind homodimeră.
Culoarea galbenă prezentă din nou indică o flovoproteină cu 2 moli de FAD pe mol de
proteină, legare fiind necovalentă. Acţionând asupra 2,6-dihidroxipiridinei enzima are un
pH optim de 8 şi o temperatură optimp de 200C. (3).

C. Gene implicate în sinteza cofactorului molibdenic

După cum am văzut două din enzimele cheie din calea de degradare a nicotinei,
NDH şi KDH conţin în structura cofactorului ionul de molibden. Acesta este metal este
deosebit de frecvent întâlnit în lumea vie, în special la enzimele ce realizează o reacţie
redox ce implică transferul a 2 e- (22). Atomul de molibden este liber doar în cazul
nitrogenazelor, la celelalte enzime este întotdeauna coordinat de un compus organic şi
formând împreună aşa numitul cofactor molibdenic (MoCo) (39). La bacterii cofactorul
molibdenic poate fi sub forma unui atom de Mo legat de pterină, alcătuind

20
molibdopterina (MPT) sau sub forma metalului coordinat de un derivat al pterinei,
format prin adiţia unui nucleozid monofosfat la aceasta. Nucleosidul poate conţine
guanozină, caz întâlnit la E.coli, cofactorul fiind deci molibdopterin-guanozin-
nucleotidul (MGD) sau citozină, cazul specie Arthrobacter, cofactorul fiind deci
molibdopterin-citozin-nucleotidul (MCD) (54).
Deşi este foarte frecvent la toate regnurile lumii vii, calea de sinteză a acestui
cofactor este înalt conservată. Ea cuprinde trei etape ((22),(54)), prima constând în
convertirea unui derivat al guanozinei într-un compus lipsit de S ce a primit numele de
precursorul Z (tetrahidropiranopterină cu un diol geminal şi un fosfat ciclic). În
următoarea etapă, sub acţiunea enzimei heterotetramerice MPT sintaza are loc transferul
a 2 atomi de S la C1 şi C2 ai inelului piranic şi se formează MPT-ene dithiolat. Etapa
finală şi cea mai enigmatică constă în ataşarea ionului de Mo la MPT. Această cale este
continuată la bacterii cu ataşarea mucletideolor şi formarea derivaţilor mono sau
binucleotidici. După sinteza cofactorului acesta trebuie inserat în apoenzimă, acest
proces fiind catalizat la microorganisme de MogA şi MoeA. Recent s-a demonstrat
existenţa unei etape esenţiale în sinteza acestui compus, şi anume o etapă de adenilare a
molibdopterinei fără de care inserţia lui în apoenzimă nu se realizează (39).
Pe lângă sinteza propiu-zisă a cofactorului una din problemele pe care celula
trebuie să le rezolve este aprovizionarea cu Mo. La E. coli importul acestui metal este
realizat de pompă specializată. Pompa este alcătuită din proteina periplasmatică ModA
ce manifestă afinitate faţă de Mo, proteina dimeră ce formează porul ModB şi proteina
asociată de membrană capabile să lege şi să hidrolizeze ATP-ul ModC (46).
Separate de clusterul de gene ce codifică NDH prin elementul de inserţie IS1473
se află o serie de 8 gene implicate în biosinteza cofactorului. Pe baza similarităţii cu gene
cunoscute din E.coli ele au fost notate modABC, moaDACE, moeA, modul lor de
distribuţie putând fi observat în figura următoare.

Fig.
11.
Ara
nja
men
tul
OR
F-
urilor implicate în biosinteza cofactorului molibdenic
ModA prezintă la capătul terminal o peptidă semnal pentru translocarea prin
membrana citoplasmatică, în concordanţă cu observaţia că echivalentul din E.coli este
plasat în afara celulei (periplasmic). Din secvenţa de aminoacizi a ModB se poate
observa existenţa a 6 regiuni transmembranare, fiind deci un bun candidat pentru
formarea porului transmembranar necesar importului molibdenului. ModC manifestă
similarităţi cu o lista lungă de ATP-aze, alcătuind aşadar ultimul element component al
pompei pentru Mo. Similarităţile de secvenţe sunt completate de observaţia
experimentală că modC poate complementa şi restabili întreaga funcţionalitate a unei
tulpini de E.coli având modC inactiv (46).

21
Gena ce pare să deschidă operonul pe care se află genele ce formează pompa ,
moeA, a fost clonată şi purificată. Pe geluri de poliacrilamidă denaturante proteina duce
la formarea a 2 benzi apropiate ce dispar prin creşterea cantităţii de agent reducător.
Acest comportament apare probabil datorită existenţei unor punţi disulfidice
intermoleculare. Pe geluri native însă proteina ramâne în gelul de concentrare
demonstrând formarea unor complexe macromoleculare mari. De altfel, soluţiile ce
depăşesc concentraţia de 1 mg/ml se gelifică în mod spontan. Legare covalentă cu
glutaraldehidă a complexelor duce la obţinerea de dimeri şi trimeri. Analizând la
microscopul electronic gelurile se poate observa formarea unor fibre cu lungimea de 10-
30 nm. Proprietatea de a gelifica şi de a forma este una reversibilă, fiind influenţată de
prezenţa ATP-ului şi Mg2+.
Pe lângă această proprietate produsul genei moeA mai are şi activitate ATP-azică
cu generare de ADP şi poate de asemenea lega dimerii de neurotubulină. Aceste
observaţii indică rolul acestei proteine în formarea unui schelet ce conectează pompa
pentru Mo cu enzimele implicate în sinteza cofactorului, ajutând la protejarea acestui
metal în interiorul celulei (48) şi de asemenea la inserţia Mo în apoenzimă (Mo insertază,
(8)).
În direcţie opusă faţă de moeA, plasată la începutul unui operon alcătuit din 2 gene
se află cadrul de citire cu numărul 100, moaA . Produsul genei o fost purificat sub forma
unei proteine recombinate cu 6 resturi de His şi masa moleculară de aproximativ 40 kDa
sau sub forma unei proteine de fuziune cu GST având masa moleculară de 67 kDa. Masa
moleculară a proteinei fără tag este de 39 kDa. Proteina purificată are culoare maro,
indicând prezenţa ionilor de fier. Analiza cantitativă şi EPR a demonstrat existenţa unui
cluster de tipul 3Fe-3S per mol de proteină. În privinţa rolului pe care îl joacă această
proteine în contextul celorlalte proteine se poate presupune că aceasta ar fi donorul de S
în procesul de sinteza a cofactorului (47). Faptul că funcţia este reală o arată
experimentele de complementare, gena din Arthrobacter fiind capabilă să restaureze
complet fenotipul unei tulpini mutante pentru moaA la cel normal (8).
În acelaşi cluster sunt cantonate un număr de 3 alte gene a căror funcţie este încă
nedemonstrată practic, putând fi însă presupusă pe baza similarităţilor cu alte proteine.
MoaD, plasată în acelaşi sens cu moaA, împreună cu moaE, plasată în direcţie opusă, ar
putea forma enzima heterotetramerică molibdopterin-sintaza, responsabilă de transferul
atomilor de S la molecula de pterină.
Acest aranjament al genelor pentru sinteza cofactorului molibdenic este specific
plasmidului pAO1 şi nu a mai fost descris pentru alţi plasmizi până acum.

D. Gene implicate în transportul nicotinei

Nicotina, datorită dimensiunilor şi structurii sale nu este uşor permeabilă prin


membrane, de aceea celula are nevoie de sisteme de transport specializate. Procesele de
import a nicotinei şi dependenţa lor de plasmidul pAO1 au fost descrise în 2003.
Urmărindu-se dependenţa de timp a importului de nicotină se poate observa, din
momentul introducerii de nicotină în mediu apariţia unei perioade de lag de aproximativ
10 minute. Acesta este un indiciu clar al faptului că importul trebuie indus, timpul scurs
fiind cel necesar pentru ca alcaloidul să pătrundă prin difuzie lentă în celulă şi sa
activeze enzimele implicate în transport. Parametrii cinetici ai acestui sistem de transport

22
determinaţi sunt km 5,6±2.2 µM şi Vmax 0,6 ± 0,06 nmol/min, similar cu ai unor pompe
cu afinitate mare dar capacitate mică pentru aminoacizi (31).
Secvenţa de nucleotide indică câteva cadre de citire cu potenţial rol în transportul
nicotinei. Flancând 6hdno se află două cadre de citire (orf 111 şi 113) al căror produs
are un grad mare de similitudine cu o aminoacid permează din C.acetobutylicum (orf
111, 22% identitate) şi respectiv cu transporter pentru aminoacizi din M. loti (orf 113,
22% identitate). Influenţa aminoacizilor asupra transportului a fost testată şi s-a observat
că D-Arg şi D-Pro au rol activator, prezenţa lor în mediu ducând la creşterea vitezei de
import a nicotinei.
Plasate diametral opus în raport cu clusterul responsabil de metabolizarea nicotinei, în
apropiere de mabO se află alte 2 cadre de citire (orf 60 şi orf 61) posibil a fi implicate în
transportul nicotinei. Până acum nu există nici o dată experimentală care să arate implicare
directă a acestor gene în fenomenele de transport.

E. Gene cu funcţie necunoscută

Deşi calea de degradare a nicotinei, după cum am văzut, este bine cunoscută nu
toate genele plasate în regiunea aceasta au funcţii cunoscute sau măcar presupuse. De
departe, zona cu cele mai multe necunoscute se află între kdhS şi orf 68 codificând o
transpozază. Este vorba despre 22 de cadre de citire, dintre care doar 4 au funcţie
cunoscută şi demonstrată experimental. ORF-urile sunt grupate probabil în 3 operoane,
unul probabil începând cu kdhS iar cel de-al treilea şi cel mai mare cu kdhL. În acest
ultim operon sunt plasate o serie de cadre de citire ce apar deosebit de frecvent asociate
cu enzimele molibdenice, rolul lor fiind însă încă neelucidat. Este vorba despre orf 78 o
presupusă oxidoreductază membranară, orf 76 o ATP-ază din familia AAA şi orf 75 o
subtilizin-protează. Ultimele două sunt subiectul investgat pe parcursul acestei teze, gene
fiind probabil responsabile de integrarea cofactorului enzimatic în apoenzimă. Singurul
cadru de citire care a fost în mod indirect implicat în acest proces este orf 72, cadru
similar cu proteina mobA. Inserţia prin recombinare omoloagă a casetei cmx în orf 80
duce la inactivarea întregului ansamblu de gene plasate după acesta în sensul
transcripţiei. Într-o tulpină modificată în acest mod nu au fost putut fi evidenţiate
activităţii ale enzimelor KDH şi NDH. De asemenea, KDHL izolat din această tulpină
este lipsită de MCD şi nu este ansamblată în enzima tricomponentă. Complementarea
însă cu o copie funcţională a genei orf 72 duce la refacerea totală a celor 2 activităţi şi
izolarea de KDH activă. Aşadar produsul acestei gene este implicat în ansamblarea în
forma activă a enzimelor molibdenice(54), în ce mod însă nu este cunoscut.

1.3.6. Apariţia şi evoluţia plasmidului

Analiza conţinutului G+C raportate la cadrele de citire alături de cea a proteinelor,


chiar şi presupuse pe care acest plasmid le conţine arată clar faptul că, aşa cum este cazul
plasmizilor catabolici, acesta are o structură modulară generată prin o serie de fenomene
de transpoziţie. Fragmentul de ADN cuprins între Tn554 şi IS1473 care conţine şi genele
nic are un conţinut de G+C mediu mai scăzut decât al restului de plasmid, 56% faţă de
62% (36), fiind clar că a fost achiziţionat de la o specie cu un conţinut diferit în aceste 2
23
baze.
Transpozonii implicaţi în căi catabolice sunt frecvent plasaţi pe plasmizi
transmisibili, şi sunt flancaţi de elemente IS înrudite, dar nu identice. Pot avea
dimensiuni mari, mai mult de 50 kB şi cei mai bine cunoscuţi sunt cei implicaţi în
degradarea compuşilor aromatici. Este şi cazul plasmidului pAO1, în care fragmentul
cuprins între 97125 şi 142769 este flancat de IS1473 şi 2 elemente de inserţie înrudite
cu acesta alcătuind un transpozom. Conţinutul mediu de GC este de asemenea diferit
(60,2 % faţă de 62%) şi conţine genele implicate în producţia cofactorului molibdenic şi
de asemenea 6-HDNO (31).
Aşadar plasmidul pAO1 s-a format în urma a 2 fenomene transpoziţionale prin care pe
un plasmid ancestral conţinînd cadrele de citire 1 pană la 46 au fost grefate 2 fragmente, primul
conţinând calea de degradare a nicotinei şi cel de-al doilea cu posibili transporteri, genele pentru
biosinteza cofactorului şi 6HDNO.

Cap II. Proprietăţile teoretice ale proteinelor coxD şi coxE rezultate din
analiza secvenţei celor 2 gene

2.1. Metode de investigare şi analiză a secvenţelor de nucleotide şi aminoacizi

Proiectele de secvenţiere completă a genomului unei anumite specii sunt deosebit


de frecvente la ora actuală pe plan internaţional. Numai în 1999 genomul a 8 specii
diferite de bacterii au fost secvenţiate complet. Această avalanşă de date ridică o
problemă deosebit de importantă, şi anume identificare cu acurateţe a cadrelor de citire.
Identificarea manuală prin inspecţia secvenţei pentru identificare codonilor start şi
situsurilor de legare a ribosomilor este o muncă titanică în condiţiile unei asemenea
abundenţe de date, fiind la ora actuală înlocuită de diferite programe ce realizează acest
lucru automat după algoritmi bine stabiliţi.
La microorganisme, problema nu îşi găseşte soluţia prin simpla identificare a
acestor elemente. Aceasta deoarece secvenţa conţine 90% cadre de citire, faţă de
aproximativ 10% la eucariote. Dificultatea mare rezidă în special din identificarea
cadrelor de citire reale atunci când apar suprapuneri. O altă problemă constă în
identificarea situsurilor de start ale transcripţiei şi a elementelor de regalaj (promotori şi
terminatori) (55). Pentru aceasta au fost create programe speciale, unul dintre aceste
fiind GLIMMER (Gene Locator and Interpolated Markov ModelER) care reuşeşte să
prezică 97-98% din genele procariotelor, sau GENEMARK (17).
După această etapă de identificare a potenţialelor cadre de citire, acestea sunt

