Sunteți pe pagina 1din 87

UNIVERSITATEA TRANSILVANIA BRAOV

FACULTATEA DE SILVICULTUR I EXPLOATRI FORESTIERE

Diversitatea genetic a grniei (Q. frainetto) din pdurea Seaca-Optani, O. S. Slatina

Absolvent: Elisa- Mariana Vlsceanu

Coordonator tiinific : Conf. dr. ing. Alexandru-Lucian Curtu 2011


1

Quercus frainetto

CUPRINS

A. PIESE SCRISE

CAPITOLUL I - Aspecte generale privind grnia (Q. frainetto) 1.1 ncadrarea sistematic ........................................................................6 1.2 Morfologie...........................................................................................6 1.3 Areal ...................................................................................................7 1.4 Cerine ecologice ................................................................................8 1.5 nsuiri biologice.................................................................................9

CAPITOLUL II - Cadrul natural al pdurii Seaca-Optani 2.1 Elementele de identificare a UP .....................................................11 2.2 Condiii geologice ..........................................................................13 2.3 Condiii geomorfologice ...............................................................13 2.4 Condiii climatice ..........................................................................14 2.4.1Regimul termic .............................................................................14 2.4.2 Regimul pluviometric..................................................................16 2.4.3 Regimul eolian.............................................................................17 2.4.4 Caracterizarea general a climei .................................................17 2.5 Condiii hidrologice .......................................................................18 2.6 Condiii edafice ..............................................................................18 2.7 Tipuri de staiune ...........................................................................19. 2.8 Tipuri de pdure..............................................................................21 2.9 Concluzii privind condiiile staionale i de vegetaiei ...................22 3

CAPITOLUL III - Material i metod de lucru 3.1 Recoltarea probelor pentru analiz..24 3.2 Izolarea ADN-ului26 3.3 Reacia de polimerizare n lan (PCR)..36 3.4 Secvenele simple repetitive de ADN..40 3.5 Electroforeza capilar..42 3.6 Calculul indicilor diversitii genetice.46

CAPITOLUL IV - Diversitatea genetic a grniei 4.1 Date primare........54 4.2 Structura genotipic ..............................................................................67 4.3 Structura alelic ....................................................................................75 4.4 Indicii diversitii genetice ...................................................................82 4.5 Concluzii ...............................................................................................85

CAPITOLUL V - Bibliografie ...............................................................86

B. PIESE DESENATE

CAPITOLUL I
Aspecte generale privind grnia (Q. frainetto)

Diversitatea genetic a grniei (Q. frainetto)

1.1 ncadrarea sistematic


Quercus frainetto ( Q.conferta Kit., Q.hungarica Hubney)- Grni ncrengatura : Magnoliophyta Clasa : Magnoliatae Ordinul : Fagales Familia : Fagaceae Genul : Quercus Specia : Quercus frainetto (ofletea i Curtu, 2007).

1.2 Morfologie
Arbore de mrimea I,cu nlimi pn la 30-40 m,cu ritidom potrivit de gros ( mai gros dect al gorunului, dar mai subire dect la stejar), cenuiu-negricios, brzdat longitudinal, caracteristic solzos,moale,friabil. Tulpina este bine conformat,iar coroana este larg i relativ deas. Lujerii sunt viguroi,mslinii, tomentoi, cu peri simpli bruni sau brun-glbui i peri fasciculai, cenuii, nclcii,spre toamn, de regul, glabresceni, cu numeroase lenticele mari.

Fig.1.1 Ritidom de grni

Fig. 1.2 Frunz i ghind

Diversitatea genetic a grniei (Q .frainetto)

Mugurii sunt mari,de pn la 1,8 cm lungime,ovoizi, acui, bruni-glbui,cei terminali nconjurai de cteva stipele persistente, relativ scurte. Frunzele relativ mari, de 10-18 cm lungime i 6-12 cm lime, ngrmdite spre vrful lujerului, lat-eliptice pn la obovat-eliptice, la baz auriculate i sesile sau scurt peiolate, cu 8-9(10) perechi de lobi,penat-fidate, lobii sunt dispui simetric,aproape pateni, desprii adesea prin sinuri foarte nguste i adnci. Pe dos, la nceput sunt catifelat-cenuiu-proase, cu peri bruni, spre toamn adesea glabrescente. Ghindele sesile sau foarte scurt pendunculate , cte 2-8 la un loc, ovoidal-elipsoidale, de pn la 2,5 cm lungime, la vrf trunchiate sau obtuze. Cupa este lat-conic, de circa 612 mm nlime, cu solzi liniar lanceolai,laci,dezlipii de peretele cupei, bruni-glbuitomentoi. ( ofletea i Curtu, 2008 )

1.3 Areal
Grnia este o specie sudic i sud-estic, cu areal mult mai restrns dect al cerului, ncepnd din sudul Italiei, continund prin Peninsula Balcanic,pn n nord-vestul Asiei Mici, n Turcia. Limita nordic a arealului su se afl n ara noastr (la circa 47 latitudine nordic). n Ungaria,grnia nu este o specie autohton, ci a fost introdus formnd cteva arborete de mic ntindere. Apare insular i n sudul Republicii Moldova. La noi in ar ocup circa 2% din suprafaa pduroas ,constituind arborete pure sau de amestec cu cerul,stejarul, fiind prezent ndeosebi la vest de rul Ialomia, din sivostepa Olteniei i Munteniei pn n altitudine n Banat i n regiunea dealurilor subcarpatice, la circa 450 m altiutdine. Cele mai ntinse pduri de grni din ntregul areal al speciei se afla la noi n ar, pe platforma Cotmeana, ntre rurile Vedea i Teleorman, ndeosebi n judeul Olt- pdurea Seaca, ocupat de aceast specie n proporie de 80%.

Diversitatea genetic a grniei (Q. frainetto)

1.4 Cerine ecologice


Grnia, la fel ca i cerul,este o specie euterm-mezoterm,de inuturi cu clim moderat, cu veri lungi i clduroase. Rezist mulumitor fa de gerurile mari din iarn,dar manifest sensibilitate fa de ngheuri. Totodat, este o specie semixerofit, fapt care face posibil,uneori,coborrea sa din inuturile colinare, care i sunt favorabile,pn la cmpie ,n contact cu silvostepa,n zone cu 450-500 mm precipitaii medii anuale. Uscciunea aerului constituie un factor care mulumindu-se cu cantiti reduse de ap. Grnia prefer solurile cele mai compacte,puternic ndesate pentru c dispune de o for apreciabil de extragere a apei din soluri cu textur fin, cu coeficient mare de ofilire i apa freatic situat la mare adncime. Solurile din staiunile caracteristice grniei prezint fenomene accentuate de podzolire i sunt caracterizate adeseori prin regim alternant de umiditate, primvara mbibate puternic cu apa din precipitaii, iar vara devin extrem de uscate i crap. Spre deosebire de cer,g)rnia este sensibil fa de concentraia solului n CaCO,prefernd solurile cu compoziie silicioas. Temperamentul este de lumin, dar mai heliofil dect al stejarului (heliofil-subheliofil). limiteaz rspndirea sa n inuturile n perioadela secetoase, silvostepice, are capacitatea de a-i reduce transpiraia

1.5 nsuiri biologice


Maturitatea este trzie, ca i n cazul altor specii de cvercinee, iar periodicitatea fructificatiei este de 4-6 ani. Pe lng nmulirea pe cale generativ, grnia dispune de o bun capacitate de lstrire pn la vrste naintate. n pdurea din Seaca-Optani, jud. Olt s-au evideniat cazuri de nmulire vegetativ prin drajoni. Maturaia este anual, ca la toate speciile din subgenul Lepidobalanus,iar puterea germinativ este de circa 50-70%. Creterea n tineree, dar i n general,este mai nceat dect la stejar,gorun i cer.

Diversitatea genetic a grniei (Q. frainetto)

n condiii optime,la 100 de ani, arboretele de grni produc circa 4,5 m/an/ha,iar la 120 de ani productivitatea poate ajunge la circa 6 m/an/ha. Numrul de cromozomi pentru grni este de 2n=24. Importana grniei Lemnul de grni este greu,foarte tare i rezistent, este utilizat n construcii i industria mobilei. Este mai puin apreciat pentru confecionarea butoaielor,n tmplrie, deoarece crp adeseori. Este valoros ca lemn de foc. Grnia (Quercus frainetto Ten.) este o specie de mare valoare ecologic i economico-social, capabil s pun n valoare staiunile cu solurile cele mai compacte i mai argiloase. n spaiul romnesc exist suprafee ntinse cu soluri extrem de argiloase sau soluri superficiale uscate i drenate n adncime pe versani nsorii, unde grnia este singura specie capabil s reziste i s pun n valoare foarte productiv aceste soluri Lipsa fructificaiilor abundente la aceast specie o perioada ndelungat, peste10 ani, a impus necesitatea efecturii de cercetri privind cunoaterea cauzelor caredetermin acest fenomen, n special n arboretele desemnate rezervaii de semine. naceste rezervaii s-au constatat deosebiri ntre vitalitatea i capacitatea de bioacumularea arborilor, pe de o parte i capacitatea de fructificaie i aptitudinile de regenerare natural, pe de alt parte. Scopul cercetrilor de fa a fost analiza structurii arboretelor rezervaii desemine de grni n vederea producerii de smn cu fond genetic valoros, i stabilireade msuri de gospodrire n vederea stimulrii nfloririi i meninerii fructificaiei.

CAPITOLUL II Cadrul natural al pdurii Seaca-Optani

10

Diversitatea genetic a grniei (Q. frainetto)

2.1. Elemente de identificare a unitii de producie


Pdurea Seaca-Optani se gsete n unitatea de producie V Seaca din cadrul Ocololui Silvic Slatina. Unitatea de producie Seaca este situat n partea de nord a judeului Olt , n stnga Olteului. Se ntinde pe o suprafaa de 1398 ha. Ocrotirea ei constitue o problem de interes naional i european pentru c aici se gsete cel mai reprezentativ eantion de grni. Vegetaia lemnoas mai cuprinde i alte specii de arborii : ulmul de cmp , gorunul , lemnul cinesc , cornul , etc. Vegetaia ierboas cuprinde numeroase specii : fragii de pdure , cpsuni de cmp , cucut de pdure , lptucile , sovarul , glbenele , coada mielului , dragaveiul , etc.

