Sunteți pe pagina 1din 10

Cod brosura: 38 e) [ ] 3

---------------------------------------------------------------------
---------------------------------------------------------------------
1. CS Care glucidă intră în componenţa ATP-ului?
a) [x] Riboza 5. CS Transportul macromoleculelor:
b) [ ] Dezoxiriboza a) [ ] Este reprezentat numai de fagocitoză
c) [ ] Fructoza b) [ ] Poate fi activ şi pasiv
d) [ ] Glucoza c) [x] Este mediat de formarea veziculelor endo- sau
e) [ ] Glicogenul exocitare
d) [ ] Este caracteristic numai leucocitelor
--------------------------------------------------------------------- e) [ ] Se realizează prin proteinele-canal

2. CS Formarea lanţului polipeptidic este determinată de: ---------------------------------------------------------------------


a) [ ] Legături de hidrogen
b) [ ] Forţe Van der Vaals 6. CS Care afirmaţie este incorectă în caracteristica
c) [ ] Legături ionice replicării?
d) [x] Legături covalente a) [ ] Poate fi monodirecţionată sau bidirecţionată
e) [ ] Punţi bisulfidice b) [ ] Reprezintă procesul principal ce asigură
autoreproducerea
--------------------------------------------------------------------- c) [ ] Moleculele replicate conţin catene complementare
d) [x] Moleculele replicate conţin catene identice
3. CS Structura secundară a ADN-ului este determinată de: e) [ ] Asigură sinteza moleculelor de ADN
a) [ ] Catena polinucleotidică
b) [x] Dublul helix de tip B ---------------------------------------------------------------------
c) [ ] Catena polipeptidică
d) [ ] Filamentul polinucleosomic 7. CS ADNc reprezintă:
e) [ ] -spirale şi -structuri a) [ ] ADN celular
b) [x] ADN fără introni
--------------------------------------------------------------------- c) [ ] ADN genomic
d) [ ] ADN ce conţine introni
4. CS Identificati Adenina: e) [ ] Moleculă hibridă

---------------------------------------------------------------------

8. CS Monomeri ai acizilor nucleici sunt:


a) [x] Nucleotidele
b) [ ] Aminoacizii
c) [ ] Tripletele
d) [ ] Bazele azotate
e) [ ] Nucleozidele

---------------------------------------------------------------------

9. CS Recombinarea genetică la eucariote se realizează


prin:
a) [ ] Transducţie
b) [x] Transpoziţie
c) [ ] Mutaţie
d) [ ] Hibridarea celulelor somatice
e) [ ] Conjugare celulară
a) [x] 1
b) [ ] 5 ---------------------------------------------------------------------
c) [ ] 2
d) [ ] 4 10. CS Cromatina este maximal spiralizată în:
a) [ ] Interfază 16. CS Caracteristicile primerilor pentru PCR:
b) [ ] Profază a) [ ] Stopează sinteza ADN
c) [ ] Telofază b) [x] Sunt secvenţe oligonucleotidice monocatenare
d) [ ] Anafază c) [ ] Sunt secvenţe oligonucleotidice bicatenare
e) [x] Metafază d) [ ] Se întâlnesc în celula bacteriană
e) [ ] Sunt fragmente de ADN cu o lungime mare
---------------------------------------------------------------------
---------------------------------------------------------------------
11. CS Cromozomul devine bicromatidian:
a) [ ] În G2 17. CS Identificati gena transcrisa de ARN-polimeraza I:
b) [ ] În anafază a) [ ] Gena histonei H1
c) [x] La sfîrşitul perioadei S b) [ ] Gena ARN 5S
d) [ ] În G1 c) [ ] Gena actinei
e) [ ] În telofază d) [ ] Gena Val-ARNt
e) [x] Gena ARNr 5,8S
---------------------------------------------------------------------
---------------------------------------------------------------------
12. CS Un triplet de nucleotide al moleculei de ADN
corespunde cu: 18. CS Proteinele ribozomale se sintetizează în:
a) [ ] O bază azotată a) [ ] Peroxizomi
b) [ ] Un ARNm b) [ ] Nucleol
c) [x] Un aminoacid c) [ ] Nucleu
d) [ ] O proteină d) [x] Citoplasmă
e) [ ] O genă e) [ ] Aparatul Golgi