24
comparate cu proteine cu funcţii cunoscute prin BLAST şi identificate. De multe ori,
multe gene nu au parteneri în bazele de date, fiind fie necunoscute, fie o eroare datorată
algoritmului utilizat. Acest sistem a fost folosit cu succes pentru identificarea cadrelor de
citire din genomul speciilor Borrelia burgodorferi, Treponema pallidum, Chlamydia
trachomatis, Thermotoga maritima (17) şi al plasmidului pAO1 din Arthrobacter. Pe
acesta din urmă au fost identificate 165 de cadre de citire, din care 126 pot fi corelate cu
proteine cu funcţii cunoscute sau presupuse, iar 39 au fost prezise de GLIMMER sau
GENEMARK fără a avea similitudini cu proteine cunoscute (31).
Odată o genă identificată (sau o proteină secvenţiată) apare problema identificării
genei (proteinei) respective (dacă nu este cunoscută), identificării genelor (proteinelor)
asemănătoare ca structură în vederea realizării unor aprecieri legate de: originea
secvenţei respective, înrudirea cu alte secvenţe, distanţa evolutivă care o desparte de
celelalte secvenţe. Cunoaşterea proteinelor înrudite ca structură poate aduce informaţii
referitoare la structura 3D sau la rolul fiziologic al biomoleculei respective. Această
secvenţă ce ne interesează reprezintă secvenţa de cercetat. Bazele de date conţin un
număr mare de secvenţe, obţinute de diferite laboratoare şi făcute publice, cu care
comparăm secvenţa de cercetat. Acestea sunt secvenţele subiect. Ne interesează deci
identificarea secvenţelor ce se aseamănă cel mai mult cu secvenţa de cercetat, adică
secvenţele care au în comun cele mai multe baze (aminoacizi) cu secvenţa de cercetat.
Pot apare două cazuri. Cel mai puţin probabil, în care atât subiectul cât şi secvenţa de
cercetat au aceeaşi lungime şi le putem deci “suprapune”. Prin această împerechere se
verifică corespondenţa bază cu bază (aminoacid cu aminoacid) pe toată lungimea celor 2
secvenţe.
De cele mai multe ori însă cele 2 secvenţe au dimensiuni diferite, deşi pot avea un
înalt grad de înrudire. Acest lucru se explică prin aceea că un mecanism comun al
evoluţiei la nivelul genelor este duplicaţia sau deleţia unui întreg fragment de nucleotide.
În acest caz se practică compararea pe bază de alinieri locale. Această comparare a 2
secvenţe pe bază de alinieri locale este realizată de programul BLAST (Basic Local
Aligment Tool) (43), care oferă pentru compararea diferitelor alinieri punctaje
standardizate.
Transcripţia şi translaţia secvenţei de aminoacizi cu formarea catenelor
polipetidice sunt procese foarte bine cunoscute la ora actuală. Ele necesită un foarte
complex sistem enzimatic, dar în ciuda acestui fapt se caracterizează printr-un înalt grad
de conservare, realizându-se după aceleaşi reguli de bază în toată lumea vie (1).
Pe baza secvenţei de aminoacizi şi a unor factori celulari se realizează edificarea
structurii secundare, terţiare şi cuaternare a proteinelor (14) şi, odată cu aceasta, aceste
molecule iau forma nativă activă.
Analiza unei proteine nu trebuie deci să se oprească doar la determinarea
secvenţei de aminoacizi, ci trebuie să ţină cont şi de această componentă tridimensională.
Importanţa acestui aspect este demonstrată şi de faptul că pe parcursul evoluţiei
secvenţa poate suferi modificări datorate mutaţiilor, aceste modificări neafectând însă
structura tridimensională. Din aceste motive au fost introduse o serie de elemente
suplimentare ce caracterizează structura unei proteine. Asemenea elemente sunt familia,
domeniul şi motivul. Familia cuprinde proteine înrudite din punct de vedere evolutiv, iar
motivul reprezintă un element structural de dimensiuni mici înalt conservat (ex: motivul
implicat în reglarea NAD sau FAD).

25
Un domeniu trebuie văzut ca o unitate de structură tridimensională la nivelul
căreia este cantonată o funcţie. Există astfel domenii de legare a ADN-ului, a ATP-ului,
domenii ce realizează clivarea unei anumite legături sau responsabile de integrarea unui
anumit cofactor în enzimă. Caracteristic unui domeniu proteic nu este deci secvenţa ci
structura tridimensională, modul în care sunt dispuse helix-urile şi structurile beta-pliate,
puse în legătură directă cu funcţia. O proteină poate fi alcătuită din unul sau mai multe
domenii, funcţie de rolul jucat. Ele reprezintă aşadar şi elemente genetice mobile care se
rearanjează şi se combină pentru a da naştere moleculelor noi (42).
Domeniile pot fi şi ele clasificate şi sunt grupate în familii şi suprafamilii, funcţie
de gradul de înrudire structurală şi funcţională. Se pot astfel realiza o serie de arbori de
evoluţie a domeniilor proteice, arbori în care pot fi localizate proteinele necunoscute.
Problema apare la identificarea acestor domenii şi clasificarea lor, în special
deoarece multe dintre ele se suprapun, iar clasificarea este realizată de diferite persoane
utilizînd algoritmi variaţi. Şi în această ramură, la ora actuală, se pune un accent foarte
mare pe o globalizare şi standardizare a metodelor şi rezultatelor. Astfel, au luat naştere
o serie de baze de date şi servere specializate pe depozitarea şi prezentarea într-o formă
grafică acceptabilă a acestor date. Un asemenea server este PFAM care conţine un număr
de 7973 de familii grupate în 17 clanuri. Serverul PFAM poate fi accesat din 3 locaţii,
una în Anglia (http://www.sanger.ac.uk/Software/Pfam), una în SUA
(http://pfam.wustl.edu), una în Elveţia (http://www.cgb.ki.se/Pfam/) şi una în Franţa
(http://pfam.jouy.inra.fr) (18).
Un alt server de asemenea des utilizat este CDD (conserved domain database),
care pune în legătură bazele de date PFAM , SMART şi COG pentru a furniza un
serviciu unitar. Acesta este integrat în serviciul de investigare şi obţinere a datelor Entrez
de la NCBI şi poate fi accesat prin interfaţa web la adresa
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=cdd. Un utilitar important este CD-Search
care se lansează de la sine atunci cînd este accesat serviciul BLAST şi permite
identificare rapidă interactivă a domeniilor înalt conservate. El poate fi accesat la adresa
http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi.
O serie de utilitare deosebit de importante se află cantonate pe serverele EXPASY
http://www.expasy.ch/ şi cuprind algoritmi ce servesc la calcule unor parametri mai simpli
ai proteinelor, precum masa moleculară, pI sau conţinutul de elemente (20).
Toate investigaţiile au fost realizate utilizând setările implicite ale aplicaţiilor mai
sus menţionate.

2.2. Analiza secvenţei genei coxD

a. Date derivate din analiza structurii primare a proteinei CoxD


Cadrul de citire 76 a primit numele de coxD datorită asemănării din punct de vedere al
secvenţei cu proteina coxD din Oligotropha carboxidovorans. La acest microorganism proteina
face parte dintr-un grup de gene plasate în apropierea celor 3 cadre de citire ce codifică o
dehidrogenaza a monoxidului de carbon (60).
La Arthrobacter nicotinovorans ea se află plasată după cum am văzut în operonul
deschis de către kdhL, operon ce conţine un număr foarte mare de gene necunoscute. Codonul
start este la poziţia 75752 şi gena are 893 de nucleotide. Serverul ProtParam de la Expasy arată

26
un număr de 305 aminoacizi şi o masă moleculară de 33769.4 Da pentru secvenţa de aminoacizi
dedusă din cea de nucleotide. PI-ul teoretic dedus este de 4,73 iar coeficientul de extincţie la 280
nm este 0.736 în 6.0 M clorură de guanidină, 0.02 M tampon fosfat, pH 6.5.
Analiza BLAST a secvenţei de aminoacizi dedusă arată un grad mare de înrudire cu o
serie de ATP-aze precum ATP-aza asemănătoare cu MoxR din Rubrobacter xylanophilus DSM
9941 (scorul in biti 260, E 4e-74 ), o ATP-ază din Arthrobacter sp. FB24 cu funcţie încă
necunoscută (255, 1e-66). Urmează un şir foarte lung de proteine cu funcţie necunoscută, toate
având însă un element comun, şi anume o presupusă capacitate de a cliva ATP-ul.

b. Domenii înalt conservate prezente în structura proteinei coxD


Analiza domeniilor înalt conservate prezente la această proteină explică într-un
fel lungul şir de proteine înrudite prin aceea că coxD prezintă un domeniu foarte
frecvent. Este vorba despre domeniul AAA+ sau triple-A ATP-ases. Numele derivă din
faptul că conţine ATP-aze asociate cu variate activităţi celulare. Iată doar câteva exemple
de funcţii realizate de aceste proteine asemenea proteine:
1. proteaze. Acestea pot fi împărţite în 3 clase:
a) ATP-azele cu rol reglator din proteosome
b) proteazele AAA legate de membrană
c) alte AAA protease
2.proteine implicate în transportul prin membrane
3. peroxine (proteine implicate în formarea peroxizomilor)
5.dineina
6.Proteine implicate în replicarea ADN.
7.RuvB-implicate la PK în recombinarea omoloagă şi obţinerea de molecule de ADN
recombinant
8. Echivalentul RuvB de la EK
Structura domeniului caracteristic AAA+ este prezentată în figura 12.

Fig.12 Organizarea domeniului AAA+. a) structura secundară şi elementele cheie


ale acestui domeniu: cu săgeţi albastre sunt reprezentate elementele beta-pliate iar cu
dreptunghiuri alfa-helixurile. În partea de jos se află plasarea elementelor funcţionale
cheie. b) Aranjarea în structura 3D a elementelor din a). Culorile sunt aceleaşi cu
elementele funcţionale din a), (după (24) )
După cum se poate observa, acest domeniu este alcătuit din două subdomenii:
unul N-terminal de tip αβ (de forma β5-β1-β4-β3-β2) şi unul C-terminal α-helical. În
interiorul acestui domeniu se află 2 motive –Walker -A şi Walker B, ce fac parte din
situsul de legare al ATP-ului. Walker A este reprezentat de secvenţa GXXXXGK(T/S),
unde X este orice aminoacid. Walker B începe de la β3 până la începutul α3 şi este de

27
forma hhhhDE. Importante în realizarea funcţiei acestor proteine sunt şi cei doi senzori.
Senzorul 1, plasat pe bucla ce face legatura între β4 si α4, conţine un rest polar (T), ce se
plaseaza între Walker A si B, intreacţionând cu acestea şi cu fosfatul din ATP. Senzorul
2 se situeaza la capatul C-terminal, şi este implicat în interacţia cu nuclotidul. Un rest de
Arg înalt conservat, plasat în apropierea de începutul α7 are un rol esenţial în legarea
ATP.
Un alt element comun este Arg-finger, 2 resturi de arg care patrund in situsul de legare al
nucleotidei având rol esenţial în clivare legăturii fosfodiesterice. ((24)
Toate aceste elemente de structură specifice intră în alcătuirea situsului de legare
şi clivare a ATP-ului, asigurând transferul şi transformarea energiei conţinute în legătura
fosfodiesterică. Mecanismul prin care se realizeaza clivarea ATP constă dintru-un atac
nucleofil al unei molecule de apa activată la γ-fosfatul ATP-ului. Aceasta duce la
formarea unui intermediat pentacovalent, în care sarcinile negative sunt stabilizate de
ionul de Mg şi de sarcinile pozitive inconjuratoare. Deci, situsul activ va conţine o bază
capabilă să activeze apa şi grupări electrofile capabile să stabilizeze intermediatul
negativ, precum şi grupe care să coordineze Mg2+. Structura unui asemenea situs este
prezentată în figura13.

Fig.13. Legarea ATP la centrul activ. a) aranjarea elementelor structurii


secundare notate precum în fig.12 b) plasare elementelor funcţionale specifice şi şi
raporturile cu molecula de ATP (după (24))
Resturile din Walker A, plasate pe aşa numitul P-loop, formează interacţiuni cu
ionul de Mg2+ şi cu fosfatul din ATP, aminoacizii D şi E din structura motivului Walker
B conţin 2 grupe carboxil care predomină în interiorul situsului de legare. D se
presupune a fi implicat în coordinarea Mg2+, iar E este baza necesară clivăriii ATP.
Realizarea de mutaţii le acest nivel are ca rezultat pierderea capacitaţii hidrolitice. Restul
de Arg din structura senzorului 2 este în aşa fel plasat încat poate să semnalizeze
prezenţa fosfatului, şi să transmită această informaţie la situsuri diferite prin schimbari
conformaţionale.(24)
Enzimele din suprafamilia AAA+ se ansamblează în oligomeri, în general hexameri. Aceasta
configuraţie le dă o serie de caracteristici unice. Una este aceea că situsul activ este plasat la
interfaţa dintre subunităţi, fiind alcătuit din elemente structurale aparţinând la două subunităţi
diferite. Acest lucru permite ca legarea şi/sau hidroliza ATP sa ducă la modificări
conformaţionale care se pot transmite de la o subunitate la alta.
Nu s-a realizat încă o imagine globală asupra schimbărilor de conformaţie care

28
apar, dar sunt cunoscute câteva stări conformaţionale pentru HslU. Aceasta este un
membru al acestei familii ce are rol în formarea unui complex proteolitic în bacterii (52).
În cazul în care ATP-ul nu este legat de centrul activ, cele 2 subdomenii (N si C
terminal) sunt depărtate spaţial. Atunci când ADP-ul este legat, cele 2 subdomenii sunt
foarte apropiate unul de altul. Aceasta se datorează în principal se pare mişcării P-loop şi
a helixului şi structurii β-pliate adiacente.
Aceste modificări conformaţionale se pot propaga şi în domenii diferite de
domeniul AAA+, dar legate de acesta. Un exemplu bine studiat este p97/VCP. Aceasta
este o proteină implicată în vehicularea preoteinelor ubiquitin-late spre proteosome.
Fiecare subunitate p97/VCP conţine două domenii AAA+ şi un domeniu N-terminal
implicate în legarea substratului şi/sau a cofactorului şi ansamblării în hexameri. În cazul
în care este ATP sau ADP în situsul activ, domeniile N-terminale sunt prea mobile
pentru a fi definite prin cry-electron-microscopy, având deci o plasare difuză. În prezenta
unui analog al ATP-ului, aceste domenii apar ca densităţi discrete plasate deasupra
inelului alcătuit din domeniile AAA+(24).
În figura 5 pot fi observate elementele specifice domeniului AAA+ descrise mai
sus şi localizarea lor pe secvenţa proteinei coxD, alături de alinierea cu 4 proteine

cunoscute ca făcând parte din această superfamilie.


Fig.14. Elementele specifice domeniului AAA+ şi localizarea lor pe secvenţa proteinei
coxD. Pe aliniere sunt marcaţi cu chenar negru aminoacizii ce intră în alcăturirea centrului activ.

