Sunteți pe pagina 1din 30

UNIVERSITATEA DE STAT DIN MOLDOVA FACULTATEA BIOLOGIE ȘI PEDOLOGIE

Cu titlu de manuscris

C.Z.U.:581.8:575.:633.854.78:582.952.6

ROTARENCO VICTORIA

ASPECTE MORFO-FIZIOLOGICE ŞI GENETICE DE INTERACŢIUNE GAZDĂ-PARAZIT (HELIANTHUS ANNUUS L. - OROBANCHE CUMANA WALLR.)

03.00.12. – FIZIOLOGIE VEGETALĂ

Autoreferatul tezei de doctor în biologie

CHIŞINĂU, 2010

Teza a fost elaborată în laboratorul Securitate Biologică, catedra Biologie Vegetală, Universitatea de Stat din Moldova şi laboratorul Genomica, Centrul de Cercetare Biologie Moleculară, Universitatea Academiei de Ştiinţe a Moldovei.

Conducător ştiinţific:

Duca Maria, dr. hab. biol., prof. univ., m. cor. al AŞM

Referenţi oficiali:

Dascaliuc Alexandru, dr. hab. în biol., prof. univ., Institutul de Genetică şi Fiziologie a Plantelor, AŞM Druţă Ala, dr. în biol., conf. univ., Universitatea Agrară de Stat din Moldova

Componenţa consiliului ştiinţific specializat:

Şişcanu Gheorghe – preşedinte, dr. hab. biol., prof. univ., academician

Ştefârţă Anastasia – secretar ştiinţific, dr. hab. biol., prof. cercet.

Balaur Nicolae dr. hab. biol., prof. univ., m. cor. al AŞM

Derendovskaia Antonina dr. hab. agr., prof. univ.

Chirilov Alexandru dr. biol.

Susţinerea va avea loc la „_30_

specializat DH 10.03.00.12 05, din cadrul Institutului de Genetică şi Fiziologie a Plantelor, al Academiei de Ştiinţe a Moldovei, adresa: MD-2002, str. Pădurii 20, Chişinău, tel.: (373 22) 77 04 47, fax: (373 22) 55 61 80

2010, ora 10 00 în şedinţa Consiliului ştiinţific

septembrie_

Teza de doctor şi autoreferatul pot fi consultate la biblioteca Institutului de Genetică şi Fiziologie a Plantelor şi la pagina web a C.N.A.A. (www.cnaa.md).

Autoreferatul a fost expediat la „ 20 august 2010.

Secretar ştiinţific al Consiliului ştiinţific specializat, Ştefîrţă Anastasia, dr. hab. biol., prof. cercet.

Conducător ştiinţific, Duca Maria, m. cor. al AŞM, dr. hab. biol., prof. univ.

Autor Rotarenco Victoria

2

, Duca Maria, m. cor. al AŞM, dr. h ab. biol., prof. univ. Autor Rotarenco Victoria
, Duca Maria, m. cor. al AŞM, dr. h ab. biol., prof. univ. Autor Rotarenco Victoria

Rotarenco Victoria, 2010)

REPERELE CONCEPTUALE ALE CERCETĂRII Actualitatea temei. Problema rezistenţei şi receptivităţii plantelor la boli, în complexul aspectelor sale, rămâne a fi o prerogativă importantă în cercetările biologice. Interacţiunea dintre agentul patogen şi gazdă este într-o strânsă dependenţă de particularităţile fiziologice ale parazitului (afinitate, agresivitate şi virulenţă), de caracteristicile plantei gazdă (rezisten ţă nespecifică, specifică şi indusă), precum şi de acţiunea factorilor de mediu [8, 12]. Cunoaşterea mecanismelor morfo-fiziologice şi moleculare de acţiune şi reacţiune pe parcursul stabilirii raporturilor parazitare va permite amelioratorilor valorificarea eficientă a potenţialului genetic cu rezistenţă sporită în crearea noilor soiuri şi hibrizi de culturi agricole. Descrierea situaţiei în domeniu şi identificarea problemelor de cercetare. Floarea- soarelui este una dintre principalele plante oleaginoase cultivate în Republica Moldova, cu un spectru larg de utilizare în sectorul alimentar şi industrial, contribuind astfel la soluţionarea mai multor probleme de valoare economică [3, 4]. În legătură cu frecventele acţiunii nefavorabile ale factorilor de mediu recolta culturilor agricole, inclusiv cea a florii-soarelui, este compromisă sub aspect cantitativ, dar şi calitativ. În contextul vizat, cercetările cu privire la rezistenţă florii- soarelui la lupoaie (Orobanche cumana Wallr.) reprezintă un obiectiv de actualitate. Acţiunea acestui agent patogen s-a extins în special în zonele centrale şi de Sud-Est ale Republicii Moldova [3]. Atacul florii-soarelui de lupoaie este deseori devastator, determinând scăderi semnificative ale producţiei şi calităţii uleiului. Astfel, în Europa de Est şi de Sud au fost înregistrate pierderi economice de 50-90% [10, 28]. De aceea, în ultimele decenii au luat o amploare deosebită cercetările privind interacţiunea gazdă-parazit şi elaborarea metodelor de combatere a lupoaiei. Elucidarea mecanismelor moleculare ce determină relaţiile existente dintre planta-gazdă şi parazit ar contribui la facilitarea procesului de selecţie a formelor rezistente, ceea ce reprezintă la moment una dintre preocupările de bază ale cercetătorilor din domeniul ameliorării florii- soarelui. Scopul prezentei lucrării constă în evidenţierea unor particularităţi morfo-fiziologice şi genetice ce determină relaţia gazdă - parazit în baza sistemului model Helianthus annuus L. Orobanche cumana Wallr. Obiectivele de cercetare:

evaluarea gradului de atac al genotipurilor de H. annuus în condiţiile infectării artificiale cu O. cumana.;

studiul nivelului de rezistenţă fenotipică a diferitor genotipuri de floarea-soarelui expuse acţiunii parazitului;

3

identificarea și analiza moleculară a genei Or5 la 53 genotipuri homo- şi heterozigote de H. annuus;

evidenţierea unor secvenţe nucleotidice şi proteice implicate în reacţia de răspuns la acţiunea fitoparazitului O. cumana. Metodologia cercetării ştiinţifice. Asigurarea metodologiei cercetărilor ştiinţifice s-a realizat în baza concepţiilor şi principiilor expuse în lucrările: Laemmli U. (1970), Mullis K. (1983), Доспехов Б.А. (1985), Doyle J. (1990), Duca M. (2001), Reva V. (2001). În studiu, de asemenea, au fost utilizate metode bioinformatice cu investigarea bazelor de date ale portalului NCBI şi ExPASy şi utilizarea programelor BLAST, Clustal W şi Compute pI/Mw. Noutatea şi originalitatea ştiinţifică. S-au efectuat cercetări complexe - morfologice, fiziologice, biochimice şi genetico-moleculare asupra diferitor genotipuri de floarea-soarelui cultivate în Republica Moldova la acţiunea fitoparazitului O. cumana. Analiza comparată a screening-ului molecular şi morfologic a permis să constatăm, că populaţia de lupoaie utilizată în cercetare reprezintă o rasă mai virulentă decât rasa E. S-a identificat şi analizat secvenţa genică amplificată - markerul RTS05, regiune asociată cu gena rezistenţei (Or5) la rasa E, fiind constatat un nivel de omologie de 86% cu gena care codifică precursorul proteinei-inhibitor al poligalacturonazei, astfel fiind adusă o nouă contribuţie în elucidarea mecanismului de rezistenţă a florii-soarelui la rasa E de lupoaie. Semnificaţia teoretică. Rezultatele obţinute referitor la afinitatea, agresivitatea şi virulenţa fitoparazitului, precum şi la rezistenţa specifică şi nespecifică a florii-soarelui, contribuie cu noi informaţii în explicarea mecanismului de interacţiune gazdă-parazit la nivel pre-haustorial şi post-haustorial. Valoarea aplicativă a lucrării. S-a constatat că, zece genotipuri de floarea-soarelui (FS9, FS12, FS17, FS21, FS26, FS27, ASC1, Alcazar F 1 , Favorit F 1 , Turbo F 1 ) din cele 53 analizate au manifestat rezistenţă la atacul parazitului, cinci au prezentat toleranţă (FS4, FS8, FS11, ASC2, Xenia ♂), iar treizeci şi opt au fost susceptibile (FS1, FS2, FS3, FS5, FS6, FS7, FS10, FS13, FS14, FS15, FS16, FS18, FS19, FS20, FS22, FS23, FS24, FS25, ASC3, ASC4, ASC5, ASC6, ASC7, ASC8, ASC9, ASC10, ASC11, Olea F 1 , Oxana F 1 , Performer F 1 , Drofa ♀, Drofa ♂, Drofa F 1 , Valentino ♀, Valentino ♂, Valentino F 1 , Xenia ♀, Xenia F 1 ). Temperaturile ridicate din sol (21°C - 30°C comparativ cu 8°C - 17°C) şi atmosferă (23°C - 31°C comparativ cu 10°C - 18°C) sporesc gradul de infectare cu 8 - 30%. Rezultatele ştiinţifice principale înaintate spre susţinere.

