Sunteți pe pagina 1din 20

BIOCHIMIE FARMACEUTICA .

REFERAT 2009

Telomerii . Telomeraza
Stabilitatea si integritatea genomica constituie o componenta esentiala in functionarea unui organism. Telomerii se regasesc printre elementele cheie care contribuie la mentinerea stabilitatii genomice. Acest aspect a fost remarcat inca din 1938 de catre McClintock si Muller, care in urma unui amplu studiu citologic au dedus faptul ca regiunile terminale ale cromozomilor ( terminal genes ) au functie protectoare. Ambii cercetatori si-au condus studiile efectuand experimente pe musculita de fructe (Drosophila melanogaster). S-a constatat ca in lipsa telomerilor cromo-omii fuzioneaza. Daca noul cromozom rezultat ajunge sa fie replicat, el va suferi in timpul anafazei o ruptura ce duce la alterarea materialului genetic. Studiul celor doi a precedat descoperirile ulterioare, care au elucidat structura ADN si au demonstrat functia de material genetic al moleculei de acid dezoxiribonucleic (J.Watson).

Fig. 1

Structura unui cromozom si localizarea telomerilor

Replicarea incompleta si existenta unui mecanism compensator ce previne scurtarea cromozomilor a constituit obiect de studiu si pentru geneticianul rus Alexsei M. Olovnikov. Acesta a relationat problema replicarii cu senescenta celulara, afirmand ca rata de scurtare a telomerilor determina numarul maxim de diviziuni pe care o celula il poate suferi. Descoperirea telomerazei, o
1

BIOCHIMIE FARMACEUTICA . REFERAT 2009

reverstranscriptaza realizeaza sinteza de ADN pe baza propriei matrici de ARN, a adus o noua perspectiva in intelegerea proceselor ce se defasoara la nivelul cromozomilor.

Natura si functia telomerilor


Telomerii sunt secvente repetitive de ADN localizate la terminatiile cromozomilor majoritatii organismelor eucariote si a unui numar redus de procariote. Rolul principal al acestora il reprezinta protejarea cromozomilor de actiunea nucleazelor. Denumirea acestor formatiuni deriva din limba greaca: telos -capat si meros parte. In timpul diviziunii celulare, enzimele care asigura duplicarea cromozomilor si a ADN-ului au o activitate incompleta. Daca celulele s-ar divide fara telomeri , acestea ar pierde capetele cromozomilor si implicit in-formatia continuta in aceasta regiune. Aceasta ipoteza a fost formulata in 1972 de catre James Watson the end replication problem. O alta functie indeplinita de telomeri o reprezinta protectia impotriva recombinarilor omoloage (homologous recombination-HR) si fuziunilor neomoloage (non homologous end joining-NHEJ) a cromozomilor eucariotelor. Majoritatea organismelor procariote poseda cromozomi circulari, lipsiti de capete care ar putea fuziona. O fractie redusa a cromozomilor bacterieni din genomul speciilor Borellia si Streptomyces sunt liniari si poseda telomeri. Acestia au insa o structura si functii diferite decat cei prezenti la eucariote.

Fig.2 Lungimea telomerilor se reduce de-a lungul ciclurilor celulare. Activitatea unei enzime ,numite telomeraza, mentine constanta lungimea acestor secvente. In stadiul adult activitatea telomerazei devine nula si la fiecare replicare a celulelor somatice cromozomii devin tot mai scurti. Prin urmare noile
2

BIOCHIMIE FARMACEUTICA . REFERAT 2009

catene sunt mai scurte si fiecare telomer pierde aproximativ 100 pb (aproximativ 16 secvente repetitive TTAGGG- fig.2). Elisbeth Blackburn si Joseph Gall de la Universitatea Yale au condus un studiu dedicat elucidarii naturii, si implicit a structurii, telomerilor ( 1975-1977). Acestia au descoperit ca regiunile telomerice variaza in functie de specie si sunt constituite din secvente repetitive , care la om sunt secvente de cate 6 nucleotide TTAGGG-. Lungimea telomerilor vaziaza de la 20 pb la protozoare, 150 pb la soarece si mai multe kilobaze la om.

