Sunteți pe pagina 1din 7

Fragmentul Klenow Fragmentul Klenow este folosit pentru cateva sarcini: 2. Umplerea sptiilor 3' din fragmentele de ADN.

Procesul de umplere este utilizat pentru a creea capete boante pentru fragmentele rezultate in urma clivarii de catre enzimele de restrictie care creeaza capete tesite 5' . Aceasta reactie este teoretic identica cu cea descrisa mai jos, insa cu un primer imens si un segment foarte scurt de matrita unicatenara. 3. Prepararea probelor de ADN marcate cu radionucleotide sau alti markeri. Fragmentele Klenow sunt frecvent utilizate pentru incorporarea nucleotidelor radioactive in ADN, sau a nucleotidelor marcate cu asa numitii markeri reci.

4. Digestia protuberantelor de la capetele 3` tesite. Aceasta este o alta metoda pentru producerea fragmentelor de ADN cu capete boante, in cazul de fata, generate de enzimele de restrictie care in urma clivarii, dau capete tesite3`. Activitatea exonucleazica 3 5' a fragmentelor Klenow va digera protuberantele terminale. Reactia este mai eficienta cand se utilizeaza ADN polimeraza T4, care poseda o activitate exonucleazica pronuntata.

In unele situatii, activitatea exonucleazica 3' 5' a fragmentelor Klenow fragment este fie nedorita, fie nu este necesara. Prin introducerea mutatiilor in genele care codifica fragmentul Klenow, pot fi exprimate enzime care pastreaza activitatea polimerazica, insa sunt deficiente in orice activitate exonucleazica. Aceste forme enzimatice poarta numele de Fragmente exo-Klenow.

T4 DNA Polymerase T4 este un bacteriofag al speciei E. coli. Activitatea ADN T4 polimerazei este foarte similara celei a fragmentelor Klenow din ADN polimeraza I functioneaza ca o 5`-3` ADN polimeraza si ca o 3`-5` exonucleaza, insa nu are activitate 5`-3` exonucleazica. In general, ADN T4 polimeraza este utilizata pentru acelasi tip de reactii ca si fragmentele Klenow, in special la realizarea capetelor boante la capatul fragmentelor de ADN cu tesituri 3` sau 5` Exista totusi, 2 diferente intre cele 2 enzime, care au importanta practica: 1. Activitatea exonucleazica 3' 5' a ADN T4 polimerazei este de aproximativ 200 de ori mai pronuntata decat a Fragmentelor Klenow, facand-o pe aceasta (ADN T4 polimeraza) preferata multor investigatori pentru indepartarea capetelor 3` tesite (obtinerea capetelor boante)

2. In timp ce Fragmentele Klenow vor indeparta oligonucleotidele din aval in timp ce polimerizeaza, ADN T4 polimeraza nu va face asta. Acest atribut face din ADN T4 polimeraza cea mai eficienta alegere pentru diferite tipuri de reactii de mutageneza ale oligonucleotidelor. ADN T7 Polimeraza ADN polimeraza bacteriofagului T7 poseda ADN polimeraza si activitate exonucleazica 3' 5', lipsindu-i insa domeniul exonucleazic 5' 3' . Este prin aceasta foarte similara cu Fragmentele Klenow si ADN T4 polimeraza. ADn T7 polimeraza este faimoasa pentru capacitatea sa de procesare. Lungimea medie a ADN-ului sintetizat inainte ca enzima sa disocieze de catena matrice este considerabil mai mare decat in cazul altor ADN polimeraze. Din acest motiv, principala intrebuintarea a ADN T7 Polimerazei este in secventierea ADN-ului prin tehnica lantului terminal. T7 ADN polimeraza poate fi tratata chimic sau manipulata genetic pentru a-i inlatura activitatea 3' 5' exonucleazica. Aceste forme ale enzimei sunt disponibile comercial sub denumirea de Sequenase sau Sequenase 2.0, si sunt larg folosite pentru reactiile de secventiere a ADN-ului. ADN Polimerazele Termostabile Este interesant modul n care unele descoperiri aparent vagi sau obscure poate, ani mai trziu, pentru a fi catapultat ceva de importan practic imens. Aceasta este istoria de Taq ADN-polimerazei. Raportul original cu privire la aceast enzim, purificat din aquaticus bacterie izvoarele calde Thermus, a fost publicat n 1976. Aproximativ 10 ani mai trziu, reacia n lan a polimerazei (PCR) a fost dezvoltat i la scurt timp dup aceea "Taq" a devenit un cuvnt de uz casnic n laboratoarele de biologie molecular. n prezent, pe piaa mondial a polimerazei Taq este n sute de milioane de dolari n fiecare an. polimerazele ADN termostabil, ca ADN-polimeraze alte, catalizeaza sinteza templateregizat de ADN de la trifosfaii nucleozidici. O amorsa avnd capatul 3` hidroxil liber necesita initierea sintezei, iar ionul de Mg2+ este necesar in aceasta reactie. n general, ele au activitate maxima catalitice ntre 75 i 80 C, i activiti reduse substanial la temperaturi mai mici. De exemplu, la 37 C, Taq polimeraza are doar aproximativ 10% din activitatea sa maxima. n plus fa de Taq polimeraza ADN-ului, mai multe alte polimerazele ADN termostabile au fost izolate si exprimate in gene clonate.

