P. 1
Metode de Analiza

Metode de Analiza

|Views: 265|Likes:
Published by mougal

More info:

Published by: mougal on May 14, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/21/2014

pdf

text

original

Sections

  • I. ANALIZE GENETICE
  • Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare
  • II. CULTURI CELULARE
  • Culturi celulare
  • III. MICROSCOPUL CONFOCAL RAMAN
  • Microspectroscopia Raman
  • IV. SPECTROMETRUL IR
  • Spectroscopia de absorbţie în infraroşu
  • Tendinţe moderne în spectroscopia de absorbţie IR
  • V. SPECTROFLUORIMETRUL
  • Spectrofluorimetria
  • Spectrofluorimetria - aplicaţii
  • VI. SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ
  • Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S)
  • Rezonanţa magnetică nucleară pe sisteme lichide
  • VII. MĂSURĂTORI TERMICE
  • Analiză termică diferenţială Analiză calorimetrică diferenţială
  • VIII. DIFRACTOMETRUL DE RAZE X
  • Difracţie de raze X pe pulberi
  • Determinarea structurii cristaline prin difracţie de raze X
  • IX. MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE
  • Microscopia electronică
  • Microscopia electronică - partea a II-a
  • X. MICROSCOPUL DE FORŢĂ ATOMICĂ
  • Microscopia de forţă atomică
  • Spectroscopia fotoelectronică
  • XII. SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN
  • Spectroscopia de rezonanţă electronică de spin
  • Spectroscopia de rezonanţă electronică de spin – partea a II- a
  • XIII. METODE ELECTROCHIMICE
  • Electrochimia unei substanţe cu potenţial biologic activ Studiu de caz
  • Sisteme de analiză a suprafeţei specifice şi a dimensiunii particulelor

Editori Mihaela Aluaş Simion Simon

Metode experimentale avansate pentru studiul şi analiza bio-nano-sistemelor

1

2

Editori Mihaela Aluaş Simion Simon

METODE EXPERIMENTALE AVANSATE
PENTRU STUDIUL ŞI ANALIZA BIO-NANO-SISTEMELOR

Casa Cărţii de Ştiinţă Cluj-Napoca, 2012 3

Coperta: Patricia Puşcaş

Editură acreditată CNCSIS (24)

© Universitatea „Babeş-Bolyai”, 2012

Material editat în cadrul proiectului „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, ID 36154

Descrierea CIP a Bibliotecii Naţionale a României Metode experimentale avansate pentru studiul şi analiza bio-nanosistemelor / ed.: Mihaela Aluaş, Simion Simon. - Cluj-Napoca : Casa Cărţii de Ştiinţă, 2012 Bibliogr. ISBN 978-606-17-0115-5 I. Aluaş, Mihaela (ed.) II. Simon, Simion (ed.) 53

4

Prefaţă
În calitate de director al proiectului cu titlul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract” POSDRU/21/1.5/G/36154, doresc să mulţumesc tuturor colaboratorilor care au contribuit prin expertiza şi profesionalismul lor la realizarea acestui volum şi, implicit, la dezvoltarea programului doctoral. Mulţumirile mele se îndreaptă de asemenea către echipa de management a proiectului, în următoarea componenţă: Prof. dr. Simion Simon, coordonator ştiinţific program doctoral Prof. dr. Octavian Popescu, coordonator ştiinţific relaţii internaţionale Cristina Dominic, asistent manager Andra Ghira, responsabil logistic şi asistent manager Jr. Alexandru Braşoveanu, consilier juridic Ec. Gelu Silviu Moldovan, responsabil financiar Ing. Carmen Ciplea, expert IT Ec. István Püsök, expert contabil Am convingerea că informaţia cuprinsă în această lucrare va sprijini generaţiile prezente şi viitoare de conducători de doctorat în activitatea lor de cercetare. De asemenea, va facilita orientarea doctoranzilor în lumea minunată a ştiinţei contribuind la determinarea acestora de a face din meseria de cercetător o vocaţie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract POSDRU/21/1.5/G/36154, a fost cofinanţat din Fondul Social European prin Programul Operaţional Sectorial Dezvoltarea Resurselor Umane 2007-2013. C.S.III. dr. Mihaela ALUAŞ 5