Analiza PCR-SCAR demonstrează prezenţa genei Or5 la 47 dintre cele 53 genotipuri analizate;

4

Izolarea şi secvenţierea fragmentului de 650 pb, asociată cu prezenţa genei Or5, manifestă o similaritate de 86% cu gena care codifică precursorul proteinei-inhibitor al poligalacturonazei;

Screening-ul morfologic şi molecular demonstrează o reacţie diferită la nivelul sistemului radicular afectat de către lupoaia colectată din sudul Republicii Moldova, date care relevă că populaţia de O. cumana utilizată în cercetare este mai agresivă decât rasa E;

Utilizarea programelor bioinformatice a permis identificarea unor secvenţe nucleotidice şi proteine (D-α–fosfolipaza, glucan sintaza; metionin sintaza; glutation S-transferaza; quinon oxidoreductaza; calcon sintaza şi defensina HaDEF1) potenţial implicate în reacţia nespecifică de răspuns la acţiunea fitoparazitului;

Spectrele SDS-PAGE la nivelul sistemului radicular şi foliar se caracterizează prin biosinteza timpurie (68,5; 70,3 şi 111,0 kDa) şi intensificarea expresiei (11,3; 12,0; 16,5; 21,0; 33,8 şi 35,5 kDa) unor polipeptide pe fondal de infecţie. Implementarea rezultatelor ştiinţifice. Lucrarea în ansamblul ei constituie un suport de referinţă în ameliorarea şi cultivarea genotipurilor respective. De asemenea, reprezintă un material ştiinţifico - didactic în predarea cursurilor de Fiziologie vegetală, Genetică, Ecofiziologie şi Adaptabilitatea plantelor. Aprobarea rezultatelor ştiinţifice. Rezultatele investigaţiilor au fost prezentate şi discutate la: Conferinţa Ştiinţifică Internaţională „Învăţământul superior şi cercetarea – piloni ai societăţii bazate pe cunoaştere” (Chişinău, USM, 28 septembrie 2006); Conferinţa Internaţională a Tinerilor Cercetători dedicată aniversării a 60 ani ai AŞM (Chişinău, 15 noiembrie, 2006); Conferinţa Internaţională a Tinerilor Cercetători, ediţia VI (Chişinău, 6 - 7 noiembrie, 2008). Cercetările au fost realizate în cadrul proiectului instituţional 06.407.026 F (AŞM, Republica Moldova) şi două proiecte internaţionale BPP-04-06 (CRDF/MRDA, SUA) şi MERL- 1300 (CRDF/MRDA, SUA) Publicaţii la tema tezei. Rezultatele investigaţiilor sunt reflectate în 12 lucrări ştiinţifice (inclusiv 3 fără coautori), 5 articole în reviste recenzate, 4 în culegeri naţionale şi 3 în materiale ale comunicărilor ştiinţifice. Volumul şi structura tezei. Rezultatele cercetărilor efectuate sunt expuse în cinci capitole ale tezei cu volumul total de 128 pagini dactilografiate. Lucrarea conţine 336 titluri bibliografice, 20 tabele, 41 figuri. Cuvintele-cheie: Helianthus annuus L., Orobanche cumana Wallr., gazdă-parazit, rezistenţă, markeri moleculari.

5

CONŢINUTUL TEZEI

1. ASPECTE PRIVIND INTERACŢIUNEA GAZDĂ-PARAZIT

HELIANTHUS ANNUUS L. - OROBANCHE CUMANA WALLR.

detaliată

particularităţile morfo-fiziologice şi genetice de acţiune a parazitului O. cumana, metodele de

combatere a lupoaiei; tipurile de rezistenţă şi mecanismele reacţiei de răspuns a plantelor la

acţiunea agentului patogen; genele de rezistenţă la plante, etc. Datele relatate în teză

argumentează actualitatea studiului interacţiunii gazdă-parazit pe exemplul florii-soarelui şi

lupoaiei.

la

Compartimentul

conţine

analiza

a

surselor

bibliografice

referitor

2. OBIECTUL ŞI METODELE DE CERCETARE

Material de studiu. În calitate de obiect de cercetare au servit 53 genotipuri de floarea-

soarelui, inclusiv trei hibrizi şi liniile parentale ale acestora (Drofa, Valentino şi Xenia), 11 linii

cu androsterilitate citoplasmatică (ASC1 - ASC11), şase hibrizi F 1 (Olea, Oxana, Performer,

Alcazar, Favorit, Turbo,) şi 27 genotipuri de perspectivă (FS1 - FS27), oferite de dr. hab.

T. Rotaru, Centrul de Cercetări Ştiinţifice AMG-Magroselect SRL, or. Soroca.

Condiţii de cultivare. Plantele de floarea-soarelui au fost cultivate în vase de vegetaţie cu

capacitatea de 0,2; 1,0 şi 10,0 kg, în care s-a introdus mixtura de sol (nisip : turbă, v/v) uniform

infectată cu seminţe de lupoaie (30 - 40 mg seminţe la 200 g amestec) [7]. Precondiţionarea

seminţelor de lupoaie s-a realizat timp de 7 zile, după care au fost plantate seminţele de floarea-

soarelui, germinate preventiv în cutii Petri, timp de 2 zile. După 14 - 15 zile, plantulele au fost

transferate în vase cu un volum de 1,0 kg, care au fost expuse în camera de cultivare, la două

regimuri de temperatură: I - 15°C / 13°C (temperatura medie atmosferică/sol); II - 28°C / 25°C.

Cultivarea în vase de vegetaţie cu capacitatea de 10 kg a fost realizată fără precondiţionare.

Tempretaura medie atmosferică în lunile aprilie iulie, 2009 a constituit 16,5; 20,5; 26,5 şi

28,7 ºC respectiv [38].

Metode de cercetare. În scopul realizării sarcinilor propuse s-au utilizat metode de analiză

a indicilor morfo-fiziologici [1], izolarea proteinelor sumare [2], electroforeza proteinelor în

prezenţa SDS [22], analiza proteinelor prin tehnologia Protein LabChip în conformitate cu

protocolul propus de producător [26], izolarea ADN-ului [14], identificarea prezenţei genei Or5

prin analiza PCR - SCAR [27]. Studiul bioinformatic al secvenţelor de gene s-a realizat cu

utilizarea programelor BLAST, Clustal W [35, 36], Compute pI/Mw [37]. Prelucrarea statistică

s-a efectuat în baza următorilor parametrilor statistici: X – media aritmetică; σ – deviaţia

standard; V – coeficient de variaţie (%); mx eroarea mediei; Smx % – eroarea totală [6].

6

3. EVALUAREA FENOTIPICĂ A PROCESULUI DE INFECTARE CU O. CUMANA LA DIFERITE GENOTIPURI DE FLOAREA-SOARELUI Procesele morfo-fiziologice depind, în mare măsură de reacţia de răspuns a plantei la condiţiile nefavorabile ale mediului şi de capacitatea de adaptare la factorii de stres. Aspectul fenotipic al plantelor de floarea-soarelui infectate cu O. cumana reprezintă ultima verigă în lanţul de răspuns al plantei-gazdă la acţiunea patogenului şi este relevantă în evaluarea gradului de atac şi manifestarea rezistenţei. Acţiunea O. cumana este condiţionată de afinitatea, agresivitatea şi virulenţa agentului patogen.

3.1. Dinamica dezvoltării fitoparazitului

Rezultatele cercetărilor efectuate demonstrează un nivel înalt de afinitate a lupoaiei faţă de planta-gazdă, precum şi toleranţa florii-soarelui faţă de agentul respectiv. Astfel, analiza dezvoltării ontogenetice gazdă – parazit, realizată în decursul a şasezeci zile, precum şi studiul minuţios al sistemului radicular la finalul experienţei a permis evidenţierea mai multor stadii de dezvoltare a O. cumana: ataşamente, tuberculi, tuberculi cu rădăcini adventive, lăstari subterani şi aerieni (fig. 3.1.).

A
A
E
E
B
B
F
F
C
C
G
G
D
D
H
H

Fig. 3.1. Dezvoltarea O. cumana pe rădăcinile de H. annuus:

A – germinarea seminţei, B – ataşarea, C, D – tuberculi, E tuberculi cu rădăcini adventive şi lăstari subterani, F – lăstari aerieni, C, G, H – tuberculi necrotizaţi.

După germinarea seminţelor de lupoaie în experienţe model cu exsudate radiculare de floarea-soarelui, se formează un filament subţire - apresorium (fig. 3.1., A), a cărui extremitate radicală aderă la rădăcina plantei-gazdă formând ataşamentele (fig. 3.1., B). Primele ataşamente au fost constatate după 15 zile de cultivare la liniile parentale ale hibrizilor Xenia şi Valentino (cele mai multe, atestându-se la linia maternă Valentino), lipsind la

7

genotipurile heterozigote. Ataşamentele se dezvoltă şi se îngroaşă, luând forma unui bulb - tuberculi (fig. 3.1., C, D). Din tuberculi, în interiorul plantei-gazdă cresc celule haustoriale în formă de hife, care străbat zona corticală pătrunzând în fasciculele vasculare ale plantei-gazdă, iar la exterior – se dezvoltă rădăcini adventive şi muguri (fig. 3.1., E), care se alungesc şi străbat solul ieşind la suprafaţă, formând tulpina floriferă a parazitului (fig. 3.1., F) . Tuberculii, inclusiv cei cu rădăcini adventive au apărut iniţial după 30 zile de cultivare, fiind constataţi în număr maxim la hibridul Xenia şi linia paternă a hibridului Valentino. Începând cu perioada de 40 zile pe radăcinile genotipurilor cercetate au fost observaţi lăstari subterani, care prevalau la formele parentale a hibridului Valentino (♀ - 5,2; ♂ - 5,6 lăstari subterani/plantă). Primii lăstari aerieni s-au atestat la suprafaţa solului la genotipul Valentino ♀ după 48 zile şi după 50 zile la hibridul Xenia şi forma maternă a acestuia. Analiza sistemului radicular la floarea-soarelui în dinamică a relevat că genotipul patern Xenia se caracterizează printr-o majorare numerică lentă a lupoaiei pe parcursul întregii perioade de studiu. La linia maternă procesul de infectare a fost mai accelerat, atestându-se în decursul celor 60 zile de examinare a organului subteran de la 0,17 - 15,00 ataşamente/plantă. Cel mai afectat s-a dovedit a fi genotipul heterozigot Xenia, la care creşterea fitoparazitului a fost foarte rapidă, numărul maxim de ataşamente (23,5 ataşamente/plantă) fiind înregistrat după 40 zile de cultivare pe fon de infecţie artificială. O situaţie similară, a fost stabilită şi în cazul estimării hibridului Valentino şi a formelor parentale ale acestuia, unde numărul de ataşamente atinge valorile maxime (43,7 ataşamente/plantă) după 50 zile. Totodată, în dinamica dezvoltării genotipurilor analizate, cu excepţia Xenia ♂, s-a constatat diminuarea numerică a paraziţilor pe sistemul radicular la 60 zile postinfecţie, care poate fi determinată de apariţia ataşamentelor de culoare brună-roşietică – tuberculi necrotizaţi (fig. 3.1. G, H). Necrozele au fost depistate la genotipurile heterozigote (0,6 - 0,63 necroze/plantă) şi la una din formele parentale a acestor hibrizi (Xenia ♀ - 0,2 necroze/plantă şi Valentino ♂ - 0,7 necroze/plantă). Acestea reprezintă o consecinţă a reprogramării metabolismului în celulele înconjurate de infecţie pentru a stopa răspândirea patogenului, care duce la moartea celulară programată (răspunsul imun hipersensibil - hypersensitive response HR), date relevate şi de alţi cercetători, ca reacţie de răspuns a plantei-gazdă la invazia parazitului [16, 21]. Pornind de la rezultatele obţinute putem afirma că în perioada 15 - 60 zile din momentul cultivării florii-soarelui au fost atestate cele cinci faze de dezvoltare a parazitului cu înregistrarea numărului maxim de ataşamente la genotipul matern Valentino şi minim – la genotipul patern Xenia.