Thermostable DNA Polymerases 35 exonuclease activity No

Polymerase

Origin and Properties

Taq

From Thermus aquaticus. Halflife at 95C is 1.6 hours. From Pyrococcus furiosus. Appears to have the lowest error rate of known thermophilic DNA polymerases. From Thermococcus litoralis; also known as Tli polymerase. Halflife at 95C is approximately 7 hours.

Pfu

Yes

Vent

Yes

In plus, fa de ADN polimerazele enumerate n tabel, o serie de mutatii au fost generate i sunt disponibile, de exemplu, o form de polimerazei Vent care nu are 3 ' 5' exonuclease i este, prin urmare, mai asemntoare cu Taq. Una dintre caracteristicile cele mai discutate ale ADN polimerazele termostabil este rata lor de eroare. Ratele de eroare sunt evaluate folosind teste diferite, i ca urmare, estimrile ratei de eroare variaz, n special atunci cnd testele sunt efectuate de ctre laboratoare diferite. Aa cum ar fi de ateptat, polimerazele fara activitate 3 ' 5' exonucleazica, au n general, rate mai mari de eroare dect polimerazele cu activitate exonucleazica. Rata de eroare total de polimeraz Taq a fost divers raportat ntre 1 x 2 x 10-4 la 10-5 erori pentru fiecare pereche de baz. Polimeraza PFU pare s aib cea mai sczut rat de eroare la aproximativ 1,5 x 10-6 eroare pentru fiecare pereche de baz, i Vent este, probabil, intermediar ntre Taq i PFU. Rata de eroare nu este singurul considerent n alegerea unui polimerazei pentru PCR, altfel polimeraz Taq nu ar continua s fie cel mai enzimei utilizate pe scar larg de departe pentru o multitudine de aplicaii PCR. Alte consideraii, inclusiv tipul aplicaiei, fiabilitatea i costurile intra n alegere. Reverse Transcriptazele Revers transcriptaza este un nume comun pentru o enzim care funcioneaz ca un ARN-polimerazei ADN dependente. Ele sunt codificate de retrovirusurilor, n cazul n care copiai genomul viral in ADN-ul ARN-ului nainte de integrarea sa n ADN-ul celulelor gazda. Revers Transcriptazele au dou activiti: 1. Activitate Adn-polimerazica. 2. Activitate ARN-azica H. 1. ADN polimeraza activitate: n ciclul de via retroviral, revers transcriptaza exemplare numai ARN,dar, folosit n laborator, va transcrie att ARN, cat si matrite ADN monocatenar cu o eficien n esen echivalente. n ambele cazuri, un primer ARN sau ADN-ul este necesar s iniieze sinteza. 2. Activitate ARN-azica H: ARN-aza H este o ribonucleaz care degradeaz ARN din hibrizi ARN-ADN, care se formeaza in timpul retrotranscrierii ARN. Aceast enzim funcioneaz att ca endonucleaza cat i exonucleasa n hidrolizezele tinta. Toate retrovirusurile au o revers transcriptaza, dar enzimele care sunt disponibile n comer sunt derivate din una dintre cele dou retrovirusurilor, fie prin purificare de virus sau expresia n E. coli:

