Sunteți pe pagina 1din 37

Universitatea de Stat Alecu Russo, Bli

Facultatea de tiine ale naturii i Agroecologie


Catedra de geografie, biologie i chimie

CZU: 575 (072.8)

ndrumar la rezolvarea problemelor


Disciplina: Genetica

Specialitile: Geografie i biologie


Biologie i chimie
Didactica biologiei

Autor: Maria NICORICI, dr. conf. univ.

Discutat la edina catedrei din 27.10.2009, pr. verbal nr.3


Consiliul facultii din 23.12.2010, pr. verbal nr.4

Bli - 2010

1
Aviz

la ndrumarul indicaii metodice la Rezolvarea problemelor la genetic, autor dna


Maria Nicorici, dr.,conf. univ.
ndrumarul este expus pe 25 de pagini i include 10 lucrri practice la disciplina: Genetica.
Autorul s-a strduit s expun n lucrarea de fa modalitatea de realizare a lucrrilor practice la
genetic.
Tematica expus reprezint consecutivitatea lucrrilor practice reflectate n Curricula
universitar la disciplina Genetica.
Pentru fiecare tem sunt elaborate obiectivele, sarcinile pentru autoevaluarea temei de
acas, materialele necesare i literatura de specialitate utilizat.
La capitolul realizarea sarcinilor sunt propuse modele de probleme cu diferit grad de
complexitate. Se propune modelul concret de rezolvare a diferitor tipuri de probleme.
Sunt evideniate legitile de baz necesare pentru rezolvarea corect. Pentru dezvoltarea
capacitilor creative studenilor li se solicit s propun algoritmul de rezolvare i a altor variante
existente pentru problema respectiv neexistente n lucrare.
ndrumarul cu indicaiile elaborate sunt de real folos studenilor de la facultate, cadrelor
didactice i liceenilor.
Consider c ndrumarul prezentat de dna Maria Nicorici corespunde cerinelor fa de
realizarea acestui gen de lucrri, propun s fie aprobat la Consiliul facultii i recomandat pentru a
fi editat.

Valerii VOZIAN dr., conf. cercet., eful laboratorului de


Genetic i Ameliorare a plantelor,
Institutul de Fitotehnie

2
Aviz
la ndrumarul indicaii metodice la Rezolvarea problemelor la genetic, autor dna Maria
Nicorici, dr., conf. univ.
Lucrarea se constituie din 10 lucrri practice, fiecare avnd o tematic bine conturat. Pe
prim plan la fiecare lucrare sunt plasate obiectivele. Prin folosirea ntrebrilor de autoverificare
autorul trimite studentul la o pregtire prealabil pentru lucrarea respectiv.
Pe parcursul realizrii sarcinilor didactice, bine-venite n lucrare sunt i problemele - model
rezolvate, care sunt de un real folos studenilor n timpul realizrii lucrului individual, fiind ca un
punct de pornire n realizarea sarcinilor.
Un interes deosebit revine componentei formative a lucrrilor evaluarea. Sarcinile
didactice sunt elaborate pe nivele, nct rezolvarea lor necesit creativitate.
Coninutul lucrrilor reflect coninutul Curriculei universitare la disciplina Genetica.
Fiecare tem ia aspectul unei proiectri didactice de scurt durat n care sunt enumerate
principalele evenimente instrucionale ce necesit a fi realizate.
ndrumarul elaborat este de real folos studenilor i poate servi ca surs de informaie
studenilor, studenilor practicani, cadrelor didactice din gimnazii i licee.
Consider c ndrumarul elaborat de ctre dna Maria Nicorici corespunde cerinelor fa de
acest gen de lucrri, este binevenit i merit a fi publicat.

Zinaida DOLIN profesor de biologie,


grad didactic superior,
Colegiul industriei uoare

3
Tema 1: Rezolvarea problemelor la modelarea codului genetic
Obiective:
S aplice codul genetic la rezolvarea problemelor;
S modeleze algoritmul rezolzrii problemelor.

Materiale necesare: Plane: Codul genetic; Acizii nucleici; Biosinteza proteinelor


Bibliografie:
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999
Gh. Guleaev. Problemar la genetic, 1998

ntrebri pentru autoverificare:


Explicai:
a. Structura chimic a ARN, ADN;
b. Structura proteinelor;
c. Codonul: structura, funciile;
d. Componena tripletelor ce codific diferii aminoacizi;
e. Definiia genei;
f. Principiile reduplicrii ADN (acidul dezoxiribonucleic).
Realizarea sarcinilor:
Sarcin didactic (SD) 1: Determinarea structurii ADN dup structura proteinei
Problema 1 (model): Un fragment a moleculei de protein (mioglobina) are urmtoarea
distribuie a aminoacizilor: val - ala glu tir ser glu. Determinai structura fragmentului
moleculei ADN ce codific consecutivitatea aminoacizilor.
Rezolvare: 1) Folosind tabela codului genetic determinm codonul pentru fiecare aminoacid
(codul ARN-m (i) UUG CUG GUG - ...
Succesiunea dat de nucleotide determin (reprezint) catena moleculei a ARN-m(i).
2) Dup aceasta se determin prima caten a ADN, care a codificat sructura ARN-m(i).
Sub fiecare codon a ARN-m(i) se transcrie conform principiului de complementaritate codoanele
moleculei de ADN: AAT- GAC- CAC- TAT- ...
3) Dat fiind faptul c molecula de ADN are dou catene, sub codoanele primei catene se
nscriu i codoanele pentru catena a II-a :
catena I-a ADN-lui: AATGACCACTAT
catena a II-a ADN- lui: TTACTGGTGA TA

4
Asociind nucleotidele primei catene cu nucleotidele catenei a doua prin legturi de hidrogen
se obine un fragment al moleculei de ADN.
Problema 2: Un fragment al moleculei de ADN are urmtoarea succesiune a nucleotidelor:
TAAACTGCGAAATCTGAAGTC. Determinai structura i succesiunea aminoacizilor n catena
polipeptidic, codificat n poriunea genei propuse.
Rezolvare:
1) Conform problemei se propune o caten de ADN. Dup principiul complementaritii determinm
catena ARN-m(i).
ADN: TAAACTGCGAAATCTGAAGTC
ARN-i: AUUUGACGCUUUAGACUUCAG
Izo stop arg fen arg leu gli
2) Se determin codonii iar conform tabelei - denumirea aminoacizilor.
Rspuns: Succesiunea aminoacizilor n catena polipepdidic a moleculei de protein
este urmtoarea:
Izo - arg fen arg leu - gli.
Sarcin didactic (SD) 2: Determinarea structurei ARN-m(i) dup structura ADN
Rezolv de sine stttor
Problema 3: Un fragment al catenei de ADN are urmtoarea succesiune a nucleotidelor:
AAAGATCACATATTTCTGTTACT. Determinai structura moleculei ARN-m(i) ce se formeaz
n rezultatul transcripiei pe poriunea dat de ADN.
Problema 4: Ce schimbri vor surveni n structura proteinei, dac n fragmentul moleculei de
ARN - m (i) cu urmtoarea succesiune a nucleotidelor: AUAGUCAUGUUACUG va fi nlocuit
nucleotida din poziia a 7 cu citozin, iar din poziia a 2 cu adenin ?
Sarcin didactic (SD) 3: Determinarea structurii moleculei proteice dup structura moleculei
de ARN-m (i)
Problema 5: Un fragment al ARN-m(i) posed urmtoarea succesiune a nucleotidelor: GUG-
UUG- UUC- UCG- UUU- AUA- AUC- UGA- UAA. Ce aminoacizi va transporta ARN t (s) la
locul de sintez a proteinelor i ce anticodoane va purta ARN t (s) ?
Rezolvare: 1) Folosind tabela codului genetic determinm anticodoanele ARN-t i respectiv
denumirile aminoacizilor transportai la locul de sintez a proteinelor.
ARN-m (i): GUG UUG UUC UGG UUU AUA - ...
Val leu fen tre fen met
Anticodonii ARN-t (s): CAC AAC AAG ACC AAA UAU - ...
his ile liz tre liz tir
Rspuns: Anticodonii ARN-t (s) sunt: CAC AAC AAG