6

Cuvânt înainte
Institutul de Cercetări Interdisciplinare a fost înfiinţat prin Hotărârea Senatului Universităţii Babeş-Bolyai din data de 30.05.2001, ca unitate de cercetare şi transfer tehnologic, având ca obiectiv de activitate atât realizarea de studii şi cercetări interdisciplinare în domeniile biologie moleculară, biomateriale şi sisteme biologice, materiale avansate şi mediu ambiant, sisteme nanostructurate natural şi artificial, cât şi transferul rezultatelor obţinute către beneficiari locali, naţionali sau internaţionali. Institutul beneficiază de o clădire proprie, cu o suprafaţă desfăşurată de peste 3000 mp, modernizată la nivelul standardelor internaţionale din punct de vedere al dotărilor conexe şi având laboratoare de cercetare structurate în acord cu nevoile cercetărilor interdisciplinare menţionate. Între timp institutul, prin efortul conjugat al celor care au decis să-şi dedice energia şi cunoştinţele cercetărilor la interfaţa Bio-NanoSistemelor, a devenit Institutul de Cercetări Interdisciplinare în Bio-NanoŞtiinţe (ICI-BNS). În cadrul acestuia îşi desfăşoară activitatea în prezent 12 profesori universitari (dintre care 10 conducători de doctorat), 25 alte cadre didactice şi cercetători şi peste 40 de doctoranzi cu frecvenţă. Aceştia aparţin domeniilor Fizică, Chimie, Biologie, Informatică, Ştiinţa mediului şi Psihologie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară” a oferit posibilitatea de a mobiliza un set de cercetători valoroşi, cu experienţă deosebită în tehnicile experimentale frecvent utilizate în cercetările interdisciplinare din domeniul Bio-Nano-Ştiinţelor. Marea majoritate a experţilor a beneficiat de stagii doctorale sau postdoctorale în prestigioase laboratoare din lume unde au dobândit o bogată experienţă în utilizarea echipamentelor de înaltă performanţă de care dispune Institutul nostru. Studenţii doctoranzi, dar şi specialişti din domenii ca: fizică, chimie, biologie, geologie sau ştiinţa mediului interesaţi în studii experimentale interdisciplinare vor găsi în materialele incluse în prezentul volum date teoretice dar mai ales practice, despre tehnici experimentale avansate prezentate într-o formă accesibilă, cu exemple semnificative, menite a facilita înţelegerea fenomenelor studiate şi a contribui la creşterea aportului fiecărui cercetător la dezvoltarea domeniului în care îşi va desfăşura activitatea ştiinţifică. Prof. Dr. Simion SIMON Director ICI-BNS

7

8

CUPRINS
I. ANALIZE GENETICE ................................................................................................. 13 Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine.......................................................................................................................... 13 Asist. univ. dr. Iulia Lupan Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare ........... 36 Asist. univ. dr. Iulia Lupan II. CULTURI CELULARE ............................................................................................... 64 Culturi celulare ........................................................................................................... 64 Lect. dr. Mircea Teodor Chiriac Culturi celulare – partea a II-a .................................................................................... 82 Lect. dr. Mircea Teodor Chiriac III. MICROSCOPUL CONFOCAL RAMAN............................................................ 101 Microspectroscopia Raman....................................................................................... 101 Conf. dr. Monica Maria Baia Microspectroscopia Raman – partea a II-a................................................................ 121 Conf. dr. Monica Maria Baia IV. SPECTROMETRUL IR........................................................................................... 134 Spectroscopia de absorbţie în infraroşu .................................................................. 134 Lect. dr. Nicolae Leopold Tendinţe moderne în spectroscopia de absorbţie IR ............................................. 147 Lect. dr. Nicolae Leopold V. SPECTROFLUORIMETRUL .................................................................................. 160 Spectrofluorimetria .................................................................................................... 160 Conf. dr. Dana Maniu Spectrofluorimetria - aplicaţii ................................................................................... 172 Conf. dr. Dana Maniu VI. SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ ......... 191 Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) .................. 191 C.S.I. dr. Claudiu Filip, C.S.III. dr. Mihaela Aluaş Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă .......................................................................................................... 216 C.S.I. dr. Claudiu FILIP, C.S.III. dr. Mihaela Aluaş

