Sunteți pe pagina 1din 330

KOJI SUZUKI

Ring 2

SPIRALA
Traducere din englez de DANIEL IONESCU

HUMANITAS

fiction
2006

Coperta de IONU BROTIANU

KOJI SUZUKI SPIRAL Copyright 2004 by Koji Suzuki All rights reserved.
3

KOJI SUZUKI, supranumit Stephen King al Japoniei, s-a nscut n 1957 n prefectura Shizuoka. Studiaz literatura francez la Universitatea Keio din Tokio, schimb cteva slujbe mrunte, apoi i asum un statut neobinuit pentru un brbat din Japonia: casnic. ncepe s scrie, literalmente cu copiii pe genunchi. Debuteaz cu romanul Rakuen (1990, Marele Premiu al Japoniei pentru literatur fantasy). Devine celebru dup publicarea romanului Ringu n 1991 (Ring 1 Cercul, Humanitas, 2006), care strnete o adevrat furtun n Japonia i se vinde n aproape trei milioane de exemplare. Seria Ring, care cumuleaz vnzri de peste opt milioane de exemplare, cuprinde n prezent Ring 1 Cercul, Ring 2 Spirala (Premiul Eiji Yoshikawa, 1996), Ring 3 Bucla i Ring 0 Naterea. Succesul ei se explic i prin numeroasele ecranizri: Ringu (Japonia, 1998, n regia lui Hideo Nakata), Rasen (Japonia, 1998), Ringu 2 (Japonia, 1999), The Ring (SUA, 2002, n regia lui Gore Verbinski, cu Naomi Watts; pe ecranele noastre a rulat sub titlul Avertizarea), The Ring Two (SUA, 2005) etc. Una dintre povestirile lui Koji Suzuki a fost de asemenea ecranizat, n Japonia (Honogurai mizu no soko kara, 2002) i n SUA (Dark Water Apa ntunecat, 2005).

PROLOG

Mitsuo Ando s-a smuls dintr-un vis n care se scufunda n ocean. ritul telefonului s-a amestecat cu zgomotul valurilor i o clip mai trziu s-a trezit cu o tresrire de spaim, de parc apele l-ar fi nhat. A ntins mna dincolo de marginea patului i a ridicat receptorul. Alo. A ateptat, dar n-a auzit niciun sunet. Alo, a zis din nou, de data asta mai hotrt, ca i cum i-ar fi poruncit interlocutorului su s rspund. Le-ai primit? Glasul a stors din el i ultima pictur de energie. Parc l-ar fi tras cineva ntr-un an adnc i ntunecos. Visul din care tocmai se desprinsese s-a desfurat fulgertor n faa ochilor si. Un val uria l luase deodat de pe plaj. n timp ce se scufunda ctre fundul oceanului, i ddea seama c-i pierduse complet simul de orientare, nu mai tia unde-i stnga sau dreapta, ce nseamn sus sau jos. Neajutorat, se lsase tras de curent Ca de fiecare dat, simise cum o mn micu l apuc de picior. Ori de cte ori visa, simea atingerea acelei mini, degetele subiri ca nite anemone alunecnd, apoi pierzndu-se n adncuri. Iar el era complet neputincios, i asta l chinuia ngrozitor. i ntindea amndou braele, convins c va prinde trupuorul acela, dar pur i simplu nu reuea s-l in. i scpa din mini n fiecare vis, lsndu-i ntre degete o uvi de pr moale i fin. Doar att. Vocea femeii i-a reamintit cu o intensitate insuportabil de moliciunea uviei de pr. Da, le-am primit, a zis el enervat.
6

Actele de divor. Le primise cu dou sau trei zile n urm, deja semnate i parafate. Mai trebuia s le semneze i el, s-i pun parafa, astfel hrtiile i-ar fi mplinit menirea. nc n-o fcuse. i? Simise nerbdare n glasul soiei lui, dei nu rostise dect un singur cuvnt. Cum era n stare s tearg cu atta nepsare apte ani de csnicie? i ce? Vreau s le semnezi, s le parafezi i s mi le trimii napoi. Ando a cltinat din cap. De cte ori ncercase pn atunci s-o lmureasc? Era tentat s-o ia de la capt. Totui, de fiecare dat cnd o fcea, ea i punea condiii inacceptabile, ca i cum ar fi inut mori s-i arate c are o voin de fier. Ando era dispus s renune i la ultima rmi de respect fa de sine nsui, dar n ultimul timp pn i asta l obosea. Foarte bine. O s fac tot ce vrei. A amuit, surprins c renunase att de repede. A tcut i ea cteva momente, apoi a spus pe un ton scrnit: Cred c-mi datorezi o explicaie. Despre ce? Era un rspuns pe care ar fi trebuit s-l evite. Despre ce mi-ai fcut. Ando a strns mai tare receptorul i a nchis ochii. O s m hruiasc la fel, n fiecare diminea, chiar i dup ce obine divorul? Era un gnd insuportabil. Eu sunt de vin. Dar spusese asta prea repede, prea uor, fr s pun n cuvinte greutatea sentimentelor, iar ea atepta un pretext. Cel mai mic pretext. Nu i-a psat niciodat de el! Vorbeti prostii. i dai seama ce spui? Bine, arunci de ce Nu-mi mai pune ntrebri. tii foarte bine rspunsurile.
7

Cum ai putut s faci aa ceva? Glasul ei tremura, semn prevestitor al furtunii care avea s se dezlnuie curnd. Ando ar fi vrut s-i spun s termine cu telefoanele i apoi s trnteasc receptorul, dar s-a stpnit. Singura mngiere pe care i-o putea oferi era s-i asculte rbdtor acuzaiile, s-o lase s-i verse durerea. Spune ceva. Acum plngea. De exemplu? De un an i ceva numai despre asta vorbim. Nu mai e nimic de spus. D-mi-l napoi! Era un strigt de durere cu desvrire lipsit de raiune. i Ando l voia napoi. Pentru asta doar pentru asta se ruga zi i noapte de-atunci ncoace, contient totui c era complet inutil. Adu-l napoi, te implor! D-mi-l napoi! Nu pot, a spus el simplu, spernd s-o liniteasc. l vreau napoi! Nu mai ndura s-o aud chinuindu-se aa, prizonier a nenorocirii din trecut, incapabil s nceap o via nou. El, cel puin, ncerca s triasc ceva mai constructiv. Ceea ce pierduser nu putea fi regsit i fcuse tot ce era omenete posibil pentru a-i salva csnicia, pentru a-i convinge soia c sperana unui nou nceput nu era deart. Nu voia s divoreze din acest motiv. Era gata s fac orice. i ar fi meritat dac ar fi putut redeveni perechea fericit care fuseser odat. Numai c ea refuza s priveasc n viitor i l acuza c poart ntreaga vin. D-mi-l napoi! Ce vrei s mai fac? Nu nelegi ce-ai fcut! Ando a oftat, destul de tare pentru a fi auzit la cellalt capt al firului. Femeia repeta aceleai cuvinte lipsite de sens i era limpede c i cedaser nervii. Ando ar fi vrut s o poat duce la un psihiatru un prieten , dar tatl ei era doctor, director de spital, i ea ar fi
8

luat-o fr ndoial ca pe un afront. O s nchid acum. Foarte bine, fugi, aa cum faci de obicei. Vreau s uit totul. Vreau s trec peste asta. tia c nu avea niciun rost, dar nu reuise s gseasc un rspuns mai potrivit. n timp ce lsa receptorul n furc, a auzit un strigt disperat: Vreau s mi-l aduci napoi pe Takanori! Chiar i dup ce a nchis, numele a continuat s neasc din receptor pn cnd ecourile lui au umplut ncperea. Fr s vrea, Ando a nceput s-l opteasc: Takanori, Takanori, Takanori. O vreme a rmas ntins pe pat, cu capul n mini i complet nemicat, ghemuit ca un copil n pntecele mamei. n cele din urm, s-a uitat la ceas i i-a dat seama c nu putea rmne acolo la nesfrit. Trebuia s plece la lucru. A scos telefonul din priz, pentru a fi sigur c nu va mai putea s-i telefoneze, apoi s-a dus la fereastr. Cnd a deschis-o, dornic s primeneasc tristeea din camer, a auzit croncnitul unei ciori. Psrile zburau mereu pe-acolo dinspre parcul Yoyogi i se aezau pe cablurile electrice de pe strzi, dar cea pe care o auzise era neobinuit de aproape i i provocase o tresrire. Totui, strigtul psrii, ascuit i natural, l-a fcut s se nsenineze ct de ct. Contrastul fa de adncul ntunecat al oceanului din vis, fa de gemetele disperate ale mamei care-i chema fiul fusese desvrit. Era smbt dimineaa, o zi senin de toamn. Poate c tocmai vremea frumoas i-a provocat n minte o asociere nedorit, pentru c n clipa urmtoare ochii i s-au umplut de lacrimi. i-a suflat nasul. S-a trntit din nou pe pat. Cteva clipe a crezut c reuise s-i stpneasc lacrimile, dar au nceput s-i iroiasc iar pe obraji. Curnd plngea n hohote, mbrind perna i strignd numele fiului su. Se ura pe sine nsui pentru c renunase att de uor. Disperarea era un vizitator care nu respecta niciun program, care
9

atepta doar s se ntmple ceva i apoi ataca neobosit. Nu mai plnsese aa de cteva sptmni. Dei intervalele dintre crize se mriser treptat, tristeea care-l copleea era la fel de profund ca prima dat. Se ntrebase adesea ct timp avea s-o duc n felul sta, dar nu ndrznise niciodat s-i dea un rspuns. A luat un plic aezat ntre dou cri din bibliotec i a scos din el cteva fire de pr. Era singura amintire material de la fiul su. Minile lui atinseser capul biatului i, cnd ncercase s-l trag spre el, uvia i rmsese ntre degete. Era un adevrat miracol c nu o pierduse mai trziu, n timp ce se zbtea n valuri. Prul se ncurcase n verighet. Trupul nu fusese gsit nici pn azi. Nici mcar nu avuseser cum s organizeze ceremonia de incinerare. uvia era singura rmi din fiul lui. i-a lipit-o de obraz, amintindu-i cum l mngia pe Takanori. Cnd a nchis ochii, biatul s-a ntors la via n gndurile lui. Ando era aproape convins c ar fi fost de-ajuns s ntind mna i-ar fi putut s-l ating Dup ce s-a splat pe dini a rmas n faa oglinzii, dezbrcat pn la bru. i-a dus mna la brbie i a masat-o uor. i-a trecut limba peste dini. Nu se splase prea bine, suprafaa lor era nc puin aspr. A observat c pe gt avea o pat mai ntunecat, chiar sub brbie, unde nu se brbierise cum trebuie. A ridicat aparatul de ras i a trecut lama peste perii minusculi, apoi a ncremenit, hipnotizat de propria lui imagine din oglind. i-a ridicat capul i sa uitat atent la pielea ntins i palid a gtului. A strns mai bine aparatul de ras n mn i l-a inut o clip la baza gtului, apoi l-a cobort ncet peste piept, peste abdomen, oprindu-se n cele din urm n dreptul buricului. Pe piele i rmsese o dr alb, dreapt, care pornea dintre sfrcuri i trecea peste abdomen. i-a nchipuit c aparatul de brbierit era un bisturiu i a vzut n minte propria lui disecie. Ando i ctiga pinea disecnd cadavre, aadar tia foarte bine ce-ar fi vzut n cutia lui toracic. O inim de mrimea unui
10

pumn, cuibrit ntre plmnii rozalii. Btaia ei ferm. Dac se concentra suficient de bine, ar fi putut s-o aud. Dar durerea aceea nencetat din piept n care dintre viscere era localizat prerea de ru? n inim, oare? Ar fi vrut s-i poat smulge durerea cu minile goale. Lama a alunecat pe pielea transpirat i Ando a pus aparatul de ras pe policioara de deasupra chiuvetei. i-a ntors capul i a vzut un firicel subire de snge pe partea dreapt a gtului. Se tiase. Ar fi trebuit s simt mcar o uoar usturime acolo unde lama i crestase pielea, dar n-a simit nimic n timp ce se uita la linia fin i roie. n ultima vreme devenise insensibil la durerea fizic. De cteva ori i dduse seama c s-a rnit abia dup ce vzuse rana. Poate c-i pierduse dorina de a tri. i-a tamponat gtul cu un prosop i s-a dus s vad ct era ceasul. Opt i jumtate. Era timpul s plece. n ultimul timp, serviciul era singurul lui colac de salvare. Reuea s scape de amintiri doar aruncndu-se cu capul nainte n munca de zi cu zi. Era lector de medicin legal la Facultatea de Medicin a Universitii Fukuzawa, dar lucra i la Institutul de Medicin Legal din Tokio. Doar cnd fcea o autopsie putea s uite complet de moartea fiului su. Printr-o ironie a sorii, aciunea asupra trupurilor moarte l elibera de durerea morii care-l lovise. A ieit din apartament. n timp ce trecea prin holul blocului, a aruncat o privire la ceas. Devenise o obinuin. ntrziase cinci minute fa de program cinci minute i luaser semnarea i parafarea actelor de divor. n numai cinci minute, legtura dintre el i soia lui fusese retezat. tia c pe drumul pn la universitate erau trei cutii potale i s-a hotrt s pun plicul n prima. S-a grbit s ajung la staia de metrou.

11

Partea nti DISECIA

12

1
Ando era de serviciu n sala de autopsie. A intrat n birou i a rsfoit fiele din dosarul urmtorului cadavru. n timp ce cerceta detaliile din fotografiile polaroid fcute la faa locului, palmele au nceput s-i transpire i a fcut mai multe drumuri pn la chiuvet ca s se spele pe mini. Era o zi de la mijlocul lunii octombrie, nu prea cald, dar Ando transpira abundent indiferent de anotimp. Obinuia s se spele pe mini de cel puin apte-opt ori pe zi. A rsfirat din nou fotografiile pe birou. n prima se vedea un brbat ndesat i solid care sttea pe jos, cu capul sprijinit de marginea patului poziia n care se afla atunci cnd inima lui se oprise. Nu avea leziuni externe vizibile. Urmtoarea fotografie era un prim-plan al feei. Nicio urm de congestionare, niciun semn de strangulare. N-a reuit s gseasc nici mcar un indiciu al cauzei morii. Exact acesta era motivul pentru care cadavrul fusese trimis la Institutul Medico-Legal n vederea unei autopsii n ciuda faptului c nu existau dovezi care s ateste o crim. Dup toate aparenele, fusese un deces accidental, pe deasupra fr cauze naturale evidente, iar n aceast situaie trupul nu putea fi incinerat nainte de a se stabili precis cauza morii. Cadavrul fusese gsit cu minile i picioarele larg desfcute. Ando l cunotea pe mort, l cunotea chiar foarte bine: era un fost coleg de facultate pe care nu-i nchipuise niciodat c-l va examina n calitate profesional. Ryuji Takayama, care nc mai respira cu dousprezece ore n urm, i fusese coleg de grup toi cei ase ani de studenie la Facultatea de Medicin. Majoritatea studenilor din promoia lui doreau s practice medicina sub o form sau alta, iar cnd Ando se hotrse s fac
13

Anatomo-Patologie, colegii ncepuser s opteasc pe la spatele lui c s-a icnit de-a binelea. Takayama se abtuse i mai mult de la calea obinuit. Fusese ef de promoie, ns dup absolvire o luase din nou de la capt, de data asta ca student la Filosofie. n clipa morii, era lector i preda cursuri de logic. Ando ocupa aceeai poziie la Catedra de Anatomo-Patologie. Cu alte cuvinte, fcnd abstracie de faptul c universitatea i acceptase cererea de a se nscrie iar la studii, ascensiunea universitar a lui Ryuji fusese fulgertoare. Avea treizeci i doi de ani, cu doi mai puin dect Ando, care, dup ce terminase liceul, irosise civa ani chinuindu-se s fie admis la universitatea pe care i-o alesese. Privirea lui Ando a zbovit asupra rubricii n care era scris ora decesului: 9.49, seara trecut. Ora morii e al naibii de precis, a zis Ando, ntorcndu-se spre locotenentul de poliie care venise s asiste la autopsie. Din cte tia Ando, Takayama locuia ntr-un apartament din zona Nakano Est. Era celibatar, tria singur i murise subit n propria lui cas. Era practic imposibil ca ora decesului s poat fi stabilit att de exact. S-ar putea spune c am avut noroc, zise nepstor locotenentul, aezndu-se pe un scaun de lng masa de autopsie. Noroc? De ce? Locotenentul s-a ntors spre nsoitorul lui, un sergent mai tnr. E i Mai Takano aici, nu-i aa? Da, domnule. Am vzut-o afar, n sala de ateptare. Eti bun s-o chemi? Imediat, domnule. Nu e rud cu decedatul, dar ea e cea care a descoperit cadavrul. E una dintre studentele favorite ale profesorului Takayama, de fapt iubita lui. Dac gsii vreun motiv de suspiciune n declaraia ei, suntei liber s-o luai la ntrebri. Orice ntrebri, doctore. Regulamentul cerea ca trupul nensufleit s fie predat celei mai
14

apropiate rude imediat dup ncheierea autopsiei. n cazul lui Takayama, cele mai apropiate rude erau mama, fratele i cumnata lui. Se aflau afar, n sala de ateptare, nc dinainte s vin Mai Takano. Femeia n cauz a intrat n birou, apoi s-a oprit i a cltinat din cap. Cnd a vzut-o, Ando s-a ridicat imediat, s-a nclinat i i-a oferit un scaun. mi pare ru c trebuie s trecei prin asta, a zis el. Mai era mbrcat ntr-un costum simplu, albastru marin, i strngea n mini o batist alb. Ando s-a ntrebat deodat dac nu cumva rsuflarea morii pune mai bine n valoare frumuseea femeilor. Avea un trup zvelt, mini i picioare delicate, iar simplitatea discret a hainelor i scotea n eviden paloarea tenului. Faa ei era un oval fr cusur, cu trsturi fine i perfect echilibrate. Ando putea s-i vad curbele frumoase ale craniului fr s fie nevoit s-o aeze pe masa de disecie. Fr ndoial, sub pielea aceea fin erau organe sntoase i un schelet desvrit. A simit brusc impulsul s le ating. Locotenentul a fcut prezentrile i amndoi i-au rostit numele. Mai s-a ndreptat spre scaunul pe care i-l artase Ando, dar dup doi pai a nceput s se clatine. A trebuit s se sprijine de un birou ca s-i pstreze echilibrul. i-e ru? Ando s-a uitat la ea, examinndu-i cu mare atenie faa. Se fcuse brusc pmntie, dei mai devreme era foarte palid. S-a ntrebat dac nu cumva era anemic. Mulumesc, m simt mai bine acum. O vreme s-a uitat fix la un punct de la picioarele ei, inndu-i batista la frunte, pn cnd locotenentul i-a adus un pahar cu ap. L-a but, i asta a prut s-o calmeze ct de ct. i-a ridicat privirea i a vorbit cu un glas att de slab, nct Ando abia a reuit s neleag ce spunea: mi pare ru, pur i simplu mi-a venit
15

Ando a neles imediat. i venise ciclul. Cauzele strii ei de anemie erau neplcerea asta inevitabil i stresul provocat de emoiile puternice. Dac nu mai intervenea altceva, nu aveau niciun motiv de ngrijorare. Din ntmplare, rposatul domn Takayama i cu mine am fost prieteni buni n timpul studeniei. i fcuse aceast mrturisire ca s-o liniteasc puin. Mai i-a ridicat capul, pe care pn atunci i-l inuse plecat. Ai spus c v numii Ando? Da. S-a uitat bine la el cteva clipe. Apoi, n mod evident plcut surprins, i-a mijit ochii i s-a nclinat uor, ca i cum se ntlnise cu un prieten vechi. Sunt ncntat s v cunosc. Ando era convins c i interpretase corect expresia: fata se gndea probabil c, n virtutea relaiei lui cu Takayama, poate avea ncredere c el va trata trupul cu respectul cuvenit. n realitate, prieten sau nu cu decedatul, Ando mnuia bisturiul la fel. Scuzai-m, domnioar Takano, a intervenit locotenentul. Suntei bun s-i spunei n detaliu i doctorului ce ne-ai spus nou despre cum l-ai descoperit pe decedat? Poliistul prea hotrt s nu lase garda jos, dei nu exista niciun motiv de suspiciune. Oricum, nu era dispus s-i piard timpul ascultnd amintiri dulcege despre ndrgitul rposat. O chemase pe Mai aici cu scopul precis de a-i cere s-i repete lui Ando ntreaga poveste. Fata fusese prima persoan care vzuse cadavrul, iar Ando era legistul care conducea autopsia. Unindu-i forele, spera poliistul, vor reui s afle cauza morii. Iat de ce se adunaser acolo. Aproape n oapt, Mai i-a spus lui Ando, n linii mari, tot ce declarase la poliie seara trecut. Cnd a sunat telefonul, abia ieisem din baie i mi uscam prul. M-am uitat imediat la ceas. Cred c gestul acesta a devenit o
16

obinuin. Dac tiu la ce or sun telefonul, pot s ghicesc destul de corect cine m caut. Profesorul Takayama mi telefona rareori, de obicei eu l sunam. Oricum, nu m cuta aproape niciodat dup nou seara. Prin urmare, la nceput mi-am zis c nu poate fi el. Am ridicat receptorul i am spus Alo, iar o clip mai trziu am auzit un strigt la cellalt capt al firului. M-am gndit imediat c era o glum proast. Am fost luat prin surprindere, aa c am ndeprtat receptorul de la ureche, dar strigtul s-a transformat ntr-un geamt, apoi s-a stins. Parc m cuprinsese o o ncremenire stranie. Am lipit iar receptorul de ureche i am ncercat s aud ceva, orice, dar, n acelai timp, eram ngrozit de ceea ce a fi putut afla. Apoi, brusc, ca i cum cineva ar fi apsat pe un buton, n minte mi-a aprut faa profesorului Takayama. Atunci i-am recunoscut i vocea. A lui era, clar. Am pus receptorul n furc i am format numrul lui de telefon, dar suna ocupat. Aa am ajuns la concluzia c el m sunase i c i se ntmplase ceva. S neleg c n-ai apucat s schimbai niciun cuvnt cu Ryuji? a ntrebat Ando. Nu. Am auzit doar strigtul acela, a zis Mai, cltinnd din cap. Ando a mzglit ceva ntr-un carnet i a ndemnat-o s continue: Ce-ai fcut mai departe? M-am dus pn acolo, voiam s aflu ce s-a ntmplat. Mi-a luat cam o or s ajung la el cu metroul. Cnd am intrat l-am gsit acolo, sprijinit de pat, n dormitorul de lng buctrie Ua de la intrare era descuiat? Aveam mi dduse o cheie. Rostise aceste cuvinte cu o jen evident, pe care nici mcar nu ncercase s-o ascund. Nu, nu asta am vrut s spun. Ua era ncuiat pe dinuntru? Da, era ncuiat. Aadar, ai intrat n cas, a mboldit-o Ando. Profesorul Takayama era sprijinit de pat, cu faa n sus. Avea braele i picioarele larg desfcute
17

Glasul i s-a stins. A scuturat violent din cap, ca i cum ar fi ncercat s alunge imaginea pe care o revedea n minte. Ando nu avea nevoie s fac un efort de imaginaie. Fotografiile se aflau n faa lui i prezentau trupul nensufleit al lui Ryuji mai elocvent dect ar fi putut s-o fac cuvintele. A ridicat pozele de pe birou i le-a folosit pe post de evantai pentru a-i rcori fruntea acoperit de sudoare. Ai vzut ceva neobinuit n camer? Nu mi-a atras atenia nimic Doar c receptorul nu era n furc. Ando a ncercat s pun cap la cap informaiile din raportul poliiei cu cele din povestea fetei i s reconstituie astfel evenimentele. Ryuji simise c i se ntmpl ceva i i telefonase iubitei lui, Mai Takano. Spera, probabil, c l-ar fi putut ajuta. Dar de ce nu sunase mai degrab la 119? Dac ai un junghi n piept i mai gseti timp i putere s foloseti telefonul, n mod normal, primul numr pe care-l formezi este cel al salvrii. Cine a sunat la 119? Eu. De unde? Din apartamentul profesorului. Deci el n-a apucat s fac asta, nu-i aa? Ando i-a aruncat o privire locotenentului, iar acesta i-a confirmat printr-un semn c avea dreptate. Verificase de la bun nceput dac decedatul telefonase la salvare. O clip, Ando a luat n calcul ipoteza sinuciderii. ndurerat de cruzimea cu care-l trateaz iubita, brbatul se hotrte s-i pun capt zilelor i nghite otrav. Apoi ncercnd s vorbeasc cu femeia care l-a mpins s aleag aceast soluie extrem, vrea s-o acuze i s-o fac s se simt vinovat. n cele din urm, mai are putere doar s strige i moare. Totui, conform raportului, sinuciderea nu prea s fie o ipotez credibil. La faa locului nu fusese gsit niciun recipient cu urme de
18

otrav, nici vreo dovad c Mai ar fi luat obiectul respectiv din apartament. Mai mult, nu-i trebuia dect o singur privire pentru a nelege c starea ei sufleteasc anula orice suspiciune n aceast privin. Doar un individ complet obtuz la subtilitile relaiilor dintre sexe n-ar fi observat imediat ct de adnc era respectul pe care Mai Takano l nutrea fa de profesor. Lacrimile care apreau din cnd n cnd n ochii ei nu erau n niciun caz provocate de sentimentul de vinovie al femeii care-i mpinsese iubitul s-i curme viaa. Cauza lor era regretul profund la gndul c nu-i va mai atinge niciodat trupul. Ando avea senzaia c se privete ntr-o oglind. i el se confrunta n fiecare diminea cu propriul lui chip devastat de durere, iar o asemenea durere nu putea fi simulat. i, nu n ultimul rnd, femeia venise la morg pentru a lua cadavrul. Dar cel mai important argument dintre toate era altul: Ando nu-i putea nchipui n ruptul capului c un individ att de dur ca Ryuji s-ar fi sinucis din cauza unei femei. Rmneau n discuie inima i capul. Ando trebuia s caute dovezile unui infarct sau ale unei hemoragii cerebrale. Bineneles, nu putea exclude ipoteza c examinarea coninutului stomacului va arta prezena cianurii de potasiu sau, cine tie, semnele unei intoxicaii alimentare severe, a otrvirii cu monoxid de carbon sau ale altor cauze accidentale pe care le ntlnise din cnd n cnd de-a lungul timpului. Totui, pn atunci, bnuielile lui fuseser confirmate n majoritatea cazurilor. Takayama pricepuse brusc c i se ntmpl ceva i pur i simplu dorise s aud pentru ultima dat glasul iubitei sale. nainte ca inima lui s se opreasc, mai apucase doar s strige. n mare, cam asta se ntmplase. Tehnicianul care-l ajuta pe Ando n ziua aceea i-a vrt capul pe u i l-a anunat: Domnule doctor, am pregtit totul. Ando s-a ridicat n picioare i a zis, pentru toi i pentru nimeni: Bun, e timpul s ncepem.
19

ntr-un fel sau altul, va afla adevrul dup ce va face autopsia. Nu i se ntmplase niciodat s nu descopere cauza precis a morii. Va afla i acum, ct ai bate din palme, de ce murise Ryuji Takayama. Nicio clip prin minte nu i-a trecut gndul c era posibil s nu reueasc.

20

2
Lumina dimineii de toamn se strecura pe coridorul care ducea la sala de autopsie. Coridorul acesta era ntunecos i jilav i, n timp ce-l traversau, cizmele lor de cauciuc provocau sunete greoase. Erau patru: Ando, tehnicianul i cei doi poliiti. Restul echipei alt asistent, stenograful i fotograful era deja n sala de autopsie. Cnd au deschis ua, au auzit zgomotul apei curgnd. Asistentul sttea n dreptul chiuvetei de lng masa de disecie i spla instrumentele. Robinetul era neobinuit de mare i apa cdea din gura lui ntr-o coloan groas i alb. Podeaua ncperii de o sut de metri ptrai era deja acoperit cu ap, motiv pentru care toi apte, inclusiv cei doi poliiti, purtau cizme de cauciuc. n mod normal, apa continua s curg pe toat durata autopsiei. Ryuji Takayama i atepta pe masa de disecie, gol, ntins pe spate, cu pntecele bombat. Avea cam un metru aizeci i cinci i, dac fceai abstracie de colacul de grsime din jurul taliei i de umerii largi i musculoi, era cldit ca un butoi. Ando a ridicat braul drept al cadavrului. Cu excepia gravitaiei, nicio rezisten. O dovad sigur c viaa prsise trupul. Ando putea s mite braele acestea a cror for fusese cndva un motiv de mndrie pentru Ryuji la fel de uor cum ar fi micat braele unui nounscut. Ryuji fusese cel mai puternic din universitate, nimeni nu se putea msura cu el la skandenberg. Toi cei care l provocau se trezeau cu braul lipit de mas nainte s apuce mcar s-i ncordeze bicepsul. Acum, acelai bra nu mai avea niciun strop de putere. Dac Ando i-ar fi dat drumul, ar fi czut moale pe mas. i-a concentrat atenia asupra abdomenului i a organelor genitale expuse oarecum indecent. Penisul era chircit n mijlocul
21

unei tufe de pr negru i des, iar prepuul acoperea aproape n totalitate glandul. Membrul era uimitor de mic, aproape delicat n raport cu robusteea trupului. Ando s-a ntrebat surprins dac Ryuji i Mai reuiser vreodat s ntrein relaii sexuale normale. A luat bisturiul i l-a nfipt sub maxilarul inferior, secionnd muchii groi n linie dreapt, pn jos, la abdomen. Ryuji murise cu dousprezece ore n urm i corpul i era rece ca gheaa. A tiat coastele cu un clete i le-a ndeprtat una cte una, apoi a scos plmnii i i-a dat asistentului. n timpul facultii, Ryuji se declarase categoric mpotriva fumatului i, judecnd dup cum artau plmnii lui, rmsese ferm pe poziie pn la sfrit. Aveau o frumoas nuan de roz. Cu micri ndelung exersate, asistentul a cntrit i a msurat plmnii, rostind cu voce tare datele, iar stenograful le-a notat imediat. n tot acest timp, ncperea era scldat n lumina bliurilor, pentru c organele erau fotografiate din toate unghiurile. Fiecare tehnician i cunotea perfect meseria i treaba mergea ca pe roate. Inima era nvelit ntr-o membran subire de grsime. n funcie de unghiul din care cdea lumina, prea fie alburie, fie glbuie, i era puin mai mare dect media. Trei sute dousprezece grame. Greutatea inimii lui Ryuji. 0,36% din greutatea total a corpului. Lui Ando i-a fost de-ajuns s arunce o singur privire la suprafaa exterioar a muchiului care cu dousprezece ore n urm nc mai pompa sngele n trup ca s-i dea seama c suferise o necroz sever. Partea stng, imediat sub membran, cptase o nuan de rou ntunecat spre maroniu, mai nchis dect restul. O poriune din artera coronar, care se bifurc la suprafa pentru a se ncolci apoi n jurul inimii, era blocat, probabil din cauza unei tromboze. Sngele nu mai trecuse dincolo de punctul de ocluzie i inima se oprise. Dovezi indiscutabile ale unui atac de cord. Msurnd din ochi ntinderea poriunii necrozate, Ando i-a fcut o idee destul de precis despre locul n care se instalase blocajul: n artera coronar stng, chiar nainte de bifurcaie. Un
22

dop n punctul acela era echivalent cu un risc de deces de aproape sut la sut. Prin urmare, stabilise destul de clar cauza morii, dei pentru a afla ce anume provocase ocluzia trebuia s vad i rezultatele analizelor, pe care nu spera s le primeasc mai devreme de douzeci i patru de ore. Ando a rostit cu deplin ncredere infarct miocardic datorat blocrii arterei coronare stngi i a continuat autopsia, extrgnd ficatul. Apoi a verificat dac rinichii, splina i intestinele aveau un aspect normal i a examinat atent coninutul stomacului, dar nimic nu i-a atras atenia. Era pe punctul s deschid craniul, cnd asistentul lui i-a lungit gtul i i-a spus pe un ton ncrcat de bnuieli: Domnule doctor, uitai-v la gtul lui. Omul arta cu degetul un punct din interiorul gtului, acolo unde fusese secionat. O poriune din mucoasa de la suprafaa faringelui era acoperit de ulceraii. Leziunea avea o suprafa mic i Ando ar fi riscat s-o treac cu vederea dac asistentul n-ar fi fost la post. Nu mai vzuse nimic asemntor pn atunci. Probabil c nu avea nicio legtur cu decesul, dar, pentru orice eventualitate, a luat o prob. Trebuia s atepte analizele de laborator ale mostrei de esut ca s poat spune precis despre ce era vorba. A continuat prin a face incizii n piele de jur-mprejurul craniului i a jupuit scalpul dinspre ceaf spre frunte. Faa, ochii, nasul i gura lui Ryuji erau acoperite acum de o claie de pr srmos, iar suprafaa interioar albicioas a scalpului reflecta lumina lmpilor de deasupra. Oricine ar fi vzut aceast scen s-ar fi convins imediat c faa unui om este alctuit dintr-o singur bucat de piele. Ando a desprins calota cranian i a scos creierul. Suprafaa masei cerebrale era albicioas i brzdat de nenumrate circumvoluii. Ryuji ieea net n eviden prin inteligena lui sclipitoare, chiar n comparaie cu cei mai buni studeni de la Facultatea de medicin. Vorbea fluent engleza, germana i franceza i la cursuri punea ntrebri pe care nu puteau s le neleag dect colegii care citeau cele mai noi reviste tiinifice
23

strine. Pn i lectorii erau intimidai. Pe de alt parte, cu ct aprofunda mai mult studiul medicinii, cu att interesul lui se deplasa spre matematica pur. O vreme, toi cei din seria lor fuseser cuprini de pasiunea pentru criptologie. Inventau pe rnd cte un cod, apoi ceilali se luau la ntrecere s-l descifreze. Ryuji ctiga de fiecare dat. Cnd a venit i rndul lui, Ando a conceput un cifru pe care era convins c nimeni nu-l putea sparge, dar Ryuji l-a dat gata aproape n joac. n clipa aceea, Ando a fost nspimntat nu att de geniul matematic infailibil al lui Ryuji, ct de senzaia c-i citise gndurile. Pur i simplu nu putea s accepte c-i decriptase cifrul. Nimeni nu mai reuise asta. Pe de alt parte, Ando era singurul care fusese n stare s sparg unul dintre codurile concepute de Ryuji. Dei ar fi fost ndreptit s revendice sus i tare aceast victorie, nimeni nu tia mai bine ca el c reuise doar printr-un noroc chior, nu prin deducii logice. Obosise s se tot lupte cu cifrul i ncepuse s se uite pe fereastr, iar privirea i se oprise din ntmplare pe firma unei florrii. Citind numrul de telefon de pe firm, i venise o idee i apoi dduse peste cheia irului de caractere cifrate. Doar printr-o ans pur mintea lui ajunsese pe aceeai lungime de und cu mintea lui Ryuji. Ando era convins i azi c momentul lui de triumf fusese doar un simplu accident. Ando nutrea pe atunci fa de Ryuji un sentiment nrudit cu invidia. De cteva ori simise c ncrederea n sine i se prbuete total sub povara certitudinii c nu va putea s-l ntreac niciodat pe Ryuji, c va rmne mereu n umbra lui. Acum se uita fix la creierul care fusese cndva remarcabil. Avea o greutate ceva mai mare dect media i nu prea s se deosebeasc de creierul unui om obinuit. La ce-i folosise oare Ryuji celulele cenuii n timpul vieii? Ando bnuia motivele pentru care se adncise tot mai mult n matematica teoretic, pn cnd abandonase complet cifrele i ajunsese pe trmul logicii. Dac ar fi trit nc zece ani, ar fi reuit n mod sigur s contribuie
24

determinant la dezvoltarea acestui domeniu. Ando admira i n acelai timp detesta darurile rare cu care natura l nzestrase pe Ryuji. Circumvoluiile creierului erau adnci ca nite canioane i lobul frontal se nla ca o creast muntoas de necucerit. Dar acum totul se sfrise. Celulele nu mai funcionau. Inima se oprise din cauza unui infarct miocardic, iar creierul murise i el. De fapt, cel puin din punct de vedere fizic, Ryuji se afla acum n stpnirea lui. Ando s-a asigurat c putea s exclud ipoteza hemoragiei cerebrale, apoi a pus creierul la loc n cutia cranian. Se scurseser cincizeci de minute din clipa cnd ridicase bisturiul de pe mas. n mod obinuit, o autopsie dura cam un ceas. Aproape terminase, n linii mari, examinarea, dar s-a oprit brusc, de parc iar fi amintit ceva. i-a bgat mna n cavitatea abdominal a lui Ryuji, goal acum, i a pipit peste tot cu degetele pn cnd a apucat i a tras afar dou obiecte rotunde de mrimea unor ou de prepeli. Testiculele, de culoare cenuiu-rocat, i se preau n mod ciudat adorabile. Ando s-a ntrebat n sinea lui cine era mai demn de mil: Ryuji, care murise fr rost, sau el nsui, care era indirect vinovat de dispariia propriului su fiu n vrst de trei ani i patru luni. Eu, bineneles. Rostise rspunsul n minte fr cea mai mic ezitare. Ryuji murise netiutor. Nu l chinuise niciodat, nici mcar n ultima clip a vieii, regretul cumplit care-i sfredelea lui pieptul. Bucuria de a avea un copil nu putea fi descris. Pe de alt parte, Ando era convins c durerea pierderii lui nu putea nceta i n-avea s nceteze niciodat, nici mcar dac ar mai fi trit o mie de ani. Cu inima strns, a lsat testiculele s cad pe masa de disecie. Erau moarte acum, fr s fi creat nimic. Nu-i mai rmsese dect s coas totul la loc. Ando a umplut pieptul i cavitatea abdominal cu foi de ziar cocoloite, pentru a da iar volum trupului, apoi s-a apucat s coas inciziile. A cusut i
25

scalpul, apoi a splat corpul i l-a mbrcat cu un halat de baie. Golit de organele interne, prea mai zvelt. Ai slbit, Ryuji. Nu putea pricepe de ce vorbea n gnd cu un cadavru. De obicei nu fcea asta. Avea oare cadavrul lui Ryuji ceva deosebit, care-i provoca impulsul de a conversa cu el? Bineneles, conversaia se desfura ntr-un singur sens Ryuji nu-i putea rspunde. Totui, cnd cei doi asisteni au ridicat trupul pentru a-l aeza n sicriu, lui Ando i s-a prut c aude vocea mortului de undeva din adncul propriului su piept. A simit o furnictur ciudat n jurul buricului. S-a scrpinat, dar senzaia n-a disprut. Dup cteva clipe, mncrimea parc s-a desprins de trupul lui i a rmas suspendat n aer. Tulburat, Ando s-a aezat lng sicriu i a palpat cadavrul lui Ryuji de la gt pn la abdomen. A simit o protuberant n zona abdominal i a desfcut halatul. S-a aplecat i a vzut colul unei foi de ziar care ieea printre dou custuri, n apropierea buricului. Era convins c nchisese cu grij incizia, dar uite c ziarul ieise peacolo, mai bine zis un colior al paginii. Probabil c hrtia folosit pe post de material de umplutur se deplasase n timp ce mutaser cadavrul i colul acela de ziar se strecurase prin deschiztur. Era parial mnjit cu snge i acoperit cu o pelicul de mucoas. Ando a ters suprafaa alb cu palma i a vzut numere tiprite pe hrtie. Erau mici i greu de descifrat. i-a apropiat faa de ele. A citit dou numere, ase cifre aezate pe dou rnduri de cte trei: 178 136 i era imposibil s spun dac erau cotaii de la burs, fragmente din numere de telefon aliniate ntmpltor sau coduri ale unor programe de televiziune. Dincolo de asta, care erau ansele
26

probabilistice ca un col dintr-o pagin de ziar oarecare s conin doar ase cifre i nimic altceva? Fr niciun motiv raional, Ando ia ntiprit numerele n memorie. 178, 136. Apoi a mpins ziarul napoi n abdomen i a lovit uor pielea de cteva ori cu degetele nvelite n mnua de cauciuc. Dup ce s-a asigurat c ziarul nu avea de gnd s ias din nou, a ncheiat halatul i a pipit iar pieptul i abdomenul lui Ryuji. De data asta, curbura trupului nu mai era ntrerupt de nicio protuberant anormal. Ando a fcut doi pai n spate. Deodat, total inexplicabil, s-a nfiorat. i-a ridicat minile ca si scoat mnuile i a observat c i se ridicase prul de pe antebrae. S-a sprijinit de scaunul lng care se oprise i a fixat cu privirea faa lui Ryuji. Genele tremurau ca i cum ochii, pn atunci linitii, erau gata s se deschid dintr-o clip n alta. Zgomotul apei i s-a prut brusc asurzitor. Toi ceilali din sal i vedeau de treburile lor, numai el prea s simt aura intens a trupului ntins pe masa de autopsie. Oare individul sta chiar a murit? Fii serios! Ce ntrebare stupid. Ghemotoacele de ziar care luaser locul intestinelor s-au destins puin, provocnd ridicarea uoar a abdomenului. Ando s-a minunat cum de asistenii i poliitii erau att de nepstori. A simit deodat nevoia s urineze. i-a nchipuit c vede cadavrul lui Ryuji plimbndu-se prin morg, nsoit de fonetul foilor de ziar mototolite, i impulsul de a-i goli vezica a devenit aproape intolerabil.

27

3
Dup ce a ncheiat autopsiile programate n dimineaa aceea, Ando a pornit spre staia Osuka de pe linia JR, ca s ajung la un local unde s mnnce de prnz. n timp ce mergea, s-a oprit de mai multe ori i s-a uitat peste umr. Nu reuea s identifice cauza anxietii, i nici semnificaia ei. Nici mcar nu se gndise la fiul lui. Probabil c pn atunci fcuse peste o mie de autopsii. De ce l dduse peste cap tocmai asta? i fcea treaba de fiecare dat cu meticulozitate. Nu-i amintea s mai fi vzut vreodat un col de ziar ieind printre custurile pe care le fcuse cu mna lui. Era prima lui greeal e drept, una lipsit de importan. Dar oare asta l nelinitea? Nu, n niciun caz. A intrat n primul restaurant chinezesc care i-a aprut n cale i a comandat meniul special de prnz. Localul era mult mai linitit dect ar fi trebuit s fie la ora aceea, dousprezece i cinci. Singurul client, n afar de el, era un brbat n vrst care sttea la bar, lng cas, i nfuleca tiei. Purta o apc din piele. Din cnd n cnd se ntorcea s se uite la Ando. i asta l-a deranjat. De ce nu i-a scos apca? De ce se tot uit la mine? Acum Ando cuta o semnificaie i n lucrurile cele mai lipsite de importan. i-a dat seama c nervii i erau ntini la maximum. Mintea lui era ca o foaie de hrtie fotosensibil pe care erau imprimate cifrele din ziar. Se aprindeau i se stingeau n spatele pleoapelor i nu reuea s scape de ele. Ca o melodie repetat la nesfrit n gnd. Ceva l-a fcut s se uite la telefonul aflat n spatele brbatului cu apc din piele. Poate c era cazul s formeze cifrele. Dar numai oraele mici au numere de telefon cu ase cifre nu i-ar rspunde
28

nimeni din Tokio. n plus, tia foarte bine c ar ncerca degeaba, centrala nu i-ar face legtura. Dar dac ar ridica cineva receptorul? Hei, Ando, mare porcrie ai putut s-mi faci. Mi-ai scos biluele, zu aa, omule! Dac ar fi auzit vocea glumea a lui Ryuji Poft bun, domnule. Glasul era lipsit de inflexiuni. O mn ndemnatic a aezat n faa lui tava cu meniul de prnz: sup, orez i legume prjite. Printre legume se vedeau dou ou de prepeli rscoapte. Erau la fel de mari ca testiculele lui Ryuji. Ando a nghiit n sec, apoi a dat peste cap un pahar cu ap cldu. Nu negase niciodat categoric existena fenomenelor paranormale, dar obsesia lui pentru cele dou numere i se prea absurd. i, totui, obsesie era. 178, 136. Aveau oare vreo semnificaie? n fond, Ryuji era bun la coduri. Un cod. ntre dou sorbituri de sup, Ando a ntins pe mas un erveel, a scos un pix din buzunar i a scris cele dou numere. 178, 136 A ncercat s atribuie fiecrei litere a alfabetului un numr ntre 0 i 25, astfel ca litera A s fie echivalent cu 0, B cu 1, C cu 2 i aa mai departe. Era un cifru elementar de substituie, cel mai simplu cod cu putin. S-a hotrt s porneasc de la ideea c fiecare numr e un grup de trei litere i a nlocuit cifrele cu literele echivalente. BHI, BDG Puse cap la cap: bhibdg. Nu trebuia s deschid un dicionar ca s fie sigur c acest cuvnt nu exist n nicio limb din lume. Urmtorul pas era s desfac numerele n combinaii de una i dou cifre. Cum alfabetul are doar douzeci i ase de litere, n ipoteza
29

folosirii unui cifru simplu de substituie putea deocamdat s exclud numerele mai mari dect 26, de exemplu 78 sau 81. A nceput s scrie pe erveel toate combinaiile posibile. 17 8 1 3 6 Sau: 1 7 8 13 6 Sau: 17 8 13 6 R I N G B H I N G R I B D G

Doar una dintre combinaii avea un rezultat inteligibil: RING. Ring. Ando a reflectat o vreme, amintindu-i echivalenele cuvntului n limba englez. I-a venit n minte imediat cea mai uzual semnificaie a lui: cerc, un substantiv. Dar mai tia i c ring descrie sunetul produs de un clopoel sau de un telefon. Putea la fel de bine s fie verbul care nseamn a face s sune un clopoel sau un telefon i, prin extensie, s semnifice aciunea de a telefona sau de a chema pe cineva cu ajutorul unui clopoel sau al unei sonerii. Putea s fie o simpl coinciden? O bucic de hrtie care ieise din abdomenul lui Ryuji, ase cifre tiprite pe ea i Ando, care se
30

jucase cu ele pn cnd descoperise cuvntul ring. Hazard? Undeva, n deprtare, s-a auzit o siren. i-a amintit brusc de clopotul de alarm pentru incendii pe care-l auzise o singur dat, cnd era copil, n orelul n care crescuse. Prinii lui fceau mereu ore suplimentare i se ntorceau acas abia seara trziu, prin urmare, el rmnea singur cu bunica. Cnd dangtul clopotului a sfiat tcerea serii, amndoi i-au acoperit urechile cu minile. Ando a revzut n minte scena: el nsui ghemuit n poala bunicii, tremurnd de fric. Orelul avea un foior de foc strvechi, iar clopotul era folosit doar cnd izbucnea un incendiu. Dar atunci nu tia asta. tia doar c sunetul acela purta cu el o ameninare teribil. Prea vestitorul unei tragedii inevitabile. De fapt, exact un an mai trziu, n aceeai zi, tatl lui murise subit. Ando i-a dat seama c nu-i mai era foame. Mai mult dect att, i se fcuse ru. A mpins spre captul mesei tava cu prnzul care abia i fusese adus i a cerut nc un pahar cu ap. Hei, Ryuji, ncerci s-mi spui ceva? Cnd sicriul cu trupul rposatului fusese dat familiei, trupul acela acum la fel de gol pe dinuntru ca o jucrie de tinichea, i se pruse c faa alb ca varul i aproape ptrat a lui Ryuji era puin mai relaxat, iar trsturile ei alctuiau ceva asemntor cu un zmbet. Doar un ceas mai devreme Mai Takano se uitase la faa aceea i se nclinase, dar plecciunea ei nu era adresat cuiva anume. Pesemne c vor rmne la priveghi toat noaptea, iar incinerarea va avea loc a doua zi. n clipa asta, dricul ajunsese probabil destul de aproape de casa printeasc a lui Ryuji de la Sagami Ohno. Ando a simit brusc dorina de a vedea cum trupul lui Ryuji se transform n cenu. Avea senzaia stranie c fostul lui coleg nu murise.

31

4
Stabiliser s se ntlneasc n prculeul de lng bibliotec. Ando a ascultat pn la capt o prelegere la Facultatea de Drept din campusul principal, apoi s-a uitat la ceas i a pornit spre locul de ntlnire. Cu o zi nainte, Mai Takano telefonase la Institutul Medico-Legal. Se ntmplase ca Ando s fie acolo era din nou n tur la autopsii i, cnd i auzise vocea n receptor, i reamintise instantaneu chipul ei, n cele mai mici detalii. Nu era ceva neobinuit s primeasc telefoane de la rudele sau prietenii rposailor care trecuser prin minile lui, dar, cu puine excepii, l cutau doar ca s-l ntrebe care fusese cauza morii. Motivul lui Mai era cu totul altul. Fata i-a spus c n seara zilei cnd el fcuse autopsia lui Ryuji se strecurase din camera de priveghi i se dusese la apartamentul profesorului. Avea de gnd s pun n ordine manuscrisul la care Ryuji lucrase n ultima vreme. n timp ce fcea asta, descoperise ceva surprinztor. I-a dat apoi de neles, ntr-un mod destul de subtil, c acel ceva putea s aib legtur cu moartea lui Ryuji. Bineneles, pe Ando l interesa orice informaie concret pe care i-ar fi putut-o da Mai, dar, n acelai timp, era nerbdtor s-i contemple din nou chipul de o frumusee desvrit. I-a rspuns c trebuia s asiste la o prelegere la universitate, dar c i putea face timp dup aceea pentru o discuie cu ea. Putea s-i povesteasc totul atunci. I-a mai spus cnd se termina conferina i i-a sugerat ora ntlnirii, apoi a nchis. Bncile de lng bibliotec, cele de sub cirei. Petrecuse doi ani n campusul principal, ncercnd s uite toate prostiile nefolositoare pe care le nvase pn atunci, dar el i
32

prietenii lui nu-i dduser niciodat ntlnire pe bncile acelea. Viitoarea lui soie, student n ultimul an la arte frumoase, prefera s se ntlneasc cu el sub arborii ginkgo. A recunoscut-o pe Mai fata se aezase deja pe o banc cu mult nainte s se apropie de bibliotec. Azi purta o rochie ntr-una dintre culorile primare, care i ddea un aer i mai tineresc dect la morg, cu zece zile n urm. A ocolit banca pn a ajuns n faa ei i a ncercat s-i vad faa, dar ea citea o carte i nu i-a ridicat capul. S-a apropiat clcnd n mod deliberat ct mai apsat i Mai i-a ridicat n sfrit privirea. Domnioar Takano Fata s-a ridicat pe jumtate i i-a spus: Mulumesc pentru atunci. Era evident c nu tia cum s-l salute pe doctorul care fcuse autopsia iubitului ei. Ando i luase cu el servieta. Minile lui, care o manevrau cu agilitate, i degetele lungi i subiri erau dovezi destul de concludente pentru felul n care i ctiga pinea. mi permitei s m aez? Fr s mai atepte rspunsul, s-a aezat lng Mai, picior peste picior. Ai primit rezultatele analizelor? a ntrebat ea cu o voce lipsit de inflexiuni. Ct timp avei la dispoziie? a zis Ando, uitndu-se la ceas. Dac suntei de acord, putem s mergem s bem un ceai. Vreau s v pun cteva ntrebri. Mai s-a ridicat n picioare fr s mai scoat un cuvnt i i-a netezit poalele rochiei. S-au dus la o cafenea pe care a ales-o ea. Pentru un local studenesc, era uimitor de linite, prea mai degrab salonul unui hotel respectabil. S-au aezat la o mas de lng fereastr, de unde puteau vedea strada, iar chelneria le-a adus ap i prosoape
33

fierbini. Mai n-a ezitat nicio clip nainte s comande: Vreau un parf cu fructe. Surprins i incapabil s se hotrasc pe loc, Ando a reuit s spun doar att: O cafea pentru mine. Cu zece zile n urm, fata i lsase impresia c e destul de timid. Acum ncepea s-i schimbe prerea. Sunt ndrgostit de fructe, i-a mrturisit ea, ridicnd din umeri, dup ce chelneria plecase. O clip, lui Ando i s-a prut c spusese Sunt ndrgostit de tine, apoi i-a administrat n sinea lui o palm pentru c era capabil de o asemenea fantezie ridicol. Un brbat de vrsta ta Parf-ul era ntr-adevr superb, cuibrit pe un strat de picoturi i mpodobit cu o cirea. Dup cum s-a npustit asupra lui, era limpede c Mai avea o slbiciune pentru dulciurile din localul acesta. Avea aceeai expresie de concentrare pe care Ando o remarcase i la Takanori atunci cnd mnca un lucru care-i plcea foarte mult. Amintirea aproape c i-a frnt inima. Uitnd complet de cafea, a rmas nemicat, minunndu-se de atenia cu care fata mnuia linguria. Chiar dac ar fi reuit s-o conving pe soia lui s intre ntr-un loc ca sta, ea n-ar fi comandat niciodat parf de fructe. Ar fi rmas la ceaiul ei de lmie, fr-zahr-v-rog, sau ceva asemntor. Mereu inea cur de slbire i printre buzele ei nu reuea s se strecoare nimic dulce. Mai Takano, n schimb, chiar mbrcat mai gros, prea mai slab dect fusese soia lui n zilele ei cele mai bune. E drept, pn s se despart definitiv, nevast-sa slbise att de tare, nct Ando nu mai suporta s se uite la ea. Acum, cnd se gndea la ea, i-o amintea mereu cu faa rotund i pufoas, aa cum era cnd se cstoriser. Mai a mestecat cirea, apoi a scuipat foarte discret smburele pe o farfurioar oval de sticl i i-a ters buzele cu un erveel. Pn atunci, Ando nu mai cunoscuse o femeie pe care s fie att de
34

amuzant s-o priveti att, i nimic altceva. Fata a atacat picoturile, risipind pe mas cteva firimituri, apoi a contemplat cu o privire pofticioas stratul subire de frica de pe fundul farfurioarei. Fr ndoial c se ntreba dac era politicos s-o ling. Cnd a terminat n sfrit de mncat, l-a ntrebat brusc ce fel de analize fuseser fcute dup autopsie pe mostrele prelevate din organele lui Ryuji. Lui Ando i s-a prut extrem de ciudat s vorbeasc cu o femeie tnr, care tocmai terminase un parf de fructe, despre organele extrase dintr-un cadavru. Dar uite c se poate. O pise nu cu mult timp n urm, cnd ncerca s explice unei rude ndurerate cum se fac aceste analize. Nu reuise s stabileasc o punte de comunicare: omul pur i simplu nu pricepea ce nseamn o prob de esut. i nchipuia c organele regretatului rposat erau puse n borcane i murate n formaldehid, iar Ando pierduse mult timp ncercnd inutil s-l lmureasc. Probele de esut erau pentru el la fel de banale ca pixurile cumprate cu duzina pentru un funcionar de birou, dar abia atunci realizase c majoritatea oamenilor habar n-au cum arat, ct de mari sunt, cum sunt prelevate, i aa mai departe, i c trebuia s le explici totul ca unor copii mici. S-a hotrt s nceap prin a-i vorbi lui Mai despre probele pentru analize. Vedei, aproape totul e treab de laborator. Mai nti tiem o bucic din inim, din poriunea n care a avut loc infarctul, i o punem n formaldehid. Apoi tiem din ea o bucic i mai mic, la fel ca un sashimi1, i o punem n parafin. n cear, cu alte cuvinte. Apoi tiem din nou un specimen pentru microscopie, ndeprtm parafina i colorm esutul. Aa obinem proba de esut, pe care o trimitem apoi la laborator, pentru analize. Dup aceea nu ne rmne dect s ateptm rezultatele. S neleg c e vorba despre o felie foarte subire din organul respectiv pus ntre dou lamele de sticl?
1

Sashimi: pete crud, tiat n fii foarte subiri. (N. Tr.)

35

Cam aa ceva. i n felul acesta e mai uor s-o examinezi? Bineneles. O colorm pentru a-i pune n eviden structura celular, aa o vedem mai bine la microscop. Dumneavoastr ai aruncat o privire? O privire? La ce? La celulele lui Ryuji, evident. n ciuda francheii ntrebrii, lui Ando i s-a prut c avea o nuan ciudat. Da, m-am uitat i eu nainte s le trimit la laborator. Cum erau? Fata s-a aplecat nainte, apropiindu-se de el. Am gsit un blocaj n artera coronar stng, chiar nainte de ramura circumflex. Circulaia sngelui a ncetat i inima lui Ryuji s-a oprit. Aa cum v-am explicat, am luat probe circulare din esutul n cauz i le-am examinat la microscop. Am descoperit ceva care m-a surprins. Vedei dumneavoastr, n cazul unui atac de cord de obicei avem de-a face cu rigidizarea arterelor. Colesterolul sau alte lipide se acumuleaz treptat, iar seciunea arterei se micoreaz pn cnd un asemenea aterom plesnete i nfund artera. n schimb, n cazul lui Ryuji, dei e vorba tot despre un blocaj, cauza lui nu a fost rigidizarea. Mcar atta lucru e limpede. Atunci ce-a fost? a ntrebat fata, scurt i la obiect. Ando i-a rspuns la fel de concis: Sarcom. Sarcom? Exact. nc nu am reuit s aflm dac celulele aparin unui anumit esut sau e vorba de o tumoare nedifereniat, dar v pot spune asta cu siguran n-am mai vzut niciodat aa ceva n tunica intima sau n tunica media. Pe nelesul oricui, acolo s-a dezvoltat un dop care a blocat circulaia sngelui. Adic sunt celule canceroase? Cred c ne putem referi la ele aa fr s greim prea mult. Totui, n mod normal, sarcoamele nu apar n interiorul vaselor de snge. E imposibil.
36

Bine, dar cnd vei primi rezultatele analizelor, vei ti care a fost cauza apariiei tumorii, nu-i aa? Ando a cltinat din cap i a rs. Dac nu descoperim i alte simptome, probabil c nu vom afla. Sunt sigur c nu trebuie s v dau drept exemplu SIDA Chiar i azi, cnd tiina pare omnipotent, nc mai exist destule boli ale cror cauze au rmas necunoscute. Lui Ando i era imposibil s spun dac simptomul respectiv se va dovedi sau nu o parte dintr-un sindrom mai larg care putea fi identificat. Mai exist o explicaie, a continuat Ando. Poate c Ryuji avea un defect congenital la artera coronar stng. Pn i un profan putea nelege implicaiile acestei ipoteze. Dac Ryuji s-ar fi nscut cu un dop n arter, capacitatea lui de a duce o via activ din punct de vedere fizic ar fi fost serios afectat. Bine, dar profesorul Takayama tiu. n liceu a fost campion la atletism. Aruncarea greutii, dac nu m nel. Da. Prin urmare, e greu de crezut c tumoarea a fost acolo nc de la natere. Iat de ce vreau s v ntreb dac s-a plns vreodat de dureri n piept, nelegei la ce m refer. Legturile lui Ando cu Ryuji fuseser ntrerupte aproape complet dup absolvire. Cnd se ntlneau pe coridoarele universitii i aruncau cte un Salut, dar asta era tot. Ando era convins c n-ar fi putut observa o schimbare n starea fizic a lui Ryuji. Am fost prieteni mai puin de doi ani. Nu conteaz. V-a spus vreodat ceva n timpul sta? Era mai rezistent dect majoritatea oamenilor. Nu-mi aduc aminte s-l fi vzut vreodat bolnav, nici mcar rcit. Nu era genul de brbat care se plnge, deci chiar dac ar fi avut o problem, nu cred c mi-ar fi mrturisit ceva. Ceea ce v pot spune sigur este c nam remarcat nimic. Nimic? Absolut nimic?
37

M rog, ar fi ceva. Ando i-a amintit subit c n-o chemase pe Mai aici pentru a-i da raportul despre autopsie. Ea l cutase pentru a-i spune ce descoperise n timp ce rsfoia hrtiile lui Ryuji n noaptea de priveghi. Bine. Hai s auzim. Chiar i-aa, v atrag atenia de la bun nceput c nu sunt sigur dac asta are vreo legtur cu moartea profesorului. Mai era nnebunitor de dulce n nesigurana ei. Ando a fixat-o cu o privire intens, ncercnd s-o ndemne s continue. V rog s-mi spunei. Aa cum tii, acum zece zile am plecat pe furi de la priveghi. M-am dus acas la domnul profesor pentru a pune n ordine manuscrisul unei lucrri nepublicate. n timp ce lucram, a sunat telefonul. Nu prea tiam ce s fac, dar, n cele din urm, am ridicat receptorul. Era Asakawa, un prieten din liceu al profesorului. l cunoatei pe acest domn? Ne-am ntlnit o singur dat. L-am cunoscut chiar n apartamentul profesorului, cu patru sau cinci zile nainte de moartea lui. Am neles. i? Nu prea s tie c profesorul a murit, aa c m-am simit obligat s-i spun i s-i povestesc pe scurt ce se ntmplase cu o sear n urm. Domnul Asakawa a fost de-a dreptul ocat. Mi-a spus c vine imediat. Adic La apartamentul domnului Takayama. i a venit? Da, mult mai repede dect m ateptam. A intrat i s-a uitat cu atenie peste tot, ca i cum ar fi cutat ceva anume. Apoi m-a ntrebat iar i iar dac nu mi-a atras atenia ceva. Arta ca un om ncolit, care nu mai are scpare. M-a tot ntrebat dac n-am remarcat ceva neobinuit n cas imediat dup moartea
38

profesorului. Dar mai mult m-a frapat ce a zis dup aceea. A fcut o pauz i a sorbit din paharul cu ap. Ce anume? mi amintesc perfect cuvintele lui: Nu i-a spus nimic n ultimele lui clipe? Nu i-a transmis ultima lui dorin? N-a pomenit nimic despre despre o caset video? Poftim? O caset video? Da. Ciudat, nu-i aa? Ce subiect neateptat i mai ales nepotrivit ntr-o discuie despre cineva care murise cu mai puin de o zi n urm. De ce oare l interesa aa ceva pe Asakawa? ntr-adevr. Dar Ryuji a pomenit vreodat de o caset video? Nu, niciodat. O caset, spunei? a mormit Ando, rezemndu-se de sptarul scaunului. Simea c o umbr planeaz peste imaginea acelui Asakawa care intrase n apartamentul lui Ryuji chiar n seara autopsiei. n orice caz, m ntreb V dai seama c nu m pricep la aa ceva dar nu e oare posibil ca filmul de pe caseta aceea s fi fost att de ocant nct s-i fi provocat un infarct? Hmm Ando nelegea destul de bine cauza reticenei lui Mai. Ar fi fost prea jenat s ntrebe asta nainte s afle cauza morii. i-a adus aminte de un thriller pe care l vzuse la televizor cu dou sau trei zile n urm. O femeie are o aventur cu unul dintre angajaii soului ei, dar nu tie c totul e o nscenare. Cineva i filmeaz n timp ce fac dragoste ntr-o camer de hotel, surprinznd pe band i cele mai mici detalii, apoi i trimite prin pot o copie a casetei i o scrisoare de antaj. Femeia ajunge acas, pune caseta n aparat i se uit fix la ecranul televizorului. La nceput nimic, apoi o imagine. Trupul gol al unui femei lipit de trupul gol al unui tnr. Gemete de plcere. n clipa cnd i d seama c femeia de pe ecran este ea nsi, lein. Era un clieu att de uzat i de vulgar, nct Ando se
39

simise ca un caraghios pentru c-i pierduse timpul cu aa ceva. Fr discuie c o nregistrare video putea produce simultan stimuli vizuali i auditivi suficient de puternici nct s dea peste cap echilibrul unei persoane sensibile. Dac toate condiiile negative ar fi ndeplinite, nu puteai scoate din calcul posibilitatea decesului. Dar Ando examinase cadavrul lui Ryuji n cele mai mici detalii. Luase chiar i probe din artera coronar i le trimisese la laborator. Nu, este exclus. Artera coronar stng era ntr-adevr blocat. n plus, l cunoatei bine pe Ryuji. Chiar credei c ar fi putut s moar uitndu-se la o caset video? Rostind ultimele cuvinte, Ando izbucni n rs. Nu, sigur c nu Mai s-a lsat molipsit de rsul lui Ando i a chicotit ncetior. Prin urmare, amndoi aveau aceeai prere despre Ryuji. Fusese un brbat de o ndrzneal aproape respingtoare, cu o coloan vertebral din oel. Doar ceva literalmente extraordinar l-ar fi putut afecta fizic sau psihic. Din ntmplare, putei s-mi spunei unde-l gsesc pe acest Asakawa? mi pare ru Fata era gata s-i spun c nu tie, dar i-a dus mna la gur. Nu, stai o clip, mi se pare c domnul profesor mi l-a prezentat drept Kazuyuki Asakawa de la Daily News. Kazuyuki Asakawa de la Daily News. Ando i-a notat informaia n agend. Putea s afle foarte uor datele de contact ale omului, trebuia doar s dea un telefon la redacie. Nu era exclus s aib nevoie s discute cu el. Mai, care se uitase tot timpul la el, vzuse pesemne ce i notase n agend. i-a ridicat mna dreapt la piept i a spus doar att: Hm. Ce s-a ntmplat? a zis Ando. Vaszic, aa se scrie Kazuyuki. Ando s-a uitat din nou n agenda deschis. A trecut aproape un minut pn a neles ce voia s spun fata.
40

Pentru a scrie Asakawa puteau fi folosite cteva combinaii diferite de caractere. Lucru valabil i pentru Kazuyuki. n mod normal, ar fi trebuit s ntrebe ce caractere s foloseasc sau s scrie numele pur i simplu dup pronunie. n loc s fac asta, mzglise ideogramele fr cea mai mic ezitare, ca i cum ar fi tiut de cnd lumea cum s scrie numele acela, pe care nu-l mai auzise pn atunci. Mai a deschis larg ochii i l-a ntrebat: De unde tii c aa e corect? Ando n-a tiut ce s-i rspund. Fusese oare un soi de premoniie? Avea senzaia c urma s se ntlneasc foarte curnd cu ziaristul.