29
c. Analiza structurii secundare a proteinei coxD
Utilizarea aplicaţiei Jpred (16) ce poate fi accesată prin intermediul interfeţei web
la adresa http://www.compbio.dundee.ac.uk/~www-jpred/v se poate obţine predicţia
structurii secundare pe care această proteină o poate adopta. Aceste date vin să
completeze ideea unei ATP-aze prin aceea că numărul şi modul de arnajare al
structurilor helicale şi bete-pliate se aseamănă cu cele descrise la alte proteine cu funcţie
cunoscută. Mai mult decât atât elementele cheie în realizarea funcţiei se află plasate în
aceleaşi poziţii precum în proteinele model, după cum se poate observa în figura 14:

Fig.15. Structura primară şi secundară presupusă a proteinei CoxD. Pe primul


rând se află secvenţa de aminoacizi iar pe al doilea presupusa structură secundară. Cu H
sunt reprezentate porţiunile helicale iar cu E cele beta-pliate. Notarea elementelor de
structură secundară şi a elementelor functionale s-a realizat conform (24)
Din figură se poate aşadar observa că CoxD este o proteină alcătuită din o
alternanţă de structuri helicale şi beta-pliate, conţinând un număr de 9 helixuri şi 5
elemente beta pliate.

2.3. Analiza secvenţei genei coxE

a. Date derivate din analiza structurii primare a proteinei CoxE


Plasată aparent în acelaşi operon cu coxD la doar 18 nucleotide distanţă gena
coxE are 1091 de nucleodide, ceea ce corespunde la un număr de 363 de aminoacizi.
Serverul ProtParam de la Expasy indică o masă moleculară de 38205.2 Da iar PI-ul
calculat este de 8.67. Coeficientul de extincţie la 280 nm este 1.013 în 6.0 M clorură de
guanidină, 0.02 M tampon fosfat, pH 6.5 permiţând aşadar cuantificarea uşoară prin
simpla determinare a absorbanţei la această lungime de undă.
Analiza Blast a secvenţei de aminoacizi nu oferă nici un indiciu foarte sigur
privind funcţia acestei proteine, fiind asemănătoare cu un număr mare de proteine cu
funcţie necunoscută, dar avînd un element comun, şi anume factorul von Willebrand tip
A.

b. Domenii înalt conservate prezente în structura proteinei coxE


Proteina luată în discuţie prezintă un domeniu înalt conservat în structura sa, şi
anume factorul von Willebrand tip A. Acesta este întâlnit în special la proteinele

30
eucariote, dar destul de recent au fost descrise şi elemente similare şi la procariote. La
eucariote domeniul este prezent la proteinele implicate în adeziunea celulară mediată de
ioni metalici şi a fost descris şi la integrine.
Interesant este însă un alt aspect al structurii primare, şi anume prezenţa unor
motive detectate de către Prosite (http://expasy.org/prosite/) (28). Acestea sunt:
− în poziţia 298 ANPHRGKS, situs de legare a ATP-ului sau GTP-ului (P-loop)
− în pozitia 274 RGD, situs responsabil al adeziunea celulară
− în poziţia 246 VALLDAGLVVPD situs activ conţinând acid aspartic specific unor
serin proteaze
Ţinând cont de aceste elemente, este posibil ca acestă proteină să fie implicată,
împreună cu coxD la maturarea enzimei multimerice KDH. Este cunoscut că aceste
enzime multimerice sunt în general asociate cu membrana, acest lucru fiind necesar
pentru a direcţiona mai uşor fluxul de electroni spre lanţul transportori de electroni.
CoxE, prin situsurile de recunoastere a Mo şi de adeziunea de membrană ar putea fi
implicată tocmai în acest lucru, situsul activ asemănător cu cel al unor serin proteaze
fiind necesar pentru eventuale modificări postranslaţionale ale uneia dintre subunităţile
KDH. CoxD, prin funcţia sa ATP-azică ar urma să furnizeze energia necesară acestor
procese.
O ipoteză deosebit de interesantă ce trebuie luată în considerare este şi aceea a
unui sistem de proteine ce asigură deplierea uneia dintre subunităţi în vederea asocierii
cu subunităţile partenere, a integrării cofactorului sau a degradării. Asemenea sisteme
implicate în reciclarea sau degradarea proteinelor defecte au fost intens studiate atît la
microorganisme cât şi la eucariote. Un exemplu clasic din categoria celor ce asigură
degradarea este sistemul ClpXP sau ClpAP . Clp are forma unui butoi cu diametrul de 1-
2 nm, alcătuit din două inele, fiecare inel având 7 subunităţi proteolitice. Intrarea în butoi
este controlată de ClpA sau ClpX, proteine din superfamilia AAA+. Acestea sunt
homohexameri, ansamblaţi în formă de inel, plasaţi la ambele capete ale butoiului.
Esenţial pentru legarea ClpA de ClpX este o secvenţă conservată plasată la C-terminal de
sensorul 1. Prin acest senzor se realizează modularea legării, funcţie de prezenţa sau nu a
ATP-ului. Este simplu de imaginat deci că ClpA sau ClpX, în cazul nostru coxD, au
rolul de a modula intrarea în butoiul proteazic, ele recunoscând substratul şi de asemenea
depliind proteinele pentru a pătrunde prin porul îngust.
Cum sunt alese însă care proteine vor fi degradate şi care nu? Cel mai frecvent
semnalul este o anumită secventă. Aceste secvenţe semnal sunt recunoscute în mod
direct de domeniile AAA+, sau pot fi recunoscute de o a treia proteină adaptor.
Cea mai cunoscută secvenţă semnal este o coada de 11-aminoacizi, de forma
AANDENYALAA, codificată de 10S RNA(ssrA). Ea este grefată pe catena-nascentă în
momentul în care ribozomul se opreşte. Proteinele-ssrA disociază de pe ribosom şi sunt
degradate de ClpXP(22). Aceasta nu este însa singura secvenţa semnal. Cu ajutorul unor
sisteme ClpXA mutante care functioneaza ca veritabile capcane, care captează proteine
dar nu le degradează, au fost analizate o multitudine de proteine şi s-au descoperit 5
secvenţe semnal diferite. Exact cum se realizeaza deplierea şi translocarea prin por nu
este încă pe deplin cunoscut (62).
Acest model ar funcţiona aşadar destul de bine cu cele 2 proteine luate în
studiu, coxD alcătuind porul iar coxE realizănd clivarea subunităţilor incorect pliate sau
fără cofactor.

31
c. Analiza structurii secundare a proteinei coxE
Din păcate, datorită faptului că proteinele cu care coxE este înrudită sunt
necunoscute şi puţin investigate, structura secundară calculată aduce puţine informaţii
referotoare la posibilul ei rol. Modul de succesiune al zonelor beta-pliate cu cele alfa-
helicale este prezentat în figura 15. Se poate observa că proteina conţine 14 α helix-uri şi
numai 3 porţiuni beta-pliate.

Fig.15. Structura secundară a proteinei coxE. Pe primul rând este reprezentată


secvenţa de aminoacizi iar pe al doilea succesiunea zonelor helicale (H) cu cele beta-
pliate (E).

Cap. III. Material şi metode de cercetare

3.1. Tulpini bacteriene şi condiţii de creştere

a. Tulpini bacteriene
Pentru producerea de plasmizi şi pentru expresia proteinelor a fost utilizată o
tulpină derivată din tulpina K-12 (2) şi anume Escherichia coli XL1 Blue de la
Stratagene, care are genotipul:
endA1 gyrA96(nalR) thi-1 recA1 relA1 lac glnV44 F'[::Tn10 proAB+ lacIq
∆(lacZ)M15] hsdR17(rK- mK+)
endA1 – endonucleaza I inactivă
gyrA96(nalR) – rezistenţă la acid nalidixic
thi-1- necesită tiamină în mediul de cultură
recA1 – sensibilitate la UV, datorită inactivării mecanismelor de reparare a ADN
lac
glnV44 – codonul stop UAG a fost suprimat pentru prin inserţia glutaminei
F'[::Tn10 proAB+ lacIq ∆(lacZ)M15] – conţine plasmidul F integrat în cromozomul
bacterian, pe acest plasmid aflându-se Tn10 – transpozom purtând rezistenţa pentru
tetraciclină
ProAB – necesită prolină în mediu
lacIq – supraexprimă represorul lac

32
∆(lacZ)M15 – deleţia parţială a a genei lacZ ce
permite α- complementarea
hsdR17 – pentru transformarea usoară utilizând ADN nemetilat (2)
Pentru expresia proteinelor recombinate a fost utilizat de asemenea şi tulpina
E.coli BL-21. Aceasta este derivată din tulpina B834 şi se caracterizează prin genotipul:
F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])
F– - nu conţine plasmidul F
ompT – o mutaţie în sistemul proteazic VIII ce reduce liza proteinelor exprimate
gal – nu poate metaboliza galactoza
dcm – metilarea citozinei în situsul CCWGG a fost inactivată
lon – nu prezintă proteaza lon
hsdSB - sistemul de metilare şi restricţie este inactiv
λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) - profagul λ a fost înlocuit cu unul
modificat a λDE3 ce conţine genele: lacI – pentru producerea de represor lac
lacUV5-T7 gene 1 – gena pentru T7 ADN polimeraza se
află sub controlul unui promotor mai puternic lacUV5
Acest genotip, prin lipsa proteazelor lon şi a celor de tip VII, alături de prezenţa
sistemului de reparare (gena recA nu este afectată) este unul foarte bine adaptat pentru
supraexpresia proteinelor recombinante.

b. Mediul de cultură:
Mediul LB
Tulpinile de E.coli au fost crescute pe mediul LB (Lauria-Bertani) (56). Acesta
conţine, pe litru:
Peptonă din cazeină (Roth,
Germania)..............................................................................10g
Extract de drojdii (Roth,
Germania)....................................................................................5g
NaCl (Roth,
Germania)......................................................................................................10g
PH-ul a fost adus la 7 cu soluţie NaOH 5M (20 g NaOH în 100 ml apă). Pentru
obţinerea de mediu solid s-au adăugat 16 g/l agar. Sterilizarea s-a realizat pentru 20
minute la 125 0C (aproximativ 1,4 atm). După răcire, înainte de utilizare, s-a adăugat în
mediu soluţia de antibiotic funcţie de necesităţi. Antibioticele utilizate au fost preparate
ca soluţii stoc, sterilizate prin filtrare şi diluate conform tabelului:

Tulpină Antibiotic Concentraţia Concentraţia înDiluţie


soluţiei stocmediu (µg/ml)
(mg/ml)
E. coli XL1 BlueTetraciclină* 10 20 2 µl/ml
wt
E.coli XL1BlueAmpicilină 50 50 1 µl/ml
pH6
E. coli BL21 Cloramfenicol* 15 15 1 µl/ml
E. coli BL21 pH6 Ampicilină 50 50 1 µl/ml
33
Arthrobacter Kanamicină 70 140 2 µl/ml
nicotinovorans
pAO1+
* soluţiile au fost făcute în etanol
Mediul mineral citrat
Pentru creşterea în mediul lichid şi solid a speciei Arthrobacter nicotinovorans am
utilizat mediul mineral conţinând citrat descris de (31). Acesta conţine, pe litru:
2 g citrat trisodic
2 g (NH4)2SO4
4,92 g Na2HPO4
3,06 g KH2PO4
5 g extract de drojdii (Roth, Germania)
Soluţia obţinută se sterilizează prin autoclavare şi, înainte de utilizare se adaugă 5
ml/L soluţie de minerale şi, după caz, 0,05 % nicotină (Roth, Germania).
Soluţia de minerale conţine, pe litru:
0,75 g CaCl2
3,5 g ZnSO4.2H20
4,58 g H3BO3
0,22 g FeSO4.7H20
0,24 g MnSO4.7H20
0,1 g CuSO4.5H20
0,1 g CoSO4.7H20
2 g KH2PO4
2 g MgSO4.7H20
7,5 g EDTA
După completa dizolvare a sărurilor, soluţia se sterilizează prin filtrare şi
păstrează la întuneric. Deşi iniţial soluţia are culoarea verde, după căteva zile devine
roşie. Acest lucru nu afectează însă creşterea celulelor.

c. Condiţii de cultivare:
Plăcile conţinând mediul LB pentru Escherichia coli şi citrat pentru Arthrobacter
au fost incubate la 370C peste noapte, respectiv 300C pentru 48 ore.
Pentru culturile în mediul lichid în vederea producerii de ADN plasmidial o
colonie de pe placa cu E. coli a fost inoculat în 20 ml de mediu ( plasaţi în flacoane de 50
ml) conţinând antibioticul corespunzător şi incubat peste noapte la 370C sub agitaţie
continuă (190 rpm).
Pentru expresia proteinelor în aceeaşi specie, o precultură de 100 ml (în flacoane
Erlenmeyer de 500 ml) a fost incubată peste noapte la 370C sub agitaţie continuă (190
rpm) iar a doua zi a fost utilizată pentru inocularea unui culturi de 1 L (diluţie 1:10 într-
un flacon de 5 L) conţinând antibioticul corespunzător. Cultura a fost incubată la 370C
pentru 2 ore (până densitatea optică la 600 nm a atins 0,6) după care a fost adăugat IPTG
la concentraţia finală de 1 µM (dintr-o soluţie stoc de 1 mM, diluţie 1 µl/1ml). După
inducţie temperatura a fost redusă la 300C şi nivelul de agitare la aproximativ 100 rpm,
cultura fiind incubată pentru încă 6 ore.
Pentru producerea de biomasă o precultură a fost obţinută prin inocularea cu o
colonie de Arthrobacter nicotinovorans a 100 ml mediu citrat (în care au fost adăugate

34
cantităţile corespunzătoare de soluţie de minerale şi antibiotic), urmată de incubarea
pentru 24 ore la 300C. Precultura a fost apoi utilizată la inocularea unei culturi de 2 litri
conţinând mediu citrat, soluţia de minerale, 0,005% nicotină şi kanamicină 140 µg/ml.
Cultura a fost incubată în continuare la aceeaşi temperatură şi acelaşi nivel de agitare
pentru încă 12 ore.
În general celulele au fost procesate imediat. În cazul în care acest lucru nu a fost
posibil fost separate prin centrifugare (4500 rpm pentru 10 minute) şi păstrate la -200C.