Secventele telomerice cunoscute:


Om Soarece Xenopus Neurospora crassa Physarum Didymium Dictyostelium Trypanosoma Crithidia Tetrahymena Glaucoma Paramecium Oxytricha Stylonychia Euplotes Plasmodium Arabidopsis thaliana Chlamydomonas Bombyx mori Ascaris lumbricoides Schizosaccharomyces pombe Saccharomyces cerevisiae Candida glabrata Candida albicans Candida tropicalis TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG TTAGGG AG(1-8) TTAGGG TTAGGG TTGGGG TTGGGG TTGGG(T/G) TTTTGGGG TTTTGGGG TTTTGGGG TTAGGG(T/C) TTTAGGG TTTTAGGG TTAGG TTAGGC TTAC(A)(C)G(1-8) TGTGGGTGTGGTG sau G(2-3)(TG)(1-6)T GGGGTCTGGGTGCTG GGTGTACGGATGTCTAACTTCTT GGTGTA[C/A]GGATGTCACGATCATT
3

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Candida maltosa Candida pseudotropicalis Candida guillermondii Kluyveromyces lactis

GGTGTACGGATGCAGACTCGCTT GGTGTACGGATTTGATTAGTTATGT GGTGTAC GGTGTACGGATTTGATTAGGTATGT

Scurtarea telomerilor
Telomerii devin mai scurti datorita proceselor enzimatice care au loc la sfarsitul replicarii ADN. Acest aspect, cunoscut sub denumirea de the end replication problem a fost sesizat de catre Watson si Olovnikov care au demonstrat ca necesitatea ADN polimerazei de a inainta doar dupa introducerea unui primer ARN care sa ofere un capat 3OH liber , va duce la scurtarea catenei de ADN sintetizata discontinuu (lagging strand ) prin degradarea ARN primerului terminal. Replicarea ADN in timpul fazei S de catre furcile de replicare nu incepe la nici unul din capetele cromozomului, ci dintr-o zona interioara a acestuia sub actiunea unui complex multienzimatic numit primozom. In cazul eucariotelor exista aproximativ 100 de repliconi, fiecare avand un punct de start si un punct terminal intre care ADN polimeraza sintetizeaza o noua catena mereu in directia 5-3, indiferent daca actioneaza pe catena conducatoare sau pe catena intarziata. Pe catena conducatoare, sinteza de ADN complementar are loc fara dificultati deoarece se petrece in acelasi sens cu sensul de inaintare al despiralizarii. Problema apare in cazul catenei intarziate, care pentru a respecta sensul de sinteza 5-3 , va avansa mai lent in sens opus sensului de despiralizare. Aceasta catena este sintetizata discontinuu sub forma unui unui fragment pentru fiecare ochi de despiralizare (fragment Okazaki). Pentru a compensa acest neajuns,secventele scurte de ARN primer sunt atasate catenei intarziate in fata punctului de initiere a replicarii. ADN polimeraza isi exercita actunea spre directia 3 si noi primeri sunt atasati fiecarui fagment Okazaki. Dupa atasarea ultimului primer ARN si copierea intregului segment parental, ADN polimeraza I , ARN nucleaze si ADN ligaza convertesc ARN din primeri in ADN, eliminand in totaltate ribonucleotidele si lipesc fragmentele Okazaki. Procesul descris are loc in toate regiunile de sinteza , mai putin in locul in care a fost introdus ultimul fragment de ARN primer. Acesta este
4

BIOCHIMIE FARMACEUTICA . REFERAT 2009

degradat enzimatic ,iar gap-ul format este inlaturat de catre ADN ligaza care uneste prin extensie fragmentele Okazaki . Prin urmare o portiune din telomeri se pierde la nivelul catenei intarziate in cadrul fiecarui ciclu de replicare.

Fig.3 Studii in vitro mai recente au demonstrat ca telomerii sunt foarte susceptibili stresului oxidativ. Scurtarea telomerilor datorata radicalilor liberi explica diferenta dintre pierderea estimata ca apare in urma replicarii materialului genetic , 20 pb la fiecare diviziune celulara, si cifra care indica pierderile reale de telomeri (50-100pb).

Mecanismul de reglare genetica


Unitatile telomerice dublucatenare sunt legate de un complex format din mai multe proteine, numit telozom (telosome sau shelterine). Telozomul prezinta un domeniu de legare la telomer si contine factori de legare: TRF1, TRF2, TIN 2 (TNF1 interacting nuclear factor 2), RAP1, POT1 si TPP1. Telomeraza recunoaste capatul cromozomului si elongeaza catena de ADN.

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Fig.4 Exista si celule lipsite de telomeraza unde alungirea telomerilor e posibila printr-un mecanism de recombinare omoloaga intre unitatile repetitive de telomeri, asa numita alungire alternativa a telomerilor (ALT- Alternativ lenghtening of telomeres).

