Sunteți pe pagina 1din 36

Universitatea de Stat Alecu Russo, Bli Facultatea de tiine ale naturii i Agroecologie Catedra de biologie, chimie i geografie

ndrumar la rezolvarea problemelor Disciplina: Genetica Specialitile: Geografie i biologie Biologie i chimie Didactica biologiei

Autor: Maria NICORICI, dr. conf. univ.

Bli - 2010

CZU: 575 (076.5) Aprobat pentru editare la edina catedrei din 27.10.2009, proces verbal nr.3 i a Consiliului facultii din 23.12.2010, proces verbal nr.4 Recenzeni: Valeriu VOZIAN, director general, dr., conf. cercet., eful laboratorului de Genetic i Ameliorare a plantelor, ICCC Selecia, m. Bli Zinaida DOLIN, profesor de biologie, grad didactic superior, Colegiul de industrie uoar, m. Bli Lucrarea de fa conine algoritmul realizrii lucrrilor practice la genetic. Se recomand ca material didactic suport pentru profesorii de biologie, studenilor i masteranzilor de la specialitile: biologie i chimie, geografie i biologie.

ndrumar la rezolvarea problemelor la disciplina Genetica / elab.: Maria Nicorici; Universitatea de Stat Alecu Russo din Bli, Facultatea de tiine ale Naturii i Agroecologie. Bli: Presa univ. blean, 2011. 34 p. 50 ex. ISBN 978-9975-50-062-3. 575(076.5) I-50

Tema 1: Rezolvarea problemelor la modelarea codului genetic Obiective: S aplice codul genetic la rezolvarea problemelor; S modeleze algoritmul rezolzrii problemelor. Materiale necesare: Plane: Codul genetic; Acizii nucleici; Biosinteza proteinelor Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999. Gh. Guleaev. Problemar la genetic, 1998. ntrebri pentru autoevaluare: Explicai: a. Structura chimic a ARN, ADN; b. Structura proteinelor; c. Codonul: structura, funciile; d. Componena tripletelor ce codific diferii aminoacizi; e. Definiia genei; f. Principiile reduplicrii ADN (acidul dezoxiribonucleic). Realizarea sarcinilor: Sarcin didactic (SD) 1: Determinarea structurii ADN dup structura proteinei Problema 1 (model): Un fragment a moleculei de protein (mioglobina) are urmtoarea distribuie a aminoacizilor: val - ala glu tir ser glu. Determinai structura fragmentului moleculei ADN ce codific consecutivitatea aminoacizilor. Rezolvare: 1) Folosind tabela codului genetic determinm codonul pentru fiecare aminoacid (codul ARN-m (i) UUG CUG GUG - ... Succesiunea dat de nucleotide determin (reprezint) catena moleculei a ARN-m(i). 2) Dup aceasta se determin prima caten a ADN, care a codificat sructura ARN-m(i). Sub fiecare codon a ARN-m(i) se transcrie conform principiului de complementaritate codoanele moleculei de ADN: AAT- GAC- CAC- TAT- ... 3) Dat fiind faptul c molecula de ADN are dou catene, sub codoanele primei catene se nscriu i codoanele pentru catena a II-a : catena I-a ADN-lui: AATGACCACTAT

catena a II-a ADN- lui: TTACTGGTGA TA Asociind nucleotidele primei catene cu nucleotidele catenei a doua prin legturi de hidrogen se obine un fragment al moleculei de ADN. Problema 2: Un fragment al moleculei de ADN are urmtoarea succesiune a nucleotidelor: TAAACTGCGAAATCTGAAGTC. Determinai structura i succesiunea aminoacizilor n catena polipeptidic, codificat n poriunea genei propuse. Rezolvare: 1) Conform problemei se propune o caten de ADN. Dup principiul complementaritii determinm catena ARN-m(i). ADN: TAAACTGCGAAATCTGAAGTC

ARN-i: AUUUGACGCUUUAGACUUCAG Izo - stop - arg - fen - arg - leu - gli 2) Se determin codonii iar conform tabelei - denumirea aminoacizilor. Rspuns: Succesiunea aminoacizilor n catena polipepdidic a moleculei de protein este urmtoarea: Izo - arg fen arg leu - gli. Sarcin didactic (SD) 2: Determinarea structurei ARN-m(i) dup structura ADN Rezolv de sine stttor Problema 3: Un fragment al catenei de ADN are urmtoarea succesiune a nucleotidelor: AAAGATCACATATTTCTGTTACT. Determinai structura moleculei ARN-m(i) ce se formeaz n rezultatul transcripiei pe poriunea dat de ADN. Problema 4: Ce schimbri vor surveni n structura proteinei, dac n fragmentul moleculei de ARN - m (i) cu urmtoarea succesiune a nucleotidelor: AUAGUCAUGUUACUG va fi nlocuit nucleotida din poziia a 7 cu citozin, iar din poziia a 2 cu adenin ? Sarcin didactic (SD) 3: Determinarea structurii moleculei proteice dup structura moleculei de ARN-m (i) Problema 5: Un fragment al ARN-m(i) posed urmtoarea succesiune a nucleotidelor: GUG- UUG- UUC- UCG- UUU- AUA- AUC- UGA- UAA. Ce aminoacizi va transporta ARN t (s) la locul de sintez a proteinelor i ce anticodoane va purta ARN t (s) ? Rezolvare: 1) Folosind tabela codului genetic determinm anticodoanele ARN-t i respectiv denumirile aminoacizilor transportai la locul de sintez a proteinelor. ARN-m (i): GUG UUG UUC UGG UUU AUA - ... Val Anticodonii ARN-t (s): leu fen tre fen met CAC AAC AAG ACC AAA UAU - ...