3.2. Strategii de clonare şi verificare a clonelor utilizate

În principiu, clonarea unui fragment de ADN într-un vector este un proces simplu
ce implică clivarea vectorului cu enzime de restricţie şi ligarea lui in vitro cu fragmentul.
Vectorul recombinant este apoi folosit pentru transformarea celulelor competente.
În practică însă pot apare dificultăţi în special în distingerea vectorilor ce conţin
insertul de cei care s-au recircularizat fără acesta. De aceea a fost necesară punerea la
punct a unor tehnici şi abordări ale procesului de clonare care să uşureze acestă selecţie
şi identificare a recombinantelor(56).
Un prim element ce trebuie avut în vedere este alegerea judicioasă a enzimelor de
restricţie utilizate. Acestea pot produce cele 2 tipuri de capete cunoscute: capete
lipicioase sau blunt.
Digestia vectorului cu enzime ce formează capete blunt este una dintre cele mai
vechi obordări utilizate, având avantajul că se poate clona direct produsul PCR.
Dezavantajul constă din faptul vectorul se poate recirculariza deosebit de uşor sau poate
forma oligomeri în tandem. De aceea cel mai frecvent este necesar ca vectorul să fie
supus unei etape premergătoare de defosforilare la capătul 5´ realizată cu fosfataza
alcalină. În timpul ligării în vitro ligaza bacteriofagului T4 va cataliza formarea unei
legături fosfodiesterice între 2 nucleotide adiacente dacă una conţine o grupare 5´- fosfat
şi cealaltă 3´- hidroxil. Lipsa grupării fosfat va duce la imposibilitate recircularizării
vectorului fără fragment.
Aceeaşi abordare poate fi utilizată şi în cazul în care vectorul a fost digerat cu o
singură enzimă, iar fragmentul cu o aceeaşi enzimă ce produce capete lipicioase. Acest
tip de clonare poartă numele de clonare nedirecţiontă, deoarece direcţia de inserare al
fragmentului în vector este aleatoare.
În cazul utilizării a două enzime ce duc la formarea de capete diferite
necompatibile cercetătorul are un control foarte precis asupra orientării fragmentului
acest tip de abordare primind numele de clonare direcţionată. Ea presupune aşadar
alegerea judicioasă a enzimelor cu care atât vectorul cât şi fragmentul vor fi clivate la
capătul 5´ şi la cel 3´. Alegerea se face funcţie de situsurile de restricţie existente în
interiorul fragmentului şi la nivelul vectorului fiind necesar ca enzimele să taie doar o
dată în ambele fragmente de ADN.
În general plasmizii prezintă un situs de clonare multiplu constând dintr-un
fragment de ADN la nivelul căruia sunt cantonate un număr mare de situsuri unice de
restricţie pentru enzime foarte frecvent utilizate. Problema apare în cazul fragmentului
de clonat, care are o lungime limitată iar pentru a fi exprimată gena respectivă trebuie
clonată într-un cadru de citire bine stabilit, iar pentru a fi pusă sub controlul
promotorului lac. Aceasta face ca situsul de clivare al fragmentului în regiunea 5´ să fie
35
foarte puţin permisiv. Prin utilizarea de primeri degeneraţi ce inseră situsuri de restricţie
în fragmetul amplificat, cercetătorul poate alege dintr-o gamă destul de largă de enzime
de restricţie.
Clonarea celor 2 gene luate în discuţie s-a realizat urmând modelul pentru
clonarea direcţionată. Vectorul utilizat pentru clonare şi expresie a fost pH6EX3 (5).

Harta situsurilor de restricţie a acestui plasmid este prezentată în figura 16.

Fig 16. Harta situsurilor de restricţie a plasmidului pH6EX3


Harta situsurilor de restricţie pentru fragmentele clonate a fost generată cu
programul NEBcutter (63).
Fragmentele conţinând genele de interes au fost amplificate prin PCR utilizând
primeri degeneraţi şi polimeraza PfuTurbo (Stratagene), iar în calitate de template o
soluţie conţinând celule de Arthrobacter nicotinovorans pAO1+. Un amestec de reacţie a
conţinut:
Tampon reacţie (10X)........................................................................................................5
µl
Primeri ................................................................................................10
pmoli
Amestec dNTP, 10 µM din fiecare (Roche)......................................................................1
µl
Template .......................................................................................................1

36
µl
Enzimă ...................................................................................................0,8
µl
Apă sterilă .......................................................................................până la 50
µl
Un program de PCR tipic a conţinut o etapă de denaturare de 1 minut (950C), o
etapă de annealing de 45 de secunde şi o etapă de sinteză la 720C cu durată variabilă
funcţie de dimensiunea fragmentului, după care aceste etape se repetă de 30 ori. Ultima
etapă a programului constă din aşa numita terminare, 10 minute la 720C. În general
pentru determinarea temperaturii de annealing s-a realizat o tatonare, alegându-se
temperatura la care amplificarea şi specificitatea au fost maxime.
Fragmentele amplificate au fost purificate utilizând QIAquick Gel Extraction Kit
(Qiagen) urmând indicaţiile producătorului. ADN-ul plasmidial a fost preparat utilizând
QIAprep Spin Miniprep Kit (Qiagen) urmând indicaţiile producătorului.
Enzimele de restricţie utilizate au fost procurate de le New-England Biolabs şi au
fost utilizate conform manualelor producătorului. În general un amestec de digestie a
conţinut:
Tampon specific ..........................................................................................................2.5
µl
Albumină serică bovină 10 µg/µl...................................................................................2,5
µl
Soluţia ADN ......................................................................................................10-20
µl
Enzimă .............................................................................................................1
µl
Apă sterilă ...............................................................................................până la 25
µl
În cazurile în care cele două enzime permit, s-a realizat o dublă digestie, cu
ambele enzime şi un tampon corespunzător. Digestia s-a realizat pentru 4 ore la
temperatura indicată de producător (în general 370C).
Pentru separarea fragmentelor mici de cateva zeci de nucleotide rezultate în urma
digestiei de produsul de interes s-a fost utilizat electroforeza în geluri de agaroză. De
altfel, pe tot parcursul etapelor următoare, fragmentele ADN au fost vizualizate utilizând
această tehnică pe geluri 0,75 % în sistemul tampon TBE, pentru vizualizare utilizându-
se bromura de etidiu şi expunerea la UV.
Ligarea fragmentului s-a realizat utilizând Rapid DNA ligation Kit (Roche)
urmărind indicaţiile producătorului. S-a încercat păstrarea unui raport fragment: vector
de 1:3.
După ligare amestecul a fost utilizat pentru realizarea transformării celulelor de
E.coli XL1Blue competente. Pentru transformarea propriu-zisă 200 µl de celule
preparate după îndicaţiile producătorului (Roti®-Transform, Roth, Germania) au fost
amestecate cu 10 µl amestec de ligare şi incubate pe gheaţă pentru 30 minute. Amestecul
obţinut a fost plasat pe plăci cu mediu LB şi ampicilină şi incubate peste noapte la 370C.
Coloniile obţinute au fost a doua zi transferate pe o nouă placă.
Pentru verificarea clonelor, un screening iniţial s-a realizat prin prepararea ADN-
37
ului plasmidial a 10-20 de colonii potenţial recombinante utilizând metoda lizei alcaline
descrise de Sambrook şi colab. (57). Plazmidzii au fost supus digestiei enzimatice cu
enzime ce flanchează fragmentul, iar apariţia unui fragment de dimensiunile aşteptate a
indicat o potenţială clonă.
Pentru siguranţă, ADN-ul plasmidial a fost preparat folosind kit-ul mai sus
menţionat şi supus unei noi digestiii cu enzime de restricţie. De această dată, acestea au
fost selecţionate în aşa fel încât pe de o parte să să excizeze fragmentul din vector, pe de
altă parte să cliveze în vector o dată şi în fragment o dată. Apariţia pe gel a fragmentelor
cu masele moleculare deduse teoretic a fost considerată ca fiind suficientă pentru a
considera colonia pozitivă.

3.3. Purificarea proteinelor recombinate utilizând cromatografia de afinitate pentru


metale imobilizate

Purificarea proteinelor în formă activă a constituit o problemă deosebit de


spinoasă a biochimiei, deoarece se utilizau tehnici ce se bazau pe proprietăţile native ale
proteinelor. Tehnicile de biologie moleculară permit o altă abordare, şi anume de a
conferi proteinelor de interes proprietăţi care să uşureze foarte mult efortul necesar
obţinerii de preparate pure.
Una dintre cele mai utilizate tehnici este cea de fuzionare a proteine de interes cu
o coadă ce conferă acesteia afinitate faţă de supororturi imobilizate. Câteva exemple de
asemenea cozi ar fi: Poli-Arg – conferă afinitate faţă de cationi
Poli-His – conferă afinitate faţă de Ni2+ sau Co2+
Strep-Tag II – conferă afinitate faţă de streptavidină
S – conferă afinitate faţă de fragmentul S al RN-azei A
Calmodulin-binding peptide – conferă afinitate faţă de calmoduluină
Cellulose-binding domain – conferă afinitate faţă de celuloză
Chitin-binding domain – conferă afinitate faţă de chitină
Glutathion S-transferaze – conferă afinitate faţă de glutation
Maltose-binding protein – conferă afinitate faţă de maltoză (64)
Dintre acestea coada poli-His (alcătuită din un numar variabil, 6-8, reziduuri de
histidină) are un succes foarte mare, fiind intens folosită într-un număr mare de
laboratoare oferind o serie de avantaje. În primul rând dimensiunile deosebit de mici
fac ca modificările induse asupra structurii secundare şi terţiare a proteinei de interes să
fie minime. De asemenea, între coadă şi proteina de interes se poate insera un situs de
clivare ce permite eliminarea ei şi obţinrea enzimei native. Avantajul cel mai mare este
însă faptul că întregul proces de purificare se reduce la o singură etapă, ce constă în
legarea proteinei recombinate de coloana cu Ni2+ imobilizat. De asemenea demn de
remarcat este faptul această coadă îşi menţine proprietăţile şi în condiţii denaturante.
Această tehnică de purificare a fost descrisă pentru prima dată de Porath şi colab.
(49) şi a primit numele de cromatografie de afinitate pentru metale imobilizate (IMAC).
Ionul unui metal tranziţional ( Co, Cu, Zn sau cel mai frecvent Ni) este imobilizat pe o
matrice inertă. Prima matrice a fost descrisă de Hochuli în 1987 (64) şi este reprezentată
de acidul nitrilotriacetic (NTA), autorul folosind ionul de Ni2+ ( Ni-NTA). Un alt suport
inert este TALON sau carboximetilaspartat utilizat în special cu ionul de Co2+.

38
Pentru purificarea produşilor genelor coxD şi coxE am utilizat High-Performance
Nickel-chelating Sepharose produsă de GE Healthcare fie sub formă de mediu ca atare
sau împachetat în coloane cromatografice. High-Performance Nickel-chelating
Sepharose este reprezentat dintr-un un matrix alcătuit din particule de agaroză de 90
micrometri de care sunt fixate grupele chelatante. Acestea ocupă 4 din cele 6 valenţe ale
ionului de Ni2+ ceea ce conferă o fixare stabilă a ionului de matrix şi posibilitate ca
celelalte 2 valenţe să fie ocupate de moleculele de histidină din proteina de interes.
Protocolul utilizat pentru purificarea propriu-zisă este unul adaptat după
instrucţiunile producătorului şi etapele propuse de (2) şi a constat din 4 etape:
1. Pregătirea coloanei
Ni-Sepharose 6 Fast Flow este menţinută ca o suluţie 40% în alcool etilic 20% la
frigider. Înaintea utilizării soluţia se agită pentru omogenizare şi 5 ml se plasează în
coloana de plastic. Aceasta va duce la obţinerea unei coloane cu volumul de 2 ml (CV).
Materialul se spală apoi cu apă distilată 10 volume de colană (CV). Pentru siguranţă
coloana a fost curăţată şi apoi reîncărcată cu Ni. Aceasta s-a realizat prin spălări
succesive cu:

EDTA 0,05 M, NaCl 0,5 M 10x CV


NaCl 0,5 M 2-3x CV
NaCl 1M* 1x CV
NaOH 1M 10x CV
Etanol 70% 10x CV
Apă distilată 10x CV
NiCl2 150 mM 4x CV
Apă 10x CV
*această soluţie este menţinută în contact cu coloana pentru 15-20 minute la temperatura
camerei
2. Echilibrare coloanei şi încărcarea extractului:
După etapa preliminară mai sus menţionată coloana a fost echilibrată prin spălare
cu 10xCV de tampon de lucru: HEPES 40mM, Nacl 500 mM, pH 7,4.
Culturile obţinute după metoda descrisă la punctul 3.1. în vederea supraexpresiei
de proteine au fost centrifugate pentru 10 minute la 4500 rpm în vederea recuperării
celulelor. Acestea au fost resuspendate în aproximativ 40 ml de tampon de lucru şi
sonicate în 3 reprize de câte 2 minute pe gheaţă utilizând un sonicator Branson. Soluţia
obţinută, numită de aici extract total a fost supusă unei noi centrifugări la 14500 rpm
pentru 30 minute în vederea clarificării şi separării celuleor intacte şi elemetelor
insolubile. Supernatantul este extractul acelular (cell free extract CFE), iar depozitul
(pellet, P) conţine proteinele insolubile.
CFE a fost apoi aplicat pe coloana echilibrată. Soluţia evacuată la ieşirea din
coloană a fost colectată şi analizată din punct de vedere al conţinutului de proteine.

3. Spălarea coloanei
După aplicare CFE cu proteina de interes coloana este spălată pentru eliminare
componentele legate nespecific de aceasta. Spălarea se face prin aplicare succesivă pe
coloana a următoarelor soluţii cu volumul indicat:

39
Imidazol 10 mM în HEPES 40mM, Nacl30xCV
500 mM, pH 7,4
Imidazol 40 mM în HEPES 40mM, Nacl30xCV
500 mM, pH 7,4
Imidazol 80 mM în HEPES 40mM, Nacl10xCV
500 mM, pH 7,4
Fracţiuni de câte 1 ml sunt preluate din primii 10 ml de lichid în vederea
monitorizării conţinutului proteic.

4. Eluţia
Eluarea proteinei spălate s-a realizat prin spălarea cu 10xCV soluţii conţinând 200
şi apoi 500 mM imidazol. Lichidul evacuat a fost colectat în fracţiuni de 1 ml şi analizat
în vederea conţinutului de proteine.

3.4. Analiza conţinutului proteic


Analiza cantităţii de proteine s-a realizat după metoda Bradford cu reactivul gata
preparat produs de Sigma Aldrich (Germania) urmând indicaţiile producătorului.
Analiza spectrului proteic a fost realizată prin elecroforeza în geluri de
poliacrilamidă în sistem denaturant sau nedenaturant, după caz. Elecroforeza s-a realizat
într-o cuvă MiniProtean 3 produsă de Biorad. Gelurile au fost preparate după indicaţiile
lui Sambrook şi colab. (57) şi ai producătorilor sistemului electroforetic. După
decolorare gelurile au fost uscate şi scanate.