--------------------------------------------------------------------- ---------------------------------------------------------------------

13. CS Care dintre afirmaţii este falsă referitor la RE 19. CS Activitatea enzimelor este determinată de:
rugos? a) [ ] Presiune
a) [ ] Este responsabil de sinteza diferitor proteine b) [ ] Prezenţa sau lipsa cofactorilor enzimatici
b) [x] Participa la reinnoirea proteinelor nucleare c) [x] Toate variantele propuse
c) [ ] Participă în biogeneza membranelor d) [ ] Temperatură
d) [ ] Comunică cu spaţiul perinuclear e) [ ] pH
e) [ ] Suprafaţa membranelor are numeroşi ribozomi
---------------------------------------------------------------------
---------------------------------------------------------------------
20. CS Reticulul endoplasmatic participă la:
14. CS Din nucleu în citoplasmă se transportă: a) [x] Sinteza proteinelor
a) [ ] Diverse enzime b) [ ] Sinteza ADN
b) [x] Subunităţile ribozomilor c) [ ] Identificarea substanţelor straine
c) [ ] Nucleotidele d) [ ] Sinteza ARN
d) [ ] ATP e) [ ] Transportarea aminoacizilor spre ribozomi
e) [ ] Aminoacizii
---------------------------------------------------------------------
---------------------------------------------------------------------
21. CS Plasmalema la eucariote se reînnoieşte:
15. CS Replicarea ADN la eucariote are loc: a) [ ] În mitocondrii
a) [ ] Toate enunţurile sunt false b) [ ] În lizozomi
b) [ ] După tipul nematricial c) [x] În RE
c) [ ] După tipul dispers d) [ ] În nucleu
d) [x] Semiconservativ e) [ ] În peroxizomi
e) [ ] Conservativ
---------------------------------------------------------------------
---------------------------------------------------------------------
22. CS Replicarea este un proces caracteristic:
a) [ ] Numai virusurilor 28. CS ARN-polimeraza I efectuează:
b) [ ] Toate răspunsurile sunt false a) [ ] Sinteza ARNm
c) [x] Tuturor sistemelor vii b) [ ] Reparaţia ADN
d) [ ] Numai procariotelor c) [ ] Transcripţia genelor ARNt
e) [ ] Numai eucariotelor d) [x] Sinteza transcriptului ARNr 45S
e) [ ] Sinteza ADN
---------------------------------------------------------------------
---------------------------------------------------------------------
23. CS Care din afirmaţiile menţionate este corectă?
a) [ ] Meioza se referă la diviziunea directă 29. CS Intronii pot fi localizaţi în:
b) [ ] În rezultatul meiozei se formează 4 celule diploide a) [ ] Genele pentru ARNr la om
c) [ ] Meioza reprezintă o diviziune simplă ecvaţională b) [ ] Genele mitocondriale umane
d) [x] În meioză are loc reducerea numărului de cromozomi c) [x] Genele structurale nucleare
e) [ ] Meioza asigură regenerarea ţesuturilor d) [ ] Majoritatea genelor la procariote
e) [ ] Spaţiile intergenice
---------------------------------------------------------------------
---------------------------------------------------------------------
24. CS Transcripţia este:
a) [ ] Sursa modificărilor structurale ale materialului 30. CS "CAP"-area ARNm precursor asigură:
ereditar a) [ ] Splicingul
b) [ ] Dublarea semiconservativă a ADN b) [ ] Replicarea ADN
c) [ ] Sinteza polipeptidului c) [ ] Denaturarea ADN
d) [ ] Decodificarea informaţiei ereditare d) [x] Stabilitatea moleculelor de ARNm
e) [x] Copierea informaţiei ereditare înregistrată în genă e) [ ] Repararea ADN