5
Rezolv de sine stttor (problemele 6, 7, 8 din Culegeri de probleme la genetic de N.V.
Helevin i al., 1998).
Problema 6 (se rezolv de sine stttor): Un fragment al catenei de ADN are urmtoare succesiune a
codonilor: AAG GAA TAT ACC ATA CGA GTA ATT TTT.
Determinai care codoni vor intra n componena ARN-m(i) i n ce consecutivitate vor fi
inclui?
Problema 7 (se rezolv de sine stttor): Determinai structura primar a proteinei, care se
sintetizeaz pe fragmentul ARN-m(i) cu urmtoarea succesiune a nucleotidelor:
AUCGUUCUCUAAAUAGUGUAUCUU.
Problema 8 (se rezolv de sine stttor): Fragmentul catenei A a insulinei const din 5 aminoacizi:
glicin izoleucin valin glutamin - glutamin. Determinai structura fragmentului ARN-m(i),
ce codific poriunea dat a insulinei.
Sarcin didactic (SD) 3: Determinarea coefcientului de specificitate (A+T/G+C).
Problema 9: Segmentul lanului B la insulin const din urmtorii aminoacizi: fen val asp
glu his leu cis gli - his. Determinai raporturile cantitative de adenin + timin i guanin +
citozin (A + T i G + C) n lanul ADN, ce codific acest segment al insulinei.
Rezolvare: 1) Folosind tabela codonului ARN-m determinm codonii respectivi de ARN-m:
UUU, GUU, GAU, CAG, CAU, UUA, UGA, GGU, UCU, CAU.
2) Se transcrie informaia de pe catena respectiv pe catena ADN-I:
ADN-I: AAACAACTAGTGG...
3) Deoarece molecula de ADN este bicatenar se nscrie i a doua caten a ADN-lui, folosind
principiul complementaritii.
ADN-I: AAACAACTAGTGG.
ADN-II: TTTGTT...
4) Se calculeaz apoi totalitatea bazelor adenilice A = (20), guanilice G = (10), timidinice T =
(20), citidilice C = (10);
5) Se alctuiete raportul A+T/G+C = 20+20/10+10 = 2,0.
Rspuns: Coeficientul de specificitate variaz n limite foarte mari la bacterii, la plante i
animalele inferioare. La plantele superioare i la animalele vertebrate el se apropie de 1,5. De ce ?
Reinei:
1. Tripletele (codoanele) non- sens: UAA , UAG, UGA.
2. Tripletele de iniiere: AUG , GUG.
Test de consolidare a cunotinelor:
1.Cte triplete de ARN-m(i) pot fi dispuse n centrul funcional al ribosomului?
a) 1; b) 2; c) 3; d) 4.
2. Care din acizii nucleici servesc ca matrice n biosinteza proteinelor n procesul translaiei?

6
a) ADN; b) ARN-m(i); c) ARN-t; d) ARN-r.
3. Dac codonul ADN este AAT, care din urmtorii codoni i sunt complimentari?
a) UUA; b) AAU; c) CCA; d) GTG.
4. De ce depinde succesiunea distribuirii nucleotidelor n molecula de ARN-m(i)?
a) Succesiunea aminoacizilor n molecula proteic;
b) Succesiunea nucleotidelor n ADN;
c) Fermentul ADN - polimeraza;
d) Structura nucleotidului.
5. Determinai codoanele ARN-m(i) ce semnific sfritul transcripiei?
a) UAA; b) UAT; c) UTA; d) AAG.
6. Determinai tripletele ARN-m(i) ce semnific iniierea transcipiei?
a) AUG; b) AUU; c) UUG; d) AAG.
7. Care din tipurile de ARN transport aminoacizii la locul biosintezei proteinelor?
a) ARN-m(i); b) ARN-r; c) ARN-t; d) ARN-m(i).
8. Un fragment al moleculei de ADN are urmtoarea succesiune a nucleotidelor:
ACGCAACCACA. Determinai aminoacizii ce vor fi codificai pe aceast poriune de fragment?

7
Tema 2: Determinarea claselor de gamei
Obiective:
S stabileasc tipurile de gamei pentru diferite genotipuri i fenotipuri;
S determine numrul de gamei dup formul;
S defineasc noiuni concrete la tema respectiv.
Materiale necesare: Plane: ncruciarea monohibrid i dihibrid;
Bibliografie:
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai noiunile de:
a. Homozigot; e. Gene alele;
b. Heterozigot; f. Gene nealele;
c. Dihomozigot; g. Crossing-over;
d. Diheterozigot; h. Caractere cuplate cu sexul;

Pentru rezolvarea nsrcinrilor reinei urmtoarele legiti:


1. Gameii se formeaz n rezultatul meiozei;
2. Gameii conin o jumtate din informaia ereditar;
3. Genele alele sunt plasate pe cromozomi omologi;
4. Genele nealele sunt plasate pe cromozomi neomologi.

Sarcin didactic (SD) 1: Determinai cte tipuri de gamei vor forma organismele care au
urmtoarele genotipuri: AA; bb; Aa; MmPP; PpKk; Aabbcc; MmPpKk; AaBbCcDd.
Pentru a determina tipurile de gamei este necesar a reine urmtoarele:
La organismele homozigote dup o singur alel (AA) sau dup cteva (AAbbcc) tipuri de gene
alele toi gameii vor fi la fel dup respectivele gene.
De exemplu: AA (genotipul unei femele va forma ovule/oosfere cu gena A)

bb (genotipul unui mascul va forma spermatozoizi cu gena b)

b
b
i
b
p
Reinei: Homozigota n descenden formeaz un singur fel (tip) de gamei.
b
b
b 8
n cazul dihomozigotei dup doua perechi de gene (AABB) se va forma un singur
gamet, care va conine cte o gen alel de la fiecare pereche.
P AABB genotipul genitorului

Gametul
AB

n cazul homozigotei dup trei perechi de gene AAccbb la fel se va forma un


gamet n care vor fi plasate cte o gen de la fiecare pereche AAccbb

Acb

Dar ci gamei va forma un tetrahomozigot? (scrie genotipul i gameii


formai)

Reinei:
n cazul heterozigotei dup o gen (Aa) organismul va forma
dou tipuri de gamei cu alele diferite

Aa A sau Aa A

a a

Un diheterozigot (AaBb) va forma patru tipuri de gamei.