11

Diversitatea genetic a grniei (Q. frainetto)

Fig.2.1 Localizarea pe hart U.P V Seaca

12

Diversitatea genetic a grniei (Q. frainetto)

2.2 Condiii geologice


Teritoriul unitii de producie aparine imensului con de dejecie dintre Olt i Arge. Pe acest loc,ncepnd cu levantinul superior i pn n prima perioad a cuaternarului sa depus un strat gros de pietriuri levantine,aluviuni de argil fin, provenite din degajarea micaisturilor srace n calcar ale Munilor Fgra. Substraturile de argile, marne i nisipuri levantine sub aciunea factorilor exogeni modelatori a nregistrat modificri generate de eroziune ducnd la apariia i dezvoltarea ogaelor, ravenelor. Pe aceste depozite s-au format soluri brune de pdure mai mult sau mai puin podzolite ( luvosol ) le prezint numeroase variante n funcie de adncimea stratului de pietri i ali factori locali. Pe tot cuprinsul teritoriului se gsesc ntinse arborete de grni din care cele mai reprezentative sunt cele de la Seaca.

2.3 Condiii geomorfologice


Teritoriul unitii de producie Seaca V se ncadreaz din punct de vedere geomorfologic n Piemontul Cotmenei care este limitat la vest de terasa Oltului, la est de terasa Argeului, la sud aproximativ pe linia Slatina-Corbi(Piteti), iar spre nord, nord-est de drumul naional Piteti-Rmnicu Vlcea. Morfostructural Piemontul Cotmenei aparine de Piemontul Getic, care are drept caracteristic fragmentarea deluroas complex, fragmentarea vertical 150-300 ,vile sunt uneori strmte, alteori largi cu terase i povrniuri repezi. Vile sunt divergente pentru c unele curg spre Olt(SV), altele spre Vedea(SE). Altitudine minim este de 220 m (u.a 32 F), iar cea maxim de 330 m (u.a 72 A).

13

Diversitatea genetic a grniei (Q. frainetto)

Relieful se caracterizeaz printr-o fragmentare orizontal vertical mic, unitatea de relief predominant este platoul, care este ocupat n cea mai mare partea de grniete, mai rar de grniete cerete i de grniete gorunete. n trecut, o parte din platou a fost defriat i ocupat de sate i terenuri agricole, din aceast cauz conturul livezilor este foarte sinuos. Tipurile de soluri sunt strns legate de formele de relief, care n general se prezint astfel soluri aluviale n lunci joase; soluri brun luvice pseudogleizate i brun luvice vertice; tice pseudogleizate pe platouri i coame cu pante mici; soluri brune luvice tipice pe versanii mijlocii i inferiori cu pante 10-30.

2.4 Condiii climatice 2.4.1 Regimul termic


Regimul termic este caracterizat prin temperaturi medii lunare i anuale, valori maxime i minime,temperaturi medii pentru perioada bioactiv i cea de vegetaie,dar i datele privind primul i ultimul nghe prezente n tabelul urmtor:

Tabelul 2.1 Temperatura aerului Temperatura medie, lunar Luna I t (oC) n tabelul 2.2 sunt prezentate date referitoare la primul, respectiv ultimul nghe , primul nghe are loc n perioada 20-25 octombrie, iar ultimul nghe apare n luna mai ( 5-10 mai ). II III IV V VI VII 22,1 VIII IX X XI
Valoare

XII anual 0,0 10,6

-2,4 -0,5 4,3

10,9 16,1 19,8

21,7 17,1 11,7 5,1

14

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 2.2 Datele medii i extreme ale primului i ultimului nghe PRIMUL NGHE Data medie 25.X Date extreme Cel timpuriu 8.IX mai Cel trziu 1.XII 6.IV ULTIMUL NGHE Data Date extreme mai Cel trziu 22.V mai timpuriu 3.III mai medie Cel

Numrul de zile cu temperaturi mai mici de 0C este de 120, iar numrul mediu al zilelor cu temperaturi peste 10C este de 199, timp nghe n intervalul 5-10 mai. Aceste date caracterizeaz din punct de vedere termic zona i sunt folosite la stabilirea soluiilor,att n ceea ce privete ntemeierea noilor arborete, ct i gospodrirea pdurilor din cadrul unitii de producie. Iarna,aerul rece, de origine polar, se deplaseaz din Rusia sau din Peninsula Scandinavic spre Peninsula Balcanic, astfel nct temperatura scade pn la -30C. Vara,aerul cald, de origine tropical,vine din nordul Africii i produce o cretere accentuat a temperaturii pn la 41,5C, avnd o influen negativ asupra arboretelor tinere, care pot fii calamitate , dar i asupra arboretelor mature, provocnd uscarea acestora. valorile medii lunare ale temperaturii aerului are un maxim de 22,1C n luna iulie i un minim de -2,7C n luna ianuarie; prezint un climat cu caracter continental moderat; media temperaturilor anuale 10,6C,bilanul termic relativ ridicat; suficient pentru lignificarea puieilor. Prima zi de nghe se situeaz n intervalul 20-25 octombrie, iar ultima zi cu

15

Diversitatea genetic a grniei (Q. frainetto)

2.4.2 Regimul pluviometric


Regimul pluviometric este caracterizat prin precipitaii atmosferice(mm), medii lunare i anuale, cantiti maxime n 24 ore,ploi toreniale i abundente, evapotranspiraie: Precipitaii atmosferice medii lunare i anuale

Tabelul 2.3

VALORI LUNARE

VALOARE

Luna P (mm)

II

III

IV

VI

VII

VIII IX

XI

XII

ANUAL

35,5 28,2 30,5 46,6 74,4 82,6 50,7 47,2 41,3 51,5 46,3 37,9 578,8

Cantitatea medie anual de precipitaii 578,8 mm nu este uniform n decursul anului,variind de la o lun la alta i de la un an la altul. Cea mai mare cantitate de precipitaii se nregistreaz n jumtatea cald a anului, cu un maxim n luna iulie 68,1 mm. Anotimpul rece , lipsit de precipitaii, are un minim n luna martie de 27,6 mm.

Tabelul 2.4

Evapotranspiraia potenial

VALORI LUNARE

Luna ETP(mm)

II

III 17

IV 52

V 95

VI 125

VII 146

VIII 127

IX 85

X 46

XI 14

XII 0

VALOARE ANUAL

0 0

707

16

Diversitatea genetic a grniei (Q. frainetto)

Regimul precipitaiilor atmosferice i cel al evapotranspiraiei i raporturile dintre acestea au o mare influen asupra vegetaiei forestiere. Deficitul de ap din sol se nregistreaz n timpul sezonului de vegetaie,um maxim se nregistreaz n lunile iulie-augustseptembrie. n ultimii ani secetele prelungite au o influen nefavorabil asupra vegetaiei forestiere. Umiditatea relativ a aerului are o valoare maxim n luna decembrie 86% i o minim n luna august 59%.

2.4.3 Regimul eolian


n unitatea de producie V Seaca sunt predominante vnturile ce bat din partea de est i cele care bat din partea de vest. Vnturile ce bat cu viteze moderate au o influen favorabil asupra vegetaiei forestiere. Vnturile ce bat din est au o frecven mai mare pe timp de iarn, frecvena medie anual este de 24,6%, iar vnturile care bat din partea de vest au o frecven mai mare vara i primvara, frecvena medie anual este de 18,7%. Frecvena medie anual a zilelor de calm atmospheric este de 26,3%. Viteza medie anual a vnturilor variaz de la 1,2 m/s la cele care bat dinspre sud pnla 4,2 m/s la cele care bat dinspre vest. Numrul zilelor n care vnturile bat cu viteze de peste 11 m/s este de 66,7 zile, iar al celor cu viteze peste 16 m/s este de 13,8 zile. Principalele vnturi care bat pe teritoriul U.P. V Seaca sunt: viscolul(iarna) i austrul (primvara).

2.4.4 Caracterizarea general a climei


Indicele de ariditate de Martonne:
P T + 10 12 p t + 10

Ia =

il =

17

Diversitatea genetic a grniei (Q. frainetto)

P, p = precipitaii medii anuale i lunare; T, t = temperaturi medii anuale i lunare Indicele de ariditate de Martonne
VALOARE ANUAL

Tab.2.5 Luna

VALORI LUNARE

II 3,0

III 1,9

IV 1,8

V 2,3

VI 2,9

VII 1,7

VIII IX 1,2 1,4

X 2,0

XI 2,8

XII 4,0

Indicele 4,9

25,0

Indicele de ariditate anual are valoarea de 25,0 i indic faptul c zona luat n studiu prezint un climat favorabil pdurilor.

2.5 Condiii hidrologice


Pdurea Seaca se gsete amplasat pe interfluviul dintre vile Plopcea Mare i Plopcea Mic, fac parte din bazinul mijlociu Cotmeana-Vedea. Bazinul hidrografic Cotmeana-Vedea este alctuit n cursul lui superior din vi adnci. Att Cotmeana, ct i Vedea au vi asimetrice,versantul drept este evident mai nalt,fr terase pe cnd cel stng este mai prelung de 2-3 terase. Rul Vlcea are n cursul superior ca afluent prul Plopcea, iar n cursul inferior se gsesc o serie de vi: valea Tecuciului,valea Burdei,valea Tinoasa i valea Cinelui care alctuiesc afluenii de stnga a rului Vedea. Apele freatice ale teritoriului se afl la adncimi mari mari 25-30 m. Numele localitii i a pdurii exprim lipsa de ap.(Seaca) Regimul hidrologic al cursurilor de ap este caracterizat printr-un mediu sczut. Vara toate vile, chiar i Vedea sunt lipsite de ap o perioad de 2-3 luni, iar primvara exist pericolul viiturilor.

2.6 Condiii edafice


Vegetaia forestier are o importan deosebit pentru specificul ecologic i potenialul productiv al staiunilor i pentru formarea diverselor tipuri de soluri.

18

Diversitatea genetic a grniei (Q. frainetto)

Tipul de sol prezent n aceast unitate de producie este luvosolul. Brun luvic tipic are urmtorul profil: A-El-Bt-C, format pe gresii fine silicioase sau alternante cu luturi, pe versanii slab nclinaii este puternic acid la acid cu pH=4,6-5,8, are valori mai mici n orizontul podzolit El, are o grosime de 3-10 cm,cu un grad de saturaie n baze N=36-85% cu valorile cele mai mici n orizontul debazificat El, foarte slab la foarte bine aprovizionat cu azot total pe ntregul profil. Bonitatea acestui sol este determinat de compactitatea orizontului Bt care limiteaz ptrunderea rdcinilor i de volumul edafic mijlociu. Brun luvic-pseudogleizat are urmtorul profil: Ao-El-Btw-C, puternic la moderat acid cu pH=4,3-6,0.,coninut de humus de 3,3% n orizontul Ao. Factorii limitativi care apar n cadrul acestui sol sunt: troficitatea moderat, regimul de umiditate alternant i compactitatea ridicat datorit coninutului mare de argil n orizontul Bt. Brun luvic vertic-pseudogleizat cu profilul: Ao-El-Btzw-Cw are cea mai mare pondere n unitatea de producie (70%), format pe lcuri aezate, de regul pe platouri, cu luturi grele, pH=4,6-5,6 slab humifer. Factorii limitativi ai acestui sol sunt: compactitatea ridicat i drenajul defectuos ce conduce la variaii de umiditate n sezonul de vegetaie. Aluvic tipic Ao-C, ocup o suprafa foarte mic de 13,7 ha, adic 1% din suprafaa U.P., Ph=5,5-7,9, slab humifer cu un coninut de humus de 2,3-5,3%, uneori slab aprovizionat cu fosfor mobil, foarte bine aprovizionat cu potasiu mobil.