his

ile

liz

tre

liz

tir

Rspuns: Anticodonii ARN-t (s) sunt: CAC AAC AAG Rezolv de sine stttor (problemele 6, 7, 8 din Culegeri de probleme la genetic de N.V. Helevin i al., 1998). Problema 6 (se rezolv de sine stttor): Un fragment al catenei de ADN are urmtoare succesiune a codonilor: AAG GAA TAT ACC ATA CGA GTA ATT TTT. Determinai care codoni vor intra n componena ARN-m(i) i n ce consecutivitate vor fi inclui? Problema 7 (se rezolv de sine stttor): Determinai structura primar a proteinei, care se sintetizeaz pe fragmentul ARN-m(i) cu urmtoarea succesiune a nucleotidelor: AUCGUUCUCUAAAUAGUGUAUCUU. Problema 8 (se rezolv de sine stttor): Fragmentul catenei A a insulinei const din 5 aminoacizi: glicin izoleucin valin glutamin - glutamin. Determinai structura fragmentului ARN-m(i), ce codific poriunea dat a insulinei. Sarcin didactic (SD) 3: Determinarea coefcientului de specificitate (A+T/G+C). Problema 9: Segmentul lanului B la insulin const din urmtorii aminoacizi: fen val asp glu his leu cis gli - his. Determinai raporturile cantitative de adenin + timin i guanin + citozin (A + T i G + C) n lanul ADN, ce codific acest segment al insulinei. Rezolvare: 1) Folosind tabela codonului ARN-m determinm codonii respectivi de ARN-m: UUU, GUU, GAU, CAG, CAU, UUA, UGA, GGU, UCU, CAU. 2) Se transcrie informaia de pe catena respectiv pe catena ADN-I: ADN-I: AAACAACTAGTGG... 3) Deoarece molecula de ADN este bicatenar se nscrie i a doua caten a ADN-lui, folosind principiul complementaritii. ADN-I: AAACAACTAGTGG. ADN-II: TTTGTT... 4) Se calculeaz apoi totalitatea bazelor adenilice A = (20), guanilice G = (10), timidinice T = (20), citidilice C = (10); 5) Se alctuiete raportul A+T/G+C = 20+20/10+10 = 2,0. Rspuns: Coeficientul de specificitate variaz n limite foarte mari la bacterii, la plante i animalele inferioare. La plantele superioare i la animalele vertebrate el se apropie de 1,5. Motivai de ce ? Reinei: 1. Triplete (codoane) non - sens: UAA , UAG, UGA.

2. Triplete de iniiere: AUG , GUG. Test de consolidare a cunotinelor: 1.Cte triplete de ARN-m(i) pot fi dispuse n centrul funcional al ribosomului? a) 1; b) 2; c) 3; d) 4. 2. Care din acizii nucleici servesc ca matrice n biosinteza proteinelor n procesul translaiei? a) ADN; b) ARN-m(i); c) ARN-t; d) ARN-r. 3. Dac codonul ADN este AAT, care din urmtorii codoni i sunt complimentari? a) UUA; b) AAU; c) CCA; d) GTG. 4. De ce depinde succesiunea distribuirii nucleotidelor n molecula de ARN-m(i)? a) Succesiunea aminoacizilor n molecula proteic; b) Succesiunea nucleotidelor n ADN; c) Fermentul ADN - polimeraza; d) Structura nucleotidului. 5. Determinai codoanele ARN-m(i) ce semnific sfritul transcripiei? a) UAA; b) UAT; c) UTA; d) AAG. 6. Determinai tripletele ARN-m(i) ce semnific iniierea transcipiei? a) AUG; b) AUU; c) UUG; d) AAG. 7. Care din tipurile de ARN transport aminoacizii la locul biosintezei proteinelor? a) ARN-m(i); b) ARN-r; c) ARN-t; d) ARN-m(i). 8. Un fragment al moleculei de ADN are urmtoarea succesiune a nucleotidelor: ACGCAACCACA. Determinai aminoacizii ce vor fi codificai pe aceast poriune de fragment?

Tema 2: Determinarea claselor de gamei Obiective: S stabileasc tipurile de gamei pentru diferite genotipuri i fenotipuri; S determine numrul de gamei dup formul; S defineasc noiuni concrete la tema respectiv. Materiale necesare: Plane: ncruciarea monohibrid i dihibrid. Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai noiunile de: a. Homozigot; b. Heterozigot; c. Dihomozigot; d. Diheterozigot; Pentru rezolvarea nsrcinrilor reinei urmtoarele legiti: 1. Gameii se formeaz n rezultatul meiozei; 2. Gameii conin o jumtate din informaia ereditar; 3. Genele alele sunt plasate pe cromozomi omologi; 4. Genele nealele sunt plasate pe cromozomi neomologi. e. Gene alele; f. Gene nealele; g. Crossing-over; h. Caracter cuplate cu sexul;

Sarcin didactic (SD) 1: Determinai cte tipuri de gamei vor forma organismele care au urmtoarele genotipuri: AA; bb; Aa; MmPP; PpKk; Aabbcc; MmPpKk; AaBbCcDd. Pentru a determina tipurile de gamei este necesar a reine urmtoarele: La organismele homozigote dup o singur alel (AA) sau dup cteva (AAbbcc) tipuri de gene alele toi gameii vor fi la fel dup respectivele gene. De exemplu: AA (genotipul unei femele va forma ovule/oosfere cu gena A)

A
bb (genotipul unui mascul va forma spermatozoizi cu gena b) b b i b p Reinei: Homozigota n descenden formeaz un singur fel (tip) de gamei. b b b

n cazul dihomozigotei dup doua perechi de gene (AABB) se va forma un singur gamet, care va conine cte o gen alel de la fiecare pereche. P AABB genotipul genitorului

Gametul

AB
n cazul homozigotei dup trei perechi de gene AAccbb la fel se va forma un gamet n care vor fi plasate cte o gen de la fiecare pereche AAccbb Acb

Dar ci gamei va forma un tetrahomozigot? (scrie

genotipul i gameii

formai) Reinei: n cazul heterozigotei dup o gen (Aa) organismul va forma dou tipuri de gamei cu alele diferite

Aa

A
a

sau

Aa

A
a

Un diheterozigot (AaBb) va forma patru tipuri de gamei. Pentru calcul se folosete formula 2n, unde n - numrul de gene n stare heterozigot. La scrierea gameilor ne vom conduce de legea puritii gameilor fiecare gamet va purta cte o gen alel de la fiecare pereche. De exemplu: AaBb = 22 = 4 AB MmKk = 22 = 4

Ab aB ab MK Mk mk mK bA Aa aa Dar ci gamei va forma: aa 1. o triheterozigot MmPpKk ? 2n = 23 = 8 (................................................................). aa aA 2. un tetraheterozigot (...........................) (.................................................................). 3. citete genotipul urmtor (AABBCcDd) i determin clasele de gamei.

.....................................................................................................................................................................

Sarcina didactic 2. Determinarea tipurilor de gamei n caz de crossing-over Reinei: Unitatea de msur a crossing-over-ului este morganida. 1 morganid = 1%

Problem: Determinai cte tipuri de gamei i n ce raport procentual va forma organismul cu genotipul CcSs, dac distana dintre genele C i S = 3,5 % (sau uniti crossingovere i/sau recombinaii). Dac este indicat distana dintre gene, e clar c ele sunt dispuse liniar pe acelai cromozom omolog i ntre ele are loc crossingoverul. La aceti indivizi se vor forma dou tipuri de gamei: crossoveri i necrossoveri (n/cr). Cei necrossoveri vor constitui majoritatea, iar cei crossoveri minoritatea. Rezolvare:

Genotipul:

100 - 3,5 = 96,5 % 96,5 : 2 = 84,25 gamei ne/crossoveri 3,5 % : 2 = 1,75 % crossoveri (recombinani) c c