Alungirea telomerilor
Numarul diviziunilor celulare este limitat ,iar in cazul speciei umane se aproximeaza ca fiind 125. Observatia apartine lui Leonard Hayflick si fenomenul este cunoscut sub numele de limita Hayflick. In ultimii ani s-au facut progrese in studiul telomerilor si se promovea-za ipoteza alungirii acestora in anumite celule, prin activarea temporara a telomerazei (medicamentatie) sau prin intermediul terapiei cu gene. In acest mod s-ar putea evita senescenta celulara si s-ar extinde durata vietii.[1] Exista insa si teorii conform carora incetinirea procesului de imbatranire prin aceasta metoda ar putea conduce la cresterea vulnerabilitatii la cancer ( Weinstein si Ciszek,2002).

Variatii in comportamentul telomerilor


Un studiu efectuat pe viermi ce apartin speciei Caenorhabditis elegans a indicat existenta unei coorelatii intre alungirea telomerilor si cresterea sperantei de viata. Experimentul a fost realizat studiind doua specii de viermi ce erau diferiti prin cantitatea de proteina HRP-1 produsa
6

BIOCHIMIE FARMACEUTICA . REFERAT 2009

de celulele lor. S-a constatat ca viermii ce aveau telomerii mai lungi au trait 24 de zile, cu 20% mai mult decat media. In 2003 s-a constatat ca telomerii speciei Oceanodroma leucorhoa se alungesc odata cu inaintarea in varsta , fiind pentru prima data cand s-a observat un astfel de comportament in cadrul evolutiei telomerice. In 2006, un grup de cercetatori condusi de Frans Joula au studiat mai multe specii de pasari de mare si au concluzionat ca specia Fregata minor constituie o alta abatere de la regula conform careia telomerii se scurteaza ireversibil odata cu augmentarea varstei biologice si cresterii numarului de replicari a materialului genetic. Telomerii acestei specii au scazut in lungime pana la varsta de 40 ani ,insa dupa depasirea acestui prag viteza procesului a scazut simtitor. De asemenea s-a constatat ca rata de scadere a lungimii telomerilor variaza foarte mult in cadrul aceleiasi specii. Studiul lunigimii telomerilor ce apartin indivizilor speciei Fregata minor nu constituie un criteriu viabil in determinarea varstei acestora. Prin urmare s-a ajuns la concluzia ca exista variatii mult mai mari in comportamentul telomerilor decat cele estimate initial. Lungimea telomerilor variaza si in cazul animalelor clonate. Uneori clonele prezinta telomeri mai scurti ,deoarece ADN-ul lor s-a replicat anterior de mai multe ori. Exista si situatii in care noii telomeri ai clonei se combina cu cei vechi ,dand nastere unor telomeri aberanti.

Determinarea lungimii telomerilor


In studiul determinarii lungimii secventei telomerilor se utilizeaza mai multe tehnici, aflandu-se cu o precizie satisfacatoare numarul de perechi de baze pe care le au telomerii eucariotelor. Cea mai uzitata metoda este TRF (Terminal Restriction Fragment), o varianta a metodei Southern Blot. Aceasta prevede sectionarea ADN din genomul eucariot cu ajutorul unor enzime de restrictie si hibridizarea acestuia cu 32P-(TTAGGG)n marcat radioactiv. Alta metoda histochimica utilizata este FISH Florescent in Situ Hybridization (fig.5) si varianta acesteia in care intervine si folosirea unei surse de caldura Q-FISH. Dezavantajul metodei este constituit de cantitatea mare de ADN pe care analiza o necesita (2-20 g). Se mai recurge la aceasta doar in cazul unor studii epidemiologice mai vaste. RT-PCR ( Real Time PCR) si Flow FISH sunt metode mai noi care se bucura de o buna reproductibilitate a rezultatelor.

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Fig.5 Florescent in Situ Hybridization In 2003 Duncan Baird a introdusa o noua tehnica ce vizeaza determi- narea lungimii telomerilor, bazata pe principiile PCR. Se numeste STELA (Single Telomere Elongation Length Analysis) si are o rezolutie superioara celorlalte metode, datorita faptului ca pot fi luati in studiu primeri specifici cromozomilor si investigatia poate tinti specific terminatiile telomerice. Acest lucru nu este posibil in cazul TRF. Dezavantajul tehnicii STELA il reprezinta imposibilitatea de a utiliza telomeri mai mari de 25 Kb, deoarece acestia nu pot fi amplificati. Premergator acestor operatiuni se recolteaza sange periferic din care se separa leucocitele si apoi se izoleaza ADN. Lungimea telomerilor unui individ este determinata genetic, dar se cunoaste ca este influentata de anumiti factori: varsta subiectului, varsta tatalui in momentul nasterii ( telomeri mai lungi in cazul unui parinte mai inaintat in varsta) si sex ( barbatii au in general lungimea secventei telomerice mai scurta decat femeile).