41

5
Pentru prima dat dup aproape un an i jumtate Ando i-a permis s bea puin sake la cin. Da, era prima dat dup moartea fiului su cnd dorise s pun n gur alcool. i plcuse s bea. Nu renunase din cauz c se simea vinovat de moartea biatului, ci pentru c alcoolul avea tendina s amplifice starea sufleteasc n care se afla atunci cnd ncepea s bea, indiferent care ar fi fost ea. Dac era binedispus, devenea exuberant. Dac era trist, devenea disperat. n ultimul an i jumtate fusese prizonier ntr-o carapace de durere, prin urmare, era firesc s nu fie n stare s bea. Era convins c ar fi fost de-ajuns s ia o singur nghiitur de alcool i nu s-ar mai fi oprit dect atunci cnd ar fi czut beat mort. i era team c, dac ar fi ajuns pn acolo, n-ar fi reuit s-i mai controleze impulsul de a se sinucide. i nu avea curajul s verifice asta. Ploua, lucru rar ntlnit n ultimele zile din octombrie. O ploaie fin, care se strecura sub umbrela lui ca un nor de fum, umezindu-i gtul. Nu-i era frig. Simea nc n corp, dei tot mai slab, cldura sakeului. n timp ce mergea spre cas, a ntins de mai multe ori mna ca s prind n palm stropii de ploaie, dar n-a reuit. Ploaia prea s vin nu de sus, din nori, ci de sub picioarele lui. Pe drumul de la staia de metrou pn acas a ezitat cteva clipe n faa unui magazin, tentat s cumpere o sticl de whisky. n jurul lui se nlau zgrie-nori impuntori, cu faade strlucitoare. Peisajul citadin era mai frumos dect orice peisaj natural. Cldirile oficiale, cu toate ferestrele luminate, strluceau stins n ploaie. S-a uitat o vreme la lumina roie intermitent din vrful unei cldiri pn cnd a nceput s i se par c era un mesaj n codul Morse. Se
42

aprindea i se stingea ncetior, ca ochiul unei psri monstruoase. De cnd se desprise de soia lui, locuia ntr-o garsonier dintrun bloc cu patru etaje, cam drpnat, cu vedere spre parcul Yoyogi. Era un regres evident fa de apartamentul din AoyamaSud n care triser mpreun. Blocul nu avea parcare, aa c fusese obligat s renune la BMW-ul lui nou-nou. n garsoniera aceea strmt i mizerabil se simea iar student. Nu exista nimic acolo care s demonstreze c-i pas cum triete. Singurele piese de mobilier erau o bibliotec i un pat din aluminiu. A intrat i a traversat camera ca s nchid fereastra. Chiar atunci a sunat telefonul. Alo? Eu sunt. A recunoscut imediat glasul de la cellalt capt al firului. O singur persoan ar fi nceput aa o conversaie cu el, fr s fac efortul s se prezinte: Miyashita, alt coleg de serie din vremea studeniei la Medicin. Acum era asistent la Patologie. mi pare ru c nu te-am sunat mai devreme. Ando tia de ce l caut Miyashita, aadar s-a grbit s se scuze nainte s i se poat face reprouri. Azi am fost la tine, la laborator. Eram la morg. Trebuie s fie plcut s iei salariu din dou locuri. Ce vrei s spui? Ai i tu o slujb. N-are importan. N-ai trimis confirmarea pentru petrecerea de adio a lui Funakoshi. Funakoshi, un tip de la Medicin Intern, i dduse demisia ca s preia clinica tatlui su din oraul natal. Btrnul ieise la pensie. Miyashita luase asupra lui sarcina organizrii ceremoniei de plecare. i comunicase deja lui Ando locul i data, iar Ando ar fi trebuit s-i rspund imediat dac avea sau nu de gnd s participe. Se lsase prins de alte probleme i uitase. Dac fiul lui n-ar fi murit, probabil c pentru Ando s-ar fi organizat un mare foc de artificii.
43

Escala lui la Anatomo-Patologie trebuia s fie scurt, doar o trambulin profesional. Plnuise s nvee perfect chestiile de baz, apoi s fac un stagiu de medicin clinic, pregtindu-se astfel s preia cabinetul socrului su. Un moment de neatenie, i toate planurile lui se spulberaser ca fumul. Mai spune-mi o dat, cnd e? Ando i-a fixat receptorul ntre ureche i umr pentru a-i putea rsfoi agenda. Joia viitoare. Joi, zici? Nici mcar nu avea nevoie s-i verifice programul. Cu numai trei ore n urm, cnd se desprise de Mai, stabiliser s ia cina mpreun chiar joia urmtoare. Sptmna viitoare, joi, la ase. Era limpede care angajament avea prioritate. Pentru prima dat dup zece ani invitase o femeie la mas i, dintr-un motiv care i scpa, ea nu-l refuzase. Nu, n niciun caz nu voia s revin la prima mutare. Ando presimea c venise momentul adevrului, clipa cnd urma s afle n sfrit dac se va trezi sau nu din comarul acela interminabil. Hai, ce zici? l-a ndemnat Miyashita. mi pare ru, dar nu pot s vin. Am deja o ntlnire. Chiar aa? Eti sigur c nu e vorba de vechea ta eschiv? Vechea eschiv? Ando habar n-avea ce nsemna asta. Nu-i amintea s fi folosit pn atunci scuze inventate pe loc pentru a refuza invitaiile prietenilor. Care eschiv? C nu poi s bei. tiu foarte bine c nainte turnai n tine ca un pete. Nu, nu-i vorba de asta. Uite ce-i, dac nu vrei s bei, nimeni nu te oblig. Pref-te doar, d pe gt nite ceai sau ce vrei tu. Dar trebuie s vii acolo. i-am spus deja c nu sta e motivul. Vaszic poi s bei?
44

Oarecum. Stai puin Nu cumva e vorba de-o femeie? Intuiia lui Miyashita era mai ascuit dect te-ai fi ateptat vzndu-i faa rotund. De fiecare dat cnd vorbea cu el, Ando ncerca s joace cu crile pe fa, dar acum nu era sigur c poate s fac asta. A tcut, pentru c nu tia ce s-i rspund. Probabil c e ceva de capul ei dac te-a fcut s uii de petrecerea lui Funakoshi. Nici de data asta Ando n-a gsit un rspuns. Bine, m bucur pentru tine. Nu-i face griji Stai, de ce n-o iei i pe ea? Am primi-o fericii. Cu braele deschise, chiar. Nu am ajuns nc n etapa asta. Aha, neleg, nu vrei s grbeti lucrurile. Poi s zici i aa. Omule, nu te oblig s faci ce nu vrei. mi pare ru. Ai idee de cte ori i-ai cerut iertare n timpul conversaiei steia? Am priceput. O s te trec pe list n rubrica abseni. i, ca s-i gsesc o scuz, o s lansez zvonul c ai o prieten, aa c pregtete-te sufletete. Miyashita a rs, dar Ando tia c n-ar fi fost niciodat n stare s se supere pe el. Singura alinare, n perioada chinuitoare de dup dispariia fiului su i desprirea de soie, venise de la cadoul pe care i-l fcuse Miyashita. Amicul lui nu ncercase s-i spun Nu plnge sau altceva la fel de inutil, ci i dduse o carte i-i spusese doar att: Citete-o. Fusese prima dovad c pe Miyashita l interesa literatura i tot atunci Ando descoperise prima dat c o carte i poate da putere, literalmente. Era un fel de bildungsroman, povestea unui tnr cu rni trupeti i sufleteti adnci care nva s se desprind de trecut. Romanul ocupa i acum un loc de cinste n biblioteca lui Ando. Apropo, a zis el, mai mult ca s schimbe subiectul, ai aflat ceva despre proba de esut a lui Ryuji?
45

A, proba aia Miyashita a oftat. Ce s-a ntmplat? Nu prea tiu cum s-i explic. Mi-am cam atins limita competenei aici. Ce prere ai despre profesorul Seki? Seki era directorul Laboratorului de Patologie, celebru pentru cercetrile lui n privina formrii celulelor canceroase. Ce cred despre el? De ce? Btrnul face uneori nite afirmaii foarte ciudate. Ce-a zis? C nu-l intereseaz blocajul arterial. Mai ii minte c gtul era ulcerat? Evident. Nu fusese deloc uor de observat, dar bineneles c inea minte. Remarcase ulceraia abia cnd asistentul i atrsese atenia asupra ei. Dup autopsie, secionase ntreaga poriune de gt afectat. Btrnul i-a aruncat o privire, mai nti cu ochiul liber. Ghici cu ce-a zis c seamn? Termin i spune-mi odat. Bine, bine. A zis c seamn cu esutul bolnavilor de variol. Variol? Fr s vrea, Ando aproape c strigase. Variola fusese eradicat dup o campanie global de vaccinare n mas. Ultimul caz fusese nregistrat n 1977 n Somalia, i de-atunci nu mai fuseser raportate altele. n 1979, Organizaia Mondial a Sntii declarase c boala este eradicat. Variola este o boal exclusiv uman. Faptul c nu mai existau bolnavi nsemna c virusul nsui dispruse. Ultimele specimene erau pstrate n azot lichid la Moscova i ntr-un laborator din Atlanta, n Georgia. Dac, prin absurd, ar fi aprut un nou caz, nu putea s provin dect din aceste dou puncte, dar, innd cont de msurile de securitate foarte stricte, era un scenariu de neconceput. Surpriz?
46

Trebuie s fie o greeal. Probabil c este. i totui, asta a zis btrnul. Eu i respect opiniile. Cnd o s primii rezultatele? Cam ntr-o sptmn. Ascult, dac dm ntr-adevr peste virusul variolei, te-ai fcut om. Miyashita prea tulburat, pesemne nici el nu credea ce spune. De fapt, era sigur c undeva se strecurase o greeal. O reacie fireasc, din moment ce medicii de vrsta lor nu avuseser ocazia s vad pe viu un bolnav de variol. Singura posibilitate de a studia boala era indirect, prin intermediul revistelor de virusologie. Ando vzuse cndva, ntr-o lucrare, fotografia unui copil acoperit cu erupii de variol. Un copil drgu, desfigurat fr mil de pustule mari ct un bob de mazre, care se uita inexpresiv n obiectivul aparatului de fotografiat. Pustulele erau principala caracteristic vizibil a variolei. Ando i mai amintea vag c ajungeau la extinderea maxim cam la o sptmn dup contaminare. n primul rnd, Ryuji n-avea nici mcar un singur punct rou pe piele. O singur privire i fusese de-ajuns ca s constate asta. Pielea lui neted strlucea blnd n lumina lmpilor de deasupra mesei de autopsie. Ascult, chestia asta este att de stupid, nct nici mcar numi vine s i-o spun: tiai c exist o tulpin de variol care produce ocluzii n vasele de snge i are o rat a mortalitii de sut la sut? Ando a cltinat imperceptibil din cap. Nu. Ei bine, exist. S nu-mi spui c sta e motivul blocajului arterial al lui Ryuji. Bine, n-o s afirm aa ceva. Dar fii atent, sarcomul de pe peretele intern al arterei Ce naiba poate fi? tiu c te-ai uitat la el la microscop. Ando nu i-a rspuns.
47

Cum a aprut acolo? Ando n-a putut s-i rspund. Sper c eti vaccinat, a glumit Miyashita. Ar fi caraghios de-a binelea, nu-i aa, dac s-ar dovedi c e chiar variol. Lsnd gluma la o parte, tocmai mi-a venit o idee. Ce anume? Hai s uitm deocamdat de variol, dar s presupunem c sarcomul din arter este ntr-adevr rezultatul unei infecii virale. Ar trebui s mai fie i alii care au murit din aceeai cauz i au prezentat aceleai simptome. Miyashita a oftat. Cntrea n minte ipoteza. Poate. Nu exclud varianta asta. Dac ai timp, vrei s te interesezi la celelalte spitale universitare? tiu c ai relaii, n-ar trebui s-i fie prea greu. S-a fcut. O s aflm repede dac au mai aprut cadavre cu aceleai simptome. Dar dac se dovedete c avem de-a face cu un sindrom mai larg, am ncurcat-o. Fii linitit. Pun pariu c sptmna viitoare o s rdem de toat povestea asta. i-au luat rmas-bun i au aezat receptoarele n furc n acelai timp. Aerul umed al nopii se strecurase n camer prin fereastra ntredeschis. Ando s-a dus s-o nchid, dar s-a uitat mai nti afar. Nu mai ploua. n dreptul cldirii, strada era luminat de felinare plasate la distane egale. Drele cauciucurilor unui camion se pierdeau n deprtare, dou linii perfect paralele. Pe Autostrada Metropolitan nr. 4 se micau ncet perechi de faruri. Simfonia nentrerupt a zgomotelor oraului era saturat cu ap, transformndu-se ntr-un murmur lipsit de convingere. A nchis fereastra i sunetul a ncetat brusc. A scos din bibliotec un dicionar de termeni medicali i l-a rsfoit n grab. tia prea puine despre variol. Era un subiect pe care nu avea niciun rost s-l abordezi, cu excepia cazului n care
48

erai motivat de un real interes tiinific pentru virui. Variol era denumirea comun a bolii provocate de viruii variola minor i major din genul orthopox-virus, familia poxvirus. Variola major avea o rat a mortalitii de treizeci pn la cincizeci la sut, iar variola minor de sub cinci la sut. Existau i ali pox-virui, care puteau infecta maimuele, iepurii, vacile sau obolanii, dar n Japonia fuseser nregistrate extrem de puine cazuri. Chiar dac ar fi aprut un nou focar de infecie, pericolul ar fi fost redus i cazurile s-ar fi limitat la scar local. A nchis dicionarul. Povestea cpta o dimensiune ridicol. Profesorul Seki studiase ulceraia doar cu ochiul liber, aa c afirmaia lui cu greu putea fi considerat un diagnostic precis. n fond, nu spusese dect c aspectul poriunii afectate seamn cu cel ntlnit la bolnavii de variol. Ando avea i alte argumente contra. Dar de ce se nveruna oare att de tare s resping ipoteza infeciei? Simplu: dac, prin absurd, ar descoperi un virus n trupul lui Ryuji, atunci ar avea un motiv real de ngrijorare, i anume c Mai Takano era i ea contaminat. Fata i Ryuji aveau o relaie intim. n cazul variolei, erupiile apar mai nti pe mucoasa cavitii bucale. Cnd evolueaz la stadiul de ulceraie, virusul se rspndete. n consecin, saliva este un vehicul important n rspndirea bolii. n mintea lui au nceput s pluteasc scene n care buzele lui Mai se lipeau de cele ale lui Ryuji. i-a scuturat repede capul ca s le alunge. A turnat whisky ntr-un pahar i l-a dat peste cap, fr s-i mai adauge ghea sau ap. Dup un an i jumtate de abstinen, alcoolul a avut asupra lui un efect puternic. Pe msur ce i-a croit drum n jos, arzndu-i gtul i apoi stomacul, l-a cuprins treptat o stare de letargie. S-a aezat pe podea, i-a sprijinit spatele de marginea patului i i-a ntins minile i picioarele. Doar o prticic din creierul lui a rmas treaz i la pnd. S-a uitat la petele de pe tavan. Cu o zi nainte ca fiul lui s se nece, Ando visase oceanul. Acum,
49

privind n urm, tia c fusese un vis prevestitor. Cunoscuse soarta biatului su nainte ca accidentul s aib loc, i totui nu fusese n stare s fac nimic. Regretul l transformase ntr-un om mult mai prudent. i acum avea, n mod indiscutabil, o premoniie. Dup autopsie, din abdomenul lui Ryuji apruse o bucic dintr-o pagin de ziar, iar el reuise s citeasc dou numere i gsise, n cele din urm, cuvntul ring. i era imposibil s cread c fusese o simpl coinciden. Ryuji ncerca s-i comunice ceva, n felul lui, folosind o interfa pe care doar el o putea manevra. n clipa asta, cea mai mare parte a trupului su fusese transformat n cenu, practic tot, cu excepia unei prticele care i pstrase substana sub forma unei probe de esut. Ando avea senzaia c i n acest stadiu, de dispariie aproape complet, din postura de mostr medical, Ryuji reuea s-i vorbeasc. Iat de ce simea c prietenul lui triete. Corpul fusese incinerat, dar Ryuji mai avea ceva de spus i gsise mijloacele s-o fac. Ando a continuat s se joace cu aceast idee pn cnd a ajuns aproape la limita incoerenei. Iluzia, n sens psihiatric putea fi o glum sau un fapt real , deschisese o nou ramificaie a povetii. Absolut ridicol. Raiunea i-a ridicat capul. n clipa aceea, Ando avea impresia c se uit la propriul su trup ntins pe pat, c l vede cu ochii unui spirit dematerializat. Poziia n care sttea i se prea cunoscut. O mai vzuse undeva, nu de mult. Plutind ntr-o somnolen creia nu i se putea mpotrivi, i-a adus brusc aminte de fotografiile polaroid ale cadavrului lui Ryuji. Aceeai poziie: capul lsat pe pat, braele i picioarele larg desfcute. A mai luptat puin mpotriva somnului, pn s-a trt pe pat i s-a nvelit cu ptura. A ncetat s tremure doar cnd a adormit.

50

6
A ncheiat a doua autopsie din ziua aceea, apoi s-a ntors la universitate, lsndu-i pe asisteni s termine curenia n laborator. Miyashita l cutase la telefon, dndu-i de neles c n cursa pentru aflarea cauzei morii lui Ryuji apruse o pist nou, iar de-atunci ncoace Ando sttea ca pe ghimpi. A urcat n goan scara de la metrou. A intrat n spitalul universitii pe ua principal, apoi a traversat curtea ctre aripa veche. Aripa nou, prin care se intra acum, fusese terminat cu doar doi ani n urm. Era o construcie ultramodern cu aptesprezece etaje, legat printr-o reea complicat de coridoare i scri de partea veche a spitalului, ale crei cldiri, care se ngrmdeau de jur-mprejur, semnau mai degrab cu nite blocuri-turn rezideniale. Complexul era un labirint. Toi cei care intrau prima dat n el se rtceau fr excepie. Era un spaiu n care noul i vechiul se mbinau, iar dimensiunile, culorile i mirosurile coridoarelor pn i scritul pantofilor pe podea se schimbau pe msur ce te ndeprtai de intrare. Cnd s-a oprit n faa uii de metal care marca grania dintre domenii i s-a uitat napoi n lungul coridorului spaios din aripa nou, i-a pierdut momentan simul perspectivei. Avea senzaia c privete direct n viitor. Ua de acces n Departamentul de Patologie era ntredeschis i la vzut din spate pe Miyashita, care sttea pe un taburet. n loc s se afle n mijlocul echipamentelor de laborator, aa cum se atepta Ando, era aplecat peste masa din centrul ncperii, dup toate aparenele citind o carte. i inea capul foarte aproape de cartea deschis n faa lui i ddea repede paginile. Ando s-a apropiat i l-a
51

btut pe umrul solid. Miyashita s-a rsucit brusc, i-a dat jos ochelarii, apoi a ntors cartea i a aezat-o pe mas cu cotorul n sus. Titlul ei era Ghid de astrologie pentru nceptori, dup cum a putut citi, stupefiat, Ando. Miyashita a nvrtit taburetul pn cnd a ajuns fa n fa cu Ando, apoi l-a ntrebat, cu o expresie impasibil: Ia spune, cnd te-ai nscut? n loc s-i rspund, Ando a luat Ghidul nceptorului i a nceput s-l rsfoiasc. Horoscop? Ce naiba, astea-s pentru fetele de liceu. Te-ar mira s afli c aiurelile astea nimeresc la int de cele mai multe ori. Hai, spune-mi cnd te-ai nscut. Las asta. Ascult Ando a tras un taburet de sub mas i s-a aezat. Se micase ns neglijent i, din greeal, a drmat cartea, care a aterizat pe podea cu un pocnet nbuit. Linitete-te odat. Miyashita s-a aplecat greu, ca i cum l-ar fi durut spatele i a ridicat volumul. Dar lui Ando nu-i psa absolut deloc de astrologie. S neleg c ai gsit un virus? a ntrebat el. Miyashita a cltinat din cap. Primul lucru pe care l-am fcut a fost s verific la celelalte departamente universitare de Anatomo-Patologie dac au aprut i alte cadavre cu simptomele lui Ryuji. Am primit, n fine, rspunsurile. i au aprut sau nu? Da. ase n total, cel puin pn n clipa asta. ase mori Ando nu tia nc dac era mult sau puin. Toi tipii cu care am vorbit au rmas interzii. Fiecare credea c e primul i singurul care a descoperit o chestie att de stranie. La care universiti ai ntrebat? Miyashita s-a aplecat nainte i marginea mesei s-a nfipt n
52

abdomenul lui proeminent. A ridicat un dosar aruncat neglijent peste un maldr de hrtii. La Shuwa au dou, la Taido unul i la Yokodai din Yokohama au trei. n total, ase. Sunt anse mari s apar i altele. D-mi s m uit, a zis Ando, lund dosarul din minile lui Miyashita. n dimineaa aceea, Miyashita i omologii lui de la celelalte centre universitare fcuser schimb de informaii relevante prin fax. Dosarul coninea copiile certificatelor de deces i ale rapoartelor de autopsie originale. Erau copii fax, prin urmare neclare, nu prea uor de citit. Ando le-a scos pe toate din dosar, le-a rsfirat pe mas i a nceput s caute informaiile importante. n primul rnd, cadavrul autopsiat la Taido. Shuichi Iwata, nousprezece ani. Murise pe 5 septembrie, n jurul orei unsprezece noaptea. Se afla n aua motocicletei lui de 50 de centimetri cubi, la intersecia din faa staiei Shinagawa, cnd pur i simplu se prbuise. Din raport reieea c artera lui coronar fusese blocat de o excrescen inexplicabil care generase un stop cardiac. Dou dintre cele trei cadavre cercetate la Yokodai erau ale unei tinere perechi. Biatul i fata muriser mpreun. Takehiko Nomi, de nousprezece ani, i Haruko Tsuji, de aptesprezece. Cadavrele lor fuseser gsite nainte de zorii zilei de 6 septembrie, ntr-o main nchiriat, la poalele muntelui Okusu, n Yokosuka, prefectura Kanagawa. Cnd fuseser descoperite trupurile lor, Haruko Tsuji avea chiloii trai n jos pn la glezne, la fel Takehiko Nomi. Era limpede c aleseser o zon mpdurit pentru a face sex n main, dar inimile lor se opriser simultan. La autopsie gsiser nite formaiuni ciudate n arterele lor coronare, care blocaser, n mod limpede, circulaia sngelui. Ando i-a ridicat privirea i a mormit: Ce naiba? Cei doi din main, nu-i aa? Da. Stop cardiac, n acelai loc i n acelai timp. Iar dac l
53

adugm pe acest Shuichi Iwata care a fost deschis la Taido, avem patru ini care au suferit blocaje ale arterei coronare cam n acelai timp. Ce se ntmpl aici? i astea nu sunt toate simptomele. Te-ai uitat la mam i copil? Ando i-a aruncat privirea peste hrtii. Nu, nu nc. Pi, uit-te. Au ulceraii ale faringelui, exact ca Ryuji. Ando a rsfoit n grab documentele pn a gsit raportul laboratorului din Shuwa despre autopsia unei mame i a fiicei ei. Mama era Shizu Asakawa, n vrst de treizeci de ani, iar fiica se numea Yoko i avea doar un an i jumtate. Cnd a citit numele, Ando a simit n minte ceva asemntor unui declic. A rmas nemicat cteva clipe, ncercnd s-i aminteasc. Ceva nu era n regul aici. Ce s-a ntmplat? a ntrebat Miyashita, privindu-l mai atent. Nimic. Ando a citit mai departe. Pe 21 octombrie, n jurul orei prnzului, un automobil condus de domnul Asakawa, n care se aflau soia lui, Shizu, i fiica lui, Yoko, fusese implicat ntr-un accident n apropierea rampei Oi de pe Autostrada Metropolitan a Golfului. Pe traseul de la Urayasu la Oi, lng intrarea n tunelul care traverseaz Golful Tokio, blocajele n trafic erau ceva obinuit. Automobilul lui Asakawa se ciocnise cu o camionet la captul irului de maini care ateptau la intrarea pe rampa Oi. Un accident foarte grav: mama i fetia, care se aflau pe bancheta din spate, muriser pe loc, n vreme ce Asakawa fusese grav rnit. De ce s-a cerut autopsia? s-a ntrebat Ando cu voce tare. De obicei, persoanele care mureau n accidente rutiere nu erau trimise la laboratorul de Medicin Legal. O autopsie complet, precum cea al crei raport l primiser, era efectuat la cererea procuraturii i avea loc numai dac exista suspiciunea de crim cu premeditare. Nu te apuca s tragi concluzii pripite. Citete n continuare.
54

Apropo, de ce nu-i cumperi un fax nou? Abia pot nelege ce scrie aici. A nceput deja s m doar capul, a zis Ando, fluturnd n faa lui Miyashita hrtia fcut sul. Voia pur i simplu s neleag ce se ntmplase, iar copiile neclare produse de aparatul strvechi l scoseser din srite. Eti un ticlos nerbdtor, i-a rspuns Miyashita n loc de introducere, apoi a nceput s-i explice. Iniial au crezut c muriser n accident, dar examinarea cadavrelor n-a artat nicio ran grav. Maina s-a fcut praf, totui mama i fiica se aflau pe locurile din spate. Probabil c asta a ridicat semne de ntrebare. Au fcut autopsii complete ale ambelor cadavre. Cum era de ateptat, au gsit contuzii i zgrieturi cauzate de accident pe fee, pe picioare, pe mini i aa mai departe, ns rnile nu prezentau nicio reacie vital. Cred c sta e motivul pentru care au ajuns pe minile noastre. E simplu s constai, pe baza prezenei sau absenei reaciilor vitale, dac rnile unei persoane au fost provocate nainte sau dup moarte. n acest caz, nu exista nicio reacie. Concluzia nu putea fi dect una singur: n momentul accidentului, mama i fiica nu mai erau n via. Vrei s spui c brbatul i-a scos nevasta i fata moarte la o plimbare cu maina? Aa se pare, a zis Miyashita, desfcndu-i larg braele. Acest aspect justifica examinarea medico-legal cu prisosin. Poate c soul se hotrse s se sinucid i s-i ia cu el pe lumea cealalt i familia; poate c i strangulase nevasta i copilul i plecase n cutarea locului potrivit pentru a-i pune capt zilelor, dar pe drum fusese implicat n accident. Cu toate acestea, autopsiile l scoseser din cauz pe brbat, pentru c Shizu i Yoko aveau amndou blocaje arteriale identice cu cele descoperite n alte cazuri. Muriser amndou pe autostrad, prin stop cardiac, cu puin timp nainte de accident. Odat stabilit acest fapt, nu era greu s deduci de ce brbatul
55

pierduse controlul volanului O vreme, nu observ c soia i fetia lui au murit poate c i-au dat ultima suflare n tcere i conduce mai departe, gndindu-se c dorm amndou pe bancheta din spate. Dar ele rmn nemicate acolo mult timp, prea mult timp. ncearc s le trezeasc, innd o mn pe volan i ntinznd-o pe cealalt n spate. O zglie pe soia lui. Femeia nu se trezete. Se ntoarce s se uite n fa, apoi pune din nou mna pe genunchiul soiei. nelege n cele din urm c s-a schimbat ceva. Intr n panic i nu-i mai poate smulge privirea de la femeie i copil, fr s-i dea seama c n fa traficul s-a aglomerat. Aa se petrecuser lucrurile, mai mult sau mai puin exact. Pentru c el nsui i pierduse fiul, Ando putea s neleag perfect panica i durerea care-l copleiser pe brbat. i el trecuse prin asta. Dac ar fi reuit s se stpneasc, dac n-ar fi intrat n panic, poate c nu l-ar fi pierdut pe Takanori n cazul oferului ns, sngele rece n-ar fi servit la nimic. Soia i fetia lui muriser deja. Bine, i-atunci ce s-a ntmplat cu brbatul? Simea mai mult dect simpatie pentru necunoscutul acela care-i pierduse familia cu numai dou sptmni n urm. A fost internat, bineneles. Ct de grav e rnit? Fizic, nu pare s fi suferit prea mult. Cu psihicul e alt poveste. Sechele emoionale? E catatonic de cnd a fost adus la spital n aceeai ambulan cu cadavrul soiei i al copilului. Sracul om. Nu tia ce ar fi putut aduga. Faptele spuneau mai multe dect o ntreag bibliotec plin de tratate medicale despre violena ocului psihic suferit de Asakawa n clipa cnd devenise contient c i pierduse i soia, i fetia. Ando a smuls faxurile din mna lui Miyashita, i-a umezit vrfurile degetelor i a nceput s rsfoiasc din nou hrtiile subiri.
56

Voia s tie unde era internat brbatul. Ardea de nerbdare s afle simptomele lui i, dac Asakawa se afla ntr-unul dintre spitalele unde avea relaii, era sigur c va obine destul de uor toate detaliile. Primul lucru care i-a srit n ochi a fost numele. Kazuyuki Asakawa. Ce-i asta? Ando fusese att de surprins, nct aproape strigase. Un strigt ridicol. Kazuyuki Asakawa era numele pe care-l notase cu o zi n urm n agend. Numele brbatului care vizitase apartamentul lui Ryuji n noaptea cnd acesta murise i o bombardase pe Mai cu ntrebri despre o caset video. l cunoti? s-a interesat Miyashita, nbuindu-i un cscat. Nu, dar Ryuji l cunotea. Zu? Tipul sta, oferul, era prieten cu Ryuji. De unde tii? Ando i-a povestit pe scurt ce aflase de la Mai despre vizita lui Asakawa. Nu sun deloc bine. Nu era nevoie ca Ando s precizeze ce nu-i suna bine. Dac l puneau la socoteal i pe Ryuji, apte oameni muriser n acelai fel. Patru dintre ei pe 5 septembrie, unul pe 19 octombrie i ali doi pe 21 octombrie. Biatul i fata de la Okusu muriser n acelai timp, la fel mama i fiica din automobilul accidentat lng rampa Oi. Cellalt membru al familiei, cel care supravieuise, era prieten cu Ryuji. Toi aceti oameni, care preau s fie legai ntr-un fel sau altul, muriser din cauza unui sarcom, nemaintlnit pn atunci, care bloca artera coronar. Firete, primul lucru care-i trecuse prin minte lui Ando era posibilitatea unei maladii contagioase. Judecnd dup numrul redus al victimelor de pn acum, probabil c nu se transmitea pe cale aerian. Poate c, la fel ca SIDA, noua boal nu se rspndea prea uor, n ciuda ratei foarte ridicate a mortalitii.
57

S-a gndit la Mai. Trebuia s accepte c fata intrase n contact fizic direct cu Ryuji. l nnebunea ideea c era obligat s-i explice cumva aceast nou ntorstur a lucrurilor. De fapt, nu putea s-i spun dect c se afl n pericol. Dar cum s-o ajute asta, dac nu era n stare s fac mai mult pentru ea? Mai bine m-a duce la Universitatea Shuwa. Documentele pe care le inea n mn pur i simplu nu conineau suficiente informaii. Cel mai bun lucru pe care-l putea face era s vorbeasc direct cu doctorul care efectuase autopsiile soiei i fetiei lui Asakawa. I-a cerut voie lui Miyashita s dea un telefon, a ridicat receptorul i a format numrul Universitii Shuwa.

58

7
n lunea care a urmat weekendului de trei zile, Ando a fcut un drum la Facultatea de Medicin a Universitii Shuwa, n districtul Ota. Cnd telefonase din laboratorul lui Miyashita, insistase s obin o ntlnire n aceeai zi, dar interlocutorul lui nu se lsase impresionat i-i rspunsese calm c putea s-i fac timp abia luni, dac era convenabil i pentru Ando. Fusese obligat s accepte. n fond, nu era vorba despre o bnuial de crim i nici mcar despre o anchet oficial. Era doar curiozitatea lui strnit, atta tot. Ando a btut la ua Departamentului de Medicin Legal i a ateptat. Din spatele uii nu se auzea niciun sunet. S-a uitat la ceas i a constatat c mai erau zece minute pn la ntlnirea stabilit pentru ora unu. Departamentele de Medicin Legal aveau de regul mai puini angajai dect cele de Chirurgie sau de Medicin Intern. Cei trei sau patru ini de aici se duseser probabil s ia masa de prnz. n vreme ce sttea acolo ntrebndu-se ce s fac, n spatele lui s-a auzit un glas: V pot ajuta cu ceva? La anc. S-a rsucit pe clcie i a vzut un tnr nu prea nalt, care purta ochelari fr rame. Ando i-a spus c era prea tnr pentru a fi unul dintre lectorii departamentului, dar, pe de alt parte, i se pruse c recunoate vocea, cam strident. I-a ntins brbatului o carte de vizit, s-a prezentat i i-a spus de ce venise acolo. ncntat de cunotin, a zis tnrul i i-a dat cartea lui de vizit. Presupunerea fusese corect: era brbatul cu care vorbise la
59

telefon. Numele de pe cartea de vizit era Kazuyoshi Kurahashi, lector n Medicin Legal la Universitatea Shuwa. Judecnd dup funcia omului, Ando a dedus c aveau cam aceeai vrst, dei Kurahashi nu prea s fi mplinit treizeci de ani. Probabil c ncerca s se fereasc de pericolul de a fi confundat cu vreun student adoptnd tonul acela exagerat de autoritar i de sigur. V rog, pe aici, a zis Kurahashi foarte ceremonios, conducndu-l pe Ando nuntru. Ando aflase prin fax cam tot ce se putea afla. Scopul vizitei de azi era s vad cu ochii lui tot ce nu putea fi transmis prin fax i s vorbeasc ntre patru ochi cu doctorul care fcuse treaba de laborator. Au conversat o vreme despre fleacuri, apoi au nceput s fac schimb de informaii despre cadavrele pe care le examinaser. Dup toate aparenele, Kurahashi fusese extrem de surprins de sarcoamele neidentificate pe care le gsise n arterele coronare. Imediat ce discuia a ajuns la ele, stpnirea de sine de care dduse dovad pn atunci s-a prbuit. Vrei s aruncai o privire? Spunnd asta, s-a dus s ia o prob din esutul care provocase ocluzia arterial. Ando a privit-o atent, mai nti cu ochiul liber, apoi la microscop, examinnd structura celular. O singur privire i-a fost de-ajuns pentru a-i da seama c i aceste celule suferiser transformarea pe care o remarcase n cazul lui Ryuji. Cnd celulele sunt tratate cu colorant hematoxilin-eozin , citoplasm devine roie i nucleul albastru, iar astfel pot fi difereniate foarte uor. Aici, celulele bolnave erau deformate, iar nucleele mai mari dect n mod obinuit. Spre deosebire de celulele normale, care au o nuan n general rocat, acestea erau albstrii. Ando a privit fix formele roii, asemntoare cu nite amibe, care pluteau pe un fond albastru. Trebuia s afle cauza transformrii, cu alte cuvinte, s afle vinovatul. Bineneles, n-avea s fie o treab uoar. Era obligat s descopere arma crimei i identitatea criminalului doar pe baza
60

rnilor pe care le putea vedea pe trupurile victimelor. Ando i-a ridicat capul de la ocularul microscopului i a inspirat adnc. Dintr-un motiv oarecare, cu ct se uita mai mult la proba aceea de esut, cu att mai greu i era s respire. Apropo, ale cui sunt celulele astea? Ale soiei. Kurahashi i ntorsese puin capul ca s-i rspund. Sttea lng rafturile care acopereau un perete ntreg, scond i punnd la loc dosare. Cltina din cap fr ncetare, semn c nu reuea s gseasc ce cuta. Ando i-a lipit ochii de lentilele ocularului i s-a cufundat din nou n universul microscopic. Prin urmare, sunt celulele soiei lui Kazuyuki Asakawa. tiind acum ale cui erau, s-a pomenit c ncearc s-i imagineze, n cele mai mici detalii, ce se ntmplase cu persoana din corpul creia fuseser prelevate. Luna trecut, automobilul condus de soul ei se ciocnise cu o camionet lng rampa de ieire Oi de pe Autostrada Metropolitan a Golfului. Duminic, 21 octombrie, la prnz. Autopsiile au confirmat faptul c mama i copilul muriser cu o or nainte de accident. Cu alte cuvinte, muriser n acelai timp, n jurul orei unsprezece dimineaa. i din aceeai cauz, nici mai mult, nici mai puin. Iar Ando nu putea asimila sub nicio form informaia asta. Att de mici n comparaie cu restul trupului, bucelele acestea de carne erau totui suficient de mari nct s blocheze o arter i s opreasc o inim. i, din moment ce luaser dou viei simultan, i venea greu s cread c sarcoamele crescuser treptat, ndelung. Chiar acceptnd c victimele fuseser contaminate cu un virus oarecare, dac perioada de incubaie era de sptmni sau luni, era practic imposibil ca victimele s fi decedat aproape simultan. Diferenele fizice dintre ele ar fi trebuit s genereze, fr ndoial, i o diferen n timp. ntre Shizu i Yoko Asakawa era o distan de aproape treizeci de ani, iar asta ar fi trebuit s aib un efect oarecare.
61

Poate c era o simpl coinciden. Ba nu, imposibil. Biatul i fata ale cror autopsii fuseser fcute la Yokodai muriser tot simultan. Iar dac nu era o coinciden, nu avea ncotro i trebuia s trag concluzia c intervalul de timp dintre contaminare i moarte era extrem de scurt. Pe de alt parte, ipoteza virusului nu prea s stea prea bine n picioare. Ando a renunat temporar la acest scenariu, ntrebndu-se dac putea fi vorba de o intoxicaie alimentar acut sau de un accident asemntor. n cazul intoxicaiei alimentare, dac dou persoane mnnc acelai aliment alterat, nu este ieit din comun ca amndou s manifeste simptomele simultan. Bineneles, diagnosticul de intoxicaie alimentar acoperea o arie vast: exist toxine naturale, chimice, bacteriene i aa mai departe. Nu auzise ns niciodat despre o toxin care s provoace apariia unui sarcom n artera coronar. Poate c n vreun laborator de cine tie unde se desfura un program de cercetare bacteriologic ultrasecret, poate c un virus care suferise mutaii scpase n lumea larg Ando i-a ridicat iar privirea. Erau simple speculaii i tia perfect c pe ghicite nu va ajunge nicieri. Kurahashi s-a apropiat de masa n faa creia sttea Ando i i-a tras un scaun. inea n mn un dosar din care a scos vreo zece sau dousprezece fotografii. Astea sunt de la locul accidentului. Nu tiu dac i vor folosi la ceva sau nu. Nici Ando nu se atepta, de altfel, s descopere n scenele de pe autostrad vreun indiciu care s-l conduc pe o pist nou. Era convins c explicaia sttea n neregularitile pe care le observase la nivel celular, i n niciun caz n neatenia oferului. Dar, din moment ce Kurahashi se chinuise att de tare s gseasc fotografiile, nu i se prea politicos s i le dea napoi fr s arunce mcar o privire. Le-a cercetat ncet, una cte una. n prima poz se vedea maina lui Asakawa. Capota motorului era fcut armonic, arta ca un ir de creste muntoase n miniatur.
62

Amndou farurile i spoilerul erau zdrobite. Parbrizul era ndri, dar, ciudat, stlpii laterali nu se ndoiser. Dei automobilul era avariat grav, srea n ochi c ocul nu se propagase pn la locurile din spate. n urmtoarea fotografie se vedea suprafaa autostrzii. Era uscat, nu existau urme de derapaj, ceea ce sugera faptul c n momentul impactului Asakawa sttea cu spatele. La ce se uita atunci? Cel mai probabil, la bancheta din spate. Poate chiar atinsese trupurile pe cale s se rceasc ale soiei i fetiei lui. Ando a parcurs din nou n minte evenimentele pe care le reconstituise n laboratorul lui Miyashita, cu trei zile n urm. A trecut repede peste alte dou sau trei fotografii, aezndu-le pe mas de parc etala cri de joc. Nu e nimic n ele care s atrag atenia, i-a spus, dar n clipa urmtoare mna lui s-a oprit n aer. Dduse peste o poz a interiorului mainii. Aparatul de fotografiat fusese plasat la geamul portierei din stnga, pe latura pasagerului, pentru a acoperi partea din fa a habitaclului. Centura de siguran atrna moale pe fotoliul oferului i scaunul pasagerului era mpins nainte. Ando a continuat s priveasc, fr s reueasc imediat si dea seama care detaliu din fotografie i strnise interesul. Trise experiene asemntoare n timp ce frunzrea fr prea mare atenie o carte. Uneori un cuvnt se ncpna s-i rmn n minte i l mpiedica s ntoarc pagina, dar nu era n stare s-i aminteasc unde anume l citise i nici mcar ce cuvnt era. Palmele au nceput s-i transpire. Simea c mecanismul intuiiei sale se pusese n micare. Fotografia ncerca s-i comunice ceva. A apropiat-o de fa, pn cnd aproape c a atins-o cu vrful nasului. A examinat-o milimetru cu milimetru. Apoi i-a concentrat privirea ntr-un singur punct i, n sfrit, a gsit acel ceva care se ascundea acolo. Pe locul pasagerului se afla un obiect negru, ascuns n mare msur privirii din cauz c sptarul scaunului era mult aplecat nainte. Erau vizibile doar partea lui frontal i una dintre laturi. Un
63

obiect asemntor, tot de culoare neagr, se afla pe podeaua automobilului, tot pe partea pasagerului. Tetiera scaunului czuse peste el. Ando nu i-a putut stpni o exclamaie de entuziasm i l-a chemat pe Kurahashi. Hei, ce prere ai despre asta? A ridicat fotografia spre Kurahashi i i-a artat cu degetul unde trebuia s se uite. Lectorul i-a scos ochelarii i a studiat cu atenie poza. Apoi a cltinat din cap, nu din cauz c nu reuise s vad detaliul n cauz, ci pentru c nu tia de ce i strnise lui Ando interesul. Ce poate fi? a mormit Kurahashi fr s-i ia ochii de la fotografie. Mie mi se pare c e un video, a zis Ando, cerndu-i din priviri o confirmare. Asta pare s fie. Imediat cum a recunoscut natura obiectului, Kurahashi a mpins fotografia spre Ando. Obiectul de pe scaunul pasagerului putea foarte bine s fi fost o cutie cu dulciuri, innd cont de culoarea i de forma lui paralelipipedic. Dar, la o privire mai atent, pe partea lui frontal se distingea un buton negru, rotund. Semna n mod cert cu un videorecorder, dar putea s fie la fel de bine un tuner sau un amplificator. Cu toate acestea, Ando era ferm convins c nu putea fi dect un video. Obiectul de pe jos, de sub tetier, prea s fie o main de scris electronic sau un laptop. Dac te gndeai la profesia lui Asakawa, nu era deloc neobinuit c avea la el o main de scris. Dar un video? Ce caut acolo? Concluzia lui, i anume c era un videorecorder, era consecina fireasc a informaiei pe care o primise de la Mai. Potrivit fetei, a doua zi dup moartea lui Ryuji, Asakawa intrase n apartament i o ntrebase de mai multe ori dac nu gsise o caset video. n ziua urmtoare aezase pe scaunul pasagerului un videorecorder i pornise la drum spre o destinaie necunoscut. Sfrise prin a avea
64

un accident n timp ce se ntorcea acas, la Shinagawa. Unde se ducea cu aparatul acela? Dac avea de gnd s-l dea la reparat, era inutil s ias pe autostrad. Existau, n mod sigur, ateliere de reparaii i n cartierul n care locuia. Ando a nceput s se enerveze. Asakawa nu plecase la drum cu un video dup el fr s aib un motiv precis. A studiat din nou fotografiile. A gsit una n care numrul de nmatriculare al automobilului era vizibil, i-a scos agenda i l-a notat. Un numr de Shinagawa: WA 5287. Acel WA i-a dat de neles c era o main nchiriat. n concluzie, nu numai c Asakawa cra dup el un video, dar i dduse osteneala s nchirieze o main. De ce? Ando a ncercat s se pun n locul lui Asakawa. Ce motiv ar fi avut s ia de acas un videorecorder? Copiere Nu-i venea n minte alt explicaie. S presupunem c A l sun pe B i-i spune c a fcut rost de o caset fantastic. B vrea s-o copieze, dar A nu are dect un singur videorecorder. Dac B i dorete att de tare o copie, singura soluie este s mearg cu propriul lui video acas la A. Chiar aa fiind Ando i-a lsat brbia n piept. Ce legtur poate s aib o caset video cu cei apte mori? L-a copleit deodat o dorin pe care raiunea nu putea s-o stpneasc. Voia s pun mna pe caset i, mai mult dect att, voia s vad ce era nregistrat pe ea. Accidentul se petrecuse lng rampa Oi. n jurisdicia crei secii de poliie era oare zona aceea? Maina fusese inut o vreme la biroul de circulaie al seciei locale, era sigur de asta. Dac n ea se afla un videorecorder, cu siguran i acesta era pstrat la poliie. Din moment ce Asakawa nu era contient i soia lui murise, poate c nu venise nimeni s ia aparatul, poate c se afla nc n magazia seciei de poliie. n calitate de medic legist, Ando avea destule relaii la poliie. Nu i-ar fi fost prea greu s pun mna pe aparat. Dar, a realizat el, nainte de toate trebuia s-l vad pe Asakawa.
65

Dac reuea s afle faptele direct din gura lui, economisea mult timp i scutea mult alergtur. Potrivit raportului, n clipa internrii brbatul era catatonic, dar de-atunci trecuser zece zile. Poate c i revenise ntre timp. Dac exista o ans de a putea vorbi cu el, indiferent ct de mic, atunci cu ct mai repede, cu att mai bine. tii cumva unde a fost internat Asakawa? La spitalul Societii de Ajutor Saisei din Shinagawa, dac nu m nel. Kurahashi a rsfoit dosarul. Da, aa e. Dar aici scrie c pacientul e catatonic. N-are importan, o s-i fac oricum o vizit, a spus Ando, scuturnd energic din cap, ca i cum ncerca s se ncurajeze singur.

66

8
Ando a aipit cu obrazul lipit de geamul taxiului. Apoi brbia i-a alunecat din mna dreapt, pe care i-o sprijinea, i capul i-a czut nainte, lovindu-se de sptarul scaunului oferului. n aceeai clip a auzit n deprtare un sunet care semna cu o siren de alarm. S-a uitat n mod reflex la ceas. Dou i zece. Srise ntr-un taxi imediat dup ce ieise din cldirea Universitii Shuwa, i probabil c deatunci nu trecuser mai mult de zece minute. Pesemne c aipise doar cteva minute, dar avea senzaia c se scursese o venicie de cnd adormise. Parc trecuser zile ntregi de cnd Kurahashi i artase fotografiile de la locul accidentului. Simindu-se ca unul care a fost trimis prin magie undeva departe de cas, Ando i-a ndreptat spatele i a ascultat mai atent dangtul alarmei. Taxiul era nemicat. Se afla pe partea stng a unei strzi cu patru benzi, probabil pe banda pentru schimbarea direciei din moment ce pe toate celelalte mainile naintau fr ntrerupere. Doar ei stteau pe loc. S-a aplecat n fa i s-a uitat prin parbriz. nainte i la stnga se vedea o trecere peste calea ferat. Bariera era cobort i luminile de avertizare clipeau. Poate c i se prea lui, dar avea impresia c ritmul luminilor i cel al clopotului nu erau sincronizate. Intersecia cu linia Keihin se afla cam la treizeci de metri n fa, pe oseaua Tokio-Yokohama, i taxiul lui Ando atepta s treac un tren. Spitalul Saisei din Shinagawa, destinaia lui, era dincolo de calea ferat. Trenul a trecut n sfrit, ndreptndu-se spre Tokio, dar bariera tot nu s-a ridicat. A nceput apoi s clipeasc sgeata de avertizare pentru alt tren, de data asta n direcia Yokohama. Probabil c mai aveau destul de ateptat. oferul taxiului se resemnase i frunzrea un teanc de hrtii prinse cu o
67

agraf de metal, notnd din cnd n cnd cte ceva. Nu e nicio grab. Vizitele se ncheie abia la ora cinci, prin urmare mai am destul timp. Ando i-a ridicat brusc capul, pn atunci sprijinit de tetier. Avea senzaia c se uit cineva la el. De undeva de-afar, din apropiere, l fixau doi ochi. Poate c s-ar fi simit la fel dac ar fi fost strivit ntre dou lamele de sticl, ca o mostr de esut, i examinat la microscop. Privirea aintit asupra lui avea ceva din concentrarea unui observator exersat. Ando s-a uitat n jur. Poate c pasagerul altei maini l recunoscuse i ncerca acum s-i atrag atenia. N-a vzut ns niciun chip familiar n automobilele din apropiere, iar trotuarul era pustiu. A ncercat s se conving c imaginaia i juca feste, ns privirea pe care o simise mai devreme nu ddea semne c ar abandona observaia. S-a uitat din nou n stnga i n dreapta. La stnga, imediat dup ce se sfrea trotuarul, se nla un taluz acoperit cu iarb, paralel cu linia de tren. Ceva se mica n umbra tulpinilor nalte. Se mica i ncremenea, iar se mica i iar ncremenea. Fr s-l scape o clip din priviri, o creatur necunoscut se tra de-a lungul taluzului, ntr-o secven de naintri i opriri succesive. Un arpe. Ando s-a mirat s vad unul tocmai acolo. Ochii lui minusculi i strlucitori scnteiau n lumina dup-amiezii de toamn. Nu ncpea nicio ndoial c el era observatorul pe care-l simise. arpele i-a trezit amintirea unei ntmplri din vremea colii. Locuia n provincie, ntr-un orel nconjurat de cmpuri cultivate. Odat, cnd se ntorcea de la coal Ando i amintea c era o dup-amiaz linitit de primvar , vzuse un arpe pe un zid de beton care mrginea un canal plin cu ap. La nceput i se pruse c arpele acela foarte subire i cenuiu era o simpl crptur n zid, dar se apropiase i remarcase corpul lui cilindric reliefat pe creasta zidului. i imediat cum vzuse c era un arpe, se aplecase i ridicase o piatr de mrimea pumnului. O cntrise n palm de cteva ori, obinuindu-se cu mrimea i greutatea ei, apoi
68

luase poziia clasic a unui arunctor. Punctul n care se oprise era la civa metri de zidul aflat de cealalt parte a canalului. Nu trgea prea mari sperane c va nimeri n plin. Cu toate acestea, piatra s-a nlat mult, pe o traiectorie arcuit, i a czut exact pe capul arpelui, zdrobindu-l. Ando a strigat i s-a dat un pas napoi. Se afla la cel puin patru metri deprtare, dar avea senzaia c strivise capul arpelui cu pumnul. i-a ters palma pe pantaloni de mai multe ori. arpele czuse n ap, ca i cum o for invizibil l-ar fi tras acolo. Ando a fcut civa pai prin iarba care cretea pe marginea canalului i s-a aplecat n fa, ncercnd s surprind ultimele clipe ale arpelui. A ajuns la timp ca s vad cum se ndeprta, plutind n voia apei. n clipa aceea a simit aceeai privire ca acum. Nu a arpelui mort, ci a altuia, mult mai mare, care se ascundea n iarb i-i urmrea micrile. Capul lui neted era inexpresiv, dar Ando se simea nvluit de privirea insistent, neclintit. Atunci s-a cutremurat de rutatea din ochii aceia. Dac arpele cel mic pe carel omorse era copilul arpelui cel mare, n mod sigur l atepta o nenorocire. arpele cel mare l blestemase, asta era explicaia privirii intense. Bunica lui i spusese de nenumrate ori c va pi ceva ngrozitor dac va omor vreodat un arpe. Cindu-se amarnic, Ando s-a rugat de arpe, n tcere, spernd din tot sufletul c-l va convinge c nu dorise s ucid. ntmplarea se petrecuse cu peste douzeci de ani n urm, i totui Ando i-o amintea cu o exactitate uimitoare. Blestemele erpilor, tia prea bine acum, erau simple superstiii. Se ndoia c reptilele puteau s-i recunoasc mcar propriile progenituri. i totui Alarma continua s sune. Ajunge! Nu te mai gndi la asta! a strigat n sinea lui. Dar l obseda imaginea puiului de arpe plutind ncet n anul cu ap, cu burta albicioas ntoars spre cer, urmat not de arpele mai mare. M-a blestemat. Nu mai reuea s-i controleze gndurile. n pofida voinei sale, avea perfect n faa ochilor lanul karmic al cauzelor i efectelor. Nu putea s scape de imaginea puiului de arpe prins n desiul
69

vegetaiei care cretea pe marginea canalului, nici de privelitea arpelui-printe care notase pn la el i se ncolcise n jurul lui, amndoi plutind ncetior Imaginea aceea i-a amintit de ADN. ADN-ul din nucleele celulelor, a realizat el brusc, arat ca doi erpi ncolcii unul n jurul altuia, nlndu-se ca o spiral spre cer. ADN-ul, care transmite informaia biologic din generaie n generaie, la nesfrit. O pereche de erpi nlnuia perpetuu omenirea. Takanori! Chemarea mut pe care o nlase ctre fiul su era plin pn la refuz de suferin. i era team c nu va putea s mai reziste prea mult. i-a ridicat capul i s-a uitat afar. Trebuia s-i distrag singur atenia, s ntrerup imediat lanul de asociaii. A vzut prin parbriz expresul Keihin, de un rou strlucitor, trecnd ncet dincolo de barier. Cum staia Shinagawa era foarte aproape, trenul nainta la fel de ncet ca un arpe lene. Din nou erpi. Nu avea nicio cale de scpare. A nchis ochii i a ncercat iar s se gndeasc la altceva. O mn micu i-a apucat glezna, apoi a alunecat i a disprut n adncul oceanului. A simit nc o dat atingerea ei. Era blestemul arpelui, fr ndoial. Mai avea puin i izbucnea n plns. Situaiile erau ciudat de asemntoare. Puiul de arpe cu capul sfrmat, dus de ape. i blestemul aruncat de arpele-printe, materializat douzeci de ani mai trziu. Takanori fusese att de aproape, dar Ando nu reuise s-l salveze. Iunie, plaja nainte de deschiderea oficial a sezonului. El i fiul lui plutind spre larg, inndu-se de o saltea pneumatic. Soia lui strignd de pe rm: Taka, ai ajuns prea departe! ntoarce-te! Dar biatul era mult prea ocupat s se joace, s-l stropeasc. Chemarea mamei nu ajunsese la el. Scumpule, ascult-m! Vino napoi! n glasul ei apruse un accent de isterie. Valurile erau tot mai nalte. Pn i Ando i-a spus c venise timpul s ias din ap. A ncercat s ntoarc salteaua spre rm.
70

Chiar n clipa aceea, un val uria i nspumat s-a nlat n faa lor i a rsturnat instantaneu salteaua, aruncndu-i pe amndoi n ap. Sa scufundat complet i abia atunci i-a dat seama c erau att de departe de rm, nct nici mcar el nu mai atingea cu picioarele nisipul de pe fund. A nceput s intre n panic. Cnd a reuit s scoat capul din ap, fiul lui dispruse. Clcnd apa, s-a ntors de jur-mprejur i a vzut-o pe soia lui alergnd ctre el, nc mbrcat, n acelai timp, o mn l-a apucat de glezn. Mna biatului su. Ando a ncercat disperat s plonjeze i s-l trag la suprafa, dar exact micarea aceea nu avea voie s-o fac. Mnua lui Taka a alunecat de pe glezna lui i Ando a mai reuit s apuce doar o uvi de pr. Strigtele nnebunite ale soiei sale pluteau deasupra valurilor. tiu c-i aproape, dar nu reuesc s ajung Ia el! S-a scufundat imediat i a nceput s caute orbete, dar n-a reuit s gseasc din nou mna aceea micu. Unde fusese dus de ape? A rmas, pentru totdeauna, doar cu uvia de pr ncurcat n verighet. Bariera s-a ridicat n sfrit. Ando plngea, ncercnd s-i nbue suspinele cu mna. oferul taxiului l auzise totui i acum l privea fr ncetare n oglinda retrovizoare. Vino-i n fire nainte s te prbueti de tot! Una era s plng acas, n pat, i cu totul altceva n vzul tuturor. i dorea din tot sufletul s existe o cale, indiferent care, s-l poat aduce napoi, aici i acum. Deodat i-a aprut n minte chipul lui Mai Takano. Fata atacase parfeul de fructe cu un asemenea entuziasm, nct Ando era convins c la sfrit ar fi fost n stare s ling farfuria. Pe sub rochie purta o bluz alb i i inea mna stng pe genunchi. Terminase parfeul, i tersese buzele cu un erveel i se ridicase de pe scaun. Ando a nceput s neleag. Singurele gnduri care-l puteau scoate din prpastia suferinei erau fanteziile sexuale cu Mai Takano. n aceeai clip i-a dat seama c nu se mai gndise aa la o femeie de cnd l prsise soia sau, mai bine zis, de cnd murise fiul lui. i pierduse complet dorina de a
71

face dragoste. Cnd a trecut peste calea ferat, taxiul a sltat de dou ori n sus i-n jos. n mintea lui Ando, trupul lui Mai Takano s-a micat n acelai ritm.

72

9
La Sagami Ohno, Mai Takano a cobort din trenul de pe linia Odakyu i a ieit n strad, dar n-a reuit s se hotrasc imediat n ce direcie s porneasc. Cu dou sptmni n urm fcuse acelai drum, n sens invers, dar ntre timp i pierduse cu desvrire simul de orientare. Cnd se dusese la prinii lui Ryuji pentru priveghi, se urcase ntr-o main a universitii. De data asta, mergnd pe jos n aceeai direcie de la staia de metrou, n-a apucat s strbat nici cincizeci de metri i i-a dat seama c nu recunoate nimic njur. Nu era o experien nou pentru ea. Se rtcea de fiecare dat cnd ncerca s ajung ntr-un loc unde mai fusese doar o singur dat. Avea numrul prinilor lui Ryuji, aadar ar fi fost de-ajuns s le dea un telefon, ns i era ruine s-o roage pe mama lui s vin acolo. S-a hotrt s se bazeze n continuare pe intuiie. tia c nu mai avea mult de mers. Pe jos, era un drum de cel mult zece minute. Deodat, n minte i-a aprut faa lui Ando. Stabilise s ia cina cu el vinerea urmtoare, dar acum se ntreba dac nu cumva se pripise. ncepea s-i par ru c acceptase. Din punctul ei de vedere, Ando era prietenul lui Ryuji, un om cu care putea mpri amintiri. Dac lar convinge pe Ando s-i povesteasc despre anii de studenie ai lui Ryuji, poate c ar reui s neleag mai bine ideile impenetrabile ale profesorului. Cu alte cuvinte, trebuia s admit c hotrrea ei de a iei cu Ando era parial consecina unor calcule raionale. Dac Ando ar ncepe s se gndeasc la ea aa cum un brbat se gndete la o femeie, relaia lor ar lua o turnur neplcut. De cnd ncepuse facultatea, Mai nvase pe propria piele c brbaii i femeile i doreau lucruri complet diferite. Mai voia s pstreze relaiile la un
73

nivel la care ea i brbatul ales s se poat stimula reciproc din punct de vedere intelectual; n schimb, interesul colegilor prea s graviteze mereu n jurul prilor ei intime. Era obligat de fiecare dat s-i resping, dar ncerca s-o fac ct mai blnd cu putin. Aproape c nu putea s ndure suferina pe care le-o provoca retragerea ei. i trimiteau lungi scrisori cu scuze, care nu fceau altceva dect s pun sare pe ran. Sau i telefonau i primele cuvinte pe care le auzea erau Ascult, regret sincer ce s-a ntmplat ultima dat. Nu dorea s aud scuze. Dorea, n schimb, s nvee ceva din experienele lor i s devin mai nelepi. Dorea s vad brbai care transformau ruinea n energie creatoare i se angajau ntr-o lupt sincer cu viaa, ndreptndu-se hotri spre maturitate. Dac mcar unul dintre ei ar fi procedat aa, ar fi rennodat imediat prietenia cu el. Dar nu putea fi prieten cu oameni care refuz s creasc, cu oameni al cror psihic rmnea pe vecie, fr speran, n stadiul copilriei. Ryuji fusese singurul brbat care o angajase ntr-o relaie serioas. Nu semna deloc cu adolescenii care roiau n jurul ei. Schimbase cu el idei i emoii de o valoare inestimabil. Dac ar fi fost sigur c relaia cu Ando putea s fie ca aceea cu Ryuji, ar fi acceptat i o mie de invitaii la cin. Dar tia din propria ei experien c ansele erau infime. n Japonia, probabilitatea ca o femeie s ntlneasc un brbat independent, un brbat ntr-adevr demn de acest nume, era apropiat de zero. Cu toate acestea, nu putea s-l alunge pe Ando din minte. Ryuji i pomenise de el o singur dat. n toiul unei discuii despre ingineria genetic, profesorul se ndeprtase brusc de la subiect i aruncase ntr-o doar numele lui Ando. Mai nu reuise niciodat s priceap pe deplin diferena dintre gene i ADN. Nu sunt, n mare, unul i acelai lucru? Ryuji se apucase s-i explice c ADN-ul este suportul chimic pe care sunt nregistrate informaiile ereditare, n vreme ce gena este o singur unitate din volumul aproape infinit de informaii transmise din generaie n
74

generaie. n cursul discuiei menionase faptul c exista deja tehnologia prin care ADN-ul putea fi mprit n segmente, cu ajutorul enzimelor de restricie, apoi rearanjat. Ea remarcase c acest proces era ca un puzzle. Ryuji fusese de acord: Absolut, e ca i cum ai compune un puzzle sau ai descifra un cod. Din acel punct, discuia a luat-o razna, pn cnd Ryuji s-a apucat s-i povesteasc o ntmplare din vremea studeniei. Dup ce Ryuji aflase c bazele tehnologiei de manipulare a ADNului implicau i decodificarea, n timpul liber ncepuse s se joace de-a decriptarea cu colegii lui din facultate. Anecdota pe care i-o povestise despre aceste jocuri era interesant. Muli studeni erau fascinai de biologia molecular, aa c n-a trecut mult i Ryuji a recrutat cam zece parteneri pentru jocurile lui. Regulile erau simple. Unul dintre ei compunea un mesaj cifrat, iar ceilali aveau la dispoziie un anumit numr de zile pentru a sparge cifrul. Ctiga, evident, primul care reuea. Jocul le punea la ncercare cunotinele de matematic i logic, dar le cerea i o scnteie de inspiraie. Toi erau pasionai. Codurile erau mai mult sau mai puin dificile, n funcie de priceperea autorului, ns Ryuji le rezolva aproape pe toate. Pe de alt parte, un singur student reuise s sparg un cod de-al lui: Mitsuo Ando. Ryuji i-a povestit lui Mai c a fost de-a dreptul ocat cnd Ando a reuit s-i descifreze codul. M-au trecut fiori. Parc mi citise gndurile. Aa ajunsese numele lui Mitsuo Ando s-i fac o impresie puternic lui Mai. Tot aa se explica i de ce fusese att de uimit cnd poliistul i-l prezentase pe Ando la morg. Nu putea fi dect acel Ando, n fond, chiar se prezentase ca un vechi prieten al lui Ryuji. tiind c Ando era singurul care reuise vreodat s descifreze mesajele codate ale lui Ryuji, Mai se gndise c poate avea ncredere n el. Cu alte cuvinte, era convins c talentul lui n mnuirea bisturiului era la fel de mare, deci avea s afle cu uurin cauza morii profesorului.
75

Fata se afla nc sub influena cuvintelor rostite de un om care murise cu dou sptmni n urm. Dac Ryuji nu i-ar fi pomenit de Ando, probabil c n-ar fi sunat niciodat la morg pentru a afla care fusese cauza morii i nici n-ar fi acceptat s se ntlneasc din nou cu legistul n campusul universitii. n mod sigur nu i-ar fi fcut planuri s ia cina cu el. Dar cteva cuvinte aruncate din ntmplare o legaser n mod subtil de acel om. Mai a prsit strada principal i a intrat ntr-un labirint de strdue rezideniale. Pe una a vzut firma unui magazin non-stop i a recunoscut-o imediat. Mai departe cunotea drumul. Ca s ajung la casa prinilor lui Ryuji trebuia s treac de magazin i s mearg drept nainte. Pe msur ce amintirile vechi de dou sptmni i reveneau n memorie, Mai a iuit pasul. Era o cas care nu ieea deloc n eviden, construit pe un teren de nici cincizeci de metri ptrai. i amintea, din noaptea priveghiului, c la parter era o sufragerie destul de mare i alturi o camer mic, mobilat n stil japonez. Nici n-a apucat bine s apese pe butonul soneriei c mama lui Ryuji a deschis ua. O ateptase cu nerbdare pe Mai i a condus-o imediat la etaj, n camera n care locuise fiul ei din coala primar pn n primul an de facultate. Ryuji plecase de acas cnd era n anul doi, dei putea foarte bine s fac naveta. nchinase o cmru lng universitate i mai folosea vechea lui camer din casa printeasc doar pentru studiu, cnd venea n vizit. Doamna Takayama a pus pe jos o farfurie cu prjiturele i o ceac cu cafea i a ieit. Urmrind-o cu privirea n timp ce se ndeprta ncet pe coridor, cu capul plecat, Mai s-a simit nduioat de durerea profund a femeii care-i pierduse fiul. Rmas singur, a studiat pentru prima dat n voie ncperea. Era decorat n stil japonez, cu podeaua acoperit de rogojini. n colul n care se afla biroul era aternut un covora. Pereii erau i ei acoperii cu rafturi pentru cri, dar numai partea superioar a acestora era vizibil. Jumtatea de jos a rafturilor se pierdea n
76

spatele unui talme-balme de cutii de carton i de aparate aezate claie peste grmad pe podea. A numrat repede cutiile: douzeci i apte. n ele erau toate lucrurile adunate din apartamentul lui Ryuji din Nakano. Cele mai mari piese de mobilier patul, biroul i altele fuseser deja date. Cutiile preau s fie pline cu cri. Mai a oftat, apoi s-a aezat pe jos i a sorbit din cafea. ncercase deja s se mpace cu ideea c era posibil s nu gseasc niciodat ce cuta. Chiar dac se aflau acolo, era un adevrat tur de for s gseasc cteva foi de hrtie printre toate celelalte lucruri. Poate c paginile cu pricina nici mcar nu erau n cutii. Cele douzeci i apte de cutii erau sigilate cu band adeziv. i-a scos haina, i-a suflecat mnecile i a deschis-o pe cea mai apropiat. Cri, ediii de buzunar. A scos cteva i una dintre ele s-a dovedit a fi un cadou pe care i-l fcuse chiar ea. A copleit-o dorul de Ryuji. Cartea mai pstra nc mirosul apartamentului din Nakano. Nu e momentul s te lai copleit de sentimente. i-a stpnit lacrimile, apoi s-a ntors la lucru i a scos tot ce era n cutie. A ajuns la fund, dar nici urm de hrtii. S-a oprit i a ncercat s ghiceasc cu ce alte hrtii puteau fi asociate paginile. Poate erau mpreun cu tratatele pe care le folosise ca bibliografie, poate ntr-un dosar n care inea i alte lucrri tiinifice. S-a apucat s desigileze toate cutiile. Transpirase i bluza i se lipise de spate. Sarcina aparent simpl de a scoate crile din cutii i de a le pune la loc s-a dovedit uimitor de dificil din punct de vedere fizic. Dup ce a terminat a treia cutie, a luat o pauz i cteva clipe a fost tentat s rescrie ea nsi paginile lips. Teoria provocatoare a lui Ryuji din domeniul logicii simbolice fusese deja publicat n revistele de specialitate, e drept, n foileton. Lucrarea de fa nu era ns nici pe departe la fel de ezoteric. Ryuji scrisese n acelai timp un studiu de mari dimensiuni destinat publicului larg, n care trata tiinele n general i logica n particular n contextul problemelor sociale. Ceea ce spunea acolo era destul de accesibil. De fapt, i aceast lucrare apruse n foileton
77

ntr-o revist lunar cunoscut, publicat de o mare editur. Ea se implicase de la bun nceput n acest proiect, oferindu-se s transcrie pe curat manuscrisele lui Ryuji. Participase pn i la ntlnirile cu editorul. Prin urmare, simea c stpnete destul de bine logica argumentaiei lui Ryuji, i chiar stilul lui literar. Dac lipsea doar o pagin sau dou, era convins c ar putea s umple golul fr a risca s dezechilibreze lucrarea. Dar numai dac m asigur c lipsete o singur pagin. Probabil c pn la urm va ceda tentaiei. Fiecare fragment publicat avea n medie patruzeci de pagini de manuscris doar n medie. Mai precis, ntre treizeci i apte i maximum patruzeci i trei de pagini. Acesta era al doisprezecelea i ultimul fragment, iar ea habar n-avea cte pagini apucase Ryuji s scrie. n consecin, nu putea s afle cte pagini lipseau. Dup ce plecase pe furi de la priveghi ca s pun manuscrisul n ordine, gsise partea final treizeci i opt de pagini scrise de mn. Ultima pagin avea numrul 38 i toate celelalte erau numerotate consecutiv, aadar la nceput nu observase c manuscrisul era incomplet. Din cauza nmormntrii i a strii ei sufleteti, nu se mai aezase la masa de lucru pentru a transcrie lucrarea. Cnd n fine se linitise i se apucase s citeasc textul, i dduse seama c termenul-limit de predare era periculos de apropiat. Abia atunci realizase c exista o lacun ntre ultimele dou pagini. Dac inea cont doar de numerotare, totul prea n regul: pagina 37 era urmat de pagina 38. Lipsea totui ceva important. De fapt, lipsea chiar concluzia. Fr ea, argumentaia era inutil. Ultimele dou rnduri de pe pagina 37 erau tiate cu pixul i alturi era desenat o sgeat cu vrful ndreptat spre marginea foii. Pe pagina urmtoare nu fusese ns adugat nimic. Se vzuse obligat s conchid c Ryuji fcuse ntr-adevr o completare, dar c aceasta dispruse. Simind c plete, citise de cteva ori toat lucrarea, de la primul pn la ultimul rnd. Cu ct o citea de mai multe ori, cu att era mai convins c lipsea ceva la sfrit. Firul argumentaiei, reluat i
78

aprofundat n fiecare fragment publicat, se oprea brusc cu aceste cuvinte: Totui, chiar din acest motiv Era promisiunea unei antiteze, dar fraza fusese retezat dup cinci cuvinte. Pe msur ce aprofunda stilul de gndire al profesorului, era din ce n ce mai sigur c dispruse un pasaj extrem de important, poate chiar unul de cteva pagini. i toat lucrarea, dousprezece fragmente care nsumau cinci sute de pagini, era deja inclus n planul editorului i trebuia s apar n volum. Iat cu ce se confrunta. Era o problem serioas. Prin urmare, vorbise imediat cu prinii lui Ryuji i le explicase n ce situaie se afla. La dou sau trei zile dup nmormntare, goliser apartamentul fiului lor i mutaser toate crile i obiectele personale n vechea lui camer de acas. Dac paginile lips s-au amestecat din greeal cu alte hrtii, n mod sigur se afl n camera lui, le-a explicat Mai btrnilor. Avea nevoie de acordul lor pentru a cuta n lucrurile lui Ryuji. Dar acum, fa n fa cu mormanul de cutii, simea c e gata s izbucneasc n lacrimi. O, de ce a trebuit s pleci aa? i totui, ce contiin profesional desvrit, s mori imediat dup ce termini un manuscris. Gndul acesta era insuportabil. Vreau s vii aici n clipa asta i s-mi spui ce s-a ntmplat cu paginile care lipsesc! A ntins mna spre cafea, care ntre timp se rcise. Dac ar fi citit din timp manuscrisul, n-ar fi fost acum n ncurctura asta. Orict ar fi regretat, tot i se prea c nu e destul. Dac nu gsea pn la urm paginile, nu avea alt soluie dect s le rescrie cu mna ei. Inima i s-a strns de team la gndul c risca s se ndeprteze mult de la linia trasat de Ryuji. Era, oricum, o mare ndrzneal din partea ei. Sigur, se nscrisese deja la masterat, dar o fat abia trecut de douzeci de ani s redacteze concluzia ultimei lucrri a unui logician de la care lumea academic atepta numai realizri de excepie
79

Nu pot s fac asta. Repetndu-i n sinea ei c trebuia doar s gseasc hrtiile, a deschis urmtoarea cutie. Dup ora patru, camera care avea fereastra orientat spre est a nceput s se ntunece. A aprins lumina. Era noiembrie i ziua se scurtase simitor, dar nc nu venise frigul. Mai s-a ridicat i a tras perdelele. De ctva timp o deranja senzaia ciudat c o privete cineva de-afar. Brusc, a devenit contient c aude btaia propriei sale inimi. Pieptul i bubuia. S-a oprit i a rmas ncremenit, cu un genunchi ridicat, aplecat n spate, ateptnd ca palpitaiile s dispar. Nu i se mai ntmplase aa ceva. i-a lipit palma de partea stng a pieptului i a ncercat s-i dea seama de ce era nelinitit. Era oare vinovia c nu reuea s gseasc paginile din lucrarea profesorului? Nu, nu era asta. n camer se ascundea ceva. Cu un minut n urm crezuse c acel ceva se afla afar, c o privea, dar acum era sigur c se nelase. Se atepta ca dintr-o clip n alta o pisic sau vreun alt animal s neasc din spatele vreunei cutii. A simit o adiere rece la ceaf i pe gt. O privire sfredelitoare. Sa rsucit. i-a vzut pardesiul roz aruncat pe o cutie, acolo unde-l lsase cnd se apucase s caute hrtiile. Spaiile minuscule dintre fibrele esturii preau nite ochi strlucitori ce reflectau lumina becului. A ridicat haina i sub ea a descoperit un videorecorder. Aparatul negru ca tciunele fusese pus peste cutie, cu cablurile nfurate n jurul lui. Era, fr ndoial, cel din apartamentul lui Ryuji. n camer nu se afla niciun televizor. A ntins mna i a atins cu grij una dintre muchiile aparatului. Cablurile groase erau nfurate pe mijloc, iar aparatul sttea n echilibru pe ele, ca un balansoar. Eu am aruncat haina aici? Nu reuea s-i aminteasc, dar firete c era singura explicaie posibil. nainte s deschid cutiile, i scosese pardesiul i-l aruncase la ntmplare, peste aparat. Atta tot.
80

S-a uitat fix la aparat aproape un minut. Toate gndurile negre i grijile despre paginile lips s-au ters treptat din mintea ei. n locul lor au aprut semne de ntrebare. Nu uitase nicio clip ce o ntrebase Kazuyuki Asakawa a doua zi dup moartea lui Ryuji: Nu ti-a spus nimic n ultimele lui clipe? Nu i-a transmis ultima lui dorin? N-a pomenit nimic despre o caset video? A desfurat ncet cablurile. Cu tecrul n mn, s-a uitat prin camer dup o priz. Sub birou era un prelungitor. A bgat tecrul n el. Pe afiajul aparatului au clipit patru zerouri, pulsnd ca inima unui mort readus la via. i-a micat mna de cteva ori prin faa butoanelor, cu degetul arttor ntins. Nu reuea s se hotrasc. O voce interioar i optea s nu fac nimic. A apsat totui pe eject. Un motora a bzit, uia s-a deschis i a aprut o caset. Pe latura ei exterioar era lipit o etichet, pe care scria: Liza Minelli, Frank Sinatra, Sammy Davis jr. / 1989 Aa cum ieise din aparat, caseta prea o limb mare. Aparatul nsui parc era un copil obraznic care i fcea cu ochiul i se strmba la ea. Mai Takano a apucat strns limba aceea neagr i a tras-o afar.