S Gameii: C C c

n/cr. 48,5%

crossov. 1,75% 1,75%

n/cr. 48,5%

Reinei legitatea de baz a crossing-over-ului: Dac genele de pe acelai cromosom sunt plasate la o distan mai mare una fa de alta, atunci posibilitatea crossing-overului este mai frecvent Rezolvai problema : Distana dintre genele A i B = 4,6 % (uniti crossovere). Determinai tipurile de gamei formai i cantitatea lor procentual pentru indivizii care posed urmtoarele genotipuri: AB ab Reinei: * Frecvena genelor recombinante semnific i distana dintre genele plasate pe acelai cromozom; * Frecvena recombinanilor = suma recombinanilor crossoveri / suma tuturor recombinanilor (crossoveri i necrosoveri) * 100% i A B ?

a b

Tema 3: ncruciarea monohibrid Obictive: S determine tipurile de ncruciri; S identifice caracterele dominante i recesive; S rezolve probleme i situaii de problem pivind ncrucirile monohibride. S argumenteze rezultatul obinut. Materiale necesare: Plane: ncruciarea monohibrid i dihibrid, machetul ncrucirilor. Bibliografie: N. V. Helevin i al. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai noiunile: a. ncruciare monohibrid; b. Caractere alternative; c. Caracter dominant; d. Caracter recesiv; e. Hibrid. Algoritmul rezolvrii unei probleme la genetic: Problemele la genetic ca i cele de matematic posed un algoritm asemntor de rezolvare. 1. nscrierea coninutului. Coninutul se scrie n simboluri. Se determin (caracterele fiecrui genitor/printe) i ce este necesar a determina (caracterele descendenilor): a. b. Pe primul loc se plaseaz mama cu simbolul (); pe locul doi - tata cu simbolul (). Genitorii luai pentru ncruciare se vor nsemna cu litera P; descendenii - cu litera F1, 2... (cifrele determin consecutivitatea descendenilor). c. Caracterul dominant se noteaz cu o oarecare liter majuscul a alfabetului A, B, K, iar alela recesiv cu aceiai liter minuscul a (A a; B b; K - k). n algoritmul de rezolvare se respect o anumit consecutivitate. La nceput se ntocmete: 1. genotipul genitorilor/prinilor; 2. fenotipul; 3. schema citologic; 4. grilajul lui Pennet pentru determinarea probabil a zigoilor (hibrizilor) obinui. Grilajul lui Pennet se ntocmete astfel: pe orizontal se pun gameii feminini, pe vertical cei masculini. n ptrelele formate se nscrie descendenii obinui la care se determin apoi fenotipul i genotipul; se calculeaz procentul claselor de hibrizi obinui etc.

10

2.

Condiiile problemei. La mazre culoarea galben domin culoarea verde. Au fost

ncruciate dou soiuri de mazre care aveau culoarea galben i verde a seminelor. Determinai fenotipul seminelor la hibrizii de F1? Se d: A - galben (AA, Aa) a - verde (aa) F1=? G F1 Aa (2n) Fenotipul: galben (100%) Genotipul: heterozigot (Aa -100%) 2) P Aa x aa g G A a v a a a (2n) A a (n) 3. Rezolvare: 1) P AA x aa (2n) g v

F1 Aa 1g 4. Rspuns: 1) Cnd este AA toi hibrizii de F1 sunt dup fenotip galbeni; iar dup genotip heterozigoi. 2) Cnd este Aa n descenden are loc o segregare de 1:1 sau de (50% - galbeni i 50% - verzi). Sarcin didactic 1. Determinarea genotipului i a fenotipului descendenilor dup genotipul prinilor. Problem (model): Culoarea cpruie a ochilor domin culoarea albastr. O femeie cu ochii albatri se cstorete cu un brbat cu ochii cprui. Determinai culoarea ochilor la descendenii de F1? aa 1v

50 % g : 50 % v

11

Rezolvare: Se d K - cprui (KK, Kk) k - albatri (kk) F1= ? G I P kk alb. x Kk (2n) cp. K k (n)

k
F1 Kk

kk

(2n)

fenotipul - 1 cprui : 1 albastru genotipul - 1Kk : 1 kk Rspuns: 50 % din descendeni au motenit culoarea cpruie i 50% culoarea albastr a ochilor. Propunei i varianta a II-a de rezolvare? Problem: Mioplegia (paralizie periodic) se motenete drept caracter dominant autozomal. Determinai probabilitatea naterii copiilor cu anomalii n familie, dac tata dup genotip este heterozigot, iar mama nu sufer de aceast maladie. Se d: M bolnav (Mm; MM) m sntos (mm) Rezolvare: P mm x sntos Mm bolnav (2n)

F1= ?

F1

Mm

mm

fenotipul : 1 bolnav : 1 sntos genotipul : 1 Mm : 1 mm Rspuns: 50 % din copiii nscui vor fi bolnavi de mioplegie. Propunei i varianta a II a de rezolvare? Problem (model): La tomate culoarea roie a fructelor domin culoarea galben. La ncruciarea tomatelor heterozigote cu cele galbene au fost obinute 352 plante cu fructe roii. Restul plantelor aveau fructe galbene. Determinai cte plante aveau culoarea galben?

12

Se d: A roie (AA P

Rezolvare Aa r x aa (2n) g

F1= ?

F1

Aa

aa 1 galben 352

(2n)

fenotipul: 1 rou : 352 :

Rspuns: Rezultatele ncrucirii corespund ncrucirilor de analiz, unde segregarea dup fenotip i genotip are loc n raport de 1: 1, deci plante cu fructe galbene sunt la fel n numr de 352. Sarcin didactic Nr. 2: Determinarea genotipului prinilor dup fenotipul descendenilor Problem (model): Gena polidactiliei este dominant, iar gena minii normale recesiv. n familia, unde mama are o structur normal a minii, iar tata este polidactil s-au nscut doi copii: unul cu ase degete, iar altul cu cinci. Determinai genotipul prinilor. Se d: P bolnav (PP, Pp) p sntos (pp) P (genotipul ) = ? G P pp

Rezolvare: x Pp (2n)

(n)

F1

Pp 1b :

pp 1s

(2n)

Rspuns: Genotipul este pp; genotipul este - Pp.

Problem (model): Gena dominant C determin manifestarea dizostozei la om (anomalie a scheletului scapulei i craniului). Gena recesiv determin structura normal a scheletului. O femeie cu structura normal a scheletului se cstorete cu un brbat bolnav. Copilul de la aceast cstorie are un schelet normal. Se poate determina genotipul tatlui dup fenotipul copilului?