9

Rezonanţa magnetică nucleară pe sisteme lichide ................................................ 246 Lect. dr. Mihai Vasilescu VII. MĂSURĂTORI TERMICE .................................................................................. 266 Analiză termică diferenţială. Analiză calorimetrică diferenţială......................... 266 Conf. dr. Raluca Ciceo-Lucăcel Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială. Ghid de interpretare a măsurătorilor DTA/TG şi DSC........................................................................................................................... 275 Conf. dr. Raluca Ciceo-Lucăcel VIII. DIFRACTOMETRUL DE RAZE X ................................................................... 286 Difracţie de raze X pe pulberi ................................................................................... 286 C.S.I. dr. Gheorghe Borodi Determinarea structurii cristaline prin difracţie de raze X................................... 305 C.S.I. dr. Gheorghe Borodi IX. MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE ........... 327 Microscopia electronică ............................................................................................. 327 şef lucrări dr. Lucian Barbu-Tudoran Microscopia electronică - partea a II-a .................................................................... 347 şef lucrări dr. Lucian Barbu-Tudoran X. MICROSCOPUL DE FORŢĂ ATOMICĂ ............................................................ 365 Microscopia de forţă atomică ................................................................................... 365 Conf. dr. Ioan Burda Microscopia de forţă atomică – partea a II-a ........................................................... 378 Conf. dr. Ioan Burda XI. SPECTROMETRUL DE FOTOELECTRONI DE RAZE X ŞI ULTRAVIOLETE .......................................................................................................... 394 Spectroscopia fotoelectronică ................................................................................... 394 C.S.III. dr. Maria Teodora Radu Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale ................................................................................... 424 C.S.III. dr. Teodora Maria Radu, C.S.dr. Emilia Sabina Varga XII. SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN .......... 437 Spectroscopia de rezonanţă electronică de spin ................................................... 437 C.S. dr. Milica Todea Spectroscopia de rezonanţă electronică de spin – partea a II- a ............................ 452 C.S. dr. Milica Todea

10

.....................XIII.. dr... METODE ELECTROCHIMICE ..................... SISTEME DE ANALIZĂ A SUPRAFEŢEI SPECIFICE ŞI A DIMENSIUNII PARTICULELOR ............ 467 Conf......................... ing......... Graziella Liana Turdean Electrochimia unei substanţe cu potenţial biologic activ.... Studiu de caz ....... Graziella Liana Turdean XIV.. testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice ....... Réka Barabás     11 .. dr................... 509 Lect...................... ing... dr....................... ing.. 467 Elaborarea.................... 509 Sisteme de analiză a suprafeţei specifice şi a dimensiunii particulelor .... 490 Conf..

  12 .

........................................... Păstrarea include transmiterea materialului genetic nemodificat de la o generaţie la alta.. Acest fapt este realizat prin replicarea ADN şi împărţirea egală a celor două copii în timpul diviziunii celulare.......... 13 ................................ Mesagerul informaţiei între ADN şi proteine este ARN...... Bibliografie ..... ANALIZE GENETICE Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine Asist.......... A doua funcţie este legată de descifrarea informaţiei pentru sinteza de proteine... ARNm rezultat serveşte ca matriţă în procesul de traducere a ADN (sinteza proteinelor) care are loc în ribozomi............. Practic ARN este cărăuşul informaţiei din nucleu în citoplasmă unde are loc sinteza proteinelor. Nu există cazuri de transmitere a informaţiei de la ADN direct la proteine... Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare .............. care este sintetizat în procesul de transcriere a ADN de către o enzimă numită ARN polimerază........... 34 1.................................. de la proteine la ADN...................... univ............ Infrastructura existentă în cadrul Centrului de Biologie Moleculară . 33 4.................................... Dogma centrală a biologiei presupune transmiterea unidirecţională a informaţiei de la ADN la proteine prin intermediul ARN (Figura 1).. Iulia Lupan Cuprins 1................................................. Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot ADN în sine are doar 2 funcţii importante şi anume păstrarea informaţiei genetice şi furnizarea acesteia pentru sinteza de proteine............. 13 2...... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot .. Informaţia genetică nu poate fi transmisă invers.....I. 31 3..... dr................. Informaţia genetică poate fi transmisă de la ARN la ADN în cazul retrovirusurilor la care materialul genetic este ARN.......