8

3.2. Identificarea agresivităţii lupoaiei la diferite genotipuri de Helianthus annuus L.

Frecvenţa bolii este determinată de agresivitatea lupoaiei capacitatea parazitului de a infecta şi învinge rezistenţa gazdei, absorbind substanţele nutritive care, ulterior, vor fi utilizate pentru dezvoltarea şi reproducerea proprie. Analiza celor 53 de genotipuri, incluse în cercetare după 42 zile de cultivare pe fond de infecţie artificială a scos în evidenţă o reacţie diferită a acestora la atacul O. cumana. Astfel, în cadrul genotipurilor de perspectivă (FS1 – FS27) cea mai mare frecvenţă de atac (100%) s-a înregistrat la genotipurile FS14 şi FS22, iar genotipurile FS9, FS12, FS17, FS21, FS26, FS27 s-au dovedit a fi rezistente la patogen (fig. 3.2.).

100 90 80 70 60 50 40 30 20 10 o 1 2 3 4
100
90
80
70
60
50
40
30
20
10
o
1 2
3
4
5
6
7
8
9 10
11
12
13
14
15
16
17
18
19 20 21 22 23 24 25 26 27
28 2930 31 32 33
Frecvenţa atacului, %

Fig. 3.2. Frecvenţa atacului la diferite genotipuri de floarea-soarelui după şase săptămâni de la cultivarea în condiţiile infectării artificiale 1-27 genotipuri FS, 28-38 linii ASC, 39 Turbo F 1 , 40 Alcazar F 1 , 41 Favorit F 1 , 42 Olea F 1 , 43 Oxana F 1 , 44 Performer F 1 , 45 – Drofa ♀, 46 – Drofa ♂, 47 – Drofa F 1 , 48 – Valentino ♀, 49 – Valentino ♂, 50 – Valentino F 1 , 51 – Xenia ♀, 52 – Xenia ♂, 53 – Xenia F 1

La genotipurile cu androsterilitate citoplasmatică (ASC), liniile ASC3, ASC4, ASC8 şi ASC11 s-a atestat o frecvenţă maximă a atacului, astfel încât, toate plantele cercetate au fost infectate, având 6 - 10 paraziţi per plantă, iar la unele genotipuri – mai mult de 15 ataşamente. Linia ASC1 a manifestat rezistenţă demonstrată de lipsa ataşamentelor. Analiza sistemului radicular a formelor homo- şi heterozigote a demonstrat că genotipul matern Valentino s-a caracterizat printr-o frecvenţă a atacului de 100%, iar hibridul Valentino a înregistrat un număr maxim de O. cumana per plantă (fig. 3.3.). Hibrizii Alcazar, Favorit şi Turbo au manifestat un grad de atac nul, confirmând datele existente în literatura de specialitate referitor la rezistenţa genotipurilor menţionate [5, 28].

9

Fig. 3.3. Dezvoltarea fitoparazitului pe rădăcinile hibrizilor Xenia (A) şi Valentino (B) după 42 zile

Fig. 3.3. Dezvoltarea fitoparazitului pe rădăcinile hibrizilor Xenia (A) şi Valentino (B) după 42 zile din momentul cultivării

(A) şi Valentino (B) după 42 zile din momentul cultivării Fig. 3.4. Repartizarea celor 53 genotipuri

Fig. 3.4. Repartizarea celor 53 genotipuri de floarea-soarelui în patru grupuri după rezistenţă faţă de O. cumana (rasa E)

Generalizând rezultatele screening-ului efectuat am constatat că în baza determinării frecvenţei atacului cele 53 genotipuri de floarea-soarelui pot fi clasificate în patru grupe (fig. 3.4.): rezistente – genotipuri cu frecvenţa atacului de până la 5%, care fie posedă o imunitate absolută (în cazul în care nu se relevă prezenţa parazitului pe parcursul creşterii şi dezvoltării acestuia) sau o imunitate relativă (se constată ataşarea seminţelor de lupoaie şi formarea tuberculilor într-un număr mic care în majoritatea cazurilor se necrotizează şi pier în primele zile de dezvoltare); tolerante – genotipuri cu frecvenţa atacului de 5 - 20%, plantele posedă o imunitate condiţionată, atestându-se germinarea, ataşarea şi dezvoltarea fitopatogenului, dar care nu afectează drastic dezvoltarea şi creşterea plantei-gazdă; sensibile genotipuri cu frecvenţa atacului de 20 - 50% şi foarte sensibile - peste 50%, sunt lipsite complet de imunitate, fiind sever afectate, iar la un atac puternic pier. Astfel, rezultatul evaluării demonstrează că dintre cele 53 genotipuri investigate, zece au manifestat rezistenţă (FS9, FS12, FS17, FS21, FS26, FS27, ASC1, Alcazar F 1 , Favorit F 1 , Turbo F 1 ), 5 au fost tolerante (FS4, FS8, FS11, ASC2, Xenia ♂), un genotip – sensibil (FS10) şi 37 - foarte sensibile la atacul O. cumana.

3.3. Virulenţa fitoparazitului în sistemul Helianthus annuus L. - Orobanche cumana Wallr.

Lupoaia demonstrează un nivel de virulenţă diferit, care se manifestă asupra intensităţii bolii, determinând tulburări de diferite grade ce ajung uneori până la distrugerea totală a unor organe sau chiar a plantei în întregime. Intensitatea atacului la genotipurile de floarea-soarelui utilizate în studiu a variat în limitele de 0 - 13,3 ataşamente per plantă şi depinde de genotipul plantei (fig. 3.5.).

10

Nr. de ataşamente per plantă

14

12

10

8

6

4

2

0

Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3
Nr. de ataşamente per plantă 14 12 10 8 6 4 2 0 1 2 3

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18 19 20

21 22 23 24 25 26 27

28 29 30 31 32 33 34

Fig. 3.5. Intensitatea atacului la diferite genotipuri de floarea-soarelui după şase săptămâni de la cultivarea în condiţiile infectării artificiale. 1-27 genotipuri FS, 28-38 linii ASC, 39 Turbo F 1 , 40 Alcazar F 1 , 41 Favorit F 1 , 42 Olea F 1 , 43 Oxana F 1 , 44 Performer F 1 , 45 – Drofa ♀, 46 – Drofa ♂, 47 – Drofa F 1 , 48 Valentino ♀, 49 Valentino ♂, 50 – Valentino F 1 , 51 – Xenia ♀, 52 – Xenia ♂, 53 – Xenia F 1

Valorile cele mai mari ale intensităţii atacului s-au atestat în special la genotipurile de perspectivă (FS), comparativ cu liniile androsterile (ASC) şi unele forme homo- (♀, ♂) şi heterozigote (F 1 ). Acţiunea lupoaiei asupra gazdei poate fi foarte diferită: de la lezarea non-vizibilă a ţesuturilor vegetale până la moartea plantei. Însă, în general, efectele sesizabile ale intensităţii atacului la genotipurile studiate s-a manifestat prin ofilirea plantelor, îngălbenirea frunzelor, reducerea în dimensiune a organelor subterane şi aeriene. O. cumana este un rizoparazit care se ataşează şi se dezvoltă nemijlocit la nivelul sistemului radicular, afectând dezvoltarea acestuia. Creşterea şi dezvoltarea parazitului a determinat diminuarea lungimii rădăcinii la majoritatea genotipurilor cercetate. Cele mai afectate s-au dovedit a fi genotipurile FS25 şi ASC9, unde s-a constatat o diferenţă de 67,9% faţă de martor (fig. 3.6., A). Diminuarea sistemului radicular s-a observat şi la genotipurile rezistente (37,4 - 53,0%) cu excepţia genotipului FS21, la care s-a atestat o sporire a sistemului radicular cu

11,8%.

Influenţa lupoaiei a fost relevată şi la nivelul înălţimii plantelor de floarea-soarelui. Astfel, dintre genotipurile studiate, 47 au înregistrat valori mai mici ale parametrului studiat. Stagnarea maximă a fost atestată la genotipurile foarte sensibile FS6 (33,8%) şi Drofa (36,1%). La genotipurile tolerante indicele studiat a diminuat cu 15,5 - 23,5% (fig. 3.6., B.), cu exepţia FS4 şi FS8 la care s-a observat o uşoară stimulare a creşterii în înălţime (4,4%), acest fapt fiind constatat şi la unele genotipuri rezistente (FS4, FS17, FS21 şi FS26) unde valorile obţinute au depăşit martorul cu 4,2 - 42,5% (fig. 3.6., C).

11

A
A
B
B
C
C

Fig. 3.6. Manifestarea acţiunii O. cumana asupra dezvoltării plantelor de H. annuus: la genotipuri sensibile (A), tolerante (B) şi rezistente (C)

Generalizând rezultatele obţinute, putem constata că fitoparazitul a manifestat o acţiune

negativă asupra genotipurilor sensibile de H. annuus, iar afectarea celor rezistente, probabil se

datorează faptului că planta-gazdă include unele mecanisme de rezistenţă pre-haustoriale şi post-

haustoriale, având ca consecinţă diminuarea creşterii şi dezvoltării plantelor de floarea-soarelui.