Pentru calcul se folosete formula 2n, unde n - numrul de gene n stare
heterozigot. La scrierea gameilor ne vom conduce de legea puritii gameilor fiecare gamet va
purta cte o gen alel de la fiecare pereche.
De exemplu: AaBb = 22 = 4 MmKk = 22 = 4

AB Ab aB ab MK Mk mK mk
bA
Aa
aa va forma:
Dar ci gamei
aa n 3
1. o triheterozigot
aa MmPpKk ? 2 = 2 = 8 (................................................................).
aA (...........................) (.................................................................).
2. un tetraheterozigot
3. citete genotipul urmtor (AABBCcDd) i determin clasele de gamei.

.....................................................................................................................................................................

9
Sarcina didactic 2. Determinarea tipurilor de gamei n caz de crossing-over

Reinei: Unitatea de msur a crossing-overului este morganida


1 morganid = 1%

Problem: Determinai cte tipuri de gamei i n ce raport procentual va forma organismul cu


genotipul CcSs, dac distana dintre genele C i S = 3,5 % (sau uniti crossingovere i/sau
recombinaii). Dac este indicat distana dintre gene, e clar c ele sunt dispuse liniar pe acelai
cromozom omolog i ntre ele are loc crossingoverul. La aceti indivizi se vor forma dou tipuri de
gamei: crossoveri i necrossoveri (n/cr). Cei necrossoveri vor constitui majoritatea, iar cei crossoveri -
minoritatea.
Rezolvare:

Genotipul: C c 100 - 3,5 = 96,5 %


96,5 : 2 = 84,25 gamei ne/crossoveri
S s 3,5 % : 2 = 1,75 % crossoveri (recombinani)
Gameii: C C c c

S s S s

n/cr. crossov. n/cr.


48,5% 1,75% 1,75% 48,5%

Reinei legitatea de baz a crossing overului:


Dac genele de pe acelai cromosom sunt plasate la o distan mai mare una fa de alta,
atunci posibilitatea crossing-overului este mai frecvent
Rezolvai problema :
Distana dintre genele A i B = 4,6 % (uniti crossovere).
Determinai tipurile de gamei formai i cantitatea lor procentual la speciile cu genotipul:
AB i A B ?
ab a b
Reinei:
* Frecvena genelor recombinante semnific i distana dintre genele plasate pe acelai
cromozom;
* Frecvena recombinanilor = suma recombinanilor crossoveri / suma tuturor recombinanilor
(crossoveri i necrosoveri) * 100%

10
Tema 3: ncruciarea monohibrid
Obictive:
S determine tipurile de ncruciri;
S identifice caracterele dominante i recesive;
S rezolve probleme i situaii de problem pivind ncrucirile monohibride.
S argumenteze rezultatul obinut.
Materiale necesare: Plane: ncruciarea monohibrid i dihibrid, machetul ncrucirilor.
Bibliografie:
N.V. Helevin i al. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai noiunile de:
a. ncruciare monohibrid;
b. Caractere alternative;
c. Caracter dominant;
d. Caracter recesiv;
e. Hibrid.
Algoritmul rezolvrii unei probleme la genetic:
Problemele la genetic ca i cele de matematic posed un algoritm asemntor de rezolvare.
1. nscrierea coninutului. Coninutul se scrie n simboluri. Se determin (caracterele fiecrui
genitor/printe) i ce este necesar a determina (caracterele descendenilor):
a. Pe primul loc se plaseaz mama cu simbolul (); pe locul doi - tata cu simbolul ().
b. Genitorii luai pentru ncruciare se vor nsemna cu litera P; descendenii - cu litera F1, 2...
(cifrele determin consecutivitatea descendenilor).
c. Caracterul dominant se noteaz cu o oarecare liter majuscul a alfabetului A, B, K,
iar alela recesiv cu aceiai liter minuscul a (A a; B b; K - k).
n algoritmul de rezolvare se respect o anumit consecutivitate. La nceput se ntocmete:
1. genotipul genitorilor/prinilor;
2. fenotipul;
3. schema citologic;
4. grilajul lui Pennet pentru determinarea probabil a zigoilor (hibrizilor) obinui.
Grilajul lui Pennet se ntocmete astfel: pe orizontal se pun gameii feminini, pe vertical cei
masculini. n ptrelele formate se nscrie descendenii obinui la care se determin apoi fenotipul i
genotipul; se calculeaz procentul claselor de hibrizi obinui etc.

11
2. Condiiile problemei. La mazre culoarea galben domin culoarea verde. Au fost
ncruciate dou soiuri de mazre care aveau culoarea galben i verde a seminelor. Determinai
fenotipul seminelor la hibrizii de F1?

Se d: 3. Rezolvare:
A - galben (AA, Aa) 1) P AA x aa (2n)
a - verde (aa) g v
F1=?
G A a (n)
F1
Aa (2n)
Fenotipul: galben (100%)
Genotipul: heterozigot (Aa -100%)
2) P Aa x aa (2n)
g v
G
A a a
a
a

F1
Aa aa
1g 1v
50 % g : 50 % v
4. Rspuns:
1) Cnd este AA toi hibrizii de F1 sunt dup fenotip galbeni; iar dup genotip heterozigoi.
2) Cnd este Aa n descenden are loc o segregare de 1:1 sau de (50% - galbeni i 50% - verzi).

Sarcin didactic 1. Determinarea genotipului i a fenotipului descendenilor dup genotipul


prinilor.
Problem (model):
Culoarea cpruie a ochilor domin culoarea albastr. O femeie cu ochii albatri se cstorete
cu un brbat cu ochii cprui. Determinai culoarea ochilor la descendenii de F1?
Rezolvare:
Se d
K - cprui (KK, Kk) I P kk x Kk (2n)
k - albatri (kk) alb. cp.
F1= ? G (n)
k K k

12
F1 Kk kk (2n)
fenotipul - 1 cprui : 1 albastru
genotipul - 1Kk : 1 kk
Rspuns: 50 % din descendeni au motenit culoarea cpruie i 50% culoarea albastr a ochilor.
Propunei i varianta a II-a de rezolvare?
Problem:
Mioplegia (paralizie periodic) se motenete drept caracter dominant autozomal. Determinai
probabilitatea naterii copiilor cu anomalii n familie, dac tata dup genotip este heterozigot, iar
mama nu sufer de aceast maladie.
Se d: Rezolvare:
M bolnav (Mm; MM) P mm x Mm (2n)
m sntos (mm) sntos bolnav

F1= ? G m M m

F1 Mm mm
fenotipul : 1 bolnav : 1 sntos
genotipul : 1 Mm : 1 mm
Rspuns: 50 % din copiii nscui vor fi bolnavi de mioplegie.
Propunei i varianta a II a de rezolvare?
Problem (model):
La tomate culoarea roie a fructelor domin culoarea galben. La ncruciarea tomatelor
heterozigote cu cele galbene au fost obinute 352 plante cu fructe roii. Restul plantelor aveau fructe
galbene. Determinai cte plante aveau culoarea galben?
Se d: Rezolvare
A roie (AA P Aa x aa (2n)
r g
F1= ? G
A a a

F1 Aa aa (2n)
fenotipul: 1 rou : 1 galben
352 : 352

13
Rspuns: Rezultatele ncrucirii corespund ncrucirilor de analiz, unde segregarea dup fenotip i
genotip are loc n raport de 1: 1, deci plante cu fructe galbene sunt la fel n numr de 352.
Sarcin didactic Nr. 2: Determinarea genotipului prinilor dup fenotipul descendenilor
Problem (model): Gena polidactiliei este dominant, iar gena minii normale recesiv.
n familia, unde mama are o structur normal a minii, iar tata este polidactil s-au nscut doi
copii: unul cu ase degete, iar altul cu cinci. Determinai genotipul prinilor.