3.5. Metode de determinare a activităţii ATP-azice utilizate

În vederea testării activităţii ATP-azice 2 metode diferite au fost utilizate, fiecare


bazându-se pe un alt principiu de detectare a produşilor de reacţie formaţi.
O primă metodă este una ce presupune utilizarea de ATP marcat radioactiv cu P32
la gruparea fosfat din poziţia α. Metoda utilizată a fost cea descrisă de Menedez şi colab.
în 1997 (46). Condiţiile standard au constat din 3,3 pmoli de (α-32P) ATP (3000
Ci/mmol) în 100 µl 10 mM Tris/HCl pH 7,5, 10 mM MgCl2 şi cantităţi variate de coxD.
Amestecul a fost incubat la 300C pentru 1, 2, 5, 10 şi 30 minute. La expirarea perioadei,
10 µl de amestec au fost prelevaţi şi proteina inactivată prin îngheţare. 2 µl din probă au
fost apoi plasaţi pe o placă cromatografică de celuloză impregnată cu polietilenimină
produsă de Machery-Naegel. După uscarea probei pe placă, aceasta a fost introdusă într-
un tanc cromatografic conţinând acid formic 0,5 M şi LiCl2 0,5 M saturat în vapori.
După 45 de minute placa a fost recuperată iar după uscare autoradiografiată.
A doua metodă a constat într-un sistem enzimatic de regenerare a ATP-ului ce
oferă avantajul păstrării constante a concentraţiei substratului şi eliminării din sistem a
potenţialilor inhibitori ai reacţiei: ADP şi fosfatul anorganic. Acest sistem a fost descris
de Kimb şi colab. (33) şi utilizat cu succes pentru evidenţierea activităţii ATP-azice a
proteinelor Clp şi Hsp100. Tamponul de reacţie a constat din 25 mM HEPES-KOH (pH
7.6), 5 mM KCl, 5 mM MgCl2, iar sistemul enzimatic este reprezentat din 2.5 mM ATP,
1 mM NADH, 7.5 mM fosfoenolpiruvate, 0.05 mg/ml piruvat-kinază, 0.025 mg/ ml

40
lactat-dehidrogenază. Schema reacţiilor ce au loc este următoarea:

Activitatea nucleozidazică atrage deci după sine scăderea consumului de NADH


existent în sistem, acesta din urmă fiind monitorizat prin determinarea extincţiei la 340
nm. Reacţia a fost iniţiată prin adăugarea a 6 micrograme proteină şi incubarea la 300C
sub agitare continuă. În paralel un control al reactivilor a fost realizat în vederea
eliminării unei potenţiale hidrolize neenzimatice a ATP-ului sau NADH-ului. La
intervale de o oră A340 a fost determinată utilizând cuve de cuarţ la un spectrofotometru
Ultrospec 3100 UV/Visible (Amersham Biosciences).

3.6. Prepararea anticorpilor şi Western-Blot


Obţinerea de anticorpi specifici pentru o proteină de interes poate fi un pas
important ce deschide calea unor studii funcţionale deosebit de interesante. Deoarece am
fost interesaţi de condiţiile în care cele două proteine sunt exprimate şi de localizarea lor
celulară probleme ce sunt destul de uşor de abordat utilizând tehnici de imonologie, am
încercat obţinerea unor anticorpi specifici pentru coxD şi coxE.
Pentru aceasta aproximativ 100 µg de proteină au fost amestecaţi 400 cu µl de
adjuvant complet al lui Freud. Acesta este un amestec de uleiuri minerale şi conţine şi
bacterii inactivate pentru potenţarea răspunsului imun. Volumul a fost adus la 800 µl cu
apă sterilă şi injectat în vena de la ureche a unui iepure de laborator.
Înainte de injecţie, 10 ml de sânge au fost prelevaţi. Prin incubarea la 370C pentru
o oră şi centrifugarea la 5000 rpm pentru 10 minute a fost separat serul de celule. Acesta
a constitui serul preimun, control necesar eliminării unor eventuale reacţii accidentale ale
anticorpilor preexistenţi în sânge cu proteinele de interes.
După 28 de zile de la prima injecţie răspunsul imun a fost potenţat prin o nouă
injectare, cu aceeaşi cantitate de proteină, dar folosind adjuvantul incomplet al lui Freud.
Acesta nu conţine bacterii. La 14 zile de la a doua injecţie 20 de ml de sânge au fost
prelevaţi şi procesaţi ca în cazul serului preimun. Existenţa şi specificitatea anticorpior
existenţi în ser a fost testată prin Western-Blot (urmând protocolul descris mai jos),
realizându-se în paralel 2 transferuri a două geluri identice pe 2 membrane diferite şi
incubarea uneia cu serul preimun şi a celeilalte cu anticorpul de interes. Dacă reacţia a
fost prea slabă s-a repetat injectarea şi prelevarea sângelui până la obţinerea răspunsului
cu sensibilitatea şi specificitatea dorită.
Metoda numită Western-blot constă din transferul proteinelor pe membrane de
membrane de nitroceluloză şi legarea de proteina de interes a anticorpului specific.
Acesta interacţionează cu un al doilea anticorp specific pentru animalul în care primul a
fost produs. Acest al doilea anticorp este modificat în vitro prin cuplare cu o enzimă (cel
41
mai frecvent peroxidaza) şi permite evidenţierea uşoară a interacţiunii.
Metoda utilizată a fost cea propusă de (25), timpii de incubare fiind adaptaţi
funcţie de anticorp. Aproximativ 25 µg extract proteină sau 5 µg de proteină purificată
au fost încărcate pe un gel 12% denaturant de poliacrilamidă. Gelul a fost rulat până
colorantul a ieşit din gel şi apoi plasat în aparatul de transfer, în care au fost plasate în
prealabil 4 foi de hârtie Watmann îmbibate cu tampon de transfer: 20 mM Tris, 150 mM
glicină, pH 8,2-8,4 0,02 % SDS, 20% metanol. Peste gel a fost plasată membrana de
nitroceluloză Optitran BA-S 85 (Schleicher & Schuell) echilibrată în prealabil în tampon
de transfer pentru 5 minute şi încă 4 foi de hârtie Watmann îmbibate în acelaşi tampon.
S-a acordat atenţie deosebită pentru eliminarea bulelor de aer dintre foile de hârtie,
membrană şi gel. O tensiune electrică de 250 mA pentru o oră a fost aplicată, cu polul
pozitiv pe partea dinspre membrană şi cel negativ pe partea dinspre gel a sandwich-ului.
Membrana a fost apoi spălată cu apă şi incubată cu soluţie Ponceau S (30% acid
triclor acetic, 0,2 % Ponceau S) pentru evidenţierea proteinelor. Fiecare godeu şi poziţia
marker-ilor a fost marcată cu un creion cu vârful moale iar apoi membrana a fost
decolorată prin spălare cu apă pentru 5 minute.
Pentru fixarea proteinelor pe membrană şi inactivarea grupărilor active ale
acesteia (care ar putea reţine în mod nespecific anticorpii) membrana a fost apoi incubată
în 50 mM Tris, 150 mM NaCl, 0,5 % Tween 20 pentru 30 minute. A urmat echilibrarea
în tampon TBS 20 mM Tris, 500 mM NaCl pH 7,5 pentru 5 minute.
10 µl de ser conţinând anticorpul de interes au fost diluaţi în 20 ml tampon TBS
(diluţie 1:2000) şi apoi incubaţi cu membrana pentru cel puţin 2 ore. Timpul a fost extins
până la 3 ore fără a apare un semnal de fond foarte intens. A urmat incubarea în tampon
TTBS (tampon TBS la care se adugă 0,5 ml/L Tween20) pentru 30 minute şi incubarea
cu cel de-al doilea anticorp. În această etapă am utilizat un anticorp anti iepure produs în
capră cuplat cu peroxidaza alcalină într-o diluţie 1:2000 cu TBS. Timpul de incubare a
fost de minim o oră. A urmat apoi pe rând incubarea cu TBS pentru 10 minute şi TTBS
pentru 10 minute.
Developarea s-a realizat prin incubarea în tampon carbonat 0,1 M NaHCO3, 1
mM MgCl2 pH 9,8 pentru 10 minute urmată de adăugare de soluţie de developare ce
conţine în 20 ml tampon carbonat: 60 µl NBT 10% (nitroblue tetrazolium chloride) în
DMF 70% (dimetil-formamidă), 7,5 mg 5-bromo-indolilfosfat. Se agită pentru câteva
minute şi imediat ce benzile apar membrana se spală şi se usucă între 2 foi de hârtie
Watmann.

3.7. Re-plierea in vitro a corpilor de incluziune


Supraexpresia proteinelor recombinate în E.coli a devenit tehnică de bază a
biologiei moleculare şi biochimiei. Aceasta nu înseamnă însă că este ferită de probleme.
Este suficient să ţinem cont doar de două aspecte pentru a putea explica problema cea
mai gravă cu care această abordare se confuntă: solubilitatea proteinelor
supraexprimate(23).
Unul dintre aceste aspecte este faptul că se încearcă expresia unei proteine noii, de
multe ori de la un organism aparţinând unui alt regn, şi din aceste cauze celula gazdă ar
putea fi lipsită de anumite sisteme necesare pentru corecta producere a proteinei de
interes (cheperones, sisteme de modificare postranslaţională). De asemnea această

42
proteină ar putea fi toxică pentru E. coli, celula inactivând-o.
Al doilea aspect este derivat din vectorii şi sistemul de expresie utilizat. Se
vorbeşte de fapt despre o supraexpresie, proteina de interes devenind dominantă în raport
cu celelalte proteine celulare. Datorită vitezei mare de producţie, de multe ori celula
gazdă este copleşită şi nu se poate adapta, ceea ce duce la defecte de creştere, moarte
celulară sau depozitarea proteinei sub formă de corpi de incluziune (23).
Aceştia reprezintă aşadar aglomerări masive cuprinzând în general o singură
proteină inactivă, depliată (15). Recent s-a arătat că de fapt deplierea nu este totală, ci
proteina păstrează un anumit grad de organizare al structurii secundare (32). Priviţi până
acum ca o fundătură, o situaţie fără ieşire, aceştia au început recent să fie priviţi cu
interes deoarece oferă două avantaje foarte mari: nivele mari şi foarte mari de expresie a
proteinei, chiar şi a celei toxice pentru celula gazdă şi uşurinţă în purificare. Corpii de
incluziune conţin numai proteina supraexprimată şi sunt foarte denşi în raport cu
celelalte componente celulare, astfel încât o etapă de centrifugare şi una de spălare cu
detergenţi este suficientă pentru obţinerea de preparate pure.
Problema este însă readucerea în starea lor nativă, activă fiziologic. Pentru aceasta
au fost propuse o serie de abordări, care au în comun 2 etape principale: solubilizarea
utilizând agenţi denaturanţi şi re-plierea in vitro (35).
Pentru solubilizarea şi purificarea corpilor de incluziune am utilizat 2 abordări
distincte. Una dintre ele a constat din izolarea materialului celular insolubil (aşa cum este
descris la punctul 3.2) şi spălarea lui succesivă cu soluţii de 4 M uree triton 1%, şi 4 M
uree S-dodecyl-maltozid 1%, urmată de solubilizarea în uree 8M peste noapte sub agitare
continuă.
A doua abordare a utilizat proprietatea cozii poli-His de a păstra afinitatea faţă de
nichel şi în condiţii denaturante. A constat din solubilizarea directă a materialului celular
insolubil în 8 M uree sau 6 M clorhidrat de guanidină urmată de utilizarea
cromatografiei de afinitate pentru metale aşa cum a fost descrisă la punctul 3.3, cu
precizarea că toate soluţiile tampon au conţinut 8M uree sau 6M clorură de guanidină.
În principiu replierea constă din eleminarea treptată sau bruscă a agentului
denaturant ce are ca urmare reformarea structurii secundare a proteinei de interes. Pentru
repliere 2 abordări distincte au fost de asemenea aplicate: diluţia cu picătura şi aşa
numita on-column refolding.
În primul caz 2 ml de soluţie conţinând aproximativ 20 mg de proteină purificată
au fost plasate picătură cu picătură într-un interval de 2 ore într-un volum de 200 ml de
tampon de re-pliere alcătuit din: hepes 40 mM, NaCl 500 mM, PEG (polietilen-glicol)
1%, triton 1% sub agitare continuă.
În al doilea caz, proteina este fixată pe o coloană de Ni-Sepharoză şi agentul
denaturant se elimină treptat prin creearea unui gradient descrescător. Pentru aceasta am
utilizat coloane preîmpachetate HisTrap HP de 1 ml şi un sistem cromatografic ÄKTA
basic produs de Amersham Biosciences.

43
Fig. 17. Sistemul cromatografic utilizat pentru studiile de repliere in vitro
Programul utilizat a constat din:
− echilibrarea coloanei cu 30 ml tampon de denaturare: 40 mM HEPES, 0,5 M NaCl, 6
M clorură de guanidină
− injectarea probei constând din 5 ml material celular insolubil solubilizat în tampon de
denaturare pH 7,4
− spălarea coloanei cu 20 ml tampon de denaturare
− renaturarea prin realizarea unui gradient de la 6M la 0 M guanidinium hidrochloride
având o lungime de 35 ml.
− echilibrarea coloanei cu 10 ml tampon de lucru 40 mM HEPES, 0,5 M NaCl
− eluţia cu un gradient de la 0 la 1 M imidazol cu o lungime de 20 ml. În această etapă
au fost prelevate probe de 1 ml şi analizate din punct de vedere al conţinutului de
proteine.
Programul a fost rulat cu o viteză de 1 ml/min sau mai mică atunci când citirile de
presiune depăşeau valorile recomandate de producătorul coloanei. Pentru realizare
gradientelor din etapa de renaturare la intrarea A a pompei a fost plasat tampon de
denaturare iar în intrarea B tampon de lucrul, iar în etapa de eluţie la intrarea A a fost
tampon de lucru iar la B tampon de lucru cu 1M imidazol.