--------------------------------------------------------------------- ---------------------------------------------------------------------

25. CS Fragmentele de restricţie: 31. CS Translaţia este:


a) [ ] Fiecare fragment reprezintă o genă a) [ ] Sinteza ARNm
b) [ ] Conţin numai exoni b) [ ] Eliminarea secvenţelor neinformative ale ARNm -
c) [ ] Sunt întotdeauna de aceiaşi lungime precursor
d) [ ] Sunt monocatenare c) [x] Decodificarea informaţiei ARNm
e) [x] Se obţin în urma clivării ADN cu restrictaze d) [ ] Sinteza semiconservativă a ADN-lui
e) [ ] Schimbarea structurii materialului genetic
---------------------------------------------------------------------
---------------------------------------------------------------------
26. CS Porii membranelor nucleare fac legătura nucleului
cu: 32. CS Enzima implicată în translaţie este:
a) [ ] Exteriorul celulei a) [ ] ARN-polimeraza I
b) [ ] Ribozomii b) [x] Aminoacil -ARNt-sintetaza
c) [ ] Mitocondriile c) [ ] Primaza
d) [x] Citoplasma d) [ ] Helicaza
e) [ ] Aparatul Golgi e) [ ] Topoizomeraza

--------------------------------------------------------------------- ---------------------------------------------------------------------

27. CS Componentele nucleolului: 33. CS Processing-ul ARNm precursor are loc in:
a) [ ] Secvenţe de ADN ce codifică ARNt a) [ ] Aparatul Golgi
b) [ ] Gene ce codifică ARNm b) [ ] Citoplasmă
c) [ ] Gene ce codifică ARNt 5S c) [x] Nucleu
d) [ ] O membrană d) [ ] Ribozomi
e) [x] Secvenţe de ADN ce codifică ARNr e) [ ] Reticulul endoplasmatic

--------------------------------------------------------------------- ---------------------------------------------------------------------
+ +
34. CS Pompa Na -K :
a) [ ] Reglează nivelul pH-ului celular
b) [ ] Este prezentă numai în plasmalemă
c) [ ] Este o variantă de sinport
+
d) [ ] Asigură importul ionilor de Na
e) [x] Asigură diferenţa de potenţial membranar

--------------------------------------------------------------------- a) [ ] n=2c
b) [ ] n=c
35. CS Heterocromatina NU se deosebeşte de eucromatină c) [x] 2n=4c
după: d) [ ] 2n=2c
a) [ ] Colorare e) [ ] 4n=4c
b) [ ] Nivelul de compactizare
c) [x] Compoziţia chimică ---------------------------------------------------------------------
d) [ ] Funcţiile îndeplinite
e) [ ] Activitatea genetică 40. CS Identificati situsul peptidil-transferazei:

---------------------------------------------------------------------

36. CS Secvenţa genei care asigură interacţiunea cu factori


proteici de transcriptie este:
a) [ ] Terminatorul
b) [ ] Operonul
c) [ ] Exonul
d) [x] Promotorul
e) [ ] Intronul

---------------------------------------------------------------------
a) [ ] R
37. CS Ce codon al ARNm corespunde codonului ATC din b) [ ] A
ADN? c) [x] T
a) [ ] UAC d) [ ] E
b) [ ] AUG e) [ ] P
c) [x] AUC
d) [ ] UAG ---------------------------------------------------------------------
e) [ ] ATC
41. CM Fagocitoza:
--------------------------------------------------------------------- a) [x] Se poate realiza prin reacţia ligand-receptor
b) [ ] Asigură transportul macromoleculelor din celulă în
38. CS Sunt baze complementare: spaţiul extracelular
a) [ ] Guanina şi Uracilul c) [ ] Se poate realiza prin reacţia ligand-ligand
b) [ ] Timina şi Guanina d) [x] Reprezintă o variantă a endocitozei
c) [ ] Guanina şi Adenina e) [ ] Se realizează cu ajutorul unei proteine-transportor
d) [ ] Timina şi Uracilul
e) [x] Adenina şi Timina ---------------------------------------------------------------------