3.4. Analiza interrelaţiilor gazdă – parazit – temperatură la unele genotipuri de Helianthus annuus L.

Starea de boală este considerată ca rezultat al raportului: plantă-gazdă agent patogen

mediu. Temperatura reprezintă indicele cheie, care influenţează interacţiunea gazdă-parazit la

floarea-soarelui [29]. Temperaturile ridicate stimulează germinarea seminţelor de O. cumana şi

respectiv contribuie la creşterea nivelului de infectare, însă creşterea temperaturii determină

declanşarea mecanismelor de rezistenţă a plantei-gazdă într-o corelaţie polinomă, cauzând

degradarea şi moartea parazitului [15], date care ne-au determinat să modelăm şi să analizăm

dezvoltarea patosistemului în două regimuri de temperaturi:

experienţa I a fost realizată la temperatura medie (Tm) a aerului de 15°C, care a variat

între 10-18°C şi Tm a solului de 13°C, cu o variaţie de 8-17°C;

experienţa II s-a efectuat la Tm a aerului de 28°C, variind de la 23-31°C şi Tm a solului

de 25°C, variind între 21-30°C.

Dezvoltarea ontogenetică a florii-soarelui şi a parazitului a fost influenţată semnificativ de

cele două regimuri de temperatură (fig. 3.7.). Temperaturile joase, au determinat atât întârzierea

germinării şi răsăririi genotipurilor de floarea-soarelui studiate, cât şi apariţia primei perechi de

frunze adevărate. Plantele crescute în condiţiile variantei I au atins faza de 4 - 5 frunzuliţe

adevărate timp de 11 săptămâni, în timp ce în varianta II – după 6 săptămâni.

12

Temperaturile joase au reţinut şi dezvoltarea parazitului. Astfel, în prima experienţă apariţia parazitului la suprafaţa solului nu s-a observat pe parcursul creşterii plantelor timp de 11 săptămâni, fiind depistată doar pe sistemul radicular. În experienţa II, lupoaia a apărut la suprafaţa solului la cea de-a 4 săptămână (după 31 zile) la hibridul Xenia, mai târziu (după 35 zile) - la linia paternă a acestuia şi la linia maternă a hibridului Valentino.

A t° aerului t° solului 19 17 15 13 11 9 7 5 7 14
A
t° aerului
t° solului
19
17
15
13
11
9
7
5
7
14
21
28
35
42
49
56
63
70
77
zile
Temperatura,°C
t° aerului t° solului B 33 31 29 27 25 23 21 19 17 15
t° aerului
t° solului
B
33
31
29
27
25
23
21
19
17
15
7
14
21
28
35
42
Nr. zilelor
zile
Fig. 3.7. Regimurile de temperatură (A – regimul I, B – regimul II) utilizate în studiul
patosistemului H. annuus - O. cumana.
- răsărirea plantulelor,
- faza de două frunzuliţe,
- apariţia parazitului la suprafaţa solului,
- faza de butonizare
Temperatura °C

S-a stabilit, că temperaturile joase reţin dezvoltarea parazitului, astfel încât acesta nu afectează planta-gazdă, în timp ce temperaturile înalte, dimpotrivă grăbesc creşterea şi dezvoltarea parazitului, şi respectiv diminuează valorile parametrilor morfo-fiziologici ale florii- soarelui. Gradul de infectare la hibrizii Xenia şi Valentino la temperaturile joase şi ridicate, s-a menţinut la acelaşi nivel, ceea ce denotă o labilitate şi adaptare a genotipurilor heterozigote la condiţiile mediului. Totodată, s-a constatat că Valentino F 1 comparativ cu Xenia F 1 a fost mai sensibil la atacul parazitului, fiind atestate cele mai multe ataşamente per plantă.

13

4. ASPECTE GENETICO - MOLECULARE ALE REZISTENŢEI LA OROBANCHE CUMANA WALLR.

Rezistenţa plantelor la lupoaie reprezintă un proces complex multifactorial, determinat de

mecanisme de protecţie specifice, strâns asociate cu recunoaşterea genă pentru genă R-gene

(R-resistance), precum şi de mecanisme generale, sau constitutive, mediate de un număr mare de

gene minore, care sunt nespecializate, au efect individual slab şi acţionează aditiv.

4.1. Evidenţierea genei Or5 în diverse genotipuri de H. annuus L.

În vederea evidenţierii locusului lincat cu gena Or5 s-a utilizat markerul SCAR RTS05

cartat la distanţa de 5,6 cM proximal de gena rezistenţei, care generează un produs de

amplificare de 650 pb [25].

Rezultatele reacţiei PCR cu primerii specifici asupra ADN-ului genomic extras din cele 27

genotipuri de perspectivă a demonstrat prezenţa ampliconului cercetat la 23 dintre acestea. În

cadrul genotipurilor FS7, FS14, FS16 şi FS24 s-a constatat lipsa secvenţii de 650 pb (fig. 4.1.,

trecurile 1-27). Ampliconul de 650 pb a fost analizat şi la 11 linii cu androsterilitate

citoplasmatică (fig. 4.1., trecurile 28-38), fiind identificat la liniile ASC1, ASC2, ASC3, ASC5,

ASC6, ASC10, printr-un profil destul de pronunţat şi la liniile ASC4, ASC8, ASC9, ASC11 -

mai slab. Linia ASC7 nu a demonstrat prezenţa ampliconului aşteptat. Testarea hibriziilor la

prezenţa/absenţa locusului lincat cu gena Or5 a permis vizualizarea produsului de amplificare la

toate cele 7 genotipuri heterozigote (fig. 4.1., trecurile 39-44), iar analiza moleculară a celor trei

hibrizi (Valentino, Xenia şi Drofa) şi formele lor parentale au pus în evidenţă produsul teoretic

aşteptat de 650 pb la toate genotipurile heterozigote şi paterne, ceea ce denotă moştenirea

dominantă a acestuia (fig. 4.1., trecurile 45-53). La liniile materne Valentino şi Xenia ampliconul

s-a evidenţiat foarte slab, iar la genotipul matern al hibridului Drofa markerul respectiv nu a fost

depistat.

Lipsa ampliconului 650 pb la genotipul matern Drofa, ASC7 şi genotipurile de perspectivă

FS7, FS14, FS16, FS24 demonstrează că genotipurile respective nu conţin gena de rezistenţă la

această rasă de lupoaie şi deci sunt susceptibile. Celelalte genotipuri au fost clasate în grupul

celor rezistente.

14

pb

1000

500

100

pb 1000 500 100 M 1 2 3 4 5 6 7 8 9 10 11
pb 1000 500 100 M 1 2 3 4 5 6 7 8 9 10 11

M

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20 21

100 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14
100 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14

M

23 24

25

26

27

28

29 30

31

32

33

34

35

36

37 38

M

22

650 pb

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

39

40

41

42

43

44

29 30 31 32 33 34 35 36 37 38 M 22 650 pb 39 40

45

46

47

48

49

50

51

52

53

650 pb

650 pb

Fig. 4.1. Electroforeza produsului de amplificare cu primerul specific RTS05 M marker, 1-27 genotipuri FS, 28-38 linii ASC, 39 Turbo F 1 , 40 Alcazar F 1 , 41 Favorit F 1 , 42 Olea F 1 , 43 Oxana F 1 , 44 Performer F 1 , 45 – Valentino ♀, 46 – Valentino ♂, 47 – Valentino F 1 , 48 – Xenia ♀, 49 – Xenia ♂, 50 – Xenia F 1 , 51 – Drofa ♀, 52– Drofa ♂, 53 – Drofa F 1

Analiza comparată a rezultatelor screening-ului molecular şi cel morfologic demonstrează, că cele 6 genotipuri susceptibile au manifestat aceiaşi reacţie, în timp ce dintre cele 47 genotipuri, care au demonstrat prezenţa ampliconului 650 pb, 37 au fost afectate la nivelul sistemului radicular de O. cumana (fig. 4.2.). Aceasta ne permite să presupunem că fitopatogenul colectat din regiunea de Sud a Republicii Moldova reprezintă o rasă mai agresivă decât rasa E.

Screening-ul GENETIC (rasa E) 47 Rezistente 53 genotipuri 6 Susceptibile (Drofa ♀; ASC7; FS7; FS14;
Screening-ul GENETIC
(rasa E)
47
Rezistente
53
genotipuri
6
Susceptibile
(Drofa ♀; ASC7; FS7;
FS14; FS16; FS24)
Screening-ul MORFOLOGIC (rasă necunoscută) 5 Tolerante (FS4, FS8, FS11, ASC2, Xenia ♂) 10 Rezistente (FS9,
Screening-ul MORFOLOGIC
(rasă necunoscută)
5 Tolerante
(FS4, FS8, FS11, ASC2, Xenia ♂)
10 Rezistente
(FS9, FS12,
FS17, FS21,
FS26, FS27,
ASC1, Alcazar
F 1 , Favorit F 1 ,
Turbo F 1 )
32 Sensibile
(FS: 1-3, 5, 6, 10, 13, 15, 18-20, 22, 23,
25; ASC: 3-6, 8-11;
Xenia: ♀, F 1 ; Valentino: ♂, ♀, F 1 ; Drofa:
♂, ♀, F 1 ; Hibrizii: Olea, Oxana,
Performer)
6 Sensibile
0 0
Rezistente
Tolerante
(Drofa ♀; ASC7; FS7;
FS14; FS16; FS24)

Fig. 4.2. Clasificarea genotipurilor de H. annuus în rezultatul screening-ului genetic şi morfologic

15

4.2. Analiza structurală şi funcţională a ampliconului 650 pb

Secvenţierea ampliconului de 650 pb şi identificarea succesiunii nucleotidelor (fig. 4.3.) a relevat o similaritate de 100% a acestora la genotipurile analizate, ceea ce denotă caracterul filogenetic conservativ al fragmentului genomic.