îndeplineşte anumite funcţii în celulă (în cea mai mare parte participă la procesul de traducere) şi ocupă cea mai mare parte din ARN total din celulă: ARN ribosomal (ARNr) şi ARN de transport (ARNt). procesul clonării constă din următoarele etape: • amplificarea genei de interes • introducerea genei de interes într-un vector de clonare • introducerea moleculelor recombinate în celule gazdă • selecţia celulelor transformate (purtătoare ale moleculei recombinate) Figura 1.Clonarea genelor constă în izolarea unei gene dintr-un genom şi introducerea ei în alte celule gazdă pentru multiplicare şi în unele cazuri pentru exprimare. care necesită apoi o izolare din amestecul de fragmente generate. Prin multiplicarea celulelor cu genele clonate se pot obţine milioane de copii ale unei singure gene. Există 2 modalităţi de a obţine fragmentul dorit. Din această cauză în continuare se va utiliza doar termenul fragment ADN de interes pentru a evita confuziile. Sumar. A doua opţiune de copiere a fragmentului din genom este cea mai des 14 . fie prin copierea acestuia. ci un fragment de ADN care nu poate fi separat dintr-un amestec heterogen de molecule apropiate ca mărime. fie prin tăierea acestuia din genom. De cele mai multe ori genele de interes care sunt scopul clonării codifică un polipeptid. În alte cazuri scopul clonării nu este obligatoriu o genă. Dogma centrală a biologiei. ARN informaţional este ARN mesager (ARNm) care codifică un polipeptid şi serveşte ca matriţă în procesul de traducere (sinteză a proteinelor). Moleculele de ARN rezultate în urma transcrierii pot fi împărţite în 2 categorii: • ARN funcţional • ARN informaţional ARN funcţional este ARN care nu se traduce. iar numărul moleculelor deci şi cantitatea de ADN este mică. Tăierea fragmentului din genom este mai dificilă deoarece necesită prezenţa unor situsuri (secvenţe specifice) la capetele fragmentului. O genă este considerat orice fragment de ADN care se transcrie într-o moleculă de ARN. Deoarece fragmentul ADN de interes sau ţintă se află într-un genom este necesară extragerea acestuia. • verificarea moleculelor recombinate Amplificarea genei de interes.

iar după 35-40 de cicluri se obţin milioane de copii ale fragmentului ţintă pornind de la o singură copie. în special la capetele acesteia. Procesul este reversibil. Tehnica este pe larg utilizată. aici rolul unora dintre ele este preluat de unii factori fizici. Există mai multe formule de calcul. O condiţie obligatorie pentru o amplificare reuşită este cunoaşterea secvenţei ţintă. În acest scop se utilizează tehnica PCR (Polymerase Chain Reaction).utilizată. cea mai simplă formulă de calcul pentru o amorsă de până în 25 de nucleotide este: Tm = 4 (G + C) + 2(A + T) 15 . Aceste amorse sunt complementare cu extremităţile secvenţei ţintă şi formează cu acestea porţiuni scurte dublu catenare. Denaturarea din primul ciclu durează câteva minute (2-6) deoarece pentru denaturarea moleculelor de ADN genomic. sunt secvenţe scurte de ADN monocatenar. Denaturarea ADN presupune separarea celor două catene. care sunt foarte mari. e nevoie de mai mult timp. Această etapă este numită de aliniere sau hibridizare. Amorsele (termenul englezesc este primer). Această tehnică poate fi considerată un adevărat copiator de gene. fiecare ciclu fiind alcătuit din 3 etape: • denaturarea ADN • alinierea amorselor • sinteza catenei complementare de către ADN polimerază După fiecare ciclu practic cantitatea de ADN se dublează. temperatura este coborâtă la 40-60ºC timp de câteva zeci de secunde. catenele complementare formând molecula dublu catenară după înlăturarea agentului de denaturare. denumite şi oligonucleotide. Etapele de denaturare după primul ciclu sunt mai scurte. Pentru alinierea amorselor la secvenţele complementare. Dacă secvenţa este necunoscută. Dacă în celule pentru replicare se foloseşte o întreagă serie de proteine. atunci se vor analiza cel puţin secvenţe ADN omoloage de la alte specii sau secvenţa de aminoacizi a proteinei dacă este vorba despre o genă. este rapidă şi sensibilă deoarece necesită cantităţi foarte mici de ADN matriţă. Principiul tehnicii PCR este o imitaţie a procesului de replicare a ADN care are loc în celule. Denaturarea ADN este necesară pentru separarea celor 2 catene. Temperatura de topire se calculează în dependenţă de lungimea amorsei şi de compoziţia ei. cum ar fi spre exemplu denaturarea ADN. Ca agent denaturant se utilizează temperaturi înalte de 94-98ºC. doar de 30-45 sec. Reacţia de amplificare este una ciclică. Temperatura de aliniere se stabileşte la câteva grade (2-5ºC) mai puţin decât temperatura de topire (Tm) a amorsei.