13

Se d: C bolnav (CC, Cc) c sntos (cc)

Rezolvare: P cc x Cc (2n)

c
Genotipul (prinilor) = ? G

c
(n)

F1

Cc b 1 : s 1

cc

(2n)

Rspuns: Din coninutul problemei putem conchide c genotipul este Cc. Naterea copiilor sntoi ct i a celor bolnavi are loc n raport de 1:1 sau (50 % : 50 %). Tema 4. Ereditatea intermediar Problem: La barba mpratului (regina nopii) culoarea roie domin incomplet culoarea alb. Determinai fenotipurile i genotipurile descendenilor de la ncruciarea a dou plante heterozigote ? Reinei: n cazul ereditii intermediare segregarea n F2 dup fenotip i genotip are loc n raport de 1 : 2 : 1 Se d: R - rou r - alb Rr - roz F1 = ? F1 G P Rr roz

Rezolvare: x Rr roz (n) (2n)

R
RR

r
Rr rR

r
rr (2n)

Fenotipul: 1 rou Genotipul: Rspuns: 1RR :

: 2 roz : 1 alb 2Rr : 1 aa

Segregarea dup fenotip are loc n raport de: 1 rou : 2 roz : 1alb. 25% : 50% : 25% Segregarea dup genotip: 1AA : 2Aa : 1aa 25% : 50% : 25%.

14

Rezolv urmtoarele probleme: 1. De la ncruciarea a dou plante de barba mpratului au fost obinui: hibrizi roii; roz; albi. Determinai genotipul i fenotipul prinilor (genitorilor)? 2. La fasole culoarea neagr domin culoarea alb. ncruciind plante, obinute din semine negre, cu plante ce au semine albe, n descenden s-au obinut hibrizi cu semine negre. Poate oare fi stabilit genotipul mamei? 3. De la ncruciarea a doi genitori cu culoarea neagr a seminelor, descendenii obinui sunt cu semine de culoare neagr. Se poate de determinat genotipul prinilor? 4. Culoarea cpruie domin culoarea albastr a ochilor. O doamn cu ochii cprui (tatl crea avea ochii cprui, iar maic-sa albatri) se cstorete cu un domn cu ochii albatri, prinii cruia aveau ochii cprui. Determini genotipurile tuturor persoanelor nominalizate n problem? Verificai v cunotinele: 1. Completai schema formrii gameilor la o femel heterozigot i un mascul homozigot. Determin genotipul prinilor i gameii formai la femel i masculul respectiv.

2. Este oare posibil naterea descendenilor cu blan alb la speciile de oi de la prinii cu blana neagr? Argumentai rspunsul. 3. O plant crescut din semine de culoare verde a nflorit, s-a realizat apoi autopolenizarea, fecundarea, formarea zigotei i a seminelor. Determinai genotipul i fenotipul descendenilor (seminelor). Argumentai rspunsul. 4. La tomate creterea normal domin piticismul. Determinai genotipul plantelor, dac n descenden are loc o segregare a caracterelor n raport de 1: 1 i de 3 : 1? 5. Determinai tipurile de gamei pe care le poate forma individul cu urmtoarele genotipuri: a) AaBbcc; b) AaBbCcDd; c) aabbcc; d) AaBaDdCC ? Unele reguli care faciliteaz rezolvarea problemelor: 1. Dac de la ncruciarea a doi indivizi fenotipic asemntori n descenden se observ segregarea caracterilor, aceasta semnific faptul c indivizii sunt heterozigoi.

15

2. Dac de la ncruciarea indivizilor ce se deosebesc fenotipic dup o pereche de caractere i n descenden se observ o segregare dup aceleai caractere, atunci una din formele parentale este heterozigot, iar cealalt - homozigot dup gena recesiv. 3. Dac de la ncruciarea a doi indivizi fenotipic asemntori (dup o pereche de caractere) n F2 are loc o segregare dup fenotip i genotip n raport de 1 : 2 : 1, atunci merge vorba despre ereditatea intermediar, iar formele parentale au fost heterozigote. 4. Dac de la ncruciarea a doi indivizi cu acelai fenotip n descenden are loc o segregare dup fenotip n raport de 9 : 3 : 3 : 1, atunci indivizii sunt diheterozigoi. 5. Dac de la ncruciarea a doi indivizi cu acelai fenotip n descenden are loc o segregare dup fenotip n raport de: 9 : 7; 9 : 6 : 1; 12 : 3 : 1; 13 : 3; 15 : 1; 1: 14 : 1, atunci merge vorba despre interaciunea genelor nealele: 9 : 7; 9 : 6 : 1 - complementaritate; 12 : 3 : 1; 13 : 3 - epistatie dominant; 9 : 3 : 4 - epistatie recesiv; 15 : 1; 1 : 14 : 1 - polimerie.

Tema 5: ncruciarea dihibrid i polihibrid Obiective: S alctuiasc schema determinrii gameilor la ncruciarea dihibrid ; S determine raportul dup genotip i fenotip de la ncruciarea dihibrid i polihibrid; S argumenteze rezultatele obinute; S stabileasc frecvena fenotipului i a genotipului. Materiale necesare: Plane ncruciarea monohibrid, dihibrid; ncruciarile de analiz; Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai esena: a. ncrucirii dihibride; b. ncrucirii polihibride; c. a claselor de gamei formate; formula; d. genelor alele i a proprietilor lor; e. importanei legilor lui Mendel n medicin; Sarcin didactic 1: Rezolvarea problemelor cu aplicarea ncrucirilor di - i polihibride

16

Problem (model): La cobai forma crlionat a blnii (P) domina forma neted (p), iar culoarea neagr (B) - cea alb (b). O femel dihomozigot dup ambele gene dominante este ncruciat cu un mascul cu prul neted i alb. Determinai genotipul i fenotipul n F1 i F2 ? Se d: P - forma crlionat p - forma neted B - culoarea neagr b - culoarea alb F1 - ?, F2 - ? F1 PpBb (2n) G Rezolvare: I. P PPBB x ppbb c. n n. a (2n)

PB B

pb

(n)

Fenotipul: crlionat negru Genotipul: PpBb - diheterozigot Rspuns: descendenii de F1 au fenotipul crlionat negru, iar genotipul - PpBb (diheterozigot). Pentru determinarea descendenilor de F2 se vor ncrucia ntre ei hibrizii de F1: P PpBb PpBb

II.