Influenta vitaminei D asupra lungimii telomerilor


In 2007 a fost finalizat un studiu ce a plecat de la premiza ca lungimea telomerilor este coorelata cu nivelul seric al vitaminei D. O echipa de cercetatori
8

BIOCHIMIE FARMACEUTICA . REFERAT 2009

condusa de catre J.B. Richards a examinat consecintele unei concentratii ridicate de vitamina D asupra telomerilor. S-a ajuns la concluzia ca vitamina D reprezinta un posibil inhibitor al raspunsului proinflamator si incetineste turnover-ul leucocitar. Lungimea telomerilor leucocitari (LTL) scade dupa fiecare diviziune si in urma fiecarui proces inflamator suferit de organism. S-a masurat concentratia serica la 2160 femei cu varsta cuprinsa intre 18-79 ani (media de varsta: 49,4). La sfarsitul studiului au fost sesizate diferente semnificative intre lungimea telomerilor leucocitari ai persoanelor cu nivel seric scazut de vitamina D si cea a subiectilor cu o concentratie mai crescuta de vitamina D in ser . In ultimul caz valoarea LTL este sensibil mai mare chiar si in urma ajustarii prin intermediul unor factori de corectie a unor variabile independente ce afecteaza LTL (varsta, sezonul in care a fost determinat nivlul vitaminei D, prezenta menopauzei, folosirea de substante bogate in hormoni, activitatea fizica). In consecinta, un aport alimentar crescut de vitamina D influenteaza pozitiv lungimea telomerilor si poate juca un rol important in incetinirea procesului de senescenta celulara.

Telomerii si bolile cardiovasculare


Prin studiul telomerilor proveniti din sangele sistemic s-a constatat ca o lungime mai redusa a acestora constituie un factor de risc in dezvoltarea bolilor cardiovasculare. Originea acestei asocieri este inca neclara, desi lumea stiintifica internationala a propus mai multe mecanisme care leaga cele doua aspecte, aparent independente. Una din ipoteze asociaza scurtarea telomerilor cu stresul oxidativ si procesul inflamator.

Influenta stilului de viata asupra lungimii telomerilor


Studiul a fost realizat de cercetatorii de la King's College din Londra i publicat n Archives of Internal Medicine. Au participat 2.401 perechi de gemeni, barbai i femei. Subiectii au oferit informatii despre nivelul de activitate fizica efectuata, statutul socio-economic i statutul de fumator. De asemenea, cercetatorii au prelevat mostre de ADN de la fiecare subiect pentru a examina lungimea telomerilor din leucocite. Telomerii din mostrele prelevate de la persoanele care au efectuat mai puina activitate fizica n timpul liber erau mai scurti decat cei ai subiectilor care faceau mai mult sport, au constatat cercetatorii.
9

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Profesorul Lynn Cherkas, coordonatorul studiului, a indicat ca asocierea dintre lungimea telomerilor i nivelul de activitate fizica ramane semnificativa chiar i dupa ce s-a inut cont de factori de risc precum indicele de mas corporal (IMC), statutul de fumtor, statutul socioeconomic i nivelul de activitate fizica de la slujba. Diferenta ntre telomerii persoanelor mai active - n medie, 199 de minute de exercitii efectuate saptamanal - si ai celor mai sedentare - in medie, 16 minute de activitate fizica saptamanal - este, n medie, de 200 de nucleotide, au spus cercetatorii. Cu alte cuvinte, subiectii mai activi aveau telomeri de lungime comparabila cu cea inregistrata la persoanele mai tinere cu zece ani. Se considera ca activitatea fizica previne stresul oxidativ, care afecteaza celulele i, implicit ADN-ul, contribuind la imbatranire.

Importanta telomerilor in mentinerea integritatii sistemului imunitar


Functionalitatea sistemului imun este strans legata de capacitatea sa proliferativa. Abilitatea de a genera un raspuns imun adaptat specific, depinde, in mare masura, de puseele de proliferare ca raspuns la stimularile antigenice. La persoanele adulte la care functia de generare timica este n declin, mecanismele homeostatice responsabile de mentinerea numarului de limfocite este controlata mai curand prin duplicarea celulelor mature decat prin generarea de celule noi. Celulele somatice normale detin proprietatea intrinseca de reglare a proliferarii. Pe masura imbatranirii celulelor, abilitatea proliferativa descreste pana la atingerea senescentei replicative.Telomerii sunt indicatorii senescentei celulare i ai capacitatii de proliferare.Celulele B i T au abilitatea de a mentine lungimea telomerilor si a-si prelungi supravietuirea prin activarea telomerazei, enzima fiind inactiva in majoritatea celulelor. Supraexpresia telomerazei este prezenta n celulele stem, celulele germinale, foliculii pilosi si in 90% din celulele tumorilor maligne. Cu toate acestea, limfocitele B si T nu devin rezistente la erodarea telomerica.