Se d: Rezolvare:
P bolnav (PP, Pp) P pp x Pp (2n)
p sntos (pp)
P (genotipul ) = ? G p P p (n)

F1 Pp pp (2n)
1b : 1s

Rspuns: Genotipul este pp; genotipul este - Pp.

Problem (model):
Gena dominant C determin manifestarea dizostozei la om (anomalie a scheletului scapulei i
craniului). Gena recesiv determin structura normal a scheletului. O femeie cu structura normal a
scheletului se cstorete cu un brbat bolnav. Copilul de la aceast cstorie are un schelet normal.
Se poate determina genotipul tatlui dup fenotipul copilului?
Se d: Rezolvare:
C bolnav (CC, Cc) P cc x Cc (2n)
c sntos (cc)
c C c
Genotipul (prinilor) = ? G (n)

F1 Cc cc (2n)
b s
1 : 1
Rspuns: Din coninutul problemei putem conchide c genotipul este Cc.
Naterea copiilor sntoi ct i a celor bolnavi are loc n raport de 1:1 sau (50 % : 50 %).

14
Tema 4. Ereditatea intermediar
Problem:
La barba mpratului (regina nopii) culoarea roie domin incomplet culoarea alb. Determinai
fenotipurile i genotipurile descendenilor de la ncruciarea a dou plante heterozigote ?
Reinei: n cazul ereditii intermediare segregarea n F2 dup fenotip i genotip are loc n
raport de 1 : 2 : 1

Se d: Rezolvare:
R - rou P Rr x Rr (2n)
r - alb roz roz
Rr - roz G (n)
F1 = ?
R r R r

F1 RR Rr rR rr (2n)

Fenotipul: 1 rou : 2 roz : 1 alb


Genotipul: 1RR : 2Rr : 1 aa
Rspuns: Segregarea dup fenotip are loc n raport de: 1 rou : 2 roz : 1alb.
25% : 50% : 25%
Segregarea dup genotip: 1AA : 2Aa : 1aa
25% : 50% : 25%.
Rezolv urmtoarele probleme:
1. De la ncruciarea a dou plante de barba mpratului au fost obinui: hibrizi roii; roz;
albi. Determinai genotipul i fenotipul prinilor (genitorilor)?
2. La fasole culoarea neagr domin culoarea alb. ncruciind plante, obinute din semine negre,
cu plante ce au semine albe, n descenden s-au obinut hibrizi cu semine negre. Poate oare fi stabilit
genotipul mamei?
3. De la ncruciarea a doi genitori cu culoarea neagr a seminelor, descendenii obinui sunt cu
semine de culoare neagr. Se poate de determinat genotipul prinilor?
4. Culoarea cpruie domin culoarea albastr a ochilor. O doamn cu ochii cprui (tatl crea avea
ochii cprui, iar maic-sa albatri) se cstorete cu un domn cu ochii albatri, prinii cruia aveau
ochii cprui. Determini genotipurile tuturor persoanelor nominalizate n problem?
Verificai v cunotinele:

15
1. Completai schema formrii gameilor la o femel heterozigot i un mascul homozigot.
Determin genotipul prinilor i gameii formai la femel i masculul respectiv.

2. Este oare posibil naterea descendenilor cu blan alb la speciile de oi de la prinii cu blana
neagr? Argumentai rspunsul.
3. O plant crescut din semine de culoare verde a nflorit, s-a realizat apoi autopolenizarea,
fecundarea, formarea zigotei i a seminelor. Determinai genotipul i fenotipul descendenilor
(seminelor). Argumentai rspunsul.
4. La tomate creterea normal domin piticismul. Determinai genotipul plantelor, dac n
descenden are loc o segregare a caracterelor n raport de 1: 1 i de 3 : 1?
5. Determinai tipurile de gamei pe care le poate forma individul cu urmtoarele genotipuri:
a) AaBbcc; b) AaBbCcDd; c) aabbcc; d) AaBaDdCC ?
Unele reguli ce vor facilita rezolvarea problemelor
1. Dac de la ncruciarea a doi indivizi fenotipic asemntori n descenden se observ segregarea
caracterilor, aceasta semnific faptul c indivizii sunt heterozigoi.
2. Dac de la ncruciarea indivizilor ce se deosebesc fenotipic dup o pereche de caractere i n
descenden se observ o segregare dup aceleai caractere, atunci una din formele parentale este
heterozigot, iar cealalt - homozigot dup gena recesiv.
3. Dac de la ncruciarea a doi indivizi fenotipic asemntori (dup o pereche de caractere) n F2
are loc o segregare dup fenotip i genotip n raportul de 1: 2 : 1 e vorba de ereditatea intermediar, iar
formele parentale au fost heterozigote.
4. Dac de la ncruciarea a doi indivizi cu acelai fenotip n descenden are loc o segregare dup
fenotip n raportul de 9 : 3 : 3 : 1, atunci indivizii sunt diheterozigoi.
5. Dac de la ncruciarea a doi indivizi cu acelai fenotip n descenden are loc o segregare dup
fenotip n raportul de 9 : 7 ; 9 : 6 : 1; 12 : 3 : 1; 13 : 3; 15 : 1; 1: 14 : 1 - merge vorba despre
interaciunea genelor nealele:
9 : 7; 9 : 6 : 1 - complementaritate;
12 : 3 : 1; 13 : 3 - epistatie dominant;
9 : 3 : 4 - epistatie recesiv;
15 : 1; 1 : 14 : 1 - polimerie.
16
Tema 5: ncruciarea dihibrid i polihibrid
Obiective:
S alctuiasc schema determinrii gameilor la ncruciarea dihibrid ;
S determine raportul dup genotip i fenotip de la ncruciarea dihibrid i polihibrid;
S argumenteze rezultatele obinute;
S stabileasc frecvena fenotipului i a genotipului.
Materiale necesare: Plane ncruciarea monohibrid; dihibrid; ncruciarile de analiz;
Bibliografie:
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai esena:
a. ncrucirii dihibride;
b. ncrucirii polihibride;
c. a claselor de gamei formate; formula;
d. genelor alele i a proprietilor lor;
e. importanei legilor lui Mendel n medicin;
Sarcin didactic 1: Rezolvarea problemelor cu aplicarea ncrucirii dihibride i polihibride
Problem (model): La cobai forma crlionat a blnii (P) domina forma neted (p), iar culoarea
neagr (B) - cea alb (b). O femel dihomozigot dup ambele gene dominante este ncruciat cu un
mascul cu prul neted i alb. Determinai genotipul i fenotipul n F1 i F2 ?
Se d: Rezolvare:
P - forma crlionat I. P PPBB x ppbb (2n)
p - forma neted c. n n. a
B - culoarea neagr G (n)
PB pb
b - culoarea alb
B
F1, F2
F1 PpBb (2n)