Cap IV. Rezultate şi discuţii

4.1. Clonarea secvenţelor genelor coxD şi coxE şi expresia proteinelor


recombinante

Pentru clonarea secvenţelor genelor menţionate am utilizat clonarea direcţiontă,


utilizând câte o pereche de enzime diferite pentru fiecare genă. Această abordare a

44
asigurat un randament de obţinere a recombinantelor mare, reducând foarte mult
eforturile depuse pentru selecţia recombinantelor.
Pentru ambele gene au fost utilizaţi primeri degeneraţi. Secvenţa acestora au fost
dedusă de pe secvenţa plasmidului pAO1 depus în baza de date GenBank, gi|25169022
(31) ţinându-se cont de modificările dorite.
Astfel pentru coxD primerul 5´ a avut secvenţa:
5´ C ACC TCG AAT TCC GAC TCG CAA GGC 3´. Bazele subliniate reprezintă situsul
de recunoaştere al enzimei EcoRI iar cele marcate cu italic, nucleotidele înlocuite. După
cum se poate observa pentru creearea situsului de restricţie au fost necesare 2 înlocuiri
(A cu T). Cea de-a treia a fost necesară pentru inactivarea unui codon STOP plasat
înaintea codonului START nativ. Temperatura de topire teoretică calculată a acestui
primer a fost de 800C.
Primerul 3´ a avut secvenţa
5´ CTT GTG AAG ACG TCG ACA GTA C 3´ fiind înlocuite un număr de 2 nucleotide
pentru a forma situsul de restricţie a enzimei SalI. Temperatura de topire teoretică
calculată a acestui primer a fost de 640C.
Amestecul PCR şi programul utilizat a respectat coordonatele descrise în capitolul
III, temperatura de annealing fiind 620C iar timpul de extensie de 1 minut. S-a realizat
astfel amplificarea unui fragment de aproximativ 900 pb care a fost supus digestiei
enzimatice cu EcoRI şi SalI în tampon NEB EcorI pentru 4 ore la 370C. Vectorul a fost
clivat în aceleaşi condiţii. Ligarea s-a realizat menţinănd un raport fragment:vector de
aproximativ 3:1, raport realizat funcţie de intensitatea benzilor corespunzătoare pe gelul
de agaroză colorat cu bromură de etidiu.
Transformarea cu 10 µL de amestec de ligare a 200 µL celule competente E.coli
XL1 pentru 30 minute pe gheaţă a dus la obţinerea a 8 colonii dintre care 7 sau dovedit
pozitive.
Clonarea cu primerii descrişi mai sus duce la obţinerea unei proteine
recombinante care la capătul N terminal are secvenţa:
MSPIHHHHHHLVPRGFEASNSDSQGETM, unde metionina scrisă îngroşat este
primul aminoacid al proteinei coxD.
Pentru expresie 2 colonii au prelevate şi au fost realizate 2 culturi de 400 ml
induse cu IPTG 1mM aşa cum este descris în capitolul III. Celulele au fost colectate,
resuspendate în tampon de lucru şi sonicate. Aproximativ 25 µg proteine au fost
încărcate pe un gel SDS-PAGE de concentraţie 12%. Aşa cum se poate vedea din figura
10, în dreptul masei moleculare deduse teoretic (34 kDa) apare o bandă deosebit de
intensă, semn al unei supraexpresii puternice.
În cazul genei coxE, clonarea s-a realizat prin clivarea fragmentului cu BglII
pentru capătul 5´ şi KpnI pentru cel 3´ şi a vectorului cu enzimele BamHI şi KpnI.
Enzimele BamHI şi BglII au capete compatibile ceea ce face posibilă ligarea. Pentru
digestia fragmentului s-a utilizat tamponul NEB 2, iar pentru digestia vectorului
tamponul 1, în care BamHI are 75% din activitate.
Primerii utilizaţi au avut secvenţa:
primerul 5´ - 5´G.GTACTGGCGAGATCTTCACAAGTAGG 3´
primerul 3´ - 5´CGAGGGCGAAGGTACCTCCGTGCGTC 3, proteina de fuziune având
secvenţa N-terminală de forma: MSPIHHHHHHLVPRRS, în care aminoacidul îngroşat
este cel rezultat prin modificarea codonul corespunzător primului aminoacid (M) al
45
proteinei.
Ligarea şi transformarea s-a realizat ca şi în cazul precedent, obţinându-se 12
colonii din care 10 pozitive. Testarea în vederea expresiei s-a încercat ca şi în cazul
proteinei coxD, însă nu a putut fi observat un semn clar de supraexpresie. Datorită
acestui fapt, plasmidul recombinant a fost transformat într-o altă tulpină bacteriană
recunoscută ca o mult mai bună gazdă de expresie: E. coli BL21. Expresia a fost testată
în aceleaşi condiţii, de această dată fiind însă analizat prin electroforeză şi materialul
celular insolubil dizolvat în prealabil în 1% SDS. Analiza în paralel a proteinelor
solubile din celule BL21 purtând pH6EX3 pe de o parte şi cele purtând pH6EX3coxE pe
de altă parte nu a demonstrat diferenţe semnificative.
După cum se poate vedea din figura 18 însă, materialul celular insolubil provenit
de la tulpina purtînd pH6EX3coxE prezintă o bandă în plus, bandă de corespunde masei
moleculare deduse teoretic de 38 kDa. Aceasta reprezintă proteina coxE exprimată în
condiţiile testate sub formă insolubilă.

Fig.18. Expresia proteinelor coxD în E.coli XL1Blue (A) şi coxE în E.coli BL21
(B). Fiecare panou cuprinde 1,4 - markerii de masă (Sigma, Wide Molecular Weight
Range) cu masele moleculare exprimate în kDa şi câte 25 micrograme proteine solubile
(A) sau material celular insolubil (B) din celulele gazdă conţinând plasmidul normal
(2,5) şi cel recombinant (3,6)
După cum am văzut cauza principală a insolibilităţii proteinelor supraexprimate în
E.coli este nivelul mare de expresie raportat la restul de proteine celulare. Pentru a trece
peste această problemă, Sambrook şi colab. (56) propune modificarea unor parametri de
cultivare care promovează creşterea solubilităţii. Unul dintre acestea este temperatura,
scăderea ei ducând la diminuarea ratei de creştere şi dezvoltare celulară. În cazul acestei
proteine, am încercat expresia la temperaturi de 28, 26, 22, 20, 18 şi 160C crescând
corespunzător timpul de incubare. De asemenea, într-o altă serie de experimente viteza
de agitare a fost diminuată, şi de asemenea cei doi factori combinaţi au fost testaţi.
IPTG-ul este un compus chimic de sinteză, similar lactozei, dar nemetabolizabil.
Datorită acestui fapt asigură nivele mare şi constant de expresie. Într-o altă serie de

46
experimente concentraţia de IPTG utilizată pentru inducţie a fost redusă până la 0,01
mM, în combinaţie cu scăderea temperaturii şi diminuarea vitezei de agitare. În nici una
din condiţiile testate nu s-au observat îmbunătăţiri ale solubilităţii proteinei. Mai mult,
spălări succesive cu detergenţi ce elimină fragmentele membranare din materialul celular
insolubil au dus la izolarea unor corpusculi granulaţi amorfi, asemănători corpilor de
incluziune descrişi de (15).

4.2. Purificarea proteinei recombinante coxD

Utilizând modalitatea de cultură descrisă la punctul 3.1 şi protocolul de purificare


descris la punctul 3.3, s-a reuşit purificarea printr-o singură etapă a proteinei
recombinante coxD. Modul de evoluţie a numărului de fracţii proteice de-a lungul
etapelor de purificare se poate vedea în figura 11. Iniţial protocolul utilizat presupunea
eluţia proteinei cu 200 mM imidazol în tampon de lucru urmată de o nouă etapă de eluţie
cu 500 mM imidazol. În mod surprinzător, o cantitate mare de proteină rămâne încă pe
coloană şi după această etapă, fapt ce ne-a determinat să modificăm protocolul de lucru.
Deoarece, după cum se poate vedea în figura 11, fracţiunile de 80 şi 200 mM conţineau
şi alte fracţiuni etapa de spălare cu aceste concentraţii au fost păstrate. Etapa de eluţie cu
500 mM imidazol a fost însă
eliminată şi înlocuită cu eluţia cu
tampon conţinând 700 mM
imidazol. Aceasta a dus la obţinerea
marii majorităţi a proteinei
recombinante într-o cantitate
minimă de 3-4 ml de tampon.

Fig.19. Modul de evoluţie al


fracţiunilor proteice de-a lungul
purificării
M- markerii de masă (Sigma, Wide
Molecular Weight Range)
1 – extras total, 25 microg. proteină
2 – proteine solubile, 12,5 microg
3 – material nefixat pe coloană, 12,5
microg.
4 – prima spălare cu tampon 20
microL
5 – spălare cu 10 mM imidazol, 20
microL
6 – spălare cu 40 mM imidazol, 20
microL
7,8,9 – spălare cu 80 mM imidazol,
20 microL
10,11,12 – eluţie cu 200 mM imidazol, 5 microg. proteină
14,15,16,17,18 - eluţie cu 700 mM imidazol, 5 microg. proteină
47
Utilizând protocolul descris cu observaţiile mai sus menţionate a fost posibilă
purificarea proteinei pînă la 95%, cifra fiind apreciată vizual pe gelul colorat cu Brillant-
Blue. Randamentul procesului de purificare nu a putut fi calculat, deoarece nu există o
modalitate specifică de aprecierii cantităţii de proteine totale produse. De asemenea
cantitatea totală de proteină obţinută nu a putut fi estimată exact deoarece imediat după
purificare proteina precipită în tamponul cu imidazol. O serie de măsuri au fost luate în
vederea eliminării acestui incovenient. Astfel, imediat după obţinerea celor 6-7 fracţii de
700 mM acestea au fost diluate la 20 mL cu tampon de lucru lipsit de imidazol, după
care concentrate utilizînd un sistem filtrant Vivaspin MWCO 5000. După ce volumul a
fost redus din nou la 6 ml prin centrifugare la 5000 rpm pentru aproximativ o oră, a fost
adăugat din nou tampon de lucru lipsit de imidazol şi procedura repetată de 5-6 ori. Prin
aceasta se reduce foarte mult cantitatea de imidazol din tampon, o cauză posibilă a
instabilităţii proteinei. După primul ciclu de diluţie-filtrare randamentul membranei a
scăzut drastic, ceea ce ne face să credem că aceasta a fost înfundată cu proteina
precipitată. De asemenea adăugarea de glicerol până la o concentraţie de 20% sau
adăugarea de TWEEN 20 sau 80 în concentraţie de până la 2 %. Una dintre cele mai
frecvenţe cauze ale precipitării este formarea de legături disulfurice inter-moleculare, de
aceea am încercat şi adăugarea de DTT 1 mM în tamponul de lucru utilizat pentru
purificare.
Abordările utilizate pentru mărirea solubilităţii nu au dat rezultate. Prin
centrifugare la 14000 rpm pentru 30 minute s-au putut separa în permanenţă două
fracţiuni: un depozit de culoare albă conţinând proteina precipitată şi supernatantul clar,
transparent, conţinînd proteina solubilă. Interesant este însă că această precipitare este
dependentă de concentraţie. Concentraţia maximă la care proteina se păstrează sub formă
solubilă este aproximativ 0,3 micrograme/microL. Trecerea acestei valori prag duce la
apariţia fenomenului de precipitare şi reducerea concentraţiei de proteine solubile sub
0,3 micrograme/microL. O posibilă cauză a acestui fenomen ar putea fi capacitatea
proteinei de a se asocia în complexe macromoleculare, la concentraţii foarte mare,
fiziologic imposibile, complexele asociindu-se şi ele şi formând conglomerate insolubile.
În sprijinul acestei ideii vin 2 elemente. Pe de o parte comportamentul fracţiunii solubile
atunci când este încărcată pe o coloană de GPC (gel permeation chromatography)
conţinând Superdex 200. Astfel, cea mai mare parte a proteinei nu pătrunde în coloană,
demonstrând existenţa unor asocieri mai mari decât dimensiunea porilor, care îşi
păstrează totuşi solubilitatea.
Pe de altă parte, în sprijinul aceleiaşi idei vine şi coportamentul proteinei pe geluri
PAGE native. După cum se poate vedea în figura 20, atunci când proteina este tratată cu
tampon pentru probele proteice pentru electroforeză fără DTT, ea migrează în numeroase
benzi, de dimensiuni variabile. Dacă însă un exces de DTT este adăugat în tampon,
proteina migrează sub forma unei singure benzi, ceea ce arată că asocierea are la bază
formarea unor punţi disulfurice.

48
Fig. 20. Asocierea proteinei coxD în
structuri macromoleculare aşa cum reiese din
electroforeza în nativă geluri de poliacrilamidă
Probele 1,2: 2,5 respectiv 5 micrograme coxD
tratate cu DTT
Probele 3,4: 2,5 respectiv 5 micrograme coxD

4.3. Măsurarea activităţii ATP-azice a proteinei coxD

După cum am văzut în capitolul 2.2, principala caracteristică a proteinei coxD


derivată aşa cum reiese din analiza secvenţei de aminoacizi este prezenţa motivului
Walker A şi B, implicat în legarea şi hidroliza moleculei de ATP. Acesta a fost motivul
pentru care am testat această activitate. Deoarece de cele mai multe ori, produşii
hidroliză ai acestei molecule sunt şi inhibitori sau modulatori ai ATP-azei, am preferat
utilizare unei metode enzimatice cuplate, în care are loc regenerarea continuă a ATP-
ului din produşii reacţiei de hidroliză şi consumul NADH-ului. Aşadar, activitatea ATP-
azică este evidenţiată în mod indirect, prin scăderea cantităţii de NADH existente în
mediul de reacţie.
După cum se poate
vedea din figura 21, coxD are
întradevăr activitate ATP-
azică, însă una destul de
slabă. De altfel, activitatea nu
este detectabilă de abia după
o oră de incubare la 300C,
fiind pe deplin evidentă de-
abia după 6 are.
Fig.21. Modul de

49
evoluţie în timp al cantităţii de NADH ca măsură nivelului de ATP utilizat.
Cu albastru sunt probele conţinând amestecul de reacţie descris în material şi metodă şi 6
micrograme coxD purificată
Cu mov sunt reprezentate probele control conţinând doar amestecul de reacţie
Faptul că este o reacţie reală este demonstrată de faptul că, aşa cum se poate
vedea în figura 22 este dependentă de concentraţia de ATP existentă în mediul de reacţie.

Fig. 22. Dependenţa


activităţii ATP-azice a
proteinei coxD de
concentraţia substratmediul
de reacţie

Deoarece sistemul utilizat mai sus nu poate funcţiona decât dacă produşii de
reacţie sunt ATP şi fosforul anorganic, am concluzionat că aceştia sunt produşii de
reacţie. Identificarea directă a acestora s-a realizat prin o serie de experimente de
cromatografie în strat subţire. Acestea au valorificat însuşirea AMP, ADP şi ATP-ului de
a migra în mod diferit pe plăcile de celuloză impregnate cu polietileimină. Utilizarea
ATP-ului marcat radiaoctiv la gruparea fosfat din poziţia alfa a uşurat foarte mult
procesul de vizualizare a rezultatului. După cum se poate vedea din autoradiografia
plăcii de celuloză prezentată în figura 23, odată cu creşterea perioadei de incubare a
ATP-ului cu coxD, cantitatea de ADP creşte iar cea de ATP scade. Interesant este
existenţa în probele conţinînd coxD şi a unor cantităţi relativ constante de AMP.

Fig. 23. Produşii de reacţie formaţi în


urma acţiunii coxD asupra ATP-ului.
1: control fără enzimă
2,3,4,5,6: proba conţinînd 5 micrograme coxD şi
incubate pentru 1, 2, 5, 10 şi respectiv 30
minute.

50
CoxD este aşadar o ATP-ază ce hidrolizează acest substrat cu formare de ADP şi
P, şi într-o mai mică măsură AMP. Nivelul activităţii este însă unul destul de redus, fiind
însă de acelaşi ordin de mărime cu cel descris de (65), caracteristic unor unei proteine
asociate de membrană cu rol în degradarea proteinelor defecte. Aceste date corespund cu
concluziile rezultate din analiza secvenţei de aminoacizi, proteina făcînd parte din clasa
AAA+. Nu au fost efectuate alte măsurători ale parametrilor cinetici ai acestei enzime,
deoarece principalul interes a fost elucidarea rolului său fiziologic.