10

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Fig.6 - Efectele scurtarii telomerilor intr-o celula epiteliala Telomerii persoanelor sanatoase n celulele T: CD4+ i CD8+ sunt erodati progresiv pana la varsta de 65 ani, cand ajung la o lungime mult diminuat. Lungimea telomerilor reprezinta, astfel, un bun marker pentru estimarea varstei si istoriei replicative a sistemului imun. Indivizii sanatoi pierd, n medie, 2 kb din unitatile telomerice intre varsta de 20 i 70 de ani.

Efectul bolilor autoimune asupra telomerilor


Erodarea telomerica este accelerata la pacientii cu boli autoimune, cum ar fi artrita reumatoida, indiferent de varst. La pacienii care dezvolta boli autoimune n tinerete (intre 20 i 30 de ani), telomerii pot fi scurtati cu aproximativ 1 kb, comparativ cu indivizii sanatosi de aceeasi varsta. Pierderea unui kb de unitai repetitive telomerice corespunde cu un surplus de 20 de cicluri celulare prin care celula a trecut. Celulele T de memorie au, in general, o scurtare semnificativa a telomerilor, n comparaie cu celulele T naive. In dereglarile raspunsului imun din variate imunodeficiene, atat celulele T naive, cat i celulele T de memorie evidentiaza o scurtare telomerica necorespunzatoare varstei. Aceasta constatare nu se refera la un raspuns antigenic specific izolat ca parte a
11

BIOCHIMIE FARMACEUTICA . REFERAT 2009

procesului patologic, ci este, cu mare probabilitate, un indicator al unei imbatraniri accelerate a sistemului imun in ansamblu. Aceasta constatare a scurtarii telomerilor, care afecteaza inclusiv celulele T naive, sugereaz c ntr-o serie de imunodeficiene sau autoimunutai este posibil ca stresul replicativ sa apara timpuriu n ontogenia celulelor B. Examinarea erodarii telomerilor n celule B i T poate fi estimata prin determinarea lungimii telomerilor in granulocitele pacienilor cu imunodeficiena, comparativ cu subiecii sanatoi. Lungimea telomerilor granulocitelor reflecta cu acuratete erodarea telomerica din celulele stem hematopoietice, dat fiind ca diferentierea granulocitelor necesita doar foarte putine cicluri celulare. Exista studii care indica reducerea lungimii telomerilor din granulocite in unele autoimunitati sugerand ca astfel de defecte survin si la nivelul celulelor stem hematopoietice. Aceste defecte globale in hematopoieza ar trebui sa fie n consens cu observatia ca pacientii imunodeficienti prezinta un repertoriu specific i redus, indicator al unei senescente evidente. Astfel, este posibil ca varsta sa predispuna la boli autoimune si ca degenerarea sistemului imun dependenta de imbatranire sa se asocieze cu un risc crescut de boala si cu compromiterea raspunsului faa de antigenul exogen.

Rolul telomerazei in sinteza telomerilor


Telomeraza este un complex ribonucleoproteic alcatuit dintr-o componenta proteica si o secventa de ARN. Prezenta telomerazei este indispensabila deoarece in timpul replicarii, ADN polimeraza I poate sintetiza ADN doar in directia 5-3, adaugand dezoxiribonucleotide in continuarea unor ARN primeri ,care ulterior sunt inlocuiti cu secvente de ADN. In regiunea terminala a cromozomului, la nivelul ultimului primer, procesul nu mai este posibil. In aceasta etapa intervine telomeraza, care dispune de un mecanism pe baza caruia sintetizeaza ADN , permitand replicarea regiunii terminale a cromozomilor, aparandu-i de degradare si preintampinand fuziunea cromozomilor intre ei.