Fenotipul: crlionat negru


Genotipul: diheterozigot (PpBb).
Rspuns: descendenii de F1 au fenotipul crlionat negru, iar genotipul - PpBb (diheterozigot).
Pentru determinarea descendenilor de F2 se vor ncrucia ntre ei hibrizii de F1:

17
II. P PpBb x PpBb (2n)

G PB Pb pB pb PB Pb pB pb
v
Genele (n) fiecrui printe se combin liber ntre ele i fiecare printe formeaz cte 4 tipuri de
gamei (n fiecare gamet nimerete cte o gen de la fiecare pereche).
Pentru determinarea genotipurilor descendenilor alctuim grilagul lui Pennet:
F2
PB Pb pB pb
PB PPBB c.n PPBb c.n PpBB c.n PpBb c.n
Pb PPBb c.n PPbb c.a PpBb c.n Ppbb c.a
pB PpBB c.n PpBb c.n ppBB n.n ppBb n.n
pb PpBb c.n Ppbb c.a ppBb n.n ppbb n.a

Rspuns:
Segregarea dup fenotip se realizeaz n raport de: 9/16 (P-B-) : 3/16 (P-bb) : 3/16 (pp-B-) : 1/16
(aabb).
Crlionat neted: crlionat albi: netezi negri i netezi albi sau: 9 : 3 : 3 : 1 (dup ambele perechi de
caractere).
Dup fiecare caracter separat segregarea se produce astfel:
Forma: 12 crlionai : 3 netezi
3:1
Culoarea: 12 negri : 3 albi
Segregarea dup genotip constituie:
1PPBB : 2PPBb : 2PpBB : 4PpBb : 1PPbb : 2Ppbb : 1 ppBB : 2ppBb : 1ppbb.

Verificai-v cunotinele:
1. Problem: La om gena membrelor strmbe (P) domin gena structurii normale a tlpii, iar
metabolismul normal (O) - diabetul zaharat (o). O femeie cu structura normal a membrelor i
metabolism normal se cstorete cu un brbat cu membre strmbe. De la aceast cstorie s-au nscut
2 copii: unul din ei era cu membre strmbe, altul cu diabet zaharat.
a) se poate determina genotipul prinilor dup fenotipul copiilor?
b) ce fel de genotipuri i fenotipuri sunt posibile nc n aceast familie ?
2. Determinai tipurile i numrul de gamei pe care le formeaz genotipurile: MmPp? MMPP?
CcDdKkPP?

18
3. Culoarea cpruie a ochilor domin culoarea albastr, iar capacitatea de a mnui cu mna dreapt,
domin pe cea stng. O dreptace cu ochii cprui se cstorete cu un stngaci cu ochii albatri, care au
avut 2 copii: unul dreptaci cu ochii albatri i altul stngaci cu ochii albatri. Determinai genotipul
mamei?
4. O tetraheterozigot (AaBbCcDd) a fost ncruciat cu un homozigot recesiv. Determinai numrul
i clasele de genotipuri n F1? Ce parte de hibrizi vor avea toate 4 gene recesive ?
5. Cte tipuri de gamei va forma o femel cu ochii cprui (heterozigot dup acest gen), tatl
creia a fost hemofilic, i care sunt ele?
6. Care este genotipul zigotei din care se dezvolt hibrizii de F3 (legile lui Mendel).
7. Polidactilia, miopia i lipsa premolarilor se transmit ca caractere autozomale dominante, genele
crora sunt localizate n diferii cromozomi.
Determinai probabilitatea naterii copiilor fr anomalii n familie?

19
Tema 6: Alele multiple. Grupele de snge
Obiective:
S prognozeze motenirea grupelor de snge;
S stabileasc genotipul i fenotipul conform interaciunii alelelor multiple;
S alctuiasc probleme pentru a determina genotipul grupelor sanvine a propriei familii.
Materiale necesare: Plane: Grupele de snge; machete;
Bibliografie
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai noiunile:
a) de gene alele i multiple;
b) fenomenul de codominan.

Reinei:
Genele alele influeneaz n mod diferit asupra manifestrii caracterului. Dac gena are mai
mult de dou forme alele, atunci astfel de alele formeaz n populaie seria aa - ziselor alele multiple.
Fiecare individ al populaiei poate s conin n genotipul su oricare dou alele, iar fiecare
gamet respectiv doar una din ele.
Gradul de dominaie n seriile de alele poate crete de la gena recesiv extrem pn la cea
dominant extrem. De exemplu, la cobai culoarea blnii este determinat de cinci alele ale aceluiai
locus, care n diferite mbinri ne ofer unsprezece variante de culoare.
La om, conform tipului de alele multiple, se transmit prin ereditate, grupele sangvine dup
sistemul ABO.
Sngele omului dup prezena proteinelor aglutinogene i aglutinine n eritrocite i respectiv
plasma sangvin se divizeaz n 4 grupe.
Aglutinogenele (A i B); Aglutininele (alifa i beta).
Motenirea grupelor sangvine se determin de un sistem de alele multiple (a trei gene multiple:
una recisiv io i dou dominante IA i IB) care interacioneaz ntre ele.
Pentru rezolvarea problemelor e necesar a memora fenotipul i genotipul grupelor sangvine.
Fenotipul Genotipul
* I (0) *io io
*II (A) *IA IA; IA io
*III (B) *IB IB ; IB io
*IV (AB) *IA IB

20
Sarcin didactic 1: Rezolvarea problemelor la motenirea grupelor de snge n sistemul
ABO.
Problem (model):
Mama este homhzigot conform grupei a II (A) de snge, iar tata homozigot conform grupei III
(B) de snge. Determinai grupa sangvin pe care o vor moteni descendenii din aceast familie?

Se d: Rezolvare:
- II (A) - IA IA 1) Conform condiiilor problemei prinii sunt
- III (B) - IB IB homozigoi, deci au urmtorul genotip: (IA IA ; IB IB)

P IA IA x IB IB (2n)
F1 = ? 2) Gameii formai - G
IA IB (n)

3) F1 IA IB (2n)
Fenotipul: gr. IV
Genotipul: heterozigot

Rspuns: cnd prinii sunt homozigoi copiii vor moteni grupa a IV (IAIB) de snge.
Propunei rezolvarea i pentru varianta cnd prinii sunt heterozigoi dup grupele respective.
Se mai pot propune pentru rezolvare i alte combinaii?
Verificai-v cunotinele:

1. Numii genotipurile omului care posed grupele sangvine: I; II; III; IV; ?
2. Cte gene alele determin grupa sangvin?
3. Cte gene alele conine fiecare gamet ?
4. Cte tipuri de gamei formeaz o femel cu genotipul: homozogot dup culoarea ochilor i
grupa a II (A) de sangvin?
5. Cte tipuri de gamei va forma un mascul cu grupa a III (B) sangvin i heterozigot dup gena
polidactiliei?
6. n ce const esena procesului de codominan?
7. Definete noiunea de grupa sangvin unu ?
8. La un om rezusul factorul rezus pozitiv este dominant, iar cel negativ este recesiv. Gena grupei
I (O) e recesiv fa de genele grupei II (A) i a III (B):
a) O femeie cu grupa II i rh (-), tatl creia avea grupa I (O) i rh (-), se cstorete cu un brbat
cu grupa a I (O) i rh (-). Determinai probabilitatea naterii copiilor cu ambele caractere ale tatlui.
21
b) Un brbat cu grupa IV (AB), rh (-) se cstorete cu o femeie ce posed grupa III (B) i Rh (+).
Tatl femeiei avea grupa III (B i rh (-). S-au nscut doi copii: unul cu grupa a III (B) i rh (-); altul cu
grupa I (O) i Rh (+). Expertiza medico - judiciar a stabilit c unul din copii este extraconjugal.
Dup care din doua perechi de alele tatl nu e confirmat?