4.5. Expresia nicotin-dependentă si localizarea celulară a proteinei coxD


O problemă deosebit de interesantă în elucidarea rolului fiziologic al acestei
proteine este determinarea condiţiilor specifice în care această enzimă este exprimată.
Fiind plasată în acelaşi operon cu o serie de gene cunoscute a fi implicate în degradarea
nicotinei (31), acest compus sau derivaţi ai lui sunt cei mai buni candidaţi pentru a
induce expresia. O modalitate simplă de a testa dacă întradevăr expresia acestei proteine
este una nicotin dependentă este cu ajutorul unui anticorp specific. Modul de obţinere a
acestui este descris în capitolul material şi metode de cercetare. Au fost necesare trei
injectări pentru obţinerea anticorpului a cărui specificitate şi sensibilitate poate fi
apreciată din fig. 15. Se poate observa aşadar că utilizând acest anticorp şi tehnica
Western-blot pot fi detectate cantităţi de ordinul 0,01 microgramelor de proteină.
Pentru a investiga dacă coxD este produsă în prezenţa nicotinei, două culturi de
câte 400 ml de mediu citrat au fost inoculate cu câte 40 ml de precultură (cultivată peste
noapte). Doar una dintre cele 2 culturi a fost indusă cu nicotină şi ambele au fost
incubate la 300C sub agitare continuă pentru aproximativ 6 ore. După expirarea timpului,
cultura indusă a devenit albastră, semn al inducerii căii de degradare a nicotinei. Celulele
au fost recuperate şi deschise utilizând sonicarea, aşa cum este descris în cap 3. 25
micrograme de proteine au fost încărcate pe un gel SDS-PAGE 12%. După ce frontul
colorantului a ieşit din gel, acesta a fost supus transferului pe o membrană de
nitroceluloză. Membrana a fost decorată apoi cu anticorpul specific şi developat
utilizând metoda descrisă în capitolul anterior. După cum se poate vedea din figura 24,
panoul B, proteina coxD este produsă numai în prezenţa nicotinei, ea lipsind în absenţa
acestui compus din mediu. Diferenţa de masă care apare între proteina din extractele
proteice totale din Arthrobacter şi cea utilizată pentru testarea anticorpului apare datorită
cozii His, care adaugă şi ea un număr de 27 de aminoacizi la secvenţa poteinei coxD.

51
A B

Fig.24. Proteina coxD este asociată de membrană (panoul A) şi are o expresie


nicotin-dependentă (panoul B)
Am văzut în capitolul 2 că foarte multe dintre ATP-azele AAA+ sunt integrate sau
asociate cu membrane. Acest element, împreună cu faptul ca lanţul transportor al
electronilor este plasat la bacterii la nivelul membranei celulare face din această enzimă
un posibil candidat pentru fixarea enzimei cheie KDH, principalul donor de electroni din
această cale enzimatică, de membrana celulară. Această posibilitate ne-a îndemnat să
investigăm localizarea celulară a acestei enzime.
Pentru aceasta, 400 ml de cultură de Arthrobacter obţinuţi după modul descris
anterior au fost prelucraţi după cum urmează. Celulele recuperate prin centrifugarea au
resuspendat în 3 ml tampon de lucru şi deschise utilizând presa frenceză. Extractul total a
fost centrifugat pentru 30 minute la 4500 rpm pentru sedimentarea celulelor rămase
întregi şi a fragmentelor celulare mari. Supernatantul a fost apoi centrifugat la 40000
rpm pentru 2 ore în vederea separării membranelor de proteinele solubile. Depozitul
obţinut a fost apoi resuspendat în tampon de lucru conţinând 2% Triton. 25 micrograme
de proteine solubile respectiv extract membranar au fost încărcate pe un gel SDS-PAGE
12%. Acesta a fost prelucrat în vederea realizării transferului iar membrana decorată cu
anticorpi anti-coxD şi developată cu anticorpi anti-iepure cuplaţi cu peroxidază utilizând
sistemul NBT/indolil-fosfat.
După cum se poate vedea în figura proteina de interes a fost detectată atât în
fracţia de proteine solubile cât şi în cea conţinând proteine mebranare. Acest lucru este
comun pentru proteinele asociate de mebrane, care, în timpul prelucrării probei se pot

52
desprinde şi pot apare libere în membrane. De asemenea este posibil existenţa unui ciclu
funcţional al acestei proteine, în care aceasta se asociază de membrană pentru realizarea
rolului specific şi se desprinde după terminarea funcţiei.

4.6. Replierea in vitro a corpilor de incluziune şi purificarea parţială a proteinei


coxE

După cum am văzut în la punctul 4.1 a doua proteină de interes este exprimată în
E. coli sub formă insolubilă, fiind detectată în materialul celular insolubil rezultat în
urma centrifugării extractului total pentru 30 minute la 14500 rpm. Acest lucru ridică o
serie de probleme deoarece în această formă proteina nu este activă, testele privind
activitatea enzimatică fiind imposibil de realizat.
De aceea o abordare utilizată destul de frecvent o eventuală recuperare a activităţii
enzimatice este replierea in vitro. Deşi nu dă întotdeauna rezultat, această abordare a
problemei proteinelor insolubile a fost utilizată de un număr mare de autori, drept
dovadă fiind cele 431 proteine repliate cu recuperarea solubilităţii şi activităţii ce sunt
plasate în baza de date Refold http://refold.med.monash.edu.au/ (9). Elementul cheie este
determinarea condiţiilor specifice în care proteina se repliază cu refacerea activităţii
enzimatice, ţinând cont de faptul că acestea sunt dependente de proteină.
În cazul proteinei coxE, lipsa unui test funcţional pentru aprecierea nivelului de
recuperare a activităţii şi structurii secundare a fost impedimentul cel mai mare în
realizarea unui protocol clar de replire.
Chiar şi fără un asemenea test, am încercat abordarea acestei probleme în 2
moduri. Pe de o parte purificarea proteinei în stare denaturată urmată de repliere, pe de
altă parte replierea proteinei denaturante urmate de purificare.
În cazul primei abordări, purificarea s-a realizat în două moduri diferite. Într-un
prim mod am utilizat spălarea succesivă cu diferiţi detergenţi, urmând modul de lucru
prezentat la punctul 3.6. După ultima spălare materialul insolubil rezultat a fost
solubilizat în tampon de lucru conţinând uree 8M. Modul de evoluţie al fracţiilor
proteice poate fi observat în figura 25. Am întâmpinat numeroase dificultăţi de asemnea
în realizarea analizei fracţiilor proteice datorită conţinutului mare de uree ce interferă cu
separarea.

Fig. 25. Izolarea corilor de


incluziune conţinând proteina coxE
M- marker molecular de masă Sigma Wide
Range
2- material celular insolubile
2,3,4 – trei spălari succesive cu 4 M uree
triton 1%
5,6,7 – trei spălări succesive cu 4 M uree
S-dodecyl-maltozid 1%
8,9 – materialul solubilizat în 8M uree.

După cum se poate vedea, în cursul procesului de purificare, se pierde o cantitate


53
foarte mare din proteina de interes, în special prin spălările cu S-dodecyl-maltozid.
Această etapă nu a putut fi eliminată însă, deoarece acest detergent este singurul din cei
6 testaţi care solubilizează proteina dominată cu masa moleculară relativă de 36 kDa.
Proteina coxD purificată parţial obţinută a fost folosită pentru repliere în vitro prin
tehnica diluţiei. Volumul de 202 ml tampon de repliere obţinut prin diluarea celor 2 ml
soluţie proteică în 200 ml tampon au fost apoi trecuţi peste o coloană de Ni-sefaroză.
Lipsă proteinei la eluţia cu 200, 500 mM şi 1 M imidazol demonstrază că plierea s-a
realizat în aşa fel încăt capătul N-terminal conţinând coada poli-His nu mai este expus la
exterior, neputând interacţiona cu ionul de Ni2+.
O trăsătură importantă a acestei cozi este proprietatea de a-şi păstra afinitatea
chiar şi în condiţii denaturante. Am utilizat această proprietate pentru a uşura procesul de
purificare. Astfel materialul celular insolubil a fost solubilizat direct peste noapte în
tampon de lucru cu 8M uree şi încărcat pe o coloană de Ni-sepharoză. Utilizând metoda
de purificare prin IMAC descrisă în capitolul anterior cu precizarea că toate soluţiile
tampon au conţinut uree 8M, s-a reuşit purificarea printr-o singură etapă a coxE şi
obţinerea unui randament de recuperare mult mai mare. Fracţiile rezultate în urna eluţiei
cu 200 mM imidazol sunt prezentate în figura 17.

Fig. 26. Probele rezultate în urma


eluţiei cu 200 mM imidazol

Deşi gradul de puritate nu este la fel


de bun cu cel obţinut în cazul protinei coxD,
soluţia obţinută a fost utilizată pentru
obţinerea unui anticorp specific şi pentru
repliere prin tehnica diluţiei. Din păcate
aceasta s-a soldat cu acelaşi rezultat, proteina
pierzând capacitatea de a chelata ionul de Ni
şi nu a putut fi evidenţiată nici o activitate
proteazică pe substratul testat.

A doua abordare a procesului de repliere a constat în utilizarea tehnicii numite on


coulum refolding (repliere pe coloană), în care proteina este legată de Ni-sepharoză şi
apoi agentul denaturant este eliminat treptat prin crearea unui gradient descrescător.
Pentru aceasta, materialul insolubil a fost dizolvat în 5 ml tampon de lucru conţinând 6
M clorură de guanidină şi plasat în bucla de injectare a unui sistem cromatografic ÄKTA
basic. Programul rulat este cel descris la punctul 3.6. Profilul cromatogramei poate fi
observat în figura 26.

54
Fig.
26.
Aspe
ctul
unei
crom
atogr
ame
tipic
e
obţin
ute
în
cazul
repli
erii
in
vitro
a
proteinei coxE. Cu albastru este reprezentată evoluţia absorbanţei la 280 nm, cu verde
evoluţia concentraţiei soluţiei din intrarea B a pompei iar pe axa 0X este reprezentat
volumul în ml.
După cum se poate vedea din cromatogramă, aşa cum era de aşteptat majoritatea
proteinelor nu au afinitate faţă de Ni şi din aceste motive cad în primele etape de spălare
cu tampon de lucru. Probele 10, 11 şi 12 sunt cele care conţin proteinele ce au manifestat
afinitate faţă de ionul de nichel. Analiza electroforetică a fracţiilor 10 şi 11 poate fi
observată în figura 27.

Fig. 27. Electroforeigrama probelor 10 şi 11


rezultate în urma experienţelor de repliere pe coloană.
M-marker de masă Sigma
10, 11 – 25 micrograme proteină din probele 10,11
Control – 5 microg proteină purificată

55
După cum se poate observa, alături de o cantitate deosebit de redusă de coxE se
află şi un număr mare de alte proteine. Acest lucru era într-o oarecare măsură de aşteptat.
Sub formă denaturată toate proteinele expun resturi de histidină ce pot interacţiona cu
ionul de Ni. Aşadar, funcţie de numărul de resturi de His conţinute în secvenţă,
proteinele depliate se vor lega de coloană într-o manieră mai slabă sau mai puternică.
Deoarece următoarea etapă nu a constat în spălarea coloanei ci în repliere, aceasta s-a
făcut şi pentru proteinele balast fixate slab. În cursul acestui proces plierea a fost
influenţată şi de noile legături existente între resturile de His şi Ni. Prin modificarea
poziţiei spaţiale a resturilor de aminoacizi, este posibil ca această afinitate să fie
accentuată, realizându-se astfel în mod artificial un centru de coordonare a Ni la toate
proteinele încărcate pe coloană.
Proteina astfel obţinută a fost testată în vederea detectării activităţii proteazice pe
un substrat sintetic, specific serin-proteazelor. Nu a putut fi detectată însă o asemenea
activitate, 2 probleme rămânând fără răspuns: dacă proteina este corect pliată şi dacă
acesta este substratul corect.

56
Concluzii
Deşi analiza informaţiilor, atât a celor teoretice provenite din analiza secvenţei de
nucleotide a proteinelor coxD şi coxE, cât şi a datelor experimentale nu ne permit
formulăm o imagine clară privind rolul acestor 2 proteine în cadrul căii metabolice de
degradare a nicotinei, putem însă face o serie de observaţii referitoare la proprietăţile
celor 2 proteine.
Cele mai multe date sunt legate de proteina coxD, în principal datorită faptului că
aceasta a putut fi purificată. Astfel, despre această proteină putem spune că:
1. are o masă moleculară relativă de 34 kDa
2. este instabilă în soluţii precipitând la concentraţii mai mari de 0,3
micrograme/microL
3. în soluţii se asociază în complexe multimere, cel mai probabil prin realizarea unor
punţi disulfurice
4. are activitate ATP-azică comparabilă cu a unor proteine de şoc termic din E.coli,
produşii de reacţie fiind reprezentaţi din ADP şi P, şi într-o mică măsură de AMP
şi PP
5. o fracţiune este liberă în citosol, iar o altă fracţiune este fixată de membrană.
Aceasta poate fi o indicaţie a unui ciclu funcţional, în care pentru a realiza funcţia
este necesară fixarea de membrană.
6. expresia acestei enzime este dependente de nicotină
Principalul impediment în studiul proteinei coxE a constat în imposibilitatea de a
fi purificată în formă activă. Cu toate aceste o serie de observaţii pot fi făcute:
1. masa moleculară relativă este de 38 kDa
2. nivelul de expresie în E.coli este unul destul de bun, dar proteina nu este solubilă,
formând corpi de incluziune
3. proteina fost purificată în stare denaturată în cantităţi suficiente pentru a putea fi
folosită pentru obţinerea unui anticorp specific. Acesta lărgeşte foarte mult
spectrul de investigaţii ce pot fi realizate. Astfel trebuie avute în vedere pe viitor
realizarea unor experienţe de precipitare co-imună pentru a evidenţia existenţa
unor interacţiuni între KDH şi coxE sau anticorpul poate fi utilizat pentru
purificarea din Arthrobacter nicotinovorans a enzimei native.