12

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Fig. 7 Activitatea telomerazei

Structura si functiile telomerazei


Telomeraza a fost descoperita de catre Elisabeth Blackburn si W. Greider in genomul de Tetrahymena (1984). Enzima este o reverstranscriptaza care adauga un hexanucleotid repetabil si multiplu ( TTAGGG) capatului 3 al catenei de ADN in regiunea telomerilor, avand rol in mentinerea stabilitatii cromozomiale. (fig. 7) TERT ( Telomerase Reverse Transcriptase) este gena care codifica subunitatea catalitica a telomerazei, cu rol in reverstranscriptie. Are aproximativ 4kb si este localizata la nivelul cromozomilor intr-o singura copie. Subunitatea catalitica , numita TP2, prezinta o greutate molecula-ra de 130 kDa. TP2 are forma unei palme (fig.8), in care degetele capteaza catena de ADN si o introduce in situsul activ (palma), la nivelul careia are loc elongarea telomerilor. Structura primara (secventa de aminoacizi) a proteinei TP2 a fost elucidata in 1997. Cealalta componenta proteica majora a telomerazei este TP1 ,ce are rol in legarea secventei de ARN . Atat Tp1 ,cat si TP2 prezinta similitudini cu
13

BIOCHIMIE FARMACEUTICA . REFERAT 2009

proteinele ce intra in structura telomerazelor altor specii. Studiile efectuate pe Saccaromyces cerevisiae si Euplotes aediculatus sugereaza consevarea ,dea lungul evolutiei, a structurii componentelor ce formeaza complexul telomerazei (structuri omoloage).

Fig. 8

Structura telomerazei active

Metodele de reglare a activitatii telomerazice in tesuturile umane


pierderea ireversibila a activitatii telomerazice in celulele somatice in procesul dezvoltarii (celulele terminal diferentiate, celule musculare si nervoase); activitatea se pastreaza in liniile embrionare pentru mentinerea lungimii cromozomiale pentru generatiile viitoare; tesuturile ce isi automentin metabolismul celular intens (sistemul hematopoetic , epiteliul); Activitatea telomerazei in tesuturile ce se reinnoiesc coreleaza cu proliferarea celulara si se regleaza hormonal (prostata, uterul).

14

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Telomeraza si imbatranirea celulara


Imbatranirea celulara este data de scurtarea cromozomilor ai caror lungime nu poate fi refacuta deoarece telomeraza exista la maturitate doar in unele tipuri de celule. Astfel, exista un numar maxim limita de diviziuni, dupa care, celula nu se mai divide (se spune ca intra in apoptoza sau moarte celulara programata) si moare fara sa mai poata fi inlocuita. Daca s-ar gasi o metoda de introducere a telomerazei in toate celulele corpului uman s-ar ajunge teoretic la fenomenul de nemurire. In 1997 s-a clonat gena componentei ARN si a subunitatii proteice din telomeraza omului, ceea ce a deschis perspective noi in depistarea locatiei acestor componente in celula. Una din deosebirile esentiale dintre celulele normale si multe tipuri de celule tumorale este potentialul proliferativ. Ultimele, capabile de polimerizare nelimitata, sunt numite nemuritoare (unul din mecanisme e legat de activarea telomerazei). Dar se confirma ca si alte modificari genetice sunt necesare pentru "imortalizare". Aceasta poate fi privita ca o fuga de la starea de oprire terminala a proliferatiei (OTP), care in final atinge celulele normale somatice. Pe langa activitatea telomerazica exista si alte gene care iau parte la procesul de imbatranire celulara: gena proteinkinazei II dependente de GMPc: activitatea ei se majoreaza in celulele batrane si expresia ei nu are loc in celulele "imortalizate" fara participarea virusilor la om; s-a stabilit ca activarea genelor cailor de fosforilare este necesara pentru o functionare normala, pe cand inactivitatea lor temporala evita imbatranirea; expresia unor gene ce duc la aparitia proteinelor ce inhiba mersul normal al ciclului celular. Pana in prezent nu sunt cunoscute abateri de la regula ca imortalizarea celulelor in vitro e determinata de activarea mecanismelor de mentinere a telomerilor, fapt ce confirma ca micsorarea telomerilor prin stoparea activitatii telomerazei este o determinanta a crizei. De aici reiese ca intre genele ce sunt responsabile de oprirea terminala a proliferatiei, posibil, sunt incluse si genele ce raspund la micsorarea critica a lungimii telomerilor si schimbarile genetice ce tin de evitarea crizei.E posibil ca in celulele nemuritoare sa se fi pierdut functia unor gene de imbatranire care sunt active in mod normal.

15

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Se presupune ca expresia mecanismului de mentinere a telomera- zei in aceste celule este determinata de pierderea unuia sau a mai multor represori ai genelor telomerazei precum in celulele normale. S-a deteminat ca prin introducerea unui cromozom prelevat de la o persoana sanatoasa, intr-o celula umana nemuritoare, acesta o aduce pe cea din urma in stare de OPT (oprire terminala a proliferarii) peste cateva dublari ale populatiei.