--------------------------------------------------------------------- 42. CM Determinaţi numărul şi lungimea fragmentelor de


restricţie, obţinute cu ajutorul HpaI care produce capete
39. CS Selectati formula caracteristica celulei: neadezive. Selectaţi schema electroforezei
corespunzătoare fragmentelor obţinute (m - marcher al
lungimii).
a) Situsul de restricţie: GTTAAC
CAATTG
b) Secvenţa de ADN: d) [x] Asigură elasticitatea membranei
e) [ ] Are rol catalitic
5'-
CATACGATCGTTAACCTTTACCCAGGGATACAGGG
---------------------------------------------------------------------
AAATAGGTTAACTTTTA-3'
3'-GTATGCTAGCAATTGGAAATGGGTCCCTATGT
46. CM Prin complexele porilor nucleari trec:
CCC TTTATCCAATTGAAAAT-5'
a) [x] Proteinele ribozomale
c) Electroforeza diferitor fragmente de ADN (selectaţi b) [x] ARNt
varianta corectă). c) [ ] Nucleolii
d) [x] ARNm
e) [x] Histonele

---------------------------------------------------------------------

47. CM Secvenţele reglatoare ale transcripţiei sunt:


a) [x] Terminatorul
b) [ ] Secventa lider
c) [x] Promotorul
d) [x] Enhacerul
e) [ ] Intronii

---------------------------------------------------------------------

a) [x] cu ajutorul HpaI se obtin 3 fragmente de restrictie 48. CM Din componenţa învelişului nuclear face parte:
b) [ ] varianta corecta a electroforezei este C a) [ ] O membrană
c) [x] varianta corecta a electroforezei este B b) [ ] Nucleolul
d) [ ] varianta corecta a electroforezei este A c) [x] Lamină nucleară
e) [ ] cu ajutorul HpaI se obtin 4 fragmente de restrictie d) [x] Două membrane
e) [x] Complexul porilor

--------------------------------------------------------------------- ---------------------------------------------------------------------

43. CM Catena matriţă şi noua catenă de ADN sintetizată: 49. CM Criteriile de bază ce caracterizează biosistemele
a) [ ] Sunt unite prin legături fosfodiesterice sunt:
b) [x] Sunt complementare a) [x] Autoregenerarea
c) [x] Sunt unite prin punţi de hidrogen b) [x] Autoreproducerea
d) [ ] Sunt identice c) [x] Prezenţa unui program genetic
e) [x] Sunt diferite d) [ ] Structura şi funcţia constantă în timp
e) [x] Autoreglarea
---------------------------------------------------------------------
---------------------------------------------------------------------
44. CM Fragmentele Okazaki:
a) [x] Reprezintă secvenţe scurte de ADN 50. CM În procesul iniţierii replicării intervin:
b) [ ] Reprezintă secvenţe scurte de ARN a) [ ] Telomerazele
c) [ ] Sunt eliminate în faza de terminaţie a replicării b) [x] ADN-polimerazele
d) [x] Sunt sintetizate discontinuu pe catena întârziată c) [x] ADN helicaza
e) [ ] Iniţiază sinteza catenelor noi de ADN d) [x] Primazele
e) [ ] Ligazele
---------------------------------------------------------------------
---------------------------------------------------------------------
45. CM Colesterolul are următoarele funcţii în membrana
bologică: 51. CM Processingul ARNm include:
a) [x] Conferă rezistenţă mecanică plasmalemei a) [x] "CAP"area
b) [ ] Are rol de receptori b) [x] Excizia intronilor
c) [ ] Conferă individualitate plasmalemei c) [ ] Translaţia
d) [x] Poliadenilarea componente:
e) [ ] Transcripţia a) [x] ARN
b) [x] ATP
--------------------------------------------------------------------- c) [ ] ADN
d) [x] Enzime
52. CM Legăturile fosfodiesterice sunt caracteristice e) [x] Aminoacizi
pentru:
a) [ ] Acizi graşi ---------------------------------------------------------------------
b) [x] ARN
c) [x] ADN 58. CM Membrana biologică este determinată de prezenţa
d) [ ] Polipeptide obligatorie a:
e) [ ] Lipide a) [ ] Colesterolului
b) [ ] Polizaharidelor
--------------------------------------------------------------------- c) [ ] Acizilor nucleici
d) [x] Fosfolipidelor
53. CM Funcţiile ARNt: e) [x] Proteinelor
a) [x] Traducerea succesiunii codonilor din ARNm într-o
secvenţă specifică de aminoacizi ---------------------------------------------------------------------
b) [ ] Transmiterea informaţiei genetice din nucleu în
citoplasmă 59. CM Ciclul celular:
c) [x] Transportul selectiv al aminoacizilor la ribozomi a) [x] Constă din interfază şi mitoză
d) [x] Decodificarea informaţiei genetice b) [x] La eucariotele superioare durează 10-25 ore
e) [ ] Participă în transcripţie c) [ ] Cromatina în interfază este maximal condensată
d) [x] Interfaza ocupă 90% din durata ciclului celular
--------------------------------------------------------------------- e) [x] Interfaza asigură condiţiile necesare pentru mitoză