GAGAGAGAGTGTTCTAGGGTTTCTAAAATGATTTCTCAGTAGTTGGGCCGGCGAAACCC

TCTTGGGCCGAAGCCCATTCCCGACGAAACCTCCACCTCGACGGAACCTCAAGGTTTCG

CCATGAAGATAGTGGCGAAACTCCCTAGTTTCGTCACCTAGGGTTTCGTTGAGTGACAT

GAGTTATGTTATAAGTTTACAATTCTAGATTTCCAACAATTACGTAAACATTATAACAG

TAATTAATCAATCAATAAGACAGTTTATACATCATCTAGCAAAGTGCACACAATACAAC

ATAACAGATCCTGAAAAACGCAACTAGAATACAAGTAACGTGTCGGGGAAAGACCTTG

GAAAGTCGGGTTTTCACAAATTTCATTCTTTTTATGTTTTAAATCCGTTTCATGGATTCA

AACCTTTCTTTCATACTTTTCATTCTTTTTATGTTTTGAATCTGTTTCGTGGATTCAAACA

TATCATCCATATTTTTCATTCATGCCTTTCGTTTTTACAAGTTTGATCCGTACATCAACTA

CGGATTCAAACTTTTCGTTCATGCTTTTTTTCTTATAGAATACTCTCAATTTCTTGAGAGT

CTTACAACTCCTTTCACCCACACGTCCATCTGCGACCAAAAAA

Fig. 4.3. Succesiunea nucleotidelor din produsul de amplificare cu primeri SCAR

Analiza hărţii de restricţie a succesiunii nucleotidice de 650 pb a permis să constatăm prezenţa a 39 site-uri de restricţie pentru 39 enzime de digestie, unde prima restrictază (PpII) se constată la cea de-a 25 nucleotidă, iar ultima la a 630-a nulceotidă (BccI). Autenticitatea produsului de amplificare, obţinut la cele 47 genotipuri, s-a realizat cu una dintre enzimele identificate - Taq I (site-ul de recunoaşte 5' T/CGA 3'), care a permis punerea în evidenţă, în rezultatul digestiei, a două produse de restricţie de 530 pb şi 120 pb (fig. 4.4.), rezultate obţinute anterior şi de alţi cercetători [25].

500 pb

M

FS27

Alcazar F 1 Favorit F 1

Turbo F 1 ASC1

a r a r a r a r a r 650 pb 530 pb 120
a
r
a
r
a
r
a
r
a
r
650
pb
530
pb
120
pb

Fig. 4.4. Electroforeza produselor de restricţie la diferite genotipuri de floarea-soarelui M marker (100-1000 pb), a amplicon, r – produsele de restricţie

Studii bioinformatice ample asupra succesiunii identificate a permis evidenţierea mai multor cadre deschise de citire - ORF posibile, ceea ce indică că secvenţa respectivă, ar putea avea caracter codificator. Totodată, a fost relevată o similaritate înaltă (85%) pe un nivel de acoperire de 19% cu markerul ORS 427 de tip STS (Sequence Tagged Site ), identificat la floarea-soarelui [32] şi un grad de similaritate de 100% pe un nivel de acoperire de 17% - cu ADN-ul plastidic.

16

Asocierea acestei gene cu mecanismele moleculare ale rezistenţei la lupoaie ar putea fi

determinată de similaritatea de 86% cu gena ce codifică precursorul proteinei inhibitor a enzimei

poligalacturonaza (PIPG), care ar bloca poligalacturonazele secretate de parazit [11] şi ar stopa

pătrunderea haustoriei printre celulele epidermale în cortexul plantei-gazdă după ataşarea

O. cumana [31].

4.3. Gene implicate în rezistenţa nespecifică a florii-soarelui la Orobanche cumana Wallr.

La floarea-soarelui se disting şapte gene dominante ale rezistenţei - R (Or 1 - Or 7 ) pentru

cele şapte rase fiziologice ale lupoaiei (A - G), dar întrucât genomul florii-soarelui la momentul

actual nu este în totalitate secvenţiat este dificil de a depista secvenţele acestor gene şi de a

explica rolul lor funcţional în mecanismele de rezistenţă a plantei-gazdă la fitoparazitul

respectiv.

Aplicarea instrumentelor bioinformatice de cercetare şi caracterizare a secvenţelor ne-a

permis identificarea altor secvenţe nucleotidice şi proteine, potenţial implicate în mecanismul

rezistenţei florii-soarelui faţă de lupoaie. Investigarea bazelor de date NCBI (National Center for

Biotechnology Information) a scos în evidenţă 20 de referinţe la diverse succesiuni nucleotidice

(10 secvenţe ADN şi 10 - ARNm) pentru rezistenţă la Orobanche (Orobanche Resistance) şi

şase fragmente complete sau parţiale de ARNm, pentru defensina florii-soarelui (Sunflower

Defensin). Una dintre cele mai importante secvenţe Orobanche Resistance poate fi considerată

proteina D-α fosfolipază, codificată de gena EF575487 cu rol în degradare a fosfolipidelor din

membrana citoplasmatică, iar mai specifică dintre defensine s-a dovedit a fi secvenţa

polipeptidică AAM27914 (secvenţa ARNm AF364865), care a fost identificată ca HaDef1 cu rol

activ în mecanismul rezistenţei la lupoaie.

Astfel, prin metode bioinformatice au fost evidenţiate unele gene nespecifice ce codifică

proteinele: D-α–fosfolipaza, glucan sintaza; metionin sintaza; glutation S-transferaza; quinon

oxidoreductaza; calcon sintaza şi defensina HaDEF1 cu diverse funcţii în procesele de oxido-

reducere la nivelul membranelor biologice, implicate în mecanismul de rezistenţă al H. annuus la

O. cumana.

5. METABOLISMUL PROTEIC ÎN PATOSISTEMUL HELIANTHUS ANNUUS L. OROBANCHE CUMANA WALLR.

Conform ipotezei genă pentru genă, interacţiunea gazdă-parazit este determinată de genele

pentru rezistenţă/susceptibilitate (R/r) şi cele pentru avirulenţă/virulenţă (Avr/avr). Astfel,

17

întrucât proteinele R-, direct sau indirect recunosc şi interacţionează cu elicitori specifici

sintetizaţi de genele de avirulenţă a patogenului blocând invazia acestuia [17, 18].

Astfel, atacul patogenului afectează metabolismul celular al plantelor, cauzând modificări

calitative şi cantitative semnificative în complexul proteic, schimbări ce reflectă intensitatea

răspunsului defensiv al plantelor.

5.1. Spectrul electroforetic al polipeptidelor sistemului radicular la diverse genotipuri de floarea-soarelui, neinfectate şi infectate cu lupoaie

Rezultatele analizei a 72 spectre electroforetice ale proteinelor extrase din sistemul

radicular la şase genotipuri de floarea-soarelui cu sensibilitate diferită la atacul lupoaiei au pus în

evidenţă spectre individuale în funcţie de reacţia de apărare a plantei şi durata infecţiei.

Fiecare dintre etapele analizate (15, 20, 30, 40, 50, 60 zile de cultivare) s-au caracterizat

prin prezenţa în gel aproximativ a 30 - 40 componenţi proteici cu masele moleculare cuprinse în

diapazonul 10,0 120,0 kDa.

Infecţia cu O. cumana modifică nesemnificativ numărul de benzi polipeptidice a

genotipurilor studiate. Dar, la diferite etape de analiză, au fost evidenţiate polipeptide, cantitatea

cărora a variat la probele infectate, manifestându-se prin intensificarea/diminuarea coloraţiei

benzilor electroforetice. Astfel, în cadrul genotipului hibrid Xenia şi formele parentale ale

acestuia, la etapele de 15 şi 20 zile de la inocularea parazitului s-a constatat intensificarea

sintezei fracţiilor cu Mr 16,5; 26,8; 28,5 şi 36,2 kDa. Începând cu etapa de 30/40 zile de cultivare

pe fond infectat, intensificări vădite au fost caracteristice doar genotipului matern, la care pe

parcursul creşterii în condiţii de stres biotic predomină intensificarea aceloraşi benzi

polipeptidice - 16,5; 26,8 şi 35,5 kDa cu excepţia celei cu Mr 28,5 kDa (fig. 5.1.).

Spre deosebire de genotipurile homo- şi heterozigote Xenia, care s-au caracterizat prin

modificări la nivel polipeptidic începând cu primele zile de infectare, cele care formează grupul

Valentino au prezentat o reacţie de sensibilitate mai mică la acţiunea patogenului, acestea fiind

observate în perioada a două de studiu (30 – 40 zile) şi care atenuează în intensitate deja peste

zece zile.

Intensificarea unor proteine la atacul parazitului, constatată în cercetările noastre sunt în

acord cu datele altor cercetători privind investigarea interacţiunii O. cumana cu diverse specii de

plante, care relevă acumularea proteinelor asociate cu patogeneza din grupul PR (PR-

pathogenesis-related). Biosinteza accelerată a acestora fiind indusă de mecanismele rezistenţei

sistemice dobândite, ca rezultat al reacţiei defensive generale [12].

18

kDa

68

45

25

13,4

A

c i c i c i
c
i
c
i
c
i

M

F 1

B

C

D

c i
c
i

c i c i ♂ F 1
c
i
c
i
F 1
i c i M ♀ ♂ F 1 B C D c i ♀ c i
c i c i
c
i
c
i
♀ ♂ F 1 B C D c i ♀ c i c i ♂ F
c i c i c i c i
c
i
c
i
c
i
c
i

F 1

F 1

76,5 kDa

68,7 kDa

36,2 kDa

35,5 kDa

21,0 kDa

16,5 kDa

13,4 kDa

12,0 kDa

Fig. 5.1. Spectrele polipeptidelor din rădăcinile plantelor martor şi infectate a hibridului Xenia şi liniilor parentale (♀, ♂) examinate peste 20 (A), 30 (B), 40 (C) şi 60 (D) zile

M- proteine cu masa moleculară cunoscută, c – control, i infectat.

De asemenea, atacul parazitului la anumite etape a determinat biosinteza timpurie comparativ cu varianta martor a unor benzi polipeptidice (68,5; 70,3 şi 111,1 kDa), acestea fiind evidenţiate la etapele mai avansate atât la martor, cât şi la plantele cultivate pe fond de infecţie. Modificările depistate reflectă intensitatea răspunsului defensiv a genotipurilor cercetate, demonstrând că sinteza proteinelor de stres manifestă un caracter tranzitoriu, de o intensitate mai mare la prima treaptă de infectare, direcţionată spre reorganizarea metabolismului biochimic în funcţie de nivelul de rezistenţă a plantelor infectate.