Activitatea telomerazica si celulele cancerigene


Se stie ca celulele maduvei spinarii si celulele periferice ale sangelui contin telomeraza activa (ganglionii limfatici normali si benigni poseda activitate localizata in celule proliferative, in centrele germinale din foliculii secundari). Este prezenta activitatea si in derm, epiderm, colul uterin, foliculele parului, celulele endoteliale ale vaselor, mucoasa uterului si a intestinului gros. In aceste tesuturi, metabolismul celular e intens si activitatea telomerazica e marginita de localizarea celulelor-tulpina si subpopulatia proliferativa. Activitatea telomerazica e pierduta in zonele unde are loc diferentierea terminala. Datele confirma ca, in lipsa ganglionilor limfatici, pielii, uterului si intestinului gros, numai 6% din tesutul normal contine activitate telomerazica. Este clar ca in tesuturile cu o capacitate mare de regenerare, activitatea de fond micsoreaza insemnatatea clinica a determinarii activitatii telomerazei. Nivelul activitatii telomerazei in celulele cancerigene e mult mai evidenta: daca ar fi depistata foarte devreme, poate fi un marker pentru diagnoza; daca realizarea depistarii are loc mai tarziu - s-ar utiliza ca proba in confirmarea fazei procesului si prognozei lui. La primele stadii se activeaza telomeraza afectand vezica urinara, ficatul, intestinului gros, capul, gatul, plamanii, rinichii, uterul, prostata si glanda tiroida. Exista o legatura intre activitatea enzimatica si starea tumorii, faza ei, factorii de prognoza si supravietuirea la meningiom, neuroblastom, unele leucemii, etc. Azi analiza TRAP (amplificarea telomerului repetabil -telomere repeat amplification protocol) depisteaza activitatea telomerazica chiar si intr-o celula, dar utilizarea metodei cere o executare corecta a ei - sunt multe surse de primire a datelor false.
16

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Aproximativ 15% dintre tumori nu poseda activitate telomerazica. S-au depistat celule nemuritoare ce nu poseda o activitate telomerazica.

Fig. 9 Expresia genei TERT in cancerul de colon


(a) colon normal; (b) expresia genei se intensifica in epiteliul adenomatos situat in zona proliferativa; (c) expresia TERT este si mai intensa in carcinom; (d) expresia genei este foarte puternica in metastazele carcinomatoase ale ficatului

Studiul lui Parkinson


Se cunoaste ca majoritatea celulele canceroase contin un nivel crescut de telomeraza, iar inhibarea acesteia duce la moartea lor. Cercetarile realizate de echipa doctorului Parkinson s-au concentrat asupra a doua tinte: identificarea unei gene, a carei disfunctii contribuie la inducerea imortalitatii celulelor canceroase si reglarea telomerazei in keratinocitele umane.

17

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Inhibarea telomerazei
Dupa determinarea legaturilor dintre activitatea telomerazica, oncogeneza si senilitate, cercetarile geneticienilor s-au indreptat, in special, in doua directii: crearea ADN antisens fata de telo-ARN si gasirea de inhibitorii ai reverstranscriptazelor. Printre inhibitori, se numara oligonucleotidele modificate, complementare regiunii matrice a telo-ARN. Ele sunt rezistente la actiunea proteinelor si a nucleazelor. Acest gen de nucleotide se fixeaza de matrita telo-ARN a omului, efectiv inhiband activitatea telomerazica in vitro. In realitate, apare problema transportului inhibitorilor prin membrana celulara si miscarea dirijata in nucleul celular. Ca inhibitori au fost testati si inhibitorii reverstranscriptazelor: azidotimidina si didezoxiguanozina, dar nu au fost observate rezultate notabile.

Caldura - substratul activarii telomerazei in celulele canceroase. Importanta .


Radioterapia este considerata in continuare unul dintre punctele forte in tratamentul antineoplazic desi de multe ori inducerea regresiei bolii este imposibila. Pentru cativa ani, ridicarea temperaturii asociata radioterapiei a fost considerata speranta de viitor in reducerea dimensiunilor tumorale. Cu toate acestea s-au inregistrat numeroase efecte adverse. Experimentele realizate recent si facute public la inceputul anului 2008, au lansat insa ideea conform careia caldura este substratul activarii telomerazei celulelor canceroase. Prin urmare, cercetatorii au folosit inhibitori ai telomerazei pentru a demonstra ca in absenta acesteia radioterapia asociata cu hipertermie este mult mai eficienta. In studiul realizat, Tei K. Pandita impreuna cu colaboratorii sai de la Universitatea Washington, a descoperit ca o ridicare moderata a temperaturii determina cresterea expresiei telormerazei celulelor tumorale. Cercetatorii au descoperit ca daca mai intai inactiveaza telomeraza, apoi ridica temperatura la nivelul celulelor tumorale, numarul celulelor distruse prin radiatie ionizanta va fi mai crescut. Avand in vedere faptul ca majoritatea neoplaziilor au telomeraza celulara, inhibitorii acesteia ar putea avea o scara larga de aplicare ca si tratament. Au fost testate trei tipuri de inhibitori, dintre care unul s-a dovedit a fi cel mai eficace in inhibarea activitatii telomerazice, GRN163L. Pentru a continua studiile Pandita va testa efectele GRN163L pe diverse tumori la soareci pentru
18