(2n)

PB

Pb

pB

pb

PB

Pb

pB

pb v

Genele (n) fiecrui printe se combin liber ntre ele i fiecare printe formeaz cte 4 tipuri de gamei (n fiecare gamet nimerete cte o gen de la fiecare pereche). Pentru determinarea genotipurilor descendenilor alctuim grilagul lui Pennet: F2 PB Pb pB pb Rspuns: Segregarea dup fenotip se realizeaz n raport de: 9/16 (P-B-) : 3/16 (P-bb) : 3/16 (B-pp) : 1/16 (ppbb). PB PPBB c.n PPBb c.n PpBB c.n PpBb c.n Pb PPBb c.n PPbb c.a PpBb c.n Ppbb c.a pB PpBB c.n PpBb c.n ppBB n.n ppBb n.n pb PpBb c.n Ppbb c.a ppBb n.n ppbb n.a

17

Crlionai netezi : crlionat albi : netezi negri i netezi albi sau: 9 : 3 : 3 : 1 (dup ambele perechi de caractere alternative se obin 4 fenotipuri). Dup fiecare caracter separat segregarea se produce astfel: Forma: 12 crlionai : 3 netezi 3:1 Culoarea: 12 negri : 3 albi

Segregarea dup genotip constituie: 4PpBb : 2PPBb : 2PpBB : 2Ppbb : 2ppBb : 1PPBB : 1PPbb : 1 ppBB : 1ppbb, adic n descenden se obin 9 genotipuri. Verificai-v cunotinele: 1. Problem: La om gena membrelor strmbe (P) domin gena structurii normale a tlpii, iar metabolismul normal (O) - diabetul zaharat (o). O femeie cu structura normal a membrelor i metabolism normal se cstorete cu un brbat cu membre strmbe. De la aceast cstorie s-au nscut 2 copii: unul din ei era cu membre strmbe, altul cu diabet zaharat. a) se poate determina genotipul prinilor dup fenotipul copiilor? b) ce fel de genotipuri i fenotipuri sunt posibile nc n aceast familie ? 2. Determinai tipurile i numrul de gamei pe care le formeaz genotipurile: MmPp? MMPP? CcDdKkPP? 3. Culoarea cpruie a ochilor domin culoarea albastr, iar capacitatea de a mnui cu mna dreapt, domin pe cea stng. O dreptace cu ochii cprui se cstorete cu un stngaci cu ochii albatri, care au avut 2 copii: unul dreptaci cu ochii albatri i altul stngaci cu ochii albatri. Determinai genotipul mamei? 4. O tetraheterozigot (AaBbCcDd) a fost ncruciat cu un homozigot recesiv. Determinai numrul i clasele de genotipuri n F1? Ce parte de hibrizi vor avea toate 4 gene recesive ? 5. Cte tipuri de gamei va forma o femel cu ochii cprui (heterozigot dup acest gen), tatl creia a fost hemofilic, i care sunt ele? 6. Care este genotipul zigotei din care se dezvolt hibrizii de F3 (legile lui Mendel). 7. Polidactilia, miopia i lipsa premolarilor se transmit drept caractere autozomale dominante, genele crora sunt localizate n diferii cromozomi. Determinai probabilitatea naterii copiilor fr anomalii n familie?

18

Tema 6: Alele multiple. Grupele de snge Obiective: S prognozeze motenirea grupelor de snge; S stabileasc genotipul i fenotipul conform interaciunii alelelor multiple; S alctuiasc probleme pentru a determina genotipul grupelor sanvine a propriei familii. Materiale necesare: Plane: Grupele de snge; machete; Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai noiunile: a) de gene alele i multiple; b) fenomenul de codominan. Reinei: Genele alele influeneaz n mod diferit asupra manifestrii caracterului. Dac gena are mai mult de dou forme alele, atunci astfel de alele formeaz n populaie seria aa - ziselor alele multiple. Fiecare individ al populaiei poate s conin n genotipul su oricare dou alele, iar fiecare gamet respectiv doar una din ele. Gradul de dominaie n seriile de alele poate crete de la gena recesiv extrem pn la cea dominant extrem. De exemplu, la cobai culoarea blnii este determinat de cinci alele ale aceluiai locus, care n diferite mbinri ne ofer unsprezece variante de culoare. La om, conform tipului de alele multiple, se transmit prin ereditate, grupele sangvine din sistemul ABO. Sngele omului dup prezena antigenelor (A, B) i a anticorpilor (alfa i beta) pe suprafaa hematiilor se divizeaz n 4 grupe. Motenirea grupelor sangvine se determin de trei gene alele ale aceluiai locus: una recesiv io i dou dominante IA i IB, care interacioneaz ntre ele. Pentru rezolvarea problemelor e necesar a memora fenotipul i genotipul grupelor sangvine. Fenotipul * I (0) * II (A) * III (B) * IV (AB) Genotipul * io io * IA IA; IA io * IB IB ; IB io * IA IB

19

Sarcin didactic 1: Rezolvarea problemelor la motenirea grupelor de snge n sistemul ABO. Problem (model): Mama este homozigot conform grupei a II (A) de snge, iar tata - homozigot conform grupei a a III (B) de snge. Determinai grupa sangvin pe care o pot moteni descendenii din aceast familie? Se d: - II (A) - IA IA - III (B) - IB IB

Rezolvare: 1) Conform condiiilor problemei prinii sunt homozigoi, deci au urmtorul genotip: (IA IA ; IB IB) P IA IA x IB IB (2n)

F1 = ?

2) Gameii formai - G

IA

IB

(n)

3)

F1 Fenotipul: Genotipul:

IA IB gr. IV heterozigot

(2n)

Rspuns: cnd prinii sunt homozigoi copiii vor moteni grupa a IV (IAIB) de snge. Propunei rezolvarea i pentru varianta cnd prinii sunt heterozigoi dup grupele respective. Se mai pot propune pentru rezolvare i alte combinaii? Verificai-v cunotinele: 1. Numii genotipurile omului care posed grupele sangvine: I; II; III; IV; ? 2. Cte gene alele determin grupa sangvin? 3. Cte gene alele conine fiecare gamet ? 4. Cte tipuri de gamei formeaz o femel cu genotipul: homozogot grupa a II (A) sangvin? 5. Cte tipuri de gamei va forma un mascul cu grupa a III (B) sangvin i heterozigot dup gena polidactiliei? 6. n ce const esena procesului de codominan? 7. Definete noiunea de alele multiple ? 8. La un om rezusul factorul rezus pozitiv este dominant, iar cel negativ este recesiv. Gena grupei I (O) e recesiv fa de genele grupei II (A) i a III (B): a) O femeie cu grupa II i rh (-), tatl creia avea grupa I (O) i rh (-), se cstorete cu un brbat cu grupa a I (O) i rh (-). Determinai probabilitatea naterii copiilor cu ambele caractere ale tatlui. dup culoarea ochilor i

20

b) Un brbat cu grupa IV (AB), rh (-) se cstorete cu o femeie ce posed grupa III (B) i Rh (+). Tatl femeiei avea grupa III (B i rh (-). S-au nscut doi copii: unul cu grupa a III (B) i rh (-); altul cu grupa I (O) i Rh (+). Expertiza medico - judiciar a stabilit c unul din copii este extraconjugal. Determinai dup care din doua perechi de alele este exclus paternitatea?

21

Tema 7: Rezolvarea problemelor la ereditatea cuplat cu sexul Obiective: s determine caracterele cuplate cu sexul; s calculeze tipurile de gamei; s stabileasc fenotipurile i genotipurile n cazul plasrii genelor pe heterozomi. Materiale necesare: Plane Caractere cuplate cu sexul. Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai: Mecanismul genetic de determinare a sexului; Deosebirile n structura cromozomilor sexuali la diferite sexe; Noiunea de heterozom i hemizigot.