2.7 Tipuri de staiuni


Pe teritoriul unitii de producie V Seaca cele mai rspndite tipuri de staiuni fac parte din etajul FD1 staiuni de cvercete cu stejar (cu cer,grni,gorun i amestecuri ale acestora). n pdurea Seaca se gsete un singur tip de staiune, i anume:

deluros de cvercete cu stejar Pm, podzolit cu Poa PratensisCarex Cayaphyllea.

19

Diversitatea genetic a grniei (Q. frainetto)

2.8 Tipuri de pdure


n pdurea Seaca tipul de pdure este:

grniet de platou de productivitate superioar (s), care ocup o


suprafa 1382,4 ha; Cele mai importante i cele mai rspndite formaii forestiere din U.P V Seaca sunt grnietele pure (96%), urmate de gorunetele pure (3%) i stejerete pure de stejar (1%). Speciile de baz existente n uniitatea de producie sunt GO,G,CE, aacestea sunt corespunztoare zonei fitoclimatice i sunt folosite la crearea de arborete valoroase , rezistente la aciunea factorilor destabilizatori.

2.9 Concluzii privind condiiile staionale i de vegetaie


Din cele prezentate la subcapitolele anterioare se desprinde concluzia c factorii staionali favorizeaz biocenozele forestiere locale care au n componen grnia. Prin compararea datelor privind condiiile staionale i de vegetaie cu cele prezentate n fia ecologic a speciei se pot desprinde urmtoarele concluzii: o temperatura medie anual i precipitaiile medii anuale sunt optime pentru grni; o lungimea perioadei bioactive se situeaz n zona de suboptim ecologic; o altitudinea la care se gsete populaia studiat are valori optime pn la 300 m, o zon situat pn la 350 m se afl n zona de suboptim; o luvosolul-caracteristicile sale aflate n zona de optim ecologic este de bonitate superioar pentru grni.

20

CAPITOLUL III Material i metod de lucru

21

Diversitatea genetic a grniei (Q. frainetto)

3.1 Recoltarea probelor pentru analiz


Pentru a studia diversitatea genetic a populaiei de grni a fost necesar s se recolteze lujeri cu muguri din fiecare arbore luat n studiu. n populaia de grni din Seaca-Optani exemplarele s-a ales la o distan de cel puin 30-50 m unul fa de altul, n vederea reducerii probabilitii ca dou sau mai multe exemplare s provin din regenerarea din smn de la acelai exemplar mam. n total s-au eantionat 53 de exemplare, din cadrul U.P V Seaca cu o suprafa de 1398 ha. Probele s-au recoltat cu ajutorul une foarfeci, cte 2-3 lujeri cu muguri din fiecare arbore luat n studiu. n teren, fiecare exemplar luat n studiu a fost numerotat cu cifre arabe de la 1 pn la 53 (figura 3.1). Pozele au fost fcute cu ajutorul programului Google Earth n care s-a importat un fiier de tip KMZ care conine coordonatele geografice ale populaiei studiate, coordonate care au fost preluate cu ajutorul unui aparat GPS.

22

Diversitatea genetic a grniei (Q. frainetto)

Fig 3.1 Imaginea satelitar cu arborii eantionai n pdurea Seaca-Optani

23

Diversitatea genetic a grniei (Q. frainetto)

3.2 Izolarea ADN-ului


Izolarea ADN-ului necesit pregtirea probelor i parcurgerea urmtoarelor etape: s-a secionat longitudinal fiecare mugure;

Fig 3.2 Secionarea mugurilor s-a recoltat material necesar analizei din trimea superioar a mugurelui (

aproximativ 50 mg pentru fiecare arbore); materialul prelevat s-a inut n ghea pentru a evita degradarea ADN-ului pn la izolarea acestuia; pentru a se efectua aceste operaii s-a folosit bisturiul i penseta care se cur dup prelevarea materialului de la fiecare arbore pentru a evita contaminarea probelor; Izolarea propiu-zis a ADN-ului terbuie s respecte un protocol de lucru specific (Qiagen DNeasy96 Plant Kit) care const n parcurgerea urmtorilor pai: 1. Materialul recoltat din muguri sau frunze ntr-o cantitate de aproximativ 50 mg, se introduce n dou plci (racks) , fiecare a cte 96 tuburi (collection microtube) ; 2. Se adaug cte o bil de wolfram n fiecare tub din cele dou plci ; 3. Se combin Buffer AP1 , Rnase A , Reagent DX potrivit tabelului urmator (tabelul 3.1) pentru a crea o soluie adecvat . Se adaug cu pipeta 400 l din aceast soluie n fiecare tub , apoi se acoper tuburile cu capacele furnizate;

24

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 3.1 Volum de reactivi pe prob extras Volum/proba Buffer AP1 RNase A (100 mg/ml ) Reagent DX 400 l 1 l 1 l Volum/2x96 probe 90 ml 225 l 225 l

4. Se aeaz fiecare plac cu tuburi ntre dispozitivele de prindere ale morii cu bile (TissueLyser) ; 5. Se macin probele timp de 1.5 minute la frecvena de 30 Hz (figura 3.3); Important : Prelungirea timpului de macinare conduce la dezagregarea ADN-ului.

Figura 3.3 Moara cu bile TissueLyser 6. Se scot plcile din dispozitivele de prindere ale morii i se reaeaz intr-o nou poziie opus primei poziii;

25

Diversitatea genetic a grniei (Q. frainetto)

Important : Simpla rotaie a plcilor n dispozitivele de prindere nu este suficienta deoarece aceleai probe care au fost periferice morii in faza iniial vor rmne periferice si n a doua faz. 7. Se macin probele pentru alte 1.5 minute la 30 Hz; 8. Se scot plcile din moara cu bile . Pentru a nu rmne soluie pe capacele tuburilor , acestea se vor centrifuga pna cnd centrifuga va atinge turaia de 3000 rpm; 9. Se scot i se arunc capacele tuburilor dup care se adaug 130 l Buffer AP2 n fiecare tub; 10. Se acoper cu grij tuburile cu capace noi ; se asigur c tuburile sunt acoperite

corespunztor pentru a evita scurgerea soluiei i n continuare se vor agita viguros timp de 15 s . n continuare plcile se vor centrifuga pn la 3000 rpm pentru a se colecta soluia rmas pe capace . Not : Centrifugarea are rolul de a preveni nghearea soluiei de pe capace ceea ce ar conduce la o ngreunare a ndeprtrii acestora dup incubarea probelor la -20C . 11. Plcile se vor incuba timp de 10 minute la -20C ; 12. Se centrifugheaz plcile timp de 5 minute la 6000 rpm; Se vor sedimenta granule compacte, dar unele particule pot s pluteasc i se va acorda atenie pentru ca acestea s nu se transfere n paii urmtori . 13. Se scot i se arunc capacele; Se transfer cu grij 400 orientare corect a acestora. Bilele de wolfram din fiecare tub se vor recupera i refolosi . Nu se transfer mai mult de 400 l de supernatant deoarece capacitatea plcilor DNeasy 96 i S-Blocks , folosite in paii urmtori va fi depit. Dac se va extrage mai puin de 400 l supernatant , se va ajusta cantitatea de Buffer AP3/E din urmatotul pas in mod corespunztor . l de supernatant n plci cu tuburi, asigurndu-se o

26

Diversitatea genetic a grniei (Q. frainetto)

Fig 3.4 Extragerea supernatantului 14. Se adaug 600 l Buffer AP3/E in fiecare prob. Not: Se verific dac etanolul a fost adugat n Buffer AP3/E; 15. Tuburile se acoper cu capace noi i se agit viguros 15 secunde manual dup care se centrifugheaz pn la 3000 rpm ; 16. Se aeaza dou plci Dneasy 96 (figura 3.5) deasupra plcilor S-Blocks . Plcile Dneasy 96 se marcheaz pentru ca probele s se poat identifica mai trziu.

Fig 3.5 Placa cu membran Dneasy 96

27

Diversitatea genetic a grniei (Q. frainetto)

17. Se scot i se arunc capacele de pe colecia de microtuburi dup care se transfer cu atenie 1 ml din fiecare prob n fiecare orificiu al plcilor Dneasy 96 (figura3.6).

Fig 3.6 ncrcarea plcilor Dneasy 96 18. Se acoper fiecare plac Dneasy 96 cu band adeziv (AirPore Tape Sheet ) Se centrifugheaz 4 minute la 6000 rpm; Banda adeziv cu pori previne contaminarea reciproc a probelor n timpul centrifugrii . Dup centrifugare se verific dac toat soluia a trecut prin membranele plcilor Dneasy 96 . Dac nu a trecut toat soluia se mai centrifugheaz nca 4 minute. Dup centifugare se arunc solutia din plcile S-Blocks ; 19. Se ndeprteaz banda adeziv i se adaug cu grij 800 l Buffer AW n fiecare prob. Not : Se verific dac a fost adugat etanol la Buffer AW nainte de utilizare 20. Se centrifugheaz timp de 15 minute la 6000 rpm pentru a usca membranele Dneasy (figura 3.7). Pentru o uscare eficient , plcile Dneasy 96 nu se acoper cu banda adeziv. Important : Etanolul rezidual din membranele Dneasy derivat din Buffer AW poate inhiba PCR-ul si trebuie ndeprtat prin centrifugare naintea eluiei ADN-ului.
Diversitatea genetic a grniei (Q. frainetto)

28

Fig 3.7 Centrifugarea probelor 21. Pentru eluia ADN-ului se aeaz plcile Dneasy n poziia corect pe noile plci Elution Microtubes RS (figura 3.8), se adaug 100 l Buffer AE n fiecare prob i se acoper plcile cu band adeziv. Dup un minut probele se centrifugheaz timp de 2 minute la 6000 rpm. 22. Plcile Elution Microtubes RS (figura 3.9) se vor acoperi cu capacele furnizate i se vor pstra la -20C pn n momentul n care se vor efectua experimentele.