22
Tema 7: Rezolvarea problemelor la ereditatea cuplat cu sexul
Obiective:
s determine caracterele cuplate cu sexul;
s calculeze tipurile de gamei;
s stabileasc fenotipurile i genotipurile n cazul plasrii genelor pe heterozomi.
Materiale necesare: Plane Caractere cuplate cu sexul.
Bibliografie
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai:
Mecanismul genetic de determinare a sexului;
Deosebirile n structura cromozomilor sexuali la diferite sexe;
Noiunea de heterozom i hemizigot.

REINEI:
Genele plasate n acelai cromozom, n loci omologi, se numesc nlnuie i se transmit
mpreun (cuplate);
Totalitatea genelor dintr-un cromozom formeaz grup de linkaje. Numrul grupelor de linkaje
este egal cu setul haploid de cromozomi (de exemplu la om 2n = 46 sau 23 grupe de linkaje);
Genele unei grupe linkate nu se supun segregrii independente (mendeliene);
nlnuirea genelor plasate pe acelai cromozom poate fi complet i incomplet;
n cazul cuplrii incomplete are loc crossingoverul;
Plasarea genelor pe heterozomi ereditatea sexual;
Plasarea genelor pe autozomi ereditatea autozomal;
Numrul probabil de gene alele recombinate n gameii i se determin dup formula
2n , unde n numrul haploid de cromozomi;
De exemplu, la om: n = 23, iar numrul probabil de recombinaii este egal cu 223 = 8.388609;
Genele localizate n cromozomii sexuali pot fi divizate n 3 grupe de nlnuire (lincaje) i se
transmit prin ereditate
Grupa I o constituie genele plasate doar n poriunea cromozomului X - care nu are
omolog n cromozomul .. Pe aceast poriune sunt plasate genele responsabile de aa maladii ca:
hemofilia, daltonismul, atrofia nervului optic, cheratoza folicular, anemia hemolitic, ihtioza;
Grupa a II-a genele sunt localizate pe cromosomul - poriune neomoloag cu
cromosomul X. Genele plasate pe cromozomul Y se numesc holandrice (respectiv i ereditatea

23
holandric) i se transmit din tat n fiu (hipertricoza urechilor);
A II Grupa a III-a genele sunt plasate n poriunele omoloage ale cromozomilor X i Y,
transmindu-se n egal msur att prin cromozomul X ct i prin cromozomul (xeroderma
pigmentar, retinita, miopia total).

24
Poriunea ce n-are omolog n cromosomul -

Poriunele omoloage ale cromosomilor sexuali


X (heterozomilor)

Sarcin didactic 1: Rezolvarea problemelor n cazul plasrii genelor pe heterozomi

a) Problem (model):
Gena culorii ochilor la musculia de oet este plasat n cromosomul X. Culoarea roie
(W) domin culoarea alb (w). Determinai fenotipul i genotipul descendenilor de F1, dac s - a
ncruciat o femel cu ochii albi cu un mascul cu ochii roii.
Rezolvare:
1. Notm caracterele cercetate:
XW rou
Xw alb
2. Stabilim genotipurile prinilor din problem
- femela poate fi numai homozigot, deoarece gena culorii albe Xw Xw - este
recesiv.
XW masculul este heterozigot (n cazul dat cu ochii roii)

3. Alctuim schema genitorilor i a formrii gameilor:

25
P XwXw x XW (2n)
alb rou

G Xw XW (n)

F1 XW Xw Xw (2n)
4. Determinm fenotipul i genotipul descendenilor
Fenotipul: 1 rou : 1 alb
Genotipul: 1 XWXw : 1 Xw ( 50 % : 50 %)
Rspuns: Dup fenotip femela de F1 - roie, iar - alb; dup genotip - XWXw; Xw.

b. Rezolvai de sine stttor urmtoarele probleme: 102, 103, 104, 105 - pag. 46-47
(Helevin)

Sarcin didactic 2. Rezolvarea problemelor la motenirea hemofiliei i daltonismului.


Problema (model):
Hemofilia clasic se transmite prin ereditate ca caracter recesiv cuplat cu cromosomul X.
Un brbat bolnav de hemofilie se cstorete cu o femeie normal, tatl creia sufer de
hemofilie. Determinai probabilitatea naterii copiilor sntoi ?
1. XH normal
Xh bolnavi de hemofilie

2. XHXH sntoas; XHXh sntoas, purttoare


XH sntos; Xh- bolnav.

3. P XHXh x Xh (2n)
s.p. b.

4. G
XH Xh Xh

Din condiiile problemei e clar, c femeia dup gena hemofiliei este heterozigot, fiindc
motenise gena hemofiliei - h de la taic-su.
Rspuns: Probabilitatea naterii copiilor sntoi e de 50 % (25% XHXh i 25%
XH).

26
Problem model
Daltonismul este determinat de gen recesiv localizat pe cromozomul X, iar vederea
normal e determinat de gena dominant.
O femeie ce sufer de daltonism (tatl creia a fost sntos) se cstorete cu un brbat
normal conform acestei gene. Care este probabilitatea naterii copiilor normali i daltonici n
familia respectiv?
1. XD normal
Xd bolnav
2. XDXD sntoas; XD Xd sntoas, dar purttoare; Xd Xd bolnav.
XD sntos; Xd bolnav
3. Din coninutul problemei ne este clar c femeia este heterozigot conform genei
daltonismului, deoarece tatl ei era sntos.

P XD Xd x XD genitorii (2n)

G XD Xd XD (n)

4. F1 XD XD XD XD Xd Xd (2n)
s s s. p b

Rspuns:
Se vor nate 75 % copii sntoi, din care 50 % sntoi complet; 25 % sntoi dar
purttori ai genei daltonismului i 25 % bolnavi de daltonism.
c. Analogic se vor rezolva problemele 108, 109, 110 (problemar N.V. Helevin, 1993).
Verificai-v cunotinele
1. Care din genele maladiilor enumrate sunt localizate pe cromosomul X?
a) hemofilia; b) daltonismul; c) grupele sangvine; d) rezusul-factor; e) sindactilia.
2. Cte grupe de nlnuire sunt caracteristice penrtu cariotipul uman?
3. Cte gene alele a daltonismului sunt n cariotipul diploid al brbatului?
a) 1; b) 2; c) 3; d) 4.
4. O plant homozigot cu flori purpurii i tulpina pitic a fost ncruciat cu o plant
homozigot cu flori roii i tulpin nalt. Descendenii de F1 aveau flori purpurii i tulpin
pitic. ncruciarea de analiz a hibrizilor de F1 cu o homozigot recesiv a demonstrat c:
52 plante sunt cu flori purpurii i tulpin scurt;
48 plante sunt cu flori purpurii i tulpin nalt;

27
49 plante sunt cu flori roii i tulpin scurt;
45 plante sunt cu flori roii i tulpin nalt.
Explicai rezultatele obinute. Care este secretul segregri obinute?
5. Determinai numrul probabil de combinaii cromozomiale n gruncioarele de polen la ofran
(Crocus balansae) care are setul diploid de cromozomi egal cu ase (2n = 6).
6. Cte tipuri de gamei va forma un mascul heterozigot dup gena albinismului i bolnav de
hemofilie? Dar o femel heterozigot dup gena hemofiliei i miopiei?