1. Moloney virusul leucemiei murine (MMLV): un lan polipeptidic unic. 2. Virusul myeloblastosis aviar (AMBV): compus din dou lanuri polipeptidice. Ambele enzime au aceleai activiti fundamentale, dar difer ntr-o serie de caracteristici, inclusiv temperatura i pH-ul Optima. Cel mai important, enzima MMLV are foarte slab activitate RNase H, comparativ cu enzima AMBV, ceea ce face aceasta alegere clar atunci cnd ncearc s sintetizeze cDNAs din RNAs messenger lung. Revers transcriptaz este folosit pentru a copia ARN n ADN. Aceast sarcin este parte integrant a cDNAs clonarea, care sunt copii ADN-ul de messenger RNAs mature. Clonarea cDNAs este, de obicei iniiata prin amestecarea oligomerilor scurti (12-18 baze) oligomeri de timidinei (oligo dT), cu mARN astfel nct s se alinieze la coada poliA a ARN-ului. Revers transcriptaza este apoi adugat i utilizeaz dT oligo ca un primer pentru a sintetiza ADNc unicatenar. O alta utilizare comuna pentru reverstranscriptaza este de a genera copii ale ADN ale ARN-ului inainte de amplificarea ADN-ului prin reacia n lan a polimerazei (PCR). Revers-transcrierea PCR, numit de obicei pur i simplu RT-PCR, este un instrument util pentru uimitor de multe lucruri, cum ar fi clonarea cADN, diagnosticarea bolilor microbiene rapid i o mulime de alte aplicaii. n majoritatea cazurilor, preparate standard ale reverstranscriptazei sunt utilizate pentru RT-PCR, dar formele mutante cu stabilitate termica relativ ridicate au fost dezvoltate pentru a facilita procesul. ARN Polimerazele Bacteriofage ARN polimerazele ADN-dependente sunt utilizate pentru transcriptia in vitro pentru generarea ARN-urilor definite. Cel mai comun, reactia utilizeaza ribonucleotide marcate cu radioizotopi sau alte etichete, iar ARN-ul marcat care rezulta este utilizat ca si proba pentru hibridizare. Alte aplicatii ale transcriptiei in vitro transcription incluzand marcarea ARN-urilor pentru translatia sau studiul structurii si functiei ARN. Exista cateva ARN polimeraze fagice, care sunt denumite dupa fagul care le contine si sunt fie purificate din bacteriile infectate de catre fagi, fie produse ca proteine recombinate. Host of Encoding Phage

Name

Promoter Sequence

T7 RNA Polymerase

E. coli

TAATACGACTCACTATAGGG

T3 RNA Polymerase

E. coli

AATTAACCCTCACTAAAGGG

SP6 RNA Polymerase

Salmonella typhimurium

AATTTAGGTGACACTATAGAA

Multe dintre plasmidele utilizate pentru transportul promoterilor cu ADN clonat incorporat pentru ARN polimerazele fagice adiacente site-ului de clonare. Aceasta permite obtinerea facila a transcripturilor mARN-sens sau mARN-antisens din ADN-ul inserat. Procesul este deseori numit transcriptie run-off, deoarece plasmidul este taiat cu o enzima de restrictie in aval de insertul ADN, ceea ce cauzeaza desprinderea polimerazei de pe matrita, odata ce a ajuns la punctul respectiv. Cele mai multe plasmide utilizate pentru transcriptia in vitro au doi promotori polimerazici fagici care flancheaza site-ul de inserare, ceea ce permite transcriptia ARNului sens cu o polimeraza si a ARN-ului antisens cu cealalta.