Fig 3.8 Placa Elution Microtubes RS

29

Diversitatea genetic a grniei (Q. frainetto)

Testarea ADN-ului Dup ce s-a ncheiat izolarea ADN-ului se dorete o testare a probelor pentru a se vedea dac toate au fost izolate n mod corespunztor. Testarea se realizeaz prin parcurgerea urmtorilor pai: Colorarea soluiei de ADN Pregtirea gelului de agaroz ncrcarea gelului cu soluia de ADN Punerea n funciune a electroforezei orizontale Colorarea gelului de agaroz Transferarea gelului n spectrul ultra-violet Interpretarea rezultatelor

1) Colorarea soluiei de ADN cu ajutorul unei pipete dispencer se ncarc ntr-o plac 2 l de colorant (DYE) peste care cu ajutorul unei pipete multicanal se ncarc 4 l din soluia obinut n urma izolrii ADN-ului (figura 3.9).

Fig 3.9 Transferul cu ajutorul pipetei multicanal 2) Pregtirea gelului de agaroz ntr-un vas Erlenmayer se toarn 100 ml ap bidistilat (TAE 1%) peste care se adaug 1,5g de agaroz (s-a cntrit pe o

30

Diversitatea genetic a grniei (Q. frainetto )

balan electronic cu o precizie de 10-3g). Dup agitare i realizarea omogenizrii (figura 3.10), soluia se fierbe i dup rcirea parial a acesteia se toarn ntr-o tav pregtit cu doi piepteni. Dup ce s-a ntrit gelul, marginile metalice ale tvii se ndeprteaz iar tava mpreun cu gelul este introdus n baia electroforezei orizontale (figura 3.11) unde urmeaz ndeprtarea pieptenilor, formndu-se 2 rnduri a cte 30 de locauri pentru testare.

Figura 3.10 Omogenizarea gelului

Fig. 3.11 Introducerea gelului n unitatea de electroforez orizontal

3) ncrcarea gelului cu soluia de ADN se realizeaz cu ajutorul unei pipete care transfer soluia de ADN colorat, pregtit anterior, spre locaurile gelului de agaroz care se afl submersate n ap bidistilat. 4) Punerea n funciune a electroforezei orizontale unitatea de electroforez se conecteaz la sursa de curent electric prin intermediul unor fire, dup care urmeaz setarea voltajului i a duratei de funcionare (figura 3.12). n mod uzual s-a folosit un voltaj de 100V timp de 30-45 de minute. Electroforeza este o metod analitic i preparativ de separare a particulelor sau ansamblurilor de particule ncrcate electric, sub aciunea unui cmp electric uniform aplicat din exterior. Metoda are la baz fenomenul fizico-chimic de deplasare sau migrare difereniat a diferitelor specii de particule ntr-un cmp electric; deplasarea se face de la

31

Diversitatea genetic a grniei (Q. frainetto)

electrodul catod (-) la anod (+), iar ntre electrozi i elementele de separat nu au loc reacii.

Fig 3.12 Electroforeza orizontal 5) Colorarea gelului de agaroz dup ce s-a ncheiat migrarea sub aciunea curentului electric, gelul de agaroz se transfer ntr-o tav n care se afl o soluie de gel red. Se folosete un leagn electronic(figura 3.13) pentru o mai bun colorare a gelului de agaroz.

Fig 3.13 Colorarea gelului de agaroz 6) Transferarea gelului n spectrul ultra-violet dup colorarea gelului timp de 2030 de minute urmeaz transferul acestuia spre un transiluminator cu ultraviolete (UVP) cu ajutorul cruia se pot observa probele care conin ADN (figura 3.14).

32

Diversitatea genetic a grniei (Q. frainetto)

Fig 3.14 Transiluminatorul UVP 7) Interpretarea rezultatelor - n imaginea urmtoare se poate observa c n toate probele s-a gsit ADN (figura 3.15).

Fig 3.15 Vizualizarea probelor cu AND

33

Diversitatea genetic a grniei (Q. frainetto)

3.3 Reacia de polimerizare n lan


Reacia de polimerizare n lan (engl. Polymerase Chain Reaction, presc. PCR) este o metod folosit n biologia molecular, bazele acesteia au fost puse de Kary Mullis in anii 80, primind premiul Nobel pentru medicin. Reacia de polimerizare n lan are ca scop identificarea i amplificarea unei regiuni int de ADN, putnd fi o gen sau un segment ADN anonim din ADN-ul cloroplastic, mitocondrial sau nuclear. Aceast reacie se parcurge tampon din: ADN izolat de la individul respectiv (engl. template DNA) printr-un procedeu special; o enzim de tip ADN polimeraza care rezist la temperaturi ridicate, denumit i Taq pentru c a fost extras iniial dintr-o bacterie care triete n apele termale Thermus aquaticus; cele patru tipuri de nucleotide din ADN dar trifosforilate (dATP, dGTP, dCTP i dTTP); doi primeri (amorse) polinucleotide scurte monocatenare, obinute sintetic, cu rolul de a fi folosite de ADN-polimeraza Taq pentru iniierea replicaiei. Reacia de polimerizare n lan este precedat de diluia ADN-ului care const n adugarea unei anumite cantiti de ap (H2O) peste soluia obinut cu ajutorul kitului Qiagen DNeasy96. Realizarea amestecului (mix-ului) presupune combinarea urmtoarelor substane ntr-un tub cu un volum cunoscut (tabelul 3.1): Tabelul 3.1 Protocolul folosit n cadrul reaciei de polimerizare n lan Substana Master Mix Primer A(+) Primer B (-) H2O Volum pentru 1 prob, l 7,5 1,5 1,5 2,5 Volum pentru 9 probe, l 67,5 13,5 13,5 22,5 prin realizarea unui amestec ntr-o soluie

34

Diversitatea genetic a grniei (Q. frainetto)

n continuare se adaug cte 5 pmoli pentru cei doi primeri A(+), prevzut cu infrared i primerul B(-), de regul se calculeaz o prob n plus deoarece se pot face greeli de pipetare. Apoi se pregtesc tuburile specifice reaciei de polimerizare i fiecare prob este numerotat pentru a fi identificat. n fiecare tub se vor pipeta 13 l din mix-ul pregtit anterior, apoi 2 l din soluia rezultat n urma diluiei ADN. Reacia se efectueaz ntr-o main special numit thermocycler care are rolul s ridice i s scad temperatura din tuburi dup un program setat iniial. Mainile care au rulat reacia de polimerizare n lan sunt:

Fig 3.1 Eppendorf Master Cycler

Fig 3.2 Palm-Cycler

Aceste aparate au rulat programul ZAG9 dup urmtori pai: 1 - denaturarea iniial a ADN-ului la temperatura de 94C timp de 3 minute; 2 - denaturarea ADN-ului prin ruperea punilor de hidrogen dintre cele dou catene complementare ale ADN-ului la temperatura de 94C timp de 50 de secunde; 3 - legarea primerilor (engl. annealing) pe cele dou catene antisens la capetele zonei de amplificat; acest pas se mai numete i hibridare i are loc la temperatura de 56C timp de 50 de secunde; 4 - sintetizarea sau elongarea noilor catene, proces ce are loc la temperatura de 72C timp de 1 minut; 5 - repetarea pailor 2, 3, 4 de nc 31 de ori (rezult 32 de cicluri) cu scopul de a obine un numr foarte mare de copii ale fragmentului int, de ordinul zecilor i sutelor de milioane; 35

Diversitatea genetic a grniei (Q. frainetto)

6 - completarea catenelor la temperatura de 72C timp de 10 minute; 7 - meninerea probelor la o temperatur constant de 8C pn n momentul scoaterii lor din aparat de ctre operator .

Figura 3.3 Principiul reaciei de polimerizare n lan Principiul reaciei de polimerizare n lan urmrete: denaturarea; legea primerilor; sinteza noilor catene.

36

Diversitatea genetic a grniei (Q. frainetto)

1) Denaturarea moleculei de ADN- matria ADN este o macromolecul polimeric alctuit din 2 catene complementare, antiparalele, astfel nct la o temperatur de 94C cele 2 catene se separ avnd loc denaturarea.

Fig 3.4 Denaturarea ADN-ului Copiile secvenelor iniiale de ADN pot fi vizualizate cu ajutorul electri\oforezei orizontale, astfel nct fragmentele de mrimi specifice vor migra difereniat pe suportul de gel, spre anod, la anumite distane fa de punctul de plecare, rezultnd benzi electroforetice. Benzile pot fi evideniate prin colorare, n unele proceduri de lucru se folosete i metoda de evideniere a ADN prin autoradiografiere sau prin electroforez capilar cu ajutorul unui analizor genetic care determin lungimea fragmentelor prin intermediul laserului. Testarea produselor PCR se face combinnd 4 l produse PCR cu 2 l de DYE (vopsea-ne ajut s vedem dac migreaz n cmpul electroforezei orizontale.

37

Diversitatea genetic a grniei (Q. frainetto)

nainte de electroforez s-a turnat un gel de agaroz cu concentraia de 2% ( n 2 g de agarozla 100 ml soluie TAE).

Fig 3.5 Testarea produselor PCR prin electroforez orizontal n figura 3.5 o parte din probele testate nu au funcionat pentru c nu apar cele dou benzi specifice. Pentru probele care nu au trecut acest test se va face o nou reacie de polimerizare n lan.

3.4 Secvenele simple repetitive de ADN


Marker-ul genetic (engl. genetic marker) este un caracter calitativ care ofer informaii despre gena care controleaz expresia acelui caracter. Markeri sunt considerai instrumente utile i sunt folosii la estimarea nivelului de variaie genetic n populaiile de arbori. Markerii genetici sunt secvene simple repetitive folosii n genetic n studiul ereditii i studiul populaiilor. Acest tip de marker genetic face parte din familia markerilor moleculari sau ADN care se folosesc n prezent la investigarea atent i profund a genomului organismelor, inclusiv cel al arborilor.

38

Diversitatea genetic a grniei (Q. frainetto)

Secvenele simple repetitive sau microsateliii (engl. SSRs - simple sequence repeats sau microsatellites) sunt regiuni din ADN cu repetri a unor secvene scurte de 1 pn la 6 baze. Aceste secvene se repet de un anumit numr de ori : de la 3-4 pn la peste 200. Microsateliii sunt nite markeri hipervariabili avnd adesea peste 20 de alele (variante) la un singur locus. Un alt avantaj al microsateliilor este c sunt nite markeri codominani (heterozigoii sunt direct observabili). Se gsesc att n nucleu ct i n organite (cloroplaste i mitocondrii). Detectarea microsateliilor se face prin proiectarea primerilor PCR care sunt unici pentru un locus din genom i pentru perechea de baz din ambele pri ale regiunii repetate - figura 3.6. Singur pereche de primeri PCR va funciona pentru fiecare individ i va realiza produse de mrimi diferite pentru fiecare dintre microsateliii de lungimi diferite.