5.2. Spectrul electroforetic al polipeptidelor din frunze

SDS - electroforeza proteinelor extrase din frunze, similar celor obţinute la nivelul sistemului radicular, a pus în evidenţă o diversitate moleculară a componenţilor proteici cu un anumit grad de specificitate determinat atât de genotip, cât şi de stresul biotic. În aspect general, spectrele electroforetice ale tuturor genotipurilor studiate au relevat prezenţa a 30 - 40 polipeptide în funcţie de etapa de dezvoltare a plantei-gazdă, repartizate într-un diapazon cu Mr 11 - 130 kDa. Majoritatea fracţiilor au fost comune pentru ambii hibrizi şi liniile parentale. La formele parentale la anumite etape de creştere şi dezvoltare s-a atestat apariţia unor componenţi polipeptidici (20,0 kDa Xenia ♀ dupa 20 zile, 42,0 kDa la Xenia ♂ după 60 zile ) şi lipsa altora (65,4 kDa Xenia ♂ după 15 zile), cele mai multe schimbări de genul acesta fiind înregistrate la genotipul patern al hibridului Xenia. Plantele infectate ale hibridului Valentino, similar hibridului Xenia şi formelor parentale, a prezentat o intensificare a colorantului la majoritatea fracţiilor polipeptidice (30 zile de creştere

19

pe mediu infectat). După 40 zile, polipeptidele cu masa moleculară mica (13,6 - 20,0 kDa) diminuează în intensitate cu excepţia fracţiei 11,3 kDa care în continuare se intensifică. Impactul O. cumana asupra metabolismului proteic la nivelul sistemului foliar, comparativ cu cel radicular este mai slab evidenţiat.

5.3. Polimorfismul polipeptidic asociat cu interacţiunea gazdă-patogen

Variaţia cantitativă a anumitor componenţi proteici la etapele critice de infecţie, identificată în SDS - PAGE a fost confirmată prin analize de cuantificare a componenţilor, utilizând tehnologia - Protein LabChip. Astfel, componentul cu Mr 28,2 kDa al cărui conţinut la martor (frunze, planta neinfectată)

a fost de 2327,8 ng/μl s-a micşorat după infectare până la 12,61 ng/μl (185 ori) în cazul liniei

paterne a hibridului Xenia, iar fracţia de Mr 58,5 kDa prezentă la linia maternă a aceluiaşi hibrid

a scăzut după infectare de la 389,79 ng/μl până la 111,9 ng/μl. Formele parentale ale hibridului Valentino au demonstrat modificări cantitative şi calitative

mai atenuate în intensitate, dar a unui număr mai mare de benzi. Astfel, variabilitatea benzilor polipeptidice la linia maternă infectată în raport cu martorul este exprimată prin lipsa şi prezenţa unor polipeptide specifice. Aceeaşi tendinţă de variaţie a conţinutului şi a diversităţii moleculare

a fost observată şi la genotipul patern infectat (fig. 5.2.). Electroforegramele polipeptidice ale hibrizilor F 1 au relevat un grad mai mare de homeostazie fiziologică, ceea ce indică şi asupra unui nivel de adaptabilitate mai înalt. Acest tablou al variaţiilor cantitative / calitative ale complexului polipeptidic care este diferit în cadrul liniilor parentale şi a acestora faţă de hibrid ar putea fi rezultatul unor efecte compensatorii asigurate de interacţiuni aditive ale genelor care controlează rezistenţa - fenomene caracteristice heterozigoţiei şi care decurg prin diverse mecanisme biochimice şi fiziologice în funcţie de norma de reacţie a organismului, în cazul nostru la parazitul O. cumana. Particularităţile temporale în afectarea patternului polipeptidic la liniile parentale ale hibridului Valentino se asociază cu rezultatele analizei morfologice a plantelor infectate cu lupoaie, prezentând un grad de infecţie mai înalt comparativ cu formele parentale ale hibridului Xenia. Astfel, putem considera, că reacţia de hipersensibilitate observată la genotipurile Xenia prin reorganizarea metabolismului proteic în primele zile de infectare pe fonul unui nivel mai slab de afectare fenotipică a plantelor în comparaţie cu cele din grupul Valentino este

20

determinată de generarea unui nivel mai înalt de rezistenţă faţă de patogen nu numai în zona de contact (rădăcini), dar şi în ţesuturile mai îndepărtate (partea aeriană).

Valentino ♀

martor Valentino ♀ 1638,99 ng/μl* 783,15 ng/μl 500 1496 ng/μl ng/μl infectat 463,14 1314,13 ng/μl
martor
Valentino ♀
1638,99 ng/μl*
783,15 ng/μl
500 1496
ng/μl
ng/μl
infectat
463,14
1314,13 ng/μl
ng/μl
91,22 ng/μl

kDa

Valentino ♂ 150 martor 1638,55 ng/μl* 95 0 887,38 ng/μl infectat 1122,7 ng/μl 63 0
Valentino ♂
150
martor
1638,55 ng/μl*
95
0
887,38 ng/μl
infectat
1122,7 ng/μl
63
0
46
0
28
0
62,85
15
0
ng/μl
64,81 ng/μl
7
0
4
5
kDa

150,0

95,0

63,0

46,0

28,0

15,0

7,0

4,5

7 0 4 5 kDa 150,0 95,0 63,0 46,0 28,0 15,0 7,0 4,5 M martor infectat

M martor

infectat

150,0

95,0

63,0

46,0

28,0

15,0

7,0

4,5

martor infectat 150,0 95,0 63,0 46,0 28,0 15,0 7,0 4 , 5 M martor infectat Fig.

M

martor

infectat

Fig. 5.2. Analiza cantitativă a polipeptidelor utilizând tehnologia Protein LabChip la forma maternă şi paternă a hibridului Valentino

Fu – intensitatea fluorescenţei; *concentraţia proteinei calculată la BioAnalyzer.

Generalizând cercetările efectuate propunem o schemă ipotetică privind mecanismele genetico-moleculare şi fiziologice ce stau la baza interrelaţiei H. annuus - O. cumana. Rezistenţa florii-soarelui faţă de lupoaie este determinată preponderent de capacitatea de a se opune procesului de ataşare a parazitului pe sistemul radicular al plantei-gazdă şi de penetrare a haustorilor prin ţesuturile vegetale. Astfel, un aspect important în includerea mecanismului de rezistenţă la nivel de perete celular ar reveni glucan sintazei (fig. 5.3.), cu funcţii în sinteza calozei şi proteinei inhibitor a enzimei poligalacturonaza, care aparţine familiei de proteine bogate în resturi de leucină [19] şi blochează degradarea poligalaturonazei - una dintre primele enzime ce participă în degradarea peretelui celular, polipeptide identificate de noi în cadrul polipeptidelor Orobanche Resistance. Procese mult mai complexe au loc la nivelul membranelor biologice şi sunt asociate în cea mai mare parte cu destabilizarea/permeabilizarea acestora, determinată de formarea speciilor reactive de oxigen - SRO [18] modificarea statutului redox celular [25] şi peroxidarea lipidelor structurale în celula gazdă infectată.

21

HaDef1 Patogen Peretele celular lignificare Glucansintaza SRO Canal de Ca 2+ HaDef1 peroxidarea lipidelor
HaDef1
Patogen
Peretele celular
lignificare
Glucansintaza
SRO
Canal de Ca 2+
HaDef1
peroxidarea lipidelor
Membrana
Potenţial redox
plasmatică
Ca 2+
D-α- fosfolipaza
Glutation
Q
inonreductaza
SRO
Chalcon sintaza
S-transferaza
Ca 2+
Metionin
sintaza
Transmiterea
Acumularea
Acid
Acid
semnalelor
Ca 2+
CITOPLASMA
fitoalexinelor
benzoic
salicilic
Glutation
Acumularea
Ca 2+
fenolilor
Nucleu
Activarea factorilor de transcripţie

Activarea

genelor

apoptozei

Defensine

-fenialalanin

amonialiaza

-chalcon

s intaza

Genele

- asociate cu

patogeneza

-glucanazei

-chitinazei

Activarea

-tioninelor

-lipoxigenazelor

-inhibitorilor de

proteaze

Amplificarea

semnalelor

-aminociclopropan

carboxilat oxidaze

Activarea genelor de

protecţie

-glutation

S -transferaza

-glutation peroxidaza

-peroxidaze

Fig. 5.3. Schema ipotetică a proceselor asociate cu rezistenţa H. annuus la O. cumana

Abordând ideea că glutation-S-transferaza, metionin sintaza şi quinon oxidoreductaza, se acumulează la unele plante rezistente de Arabidopsis [34] şi H. annuus [20] în primele zile după infecţie, acestea ar putea fi implicate, de rând cu enzimele oxido-reducătoare [24], în inducerea detoxificării SRO în cadrul mecanismelor asociate cu rezistenţă. Acest proces poate fi asociat şi cu activitatea D-α–fosfolipazei, care de rând cu calcon sintaza, contribuie la degradarea lipidelor şi includerea lor în căile metabolice secundare, ce duc la formarea compuşilor ciclici (fenolii, fitoalexinele şi acidul salicilic), care fie acţionează direct asupra parazitului [18 30] sau induc activarea unor factori de transcripţie ai genelor asociate cu patogeneză (PR proteine )[20]. Un rol mai activ în mecanismul rezistenţei la lupoaie ar reveni defensinei HaDEF1, expresia căreia este indusă puternic în primele zile după ataşare parazitului. Acesta interacţionează cu lipidele membranare specifice, determinând astfel destabilizarea permeabilităţii membranelor ţintă, iar fluxurile de ioni (K + , Ca 2+ ) cauzează inhibarea creşterii parazitului [33]. În concluzie remarcăm, că în rezultatul infectării plantei de către patogenul biotrof se induc un şir de reacţii de apărare, de diferită natură, care sporesc rezistenţa plantelor la infectarea curentă sau ulterioară. Cunoaşterea factorilor genetici de rezistenţă la lupoaie precum şi a mecanismelor fiziologice de protecţie ar facilita eforturile amelioratorilor în obţinerea formelor mai rezistente la O. cumana.

22

CONCLUZII GENERALE

1. Screening-ul fenotipic al afinităţii, agresivităţii şi virulenţei parazitului (frecvenţa şi intensitatea infecţiei) a permis clasificarea celor 53 genotipuri de H. annuus în patru grupe distincte: rezistente (FS9, FS12, FS17, FS21, FS26, FS27, ASC1, Alcazar F 1 , Favorit F 1 , Turbo F 1 ); tolerante (FS4, FS8, FS11, ASC2, Xenia ♂); sensibile (FS10) și foarte sensibile (37 de genotipuri).