81

10
Cnd aproape ajunsese la spital, taxiul n care se afla Ando a fost depit de o ambulan cu sirena urlnd. Erau pe o strad ngust, cu sens unic i plin de magazine, iar oferul a fost obligat s strecoare maina ntre dou dube de aprovizionare parcate lng bordur. Cum nu prea prea uor s-o scoat de acolo, Ando s-a hotrt pe loc s coboare i s mearg pe jos. Cldirea cu unsprezece etaje a spitalului domina strada, la doar doi pai de acolo. I-ar fi luat mult mai puin timp s mearg pe jos. n timp ce mergea pe aleea ce ducea la intrarea principal, a vzut ambulana care tocmai trecuse pe lng taxi parcnd n spaiul dintre aripa veche i cea nou. Salvarea strbtuse att de ncet strduele nguste, nct ajunsese n acelai timp cu el, care mersese pe jos. Sirena a tcut, dar girofarul a rmas aprins, aruncnd pete de lumin roie pe zidurile spitalului. Zgomotul a fost absorbit de cerul albastru, perfect senin, iar linitea a format o zon circular n jurul ambulanei, ca un halou de lumin n jurul unei lmpi. Ca s intre, trebuia s treac pe lng main. Luminile roii au ncetat n cele din urm s se roteasc i ultimele ecouri ale sirenei s-au pierdut n vzduh. Aerul era greu de ateptare. Uile din spate ale mainii se puteau deschide dintr-o clip n alta, scuipnd afar echipa de infirmieri i targa dar nu s-a ntmplat nimic. Ando a rmas pe loc. Au trecut zece secunde, douzeci, dar uile nu s-au deschis. Tcerea era palpabil. Treizeci de secunde. Aerul parc nghease. N-a aprut nimeni. Ando s-a smuls din trans, relundu-i drumul spre intrare. Deodat, uile ambulanei s-au cscat larg. Un infirmier a srit afar
82

i i-a ajutat pe colegii lui din main s coboare o targa. Lui Ando puin i psa de motivul care-i mpiedicase s scoat bolnavul imediat dup oprire: indivizii erau prea leni. Acum ineau targa nclinat i faa lui a fost pentru o clip la acelai nivel cu a bolnavului, acoperit cu o masc de oxigen. Privirile lor s-au ntlnit. Omul s-a rsucit brusc spre Ando, dar s-a oprit la fel de brusc. Ochii lui erau lipsii de via. Salvarea l luase cnd era deja ntr-o stare foarte grav, iar n clipa cnd se rsucise spre el i dduse sufletul. De-a lungul anilor Ando vzuse nenumrai mori, dar nu se ntlnise niciodat cu moartea aa, din ntmplare. Lundo drept un semn ru prevestitor, i-a ferit privirea. n fond, se comporta la fel ca Miyashita cu astrologia lui. Mai nti arpele de pe malul canalului, apoi ntlnirea asta ntmpltoare cu moartea. n ultima vreme, cutase un sens ntr-o mulime de evenimente nensemnate. i lua mereu n rs pe colegii care credeau n prevestiri i noroc, dar acum, iat, devenise unul dintre ei. Shinagawa Saisei era un spital de medicin general administrat de Universitatea Shuwa, iar cel cu care urma s vorbeasc, doctorul Wada, era de fapt cadru universitar. Se pare c superiorul lui ierarhic, Kurahashi, l contactase deja. Nici n-a apucat bine Ando s spun care era motivul vizitei c a i fost condus ntr-o camer din aripa de vest, la etajul al aptelea. Ando s-a uitat la Asakawa, care zcea apatic pe pat, i i-a amintit pe loc ochii bolnavului din ambulan. Ochii lui Asakawa aveau acelai aspect: erau ochii unui mort. Ziaristul sttea perfect nemicat, cu faa n sus i cu dou perfuzii nfipte n brae. Ando habar n-avea cum arta omul nainte s fie adus aici, ns bnuia c nefericitul ajunsese la jumtate din greutatea lui normal. Avea obrajii supi i barba aproape alb. S-a oprit la capul patului i a spus cu blndee: Domnule Asakawa Niciun rspuns. S-a gndit s-i pun mna pe umr, dar a ezitat i s-a ntors s cear permisiunea doctorului Wada. Doctorul i-a
83

fcut semn c nu era nicio problem, aa c i-a lsat mna pe umrul lui Asakawa. A simit prin halat c pielea bolnavului i pierduse elasticitatea. A simit i suprafaa dur a omoplatului, i ia retras mna fr s vrea. Nicio reacie. ndeprtndu-se de pat, Ando s-a ntors cu faa la Wada i l-a ntrebat: A fost tot timpul n starea asta? Da, i-a rspuns sec doctorul. Asakawa fusese adus direct de la locul accidentului, la 21 octombrie, ceea ce nsemna c timp de cincisprezece zile nu vorbise, nu strigase, nu zmbise, nu se nfuriase, nu mncase, nu urinase i nu-i golise intestinele n mod contient. Care credei c e cauza, doctore? a ntrebat Ando pe un ton de o politee cam exagerat. La nceput, am presupus c a suferit un traumatism cerebral, dar analizele n-au artat nimic suspect. Bnuim c e vorba de o cauz psihic. Stare de oc? Foarte probabil. Pesemne c ocul provocat de pierderea simultan a soiei i fiicei sale zdrobise mintea lui Asakawa. Dar Ando a nceput s se ntrebe dac asta era ntr-adevr singura cauz. Avea n minte o imagine surprinztor de limpede a clipei accidentului, poate din cauz c vzuse fotografiile fcute la faa locului. i de fiecare dat cnd rememora scena, privirea lui era atras de scaunul din dreapta oferului i de videorecorderul rmas acolo. n imaginaia lui, aparatul cptase dimensiuni impuntoare. De ce luase ziaristul n main un video? Unde se ducea cu el? Dac omul ar fi putut s-i explice Ando a tras un taburet lng cptiul patului i s-a aezat. S-a uitat o vreme la profilul lui Asakawa, ncercnd s ghiceasc n ce trm al viselor se rtcise bietul om. n care lume e mai bine s trieti, s-a ntrebat el, n cea real sau n cea iluzorie? Probabil c, n
84

lumea viselor, soia i fetia lui Asakawa erau nevtmate. n chiar clipa asta brbatul i inea poate fiica pe genunchi i se juca cu ea. Domnule Asakawa, a repetat Ando, cu toat compasiunea pe care putea s-o adune un om care suferise aceeai pierdere. Din moment ce Asakawa fusese coleg de liceu cu Ryuji, era cu doi ani mai mic dect Ando. Oricine l-ar fi privit acum nu i-ar fi dat mai puin de aizeci de ani. Ce provocase o asemenea schimbare? Tristeea accelereaz mbtrnirea. De pild, Ando era contient c el nsui mbtrnise rapid n ultimul an. nainte i se spunea adesea c nu-i arat vrsta, dar n ultima vreme oamenii l credeau mai btrn dect era de fapt. Domnule Asakawa, a zis el din nou. Wada n-a mai suportat: Nu cred c v aude. Era adevrat. Ar fi putut s-l strige la nesfrit, n-ar fi obinut nicio reacie. A renunat i s-a ridicat n picioare. O s-i revin? Cerul tie, a zis Wada ridicndu-i braele. Starea pacienilor cu simptomele lui Asakawa se putea mbunti sau nruti fr niciun semn prevestitor. Medicina nu era n stare s prevad evoluia unor cazuri de genul acesta. V rog s m anunai dac survine vreo schimbare. Desigur. N-avea niciun rost s mai zboveasc acolo. Au ieit mpreun din rezerv. n pragul uii, Ando s-a oprit i i-a aruncat o ultim privire lui Asakawa. N-a observat nici cea mai mic schimbare. Ziaristul se uita fix la tavan.

85

11
Mai a nclinat sptarul ct a putut de mult, apoi s-a ntins pe spate i a rmas aa, uitndu-se la tavan. Fcea asta de fiecare dat cnd ajungea ntr-un impas. Aa cum sttea acum, cu spatele arcuit i cu capul n jos, putea s citeasc titlurile crilor de pe rafturile din spatele ei. Fr s-i pese c prul ei, nc ud, atrna pe covor, a nchis ochii i a rmas o vreme n poziia aceea incomod. Garsoniera ei, inclusiv baia i chicineta, avea mai puin de douzeci de metri ptrai. Un perete ntreg era acoperit de bibliotec, iar spaiul rmas era insuficient pentru un pat i un birou. Seara, ca s-i poat ntinde salteaua, mpingea ntr-un col msua joas pe care o folosea n loc de birou. Fusese obligat s renune la spaiu, altfel nu i-ar fi putut permite o locuin lng campusul universitar doar din banii pe care-i primea de acas i din ce ctiga cu meditaiile. Cele trei condiii eseniale pe care i le impusese erau s fie aproape de universitate, s aib propria ei baie i s fie ct de ct linitit. Chiria consuma aproape jumtate din venitul ei lunar, dar, chiar i aa, era mulumit de soluia asta. tia foarte bine c, dac s-ar fi mutat ceva mai departe, ar fi avut mai mult spaiu, dar nu avea intenia s plece de-acolo. De fapt, i se prea foarte comod s stea la msua ei, n mijlocul camerei, i s poat lua orice obiect doar ntinznd braul. Cu ochii nchii, pe pipite, a gsit CD player-ul i l-a pornit. i plcea melodia aceea. Btea cu palmele pe coapse ritmul muzicii. n gimnaziu i n liceu fcuse parte din echipa de atletism, era bun la sprint, i picioarele i erau nc puternice. i-a reglat respiraia pn cnd pieptul a nceput s se ridice i s se lase n ritmul muzicii, sub bluza de pijama nflorat. i dilata nrile n acelai ritm, rugndu-se
86

pentru o inspiraie brusc. Gndul c trebuia s ncheie manuscrisul chiar n noaptea aceea o mpiedica s se concentreze. i dduse ntlnire cu Kimura, editorul lui Ryuji, a doua zi dupamiaz. Tot atunci trebuia s-i predea o copie corectat a ultimei pri a lucrrii, iar ea nc nu avea idee cum s o termine. Nu gsise paginile lips n casa prinilor lui Ryuji i nu mai avea timp s le caute n alt parte. ncepuse chiar s se ntrebe dac ntr-adevr lipsea ceva din lucrare. Poate c Ryuji avusese intenia s completeze manuscrisul mai trziu, ns murise nainte s poat face asta. Dac acesta era adevrul, trebuia s-i adune puterile i s se concentreze asupra unei ncheieri demne de restul lucrrii. Dar trecuse foarte mult timp i ea nu-i gsea cuvintele. Nu scrisese nici mcar un rnd. Fcuse un du ca s-i limpezeasc mintea, i totui stiloul nu reuea s produc niciun rnd. De fapt scrisese cte ceva, dar de fiecare dat mototolise foaia i o aruncase la co. Deodat a avut o revelaie. A deschis ochii. Nu ajungi nicieri pentru c ncerci s adaugi ceva. Se chinuise atta timp pentru c ncercase s umple cu propriile ei cuvinte golul de la sfritul crii, dar era de ateptat c nu va reui s ghiceasc unde ar fi adugat Ryuji un rnd sau o idee. Srea de la o idee la alta chiar i n zilele lui cele mai bune. Prin urmare, tot ce putea s fac era s elimine pasajele dinainte i de dup partea lips, pentru a ncheia lucrarea. S-a ridicat i a fixat sptarul scaunului n poziie aproape vertical. Ct de proast fusese. E mult mai uor s tergi dect s adaugi. Probabil c nsui Ryuji ar fi ales aceeai soluie, chiar dac asta ar fi nsemnat s renune la unele dintre ideile sale. Dar era de departe mai bine aa dect s rite s-i distorsioneze ideile pn ar fi ajuns de nerecunoscut. Acum, dup ce gsise soluia, Mai se simea mai relaxat. Ca i cum ar fi vrut s-o mpiedice s se liniteasc, caseta video i-a atras iar atenia. O luase de la prinii lui Ryuji fr s le spun. nc de
87

cnd o gsise acolo ardea de curiozitate s afle ce era pe band. Dar, n ciuda faptului c n camer era un video, nu gsise niciun televizor. Nu putea s vad nregistrarea dect dac lua caseta acas. La nceput intenionase s le cear permisiunea s-o mprumute, dar cnd, n cele din urm, se hotrse s plece, toate formulele pe care i le pregtise n minte dispruser brusc. Nu mai tia cum s abordeze subiectul. Scuzai-m, dar caseta asta video m intereseaz foarte mult. V suprai dac o mprumut puin? Ce formul vag. Apropo, ce nseamn te intereseaz? Dac iar fi cerut explicaii, n-ar fi tiut ce s le spun. Aa c, pn la urm, plecase cu caseta n geant. Liza Minelli, Frank Sinatra, Sammy Davis Jr. / 1989. Probabil c nregistrase muzic, pur i simplu. Caseta nsi era absolut banal. i totui ea o luase. Nici mcar nu-i amintea cnd o scosese din geant. i uite-o, aezat pe combina ei TV-video cu ecran de paisprezece oli, parc invitnd-o. Pn i n camera lui Ryuji, cnd se afla n video, n cutia aceea mecanic, caseta o atrsese ntr-un anumit fel. Acum, scoas din cutia ei, expus privirii, i se prea c are puterea s-o absoarb, ca o gaur neagr. Titlul nu prea se potrivea cu gusturile muzicale ale lui Ryuji. De fapt, din cte tia, Ryuji nu asculta muzic aproape deloc. Cnd asculta totui, prefera piese clasice mai uoare. n orice caz, scrisul de pe etichet demonstra limpede c nu fusese caseta lui Ryuji. Altcineva fcuse nregistrarea. ntr-un fel sau altul, caseta ajunsese n apartamentul lui Ryuji din Nakano Est. Acum se afla n garsoniera lui Mai. Fr s se ridice de pe scaun, Mai a ntins mna i a introdus caseta n combin. Aparatul s-a aprins automat. A selectat canalul video i a apsat pe Play. Cnd rolele au nceput s se nvrteasc, s-a auzit un zgomot uor i Mai a apsat repede pe Pause. i dac pe caset era o nregistrare pe care n-ar fi trebuit s-o vad nimeni? A ezitat. tia
88

bine c, odat ce ai vzut anumite imagini, i rmn ntiprite n memorie i nu mai ai cum s le tergi de-acolo, nu te mai poi ntoarce la starea de puritate iniial. Poate c ar trebui s se opreasc totui, nainte de a fi prea trziu. Dar dubiile n-au reuit pn la urm s-i alunge curiozitatea i a apsat iar pe butonul de pauz. S-a auzit un fit electrostatic i imaginea de pe ecran a tremurat. O secund mai trziu, ecranul s-a fcut negru ca smoala, ca i cum televizorul s-ar fi umplut cu tu. Acum nu mai putea da napoi. S-a pregtit sufletete. Scenele pe care le-a vzut apoi nu aveau nicio legtur cu titlul casetei i n-a reuit s le neleag semnificaia. Imediat dup ce caseta s-a terminat, lui Mai i s-a fcut ru i a alergat la baie. Pe la mijlocul nregistrrii avusese intenia s renune, dar puterea imaginilor era irezistibil. Privise pn la sfrit. Ba nu, era mai potrivit s spun c fusese obligat s priveasc. Pur i simplu nu reuise s apese pe Stop. Era lac de sudoare i tremura. A simit cum ceva i croia drum din stomacul ei, n sus, pe gt. Era mai degrab dezgustat dect nfricoat ceva se cuibrise n ea, se cuibrise adnc. tia c trebuie s scape de acel ceva. i-a bgat dou degete n gur, dar n-a izbutit s vomite mare lucru. Cnd a simit gustul amar al fierii s-a necat i lacrimile i-au nit din ochi. Uitndu-se de jur-mprejur cu o privire inexpresiv i neajutorat, a czut n genunchi. O vreme a ascultat cum acel ceva dinuntrul ei o distrugea, apoi contiina i s-a retras departe, foarte departe.

89

Partea a doua DISPARIIA

90

1
Trecuser cincisprezece minute de la ora stabilit pentru ntlnire i Ando ncepea s fie nelinitit. i-a scos agenda i a verificat din nou data i locul. Datele erau corecte: vineri, 9 noiembrie, ora 6 dup-amiaz, n faa statuii Moai de la ieirea dinspre vest a staiei Shibuya. Cina cu Mai. Nu greise. Ando s-a aruncat n uvoiul de trectori i a fcut repede turul complet al zonei. De fiecare dat cnd vedea o femeie cam de aceeai vrst cu Mai, se uita la faa ei, dar mereu era altcineva. Trecuse deja o jumtate de or. Gndindu-se c poate fata uitase, Ando a sunat-o de la un telefon public. A lsat telefonul s sune de ase sau apte ori, imaginndu-i cum ricoau ecourile soneriei n pereii garsonierei strmte. E ntr-adevr minuscul, spusese ea. Mai puin de cinci rogojini. Telefonul a sunat a zecea oar. n mod sigur nu era acas. i-a ndeprtat receptorul de ureche. Fr ndoial c ntrziase din cauz c i se ntmplase ceva. Probabil c era pe drum acum. Cel puin asta spera cnd a nchis telefonul. Fr s vrea, se uita mereu la ceas. Trecuse aproape o or. La apte renun. Se scursese att de mult timp de la ultima lui ntlnire cu o femeie, nct nici mcar nu mai tia dac era cazul s atepte n continuare. Dac se gndea mai bine, nu fusese niciodat lsat s atepte. Soia lui era foarte punctual la ntlniri. El mai ntrzia uneori, dar ea niciodat. O vreme a ncercat s-i aminteasc toate ocaziile cnd el i ateptase pe alii i, fr s-i dea seama, ora apte a venit i a trecut.
91

Dar Ando nu reuea s se hotrasc s plece. Atta vreme ct mai avea o urm de speran, nu putea s renune. i tot repeta n gnd: nc cinci minute Toat sptmna se gndise la ntlnirea asta. Nu putea s abandoneze tocmai acum. n cele din urm, Ando a ateptat n faa staiei Shibuya o or i treizeci i trei de minute, dar Mai n-a venit. A intrat n holul hotelului i s-a dus direct la recepie, s ntrebe unde avea loc petrecerea de rmas-bun. Desprirea de Funakoshi. Acum, dup ce Mai i fcuse figura, nu mai avea niciun motiv s nu mearg la petrecere. n plus, dup ce ateptase atta timp n aerul rece al serii i n mijlocul unei mulimi de tineri, pur i simplu nu suporta gndul de a se ntoarce n apartamentul lui gol. Cutnd o idee pentru a-i salva seara, i venise inspiraia s se duc totui la petrecere. Nu i-ar fi stricat s stea la taclale cu vechii lui prieteni, mai ales c trecuse mult timp de cnd nu mai fcuse asta. Etapa oficial a adunrii tocmai se ncheiase, iar invitaii se separaser n grupuri de trei-patru ini pentru a lua cu asalt barurile. Aa se ntmpla de fiecare dat. Profesorii plecau acas dup festivitatea oficial, lsndu-i pe universitarii tineri s vorbeasc liber n timpul partidei de excese de dup. Ando nimerise la anc, ajunsese exact la timp pentru a se altura unuia dintre grupuri. Miyashita a fost primul care l-a vzut. A venit repede la el i i-a pus o mn pe umr. Credeam c ai o ntlnire A, mi-a tras clapa, a zis Ando, ncercnd s par ct mai nepstor. mi pare ru. Hai, vino aici o clip. Miyashita l-a apucat de mnec i l-a condus ntr-un colior liber de lng u. Nu prea prea interesat s aprofundeze pania lui Ando. Ce s-a ntmplat?
92

Ceva nu era n regul. nainte ca Miyashita s apuce s-i rspund, profesorul Yasukawa de la Medicin Intern a trecut pe lng ei. Miyashita i-a optit lui Ando: Vii cu noi la but, nu-i aa? De-asta am venit aici. Perfect. i spun mai trziu. Apoi Miyashita a plecat s-l lingueasc pe Yasukawa. n calitatea lui de organizator, i-a mulumit profesorului pentru prezena lui acolo. Era numai zmbete i glume, iar faa lui rubicond strlucea ca o lun plin. Ando n-a avut ncotro i a trebuit s admire miestria cu care prietenul lui reuea s intre n graiile tuturor profesorilor universitari. Oricine altcineva n locul lui s-ar fi comportat la fel, ar fi fost imediat etichetat drept servil, dar Miyashita tia cum s-o scoat la capt. Ando a rmas lng u, ateptnd ca Miyashita s-i ncheie discuia cu Yasukawa. ntre timp, mai muli cunoscui au trecut pe lng el, dar niciunul nu i-a oferit mai mult dect un salut. Nimeni nu avea chef s se opreasc i s stea de vorb cu el. Cercul lui de prieteni se micorase considerabil de cnd i pierduse fiul. Cu toate acestea, nu le purta nicio urm de ranchiun celor care se ndeprtaser de el. tia c vina i aparine doar lui. Imediat dup tragicul eveniment, toi se nghesuiser n jurul lui, oferindu-i ajutor i consolare, dar Ando nu fusese n stare s le rspund aa cum ar fi trebuit. Dimpotriv, i tra dup el nenorocirea peste tot i era posomort n compania prietenilor. Nu mai fi trist, i spuneau, dar cum putea s nu fie? l prsiser treptat, unul cte unul. nainte s-i dea seama ce se ntmpl, doar Miyashita mai rmsese lng el. Miyashita avea totdeauna o glum n tolb, indiferent ct de melancolic era Ando. tia cum s gseasc un motiv de veselie n orice nenorocire, indiferent a cui. Singurele momente cnd Ando reuea s se scuture ct de ct de tristee erau cele petrecute n compania lui Miyashita. De-acum, Ando tia ce l
93

deosebete pe Miyashita de ceilali prieteni ai lui: n vreme ce toi ncercau s-l nveseleasc, Miyashita venea la el s se distreze. Nu exist cuvinte mai lipsite de sens dect nu mai fi trist. Singura cale de a nveseli un om este s-l ajui s uite, iar ndemnul nu mai fi trist are exact efectul contrar, aducndu-i aminte persoanei respective din ce cauz este de fapt trist. Ando tia foarte bine c n ultimul an nu arborase niciodat o expresie senin. ncercase s-i imagineze, obiectiv, cum arta el din punctul de vedere al lui Mai. Foarte sumbru, fr ndoial. Nu era de mirare c fata n-avea niciun chef s ia masa cu el. Ar fi adncit-o i mai mult n depresie. n schimb, aceste gnduri l-au deprimat pe el. Cu un an i jumtate n urm era plin de ncredere. Viitorul se ntindea naintea lui, larg deschis i doldora de promisiuni. Avea o soie care l iubea i un copil frumos, un apartament elegant n Aoyama Sud, un BMW cu scaune mbrcate n piele i perspectiva de a ocupa curnd funcia de administrator-ef. i dduse seama prea trziu c toate posesiunile erau trecute pe numele soiei sau al tatlui ei, i fusese de-ajuns o simpl ntorstur a destinului ca s rmn cu minile goale. Miyashita nc mai discuta cu profesorul Yasukawa. n lips de ceva mai bun de fcut, Ando se uita fr prea mare atenie prin sal. A vzut trei telefoane publice. A scos din portofel cartela telefonic i s-a ndreptat spre ele, cu intenia s-i telefoneze nc o dat lui Mai. innd receptorul ntre brbie i umr, s-a ntors s se mai uite o dat la Miyashita. Dac se rtcea de prietenul lui i nu mai ajungea la edina de alcoolizare, btuse degeaba drumul pn acolo. Miyashita era vioara nti aici. Atta vreme ct Ando se inea de el, nu era n pericol s rmn singur. A lsat telefonul s sune de opt ori, apoi a nchis i s-a uitat ntr-o doar la ceas. Aproape nou. Trecuser trei ore de cnd trebuiau s se ntlneasc i Mai nc nu se ntorsese acas. M ntreb unde s-a dus. ncepuse s fie foarte ngrijorat.
94

Miyashita tocmai se nclina adnc n faa lui Yasukawa. Discuia lor prea s se fi ncheiat. Dup ce prietenul lui s-a ndeprtat de profesor, Ando a pornit spre el. Hei, mi pare ru c te-am fcut s atepi. Tonul lui era extrem de amical, opusul celui pe care-l folosise cnd vorbise cu Yasukawa. Nu-i nimic. Miyashita a scos un bileel din buzunar i i l-a ntins lui Ando. Aici mergem. Cred c tii locul, e n Sectorul trei. Vrei s-mi faci o favoare i s-o iei nainte? Trebuie s nchei socoteala aici. I-a fcut un semn de rmas-bun cu mna i s-a ntors s plece, dar Ando l-a apucat de cot. Stai o clip. Da? Ce-ai vrut s-mi spui? Aluzia lui Miyashita de mai devreme l scise fr ncetare. Miyashita i-a lins buzele. Mncaser friptur de vit i voia s se bucure i de ultimele picturi de grsime. Cnd a deschis gura s vorbeasc, buzele lui roii strluceau. Am gsit ceva. Ce? Un virus. Un virus? Am primit un telefon azi dup-amiaz de la Universitatea Yokodai. i aduci aminte de putii crora li s-a fcut autopsia acolo? Cei care au fcut infarct n main n acelai timp? Da. Ei bine, chestia e c au gsit un virus n esuturile atacate. La amndoi. Ce fel de virus? Miyashita s-a ncruntat i a pufnit. N-o s-i vin s crezi, dar seamn ca dou picturi de ap cu virusul variolei. Ando a rmas mut de uimire.
95

Seko a nimerit la fix diagnosticul. N-a trebuit s fac altceva dect s examineze ulceraiile faringelui, i gata variola. De necrezut, a mormit Ando. Ai dreptate. Dar am o presimire c o s gsim acelai virus i n probele lui Ryuji. Atunci n-o s mai ai ncotro i o s fii obligat s m crezi. Faa lui Miyashita era i mai roie dect n mod obinuit, poate din cauz c buse. Prea aproape bucuros. Poate c, din punctul de vedere al unui medic, descoperirea unui virus necunoscut era mai degrab un prilej de srbtoare dect de ngrijorare. Dar nu i din punctul de vedere al lui Ando. Mintea lui fcuse deja un salt nainte i se concentrase asupra lui Mai. Faptul c nu rspundea la telefon l ngrijora foarte tare. Dispariia ei i descoperirea virusului care semna cu virusul variolei preau s aib o legtur oarecare. Presimea c toate astea nu vor duce la nimic bun. Poate c ceea ce i s-a ntmplat lui Ryuji i se ntmpl acum i lui Mai. Poate s-a ntmplat deja. Sala de ntruniri a hotelului rsuna de hrmlaia brbailor cu chef. Undeva, n haosul sonor, s-a auzit rsul unui copil. Un copil aici, la ora asta? s-a ntrebat Ando, uitndu-se n jur. Dar nu l-a vzut.

96

2
Miercuri, 14 noiembrie. Ando s-a dus n campusul principal, la Facultatea de Filosofie, pentru a-i ntreba pe profesorii lui Mai dac fata fusese la ore n ultima vreme. Toi i-au spus acelai lucru: n-o mai vzuser de o sptmn. Cum era una dintre puinele studente din facultate, ieea n eviden ca o floare pe pajite. Cnd nu venea la cursuri, toat lumea i remarca absena. nc de vinerea trecut, Ando o sunase de dou-trei ori pe zi, dar nimeni nu ridicase receptorul. i venea greu s cread c rmsese la vreun prieten atta timp, iar rezultatul escapadei lui la facultate i confirmase temerile. La un moment dat i-a trecut prin minte c fata plecase acas, aa c s-a dus la secretariat. I-a explicat funcionarei situaia i i s-a permis s arunce o privire n fia lui Mai. A descoperit c oraul natal al fetei se numea Toyoda i se afla n regiunea Iwata din Prefectura Shizuoka. Era la dou-trei ore distan de Tokio cu trenul de mare vitez. Ando i-a notat mai nti n agend numrul de telefon, apoi i adresa, pentru orice eventualitate. n aceeai sear, imediat dup ce s-a ntors acas, a pus mna pe telefon. I-a rspuns mama lui Mai. Dup ce i-a explicat cine era i ce dorea, a auzit la cellalt capt al firului o exclamaie nbuit. Femeia intrase n panic, doar vorbea cu cineva de la Facultatea de Medicin a universitii unde nva fiica ei. i un telefon de la facultatea fetei ar fi fost alarmant, dar unul de la un medic nu putea avea alt motiv dect c Mai se mbolnvise grav. Probabil c se pregtea sufletete pentru vestea cea rea. Toi studenii aveau dreptul la controale medicale gratuite la spitalul universitii, aa c
97

Mai n-ar fi avut de ce s-o anune pe mama ei c vrea s-i fac un control. Dar femeia nu reuea s neleag de ce i telefonase Ando. Vorbea cu fiica ei cel puin de dou-trei ori pe lun. E drept, nu mai avea veti de la Mai cam de trei sptmni. Cnd i telefonase sptmna trecut, se ntmplase ca ea s nu fie acas. Dar nu putea pricepe de ce un doctor de la universitate ar fi luat legtura cu prinii ei din cauz c nu o mai vzuse pe fat de o sptmn. Ando a reuit fr prea mare greutate s disting suspiciunea din glasul femeii, care i cntrea fiecare cuvnt. Spunei c fiica dumneavoastr nu era acas cnd i-ai telefonat sptmna trecut. Ando s-a ncruntat. Spera s afle c acum o sptmn fata plecase pur i simplu acas. Se pregtise pentru un moment uor penibil, dar acum optimismul lui, i aa moderat, dispruse cu desvrire. Mai nu era acas nici cnd mama ei o sunase cu dou sptmni n urm. Sunt sigur c nu e nimic serios, domnule doctor. i anul trecut s-a ntmplat la un moment dat s nu reuim s vorbim la telefon cu ea. Au trecut aproape dou luni pn cnd am gsit-o. Ando era nervos. Orict de tare s-ar fi strduit, tot nu era n stare s gseasc o explicaie. Nu mai departe de ieri gsiser n biopsiile lui Ryuji acelai virus care fusese descoperit n sngele celor doi copii care muriser n Yokohama. Dar nu reuiser s stabileasc nici cum se transmite virusul de la o persoan la alta, nici cum ajunge dintr-un loc n altul. n funcie de ceea ce aveau s afle, poate c era mai bine ca adevrul s nu ajung n ziare. Nu putea s-i spun nici mamei lui Mai ce se ntmplase n realitate. Scuzai-m c v ntreb, dar fiica dumneavoastr are obiceiul s-i petreac nopile n alt parte? Nu, n mod sigur nu, i-a rspuns ferm femeia. V mai amintii n ce zi i-ai telefonat sptmna trecut? Femeia s-a gndit cteva clipe, apoi i-a spus:
98

Mari. Vaszic nc de mari nu rspundea la telefon. i azi era miercuri. Mai mult de o sptmn. E posibil s fi plecat ntr-o excursie? Nu, nu cred. Ando s-a ntrebat cum putea fi att de sigur. De ce nu? S-a angajat preparator cu jumtate de norm ca s-i acopere cheltuielile zilnice. Ne-a spus c nu vrea s fie o povar pentru noi. Sunt convins c nu are destui bani s plece undeva. Deodat, Ando a fost absolut sigur c Mai avea mari necazuri. Vinerea trecut, fata nu apruse la ntlnire. El nu era nici pe departe un tip dificil. Dac nu voia s vin la ntlnire, ar fi fost deajuns s-i dea un telefon cu o zi nainte i s-i spun asta. Dar nu-l sunase. Iar acum era aproape sigur c tie de ce. Nu putea s ia legtura cu el. i-a amintit fotografiile cadavrului lui Ryuji. Orict de tare ncerca, nu reuea s-i tearg din minte imaginea trupului cu membrele ntinse, aa cum l surprinsese moartea. Era gravat adnc n memoria lui. Credei c ai putea veni mine pn la Tokio? n timp ce rostea aceste cuvinte, Ando s-a nclinat, dei era perfect contient c vorbete cu ea la telefon. Nu, nu pot s vin. Dac m-ai fi anunat mai din timp Femeia a oftat, apoi a tcut. Ando i-a dat seama c nu se putea atepta de la ea s neleag urgena real a situaiei atta vreme ct nu-i ddea toate informaiile. Pe de alt parte, nu prea s fie prea ngrijorat de aceast poveste. Ando ar fi vrut s-i spun ct de uor pierzi pe cineva drag. Cum n clipa asta i auzi glasul, apoi te ntorci i vezi c a disprut. Doamna Takano a rupt n cele din urm tcerea stnjenitoare: Dac vin la Tokio, ce ai vrea s fac? S dau o declaraie c a disprut? A vrea s aruncai o privire prin camera ei. O s vin cu
99

dumneavoastr. Vom vedea apoi ce facem mai departe. Dar nu credea sincer c vor ajunge s-i declare dispariia. Din pcate, nu era genul acela de caz. Nu tiu Chiar trebuie s vin? Nu reuea s se hotrasc. Ce putea fi att de important nct s-o mpiedice s vin i poate s-o gseasc pe fiica ei moart? Ando nu mai avea cum s-o menajeze. Bine, atunci. Am s m duc singur pn acolo, mine. Am neles c locuiete ntr-o garsonier. tii cumva dac blocul are un administrator? Da, are. L-am cunoscut cnd am ajutat-o s se mute. Bine, atunci. mi pare ru c v deranjez n continuare, dar ai putea s-i dai un telefon i s-i spunei c Mitsuo Ando va veni mine dup-amiaz, ntre dou i trei, i c ar vrea s arunce o privire n garsonier? n prezena lui, bineneles. Pi V rog. Nu cred c mi-ar da cheia dac m-a duce acolo neanunat. Bine. O s-l sun i o s aranjez cu el. Mulumesc. V anun dac aflu ceva nou. Era gata s nchid, dar mama fetei l-a oprit: Stai puin! Ando a ateptat. Salutai-o pe Mai din partea mea dac v ntlnii cu ea. Nu nelege. Cnd a pus receptorul n furc, n-ar fi putut s spun care i erau sentimentele.

100

3
Garsoniera lui Mai se afla doar la cteva staii de metrou deprtare i nici nu trebuia s schimbe trenul. A ieit de pe peron, apoi din staie i a nceput s caute blocul, cu o hart ntr-o mn i agenda n cealalt. A vzut n faa lui, pe trotuar, o feti mbrcat cu un kimono portocaliu, nsoit de prinii ei. i-a amintit c azi era festivalul tradiional Shichi Go San, 7-5-3, o srbtoare pentru bieii ntre trei i cinci ani i fetele ntre trei i apte. Cnd a ajuns din urm i a depit grupul care mergea naintea lui, s-a uitat o clip la faa fetiei. Prea prea mare pentru un copil de apte ani, avea trsturi excesiv de bine conturate. Dar costumul ei festiv strlucea vesel n lumina blnd a dup-amiezii. I s-a prut incredibil de drgu, aa cum se cltina pe strad n sandalele de lac cu care nu era obinuit, agat de mna mamei sale. Chiar i dup ce a trecut, Ando a continuat s arunce din cnd n cnd o privire peste umr, gndindu-se c n cincisprezece ani fetia va fi la fel de frumoas ca Mai. n cele din urm a gsit blocul cu apte etaje vizavi de o galerie comercial. Adresa se potrivea cu cea pe care i-o notase n agend. Faada era drgu, dar i-a dat seama de la prima privire c apartamentele erau foarte mici. Antreprenorul reuea s menin chiria la un nivel acceptabil doar nghesuind ct mai muli oameni n cldire. A intrat, s-a dus la ghieul administratorului i a apsat pe butonul soneriei. A vzut pe geam un brbat ieind dintr-o camer din spate. Era destul de btrn. A deschis uia ghieului i Ando i-a spus cine este.
101

A, da. Mama domnioarei Takano m-a anunat c o s venii. A ieit din birou, fluturnd o legtur voluminoas de chei. V rmn ndatorat, a zis Ando. Nu, eu trebuie s v mulumesc. Mi-e team c n ultima vreme fata asta a avut necazuri. Ando nu avea cum s ghiceasc ce-i spusese doamna Takano administratorului, aa c n-a tiut ce s-i rspund. S-ar putea, a zis el i l-a urmat. n drumul ctre lift au trecut pe lng cutiile potale. ntr-una se vedeau cteva ziare. Bnuind c era cutia lui Mai, Ando s-a apropiat i s-a uitat mai atent. Aa cum i nchipuise, pe ui scria Takano. Erau patru rnduri de cutii potale, iar a ei era pe rndul de sus. Ea domnioarei Takano. Rareori ajunge aa. Ando a tras ziarele din cutie ca s verifice datele. Cel mai vechi era o ediie de diminea de joi, 8 noiembrie. De atunci trecuser apte zile. n concluzie, Mai i ridicase ultima dat corespondena acum o sptmn. Poate c dormise n alt parte, dei era greu de crezut. Nu, era sus, n garsonier. Pur i simplu nu reuise s coboare pn la parter. Toate indiciile confirmau aceast ipotez. Administratorul i-a ntrerupt irul gndurilor: Bun, suntei pregtit? Tonul lui lsa s se neleag c nu s-ar fi mirat dac Ando ar fi dat napoi. Da, haidei s mergem. Adunndu-i toate rezervele de curaj, Ando l-a urmat pe brbat n lift. Garsoniera lui Mai era la etajul trei i avea numrul 303. Administratorul a scos din buzunar legtura de chei, a ales una i a bgat-o n broasc. Ando a fcut fr s vrea un pas napoi. Ar fi trebuit s iau o pereche de mnui chirurgicale. Virusul care provocase moartea lui
102

Ryuji probabil nu se rspndea pe cale aerian. Bnuia c era ceva asemntor cu virusul SIDA, destul de greu transmisibil. Totui, un risc exista i ar fi trebuit s-i ia msuri de precauie. E drept, nu se aga cu disperare de via, dar nici nu voia s moar acum. Cel puin nu nainte de a descifra misterul. Ecourile clinchetului metalic al broatei au ricoat ntre pereii coridorului. Ando a mai fcut un pas n spate, dar s-a concentrat asupra simului olfactiv, ncercnd s-i dea seama ce se afla n spatele uii. Cunotea prea bine duhoarea morii. Era jumtatea lui noiembrie i toamna fusese destul de secetoas, dar un cadavru n descompunere ar fi mirosit puternic. S-a pregtit sufletete, pn cnd a fost sigur c era capabil s suporte ocul, s suporte indiferent ce ar fi descoperit nuntru chiar i ce se atepta s gseasc. Ua s-a deschis civa centimetri. Din garsonier a ieit un curent de aer care s-a destrmat pe coridor. Probabil c fereastra era deschis. Ando primise adierea drept n fa i acum respira cu grij, numai pe nas. Nu simea mirosul inconfundabil al morii. A inspirat i a expirat de cteva ori. Nici urm de miros de putreziciune. Sentimentul de uurare a fost att de puternic, nct sa cltinat pe picioare i s-a sprijinit cu o mn de perete pentru a-i pstra echilibrul. Dup dumneavoastr, l-a invitat administratorul, care se oprise n pragul uii. Din punctul acela putea s vad toat garsoniera. Nici mcar nu trebuia s se uite n jur. Fata nu era acolo, prin urmare presentimentul lui se dovedise fals. S-a relaxat i a oftat adnc. i-a scos pantofii, a trecut pe lng administrator i a intrat n camer. Unde s-o fi dus? a mormit brbatul n spatele lui. L-a nvluit o melancolie adnc, stranie. Ar fi trebuit s se simt uurat c nu gsise ce se atepta s gseasc, dar inima lui continua s bat nebunete. n camer era o atmosfer ciudat, i nu reuea
103

s-i dea seama de ce. N-a mai fost aici de o sptmn. Era singura concluzie raional. Unde o fi acum? Trebuia s afle dac rspunsul la aceast nou ntrebare, inevitabil, l atepta undeva n camer. Baia, miniatural, era chiar lng intrare. A ntredeschis ua i s-a asigurat c nu era nimeni nuntru, apoi s-a ntors s studieze camera mare. Se vedea bine c fata ncerca s utilizeze ct mai eficient spaiul limitat. ntr-un col sttea mpturit cu grij un futon. Nu era suficient loc pentru un pat, nici mcar pentru un dulap, n adevratul neles al cuvntului, n care s fi pus salteaua. Pe post de birou folosea o msu joas, sub care fixase un radiator electric. Pe msu erau rsfirate pagini de manuscris. O foaie de hrtie mpturit servea drept suport pentru cana cu cafea i o cutie cu lapte. Biblioteca acoperea un perete ntreg, iar ntre cri era nghesuit o combin TV-video. Toate celelalte aparate erau aranjate n aa fel nct lsau impresia c fuseser concepute special pentru spaiul acela strmt, ceea ce dovedea cu ct grij alesese Mai lucrurile pe care le cumprase pentru garsoniera ei minuscul. n faa mesei se afla un scuna cam ubred, cu sptar reglabil, acoperit cu o pnz pe care erau imprimai pinguini. Pijamaua, mpturit cu mare grij, era aezat pe scaun. Lng ea, un sutien i un dres. Poate c m simt aa din cauz c sunt n casa unei femei tinere? Ando ncerca s-i dea seama de ce era nelinitit. Simea o greutate n piept i pulsul i se accelerase. Vznd lenjeria intim, se ntrebase o clip dac nu cumva se excita ca un adolescent. Ce credei, domnule doctor? Administratorul rmsese la u. Nu fcuse niciun pas nuntru, nici mcar nu-i scosese pantofii. Cum era evident c fata nu se afla acolo, ajunsese la concluzia c i terminaser treaba i era timpul s plece. n loc s-i rspund, Ando a intrat n chicinet. Pe jos era parchet,
104

dar dintr-un motiv sau altul i se prea c pete pe un covor gros. S-a uitat n sus: un neon de zece wai rmsese aprins. Nu l observase imediat, pentru c interiorul era scldat n lumina soarelui de dup-amiaz. n chiuvet erau dou pahare. A rsucit robinetul i, dup un timp, apa s-a nclzit. A tras de firul care atrna sub neon i a ieit din buctrioar. Cnd lumina s-a stins, sa nfiorat din cap pn-n picioare. Nimic din ce vzuse pn atunci nu-i oferise vreun indiciu despre soarta lui Mai. Vrei s mergem? a zis, fr s se uite la administrator. i-a pus pantofii i a ieit din garsonier. A auzit cheia rsucindu-se n broasc n spatele lui. i-a ncheiat ireturile, s-a ridicat i a pornit spre lift fr s-l mai atepte pe brbat. Stnd n faa liftului, i-a amintit brusc o autopsie pe care o fcuse vara trecut. O femeie tnr care fusese strangulat n drum spre cas. Murise de unsprezece ore, dar dup ce o tiase constatase uimit c organele ei aveau temperatura aproape normal. Cnd un om moare, temperatura corpului su scade n medie cu un grad pe or. Bineneles, e doar o medie care depinde de o multitudine de factori, de exemplu temperatura mediului ambiant i locaia. Chiar aa fiind, se ntmpla extrem de rar ca trupul s rmn cald la unsprezece ore dup moarte. Liftul ajunsese la trei i uile au nceput s se deschid. Stai o clip, a zis Ando. Nu voia s plece atta vreme ct nc mai avea dubii. Nelinitea, cnd intrase n garsoniera lui Mai. Senzaia ciudat c podeaua de lemn se lsa sub greutatea lui, ca i cum ar fi clcat pe asfalt topit. Atmosfera stranie din camera aceea putea fi descris ntr-un singur fel: parc deschisese cadavrul femeii care murise de unsprezece ore i constatase c nc mai era cald. Uile ascensorului s-au deschis complet, dar Ando a rmas pe loc. Nici administratorul nu putea s se urce n lift, pentru c el i bloca accesul.
105

Nu vrei s mergem? Ando i-a rspuns cu alt ntrebare: Suntei sigur c n-a fost aici n ultima sptmn? Uile s-au nchis i liftul a nceput s coboare. Dac ar fi fost, atunci n-am fi venit aici, nu-i aa? Omul n-o vzuse. Lipsise i de la cursuri, n ciuda faptului c pn atunci avusese o frecven de aproape sut la sut. Nu-i rspunsese la telefon, dei o sunase de nenumrate ori. Cutia ei potal era plin cu ziarele din ultima sptmn. Era clar c lipsea de joia trecut. i totui, ceva nu era n regul cu garsoniera ei Nu aveai senzaia c e o cas n care n-a mai clcat nimeni de o sptmn ncoace. Interiorul era cald, dar asta nu avea nicio legtur cu temperatura. Plutea ceva n aer care te ndemna s crezi c acolo se aflase cineva cu o clip mai devreme. Vreau s m mai uit o dat, a zis Ando, ntorcndu-se cu faa la administrator. Brbatul a fost mai nti surprins, apoi tulburat i apoi, o clip, nspimntat. Expresia lui nu i-a scpat lui Ando. Btrnul se teme de ceva. Administratorul i-a ntins inelul cu chei i i-a spus: Lsai-le n biroul meu cnd terminai. S-a uitat la Ando ca i cum ar fi vrut s adauge: Dac vrei s v ducei iar acolo, suntei invitatul meu, dar nu contai pe mine. Ando ar fi vrut s-l ntrebe ce prere are despre garsoniera fetei, dar probabil c omul n-ar fi tiut ce s-i rspund, chiar dac ar fi insistat. Senzaia aceea nu putea fi prea uor exprimat n cuvinte. Nici el nu era sigur c ar fi fost n stare s explice ce simise nuntru. Mulumesc, aa o s fac, a spus, lund cheile i rsucindu-se pe clcie. i era team c i-ar pierde curajul dac ar ezita chiar numai o clip. n orice caz, era hotrt s plece de-acolo imediat dup ce va pricepe de ce i se prea totul att de ciudat. A deschis ua. i prea ru c nu o lsase deschis cnd intrase
106

prima dat, dar se nchisese singur cnd luase mna de pe clan. n clipa urmtoare curentul de aer dispruse. S-a desclat iar i s-a dus la fereastr. A nchis-o i a tras pn la capt perdeaua de dantel. Trecuse de trei dup-amiaza i fereastra ddea spre sud. Razele soarelui bteau direct nuntru. nvluit n lumin, Ando s-a ntors i a studiat iar camera. Decorul nu era n niciun caz tipic feminin, dei n mod sigur nu era nici masculin. Dac n-ar fi vzut imprimeul cu pinguini, n-ar fi putut s ghiceasc sexul locatarului. S-a aezat pe jos i a luat de pe scunel lenjeria lui Mai. A ridicat sutienul i dresul aproape de nas i le-a mirosit. A ntins braul, apoi le-a apropiat din nou. Miroseau a lapte. Scutecele lui Takanori miroseau aa. A pus lenjeria la loc i s-a rsucit pn cnd a vzut combina TV. n partea ei de jos strlucea un punct rou: videorecorderul era aprins. A apsat pe eject i a aprut o caset. Pe cotor era lipit o etichet cu titlul: Liza Minelli, Frank Sinatra, Sammy Davis Jr. /1989. Titlul era scris cu litere groase, cam neregulate, cu o carioca neagr. Nu prea scrisul unei femei. A luat caseta i a examinat-o. Banda fusese rulat la loc. Dup ce a ntors-o pe toate feele, a pus-o la loc n combin. Nu uitase c incidentele aveau o oarecare legtur cu o caset video. Povestea despre Asakawa pe care o auzise de la Mai, faptul c n clipa accidentului ziaristul avea n main un videorecorder. Ando a apsat pe play. Timp de dou sau trei secunde, ecranul a fost parc inundat de o cerneal amestecat cu un lichid mai vscos. Apoi, n centrul vrtejului negru a aprut un punct strlucitor. Punctul a clipit, micndu-se ntr-o parte i-n alta, i a nceput s creasc. O fraciune de secund, dar foarte distinct, Ando a avut o senzaie neplcut. Apoi, chiar cnd punctul ncepuse s se transforme n altceva, a nceput o reclam. i-a amintit c o mai vzuse de cteva ori. Contrastul dintre bezna de mai devreme i banalitatea luminoas de
107

acum era uluitor. A simit c muchii umerilor i se relaxeaz. A urmat alt reclam, i nc una. A derulat banda nainte i a vzut numai reclame. Apoi prognoza meteo. O femeie zmbitoare arta ceva pe o hart meteorologic. A apsat iar pe fast-forward i a ajuns la ceea ce prea s fie un talk-show matinal. Scena s-a schimbat iar: un reporter care se uita drept n obiectivul camerei de luat vederi vorbea n microfon despre o vedet care tocmai divorase. A continuat s apese pe fast-forward, dar n-a gsit nimic care s corespund titlului de pe etichet. Probabil c nregistrarea iniial fusese tears. n timp ce se uita la programele de televiziune, Ando ncepuse s se relaxeze. Bineneles, nu se atepta s vad cntrei americani, ci altceva, mult mai nspimnttor. Totui, cu excepia primelor cteva secunde, nimic nu dovedea c temerea lui fusese ntemeiat: pe caset erau nregistrate fragmente din cele mai banale programe de televiziune. Talk-show-ul s-a terminat i a urmat un film vechi cu samurai. Ando a oprit aparatul i a rulat banda napoi. Voia s mai vad o dat partea cu prognoza meteo. A gsit primul cadru i a apsat pe play. Femeia tocmai spunea: Iar acum s vedem cum va fi vremea mari, 13 noiembrie. A apsat pe pause i imaginea a ngheat. Treisprezece noiembrie? Azi era 15, ceea ce nsemna c nregistrarea fusese fcut alaltieri. Dar cine apsase pe record? A fost Mai aici acum dou zile, de diminea? Atunci care era explicaia pentru cutia potal plin de ziare? Uitase pur i simplu s le ia? Sau poate A deschis panoul frontal de comand al videorecorderului i a ncercat s-i dea seama dac aparatul fusese programat. Poate c acum o sptmn, nainte s plece, Mai programase aparatul s nregistreze o emisiune n dimineaa zilei de 13. n aceeai clip a auzit ceva. Prea s fie zgomotul slab al unei
108

picturi de ap care cade. Fr s se ridice, Ando s-a rsucit pn a putut s vad chiuveta din chicinet. Dar robinetul nu curgea. S-a ridicat n picioare i a aruncat o privire n baie. Ua era ntredeschis, exact aa cum fusese i ultima dat cnd o verificase. A aprins lumina i a ncercat s deschid ua. Se deschidea doar pe jumtate, o bloca toaleta. S-a aplecat prin deschiztura ngust i a vzut o cad exact att de mare ct s poat sta cineva n ea cu genunchii la gur. O perdea de plastic atrna n ea. A tras perdeaua i s-a uitat n cad. Picturile cdeau din tavan. Pe fundul czii se adunase ap. n timp ce se uita a czut alt pictur, fcnd cerculee la suprafa. Apa era adnc de vreo zece centimetri, iar la un capt al czii se formase un mic vrtej. Pe ap pluteau fire de pr. Cteva s-au ncurcat n timp ce se nvrteau deasupra scurgerii. Ando s-a strecurat n baie i s-a aplecat pn cnd a ajuns cu capul n cad. Scurgerea era o gaur neagr i rotund, adic dopul fusese scos. N-a neles imediat semnificaia acestui fapt. Conducta era nfundat cu spun, cu pr sau altceva, i apa nu se mai scurgea cum trebuie. Dar, privind mai atent, a vzut c nivelul scdea totui, dar foarte ncet. n cele din urm, i-a dat seama c trebuia s se ntrebe cine scosese dopul czii. n niciun caz administratorul. Nu clcase n camer. Nici mcar nu-i scosese pantofii. Atunci cine? Ando a mai fcut un pas nainte i s-a ghemuit. A ntins mna, ezitant, i a atins suprafaa apei. Era cldu. Cteva fire de pr i sau nfurat n jurul degetelor. Se simea ca arunci ca atunci cnd i bga minile ntr-un cadavru vechi de unsprezece ore i constata c temperatura nu-i sczuse prea mult. Dup toate probabilitile, apartamentul rmsese gol o sptmn. Dar, cu nicio or n urm, cineva umpluse cada cu ap fierbinte i, nu de mult, scosese dopul. Fereastra era deschis pentru ca baia s se aeriseasc.
109

i-a tras repede mna i i-a ters-o de pantaloni. A observat o pat maronie de cealalt parte a closetului, chiar sub sulul de hrtie igienic. Nu erau materii fecale, prea mai degrab vom. Materia, acoperit cu o pelicul subire, i amintea de aspectul hranei nedigerate. Un obiect roiatic, de form cubic poate o bucic de morcov? Ea a vomitat aici? Ando se sprijinea pe un picior, dar ca s poat examina mai bine locul trebuia s se aplece mult. S-a aplecat, ns i-a pierdut echilibrul. A czut i s-a trezit cu faa lipit de marginea closetului. Porelanul de culoare crem era rece, i Ando i-a imaginat fr s vrea expresia pe care o avea n clipa aceea. I s-a prut c aude un chicotit n spatele lui. i-a nbuit un strigt i a rmas ncremenit n poziia aceea caraghioas. Nu fusese doar o nchipuire. Auzise distinct rsul, n spatele lui, ntr-un punct destul de apropiat de podea. Mai bine zis, ca i cum pornise din podea, ca o plant care crete din pmnt i, n loc s nfloreasc, izbucnete n rs. i-a ncordat muchii i i-a inut rsuflarea. He, he. Da! Acelai rs. Nu avea halucinaii. Era absolut sigur c n spatele lui se afl cineva. Dar nu putea s mite un deget, cu att mai puin s se ntoarc i s se uite. Nu reuea s se hotrasc ce s fac. Cu faa nc lipit de porelanul rece, a reuit n cele din urm s deschid gura, dar n-a ieit dect o ntrebare stupid: Dumneavoastr suntei, domnule administrator? Nu putea s-i stpneasc tremurul din glas. I s-a prut c simte un curent uor de aer pe piciorul care-i rmsese afar din baie. Acolo se mica ceva. Acum. Acel ceva i atingea poriunea de piele dezgolit dintre maneta pantalonului i partea de sus a ciorapului, care-i czuse pn la glezn. L-a atins n trecere, apoi s-a ndeprtat, lsnd n urm doar amintirea atingerii uoare. Jumtatea inferioar a
110

corpului su s-a nfiorat i Ando a ipat. A ncercat s-i spun c nu era nimic neobinuit, c o pisic rmas prizonier n camer i linsese piciorul. Doar att. Dar n-a mers. Toate cele cinci simuri i spuneau c fusese altceva. Ceva necunoscut care se ascundea n spatele su. Faa lui era sub marginea czii, aa c nu putea vedea nuntru, dar auzea zgomotul apei care se scurgea pe conduct i un sunet slab de suciune n timp ce apa trecea prin gaura de scurgere, ducnd cu ea prul risipit prin cad. Dar sunetul a fost acoperit de scritul parchetului. Scritul se deprta de el. N-a mai reuit s se stpneasc. i-a ridicat glasul i a ipat. A lovit de mai multe ori ua bii cu genunchiul i chiar a tras apa la closet. Hrmlaia pe care o provocase i-a dat n cele din urm curaj s se ridice n picioare. Sprijinindu-se n mini pentru a-i menine echilibrul, s-a ridicat pn cnd a ajuns aproape drept, apoi s-a oprit s verifice dac se mai auzea vreun zgomot n spatele lui. A ncercat disperat s gseasc o cale de a iei din camer fr s fie obligat s se ntoarc. I se ridicase prul de pe ceaf i mii de pianjeni i alergau pe spate. S-a dat napoi centimetru cu centimetru, pipind cu clciele ca s fie sigur c nu era nimic acolo, apoi s-a rsucit brusc, a apucat clana i s-a npustit pe coridor. S-a lovit cu umrul de perete, dar a simit durerea abia dup ce ua s-a nchis complet. Respirnd ntretiat, a pornit spre lift. Cheile pe care i le dduse administratorul zdrngneau n buzunar. Slav Cerului c nu le lsase nuntru. Era absolut sigur c nu ar mai fi fost n stare vreodat s intre acolo. i era convins c nuntru se afla ceva, chiar dac i amintea perfect fiecare detaliu din camera aceea i tia c nu exista niciun colior n care s-ar fi putut ascunde ceva. Futonul era strns i rulat cu grij. Dulapul ncastrat n perete nu era nici destul de lat, nici destul de adnc. Nu exista niciun loc unde s-ar fi putut ascunde o fiin vie. Poate doar una foarte mic. Un nar ntrziat i-a bzit pe la ureche. A ncercat s-l alunge,
111

dar se tot ntorcea. A tuit slab i i-a ndesat minile n buzunare. Deodat i s-a fcut frig. Atepta liftul de o venicie. n cele din urm i-a ridicat nerbdtor privirea i a vzut c ascensorul se afla tot la parter. Uitase s apese pe buton. A apsat de dou sau de trei ori la rnd, ca s fie sigur, apoi i-a bgat iar minile n buzunare.

112

4
Hei, ce s-a ntmplat? Ando i-a dat seama c mintea lui o luase razna abia cnd a auzit glasul lui Miyashita. Senzaiile de acum dou ore se transformaser ntr-un val seismic amenintor, gata-gata s-i scoat contiina din rdcini. S-a mpotrivit din rsputeri i efortul i-a fost rspltit cu un fior. Monologul frenetic al lui Miyashita ajungea la creierul lui cu intermitene. M asculi mcar? Miyashita prea enervat. Da, te ascult, i-a rspuns Ando, dar expresia lui dovedea c era cu gndul aiurea. Dac te roade ceva, poate ar fi cazul s-mi spui ce anume. Miyashita a tras un taburet de sub mas, i-a trntit picioarele pe el i s-a lsat pe spate. Era un simplu musafir n biroul lui Ando, dar se purta de parc ar fi fost stpnul locului. n clipa aceea, Ando i colegul lui erau singuri n laboratorul de Medicin Legal. nc nu se fcuse ase, dar afar era deja ntuneric. Dup experiena tulburtoare din garsoniera lui Mai, Ando venise direct la birou ca s stea de vorb cu Miyashita. Drept urmare, nu avusese rgaz s-i recapete echilibrul. Iar Miyashita nu turuia dect despre virus. Nu, nu m roade nimic. Nu avea de gnd s-i spun lui Miyashita ce pise acas la Mai. n primul rnd, nu ar fi gsit cuvintele potrivite pentru a-i descrie ce se ntmplase acolo. Nu-i venea n minte nicio comparaie elocvent. Poate doar senzaia pe care o ai uneori noaptea, cnd te duci la baie, i tii c n spatele tu pndete cineva. Sau c, odat ce le-ai simit prezena, montrii din imaginaia ta cresc fr ncetare, pn cnd i iei inima n dini i te ntorci, iar iluzia se spulber.
113

Dar Ando nu trise o asemenea experien banal. Cnd i pierduse echilibrul n baia din garsonier i rmsese nemicat, cu obrazul lipit de closet, n spatele lui se afla ceva. n mod sigur. Nu fusese rodul imaginaiei sale. Ceva emisese sunetul acela ca un rs ascuit. Ceva care-l nspimntase att de tare tocmai pe el, care n mod obinuit nu era un la , nct nici mcar nu fusese n stare s se ntoarc. Eti cam palid, totui. Vreau s zic, mai palid dect n mod normal, a spus Miyashita, tergndu-i ochelarii cu halatul. n ultima vreme n-am dormit prea bine, asta-i tot. i nu minea. De ctva timp ncoace se trezea n toiul nopii i reuea cu greu s adoarm la loc. Bine, n-are importan, dar nu-mi mai pune ntruna aceleai ntrebri. Nimnui nu-i place s fie ntrerupt. Scuz-m. Bun, pot s continui? Te rog. i spuneam de virusul gsit n cadavrele de la Yokohama Cel care seamn cu virusul variolei, a precizat Ando. Exact. Adic are caracteristici exterioare asemntoare cu virusul variolei? Miyashita a izbit cu pumnul n mas i i-a aruncat lui Ando o privire exasperat. Uite c nu m-ai ascultat. Doar i-am spus: au fcut o separare de ADN ca s-i analizeze bazele, apoi au introdus rezultatele n calculator. S-a dovedit c se apropie mult de informaiile despre variol din baza de date. Dar nu e identic? Nu. Vorbim despre o suprapunere de aptezeci la sut. i restul de treizeci la sut? Pregtete-te s auzi una bun: e identic cu secvena de baz a genei care codific enzimele.
114

Enzimele? Ale crei specii? Homo sapiens. Glumeti. Da, sunt de acord c pare incredibil, dar sta-i adevrul. i mai exist un specimen din acelai virus care conine genele proteinelor umane. Cu alte cuvinte, acest nou virus e alctuit din gene de variol i gene umane. Virusul variolei este un virus ADN. Dac ar fi un retrovirus, nu sar mira nimeni c nglobeaz gene umane. Un asemenea virus ar avea enzime de transcripie invers. Dar, din moment ce viruii ADN nu le au, cum ajunsese acesta s ia gene umane i s le ncorporeze? Ando nu reuea s gseasc nicio explicaie plauzibil. Iar dac un virus conine enzime i altul proteine, nseamn c amndoi au gene umane, dar n componente separate. Ca i cum ai desface corpul omenesc n sute de mii de fragmente i ai distribui fiecare prticic unui virus, pentru a fi pstrat n condiii de siguran. Virusul din cadavrul lui Ryuji e acelai? n sfrit am ajuns i la asta. Chiar ieri am gsit un virus aproape identic ntr-o prob congelat din sngele lui Ryuji. Alt combinaie variol-om? Am spus aproape. A, bine. E aproape identic, dar, ntr-un anumit segment, exist o repetare a aceleiai secvene de baz. Ando a ateptat ca Miyashita s continue, ceea ce s-a i ntmplat: Indiferent unde l-am secionat, de fiecare dat am obinut repetiia acelorai patruzeci i ceva de baze. Ando habar n-avea cum s interpreteze aceast informaie. M urmreti? n schimb, n-au gsit aa ceva n probele luate din cadavrele de la Yokohama. Vrei s spui c virusul din ele este uor diferit de cel care l-a ucis pe Ryuji?
115

Exact. Viruii par la fel, dar sunt oarecum diferii. Bineneles, abia dup ce primim rezultatele de laborator de la celelalte universiti vom putea spune mai multe. n clipa urmtoare a sunat telefonul, care se afla pe alt birou. Miyashita a mormit o njurtur. Acum ce mai e? Scuz-m o clip, te rog. Ando s-a aplecat i a ridicat receptorul. Alo? Bun ziua, sunt Yoshino de la Daily News. l caut pe doctorul Ando. La telefon. Dar Yoshino nu s-a mulumit cu att: Suntei doctorul Ando, lector n Medicin Legal? Da, da. Am neles c pe douzeci luna trecut ai fcut la Institutul de Medicin Legal din Tokio autopsia unui anume Ryuji Takayama. Aa este? Da, eu am condus autopsia. neleg. Cu permisiunea dumneavoastr, a vrea s v pun cteva ntrebri despre asta. Ai fi de acord s ne ntlnim? Hm. n timp ce Ando se gndea ce s-i spun, Miyashita s-a aplecat spre el i i-a optit la ureche: Cine e? nainte s-i rspund, Ando a acoperit receptorul cu mna. Un ziarist de la Daily News. Apoi a descoperit repede receptorul i a ntrebat: Despre ce e vorba? A vrea s aflu prerea dumneavoastr despre o serie de incidente. Modul n care se exprimase jurnalistul l-a luat pe Ando prin surprindere. Oare presa deja mirosise ceva? Era prea devreme pentru asta. Pn i laboratoarele universitare n care se fcuser autopsiile abia ncepeau s descopere o legtur ntre cazurile de
116

deces din ultimele dou sptmni. La ce incidente v referii? Ando se hotrse s fac pe netiutorul ca s afle ct de mult tia Yoshino. M refer la moartea misterioas a lui Ryuji Takayama, Tomoko Oishi, Haruko Tsuji, Shuichi Iwata i Takehiko Nomi. Plus Shizu Asakawa i fiica ei. Ando avea senzaia c-l lovise cineva cu o bt n cretetul capului. Cum naiba transpiraser informaiile? Nu tia ce s-i rspund ziaristului. Ce zicei, domnule doctor? Credei c avei timp s ne ntlnim? Ando i chinuia mintea. Informaiile curg totdeauna la vale, dac se poate spune aa, de la cei care au mai multe la cei care au mai puine. Dac ziaristul avea mai multe informaii dect el, atunci era cazul s ncerce s le obin. Nu era obligat s-i arate toate crile. Trebuia numai s afle ce voia, dar fr s-i dezvluie secretele. Bine, s ne ntlnim. Unde ar fi mai convenabil pentru dumneavoastr? Ando i-a luat agenda i i-a verificat programul pe zilele urmtoare. Presupun c dorii s ne vedem ct mai repede. Mine e bine? Am dou ore libere imediat dup prnz. A urmat o pauz, ct timp Yoshino i-a verificat i el agenda. Da, e perfect. O s vin la dumneavoastr la dousprezece fix. Au nchis telefoanele n acelai timp. Ce-a fost asta? a ntrebat Miyashita trgndu-l pe Ando de mnec. Un reporter de la un ziar. Ce vrea? S se ntlneasc cu mine. De ce? A zis c vrea s-mi pun cteva ntrebri. Hm.
117

Miyashita a oftat i a czut pe gnduri. Mi-a lsat impresia c tie tot. i ce nseamn asta? C a trncnit cineva? Cred c va trebui s-l ntreb asta mine, cnd ne ntlnim. Bine, dar s nu-i spui nimic. tiu. Mai ales c e vorba despre un virus. Asta dac nu tie deja. Deodat, Ando i-a amintit c Asakawa lucrase i el la trustul de pres care publica ziarul Daily News. Dac el i Yoshino se cunoteau, probabil c Yoshino tia destul de multe. Poate c mine va obine informaii interesante. Deja nu mai reuea s-i in n fru curiozitatea.

118

5
Yoshino tot ntindea mna dup paharul cu ap. Prea c vrea sl apuce, dar n loc s-l ridice de pe mas, se uita la ceas. Prea ngrijorat. Poate mai avea o ntlnire, imediat dup asta. Scuzai-m o clip, v rog. Yoshino s-a nclinat i s-a ridicat de pe scaun. Fcnd slalom printre mesele de pe terasa cafenelei, s-a oprit la telefonul public de lng bar. n timp ce ziaristul se uita n agend i ncepea s apese tastele telefonului, Ando a reuit n sfrit s se liniteasc. S-a lsat pe spate i s-a sprijinit de sptarul scaunului. Cu un ceas n urm, la dousprezece fix, Yoshino i fcuse apariia n biroul lui de la universitate. Ando l dusese la o cafenea din dreptul staiei de metrou. Cartea de vizit a lui Yoshino se afla i acum n faa lui, pe mas. Kenzo Yoshino. Daily News, Yokosuka. i venea greu s cread ce-i spusese Yoshino. Ameeala nu-i trecuse nici acum. Yoshino intrase n cafenea, se aezase i se lansase ntr-un monolog care sdise adnc n mintea lui Ando seminele ndoielii. Iar acum plecase s telefoneze cine tie cui. Potrivit lui Yoshino, toat povestea ncepuse n noaptea de 29 august, ntr-un complex de cabane al companiei turistice Pacific Land din Hakone, undeva n nordul peninsulei Izu. Patru tineri, doi biei i dou fete care petrecuser o noapte n cabana B-4, gsiser o caset video pe care o femeie nregistrase ceva prin telepatie. Toi cei care vzuser nregistrarea muriser la exact o sptmn dup vizionare. Ce naiba! Degeaba nvrtise Ando n minte de nenumrate ori povestea asta, tot i se prea o aberaie. E probabil ceva asemntor cu
119

psihofotografia, i spusese Yoshino, ca i cum asta ar fi fost o explicaie. Proiectarea mental a unor imagini pe band magnetic? Oricum ai fi luat-o, era pur i simplu imposibil. i totui S presupunem c el, Ando, ar spune cuiva c gsise dou numere pe o bucic de hrtie care apruse din cadavrul lui Ryuji. Sau ar descrie ntmplrile stranii din garsoniera lui Mai. Astea n-ar fi tot aberaii? E imposibil s percepi n acelai fel o experien pe care ai trit-o direct i una pe care i-a povestit-o cineva. Cea de-a doua nu va fi niciodat la fel de real ca prima. Dar Yoshino fusese direct implicat, iar ceea ce-i spusese avea ntr-o oarecare msur girul experienelor pe care le trise chiar Ando. Povestea lui Yoshino nu era chiar att de lipsit de credibilitate. mi pare ru c v-am fcut s ateptai, a zis Yoshino, aezndu-se din nou pe scaun. A scris repede ceva n agend, apoi i-a mpuns obrazul neras cu vrful pixului. i lsase o barb aspr, lung i deas, ca i cum ar fi ncercat s compenseze astfel nceputul de chelie din cretetul capului. Bun, unde rmseserm? S-a aplecat n fa, apropiindu-i de Ando faa acoperit de barba slbatic. Cnd vorbea, avea o anumit carism. mi spuneai cum a ajuns Ryuji s fie implicat n treaba asta. A, da. Dar acum, dac nu v suprai, v-a ntreba n ce relaii erai cu rposatul profesor. Am fost colegi de facultate. n regul, aa tiam i eu. Ando a interpretat remarca lui Yoshino ca pe o dovad c ziaristul l verificase nainte de ntlnire. Pentru c tot a venit vorba, domnule Yoshino, ai vzut i dumneavoastr nregistrarea? Probabil c glumii, zise Yoshino, fcnd ochii mari. Dac a fi vzut-o, v-ai fi ntlnit cu mine pe masa de autopsie. Nu, n-am avut curaj.
120

Yoshino a chicotit. Bineneles, Ando bnuia de ctva timp ncoace c misterioasa caset video era implicat ntr-un fel sau altul n incidente. Dar nici n cele mai fanteziste nchipuiri ale sale n-ar fi suspectat existena unei nregistrri video care i ucide, dup exact o sptmn, pe toi cei care o vd. nc nu putea crede aa ceva. i cum ar fi putut? Nu era capabil s accepte aceast explicaie nainte s vad el nsui caseta. Chiar aa fiind, probabil c nu ar accepta cu adevrat realitatea dect o sptmn mai trziu, cnd s-ar afla n pragul morii. Yoshino i sorbea pe ndelete cafeaua, care ntre timp se rcise. Pesemne c i schimbase programul, pentru c gesturile lui nu mai erau febrile. Atunci de ce n-a murit i Asakawa? A vzut i el nregistrarea, nu-i aa? n glasul lui Ando se strecurase un accent de batjocur. Asakawa era n com, dar n via. Asta nu prea se potrivea cu povestea lui Yoshino. Da, aici ai pus punctul pe i. Exact asta m deranjeaz i pe mine, a zis Yoshino, aplecndu-se iar n fa. Presupun c cel mai bun lucru pe care l-a putea face ar fi s-l ntreb chiar pe el, dar am ncercat i n-am obinut nimic. Yoshino se dusese la spitalul din Shinagawa, dar nici el nu reuise s comunice cu Asakawa. Apoi ziaristul a tresrit, de parc i venise o idee. Poate c a nceput el, dar s-a oprit imediat, uimit. Poate c? Cred c tii despre ce vorbesc. Dac am reui s facem rost de ea Ce anume? Asakawa lucreaz la sptmnalul nostru de tiri. Ando nu pricepea ncotro btea Yoshino. tiu.
121

Bun, la un moment dat mi-a spus c pregtea un dosar amnunit despre toat chestia asta. La nceput a fost vorba doar de curiozitate i de bnuiala c totul s-ar putea transforma ntr-o poveste pentru prima pagin. A fcut echip cu Takayama i s-au dus amndoi la Atami, apoi pe insula Oshima, n sperana c vor gsi un indiciu care s lmureasc misterul casetei. i cred c au descoperit ceva. A pune pariu pe orice c a scris tot i c exist undeva o dischet cu povestea asta. Yoshino i-a ntors capul i Ando s-a trezit c-i privete profilul. Aha, am neles. Yoshino s-a ntors iar ctre Ando, dar acum trsturile lui exprimau amrciune. Din pcate nu tiu unde ar putea fi. N-am gsit-o n apartamentul lui Asakawa. Dup ce a rostit ultimele cuvinte, privirea lui s-a pierdut n gol. Asakawa zcea ntr-un spital, soia i fetia lui muriser. n apartamentul lui nu mai locuia nimeni. Ce voia Yoshino s spun, sprsese oare ua i scotocise prin cas? n apartamentul lui? Da, m rog, administratorul blocului e un btrnel uor de dus de nas. A fost de-ajuns s inventez pretextul potrivit: a descuiat cu cheia lui i m-a lsat nuntru. ngrijorat de absena lui Mai, Ando fcuse acelai lucru cu o zi nainte, aa c nu avea niciun drept s critice comportamentul lui Yoshino. Poate c motivele lor erau diferite, dar, n ultim instan, amndoi fcuser acelai lucru: scotociser casa n absena proprietarului. n orice caz, Yoshino nu prea deloc ruinat, ci doar enervat. Am cutat n fiecare colior. N-am gsit nimic, nici calculatorul, nici discheta. Un picior i tresalt involuntar i energic, dovad a strii lui de nervozitate. i-a dat seama i i-a pus mna pe genunchi, aruncndu-i lui Ando un zmbet jenat.
122

Ando a revzut n minte fotografiile fcute la locul accidentului lui Asakawa. i amintise c una arta interiorul mainii vzut de la fereastra oferului. Aparatul pe care l identificase drept un videorecorder se afla pe locul pasagerului, ascuns sub sptarul scaunului, mult aplecat n fa. Pe jos, tot n partea pasagerului, se vedea ceva ce prea un laptop. Cele dou obiecte negre i produseser lui Ando o impresie puternic. i uite c acum i ddeau o idee. i-a ntors capul, prefcndu-se c se uit la mulimea care se scurgea afar din staie ca o maree uman, dar n realitate ncercnd disperat s gndeasc limpede. Ando i-a dat seama c tia unde s gseasc materialul care i-ar fi explicat tot misterul. Degeaba cutase Yoshino cu cea mai mare atenie n apartamentul lui Asakawa, calculatorul i discheta naveau cum s fie acolo. Yoshino nu tia c Asakawa le luase cu el n ultima lui cltorie, habar n-avea c se aflau n main n clipa accidentului. Acum era destul de sigur c va reui s pun mna pe discheta n cauz, dar nu avea de gnd s-i mprteasc lui Yoshino aceast informaie. Abia dup ce va citi raportul lui Asakawa se va hotr dac era cazul s dezvluie ceva presei sau nu. n clipa asta nu tia cu certitudine dect un singur lucru, i anume c n toate cele apte cadavre fusese gsit un virus asemntor cu virusul variolei, ns nu erau pregtii nc s anune public descoperirea. De fapt, abia ncepeau s adune o echip de cercetare format n special din oameni de la Shuwa i Yokodai. Dac ar implica mass-media n stadiul de fa, ar risca s declaneze o panic de proporii. Erau datori s acioneze ct mai prudent, pentru a fi siguri c lucrurile nu scap de sub control. n timpul rmas pn la sfritul ntlnirii, Yoshino i-a pus lui Ando o mulime de ntrebri, toate previzibile. Care a fost rezultatul autopsiilor? Care era, dup prerea lui, cauza deceselor? Se potrivea ceva din povestea lui cu rezultatele autopsiilor? n timp ce bifa ntrebrile, reporterul aproape c nu-i ridicase privirea din agend.
123

Ando a ncercat s rspund ct mai politicos i mai plauzibil cu putin. Dar, n tot acest timp, gndurile lui zburau n alt direcie. Avea nevoie de dischet, urgent. Ce trebuia s fac pentru a pune mna pe ea?