Fig 3.6. Detectarea secvenelor simple repetitive din ADN (

Primerii PCR( notai cu sgeat gri) sunt destinai s mrgineasc regiunea cu


microsatelii.

La cvercinee (Quercus spp.), un gen de plante lemnoase rspndit n emisfera nordic, markerii de tipul microsateliilor ofer o unealt puternic pentru estimarea cantitii intraspecifice i interspecifice ale fluxului de gene (Down i Ashley,1998) i privind structura genetic din interiorul populaiilor (Streiff et al., 1998).

39

Diversitatea genetic a grniei (Q. frainetto)

Microsateliii sunt de obicei localizai n regiuni foarte repetitive acetia sunt subiectul unei rate mari a mutaiei, o atenie special trebuie acordat variaiei secvenelor din regiunile de margine ale microsateliilor n amplificarea dintre specii. n cadrul acestui proiect s-a lucrat cu 7 microsatelii numii ZAG112, ZAG110, ZAG96, ZAG11, ZAG39, o gen care a fost descoperit pentru prima oar n Austria la gorun (Quercus petraea), fiind cunoscut n literatura de specialitate sub urmtoarea form: ssrQpZAG9. Secvena repetitiv este AG (adenin - guanin) care se repet de 12 ori. Cei doi primeri sunt urmtorii: o primerul nainte : gcaattacaggctaggctgg; o primerul napoi : gtctggacctagccctcatg.

3.5 Electroforeza capilar


Electroforeza capilar este o tehnic mai nou care combin mecanismele de separare ale electroforezei cu aparatura si automatizarea cromatografiei. Electroforeza este o metod puternic care a fost pus la punct naintea apariiei biologiei moleculare. Exist numeroase variante de electroforez capilar care soluioneaz diversele probleme de separare. Acestea includ electroforeza zonal, electroforeza pe gel, focalizare izoelectric si izotacoforeza. Puterea extraordinar de separare, viteza analizelor si sensibilitatea extrem (o singura molecul prin detectarea cu fluorescena indus cu laser) conduc la aplicarea intensiv a electroforezei capilare de ctre multe dintre cele mai bune laboratoare de cercetare analitic din lume. Principiul pe care se bazeaz electroforeza este acela c moleculele ncrcate vor migra spre polul opus i se vor separa unele de altele datorit caracteristicilor fizice. Electroforeza are doi factori limitativi: detectarea moleculelor dup completarea separrii electroforetice; se putea folosi doar un voltaj sczut pentru a preveni daunele probelor provocate de cldur.

40

Diversitatea genetic a grniei (Q. frainetto)

Tuburile capilare au o suprafa ntins raportat la volum, aceasta radiaz uor cldura i astfel probele nu se supranclzelzesc. Detectarea moleculelor migrate se realizeaz cu ajutorul unei surse de lumin care ilumineaz o poriune a tuburilor i detecteaz lumina emis din partea opus (figura 3.7) .

Figura 3.7 Schema unui sistem de electroforez capilar Probele intr n tub prin partea dreapt i migreaz spre stnga unde se gsete sistemul de detectare care nregistreaz cromatograma, transmitnd-o apoi spre un computer.Timpul de

rulare al probelor este foarte scurt datorit voltajului nalt (10 - 30 kV). Probele sunt furnizate tuburilor capilare atunci cnd soluia tampon (buffer) de la catod este ndeprtat i orificiile n care se gsesc probele sunt aranjate n dreptul tuburilor capilare. Se aplic probelor fie o presiune i se injecteaz 10 - 100 nL , fie se aplic un curent electric i doar moleculele ncrcate intr n capilare. Sistemul de electroforez capilar folosit n cadrul acestui proiect este secveniatorul Beckman Coulter cu 8 capilare.

41

Diversitatea genetic a grniei (Q. frainetto)

Figura 3.8 Secveniator cu 8 capilare 1. Efectuarea diluiei produselor PCR - n urma testrii produselor PCR s-a ajuns la concluzia c unele probe au o concentraie mai mare dect altele i astfel trebuie efectuat o diluie difereniat. Pentru probele concentrate s-a ales ca diluia s fie de 1:15, n timp ce pentru probele cu o concentraie mai redus s-a efectuat o diluie de 1:3. 2. Pregtirea probelor - aceast operaie se va efectua respectnd urmtoarele volume (tabelul 3.2): Tabelul 3.2 Volumul de reactivi Componente SLS Standardul SZ400 Microsatelit Probe Volum total 1 Prob 37,56 0,44 2 1 40,0 L L L L 8 Probe 1164,36 L 13,64 L 62 8 1240 L L

42

Diversitatea genetic a grniei (Q. frainetto)

Pentru a rula 8 probe se vor amesteca ntr-un tub 1164,36 l din SLS i 13,64 l Standard. n placa de secveniator se pipeteaz n fiecare orificiu 2 L din soluia PCR diluat, apoi se adaug 38 l din amestecul din SLS+Standard. Pentru ca probele s nu se evaporeze datorit temperaturilor nalte, n fiecare orificiu se va aduga o pictur de ulei mineral. 3. Pregtirea secveniatorului - const n echiparea acestuia cu cele 8 capilare i cu un gel de poliacrilamid. ntr-o plac se va aduga buffer necesar pentru splarea capilarelor. n continuare se va aduga i placa cu probele pregtite, se va nchide capacul i va urma setarea din software-ul aparatului. Separarea probelor n aparat Metodele de separare FRAG-1 i FRAG-3 sunt corespunztoare pentru folosire cu mrimea scrii standard 400. Metodele de separare FRAG-2 i FRAG-4 sunt optime pentru folosire cu mrimea scrii standard 600. Dac separarea are loc cu mrimea standard 400 atunci parametrii fragmentelor de analiz sunt corespunztori pentru demarare. Dac mrimea standard 600 este folosit atunci parametrii de analiz corespunztori vor trebui modificai pentru folosirea setului de mrime standard 600 i a modelului Quartic.Metoda de separare folosit a fost FRAG3 pentru Standardul 400 care const n efectuarea urmtoarelor operaii succesive: Denaturarea la temperatura de 90C, timp de120 secunde; Dup ce separarea electroforetic este complet, coninutul capilarelor este aruncat i un nou matrix va umple tuburile. Operaia de nlocuire a matrix-ului din capilare minimizeaz posibilitatea de contaminare a probelor ntre rulri. n cadrul proiectului electroforeza capilar s-a folosit pentru determinarea mrimii produselor obinute n urma Reaciei de Polimerizare n Lan (PCR). n figura urmtoare se ofer o imagine stilizat a unei secvenieri pentru patru probe : Separarea la un voltaj de 6000V, timp de 60 de minute

43

Diversitatea genetic a grniei (Q. frainetto)

Figura 3.9 Exemplu stilizat de electroforez capilar. Aceste benzi formeaz nite vrfuri (engl. peaks) principale dar se poate observa c exist i alte vrfuri mai mici cu 2 nucleotide care poart denumirea de stutter peaks. Pentru un individ heterozigot exist dou vrfuri principale corespunztoare celor dou alele ale genotipului (probele 1, 2, 3), n timp ce pentru un individ homozigot exist un singur vrf principal (proba 4).

3.6 Calculul indicilor diversitii genetice


Parametrii variabilitii genetice intrapopulaionale (n interiorul populaiilor) se calculeaz separat pentru fiecare populaie n parte. Calculul parametrilor genetici se bazeaz ntotdeauna pe distribuia frecvenelor variantelor genetice ntr-una sau mai multe populaii (structurile genetice). Cei mai folosii parametri pentru evaluarea variabilitii genetice intrapopulaionale sunt: Numrul mediu de alele pe locus sau rata medie a alelismului (A/L; engl. mean number of alleles per locus); Curtu, curs 2010 44

Diversitatea genetic a grniei (Q. frainetto)

Numrul efectiv de alele pe locus sau numrul de alele eficace (Ae; engl. effective number of alleles per locus); Heterozigoia ateptat denumiri sinonime: diversitatea genic, diversitatea genetic - (He; engl. expected heterozygosity, gene diversity, genetic diversity); Heterozigoia observat (Ho; observed heterozygosity); Indicele de fixare Fk. Frecvena alelic (pi; engl. allele frequency) se calculeaz n funcie de

frecvena genotipurilor pi = Pii +

Pij (condiie:
i =1

p
i =1

= 1), n care:

Pii = frecvena genotipurilor homozigote n locusul K (numrul de genotipuri ii = homozigote / numrul total de genotipuri); Pij = frecvena genotipurilor heterozigote n locusul ij n locusul K; Frecvena alelelor nu reprezint un indicator al diversitii genetice dar cu ajutorul lor se pot calcula toi parametri care msoar diversitatea i structura genetic a populaiilor.

Numrul mediu de alele pe locus (A/L) Acest indice se calculeaz ca raport ntre numrul total de alele observate la toi locii genici i numrul de loci genici analizai:

A/ L =

n
a

(a)

, n care:

A/ L reprezint numrul mediu de alele pe locus;


na reprezint numrul de alele la locusul A;
L reprezint numrul de loci observai.

45

Diversitatea genetic a grniei (Q. frainetto)

Valoarea minim pentru parametrul A/L este 1 n timp ce valoarea maxim este 2N, unde N este numrul de indivizi diploizi dintr-o populaie. Aceast valoarea maxim este atins numai atunci cnd toi indivizii unei populaii sunt heterozigoi i fiecare alel este reprezentat o singur dat n populaie.