2. Analiza SCAR a demonstrat prezenţa genei Or5 la 47 dintre cele 53 genotipuri analizate. Lipsa ampliconului de 650 pb şi, respectiv, lipsa genei Or5 la genotipul matern Drofa, ASC7; FS7; FS14; FS16; FS24 permite să presupunem că aceste genotipuri sunt susceptibile la atacul O. cumana, rasa E.

3. Corelarea datelor privind screening-ul morfologic şi molecular demonstrează că genotipurile lipsite de gena Or5, se clasează ca genotipuri sensibile în testul experimental în vase de vegetaţie, iar genotipurile care conţin gena Or5 manifestă o reacţie diferită la nivelul evaluării acestora pe fondalul lupoaiei colectate din sudul Republicii Moldova, date care relevă că populaţia de O. cumana utilizată în cercetare este mai agresivă.

4. A fost izolată şi pentru prima data secvenţiată regiunea de 650 pb, asociată cu prezenţa genei Or5 la şase genotipuri de H. annuus. S-a constatat că fragmentul respectiv manifestă o similaritate de 86% cu gena care codifică precursorul proteinei-inhibitor al poligalacturonazei.

5. Rezultatele investigării bazelor de date au permis sa evidenţiem o serie de secvenţe nucleotidice şi proteine (D-α–fosfolipaza, glucan sintaza; metionin sintaza; glutation S- transferaza; quinon oxidoreductaza; calcon sintaza şi defensina HaDEF1), potenţial implicate în reacţia de răspuns la acţiunea fitoparazitului şi să elaboram o schemă ipotetică privind mecanismul fiziologic şi genetico-molecular al rezistenţii H. annuus la O. cumana.

6. Spectrele SDS-PAGE la nivelul sistemului radicular şi foliar au pus în evidenţă sinteza timpurie a unor polipeptide (68,5; 70,3 şi 111,0 kDa) şi intensificarea produşilor de expresie (11, 3; 12,0; 16,5; 21,0; 33,8 şi 35,5 kDa) pe fondal de infecţie cu lupoaie.

RECOMANDĂRI PRACTICE

1. Genotipurile de perspectivă FS9, FS12, FS17, FS21, FS26, FS27 şi linia androsterilă ASC1, rezistente la fitoparazitul lupoaia pot fi utilizate pentru ameliorarea floarea-soarelui.

23

2.

Hibrizii rezistenţi Alcazar, Favorit şi Turbo de origine română sunt recomandaţi de a fi utilizate în zonele afectate de parazitul O. cumana în Republica Moldova.

BIBLIOGRAFIE:

1. Duca M., Savca E., Port A. Fiziologia vegetală. Tehnici speciale de laborator. Chişinău, 2001. 174 p.

2. Reva V., Ciobanu V., Mueller-Uri F. Strategia şi tactica izolării şi purificării proteinelor. Chişinău, 2001. 186 p.

3. Siminel V. Ameliorarea generală a plantelor de cîmp. Chişinău: Ed. Tipografia Centrală, 1998. 600 p.

4. Ştefan I. ş. a. Floarea-soarelui. Buzău: Alpha MDN, 2008. 266 p.

5. Vrânceanu A. Floarea-soarelui hibridă. Bucureşti: Ed. Ceres, 2000. 520 p.

6. Доспехов А. Методы полевого опыта. Москва: Агропромиздат, 1985. 351 c.

7. Панченко А. Ранняя диагностика заразихоустойчивости при селекции и улучшением семеноводстве подсолнечника. В Вестник Сельско-ных наук., 1975. с. 2.

8. Чикин Ю. Общая фитопатология. Томск: Томский госуниверситет, 2001. 170 c.

9. Atanasova R., Batchvarova R., Christov M. Characterization of sunflower lines with different resistance to broomrape. In: Biotechnol. And Biotechno. Eq. 2004, p. 69-74.

10. Ciucă M., Păcureanu-Joiţa M., Iora M. RAPD markers for polymorphism identification in parasitic weed Orobanche cumana Wallr. In: Romanian Agricultural Research. 2004, no. 21, p. 29-32.

11. De Lorenzo G., D’Ovidio R., Cervone F. The role of polygalacturonase-inhibiting proteins (PGIPs) in defense against pathogenic fungi. In: Ann. Rev. Phytopathology. 2001, vol.39, p. 313-335.

12. Dickinson M. Molecular plant pathology. In: Bios scientific publisher. 2003. 258 p.

13. Dominguez J., Melero-Vera J., Refoyo A. Virulence groups of Orobanche cernua in Andalusia (Southern Spain). In: Advances in Parasitic Plant Research, Sixth Intern, Parasitic Weed Sym., Cordoba, Spain. 1996, p.

633-637.

14. Doyle J., Doyle J. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. In: Phytochem Bull. 1987, vol. 19, p. 11-15.

15. Eizenberg H. et al. Resistance to broomrape (Orobanche spp.) in sunflower (Helianthus annuus L.) is temperature dependent. In: Journal of Experimental Botany. 2003, vol. 54, no. 385, p. 1305-1311.

16. Fernandez-Martinez, J. et al. Update on breeding for resistance to sunflower broomrape. In: Helia. 2008, vol. 31, no. 48, p. 73-84.

17. Flor H. Current status of the gene-for-gene concept. In: Annu. Rev. Phytopathol. 1971, vol. 9, p. 275-296.

18. Hammond-Kosack K., Jones J. Plant disease resistance genes. In: Annu. Rev Plant Physiol. Plant Mol. Biol. 1997, vol. 48, p. 2-45

19. Jones D. et al. Isolation of the tomato Cf-9 gene for resistance to Cladosprium fulvum by transposon tagging. In:

Science. 1994, vol. 266, p. 789-793.

20. Jorrín J., Prats E. Allelochemicals, phytoalexins and insect-feeding deterrents: different definitions for a family of plant phenolic compounds, the simple 7-hydroxylated coumarins. In: Macías FA, et al. eds. Recent advances on allelopathy. A science for the future. Cádiz: Universidad de Cadiz. 1999, p. 179-192.

21. Labrousse P. et al. Several mechanisms are involved in resistance of Helianthus to Orobanche cumana Wallr. In: Annals of Botany. 2001, vol. 88, p. 859-868.

24

22.

Laemmli U. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. In: Nature. 1970, vol. 227, no. 5259, p.680-685.

23. Lamb C. and Dixon R.A. The oxidative burst in plant disease resistance. In: Annu. Rev. Plant Physiol. Plant Mol. Biol. 1997, vol. 48, p.251275.

24. Larson R. Plant defenses against oxidative stress. In: Arch. Insect. Biochem. Physiol. 1995, vol. 29, p. 175-186.

25. Lu Y. et al. Development of SCAR markers linked to broomrape Orobanche cumana Wallr. resistance gene Or5 in sunflower. In: Theor. Appl. Genet. 2000, vol. 100, p. 625-632.

26. Kuschel M. Protein sizing and analysis using the Agilent 2100 Bioanalyzer and Protein 200 LabChip® kit. In:

Agilent Technologies. 2000, no. 5988-0975EN, p. 1-8.

27. Mullis K. et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. In: Cold Spring Harbor Symposium in Quantitative Biology. 1986, vol. 51, p. 263-273.

28. Păcureanu-Joiţa M. et al. The impact of the new race of broomrape (Orobanche cumana Wallr.) parasite in sunflower crop in Romania. In: Proceeding 17th International Sunflower Conference, Cordoba, Spain. 2008, p.

225-229.

29. Sauerborn J. The influence of temperature on germination and attachment of the parasitic weed Orobanche spp. on lentil and sunflower. In: Angewandte Botanic. 1989, vol. 63, p. 543-550.

30. Serghini K. et al. Sunflower (Helianthus annuus L.) response to broomrape (Orobanche cernua Loefl.) parasitism: induced synthesis and excretion of 7-hydroxylated simple coumarins. In: Journal of Experimental Botany. 2001, vol. 52, p. 2227-2234.

31. Shomer-Ilan A. Germinating seeds of the root parasite Orobanche aegyptiaca Pers. excretes enzymes with carbohydrase activity. In: Symbiosis. 1993, vol. 15, p. 61-70.

32. Tang S. et al. Simple sequence repeat map of the sunflower genome. In: Theor. Appl. Genet. 2002, vol.105, p.

1124-1136.

33. Velasco L. et.al. Inheritance of resistance to broomrape (Orobanche cumana Wallr.) race F in a sunflower line carrying resistance genes from wild sunflower species. In: Plant Breed. 2006, vol. 126, p. 67-71.

34. Vieira Dos Santos C. et.al. Defense gene expression analysis of Arabidopsis thaliana parasitized by Orobanche ramosa. In: Phytopathology. 2003b, vol. 93, p. 451-457.

35. http://blast.ncbi.nlm.nih.gov/Blast.cgi (vizitat 09.04.2009).

36. http://www.ebi.ac.uk/Tools/clustalw2 (vizitat 14.04.2009).

37. http://www.expasy.ch/tools/pi_tool.html (vizitat 09.04.2009).

38. http://www.meteo.md (vizitat 02.10.2009).

LISTA LUCĂRILOR ŞTIINŢIFICE PUBLICATE LA TEMA TEZEI

Articole în reviste recenzate:

1. Duca M., Glijin A., Savca E., Rotaru T., Popescu V., Begu T., Antohi M. Variaţia parametrilor morfo-fiziologici la interacţiunea gazdă-parazit (Helianthus annuus L. - Orobanche cumana Wallr.). În: Buletinul Academiei de Ştiinţe a Moldovei. Ştiinţele vieţii. 2007, nr. 1(301), p. 34-41.

25

2. Duca M., Lupaşcu V., Popescu V. Aspecte ale statutului oxido-reducător la diferite genotipuri de floarea-soarelui atacate de lupoaie. În: Studia Universitatis. Seria Ştiinţe ale naturii. 2007, nr.7, p.

68-73.

3. Popescu V. Evaluarea gradului de infecţie la unele genotipuri de floarea-soarelui (Helianthus

annuus L.) la interacţiunea cu trei populaţii de lupoaie (Orobanche cumana Wallr.). În: Studia Universitatis. Seria Ştiinţe ale naturii. 2007, nr.7, p. 125-128.