57
Bibliografie
1. Artenie V. (1991), editura Univ. Al. I Cuza, Fac. de Biologie, Iaşi, 45-49, 285-296
2. Ausubel M.F., Brent R., Kingston E.R., Moore D.D.,Seidman J. G., Smith A. J., Struhl
K. (2002): Short Protocols in Molecular Biology, John Wiley & Sons
3. Baitsch D., Sandu C., Brandsch R., Igloi G.L., (2001): Gene Cluster on pAO1 of
Arthrobacter nicotinovorans Involved in Degradation of the Plant Alkaloid Nicotine:
Cloning, Purification, and Characterization of 2,6-Dihydroxypyridine 3-Hydroxylase.
Journal of Bacteriol, 183, 5262-5267.
4. Bernauer H., Mauch L., Brandsch R., (1992): Interaction of the regulatory protein
NicR1 with the promoter region of the pAO1-encoded 6-hydroxy-D-nicotine oxidase
gene of Arthrobacter oxidans. Molecular Microbiology, 6, 1809-1820.
5. Berthold H, Scanarini M, Abney C.C., Frorath B, Northemann W. (1992): Purification
of recombinant antigenic epitopes of the human 68-kDa (U1) ribonucleoprotein antigen
using the expression system pH6EX3 followed by metal chelating affinity
chromatography. Protein Expression and Purification, 3, 50-56.
6. Borodina Elena, Donovan P. K. , Schumann P., Rainey A. F., Ward-Rainey L. N.,
Wood P. A., (2002): Enzymes of dimethylsulfone metabolism and the phylogenetic
characterization of the facultative methylotrophs Arthrobacter sulfonivorans sp. nov.,
Arthrobacter methylotrophus sp. nov., and Hyphomicrobium sulfonivorans sp. nov.,
Arch. Microbiol, 177, 173-183.
7. Brandsch R., Decker K., (1984): Isolation and partial characterization of plasmid DNA
from Arthrobacter oxidans. Arch Microbiol, 138, 15-17.
8. Brandsch R. (2006): Microbiology and biochemistry of nicotine degradation. Appl.
Microbiol. Biotechnol, 69, 493-498.
9. Buckle M. Ashley, Devlin L. G., Jodun A. Rachel, Fulton F. Kate, Faux N., Whisstock
C. J., Bottomley P. S. (2005): The matrix refolded. Nature Methods, 2, 3.
10. Câmpeanu M. Mirela, Câmpeanu S. C., Băra I. I., ADN-recombinant, editura Corson,
Iaşi
11. Chiribau B. C., Sandu C., Fraaije Marco, Schiltz E., Brandsch R., (2004): A novel ɣ-N-
methylaminobutyrate demethylating oxidase involved in the catabolism of the tobacco
alkaloid nicotine by Arthrobacter nicotinovorans pAO1. Eur. J. Biochem, 271, 4677-
4684.
12. Chiribau C. B., Sandu C., Igloi G. L., Brandsch R., (2005): Characterization of PmfR,
the transcriptional activator of the pAO1-borne purU-mabO-folD operon of
Arthrobacter nicotinovorans. Journal of Bacteriol, 187, 3062-3070.
13. Chiribau C.B., Mihasan M., Ganas P., Igloi G. L., Artenie V., Brandsch R., (2006):
Final steps in nicotine dgradation. Deamination versus demethylation of gamma-N-
methylaminobutyrate. FEBS J, 273, 1528-1526.
14. Cojocaru D. C., Sandu Mariana, (2004): Biochimia proteinelor şi acizilor nucleici,
editura PIM, Iaşi,
15. Creighton E. Thomas (1999): Encyclopedia of Molecular Biology, John Wiley & Son,
Inc.

58
16. Cuff J.A., B. G. (2000): Application of multiple sequence alignment profiles to improve
protein secondary structure prediction. Proteins, 40, 502-511.
17. Delcher L. A., Harmon D., Kasif S., White O., Salzberg L. S. (1999): Improved
microbial gene identification with GLIMMER. Nucleic Acids Res, 27, 4636-4641.
18. Finn D. Robert, Mistry Jaina, Schuster-Beckler B., Griffiths-Jones S., Hollich V.,
Lassmann T., Moxon S., Marshall M., Khanna A., Durbin R., Eddy R. S., Sonnhammer
E., Bateman A., (2006): Pfam: calns,web tools and services. Nucleic Acids Res, 34,
d247-d251.
19. Freudenberg W., Konig K., Andreesen R. J., (1988): Nicotine dehydrogenase from
Arthrobacter oxidans: A molybdenum-containing hydroxylase. FEMS. Microbiol.
Letters, 52, 13-18.
20. Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins M.R., Appel R.D., Bairoch
A. (2005): The Proteomics Protocols Handbook, Human Press
21. Gherna L. Robert, Richardson S. H., Rittenberg C. S., (1965): The Bacterial Oxidation
of Nicotine VI. The Metabolism of 2,6-Dihydroxypseudooxynicotine. The Journal of
Biological Chemistry, 240, 3669-3673.
22. Guse Annika, Stevenson E. M. Clare, Kuper J., Buchanan G., Schwarz G., Giordano
G., Magalon A., Mendel R. R., Lawson M. D., Palmer T. (2003): Biochemical and
Structural Analysis of the Molybdenum Cofactor Biosynthesis Protein MobA. The
Journal of Biological Chemistry, 278, 25302-25307.
23. Hames B. D., (1999): Protein Expression - A Practical Approach, Oxford University
Press
24. Hanson I. P. (2005): AAA+ proteins: have engine, will work. Nature Reviews -
Molecular Cell Biology, 6, 519-529.
25. Harlow E., (1988): Antibodies: A Laboratory Manual,, Cold Spring Harbor Laboratory,
New-York
26. Hochstein L. I., Rittenberg C. Sydney, (1958): The Bacterial Oxidation of Nicotine II.
The Isolation of the first oxidative product and its identification as (l)-6-
hidroxynicotine. J. Biol. Chem, 234, 156-161.
27. Hochstein L. I., Sydney C. Rittenberg, (1958): The Bacterial Oxidation of
Nicotine I. nicotine oxidation by cell-free preparations. J Biol. Chem, 234, 151-155.
28. Hofmann, K., Bucher, P., Falquet, L.,Bairoch, A. (1999): The PROSITE database, its
status in 1999. Nucleic Acids Research, 257, 215-219.
29. Holmes E. Paul, Rittenberg C. Sydney, (1972): The bacterial oxidation of nicotine. VII.
Partial purification and properties of 2,6-dihydroxypyridine oxidase. The Journal of
Biological Chemistry, 247, 7628-7633.
30. Holmes P.E., Rittenberg S.C., Knackmuss H.J., (1972): The bacterial oxidation of
nicotine. 8. Synthesis of 2,3,6-trihydroxypyridine and accumulation and partial
characterization of the product of 2,6-dihydroxypyridine oxidation. J. Biol. Chem, 1972,
23.
31. Igloi G.L., Brandsch R., (2003): Sequence of the 165-kilobase catabolic plasmid pAO1
from Arthrobacter nicotinovorans and identification of a pAO1-dependent nicotine
uptake system. J Bacteriol, 185, 1976-86.
32. Khan R. H., Appa Rao K. B, Eshwari A. N. S., Totey, S. M., Panda A. K. (1998):
Solubilization of Recombinant Ovine Growth Hormone with
Retention of Native-like Secondary Structure and Its Refolding from
the Inclusion Bodies of Escherichia coli. Biotechnol. Prog., 14, 722-728.
33. Kimb Yong-In, Levchenko I., Fraczowska Karolina, Woodruff V. Rachel, Sauer T. R.,
Baker A. Tania (2001): Molecular determinants of complex formation between
Clp/Hsp100 ATP-ases and Clp peptidase. Nature Structural Biology, 8, 230-233.

59
34. Kodama Y., Yamamoto H., Amano N., Amachi T., (1992): Reclassification of two
strains of Arthrobacter oxydans and proposal of Arthrobacter nicotinovorans sp. nov.
Int J Syst Bacteriol, 42, 234-239.
35. Kouhei T., Daisuke E., Izumi K., Tsutomu A. (2003): Practical considerations in
refolding proteins from inclusion bodies. Protein Expression and Purification, 28, 1-8.
36. Lawrence I. Hochstein, Rittenberg C.Sydney , (1958): The Bacterial Oxidation of
Nicotine III. The isolation and identification of 6-hidroxypseudooxynicotine. Journal of
Biological Chemistry, 234, 156-160.
37. Lee Jung-Sook, Lee Keun Chul, Pyun Yu-Ryang, Bae Kyung Sook, (2003):
Arthrobacter koreensis sp. nov., a novel alkalitolerant bacterium from soil. International
Journal of Systematic and Evolutionary Microbiology, 53, 1277-1280.
38. Lewin B. (2004): Genes VII, Pearson Prentice Hall
39. Llamas A., R Mendel R., Schwarz G. (2004): Synthesis of Adenylated Molybdopterin an
essential step for molibdenum insertion. The Journal of Biological Chemistry, 279,
55241-55246.
40. Loveland-Curtze Jennifer, Sheridan P. P., Gutshall R. K., Brenchley E. Jean, (1999):
Biochemical and phylogenetic analyses of psychrophilic isolates belonging to the
Arthrobacter subgroup and description of Arthrobacter psychrolactophilus, sp. nov.
Arch Microbiol, 355-363.
41. Malphettes Laetitia, Weber C. Cornelia, El-Baba Marie D., Schoenmakers G. R., Aubel
Dominique, Weber W., Fussenegger M., (2005): A novel mammalian expression system
derived from components coordinating nicotine degradation in arthrobacter
nicotinovorans pAO1. Nucleic Acids Research, 33, .
42. Marchler-Bauer A., Bryant S.H., (2004): CD-Search: protein domain annotations on the
fly. Nucleic Acids Res, 32, 327-331.
43. McGinnis S., Madden L. T., (2004): BLAST: at the core of a powerful and diverse set of
sequence analysis tools. Nucleic Acids Research, 32, w21-w25.
44. Megharaj M., Avudainayagam S., Naidu R., (2003): Toxicity of Hexavalent Chromium
and Its Reduction by Bacteria Isolated from Soil Contaminated with Tannery Waste.
Current Microbiology, 47, 51-54.
45. Menendez C., Igloi G.L., Brandsch R., (1997): IS1473, a putative insertion sequence
identified in the plasmid pAO1 from Arthrobacter nicotinovorans: isolation,
characterization, and distribution among Arthrobacter species. Plasmid, 37, 35-41.
46. Menendez C., Otto A., Igloi G., Nick P., Brandsch J. R., Schubach B., Bottcher B.,
Brandsch R., (1997): Molybdate uptake genes and mlybdopterin biosynthesis genes on a
bacterial plasmid: characterization of MoeA as a filament-forming protein with ATP-ase
activity. Eur. J. Biochem, 250, 524-531.
47. Menendez C., Siebert D., Brandsch R., (1996): MoaA of Arthrobacter nicotinovorans
pAO1 involved in Mo-Pterin cofactor synthesis is an Fe-S protein. FEBS Letters, 391,
101-103.
48. Menendez C., Otto Annegret, Igloi G., Nick P., Brandsch R., Schubach B., Battcher
Bettina, Brandsch R., (1997): Molybdate-uptake genes and molybdopterin-biosynthesis
genes on a bacterial plasmid Characterization of MoeA as a filament-forming protein
with adenosinetriphosphatase activity. FEBS J, 250, 524-531.
49. Porath E., Carlosson Jan, Olsson I., Greta Belfrage (1975): Metal chelate affinity
chromatography, a new approach to protein fractionation. Nature, 258, 598-599.
50. Reddy G.S.N., Aggarwal R .K., Matsumoto G.I., Shivaji S., (2000): Arthrobacter flavus
sp. nov., a psychrophilic bacterium isolated from a pond in McMurdo Dry Valley,
Antarctica. International Journal of Systematic and Evolutionary Microbiology, 50,
1553-1561.

60
51. Richardson S. H., Rittenberg C. S., (1961): The bacterial oxidation of nicotine. IV. The
isolation and identification of 2,6-dihydroxy-N-methylmyosmine. The Journal of
biological chemistry, 236, 959-963.
52. Rohrwild M., Coux O., Huang H.-C., Moerschell P. R., SOON JI YOO,
Seol Jae E H.,Chung C. H., Goldberg L.A. (1996): HslV–HslU: A novel ATP-
dependent protease complex in
Escherichia coli related to the eukaryotic proteasome. Proc. Natl. Acad. Sci, 93, 5808-
5813.
53. Rowland S.J., Dyke K.G., (1990): Tn552, a novel transposable element from
Staphylococcus aureus. Mol Microbiol, 4, 961-975.
54. Sachelaru P., Schiltz E., Brandsch R., (2006): A functional mobA gene for
molybdopterin cytosine dinucleotide cofactor biosynthesis is required for activity and
holoenzyme assembly of the heterotrimeric nicotine dehydrogenases of Arthrobacter
nicotinovorans. Appl Environ Microbiol, 72, 5216-5231.
55. Salzberg L. Steven, Delcher L. Arthur, Kasif Simon, White Owen, (1998): Micobial
gene identification using interpolated Markov models. Nucleic Acids Res, 26, 544-548.
56. Sambrook J., Fritsch E.F., Maniatis T. (1989): Molecular Cloning - A Laboratory
Manual, Cold Spring Harbour Laboratory Press
57. Sambrook J., Fritsh E.F., Maniatis T. (1989): Molecular Cloning - A laboratory manual,
Cold Spring Harbor Laboratory Press
58. Sandu C., Chiribau C. B., Sachelaru P., Brandsch R., (2005): Plasmids for Nicotine-
Dependent and -Independent Gene Expression in Arthrobacter nicotinovorans and
Other Arthrobacter Species. Appl Environ Microbiol, 71, 8920-8924.
59. Sandu C., Chiribau B. C., Brandsch R., (2003): Characterization of HdnoR, the
transcriptional repressor of the 6-hydroxy-D-nicotine oxidase gene of arthrobacter
nicotinovorans pAO1, and its DNA-binding activity in response to L- and D-nicotine
derivatives. The Journal of Biological Chemistry, 278, 51307-51315.
60. Schube U, Kraut M, Morsdorf G, Meyer O. (1995): Molecular characterization of the
gene cluster coxMSL encoding the molybdenum-containing carbon monoxide
dehydrogenase of Oligotropha carboxidovorans., J. Bacteriol, 177, 2197-2203.
61. Streips N. Uldis, Yasbin E.Ronal, (2003): Modern microbial genetics, John Willey and
sons
62. Gottesman Susan, William P. C., (1990): The ATP-dependent Clp Protease of
Escherichia coli-sequence of clpA and identification of a Clp-specific substrate. The
Journal of Biological Chemistry, 265, 7666-7693.
63. Tamas V., Posfai J., Robertsa J. R. (2003): NEBcutter: a program to cleave DNA with
restriction enzymes. Nucleic Acids Res., 31, 3688-3691.
64. Terpe K. (2003): Overview of tag protein fusions:
from molecular and biochemical fundamentals to commercial systems. Appl Microbiol
Biotechnol, 60, 523-533.
65. Toshiaki F., Tomohiro E., Haruyuki A., Tadayuki I. (2002): A Membrane-Bound
Archaeal Lon Protease Displays ATP-Independent Proteolytic Activity towards
Unfolded Proteins and ATP-Dependent Activity for Folded Proteins. Journal of
Bacteriology, 184, 3689-3698.
66. Wauters G., Charlier Jacqueline, Janssens Michele, Delmee M., (2000): Identification
of Arthrobacter oxydans, Arthrobacter luteolus sp. nov., and Arthrobacter albus sp.
nov., Isolated from Human Clinical Specimens. Journal of Clinical Microbiology, 2412-
2425.
67. Westerberg Karolina, Elvang M. Annelie, Stackebrandt E., Jansson K. Janet, (2000):
Arthrobacter chlorophenolicus sp. nov., a new species capable of degrading high

61
concentrations of 4-chlorophenol. International Journal of Systematic and Evolutionary
Microbiology, 2083-2092.
68. Wheeler L .D., şi colab, (2006): Database sesources of the National Center for
Biotechnology Information. Nucleic Acids Res, 34, D173-D180.
69. Yoshiaki K., Nagatoshi F., Takashi N., Hongsheng Liu Xinxiang, Huang Kazuo K.,
Takayuki Ying L., (2004): Rothia aeria sp. nov., Rhodococcus baikonurensis sp. nov.
and Arthrobacter russicus sp. nov., isolated from air in the Russian space laboratory
Mir. International Journal of Systematic and Evolutionary Microbiology, 54, 827-835.

62