124

6
A doua zi, smbt. Dup ce a terminat dou autopsii, Ando l-a luat deoparte pe poliistul care se afla acolo n calitate de martor i la ntrebat ce se ntmpl de obicei cu mainile implicate n accidente. De exemplu, unde ajunge o main distrus ntr-un accident produs lng ieirea Oi de pe Autostrada Metropolitan a Golfului? Pi, mai nti, mainile sunt cercetate, i-a rspuns poliistul, un tnr care purta ochelari i avea un aer demn de ncredere. Ando l mai vzuse de cteva ori pn atunci, dar nu vorbise niciodat cu el. i mai departe? Le returnm proprietarilor. Dar dac e o main nchiriat? O trimitem napoi la agenie, evident. Bine. n maina despre care vorbesc eu erau trei persoane, soul, soia i fiica. Locuiesc locuiau ntr-un apartament din Shinagawa. Femeia i fetia au murit n accident, iar brbatul e n stare grav. Ce se ntmpl cu lucrurile din main n cazul sta? Sunt pstrate o vreme la biroul poliiei rutiere din secia local. Dac accidentul s-a produs lng Oi, pe Autostrada Metropolitan, n jurisdicia crei secii intr? Ieirea Oi? Da, exact. Lng ieire. Nu, ce vreau eu s zic e dac s-a ntmplat pe autostrad sau n afara ei? Sunt jurisdicii diferite. Ando a revzut iar n minte fotografiile de la locul accidentului. Era aproape sigur c se ntmplase pe autostrad. Parc i amintea c i citise undeva n dosar meniunea Intrarea n Tunelul Portului
125

din Tokio. n mod sigur pe autostrad. Atunci e treaba patrulei rutiere a Autostrzii Metropolitane. Ando auzea prima dat numele acesta. Unde e secia? n Shintomi. Bine. Deci obiectele sunt pstrate acolo temporar. Ce se ntmpl n continuare? Vor lua legtura cu un membru al familiei i-l vor chema s le ia. S presupunem, aa cum am spus, c toi membrii familiei au decedat. Chiar i rudele, i prinii brbatului? Ando nu tia nimic despre rudele i prinii lui Asakawa. Judecnd dup vrsta ziaristului, erau anse mari ca prinii lui s fie nc n via. Prin urmare, nu putea exclude posibilitatea ca lucrurile s fie deja n posesia lor. Asakawa i Ryuji fuseser colegi de liceu. Din moment ce prinii lui Ryuji locuiau n Sagami Ohno, probabil c i prinii lui Asakawa se aflau n aceeai zon. n orice caz, primul lucru pe care trebuia s-l fac era s dea de urma lor i s vorbeasc cu ei. neleg. Mulumesc mult. Ando s-a desprit de poliist i s-a apucat imediat s-i caute pe prinii lui Asakawa. A aflat c triau amndoi i c locuiau n cartierul Kurihara din Zama, nu departe de Sagami Ohno. Le-a telefonat imediat i i-a ntrebat ce se ntmplase cu lucrurile din maina fiului lor. Tatl lui Asakawa i-a spus, cu o voce tremurtoare, s vorbeasc cu fiul lui cel mare, care locuia la Tokio, n Kanda. S-a dovedit astfel c Asakawa, mai bine zis Kazuyuki, era cel mai mic dintre cei trei frai. Fratele mai mare lucra la departamentul de albume de art al uneia dintre cele mai importante edituri din ar, Shotoku, iar cel mijlociu era profesor de japonez la un liceu. Ando a aflat c tatl lui
126

Asakawa primise un telefon de la poliie i fusese invitat s ia lucrurile gsite n main i pstrate la secie, dar n loc s fac personal drumul pn acolo, preferase s-l trimit pe fiul lui. Acesta locuia nu departe de Shintomi, unde se afla sediul patrulei rutiere, iar btrnul nu se simea n stare la vrsta lui peste aptezeci de ani s care un videorecorder i un calculator atta drum pn acas. n aceast situaie, urmtoarea micare a lui Ando era s vorbeasc cu Junichiro Asakawa, care locuia mpreun cu soia lui ntr-un apartament din Kanda. Cnd a reuit n cele din urm s-l gseasc, abia seara, Ando a procedat fr ocoliuri i i-a spus adevrul, sau cel puin o bun parte din el. Dac i-ar fi ndrugat lui Junichiro o minciun cusut cu a alb sau ar fi inventat un scenariu fantezist, ar fi riscat s nu mai obin niciodat discheta. Pe de alt parte, nici nu putea s repete cuvnt cu cuvnt povestea pe care o auzise de la Yoshino. Nici mcar el nu credea mare parte din ea, iar Junichiro l-ar fi considerat fr ndoial nebun. A scurtat-o, deci, aa cum i s-a prut mai potrivit, i a sfrit prin a sublinia c era posibil ca Asakawa s fi lsat un document scris care putea arunca o raz de lumin asupra evenimentelor. Vorbind n numele Institutului Medico-Legal, i-a mai spus lui Junichiro c dorea foarte mult s obin acel document i se ntreba dac i-ar permite s fac o copie, v rog foarte mult i mulumesc frumos. Nu cred c exist aa ceva printre lucrurile pe care le-am primit. Junichiro nu prea prea convins. Tonul lui nesigur i-a dovedit lui Ando c nu se uitase prea atent la obiectele din main. Dar exist printre ele un laptop, nu-i aa? Sigur, ns m tem c s-a stricat. Era cumva o dischet n el? S fiu sincer, n-am verificat. Nici mcar nu l-am scos din cutia de carton n care mi l-au dat. Ai primit i un videorecorder mpreun cu calculatorul?
127

Da, dar l-am aruncat. Am greit cumva? Lui Ando i se tiase rsuflarea. L-ai aruncat? neleg de ce cra dup el un calculator, asta i era meseria, dar de ce i un video? Scuzai-m, ai spus c l-ai aruncat? Da, nu mai era bun de nimic. Am aranjat cu gunoierii s vin ieri s ia un televizor vechi, aa c le-am dat i videorecorderul cu aceeai ocazie. Nu mai putea fi reparat. Oricum, m ndoiesc c asta l-ar deranja pe Kazuyuki. Ando fusese la un pas s pun mna pe cele dou lucruri la care rvnea, iar acum afla c unul dintre ele dispruse. Exista o ans serioas ca misterioasa caset cheia tuturor evenimentelor s se afle nc n aparat, iar el sperase c, ajutat de noroc, va reui s o obin odat cu discheta. i venea s-i trag palme c nu vorbise mai devreme cu Junichiro. n afar de aparat, nu cumva mai era acolo i o caset video? a ntrebat Ando, rostind n gnd o rugciune scurt. Nu tiu. N-am vzut dect calculatorul, videorecorderul i dou geni sport din piele n care sunt, pesemne, lucrurile lui Shizu i Yoko. Nu le-am deschis. Ando s-a asigurat c Junichiro pricepuse cum stteau lucrurile, cu alte cuvinte c trebuia s vad ct mai repede obiectele. Ai fi de acord s v fac o vizit? Da, nicio problem, zise Junichiro surprinztor de repede. Mine e bine? Era duminic. S vedem Joc o partid de golf cu unul dintre autorii mei, dar ar trebui s fiu acas pe la apte. Bine atunci, apte s fie. Ando a scris ora n agend i a subliniat-o de cteva ori. n seara zilei de duminic, la apte i cteva minute, Ando s-a
128

oprit la ua apartamentului lui Junichiro din zona Sarugaku a cartierului Kanda. mprejurimile nu aveau un aer rezidenial: blocul lui Junichiro era nconjurat de cldiri cu birouri. Pe strad plutea o linite ciudat pentru o sear de duminic. Ando a apsat pe butonul soneriei i a auzit n spatele uii vocea unui brbat: Cine e? Ando. Am vorbit ieri la telefon. Ua s-a deschis imediat i a fost invitat nuntru. Junichiro era mbrcat ntr-un tricou i avea prul ud. Pesemne c abia se ntorsese de pe terenul de golf i tocmai fcuse un du. Judecnd dup vocea pe care o auzise la telefon, Ando se atepta s vad un brbat nalt i nervos, dar, n realitate, Junichiro era scund i solid i arbora o expresie cordial. n timp ce gazda l conducea prin apartament, Ando s-a gndit c toi fraii cel mai n vrst editor, cel mijlociu profesor de japonez i cel mic ziarist la un mare trust de tiri i aleseser meserii n care aveau de-a face zi de zi cu limba, cu scrisul. Probabil c fratele cel mare avusese o oarecare influen asupra celorlali. Ando nsui ajunsese s studieze medicina urmnd exemplul fratelui su mai mare, profesor de biologie la un liceu. Junichiro s-a oprit la un dulap de pe hol i a scos din el o cutie mare din carton, n care erau nghesuite laptopul i cele dou geni de voiaj. Astea sunt. Vrei s v uitai la ele? Junichiro s-a aezat pe jos i a mpins cutia spre Ando. Mulumesc, da. Ando a scos mai nti calculatorul i s-a aplecat ca s poat vedea ce model era. Carcasa aparatului suferise mult n urma accidentului. Capacul nu se mai deschidea, iar butonul de pornire era nepenit. inndu-l vertical pe genunchi, Ando a observat pe o latur butonul unitii floppy. S-a uitat n fant i a vzut o dischet albastr. Cnd a apsat pe eject, i-a stpnit cu greu un strigt de bucurie.
129

Aparatul a emis un clic care lui i-a sunat mai mult ca un bingo!. A scos discheta i a inut-o n palm cteva clipe, ntorcnd-o pe toate prile. Nu avea etichet, deci nu-i oferea niciun indiciu cu privire la coninut, dar Ando a tiut din prima clip c gsise n sfrit ce cuta. Cnd ieise din fanta aparatului, discheta sunase aa cum trebuia. Ardea de nerbdare s citeasc raportul lui Asakawa, aa c i-a spus imediat lui Junichiro: A vrea s verific discheta. Mi-e team c modelul sta nu e compatibil cu al meu. Junichiro nu putea s deschid discheta cu calculatorul lui. n cazul acesta, ai fi de acord s-mi mprumutai discheta dou-trei zile? N-am nimic mpotriv, dar V-o napoiez imediat cum termin. Bine, dar ce-i att de important pe discheta asta? Junichiro se molipsise de entuziasmul lui Ando i acum era curios. Nu tiu sigur, a zis Ando, cltinnd din cap. A vrea s mi-o dai napoi ct mai repede posibil. Acum Junichiro voia i el s vad ce era pe dischet. Poate c i se treziser reflexele de editor. Ando a pus discheta n buzunarul sacoului. Simea o mare uurare, dar i o nou dorin imperioas. Sacoele de voiaj tia c era zadarnic, dar nu putea s nu spere c misterioasa caset se afla ntr-una din ele. Ar fi prea mult dac v-a ruga s-mi permitei s m uit i aici? ncercase s-i aleag cuvintele cu grij, oarecum jenat de perspectiva de a cotrobi prin lucrurile unei femei. Nu cred c vei gsi ceva n geni. Junichiro a rs, dar i-a dat sacoele una cte una. Cnd Ando le-a deschis, sperana lui i aa palid s-a spulberat imediat. n ambele geni erau doar haine i scutece de unic folosin, nici pe
130

departe ce cuta el. Aa cum se temuse, n momentul accidentului caseta se afla n videorecorder. Reuise totui s gseasc discheta i trebuia s considere asta un mare succes. Cnd i-a luat rmas-bun, trepida de nerbdare. Avea de gnd s caute la birou un aparat care putea s deschid discheta. Abia atepta s citeasc raportul lui Asakawa.

131

7
Ando i-a vrt capul pe ua Departamentului de Patologie ca s vad dac Miyashita era acolo, dar colegul lui l-a invitat nuntru nainte s apuce s deschid gura. Hei, chiar omul pe care voiam s-l vd. Spune-mi ce prere ai despre asta. Miyashita inea un print ntr-o mn i cu cealalt i tot fcea semn s se apropie. Lng el sttea Nemoto, un asistent de la laboratorul de biochimie. Nemoto i Miyashita semnau att de tare, nct toi cei care-i vedeau mpreun se abineau cu greu s rd. ncepnd cu nlimea i cu greutatea sub unu aizeci i cinci i cel puin nouzeci de kilograme , continund cu lungimea picioarelor, circumferina taliei i trsturile feelor i terminnd cu gusturile vestimentare i glasurile, erau la fel de diferii ca dou boabe de mazre. Ia te uit, n-am tiut c ai un frate, a repetat Ando gluma pe care o fcea de fiecare dat cnd i vedea. Te rog, domnule doctor, nu m pune n aceeai categorie cu individul sta, i-a rspuns Nemoto, strmbndu-se. Dar nu era nici pe departe o jignire s i se spun c semna cu colegul lui, care era cu doi ani mai mare. n fond, Miyashita avea succes att datorit personalitii, ct i culturii sale tiinifice, i era trecut pe lista candidailor pentru postul de profesor plin. Toi ne spun c artm la fel, drag Nemoto. Trebuie s-i mrturisesc c ncepe s fie o remarc neplcut. De ce nu ii cur de slbire? Miyashita l-a lovit n glum cu cotul n burt. Pi, dac ncep s in cur de slbire, va trebui s ii i tu.
132

Atunci ne-am ntoarce de unde-am plecat. Apoi Miyashita i-a dat lui Ando hrtia pe care o inea n mn, artnd astfel c ritualul de glume rsuflate se ncheiase. Ando a ntins printul pe un birou i i-a fost de-ajuns o singur privire ca s priceap despre ce era vorba. Erau rezultatele analizei secveniale a unei probe de ADN. Pe planeta noastr, viaa e reprezentat de organisme uni sau pluricelulare. Celulele conin ADN sau, n anumite cazuri, ARN. Nucleele celulelor conin, la rndul lor compui moleculari numii acizi nucleici. Exist dou tipuri de acizi nucleici: ADN acidul dezoxiribonucleic i ARN acidul ribonucleic. Acetia au roluri diferite. ADN-ul, compusul n care este stocat informaia genetic prin intermediul cromozomilor, seamn cu dou benzi lungi care se mpletesc ntr-o spiral o form cunoscut ca dubla elice. n aceast structur dubl e nscris toat informaia genetic a unei forme de via. Iar aceast informaie poate fi privit ca un set de planuri pentru construirea proteinelor specializate. Fiecare gen este un plan separat. Cu alte cuvinte, genele i ADN-ul nu sunt acelai lucru. O gen este o unitate de informaie. Mai precis, ce anume conin aceste planuri? Literele care le codific corespund unor substane chimice cunoscute drept baze: adenina (A), guanina (G), citozina (C) i timina (T) sau, n cazul ARN-ului, uracilul (U). Aceste patru baze lucreaz n grupuri de cte trei numite codoni, care codific aminoacizii. De exemplu, codonul AAC formeaz asparagina, codonul GCA alanina, i aa mai departe. Proteinele, conglomerate formate din sute de molecule de aminoacizi, sunt de douzeci de tipuri. Asta nseamn c planul pentru o protein trebuie s conin un ir de baze n numr egal cu numrul moleculelor de aminoacizi nmulit cu trei. Planul numit gen poate fi comparat, n mare, cu un lung ir de litere care arat cam aa: TCT-CTATACCAGTTGGAAAATTAT n traducere, asta nseamn o serie de aminoacizi: TCT (serin sau
133

Ser), CTA (leusin sau Leu), TAC (tirozin sau Tyr), CAG (glutamin, Gln), TTG (leusin, Leu), GAA (acid glutamic, Glu), AAT (asparagin, Asn), TAT (tirozin, Tyr) etc. Ando s-a uitat din nou la codurile bazelor care acopereau hrtia. Cele patru litere A, T, G i C preau distribuite ntmpltor pe suprafaa paginii. Anumite segmente de trei rnduri erau marcate i sreau n ochi. Ce-i asta? Miyashita i-a fcut cu ochiul lui Nemoto, ca i cnd i-ar fi zis: Spune-i tu. E analiza segmentului de ADN prelevat din virusul gsit n sngele lui Ryuji. Bine, tiu. Dar ce este? Am gsit o secven destul de stranie de baze, o chestie pe care am observat-o doar la virusul lui Ryuji. i asta ai marcat aici? Corect. Ando s-a uitat mai atent la prima serie de litere nsemnate. ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCA ACAACAA S-a uitat apoi la urmtoarea poriune subliniat i a comparat-o cu prima. i-a dat seama c era exact aceeai secven. O secven care aprea de dou ori ntr-un grup de nicio mie de baze.

134

Deasupra, ntre poziia 535 i 576, apoi din nou ntre 815 i 856 se putea observa repetarea celor 42 de baze: ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA Diagrama de compoziie a aminoacizilor ADN
a doua baz prima baz T T Phe Phe Leu Leu Leu Leu Leu Leu lie lie lie Met C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr A Tyr Tyr stop stop His His Gin Gin Asn Asn Lys Lys G Cys Cys stop Trp Arg Arg Arg Arg Ser Ser Arg Ar a treia baz T C A G T C A G T C A G

135

Val Val Val Val

Ala Ala Ala Ala

Asp Asp Glu Glu

Gly Gly Gly Gly

T C A G

Tripleii de baze (codonii) sunt convertii n aminoacizi potrivit principiilor ilustrate n diagrama de mai sus. De exemplu, TET este serina (Ser), AAT este asparagina (Asn), GAA este acidul glutamic (Glu). Stop nseamn sfritul unei gene. Codul de nceput este ATG. Mai jos sunt abrevierile i denumirile complete ale celor douzeci i doi de aminoacizi:

Phe Leu Ile Met Val Ser Pro Thr Ala Tyr

fenilanin leucin izoleucin metionin valin serin prolin treonin alanin tirozin

His Gln Asn Lys Asp Glu Cys Trp Arg Gly

histidin glutamin asparagina lizin acid aspartic acid glutamic cistein triptofan arginin glicin

Ando i-a ridicat privirea i s-a uitat la Nemoto. Indiferent cum l segmentm, obinem mereu aceeai secven. Cte sunt aici? Baze, adic? Da. Patruzeci i dou. Patruzeci i dou. Deci paisprezece codoni, nu-i aa? Nu sunt
136

prea muli. Ne-am gndit c nseamn ceva, a zis Nemoto cltinnd din cap. Dar cel mai straniu aspect, doctore Ando Miyashita l-a ntrerupt: Repetiia asta lipsit de sens a fost gsit numai n virusul din sngele lui Ryuji Takayama, nu i la celelalte victime. i-a ridicat minile, ntr-un gest care voia s exprime perplexitate. Cu alte cuvinte Ando a ncercat s gseasc analogia potrivit. S presupunem c trei persoane una dintre ele fiind Ryuji au cte un exemplar din Regele Lear de Shakespeare. S mai presupunem c exemplarul lui Ryuji i doar al lui conine iruri ininteligibile de litere nghesuite printre rnduri. Sunt patruzeci i dou de baze care funcioneaz n grupuri de cte trei, iar fiecare grup corespunde unui aminoacid. Dac alocm fiecrui grup o liter, obinem serii de paisprezece litere. i aceste paisprezece litere care se repet se gsesc n fiecare pagin a piesei de teatru, poziionate la ntmplare. Dac tii de la bun nceput c ai n fa Regele Lear, poi s porneti de la nceputul piesei, s gseti fragmentele fr sens inserate n text i s le marchezi unul cte unul. Bun, ce prere ai? Miyashita prea sincer interesat s afle opinia lui Ando. Era un om de tiin adevrat, nsufleindu-se imediat cnd era confruntat cu inexplicabilul. Ce cred eu? C ar trebui s aflu mai multe nainte s-i dau un rspuns. O vreme au tcut toi trei, uitndu-se unul la altul. Ando, care nc mai inea mna pe foaia de hrtie, nu se simea deloc n largul lui. Ceva nu-i ddea pace. Pentru a afla ce anume, avea nevoie de timp i de linite, trebuia s se aeze la birou i s studieze irul acela de baze lipsit de sens. Avea mai mult dect o presimire, avea aproape certitudinea c acolo se ascunde ceva important. Marea
137

ntrebare era Ce?. Iar dac secvena bizar de baze fusese ntradevr introdus acolo, cnd se ntmplase asta? Virusul care invadase corpul lui Ryuji era pur i simplu diferit sau suferise o mutaie n purttor, iar irul de paisprezece codoni care aprea ici i colo era chiar rezultatul acelei mutaii? S fie oare posibil? i dac da, ce semnificaie ar fi putut avea asta? Se aternuse o tcere greu de suportat. n stadiul acesta, orict de mult ar fi speculat pe marginea problemei, tot n-ar fi reuit s interpreteze noile informaii. n cele din urm, Miyashita a rupt tcerea: Apropo, ai venit aici cu un anumit scop? Ando era att de intrigat de noua descoperire, nct uitase pur i simplu motivul iniial al vizitei sale. Ai dreptate, am uitat. A deschis servieta, a scos agenda i le-a artat lui Miyashita i Nemoto ce scrisese n ea. M intereseaz dac are cineva de-aici un laptop de tipul sta. Miyashita i Nemoto au citit numele modelului pe care-l notase Ando. Era destul de banal. Trebuie neaprat s fie acelai model? Atta vreme ct e aceeai marc, modelul nu are prea mare importan. n principiu e o problem de compatibilitate ntre dischete. Adic fiierele nu sunt salvate n MS-DOS? Nu prea cred. Nemoto a btut din palme, ca i cum i-ar fi amintit ceva. Stai puin, un tip din departamentul meu Ueda, dac nu m nel are exact acelai model. Crezi c ar accepta s mi-l mprumute puin? a ntrebat Ando, nesigur. Nu-l cunotea personal pe Ueda. Nu vd de ce nu. Abia a terminat facultatea. Nemoto vorbise cu ncrederea omului aflat ntr-o poziie ierarhic superioar, care e convins c un proaspt rezident are
138

datoria s fac orice i-ar cere. Mulumesc. Pentru puin. Dar de ce s nu rezolvm problema chiar acum? Cred c Ueda e aici. Cuvintele lui sunaser n urechile lui Ando ca o muzic dulce. Abia atepta s afle ce era pe dischet. Perfect, hai s mergem. Ando a pus discheta la loc, n buzunarul hainei, apoi i-a fcut cu mna un semn de rmas-bun lui Miyashita i a ieit din birou n urma lui Nemoto.

139

8
Ando i Nemoto mergeau cot la cot pe coridorul luminat cu zgrcenie al Facultii de Medicin. Ando nu-i ncheiase halatul de laborator, ale crui poale fluturau n spate ca dou aripi. i inea minile n buzunare, i n dreapta strngea discheta. Nici Miyashita, nici Nemoto nu-l ntrebaser ceva despre ea. Nu ncerca n mod deliberat s pstreze secretul. Dac Miyashita l-ar fi ntrebat, i-ar fi spus adevrul. Fr ndoial c ar fi czut amndoi n genunchi la picioarele lui dac ar fi tiut c acolo se afla, foarte probabil, cheia misterului. Sigur, Ando nc nu tia ce conine discheta. Nu era exclus s gseasc n ea cu totul altceva dect se atepta, dar nu putea s afle asta dect n clipa n care i vedea coninutul afiat pe un monitor. Cu toate acestea, avea senzaia c era discheta potrivit: o simea cald, i asta nu avea nicio legtur cu faptul c o inuse atta timp n buzunar. Simpla ei atingere parc l asigura c acolo sunt cuvinte vii. Nemoto a deschis ua laboratorului de biochimie. Ando a scos discheta din buzunar i a trecut-o n mna stng, apoi a inut ua cu dreapta. Hei, Ueda. Nemoto l-a salutat cu un gest pe un tnr usciv care se afla ntrun col al laboratorului. Da? Ueda s-a rsucit cu scaunul spre Nemoto, dar nu s-a ridicat. Zmbind, Nemoto s-a apropiat de el i i-a pus mna pe umr. Ai nevoie de calculator n clipa asta? Nu prea. Nu.
140

Perfect. Te superi dac doctorul Ando l mprumut puin? Ueda s-a uitat n sus la Ando i s-a nclinat: Bun ziua. mi pare ru c te deranjez. Am o dischet i nu pot s-o citesc pe calculatorul meu. Ando s-a apropiat de Nemoto, innd discheta n mna ridicat. V rog s-l luai chiar acum, a spus Ueda, ridicnd de pe jos laptopul i aezndu-l pe birou. Te superi dac ncerc chiar acum, pentru mai mult siguran? Deloc. Ando a deschis aparatul i l-a pornit. Dup cteva clipe, pe monitor a aprut meniul de deschidere. A selectat DOCUMENTE din lista de opiuni i pe urmtorul ecran au rmas dou variante: DOCUMENT NOU i DESCHIDE DOCUMENT. Ando a mutat cursorul pe a doua opiune i a apsat pe Enter. Aparatul a nceput s zumzie i s citeasc discheta. n cele din urm, pe ecran au aprut numele fiierelor de pe dischet: RING 9 RING 8 RING 7 RING 6 RING 5 RING 4 RING 3 RING 2 RING 1 21.10.1990 20.10.1990 19.10.1990 17.10.1990 15.10.1990 12.10.1990 07.10.1990 04.10.1990 02.10.1990

Ando a citit cu voce tare numele fiierelor, aproape n delir: Ring, ring, ring, ring Ring. Ce naiba? Cuvntul pe care l-am descoperit rezolvnd cifrul. Cifrul pe care l-am scos din cadavrul lui Ryuji.
141

Ando, i-e ru? Nemoto prea ngrijorat. l privea atent: avea faa unui om ameit. Ando abia a reuit s-i fac semn c nu. Era imposibil s fie o simpl coinciden. Asakawa ntocmise un raport despre evenimentele stranii i l mprise n nou pri, toate intitulate Ring. Acelai cuvnt apruse din abdomenul lui Ryuji. Ando intrase ntr-o stare de negare total. Cadavrul lui Ryuji era complet golit. Era ca un om de tinichea. Chiar vreau s cred c mi-a scris un mesaj i l-a scos din propriul lui corp pentru mine? C voia s-mi spun ceva despre fiierele de pe discheta asta? i-a amintit brusc cum arta faa lui Ryuji imediat dup autopsie: zmbitoare. i-a amintit cum se ateptase ca mortul s nceap s rd dintr-o clip n alta, dei zcea, complet golit, pe mas. Undeva, n adncul sufletului, Ando simea c povestea neverosimil a lui Yoshino ncepe s capete consistena realitii. Poate c totul e adevrat. Poate c exist ntr-adevr o caset video care te ucide la o sptmn dup ce vezi nregistrarea.

142

9
Calculatorul bzia ncontinuu i printa pagin dup pagin. Ando smulgea foaia imediat cum ieea din imprimant i o citea pe loc. Textul era la un rnd, dar reuea s citeasc fiecare pagin nainte ca imprimanta s-o scoat pe urmtoarea. n loc s citeasc direct pe monitor, se hotrse s printeze tot: era mai sigur s aib i o copie pe hrtie. Acum l scoteau din srite ateptrile repetate de doutrei minute, ct dura imprimarea unei pagini. Pn la urm, mprumutase calculatorul lui Ueda i-l luase cu el. O verificare rapid i artase c raportul avea n total cam o sut de pagini, mai multe dect ar fi putut printa n timp util la birou. Navea de ales, trebuia s fac treaba asta acas, n timpul nopii. Ajunsese la sfritul celei de-a douzeci i una pagini a manuscrisului, alternnd lectura cu cina pe care o cumprase n drum spre cas de la un magazin non-stop. Ceea ce aflase pn acum corespundea aproape exact cu povestea pe care o auzise de la Yoshino sptmna trecut. Era totui diferit de versiunea pe care i-o spusese ziaristul la cafenea, n sensul c meniona date i locaii precise, n consecin, era mult mai convingtoare. Stilul gazetresc lipsit de nflorituri ntrea impresia de plauzibil. n timp ce investiga moartea simultan prin atac de cord a patru tineri din Tokio i din Prefectura Kanagawa, lui Asakawa i-a trecut prin cap c vinovatul era un fel de virus. Din punct de vedere tiinific, era singura concluzie posibil. i, cum autopsiile cadavrelor puseser n eviden un virus care semna mult cu cel al variolei, s-a dovedit c ipoteza lui Asakawa fusese corect. Din
143

moment ce toi patru au murit simultan, s-a gndit Asakawa, fr ndoial c au fost contaminai n acelai timp i n acelai loc. Ziaristul trecuse concluzia c elementul-cheie pentru rezolvarea acestui caz era locul contaminrii, mai bine zis, traseul de transmitere a bolii. i Asakawa a reuit s descopere cnd i unde se aflaser cei patru mpreun: pe 29 august, cu exact o sptmn nainte s moar, tinerii erau n staiunea Pacific Land din Hakone, ntr-o caban nchiriat. Cabana B-4. Urmtoarea pagin, a douzeci i doua, ncepea cu plecarea lui Asakawa ctre cabana n cauz. Ziaristul luase expresul pn la Atami, apoi nchiriase o main i pornise spre staiunea montan pe autostrada Atami-Kannami. ntunericul i ploaia i ngreunaser mult cltoria, iar drumul de munte era ngrozitor. Rezervase cabana B-4 nc de la prnz, dar a ajuns acolo abia dup opt seara. Deci aici i-au petrecut cei patru noaptea Gndul acesta i-a provocat lui Asakawa o tresrire de spaim. Muriser la fix o sptmn dup ce fuseser aici, n cabana asta. tia c aceeai ameninare spectral putea foarte bine s-l pndeasc i pe el, dar n-a reuit si nbue instinctul de reporter i a scotocit n fiecare colior. Dup ce a gsit un carnet i a citit nsemnrile din el, Asakawa a aflat c tinerii vzuser n noaptea aceea o caset video, aa c s-a dus la recepie s-o caute. A gsit pe raftul de jos o caset fr etichet i fr cutie. Oare era chiar caseta misterioas? Recepionerul i-a dat voie s ia caseta n caban i, fr s aib idee ce conine, a pus-o n videorecorderul din living i a vizionat nregistrarea de la primul pn la ultimul cadru. La nceput, totul a fost negru. Asakawa descria prima secven chiar aa: Mi s-a prut c vd o licrire chiar n mijlocul ecranului ntunecat, un punct luminos, ct un vrf de ac. Oscilnd la stnga i la dreapta, punctul s-a mrit treptat i s-a oprit n cele din urm n partea stng a ecranului. Apoi din el au crescut ramuri i a devenit un ghem de lumin zdrenuit,
144

cu filamente care se zvrcoleau ca viermii Ando i-a ridicat privirea. Cele cteva rnduri l ajutaser s-i formeze o imagine suficient de limpede a scenelor care se succedau pe ecran. De altfel, n timp ce citea descrierea lui Asakawa, n minte i-a aprut o imagine precis, pe care avea senzaia c o mai vzuse undeva nainte. Un licurici care zboar pe un fond ntunecat i devine treptat tot mai mare apoi punctul luminos explodeaz, ca i cum o pensul mproac vopsea pe ecran. Era o scen scurt, dar tia c o mai vzuse, i nc de curnd. N-a durat mult pn cnd i-a amintit exact: ncerca s dea de urma lui Mai i ajunsese astfel n garsoniera ei. Caseta era n videorecorder i el apsase pe Play. Era caseta pe eticheta creia citise Frank Sinatra, Liza Minelli i nc ceva un scris de mn, masculin. Primele cteva secunde ale nregistrrii se potriveau perfect cu descrierea lui Asakawa. Dar pe caseta din garsoniera lui Mai scena durase doar cteva secunde, apoi ecranul devenise brusc strlucitor. Iar Mai, fr ndoial ncercnd s tearg ce era pe caset, nregistrase o emisiune de varieti, o telenovel cu samurai i altele, pn cnd banda se terminase. Ando i-a dat seama imediat ce nsemna asta. ntr-un fel sau altul, probabil prin intermediul lui Ryuji, Mai fcuse rost de caseta misterioas i vzuse nregistrarea acas, n garsonier. Dup aceea tersese tot de pe band, indiferent ce fusese acolo. Probabil c avea motive ntemeiate s-o fac. Dar nu reuise s tearg exact nceputul benzii, aadar primele secunde ale nregistrrii originale rmseser pe band. Oare asta nsemna c n minile lui Mai ajunsese chiar nregistrarea pe care o gsise Asakawa n cabana B-4? Ando a ncercat s-i ordoneze gndurile. Nu, nu poate fi ea. Caseta pe care a gsit-o Asakawa i caseta de la Mai sunt evident diferite. Potrivit raportului scris de Asakawa, caseta din caban nu avea etichet, dar cea din garsoniera lui Mai avea una, scris cu marker negru. Cu alte
145

cuvinte, era o copie. Cea din caban era originalul, cea de la Mai o copie. Prin urmare, caseta a fost copiat, tears, deghizat, transportat un ir uimitor de transformri. n mintea lui Ando, a nceput s capete un statut hibrid, ceva ntre fiin i obiect, i a nceput s semene cu un virus. n concluzie, dispariia lui Mai era sau nu consecina faptului c fata vzuse nregistrarea? Aceast posibilitate ncepuse s-l ngrijoreze serios pe Ando. Fata nu se mai ntorsese acas. Nu mai trecuse nici pe la facultate i nici mcar nu-i telefonase mamei sale. Pe de alt parte, Ando nu auzise nimic la tiri despre vreo tnr care s fi murit n mod inexplicabil. i-a lsat gndurile s rtceasc o vreme i a trecut n revist toate cauzele posibile ale dispariiei lui Mai. Poate c murise singur, ntr-un loc unde nimeni nu putea s-o gseasc. Ideea l-a ndurerat fata avea doar douzeci i doi de ani. Ba nu, era de-a dreptul insuportabil, pentru c, i ddea seama, ncepuse s se ndrgosteasc de ea. Din imprimant a ieit n sfrit alt pagin. Zgomotul l-a readus pe Ando la realitate. n orice caz, nu era momentul potrivit s pun paie pe foc. n clipa asta, cel mai bun lucru pe care-l putea face era s afle ce fusese nregistrat pe caseta original.

146

10
Urmtoarele cteva pagini conineau descrierea detaliat a nregistrrii. n timp ce citea, Ando vedea n minte un ecran de televizor pe care scenele se succedau rapid. Ceva rou i vscos a mprocat ecranul. Apoi a aprut imaginea unui munte, i a tiut din prima clip c era un vulcan. Din gura lui se revrsa lav, pmntul se cutremura. Erupia lumina noaptea. Scena s-a ntrerupt brusc i a fost nlocuit de un fond alb pe care aprea, scris cu negru, ideograma pentru munte, cu un contur slab, tremurtor. Apoi dou zaruri care se rostogoleau pe fundul unui vas. n cele din urm, a vzut un personaj uman. O btrn cu faa plin de riduri, care sttea pe o rogojin tatami. Se uita chiar n obiectivul camerei de luat vederi i murmura ceva. Vorbea ntr-un dialect aproape ininteligibil, dar a reuit s neleag, mai mult dup cum sunau cuvintele, c btrna ghicea viitorul cuiva, rostind un fel de avertisment. Apoi un nou-nscut, scncind. ntre scene nu exista nicio legtur logic. Se succedau brusc, la ntmplare, ca nite cri de joc mprite dintr-un pachet bine amestecat. Copilul a disprut i n locul lui s-au ivit sute de chipuri, care au umplut treptat ecranul, nmulindu-se parc prin diviziune celular. n fundal se auzeau nenumrate voci scandnd acuzaii: Minciun! neltorie! Apoi un televizor vechi, pe ecranul cruia plutea cuvntul sada. Un brbat cu ochii roii, injectai. Respira ntretiat i faa i lucea de sudoare. n spatele lui se vedeau copaci. Gura i era schimonosit ntr-un strigt i din colurile ei se scurgeau firioare de saliv. Avea
147

o ran adnc n umr, ca o gur deschis, din care curgea snge. Apoi s-a auzit din nou, de peste tot i de nicieri, plnsetul unui copil, n centrul ecranului s-a ivit o lun plin din care cdeau, cu bufnete nfundate, buci de mrimea unui pumn. n cele din urm, pe ecran au aprut cuvinte. Cine a vzut aceste imagini este condamnat s moar dup o sptmn, la exact aceeai or. Dac nu vrei s mori, trebuie s respeci ntocmai urmtoarele instruciuni Apoi scena s-a schimbat complet. n loc s vad instruciunile care l-ar fi salvat de la moarte, a vzut o reclam comercial banal pentru un insecticid. Reclama s-a terminat i ecranul i-a recptat aspectul bizar de la nceput, mai bine zis, amintirea lui. La sfritul acestei serii de viziuni stranii, Asakawa a reuit s neleag doar dou lucruri. Primul: oricine vedea nregistrarea era sortit s moar dup exact o sptmn. Al doilea: exista o cale de salvare, dar instruciunile fuseser terse n mod deliberat. Cei patru puti care vzuser prima dat caseta terseser probabil poriunea respectiv, n glum sau pur i simplu din rutate. Asakawa nu mai fusese n stare dect s arunce caseta n geant i s fug din cabana B-4. Ando a inspirat adnc i a pus hrtiile pe birou. Ce naiba. n relatarea lui, ziaristul creionase o descriere dureros de precis a celor douzeci de minute stranii de nregistrare. Folosind doar cuvinte, fcuse toate eforturile posibile s renvie imaginile i sunetele pe care le vzuse i le auzise n mod direct, i reuise n mare msur. Scenele nc mai dinuiau n mintea lui Ando, la fel de precise ca i cum le-ar fi vzut i auzit el nsui n noaptea aceea. A oftat i, brusc, s-a simit epuizat. Poate c nu era oboseal. Poate c acum spaima lui Asakawa devenise a lui i ncerca astfel s-o alunge. Dar pn i acest scurt rgaz i-a alimentat dorina de a afla mai
148

mult. Sorbind din cana cu ceai, a luat din imprimant urmtoarea pagin i a nceput s-o citeasc imediat, chiar mai repede dect pn atunci. Primul lucru pe care l-a fcut Asakawa dup ce s-a ntors la Tokio a fost s-i telefoneze lui Ryuji Takayama i s-i spun ce se ntmplase. Asakawa nu avea nici timp, nici curaj s descifreze de unul singur misterul. i trebuia un partener de ncredere i, n mod firesc, se gndise la Ryuji, pe care l cunotea nc din liceu. Vorbise i cu Yoshino, dar acesta refuzase s vad nregistrarea. Nu mai conta dac crezuse sau nu povestea. Voia s evite orice risc, n cazul n care ar fi existat cea mai mic posibilitate ca vizionarea casetei s conduc la un deznodmnt tragic. Nu i Ryuji. Dup ce aflase c exist o nregistrare video care-i ucide dup o sptmn pe toi cei care o vizioneaz, primele lui cuvinte fuseser: Mai nti s aruncm o privire la caset. Aadar Ryuji a vzut nregistrarea n apartamentul lui Asakawa i a fost literalmente fascinat. Dup ce ultima imagine s-a stins pe ecran, i-a cerut lui Asakawa s-i fac o copie. Cnd a citit cuvntul copie, Ando s-a ridicat brusc n picioare i a devenit mai atent. Acum ncepea s bnuiasc traseul casetei. nregistrarea original din cabana B-4 rmsese o vreme la Asakawa. n momentul accidentului, caseta se afla n videorecorderul din maina ziaristului. Apoi ajunsese la Junichiro, fratele lui Asakawa, i fusese aruncat la gunoi. Dar mai exista una, cea din garsoniera lui Mai Takano, pe care nu mai era dect nceputul nregistrrii originale. Era probabil copia pe care Asakawa o fcuse pentru Ryuji n prima noapte dup ce se ntorsese la Tokio. Titlul de pe eticheta ei, n caractere negre i groase, fusese scris de mna unui brbat. Dup toate probabilitile, era scrisul lui Asakawa. Cnd Ryuji i ceruse s-i fac o copie, ziaristul, n loc s foloseasc o caset nou, ntrebuinase una mai veche, pe care era
149

nregistrat muzic. Aceast copie ajunsese apoi de la Ryuji la Mai. Pn aici, lucrurile erau clare. Dar cnd o primise Mai? Fata nu-i spusese lui Ando c ar avea caseta. Putea s presupun c Mai gsise caseta din ntmplare, la cteva zile dup moartea lui Ryuji, i vzuse nregistrarea fr s tie ct de periculoas era. n orice caz, caseta fusese copiat n apartamentul lui Asakawa. Ando a simit c trebuia s in minte acest detaliu. Prin urmare, Ryuji a luat copia i mai nti a ncercat s reconstituie instruciunile terse (pe care el i Asakawa le-au numit descntecul). Amndoi s-au ntrebat cum ajunsese de fapt caseta n cabana B-4. La nceput s-au gndit c scenele fuseser filmate cu o camer video i caseta rmsese n caban, dar s-a dovedit c greeau. Cu trei zile nainte de sosirea celor patru tineri, n cabana B-4 era cazat o familie de trei persoane. Cineva bgase caseta n aparat i apsase pe Record. Cnd plecaser acas, uitaser caseta acolo. Prin urmare, scenele nu fuseser filmate n alt parte, ci erau rezultatul suprapunerii unei transmisii de origine necunoscut peste nregistrarea de la televizor. Apoi intraser n scen cei patru tineri. Ca s-i omoare timpul, se hotrser s vad un film. ncercaser s porneasc videorecorderul, dar din el ieise o caset. Se uitaser din pur curiozitate. Pesemne c luaser n glum ameninarea din final. Zu? Chiar o s murim dup o sptmn dac nu facem ce spune? Se hotrser, aadar, s le joace o fest urmtorilor oaspei ai cabanei i terseser instruciunile. Bineneles, putii n-au crezut nicio clip c ameninarea poate fi real. Dac ar fi crezut asta, nu le-ar mai fi ars de glume. n orice caz, recepionerul a gsit caseta a doua zi i a aruncat-o pe raftul din biroul lui, unde a rmas neobservat pn cnd Asakawa a ajuns acolo. ntrebarea-cheie era cum se imprimaser imaginile pe band n timp ce aparatul nregistra altceva. Lui Asakawa i-a venit ideea c un maniac oarecare ar fi putut s fac o transmisiune-pirat, aadar a
150

ncercat s localizeze sursa de emisie. ntre timp, soia lui a gsit caseta care rmsese n videorecorderul de acas i a vzut nregistrarea mpreun cu fiica ei. Acum, Asakawa trebuia s salveze alte dou viei: ale soiei i fetiei lui. Apoi Ryuji a fcut o descoperire surprinztoare. Dup ce a revzut acas nregistrarea de nenumrate ori, a avut un moment de inspiraie. A ntocmit un tabel i a observat c nregistrarea putea fi mprit n dousprezece scene care se ncadrau n dou categorii: scene abstracte, constituite doar din ceea ce el a numit imagini mentale, i scene reale, vzute prin ochii unui om. De exemplu, erupia vulcanic i faa brbatului erau n mod evident scene vzute direct, n timp ce luminia ca un licurici de la nceputul nregistrrii prea s fie o imagine mental ceva asemntor cu o scen dintr-un vis. Aadar, Ryuji numise cele dou grupuri, prin comparaie, reale i abstracte. Dup alte cercetri, a observat c n scenele reale existau momente cnd ecranul era parc acoperit de un vl negru, dar numai pentru o fraciune de secund. n scenele reale, aceste momente surveneau cam de cincisprezece ori pe minut, n timp ce n cele abstracte nu apreau deloc. Ce nsemna asta? Ryuji a conchis c vlul negru era de fapt un ochi care clipea. Clipitul aprea n scenele care fuseser vzute n mod direct, nu i n cele mentale. Mai mult dect att, frecvena ntunecrii ecranului se potrivea cu frecvena btii din pleoape a unei femei. Era, deci, o presupunere susinut de argumente rezonabile. Asta l-a condus, n mod firesc, la concluzia c imaginile de pe band nu fuseser nregistrate cu o camer de luat vederi, ci mai degrab de ochii i imaginaia unei persoane care apoi le proiectase pe caset printr-un act de voin. Lui Ando i-a venit greu s accepte aceast parte a explicaiei. Ideea c un om ar putea s nregistreze imagini pe band magnetic folosindu-i doar puterea gndului i se prea aproape absurd. Era dispus, la limit, s accepte posibilitatea imprimrii unei imagini
151

statice pe film fotografic, dar imagini n micare? n primul rnd, era o diferen major de nivel. Ca s poat nainta, trebuia s sar deocamdat peste acest punct, chiar dac admira n sinea lui perspicacitatea lui Ryuji. Acceptnd ipoteza c o persoan nregistrase imaginile pe ci paranormale, urmtoarea ntrebare era Cine?. Asakawa i Ryuji sau concentrat asupra ei i s-au dus la Muzeul Tetsuzo Miura din Kamakura. Miura, cercettor asiduu al parapsihologici, i-a dedicat viaa descoperirii persoanelor din Japonia nzestrate cu nsuiri paranormale. Dosarele care conineau rezultatele cercetrilor sale erau pstrate chiar n muzeu, peste o mie la numr. Cei doi au cerut permisiunea s le examineze, gndindu-se c un om care avea capacitatea de a proiecta imagini n micare nu putea s nu atrag atenia profesorului Miura. i, dup cteva ore de cercetri, au gsit, ntr-adevr, un candidat plauzibil. Potrivit fiei din dosar, la vrsta de zece ani reuise deja s proiecteze pe film caracterele yama (munte) i sada, elementele constituente ale numelui ei. Exact aceleai caractere care apreau i pe caset. Convini c Sadako Yamamura era persoana pe care o cutau, Ryuji i Asakawa s-au urcat n dimineaa urmtoare pe un vapor cu destinaia Izu Oshima. Sperau s afle mai multe despre viaa i personalitatea ei, informaii care ar fi lmurit poate o parte din secretele casetei video. Sadako i amenina cu moartea pe cei care vedeau nregistrarea pentru a-i obliga s fac ceva. Caseta nsi era expresia dorinei sale ca privitorul s acioneze ntr-un anumit fel. Din acest punct de vedere, devenise crucial s afle ce anume voia femeia. n clipa aceea, Ryuji bnuia deja c Sadako nu mai era n via. Se gndea c, n pragul morii, femeia i aruncase n lume ultima dorin, sub forma unei proiecii psihice. Ura ei profund ajunsese n cele din urm pe banda casetei video. Cu ajutorul corespondentului Daily News din Oshima i al lui Yoshino din Tokio, Asakawa i Ryuji au reuit s reconstituie
152

biografia lui Sadako Yamamura. Sadako se nscuse n 1947. Mama, Shizuko Yamamura, avea i ea capaciti paranormale i strnise o oarecare vlv n presa naional, dar pentru puin timp. Tatl ei, Heihachiro Ikuma, era asistent la Catedra de psihiatrie a Universitii Taido i se apucase s fac cercetri n domeniul parapsihologiei folosind-o drept subiect principal pe Shizuko. La nceput, cei trei Ikuma, Shizuko i Sadako au trezit curiozitatea publicului, ba chiar au fost o vreme rsfaii presei. Dar n ziua cnd o societate academic prestigioas a declarat c puterile lui Shizuko nu erau reale, oamenii s-au ntors mpotriva lor i presa i-a atacat furibund. Heihachiro a fost obligat s prseasc universitatea i n cele din urm s-a mbolnvit de tuberculoz, iar Shizuko a suferit o depresie nervoas i s-a sinucis aruncndu-se n craterul muntelui Mihara, vulcanul de pe insula Izu Oshima. Sadako a fost luat de nite rude de pe insul, n casa crora a trit pn a terminat liceul. n clasa a patra, i-a ctigat un oarecare renume n coal prezicnd corect erupia vulcanului Mihara, dar, cu excepia acestui episod izolat, nu i-a mai artat vreodat nsuirile pe care le motenise de la maic-sa. Dup bacalaureat s-a mutat la Tokio, unde s-a angajat ntr-o companie teatral, spernd s-i ctige pinea ca actri. Yoshino a reuit s-i ia urma din acest punct. Asakawa i telefonase de pe insul i l rugase s gseasc sala de repetiii a teatrului din Tokio, undeva n Yotsuya. Yoshino a gsit-o i, odat ajuns acolo, a aflat mai multe despre adevrata natur a lui Sadako de la un anume Arima, unul dintre efii companiei. Dei trecuser douzeci i cinci de ani de cnd Sadako clcase ultima dat n teatru, Arima o inea minte foarte bine. Fata prea s aib puteri supranaturale, reuind s proiecteze dup bunul ei plac imagini pe ecranul unui televizor care nici mcar nu era pus n priz. Dac povestea lui Arima era adevrat, atunci nsuirile paranormale ale lui Sadako le depeau cu mult pe cele ale mamei
153

sale. Yoshino a reuit s fac rost i de o fotografie a lui Sadako. Teatrul pstrase dosarul cu CV-ul ei, mpreun cu dou fotografii alb-negru pe care fata le adusese pentru angajare. ntr-una dintre ele aprea de la mijloc n sus, n cealalt stnd n picioare. Amndou dovedeau c Sadako avea trsturi de o asemenea perfeciune, nct nici mcar cuvntul frumoas nu era de-ajuns. n schimb, Yoshino n-a reuit s afle unde se dusese Sadako dup ce prsise teatrul, prin urmare a trimis prin fax fotografiile i celelalte informaii la biroul Daily News de pe insula Izu Oshima. Cnd a citit faxul i i-a dat seama c urma fetei se pierduse complet, Asakawa fost de-a dreptul distrus. Dac nu reueau s-o gseasc, cum mai puteau spera s afle descntecul? Tot Ryuji a avut o sclipire de inspiraie. i-a dat seama c nu era obligatoriu s urmreasc fiecare micare a fetei. n loc s piard timpul aa, era preferabil s-i concentreze atenia asupra scenei evenimentelor cabana B-4 din staiunea montan i s ncerce s neleag de ce imaginile fuseser nregistrate tocmai acolo. Fr ndoial c Sadako avea o anumit legtur cu locul acela. Ryuji i Asakawa au aflat c toate cldirile din complexul Pacific Land de la Hakone erau relativ noi i c nu era exclus ca acolo s fi existat n trecut alte construcii. Asakawa i-a telefonat lui Yoshino la Tokio i l-a rugat s urmreasc o nou pist, adic s afle ce cldiri se gseau cu ani n urm pe terenul ocupat n prezent de staiunea turistic. Yoshino i-a rspuns prin fax n dimineaa urmtoare. S-a dovedit c n locaia respectiv funcionase cndva un sanatoriu pentru tuberculoi. Yoshino reuise chiar s fac rost de planul instituiei. A ataat la el i fia cu numele, adresa i CV-ul unui anume Jotaro Nagao, n vrst de 57 de ani, un doctor pediatru care avea un cabinet la Atami. Doctorul lucrase cinci ani la sanatoriul din Hakone, din 1962 pn n 1967, ceea ce nsemna c Nagao era singurul care le putea oferi informaii amnunite despre sanatoriu. Prin urmare, narmai numai cu datele pe care le primiser de la
154

Yoshino, Asakawa i Ryuji au luat un feribot rapid pn la Atami. Era a aptea zi de cnd Asakawa vzuse nregistrarea. Dac nu reueau s afle descntecul pn la zece seara, Asakawa putea si ia adio de la via. n noaptea urmtoare, tot la zece, i venea rndul i lui Ryuji. Urmau soia i fetia lui Asakawa, a treia zi la unsprezece dimineaa. Cei doi s-au urcat iar n maina nchiriat i s-au grbit s ajung la cabinetul doctorului Nagao. Din fericire, speranele lor de a obine noi informaii s-au mplinit, ba chiar mult peste ateptri. Cnd au ajuns n sfrit fa n fa cu doctorul, l-au recunoscut amndoi. Spre sfritul nregistrrii aprea n prim-plan un brbat cu faa lucind de sudoare, respirnd ntretiat i cu o ran la umr. Dei ntre timp mbtrnise i aproape chelise, nu ncpea nicio ndoial c brbatul acela era Nagao. Sadako i vzuse chipul de foarte aproape. Mai mult dect att, n ochii fetei, Nagao era un personaj detestabil. Cu impetuozitatea lui caracteristic, Ryuji l-a nghesuit pe Nagao pn cnd a mrturisit tot. Doctorul le-a povestit ntr-un final ce se ntmplase ntr-o dup-amiaz fierbinte de var, cu douzeci i cinci de ani n urm Nagao luase variol de la un pacient n timpul unei vizite la pavilionul de carantin al sanatoriului, i n dup-amiaza aceea au nceput s se fac simite primele simptome ale bolii. Cu toate c avea dureri de cap i febr, doctorul nu i-a dat seama c e vorba de variol i a continuat s trateze bolnavii. Credea c e vorba de o simpl rceal. Apoi s-a ntlnit n grdin cu Sadako Yamamura. Fata venea adesea s-l viziteze pe tatl ei, internat acolo. Cum abia prsise compania de teatru, nu avea unde s se duc i urca la sanatoriu ori de cte ori se ivea ocazia. O singur privire, i Nagao a fost vrjit de frumuseea lui Sadako. S-a apropiat de ea i au schimbat cteva vorbe, apoi, ca i cum l-ar fi mpins de la spate ceva mai presus de voina lui, a condus-o pn la o cas prsit, n pdure. Acolo, lng un pu vechi, a violat-o.
155

Disperat, ncercnd s-i reziste, Sadako l-a mucat de umr. Din cauza rnii care sngera i a ameelii provocate de febr, Nagao nu a observat imediat c Sadako era unic n felul ei. Avea sindromul feminizrii testiculare, o afeciune extrem de rar numit aa pentru c persoana respectiv are organe genitale de ambele sexe. Femeile care sufer de acest sindrom au sni i vagin, dar n-au uter i trompe uterine. Aspectul lor exterior este feminin sut la sut, ns din punct de vedere genetic sunt brbai adic au cromozomi XY i nu pot avea copii. Nagao a sugrumat-o pe Sadako i a aruncat-o n pu, apoi a acoperit-o cu bolovani. Dup ce a ascultat mrturisirea doctorului, Asakawa i-a artat planul staiunii i i-a cerut s-i arate unde se afla puul. Nagao a reuit s le indice o zon mai larg, i anume cea n care se gseau acum cabanele. Asakawa i Ryuji au plecat imediat la Hakone. Odat ajuni acolo, au nceput s caute puul printre cabane. L-au gsit n sfrit, sub B-4. Cabana era construit pe o pant lin i, cnd s-au uitat n spaiul gol de sub ea, au vzut ghizdul din piatr al unui pu vechi, acoperit cu un capac din beton. Dac energia psihic a lui Sadako fusese canalizat de cilindrul puului, ajunsese exact la televizorul i videorecorderul care se aflau deasupra, n caban. Caseta video se afla n poziia perfect pentru a recepiona proieciile mentale. Asakawa i Ryuji au schimbat cteva cuvinte, s-au strecurat sub caban i au dat la o parte capacul, apoi au nceput s caute rmiele lui Sadako. n clipa aceea, amndoi erau convini c descntecul ters de pe band nu putea fi dect acesta: fata dorea ca persoana care ar fi vzut nregistrarea s-o salveze din spaiul acela ntunecos i strmt. Cei doi au cobort pe rnd n pu pentru a scoate apa care se adunase la fund. Cnd, n sfrit, au gsit n noroi un craniu care nu putea fi dect al fetei, trecuse deja de zece. Ora fatidic a lui Asakawa venise i trecuse, iar el tria nc. Amndoi erau fericii c descifraser secretul casetei.
156

A doua zi, Asakawa a dus rmiele pmnteti ale lui Sadako la rudele fetei de pe insula Izu Oshima, iar Ryuji s-a ntors la Tokio pentru a termina o lucrare tiinific. Cazul era nchis. Osemintele lui Sadako Yamamura, femeia cu puteri psihice nspimnttoare, fuseser smulse din adncul pmntului. Sadako i gsise linitea. Nici Asakawa, nici Ryuji nu se ndoiau de asta.

157

11
Ajuns aici, Ando s-a ridicat n picioare i, fr s lase hrtiile din mn, a deschis fereastra. Fcuse greeala s-i imagineze cum ar fi s coboare pe frnghie ntr-un pu i asta i provocase o senzaie de sufocare. Un spaiu de dou ori opresiv: sub caban era ntuneric chiar i ziua, iar puul avea diametrul mai mic de un metru. Ando i-a dat seama c avea un acces de claustrofobie i c trebuia s respire aer proaspt. Copacii din grdina templului Meiji se unduiau n btaia vntului chiar sub fereastr. i paginile din mna lui tremurau, atinse de aceeai adiere. Ultima pagin a manuscrisului tocmai ieea din imprimant. nc una, deci, i povestea lui Asakawa se va sfri. A auzit sunetul mainriei care-i sfrise treaba. S-a uitat n spate i a vzut o hrtie aproape n ntregime alb care parc i ntorcea privirea. A luat-o i a citit doar att: Duminic, 21 octombrie Scopul unui virus este reproducerea. Descntecul: f o copie a casetei. Asta era tot. Dar cuvintele aveau, fr ndoial, o importan crucial. Duminic, 21 octombrie era chiar ziua accidentului lui Asakawa. n dimineaa zilei precedente, Ando fcuse autopsia lui Ryuji i se ntlnise cu Mai la morg. Dei manuscrisul se termina brusc, Ando putea acum s reconstituie, n mare, paginile care lipseau. Pe 19 octombrie, rmiele lui Sadako Yamamura fuseser nmnate rudelor fetei din localitatea natal. Dar povestea nu se
158

sfrise aici. n timp ce Asakawa i redacta ntr-un hotel din Oshima raportul lui minuios, Ryuji era pe moarte n apartamentul lui din Nakano Est. Cnd se ntorsese la Tokio i aflase de moartea prietenului su, Asakawa pornise n goan ctre Ryuji. Acolo se ntlnise cu Mai Takano i o bombardase cu tot felul de ntrebri care i se pruser fetei ciudate ntr-o asemenea ocazie. Nu i-a spus nimic n ultimele lui clipe? N-a pomenit nimic despre despre o caset video? Era lesne de neles c Asakawa intrase n panic. Fusese convins c descifraser misterul casetei i c scpaser de la moarte, dar acum descoperea c se nelaser. Blestemul era nc funcional. Iar el nu mai avea niciun indiciu. De ce Ryuji murise, i el nu? Mai ru, soia i fiica lui erau sortite s moar i ele, chiar a doua zi, la unsprezece dimineaa. Prin urmare, Asakawa trebuia s o ia de la capt, s descifreze din nou enigma descntecului, de data asta singur i n doar cteva ore. n mod logic, ziaristul a ajuns la concluzia c, indiferent ce i se cerea s fac, fcuse acel ceva n cursul sptmnii, fr s-i dea seama. i, la fel de logic, Ryuji nu fcuse acelai lucru. Ce putea fi? Ando i nchipuia c Asakawa petrecuse toat noaptea scormonindu-i mintea. n cele din urm, n dimineaa zilei urmtoare, ziaristul avusese o scnteie de inspiraie i descoperise o soluie care prea sigur. Atunci scrisese n grab cele cteva cuvinte de ncheiere: Duminic, 21 octombrie Scopul unui virus este reproducerea. Descntecul: f o copie a casetei. Virusul menionat de Asakawa nu putea fi dect cel al variolei. Chiar nainte de moarte, Sadako Yamamura fusese violat de ultimul bolnav de variol din Japonia, Jotaro Nagao. Presupunerea c i ea fusese contaminat era fireasc. Ajuns n pragul dispariiei, virusul variolei se folosise de puterea psihic ieit din comun a
159

femeii pentru a-i atinge scopul, adic perpetuarea. Dar, odat transferat pe banda magnetic, virusul nu se mai putea reproduce de la sine. Acum trebuia s acioneze prin intermediul oamenilor, s-i oblige s copieze caseta. Dac cineva ar fi rescris poriunea lips din nregistrare, ea ar fi sunat cam aa: Cine a vzut aceste imagini este condamnat s moar dup o sptmn, exact la aceeai or. Dac nu vrei s mori, trebuie s respeci ntocmai urmtoarele instruciuni: copiaz caseta i arat altei persoane nregistrarea. Privite din acest unghi, evenimentele cptau un sens. A doua zi dup ce vzuse nregistrarea, Asakawa i-o artase lui Ryuji i copiase caseta pentru el. Fr s vrea, ajutase virusul s se nmuleasc. Dar Ryuji nu fcuse nicio copie. Convins c a gsit rspunsul, Asakawa a pus videorecorderul n main i a plecat ctre o destinaie necunoscut. Fr ndoial c avea de gnd s fac dou copii ale casetei una pentru soia lui, cealalt pentru feti i s arate nregistrarea altor dou persoane. Iar persoanele n cauz ar fi fost obligate s gseasc la rndul lor alt prad, ali oameni care s primeasc cte o copie i s vizioneze nregistrarea. Dar asta era o problem secundar. Cel mai important lucru, din punctul de vedere al lui Asakawa, era s-i salveze soia i copilul. i totui, chiar n clipa cnd rsufla uurat pentru c reuise n fine s gseasc o cale de a-i salva familia, Asakawa se ntorsese i constatase c soia i fiica lui erau deja reci. Atunci pierduse controlul volanului. Ando i-a dat seama de ce ziaristul se afla i acum n com. Nu numai c fusese ocat de pierderea familiei sale, dar l torturase cumplit i ntrebarea: Care este, de fapt, descntecul? De fiecare dat cnd credea c l-a descoperit, rspunsul i scpa printre degete, transformndu-se n altceva. i de fiecare dat murea cineva. Furie, prere de ru i repetarea la nesfrit a ntrebrii: De ce? De ce mai sunt n via?
160

Ando a aezat toate paginile manuscrisului pe mas, apoi s-a ntrebat, la rndul lui: Chiar crezi povestea asta fantastic? A cltinat din cap. Nu tiu. i chiar nu tia ce ar mai fi putut spune. Vzuse cu ochii lui sarcomul bizar din artera coronar a lui Ryuji. apte oameni muriser din aceeai cauz. Gsiser n sngele lor un virus aproape identic cu cel al variolei. i unde dispruse Mai? Cum putea fi explicat atmosfera stranie din casa ei, n care, dup toate aparenele, nu mai clcase totui de o sptmn? Cum se putea explica senzaia lui visceral i nspimnttoare c ntre pereii aceia tria totui ceva? Sau urmele de pe caseta care se mai afla n aparat? nregistrarea continua s se nmuleasc? Cu ct reflecta mai mult, cu att numrul ntrebrilor cretea. A nchis calculatorul i s-a ntins s ia sticla de whisky de pe comod. tia c nu va fi n stare s adoarm fr ajutorul alcoolului.

161

12
Ando a trecut mai nti pe la laboratorul de biochimie ca s-i napoieze lui Ueda calculatorul, apoi a pornit spre Departamentul de Anatomo-Patologie. Ducea sub bra raportul pe care-l printase noaptea trecut. Voia s-l citeasc i Miyashita. Colegul lui sttea aplecat peste mas i mzglea ceva cu un pix. Ando a aruncat teancul de hrtii lng el i Miyashita, surprins, i-a ridicat capul. Ascult, f-mi o favoare i citete asta. Miyashita a continuat s se uite uimit la Ando. Ce s-a ntmplat? Vreau s-mi spui ce crezi despre asta. Miyashita a tras mai aproape hrtiile. E destul de mult. Da, este, dar o s gseti acolo cteva lucruri foarte interesante. Hai, n-o s-i ia prea mult s le citeti. Nu-mi spune c te-ai apucat s scrii un roman n timpul liber. Kazuyuki Asakawa a scris un raport despre cei apte mori. Adic Asakawa al nostru? Da. Acum ochii lui Miyashita sclipeau de interes i degetele lui rsfoiau deja primele pagini. Hm, a mormit el. Bine, asta e. Dup ce termini, spune-mi ce prere ai. Ando s-a ntors s plece, dar Miyashita l-a oprit: Stai o clip. Ce s-a ntmplat? Miyashita i-a sprijinit capul n palm i a nceput s bat cu
162

pixul n tblia mesei. Te pricepi bine la coduri, nu-i aa? N-a spune c sunt prea bun la decriptare. n studenie m-am jucat puin cu codurile mpreun cu civa prieteni, dar asta-i tot. Hm, a fcut din nou Miyashita, btnd mai departe cu pixul n mas. De ce m-ai ntrebat? Miyashita i-a ridicat cotul de pe hrtia la care se uitase pn atunci i a mpins-o spre Ando. Uite de ce. A btut cu pixul n centrul paginii. Era printul pe care Ando l vzuse cu o zi n urm, cel cu rezultatele analizei secveniale a virusului gsit n sngele lui Ryuji. Mi-ai artat asta ieri. tiu, dar nu-mi iese din minte. Ando a luat foaia de hrtie i a ridicat-o n dreptul ochilor. n cteva locuri, ntre irurile altfel neordonate de baze, se intercala, inexplicabil, alt ir. De fiecare dat acelai: ATGGAAGAAGAATATCGTTATATTCCTCCTCC TEAACAACAA Era, fr ndoial, straniu ca acelai ir de patruzeci i dou de baze s apar de cteva ori la intervale egale. Zici c virusul lui Ryuji este singurul care are particularitatea asta? Da. E singurul care are n plus astea patruzeci i dou de baze, a zis Miyashita, continund s-l priveasc pe Ando drept n ochi. Nu i se pare ciudat? Bineneles c da. Btaia pixului s-a oprit. Mi-a trecut prin minte c ar putea fi un fel de cod. Ando a nghiit n sec. Nu-i amintea s-i fi spus lui Miyashita
163

vreun cuvnt despre ce se ntmplase n timpul autopsiei lui Ryuji. Nu pomenise nimic despre colul de ziar, i, evident, nici att despre faptul c obinuse cuvntul ring dup ce se jucase cu numerele. Iar acum Miyashita i vorbea despre coduri. Presupunnd c e un cod, cine ni l-a trimis? Ryuji. Ando a nchis ochii. ncercase cu disperare s evite aceast idee, iar acum colegul lui i-o arunca pur i simplu n fa. Ryuji e mort. Chiar eu i-am fcut autopsia. Miyashita nu prea deloc deranjat de cuvintele lui Ando. Da, cum zici tu. Dar vezi dac poi s-l descifrezi, bine? Era oare cu putin ca succesiunea de baze s reprezinte un cuvnt? Cine tie, poate cele patruzeci i dou de baze alctuiau o ntreag propoziie, la fel cum cifrele 178136 nsemnau de fapt ring. Poate c ntr-adevr conineau un mesaj important. Nu cumva nsui Ryuji, de dincolo de mormnt, scrisese n mod repetat un mesaj n propriile lui rmie pmnteti? Ando se simea atras pe acelai drum fr ieire pe care pise cndva Asakawa i mna n care inea hrtia a nceput s tremure. Dar nu avea cum s refuze cererea imperioas a lui Miyashita. i lui i venise aceeai idee cnd vzuse prima dat secvena de baze, dar o ngropase adnc ntr-un colior al minii. Era convins c, altfel, tot eafodajul tiinific pe care se sprijinea viaa lui s-ar deforma pn cnd ar deveni de nerecunoscut. Evenimentele ameninau s treac dincolo de limita pn la care era capabil s le asimileze. Poi s pstrezi hrtia. Nu te grbi, vezi ce poi face cu ea. Miyashita era om de tiin i ar fi trebuit s se comporte ca atare. Ando nu reuea s priceap cum de era dispus s adopte att de repede idei evident netiinifice. Am ncredere n tine. O s gseti cheia, a zis Miyashita i l-a lovit cu palma peste fund.