54. CM Componente necesare pentru tehnica PCR: ---------------------------------------------------------------------


a) [x] Patru tipuri de dezoxiribonucleozidtrifosfaţi
b) [ ] Restrictaze 60. CM RE neted:
c) [x] ADN genomic a) [ ] Lumenul canalelor reprezintă continuarea spaţiului
d) [x] Enzima Taq-polimeraza perinuclear
e) [x] Primeri sintetici b) [ ] Controlează biosinteza lamininei şi colagenului
c) [x] Este responsabil de biosinteza hormonilor steroizi şi
--------------------------------------------------------------------- a colesterolului
d) [x] Comunică cu cisternele RE rugos
55. CM Heterocromatina se caracterizează prin: e) [x] Participă la detoxificarea xenobioticelor
a) [ ] Este slab colorată
b) [x] Formează cromocentri ---------------------------------------------------------------------
c) [x] Se replică tardiv în perioada S a ciclului celular
d) [ ] Este activă genetic 61. CM Determinaţi etapele PCR:
e) [x] Nu se transcrie a) [ ] Sinteza primerilor
b) [ ] Digestia cu restrictaze
--------------------------------------------------------------------- c) [x] Sinteza enzimatică a ADN
d) [x] Unirea complementară a primerilor
56. CM Transportul macromoleculelor şi corpusculilor e) [x] Denaturarea ADN nou sintetizat
poate fi:
a) [ ] Prin ionofori ---------------------------------------------------------------------
b) [x] Vezicular
c) [ ] În direcţia gradientului electrochimic 62. CM Aminoacil - ARNt -sintetaza:
d) [ ] Prin difuzie simplă a) [x] Leagă, aminoacidul la capătul 3' al ARNt
e) [x] Prin endocitoză b) [x] Adaptează aminoacizii la ARNt corespunzător
c) [x] Este o enzimă specifică fiecarui aminoacid
--------------------------------------------------------------------- d) [ ] Este o enzimă care participă în replicarea ADN
e) [ ] Este factor proteic în iniţierea transcripţiei
57. CM Pentru translaţie sunt necesare următoarele
--------------------------------------------------------------------- d) [ ] 5
e) [x] 1
63. CM Transcripţia la eucariote se finalizează cu sinteza:
a) [x] Structurii monocatenare ---------------------------------------------------------------------
b) [x] ARNm monocistronic
c) [ ] Structurii dublucatenare 67. CM Cromozomul metafazic este bicromatidian
d) [ ] ARNm policistronic deoarece:
e) [x] ARNm precursor a) [ ] Este format dintr-un braţ proximal şi unul distal
b) [ ] Conţine o moleculă de ADN şi una de ARN
--------------------------------------------------------------------- c) [x] Reprezintă materialul genetic dublat
d) [ ] Este format din eucromatină şi heterocromatină
64. CM Care afirmaţii pentru codul genetic sunt FALSE? e) [x] Este format din două molecule identice de ADN
a) [x] Un codon codifică diferiţi aminoacizi la diferite
specii ---------------------------------------------------------------------
b) [x] Conţine semne de punctuaţie între codoni
c) [ ] Fiecare nucleotid participă la un singur codon 68. CM Selectaţi caracteristicile mitozei:
d) [x] Mai frecvent aminoacidul este codificat de un singur a) [x] Are loc blocarea transcripţiei
codon b) [ ] Este o diviziune a celulelor sexuale
e) [ ] Fiecare aminoacid este codificat de trei nucleotide c) [x] Este o diviziune caracteristică celulelor somatice
d) [x] Este o diviziune ecvaţională
--------------------------------------------------------------------- e) [x] Are loc separarea cromatidelor surori

