Sunteți pe pagina 1din 1

atggcaagcctacgaaaaacacaccccctcattaaaatcgctaatgacgcactagttgacctacccacaccatccaacatttcagcatgatgaaa

ctttggctctctactaggattatgcttaattactcaaattctaaccggcctatttctagctatacattacacctcagacatttca

atggcaagcctacgaaaaacacaccccctcattaaaatcgctaatgacgcactagttgacctacccacaccatccaacatttcagcatgatgaaa
ctttggctctctactaggattatgcttaattactcaaattttaaccggcctatttctagctatacattacacctcagacatttca

atggcaagcctacgaaaaacacaccctctcattaaaatcgctaacgacgcactagttgacctaccaacaccatccaacatctcagcatgatgaa
actttggatccctcctaggactatgcttaattacccaaattttaaccggcctattcctagccatacactacacctcagacatctca

atggcaagcctacgaaaaacacaccccctcattaaaatcgctaatgacgcactagttgacctacccacaccatccaacatttcagcatgatgaaa
ctttggctctctactaggattatgcttaattactcaaattctaaccggcctatttctagctatacattacacctcagacatttca

atgaccccaatacgcaaaactaaccccctaataaaattaattaaccactcattcatcgacctccccaccccatccaacatctccgcatgatgaaac
ttcggctcactccttggcgcctgcctgatcctccaaatcaccacaggactattcctagccatgcactactcaccagacgcctca

1. Cuantificați lungimea segmentelor


2. Identificați frecvența bazelor azotate purinice și pirimidinice
3. Identificați rapoartele bazelor azotate A+G/C+T
4. Identificați coeficientul de specificitate dat de raportul A+T / G+C
5. Identificați numărul codonilor
6. Considerând catenele prezentate ca fiind 5’- 3’, identificați:
a. Structura catenelor complementare de ADN
7. Identificați numărul aminoacizilor codificați
8. Aliniați secvențele
9. Marcați diferențele existente între secvențe
10. Identificați numărul, poziția și tipul mutațiilor existente între cele 5 secvențe
11. Identificați frecvența diferitelor tipuri de mutații
12. Identificați poziția din cadrul codonului care prezintă cele mai multe mutații
13. Care vor fi structurile primerilor pentru amplificarea prin PCR a secvenței cuprinse între
pozițiile 71 – 100?
14. Identificați procentele de similaritate și divergență pentru cei 5 indivizi
15. Identificați gena si specia pentru care fragmentele prezintă o identitate maximă