Numrul efectiv de alele pe locus (Ae) Numrul efectiv de alele pe locus ca parametru genetic al variabilitii intrapopulaionale, este un indicator deosebit de expresiv n caracterizarea populaiilor de arbori. Dac pentru primii doi parametri nu s-a inut seama de frecvena relativ a alelelor, acest lucru este luat n considerare la calculul parametrului denumit numrul efectiv de alele. Atunci cnd se cuantific variaia genetic la un anumit locus genic se pleac de la ideea c nivelul cel mai ridicat de variaie genetic este considerat a fi atins atunci cnd alelele au o frecven egal. Numrul efectiv de alele pe locus se calculeaz dup cum urmeaz (CROW and KIMURA 1970): Ae ( a ) = 1

pi2( a )

, n care:

Ae(a) reprezint numrul efectiv de alele la locusul genic A; pi(a) reprezint frecvena relativ a alelei Ai la locusul genic A. n cazul n care alelele au aceeai frecven i anume pi(a)=1/ni(a), unde ni(a) reprezint numrul de alele la gena A parametrul atinge valoare maxim: Ae ( a ) = 1 n( a ) 1 n(2a ) 1 = n( a ) 1 n( a )

)=

Valoarea minim (1) este atins n cazul n care locusul genic este monomorf. Aadar intervalul de variaie al acestui indice este: 1 Ae(a) ni(a)

46

Diversitatea genetic a grniei (Q. frainetto)

Dac se calculeaz numrul efectiv de alele la mai muli loci (pentru fondul de gene) se folosete media armonic:
1 1 Ae = L a A e(a )
1

Heterozigoia ateptat (He)


Este parametrul cel mai cunoscut i cel mai utilizat pentru caracterizarea variaiei genetice intrapopulaionale. Se calculeaz cu urmtoarea formul: H e ( a ) = 1 pi2( a ) , n care:
i

He(a) reprezint heterozigoia ateptat la locusul genic A; pi(a) - frecvena relativ a alelei Ai la locusul genic A. n funcie de autor acest parametru este denumit heterozigoia ateptat sau diversitatea genetic (engl. expected heterozygosity sau genetic diversity) (BERG and HAMRICK 1997) respectiv diversitate genic (engl. gene diversity) (NEI 1973). Totui termenul de heterozigoie ateptat este cel mai folosit pe plan internaional, fiind adoptat, i n prezentul tratat chiar dac poate fi oarecum greit interpretat. Astfel, este important de reinut c acest parametru se bazeaz exlusiv pe structurile alelice, ceea ce nseamn c poate fi calculat n absena oricrei informaii privind structurile genotipice. Pe de alt parte, heterozigoia este un atribut al genotipurilor (indivizilor) iar observarea heterozigoiei presupune cunoaterea structurilor genotipice. Se poate deduce uor c pentru acest parametru este valabil relaia: 0 He < 1. Valoarea heterozigoiei ateptate pentru fondul de gene se calculeaz ca medie aritmetic:

47

Diversitatea genetic a grniei (Q. frainetto)

He =

H
a

e(a)

L
n unele lucrri parametrul He este dat i ca valoare procentual (nmulit cu

100).

Heterozigoia observat (Ho)


La un locus genic A, parametrul numit heterozigoia observat corespunde proporiei heterozigoilor n populaia dat. Heterozigoia este un atribut al genotipurilor i de aceea heterozigoia observat spre deosebire de heterozigoia ateptat se bazeaz numai pe structura genotipic i nu poate fi calculat plecnd de la strucutra alelic a unui locus genic. Se calculeaz dup cum urmeaz:
H o ( a ) = Pij ( a ) = 1 Pii ( a ) cu i j, n care:
i j i

H o (a ) reprezint heterozigoia observat; Pij (a ) - frecvena relativ a genotipurilor heterozigote la locusul genic A; Pii (a ) - frecvena relativ a genotipurilor homozigote la locusul genic A.

Evident este valabil relaia: 0 Ho 1. Valoarea heterozigoiei observate pentru fondul de gene se calculeaz ca medie aritmetic:

Ho =

H
a

o(a)

n concluzie, calculul parametrilor variaiei genetice intrapopulaionale se poate baza fie pe identificarea locilor polimorfi (PPL) sau numrarea alelelor care apar la mai muli loci genici (A/L) fr ns s se in cont de frecvenele alelelor. De aceea, aceti doi parametrii se mai numesc indici ai multiplicitii (engl. multiplicity). Dac

48

Diversitatea genetic a grniei (Q. frainetto)

ns se iau n considerare frecvenele tipurilor genetice, i aici ne referim in principal la alele, se vorbete de indici ai diversitii. Cei mai importani parametri ai diversitii sunt Ae i He. ntre cei doi parametrii exist urmtoarea relaie:

H e = 1 pi2 = 1

1 1

=1
2 i

1 Ae

Indicele de fixare
Acest indice a fost propus de Wright (1965) pentru cazurile de bialelism, fiind extins ulterior de Nei (1977, 1986) i red msura n care o populaie se abate de la starea de echilibru Hardy Weinberg. Cu ct valorile FK sunt mai mici, cu att populaia este mai apropiat de starea de echilibru genetic. FK = 1Ho , n care: He

FK indicele de fixare;

Ho reprezint heterozigoia observat; He reprezint heterozigoia ateptat.


n cazul n care indicele de fixare are valori pozitive, atunci populaia respectiv poate fi caracterizat cu un deficit de heterozigoi, iar dac FK are valori negative, populaia prezint un exces de heterozigoi. n cazul unui ansamblu de m loci se calculeaz un indice de fixare mediu dup urmtoarea formul:
1 m FK m K =1

F=

49

Diversitatea genetic a grniei (Q. frainetto)

Structura Hardy-Weinberg
Savanii Hardy (englez) i Weinberg (german) au putut demonstra c frecvena homozigoilor i cea a heterozigoilor ntr-o populaie rmne constant timp de generaii dac anumite condiii sunt ndeplinite. Fie o populaie n care ncruciarea are loc pe baz de ntmplare iar la locusul genic A avem: pi = pi=pi (frecvena alelei i este aceeai att n gameii femeli ct i n cei masculi), iar probabilitatea de a se forma un genotip Ai Ai este: pi x pi=pi2 , iar frecvena homozigoilor de tipul Ai Ai (Pii) = pi2 . Dac se unesc dou tipuri diferite de gamei avem: pipj; Dac exist ncruciare randomizat atunci exist o legtur ntre structura alelic i structura genotipic. Structur alelic cunoscut rezult structura genetic, conform urmtoarelor formule: Pii = pi2 pentru toi homozigoii Pij = 2 pi pj pentru toi heterozigoii. Dup care a urmat prelucrarea datelor obinute cu ajutorul programului GenAlex (Version 6.1). Cu ajutorul programului GenAlex se poate determina frecvena alelelor, numrul mediu de alele pe locus (Na), numrul efectiv de alele pe locus (Ne), heterozigoia ateptat (diversitatea genic, diversitatea genetic) (He), heterozigoia observat (Ho) i indicele de fixare (Fk). n concluzie, cu toi aceti parametrii se poate estima diversitatea genetic n populaia de grni din U.P V Seaca luat n studiu. probabilitatea de a se forma un genotip Ai Aj este: pi x pj=pipj; iar probabilitatea de a se forma un genotip Aj Ai este: pj x pi=pjpi.

Iar frecvena acestor genotipuri va avea: Ai Ai (Pii) =( pi x pj) + (pj x pi) = 2

50

CAPITOLUL IV Diversitatea genetic a grniei

51

Diversitatea genetic a grniei (Q. frainetto)

4.1 Date primare


n cadrul proiectului s-au determinat cu ajutorul secveniatorului Beckman-Coulter electroforegramele pentru fiecare locus marker ( ZAG,PIE040, GOT004). n urma rulrii celor 32 de probe de ADN cu ajutorul secveniatorului au fost obinute urmtoarele rezultate: 1. Pentru primul locus marker ZAG11 vor fi prezentate n continuare cteva exemple de arbori heterozigoi i cteva exemple de arbori homozigoi. Arborii heterozigoi au dou peak-uri , iar arborii homozigoi au un singur peak. Pentru locusul ZAG11, att heterozigoi, ct i homozigoi sunt reprezentai prin culoare verde.

Fig.4.1 Arborele nr. 29- heterozigot cu genotipul 269/271 bp

52

Diversitatea genetic a grniei (Q. frainetto)

Fig. 4.2 Arborele 19- homozigot cu genotipul 250 bp

Fig. 4.3 Arborele nr.38- homozigot cu genotipul 252 bp

53

Diversitatea genetic a grniei (Q. frainetto)

Pentru locusul marker ZAG39 arborii att heterozigoi i homozigoi sunt de culoare neagr. Exemple de electroforegrame pentru acest marker sunt redate n figurile:

Fig.4.4 Arborele nr.17- homozigot cu genotipul 125 bp

54

Diversitatea genetic a grniei (Q. frainetto)

Fig.4.5 Arborele nr. 39- heterozigot cu genotipul 108/112 bp

Fig.4.6 Arborele nr. 23- heterozigot cu genotipul 143/145 bp

55

Diversitatea genetic a grniei (Q. frainetto)

- locusul marker ZAG96 este de culoare verde ca i ZAG11;

Fig.4.7 Arborele nr.17- homozigot cu genotipul 160 bp

Fig. 4.8 Arborele nr.14-homozigot cu genotipul 162 bp

56

Diversitatea genetic a grniei (Q. frainetto)

- locusul marker ZAG110 este de culoare albastr;

Fig. 4.9 Arborele nr. 15- homozigot cu genotipul 208 bp

Fig.4.10 Arborele nr. 30- homozigot cu genotipul 207 bp

57

Diversitatea genetic a grniei (Q. frainetto)

Fig. 4.11 Arborele nr.36- heterozigot cu genotipul 207/213 bp

Fig.4. 12 Arborele nr. 37- homozigot cu genotipul 207 bp

58

Diversitatea genetic a grniei (Q. frainetto)

- locusul marker ZAG112 este de culoare albastr ca i ZAG110;

Fig. 4.13 Arborele nr. 10-heterozigot cu genotipul 86/88 bp

Fig.4. 14 Arborele nr. 22- heterozigot cu genotipul 86/88 bp

59

Diversitatea genetic a grniei (Q. frainetto)

Fig.4.15 Arborele nr.11- heterozigot cu genotipul 98/100 bp 2. Urmtorul locus marker este GOT004, acesta este repezentat prin culoare albastr la fel ca ZAG110 i ZAG112. Arborii homozigoi au un singur peak,iar cei heterozigoi au doua peak-uri. n continuare vor fi cteva exemple:

Fig.4.16 Arborele nr.25-homozigot cu genotipul 293 bp

60

Diversitatea genetic a grniei (Q. frainetto)

Fig 4.17 Arborele nr. 31- homozigot cu genotipul 285 bp

61

Diversitatea genetic a grniei (Q. frainetto)

Fig.4.18 Arborele nr. 30- heterozigot cu genotipul 284/285 bp

3. Ultimul locus marker PIE040 este de culoare verde, avnd aceeai culoare ca ZAG11 i ZAG96. i n acest locus regsim arbori homozigoi cu un singur peak i heterozigoi cu dou peak-uri. Exemple de electroforegrame pentru acest marker sunt redate n figurile urmtoare:

62

Diversitatea genetic a grniei (Q. frainetto)

Fig.4.19 Arborele nr.26-heterozigot cu genotipul 176/184 bp

Fig.4.20 Arborele nr. 32- heterozigot cu genotipul 181/184 bp

63

Diversitatea genetic a grniei (Q. frainetto)

Fig.4.21 Arborele nr.33- heterozigot cu genotipul 176/181 bp

Fig.4.22 Arborele nr.40- heterozigot cu genotipul 178/180 bp

64

Diversitatea genetic a grniei (Q. frainetto)

Fig. 4.23 Arborele nr. 25- homozigot cu genotipul 181 bp

4.2 Structura genotipic


Stuctura genotipic arat distribuia frecvenelor relative ale genotipurilor. Genotipurile arborilor studiai din populaia de grni din Seaca-Optani sunt redate n urmtoarele tabele: n tabel au fost genotipizai 31 de arbori, iar 22 de arbori n-au rulat, urmnd a fi rulai ntr-o alt etap. La markerul ZAG112 (tabelul4.1) au fost observai 24 de arbori homozigoi i 7 arbori heterozigoi. Au fost observate alele ce difer ca un multiplu de baze,n cazul locusului ZAG39 (tabelul 4.2) au fost observai 6 arbori homozigoi i 9 arbori heterozigoi, iar restul pn la 31 de arbori genotipizai, 16 nu au rulat. .