164

Partea a treia DECRIPTAREA

165

1
Ando i Miyashita au urmat-o pe chelneri pn la masa de lng fereastr. Restaurantul se afla la ultimul etaj al spitalului universitii i oferea o privelite fantastic a grdinii exterioare a Templului Meiji. Mai mult, personalul universitar avea dreptul la reduceri de pre. Amndoi i dezbrcaser halatele nainte s vin aici, dar chelneriei i fusese de-ajuns o singur privire ca s-i dea seama c nu erau rudele vreunui pacient. Femeia le-a dat meniul special de prnz pentru angajai. Abia uitndu-se n list, Ando i Miyashita au comandat amndoi specialitatea zilei i cte o cafea. Imediat dup ce femeia a plecat, Miyashita a deschis discuia pe un ton grav: Am citit-o. Ando tia c asta va spune nc din clipa cnd colegul lui l invitase s ia prnzul mpreun. Miyashita citise raportul Ring al lui Asakawa i acum era nerbdtor s-l comenteze. i ce prere ai? a zis Ando, aplecndu-se nainte. Nu pot s te mint: sunt stupefiat. Dar l crezi? Ce naiba, nu se pune problema dac e de crezut sau nu. Totul se leag. Numele victimelor i ora morii fiecreia sunt corecte. Doar am citit amndoi rapoartele poliiei i rezultatele autopsiilor. Avea dreptate, bineneles. Citiser concluziile legitilor i celelalte documente anexate la dosarele celor patru victime din staiunea montan. Orele estimate ale deceselor se potriveau cu cele din raportul lui Asakawa. Nu existau niciun fel de neconcordane. Dar ceea ce-l uimea pe Ando era uurina cu care un patolog att de strlucit ca Miyashita putea s accepte fr nicio rezisten ideea c
166

blestemele i supranaturalul jucau un rol important n povestea asta. i accepi totul aa, pur i simplu? M rog, asta nu nseamn c n-am rezerve. Pe de alt parte, dac te gndeti mai bine, tiina modern n-a reuit s rspund la nite ntrebri elementare. Cum a aprut viaa pe Pmnt? Care este mecanismul evoluiei? E rezultatul unui ir de evenimente ntmpltoare sau are o direcie precis, aa cum susine teleologia? Exist tot felul de teorii, dar n-am fost n stare s demonstrm niciuna. Structura atomului nu reproduce n mic structura sistemului solar, e mult mai complicat i mai greu de neles, e plin de ceea ce putem numi fore latente. Cnd ncercm s studiem universul subatomic, descoperim c mintea observatorului influeneaz procesul n modul cel mai subtil. Mintea, prietene! Aceeai minte care, nc din vremea lui Descartes, a susinut viziunea mecanicist despre univers i a fost subordonat mecanicii corpului omenesc. Iar acum descoperim c mintea influeneaz rezultatele experimentelor. Eu renun. Nimic nu m mai surprinde. Sunt pregtit s accept orice s-ar ntmpla pe lumea asta. Ba chiar i invidiez pe fericiii care nc mai cred n atotputernicia tiinei moderne. i Asakawa avea ndoielile lui n privina aa-zisei omnipotene a tiinei moderne, dar n mod clar nu erau att de grave ca ale lui Miyashita. Cum ar putea cineva s se simt n largul lui n comunitatea tiinific dac nu se putea dezbra de scepticism? E o poziie extrem. Nu i-am spus niciodat pn acum, dar sunt un idealist. Zu, idealist? Aa cum spunea Buddha: forma nu este diferit de gol, iar golul nu este diferit de form. Ando nu prea nelegea unde bate Miyashita. Era sigur ns c ntre idealismul filosofic i realitatea e goal exist o mulime de idei nerostite, dar nu era momentul potrivit s dezbat subtilitile
167

viziunii lui Miyashita asupra lumii. Bine, i-a atras atenia ceva, vreau s zic n mod special, n raportul lui Asakawa? Ando voia s afle dac Miyashita avea aceleai dubii ca i el. Da, sunt mai multe puncte care m deranjeaz. Chelneria le-a adus cafeaua i Miyashita i-a turnat doze generoase de frica i zahr. Soarele btea n plin pe faa lui rumen. n primul rnd, de ce a rmas n via doar Asakawa dup ce a vzut caseta? Miyashita a gustat din cafea. Pentru c a descoperit descntecul, nu? Descntecul? M rog, instruciunile care au fost terse de pe band. Partea n care privitorul afl c e obligat s fac ceva. Da. i dac Asakawa a fcut ce trebuia fr s-i dea seama Ce a fcut? Scrie chiar la sfritul raportului, nu-i aa? Scopul unui virus este reproducerea. Descntecul: f o copie a casetei. Apoi Ando i-a spus lui Miyashita cteva lucruri pe care acesta nu le tia. n momentul accidentului, n maina lui Asakawa era un videorecorder, iar Ando gsise acas la Mai o copie a casetei din aparat. nregistrarea iniial fusese tears de pe aceast copie. n mintea lui Miyashita s-a aprins un becule: Aha, deci asta a vrut s spun. Credea c descntecul nseamn s copiezi caseta i s convingi pe cineva s vad nregistrarea. Sunt convins c la asta s-a gndit. Bun, atunci unde se ducea cu videorecorderul n dimineaa cnd a avut accidentul? E evident: undeva unde gsise doi oameni dispui s vad nregistrarea. ncerca disperat s-i salveze soia i fiica, nu-i aa? Dar nu i-ar fi fost deloc uor s conving pe oricine s se uite la o caset att de periculoas.
168

Cred c se ducea la prinii soiei. Nu poate fi vorba de prinii lui, din moment ce taic-su e bine sntos. Am vorbit cu el la telefon chiar ieri. Prin urmare, prinii ei au acceptat s fie expui temporar unui risc major ca s le poat salva pe fiica i pe nepoata lor. Ar trebui s aflm unde locuiesc i s lum legtura cu poliia local. Dac nregistrarea video fusese copiat i pus n circulaie mpreun cu avertismentul acela incredibil din final, era foarte posibil ca n zona n care locuiau prinii soiei lui Shizu Asakawa s se fi nregistrat mai multe victime. Dac era aa, presa nc nu aflase. Caseta nu circula deocamdat la lumina zilei, sub privirile agere ale ochiului public. Pesemne c Miyashita ajunsese la aceeai concluzie, i anume c nregistrarea video se nmulea i se rspndea ca un virus. Am impresia c o s ai multe cadavre de tiat, a zis el pe un ton glume. n clipa aceea, Ando a neles altceva. Judecnd dup datele cunoscute, era mai mult dect probabil c Mai vizionase caseta. Se mpliniser aproape dou sptmni de cnd lipsea. Poate c va fi obligat s-i fac chiar el autopsia. i-a nchipuit trupul ei frumos ntins pe masa de disecie i imaginea l-a ngrozit. Dar Asakawa n-a murit, a zis el ca i cum ar fi rostit o rugciune. Cea mai mare problem cu care ne confruntm e asta: dac Asakawa a reuit s fac dou copii ale casetei, de ce au murit soia i fetia lui? Sau, altfel spus, de ce mai triete? Nu tiu. n toat chestia asta e amestecat virusul variolei, nu? Din punctul sta de vedere mi se pare perfect logic ca descntecul s fie aciunea de copiere a casetei. Doar aa se rspndete virusul. E logic, dar numai pn la moartea lui Ryuji. Moartea familiei lui Asakawa pune din nou totul sub semnul ntrebrii.
169

Adic nu nseamn, de fapt, s copiezi caseta? Nu tiu. ntr-adevr, nu tia cum s interpreteze situaia. Fie descntecul era cu totul altul, fie se ntmplase ceva n timpul copierii casetei. Sau poate c nregistrarea i ucidea oricum pe cei care o vizionau, indiferent dac foloseau sau nu descntecul. Dar, n cazul acesta, supravieuirea lui Asakawa era i mai greu de explicat. Chelneria le-a adus prnzul i o vreme au tcut amndoi, prea ocupai s mnnce. n cele din urm, Miyashita a lsat furculia pe farfurie i a zis: Am ajuns ntr-o dilem. Adic? Bun, dac exist o asemenea caset video, a vrea s-o vd. Dar s-ar putea s m ucid. Asta numesc eu dilem. O sptmn trece repede. O sptmn? Prea repede ca s poi afla ceva. Zu c povestea asta m-a prins. Din punct de vedere tiinific, avem de-a face cu o nregistrare video, un semnal care atac creierele oamenilor prin canalul senzorial auditiv i prin cel vizual i poate, ntr-un fel sau altul, s implanteze n trupul victimei un virus asemntor cu virusul variolei. Poate c nu caseta l implanteaz. Poate c imaginile influeneaz cumva ADN-ul victimei i el se metamorfozeaz n virusul nostru misterios. S-ar putea s ai dreptate. M gndeam la SIDA. nc nu tim precis care este originea virusului, dar se pare c, dintr-un motiv oarecare, viruii umani i cei ai maimuelor, care exist dintotdeauna, au evoluat i au dat natere virusului SIDA aa cum l cunoatem acum. n orice caz, SIDA nu e un virus care exist de secole. Analizele secveniale arat limpede c s-a desprit n dou tulpini diferite cu doar o sut cincizeci de ani n urm. Cine tie ce ntmplare
170

i vrei s afli care ar fi evenimentul ntmpltor n cazul nostru? Eu unul cred c are o legtur cu mintea, a zis Miyashita i s-a aplecat nainte pn cnd aproape l-a atins pe Ando. Bineneles, toat lumea tie c mintea, orict de abstract i de imaterial ar fi, poate s influeneze corpul n multe feluri. i Ando tia foarte bine asta. i era de-ajuns s se gndeasc, de exemplu, c stresul prelungit poate duce la ulcer perforat. Acum el i Miyashita raionau n acelai mod. Mai nti, nregistrarea video induce n mintea privitorului o stare care influeneaz ntr-un anumit mod ADN-ul i-l determin s se modifice pn cnd apare virusul misterios asemntor cu variola. Apoi, acest virus provoac un cancer galopant n artera coronar, iar rezultatul este o tumoare, care ajunge la dimensiunea maxim n numai o sptmn, blocnd circulaia sngelui i provocnd oprirea inimii. Iar virusul nsui este de natur cancerigen funcia lui primar e aceea de a se infiltra n ADN i de a produce mutaii la nivel celular n tunica media a arterei coronare. Deci nu este un virus prea contagios. La aceast concluzie i conducea deocamdat analiza lor. Hai, fii sincer, tu n-ai vrea s-o vezi? l-a provocat Miyashita. Pi Trebuie s pun mna pe caseta asta. Ba nu, cred c e mai bine s lai montrii s doarm. Ai sfri ca Ryuji. Apropo de Ryuji, ai reuit s descifrezi codul? nc nu. Chiar dac e ntr-adevr un cod, patruzeci i doi e un numr prea mic, nu poi s lucrezi cu el. Poate conine cel mult cteva cuvinte. Era o scuz. De fapt, Ando ncercase de mai multe ori s sparg codul, dar dduse gre de fiecare dat. mi nchipui cum o s-i petreci zilele libere. Abia atunci i-a amintit Ando c a doua zi era srbtoare naional, Ziua Muncii. i cum a treia zi, duminic, oricum era liber,
171

avea n fa un weekend prelungit, de trei zile. De cnd i pierduse fiul i se desprise de soie, nu-i mai psa de srbtori. Perspectiva de a rmne singur acas n weekend era de fiecare dat sumbr, iar o mic vacan de trei zile pentru care nu avea niciun plan era cu att mai deprimant. Da, bine, mai ncerc. Dar gndul c-i va petrece sfritul de sptmn chinuindu-se s citeasc mesajul cifrat expediat de un mort era cel puin sumbru. Pe de alt parte, dac ar reui, poate c ar avea mcar o minim satisfacie. Cel puin va fi o schimbare. S-a ridicat i i-a promis lui Miyashita c va descifra mesajul pn la sfritul sptmnii. Luni o s-i spun ce ncearc Ryuji s ne transmit. Miyashita s-a ntins peste mas i l-a btut pe umrul stng: Acum totul depinde de tine.

172

2
Dup prnz, Ando s-a ntors la birou i a telefonat la Departamentul de Medicin Legal al Spitalului universitar Toji, n Utsunomiya, prefectura Tochigi. Dup o investigaie rapid obinuse informaia c prinii soiei lui Asakawa locuiau n Ashikaga, n aceeai prefectur. Toate decesele din cauze necunoscute din acea regiune cdeau sub jurisdicia doctorilor de la spitalul Joji. I-a rspuns la telefon un asistent, iar Ando l-a ntrebat dac nregistraser n ultima lun vreun deces prin stop cardiac provocat de blocarea arterei coronare. Brbatul i-a rspuns cu o ntrebare concis: Scuze, dar de ce v intereseaz? Ando i-a explicat c se confruntau deja cu apte decese din aceeai cauz n zona metropolitan Tokio i c existau indicii potrivit crora numrul victimelor putea fi mai mare. A evitat s pomeneasc despre fenomenele paranormale. Explicaia lui nu a eliminat totui suspiciunea asistentului. S neleg c ai luat legtura cu toate spitalele din regiune? Nu, nu chiar. Atunci de ce ai telefonat la noi? Pentru c este o zon de risc. Vrei s spunei c vom avea victime la Utsonomiya? Nu, la Ashikaga. Ashikaga? Menionarea numelui l luase complet prin surprindere pe asistent. Omul a tcut i Ando aproape c a simit cum i ncleta mna pe receptor.
173

E uluitor. Nu-mi dau seama cum ai aflat asta. Realitatea este c pe 28 octombrie au fost descoperite acolo cadavrele unor persoane n vrst, so i soie. Le-am examinat a doua zi. Putei s-mi spunei numele lor? Numele de familie e Oda, dac nu m nel, iar prenumele soiei Setsuko. Am uitat numele brbatului. Ando aflase deja cum se numeau prinii lui Shizu: Toru i Setsuko Oda. Nu puteau fi dect ei. Acum aveau o dovad. n dimineaa zilei de 21 octombrie, Asakawa aruncase videorecorderul n maina nchiriat i pornise ctre casa socrilor lui din Ashikaga, unde avea de gnd s fac dou copii ale casetei i s le arate nregistrarea. i asigurase, fr ndoial, c vieile lor nu erau n pericol dac fceau la rndul lor alte dou copii i gseau alte dou persoane care s vad caseta. Probabil c se lsaser convini fr prea mare efort, indiferent dac crezuser sau nu sut la sut povestea fantastic a lui Asakawa. Orice risc, chiar i unul infim, ca vieile fiicei i nepoatei lor s fie n pericol era un argument mai mult dect convingtor. Aadar, Asakawa fcuse copiile, sigur c i salveaz astfel soia i fetia. Dar n drum spre cas le pierduse pe amndou. O sptmn mai trziu muriser i btrnii. A pune pariu c ai fost foarte surprini de rezultatele autopsiilor. Ando i imagina foarte bine ct de ocai fuseser medicii din echip cnd descoperiser c amndou victimele aveau aceleai simptome. Mi-ai luat vorba din gur. De fapt, innd cont c au murit n acelai timp i c au lsat un bilet, am presupus, n mod firesc, c avem de-a face cu o dubl sinucidere. Dar, cnd am deschis cadavrele, am gsit n loc de urme de otrav nite tumori ciudate n arterele lor coronare. Surprini e un cuvnt prea blnd. Stai o clip, l-a ntrerupt Ando. Ce s-a ntmplat? Spunei c au lsat un bilet?
174

Da. Doar o bucic de hrtie, a fost gsit pe pat, lng perne. Se pare c l-au scris chiar nainte s moar. Ando nu tia cum s interpreteze aceast informaie. Ce semnificaie avea? De ce lsaser un bilet de adio? Putei s-mi spunei ce au scris? Ateptai puin. Asistentul a lsat jos receptorul, dar s-a ntors dup cteva secunde. O s dureze ceva pn-l gsesc. S vi-l trimit prin fax mai trziu? V-a fi recunosctor. Ando i-a dictat numrul de fax i a nchis. Dup aceast discuie n-a mai ieit din birou. Faxul era aezat pe raftul din mijloc al unui stativ pentru echipament electronic, la dou birouri deprtare de el. i-a rsucit scaunul cu patruzeci i cinci de grade ca s stea cu faa la aparat i a nceput s atepte mesajul. Nu era capabil s se relaxeze, nu putea nici mcar s se sprijine de sptarul scaunului. A preferat s-i umple timpul trecnd n revist lanul evenimentelor, de la nceputul nceputului. Oricum nu putea face altceva dect s revad trecutul. ntrebarea Cnd va veni faxul? nu-i ddea pace i nu se simea n stare s nceap o nou analiz. Aparatul a nceput n sfrit s bzie i rola de hrtie s se desfoare. A ateptat pn cnd zgomotul a ncetat, apoi s-a ridicat i a smuls hrtia. S-a aezat la loc, a ntins faxul pe birou i l-a citit: Destinatar: Dr. Ando, Facultatea de Medicin, Universitatea Fukuzawa Iat biletul pe care l-au lsat dl i dna Oda. V rog s m inei la curent cu noutile. Dr. Yokota Facultatea de Medicin Universitatea Joji Sub nota scris n grab erau cteva rnduri nsoite de numele celor doi Oda. Scrisul, tot de mn, era diferit de cel al lui Yokota.
175

Omul fotocopiase originalul. 28 octombrie, dimineaa Am luat asupra noastr sarcina de a rezolva problema casetelor. Nu mai exist niciun motiv de ngrijorare. Suntem obosii. Yoshimi i Kazuko, v rugm s avei grij de toate. Toru Oda Setsuko Oda Dei era foarte concis, mesajul demonstra fr niciun dubiu c btrnii tiau c i ateapt moartea. Yoshimi i Kazuko erau, probabil, singurele lor fete. Dar cui i era adresat propoziia precedent? i cum adic au rezolvat problema casetelor? Ce nsemna asta, c scpaser de ele? n niciun caz nu reieea c le copiaser. Ando s-a hotrt s reconstituie starea de spirit a btrnilor din ziua respectiv. Duminic, 21 octombrie, ginerele lor a aprut din senin i le-a spus c Shizu i Yoko erau n pericol din cauza unui blestem transmis prin intermediul unei nregistrri video. Domnul i doamna Oda au fost de acord s copieze caseta. Dar apoi, n cursul aceleiai zile, Shizu i Yoko au murit la ora-limit. Chiar dac btrnii trataser iniial cu scepticism explicaia lui Asakawa, erau obligai acum s accepte puterea nefast a casetei. Mai trziu, dup nmormntare, au aflat i rezultatele autopsiilor: moarte prin stop cardiac, din cauze necunoscute. n momentul acela, btrnii i-au pierdut orice speran c s-ar mai putea salva. Fiica i nepoata lor muriser, n ciuda faptului c respectaser instruciunile din nregistrare. Domnul i doamna Oda erau, fr ndoial, convini c nu vor reui s-i schimbe soarta, indiferent ce-ar face. Epuizai de durere, de efort, de emoiile provocate de nmormntare i, cine tie, poate obosii oricum de via, s-au hotrt s nu mai copieze caseta i au ateptat clipa morii. Dar, dac biletul lor de adio spunea
176

adevrul, nainte de asta rezolvaser problema casetelor, cauza nenorocirii care se abtuse asupra lor. Ando nu avea cum s ghiceasc n ce fel scpaser btrnii de casete. Poate c le terseser complet i apoi le aruncaser, sau le ngropaser n curte. n orice caz, n clipa cnd a nceput s traseze pe o foaie de hrtie traseul strbtut de caset, i-a spus c, deocamdat, ipoteza distrugerii celor dou copii era credibil. Iniial existase doar caseta gsit n cabana B-4, sursa tuturor relelor, creat ntr-un videorecorder care nregistra o emisiune de la televizor. Asakawa luase cu el acas aceast caset i fcuse o copie pentru Ryuji. n clipa aceea existau dou casete, dou puncte de rspndire a virusului. Dup toate probabilitile, copia lui Ryuji ajunsese n minile lui Mai Takano, care tersese toat nregistrarea, cu excepia primelor zece secunde. ntre timp, caseta lui Asakawa ajunsese la fratele lui, Junichiro, care o aruncase odat cu videorecorderul stricat. nregistrarea original de la Asakawa generase ns alte dou puncte de contaminare, sub forma copiilor fcute pentru domnul i doamna Oda, dar i acestea dou fuseser distruse. Pe scurt, imaginile izvorte din sufletul plin de ur al lui Sadako Yamamura dispruser de pe faa pmntului. Ando a verificat de mai multe ori diagrama arborescent pe care o desenase ca s fie sigur c nu greea. Caseta prea, ntr-adevr, s fi disprut definitiv. La numai dou luni dup ce se trezise la via ntr-o zi de la sfritul lui august, i dup ce curmase nou viei, blestemul se stinsese. Dar i-a spus Ando. Dac nregistrarea i-a ucis pe toi cei care au vizionat-o, indiferent dac ei copiaser sau nu caseta, era evident c, mai devreme sau mai trziu, ar fi disprut de la sine. Nu se putea reproduce dect prin ameninare, nu putea supravieui dect prin adaptare la mediu. n clipa cnd ameninarea s-ar fi dovedit o minciun, caseta ar fi pornit n mod inevitabil pe calea extinciei. Iar dac dispruse, nseamn c ei fcuser autopsiile ultimelor victime ale virusului misterios. i dac nimeni nu va mai vedea
177

vreodat imaginile acelea nefaste, puteau sta linitii, nimeni nu va mai muri prin stop cardiac provocat de blocarea arterei coronare. Dar n mintea lui Ando s-a insinuat brusc o ntrebare crucial: De ce n-a murit Asakawa? i apoi alta: Unde este Mai Takano? Logica i spunea c nregistrarea era de domeniul trecutului, iar intuiia exact contrariul. Era imposibil ca totul s se ncheie aa uor. Ceva nu se potrivea.

178

3
Ando a luat o cheie de la bibliotecar, apoi, n drum spre fiete, i-a scos jacheta. Iarna aproape se instalase. Oricine l-ar fi vzut doar n cma ar fi nceput s tremure de mila lui. Dar Ando transpira abundent i, chiar numai n cmaa aceea subire, tot i se prea sufocant de cald n biblioteca dotat cu instalaie de climatizare. A scos din serviet un pix i un carnet, apoi i-a aruncat haina peste serviet i le-a pus pe amndou ntr-un fiet. inea n carnet hrtia cu rezultatele analizei secveniale a virusului gsit n corpul lui Ryuji. Era ferm hotrt s sparg codul chiar azi exact din acest motiv venise la bibliotec de la prima or a dimineii , dar, cnd s-a uitat iar la irul de litere aparent fr sens de pe pagina de imprimant, ochii i s-au nceoat. Nu, n niciun caz nu era n stare s decripteze cifrul. Cnd s-a gndit mai bine, i-a amintit ns c fcea asta i ca s-i omoare timpul. Oricum nu avea o ocupaie mai bun care s-l ajute s treac peste cele trei zile de weekend. A pornit, aadar, cu carnetul sub bra, spre sala de lectur de la etajul al treilea, unde a ales un loc la fereastr. n vremea studeniei, cnd se juca cu Ryuji de-a sprgtorul de coduri, avea acas un numr respectabil de lucrri de criptografie. Dar dup cstorie i dup divor se mutase deja de trei ori, fr a mai pune la socoteal faptul c-i pierduse complet interesul pentru acest subiect. Existau anumite coduri pe care n-ar fi avut nicio ans s le descifreze fr ajutorul diagramelor de substituie i al graficelor de frecven a literelor, iar acestea se gseau numai n lucrrile de specialitate. Se ndoia c ar fi fost capabil s obin vreun rezultat fr ajutorul lor. Cum ar fi fost o nebunie s cumpere
179

iar crile, se gndise s mearg la bibliotec. Cndva stpnea bine bazele criptrii i decriptrii, dar de-atunci trecuser zece ani, aa c a nceput prin a face un tur rapid al subiectului. A hotrt c n prima etap trebuia s stabileasc tipul de cifru inclus n secvena de baze a virusului. Codurile pot fi mprite de obicei n trei mari categorii: de substituie, n care literele mesajului sunt nlocuite cu alte litere, simboluri sau numere; de transpunere, n care se schimb ordinea cuvintelor din mesaj; de inserie, n care sunt introduse alte cuvinte ntre cuvintele mesajului. Numerele care apruser din cadavrul lui Ryuji dup autopsie, cele care l conduseser pe Ando la cuvntul ring, erau un exemplu foarte bun de cod elementar de substituie. Nu i-a luat prea mult pn s-i dea seama c i cifrul din virus intra n aceeai categorie. Materialul de lucru era n acest caz un grup de patru litere, ATGC, care corespundeau celor patru baze, aadar era mai mult dect probabil c cifrul fusese constituit prin echivalarea unei anumite litere cu un grup predeterminat de alte litere. Ce putea fi mai evident? Un cod evident. Cnd a rostit aceste cuvinte n minte, s-a ridicat de pe scaun i a nceput s se gndeasc. Scopul principal al unui cod este s ascund informaiile fa de tabra advers, dar n aa fel nct nicio ter parte s nu fie capabil s le descifreze. n studenie, codurile erau pentru ei simple jocuri, simple exerciii de logic. n alte cazuri ns, de exemplu n timpul unui conflict militar, folosirea unui cod evident ar fi fost mult prea riscant. Cu alte cuvinte, una dintre metodele de a-l mpiedica pe inamic s-i sparg codul ar fi s-l deghizezi n aa fel nct s nu semene cu un cod, cel puin la prima privire. Dac prinzi un spion inamic i gseti asupra lui un carneel plin cu iruri suspecte de numere, poi s pariezi linitit c ai de-a face cu informaii strict secrete i criptate. Chiar dac ipoteza pistei false nu poate fi exclus, cnd un cod este identificat ca atare, ansele de a-l descifra cresc considerabil. Ando a ncercat s gndeasc logic. Dac scopul unui cod este s
180

protejeze informaiile de ochii taberei inamice, atunci trebuie s fie evident doar pentru ochii destinatarului. Continund s priveasc fix cele patruzeci i dou de litere intercalate n secvena de baze a virusului, a constatat c artau evident ca un cod. Avusese aceast impresie nc de cnd vzuse prima dat diagrama. Dar de ce aa? A ncercat s analizeze cauza impresiei. De ce i se prea c arat ca un cod? Nu era prima dat cnd ntlnea repetiii ciudate n rezultatele analizelor secveniale de ADN. n ciuda acestei realiti, repetiia pe care o avea acum n fa prea s aib o logic. Aprea peste tot n irul de baze, indiferent de punctul n care l secionaser. Parc ncerca s atrag atenia asupra ei, parc spunea Da, sunt un cod, prostule. Iar irul de litere i se prea i mai asemntor cu un cod cnd i amintea de ntmplarea cu numerele care apruser din abdomenul lui Ryuji. Cu alte cuvinte, poate c apariia cuvntului ring n acel moment avea de fapt dou scopuri: s-i transmit lui Ando informaia despre existena raportului Ring, dar i s-l avertizeze. Era ca i cum Ryuji i-ar fi spus de-a dreptul: S-ar putea s mai folosesc coduri dac va fi necesar, aadar casc bine ochii ca s nu-i scape. Poate c folosirea celui mai simplu cod de substituie era tocmai un indiciu. innd cont de faptul c irul ciudat de baze fusese gsit doar n virusul prelevat din cadavrul lui Ryuji, era rezonabil s presupun c Ryuji nsui i trimisese mesajul. Era, bineneles, un adevr indiscutabil c Ryuji murise. Cadavrul lui se transformase n cenu, dar n laborator mai exista o prob de esut. i nenumrate secvene din ADN-ul lui, planul entitii unice care fusese Ryuji, existau n continuare n acea prob. Ce s-ar fi ntmplat dac ADNul ar fi motenit voina lui Ryuji i ar fi ncercat s se exprime n cuvinte? Era o teorie absurd, total nedemn de un om de tiin ca Ando. Dar, dac ar reui s stoarc cuvinte din irul de litere folosind metoda substituiei, toate celelalte interpretri ale situaiei de fa ar
181

fi scoase din cauz. n teorie, ar fi posibil s iei ADN-ul din sngele lui Ryuji i s-l foloseti pentru a obine un individ identic, o clon. Poate c ADN-ul cu voin exercitase o anumit influen asupra virusului care ptrunsese n snge i imprimase n el un mesaj format din cuvinte. Brusc, Ando a avut impresia c simte n spatele acestei poveti geniul pur al lui Ryuji. De ce s introduc mesajul doar n virus, n invadator, nu i n propriile lui celule roii? Pentru c, avnd pregtire medical, Ryuji tia c nimeni n-ar fi fcut vreodat analiza secvenial a ADN-ului din alte celule. tia c numai virusul rspunztor de moartea attor oameni va fi analizat secvenial, aa c i concentrase eforturile asupra ADN-ului din virus. Ca s fie sigur c mesajul pe care l trimite va ajunge unde trebuie. Iar toate acestea l conduceau pe Ando la o singur concluzie: din moment ce codul aprea n ochii lui exact ca un cod, n principiu nu mai putea s funcioneze ca un cod. Adevrul era, mai degrab, c ADN-ul lui Ryuji nu avea alt cale de comunicare cu lumea exterioar. Spirala dubl a ADN-ului este compus din patru baze reprezentate prin literele ATGC. Ando nu putea concepe alt cale de comunicare dect combinarea celor patru litere n diferite moduri. Ryuji alesese aceast metod pentru c nu avea alta la dispoziie. Era singura la care putuse apela. Disperarea care l copleise cu cteva clipe n urm a disprut brusc i a fost nlocuit de o convingere ferm. Pn la urm, s-ar putea s descifrez mesajul. i venea s strige de bucurie. Dac voina lui Ryuji, concentrat n ADN, ncerca s-i vorbeasc, atunci era firesc s foloseasc cuvinte pe care Ando le-ar fi putut descifra cu uurin. Ce rost ar fi avut s fie mai complicate dect un minimum necesar? Ando a luat-o de la capt i a verificat irul logic pentru a vedea dac deduciile lui aveau vreo hib. Dac pornea cu stngul, risca s rtceasc la nesfrit fr s gseasc rspunsul. Nu mai avea impresia c i omoar timpul. Acum, cnd simea
182

c are anse mari s descifreze mesajul, ardea de nerbdare s afle ce voia Ryuji s-i transmit. Tot restul dimineii, pn la prnz, Ando a abordat problema n dou moduri. irul cu care trebuia s lucreze era urmtorul: ATGGAAGAAGAATATCGTTATATTCCTCCTCC TEAACAACAA Prima ntrebare pe care i-a pus-o a fost cum putea s mpart literele. A ncercat s le aeze n grupuri de cte dou i trei. Mai nti perechi: AT TA CC CA GG TC TC AC AA GT CT AA GA TA CC AG TA TC AA TT AA

Considernd c o pereche de litere era o unitate, cele patru litere pe care le avea la dispoziie puteau s formeze aisprezece combinaii diferite. S-a ntrebat dac fiecare combinaie reprezenta o liter. Dar aceast ipotez l-a condus imediat la alt problem: n ce limb era scris mesajul? Probabil c nu n japonez, care folosea aproape cincizeci de caractere, mult mai multe dect cele aisprezece permise de aplicarea metodei perechilor. Engleza i franceza au fiecare douzeci i ase de litere, iar italiana doar douzeci. Dar Ando tia c nu poate exclude posibilitatea ca mesajul s fi fost scris n japoneza romanizat. Dac reuea s identifice limba, btlia era pe jumtate ctigat. Dar, de fapt, rezolvase deja aceast problem. Faptul c reuise s obin cuvntul ring din cifrele 178136 era un indiciu c i acest
183

mesaj fusese transmis n englez. Ando era aproape sigur. Prin urmare, problema limbii era soluionat. Cele patruzeci i dou de litere care desemnau bazele puteau fi mprite n douzeci i una de perechi, dar cteva se repetau: de patru ori AA, de trei ori TA, de trei ori TE i de dou ori CE. Existau doar treisprezece perechi unice. Ando a scris numerele pe o foaie de hrtie, apoi a rsfoit o carte despre decriptare pn a gsit diagrama frecvenei de apariie a literelor alfabetului n limba englez. Dei alfabetul limbii engleze are douzeci i ase de litere, n vorbirea i scrierea de zi cu zi ele sunt folosite n proporii diferite. De exemplu E, T i A sunt comune, n vreme ce Q i Z apar doar o dat sau de dou ori ntr-o pagin. Majoritatea manualelor de decriptare au la sfrit tot felul de diagrame de frecven i alte instrumente statistice. Scopul lor este s uureze efortul specialistului de a afla n ce limb a fost scris mesajul codificat. n cazul acesta, cifrele i spuneau c ntr-o propoziie de douzeci i una de litere scris n englez erau folosite n medie dousprezece litere diferite. Ando a btut cu piciorul n podea. El avea treisprezece litere, foarte aproape de medie. Iar asta i spunea c, din punct de vedere statistic, nu greise deloc cnd mprise irul n douzeci i una de perechi i considerase c fiecare pereche reprezint o liter. Lsnd deocamdat deoparte aceast ipotez, Ando a ncercat s despart irul n grupuri de cte trei: ATG GAA GAA GAA TAT CGT TAT ATT CCT CCT CCT CAA CAA CAA Prin urmare, paisprezece grupuri, din care apte unice: GAA, TAT, CGT, ATT, CCT i CAA. Diagramele i-au artat c o propoziie de paisprezece litere scris n englez folosete n medie nou litere diferite. Deloc departe de cele apte pe care le obinuse
184

el. Ando a observat imediat c acest sistem producea o redundan puternic. GAA, CCT i CAA apreau fiecare de trei ori, iar TAT doar de dou ori. Dar cel mai mult l deranja faptul c GAA, CCT i CAA apreau de cte trei ori la rnd. Dac aloca fiecrui triplet o singur liter din alfabet, n textul i aa scurt existau trei cazuri n care aceeai liter se repeta de trei ori. Vorbea engleza suficient de bine nct s tie c dublarea literelor nu era neobinuit, dar nu reuea s-i aminteasc niciun cuvnt cu liter tripl. Singura concluzie la care a reuit s ajung a fost c un cuvnt se termina cu dublarea literei, iar urmtorul ncepea cu aceeai liter, de exemplu too old sau will link. A luat de pe mas o carte n englez pe care o vzuse acolo mai devreme i a nceput s citeasc la ntmplare cte o pagin, pentru a verifica frecvena de apariie a literelor repetate de trei ori. Abia dup patru sau cinci pagini a gsit prima situaie de acest fel. Probabilitatea ca repetarea s apar de trei ori ntr-un text de paisprezece litere era practic nul, a conchis el. Dimpotriv, prin mprirea celor patruzeci i dou de litere n perechi obinuse doar o singur repetare dubl. A hotrt, aadar, c, din punct de vedere statistic, era mult mai raional s adopte prima soluie, adic s mpart irul de baze n perechi de litere. n felul acesta micorase numrul posibilitilor i de aici nainte putea continua prin eliminare. AT TA CC CA GG TC TC AC AA GT CT AA GA TA CC
AG TA TC

AA TT AA

Perechea AA aprea de patru ori, adic n mod sigur era corespondentul unei litere folosite cu frecven mare. Deschiznd manualul la alt diagram, Ando s-a asigurat c litera cea mai
185

folosit din alfabetul limbii engleze era, bineneles, E. Putea s porneasc de la ipoteza c grupul AA reprezenta litera E. Pe locul doi n ordinea frecvenei apreau grupurile TA i TC, fiecare de trei ori. A mai observat c grupul AA era urmat o singur dat de TA i precedat o singur dat de TC. Putea fi un aspect important, din moment ce existau statistici precise i pentru diferitele combinaii de litere. A nceput s experimenteze cu grupurile TA i TC, verificnd mereu diagramele. Dintre toate literele care urmeaz literei E i care sunt de asemenea folosite frecvent i de sine stttor, litera A prea cel mai plauzibil candidat, ceea ce nsemna c perechea TA putea fi echivalent cu A. Urmnd acelai fir logic, a presupus c TC ar putea s corespund literei T. A dedus n continuare, din felul n care se combina cu celelalte litere, c CC putea fi N. Pn aici, datele statistice l ajutaser perfect. A scris rezultatul pe hrtie: _ _E_ _E A T_A A_N T_N T E_ _E irul care nainte i se pruse o amestectur alandala de litere ncepea s semene ct de ct cu un text n englez. A ncercat apoi s umple golurile, bazndu-se pe ceea ce tia despre combinaiile de consoane i vocale i verificnd mereu diagramele. SHERDEATYAALNTINTECME Primele trei litere preau s alctuiasc cuvntul she, dar cu restul n-a reuit s formeze niciun alt cuvnt, dei le-a desprit n toate felurile posibile. A ncercat s fac permutri ntre literele E, A, T i N i a schimbat la inspiraie i poziiile altor litere. Cnd i-a dat seama c i-ar fi luat prea mult timp s scrie toate combinaiile posibile pe hrtie, a rupt pagini din carnet i a fcut douzeci i ase de bileele, cte unul pentru fiecare liter. ncepea s semene cu un
186

joc. THEYWERBORRLNBINBECME Cnd a ajuns la aceast combinaie, primul lucru care i-a trecut prin minte a fost propoziia they were born. tia c nu era scris corect, dar poate c nu se hazardase prea mult. Pe deasupra, semnificaia cuvintelor i atingea o coard sensibil. Ando avea totui senzaia c exista o combinaie mai potrivit, aa c a continuat s se joace. Dup vreo zece minute de ncercri, i s-a prut c ghicete rezultatul i s-a oprit. A oftat, gndindu-se c un calculator i-ar fi uurat mult munca. A treia, a asea, a optsprezecea i a douzeci i una liter erau una i aceeai. A aptea, a zecea i a unsprezecea la fel. A opta, a paisprezecea i a aptesprezecea de asemenea. La fel a treisprezecea i a aisprezecea. Propoziia sau fraza era format din douzeci i una de litere. Dac ar fi introdus toate aceste date ntrun calculator, probabil c ar fi obinut rspunsul corect, cu condiia s stabileasc precis frecvena de utilizare a literelor. Computerul iar fi oferit, oricum, mai multe soluii posibile. Probabil c n limba englez exista un numr infinit de fraze inteligibile care respectau aceste reguli. Cum ar fi putut s aleag dintre ele mesajul pe care i-l trimisese Ryuji? Ar fi reuit numai dac ar fi observat de la prima privire c acela, i nu altul este mesajul corect, de exemplu dac ar fi gsit o semntur la sfrit. Fr un asemenea indiciu s-ar fi rtcit printre posibiliti. Ando i-a dat seama c ajunsese ntr-un impas. i-a lsat capul n mini. Se simea ca un prost din cauz c nu observase asta mai repede. Cu ani n urm, cnd era student i cnd intuiia lui de sprgtor de coduri era mult mai fin, ar fi ajuns n acelai punct dup un minut sau dou. Trebuia s-i schimbe complet sistemul de gndire. Trebuia s gseasc o nou ipotez. Fusese att de absorbit, nct pierduse noiunea timpului. S-a
187

uitat la ceas i a constatat surprins c era aproape unu. i-a dat seama c era hmesit. S-a ridicat de pe scaun, gndindu-se s mnnce de prnz la braseria de la etajul al patrulea. I-ar fi fcut bine o schimbare de decor. ncercri prin eliminare i inspiraie. Dac voia s descopere soluia, avea nevoie de amndou. I se ntmpla adesea s-i gseasc inspiraia n timp ce mnca. Rspunsul trebuie s fie la mintea cocoului. n drum spre braserie a continuat s murmure aceste cuvinte ca pe o incantaie.

188

4
n timp ce-i lua prnzul, Ando s-a uitat pe fereastr la copacii de jos i la copiii care se ddeau n leagnele i balansoarele din parc. Trecuse bine de unu. Cnd intrase, localul era nesat, dar acum se vedeau ici i colo scaune libere. Pusese hrtia cu irul de baze pe mas, lng tava de aluminiu, dar nu se uitase la ea. Unul dintre pereii braseriei era n ntregime din sticl, aadar nu exista niciun obstacol ntre el i scena de jos. Parc se uita la un film mut. De fiecare dat cnd vedea un bieel de patru-cinci ani, Ando nu mai era n stare s-i ia privirea de la el. Fr s vrea, se uita fix la copil, i de obicei treceau cteva minute pn reuea s ias din trans. O dat venise la bibliotec cu fiul lui. Era o dup-amiaz de duminic, cu doi ani n urm, cnd mai locuiau nc n apartamentul din Aoyama-Sud. Ando i adusese aminte n ultima clip c trebuia s verifice nite date pentru lucrarea pe care urma so prezinte la o conferin tiinific, aa c se hotrse s fac un drum pn la bibliotec. l luase i pe Takanori la o plimbare. Dar, cnd ajunseser aici, Ando citise pe o plcu de la intrare Accesul interzis persoanelor sub 18 ani. Nu putea s-l lase pe biat afar n timp ce el cuta lucrrile de care avea nevoie, aa c renunase i se jucaser n parc. i amintea c se postase n spatele unui leagn i-i fcuse vnt lui Takanori, i amintea ritmul pendulrii. Acelai leagn se mica i acum sub frunzele aurii ale copacilor ginkgo. Nu auzea niciun sunet, nu putea nici mcar s disting expresiile copiilor care-i ntindeau i i strngeau picioarele n ritmul balansului. Dar auzea perfect n minte glasul fiului su. i-a dat seama c deviase de la int. S-a uitat din nou la hrtia de
189

pe mas i a scos pixul din buzunar. Venise timpul s se ntoarc la elementele de baz ale decriptrii. Singura cale de a descifra un asemenea tip de cod era s porneasc de la cteva ipoteze diferite i apoi s le verifice pe fiecare n parte. Cnd una dintre ele s-ar fi dovedit greit, cel mai bun lucru pe care-l putea face era s-o abandoneze imediat i s treac la urmtoarea. Pentru c mesajul avea numai douzeci i una de litere, nu putea s se bizuie doar pe diagramele de frecven i pe tiparele de combinare. De fapt, dac cifrul ar fi att de complex nct s cear folosirea unei chei unice de conversie, ar fi n acelai timp mult prea dificil i nu i-ar mai atinge scopul, acela de a-i transmite mesajul. Nu, era obligat s lucreze bbete, s-i croiasc drum nainte pornind de la cteva teorii. Dac una dintre ele se dovedea nefuncional, trebuia s-o lase balt, atta tot. Exista totui o ipotez pe care Ando avea impresia c o abandonase prea repede: ideea c cifrul putea fi o anagram. S-a ntors n sala de lectur i a desprit din nou cele patruzeci i dou de litere n grupuri de cte trei: ATG GAA CGT TAT CCT CAA GAA GAA TAT ATT CCT CCT CAA CAA

Abandonase aceast abordare pentru c obinuse astfel repetiii triple ale aceleiai litere, un caz extrem de rar n englez. Dar dac soluia era s rearanjeze literele? S-a gndit la un exemplu pe care-l citise cndva: propoziia Bob opened the door fusese codificat sub forma OOOOEEEBBDDTPNHR. Sub aceast form, irul coninea mult prea multe repetiii pentru a fi considerat un text n limba englez, dar dac literele erau rearanjate dup anumite reguli, se dovedea c reprezint o propoziie cu o semnificaie precis. S-ar putea s mearg, i-a spus Ando. S-a oprit brusc, exact n clipa cnd se pregtea s pun pixul pe
190

hrtie. La fel ca mai devreme, i dduse seama unde ar fi ajuns aa. Dac, pe lng faptul c trebuia s aloce fiecrui triplet cte o liter, ar fi fost constrns s gseasc i aranjamentul potrivit, s-ar fi confruntat cu o sarcin imposibil. i nu era doar o chestiune de timp. Fr cheia mesajului, ar fi sfrit de fiecare dat n impasul n care ajunsese la nceput: nenumrate soluii posibile i nicio posibilitate de a alege una dintre ele. S-a gndit iar la numerele carel conduseser la cuvntul ring i s-a ntrebat dac nu cumva chiar ele erau cheia, dac nu-i indicau cum s aranjeze literele din mesaj. Dar mai nti trebuia s afle ce liter corespundea fiecrui triplet. Alt impas. Ai nevoie de o abordare nou, i-a spus Ando. ncercase s nainteze prin ncercri i eliminri succesive, dar avea senzaia c se nvrtete n cerc. Poate c se agase prea tare de ideea c fiecare set de dou sau trei baze corespunde unei litere a alfabetului limbii engleze. Soluia este n mod sigur simpl i evident, una pe care ar trebui s-o gsesc fr s trec printr-un proces lung i complicat. A simit c i pierde concentrarea i privirea lui a nceput s rtceasc prin sal. S-a pomenit c se uita fix la prul unei femei tinere care se aezase la cellalt capt al mesei. Aa cum sttea, cu capul plecat, semna cu Mai Takano. Unde este acum? i fcea griji pentru ea, mai ales cnd se gndea c fusese iubita lui Ryuji. Oare Ryuji a ncercat s-mi spun n mesajul lui cifrat unde e fata? A cntrit o vreme aceast posibilitate, dar a renunat la ea, zmbind n sinea lui: era o soluie demn de benzile desenate. Ce reacie de adolescent, s viseze c era detectivul particular infailibil care o salveaz pe eroin dintr-un pericol mortal! Deodat, toat povestea i s-a prut ridicol. Probabil c nici mcar nu era un cod. Probabil c apariia secvenei de baze n ADN-ul virusului avea o explicaie tiinific precis. i, imediat ce Ando a admis aceast
191

posibilitate, entuziasmul lui pentru decriptarea aa-zisului mesaj a disprut complet. Parc i omora timpul, nu-i aa? Dac da, atunci muncise pe brnci pentru asta. Razele soarelui care asfinea i colorau prul de pe brae n auriu. Pasiunea care-l pusese n micare dimineaa se evaporase. S-a gndit s se mute pe alt scaun, ntr-un loc unde nu btea soarele, i s-a ridicat n picioare. Totui, privind n jur, a vzut c era nconjurat de copii, de studeni i elevi de liceu care nvau pentru examene, toi moind n spatele unor muni de cri. Schimbarea locului nu era o soluie, nu aa putea s-i recapete concentrarea. Toat sala prea copleit de letargie. Ando s-a aezat la loc. Gndete logic, i-a spus. Trebuie s existe o formul. i-a ndreptat spatele. Pn acum ncercase s stabileasc o coresponden ntre literele alfabetului i tripletele de baze, dar aa nu reuise s gseasc nicio formul. Dac ar fi reuit s stabileasc o coresponden simpl, de unu la unu, sau chiar una de multiplu la unu, i s-o exprime printr-o funcie, ar fi obinut i rspunsul. Trebuia s existe o formul care putea fi identificat. S-a ridicat iar n picioare. Logic vorbind, nu exista alt cale. Intuiia i spunea c ajunsese cu un pas mai aproape de soluie, iar aceast constatare i-a alungat lncezeala i l-a mpins s acioneze. S-a dus la secia de tiine naturale, a gsit un tratat despre ADN i a nceput s-l rsfoiasc cu micri febrile. Pe msur ce entuziasmul lui cretea, transpira tot mai tare. Cuta un tabel care s-i arate corespondena dintre aminoacizi i tripleii de baze. n cele din urm, l-a gsit. A luat cartea la mas i a aezat-o n faa lui, deschis, lng mesajul cifrat. Cnd un triplet de baze un codon formeaz o protein, codonul se transform ntr-un aminoacid. Regulile acestei transformri erau sintetizate n tabelul pe care-l gsise. Exist douzeci de tipuri de aminoacizi. Exist i patru baze, ceea ce nseamn c sunt posibile aizeci i patru de combinaii diferite de cte trei. aizeci i patru de combinaii pentru numai douzeci de
192

aminoacizi, adic un grad destul de ridicat de suprapunere. Era o coresponden de multiplu la unu. Fiecare grup de baze desemna un aminoacid sau altul, sau un stop. Studiind tabelul, Ando a scris abrevierile aminoacizilor sub cele patruzeci i dou de baze ale codului. ATG (Met) TAT (Tyr) CCT (Pro) CAA (Gln) GAA (Glu) CGT (Arg) CCT (Pro) CAA (Gln) GAA (Glu) TAT (Tyr) CCT (Pro) GAA (Glu) ATT (Ile) CAA (Gln)

A luat apoi prima liter din denumirea fiecrui acid i a obinut un ir: MGGGTATIPPPGGG Dar irul nu avea nicio semnificaie i se confrunta n continuare cu combinaiile de trei litere. Trebuia s existe o alt cale de interpretare. De exemplu, poate c tripla repetare a unei litere nsemna c primele dou erau spaiul alb dintre cuvinte. A ncercat aa: MG TATIP G

Nici acestea nu erau cuvinte n englez. n pofida acestei nereuite, Ando simea c merge n direcia bun. Era aproape convins c se apropie de soluie. Nu tia de ce, dar avea senzaia c va descoperi dintr-o clip n alta un cuvnt care s nsemne ceva.
193

Glu, Pro i Gl n se repetau de trei ori. A ncercat s le scrie altfel: Met Glu (x3) Tyr Arg Tyr Ile Pro (x3) Gln (x3) S-a uitat la list cam un minut, apoi a observat un cuvnt englezesc pe care-l cunotea. i venise ideea c acei codoni care se repetau de trei ori nu nsemnau trei, ci a treia. Adic a treia liter a abrevierii pentru aminoacidul respectiv. Cu alte cuvinte: Met Glu Tyr Arg Tyr Ile Pro Gln Soluia era Mutation. Uitnd unde se afla, Ando a gemut fr s vrea. Singurul rspuns pe care reuise s-l obin rezultatul logicii, metodei, experimentrii i erorii era chiar acesta. Un rspuns simplu, precis. Nu putea fi dect corect.
194

Dar nc nu scpase de btile de cap. Cunotea foarte bine semnificaia cuvntului mutation adic tia ce nseamn din punctul de vedere al evoluiei organismelor. Nu avea ns nici cea mai mic idee cum s-l interpreteze n contextul dat. Ce naiba ncerci s-mi spui, Ryuji? Nu rostise ntrebarea cu glas tare, ns chiar aa, pronunnd-o doar n minte, Ando i auzise vocea tremurnd de exaltare. Descifrase mesajul.

195

5
S-a dus la intrare, s-a oprit la primul telefon public i a format numrul lui Miyashita. Nu se atepta s-l gseasc acas pe colegul lui innd cont c era duminic seara i, pe deasupra, mijlocul unui weekend de trei zile , dar n ciuda sorilor potrivnici, Miyashita rmsese ntre patru perei cu familia. Ando a reuit s-i spun c descifrase codul. i-a nchipuit c Miyashita se afla n sufragerie. De fapt, l vedea n faa ochilor, mpreun cu soia i copilul, pregtindu-se pentru cin. Miyashita chiar i pusese palma cu n jurul microfonului pentru a atenua glgia din fundal, dar nu reuea s reduc sonorul vieii lui de familie, care se strecura pe fir pn la Ando. Bravo ie, excelent! Ce spune? Miyashita avea oricum o voce puternic i, cum inea mna plnie la microfon, aproape c-l asurzea pe Ando. Pn la urm, nu era o propoziie. Doar un singur cuvnt. Bun, un singur cuvnt. Care? Mutaie. Mutaie? Miyashita a repetat cuvntul de cteva ori, ca i cum l cntrea. Ai idee ce nseamn? a ntrebat Ando. Nu tiu. Dar tu? i-a venit vreo idee? Nimic. Ascult, ce-ar fi s vii pn aici? Miyashita locuia la Terao, n sectorul Tsurumi din Yokohama, ntr-un apartament aranjat cu gust. Ando trebuia s ia metroul pn la Shinagawa i acolo s treac pe linia Keihin Expres, dar drumul n-ar fi durat mai mult de-o or.
196

Bine, vin. Sun-m cnd ajungi n staie. tiu un brule bun chiar alturi, unde putem s bem un pahar i s discutm n linite. Se pare c fetia de civa ani a lui Miyashita ghicise ce plnuia tatl ei. S-a agat de pantalonii lui i a scncit: Rmi acas, tati! Din respect pentru Ando, Miyashita a acoperit microfonul cu palma i a gonit-o. Ando l-a auzit cum umbla prin cas cu telefonul n mn, ncercnd s scape de ea. S-a simit vinovat, chiar dac nu venise el cu propunerea s discute afar. n acelai timp, l-au copleit amrciunea pierderii suferite i invidia. Putem s-o lsm pe alt dat, dac vrei. Dar Miyashita nici nu voia s aud: n niciun caz. Abia atept s-mi spui toate amnuntele. Bun, sun-m din staie i cobor imediat. A nchis, fr s mai atepte rspunsul lui Ando. Oftnd din greu, Ando a ieit din bibliotec i a pornit spre staia de metrou. nc mai auzea sunetele plcute din casa prietenului su. Ando nu mai cltorise de mai bine de-o sptmn pe linia Keihin Expres, din ziua cnd se dusese acas la Mai. Nu mult dup staia Kita Shinagawa trenul circula la suprafa, pe o linie suspendat. S-a pomenit uitndu-se n jos, la cldiri i la firmele luminoase. Era ase, ntr-o sear de la sfritul lui noiembrie, i se fcuse deja aproape noapte. ntorcndu-i privirea n direcia portului, spre Yoshio, a vzut blocurile cu apartamente rsfirate dea lungul canalului. Ferestrele lor luminate i ntunecate formau un model asemntor cu o tabl de ah. Pentru o sear de weekend, luminile strluceau la uimitor de puine ferestre. Ando a ncercat involuntar s disting cuvintele ascunse n tiparul de ptrate argintii i negre. n ultima vreme se gndise prea mult la coduri. I sa prut c vede pe una dintre faadele din pdurea de blocuri silaba fonetic ko copil , dar bineneles c era o iluzie. Mutaie. Mutaie.
197

n timp ce privea n deprtare, a continuat s murmure cuvntul. Spera, n mod absurd, c repetarea incantaiei va da un sens mesajului transmis de Ryuji. n deprtare s-a auzit o siren de cea. Trenul s-a strecurat ntr-o staie i a rmas pe loc, iar cltorii au fost anunai c atepta s treac un expres. Ando se afla n ultimul vagon. i-a scos capul pe u ca s vad numele staiei. A constatat, fr s se mire, c era staia de lng garsoniera lui Mai. De acolo, din tren, putea s vad strada mrginit de magazine i, dup cteva clipe, a nceput s caute fereastra lui Mai, scotocind prin amintirile sale vechi de opt zile. i-a amintit c atunci, n garsonier, cnd se uitase pe fereastr, vzuse staia chiar la nivelul ochilor. Vzuse cltorii care ateptau pe peron, prin urmare putea s zreasc de-acolo fereastra ei. Cum nu avea un unghi de observaie prea bun din vagonul n care se afla, a cobort din tren. A mers pn la captul peronului i s-a uitat peste palisad. Strada cu magazine se ntindea spre est, fcnd un unghi drept cu linia metroului. A vzut, la nici dou sute de metri, un bloc cu apte etaje pe care l-a recunoscut imediat. Deodat a auzit zgomotul expresului care se apropia dinspre Shinagawa. Imediat dup trecerea lui, trenul local n care cltorise pn acolo trebuia s-i continue drumul spre Kawasaki. Ando a cutat repede fereastra ei. tia c garsoniera avea numrul 303, adic trebuia s fie a treia fereastr de la dreapta spre stnga. Expresul trecuse i acum se auzea clopoelul care anuna plecarea cursei locale. S-a uitat la ceas. ase i cteva minute. n clipa asta, Miyashita lua masa n familie. Ando nu voia s ajung acolo prea devreme i s-i rpeasc din timpul, i aa drmuit, pe care-l petrecea mpreun cu cei dragi. i-a fcut socoteala c avea un avans de aproximativ o jumtate de or, aa c s-a hotrt s nu se mai urce n trenul din care coborse, ci s-l ia pe urmtorul. Ferestrele de la etajul al treilea erau aproape la acelai nivel cu peronul. S-a uitat atent la fiecare, dar nu se zrea nicio raz de lumin.
198

Vaszic nu e aici. Sperana lui, i aa palid, s-a destrmat repede. Apoi, chiar n clipa cnd voia s renune, privirea i-a fost atras de o raz de lumin albstrie care juca pe fereastra a treia, numrnd de la dreapta. i-a mijit ochii, ntrebndu-se dac nu era o nchipuire, dar lumina licrea acolo, fluturnd ca un drapel alb-albstriu. Strlucea att de slab, aprea i disprea att de repede, nct n-ar fi observato dac nu s-ar fi uitat foarte atent. S-a aplecat i mai mult n fa, dar era prea departe. Nu putea s disting detalii. Voia s mearg acolo. I-ar fi luat doar douzeci de minute, poate mai mult, poate mai puin, adic ar fi reuit s prind la anc trenul urmtor. Fr s mai ezite, Ando a ieit repede pe lng casa de bilete i a cobort n strad. Abia cnd s-a oprit chiar sub fereastra ei i s-a uitat n sus i-a dat seama de unde venea ciudata lumin albastr. Fereastra era deschis i perdeaua de dantel alb flutura afar, n adierea blnd. Pe suprafaa imaculat se reflecta lumina firmei de neon a unei agenii de nchiriat automobile. Din cnd n cnd, culorile primare care strluceau pe estura alb preau pete de vopsea fluorescent, aa explicndu-se strlucirea albstruie abia vizibil din staie. n ciuda acestei constatri raionale, n mintea lui Ando au aprut mai multe semne de ntrebare. Cnd ajunsese acolo, acum opt zile, fereastra era deschis i perdeaua pe jumtate tras, dar i amintea perfect c nainte s plece nchisese fereastra i trsese perdeaua pn la capt. Era sigur c nu lsase fereastra aa. Dar altceva l deranja i mai mult. Adierea care sufla n aceast sear de sfrit de toamn era foarte slab, practic inexistent, i totui perdeaua flutura n exterior ntr-o poziie aproape orizontal. De unde venea curentul de aer? Nu numai c nu simea, dar nici nu auzea vntul. Frunzele copacilor de pe marginea strzii erau nemicate. i totui, perdeaua dansa n noapte chiar deasupra crengilor ncremenite. Scena era stranie, halucinant. Niciun trector nu-i ridicase privirea, nimeni nu prea s observe
199

fenomenul bizar. Singura explicaie pe care Ando a reuit s-o gseasc era de natur mecanic. Poate c n camer cineva pornise un ventilator puternic care sufla aerul n direcia ferestrei. Dar de ce? De-acum curiozitatea nu-i mai ddea pace. A mers de-a lungul cldirii i a intrat n hol. Singura cale de a dezlega misterul era s ajung din nou n garsonier. Probabil c administratorul i luase liber, pentru c perdeaua ghieului era tras. Cldirea era tcut i aparent pustie, toi locatarii stteau n apartamentele lor. A luat liftul pn la trei i a pornit spre numrul 303. Pe msur ce se apropia, mergea cu pai tot mai mici i mai rari. Instinctul i optea s se ntoarc, dar trebuia s tie. A vzut o u pe jumtate deschis. n spatele ei, scara de serviciu folosit doar n cazuri de urgen. Dac se ntmpl ceva, poate ar fi mai bine s nu m urc n lift. Poate ar trebui s cobor pe scri Chiar fr s tie exact de ce se temea, Ando i plnuia traseul de retragere. A ajuns la ua cu numrul 303. Sub sonerie era lipit aceeai etichet roie pe care scria Takano. Nimic nu se schimbase ntre timp. Ando a ntins mna spre buton, dar s-a rzgndit imediat. Asigurndu-se mai nti c holul era pustiu, i-a lipit urechea de u. N-a auzit niciun sunet, cu att mai puin zgomotul unui ventilator. S-a ntrebat dac n clipa aceea perdeaua de dantel mai flutura la fereastr. i venea greu s cread asta, innd cont c nu auzea nimic. Mai. n loc s apese pe butonul soneriei, i rostise numele, nu prea tare, i btuse la u. Niciun rspuns. Mai a vzut nregistrarea, i-a reamintit el. i, cu dou zile nainte de vizita lui, tot ea, sau altcineva, nregistrase altceva pe caset. A cincea zi de la dispariia fetei. Cine i de ce? Deodat Ando a simit iar n jurul lui atmosfera stranie din camer, senzaia c se afla n interiorul altui corp. Apa de pe fundul
200

czii scurgndu-se ncet. Atingerea uoar pe picior. A fcut civa pai napoi. n orice caz, toate cele patru copii ale casetei blestemate dispruser de pe faa pmntului. Criza se sfrise. Fr ndoial c fata avea s reapar foarte curnd. Orict m-a nvrti pe-aici, tot n-a reui s rezolv ceva, i-a spus el n timp ce mergea ctre lift. Era nerbdtor s ias de-acolo, chiar cu riscul de a rmne fr o explicaie. Nu tia de ce, dar i se prea c s-ar fi simit la fel ori de cte ori ar fi venit acolo. A apsat pe butonul ascensorului. n timp ce atepta, a repetat fr ncetare n gnd: Mutaie, mutaie Voia s se gndeasc la altceva, la orice altceva. Parc sttea acolo de-o venicie. A auzit n dreapta un clinchet metalic, zgomotul unei yale care se deschide. A rmas nemicat. n loc s se rsuceasc pe clcie i s se uite, i-a ntors capul numai puin, ct s vad coridorul cu coada ochiului. Ua cu numrul 303 se mica ncet spre exterior. Eticheta roie era perfect vizibil, nu se putea nela n privina numrului. Fr s vrea, a apsat de mai multe ori pe butonul liftului. Ascensorul urca nnebunitor de ncet. Din pragul uii s-a desprins o siluet i Ando s-a ncordat. Era o femeie mbrcat cu o rochie de un verde proaspt. Pe jumtate ntoars spre el, a scos o cheie din poet i a ncuiat ua. Ando i-a studiat faa. Purta ochelari de soare, dar i-a dat seama imediat c nu era Mai. Da, era alt persoan. N-avea niciun motiv s se team, dar n clipa aceea trupul lui nu mai asculta comenzile raiunii. Uile liftului s-au deschis i Ando s-a strecurat nuntru. A vrut s apese pe butonul de nchidere, dar din greeal a apsat pe cellalt. Dup cteva secunde interminabile, uile au nceput s se nchid. Apoi, n ultima clip, o mn alb s-a strecurat n spaiul dintre ele i s-au ndeprtat iar una de alta. Femeia sttea n faa lui. Ochelarii de soare i mascau trsturile, dar Ando a observat c avea n jur de douzeci i cinci de ani i trsturi foarte regulate. innd mna pe marginea unei ui, a intrat repede n lift i a apsat pe butonul de nchidere, apoi pe cel pentru parter. Ando s-a dat
201

napoi civa centimetri, pn cnd coatele lui au atins peretele ascensorului i s-a pomenit c sttea pe vrfuri. A rmas n poziia aceea, uitndu-se fix la necunoscuta ciudat care ieise din garsoniera 303, iar mintea lui a proiectat spre ea, cu toat fora, o singur ntrebare: Cine eti? I-a ajuns n nri un miros ciudat, diferit de orice parfum pe care-l cunotea. S-a strmbat uor i i-a inut respiraia. Ce putea fi? Mirosea a fier, ca sngele. Femeia avea prul lung, pn la mijlocul spatelui, iar mna cu care se sprijinea de perete era att de alb, nct prea transparent. S-a uitat mai atent i a observat c unghia degetului arttor era rupt. Rochia ei cu mneci scurte era prea subire pentru luna noiembrie. Nu avea ciorapi i era nclat cu pantofi uori, fr toc. A vzut pe picioarele ei cteva vnti albstrui. Asta l-a ocat, dar n-ar fi putut spune de ce. Orict de tare ncerca, nu reuea s-i stpneasc tremurul care prea s urce din chiar fibra fiinei sale. nchis n cuca strmt a ascensorului mpreun cu femeia aceea, avea senzaia c timpul abia se trte. Liftul a ajuns n sfrit la parter i Ando a continuat s-i in respiraia n timp ce uile se deschideau. Femeia a strbtut repede holul i a disprut pe strad. Avea cam un metru cincizeci i cinci, o siluet bine proporionat i un mers uor. Rochia strmt i scurt cam zece centimetri deasupra genunchilor i scotea n eviden coapsele atrgtoare. Pentru c nu purta ciorapi, vntile de pe gambe contrastau foarte puternic cu albeaa picioarelor. Noaptea era att de rece, nct toi trectorii, fr excepie, purtau haine groase, dar ea plecase nepstoare, mbrcat doar cu o rochi subire de var. Ando a ieit din lift i a rmas o vreme acolo, uitndu-se n noapte.

202

6
Ando l-a ateptat pe Miyashita n faa bncii, aa cum l instruise colegul lui. Era o sear de weekend i banca era nchis. Din cauza obloanelor de metal care fuseser trase pn jos, trotuarul din fa avea un aspect bizar. Aici ntunericul era confortabil, dar n timp ce se uita dup Miyashita vedea n minte imaginea femeii care ieise din garsoniera 303. A ncercat s scape de ea, dar parc i era gravat pe retin. O vzuse tot timpul n gnd, i cnd se ntorsese ca un somnambul la staia de metrou, i n tren, pn aici, la staia Tsurumi. Cine e? Cea mai raional explicaie pe care o gsise era c sora fetei, ngrijorat de absena prelungit a lui Mai, venise acolo s vad cu ochii ei ce se ntmplase. Chiar el i telefonase mamei lui Mai i-i explicase ct mai pe neles ce descoperise. Dac fata avea o sor i dac aceast sor locuia la Tokio, ntlnirea ntmpltoare cu ea nu era deloc neobinuit. Dar ceva din aura indescriptibil a femeii anula posibilitatea unei explicaii att de simple. Scurta cltorie cu liftul alturi de ea l tulburase pe Ando pn n adncul sufletului. Nu prea s fie o apariie pmnteasc, ns nu arta nici ca o fantom. Fusese prezent acolo n carne i oase, Ando era sigur. Cu toate acestea, avea senzaia c i-ar fi fost mai uor s accepte c se ntlnise cu o fantom. Din spatele cldirii unei firme a aprut un cerc auriu. Venea drept spre el. Hei, Ando!
203

Ando i-a mijit ochii i s-a uitat n direcia fasciculului de lumin, apoi i-a dat seama c era Miyashita, care se apropia repede, clare pe o biciclet mic de dam ce avea pn i co pentru cumprturi. Probabil c mprumutase bicicleta soiei sale. Miyashita s-a oprit chiar n faa lui, n scrnet de frne. La nceput n-a fost n stare s vorbeasc, pentru c gfia prea tare. A rmas acolo, clare pe biciclet, cu coatele sprijinite pe ghidon i capul ridicndu-se i cobornd n ritmul respiraiei. Ando n-ar fi crezut c va apuca s-l vad vreodat pe o biciclet. De obicei, cel mai mic efort l epuiza imediat. Ai ajuns repede, a zis Ando. Se temuse c-l va atepta cel puin zece minute. Miyashita nu ajungea nicieri la timp. Dup ce a parcat bicicleta pe trotuarul din faa staiei, Miyashita a pus o mn pe umrul lui Ando i l-a condus pe o alee unde fiecare cldire prea s aib un felinar rou atrnat deasupra uii. Rsuflarea i se linitise ct de ct i, n timp ce mergeau, i-a spus lui Ando: Cred c tiu ce nseamn mutaie. Iat cum se explica apariia lui pe biciclet. Ardea de nerbdare s-i mprteasc lui Ando ce descoperise. i ce nseamn? Hai mai nti s bem o bere. n timp ce se aplecau s treac pe sub draperia de la intrarea unui local, Ando a observat c pe firm era scris Limb de bivol. Miyashita nu s-a mai deranjat s-l ntrebe ce vrea: n momentul n care au ajuns nuntru, a cerut dou beri la pahar i dou porii de limb srat. Prea s-l cunoasc pe proprietar, pentru c schimbaser o privire de salut n timp ce el i Ando se ndreptau spre captul din spate al barului. Acolo erau cele mai linitite locuri din toat sala. La nceput, Miyashita l-a ntrebat cum reuise s decodifice mesajul transmis prin intermediul virusului. Ando a scos printul
204

din serviet i i-a spus prin ce etape trecuse. Tot timpul ct l-a ascultat, Miyashita a dat din cap fr ncetare. Prea s se fi convins de justeea metodei cu mult nainte ca Ando s termine. Da, n regul, se pare c mutaie e soluia corect. Dovada c abordarea ta a fost bun e chiar faptul c te-a condus la o singur soluie. Miyashita l-a btut pe umr. Apropo, sunt sigur c i-ai dat seama ce analogie putem face. Ce vrei s spui? Miyashita a scos din buzunar o foaie de hrtie boit i a despturit-o. Ando a vzut un desen. Orice ar fi fost, era schiat la repezeal, doar pentru a prinde esena unui moment de inspiraie. Uit-te puin la asta, a zis Miyashita, ntinzndu-i hrtia. Ando a luat-o i a ntins-o pe bar, n faa lui. A neles imediat. Era ilustrarea procesului de copiere a spiralei duble a ADN-ului n interiorul unei celule. Cele dou filamente ale spiralei sunt complementare: cnd structura uneia dintre ele este fixat, i cealalt este n mod automat determinat. Cnd o celul se divide, cele dou filamente se despart i fiecare creeaz o nou generaie de copii fidele originalului. Procesul de copiere a unei gene i de transmitere de la printe la copil poate fi considerat fundamentul ereditii. Bineneles, din punctul de vedere al lui Ando, toate acestea erau cunotine elementare. i ce-i cu asta? a ntrebat el. Gndete-te o clip la mecanismul din spatele evoluiei speciilor. Mai erau multe de aflat despre evoluie. De exemplu, conceptele de baz ale teoriei lui Kinji Imanishi2 se deosebeau de cele ale neodarwinitilor, dar era imposibil s stabileti o dat pentru
Kinji Imanishi (1902-l992), antropolog, entomolog i explorator, pionier al studiului tiinific al primatelor n Japonia, fondator al unui institut specializat la Universitatea Kyoto. (N. Tr.)
2

205

totdeauna cine avea dreptate. Pe scurt, era un fel de aplicare a zicalei unde-s muli, puterea crete n domeniul teoriei evoluiei: oricine i susinea cu ndrjire opinia, indiferent dac avea calificarea necesar sau nu, putea s ncline balana ntr-o parte sau alta. Dar lipsa unor dovezi decisive care s traneze disputa nu conta prea mult. Ando tia c descoperirile recente din domeniul biologiei moleculare sprijineau ideea c adevratul motor al evoluiei era mutaia genetic brusc. A rspuns aadar destul de sigur pe el: Probabil c totul ncepe cu o mutaie genetic. ncepuse s ghiceasc n ce direcie se ndrepta discuia. Aa e. Mutaia este declanatorul procesului de evoluie. i atunci, cum au loc mutaiile? Miyashita a luat o gur bun de bere, apoi a scos un pix din buzunarul de la piept. nainte ca Ando s aib cea mai mic ans de a-i rspunde, a nceput s scrie repede pe desen. Motivele producerii mutaiilor. Ando a ncercat s vad schia, pe jumtate ascuns de mna lui Miyashita. Cnd n codul genetic survine o eroare, un accident ntmpltor care afecteaz genele, ea este copiat i transmis mai departe. O mutaie, deci. M urmreti? Asta e linia de gndire acceptat n privina mecanismului mutaiilor. Pentru a-i sublinia ideea, Miyashita a pus vrful pixului pe diagram, dar Ando nu avea nevoie de asemenea explicaii. Genele pot fi modificate n mod deliberat, n laborator, cu ajutorul razelor X sau radiaiilor ultraviolete, ns de obicei mutaiile survin la ntmplare. Secvena ADN, care, teoretic, trebuie s fie reprodus i transmis identic generaiilor urmtoare, sufer uneori modificri din cauza unor erori de copiere dac se poate spune aa. Cnd aceste erori se acumuleaz prin copieri repetate, apare treptat o specie nou. Mutaia poate fi privit ca un mic pas spre evoluia unei specii.
206

Mai ii minte, prietene, c am pomenit la un moment dat de o analogie? a murmurat Miyashita. Ando a neles n sfrit unde btea colegul lui. X era ca Y. Acum, dup ce se gndise la asta, totul prea simplu. Vorbeti despre copierea casetelor, nu-i aa? a zis Ando n cele din urm. Pi, nu crezi c, n principiu, e acelai lucru? Miyashita i-a ndesat n gur dou felii de limb i le-a fcut s alunece pe gt cu o gur de bere. Ando a ntors foaia de hrtie i a netezit-o, apoi a luat pixul lui Miyashita i a nceput s fac alt schi. Simea nevoia s clarifice punctele de similaritate. Chiar dac era convins c teoria acestui domeniu nu mai avea secrete pentru el, tia c un simplu desen pe hrtie poate fi uneori de mare ajutor. n ziua de 26 august, n cabana B-4 apruse pe lume o nregistrare video. Pe 29, patru tineri cazai n aceeai caban terseser sfritul nregistrrii poriunea n care se spunea Cine vede aceast nregistrare trebuie s fac o copie i s o arate altcuiva, dar nu mai trziu de o sptmn. Copiii nregistraser o reclam peste poriunea respectiv. Pentru caset, aceast aciune fusese echivalent cu un eveniment ntmpltor, neprevzut, care-i modificase secvena genetic, adic irul imaginilor. Apruse o eroare. Asakawa copiase
207

din nou caseta care coninea deja eroarea n cauz. Firete, eroarea fusese i ea reprodus. Pn aici, procesul fusese similar cu cel de reproducere a ADN-ului. Mai mult dect att, poriunea tears, mesajul final, ar fi trebuit s joace un rol crucial n reproducerea casetei. n termeni genetici, aceast poriune era o gen regulatoare. Modificarea unei asemenea gene nlesnete apariia mutaiilor. Nu cumva chiar trauma suferit de nregistrare provocase mutaia casetei? Ando a lsat pixul pe mas i a zis: Stai puin, nu discutm aici despre o fiin vie. Miyashita nu prea deloc ncurcat. Dup toate aparenele, i pregtise din timp rspunsul: Dac i-ar cere cineva s defineti viaa, ce i-ai spune? Dup prerea lui Ando, viaa putea fi rezumat n mare cam aa: capacitatea unei entiti de a se reproduce i existena unei forme fizice. De exemplu, lund o singur celul, observm c ADN-ul ei supervizeaz autoreproducerea, iar proteinele i dau forma exterioar. Dar o caset video? Sigur, avea o form fizic definit carcasa ei din plastic, de obicei neagr i paralelipipedic , dar nu se putea spune despre ea c are i capacitatea de a se nmuli. O caset video nu poate s se reproduc de la sine. i? Acum Miyashita prea nerbdtor. Vrei s spui c se comport ca un virus Lui Ando i venea s geam. Viruii sunt forme de via ciudate: le lipsete capacitatea de autoreproducere. Din acest punct de vedere, ei sunt poziionai ntre lumea nensufleit i cea vie. Singurul lucru pe care-l poate face un virus n aceast privin este s ptrund n celulele altei fiine vii i s le foloseasc pentru a se nmuli. La fel cum caseta n cauz i luase n stpnire pe oamenii care o vizionaser, ameninndu-i c-i va distruge dac nu o copiaz. Caseta se folosea de oameni pentru a se reproduce. Dar
208

Ando se simea dator s protesteze, ns nici mcar nu tia precis ce vrea s nege. Simea c, dac n-ar face asta, s-ar ntmpla o catastrof. Dar au fost scoase din circulaie toate copiile casetei! Cu alte cuvinte, nu mai era niciun pericol. Chiar dac nregistrarea fusese vie cndva, n sensul limitat n care i un virus este viu, dispruse ntre timp. Toate cele patru specimene care veniser pe lume fuseser anihilate. Ai dreptate. Caseta a disprut. A disprut tulpina veche. Broboanele de sudoare de pe faa lui Miyashita preau s creasc dup fiecare nghiitur de bere. Cum adic, veche? a zis Ando. nregistrarea a suferit o mutaie. S-a schimbat, a evoluat prin copiere pn cnd a aprut o nou tulpin. nc mai pndete peacolo pe undeva. i-a luat o form complet diferit. M rog, asta e prerea mea. Ando se uita la el cu gura cscat. Nici nu putea face altceva. Paharul lui era gol, dar acum simea nevoia s bea ceva mult mai tare ca berea. A ncercat s comande gin shochu cu ghea, dar n-a fost capabil s vorbeasc suficient de tare. Barmanul nu l-a auzit. Miyashita i-a srit n ajutor: a ridicat dou degete i a strigat Shochu!. Barmanul a aezat n faa lor dou pahare, iar Ando a ntins imediat mna i a but o treime din pahar dintr-o singur nghiitur. Miyashita, care se uita la el cu coada ochiului, a continuat: S presupunem c, n urma procesului de copiere repetat, nregistrarea chiar a suferit o mutaie i s-a transformat ntr-o nou specie. Atunci nu conteaz deloc pentru ea dac vechea specie a disprut. Gndete-te la asta. Ryuji a fcut efortul supraomenesc s foloseasc o secven de ADN ca s ne transmit ceva de pe lumea cealalt. Nu vd ce explicaie mai bun am putea gsi pentru cuvntul mutaie. Poate tii tu alta. Bineneles c Ando nu tia. Cum ar fi putut? A ridicat din nou
209

paharul la buze, apoi nc o dat, dar efectele alcoolului se lsau ateptate. Avea mintea chinuitor de limpede. S-ar putea s fie adevrat. Ando a observat c nclina treptat s-i dea dreptate lui Miyashita. Probabil c Ryuji le transmisese cuvntul mutaie n chip de avertisment. Aproape c-l vedea pe fostul lui coleg n faa ochilor, rnjind. Crezi c nu mai exist niciun pericol, crezi c a disprut. Dar nu scapi aa uor. A suferit o mutaie i o nou form se dezvolt chiar n clipa asta. i-a amintit de virusul SIDA. Se crede c, acum cteva sute de ani, un virus preexistent a suferit o mutaie i a devenit ceea ce azi numim SIDA. Vechiul virus nu era capabil s contamineze oamenii, deci era probabil inofensiv. Dar, prin mutaie, a cptat puterea de a face ravagii n sistemul imunitar al corpului omenesc. Dac se ntmplase acelai lucru i cu nregistrarea? Singurul lucru pe care-l putea face era s se roage s se fi ntmplat exact invers, adic un virus periculos s fi devenit inofensiv. Faptele artau ns cu totul altceva. Departe de a fi inofensiv, caseta mutant se transformase n ceva care ucidea fr discriminare, indiferent dac victimele o copiaser sau nu. Dac asta era o dovad, caseta devenise i mai periculoas. i, cum Ando nu reuise s explice dispariia lui Mai, la ora actual Asakawa era singura anomalie. De ce n-a murit Asakawa? a optit Ando, exact aceeai ntrebare pe care i-o pusese lui Miyashita cu o zi nainte. Asta-i marea ntrebare, nu-i aa? Este singurul nostru indiciu despre ce a devenit caseta. Ba nu, de fapt mai este cineva. Ando i-a spus pe scurt povestea lui Mai: cum ajunsese caseta de la Ryuji la ea, cum existau dovezi c vzuse nregistrarea i cum fata dispruse de aproape trei sptmni. Ceea ce nseamn c exist dou persoane care au vzut nregistrarea i n-au murit. Asakawa mai triete, dei la limit. Sper c i fata e n via.
210

De ce ar fi? De ce nu? N-ar fi mai bine s avem dou capete de fir dect unul singur? Miyashita avea dreptate. Dac Mai Takano triete, i-a spus Ando, poate c vom reui s nelegem ce au n comun ea i Asakawa. Poate c fata ne va da rspunsul. i dorea din tot sufletul s o gseasc n via.