Reinei: Genele plasate n acelai cromozom, n loci omologi, se numesc nlnuie i se transmit mpreun (cuplate); Totalitatea genelor dintr-un cromozom formeaz grup de linkage. Numrul grupelor de linkage este egal cu setul haploid de cromozomi (de exemplu la om 2n = 46 sau 23 grupe de linkage); Genele unei grupe linkate nu se supun segregrii independente (mendeliene); nlnuirea genelor plasate pe acelai cromozom poate fi complet i incomplet; n cazul cuplrii incomplete are loc crossing-overul; Plasarea genelor pe heterozomi ereditatea sexual; Plasarea genelor pe autozomi ereditatea autozomal; Numrul probabil de gene alele recombinate n gameii i se determin dup formula 2n , unde n numrul haploid de cromozomi; De exemplu, la om: n = 23, iar numrul probabil de recombinaii este egal cu 223 = 8.388609; Genele localizate n cromozomii sexuali pot fi divizate n 3 grupe de nlnuire (lincage), care se transmit prin ereditate: Grupa I o constituie genele plasate doar n poriunea cromozomului X - care nu are omolog n cromozomul . Pe aceast poriune sunt plasate genele responsabile de aa maladii ca: hemofilia, daltonismul, atrofia nervului optic, cheratoza folicular, anemia hemolitic, ihtioza; Grupa a II-a genele sunt localizate pe cromosomul - poriune neomoloag cu cromosomul X. Genele plasate pe cromozomul Y se numesc holandrice (respectiv i ereditatea se

22

numete holandric) i se transmit din tat n fiu (hipertricoza urechilor); A II Grupa a III-a genele sunt plasate n poriunele omoloage ale cromozomilor X i Y, transmindu-se n egal msur att prin cromozomul X ct i prin cromozomul (xeroderma pigmentar, retinita, miopia total etc.).

23

Poriunea ce n-are omolog n cromosomul -

Poriunile omoloage ale cromosomilor sexuali

(heterozomilor)

Des. 1. Poriunile omoloage i ne omoloage ale cromozomilor sexuali (dup Grin, Staut, Teilor Biologie, V. III, 1990, p. 240) Sarcin didactic 1: Rezolvarea problemelor n cazul plasrii genelor pe heterozomi a) Problem (model): Gena culorii ochilor la musculia de oet este plasat n cromosomul X. Culoarea roie (W) domin culoarea alb (w). Determinai fenotipul i genotipul descendenilor de F1, dac s - a ncruciat o femel cu ochii albi cu un mascul cu ochii roii. Rezolvare: 1. Notm caracterele cercetate: XW rou Xw alb 2. Stabilim genotipurile prinilor din problem - femela poate fi numai homozigot, deoarece gena culorii albe Xw Xw - este recesiv. XW masculul este heterozigot (n cazul dat cu ochii roii)

3. Alctuim schema genitorilor i a formrii gameilor:

24

P XwXw alb

XW (2n) rou

Xw
XW Xw 1 rou : 1 alb

XW
Xw

(n)

F1

(2n)

4. Determinm fenotipul i genotipul descendenilor Fenotipul: Genotipul: 1 XWXw : 1 Xw ( 50 % : 50 %)

Rspuns: Dup fenotip femela de F1 - roie, iar - alb; dup genotip - XWXw; Xw. b. Rezolvai de sine stttor urmtoarele probleme: nr. 102, 103, 104, 105 - pag. 46-47 (autor Helevin) Sarcin didactic 2. Rezolvarea problemelor la motenirea hemofiliei i daltonismului Problem (model): Hemofilia clasic se transmite prin ereditate ca caracter recesiv cuplat cu cromosomul X. Un brbat bolnav de hemofilie se cstorete cu o femeie normal, tatl creia sufer de hemofilie. Determinai probabilitatea naterii copiilor sntoi ? Se d: 1. XH normal Xh bolnavi de hemofilie 2. XHXH sntoas; XHXh sntoas, purttoare XH sntos; Xh- bolnav. Rezolvare: 3. P XHXh s.p. x Xh b. (2n)

4. G

XH
XH s s.p.

Xh
XhXh

Xh
Xh b nu se nasc

(2n)

F1 XHXh

Din condiiile problemei e clar, c femeia dup gena hemofiliei este heterozigot, fiindc motenise gena hemofiliei - h de la taic-su.

25

Rspuns: Probabilitatea naterii copiilor sntoi e de 50 % (25% XHXh i 25% XH). Problem model Daltonismul este determinat de gen recesiv localizat pe cromozomul X, iar vederea normal e determinat de gena dominant. O femeie ce sufer de daltonism (tatl creia a fost sntos) se cstorete cu un brbat normal conform acestei gene. Care este probabilitatea naterii copiilor normali i daltonici n familia respectiv? Se d: 1. XD normal Xd bolnav 2. XDXD sntoas; XD Xd sntoas, dar purttoare; Xd Xd bolnav. XD sntos; Xd bolnav Rezolvare: 3. Din coninutul problemei ne este clar c femeia este heterozigot conform genei daltonismului, deoarece tatl ei era sntos. P XD Xd XD genitorii (2n)

XD

Xd
XD s XD Xd s. p

XD
Xd b

(n)

4. F1

XD XD s

(2n)

Rspuns: Se vor nate 75 % copii sntoi, din care 50 % sntoi complet; 25 % sntoi dar purttori ai genei daltonismului i 25 % bolnavi de daltonism. c. Analogic se vor rezolva problemele nr. 108, 109, 110 (problemar N.V. Helevin, 1993). Verificai-v cunotinele 1. Care din genele maladiilor enumrate sunt localizate pe cromosomul X? a) hemofilia; b) daltonismul; c) grupele sangvine; d) rezusul-factor; e) sindactilia. 2. Cte grupe de nlnuire sunt caracteristice penrtu cariotipul uman? 3. Cte gene alele a daltonismului sunt n cariotipul diploid al brbatului?

26

a) 1;

b) 2;

c) 3;

d) 4.

4. O plant homozigot cu flori purpurii i tulpina pitic a fost ncruciat cu o plant homozigot cu flori roii i tulpin nalt. Descendenii de F1 aveau flori purpurii i tulpin pitic. ncruciarea de analiz a hibrizilor de F1 cu o homozigot recesiv a demonstrat c: 52 plante sunt cu flori purpurii i tulpin scurt; 48 plante sunt cu flori purpurii i tulpin nalt; 49 plante sunt cu flori roii i tulpin scurt; 45 plante sunt cu flori roii i tulpin nalt. Explicai rezultatele obinute. Care este secretul segregri obinute? 5. Determinai numrul probabil de combinaii cromozomiale n gruncioarele de polen la ofran (Crocus balansae) care are setul diploid de cromozomi egal cu ase (2n = 6). 6. Cte tipuri de gamei va forma un mascul heterozigot dup gena albinismului i bolnav de hemofilie? Dar o femel heterozigot dup gena hemofiliei i miopiei? Tema 8: Crossing-over-ul. Hrile cromozomiale Obiective: S determine % de gamei crossoveri i necrossoveri; S ntocmeasc hri cromozomiale pentru specii concrete. Materiale necesare: Microscoape i micropreparate; Plane Crossing-over-ul i Caractere cuplate cu sexul. Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai: a. Noiunea de crossing-over; b. Ipoteza plasrii mai multor gene pe un cromozom; c. Care este deosebirea la motenirea genelor localizate pe acelai cromozom i pe cromozomi diferii? d. Care este semnificaia hrilor cromozomiale?