Tema 8: Crossingoverul. Hrile cromozomiale


Obiective:
S determine % de gamei crossoveri i necrossoveri;
S ntocmeasc hri cromozomiale pentru specii concrete.
Materiale necesare: Microscoape i micropreparate; Plane Crossing-overul i Caractere
cuplate cu sexul.
Bibliografie:
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai:
a. Noiunea de crossing-over;
b. Ipoteza plasrii mai multor gene pe un cromozom;
c. Care este deosebirea la motenirea genelor localizate pe acelai cromozom i pe cromozomi
diferii?;
d. Care este semnificaia hrilor cromozomiale?

REINEI:
Crossing-overul are loc n profaza I a meiozei i asigur o mai mare diversitate
genetic a gameilor obinui;
Genele localizate n acelai cromozom sunt nlnuite i se transmit mpreun;
Totalitatea genelor dintr-un cromozom formeaz un grup de lincaje, numrul crora
este egal cu numrul haploid de cromozomi;
n cazul nlnuirii complete i incomplete are loc schimbul de gene - crossingoverul cu
formarea de gamei crossoveri i necrossoveri;
Formarea gameilor crossoveri au o frecven mai mic ca cei necrossoveri.

28
Sarcin didactic 1. Rezolvarea problemelor cu aplicarea crossing-overului
Problem (model):
La drozofil gena culorii normale a ochilor domin gena ochilor albi, gena structurii
nenormale a abdomenului gena structurii normale. Ambele gene sunt localizate n cromozomul
X la o distan de 3 morganide.
Determinai genotipurile i fenotipurile posibile ale urmailor de la ncruciarea unei
femele heterozigote conform ambelor caractere (genele dominante au fost motenite de la femela
mam) cu un mascul ce are culoarea normal a ochilor i structura normal a abdomenului.
Constatm c dac distana dintre gene e de 3 % nseamn c genotipul femel va forma
dou tipuri de gamei: crossoveri i necrosoveri.
1. XA culoarea normal a ochilor,
Xa culoarea alb a ochilor,
XB structura nenormal a abdomenului,
Xb srtuctura normal a abdomenului.
2. PXA/BX b/a x X b/a (2n)

G XA/B XA/b Xa/B Xa/b XA/b 100 -3 = 97 %


97:2 = 48,5 %
n/c cr. cr. n/c 3 : 2 = 1,5 %
48,5% 1,5% 1,5 % 48,5% 50 % 50 %
3. Alctuim grilajul lui Pennet
F1

/ XB/A 48,5% Xb/A 1,5% Xb/a 48,5 % Xba 48,5%

b/A Xb/A Xb/a


X
Xb/A XB/A 24,5 % Xb/A XB/a 0,75% Xb/A XB/a 0,75% 48,5 50 %
50% 24 ,5
100
50% XB/A 24,5 % XB/a 0,75 % XB/a 0,75 % Xb/a 24,5 %

Rspuns:
Determinm genotipurile i fenotipurile descendenilor, alctuind tabela de mai jos:

Genotipul Fenotipul %
B/A b/A
X X Femel cu ochi normali, structura nenormal a abdomenului 24,3 %

29
Xb/A Mascul, culoarea normal a ochilor i structura normal a abdomenului 24,5 %
Etc... n aa mod se va descrie fiecare din cele 8 genotipuri ale descendenilor Etc...

Sarcin didactic 2: De alctuit harta cromozomial la porumb (Zea mays)


Problem: ntocmii harta cromozomial pentru urmtoarele recombinaii a genelor:
P-Q = 24%; R-P = 14%; R-S = 8%; S-P = 6%
Pentru a ntocmi harta cromozomial efectum urmtorii pai:
1. Desenm o linie care semnific cromozomul. n centrul cromosomului marcm
cea mai mic unitate a recombinaiei, adic S-P = 6%

S 6% P
2. Se ia a doua dimensiune R-S = 8% i se pune pe cromozom, indicndu-se poziiile
probabile de instalare a lor (stnga i dreapta cromozomului).

8% 6%

? R S P R ?
8%

3. Se transfer dimensiunea a III-a R-P = 14%. Se indica c gena R nu poate fi


instalat n dreapta lui R.

R 8% 6%

R S P
14%
4. Se transfer dimensiunea a IV-a P - Q = 24%

Q R 8% S 6% P Q?

24% 24% ?

30
Verificai-v cunotinele:
1. Examinai cromozomii omologi cu 8 perechi de gene alele Aa, Bb, Cc, Dd, Ee, Ff, Gg,
Mm. Determinai poziiile, unde se vor recombina mai des genele i dac va avea loc
crossingoverul, de ce?
n care loc (i ntre care gene) crossingoverul se va realiza mai rar?

A P K D E F C M B O

a p k d e f c m b o

2. Rezolvai problemele de la pagina 69 din problemarul N.V.Helevin, 1993


Tema 9: Variabilitatea organismelor
Obiective:
S determine legitile statistice ale variabilitii modificative;
S construiasc graficul curbei variabilitii modificative;
S determine norma de reacie i s argumenteze rezultatul obinut.
Materiale necesare: semine de fasole, gru, frunze de viin, rigl, creioane etc.
Bibliografie
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.
Explicai:
a. Norma de reacie, variabilitatea modificativ, curba variaional;
b. Dac se motenete norma de reacie? Cum influeneaz ea asupra fenotipului?
c. n ce caz variabilitatea modificativ poate fi ngust i larg?;
d. Care sunt factorii care influeneaz asupra dezvoltrii fenotipului?
Sarcin didactic 1: De determinat norma de reacie i de construit graficul
irului i curbei variaionale n baza rezultatelor obinute.
Algoritmul realizrii sarcinii:
1. Msurai cu rigla lungimea frunzelor, fixnd datele n tabel:
Lungimea (cm) 10 11 12 13 14 15 16 17

31
Cantitatea (buci) 2 5 7 4 3 s. m. d.

2. Construii graficul curbei variaionale:

Pe axa absciselor plasai numrul (cantitatea) frunzelor, iar pe axa ordonatelor lungimea
frunzelor. Scara se va folosi la dorin.
3. Determinai norma reaiei pentru caracterul studiat (lungimea frunzelor).
Norma de reacie se va determina n felul urmtor: Din numrul mai mare se scade numrul mai
mic. Rezultatul obinut va semnifica norma reaciei.
n cazul nostru: 17-10 = 7. Adic norma reaciei este egal cu 7 cm. Frunzele cu devieri
considerabile de la norma reaciei sunt rezultatul unor mutaii.

Tema 10: Genetica populaiilor. Legea lui Hardy - Weinberg


Obiective:
S determine frecvena genelor i alelelor recesive i dominante n populaii;
S determine frecvena genotipurilor n populaii;
S propun algoritmul rezolvrii unor probleme.
Explicai:
a. Care este semnificaia unei populaii Mendeliene?
b. n ce const structura genetic a polulaiei?
c. Principiile unei populaii ideale?
d. Esena Legii lui Hardy-Weinberg i aplicarea ei n practic.
Bibliografie
N.V. Helevin. Culegere de probleme la genetica general i medicinal, 1993
P. Raicu. Genetica, 1999;
Gh. Guleaev. Problemar la genetic, 1980.