211

Partea a patra EVOLUIA

212

1
Luni dup-amiaz, 21 noiembrie. Ando terminase autopsia unui biat care se necase ntr-un ru, iar acum i scria raportul n timp ce-l asculta pe tatl copilului descriind mprejurrile accidentului. Ando ncercase s afle data de natere a copilului i ce fcuse n ziua morii, dar rspunsurile brbatului erau vagi i ncurcate, ceea ce nu-i uura deloc sarcina. Uneori brbatul se uita pe fereastr i conversaia lncezea, alteori i nbuea un cscat ntre dou cuvinte. Prea stors, pe jumtate adormit. Ando voia s termine ct mai repede i s-l elibereze. Apoi a primit un telefon de la recepie, unde se declanase agitaia. ntre timp poliia le trimisese alt cadavru, cel al unei femei neidentificate. n clipa aceea era deja pregtit pentru disecie. Conductorul echipei care avea s efectueze autopsia era un vechi coleg al lui Ando, doctorul Nakayama. Poliitii i spuseser c trupul femeii fusese gsit ntr-un cmin de aerisire, pe acoperiul unui bloc cu birouri. Asta nsemna c a doua autopsie urma s nceap imediat, fr pauz, aa c asistenii i poliitii intrau i ieeau ntruna din birou, pregtindu-se de lucru. Domnule doctor, cadavrul e aici. Vorbise asistentul principal. Ando a tresrit fr s vrea i s-a uitat n direcia din care venise vocea. Ikeda, asistentul, sttea lng ua deschis pe jumtate, cu faa spre Nakayama. Dar, din cine tie ce motiv, lui Ando i se pruse c vorbise cu el. Bine, a zis Nakayama, ridicndu-se ncet n picioare. Vrei, te rog, s-l pregteti? Nakayama se angajase la Institut cu doi ani naintea lui Ando.
213

Fcea parte i din Departamentul de Medicin Legal al Facultii de Medicin de la Universitatea Joji. Asistentul a disprut, iar n locul lui a aprut un poliist, care s-a apropiat de Nakayama. Dup formulele obinuite de politee, poliistul i-a tras un scaun i s-a aezat lng doctor. Ando s-a uitat peste umr la cadavrul pe care lucrase, dar auzea n spatele lui conversaia poliistului cu Nakayama i era curios. Prindea doar frnturi din discuie, cuvinte scoase din context. Poliistul prea s-i descrie doctorului condiiile n care fusese gsit cadavrul. Ando a pus pixul jos i a ciulit urechile. Cuvintele neidentificat i femeie se tot repetau. Ce cuta pe acoperi? a ntrebat Nakayama. Nu tim de ce a urcat acolo. Poate c voia s se sinucid. A lsat vreun bilet de adio? Pn acum n-am gsit nimic. mi nchipui c nimeni n-ar fi auzit-o strignd, din moment ce era ntr-un pu de drenaj. Nu locuiete nimeni n zon. Unde e? n Oi Est, sectorul Shinagawa. E un bloc vechi cu paisprezece etaje, pe oseaua rmului. Ando i-a ridicat brusc privirea. Era ocat. i-a amintit ce vzuse din staia de pe linia Keihin. Dincolo de cartierul rezidenial se zrea o poriune din oseaua rmului, mrginit de depozite i sedii de companii. Cadavrul unei femei neidentificate pe acoperiul unei cldiri de-acolo Cred c e suficient att. O s v dau un telefon dac mai am ntrebri, a zis Ando. I-a mulumit brbatului i a lsat deoparte formularele. l interesa prea mult conversaia care se desfura n spatele lui ca s mai fie n stare s se concentreze asupra raportului. tia c i mai lipseau cteva amnunte, dar s-a hotrt s le lase pentru mai trziu.
214

A pus hrtiile ntr-un dosar i s-a ridicat. Nakayama i poliistul se ridicaser n acelai timp cu el. Ando s-a apropiat de ei i l-a btut pe Nakayama pe umr. nclinndu-se puin n faa poliistului, pe care l cunotea din vedere, i-a spus doctorului: Femeia la care o s lucrezi a fost identificat? Au ieit toi trei din birou i au pornit pe coridor, spre sala de autopsie. Nu i-a rspuns Nakayama, ci poliistul: Nu. i nici n-avem vreun indiciu care s ne ajute. Ci ani are? E tnr, douzeci, douzeci i ceva. Dac n-ar fi moart, ar arta extraordinar. Douzeci, douzeci i ceva. Mai Takano avea douzeci i doi de ani, dar putea trece cu uurin drept o adolescent. Ando a simit c ncepe s se nbue. Vreun semn particular? Dac ar fi vzut cadavrul, i-ar fi dat seama imediat, dar trebuia mai nti s se pregteasc sufletete. Bineneles c spera s aud ceva care s-i arate c nu era ea. Ar fi fost liber s plece fr s mai verifice. Ce s-a ntmplat, doctore Ando? l ntreb Nakayama rnjind. Acum, dup ce-ai auzit c arat bine, i-a strnit interesul? Nu, fii serios, i-a rspuns Ando, refuznd s intre n joc. Pur i simplu ceva nu-mi sun bine. Vzndu-i expresia, Nakayama i-a ters imediat rnjetul de pe fa. Pentru c ai adus vorba, chiar e ceva ciudat cu femeia asta, a intervenit poliistul. S-ar putea s v intereseze i pe dumneavoastr, doctore Nakayama. Ce anume? Nu avea lenjerie intim. Zu? Sus sau jos? Purta sutien, dar nu i chiloi.
215

Avea hainele n dezordine cnd a fost gsit? Ando i Nakayama se gndeau la acelai lucru: poate c fusese violat pe acoperi, apoi aruncat n pu. Nu, nimic de genul sta i, cel puin la prima vedere, nici semne de viol. Cu ce era mbrcat? O rochie groas fr mneci, ciorapi trei sferturi, tricou, bluz. Nimic anormal. Am putea spune chiar c avea gusturi conservatoare. Dar nu avea chiloi. Erau n noiembrie, iar fata se mbrcase cu o rochie i nu-i pusese chiloi. Oare avea obiceiuri excentrice? Scuzai-m, dar nu cred c am neles prea bine ce nseamn c a fost gsit ntr-un pu de pe un acoperi, a zis Ando, care nu reuea s vizualizeze scena. E vorba de un pu de aproximativ trei metri adncime, cu diametrul de aproape un metru. De obicei e acoperit cu plas de srm, dar cnd am ajuns acolo era parial dat la o parte. Suficient de mult nct s cad cineva nuntru Probabil. E genul de capcan n care cazi cnd nu eti atent? Nu, nu-i uor nici mcar s te apropii de gura lui. n primul rnd, ua din casa liftului care d pe acoperi e ncuiat permanent. Atunci cum a ajuns acolo? La captul scrii de incendiu e alt scar, care urc pe acoperi. E fixat pe peretele exterior. Bnuim c pe-acolo a urcat. De fapt, e singura cale de acces pe acoperi. Ando nu reuea s gseasc o explicaie plauzibil pentru prezena fetei acolo. n legtur cu lenjeria Credei c putea s-i scoat intenionat chiloii cnd se afla n pu? Puul avea diametrul de un metru. Cnd czuse n el, probabil c se rnise. Poate c-i scosese chiloii ca s-i foloseasc pe post de compres sau de bandaj. Sau poate c ncercase cumva s-i
216

foloseasc pentru a scpa de acolo. I-am cutat, i n pu, i pe acoperi. Ca s fim absolut siguri, iam cutat i n jurul blocului. De ce n jur? a intervenit Nakayama. Ne-am gndit c poate i-a legat de o pies de metal sau de alt obiect greu i i-a aruncat afar. Nu avea nicio ans s-o aud cineva dac striga dup ajutor. Singura cale de a atrage atenia era s arunce ceva pe strad, unde mai circulau oameni. Dar i asta s-a dovedit de fapt imposibil. De ce? Nu putea s arunce nimic de pe fundul puului, pentru c obiectul n-ar fi trecut de plasa de srm. Ando n-a mai insistat asupra acestei chestiuni: i imagina c poliitii msuraser toate unghiurile. Deci putem s tragem concluzia c nu purta chiloi cnd a ieit din cas. n clipa asta, e singura explicaie plauzibil. Ajunseser n dreptul slii de autopsie. Vrei s vii cu mine, doctore Ando? l-a ntrebat Nakayama. Da, dar nu stau mult. Era un rspuns destul de cinstit. Dac moarta nu era Mai Takano, putea s ofteze uurat i s plece. Dac era ea Probabil c ar fi plecat oricum, pentru c avea ncredere n Nakayama. n orice caz, acum nu mai avea ncotro, trebuia s intre i s verifice dac era ea. Din spatele uii se auzea, ca de obicei, zgomotul apei curgnd din robinet. n timp ce ncerca s disting i alte sunete, Ando a fost copleit brusc de dorina de a fugi de-acolo. Stomacul a nceput s-i bolboroseasc i minile s-i tremure. S-a rugat n gnd s nu fie ea. Doar att mai putea face. nainte ca Ando s fie pe de-a-ntregul pregtit, Nakayama a deschis ua i a intrat n sala de autopsie. Poliistul l-a urmat imediat. Ando a rmas pe loc, uitndu-se din prag la trupul gol i alb ntins pe masa de disecie.
217

2
n sufletul lui se insinuase de mult bnuiala c va veni i aceast clip, dar acum, vznd de aproape cadavrul femeii, tot s-a nfiorat din cap pn-n picioare. A pornit n sfrit pe urmele lui Nakayama i ale poliistului i s-a apropiat de mas. S-a uitat la faa femeii din toate unghiurile. nc nu era pregtit s-o recunoasc. Prul i ceafa i erau acoperite cu noroi uscat i ntrit. Un picior era rsucit nefiresc de la glezn. Pielea din zona aceea era singura pat de culoare de pe trup. Probabil c glezna era fracturat sau luxat grav. Nu existau semne de sugrumare. De fapt, nu se vedea nicio ran exterioar. Cadavrul depise de mult stadiul de rigor mortis. Trecuser peste nousprezece ore din clipa morii. Ando i amintea perfect aura de prospeime pe care o avea cnd tria. De cte ori visase oare c o ine n brae i c-i simte trupul lipit de-al lui? Nu va mai avea niciodat ocazia. Acum era o ppu de cear, o efigie distrus. Femeia de care aproape se ndrgostise era expus nemilos pe mas, preschimbat n asta. Nu reuea s accepte realitatea i brusc l-a cuprins furia. Blestemat s fie, a uierat. Nakayama i poliistul s-au ntors n acelai timp i s-au uitat la el. Poliistul nu-i putea ascunde uimirea. Ai cunoscut-o? Ando a dat din cap aproape imperceptibil. mi pare ru, a murmurat Nakayama, dei nu tia ct de strns fusese relaia lui Ando cu femeia. Poliistul a preluat conducerea, vorbind rar i cumpnit: tii cumva pe cine trebuie s anunm? n spatele tonului su politicos, Ando simea un accent de
218

speran. Faptul c o cunoscuse l-ar fi putut scuti pe poliist de corvoada identificrii ei. Fr s-i mai rspund, Ando a scos agenda i a nceput s-o rsfoiasc. Era sigur c-i notase numrul de telefon al prinilor fetei. L-a gsit, l-a scris pe o bucic de hrtie i i-a ntins-o poliistului. Brbatul a luat-o i a citit numrul. Prin urmare, suntei sigur c ea este? s-a interesat el, acum pe un ton plin de respect. Da, sunt sigur. E Mai Takano. Poliistul a ieit n grab s le telefoneze prinilor fetei i s-i anune c fiica lor murise. Ando i-a imaginat scena care avea s se desfoare n casa familiei Takano: telefonul sunnd, mama ei ridicnd receptorul i auzind o voce oficial care spune: Sunt ofierul de poliie cutare, fiica dumneavoastr a murit S-a nfiorat. i prea ru pentru mama lui Mai, i prea ru pentru suferina cumplit pe care urma s-o nfrunte prea curnd. Nu va leina, nu se va prbui plngnd n hohote. Nu, pur i simplu lumea se va retrage din jurul ei. Nu mai suporta s stea n sala de autopsie. Cnd bisturiul va ptrunde n trupul fetei, aerul se va umple de mirosuri mult mai rele dect cele care-l ntmpinaser cnd intrase. Iar cnd legistul va tia pereii organelor pentru a examina coninutul stomacului i intestinelor, duhoarea va deveni de-a dreptul oribil. Ando tia prea bine ct de mult pot rezista amintirile olfactive, i nu voia deloc s-o primeasc pe aceasta. tia i c asta era soarta tuturor fiinelor omeneti, indiferent ct de pure sau de frumoase erau: s emane n cele din urm o miasm insuportabil. Dar acum, numai acum, simea c nu poate s reziste sentimentelor. Voia s pstreze amintirea lui Mai nentinat de mirosul morii. Gata, am plecat, a optit el la urechea lui Nakayama. Doctorul i-a aruncat o privire ncrcat de bnuieli. Nu vrei s participi totui la autopsie? Mai am ceva de terminat n laborator, dar mai trziu a vrea s
219

aflu toate detaliile. Am neles. Ando a pus mna pe umrul lui Nakayama i a adugat, tot n oapt: Fii atent la artera coronar. S nu uii s iei o prob din ea. Nakayama era uimit c Ando formulase deja o ipotez n privina cauzei decesului. Avea cumva angin? Ando nu i-a rspuns. L-a scuturat uor i, aruncndu-i o privire care l avertiza s nu-i mai pun ntrebri, i-a mai spus doar att: F asta, bine? Nakayama a dat de dou ori din cap.

220

3
Dup ce colegul lui s-a ntors n birou, Ando a tras un scaun de lng masa de lucru a lui Nakayama i s-a aezat pe el invers, nconjurnd sptarul cu braele. A rmas aa, ateptnd ca doctorul s-i termine raportul. Mi se pare c eti nelinitit, a zis colegul lui, ridicndu-i privirea de la formularul n care scria. ntr-un fel. Vrei s vezi raportul? l-a ntrebat Nakayama, artnd cu degetul un teanc de hrtii din faa lui Ando. Nu, mi e de-ajuns un rezumat. Nakayama s-a ntors i s-a uitat la el. Atunci d-mi voie s fiu direct: cauza morii n-a fost un stop cardiac produs de blocarea arterei coronare. Prin urmare, ipoteza pe care Ando i-o mprtise nainte de autopsie se dovedise incorect. Ando a pstrat tcerea o vreme, ntrebndu-se cum trebuia s interpreteze informaia. Ce nseamn asta, c Mai n-a vzut totui nregistrarea? Poate c tumoarea n-a crescut ct s blocheze circulaia sngelui. i-a dat seama c avea nevoie de amnunte. Vrei s spui c nu exist niciun sarcom n artera coronar? Eu unul n-am vzut niciunul. Eti absolut sigur? M rog, trebuie s primesc rezultatele analizelor nainte s afirm cu mna pe inim aa ceva. Deci, n clipa de fa tumoarea n cauz prea s lipseasc din artera coronar a lui Mai Takano. i atunci ce a ucis-o?
221

Probabil frigul. Era foarte slbit. Rni? Glezna stng fracturat i laceraii pe ambele coate, cel mai probabil produse n urma cderii. Am gsit n rni particule de ciment. Deci czuse cu picioarele nainte, i fracturase glezna i nu mai reuise s se caere afar. Puul avea diametrul de un metru i adncimea de trei, prea adnc ca s poat iei fr ajutor. Rmsese blocat n capcan, fr nimic altceva dect ap de ploaie ca s-i potoleasc setea. Dar i n aceste condiii tot ar fi trebuit s supravieuiasc cteva zile. M ntreb ct timp a rezistat. De fapt, nu era o ntrebare n adevratul neles al cuvntului. Pur i simplu gndea cu voce tare n timp ce-i imagina groaza i disperarea fetei, contient c rmsese singur ntr-o gaur de pe acoperiul unei cldiri cu paisprezece etaje. Aproximativ zece zile, dup prerea mea. Stomacul i intestinele sunt goale, iar grsimea subcutanat a fost consumat n mare parte. Zece zile Ando i-a deschis agenda. Presupunnd c supravieuise zece zile n puul acela i lund n calcul alte cinci zile care au trecut pn cnd cadavrul a fost descoperit, nseamn c dispruse n jurul datei de 10 noiembrie. Stabiliser s se ntlneasc pe 9, iar faptul c nu rspunsese la telefon mpingea data dispariiei napoi cu o zi. Pe de alt parte, cutia ei de scrisori era plin cu ziare, iar cel mai vechi purta data de 8. n concluzie, pe 8 sau 9 i se ntmplase ceva i fusese obligat s plece de acas. Ando a marcat cele dou date n calendarul agendei. I se ntmplase ceva pe 8 sau 9 noiembrie. A ncercat apoi s se pun n locul ei. Cnd o gsiser, era mbrcat cu o rochie i o bluz. Vestimentaia sugera c ieise din cas doar pentru puin timp, poate cu intenia s ia o gur de aer
222

proaspt. Dar, n mod straniu, nu purta chiloi. i-a analizat din nou senzaiile din timpul vizitei n garsoniera fetei. Erau nc vii n memoria lui. Asta se ntmplase pe 15 noiembrie. Dac rezultatele autopsiei erau corecte, n momentul acela era deja prizonier pe acoperi, ateptnd s fie salvat. Cu alte cuvinte, lipsea de acas de cteva zile. n ciuda acestui fapt, Ando era sigur c detectase o prezen n apartamentul ei. Ar fi trebuit s gseasc o camer goal, dar simise acolo, n mod indiscutabil, ceva viu. A, i a zis Nakayama, ridicndu-i o mn cu degetul arttor ntins, ca i cum i-ar fi amintit ceva important. Ce anume? Ai cunoscut-o destul de bine, doctore Ando, nu-i aa? N-a spune asta. M-am ntlnit cu ea doar de dou ori. Am neles. Cnd ai vzut-o ultima dat? Cred c la sfritul lunii trecute. Cu alte cuvinte, cam cu trei sptmni nainte s moar. Nakayama se uita la el de parc se strduia s-i ascund un detaliu important. Ando i-a ntors privirea, ndemnndu-l fr cuvinte: Hai, spune. Era gravid, nu-i aa? a ngimat n cele din urm doctorul. Timp de cteva clipe, Ando nu i-a dat seama despre cine vorbea colegul lui. Cine? Mai Takano, bineneles. Nakayama se uita atent la el, ncercnd s-i surprind reacia. N-ai tiut? Ando nu i-a rspuns. Doar nu vrei s-mi spui c n-ai observat nite semne inconfundabile la o femeie care se apropia de termen. Se apropia de? Att fusese n stare, s repete ca un papagal cuvintele lui Nakayama. i-a ridicat privirea i a ncercat s-i aminteasc precis silueta lui Mai. O vzuse o dat mbrcat n haine de zi, iar a doua
223

oar ntr-o rochie roie. n ambele cazuri era vorba de haine mulate pe olduri i pe coapse, care-i puneau n eviden silueta zvelt. Talia de viespe era una dintre trsturile ei cele mai atrgtoare. Dar nu asta era important. Ando simise c fata avea o aur virginal. i acum Nakayama ncerca s-i spun c era gravid? Pe deasupra, n luna a noua? E drept, se ferise s-o priveasc insistent. De fapt, cu ct se gndea mai mult la ea, cu att imaginea ei devenea mai neclar. Memoria i juca feste. Ba nu, imposibil. n niciun caz nu putea fi n luna a noua. n primul rnd, vzuse cadavrul cu ochii lui. Pntecele ei era att de supt, nct aproape c atingea coloana vertebral. Nu pot s cred c mai avea puin pn s nasc. Aa sunt unele femei, tii bine. Nu li se deformeaz silueta nici mcar n ultimele trei luni. Nu, nu e o chestiune de comparaie. Am vzut i eu cadavrul. M-ai neles greit, a zis Nakayama fluturndu-i minile prin aer, apoi i-a etalat cu grij argumentele n faa lui Ando. Uterul era mult mrit i avea rni n punctele unde s-a desprins placenta. Vaginul era plin cu o secreie de culoare maronie. Am gsit n el fragmente minuscule de esut care, dup prerea mea, sunt resturi din cordonul ombilical. i-ai pierdut minile, a strigat Ando n gnd. Dar nu credea sincer c un legist cu experiena lui Nakayama putea s fac attea greeli elementare. Cele trei dovezi gsite n corpul lui Mai l conduceau la o singur concluzie: nscuse cu puin timp nainte s rmn prizonier n pu. Pornind de la ipoteza c naterea era un fapt stabilit, cum s-ar fi putut explica micrile fetei? Poate c travaliul ncepuse pe 7 noiembrie sau n jurul acestei date, i Mai se grbise s ajung la un obstetrician. Nscuse, rmsese la spital cinci sau ase zile, apoi se externase pe 12 sau pe 13. Poate c nscuse prematur i copilul murise. nnebunit de durere, rtcise prin ora i, la un moment dat, se trezise pe acoperiul blocului, unde czuse n puul de
224

aerisire. Supravieuise zece zile. Cadavrul ei fusese gsit abia n dimineaa aceea. Din punct de vedere cronologic, totul se potrivea. Naterea era o explicaie plauzibil pentru dispariia ei. i, evident, nu i-ar fi spus nimic mamei sale. Dar Ando nu credea asta. Era dispus s accepte diferenele mari dintre femei n timpul sarcinii, dar, lsnd la o parte faptul c pur i simplu nu arta ca o gravid, nu putea uita prima impresie pe care i-o fcuse fata. O vzuse prima dat chiar aici. El se pregtea s nceap autopsia, iar fata intrase nsoit de un poliist care o chemase acolo s-i povesteasc legistului de serviciu ce tia despre moartea lui Ryuji. ncercase s se aeze, dar i pierduse echilibrul i se sprijinise de un birou. Ando i dduse seama dintr-o privire c era anemic. Simise mirosul foarte slab de snge i trsese concluzia c menstruaia era una dintre cauzele anemiei. Deducia lui fusese confirmat de expresia de jen a fetei i de scuza ei: mi pare ru, pur i simplu mi-a Privirile lor se ncruciaser. O fraciune de secund comunicaser fr s aib nevoie de cuvinte. Te rog s nu-i faci griji. E doar problema aceea lunar. Am neles. Mai i spusese asta doar din priviri, pentru c i era ruine s mrturiseasc adevrul n acea mprejurare. Amintirea schimbului mut de cuvinte era nc vie n memoria lui Ando. Fcuse autopsia lui Ryuji luna trecut, pe 20. Adic fata, care ntre timp nscuse, avea o hemoragie menstrual cu mai puin de-o lun nainte de termen. Imposibil, bineneles. Poate c am neles eu greit. Am crezut mereu c a fost o conversaie fr cuvinte, dar uite c m-am amgit singur. Poate c am interpretat totul aiurea. Dar cu ct se gndea mai mult la asta, cu att mai puin era dispus s accepte c greise. Dimpotriv, era sigur c pricepuse corect mesajul lui Mai. n orice caz, rezultatele autopsiei contraziceau total punctul lui
225

de vedere n aceast chestiune. Ando s-a ridicat de pe scaun i a ntins mna spre raport. Voia sl ia acas i s-l studieze n linite. Te superi dac fac o copie? Nakayama a mpins spre el teancul de hrtii. Deloc, d-i drumul. S nu uit, a adugat Ando. Presupun c ai luat i o prob de snge. Evident. Poi s-mi dai i mie puin? Sigur, dar puin. Trebuia s afle imediat dac Mai era sau nu purttoare a virusului misterios att de asemntor cu cel al variolei. Prezena virusului n sngele ei ar fi fost dovada c fata se uitase la caset. Trebuia s afle dac tragedia ei fusese declanat de nregistrarea video sau avea cu totul alte cauze. n clipa aceea nu putea face altceva dect s adune informaii, puin cte puin. Dac reuea s stabileasc rolul casetei n povestea asta, ajungea cu un pas mai aproape de soluia mesajului mutaie.

226

4
La scurt timp dup ce a vzut cadavrul lui Mai, Ando a fost ntiinat i de moartea lui Kazuyuki Asakawa. Pentru c starea ziaristului se agravase, l mutaser de la Shinagawa Saisei la Spitalul Universitar Shuwa, unde murise aproape imediat. Ando primise i el informaiile referitoare la starea lui, dar nu-i nchipuise c omul se va stinge att de repede. Potrivit doctorului care-l ngrijea, decesul survenise n urma unei infecii, iar pacientul plecase pe lumea cealalt fr s se chinuie, ca i cum ar fi murit de btrnee. Asakawa nu-i mai recptase cunotina dup accident. Ando a dat o fug la spitalul Shuwa i le-a spus colegilor si ce s caute n timpul autopsiei: un sarcom care blocase artera coronar i, n el, un virus asemntor cu al variolei. Dup prerea lui, aceste informaii erau vitale pentru stabilirea urmtorilor pai pe care trebuia s-i fac. nainte s plece, s-a asigurat c doctorul care conducea autopsia pricepuse perfect importana situaiei. n timp ce se ntorcea la staia de metrou, nu i-a putut stpni regretul c Asakawa nu se mai trezise dup accident. Ziaristul deinea informaii vitale pe care le luase cu el n mormnt. Dac ar fi aflat ce tia Asakawa, ar fi tiut mult mai bine la ce s se atepte. Acum viitorul era nnebunitor de tulbure. Ando n-avea nici cea mai mic idee pentru ce trebuia s se pregteasc. Ceea ce-l ngrijora cel mai tare n clipa aceea era rspunsul la o singur ntrebare: Asakawa a murit dintr-un ghinion sau pentru c aa i fusese sortit? De fapt, aceeai ntrebare era valabil i n privina lui Mai. Amndoi suferiser i muriser n urma unor accidente n cazul lui Asakawa unul rutier, n cazul lui Mai o cdere. Decesele lor preau s aib un punct comun, dar
227

deocamdat Ando nu putea s afle dac aveau sau nu vreo legtur cu vizionarea casetei video. n timp ce mergea pe strad, i-a dat brusc seama c blocul pe acoperiul cruia fusese gsit cadavrul lui Mai se afla destul de aproape de spitalul din care tocmai ieise. Se ntrebase nu o dat de ce se suise fata pe acoperiul unui bloc drpnat, i iat c acum avea ocazia s arunce o privire acolo i poate s gseasc un rspuns. Trebuia s ajung ct mai repede la faa locului, nainte s dispar indiciile. S-a hotrt s se ntoarc pe strada Nakahara i s ia un taxi. Cu maina ar fi ajuns acolo n zece minute. Dup ce s-a oprit pe drum s cumpere un buchet de flori, Ando a cobort din taxi n faa unui depozit care aparinea unei companii de curierat. La telefon aflase doar numele companiei i c blocul n cauz se gsea la sud de depozit. Nu reuise s afle i cum se numea cldirea. Stnd n mijlocul trotuarului, s-a uitat ctre sud i l-a vzut. I-ar fi fost imposibil s se nele. Avea paisprezece etaje i pe peretele dinspre depozit erpuia o scar exterioar. Ando a ajuns n faa intrrii, dar s-a oprit. A nconjurat cldirea pn la scara exterioar. Se gndise s verifice mai nti traseul pe care urcase Mai. Fata ar fi putut s ia liftul pn la etajul al paisprezecelea, s ias pe palierul scrii de incendiu i s urce pe acoperi sau s urce din strad direct pe scara de incendiu. La lsarea serii, ua de la intrare era probabil ncuiat i acoperit cu un grilaj, aa c ar fi fost obligat s foloseasc intrarea de serviciu, n mod sigur pzit. Iar dac venise mai trziu, dup plecarea paznicului, gsise oricum i ua din spate ncuiat. n concluzie, dac urcase noaptea, fusese obligat s foloseasc scara de incendiu. Dar pe palierul de la etajul al doilea a dat peste o poart care i s-a prut de netrecut. A urcat pn la ea ca s-o vad mai de-aproape. Era un fel de u din oel, cu un simplu mner rotund. A ncercat s-l rsuceasc, dar nu s-a micat. Era n mod sigur ncuiat din
228

partea cealalt. Dar poarta avea doar un metru optzeci, poate ceva mai mult, i o persoan ndemnatic i agil s-ar fi crat pe ea fr prea mare efort. n liceu, Mai fcuse parte din echipa de atletism, deci avea o condiie fizic suficient de bun nct obstacolul s nu-i ridice probleme. Pe acelai palier era o u care ddea n interiorul cldirii. A ncercat s-o deschid, dar a constatat fr s se mire c i aceasta era ncuiat. S-a ntrebat la ce or ajunsese Mai acolo. Dac venise pe lumin, probabil c luase liftul pn la ultimul etaj. Dac venise seara sau noaptea, srise peste poart i urcase pe scara de incendiu. Ando s-a ntors la ua din fa, a intrat i s-a dus la ascensor. De fapt, erau dou, i n clipa aceea ambele se aflau la parter. Dup toate aparenele, la fiecare etaj erau alte firme, ale cror nume erau scrise pe cte o tabl fixat pe perete, lng uile lifturilor. Aproape jumtate dintre nume erau tiate cu dou linii ncruciate. Probabil c se mutaser, iar proprietarul nu reuise s gseasc ali chiriai. Cldirea era att de tcut, nct prea prsit. Cnd a ieit din lift la ultimul etaj, a pit ntr-un coridor ntunecos i a nceput s caute pe bjbite ua care ddea spre scara exterioar. A strbtut o dat coridorul de la un capt la cellalt, dar n-a gsit nimic. i totui nu puteai s urci dect dac ieeai de-acolo. Ba da, exista o u, chiar la captul coridorului. Ando a deschis-o i a ieit. Vntul care btea dinspre ocean era att de puternic, nct a fost obligat s-i ridice gulerul hainei. Abia acolo, la ultimul etaj, i-a dat seama ct de aproape era Golful Tokio. A zrit Canalul Keihin, dincolo de el Docul Oi i, n ultimul plan, Tunelul Portului, care se pierdea repede sub ape. Din punctul lui de observaie, cele dou guri negre ale tunelului artau de-a dreptul ireal. Ar fi jurat c erau nrile uriae ale unui necat care plutea cu faa n sus. i tot acolo i-a dat seama de ce prea att de nghesuit etajul al paisprezecelea, n ciuda dimensiunilor cldirii. Proiectanii i micoraser suprafaa la jumtate fa de celelalte etaje i folosiser spaiul rmas pentru terasa exterioar care nconjura blocul. Ando a
229

observat c scara de incendiu pornea n jos dintr-un col al terasei. Dar trupul lui Mai fusese gsit deasupra, pe acoperi. i atunci a vzut, chiar lng u, o scar din oel fixat n zid. Prea s aib cam trei metri. A strns n dini buchetul de flori, a apucat prima bar i a nceput s urce, ncercnd s-i nchipuie ce simise Mai cnd urcase pe aceeai scar. De ce a venit aici? s-a ntrebat el n timp ce se cra ncet, treapt cu treapt. Nu pentru c a vrut s se sinucid. Mcar atta lucru era limpede, judecnd dup felul n care fusese proiectat cldirea. Dac ar fi srit de pe acoperi, s-ar fi pomenit c aterizeaz pe teras, patru metri mai jos. Nu, dac ar fi vrut s-i ia viaa, ar fi trebuit s sar de la ultimul etaj, de pe palierul scrii de incendiu. i nu era nici genul de acoperi pe care te urci pentru a admira privelitea. Vopseaua cndva rezistent la ap crpase, apoi se cocovise i acum scria neplcut sub picioarele lui. Acoperiul nu avea balustrad de protecie i nu-i venea s te apropii de margine, chiar dac tiai c puin mai jos e o teras lat. A vzut un ir de protuberane de beton plasate la distane egale, nite piese asemntoare cu stabilopozii folosii pe rmul mrii pentru a atenua fora valurilor. Habar n-avea la ce foloseau, dar aveau nlimea potrivit pentru a putea sta pe ei ca pe un taburet. n loc s se apropie de margine, Ando s-a aezat i s-a uitat n jur. Mai erau cteva minute pn la ora cinci i n aceast perioad a anului soarele apune devreme. Luminile se aprinseser deja n cldirile din jur i n magazinele de jos. Dincolo de canal se vedea un expres Keihin rou care gonea pe linia supranlat. Da, era chiar un tren rapid, trecuse n vitez prin staia al crei peron prea s pluteasc n aer. Peronul acela i era cunoscut. Coborse acolo de dou ori, i de fiecare dat se dusese acas la Mai. Acum era scldat ntr-o lumin argintie i ciudat de gol pentru ora aceea a dupamiezii. Folosind staia ca punct de referin, a ncercat s localizeze
230

blocul fetei. L-a gsit cam la patru sute de metri n linie dreapt, literalmente chiar n faa lui. A urmrit cu privirea strada plin de magazine, apoi s-a uitat n dreapta, spre oseaua rmului. nc un salt de o sut de metri i s-a ntors n locul n care sttea. De ce pe acest acoperi? n vecintate erau multe cldiri nalte. De fapt, ar fi putut s se urce chiar pe acoperiul blocului n care locuia. S-a uitat n jur pn l-a gsit din nou. Avea apte etaje, dar prea s aib mai puin de jumtate din nlimea cldirii pe acoperiul creia se afla el acum, poate din cauz c apartamentele minuscule erau i foarte scunde. Oricum, pe acoperiul blocului ei exista o suprafa plan pe care puteai merge. n acelai timp, se afla chiar pe marginea strzii cu magazine, deci era nconjurat de cldiri nalte. Ieea n eviden mai ales un bloc de nou etaje, n partea de vest, de pe care acoperiul blocului lui Mai putea fi observat cu uurin. Cldirea pe care se afla Ando se deosebea de celelalte din acest motiv. Era plasat ntr-o poriune a oselei rmului plin de depozite, deci n vecintatea ei nu existau cldiri mai nalte. Pe acoperiul ei nu riscai s te vad cineva de deasupra. Ando s-a ridicat de pe postamentul din beton i s-a oprit ntre dou cabine tehnice plasate una lng alta pe acoperi. Una adpostea motorul liftului, cealalt prea s fie destinat sistemului de ventilaie. Deasupra celei dinspre sud era fixat un rezervor de ap de dimensiuni considerabile. ntre ele era un pu adnc pentru drenajul apei de ploaie. Mergnd cu grij, calculndu-i fiecare pas, Ando a naintat ncet i s-a oprit aproape de marginea lui. Pe toate laturile erau fixate bariere din plas de srm, dar toate erau pline de guri. Probabil c oamenii din echipa de ntreinere le lsaser aa pentru c nu-i nchipuiser c i-ar fi venit cuiva ideea s urce pe acoperi. Ando na mai fost n stare s fac ultimul pas spre margine. Dac ar fi pus piciorul lng buza acelei guri ptrate i negre, s-ar fi simit imediat atras n adncul ei. S-a aplecat totui n fa i, tremurnd, a aruncat buchetul de flori printr-o gaur din plasa de oel. i-a
231

mpreunat palmele i s-a rugat pentru odihna ei venic. Dac tehnicienii n-ar fi urcat s verifice ascensorul, fata n-ar fi fost gsit nici acum. Seara se lsa repede. Acoperiul era aproape cufundat n ntuneric i briza care sufla dinspre ocean strnea vrtejuri n spaiul ngust n care se afla, nconjurat din trei pri de perei din beton. L-a scuturat un fior. Ar fi trebuit s vin mai devreme, cnd soarele strlucea deasupra acoperiului. Dar tia c nici mcar la lumina zilei n-ar fi avut curaj s se uite n pu, n gaura aceea n care ieri zcea un trup nensufleit. Nu imaginea cadavrului l fcea s tremure. Ideea c fata i ateptase moartea n spaiul acela ca o capcan perfect l umplea de groaz. Cte zile ateptase Mai acolo jos, cu glezna fracturat, incapabil s se ridice, uitndu-se la fia ngust de cer care se afla la doar trei metri deasupra ei, pierzndui treptat sperana i n cele din urm dndu-i ultima suflare? Probabil c se simea nchis de vie ntr-un sicriu care plutea n aer. Lui Ando i s-a tiat rsuflarea. ntmplarea era prea nefireasc pentru a putea fi numit accident. Dintr-o cabin s-a auzit un geamt mecanic, apoi zgomotul unui cablu care se nfura pe un tambur. Unul dintre lifturi se pusese n micare. Ando a nceput s mearg cu spatele, cu pai mici, ca s ias din spaiul ngust. Pereii cabinelor erau aspri i pe alocuri nnegrii. Vopseaua se cocovise, o dovad n plus c oamenii urcau rareori acolo. S-a ndeprtat ct de repede a putut, s-a ntors la scara pe care venise i s-a grbit s coboare pe teras. Ultima bar se afla cam la un metru nlime, aa c a fost obligat s sar. i-a calculat prost micarea i a aterizat greit. Piciorul drept i-a amorit cteva clipe. Sa ghemuit i s-a pomenit c se uit fix la ultima treapt a scrii ruginite. A intrat n cldire i s-a dus la lifturi. Unul dintre ele urca ncet. A apsat pe buton i a ateptat s ajung la ultimul etaj. A ncercat din nou s neleag de ce urcase Mai pe acoperi. A
232

cntrit mai nti presupunerea c fusese urmrit. Seara i noaptea, zona aceea cu depozite era aproape pustie. Cine tie, poate n timp ce trecea pe-acolo fata observase c o urmrea cineva. Vzuse scara de incendiu i poarta de la etajul al doilea. Dac se gndise c ea putea sri peste poart, dar urmritorul ei nu, probabil c i luase inima n dini i urcase. Poate c urmritorul ei reuise s se caere i el pe poart i fata fusese obligat s urce mai departe. Asta ar fi fost prima ei greeal, pentru c aa ar fi ajuns ntr-o situaie fr ieire. Ultima ei raz de speran ar fi fost scara de trei metri care ducea pe acoperi. Prima bar era la un metru nlime. Spernd c urmritorul va renuna n sfrit, Mai se urcase pe acoperi. i? Individul continuase sau nu s se in dup ea? A ncercat s-i nchipuie pentru cine ar fi fost biata scar un obstacol de netrecut, dar a vzut n minte nu imaginea unui om, ci a unui monstru patruped. Chiar n clipa cnd alunga aceast idee fantastic, uile liftului sau deschis. Ascensorul nu era gol. Pn atunci, Ando vzuse doar vrfurile pantofilor, dar acum, ridicndu-i privirea, a descoperit n faa lui o femeie tnr. l privea fix, ca i cum se atepta s-l gseasc acolo. Nu avea cum s se nele, se mai ntlnise cu ea o dat, n aceleai mprejurri. Era femeia care ieise din garsoniera lui Mai i coborse cu el. Unghiile crpate i mirosul acela necunoscut Chiar dac ar fi vrut, tot n-ar fi reuit s-o uite. Acum sttea n faa ei, o privea i nu era n stare s-i mite niciun muchi. Era profund tulburat. Mintea lui nu putea pricepe ce vedeau ochii i trupul nu mai asculta nicio comand. De ce. A venit. Aici? Cuta disperat o explicaie raional, dar era blestemat s n-o gseasc. l nspimnta exact absena oricrui motiv plauzibil. Dac ar fi gsit o explicaie acceptabil, ar fi scpat i de teroarea care-l copleise. n timp ce se uitau unul la altul, uile liftului au nceput s se nchid. Femeia a ntins un bra i le-a inut deschise. Micarea fusese fluid, perfect. Purta o fust albastr cu buline i nu avea
233

ciorapi, n ciuda frigului de nceput de iarn. i folosise doar o mn pentru a opri uile liftului pentru c n cealalt avea un mic buchet de flori. Flori. Privirea lui Ando a rmas fixat pe buchet. Ne-am mai ntlnit, nu-i aa? Ea vorbise prima, i vocea i-a atras atenia. Timbrul foarte grav nu se potrivea cu silueta zvelt, ca de trestie, a femeii. Ando a rmas cteva clipe nemicat, cu gura deschis, dar n cele din urm a reuit s adune cteva cuvinte din adncul gtului su uscat: Eti sora lui Mai? n realitate, asta i dorea el. Dac era ntr-adevr sora fetei, totul cpta un sens: faptul c ieise din garsonier, c venise aici cu un buchet de flori. Tot ce vzuse i-ar fi gsit explicaia. Femeia i-a rspuns cu o micare din brbie, imperceptibil i indescifrabil. Nu fusese un gest de aprobare, dar nici de negare. Putea fi interpretat oricum, ca da sau nu, ns Ando a hotrt pe loc c era un da. E sora ei mai mare. A venit s lase un buchet de flori n locul unde a murit Mai. Era cea mai fireasc explicaie, cea mai potrivit cu mprejurrile. Oamenii accept numai ce sunt n stare s neleag. Brusc, toate temerile lui de mai devreme i s-au prut caraghioase. De ce naiba se speriase att de tare? Nu mai reuea s-i neleag nici propriile reacii emoionale. Din prima clip cnd o vzuse, necunoscuta i fcuse o impresie puternic, stranie. Acum, dup ce dezlegase misterul, senzaia aceea se spulberase ca o minciun demascat i nu mai vedea n faa lui dect o femeie foarte frumoas. Nasul drept i fin, curbele line ale obrajilor, ochii puin migdalai, cu gene dese. Ochii. Cnd se ntlnise ieri cu ea, n faa garsonierei lui Mai, purta ochelari de soare. Abia acum i vedea ochii. Privirea care l nvluia prea s-l atrag ca un magnet uria. i era greu s respire i inima i bubuia.
234

Scuz-m, dar A neles imediat din tonul i expresia ei c voia s-i spun ce legtur avea el cu Mai. M numesc Ando, lucrez la Facultatea de Medicin a Universitii Fukuzawa. tia prea bine c nu era un rspuns precis la ntrebarea ei. Femeia a ieit din lift i, innd n continuare uile deschise, l-a invitat din priviri s intre. Trebuia s-o asculte. Gestul ei elegant nu putea fi refuzat. Ando i-a luat locul n ascensor, docil, parc vrjit. S-au uitat iar unul la cellalt, din poziii acum inversate. Te voi cuta curnd s-i cer ceva. A rostit aceste cuvinte chiar nainte ca uile s se nchid complet. Ando a auzit-o limpede, era imposibil s se fi nelat. Uile s-au nchis ca diafragma unui aparat de fotografiat, tergnd silueta graioas din cmpul lui vizual, dar lsndu-i imaginea ntiprit pe retin. n timp ce liftul cobora ncet, Ando i-a dat seama c era stpnit de o dorin fizic irezistibil. Primele lui fantezii sexuale de cnd i pierduse familia fuseser provocate de Mai Takano, dar ce simea acum era incomparabil mai intens. Se aflase fa n fa cu femeia asta doar cteva secunde i totui putea s-i aminteasc perfect fiecare detaliu al trupului ei, de la curbura gleznelor goale pn la conturul ochilor. Timpul trecea, ns imaginea rmnea la fel de clar. Profund tulburat de accesul neateptat de lcomie sexual, Ando a ieit n fug din cldire, a oprit un taxi i a pornit spre cas. n main s-a gndit la ultimele cuvinte ale femeii. Te voi cuta curnd s-i cer ceva. Ce anume s-i cear? Cum adic s-l caute? Ce naiba era asta, un fel de glum monden? Se grbise s ias din bloc i s se urce n taxi de parc ea i urmrea fiecare pas. Acum i prea ru c nu o ntrebase cum o cheam i nu-i ceruse numrul de telefon. De ce nu fcuse asta? Ar fi trebuit s-o atepte jos, dar uite c plecase. Mai bine zis, nu fusese
235

n stare s rmn acolo. Ca i cum femeia i controla micrile. Acionase mpotriva propriei lui voine.

236

5
Trecuse o sptmn de la autopsia lui Mai. Venise i decembrie, i iarna se instalase brusc. Lui Ando nu-i plcea iarna prefera de departe sfritul primverii i nceputul verii , dar dup moartea fiului su ncetase s mai acorde atenie schimbrii anotimpurilor. Dimineaa, gerul aspru l obligase totui s ia act de venirea iernii. Pn la universitate se oprise de cteva ori, hotrt s se ntoarc acas s-i ia un pulover gros, dar de fiecare dat renunase. Nu-i venea s bat atta drum napoi, iar mersul pe jos l nclzea oricum. Apartamentul lui din Sangubashi era destul de aproape de universitate i i putea permite s fac o plimbare dac avea chef. Dei drumul era scurt, n mod normal lua metroul, dar trebuia s schimbe trenul i transferul nu era niciodat plcut. Din acest motiv i pentru c avea nevoie de micare, Ando se ducea la birou i se ntorcea acas pe jumtate mergnd, pe jumtate alergnd. Asta ar fi trebuit s fac i azi, dar la jumtatea distanei se rzgndise i se urcase ntr-un tren JR n staia Yoyogi. Nu strica s ajung la universitate ct mai devreme. Cum avea de mers doar dou staii i vagonul se legna ca un balansoar, n-a reuit s-i pun gndurile n ordine. Stabilise c n dimineaa asta va studia la microscopul electronic probele de esut prelevate de la Mai i de la Ryuji. Trebuia s se ntlneasc n laborator cu Miyashita i specialistul n microscopie electronic, Nemoto. Gndindu-se la ce l atepta, abia putea s-i stpneasc nerbdarea. Deocamdat virusul acela ciudat nu fusese gsit dect n sngele celor care vzuser nregistrarea video. Nu primiser niciun raport
237

c s-ar transmite prin contact fizic. i chiar el gsise acas la Mai o copie a casetei, dar nregistrarea iniial fusese tears. Aceste dou informaii l conduceau la o singur concluzie: descoperirea virusului n sngele lui Mai era dovada aproape sigur c fata vizionase nregistrarea. n acest caz, moartea ei putea fi pus strict pe seama casetei. Aproape c a ratat staia la care trebuia s coboare, dar a reuit s sar din vagon n ultima clip, chiar nainte s se nchid uile. S-a lsat purtat de uvoiul mulimii care se scurgea ctre porile de lng casa de bilete. Cldirea spitalului se nla impuntoare n faa lui. Ando s-a strecurat n laborator i Miyashita i-a ntors ctre el faa rumen. n sfrit i-a fcut apariia! Miyashita i Nemoto se ocupaser toat sptmna trecut de pregtirile pentru edina de microscopie din ziua aceea. Un virus nu e un obiect oarecare pe care s-l iei i s-l pui oricnd i oricum sub lentila unui microscop. Mai nti sunt necesare o mulime de operaii, de exemplu centrifugarea, secionarea celulelor i aa mai departe. Aceast procedur depea cu mult cunotinele unui nespecialist ca Ando. innd cont de eforturile pe care le fcuse Miyashita, nerbdarea lui nu era deloc surprinztoare. Se apucase de treab foarte devreme i acum totul era gata. Stinge luminile, a zis Nemoto. Da, s trii, i-a rspuns Miyashita i a apsat imediat pe ntreruptor. Dei obinuser de mult rezultatele analizei secveniale, abia acum aveau ocazia s vad virusul direct, cu ochii lor. Nemoto a intrat singur n camera obscur i a aezat seciunea ultrasubire n dispozitivul de fixare. Ando i Miyashita au rmas n faa consolei, uitndu-se la ecran ntr-o tcere deplin. Cu toate c nu apruse nc nicio imagine, amndoi erau foarte concentrai i
238

vedeau deja cu ochii minii. Nemoto s-a ntors la consol i a stins ultimul bec, care ardea chiar deasupra lor. Pregtirile se ncheiaser. Toi trei se uitau fix la monitor, inndu-i respiraia. Treptat, pe msur ce fasciculul de electroni mngia seciunea cu materie celular, n faa lor s-a deschis o lume microscopic. La care ne uitm acum? l-a ntrebat Miyashita pe Nemoto. La a lui Takayama. Modelul verde care acoperea ecranul din faa lor era un univers n sine. O rsucire scurt a unui buton i au nceput s goneasc peste suprafaa celulelor. Undeva, acolo, se ascundea virusul. ncearc s mreti grosismentul, a zis Miyashita. Nemoto s-a executat imediat i a mrit la gradaia 9 000. La urmtoarea trecere peste cmpul seciunii au vzut limpede celulele muribunde. Citoplasm strlucea puternic, dar organitele se transformaser n bulgri negri. Fixeaz-l pe citoplasm n colul din dreapta-sus i mrete grosismentul. Tiparul celulelor aproape moarte se reflecta pe faa lui Miyashita, care strlucea stins, ca o sculptur n bronz. Nemoto a mrit grosismentul la 16 000. Mai mult. 21 000. Gata, stop! Miyashita aproape strigase. I-a aruncat o privire lui Ando care s-a aplecat pn cnd faa i-a ajuns la dou palme de ecran. Acolo erau roiuri ntregi. Filamentele se zvrcoleau ca nite erpi n jurul celulelor muribunde, agndu-se de fibrele de cromatin i mucnd din ele. Pe spatele lui Ando a cobort un fior rece. Se confruntau cu un virus nou, cum nu mai ntlniser pn atunci. Nu vzuse niciodat la microscopul electronic virusul variolei, dar tia cum arat pentru c citise destule lucrri tiinifice. Deosebirile fa de cel pe care-l
239

studiau acum erau evidente de la prima privire. Cerule! Miyashita ncremenise, cu gura cscat. Ando tia cum acioneaz virusul, tia c era purtat prin vasele de snge pn la artera coronar, unde se fixa pe peretele interior al ramurii descendente anterioare i provoca mutaii n celulele din jur, iar acestea formau n cele din urm o tumoare. Dar nu putea s neleag n ruptul capului cum era posibil ca virusul pe care-l vedea cu ochii lui s fi aprut ca urmare a unui proces psihic. Virusul nu i ataca victima din exterior. Dimpotriv, se ntea n corpul ei, dup ce aceasta vedea nregistrarea. Era consecina unui mecanism mental. Explicaia depea cu mult limitele imposibilului i Ando era stupefiat. Un salt de la nimic la fiinare, de la concept la materie. n lunga istorie a Pmntului, aa ceva se mai ntmplase doar o dat, la apariia vieii. Ce nseamn asta, c viaa a aprut datorit unei contiine active? O luase razna. Cuvintele lui Miyashita l-au readus la realitate: Nu arat ca ring? Ando i-a ntors din nou privirea la ecranul microscopului. Nu ia trebuit mult timp s neleag ce voia s spun Miyashita: era pur i simplu un termen de comparaie pentru forma virusului. Unele exemplare erau alungite, altele n form de U, dar cele mai multe semnau cu un inel deformat. Ring era fr ndoial cel mai potrivit nume. Avea chiar i o protuberant care aducea cu piatra unui inel. Ecranul prea fotografia unei camere goale n care cineva aruncase pe jos, la ntmplare, inele, erpi n miniatur i elastice rotunde.

240

Virusul Ring (grosisment 21 000)

Era de datoria lor, a celor care-l descoperiser, s-l i boteze, iar remarca lui Miyashita fusese o sugestie. Virusul Ring. Ce zici? Miyashita voia s afle prerea lui Ando. Numele era perfect, dar pe Ando chiar asta l deranja. I se prea, dac putea spune aa, prea perfect, i l obliga s se ntrebe dac nu cumva un Dumnezeu necunoscut i fcea astfel simit prezena. Cum a nceput toat povestea asta? Bineneles c nu uitase: cu numerele de pe foaia de ziar care apruse din cadavrul lui Ryuji. 178,136. l conduseser aici, la cuvntul ring. Apoi descoperise documentul acela uluitor intitulat tot Ring. Iar acum asta, n faa ochilor si: un virus n form de inel. Parc o voin colosal, care-i schimba forma la fiecare renatere i ncerca s se transforme n ceva i mai puternic, i alesese aceast imagine drept simbol. Universul microscopic avea o frumusee aparte, generat de repetarea ciclic, dar Ando nu mai vedea acum dect opusul ei, ceva oribil. Urenia nu era motivat doar de certitudinea c virusul avea s le fac ru oamenilor. Nu, ceea ce simea el era mai degrab o ur visceral fa de creaturile minuscule. Oricine ar fi vzut imaginea ar fi simit probabil aceeai repulsie, chiar dac nu tia nimic despre adevrata ei semnificaie. Ca i cum ar fi vrut s-i confirme concluzia, Nemoto era vizibil ocat. Minile i tremurau pe comenzile microscopului. Doar
241

mainria rmsese nepstoare i continua s scuipe imperturbabil negativ dup negativ. Dup ce a fcut apte fotografii, Nemoto a adunat clieele i a intrat n camera obscur. n timp ce atepta s se termine developarea, a luat seciunea cu celulele lui Mai i a pus-o n dispozitivul de fixare. S-a ntors la consol, mai calm acum, i a pornit microscopul. Ne uitm la seciunea Takano. Au mrit treptat grosismentul, aa cum procedaser i n cazul mostrei prelevate de la Ryuji. Au gsit foarte uor ceea ce cutau. Indiscutabil, aceiai virui. Se zvrcoleau acolo, pe ecran, la fel ca primii. Identic, au spus Ando i Miyashita ntr-un glas. Nu observaser vreun aspect care s le contrazic concluzia. Dar Nemoto, expertul n microscopie electronic, era mai sensibil dect ei la diferenele minore. E ciudat. Miyashita s-a uitat la Nemoto cteva clipe, n timp ce acesta cltina din cap i i mngia brbia, apoi a zis: Ce anume? Mai bine nu v spun nimic pn nu compar fotografiile. Prudent ca ntotdeauna, Nemoto ezita i acum s trag concluzii doar pe baza unor simple impresii despre virusul lui Ryuji. tiina cere dovezi, nu impresii, era sloganul lui. Dar, lsnd la o parte reticena, ar fi putut s jure c vzuse o deosebire cuantificabil. Nu era vorba despre numrul diferit de virui din cele dou mostre. Ceea ce i atrsese atenia era numrul mai mare de inele desfcute din mostra de snge prelevat de la Mai Takano. Bineneles, i n cea de la Ryuji existau destule asemenea specimene, n form de U sau ca nite erpi, dar cei mai muli virui erau ntregi, inelari, n cazul lui Mai, numrul inelelor sparte crescuse, i ele formau iruri aproximative.

242

Virus inelar desfcut (grosisment 100 000)

Pentru a-i confirma bnuielile, Nemoto a ales un specimen reprezentativ i a mrit grosismentul pn cnd virusul a umplut ecranul. Dac un specimen normal arta ca un inel, acesta semna n schimb cu un inel rupt chiar lng piatr. Piatra devenise un cap, iar montura un filament lung, unduitor. Rezultatul final era o form pe care Ando, Miyashita i Nemoto o cunoteau prea bine. Toi trei s-au gndit la acelai lucru n acelai timp, dar niciunul n-a ndrznit s vorbeasc.

243

6
Prima ntrebare s-a nscut n mintea lui Nemoto atunci cnd compara fotografiile viruilor. n orice zon a mostrei de la Mai Takano existau mai multe inele desfcute dect n oricare alt zon de mrime comparabil din mostra de la Ryuji. Din punct de vedere statistic, la Ryuji aproximativ unul din zece virui era desfcut, dar n mostra prelevat de la Mai proporia urca la cincizeci la sut. O asemenea diferen substanial trebuia s aib o cauz precis. Ando a cerut ca toate mostrele prelevate de la victimele casetei s fie examinate imediat la microscopul electronic. Au primit ultimele rezultate abia vineri, dup Anul Nou. Aruncnd o privire pe fereastra laboratorului, Ando a observat c din ninsoarea de noaptea trecut mai rmseser doar cteva fii subiri sub copacii desfrunzii din parcul din jurul Templului Meiji. Cnd se stura s studieze fotografiile, se ducea la fereastr pentru a-i odihni ochii cu privelitea lui. Miyashita era ns neobosit i continua s compare cu cea mai mare atenie clieele rsfirate pe birou. Punndu-i la socoteal pe Asakawa i pe Mai, unsprezece oameni muriser dup ce vzuser nregistrarea video. n sngele tuturor fusese gsit acelai virus. Nu mai ncpea nicio ndoial c acesta le provocase moartea. Dar, lund drept termen de comparaie inelele desfcute, victimele se mpreau n dou categorii. n cazul lui Mai sau al lui Asakawa, inelele desfcute atingeau jumtate din numrul total al viruilor, dar n celelalte mostre de snge reprezentau doar o zecime. Nu era un rezultat tocmai surprinztor. Soarta persoanei contaminate depindea n mare msur de raportul virus neinelarvirus inelar.
244

Statisticile mai artau c, odat ce se depea un anumit procent de virui neinelari, gazda era cruat de moartea prin stop cardiac. Deocamdat nu le era foarte clar ce valoare avea acest procent. Mai i Asakawa vzuser nregistrarea video. Virusul inelar apruse n corpurile lor. Pn n acest stadiu nu se deosebiser cu nimic de celelalte nou victime ale casetei. Dar ceva provocase transformarea viruilor ntr-o varietate cu flagel, iar aceste specimene depiser un anumit nivel critic. Iat de ce, chiar dac Mai i Asakawa vzuser nregistrarea, nu muriser prin stop cardiac. ntrebarea logic era urmtoarea: Ce anume provocase diferenierea viruilor din sngele lor? Prin ce se deosebeau ei de celelalte victime? O form special de imunitate? s-a ntrebat Ando cu voce tare. E posibil, a zis Miyashita, ridicndu-i privirea. Sau poate a continuat Ando, dar s-a oprit. Poate ce? Poate e ceva legat de virus. i eu nclin mai degrab n direcia asta, a spus Miyashita, ridicndu-i picioarele pe un scaun i scondu-i n fa burta respectabil. Tmpenia celor patru puti care au gsit primii nregistrarea a condamnat virusul la extincie ntr-un viitor destul de apropiat. Singura lui ans de salvare era s treac printr-o mutaie. Exact asta ne-a transmis Ryuji n mesajul lui. Bun, n concluzie cum i-a provocat mutaia i, mai ales, n ce anume s-a transformat? Dup prerea mea, rspunsul la aceste ntrebri va fi gsit n virusul din mostrele luate de la Mai Takano i Kazuyuki Asakawa. Adic n specimenele neinelare, desfcute. Dar un virus folosete pentru reproducere celulele gazdei. Corect. Iar uneori reproducerea este exploziv. i asta era o informaie de nivel elementar. Trebuia doar s te gndeti la ciuma neagr din Evul Mediu sau la gripa spaniol din timpuri mai apropiate, exemple concludente de virui care se
245

nmuleau fr opreliti. i? a zis Miyashita, deja nerbdtor. Gndete-te. Virusul i transmite omului: F o copie, altfel vei muri dup o sptmn. Iar dac omul face ce i se spune, o caset se transform n dou. E o rat de cretere foarte sczut. Chiar presupunnd c urmtoarele victime repet procesul de copiere, dup o lun apar doar patru casete. Da, cred c ai dreptate. Nu ar fi un motiv de panic. Vrei s zici c nu prea seamn cu un virus, nu-i aa? Dac nu se nmulete exponenial, nu se rspndete. Miyashita s-a uitat fix la Ando: Eti bun s ne lmureti unde anume bai? Pi, cred c Dar Ando nu tia de fapt ce vrea s spun. Nu cumva ncerca s complice i mai mult problema? Desigur, existau cazuri atestate n care un virus contaminase mii, zeci de mii de oameni practic peste noapte. Raiunea de a fi a viruilor este nmulirea maxim n cel mai scurt timp. n cazul casetei video, simpla copiere era un proces ineficient. Dovada: nregistrarea dispruse dup numai trei luni. Asta dac nu cumva renscuse sub alt form, prin mutaie Nimic, a fost un presentiment absurd. Ando s-a uitat iar la fotografiile viruilor inelari. Erau o mulime, ngrmdii unii ntr-alii. n punctele n care se suprapuneau mai multe exemplare, acestea alctuiau structuri care semnau cu fiile de band magnetic rsucit i ncurcat. n pragul morii, Sadako Yamamura i transformase gndurile ntr-o proiecie de imagini i generase un cmp energetic n puul acela prsit. nregistrarea se nscuse prin explozia acelei energii. Nu era un proces de multiplicare a materiei, ci a informaiei, aa cum fusese nregistrat pe banda magnetic i n ADN. Nu putea s scape de teama c undeva, ntr-un loc netiut, se petrecea chiar n clipa aceea o mutaie groaznic. Ando intrase n
246

camera lui Mai, se urcase pe acoperi i vzuse puul n care murise fata. Simise pe pielea lui ct de straniu era spaiul n care locuise, ct de ciudat era acoperiul de sub picioarele lui. Poate c tocmai din cauza asta el simea pericolul, iar Miyashita nu. I se prea c simte zvrcolirea acelui ceva din camera lui Mai sub tlpile lui, i era din ce n ce mai intens. Adic te atepi la o catastrof? l-a ntrebat Miyashita calm. Nu tiu, dar totul mi se pare grotesc. De cnd fcuse autopsia lui Ryuji, Ando tria ntr-o lume bizar. Parchetul era moale i lipicios sub picioarele lui, cldura vieii pulsa n spaii pustii. Fenomene inexplicabile, unul dup altul. i nc ceva: ce nscuse Mai? l treceau fiorii doar gndindu-se la asta. Fata murise cu o lun i jumtate n urm i ei tot nu aflaser ce nscuse. Ando avea mari dubii c adusese pe lume un copil frumos ca ea. Eti mereu pesimist. S zicem c a reuit s se transforme, asta nu nseamn c s-a adaptat la mediu. Crezi c virusul mutant a disprut i el? Nu putem exclude o asemenea ipotez. Eti mereu optimist. tii ce ravagii a fcut gripa spaniol n 1918. Au descoperit acelai virus n America, n 1977, dar n-a murit nimeni. Prima dat a ucis ntre douzeci i patruzeci de milioane de oameni n lume. aizeci de ani mai trziu era practic inofensiv. Da, un virus poate s slbeasc prin mutaii succesive. Dup dispariia lui Mai Takano nu mai murise nimeni n condiii suspecte, era o realitate indiscutabil. Ando citea zilnic ziarele i pstra permanent legtura cu oamenii lui din poliie, dar pn acum plasa rmsese goal. Poate c Miyashita avea dreptate: virusul renscut nu reuise s se adapteze la mediu n perioada de graie prea scurt care-i fusese acordat i i pierduse capacitatea de reproducere. Da, poate c dispruse. Ai idee ce-ar trebui s facem n continuare? a ntrebat Miyashita, dndu-i picioarele jos i rsucindu-se cu scaunul.
247

Pi, ar fi ceva ce mi-a scpat pn acum. Spune mai repede. Cnd i de unde a luat Mai caseta? Ce importan are? Chestia asta m scie. Vreau s aflu data exact. Ando simea c ar fi trebuit s verifice de mult acest aspect. Fusese prea ocupat cu virusul i uitase. Acum i se prea singura pist rmas. Era nouzeci i nou la sut sigur c nregistrarea video pe care o vzuse Mai era copia fcut pentru Ryuji, dar nu tia cum i cnd ajunsese ea n minile fetei.