65

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.1 Tabel centralizator cu genotipurile observate la markerul ZAG112


Arborele de grni 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Populaia Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Genotipul 88 88 88 88 88 88 88 88 88 88 88 88 86 88 88 88 88 88 88 88 86 86 88 88 88 88 86 88 88 88 88 88 88 100 88 88 96 88 88 88 88 88 88 88 88 88 88 88 88 88 88 88 88 88 88 96 88 88 88 88 88 88

66

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.2 Tabel centralizator cu genotipurile observate la markerul ZAG39

Arborele de grni 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Populaia Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca

Genotipul 0 111 0 0 0 0 0 125 143 0 0 0 0 143 0 127 111 115 0 123 125 123 0 111 113 111 123 127 156 164 0 0 129 0 0 0 0 0 125 169 0 0 0 0 145 0 161 111 115 0 123 125 169 0 111 133 159 161 159 159 168 0

67

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.3 Tabel centralizator cu genotipurile observate la markerul ZAG96


Arborele de grni Populaia Genotipul

9 Seaca 0 0 Seaca 10 162 180 Seaca 11 162 164 Seaca 12 156 156 Seaca 14 162 162 Seaca 15 154 168 Seaca 16 0 0 Seaca 17 160 160 Seaca 18 154 156 Seaca 19 160 162 Seaca 20 158 166 Seaca 21 0 0 Seaca 22 0 0 Seaca 23 162 164 Seaca 24 166 166 Seaca 25 162 170 Seaca 26 158 160 Seaca 27 154 162 Seaca 28 154 168 Seaca 29 154 170 Seaca 30 150 162 Seaca 31 152 166 Seaca 32 0 0 Seaca 33 154 164 Seaca 34 164 172 Seaca 35 164 166 Seaca 36 144 152 Seaca 37 152 168 Seaca 38 156 160 39 Seaca 164 168 40 Seaca 146 146 pentru acest locus au fost observai 5 arbori homozigoi i 21 arbori heterozigoi;

68

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.4 Tabel centralizator cu genotipurile observate la markerul ZAG110


Arborele de grni Populaia Genotipul

9 Seaca 0 0 Seaca 10 207 221 Seaca 11 207 213 Seaca 12 207 213 Seaca 14 207 213 Seaca 15 209 223 Seaca 16 0 0 Seaca 17 207 211 Seaca 18 207 211 Seaca 19 207 207 Seaca 20 207 209 Seaca 21 0 0 Seaca 22 0 0 Seaca 23 207 209 Seaca 24 209 223 Seaca 25 207 217 Seaca 26 207 207 Seaca 27 207 207 Seaca 28 207 207 Seaca 29 207 229 Seaca 30 207 207 Seaca 31 207 207 Seaca 32 207 207 Seaca 33 207 217 Seaca 34 207 207 Seaca 35 207 207 Seaca 36 207 213 Seaca 37 207 207 Seaca 38 207 207 39 Seaca 207 219 40 Seaca 207 227 pentru ZAG110 au fost observai 16 arbori heterozigoi i 13 arbori homozigoi;

69

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.5 Tabel centralizator cu genotipurile observate la markerul ZAG11


Arborele de grni Populaia Genotipul

9 Seaca 0 0 Seaca 10 253 269 Seaca 11 253 253 Seaca 12 0 0 Seaca 14 253 271 Seaca 15 243 251 Seaca 16 0 0 Seaca 17 253 279 Seaca 18 243 253 Seaca 19 253 253 Seaca 20 251 253 Seaca 21 0 0 Seaca 22 0 0 Seaca 23 253 271 Seaca 24 253 253 Seaca 25 253 253 Seaca 26 251 251 Seaca 27 253 269 Seaca 28 251 253 Seaca 29 269 271 Seaca 30 253 253 Seaca 31 251 269 Seaca 32 253 253 Seaca 33 255 255 Seaca 34 253 269 Seaca 35 253 253 Seaca 36 253 253 Seaca 37 253 253 Seaca 38 253 253 39 Seaca 257 269 40 Seaca 253 269 pentru ZAG11 au fost observai 14 arbori heterozigoi i 12 arbori homozigoi

70

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.6 Tabel centralizator cu genotipurile observate la markerul PIE040

Arborele de grni Populaia Genotipul Seaca 17 181 181 Seaca 18 180 184 Seaca 19 180 181 Seaca 20 180 190 Seaca 21 180 181 Seaca 22 180 183 Seaca 23 180 181 Seaca 24 180 180 Seaca 25 180 180 Seaca 26 176 184 Seaca 27 180 184 Seaca 28 180 181 Seaca 29 180 181 Seaca 30 180 184 Seaca 31 180 184 Seaca 32 180 184 Seaca 33 176 180 Seaca 34 180 180 Seaca 35 180 181 Seaca 36 180 180 Seaca 37 180 181 Seaca 38 180 181 39 Seaca 181 184 40 Seaca 179 180 pentru PIE040 au fost observai 19 arbori heterozigoi i 5 arbori homozigoi;

71

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.7 Tabel centralizator cu genotipurile observate la markerul GOT004

Arborele de grni

17 291 293 18 295 306 19 284 291 20 284 303 21 282 298 22 300 303 23 291 294 24 287 291 25 293 304 26 284 289 27 282 284 28 289 304 29 295 304 30 283 285 31 285 304 32 284 304 33 293 304 34 283 284 35 289 299 36 295 303 37 293 303 38 293 296 39 Seaca 283 285 40 Seaca 283 284 pentru PIE040 au fost observai 24 arbori heterozigoi i 0 arbori homozigoi;

Populaia Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca Seaca

Genotipul

72

Diversitatea genetic a grniei (Q. frainetto)

4.3 Structura alelic


Structura alelic arat distribuia frecvenelor alelelor la un anumit locus genic i cu ajutorul acesteia se poate afla care este cea mai reprezentativ alel pentru populaia studiat.
Tabelul 4.8 Structura alelic la markerul ZAG112

Alela 86 88 96 100

Frecvena 0.065 0.887 0.032 0.016

n figura 4.24 este reprezentat frecvena alelelor (ZAG112) n populaia SeacaOptani.

Freque ncy

1.000 0.800 0.600 0.400 0.200 0.000 Slatina 86 88 ZAG112 Locus 96 100

Figura 4.24 Frecvena alelelor pentru ZAG112 Prin compararea datelor de mai sus s-a constatat c n cazul populaiei de grni analizate, la locusul ZAG112 din cele 4 alele descoperite cea mai ridicat frecven o are alela 88 bp care atinge frecvena de 80%. Celelalte alele au frecvene foarte reduse, nici una nu depete pragul de 10%. Cea mai mic frecven se gsete la alelele 100, respectiv 96 i care se consider a fi rezultatul unor indels (se presupune c alele de lungimi mari sunt nite alele foarte vechi, ntlnite la mai multe din speciile actuale de cvercinee) (Curtu et al. 2004).

73

Diversitatea genetic a grniei (Q. frainetto)

Pentru markerul ZAG39 structura alelic este mai variat( tabelul 4.9).
Tabelul 4.9 Structura alelic la markerul ZAG39

Alela 111 113 115 123 125 127 129 133 143 145 156 159 161 164 168 169

Frecvena 0.176 0.029 0.059 0.118 0.118 0.059 0.029 0.029 0.059 0.029 0.029 0.088 0.059 0.029 0.029 0.059

Freque ncy

0.200 0.150 0.100 0.050 0.000 Slatina 111 113 115 123 125 127 129 133 143 145 156 159 161 164 168 169 ZAG39 Locus

Figura 4.25 Frecvena alelelor pentru ZAG39

74

Diversitatea genetic a grniei (Q. frainetto)

n cazul markerului ZAG39 din cele 16 alele descoperite cea mai ridicat frecven o alealela 111 care atinge frecvena de 15,5%. Alele 123 i. 125 au frecvene mai reduse dect alela 111, i anume 11,5%. Celelalte alele au frecvene reduse, nedepind pragul de 10%.
Tabelul 4.10 Structura alelic la markerul ZAG96

Alela 144 146 150 152 154 156 158 160 162 164 166 168 170 172 180

Frecvena 0.019 0.038 0.019 0.058 0.115 0.077 0.038 0.096 0.173 0.115 0.096 0.077 0.038 0.019 0.019

Freque ncy

0.200 0.150 0.100 0.050 0.000 144 146 150 152 154 156 158 160 162 164 166 168 170 172 180 ZAG96 Locus
Figura 4.26 Frecvena alelelor pentru ZAG96

Slatina

75

Diversitatea genetic a grniei (Q. frainetto)

Referitor la markerul ZAG96, alela 162 are frecvena ce mai mare de 15,5%,alele 144, 150, 172 i 180 au aceeai frecven de aproximativ 10%.
Tabelul 4.11 Structura alelic la markerul ZAG110

Alela 207 209 211 213 217 219 221 223 227 229

Frecvena 0.667 0.074 0.037 0.074 0.037 0.019 0.019 0.037 0.019 0.019

n figura 4.27 alela cu cea mai mare frecven este 207 cu un procent de 65,5%, celelalte avnd frecvene reduse ce nu depete 20%, acestea se consider a fi rezultatul unor indels (se presupune c alele de lungimi mari sunt nite alele foarte vechi, ntlnite la mai multe din speciile actuale de cvercinee) (Curtu et al. 2004).