32
REINEI:
Genetica populaiei permite determinarea frecvenei alelelor (A i a) a unei gene i
genotipurilor (AA, Aa, aa,) pentru o pereche de alele n populaia oraului, localitii, adic
strctura genetic a populaiei i rspndirea maladiilor ereditare n populaii.
Baza geneticii populaiilor o constitue Legea lui Hardy-Weinberg. Esena ei const n
coraportul a trei genotipuri pentru o pereche de alele (AA, Aa, aa) n populaie care se
supune anumitor legiti i de aceia numrul de indivizi cu un anumit genotip poate fi liber
determinat. Importana legii pentru medicin e c d posibilitatea determinrii
heterozigoilor (n caz de dominaie complet heterozigoii nu se pot deosebi dup fenotip
de homozigoii dominani, plus de aceasta, heterozigoii sunt i purttori de gene ascunse n
cazul unei maladii ereditare).
Legea permite i comparaia structurii genetice a diferitor generaii a uneia i
aceleiai populaii.
Frecvena genelor i a genotipurilor n populaie se exprim n procente (%) sau ca
parte de unitate.
Coraportul a trei genotipuri pentru o pereche de alele se exprim prin formula:
(p+q)2 = p2+2pq+q2, unde:
p frecvena alelei dominante A
q frecvena alelei recesive a
p2 frecvena indivizilor cu genotipul AA
2pq frecvena indivizilor cu genotipul Aa
q2 frecvena indivizilor cu genotipul aa

Sarcin didactic 1: Determinarea frecvenei alelelor n populaie.


Problem model:
ntr-o populaie frecvena genotipurilor genelor codominante A i A1 constituia: AA
64%, aa 4%, AA1 32%. Determinai frecvena (p) a alelei A i (q) a alelei A1, exprimnd
frecvena n pri de unitate.
Rezolvare:
Pentru determinarea frecvenei alelelor se folosete formula p+q = 1, unde p frecvena
genei - A, q frecvena genei - a. n problem sunt date frecvenele genotipurilor:
Se d:
Homozigote AA 64%
Heterozigote Aa 32%

33
Homozigote aa 4%

Frecvena p (A) - ?
Frecvena q (a) - ?

Vom considera numrul alelelor A i a n populaie egal cu 100%. n acest caz alela
A se determin astfel:
64% indivizi AA formeaz 64% alele din numrul total al alelelor populaiei i toate
ele sunt alelele A. Heterozigoii formeaz 32% din numrul total din care 16% o constituie
alela A i 16% alela a. Indivizii cu genotipul aa nu formeaz gamei cu alela A.
Deaceia frecvena alelei A va fi egal cu suma 64% A+16% A este = 80% A.
Frecvena genei a n populaie va fi egal cu 100% - 80% = 20% a.
Pentru a exprima frecvena alelelor A (p) i a (q) n pri de unitate e necesar de a
mpri numrul alelelor A la A + a:
A 80 % 80 %
p A este egal cu +a= + 20 = = 0,8.
A 80 100 %
q a = 1-p = 1- 0,8 = 0,2.
Rspuns: Frecvena genei A este egal cu 0,8%;
Frecvena genei a este egal cu 0,2%.

Sarcin didactic 2: Determinarea frecvenei genotipurilor


Problem-model:
Pentru determinarea grupei de snge n sistemul MN s-au examinat 4200 indivizi din care
1218 posedau antigenul M (genotipul LM LM), 882 antigenul N (genotipul LN LN) i 2100 cu
ambele antigene (genotipul LM LN). Determinai frecvena tuturor celor trei genotipuri
exprimndu-le n procente (%) i pri de unitate.

Se d: Rezolvare:
LM LM 1218 1) Determinm frecvena genotipului LM LM
LN LN 882 4200----------------100%
LM LN 2100 1218------------------x %
1218 100
Total 4200 X= =29%
4200
2)Determinm fercvena genotipului LN LN

34
Frecvena, %:AA-? Aa -? aa-?
4200---------------100%
882------------------x %
882 100
X= =50%
4200
3)Determinm frecvena genotipului LM LN
4200---------------100%
2100---------------- x %
2100 100
X= =21%
4200
4) Suma frecvenelor celor trei genotipuri este egal cu:
29% + 50% + 21% = 100%
2) Pentru determinarea n pri de unitate considerm 4200 = 1 i atunci frecvena
1218
genotipului LM LM = = 0,29; LN LN = 0,21; LM LN = 0,50;
4200
Suma tuturor genotipurilor este egal cu:
0,29 + 0,50 + 0,21 = 1,0 (pentru transformarea unitilor n % se va nmuli
numrul respectiv cu 100%).
Sarcin didactic 3: Determinarea heterozigoilor n populaie
Problem-model:
Albinismul se ntlnete cu o frecven de 1: 20000 i se motenete pe cale autozomial
recesiv. Determinai numrul heterozigoilor.
Se d: Rezolvare:

1 1 1
A sntos (p) Dac q2 = , atunci q = = ;
20000 20000 141
141 1 140
a bolnav (q) frecvena alelei A p = 1 q = - = ;
141 141 141
1 140 1
1: 20000 ( = q2) Rspuns: p= ; q= .
20000 141 141

Frecvena Aa-? Numrul heterozigoilor n populaie este egal cu


1 1
2 pq = 2 =
141 70
Dac vom exprima rspunsul n %, atunci frecvena genotipurilor va fi egal cu 1,4%.

35
REINEI:
Dac frecvena genelor i genotipurilor se exprim n procente (%), atunci numrul total
de gene sau indivizi se ia ca o 100%; dac se exprim n uniti, atunci numrul total de
indivizi sau alele se i-au ca o unitate, adic egal cu 1

Verificai - v cunotinele:
1. Care-i scopul aplicrii Legii lui Hardy-Weinberg n medicin?
2. Determinai frecvena sindromului Down, fenilcetonuriei i a sindromului Edwards?
3. Definii Legea lui Hardy-Weinberg?
4. Ce urmri poate avea izolarea unei populaii puin numerice?

36
Bibliografie
1. Petre Raicu. Genetica, Ed. Pedagogic, Bucureti, 1998, 570 p.
2. Bogoiavlenschi I., et al. Compendiu de lucrri practice la biologie, Chiinu, Lumina, 1991,
270 p.
3. Guleaev G.V. Zadacnic po genetiche, Moscva, Kolos, 1973, 77p.
4. ceglov N. I. Sbornic zadaci i uprajnenii po genetiche, MP, Ekoinvest, 1991, 34 p.
5. Miina N.V. Zadania dlea samostoiatelinoi rabot po obcei biologii, M:, Prosvecenie, 1988,
112 p.
6. Teste de biologie pentru examenul de Bacalaureat, Lyceum 2002, 2003. 2004.

Recenzeni:

Valerii VOZIAN, dr., conf. cercet., eful laboratorului de


Genetic i Ameliorare a plantelor, ICCC Selecia

Zinaida DOLIN, profesor de biologie,


grad didactic superior, Colegiul industriei uoare

37