65. CM Biologia moleculară studiază: ---------------------------------------------------------------------


a) [x] Diviziunea şi moartea celulelor
b) [x] Macromoleculele, interdependenţa dintre structură şi 69. CM Enzimele de restricţie:
funcţie a) [x] Se utilizează de geneticieni în calitate de "foarfece"
c) [ ] Forma şi structura celulelor, ţesuturilor şi organelor b) [ ] Realizează reparaţia ADN
d) [x] Mecanismele realizării programului biologic c) [x] Hidrolizează ADN în fragmente
(genetic) d) [ ] Recunosc situsurile de restricţie din ARN
e) [x] Bazele moleculare ale proprietăţilor universale ale e) [x] Pot forma fragmente cu capete adezive
vieţii
---------------------------------------------------------------------
---------------------------------------------------------------------
70. CM Selectati elementele caracteristice genelor
66. CM Identificati celulele cu formula cromozomiala nucleolare:
2n=2c: a) [x] Terminator
b) [x] Promotor
c) [ ] Silencer
d) [ ] Secventa lider
e) [ ] Enhancer

---------------------------------------------------------------------

71. CM Caracteristic ADN-ului nuclear este:


a) [x] Contine secvente codante, necodante si reglatoare
b) [x] Are foma lineara
c) [x] Asociat cu proteine histone
d) [ ] Se replica si se transcrie permanent
e) [ ] Are forma inelara

---------------------------------------------------------------------

72. CM Alegeţi afirmaţiile care caracterizează aminoacil-


a) [x] 7
ARNt -sintetaza:
b) [ ] 3
a) [x] Este specifică pentru fiecare tip de aminoacid
c) [x] 8
b) [x] Asigură legarea aminoacidului la molecula de ARNt ---------------------------------------------------------------------
respectiv
c) [ ] Participă la translocarea ribozomului 78. CM Matricea nucleară:
d) [x] În celulă există 20 tipuri a) [x] Menţine dimensiunea şi forma nucleului
e) [ ] Este sintetizată în nucleu b) [ ] Nu conţine enzime
c) [x] Este bogată în proteine nehistone
--------------------------------------------------------------------- d) [ ] Este structural stabilă
e) [x] Conţine molecule neorganice
73. CM Care sunt funcţiile moleculelor de ARN într-o
celulă eucariotă? ---------------------------------------------------------------------
a) [ ] Transmite mesajul genetic la descendenţi
b) [ ] Transportă ADN 79. CM Evenimente ale profazei mitozei sunt:
c) [ ] Păstrează mesajul genetic a) [x] Condensarea cromozomilor
d) [x] Realizeaza mesajul genetic b) [x] Asamblarea microtubulilor in fibrele fusului de
e) [x] Traduce mesajul genetic diviziune
c) [ ] Dispunerea cromozomilor in plan ecuatorial
--------------------------------------------------------------------- d) [x] Maturizarea kinetocorilor de ambele părţi ale
centromerilor
74. CM Genele de clasa I: e) [ ] Activarea transcripţiei genelor
a) [x] La om sunt localizate оn cromozomii 13, 14, 15, 21,
22 ---------------------------------------------------------------------
b) [x] Se repetă de mai multe ori în acelaşi cromozom
c) [x] Un promotor asigură transcrierea unui grup de gene 80. CM Selectati celulele carora le corespunde 2n=4c:
d) [x] La om sunt lipsite de introni
e) [ ] Codifică pentru toate tipurile de ARNr