Freque ncy

0.800 0.600 0.400 0.200 0.000 Slatina 207 209 211 213 217 219 221 223 227 229

ZAG110 Locus

Figura 4.27 Frecvena alelelor pentru ZAG110

76

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.12 Structura alelic la markerul ZAG11

Alela 243 251 253 255 257 269 271 279

Frecvena 0.038 0.115 0.577 0.038 0.019 0.135 0.058 0.019

Pentru locusul ZAG11,alela cu cea mai mare frecven este alela 253 care are o valoare ce atinge 60%, alela 269 are o valoare de 20%, iar celelalte alele nu depesc nici 10%. Ca i la ZAG110 alelele cu frecven sub 10% sunt considerate rezultatul unor indels, adic alele de lungimi foarte mari sunt alele foarte vechi.

Freque ncy

0.800 0.600 0.400 0.200 0.000 Slatina 243 251 253 255 257 269 271 279

ZAG11 Locus
Figura 4.28 Frecvena alelelor pentru ZAG11

77

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.13 Structura alelic la markerul PIE040

Alela 176 179 180 181 183 184 190

Frecvena 0.042 0.021 0.521 0.229 0.021 0.146 0.021

Pentru locusul PIE040, alela 180 are frecvena cea mai mare de 55,5%,urmat de alela 181 cu o frecven de 30% i alela 184 cu o frecven de 15%, celelalte au o frecven sub 10%.

Freque ncy

0.600 0.500 0.400 0.300 0.200 0.100 0.000 Slatina 176 179 180 181 PIE040 Locus
Figura 4.29 Frecvena alelelor pentru PIE040

183

184

190

78

Diversitatea genetic a grniei (Q. frainetto)

Tabelul 4.14 Structura alelic la markerul GOT004

Alela 282 283 284 285 287 289 291 293 294 295 296 298 299 300 303 304 306

Frecvena 0.042 0.083 0.146 0.063 0.021 0.063 0.083 0.104 0.021 0.063 0.021 0.021 0.021 0.021 0.083 0.125 0.021

Pentru GOT004, alelele au frecvene destul de ridicate, dar cea mai mare valoare o are alela 284 de 16,5%,urmat de celelalte alele cu valori apropiate de cea a alelei 284, i anume alelele 283,291,293,303,304. Diferenele ntre alele sunt de o singur pereche de baze.

Freque ncy

0.200 0.150 0.100 0.050 0.000 Slatina 282 283 284 285 287 289 291 293 294 295 296 298 299 300 303 304 306 GOT004 Locus
Figura 4.30 Frecvena alelelor pentru GOT004 79

Diversitatea genetic a grniei (Q. frainetto)

4. 4 Indicii diversitii genetice


Cu ajutorul structurilor genotipice i alelice prezentate anterior s-au estimat indicii genetici cu programul GenAlex.

Tabelul 4.15 Valorile estimate pentru indicii diversitii genetice Locus


ZAG112 ZAG39 ZAG96 ZAG110 ZAG11 PIE040 GOT004

N
31 17 26 27 26 24 24

Na
4.000 16.000 15.000 10.000 8.000 7.000 17.000

Ne
1.262 11.115 10.400 2.170 2.693 2.873 11.755

Ho
0.226 0.647 0.808 0.593 0.538 0.792 1.000

He
0.208 0.910 0.904 0.539 0.629 0.652 0.915

F
-0.088 0.289 0.106 -0.099 0.144 -0.214 -0.093

- numrul de arbori analizai;

Na - numrul mediu de alele pe locus; Ne - numrul efectiv de alele pe locus; Ho - heterozigoia observat; He - heterozigoia ateptat (diversitatea genetic); F - indicele de fixare; n populaia de grni Seaca au fost analizai 31 de arbori. 1. La locusul genic ZAG112 au fost gsite 4 alele. Numrul efectiv de alele pe locus este de 1,262. Heterozigoia observat Ho=0,226, ceea ce nseamn c 22,6% din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,208. Indicele de fixare are valori negative, ceea ce nseamn c populaia studiat se apropie de stare de echilibru genetic( F=-0,088). Cnd indicele de fixare are volori negative populaia prezint un exces de heterozigoi. 80

Diversitatea genetic a grniei (Q. frainetto)

2. La locusul ZAG39 au fost gsite 16 alele, numrul efectiv de alele pe locus este de 11,115 . Heterozigoia observat Ho=0,647, ceea ce nseamn c 64,7% din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,910. Indicele de fixare are valori pozitive( F=0,289) ceea ce nseamn c populaia este apropiat de starea de echilibru genetic. Cnd indicele de fixare are volori pozitive populaia prezint un exces de homozigoi. 3. La locusul ZAG96 au fost gsite 15 alele, numrul efectiv de alele pe locus este de 10,400. Heterozigoia observat Ho=0,808, ceea ce nseamn c 80,8% din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,904. Indicele de fixare are valori pozitive (F=0,106), deci populaia este apropiat de starea de echilibru genetic. 4. La locusul ZAG110 au fost gsite 10 alele, numrul efectiv de alele pe locus este de 2,170. Heterozigoia observat Ho=0,593, ceea ce nseamn c 59,3% din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,593. Indicele de fixare are valori negative, ceea ce nseamn c populaia studiat se apropie de stare de echilibru genetic( F=-0,099). Cnd indicele de fixare are volori negative populaia prezint un exces de heterozigoi. 5. La locusul ZAG11 au fost gsite 8 alele, numrul efectiv de alele pe locus este de 2,693. Heterozigoia observat Ho=0,538, ceea ce nseamn c 53,8% din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,629. Indicele de fixare are valori pozitive (F=0,144), deci populaia este apropiat de starea de echilibru genetic. 6. La locusul PIE040 au fost gsite 7 alele, numrul efectiv de alele pe locus este de 2,873. Heterozigoia observat Ho=0,792, ceea ce nseamn c 79,2%

81

Diversitatea genetic a grniei (Q. frainetto)

din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,652. Indicele de fixare are valori negative (F=-0,214), deci populaia este apropiat de starea de echilibru genetic i populaia prezint un exces de heterozigoi. 7. La locusul GOT004 au fost gsite 17 alele, numrul efectiv de alele pe locus este de 11,755. Heterozigoia observat Ho=1,000, ceea ce nseamn c 100% din indivizii analizai sunt heterozigoi. Heterozigoia ateptat conform legii Hardy-Weinberg He=0,915. Indicele de fixare are valori negative (F=-0,093), deci populaia este apropiat de starea de echilibru genetic i populaia prezint un exces de heterozigoi. Testarea echilibrului Hardy Weinberg, presupune evaluarea diferenelor dintre frecvenele observate i cele teoretice (ateptate) ale genotipurilor n ipoteza panmixiei. Printr-o distan genetic se cuantific ct de mult sau de puin se deosebesc structurile genetice a dou populaii. Parametrii de distan se bazeaz, de regul, pe structurile alelice.

Tabelul 4.16 Testarea echilibrului genetic Locus


ZAG112 ZAG39 ZAG96 ZAG110 ZAG11 PIE040 GOT004 ns= nesemnificativ *p<0,05 ; **p<0,01 ; ***p<0,001.

Probe
0.998 0.005 0.514 0.963 0.067 0.995 0.534

Nesemnificativ
ns ** ns ns ns ns ns

82

Diversitatea genetic a grniei (Q. frainetto)

4.5 Concluzii
Prin aplicarea unor metode de ultim generaie s-a determinat genotipul pentru 49 de arbori la locusul genic ZAG112,ZAG39, ZAG96, ZAG110, ZAG11; Populaia de grni Seaca este foarte apropiat de starea de echilibru genetic; Indicele de fixare tinde mai mult spre valori negative, ceea ce nseamn c populaia prezint un exces de heterozigoi; O singur gen marker a fost suficient pentru difereniearea a 31 de genotipuri; Este primul studiu din ara noastr privind estimarea variabilitii genetice cu ajutorul secvenelor simple repetitive de ADN prin electroforez capilar la specii de interes forestier; Diversitatea genic estimat a fost de circa 4 ori mai mare dect cea raportat n studiile efectuate cu ajurul aloenzimelor;

83

B. Piese scrise

84

CAPITOLUL V Bibliografie

85

1. Chiri C., Vlad I., .a., 1977: Staiuni forestiere, Editura Academiei R.S.R., Bucureti. 2. Curtu A.L., Finkeldey R., Gailing O., 2004: Comparative sequencing of a microsatellite locus reveals size homoplasy within and between european oak species (Quercus spp.). Plant Molecular Biology Reporter 3. Haralamb A.T., 1967: Cultura speciilor forestiere. Ediia a III-a. Editura Agro-Silvic, Bucureti. 4. Marcu M.,1983: Meteorologie i climatologie forestier, Editura CERES, Bucureti 5. Nei M., 1973: Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences USA 70 6. Parascan D., Danciu M., 2001: Fiziologia plantelor lemnoase. Editura Pentru Via, Braov. 7. Stnescu V., ofletea N., Popescu O., 1997: Flora forestier lemnoas a Romniei. Editura CERES, Bucureti. 8. Stnescu V., ofletea N., 1998: Silvicultura cu bazele geneticii forestiere, Editura CERES, Bucureti. 9. ofletea N., Curtu L., 2001: Dendrologie, vol. I (Determinarea i descrierea speciilor), Editura Pentru Via, Braov. 10. ofletea N., Curtu L., 2001: Dendrologie, vol. II (Corologia, ecologia i nsuirile ecologice ale speciilor), Editura Pentru Via, Braov. 11. ofletea N., 2005: Genetic i ameliorarea arborilor, Editura Pentru Via, Braov. 12. ofletea N., Curtu L., 2007: Dendrologie, Editura Pentru Via, Braov. 13. Trziu D., Sprchez Gh., 1997: Elemente de geologie i geomorfologie. Editura Lux Libres, Braov. 14. Trziu, D., 1997: Pedologie i Staiuni forestiere, Editura CERES, Bucureti. 15. Trziu D., Sprchez Gh., Dinc L., 2000: Soluri i staiuni forestiere (Lucrri practice), Editura Universitii Transilvania, Braov. 16. Trziu D., 2006: Pedologie i staiuni forestiere. Editura Silvodel, Braov 17. Valeriu E., 1985: Genetica ecologic, Editura CERES, Bucureti.

86

18. Vornam B., Decarli N., Gailing O., 2004: Spatial distribution of genetic variation in a natural beech stand (Fagus sylvatica L.) based on microsatellite markers. Conserv Genet 19.

87