BIOCHIMIE FARMACEUTICA . REFERAT 2009

a verifica daca imbunatateste efectul distructiv al hipertermiei si radiatiilor asupra celulelor tumorale. Cercetatorii lucreaza in prezent la descoperirea unor medicamente care sa suplineasca efectele pe care le are asupra tesuturilor sursa externa de caldura.

GRN163L - inhibitor de telomeraz, n tratamentul experimental al tumorilor


Geron Corporation are n dezvoltare GRN163L, un inhibitor de telomeraz. Medicamentul a fost studiat n diverse cazuri de tumori cum ar fi: cancere hematologice (mielom multiplu, limfom) i tumori solide (glioblastom, hepatom, carcinom cervical, carcinom de prostat, carcinom ovarian).Studiul condus de cercettorii americani de la Memorial SloanKettering Cancer Center, New York, a urmrit eficacitatea GRN163L n liniile celulare ale carcinomului ovarian uman. GRN163L este n msur s inhibe telomeraza n toate cele patru linii celulare, inducnd moartea celular n cea de-a treia i a patra linie. Pe modele animale, GRN163L a inhibat creterea tumorii n mod dependent de dozaj, dup ce medicamentul a fost administrat de trei ori pe sptmn. O alt serie de studii efectuat de cercettorii colii Medicale din Hannover (Germania) a evaluat efectul GRN163L asupra celulelor hepatomului uman. S-a constatat c acest medicament este mult mai potent dect un inhibitor de telomeraz analog - GRN163, n reducerea creterii tumorale la modele animale.

Rolul telomerazei in alte patologii umane


In 2005 a fost descoperit faptul ca mutaiile genei TERT sunt implicate n predispozitia la anemie aplastica, o tulburare n care maduva osoasa nu reuete s produc celule sanguine. Sindromul Cri du Chat este un complex de tulburri ce implic pierderi ale partii distale din braul scurt al cromozomului 5. TERT este localizata in acea regiune si se presupune ca pierderea unei copii a genei reprezinta o cauza care poate provoca aceasta maladie.
19

BIOCHIMIE FARMACEUTICA . REFERAT 2009

Diskeratoza congenitala (DC) este o boal a mduvei osoase care poate fi cauzat de o mutaie genei TERC ce afecteaza producerea telomerazei. Mutatia genei TERC are loc numai in 5% din cazurile de diskeratoza congenitala. Pacienii cu DC manifest tulburri de pigmentare a pielii ,distrofie ungheala, leucoplachie premaligna a mucoasei bucale precum i o varietate de alte simptome. Indiferent de gena mutanta, toti bolnavii au telomerii mai scurti i in vitro prezinta o activitate mai redusa a telomerazei dect alte persoane de aceeasi varsta. Telomeraz poate constitui o cauz a endometriozei. Enzima este secretat de celulele intermediare ale uterului la nceputul ciclului menstrual. In endometrioza, s-a constatat ca enzimea este stimulata atat n faza incipienta ct i la sfaritul ciclului menstrual, astfel incat celulele continua sa se divida i nu se mai constituie suportul bazal al sarcinii.

O posibila solutie - telomeroza


Telomeroza se extrage din glicina salbatica (Astragalus glycyphyllos), planta originara din Europa si este folosita de mii de ani in medicina traditionala chineza. Testele efectuate pe cobai la Institutul spaniol pentru tratarea cancerului au demonstrat ca subiectii la care le-a fost administrata telomeroza au trait cu 50% mai mult decat ar fi fost normal. Mai mult, cobaii au avut mai putine grasimi si au procesat mult mai bine zaharul. Dr. Maria Blasco este de parere ca aceasta reprezinta un veritabil ingredient minune ce poate creste durata de vietii a organismului uman ,iar un tratament anticancerigen aplicat concomitent cu extractele de glicina poate preveni dezvoltarea celulelor canceroase.

20