27

Reinei: Crossing-over-ul are loc n profaza I a meiozei i asigur o mai mare diversitate genetic a gameilor obinui; Genele localizate n acelai cromozom sunt nlnuite i se transmit mpreun; Totalitatea genelor dintr-un cromozom formeaz un grup de lincage, numrul crora este egal cu numrul haploid de cromozomi; n cazul nlnuirii complete i incomplete are loc schimbul de gene crossing-over-ul cu formarea de gamei crossoveri i necrossoveri; Formarea gameilor crossoveri au o frecven mai mic ca cei necrossoveri.

Sarcin didactic 1. Rezolvarea problemelor cu aplicarea crossing-over-ului Problem (model): La drozofil gena culorii normale a ochilor domin gena ochilor albi, gena structurii nenormale a abdomenului gena structurii normale. Ambele gene sunt localizate n cromozomul X la o distan de 3 morganide. Determinai genotipurile i fenotipurile posibile ale urmailor de la ncruciarea unei femele heterozigote conform ambelor caractere (genele dominante au fost motenite de la femela mam) cu un mascul ce are culoarea normal a ochilor i structura normal a abdomenului. Constatm c dac distana dintre gene e de 3 % nseamn c genotipul femel va forma dou tipuri de gamei: crossoveri i necrosoveri. Se d: 1. XA culoarea normal a ochilor, Xa culoarea alb a ochilor, XB structura nenormal a abdomenului, Xb srtuctura normal a abdomenului. Rezolvare: 2. PXA/BX b/a x X b/A (2n)

XA/B
n/c 48,5%

XA/b
cr. 1,5%

Xa/B
cr. 1,5 %

Xa/b
n/c 48,5%

XA/b

100 - 3 = 97 % 97 :2 = 48,5 % 3 : 2 = 1,5 %

50 % 50 %

28

3. Alctuim grilajul lui Pennet

F1 / Xb/A 50% 50% XB/A 48,5% Xb/A XB/A 24,5 % XB/A 24,5 % Rspuns: Determinm genotipurile i fenotipurile descendenilor, alctuind tabela de mai jos: Xb/A 1,5% Xb/A Xb/A 0,75% Xb/A 0,75 % XB/a 48,5 % Xb/A XB/a 0,75% XB/a 0,75 % Xb/a 48,5% Xb/A Xb/a 24,5% Xb/a 24,5 %

Genotipul XB/A Xb/A Xb/A Etc...

Fenotipul Femel cu ochi normali, structura nenormal a abdomenului Mascul, culoarea normal a ochilor i structura normal a abdomenului n aa mod se va descrie fiecare din cele 8 genotipuri ale descendenilor

% 24,3 % 24,5 % Etc...

Sarcin didactic 2: De alctuit harta cromozomial la porumb (Zea mays) Problem: ntocmii harta cromozomial pentru urmtoarele recombinaii a genelor: P-Q = 24%; R-P = 14%; R-S = 8%; S-P = 6% Pentru a ntocmi harta cromozomial efectum urmtorii pai: 1. Desenm o linie care semnific cromozomul. n centrul cromosomului marcm cea mai mic unitate a recombinaiei, adic S-P = 6%

6%

2. Se ia a doua dimensiune R-S = 8% i se pune pe cromozom, indicndu-se poziiile probabile de instalare a lor (stnga i dreapta cromozomului).

8%

6%

? R

P 8%

29

3. Se transfer dimensiunea a III-a R-P = 14%. Se precizeaz c gena R nu poate fi instalat n dreapta lui P.

8%

6%

R 14%

4. Se transfer dimensiunea a IV-a P - Q = 24%

Q?

8%

6% P

Q?

24%

24% ?

Verificai-v cunotinele: 1. Examinai cromozomii omologi cu 8 perechi de gene alele Aa, Bb, Cc, Dd, Ee, Ff, Gg, Mm. Determinai poziiile, unde se vor recombina mai des genele i dac va avea loc crossingover-ul, de ce? n care loc (i ntre care gene) crossing-over-ul se va realiza mai rar?

2. Rezolvai problemele de la pagina 69 din problemarul N. V. Helevin, 1993. Tema 9: Variabilitatea organismelor Obiective: S determine legitile statistice ale variabilitii modificative;

30

S construiasc graficul curbei variabilitii modificative; S determine norma de reacie i s argumenteze rezultatul obinut. Materiale necesare: semine de fasole, gru, frunze de viin, rigl, creioane etc. Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980. Explicai: a. Norma de reacie, variabilitatea modificativ, curba variaional; b. Dac se motenete norma de reacie? Cum influeneaz ea asupra fenotipului? c. n ce caz variabilitatea modificativ poate fi ngust i larg?; d. Care sunt factorii care influeneaz asupra dezvoltrii fenotipului? Sarcin didactic 1: De determinat norma de reacie i de construit graficul irului i curbei variaionale n baza rezultatelor obinute. Algoritmul realizrii sarcinii: 1. Msurai cu rigla lungimea frunzelor, fixnd datele n tabel: Lungimea (cm) Cantitatea (buci) 10 2 11 5 12 7 13 4 14 3 15 s. 16 m. 17 d.

2. Construii graficul curbei variaionale:

Pe axa absciselor plasai numrul (cantitatea) frunzelor, iar pe axa ordonatelor lungimea frunzelor. Scara se va folosi la dorin. 3. Determinai norma reaiei pentru caracterul studiat (lungimea frunzelor).

31

Norma de reacie se va determina n felul urmtor: Din numrul mai mare se scade numrul mai mic. Rezultatul obinut va semnifica norma reaciei. n cazul nostru: 17-10 = 7. Adic norma reaciei este egal cu 7 cm. Frunzele cu devieri considerabile de la norma de reacie sunt rezultatul unor mutaii. Tema 10: Genetica populaiilor. Legea lui Hardy - Weinberg Obiective: S determine frecvena genelor i alelelor recesive i dominante n populaii; S determine frecvena genotipurilor n populaii; S propun algoritmul rezolvrii unor probleme. Explicai: a. Care este semnificaia unei populaii Mendeliene? b. n ce const structura genetic a polulaiei? c. Principiile unei populaii ideale? d. Care este esena Legii lui Hardy-Weinberg i aplicarea ei n practic. Bibliografie: N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993 P. Raicu. Genetica, 1999; Gh. Guleaev. Problemar la genetic, 1980.