4. Savca E., Popescu V., Duca M. Influenţa Orobanche cumana Wallr. de diversă origine asupra

conţinutului de acizi nucleici la floarea-soarelui. În: Studia Universitatis. Seria Ştiinţe ale naturii.

2007, nr.7, p. 147-152.

5. Duca M., Glijin A., Popescu V. Identificarea gradului de rezistenţă la lupoaie (rasa E) în cadrul

unor genotipuri de floarea-soarelui. În: Studia Universitatis. Seria Ştiinţe ale naturii. 2008, nr.2 (12), p. 5-10.

6. Duca M., Port A., Bîrsan A., Popescu V. Acţiunea lupoaiei (Orobanche cumana Wallr.) asupra

componenţilor proteici la diverse genotipuri de floarea-soarelui. În: Buletinul Academiei de Ştiinţe a Moldovei. Ştiinţele vieţii. 2008, nr. 1 (304), p. 58-67.

7. Duca M., Savca E., Popescu V. Influenţa temperaturii asupra indicilor morfo-fiziologici la

diferite genotipuri de floarea-soarelui în sistemul gazdă-parazit. În: Buletinul Academiei de Ştiinţe a Moldovei. Ştiinţele vieţii. 2008, nr. 3 (306), p. 30-37.

8. Duca M., Leviţchi A., Popescu V., Popa E. Aspecte genetico-moleculare ale rezistenţei florii-

soarelui la Orobanche cumana Wallr. În: Buletinul Academiei de Ştiinţe a Moldovei. Ştiinţele vieţii. 2009, Nr. 2 (308), p. 49-57.

9. Duca M., Glijin A., Lupaşcu V., Rotarenco V. Screening-ul molecular al rezistenţei florii-

soarelui la lupoaie (Orobanche cumana Wallr.) rasa E. În: Buletinul Academiei de Ştiinţe a

Moldovei. Ştiinţele vieţii. 2009, Nr. 3 (309), p. 81-88.

Teze ale comunicărilor ştiinţifie:

10. Popescu V. Genetica rezistenţii florii-soarelui la Orobanche cumana Wallr. În: Conferinţa

ştiinţifică internaţională „Învăţământul superior şi cercetarea-piloni ai societăţii bazate pe cunoaştere” 28 septembrie 2006. Rezumatele comunicărilor. Chişinău, 2006, p. 291.

11. Glijin A., Popescu V., Ababii V. Aspecte morfo-fiziologice ale interacţiunii gazdă-parazit pe

exemplu sistemului biologic Helianthus annuus L. Orobanche cumana Wallr. În: Conferinţa internaţionala a Tinerilor Cercetători, dedicată aniversării a 60 ani ai AŞM. Chişinău, 2006, p. 93.

12. Popescu V. Efectul temperaturii la interacţiunea parazitului Orobanche cumana Wallr. cu

unele genotipuri de floarea-soarelui (Helianthus annuus L.). În: Conferinţei Internaţionale a Tinerilor

Cercetători, ediţia VI, 6-7 noiembrie. Chişinău, 2008, p. 67.

26

ADNOTARE

Rotarenco Victoria “Aspecte morfo-fiziologice şi genetice de interacţiune gazdă- parazit (Helianthus annuus L. - Orobanche cumana Wallr.)”, teză de doctor în biologie, Chişinău, 2010. Teza include introducere, cinci capitole, concluzii generale şi recomandări, bibliografia din 336 numere, volumul total de 128 pagini, 20 tabele, 41 figuri. Rezultatele obţinute sunt publicate în 12 lucrări ştiinţifice. Cuvinte cheie: Helianthus annuus L., Orobanche cumana Wallr., gazdă-parazit, rezistenţă, markeri moleculari. Domeniu de studiu: 03.00.12 - Fiziologie vegetată. Scopul prezentei lucrări constă în evidenţierea unor particularităţi morfo-fiziologice şi genetice ce determină relaţia gazdă - parazit în baza sistemului model Helianthus annuus L. Orobanche cumana Wallr. Obiectivele de cercetare: evaluarea gradului de atac al genotipurilor de H. annuus în condiţiile infectării artificiale cu O. cumana; studiul nivelului de rezistenţă fenotipică a diferitor genotipuri de floarea-soarelui expuse acţiunii parazitului; identificarea și analiza moleculară a genei Or5 la 53 genotipuri homo- şi heterozigote de floarea-soarelui; evidenţierea unor secvenţe nucleotidice şi proteice implicate în reacţia de răspuns la acţiunea fitoparazitului O. cumana. Noutatea şi originalitatea ştiinţifică. S-au efectuat cercetări complexe - morfologice, fiziologice, biochimice şi genetico-moleculare asupra diferitor genotipuri de floarea-soarelui cultivate în Republica Moldova la acţiunea fitoparazitului O. cumana. Semnificaţia teoretică. Datele obţinute contribuie cu noi informaţii în explicarea mecanismului de rezistenţă a florii-soarelui la lupoaie la nivel pre-haustorial şi post-haustorial. Valoarea aplicativă a lucrării. În rezultatul cercetărilor s-au evidenţiat şase genotipuri de perspectivă (FS9, FS12, FS17, FS21, FS26, FS27) şi linia androsterilă ASC1 rezistente la fitoparazitul lupoaia, care pot fi utilizate pentru ameliorarea şi selecţia formelor rezistente de floarea-soarelui. Implementarea rezultatelor ştiinţifice. Lucrarea în ansamblul ei constituie un suport de referinţă pentru ameliorarea plantelor şi material ştiinţifico-didactic în predarea cursurilor de Fiziologie vegetală, Genetică, Ecofiziologie şi Adaptabilitatea plantelor.

27

ABSTRACT

Rotarenco Victoria “Morpho-physiologic and genetic aspects of host-parasite interaction (Helianthus annuus L. - Orobanche cumana Wallr.), PhD thesis in Biology, Chişinău, 2010. The thesis consist of introduction, five chapters, conclusions and recommendations, 336 sources of bibliography, a total of volume 128 pages, 20 tables, 41 figures. The obtained results were published in 12 scientific papers. Key words: Helianthus annuus L., Orobanche cumana Wallr., host-parasite, resistance, molecular markers. Direction of investigation: 03.00.12 - Plant physiology. Research goals. The purpose of this work was to study the morpho-physiological and genetic aspects of host-parasite interaction, based on sunflower and broomrape. Objectives: estimation of the degree of infection in H. annuus genotypes under artificial infection with O. cumana; identification and molecular analysis of Or5 gene in 53 homo- and heterozygous genotypes of sunflower; revealing some nucleotide and protein sequences which are implicated in defense response to O. cumana. Scientific novelty and originality. Complex studies, morphologic, physiologic and genetic, have been carried out in different sunflower genotypes infected with broomrape. Theoretical significance. The obtained data bring a new contribution in explication of physiological and genetic mechanism of resistance to broomrape, at pre-haustorial and post- haustorial level. Applicative value of the work. Seven sunflower genotypes resistant to broomrape (FS9, FS12, FS17, FS21, FS26, FS27 and one androsteril line ASC1) have been identified, which can be used in further research and breeding. Implementation of scientific results. The results of the study represent a scientific and methodological support for teaching courses of Plant physiology, Genetics, Ecophysiology and Plant adaptability, and also as a theoretical tool in the creation of sunflower lines and hybrids resistant to broomrape.

28

АННОТАЦИЯ

Ротаренко Виктория „Морфо-физиологические и генетические аспекты взаимодействия хозяин-паразит (Helianthus annuus L. - Orobanche cumana Wallr.)”, диссертация на соискание учѐной степень кандидата биологических наук, Кишинев, 2010. Работа включает введение, пять глав, общие выводы и рекомендации, библиографию из 336 источников, 128 страниц общего объема, 20 таблиц, 41 рисунков. Полученные результаты отражены в 12 научных публикациях. Ключевые слова: Helianthus annuus L., Orobanche cumana Wallr., хозяин-паразит, устойчивость, молекулярные маркеры. Область исследований: 03.00.12 - Физиология растений. Цель и задачи исследований. Целью этой работы является изучение особенностей морфо-физиологических и генетических аспектов взаимодействия подсолнечника и заразихи в системе хозяин-паразит. Для достижения этой цели были предложены следующие задачи: оценка степени зараженности генотипов H. annuus. в условиях искусственного инфицирования O. cumana; идентификация и молекулярный анализ гена Or5 у 53-х гомо- и гетерозиготных генотипах подсолнечника; выявление некоторых нуклеотидных и белковых последовательностей участвующих в защитной реакции к заразихе. Новизна и научная оригинальность. Были проведены комплексные исследования - морфологические, физиологические, биохимические и молекулярно-генетические в различных генотипах подсолнечника, культивированы в условиях искусственного инфекционного фона заразихи. Теоретическая значимость. Полученные результаты вносят новый вклад в понимание физиологического и генетико-молекулярного механизма устойчивости подсолнечника к заразихе на различных уровнях развития паразита. Прикладная ценность работы. Были выявлены шесть перспективных генотипов (FS9, FS12, FS17, FS21, FS26, FS27) и одна линия с ЦМС (ASC1), устойчивых к фитопаразиту, которые могут быть использованы для селекции устойчивых форм подсолнечника. Внедрение научных достижений. Работа в целом может быть использована в качестве научно-методического пособия в процессе преподавания Физиологии растений, Генетики, Экофизиологии и Адаптации растений, а также в качестве теоретической основы в процессе выявления и создания устойчивых к заразихе линии, сортов и гибридов.

29

ROTARENCO VICTORIA

ASPECTE MORFO-FIZIOLOGICE ŞI GENETICE DE INTERACŢIUNE GAZDĂ-PARAZIT (HELIANTHUS ANNUUS L. - OROBANCHE CUMANA WALLR.)

03.00.12. – FIZIOLOGIE VEGETALĂ

Autoreferatul tezei de doctor în biologie

Aprobat spre tipar: 16.06.2010 Hîrtie ofset. Tipar ofset. Coli de tipar: 1,60

Formatul hîrtiei 60x84 1/16 Tirajul 60 ex. Comanda nr. 337

Centrul Editorial-Poligrafic al USM Str. Al. Mateevici 60, MD 2009, Chişinău

30