---------------------------------------------------------------------

75. CM Nivelul primar de organizare a proteinelor este


determinat de:
a) [x] Legăturile covalente
b) [x] Ordinea aminoacizilor în lanţul polipeptidic
c) [ ] Formarea legăturilor de hidrogen
d) [ ] Orientarea lanţului polipeptidic în direcţia 3' - 5'
e) [ ] Legăturile fosfodiesterice

---------------------------------------------------------------------

76. CM Structura secundară a polimerilor este determinată a) [ ] 1


de legăturile: b) [x] 3
a) [x] Necovalente c) [ ] 4
b) [ ] Fosfodiesterice d) [x] 5
c) [ ] Covalente e) [ ] 2
d) [ ] Peptidice
e) [x] De hidrogen ---------------------------------------------------------------------

--------------------------------------------------------------------- 81. CM Etapele clonării in vivo sunt:


a) [x] Obţinerea fragmentului de interes pentru clonare
77. CM In anafaza II a meiozei are loc: b) [x] Obţinerea ADN recombinat
a) [ ] Separarea cromozomilor omologi c) [x] Transferul ADN recombinat în celula gazdă
b) [x] Disjuncţia cromatidelor d) [x] Selecţia vectorului de clonare şi digestia cu
c) [ ] Dispariţia anvelopei nucleare restrictaze
d) [x] Deplasarea cromatidelor spre polii celulei e) [ ] Hibridizarea specifică a ADN genomic cu ADN -
e) [ ] Organizarea fusului de diviziune primeri
--------------------------------------------------------------------- ---------------------------------------------------------------------

82. CM Iniţierea replicării este controlată de: 88. CM Celula reprezintă baza:
a) [ ] Promotor a) [ ] Activităţii vitale numai a formelor celulare
b) [ ] Fragmentul Okazaki b) [x] Organizării majorităţii formelor de viaţă
c) [x] Primază c) [x] Activităţii vitale a formelor celulare şi acelulare
d) [x] ADN-polimerază d) [ ] Dezvoltării numai a formelor acelulare de viaţă
e) [x] Situsul ORI e) [x] Dezvoltării formelor celulare şi acelulare

--------------------------------------------------------------------- ---------------------------------------------------------------------