248

7
I-a fost surprinztor de simplu s afle. Dac lucrurile lui Ryuji au fost trimise prinilor si la dou sau trei zile dup nefericitul eveniment, fr ndoial c Mai a luat caseta de-acolo. Ando a telefonat imediat familiei lui Ryuji. Cnd mama lui Ryuji a aflat c doctorul era un vechi coleg de facultate al fiului ei, a devenit brusc foarte amabil. Ando a ntrebato dac vorbise vreodat cu o tnr pe nume Mai Takano. Da, i-a rspuns femeia, ba chiar i-a spus cnd anume, dup ce a cutat n dosarul de cheltuieli al familiei bonul prjiturii pe care o cumprase special pentru Mai. Prima zi a lunii noiembrie, 1990. Ando a tresrit cnd a auzit data. De ce a venit Mai Takano la dumneavoastr? Femeia i-a explicat c fata l ajuta pe Ryuji s definitiveze o lucrare ce avea s fie publicat ntr-o revist tiinific, mai precis s transcrie manuscrisul, i descoperise c lipsea o pagin. Prin urmare, v-a fcut o vizit ca s caute pagina lips. Am neles bine? Ando i-a notat repede numele editorului revistei i a nchis telefonul. Nu voia s fie ntrebat ce mai face Mai. Dac i-ar fi spus c fata murise, s-ar fi trezit imediat sub o ploaie de ntrebri i rspunsurile lui nu erau tocmai potrivite pentru o mam care-i pierduse fiul. A rmas nemicat, cu o mn pe receptor, mult timp dup ce l aezase n furc. n ziua de 1 noiembrie, Mai s-a dus la prinii lui Ryuji. A gsit caseta n timp ce cuta pagina care lipsea din manuscris. A luat-o acas. S-a uitat la nregistrare n aceeai zi.
249

A nceput s asambleze o ipotez care avea ca punct de plecare data de 1 noiembrie. Virusul avea nevoie de o sptmn s-i fac efectul. Prin urmare, fata pise ceva n 8 noiembrie. Ando avea ntlnire cu ea a doua zi, 9 noiembrie. n ziua aceea o sunase de cteva ori, zadarnic. Da, totul cpta sens. Fie era acas, ns nu putea s rspund, fie czuse deja n capcana puului. A nceput s treac n revist evenimentele n ordine invers. Autopsia le artase ct timp rezistase fata n pu i ct timp trecuse de la moartea ei pn cnd tehnicienii gsiser cadavrul. Potrivit dovezilor medicale, murise n 20 noiembrie cu o oarecare aproximaie i czuse n pu cam cu zece zile nainte. Concluzia pe care putea s-o trag, n perfect concordan cu presupunerile anterioare, era evident: virusul o afectase ntr-un fel sau altul pe 8 sau 9 noiembrie i era rspunztor i de cderea ei n pu. n sfrit, era perfect logic s presupun c fata vzuse nregistrarea pe 1 noiembrie. Urmtorul pas a fost un drum pn la secia de periodice a bibliotecii, unde a cutat revista n care fuseser publicate articolele lui Ryuji. A gsit-o repede. Ultima parte a lucrrii, intitulat Structura cunoaterii, apruse n numrul din 20 noiembrie. Era un indiciu important. Mai a reuit s completeze i s transcrie articolul i l-a dus la editur. Prin urmare, ntre cele dou puncte de referin adic vizionarea casetei i moarte fata se ntlnise cel puin cu o persoan. A telefonat la revista care publicase articolul i a aranjat o ntlnire cu redactorul care se ocupase de lucrarea lui Ryuji. Se hotrse, fr s tie prea bine de ce, s vad cu ochii lui editura i s vorbeasc ntre patru ochi cu redactorul, dei i-ar fi fost mult mai uor s-o fac la telefon. A luat un tren JR pn la Suidobashi. De-acolo a mers pe jos cam cinci minute, cutnd adresa din cldire n cldire, pn cnd a
250

vzut n sfrit blocul cu unsprezece etaje al Editurii Shotoku. S-a oprit la recepie i a ntrebat de Kimura, redactor la revista lunar Curente. n timp ce atepta, s-a uitat ntr-o doar prin hol. Kimura ia trimis vorb c va cobor imediat. Ando s-a bucurat din nou c omul acceptase fr fasoane ntlnirea cu un necunoscut. La telefon i se pruse c brbatul are douzeci i ceva de ani i i imaginase c va fi ntmpinat de un tnr artos, cu ochelari cu rame subiri. Nici gnd. A vzut un tip ndesat, mbrcat cu pantaloni n carouri prini cu bretele. n ciuda anotimpului, chelia i strlucea de sudoare. Nu se potrivea n niciun fel cu ce-i imaginase Ando despre un redactor de la o editur important, mai ales unul angajat la o revist care se ocup de ultimele direcii n gndirea filosofic i tiinific. mi pare ru c v-am fcut s ateptai. Brbatul i-a zmbit larg i i-a ntins o carte de vizit: Satoshi Kimura, redactor-ef adjunct. Era mult mai btrn dect prea dup voce. Probabil c se apropia de patruzeci de ani. Ando a scos i el o carte de vizit i i-a spus: V mulumesc c ai acceptat ntlnirea. V pot oferi o cafea undeva n apropiere? i sugerase redactorului c prefer s discute cu el afar. n zona asta nu e nicio cafenea decent, dar avem noi un bufet, dac nu v deranjeaz. Deloc. Ando s-a lsat condus de Kimura i s-au urcat amndoi n lift. Bufetul se afla la ultimul etaj i ferestrele lui ddeau spre grdina din spate. Era excelent aprovizionat. Ando s-a afundat ntr-o canapea comod, s-a uitat n jur i a recunoscut cteva figuri pe care le mai vzuse prin ziare i reviste. Dup toate aparenele, bufetul era locul preferat pentru ntlnirile cu scriitorii. Pe multe mese se vedeau manuscrise i palturi. Am pierdut o personalitate extraordinar. Aceste cuvinte l-au smuls pe Ando din reverie. S-a adunat i s-a
251

uitat la faa strlucitoare, parc uns cu ulei a lui Kimura. Din ntmplare am fost coleg cu Ryuji Takayama la Medicin, a zis el, ateptnd reacia redactorului. Chiar aa? Deci l-ai cunoscut bine. Kimura a citit cartea de vizit pe care o inea n mn i a dat din cap, de parc abia acum era sigur c avea n fa un interlocutor serios. Pe cartona era scris i numele universitii, i i amintise c Ryuji urmase cursurile Facultii de Medicin la aceeai instituie. Mai mult, eu i-am fcut autopsia. Kimura a fcut ochii mari. i-a dus mna la brbie i a scos un strigt slab, ca un scncet. Vai, dar asta e A tcut, uitndu-se fix la minile lui Ando, care ineau ntre ele ceaca cu cafea, degetele care tiaser cadavrul lui Ryuji l fascinau. Totui, n-am venit azi aici s discutm despre el, a zis Ando, lsnd ceaca pe mas i mpreunndu-i palmele. Atunci de ce? A vrea s vorbim puin despre o student de-a lui, dac nu v deranjeaz. Mai Takano. Auzind numele, expresia lui Kimura s-a mblnzit imediat. S-a aplecat spre Ando. Ce-i cu ea? Nu tie, i-a spus Ando. Dar ar fi aflat oricum, mai devreme sau mai trziu. N-ai aflat c Mai a murit? Kimura a scos alt sunet, un fel de geamt i mai ciudat dect primul, i aproape a srit de pe scaun. Trsturile i reflectau emoiile cu un asemenea dramatism, nct devenise de-a dreptul comic. Parc era omul cu o mie de fee3. Ar fi avut anse mari s obin un rol ntr-o telenovel.
Aluzie la filmul clasic Man of a Thousand Faces (1957), cu James Cagney n rolul principal. (N. tr.)
3

252

Spunei-mi c glumii! a strigat Kimura. Nu pot s cred. A czut ntr-un pu de drenaj de pe un acoperi, n noiembrie, i a murit acolo. De-aia n-am reuit s mai iau legtura cu ea Ando ncepea s simt o oarecare simpatie pentru brbatul din faa lui. Se aflau n aceeai barc. Nu tia dac redactorul e cstorit sau nu, dar era oricnd gata s parieze c Mai nu-i fusese deloc indiferent. V amintii cnd ai vzut-o ultima dat? l-a ntrebat repede, ca s nu-i lase rgazul s se cufunde n sentimentalism. Lucram la paltul articolului pentru numrul de Anul Nou, deci trebuie s fi fost pe la nceputul lui noiembrie. Nu cumva inei minte i data exact? Kimura a scos din buzunar o agend i a nceput s-o rsfoiasc. 2 noiembrie. A doua zi a lunii noiembrie. A doua zi dup ce Mai le fcuse o vizit prinilor lui Ryuji i luase acas caseta video. Probabil c vzuse deja nregistrarea. Sper c nu v deranjeaz s-mi spunei unde v-ai ntlnit. Mi-a dat un telefon i m-a anunat c a terminat transcrierea textului. M-am dus imediat s-l iau. Unde anume? La ea acas? Nu, ne-am ntlnit la o cafenea n faa staiei de metrou de lng blocul ei. Acolo ne ntlneam de fiecare dat. Kimura voia s fie clar c nu intrase niciodat n garsoniera fetei, pentru c aceasta locuia singur. Vi s-a prut schimbat n vreun fel, indiferent cum? Kimura era nedumerit. Nu pricepuse prea bine sensul ntrebrii lui Ando: Ce vrei s spunei? Din nefericire, mai exist unele semne de ntrebare n privina cauzei decesului. Semne de ntrebare, zicei?
253

Kimura i-a ncruciat braele i a czut pe gnduri. Ne-ar fi de ajutor orice detaliu, orict de nensemnat. Ai observat ceva? Ando i-a zmbit, ncercnd s-l liniteasc. Da, mi s-a prut c nu era n apele ei. Putei fi mai precis? Era palid. i inea o batist parfumat la gur, de parc i-ar fi fost grea. Ando a devenit brusc foarte atent. i-a amintit ce vzuse n baie, urmele maronii de pe pardoseal. i n-ai ntrebat-o dac se simte bine? Nu. De fapt mi-a spus chiar ea c nu se simte bine fiindc a lucrat toat noaptea la manuscrisul profesorului Takayama. neleg. Adic nu dormise deloc. Exact. V-a mai spus ceva? Trebuie s nelegei c eram pe fug. I-am mulumit pentru manuscris, am schimbat cteva cuvinte despre cartea care urma s fie publicat, apoi mi-am luat rmas-bun. Cartea? Cartea lui Ryuji adic. Da. Am stabilit de la bun nceput c la un moment dat vom publica articolele n volum. Cnd apare cartea? Va ajunge n librrii luna viitoare. V urez vnzare bun. E un text destul de dificil i nu ne facem mari sperane. Trebuie s v spun totui c e o carte foarte bun. Ce spun, e superb. Mai departe conversaia a deviat pe calea amintirilor despre Ryuji i lui Ando nu i-a fost deloc uor s-o ndrepte spre subiectul iniial. Cnd a reuit n cele din urm s-o readuc pe Mai n discuie i s se intereseze de relaia ei cu Ryuji, ora pe care i-o acordase Kimura se scursese deja. Nu reuise s afle nimic important, dar i-a
254

spus c nu era cazul s abuzeze de bunvoina redactorului. Fr ndoial c avea s mai aib i alte ntlniri cu el i voia s-i fac o impresie ct mai bun. I-a mulumit lui Kimura i a plecat. n drum spre ieire, s-a uitat ntmpltor la oamenii care tocmai intraser n bufet. Erau doi brbai i o femeie, i Ando i tia din vedere pe toi trei. Femeia era o scriitoare care se abonase la bestselleruri dup ce una dintre crile ei fusese ecranizat. Ando o vzuse de cteva ori la televizor i n revistele sptmnale. Unul dintre brbai era regizorul filmului. Dar cel care i-a captat total atenia i l-a luat prin surprindere a fost nsoitorul regizorului, care avea cam patruzeci de ani. Numele i sttea pe limb. Parc era i el scriitor. Ia te uit, Asakawa. M bucur s aud c merge treaba. Asakawa. Era Junichiro Asakawa, fratele mai mare al lui Kazuyuki. Ando i fcuse o vizit n noiembrie, n apartamentul lui din Kanda, ca s ia discheta Ring. n clipa aceea era att de fericit c fcuse rost de dischet, nct se desprise de el n grab, cu un salut formal. Totui, mai trziu, cnd i trimisese discheta napoi, pusese n plic i un bilet cu mulumiri foarte politicoase. i-a mai adus aminte c pe cartea de vizit pe care i-o dduse Junichiro citise i numele editurii. Din pur ntmplare, sau poate tocmai datorit acestei legturi, cartea lui Ryuji era publicat de editura la care lucra fratele celui mai bun prieten al su. Remarcndu-l n sfrit pe Ando, Junichiro a tresrit uor. Era surprins. Bun ziua, mi pare bine c ne ntlnim din nou a zis Ando i s-a nclinat, pregtindu-se s-i mulumeasc iar pentru ajutor i s-i fac urrile tradiionale de Anul Nou. Dar Junichiro i-a ferit privirea i i-a luat-o nainte: Scuzai-m. Doar att a spus, l-a ocolit pe Ando i i-a condus nsoitorii la o mas liber. Era clar c i se dduser papucii. S-a uitat lung la
255

Junichiro care se aezase deja, ns acesta discuta foarte concentrat cu regizorul i nu i-a aruncat nici mcar o privire. l ignora fi. A scotocit n memorie, ncercnd s gseasc o explicaie pentru comportarea cel puin nepoliticoas a lui Junichiro. Ando inea minte destul de bine discuiile lui anterioare cu editorul. Nu-i amintea s fi fcut vreo gaf care s justifice o asemenea atitudine. Pur i simplu nu reuea s priceap. Cltinnd din cap, a ieit din bufet pe urmele lui Kimura.

256

8
n aceeai sear, cnd a ajuns acas, primul lucru pe care l-a fcut a fost s umple cada. Nu mai fcuse asta de-o venicie. Cnd tria fiul lui, fceau baie mpreun n fiecare sear. Dup ce rmsese singur, pregtirea bii devenise o corvoad i se obinuise s fac numai duuri. Dup ce s-a splat, Ando a luat copiile fotografiilor fcute la microscopul electronic i le-a nfipt n perete. S-a dat civa pai napoi i s-a uitat la ele cteva minute. Un perete al garsonierei era acoperit de o bibliotec pn-n tavan, dar peretele de deasupra patului, gol i zugrvit n alb, prea un ecran de proiecie. Atrnase fotografiile acolo aa cum punea radiografiile n cutia luminoas, n ordinea cresctoare a grosismentului: 17 000x, 21 000x, 42 000x, 100 000x. Toate erau imagini ale virusului gsit n sngele fetei. S-a dat doi pai n spate fr s-i ia privirea de la ele. ntr-un punct, viruii inelari ngrmdii unii peste alii alctuiau o structur care semna cu o scar n spiral. S-a concentrat i a ncercat s gseasc orice indiciu, orice detaliu, care-i scpase pn atunci. A stins plafoniera i a ndreptat spre fotografii fasciculul puternic al unei veioze. n lumina crud, i s-a prut o clip c virui uriai se trau pe peretele alb ca laptele. A fixat veioza pe un clieu n care se vedeau cteva inele desfcute. Aceast form particular a virusului aprea frecvent n mostrele luate de la Mai i Asakawa, dar aproape deloc la Ryuji i la celelalte victime. La Mai, membrana intern a arterei coronare nu suferise nicio modificare, n schimb, la Asakawa vzuse un chist n stadiu incipient. Cu alte cuvinte, chiar Mai i Asakawa aveau simptome diferite.
257

De ce nu a fost afectat artera ei coronar? Ando i-a concentrat gndurile n aceast direcie. Virusul filiform la care se uita acum nu atacase artera coronar, care n celelalte cazuri fusese inta principal. O amintire ncerca s-i croiasc drum ctre suprafaa memoriei lui. A deschis carnetul n care notase toate micrile fetei de la sfritul lui octombrie pn la moartea ei, n noiembrie i l-a inut n lumin. Se ntlnise prima dat cu ea n 20 octombrie, la Institut, chiar nainte de autopsia lui Ryuji. Fata nu se simea prea bine. Ando bnuise de ce: i venise ciclul. Fusese doar o intuiie, dar se dovedise c nu greea. S-a uitat iar la fotografiile de pe perete. A studiat o vreme imaginea virusului filiform mrit de 100 000 de ori i a ncercat si aminteasc prima impresie pe care-o avusese cnd o vzuse la universitate. Nu-i adusese aminte de ceva, cu capul lui ovoidal i flagelul care se unduia n urm? n sngele lui Mai notau roiuri ntregi, dar nu atacaser artera coronar. Ce au atacat? Fruntea i ardea. n mintea lui s-a deschis o ferestruic i prin ea a intrat o raz de lumin. Mai trecuse prin asemenea clipe, cnd ceva ascuns vreme ndelungat ncepe s ias la iveal. Ando s-a uitat din nou n agend, la dat. Seara zilei de 1 noiembrie. A dousprezecea sau a treisprezecea zi dup menstruaie. A fcut un pas ctre perete, apoi altul. Ctre viruii cu cozi unduitoare. Asta e. Arat exact ca spermatozoizii care nainteaz spre cervix. Sperm? a zis cu glas tare. n ziua aceea ncepuse ovulaia. Perioada de ovulaie ncepe la aproximativ dou sptmni dup ncheierea menstruaiei, iar ovulul rmne n oviduct cel mult douzeci i patru de ore. Dac fata avea un ovul n trompa uterin n seara cnd vzuse nregistrarea
258

Virusul inelar gsise alt cale de aciune i i schimbase inta imediat: n loc s atace artera coronar, atacase ovulul. Ando s-a aezat pe marginea patului. Simea c se sufoc. Nu avea niciun rost s se uite iar n agend sau la fotografii. Era mai mult dect probabil c fata intrase deja n perioada de ovulaie cnd vzuse caseta. Din ntmplare o ntmplare tragic vizionase nregistrarea exact n ziua aceea a lunii. Iat de ce era o excepie. Dintre toate femeile care vzuser caseta, ea era singura la ovulaie. i Cnd a ncercat s deduc ce se ntmplase mai departe, Ando a ncremenit. Dar nu putea s resping prea mult concluzia inevitabil. Ovulul lui Mai fusese invadat de nenumrate particule ale virusului inelar, iar ADN-ul lui fusese modificat. Ovulul a fost fecundat. Dei evoluase ntre timp, virusul nu-i schimbase caracteristicile de baz. Ovulul fertilizat i ncheiase ciclul de dezvoltare n doar apte zile i fusese eliminat din corpul fetei. Dar ce a nscut? Acum Ando tremura violent. i amintise de atingerea uoar pe picior. Indiferent ce-ar fi, m-a atins Cnd intrase n garsoniera lui Mai, n spaiul acela care trebuia s fie pustiu, simise fr urm de ndoial rsuflarea unei fiine vii. i, ncremenit n baie n poziia aceea nefireasc, simise apoi o atingere uoar pe glezn, la tendonul lui Ahile, acolo unde ciorapul i alunecase. Acum putea fi sigur c se ntlnise cu ceea ce nscuse Mai. Ceva destul de mic nct s nu-l fi vzut cnd se uitase prin camer. Poate c se afla ntr-un stadiu incipient de dezvoltare, poate c ncpea ntr-un cotlon. Indiferent ce era, mai simea i acum pe piele ecoul atingerii lui. Avea frisoane. Trebuia s fac nc o baie fierbinte. S-a dezbrcat. Nu scosese dopul, cada era nc plin. A lsat apa clocotit s curg
259

pn cnd apa din cad s-a nfierbntat. Dup ce s-a cufundat n cad, a scos piciorul din ap i l-a rsucit ca s-i poat examina tendonul lui Ahile. L-a masat puin. Prea perfect normal, dar aceast constatare nu l-a linitit niciun pic. i-a scufundat iar piciorul n ap i a rmas aa, cu genunchii la piept. Dup o vreme, n mintea lui a cptat contur o ntrebare. Acum tia c Mai nu suferise un stop cardiac. Dar Asakawa? Era brbat, a optit. Poate c i el nscuse ceva. Poate c apa era prea fierbinte. Deodat i s-a fcut sete.

260

Partea a cincea PREMONIIA

261

1
Cincisprezece ianuarie, era srbtoare naional. Alt weekend de trei zile. n prima zi a mini-vacanei, Ando a primit un telefon de la Miyashita care voia s tie dac avea chef de o plimbare cu maina. Pentru Ando, invitaia era ca un port ntr-o furtun pentru o corabie veche. Pn atunci se tot ntrebase ce ar putea face de unul singur ca s treac mai uor peste zilele libere. Nu prea-i plcuse tonul lui Miyashita parc i ascundea ceva , dar nu avea niciun motiv s nu accepte. I-a spus c merge, apoi l-a ntrebat: Unde mergem? S-i art ceva, i-a rspuns Miyashita laconic. Ando i-a zis c amicul lui are un motiv bine ntemeiat, aa c s-a abinut s-l preseze. Rspunsul putea s mai atepte pn n momentul ntlnirii. Miyashita a venit s-l ia de acas. Imediat dup ce s-a urcat n main, Ando l-a ntrebat iar unde se duc. Nu pot s-i spun. Te rog s nu m mai ntrebi nimic. Aa c au pornit la drum, ctre o destinaie secret. Automobilul a ieit de pe Autostrada 3 Tokio-Yokohama i s-a angajat pe oseaua Nou Yokohama. Dup toate aparenele, se ndreptau ctre Fujisawa. Dac n zona aceea era punctul terminus, nu puteau ajunge pe lumin. Pn la Odawara sau Hakone da, poate pn la Peninsula Izu, dar n niciun caz mai departe de Atami sau Ito. Dup cteva ncercri nereuite de a ghici destinaia misterioas a cltoriei, Ando s-a hotrt s tac i s se bucure de drum. Maina s-a oprit chiar nainte s se strecoare n uvoiul traficului.
262

Intrarea pe oseaua Nou era ntotdeauna aglomerat, iar azi, la nceputul unui weekend prelungit, era mai ru ca niciodat. Gndindu-se c Miyashita se plictisea la volan, Ando s-a hotrt s-i prezinte ipoteza pe care o nchegase zilele trecute i care explica de ce fata era singura victim cu artera coronar nemodificat. I-a spus c Mai intrase n perioada de ovulaie, vzuse nregistrarea, iar virusul i schimbase inta i atacase ovulul, nu artera coronar. Apoi, chiar nainte s cad n puul de pe acoperi, fata nscuse ceva, o nou form de via. O fiin care apruse pe lume dup numai apte zile de gestaie. Naterea explica i de ce nu purta chiloi. Miyashita l-a ascultat fr s-l ntrerup i o vreme n-a zis nimic. Ochii lui rotunzi i ptrunztori preau s priveasc pierdui oseaua, dar apoi a schimbat banda cu o repeziciune uimitoare i a gonit pe o band liber. i eu m-am gndit cam la acelai lucru cnd am vzut virusul la microscopul electronic, a zis Miyashita n cele din urm, fr s ia n seam corul furios de claxoane. Cum adic? Virusul desfcut, neinelar, mi se prea cunoscut. Dup un timp mi-am dat seama aa, din senin, c seamn cu spermatozoizii. i tu? i Nemoto. Deci toi trei am avut aceeai impresie. Da. Uneori trebuie s iei n serios intuiiile. Miyashita s-a uitat la el i i-a aruncat un rnjet. Ai grij ce faci! a strigat Ando, apsnd cu piciorul n podea i uitndu-se ngrozit la stopurile mainii din fa care se apropiau cu repeziciune. Nu te speria, n-o s sfrim ca Asakawa, l-a linitit Miyashita, care ncerca s par calm dup ce tocmai strivise pedala de frn. Botul mainii lor se oprise la civa centimetri de bara automobilului din fa. n timp ce-i tergea sudoarea rece de pe
263

frunte, Ando s-a ntrebat dac Miyashita nu era cumva miop. Dac se ncpna s conduc aa, mai devreme sau mai trziu avea s fac un accident. Apropo de Asakawa, nu ne-am lmurit nici acum de ce n-a murit prin stop cardiac. Ai dreptate. Brbaii nu ovuleaz. Poate c avea i el o particularitate fizic, la fel ca Mai. Da, poate c virusul a gsit alt ieire. Ce ai spus? Ieire? O cale mai eficient de nmulire. Dup ce au trecut de bucla de la Hodogaya, nebunia traficului s-a mai potolit. Fr ndoial c Miyashita folosise cuvntul ieire inspirat fiind de indicatoarele rutiere. Colegul lui a continuat: tii, doar de noi depinde s nelegem pn la capt. Crede-m, m strduiesc ct pot. Miyashita a schimbat subiectul: Ce-ai fcut de Anul Nou? Nimic. Am stat acas. Hm. Eu am plecat cu ai mei ntr-un stuc de pescari tocmai n vrful Peninsulei Izu. Am stat la o pensiune minuscul care nici mcar nu apare n pliantele turistice. Ghiceti de ce am ales un loc att de izolat? Simplu: am citit un roman n care-i vorba despre satul la i mi-a plcut la nebunie. M-am tot gndit s-l vizitez. n carte scrie c vezi un miraj pe ocean dac te uii la orizont. Am crezut fiecare cuvinel. Ando se chinuia s priceap unde vrea Miyashita s ajung. S-a mulumit s dea din cap i s-l asculte. tiu c sunt lipsit de tact s-i spun asta, dar o familie e un lucru minunat. Vezi tu, din camera noastr se auzea zgomotul valurilor i m trezeam n toiul nopii s-l ascult. M uitam la soia i fetia mea, i-n clipele acelea simeam mai mult ca niciodat ct de mult le iubesc. Ando cunotea prea bine frumuseea vieii de familie. A ncercat
264

s-i nchipuie o vacan de Anul Nou ntr-un stuc de pescari din Izu, unde puteai vedea miraje pe mare Dac s-ar fi dus numai el, singurtatea ar fi fost insuportabil, dar mpreun cu cei dragi ar fi trit o experien minunat. A nceput s se cufunde ncet n gnduri sumbre despre familia lui destrmat, dar Miyashita nu l-a lsat s se nece: Nevast-mea e superb, nu-i aa? Cnd i-a rspuns, Ando nu se gndea la soia prietenului su, ci la fosta lui soie. Absolut, a zis el, amintindu-i ct de natural i de proaspt era la prima lor ntlnire. Unde mai pui c eu sunt bondoc, gras i urt. Dar ea Ea E frumoas i are o personalitate extraordinar. tiu bine c sunt norocos. Soia lui Miyashita era nalt, mai nalt dect el, i semna perfect cu o actri foarte cunoscut. n comparaie cu ea, Miyashita prea reprezentantul unei rase inferioare. Dar era talentat, iar dac i vedea de treab n continuare, era imposibil s nu urce rapid n ierarhia universitar. Ando a rs amar. Colegul lui nu avea niciun motiv s se simt inferior. nelegi de ce nu vreau s mor. Cred c am fost prea optimist. Vezi tu, pn acum am participat la ancheta asta n calitate de observator obiectiv. De fapt, chiar mi-a fcut plcere s ghicesc unde ne va conduce. Ando luase lucrurile mult mai n serios, dar i el se mulumise s adopte punctul de vedere al unui observator neimplicat. Iar dac nu reuea pn la urm s descifreze misterul, mcar nu avea ce pierde i nu-i era team de moarte. n aceast privin se deosebea radical de Asakawa sau Ryuji. Da, i mie. Dar mi-am dat seama c am subestimat pericolul. Cnd? Dup excursie, cnd ne-am ntors de la Izu.
265

S-a ntmplat ceva acolo? N-am vzut niciun miraj. Ando s-a ncruntat. Miyashita o luase razna. E singurul motiv? Ai vizitat vreodat scena unui roman? Da, cred c da. Bnuia c muli oameni simeau, mcar o dat n via, dorina de a vedea pe viu universul romanului preferat. i cum a fost? Nu tiu. Ceva de genul Bine, asta e. Te ateptai la altceva? Oricum, de cele mai multe ori riti s fii dezamgit. Deci locul pe care i-l construieti n imaginaie n timp ce citeti romanul este diferit de cel real, pe care-l vezi mai trziu. Nici nu poate fi altfel. Exact. Am recunoscut scena, doar citisem n carte descrierea ei. Dar ceva nu se potrivea, i pn la urm mi-am dat seama c nu era deloc cum m ateptam. Nici nu m-am mai dus s vd mirajul. Regretele lui Miyashita i se preau de-a dreptul copilreti, dar na spus-o cu voce tare. Un romancier vede lumea prin propriul filtru i o descrie n consecin. Este inevitabil. Cum filtrul e unic, cnd cititorii reconstruiesc n minte universul fizic al romanului, rezultatul final nu are cum s semene cu realitatea. Dac nu ai un aparat de fotografiat sau o camer video, nu poi s imortalizezi i s descrii precis o scen. Cuvintele au limitele lor. Miyashita s-a aplecat brusc spre Ando i i-a optit: Pe de alt parte, ce-ar fi Poi s vorbeti i n acelai timp s te uii n fa, nu? Ando a ntins mna spre parbriz, iar Miyashita a ncetinit i a trecut pe banda cealalt. i mai aduci aminte cnd ai citit Ring? Ando n-a reuit s-i aminteasc data exact. Citise raportul la o zi dup ce mprumutase discheta de la
266

Junichiro, fratele lui Asakawa. Nu uitase, n schimb, c ardea de nerbdare, smulgea fiecare pagin i o citea pe nersuflate. Nu sunt sigur. Cred c a fost n 19 noiembrie. Eu l-am citit doar o dat. Ando la fel. l citise de la cap la coad o singur dat, apoi nu se mai uitase la el. i ce-i cu asta? n ciuda acestui fapt, mi amintesc perfect fiecare scen descris acolo. Uneori chiar m gndesc la ele. Ando trebuia s-i dea dreptate i n aceast privin. Evenimentele i locurile descrise n Ring erau foarte vii, ca i cum iar fi rmas ntiprite definitiv n minte. Dac voia, putea s-i aminteasc fiecare imagine n cele mai mici detalii. Era un text foarte vizual. Bine, i? Pentru c habar n-avea ce ncerca Miyashita s-i sugereze, Ando nu i-a rspuns. La un moment dat m-am ntrebat ct de precis sunt descrise i transmise scenele de pe caset. Ciudat, expresia lui Miyashita a rmas la fel de linitit, n pofida mesajului nchis n cuvintele pe care tocmai le rostise. Abia atunci a priceput Ando ce-l nelinitea pe colegul lui. Ce s-ar ntmpla dac scenele pe care ni le-am imaginat n timp ce citeam relatarea lui Asakawa nu se deosebesc deloc, absolut deloc de cele reale? Dar era mcar posibil aa ceva? Ce-ar fi dac Gtul i se uscase, i Ando abia reuise s vorbeasc. Radiatorul meninea n main o temperatur plcut, dar aerul se uscase prea mult. n concluzie, m-am gndit c ar fi mai bine s vedem cu ochii notri i s verificm. Am neles. De-asta m-ai trt dup tine atta drum Ando aflase n sfrit destinaia cltoriei. Se duceau n regiunea Hakone-Atami, unde se desfuraser multe dintre evenimentele
267

povestite n Ring. Mergeau acolo s verifice dac locurile descrise n raport se potriveau cu cele construite n imaginaia lor. i, bineneles, dou perechi de ochi erau mai bune dect una singur. Ando i Miyashita puteau s vad, s discute, s analizeze i, dac aveau noroc, s ajung la o concluzie corect. La nceput m-am gndit c nu e bine s-i spun nimic nainte s ajungem acolo. Trebuie s fii obiectiv. N-ai nicio grij. Am uitat s te ntreb: N-ai mai fost niciodat n staiunea Pacific Land, nu-i aa? Bineneles c nu. Dar tu? Nici mcar n-am auzit de ea nainte s citesc raportul. Deci niciunul nu clcase vreodat n staiune. Cnd a nchis ochii, Ando a vzut n minte panorama staiunii turistice, cabanele risipite pe panta domoal. irul de evenimente uimitoare ncepuse n cabana B-4. Sub caban era un spaiu gol, i acolo se deschidea gura unui pu de cinci sau ase metri adncime. Cu douzeci i cinci de ani n urm, o femeie pe nume Sadako Yamamura fusese violat i aruncat n pu. n temnia aceea, mintea obsedat de rzbunare a lui Sadako fcuse un pact cu virusul variolei. Iat unde l ducea Miyashita. n drum spre Atami, Miyashita a luat-o prin Manazuru, avnd mereu n dreapta Muntele Hakone, nvluit n nori. Potrivit raportului Ring, Miyashita i Ando mergeau pe acelai traseu. Niciunul dintre ei nu mai mersese vreodat pe autostrada aceea, dar lui Ando i se prea c mai trecuse pe-acolo. Kazuyuki Asakawa strbtuse acelai drum pe 11 octombrie. Urcase pe drumul de munte fr s tie ce-l ateapt n cabana B-4, dar avnd totui o presimire. Acum se apropia ora prnzului, cerul era senin i soarele strlucea puternic. n 11 octombrie plouase cu intermitene, iar Asakawa pornise tergtoarele de parbriz. Ando citise toate acestea n Ring. Asakawa se uitase nelinitit prin parbriz, tergtoarele se
268

micau ritmic. i ora, i vremea erau diferite, dar Ando avea o senzaie acut de dj-vu. A vzut n sfrit pe versant indicatorul pentru staiunea Pacific Land. I s-a prut cunoscut, dei scrisul negru pe fond alb era neobinuit. Miyashita a luat-o la stnga fr s ezite i au nceput s urce pe drumul abrupt de munte de parc mai trecuser pe-acolo i l cunoteau perfect. Drumul s-a ngustat i panta a urcat i mai piepti. De-o parte i de cealalt se vedeau cmpuri cultivate. Asfaltul era ntr-un asemenea hal, nct le venea greu s cread c mergeau pe singura cale de acces ctre o staiune important. Crengile crescute n voie i tufele uscate zgriau maina, iar zgomotul era foarte neplcut. Senzaia de dj-vu a lui Ando s-a accentuat pe msur ce urcau. Nu mai trecuse niciodat pe-acolo, i totui ar fi jurat c recunoate locurile. Nu i se pare c ai mai fost aici? a zis el aproape n oapt. M pregteam s-i pun aceeai ntrebare. Vaszic Miyashita simea acelai lucru. Sigur, nu era prima dat cnd Ando avea impresia c revede o scen, dar senzaia nu durase niciodat att de mult. n plus, intensitatea ei cretea permanent. Ando vedea perfect cu ochii minii cldirea care-i atepta la captul drumului, o construcie elegant cu trei niveluri i faad din sticl fumurie. Au ajuns pe aleea circular care ducea n parcare i cldirea a aprut n faa lor. Era biroul de informaii, identic cu cel din nchipuirea lui Ando. Vedea deja i restaurantul din spatele holului de recepie. Nu mai aveau nevoie de alte dovezi. Raportul Ring era copia fidel a realitii. Dar ce-i mai atepta acolo?

269

2
Mult mai trziu, maina a cobort din muni, a trecut pe lng Atami i a luat-o pe oseaua Manazuru, de-a lungul coastei, ctre Odawara. Conversaia lncezea, pentru c amndoi se gndeau la scenele pe care le vzuser i la oamenii pe care-i cunoscuser. Ando era prea ngrijorat de rezultatele acelei excursii de-o zi ca s mai guste din frumuseea sublim a peisajului marin care se desfura sub ochii lui. Staiunea, cabana i puul jucau pe valuri, ca un miraj. Mirosea a pmnt rscolit. Era obsedat de faa brbatului, pe care-l recunoscuse. Cldirile i anexele staiunii Pacific Land erau risipite de-o parte i de alta a drumului, ntre biroul de informaii i hotel. Terenurile de tenis, piscina, sala de gimnastic, cabanele, toate fuseser construite pe teren denivelat, fie n amonte, pe versant, fie mai jos, ctre vale. Cabanele erau presrate pe o pant mai domoal n comparaie cu alte zone ale staiunii. S-au oprit pe marginea drumului i s-au uitat n jos la complexul de cabane. Dincolo de ele, iruri lungi de sere se pierdeau n deprtare, ntre Kannami i Nirayama. Acoperiurile lor albe strluceau orbitor sub razele soarelui iernatic. i ele li se preau cunoscute. Au ajuns la cabana B-4. Miyashita a ncercat ua, dar era ncuiat, aa c s-au dus n spate, unde tiau c se afl veranda. S-au ghemuit i au vzut imediat o pat neagr, acolo unde lipseau cteva scnduri fixate cndva pe stlpii de susinere. tiau c fuseser smulse, tiau i cine fcuse asta: Ryuji. n ziua de 18 octombrie, el i Asakawa se strecuraser prin deschiztura aceea ngust, ajunseser sub caban i coborser pe o frnghie n pu ca s scoat la lumin
270

rmiele lui Sadako Yamamura. O misiune nspimnttoare. Miyashita a luminat cu lanterna pe care o inea mereu n main spaiul ntunecos din spatele peretelui de lemn. Au vzut n centrul lui o ridictur neagr. Lng ea, un capac din beton. Exact ca n Ring. Ando n-avea niciun chef s se trasc acolo i s se uite n pu, la fel cum nu fusese n stare s se uite n puul de drenaj n care murise Mai. Ajunsese pe marginea lui, dar i pierduse curajul. Aici, alt femeie tnr, Sadako, i trise ultimele clipe ale vieii sub o bucic rotund de cer. Mai Takano respirase ultima dat pe fundul unui paralelipiped vertical din beton. Una i dduse ultima suflare ntr-un cilindru cptuit cu piatr, lng un sanatoriu construit pe versantul unui munte, cealalt pe acoperiul unei cldiri de pe malul apei. Una murise n adncul pdurii, unde o mpletitur deas de crengi acoperea albastrul cerului, cealalt n apropierea unui port, unde mirosul mrii era copleitor i nu exista nimic ntre ea i cer. Una murise ntr-un sicriu cilindric ngropat adnc n pmnt, cealalt ntr-un sicriu rectangular care plutea n aer. n loc s le diferenieze, contrastul dintre cele dou spaii sublinia de fapt similaritatea lor esenial. Deodat, inima lui Ando a nceput s bubuie. Mirosul de pmnt reavn i-a umplut nrile i, fr s vrea, i-a inut rsuflarea. Simea c se sufoc. n timp ce Ando se pregtea s fug, Miyashita se chinuia s-i strecoare trupul masiv n spaiul strmt de sub podeaua de scnduri. Ando, care se temea c prietenul lui era hotrt s ajung pn la pu, a zis rspicat: Gata, ajunge. Miyashita a ezitat cteva clipe, ncremenit ntr-o poziie incomod. Cred c ai dreptate, a recunoscut el. A urmat sfatul lui Ando i a nceput s se trasc de-a-ndratelea. Da, ajunseser suficient de departe. Aveau destule dovezi.
271

Au ieit amndoi de sub verand i au tras adnc n piept aerul proaspt de munte. Cuvintele ar fi fost de prisos. Era limpede ca lumina zilei c fiecare detaliu din Ring respecta fidel realitatea. Ipoteza se dovedise corect: imaginile mentale produse de citirea raportului erau conforme cu realitatea. Totul era la fel ca n descrierile din text. Citind Ring, Ando i Miyashita vzuser deja locurile. Fiecare cuvnt al lui Asakawa reflecta adevrul, ncepnd cu mirosul de aer jilav i terminnd cu consistena pmntului de sub tlpile lor. Miyashita nu s-a mulumit cu att: Dac tot am venit pn aici, de ce s nu-i facem o vizit lui Jotaro Nagao? Jotaro Nagao. Ando aproape uitase numele, dar i amintea perfect trsturile brbatului, dei nu-l vzuse dect n paginile raportului Ring. Era chel, iar chipul lui atrgtor nu-i trda vrsta de peste cincizeci de ani. Prima impresie pe care le-o fcea interlocutorilor era plcut, ntrit apoi i de felul n care vorbea. Ando cunotea deja i inflexiunile vocii lui Nagao. Cu douzeci de ani n urm, pe actualul amplasament al staiunii Pacific Land se afla un sanatoriu pentru tuberculoi. Dei acum Nagao avea un cabinet particular n Atami, pe vremea aceea lucra la sanatoriu. n ziua nefericit cnd Sadako Yamamura venise s-l vad pe tatl ei, Nagao o violase i-o aruncase n pu. Doctorul mai avea o particularitate: era ultimul bolnav de variol din Japonia. n Ring citiser urmtoarea descriere: Pe o strdu din faa grii Kinomiya se afla o csu cu un singur etaj, iar pe firma de lng u scria Clinica Nagao: medicin intern i pediatrie. Acolo, Ryuji care aborda foarte direct toate situaiile l scuturase pe doctor pn cnd acesta i mrturisise crima veche de dou decenii. Miyashita i propunea lui Ando s fac acelai lucru: s-l vad pe Nagao cu ochii lor. Dar, ajuni n faa cabinetului, au vzut c perdeaua de la intrare era tras. Casa nu prea s fi fost nchis doar pentru sfritul
272

sptmnii. Pe prag se adunase un strat gros de praf i la colurile tocului erau cteva pnze de pianjen. Au vzut i alte semne care dovedeau c locul era nchis pentru mult timp, dac nu definitiv. Ando i Miyashita au renunat la ideea ntlnirii cu Nagao i s-au ntors la maina parcat n apropiere. Se pregteau s se urce n ea, cnd au vzut un scaun de invalid care cobora ncet pe strada n pant, venind dinspre Spitalul Naional Atami. Scaunul cu rotile era mpins de o femeie elegant de vreo treizeci de ani, iar n el sttea un btrn chel, cu umerii adui. Btrnul i rotea ochii n toate direciile, dar nu prea s vad nimic. Era limpede c avea probleme psihice. Cnd Ando i Miyashita i-au vzut faa, au tresrit amndoi i au schimbat o privire. Dei mbtrnise cumplit, parc douzeci de ani n doar trei luni, l-au recunoscut imediat pe Jotaro Nagao. tiau cum arat doctorul i comparaser portretul din amintirea lor cu figura pe care o vedeau acum. Miyashita s-a apropiat de el i a spus linitit: Doctore Nagao Btrnul n-a reacionat, dar nsoitoarea care putea s fie fiica lui s-a ntors spre strin i l-a privit n ochi. Miyashita s-a nclinat politicos, iar femeia i-a rspuns la salut. Cum se simte? a ntrebat Miyashita plin de naturalee, de parc i-ar fi fost un vechi prieten. Mulumesc, bine, a spus femeia. i-a continuat drumul cu o expresie care descuraja orice ncercare de conversaie. Dar ntlnirea nu fusese inutil. Dovedea mcar att: ntlnirea cu Asakawa i Ryuji, n urma creia i mrturisise vechile pcate, l zdruncinase puternic pe doctor. Era limpede c Nagao pierduse orice legtur cu lumea. Tatl i fiica au trecut de cabinetul prsit i au intrat pe o strad ngust. n timp ce se uitau n urma lor, Ando i Miyashita s-au gndit la acelai lucru, care nu avea legtur doar cu Nagao. l recunoscuser amndoi pe btrnul din scaunul de invalid. Se pare
273

c Ring nregistrase perfect nu numai locurile, ci i chipurile. Ando s-a uitat la indicatorul de direcie pentru autostrada Odawara-Atsugi, apoi la Miyashita. Prietenul lui ncepea s dea semne de oboseal, i pe bun dreptate. Porniser la drum de diminea, i de-atunci conducea aproape fr ntrerupere. Poi s m lai la Odawara, a zis Ando. Miyashita s-a ncruntat i i-a ntors puin capul spre el: Termin cu prostiile. tii c te duc bucuros pn acas. Da, dar de ce s faci un ocol? Ascult-m, de la Odawara pot s iau un tren pe magistrala Odakyu. M duce chiar acas. Ando era ngrijorat din cauza lui Miyashita. Drumul pn la Yoyogi, unde l-ar fi lsat pe Ando, i napoi la Tsurumi, unde locuia el, ar fi adugat kilometri buni la sutele pe care-i fcuse deja. Miyashita era n mod evident epuizat, att fizic ct i psihic, iar Ando voia s-l tie ajuns acas i ntins pe un pat. Bine, dac insiti, te arunc din main la Odawara! a cedat Miyashita. Vorbise de parc i fcea un hatr prietenului su, dar fr ndoial c nu ardea de nerbdare s bat drumul pn la Tokio i napoi. Aa se ntmpla aproape de fiecare dat, rareori spunea un simplu mulumesc. i era greu s-i exprime recunotina n mod direct. Dup ce i-au croit drum prin centrul oraului Odawara pn la gar, Miyashita a mormit: Primul lucru pe list sptmna viitoare: ne facem analizele. Ando n-a zis nimic, pentru c se gndise deja la asta. Avea senzaia neplcut c se transformase brusc din observator neimplicat n participant. Copiile casetei nefaste dispruser, iar el nu vzuse nregistrarea. Teoretic, nu avea niciun motiv s se team, dar acum, cnd tia c raportul Ring era reflectarea fidel, aproape supranatural a evenimentelor Se simea ca un doctor care trateaz un bolnav de SIDA i constat c a fost i el contaminat, c
274

boala se transmite pe o cale pn atunci necunoscut. Sigur, nu avea dovezi, totul era deocamdat n stadiul de posibilitate. i totui Ando se temea, avea senzaia c trupul lui fusese invadat de ceva. n ultimele ceasuri trise sub imperiul unei fantezii morbide: virusul pe care-l studiase la microscopul electronic se rspndea n corpul lui, se nmulea sub pielea lui, i viola celulele. Fr ndoial c i Miyashita era nelinitit din aceeai cauz. Cu excepia autorului, Ando era primul om care citise Ring. Raportul descria n cele mai mici detalii scenele de pe band i prezenta att de precis portretul lui Jotaro Nagao, nct Ando l recunoscuse pe doctor ntr-o clip. Firete, era inevitabil s se ntrebe dac lectura textului nu avea aceleai consecine ca vizionarea nregistrrii. Dar l citise anul trecut, n 19 noiembrie. Se scurseser dou luni i nu pise nimic, cel puin nimic detectabil. Nu-i apruse nicio tumoare n artera coronar, nu murise dup o sptmn. Oare virusul suferise o mutaie i perioada de incubaie era acum mai lung? Sau era un simplu purttor i nu manifesta simptomele bolii? Miyashita avea dreptate. Analizele de snge erau prima urgen a sptmnii viitoare. Dac se mbolnviser i ei, trebuia s acioneze rapid. Dar Ando habar n-avea cum. Ce ai de gnd s faci dac eti ring-pozitiv? a ntrebat el fr prea mari sperane. Poi s fii sigur c nu m dau btut. O s-mi vin o idee. Miyashita n-a mai spus nimic. Lui Ando i se pruse c glasul prietenului su trda o spaim mai adnc dect a lui. Era firesc, dac te gndeai c Miyashita avea o familie. Maina a intrat n sensul giratoriu din faa grii Odawara, apoi pe culoarul rezervat pasagerilor, i apoi s-a oprit. Ando s-a dat jos i a rmas pe loc. Miyashita i-a fcut cu mna i n clipa urmtoare a plecat. Acum nu mai putem da napoi.
275

Abia atunci a neles Ando pe deplin prin ce chinuri trecuse Asakawa. S-a vzut pe sine nsui i l-a vzut pe Miyashita, dar siluetele lor au nceput s tremure i s semene cu Asakawa i Ryuji. Ando era Asakawa i Miyashita era Ryuji. Sigur, Ryuji i Miyashita nu prea semnau, nici fizic, nici n privina personalitii. Era o comparaie caraghioas, i Ando a zmbit n sinea lui. Zmbetul interior a disprut brusc cnd i-a amintit c Asakawa i Ryuji muriser. Chiar el disecase cadavrul lui Ryuji. A trecut pe la casa de bilete, apoi a ieit pe peron i s-a aezat pe o banc. Sptarul era ngheat i Ando s-a ntrebat deodat cum se simeau cadavrele pe masa de autopsie. Dac mai simi ceva dup moarte. Uneori e mai ru s stai pe ntuneric i s-i imaginezi scene ngrozitoare. Dintr-un anumit punct de vedere, e infinit mai chinuitor s bnuieti c ai cancer dect s i se spun adevrul n fa. Nesigurana e cea mai cumplit tortur. Dac te confruni direct cu marea ncercare, mai ai o ans s-o depeti cu demnitate. n fiecare dintre noi exist ceva care ne ndeamn s ne ateptm la ce-i mai ru. Prin urmare, era sau nu contaminat? Avea o singur cale de a depi incertitudinea clipei, i anume s se conving pe sine nsui c viaa lui oricum se consumase. Iar faptul c se simea vinovat de moartea fiului su avea s-l ajute, poate, s reteze ultima legtur cu viaa Dar n timp ce sttea acolo, pe un peron dintr-o gar oarecare, ateptnd un tren expres, Ando nu reuea s-i stpneasc tremurul.

276

3
Ando a cutat un loc liber i s-a aezat. Acum nu mai avea nimic de fcut, doar s se uite pe fereastr. De obicei citea, dar acum nu avea nicio carte la el. De diminea, cnd se urcase n maina lui Miyashita, nu se gndise c se va ntoarce cu trenul. Defilarea monoton a peisajului avea efect soporific, i Ando nu s-a mpotrivit. A nchis ochii. Cnd i-a deschis, nu tia unde se afl. Pulsul i s-a accelerat brusc, l-a cuprins spaima c n timpul somnului fusese dus departe, foarte departe. i auzea btile inimii. A ncercat s-i ntind picioarele i a lovit fotoliul din fa. ocul i s-a transmis n piept i n cap. Vibraiile familiare ale vagonului i zgomotul ritmic al roilor pe ine l-au smuls treptat din aceast stare neplcut. Sunt n tren. A oftat uurat cnd i-a amintit c se desprise de Miyashita n faa grii din Odawara, unde reuise, cu puin noroc, s se urce n primul tren spre Tokio. Parc trecuser zile ntregi de-atunci, i o venicie de cnd plecase din staiunea Pacific Land. Hakone i se prea un continent ndeprtat. Rmseser vii doar imaginea pantelor domoale i chipul doctorului Nagao. Ando s-a frecat la ochi i s-a uitat iar afar. Acum, prin dreptul ferestrei se perindau ncet scene citadine nocturne. Trenul ncetinise pentru c se apropia de ultima staie, Shinjuku. n timp ce traversa strzile, era nsoit de corul semnalelor sonore i de jocul luminilor roii de avertizare. Ando i-a mijit ochii, ncercnd s citeasc numele staiei prin care tocmai treceau. Yoyogi Hachiman. Urmtoarea staie era Sangubashi, chiar lng garsoniera lui. Acolo ar fi trebuit s coboare, dar expresul n care se
277

afla nu mai oprea nicieri pn la Shinjuku. Era obligat s coboare la capt i s ia alt tren napoi, doar dou staii. O pierdere de vreme. La Yoyogi Hachiman linia Odakyu i schimb direcia cu aproape nouzeci de grade i merge paralel cu pdurea din parcul Yoyogi. Ando cunotea foarte bine locurile. Blocul lui era aproape, undeva n dreapta, dar nu putea s-l vad din tren. n timp ce treceau prin staia pe care o folosea zilnic, Ando i-a lipit nasul de geam i s-a uitat la peron. A tresrit i i-a strivit faa de fereastr. Acolo sttea o femeie pe care o recunoscuse. Purta doar un taior, total nepotrivit pentru o sear de iarn, i atepta la cteva palme de marginea peronului. Se uita la vagonul lui. Dei trenul ncetinise mult, siluetele din staie au disprut fulgertor. n clipa aceea efemer, privirea lui Ando a ntlnit-o pe cea a femeii. Nu i se pruse. Simea acut ocul schimbului de priviri. Se ntlnea cu ea a treia oar. Prima dat ieise din garsoniera lui Mai i coborser mpreun. A doua oar o vzuse la ultimul etaj al blocului pe acoperiul cruia murise Mai. Era n lift i se trezise fa n fa cu ea. Dei o vzuse doar de dou ori, i-o amintea perfect. Dup zece minute, a cobort la Sangubashi din trenul pe care-l luase de la Shinjuku. La Sangubashi ambele linii erau n mijlocul staiei, ntre peroane. Cnd trenul lui a oprit n staie, pe cealalt linie staiona trenul care mergea n sens invers. Prin urmare, nu putea s vad peronul de vizavi. A luptat din greu mpotriva uvoiului de pasageri care se grbeau s ajung la ieire, apoi a ateptat s plece trenurile. Voia s vad dac femeia rmsese acolo. Dei trecuser zece minute de cnd o vzuse prima dat i era contient c acioneaz mnat de o dorin iraional, Ando era sigur c ea l ateptase. A auzit semnalul sonor i trenurile s-au pus n micare n acelai timp, ca dou ui glisante care se deschid. Acum vedea perfect cellalt peron. i, n clipa de linite care a urmat, i-a ntlnit iar
278

privirea. Nu se nelase. Sttea exact n acelai loc i se uita la el cu aceeai concentrare. Ando i-a susinut privirea i a salutat-o cu o micare discret. Voia s-i transmit c era pregtit s-i urmeze instruciunile. Apoi s-a ndreptat fr grab spre ieire. Femeia a pornit n acelai timp i a cobort scrile de pe partea ei. S-au oprit amndoi n dreptul casei de bilete. Ne-am ntlnit din nou, a zis ea, ca i cum ar fi fost o simpl coinciden. Dar nu era. Femeia tiuse c el va trece prin Sangubashi, n trenul acela, i nu n altul. l ateptase acolo. Acum, cnd se afla n faa lui, n-avea niciun rost s i se mpotriveasc. Au ieit mpreun pe strada ngust i plin de magazine de lng staie.

279

4
Cnd s-a trezit a doua zi diminea, femeia care sttea ntins lng el i-a cerut imediat s-o duc la un film lansat de curnd. Era weekend, dar la matineu se gseau totdeauna bilete. Femeia s-a aezat imediat, lsnd un scaun liber ntre ea i Ando. Pn atunci se agase pur i simplu de braul lui, ns acum, ca din senin, voia s pstreze distana. Fotoliile erau uriae, deci n niciun caz nu s-ar fi simit nghesuit. Ando nu reuea s priceap. Pe de alt parte, dac s-ar fi apucat s nire toate gesturile ei care i se pruser ciudate, n-ar fi terminat nici pn seara. tia doar att: c era sora lui Mai i se numea Masako. Se uita int la ecran, dar nu vedea nimic. Poate i din cauz c i era somn, dar mai ales pentru c simpla prezen a lui Masako l mpiedica s se concentreze. tia c se ntlnise cu ea ieri-sear, n staia Sangubashi, dar nu putea s-i aduc aminte cum ajunsese femeia n garsoniera lui. O invitase la barul de lng staie i acolo, cu o bere n fa, o ntrebase cum se numete. Masako Takano. Sunt sora mai mare a lui Mai. Exact cum bnuia. I-a spus c era cu doi ani mai mare dect Mai i c lucra la o firm de asigurri, la care se angajase imediat dup ce terminase facultatea. De aici ncolo, n mintea lui Ando se lsase ceaa. Nu buse prea mult, dar i aducea aminte doar frnturi. De exemplu, nu-i amintea cine fcuse propunerea, ns ntr-un fel sau altul sfriser la el acas. Urmtorul episod care-i rmsese n memorie ncepea cu zgomotul apei care curgea n baie. n acest fragment contextul era limpede: Masako fcea un du, iar Ando o atepta aezat pe marginea patului.
280

Apa s-a oprit i femeia a aprut pe hol. A stins lumina fr s-i mai cear voie. Momentul acela, cnd totul s-a ntunecat, i-a lsat o impresie puternic. O clip mai trziu, trupul gol al lui Masako s-a lipit de el. i nfurase prul ud ntr-un prosop pe care-l inea cu o mn, iar cu cealalt l-a apucat de ceaf i i-a aplecat capul pn cnd i-a atins snii. S-a pierdut n pielea ei catifelat, care i-a acoperit nasul i gura. A nceput s se sufoce. A mpins-o puin n spate, ct s respire. Apoi i-a umplut plmnii cu mirosul ei proaspt i a luat-o n brae Filmul era banal, aa c Ando i-a omort timpul lipind cioburile de amintiri rmase din noaptea aceea ciudat. Nu se mai culcase cu o femeie de un an i jumtate. i amintea c ejaculase de trei ori, dar nu era un motiv de mndrie. Mai avea puin i mplinea treizeci i cinci de ani, iar faptul c reuise s-o fac de trei ori ntr-o noapte era mai degrab dovada frumuseii ei dect a virilitii lui. Abia acum, cnd ncerca s reconstituie evenimentele, i-a dat seama c aventura lui sexual se desfurase de la nceput pn la sfrit n bezn. Deci nu avea nicio importan c Masako era de o frumusee tulburtoare, c era o femeie extrem de provocatoare, el nu fusese stimulat de fizicul ei. Nu numai c stinsese lumina, acoperise pn i ceasul electric de pe noptier. Voia s fie ntuneric, nu tolerase nici mcar lumina slab a cadranului ceasului. Fiecare micare a lui Masako trdase nevoia ei intens de ntuneric. Ando se prefcea c se uit la film, dar o studia cu coada ochiului pe Masako. ntunericul din sal i punea i mai mult n valoare frumuseea. Femeia asta era alctuit din ntuneric. n timpul filmului, Masako a nchis ochii de cteva ori. Nu aipise, pentru c i mica buzele. Prea s spun ceva, dar Ando na reuit s neleag ce anume. n cele din urm s-a aplecat n fa i spre stnga i i-a sprijinit brbia n palm. i, n sfrit, dup ce s-a uitat o vreme la ea, a neles. Masako repeta cuvintele personajelor din film.
281

Pe ecran, o tnr orfan pe care o agenie guvernamental o transformase ntr-o main de ucis tocmai fusese trimis n prima ei misiune. n scena respectiv purta o rochie neagr i avea n geant un pistol uria. A intrat ntr-un restaurant elegant. Au urmat cteva momente de tensiune intens, cu replici rapide ca un foc ncruciat. Ando i-a smuls privirea de la ecran i s-a uitat iar la Masako. Femeia repeta cuvintele eroinei. Apoi, timp de cteva clipe, glasurile lor s-au suprapus. Personajele vorbeau n francez, subtitrarea era n japonez, dar replicile n japonez ale femeii de lng el erau perfect sincronizate cu cele n francez ale femeii de pe ecran. Prea un duet exersat ndelung. Ando a constatat ocat c uneori buzele lui Masako se micau nainte s apar traducerea. Nu putea s fac aa ceva dect dac mai vzuse filmul nainte, i nu o singur dat, pentru c n-ar fi memorat dialogul. O vreme, Masako a rmas pierdut n lumea eroinei, iar fericirea care i se citea pe fa l-a amuzat pe Ando. Apoi a simit c era privit i a tcut brusc. Nu a mai rostit niciun cuvnt. Cnd au ieit din cinematograf, Masako i-a nchis ochii pe jumtate, i-a nbuit un cscat i l-a luat de bra. Soarele strlucea stins i Ando a hotrt pe loc c era mai plcut s simt direct atingerea ei dect s mearg bra la bra. i-a tras braul i a luat-o de mn. L-a scuturat un fior rece, dar apoi minile lor au ajuns la aceeai temperatur i degetele lui Masako s-au relaxat ntre degetele lui fine. Era o zi de srbtoare i n jurul lor mergeau o mulime de tinere mbrcate n kimonouri. Ando i Masako s-au lsat purtai de mulime de la Yurakucho pn n Ginza. Voia s-o invite la mas, dar nu se hotrse unde. Avea de gnd s aleag un restaurant simpatic, undeva pe drum. La fiecare intersecie din Ginza, Masako se uita n jur cu o curiozitate copilreasc i din cnd n cnd pufnea de ncntare. Nu ncercase nicio clip s rup tcerea, dar Ando se simea bine cu ea.
282

De fapt, plimbarea asta linitit prin Ginza, la sfrit de sptmn, l fcea aproape fericit. La urmtorul col de strad, Masako s-a oprit n dreptul unui fast-food care vindea hamburgeri i o vreme s-a uitat int la panoul de reclam de pe trotuar. Privirea ei sincer trda ceva din naivitatea unui copil. Vrei s mncm aici? a ntrebat-o Ando. h, a zis ea, dnd energic din cap. Ando a intrat n local, oarecum mulumit c putea s scape att de ieftin. Pofta de mncare a lui Masako l-a uluit. n cteva clipe a nfulecat doi hamburgeri i o porie mare de cartofi prjii. Nici n-a terminat bine i s-a uitat din nou la vitrine, cu aceeai scnteiere de lcomie n privire. Acum voia o ngheat, aa c Ando a comandat-o imediat i i-a adus-o. De data asta a mncat ncet, ca i cum se temea c va ajunge prea repede la ultima nghiitur. Dei ducea linguria la gur cu o grij exagerat, tot a reuit s se pteze cu ngheat topit. Ciorapii ei erau mpodobii acum cu buline albe ca laptele, amestecate cu cerculee de culoarea cpunilor. A cules o pictur i i-a supt vrful degetului, apoi a devenit brusc nerbdtoare. i-a apucat gamba cu amndou minile, i-a ridicat genunchiul la gur i l-a lins ncet. Fr s-i schimbe poziia, i-a micat ochii i i-a aruncat lui Ando o privire provocatoare. Ando s-a ferit s se uite n ochii ei. n cele din urm a terminat s ling petele de ngheat i i-a lsat jos piciorul. Avea o gaur n ciorapi, care erau nou-noui. Probabil c o fcuse cu dinii. Ando i cumprase ciorapii de diminea, de la un supermarket de lng staie. Femeia umbla cu picioarele dezgolite n toiul iernii. I se fcea frig numai cnd se uita la ea, aa c luase iniiativa fr s-i cear prerea. Cnd i primise, se repezise ntr-o toalet public s-i pun. Gaura din ciorap o deranja pe Masako, pentru c-i tot masa
283

genunchiul. Ando se gndea c nu s-ar plictisi niciodat s-i urmreasc micrile. A aprut de nicieri, i acum m ndrgostesc de ea. S-a ntrebat dac era ntr-adevr dragoste. Poate c era doar disperare, poate c viaa lui se destrmase. Dac era purttor al virusului Ring pentru c citise textul acela straniu, dac trupul lui era devorat treptat, atunci nu-i putea permite s piard nici mcar o clip de plcere. n timpul liceului citise un roman despre o femeie dintr-un sat de munte, o femeie aducnd foarte mult cu cea la care se uita acum. Eroina crii era de o frumusee ieit din comun, dar, fiindc nu vorbea i nu se purta ca restul stenilor, acetia o considerau nebun. Sfrise prin a satisface poftele brbailor care nu aveau soii sau iubite. Imaginea femeii rtcind prin pdure, ntr-o stare demn de mil, acceptnd avansurile oricrui brbat care-i ieea n cale, avea o anumit ncrctur erotic, accentuat i de scena exotic. Satul de munte era decorul perfect, asigura armonia dintre personaje i scen, iar Ando se gndise c romanul ar fi pierdut mult din atmosfer dac autorul ar fi plasat aciunea ntr-un cadru citadin. Dar acum se afla n Ginza, n inima metropolei Tokio, nu ntr-un ctun pierdut n creierii munilor. Masako avea ns aceeai aur ca eroina romanului, iar frumuseea ei, care se ncadra n canoanele moderne, nu era deloc deplasat n decorul unui fast-food. Ando i-a amintit brusc cum se termina romanul. Singur n muni, femeia nate, dar nu tie cine e tatl copilului. Povestea se sfrete cnd primele scncete ale copilului sfie linitea pdurii i strnesc ecoul printre stnci. Nu am voie s accept aa ceva. i-a adresat singur un avertisment. Trebuia s ia msuri, s protejeze corpul lui Masako. Noaptea trecut, entuziasmat de perspectiva unei partide de sex, uitase de cele mai elementare reguli de precauie i nu folosise un prezervativ.
284

Masako i masa genunchiul cu buricele degetelor, ntr-o micare circular, lrgind treptat gaura din ciorap. Acolo se vedea o pat de piele alb, att de alb nct era pcat s-o acoperi, chiar i cu o pereche de ciorapi fini. Diametrul gurii cretea. Ando a oprit-o, apucnd-o de mn. Ce spuneai n timpul filmului? a ntrebat-o el, ncercnd s afle de ce repeta replicile personajelor. Du-m la o librrie, a zis ea. Schimbase iar subiectul, evitase ntrebarea. n loc s-i rspund, i cerea mereu s fac ceva, s-o duc undeva. Bineneles, Ando nu era n stare s-o refuze. S-au dus la cea mai mare librrie din Ginza. Masako a trecut de la un raft la altul, dar pn la urm s-a aezat cu o carte pe genunchi i a citit mai mult de o or. Ando, care nu avea acest obicei, a hoinrit fr int prin librrie pn cnd a descoperit, lng casele de marcaj, un teanc de pliante ale Editurii Shotoku. Cum vizitase redacia cu o zi n urm i pliantele erau gratuite, a luat unul i s-a retras ntr-un col. Pliantul coninea un scurt text introductiv, dar n rest prezenta titlurile n pregtire. M ntreb dac lucrarea lui Ryuji apare aici. A desfcut pliantul i a nceput s-o caute. Ieri, redactorul lui Ryuji, Kimura, i spusese c volumul era n pragul publicrii. Ando spera s vad acolo numele fostului su coleg, nu numai dosarul de autopsie. Dar n-a apucat s-l gseasc, pentru c Masako l-a tras afar din librrie. Ce zici, mergem la un film? Tonul ei fusese destul de blnd, dar strnsoarea puternic i graba cu care-l mna dovedeau c n-ar fi acceptat un refuz. Poate c vzuse un afi n librrie i se hotrse c filmul era bun. Ando a strecurat pliantul n buzunarul hainei i a ntrebat-o: La ce film vrei s mergem?
285

Femeia nu i-a rspuns, s-a mulumit s-i strng mna i mai tare i s-l trag dup ea. Pentru prima dat, Ando s-a mpotrivit i a ncetinit pasul. Eti cam insistent, nu-i aa? Abia atunci a observat c Masako inea n mn o revist cu programul spectacolelor i s-a oprit n mijlocul trotuarului. Pn atunci femeia nu cheltuise nici mcar un yen. Nu schiase niciun gest c ar fi dispus s plteasc, l lsase de fiecare dat s achite notele. Lui Ando nu-i venea s cread c pltise revista din banii ei. Nu era ntr-o saco, o inea n mn. O furase. Ando s-a uitat peste umr n direcia librriei. Nu alerga nimeni dup ei. Masako reuise cumva s-i pcleasc pe librari. Era o revist ieftin, de trei sute de yeni: chiar dac ar fi prins-o, n-ar fi fost o tragedie. Ando s-a lsat dus mai departe. Se simea mai ndrzne ca niciodat.

286

5
n clipa cnd a bgat cheia n broasc, a auzit telefonul sunnd n garsonier. Nu s-a repezit s intre, pentru c se atepta s nu ajung la timp. A rsucit mnerul. Cnd l cutau prietenii, de obicei lsau telefonul s sune de cinci sau ase ori cel mult, pentru c toi tiau ct de mic e garsoniera lui. Prin urmare ghicea de fiecare dat cinei telefona, pentru c un strin nu renuna att de repede. Aa cum se atepta, pn s deschid ua telefonul a tcut, un semn sigur c l cutase cineva care-l cunotea bine. Nu erau muli, iar cei care intraser n casa lui erau i mai puini. Probabil c fusese Miyashita. Ando s-a uitat la ceas. Abia trecuse de opt seara. A deschis ua larg i a invitat-o pe Masako s intre, apoi a aprins luminile i a pornit radiatorul. Hainele erau risipite peste tot, la fel ca dimineaa, cnd plecaser. Masako i lsase lucrurile acolo, o dovad limpede c se hotrse s petreac nc o noapte cu el. Dup dou filme n aceeai zi, unul dimineaa i altul dupamiaza, lui Ando i amoriser umerii i spatele. Avea nevoie de o baie. Cnd i-a dat jos haina, a simit n buzunar pliantul editurii. L-a scos i l-a pus pe noptier, gndindu-se c avea timp mai trziu s-l citeasc pe ndelete. Se hotrse s cumpere cartea lui Ryuji i voia s afle titlul i data apariiei. i-a scos i puloverul i i-a suflecat mnecile cmii. A cltit cada puin, a potrivit temperatura i a lsat apa s curg. Cada nu era mare, aa c nu avea mult de ateptat. Baia se umpluse de aburi, iar ventilatorul nu era de prea mare ajutor. S-a gndit s-o lase pe Masako s intre mai nti i a scos capul pe u. Femeia sttea pe marginea patului i i scotea ciorapii.
287

Vrei s faci o baie? Masako s-a ridicat n picioare. n aceeai clip a sunat telefonul. n timp ce Ando se ducea s rspund, femeia a intrat n baie i a disprut n spatele perdelei impermeabile. Era Miyashita, aa cum bnuise. Nici n-a apucat s duc receptorul la ureche i l-a auzit strignd: Unde naiba ai fost toat ziua? La film. Miyashita se atepta la orice, numai la asta nu. La film? a ngimat el. La dou filme, mai precis. Trebuie s fie plcut s n-ai nicio grij pe lumea asta, a mrit el, vizibil enervat, apoi a continuat s-i verse suprarea: Habar n-ai de cte ori te-am sunat. Mai ies i eu din cas, dac n-ai aflat pn acum. Bine, nu conteaz. tii unde sunt acum? Chiar, de unde i telefona Miyashita? Nu prea s fie acas, pentru c Ando auzea zgomotul de maini. Pesemne c de la un telefon public. S nu-mi spui c eti n apropiere i vrei s-mi faci o vizit Momentul era total nepotrivit. Masako abia intrase n baie. Ando se pregtea s refuze propunerea lui Miyashita, dac asta avea de gnd. Nu fi prost. tii ce-i la teatru, omule? Ai auzit de scen? Ce tot spui acolo? Acum venise rndul lui Ando s se enerveze. Cu ce drept l luase la rost Miyashita pentru escapada lui la cinematograf, dac el nsui se dusese la teatru? Dar adevrul era cu totul altul. Sunt la Grupul Dramatic nlarea. Numele parc-i spunea ceva. Unde l citise? i-a adus aminte brusc: n Ring. Era numele trupei de teatru n care se angajase Sadako Yamamura nainte s moar. Ce naiba faci acolo?
288

Ieri mi-am dat seama c descrierile din text sunt att de precise, de obiective, nct parc ar fi scene filmate. i eu. Ce rost avea s discute iar despre asta? Ando a vzut pliantul de pe noptier i l-a tras spre el, pentru c era singura hrtie la ndemn. Avea un obicei vechi, care l linitea: de fiecare dat cnd vorbea la telefon i nota cte ceva. Poziia lui tipic de conversaie era cu receptorul inut ntre brbie i umr i cu pixul n mna dreapt. Bun. Azi am neles c mai trebuie s verific un punct. Cum si spun, dac voiam s vedem la fa un personaj din raport, de pild pe Nagao, nu trebuia s ne ducem la Atami, nu-i aa? Ando ncepuse s-i piard rbdarea. Nu-i ddea seama ncotro bate Miyashita. Hai, spune odat. Miyashita i-a luat inima n dini i i-a spus: Vorbesc despre Sadako Yamamura. Hai, ce naiba, a murit n 1966. Stai puin i Ando a neles de ce se dusese Miyashita la Grupul Dramatic nlarea. Fotografia. Da, citise n Ring c Yoshino, colegul lui Asakawa, nimerise n toiul unei repetiii, dar reuise s citeasc dosarul lui Sadako. Fata adusese un CV nainte s se angajeze, i acesta era nsoit de dou fotografii, una bust, cealalt stnd n picioare. Yoshino le copiase pe amndou. Te-ai prins n sfrit, nu? Era floare la ureche s aflm cum arta Sadako. Ando a revzut n minte imaginea pe care i-o fcuse despre Sadako. Datorit raportului, era un portret cu contururi accentuate, gravat adnc n memoria lui. Era nalt i zvelt, cu sni nu prea mari, dar n armonie perfect cu restul trupului. Faa ei avea trsturi oarecum androgine, ns ochii erau perfeci, nasul la fel, i
289

n-ar fi schimbat niciun detaliu, nici dac ar fi avut puterea s-o fac. Frumuseea ei era de neatins. Ando i-a adunat curajul, ct mai avea, i a zis: Bine, ai reuit? I-ai convins s-i arate fotografiile? Probabil c Miyashita le vzuse, iar chipul din fotografii i cel din mintea lui se dovediser a fi identice. De fapt, asta se i atepta Ando s aud. A auzit n schimb un oftat. Nu seamn. Vrei s zici E alt fa. i Ando a amuit. Nu tiu cum s-i explic. Sadako Yamamura din fotografii e diferit de cea pe care mi-am imaginat-o. E frumoas, fr discuie, dar Cum s-i spun F un efort, explic-mi. S-i explic? Ce naiba, m-am ncurcat de tot. Stai, mi-am amintit ceva. Aveam un prieten care fcea nite portrete extraordinare, i odat l-am ntrebat care fee sunt cel mai greu de desenat. Mi-a spus c poate face fr probleme orice portret. Mi-a mai spus c fiecare fa are trsturi distincte care l ajut pe portretist s prind esena ei. Dar, a adugat el, dac ar fi s aleag, cel mai dificil portret este autoportretul. Mai ales dac artistul e obsedat de propria lui persoan. Rezultatul final se deosebete totdeauna de model. i? Ce legtur are asta cu ce discutm noi? Poate niciuna. Pur i simplu mi-am amintit de el. Dar gndete-te la caset. Scenele nu au fost filmate, nu-i aa? Imaginile au fost produse n mintea lui Sadako. i, n pofida acestui fapt Ce? Reproduc perfect locuri i oameni. Ai uitat c noi n-am vzut nregistrarea? Nu, dar am citit Ring.
290

Ando se plictisise de-a binelea. Miyashita prea s se nvrt n jurul subiectului. Era ca un copil care vrea s ajung undeva, dar se teme s fac primul pas. Ascult, Miyashita, i-e chiar aa de greu s-mi spui ce te roade? Ando l-a auzit cum trgea aer n piept. Oare autorul raportului Ring e chiar Kazuyuki Asakawa? Cine altul s fie? Ando a deschis gura s-i rspund, dar a auzit un bip: cardul lui Miyashita era pe terminate. Fir-ar s fie, am rmas fr bani. Poi s primeti fotografii pe faxul tu? l-a ntrebat Miyashita pe nersuflate. Aa m-a asigurat tipul care mi l-a vndut. Perfect, i le trimit prin fax. Vreau s te uii la ele imediat i s verifici dac e vreo deosebire fa de ce i-ai imaginat. Poate c eu sunt Legtura s-a ntrerupt. Ando a rmas acolo un minut, cu receptorul la ureche, parc n trans. Zgomotul duului s-a oprit i n camer s-a aternut tcerea. A simit pe obraz o adiere rece i i-a ridicat capul s vad dac nu uitase fereastra deschis. n deprtare s-a auzit un claxon de main. Sunetul aspru, ascuit, dovedea ct de uscat era aerul rece de-afar. n garsonier aerul era ncrcat cu umezeal. Pe ua deschis a bii ieeau nori de abur. Masako nu se grbea deloc. Ando s-a gndit la ce-i spusese Miyashita. nelegea prea bine starea sufleteasc a prietenului su. Probabil c-i pierduse ziua ntreag stnd ca pe ace, dar, n cele din urm, dect s rmn acas i s se ntrebe la nesfrit dac virusul i-a invadat organismul pentru c citise Ring, s-a hotrt s acioneze. i amintise c n arhiva teatrului aceluia cu nume ciudat existau dou fotografii ale lui Sadako i se dusese acolo s le vad. Rezultatul fusese surprinztor: fotografiile nu semnau cu portretul pe care i-l imaginase. Pentru c nu avea cum s verifice dac aceast nepotrivire exista doar n mintea lui, copiase fotografiile ca s le
291

vad i Ando. Iar acum se pregtea s i le trimit prin fax. Ando s-a uitat la fax. Deocamdat nimic. Privirea lui a poposit din ntmplare pe pliantul publicitar al editurii. L-a luat i a nceput s-l rsfoiasc. Viitoarele apariii erau enumerate la sfrit. Sub titlul Nouti n februarie se nirau vreo cincisprezece apariii, fiecare dintre ele urmat de numele autorului i de o foarte scurt prezentare, de cel mult zece-dousprezece cuvinte. A vzut numele lui Ryuji la jumtatea coloanei. Titlul nu fusese schimbat, era tot Structura cunoaterii, iar dedesubt scria doar att: Avangarda gndirii contemporane. Era nghesuit ntre un roman de dragoste i o culegere de eseuri despre televiziune, lucru care nu-i fcea cinste. Dar era ultima carte a colegului su, publicat postum. Ando avea de gnd s-o citeasc, orict de arid ar fi fost. A ncercuit titlul cu pixul. n clipa aceea a auzit un declic n minte. Se declanase ceva, dar nu tia ce. A ncercat s se concentreze. nc mai inea pixul n mn, i i-a dat seama c citise ceva n pliant, un cuvnt care i se pruse cunoscut. S-a uitat din nou pe pagin. Jumtatea ei de jos era ocupat de alt list, scris cu caractere mai mici: apariiile din luna martie. A citit antepenultimul titlu. A tresrit, ocat. La nceput i-a spus c era o simpl coinciden, apoi a citit i numele autorului: Nouti n martie: RING de Junichiro Asakawa. Un horror psihologic fenomenal. A scpat pliantul din mn. Chiar vrea s publice asta? A neles n sfrit de ce l evitase Junichiro, atunci cnd se ntlnise cu el n bufetul editurii. Se hotrse s prelucreze textul rmas de la fratele lui i s-l publice sub form de roman. i, din moment ce Ando era singurul care tia c Junichiro avea de gnd s
292

foloseasc lucrarea fratelui su fr consimmntul acestuia, fugise de el fr s accepte nici mcar un salut inofensiv. Dac ar fi acceptat s stea de vorb, mai devreme sau mai trziu Ando ar fi pomenit de Ring, i vestea s-ar fi rspndit rapid n editur. Junichiro voia fr ndoial s treac drept unicul autor al crii. Nu poate fi tiprit! a urlat Ando. n cel mai ru caz, trebuia s-l conving pe Junichiro s amne publicarea pn cnd erau siguri c textul nu era periculos. Era datoria lui de medic. Mine, el i Miyashita urmau s-i fac analizele de snge. Mai aveau de ateptat cteva zile, pn primeau rezultatele. Dac se dovedea c sunt pozitivi, c amndoi sunt purttori ai virusului Ring, publicarea crii ar fi fost echivalent cu un cataclism. Caseta original se nmulea lent, exemplar cu exemplar. Publicarea unei cri era un eveniment la alt scar. Zeci de mii de exemplare, poate sute de mii, chiar milioane aveau s fie rspndite n ar i s ajung n fiecare colior. Ando a scrnit din dini. Vzuse n minte un tsunami catastrofal. Un zid de ap uria, negru, naintnd n tcere, precedat de un vnt puternic pe care parc l simea n prul lui. S-a dus la fereastr i a nchis-o. A rmas acolo i s-a uitat spre hol. Masako apruse n pragul uii, nfurat ntr-un prosop. O vedea din profil. Scotocea n geant, pesemne cuta lenjerie curat. n clipa urmtoare a sunat telefonul. Ando a ridicat receptorul, a auzit tonul de fax i a apsat pe butonul Start. Miyashita i trimitea fotografiile. Cteva secunde mai trziu, faxul a nceput s bzie i s printeze copia. Ando sttea nemicat lng aparatul negru, privind int foaia de hrtie care ieea ncet din el. A simit o prezen n spatele lui i s-a ntors. Era Masako, doar cu o pereche de chiloi pe ea. Prosopul i atrna desfcut pe umeri. Se oprise chiar n spatele lui. Avea faa mbujorat i ochii i scnteiau, erau att de plini de via nct i-a venit s-o strng n brae i s-i srute pleoapele, n privirea ei se citea o hotrre ciudat.
293

Faxul a emis un bip, semn c transmisia se terminase. Ando a smuls hrtia, s-a aezat pe pat i s-a uitat la ea. Ambele fotografii erau acolo, una lng alta. Printul nu avea nici pe departe calitatea unei fotografii, dar era suficient de bun nct s disting trsturile lui Sadako Yamamura. A urlat. Femeia din fotografii era ntr-adevr diferit de cea pe care o vzuse n minte. Dar nu din cauza asta urlase. Fotografiile erau ale femeii care sttea aici, acum, chiar n faa lui. Masako i-a luat hrtia din mn i s-a uitat la ea. Ando o privea int, dar intimidat, ca un bieel care ateapt s-i primeasc pedeapsa. A reuit n sfrit s rosteasc cuvintele care-i ncremeniser pe buze: Tu eti Eti Sadako Yamamura. Nu Masako, nu sora lui Mai. Acelea fuseser minciuni. Expresia ei s-a mblnzit. Poate c uimirea lui Ando i se prea amuzant, pentru c a schiat un zmbet. Ando a pierdut orice legtur cu realitatea. Apoi a leinat pentru prima dat n cei aproape treizeci i cinci de ani de via.