Reinei: Genetica populaiilor permite determinarea frecvenei alelelor (A i a) a unei gene i genotipurilor (AA, Aa, aa) pentru o pereche de alele n diverse populaii. Legea lui Hardy-Weinberg permite comparaia structurii genetice a diferitor generaii a uneia i aceleiai populaii. Frecvena genelor i a genotipurilor n populaie se exprim n procente (%) sau ca parte de unitate. Coraportul a trei genotipuri pentru o pereche de alele se exprim prin formula: (p+q)2 = p2+2pq+q2, unde: p frecvena alelei dominante A q frecvena alelei recesive a p2 frecvena indivizilor cu genotipul AA 2pq frecvena indivizilor cu genotipul Aa q2 frecvena indivizilor cu genotipul aa

32

Sarcin didactic 1: Determinarea frecvenei alelelor n populaie. Problem model: ntr-o populaie frecvena genotipurilor genelor codominante A i A1 constituia: AA 64%, aa 4%, AA1 32%. Determinai frecvena (p) a alelei A i (q) a alelei A1, exprimnd frecvena n pri de unitate. Rezolvare: Pentru determinarea frecvenei alelelor se folosete formula p+q = 1, unde genei - A, q frecvena genei - a. n problem sunt date frecvenele genotipurilor: Se d: Homozigote AA 64% Heterozigote Aa 32% Homozigote aa 4% Frecvena p (A) - ? Frecvena q (a) - ? Vom considera numrul alelelor A i a n populaie egal cu 100%. n acest caz alela A se determin astfel: 64% indivizi AA formeaz 64% alele din numrul total al alelelor populaiei i toate sunt alele A. Heterozigoii formeaz 32% din numrul total din care 16% o constituie alela A i 16% alela a. Indivizii cu genotipul aa nu formeaz gamei cu alela A. Deaceia frecvena alelei A va fi egal cu suma 64% A+16% A = 80% A. Frecvena genei a n populaie va fi egal cu 100% - 80% = 20% a. Pentru a exprima frecvena alelelor A (p) i a (q) n pri de unitate e necesar de a mpri numrul alelelor A la A + a: p A este egal cu
A 80 % 80 % +a= + 20 = = 0,8. 80 100 % A

p frecvena

q a = 1- p = 1- 0,8 = 0,2. Rspuns: Frecvena genei A este egal cu 0,8%; Frecvena genei a este egal cu 0,2%. Sarcin didactic 2: Determinarea frecvenei genotipurilor Problem-model:

33

Pentru determinarea grupei de snge n sistemul MN s-au examinat 4200 indivizi din care 1218 posedau antigenul M (genotipul LM LM), 882 antigenul N (genotipul LN LN) i 2100 cu ambele antigene (genotipul LM LN). Determinai frecvena tuturor celor trei genotipuri exprimndu-le n procente (%) i pri de unitate. Se d: LM LM 1218 LN LN 882 LM LN 2100 Total 4200 Frecvena, %:AA-? Aa -? aa-? 2) Determinm frecvena genotipului LN LN 4200---------------100% 882------------------x % X=
882 100 =50% 4200

Rezolvare: 1) Determinm frecvena genotipului LM LM 4200----------------100% 1218------------------x % X=


1218 100 =29% 4200

3)Determinm frecvena genotipului LM LN 4200---------------100% 2100---------------- x % X=


2100 100 =21% 4200

4) Suma frecvenelor celor trei genotipuri este egal cu: 29% + 50% + 21% = 100% 2) Pentru determinarea n pri de unitate considerm 4200 = 1 i atunci frecvena genotipului LM LM =
1218 = 0,29; LN LN = 0,21; LM LN = 0,50; 4200

Suma tuturor genotipurilor este egal cu: 0,29 + 0,50 + 0,21 = 1,0 (pentru transformarea unitilor n % se va nmuli numrul respectiv cu 100%). Sarcin didactic 3: Determinarea heterozigoilor n populaie Problem-model:

34

Albinismul se ntlnete cu o frecven de 1: 20000 i se motenete pe cale autozomal recesiv. Determinai numrul heterozigoilor.

Se d: A sntos (p) a bolnav (q) 1: 20000 (


1 = q2 ) 20000

1 1 = ; 20000 141 141 1 140 frecvena alelei A p = 1 q = = ; 141 141 141 140 1 Rspuns: p = ; q= . 141 141

Rezolvare: 1 Dac q2 = , atunci q = 20000

Frecvena Aa-?

Numrul heterozigoilor n populaie este egal cu 2 pq = 2


1 1 = 141 70

Dac rspunsul se exprim n %, atunci frecvena genotipurilor va fi egal cu 1,4%.

Reinei: Dac frecvena genelor i genotipurilor se exprim n procente (%), atunci numrul total de gene sau indivizi se ia ca o 100%; dac se exprim n uniti, atunci numrul total de indivizi sau alele se i-au ca o unitate, adic egal cu 1 Verificai - v cunotinele: 1. Care-i scopul aplicrii Legii lui Hardy-Weinberg n medicin? 2. Determinai frecvena sindromului Down, fenilcetonuriei i a sindromului Edwards? 3. Definii Legea lui Hardy-Weinberg? 4. Ce urmri poate avea izolarea unei populaii puin numerice? 5. Propune rezolvarea urmtoarelor probleme: a. Pentozuria se transmite prin ereditate drept caracter autozomal recesiv cu o frecven de 1:50000. Determinai frecvena alelei dominante i a celei recesive n populaie. b. Aniridia se transmite prin ereditate drept caracter autozomal dominant cu o frecven de 1:10000. Determinai structura genetic a populaiei.

35

Bibliografie 1. Bogoiavlenski I., et al. Compendiu de lucrri practice la biologie, Ed-ra Lumina, Chiinu, 1991, 270 p. 2. Dobrot C., Rodica L., Erno L. Biologie, manual cl. X, Ed-ra Niculescu ABC, Bucureti, 2000, 136p. 3. Guleaev G.V. Zadacnic po genetiche, M.:, Kolos, 1973, 77p. 4. Grin N., Staut U., Teilor D. Biologhia, V. III, M.:, Mir, 1999, 372 p. 5. Miina N.V. Zadania dlea samostoiatelinoi rabot po obcei biologii, M:, Prosvecenie, 1988, 112 p. 6. Petre Raicu. Genetica, Ed. Pedagogic, Bucureti, 1998, 570 p. 7. ceglov N. I. Sbornic zadaci i uprajnenii po genetiche, MP, Ekoinvest, 1991, 34 p. 8. Teste de biologie pentru examenul de Bacalaureat, Lyceum, Chiinu, 2002, 2003, 2004.

36