83. CM Componente ale aparatlui de transcriptie ale genei 89. CM Organitele membranare ale celulei:
insulinei pot fi: a) [x] Mitocondriile
a) [x] ATP b) [x] Aparatul Golgi
b) [ ] dATP c) [x] Peroxizomii
c) [x] ARN-polimeraza d) [ ] Ribozomii
d) [x] UTP e) [x] RE
e) [ ] ADN-polimeraza
---------------------------------------------------------------------
---------------------------------------------------------------------
90. CM Componente ale plasmalemei pot fi:
84. CM Ochiul de replicare se formează cu participarea: a) [x] Opsina
a) [x] Helicazelor b) [x] Receptorul insulinic
b) [ ] ADN-polimerazelor c) [x] H+-ATPaza
c) [x] Proteinelor SSB d) [ ] Receptorul androgenic
d) [ ] Primazei e) [x] Aquaporina
e) [x] Topoizomerazelor
---------------------------------------------------------------------
---------------------------------------------------------------------
91. CM In metafaza I cromozomii sunt:
85. CM Biosistemele se caracterizează: a) [x] Bicromatidieni
a) [ ] Sunt independente de mediu b) [ ] Tetracromatidieni
b) [x] Prin organizare ierarhializată c) [x] Condensaţi la maxim
c) [ ] Prin omogenitatea elementelor d) [ ] Despiralizaţi
d) [x] Prin integritate e) [ ] Monocromatidieni
e) [x] Sunt sisteme deschise
---------------------------------------------------------------------
---------------------------------------------------------------------
92. CM Bivalenţii sunt:
86. CM În anafaza I a meiozei au loc următoarele procese: a) [x] Doi cromozomi omologi bicromatidieni
a) [ ] Dublarea cantităţii de ADN b) [x] Formaţi în timpul meiozei
b) [ ] Spiralizarea şi condensarea cromozomilor c) [ ] Doi cromozomi neomologi bicromatidieni
c) [x] Separarea cromozomilor omologi d) [ ] Formaţi în timpul mitozei
d) [ ] Conjugarea cromozomilor omologi şi formarea bivalenţilor e) [ ] Două cromatide nesurori
e) [x] Deplasarea cromozomilor spre polii celulei
---------------------------------------------------------------------
---------------------------------------------------------------------
93. CM Peroxizomii conţin:
87. CM Prezenţa azotului este obligatorie în: a) [x] Catalaze
a) [x] ATP b) [ ] Hidrolaze
b) [ ] Glucide c) [x] Oxidaze
c) [ ] Lipide d) [ ] Fosfataze
d) [x] Proteine e) [ ] Polimeraze
e) [x] Acizii nucleici
---------------------------------------------------------------------
lungul cromozomului
94. CM Promotorul genelor determină: d) [ ] Secvenţe de ADN bogate în gene structurale
a) [x] Interacţiunea cu factorii proteici de transcripţie e) [x] Regiunile telomerice
b) [ ] Locul de incepere a sintezei proteinei
c) [x] Catena care va fi transcrisă ---------------------------------------------------------------------
d) [x] Direcţia de transcripţie
e) [ ] Interacţiunea cu ADN-polimeraza 100. CM Caracteristica intronilor:
a) [ ] Se conţin în toate genele eucariote
--------------------------------------------------------------------- b) [x] De obicei au o lungime mai mare decit cea a
exonilor
95. CM Citochineza: c) [x] Se găsesc în regiunea transcrisă a genei
a) [x] Separarea masei citoplasmatice şi a organitelor în două d) [ ] Conţin situsul de iniţiere a translaţiei
jumătăţi e) [x] Sunt prezenţi în transcriptul primar
b) [ ] Dublarea constituenţilor citoplasmatici
c) [x] Finalizează diviziunea celulară
d) [x] Formarea a două celule fiice identice genetic şi diferite
după conţinutul organitelor
e) [ ] Formarea a două celule fiice identice genetic şi după
conţinutul componentelor celulare

---------------------------------------------------------------------

96. CM Responsabili de transmiterea IG sunt:


a) [ ] Moleculele de ARN
b) [x] Moleculele de ADN
c) [x] Proteinele aparatului de replicare
d) [ ] Proteinele aparatului de transcriptie
e) [ ] Proteinele aparatului de translatie

---------------------------------------------------------------------

97. CM Care din următoarele afirmaţii despre codon sunt


corecte:
a) [x] Există codon iniţiator, de la care se începe sinteza
polipeptidului
b) [x] Există codon fără sens
c) [x] Sunt codoni cu sens identic
d) [ ] Constă din două nucleotide
e) [ ] Un codon codifică diferiţi aminoacizi

---------------------------------------------------------------------

98. CM Genele structurale codifică pentru:


a) [ ] ARNt
b) [ ] Hidraţi de carbon
c) [ ] ARNr
d) [x] Polipeptide
e) [x] ARNm

---------------------------------------------------------------------

99. CM Heterocromatina constitutivă este reprezentată de:


a) [x] Secvenţe de ADN repetitiv
b) [x] Regiunea constricţiilor primare
c) [x] Secvenţe de ADN ce separă genele structurale de-a