294

6
A rmas incontient mai puin de un minut, dar a fost de-ajuns. Cum nu era n stare s analizeze faptele obiective care-l loviser ca un buldozer, creierul lui nu gsise alt soluie dect s se opreasc. Poate c ar fi reuit s reziste dac i s-ar fi acordat ceva mai mult timp sau dac ar fi fost ct de ct pregtit. Da, dac ar fi avut cea mai mic bnuial, orict de mic, poate c nu ar fi recurs la soluia leinului. Dar totul se ntmplase ntr-o clip. Aflase c o femeie care murise cu douzeci i cinci de ani n urm se afla de fapt n faa lui i i amintise c fcuse dragoste cu ea de cteva ori noaptea trecut n clipa aceea ajunsese n pragul nebuniei, iar creierul su fusese nevoit s se deconecteze temporar. Ci nu ar leina imediat dac s-ar trezi n toiul nopii s se duc la baie i ar gsi acolo un cadavru? Este un mecanism firesc de aprare mpotriva ororilor: odat ce ai leinat, nu mai trebuie s nduri ceea ce nu poate fi ndurat. Doar aa, n spatele acelei bariere de incontien, ne putem pregti s acceptm realitatea. Cnd i-a revenit, i s-a prut c simte miros de carne ars. Ar fi trebuit s se trezeasc ntins cu faa n jos, dar, n mod inexplicabil, era cu faa n sus i vedea tavanul. Se rsucise singur sau l micase altcineva? De fapt, doar jumtatea lui de sus era pe pat. Picioarele, i atrnau pe jos. Ando s-a ferit s se mite i a adulmecat aerul. A deschis ochii, dar nu de tot. Nu voia s-i suprasolicite simurile. Era mai bine s se strecoare ncet n realitate, altfel risca s peasc iar acelai lucru. Undeva se auzea apa curgnd dintr-un robinet. Pesemne la baie, dar prea susurul unui izvor ndeprtat. Zgomotul apei acoperea
295

murmurul nocturn al oraului. n mod normal ar fi trebuit s aud mainile care goneau pe Autostrada Metropolitan. A deschis ochii complet. n mijlocul tavanului ardeau cele dou tuburi de neon de douzeci de wai, scldnd camera ntr-o lumin argintie. Micndu-i doar ochii, Ando s-a uitat n jur. Apoi s-a ridicat, dar foarte prudent. Era singur. Exact n clipa cnd ncepea s se ntrebe dac are halucinaii, apa s-a oprit. Fr s vrea, i-a inut respiraia. Femeia a aprut din hol. La fel ca mai devreme, purta doar chiloi i avea un prosop aruncat pe umeri. Ando a ncercat s strige, dar n-a scos niciun sunet. A mpins la o parte mna care-i ntindea un prosop ud i s-a ridicat cu greu n picioare. S-a dat napoi pn cnd spatele lui s-a lipit de perete. A ncercat iar s strige, de data asta numele ei, ns vocea nu l-a ascultat nici acum. Sadako Yamamura! i-a amintit tot ce tia despre ea. Acum un sfert de secol fusese ucis i aruncat ntr-un pu. Zmislise cu puterea minii o nregistrare video oribil. Avea nsuiri paranormale. Avea sindromul feminizrii testiculare. Era hermafrodit. S-a uitat la zona ei pubian. Nu se vedea nicio umfltur sub chiloi. Sigur, testiculele nu erau foarte evidente. Dar noaptea trecut o atinsese acolo, o mngiase ndelung. Nu simise nimic ciudat. Pentru el, era o femeie ca toate femeile. Pe de alt parte, nu vzuse cu ochii lui. Totul se petrecuse ntr-o bezn desvrit. Ando s-a ntrebat deodat dac preferina ei pentru ntuneric nu ascundea de fapt teama c el ar putea s vad ce nu trebuia. Pn la urm, prima lui impresie, att de stranie, nu era prea departe de adevr. n ziua aceea, n liftul din blocul lui Mai, ncercase s se ndeprteze de ea la fel ca acum. Apruse ca din senin acolo, iar el nu tiuse de unde, i nu tia nici n clipa asta. Ar fi vrut s-i pun o mulime de ntrebri, dar abia putea s respire. Simea c trebuie s se mite cu grij, c risc s-i piard iar
296

cunotina. Dac s-ar ntmpla asta, ar fi la cheremul ei. Singura cale de a-i pstra un strop de demnitate era s rmn acolo i s-o priveasc n ochi. A rmas acolo i n-a scpat-o din ochi. Pielea ei strlucea, alb ca laptele n lumina fluorescent, de parc voia s-l conving c muchii de sub ea erau reali, c nu se uita la o fantom. Trupul ei l fascina, acel trup ale crui brae i picioare l nlnuiser noaptea trecut cu minile i cu picioarele lui. Ce trebuia s fac pentru a rupe vraja? ntrebarea avea un singur rspuns: s fug. S plece de acolo. Creierul lui n-a gsit alt soluie. Avea n faa ochilor un monstru. O femeie care nviase dup douzeci i cinci de ani. A nceput s se mite de-a lungul peretelui, spre vestibul. Sadako n-a ncercat s-l opreasc, s-a mulumit s-l urmreasc doar cu privirea. Ando s-a uitat la u. O ncuiase oare dup ce intraser? Nu-i mai amintea. A continuat s nainteze prudent ctre u. Nu ia trecut nicio clip prin minte c ar fi trebuit s-i ia haina. Cnd a ajuns la civa pai de Sadako, s-a repezit la u i a ieit. Era mbrcat cu pantalonii i cu un pulover subire, mult prea subire pentru frigul de-afar, dar nu s-a gndit nici mcar n treact la asta n timp ce alerga pe scar. A aruncat prima privire peste umr abia dup ce a trecut ca fulgerul prin hol i a ajuns pe trotuar. Nu-l urmrea. i-a ridicat capul i s-a uitat la fereastra garsonierei. Se vedea lumin. Trebuia s ajung ntr-un loc aglomerat. A luat-o la fug spre staia de metrou.

297

7
Vntul ngheat l-a ptruns pn n mduva oaselor. Habar navea unde s se duc, dar cuta instinctiv spaiile bine luminate. A ocolit la mare distan desiul ntunecos al Parcului Yoyogi. n faa lui se nlau zgrie-norii din Shinjuku, monolii negri gigantici. ntre ei i el se afla staia Sangubashi, plin de via, nconjurat de strdue comerciale care se adnceau n zonele rezideniale. tia c acolo erau cteva localuri deschise i n weekend. A pornit spre staie. Se mulumea cu orice loc n care se aflau oameni. Abia cnd a ajuns la automatele de bilete i-a dat seama c-i lsase portofelul n garsonier. Nu putea s se ntoarc, nu acum. A scotocit n toate buzunarele. A simit nvelitoarea din plastic n carei inea permisul de conducere. O pusese acolo ieri, nainte s plece la drum cu Miyashita, gndindu-se c la un moment dat va trece i el la volan. Uitase s-o scoat din buzunar. Din fericire, pstra mereu alturi de permis o mic sum de bani pentru urgene. O bancnot de cinci mii de yeni. Toi banii lui. S-a nfiorat, dar nu de frig, ci de singurtate. Unde putea s doarm la noapte? Cinci mii de yeni nu-i ajungeau s plteasc un pat nici n cel mai amrt hotel. Singura lui speran era Miyashita. A cumprat un bilet, apoi a intrat ntr-o cabin telefonic. A format numrul prietenului su, dei se ndoia c se ntorsese acas. ntr-adevr, nu venise. Nu era de mirare, nu trecuse mult de cnd i telefonase din Yotsuya, din captul cellalt al oraului. Probabil c era pe drum. Ando s-a hotrt s porneasc spre Tsurumi, unde locuia Miyashita. Cnd s-a urcat ntr-un vagon i s-a aezat pe un scaun trecuse de nou. A nchis ochii i Sadako a aprut instantaneu n mintea lui, ca
298

un reflex condiionat. Nu i se ntmplase niciodat s-i schimbe att de drastic sentimentele fa de o femeie ntr-un timp att de scurt. Rceala i aura ei de mister de la prima ntlnire se destrmaser oarecum la cea de-a doua i fuseser nlocuite de o dorin care crescuse treptat. La cea de-a treia ntlnire, dorina i fusese satisfcut i n suflet i apruser mugurii afeciunii. Apoi, prbuirea. l ademenise la nlime, i fcuse mendrele cu el i la sfrit i dduse un brnci peste margine, n abis. l chinuia gndul c fusese n stare s se culce cu o femeie moart de un sfert de secol. A pronunat n gnd, fr s vrea, cuvntul necrofilie. De unde venea femeia asta? Poate c nu murise? Se ntorsese sau nu de pe lumea cealalt? Fiind o zi de weekend, vagonul era destul de gol. Doar civa pasageri nu mai apucaser locuri pe scaune. Vizavi de Ando se lfia un brbat cu o figur cam necioplit, probabil un muncitor, care ocupa de unul singur trei locuri. inea ochii nchii, dar nu dormea. De fiecare dat cnd un cltor mergea n lungul vagonului i trecea pe lng el, deschidea puin ochii i se uita n jur. Privirea lui era grea i inexpresiv, ca a unui mort. Ando s-a ferit s se uite n ochii lui. Dar muncitorul nu era un caz izolat. Toi cltorii i se preau palizi ca nite cadavre. Ando i-a ncruciat braele i a ncercat s-i stpneasc tremurul. Mai avea puin i ncepea s ipe de spaim, chiar acolo, n mijlocul unui vagon de metrou, n mijlocul oamenilor. A luat paharul cu coniac pe care i l-a adus Miyashita. La nceput a simit un firicel de cldur n gt i a savurat cteva clipe senzaia, apoi a golit paharul dintr-o nghiitur. ncepea s aduc iar a fiin omeneasc, dar tot mai tremura uor. i-ai revenit ct de ct? l-a ntrebat Miyashita. Mai mult sau mai puin. Sunt viu. Cred c ai ngheat. Miyashita nc nu aflase de ce era mbrcat aa de subire.
299

Nu-i din cauza frigului. Miyashita l condusese n camera de oaspei. Ando sttea pe pat, ntr-un col al ncperii. De fapt, chiar acolo urma s doarm la noapte, dar deocamdat se inea strns de barele tbliei de metal. A ncetat s tremure abia dup al doilea pahar de coniac. Ce s-a ntmplat? a continuat Miyashita cu o voce blnd. Ando i-a povestit tot, n detaliu. Cnd a terminat, s-a ntins pe pat i a oftat, dar sunetul pe care l-a scos a fost mai degrab un scncet ascuit. M dau btut! Explic-mi tu ce s-a ntmplat. Nu mai neleg nimic, a gemut el. Mi s fie, a mormit Miyashita, luat pe nepregtite. Era unul dintre momentele n care oamenii nu se pot stpni s nu rd, chiar dac amar, iar Miyashita chiar asta a fcut: a rs ncetior, fr convingere. Cnd s-a potolit, a turnat un deget de coniac n ceaca cu cafea i a sorbit din ea. Czuse pe gnduri, ncerca s gseasc un rspuns raional, o explicaie care s aib sens. Prima ntrebare este de unde a aprut Sadako. Tonul lui retoric arta c tia deja rspunsul. Bine, spune-mi. De unde? Chiar nu tii? i-a ntors-o Miyashita. Ando a cltinat din cap: Nu, nu tiu. Eti sigur? Spune-mi odat! De unde a aprut? A nscut-o Mai Takano. Rsuflarea lui Ando s-a oprit n timp ce cuta alt explicaie. Dar nu era n stare s gndeasc. i pierduse complet uzul raiunii. Pn la urm n-a reuit dect s repete cuvintele pe care le auzise: A nscut-o Mai Takano? Caseta aia blestemat s-a nscut n mintea lui Sadako. Mai a vzut nregistrarea n ziua cnd a nceput ovulaia. A aprut virusul i a fecundat ovulul. Ba nu, fecundare nu e cuvntul potrivit,
300

nlocuire e mai corect. Nucleul ovulului a fost nlocuit cu genele lui Sadako Yamamura. Sper c eti n stare s-mi explici mai precis cum s-au ntmplat toate astea. Amintete-i c am fcut o analiz secvenial a virusului. Am descoperit c nglobeaz n proporii egale gene ale variolei i gene umane. Ando s-a ridicat i a ntins mna s ia paharul. Era gol. Vrei s zici c genele umane sunt Ale lui Sadako. mprite n sute de mii de fragmente. Sute de mii de virui, i fiecare poart o prticic din ADN-ul lui Sadako? n ciuda faptului c e un virus ADN, are enzime de transcripie invers. nelegi? E capabil s introduc fragmentele n nucleul unei celule. Un singur virus nu are cum s poarte tot bagajul genetic al unui om. Pur i simplu nu e suficient de mare. Dar lucrurile se schimb fundamental dac ADN-ul persoanei respective este desfcut n sute de mii de segmente i fiecare segment este alocat unui virus. n fotografiile fcute cu microscopul electronic, vzuser clar o mulime de virui inelari, roiuri ntregi. Fiecare dintre ei cra o prticic din codul genetic al lui Sadako Yamamura, i toi luaser cu asalt ovulul lui Mai Takano. Ando a ncercat s se ridice, dar s-a rzgndit imediat i s-a aezat la loc. Simea nevoia s se mite de fiecare dat cnd ncepea s combat o teorie. Dar Sadako a murit acum douzeci i cinci de ani. Informaia ei genetic a disprut. Hai s ne gndim la asta. Pentru nceput, spune-mi de ce crezi tu c Sadako a proiectat imaginile acelea pe band? Ce i stpnea mintea n clipele acelea, ultimele, la ase metri sub pmnt? Dorina de a strnge toat ura ei n cteva imagini n stare s-i ngrozeasc pe toi cei care le-ar fi vzut? Analiznd problema
301

dintr-un unghi pragmatic, ce ar fi ctigat aa? Nu, trebuia s fi avut un scop mai important. Dar Ando nu reuea s priceap ce ncerca s-i demonstreze prietenul lui. Miyashita s-a vzut nevoit s-l duc de mn ctre rspuns: Avea doar nousprezece ani. i? Nu voia s moar. Prea tnr ca s moar i-e chiar att de greu s accepi c i-a transformat genomul ntr-un cod unic i c l-a aruncat n lume sub form de energie? Ando i-a rspuns cu un oftat. i-a transformat bagajul genetic n imagini i apoi a proiectat acele imagini pe o band magnetic? E adevrat, Ryuji reuise s comunice cu el transformnd cuvntul mutaie ntr-o secven de baze din propriul lui ADN. Dar genomul uman este uria, mult prea complex pentru a fi transferat pe o singur caset video. Ando a respins n fine ipoteza cu glas tare: Imposibil. Genomul uman e prea mare. Miyashita i-a desfcut braele i le-a ntins spre perei. Uit-te la camera asta. S presupunem c trebuie s exprimi n cuvinte totalitatea ei. ncperea avea o suprafa de aproximativ opt rogojini. Lng pat era un birou. Pe birou un calculator, iar lng el un maldr de dicionare. Mai problematic era biblioteca. Acoperea un perete de sus pn jos i era nesat cu mii de cri, de la literatur pn la tratate de medicin. i-ar fi luat o zi ntreag doar s scrii titlurile i autorii. Cam mult informaie. Da, dar dac Miyashita a mimat gestul unui fotograf care apas pe declanator. Clic faci o fotografie? Ai prins totul ntr-o fraciune de secund. Poi s stochezi cea mai mare parte a informaiei din aceast camer ntr-o singur fotografie. i, gndete-te, capacitatea de stocare crete ntr-un raport mult mai
302

mare dect numrul fotografiilor. Acum i se mai pare imposibil s reproduci genomul aa? Ando pricepuse perfect la nivel raional ce ncerca s-i spun prietenul lui, dar nu era nc pregtit s accepte. Las-m s m gndesc puin, a zis el, cltinnd din cap, pentru c avea de gnd s analizeze punct cu punct ipoteza lui Miyashita. D-i drumul, gndete-te. Eu m duc la baie. Miyashita a disprut pe hol, lsnd ua deschis. Da, mecanismul descris de el era o simpl ipotez. Dar, indiferent dac era sau nu corect, nu putea s nege c Mai Takano o nscuse pe Sadako Yamamura la numai o sptmn dup fecundare. Deocamdat acesta era un punct indiscutabil. Iar o gestaie de o sptmn era ceva uluitor. Probabil c procesul de diviziune celular fusese accelerat. Nucleul unei celule conine compui chimici numii acizi nucleici, iar diviziunea celular ncepe doar atunci cnd aceti acizi depesc un anumit nivel. Prin urmare, singura posibilitate de a grbi frecvena diviziunii celulare ar fi s alimentezi procesul cu acizi nucleici. Probabil c virusul Ring reuise s fac asta, i astfel fetusul crescuse cu o vitez fenomenal. Prima dat cnd intrase n garsoniera lui Mai simise o prezen misterioas, dei acolo nu se afla nimeni. Nu se nelase. Sadako, nou-nscuta Sadako se ascundea n camera aceea. Era nc micu, gsise un colior n care s se strecoare, poate n dulap, poate sub chiuvet. Ando nu cutase peste tot. i, pentru c era doar un copil, pufnise n rs cnd l vzuse pe Ando n poziia aceea caraghioas, n baie. Atingerea uoar fusese atingerea degetelor ei. n lipsa proprietarului ei de drept, Sadako luase casa n stpnire i crescuse acolo, ferit de ochii lumii. Ajunsese la maturitate ntr-o sptmn. Cnd Ando venise acolo a doua oar, din camer ieea o femeie n toat firea. Ando a ntors ipoteza pe toate feele de nenumrate ori, pn cnd a reuit s accepte miracolul naterii i devenirii lui Sadako.
303

Teoria se potrivea perfect cu propriile sale experiene. Dar ce putea s spun despre viitor? Dac ajunsese la maturitate ntr-o sptmn, nseamn c mai avea de trit doar cteva sptmni, asta dac procesul de mbtrnire se desfura n continuare cu aceeai vitez. Sadako renscuse la nceputul lunii noiembrie, cu zece sptmni n urm, dar trupul ei era la fel de tnr, pielea ei la fel de catifelat ca a unei femei de nousprezece ani. Poate c n cazul ei maturitatea ncepea i se termina la vrsta la care murise. Miyashita s-a ntors, scuturndu-i minile ude, i n-a pierdut nicio clip: Trebuie s inem cont i de rolul crucial pe care l-a jucat virusul variolei n toat povestea asta. Da, ai dreptate, Sadako i virusul variolei se potrivesc ca tusea i junghiul. Sadako se mbolnvise de variol chiar nainte s moar. Luase boala de la Jotaro Nagao. ntr-un fel sau altul, acolo jos, pe fundul puului, variola i ura ei se mpletiser strns, ncetul cu ncetul, pn cnd amestecul atinsese punctul critic. Dou fiine condamnate la dispariie, un virus i un om, i uniser forele mpinse de aceeai dorin irezistibil: s renvie cndva. Bine, acum spune-mi dac Junichiro Asakawa chiar vrea s publice Ring. Da. Cartea e trecut deja n lista de noi apariii. Am neles. Sadako i virusul variolei. Dou fire mpletite, iar rezultatul este caseta uciga. Acum s-au separat, sunt dou tulpini diferite. Una e Sadako nsi, cealalt e Ring. Ando nu a ridicat nicio obiecie. Viruii locuiesc ntr-un soi de no mans land ntre via i non-via, sunt entiti care nu au trecut cu mult de stadiul de informaie, i prin chiar natura lor sunt menii s provoace schimbri dramatice n ei nii i n mediu. Faptul c i schimbaser forma iniial, de nregistrare video, cu cea de text scris nu era chiar att de surprinztor.
304

Iat de ce a supravieuit Kazuyuki Asakawa. Descifraser n sfrit misterul. Cu alte cuvinte, existau dou ieiri. Una era Sadako, cealalt raportul Ring. i Mai, i Kazuyuki fuseser cruai de moartea prin blocarea arterei coronare pentru c aveau capacitatea de a nate, dac se putea spune aa. Vieile lor aveau alt valoare. Da, era logic. Viruii care invadaser trupul lui Mai se repeziser la ovul, cei care atacaser organismul lui Asakawa se grbiser s ajung la creier. De fapt, Kazuyuki Asakawa nu era autorul raportului Ring. Fusese forat s-l scrie. ADN-ul lui Sadako se instalase n creierul lui. Aa se explica i acurateea uimitoare a descrierilor, precizia lor fotografic. Singura descriere greit, neconform cu realitatea, era chiar cea a lui Sadako, personajul principal. La fel de logic, consecina faptului obiectiv c persoana care apas pe declanator nu apare n cadru. Ando i Miyashita au amuit, ncercnd s ghiceasc ce urma. Ce le pregteau oamenilor Sadako i Ring? Niciunul, nici altul nu avea nevoie s atepte rezultatele analizelor. Acum tiau sigur c era de o importan crucial s opreasc publicarea crii Ring. Junichiro n-ar nelege niciodat ce suferine groaznice ar declana romanul pe coperta cruia voia s-i vad numele. Da, asta era prima lor direcie de contraatac. S-l conving s renune. Dar i va asculta mcar? Cine ar fi crezut o asemenea poveste fantasmagoric? Miyashita s-a btut cu palma pe genunchi i a srit n picioare: Hai s mergem. Unde? Cum unde? E la mintea cocoului. La tine. i-am spus c Sadako e acolo. Ce motiv mai bun vrei? Trebuie s o nfruntm. Nu, nu, stai puin. Ando s-a tras napoi. Fugise de acolo ca s scape de Sadako. Avea nevoie de un motiv mult mai puternic ca s se ntoarc. Hai, nu ne putem permite s pierdem timpul aiurea. Nu
305

nelegi c suntem n rahat pn la gt? Ando nelegea, i nc foarte bine. Trebuia s i se ntmple ceva pentru c citise Ring, era un adevr incontestabil. Nu-i mai psa. Nu-i era fric de moarte, sau nu destul. Cnd fiul lui mai tria i cnd soia lui l iubea da. Dar nu acum. Miyashita l-a nfcat de bra i a ncercat s-l ridice de pe pat. Mic-te odat. S-ar putea s fie ultima ans. ans? Ascult-m, Sadako a venit la tine i a intrat n casa ta. Da, aa e. Deci a avut un motiv. Ce motiv? De unde naiba s tiu eu? Poate c vrea s faci ceva pentru ea. i Ando i-a amintit. La a doua ntlnire, chiar nainte s se despart, i spusese ceva. Te voi cuta curnd s-i cer ceva. n timp ce Miyashita l trgea dup el afar din camer, Ando ncerca s ghiceasc ce putea s-i cear. Habar n-avea, i nici nu dorea s afle.

306

8
Au lsat maina pe o strad paralel cu Parcul Yoyogi. Au rmas pe trotuar i s-au uitat amndoi la etajul lui Ando. Ferestrele erau ntunecate. Trecuser trei ore i ceva de cnd fugise de-acolo abia trgndu-i rsuflarea. Acum era unu fr cteva minute. Miyashita l-a ntrebat n oapt: Spune, eti sigur c trfa e acolo? Apelativul trf i s-a prut complet deplasat, dar Ando bnuia c prietenul lui ncerca s se pregteasc sufletete pentru ntlnirea iminent. Poate c doarme. Nu se vedea nicio micare, dar n-aveau cum s-i dea seama de acolo dac femeia mai era nuntru. Crezi c morii au nevoie de somn? Miyashita era sarcastic. i, ntr-adevr, ce putea fi mai bizar dect un mort care se trezete dup douzeci i cinci de ani doar ca s adoarm ntr-o garsonier? Au stat acolo, n mijlocul trotuarului, i s-au uitat o vreme la ferestrele de la etajul al patrulea. n cele din urm, Miyashita i-a regsit spiritul de lupttor i a zis doar att: Hai. A pornit imediat. Ando l-a urmat, deloc entuziasmat. Tcerea i frigul nopii l ngheaser pn n mduva oaselor i nu mai suporta s stea afar. Dac ar fi fost mai cald, poate c nici n-ar fi intrat n bloc. La ordinul ferm al lui Miyashita, Ando a rsucit mnerul. Ua nu
307

era ncuiat i s-a deschis imediat. Casa prea pustie. Pantofii dispruser de pe pardoseala de ciment a vestibulului, la fel i singurul obiect personal al lui Sadako, o geant roie cu fermoar. Ando i amintea c o vzuse ultima dat aruncat acolo, ntr-un col. Au intrat n camer i au aprins lumina. Da, n cas nu mai era nimeni. n clipa cnd sursa tensiunii a fost deconectat, Ando s-a prbuit moale pe pat. Miyashita, n schimb, rmsese n gard: a verificat baia, apoi s-a uitat pe balcon. n sfrit, dup ce a cercetat meticulos fiecare colior, s-a convins de adevr. A plecat. ntrebarea e unde s-a dus, a mormit Ando. n realitate, puin i psa. Nu dorea s-o mai vad vreodat. Ai vreo idee? l-a ntrebat Miyashita. Nu, s-a grbit Ando s-i rspund, scuturnd din cap. Atunci l-a observat. Un carnet deschis, pe biroul de sub fereastr. Nu inea minte s fi umblat n ultima vreme cu el. S-a ridicat de pe pat i l-a luat. Cteva pagini erau acoperite cu un scris stngaci. A citit primul rnd: Drag domnule Ando, apoi semntura: Sadako Yamamura. i lsase un bilet de desprire. Ando a citit prima propoziie, apoi i-a ntins lui Miyashita carnetul. Ce-i asta? Un mesaj de la Sadako. Miyashita a tresrit i a luat carnetul. Apoi, dei Ando nu-i ceruse s fac asta, a nceput s citeasc cu voce tare. Drag domnule Ando, Pentru c nu vreau s te deranjez mai mult dect am fcut-o deja, m-am gndit s-i scriu o scrisoare. tiu, e un obicei demodat. ncearc s-i pstrezi cumptul n timp ce o citeti.
308

Sunt sigur c ai neles deja de unde vin. Am mprumutat pntecele unei femei pe nume Mai Takano i astfel mi-am asigurat renaterea. Credem, nici eu nu neleg prea bine cum am reuit s m ntorc la via. Tatl meu a fost asistent universitar la o facultate de Medicin i mi vorbea adesea despre ereditate cnd l vizitam la Sanatoriul Hakone, unde era internat. Prin urmare, tiu cte ceva despre genetic. E doar o ipotez, dar m ntreb dac nu cumva am reuit, folosindu-mi puterea minii, s transfer genomul meu pe alt suport. Acum, cnd privesc n urm, sunt aproape sigur c n pragul morii am transferat undeva informaia genetic a organismului meu. Am simit atunci nu neaprat dorina de a renate, ci mai degrab spaima teribil c Sadako Yamamura i toat lumea ei vor putrezi pe fundul unui pu, departe de orice privire. n calitatea ta de specialist, vei putea, desigur, s nelegi mult mai bine dect mine ce mi s-a ntmplat n continuare. Psihicul meu, care a murit sub pmnt, s-a rentrupat treptat n femeia aceea. Cnd am devenit din nou contient, am vzut n oglind o fa necunoscut. La nceput n-am neles nimic. Faa i corpul meu nu erau ale mele, erau ale unei strine. Dar eul care gndea era eul meu adevrat. i oraul mi-era strin. Mainile de pe strzi mi s-au prut uimitor de moderne. Casa mea (o cutie minuscul din beton), aparatele electrice, totul. Cnd m-am uitat n calendar, am priceput c trecuser douzeci i cinci de ani, dar totul s-a petrecut la fel de repede ca o clip. Am neles c spiritul meu se desprise de corp i c, dup un sfert de veac, i gsise un nou adpost. Biata fat creia i-am furat trupul se numea Mai Takano. Dar contiina mea nu s-a nscut odat cu fiina mea fizic. Smna numit Sadako ncolise mai devreme, n pntecele lui Mai. n timp ce cretea ea, creteam i eu, mi ocupam locul alturi de Mai, stpna acelui corp. n clipa cnd am fost gata s m nasc, am alungat-o definitiv pe Mai de lng mine, din propriul ei pntece. Am vzut multe din ambele perspective, a mamei i a fetusului, am pipit, am auzit, am mirosit i am gustat la fel. Am reuit s ating cu minile mele micue cutele moi ale propriilor mele trompe uterine, s simt cum se unduiau ca nite valuri.
309

Pe msur ce se apropia naterea mea, eram tot mai nelinitit. Ce se va ntmpla cu trupul lui Mai dup ce voi veni pe lume? Se va ntoarce n el sufletul lui Mai, va redeveni ea, va fi din nou Mai Takano? Nu tiu de ce, dar bnuiam c nu va fi aa. M gndeam la corpul ei ca la o crisalid. O crisalid nu poate tri de una singur dup ce fluturele iese din ea, deci trebuia s abandonez trupul care i ndeplinise menirea. Poate c i se pare o concluzie egoist, ns simeam c Mai murise deja din clipa cnd corpul ei fusese invadat. Urmtoarea ntrebare a fost unde ar trebui s m nasc. Dac m-a fi nscut n casa ei, a fi fost obligat s scap de cadavru. Judecnd dup ct de repede crescusem n pntecele ei, urma s ajung la maturitate la fel de repede i aveam nevoie de o cas n care s locuiesc. Garsoniera lui Mai mi s-a prut cea mai bun alegere. Prin urmare, trebuia s m nasc ntr-un loc ferit de privirile vecinilor, undeva unde s pot lsa corpul, i s m ntorc singur n noua mea cas. Acoperiul pe care-l tii a rezolvat toate problemele. Puteam s las nveliul inutil n puul acela adnc, unde ar fi rmas mult vreme pn s-l descopere cineva, i s folosesc fr grij casa lui Mai. Cum sorocul nostru se apropia, am nceput s m pregtesc i, ntr-o noapte, ne-am urcat pe acoperi. Am legat o frnghie de un stlp i am cobort n pu. Am alunecat i mi-am fracturat glezna, dar trupul mamei n-a avut prea mult de suferit. Am venit la timp pe lumea asta. M-am trt afar din pntece, am retezat cordonul ombilical cu dinii i m-am ters cu un prosop. M-am nscut dis-de-diminea, nainte de rsritul soarelui. Abia atunci, cnd am ridicat capul, am observat ngrozit c puul n care m aflam semna foarte mult cu cel n care murisem. A fost ca un ritual de iniiere pe care mi-l pregtiser zeii. Mi-am spus c eram supus la o ncercare divin: puteam s supravieuiesc pe lumea asta doar dac reueam s ies singur din capcan. A fost o joac de copil. n pu atrna o frnghie. M-am crat pe ea i am ieit cu uurin. Cerul se luminase la rsrit i oraul se trezea. Crede-m, am tras aer n piept cu lcomie. Chiar m simeam de parc a fi renscut. O sptmn mai trziu, am ajuns la vrsta la care murisem. Naterea
310

mea la Sashikiji, pe Insula Izu Oshima, viaa mea agitat alturi de mama, care era subiectul unor experimente paranormale, tatl meu btrn, aflat la sanatoriu mi aminteam tot. De ce? m-am tot ntrebat. Poate c amintirile nu sunt pstrate n creier, ci n gene. Dar undeva, n adncul fiinei mele, era ceva care-mi optea c nu sunt chiar eu, cea de dinainte. Singurul meu instrument de msur pentru diferenele pe care le simeam era intuiia, dar tiam, fr niciun dubiu, c eram alta dect cea care fusesem. Acum am i uter, i testicule. nainte nu aveam uter. Renscut, l am. Sunt o fiin hermafrodit n adevratul neles al cuvntului. Mai mult, brbatul din mine poate s ejaculeze. Am aflat asta dup ce am fcut mpreun ce am fcut. Ajuns aici, Miyashita s-a oprit i s-a uitat la Ando. Creznd c vrea s glumeasc pe seama faptului c se culcase cu Sadako, Ando s-a rstit la el: Nu, nu, citete mai departe! Dar Miyashita se gndea la cu totul altceva. Hermafrodit, hermafrodit. S presupunem c el ea poate avea copii fr s fac sex cu un partener. i imaginezi consecinele? Exist numeroase organisme primitive care se pot reproduce fr uniunea mascul-femel. Viermii, de exemplu, au organe genitale de ambele sexe i depun ou gata fertilizate. Organismele unicelulare se nmulesc prin diviziune, care e tot o form de reproducere asexuat. Un copil care s-ar nate astfel ar avea aceleai gene ca unicul lui printe. Cu alte cuvinte, Sadako ar nate o alt Sadako. Dac aa ceva ar fi posibil. Dac e adevrat, a zis Ando, privind n gol, Sadako nu mai face parte din specia uman. E o specie nou. Speciile noi apar n urma mutaiilor. Evoluia se desfoar chiar sub ochii notri! Ando a ncercat s continue acest fir logic. ntrebarea era cum putea Sadako s se impun ca nou specie. Cnd o specie nou apare n urma unor mutaii succesive, are la dispoziie pentru mperechere doar indivizi care n-au suferit mutaii.
311

De pild, s presupunem c ntr-o turm de o mie de oi albe se nate una neagr. Aceasta e obligat s se mperecheze cu o oaie alb. Presupunnd n continuare c rezultatul mperecherii este fie o oaie alb, fie una cenuie, e limpede c principala trstur distinctiv a oii negre, culoarea, va slbi treptat, pn la dispariia complet. Trstura se va pstra i va trece de la o generaie la alta doar dac exist dou oi negre, de sexe diferite. Dar n cazul lui Sadako problema era deja rezolvat. Dac se putea reproduce asexuat, nu mai avea nevoie de un partener. Dac se putea nmuli singur, toate trsturile ei distinctive urmau s fie transmise fidel urmtoarei generaii. Chiar aa fiind, pentru c exista o singur Sadako, i ea putea s nasc doar o singur Sadako, specia s-ar fi nmulit foarte ncet, la fel ca nregistrarea video, cte o copie o dat. Omenirea ar fi avut rgazul s-o ncoleasc i s-o anihileze. Ar fi disprut la fel cum dispruse i caseta. Pentru a supravieui, specia nou trebuia s se nmuleasc rapid, en masse. Sadako trebuia s ctige spaiu vital, poate atacnd habitatul uman, poate infiltrndu-se n punctele lui slabe. Poate-i fcuse deja un plan Miyashita i-a ntrerupt irul gndurilor. ncepuse iar s citeasc. Scrisoarea e mai lung dect mi-am dorit, dar te asigur c fiecare cuvnt e adevrat. i-am spus cu sinceritate tot ce mi s-a ntmplat. De ce? Ca s nelegi. Iar acum, cnd nelegi, i cer s faci ceva pentru mine. De ce tu? Cred c tu, un om de tiin, ai cunotinele necesare. Ando s-a pregtit n mod reflex pentru ce urma. Cerule, uite c am ajuns i aici. Dac i va cere ceva ce nu e n stare s fac? Gndul l-a umplut de nelinite. n primul rnd: vreau s nu mpiedici publicarea crii Ring. Da, asta nu-i depea puterile. Tot ce trebuia s fac era, de fapt, s nu fac nimic.
312

Vreau s nu te amesteci n nimic din ceea ce voi ncerca s fac, vreau s cooperezi cu mine. Te rog s m asculi. Nu vreau s recurg la ameninri, dar m vd obligat s-i spun c i se va ntmpla ceva ru, foarte ru dac nu mi urmezi instruciunile. n fond, ai citit deja textul numit Ring. Te rog s m crezi c e deja prea trziu s iei msuri. Dac te mpotriveti, corpul tu va suferi anumite modificri. tiu foarte bine c eti curajos i c s-ar putea s-mi reziti, chiar cu riscul de a muri. M-am gndit, aadar, s-i ofer o recompens, ca s fiu sigur c vei face ce-i cer. Ce-ai zice dac i-a spune c pot s-i ofer ce i doreti mai mult, adic Miyashita s-a oprit i i-a ntins carnetul, punndu-l s citeasc singur rndul care urma. Ando l-a citit i n clipa imediat urmtoare a scpat carnetul pe jos. ntr-o clip, ntr-o fraciune de secund i pierduse complet capacitatea de a gndi. Toat puterea i se scursese din trup, pn la ultimul strop. Nici mcar nu ndrznise s viseze aa ceva. Miyashita ghicise ce gndea, pentru c n-a fcut niciun comentariu. Ando a nchis ochii. Sadako i optea dulce c trebuia s distrug lumea. C trebuia s fie de partea noii specii, s se alieze cu ea, s lucreze pentru ea. Sadako tia c specia ei nu va reui s supravieuiasc dect cu ajutorul oamenilor, al unor oameni alei. Junichiro, care se pregtea s publice Ring, era deja n tabra ei. Probabil c nu aciona n mod contient, Sadako l mnuia fr ndoial ca pe o marionet. Dar recompensa care-i fusese promis n schimbul sufletului su era irezistibil. De cte ori oare nu se rugase fierbinte pentru mplinirea acestui vis? Dar o fcuse convins c rugciunea nu i se va mplini niciodat. E posibil? s-a ntrebat. A deschis ochii i s-a uitat la bibliotec. Era acolo, ntr-un plic strecurat ntre dou cri. Din punct de vedere tiinific, nu era imposibil. Iar cu ajutorul lui Sadako, visul putea deveni realitate. i totui
313

A deschis gura i a strigat, un strigt de groaz. Dac nu o oprea pe Sadako acum, nimeni nu putea ti prin ce suferine ar trece omenirea. Iar el fcea parte din specia uman, nu avea voie s-o trdeze. Pn la urm, singura cale de a ctiga lupta cu Sadako era s-o distrug. n schimb, dac ea ar fi disprut, visul lui s-ar fi spulberat odat cu ea. Nu putea s-i mplineasc visul dect ajutnd-o s supravieuiasc. Chinurile lui erau att de groaznice, nct acum gemea fr ncetare. n timp ce zcea pe pat, respirnd ntretiat, a vzut o siluet cunoscut, o figur pe care n-a reuit s-o alunge. Ce s fac? a scncit, pentru c nu era n stare s se hotrasc. Numai tu poi s rspunzi la ntrebarea asta, a zis Miyashita, dar fr rutate, ci cu blndee, i foarte calm. Nu tiu ce s fac. Gndete-te. Dac ne mpotrivim, vom muri amndoi. Va gsi ali oameni care s-o ajute. Asta-i tot. Miyashita avea dreptate. Totul devenea limpede, dac analizai problema raional. ntlnirea lui cu Sadako nu fusese o ntmplare. l supraveghea. Nimic nu fusese ntmpltor, nici prezena ei acas la Mai, nici ntlnirea de pe acoperi, nici cea din Staia Sangubashi. Prevzuse c Ando va afla adevrul i i calculase fiecare micare. Deodat, Ando a fost convins c nu putea s ctige lupta cu Sadako. Era de-ajuns s fac o singur greeal i virusul din sngele lui ar fi nceput s-l devoreze de viu. Miyashita pricepuse asta ntr-o clip i trsese concluzia logic, ce se impunea, dar Ando tot nu era capabil s ia o decizie. Vrei s zici c trebuie s facem ce spune? Avem de ales? i omenirea? Ce-i cu ea? Ce naiba, doar nu eti reprezentantul oficial al speciei umane. De fapt, te-ai hotrt deja, nu-i aa? Gndete-te la recompens, pentru numele lui Dumnezeu. Vrei s-mi spui c eti gata s
314

renuni? Nu e un trg cinstit. Tu ce-ai ctiga? E un fel de poli de asigurare. ntr-o bun zi s-ar putea s m felicit c am semnat-o. Habar n-avem ce ne pregtete. Ando a neles n sfrit c ajunsese ntr-un impas, c era ncolit. Peste cteva decenii, elevii vor citi biografia lui n manualele de istorie, dar nu va fi un erou. Va rmne n amintirea generaiilor viitoare ca trdtorul care a dus omenirea n pragul dispariiei. Asta dac va exista vreo omenire care s-i aduc aminte de el. De ce te-am amestecat oare n nebunia asta? Copleit de regrete, Ando i-a amintit cum ncepuse totul. Cum ar fi putut s uite? Autopsia lui Ryuji, apoi codul, ring. Un indiciu c exista un raport scris. Ring. l citise. Dac nu l-ar fi citit, n-ar fi ajuns n situaia asta. Dac nu l-ar fi citit irul gndurilor i-a fost ntrerupt. De ce? Alt gnd, rzle. Mai era ceva aici. Ryuji, a optit. Miyashita i-a aruncat o privire ncrcat de nelinite. Ando nu l-a bgat n seam i a ncercat s urmeze firul logic pe care-l ntrezrise. ncepuse s cread c evenimentele pe care le interpretase iniial ntr-un anumit fel erau de fapt manifestarea altei voine. Oare Ryuji i trimisese mesajele ring i mutaie cu buncredin, doar ca s-i atrag atenia asupra pericolului? Acum se ndoia de asta. Nu, erau un fel de corecii de traiectorie, operate n momentele n care Ando risca s devieze de la cursul stabilit. De ce procedase Ryuji aa? i mai era ceva. De ce se uitase Mai la nregistrare? Coinciden? Dac n-ar fi vzut nregistrarea n ziua n care ncepuse ovulaia, Sadako n-ar fi renscut niciodat. De unde luase Mai caseta? De la Ryuji. De ce se dusese acolo? Din lucrarea lui Ryuji lipsea o pagin. Chiar lipsea o pagin?
315

Doar Ryuji tie dac e adevrat sau nu. Totul se nvrtea n jurul lui Ryuji. Ryuji, Ryuji, Ryuji. Era foarte apropiat de Mai. tia cnd avea menstruaie. El o manevrase n ziua aceea. Cerule Ando s-a uitat la Miyashita, la ochii lui plini de nelinite, i a optit: E Ryuji. Miyashita i-a mijit ochii. Nu nelegea. Nu pricepi? E Ryuji. El a tras sforile de la bun nceput. El e voina din spatele lui Sadako. Pe msur ce-i repeta numele, Ando era tot mai sigur. Bnuielile i se transformau n certitudine. Ryuji se jucase cu ei. El scrisese scenariul. Dincolo de geamuri, simfonia nocturn a oraului i continua netulburat mersul. Pe Autostrada Metropolitan a trecut o main. Vuietul motorului era ns acoperit de un zgomot ciudat, un fel de hrit metalic ascuit, ca i cum ar fi trt ceva n urma ei. La nceput i s-a prut c zgomotul aduce cu cel fcut de scritul unghiilor pe un geam, apoi s-a transformat ntr-un rs masculin batjocoritor, un chellit straniu care venea de foarte departe. Poate era glasul lui Ryuji. i-a smuls privirea de la vidul ntunecat de afar i a strigat: Ryuji, eti acolo? Firete, n-a primit niciun rspuns. Dar l simea, Ryuji era acolo. Brbatul care-i unise forele cu Sadako, cel care vna omenirea din pur plcere se afla n camera aceea, supraveghind fiecare micare i rdea dispreuitor de Ando, care n sfrit aflase c era prea trziu. Un fulger i-a strbtut mintea. Pricepuse ce voia Ryuji. Ceva ce nu putea obine dect cu ajutorul lui Ando. tia acum care era scopul ocult al Ryuji, dar nu-i mai folosea la nimic. Era prea trziu,
316

nu mai putea influena cursul evenimentelor. Era obligat s se pun n slujba lui Ryuji, care rnjea n bezn.

317

Epilog
ntr-o zi att de senin nct greu puteai crede c perioada ploilor nu se sfrise de fapt, Ando s-a dus la plaj. Fiul lui murise cu doi ani n urm, n aceeai zi i n acelai loc. Nu transformase ziua ntro aniversare. Anul trecut nu fusese. Dar azi avea motiv. Acum valurile erau blnde, nu ca atunci. Nisipul alb se ntindea la nesfrit n stnga i-n dreapta lui. Plaja era aproape pustie: ici i colo pescari i cteva familii care ieiser la un picnic. Era abia nceputul verii, prea devreme pentru baie. Ando avea senzaia c se ntorsese n timp. Apa era altfel, i ntre timp apruse pe linia rmului un dig perpendicular, care se pierdea n larg. Pn i contururile dunelor de nisip se schimbaser. Dar n ochii lui Ando totul era la fel. Ultimii doi ani preau acum un comar din care abia se trezise. S-a aezat ntr-un loc de unde se putea vedea toat plaja. Razele soarelui, deja orbitoare, l-au lovit n fa. i-a umbrit ochii cu mna i a zrit pe rm o siluet micu. Silueta s-a ghemuit la marginea apei, cu picioarele goale acoperite de nisip, i a nceput s sape o groap. Ando nu-i mai putea lua privirea de la ea. I s-a prut c l strig cineva pe nume. S-a uitat n jur, ntrebnduse dac nu fusese o iluzie. A vzut un brbat masiv cobornd de pe falez i ndreptndu-se spre el. Brbatul purta o cma n dungi, cu mneci lungi, ncheiat la toi nasturii. Pieptul i braele uimitor de musculoase preau gata s sfie pnza subire. Gtul lui scurt i gros abia ncpea n gulerul strmt. Faa ptrat, cu brbie masiv, lucea de sudoare. Gfia i legna n mn o pung de plastic cu sigla unui magazin universal. Ando l-a recunoscut imediat. l vzuse ultima dat la Institutul
318

Medico-Legal, n octombrie. Brbatul s-a aezat lng el, foarte aproape. Hei, nu ne-am vzut de mult! Ando nu i-a rspuns, nici mcar nu s-a ntors spre el. A continuat s se uite fix la silueta care se juca pe rm. Omule, ai disprut brusc, fr s-mi spui unde te duci. Aa te pori tu cu prietenii? Brbatul a scos din saco o doz cu ceai de oolong i a golit-o din cteva nghiituri. Cnd a terminat, a scos nc una i i-a oferit-o lui Ando. Nu i-e sete? Ando a luat-o i a deschis-o. Cum m-ai gsit? a ntrebat el, foarte calm. Miyashita mi-a spus c azi se mplinesc doi ani de cnd a murit fiul tu. Restul e pur deducie. Nu c ai fi o mare enigm. Brbatul a rs. Ando a fcut un efort s se stpneasc. Ce vrei? Uite ce-i, a trebuit s iau un tren i un autobuz ca s ajung aici. Cred c merit o primire mai clduroas. Pe naiba, a scrnit Ando. Hai, nu fi grosolan, a zis brbatul, cu un zmbet batjocoritor. Grosolan? ndrzneti s-mi spui aa ceva? Cine crezi c te-a adus aici? Bine, i sunt recunosctor, sincer. Ai fcut exact ce m ateptam s faci. Ando i-a amintit cu ct neruinare l manipulase brbatul de lng el. n studenie, pe vremea cnd se jucau de-a criptografia, individul sta reuea mereu s scrie coduri indescifrabile, n schimb decripta de fiecare dat codurile lui. i strnea invidia, l mbolnvea de frustrare, dar n acelai timp i ddea motive s-l admire i era un exemplu demn de urmat. Dar vremea asta trecuse, iar acum se simea folosit ca o unealt. i jignit. Nu mai avea de ce s-l admire. Ando s-a uitat n sfrit la Ryuji Takayama, pe care-l ajutase s
319

renasc. Ryuji privea drept nainte i Ando i vedea doar profilul. Ar fi vrut s tie ce se petrecea n capul lui. Ar fi vrut s-i afle fiecare gnd. Apoi i-a amintit c n urm cu un an, n octombrie, i inuse literalmente n mini creierul. Degeaba, asta nu-l ajutase s-l neleag. i pentru c nu pricepuse nimic, se lsase nelat ca un copil de mesajele lui cifrate. Dac nu i-ar fi fcut autopsia, Ryuji nu s-ar fi implicat niciodat n povestea asta. Nu crezi c i pentru tine e mai bine? l-a ntrebat Ryuji. Nu tiu. i era adevrat. Jos, la marginea apei, silueta s-a ridicat n picioare i i-a fcut cu mna. Ando i-a rspuns i biatul s-a apropiat, rscolind nisipul cu picioarele. Tati, mi-e sete! Ando i-a dat cutia cu ceai. Biatul a luat-o i a dus-o imediat la buze. Ando a privit gtul palid al fiului su. Aproape c vedea lichidul rece care se scurgea prin el. Carne vie, snge cald, reale. n comparaie cu sudoarea uleioas de pe faa lui Ryuji, picturile mici de pe gtul copilului de trei ani i jumtate preau de cristal. i venea greu s cread c aveau practic aceeai compoziie. Salut, putiule. Mai vrei o cutie? Noi doi suntem nrudii, tii? a zis Ryuji, scotocind n saco. nrudii. Cuvntul a rmas nepenit n mintea lui Ando. Dar era adevrat: Ryuji i biatul se nscuser din acelai pntece. Adevrat i ngrozitor. Copilul s-a uitat la Ryuji i a dat din cap, apoi a ridicat cutia pe jumtate plin i a ntrebat: Pot s-o beau pe toat? Sigur, bea-o, a zis Ando, iar copilul s-a ntors pe plaj, innd cutia cu grij. Ando i-a dat seama c biatul voia s se joace cu ea, poate s-o umple cu nisip. L-a strigat:
320

Takanori! Copilul s-a oprit i s-a ntors: Da, tati! S nu intri n ap, ai neles? Biatul i-a zmbit i i-a ntors spatele. Dar Ando nu trebuia s insiste. Fiul lui se temea de ap, de parci amintea c se necase. Probabil c n-ar fi intrat n ap dect forat. Dei tia asta, Ando nu se putea stpni. Era exagerat de protector. Frumos copil. Nu avea nevoie de confirmarea lui Ryuji. Bineneles c Takanori era frumos. Era un giuvaer, o comoar nepreuit pe care cndva, demult, o pierduse. O comoar pentru care el trdase specia uman. Nu era sigur nici acum c fcuse ce trebuia s fac. Recompensa pe care Sadako i-o oferise n schimbul cooperrii era renaterea fiului su. Cu ase luni n urm, cnd el i Miyashita citiser scrisoarea lui Sadako, Ando nu fusese n stare s accepte c ar fi fost posibil. Cteva clipe mai trziu nu numai c ajunsese s cread, dar chiar devenise un susintor nfocat al renvierii. n fond, Sadako nsi era o dovad suficient. Pe deasupra, avea o mostr de ADN de la fiul su: uvia de pr pe care o pstra n bibliotec. Fr ea, renaterea ar fi rmas o utopie. Dac Ando n-ar fi atins atunci capul biatului, dac firele de pr nu i s-ar fi ncurcat n verighet, informaia genetic a lui Takanori s-ar fi pierdut pe vecie. Teoretic, era uor. Aveau o mam cu nsuiri ieite din comun Sadako , iar restul era treaba tiinei. Primul pas era ca Sadako s fecundeze unul dintre propriile ei ovule. Avnd organe de reproducere de ambele sexe, Sadako era capabil s-i implanteze singur n uter un ovul fertilizat. Urmtorul pas consta n prelevarea ovulului i nlocuirea ADN-ului su cu ADN-ul persoanei pe care doreau s-o readuc la via. Sigur, nu era deloc simplu s extrag nucleul unei celule din prul lui
321

Takanori i s-l pun n locul nucleului din ovul. Dar nu era niciun lucru imposibil pentru un specialist cu experien. n teorie, la fel ar fi putut s renvie i un dinozaur dac ar fi avut ADN-ul acestuia. Ovulul cu nucleu schimbat a fost apoi reimplantat n uterul lui Sadako. Nu mai aveau acum altceva de fcut dect s atepte naterea. Fetusul a ieit din uter dup o sptmn, iar dup alte apte zile a ajuns la vrsta la care mostra de ADN se desprise de corp. n cazul lui Takanori, vrsta la care biatul dispruse n adnc, lsnd ntre degetele tatlui su o uvi de pr. Biatul i pstrase toate amintirile pn n clipa morii. Probabil c erau stocate n poriunea din ADN care nu conine cod genetic. Takanori de acum era copia fidel a copilului pe care-l pierduse cu doi ani n urm. Avea aceleai ticuri, vorbea la fel, era identic. Nu uitase nimic din prima lui via i se purta absolut firesc. Imediat dup ce Ando i recptase fiul, Sadako i ceruse s-i respecte cuvntul dat. i ceruse exact ce bnuia c-o s vrea, i-anume s foloseasc aceeai metod pentru a-l renvia pe Ryuji. Renaterea lui Takanori nu fusese doar o recompens, ci i o repetiie. Doar voina lui Ryuji de a renate pusese totul n micare. Iar Ryuji a obinut ce dorea: un corp, cel care sttea acum lng Ando, viu. Fusese din prima clip partenerul lui Sadako, cel mai bun pe care lar fi putut avea. Nu era prima dat cnd Ando se ntlnea cu noul Ryuji. Dup ce se asigurase c ADN-ul lui Ryuji ajunsese cu bine n ovulul fertilizat, Ando i luase biatul i dispruse. N-a spus nimnui unde pleac, lsnd restul operaiei pe minile lui Miyashita i ale unor tehnicieni. i nchipuia c rolul lui se sfrise de-acum. Ryuji revenise, i nimeni nu mai avea nevoie de Ando. Cea mai mare dorin a lui Sadako se mplinise, avea un aliat de ncredere. Cnd se hotrser ea i Ryuji s coopereze? Dup toate aparenele, comunicaser de la ADN la ADN, constataser c erau compatibili i c parteneriatul le-ar fi adus numai beneficii. Dar rspunsul nu-l interesa prea tare pe Ando. Acum, principala
322

lui grij era cum s-i creasc fiul. Avea nevoie de timp de gndire, aa c demisionase cu dou luni n urm i de-atunci cltorea prin Japonia, oprindu-se mai ales n localitile mici. Hoinrea fr int. Voia pur i simplu s fie ct mai departe de Ryuji i Sadako. Ryuji a scos o fiol din buzunar. Uite, a zis el. Ce-i asta? Un vaccin obinut din virusul Ring. Un vaccin Ando a luat fiola i a examinat-o cteva clipe. El i Miyashita erau pozitivi. Aa cum bnuiser, raportul Ring i transformase n purttori. De atunci ncoace triau n nesiguran, ntrebndu-se mereu cnd va ncepe boala. Ia-o, va distruge virusul. Acum nu mai trebuie s-i faci griji. Ai btut atta drum doar ca s-mi aduci asta? Cum adic, n-am voie s vin i eu la plaj din cnd n cnd? Ryuji a rs, dar fr convingere. Ando a lsat puin garda jos. Indiferent ct de departe s-ar fi dus, fr vaccin n-ar fi scpat niciodat de ameninarea virusului. Spune-mi, cu lumea ce se va ntmpla? a ntrebat dup ce a pus fiola n buzunarul de la piept i a ncheiat nasturele. Nu tiu. Scutete-m. Tu i Sadako vei recldi universul, vei transforma viaa, nu-i aa? Pot s-i spun ce se va ntmpla n viitorul imediat. Mai departe Nici eu nu tiu. Atunci descrie-mi viitorul apropiat. S-au vndut peste un milion de exemplare din Ring. Bestseller, nu? Dar Ando tia deja asta. Citea ziarele. Cartea fusese retiprit de mai multe ori, un succes trmbiat n repetate rnduri. De fiecare dat cnd citea cuvntul retiprire, Ando se gndea la reproducere. Ring se nmulise peste noapte. Acum existau peste
323

un milion de purttori. Se face i un film. Un film? Ring? Da. Se organizeaz o audiie deschis pentru rolul lui Sadako. O audiie deschis? Cum ai auzit. i ghici cine a primit rolul? Ryuji cel renscut a izbucnit n rs. Ando nu citea reviste de cinema. De unde naiba era s tie cine primise rolul? Spune. Acum Ryuji se strica de rs. i dduser lacrimile. Doar nu eti idiot. O cunoti foarte bine. Sadako? Abia dup ce i-a rostit numele i-a dat seama de ce. Sadako visase mereu s fie actri. Cnd terminase liceul se angajase ntr-o companie de teatru. Nu era o amatoare, avea cel puin cunotinele de baz. i nu era de mirare c, folosindu-i pe deasupra i puterea psihic colosal, vrjise juriul audiiei. Pentru ea, rolul era irezistibil. Sadako avea ocazia s se interpreteze pe ea nsi. i Ando tia n ce scop: voia s-i proiecteze gndurile n film, s introduc acolo nregistrarea video, genomul ei. Caseta avea s renasc, dar nu oricum, ci la scar mare. Care avea s fie rezultatul? n funcie de succesul filmului, un numr mai mare sau mai mic de femei care vor merge la cinematograf n perioada de ovulaie vor trece apoi prin aceeai tragedie ca i Mai Takano. O sptmn mai trziu o vor nate pe Sadako, iar trupurile lor, inutile ca nite crisalide uscate, vor fi abandonate. Apoi filmul va ajunge n centrele de nchiriere video i va fi difuzat la televiziune. nregistrarea se va rspndi rapid, incomparabil mai repede dect prin simpla copiere a casetei. Virusul se va nmuli exploziv. Iar nou-nscutele Sadako vor nate la rndul lor alte Sadako, fr ajutorul nimnui. Sadako alctuise un
324

plan care avea un singur rezultat: subjugarea lumii. Da, Sadako se va culca cu mass-media, a zis Ryuji, de data asta serios. La un moment dat cineva va nelege i filmul va fi interzis. Nu numai filmul, ci i cartea. Toate exemplarele vor fi retrase de pe pia i arse. Ando voia s cread c omenirea nu va rmne pasiv, c va contraataca. Ba nu. Gndete-te ct de vast este mass-media de azi, ct de multe persoane au intrat deja n contact cu virusul. Chiar dac Ring dispare, rmn totui cei care au fost deja contaminai. Gndete-te, caseta s-a transformat deja ntr-un text, aa c la fel de bine se poate transforma n orice: muzic, jocuri video, reele de computere. Aceste noi forme se vor mperechea cu Sadako i vor produce ali hibrizi media, iar fiecare femeie care va interaciona cu ei la ovulaie va nate o Sadako. Ando i-a ridicat mna la piept i a pipit vaccinul. Avea efect doar mpotriva virusului Ring. Ar fi fost neputincios n faa tulpinilor de origine mass-media. Era imposibil s obii un vaccin eficient fr s tii n ce tip de media se va transforma virusul. Omenirea va fi astfel mereu cu un pas n urm. Sadako, noua specie, o va decima treptat, pn cnd o va aduce n pragul dispariiei. i nu te deranjeaz deloc? El n-ar fi putut s priveasc linitit mcelul, s asiste la nlocuirea oamenilor cu Sadako. Dar el era doar un pion. Ryuji, n schimb, avea un rol activ, ddea o mn de ajutor. Iar Ando nu putea nelege de ce. Tu priveti totul din punctul de vedere al unui om, eu nu. Uite cum vd eu lucrurile: moare un om, dar se nate o Sadako. Minus unu, plus unu, totalul rmne neschimbat. Care-i problema? Problema e c asta depete capacitatea mea de nelegere. Ryuji s-a aplecat spre el. Faa lui uleioas aproape c l atingea. N-are niciun rost s faci pe nebunul. Eti acum n tabra noastr.
325

i ce-ar trebui s fac? n primul rnd, s te implici n procesul de evoluie. E o ocazie foarte rar, dac vrei s tii prerea mea. Evoluie? Tu numeti asta evoluie? Toat diversitatea genetic a lumii se va scurge ntr-un singur tipar, cel al lui Sadako. Puteai oare s numeti aa ceva evoluie? Ando simea c punctul slab era chiar aici. Exact diversitatea genetic era motivul pentru care unii dintre bolnavii de cium supravieuiser i cptaser imunitate. Chiar dac va veni o nou er glaciar, i-a spus Ando, eschimoii vor trece cu bine prin ea, i asta numai pentru c exist diversitatea n acest caz, diversitatea de populaii din cadrul speciei. Dac dispare diversitatea, cel mai mic accident poate terge o specie de pe faa pmntului peste noapte. Dac, de exemplu, Sadako Yamamura are un defect n sistemul imunitar, acesta va fi reprodus identic n fiecare copie Sadako. O simpl rceal poate provoca dispariia speciei. Ando spera, de altfel, c asta se va i ntmpla. Singura speran pentru omenire era s supravieuiasc i s atepte accidentul. tii de ce evolueaz fiinele vii? Ando a cltinat din cap. Era convins c nimeni nu poate rspunde cu certitudine la aceast ntrebare. Dar n vocea lui Ryuji se putea simi certitudinea: Gndete-te la ochi. tiu c n-ar trebui s-i mai explic asta, doctore Ando, dar ochiul omenesc este o mainrie uimitor de complex. E aproape imposibil s nelegi cum o bucat de piele, banala piele, s-a transformat n cornee, n pupil, n glob ocular, n nervul optic care face legtura cu creierul, s accepi c toat aceast alctuire vede. E i mai greu de crezut c poate fi doar rodul ntmplrii. Asta nu nseamn ns c am nceput s vedem abia dup ce am avut cu ce. La nceput a fost voina de a vedea, ascuns adnc n toate fiinele vii. Fr ea, mainria n-ar fi cptat niciodat form. i nu ntmplarea le-a mpins pe vieuitoarele marine s ias pe uscat, nici pe reptile s se avnte n aer. Nu, au avut voina s
326

fac asta. Dac a rosti aceleai cuvinte n prezena unui om de tiin, mi-ar rde n nas. Mi-ar spune c-i teologie, misticism, filosofie de dou parale. Te-ai gndit vreodat cum e lumea pentru o creatur care nu vede? Pentru viermii care se zvrcolesc sub pmnt este o simpl atingere n bezn. Pentru stelele de mare i anemonele din oceane, lumea se reduce la textura stncii de care sau lipit sau la curentul n care se leagn. Crezi c asemenea fiine pot mcar s viseze ce nseamn a vedea? Ar fi un efort prea mare de imaginaie. E o limit la care nu poi ajunge, ca marginea universului. Dar, ntr-un anumit punct al evoluiei i ntr-un anumit fel, vieuitoarele de pe planeta asta au nceput s vad. Ne-am trt pe uscat, am plutit n aer i n cele din urm am inventat civilizaia. Un cimpanzeu stpnete conceptul de banan, dar nu va nelege niciodat conceptul de civilizaie. Nu poate, dar n schimb ar putea s capete voina de a-l nelege. S nu m ntrebi de unde vine acest impuls, n-am nici cea mai mic idee. Ia te uit, nu tii tot? a intervenit Ando, sarcastic. Te rog s fii atent. Dac omenirea dispare ca specie i n locul ei se instaleaz ADN-ul lui Sadako, nseamn c asta e voina ei. Exist vreo specie care-i vrea dispariia? n subcontient, oare nu asta vrea? Dac ADN-ul se unete ntr-un singur fir, toate diferenele dintre indivizi dispar. Toi vor fi la fel, la fel de talentai, la fel de frumoi. Nu vor mai exista legturi emoionale i sentimentale. Vor uita de rzboi, pentru c nu vor mai exista motive de disput. Vorbim acum despre o lume dominat de pace i egalitate, dincolo de via i de moarte. Nimeni nu va mai avea de ce s se team de moarte. Spune-mi acum, dar sincer, oare oamenii nu viseaz dintotdeauna o asemenea lume? Spre sfritul discursului, Ryuji se apropiase i mai mult de Ando i i optise ultimele cuvinte la ureche. Ando, n schimb, se uita numai la Takanori, care sttea pe vine i umplea cutia de ceai cu nisip. Eu nu mi-am dorit asta.
327

Fiul lui era nepreuit, unic. Ando nu voia s piard unicitatea, s vad n acelai fel ca alii. Putea s afirme asta cu mna pe inim. Bine, cum vrei, a spus Ryuji rznd i s-a ridicat. Pleci? Trebuie. Ce-ai de gnd s faci n continuare? Ce-a putea s fac? O s gsesc o insul pustie, fr ziare, fr televiziune, i o s-mi cresc fiul acolo. M ateptam la asta. Eu am de gnd s asist la spectacolul dispariiei oamenilor. Cnd se va depi punctul de ntoarcere Cine tie, poate c o voin mai presus de cea uman va interveni i ne va face una cu pmntul. N-a vrea s ratez un asemenea eveniment. Ryuji a pornit spre falez. La revedere, Ryuji. Transmite-i salutri lui Miyashita din partea mea. Ryuji s-a oprit. Poate c ar trebui s te mai nv ceva nainte s ne desprim. De ce crezi c civilizaia uman a evoluat? Oamenii sunt n stare s ndure aproape orice, dar exist totui ceva care-i ucide. Omul este singurul animal care nu suport plictiseala. De-aici a pornit totul. Omenirea trebuia s progreseze ca s nu se plictiseasc. Presupun c urmeaz o mare plictiseal, n fond, totul va fi controlat de un singur ADN. Dac gndeti aa, bineneles c vrei s vezi o diversitate ct mai accentuat. Dar ce putem face, bieii de noi? Uite c oamenii nu vor diversitate. A, nc ceva: cred c o s mori de plictiseal pe insula ta. Ryuji i-a fcut cu mna i s-a ndeprtat. Ando nc nu tia unde l vor purta paii. n privina asta, viitorul era total incert. Poate c era inutil s-i fac planuri, poate c nici nu exista un plan viabil. O vreme, cel puin, nu avea alt soluie dect s hoinreasc, s se lase n voia valurilor. i-a scos pantalonii i cmaa i a rmas n slip. A alergat la Takanori, l-a luat de mn i l-a ridicat.
328

Hai. i explicase fiului su de o sut de ori ce trebuia s fac i de ce. Trebuia s noate departe, la fel ca atunci. i, cnd Takanori avea s dispar sub ap, Ando avea s-l apuce de mn. Acum doi ani, minile lor nu se ntlniser. Azi se vor gsi i nu se vor mai despri. Sadako i povestise n scrisoarea aceea c renaterea ei n puul de pe acoperi nu se deosebea aproape deloc de moartea ei n puul din pdure. Abia cnd ieise de-acolo simise sau intuise c putea s nfrunte lumea fr s se team. Ando se gndise c fiul su trebuia s treac prin aceeai ncercare. Biatul trebuia s retriasc tragedia de acum doi ani. Apa l ngrozea pe Takanori, l nspimnta att de tare nct viaa lui ar fi fost un chin. n timp ce mergeau pe rm, copilul se aga de el de fiecare dat cnd valurile i loveau gleznele. Takanori s-a oprit brusc i s-a ntors spre el. Tati, mi-ai promis, a spus el tremurnd. Da, i-am promis. Ando i pregtise deja recompensa: o ntlnire cu mama. Mami o s aib o surpriz. Fosta lui soie nu tia c biatul ei era viu. Ando atepta cu nerbdare clipa regsirii dintre mam i fiu. Pn atunci, trebuia s inventeze o poveste plauzibil. Takanori nu se necase, l salvaser nite pescari. Fusese amnezic i trise doi ani n casa unor strini. Povestea n sine, orict de ridicol, nu avea pn la urm nicio importan. Cnd l va mbria pe Takanori, cnd va simi c e viu, va crede orice. Vor reui oare s triasc iar ca so i soie? Asta era alt poveste. Dar Ando era dispus s ncerce. Un val mai mare dect celelalte l-a ridicat pe biat de pe nisip. Takanori a ipat i s-a agat de tatl lui. Ando l-a strns n brae i a continuat s nainteze n larg. i simea btile inimii. Ritmul ei era singura certitudine ntr-o lume ajuns pe marginea abisului.
329

Dovedea c tria.

330