Salvarea acestei metode a venit după descoperirea şi descrierea ADN polimerazelor de la bacteriile termofile. Taq polimeraza are activitatea optimă la 72°C şi nu se denaturează la temperaturi ridicate de peste 90°C foarte repede. C. ADN polimeraza catalizează sinteza catenei complementare în direcţia 5'→3' (Figura 2). De la aceste porţiuni dublu catenare formate între catena matriţă şi amorsa ADN. Amorsele servesc în primul rând la delimitarea fragmentului amplificat. care are activitatea optimă de sinteză la 37°C. A şi T sunt numărul de nucleotide ce conţin aceste baze azotate. pe larg utilizată şi astăzi este Taq polimeraza. polimeraza poate iniţia sinteza catenei complementare. Astfel amplificarea fragmentelor de ADN era una foarte costisitoare. dar şi ca punct start pentru ADN polimerază. Enzima revoluţionară în acest sens. Viteza de polimerizare a Taq polimerazei este de 16 . Cel mai mare dezavantaj al utilizării acestei enzime era inactivarea termică în timpul denaturării ADN. Iniţial la originea tehnicii PCR se folosea ADN polimeraza izolată de la bacteria Escherichia coli.Unde G. deoarece oferă o stabilitate mai mare • amorsele nu trebuie să prezinte complementaritate internă. izolată de la o bacterie termofilă Thermococcus aquaticus (de unde şi denumirea ei). în caz contrar amorsa poate forma secvenţe interne dublu catenare care au aspect de stem sau buclă • cele două amorse sens (forward) şi antisens (reverse) nu trebuie sa fie complementare între ele. Această enzimă este o ADN polimerază. care nu poate porni sinteza de la zero şi are nevoie de un capăt liber 3'. iar ca rezultat se vor amplifica porţiunile scurte rămase monocatenare. În acest fel tuburile de reacţie trebuiau schimbate de la o temperatură la alta şi după fiecare ciclu era nevoie de un surplus de ADN polimerază. astfel după câteva ore la 95°C pierderea de activitate este nesemnificativă. Există câteva reguli pentru construirea amorselor şi anume: • numărul de nucleotide este de 15-35 • temperatura de topire a amorselor trebuie să fie între 40 şi 70ºC • conţinutul de G şi C nu trebuie să depăşească 50-55% • la capătul 3' al amorsei este de dorit să fie o G sau C. altfel se vor forma porţiuni dublu catenare sau dimeri de amorse. în consecinţă moleculele bogate în G şi C au o temperatură mai mare de topire. Numărul de G şi C se înmulţeşte dublu faţă de A şi T deoarece între acestea există 3 legături de hidrogen. care sintetizează polimerizarea nucleotidelor trifosfat într-un lanţ polinucleotidic în direcţia 5′→3′.

Durata elongării necesare sintezei va fi în dependenţă de mărimea fragmentului ţintă.aproximativ 1000 de nucleotide per minut. iar pentru un fragment de 2000 de nucleotide – 2minute. Etapa iniţială de denaturare 5' 3' ADN genomic cu fragmentul ţintă 3' 5' 5' 3' 3 5' Alinierea amorselor la capetele fragmentului ţintă 3' 5' 3 ' 5' Ciclu I 5' 3' Etapa de elongare sau sinteză a catenei complementare de către ADN polimerază 3' 5' 5' 3' Sfârşitul primului ciclu 3' 5' 5' 3' 3' 5' 5' 3' 3' 5' 5' 3' 5' 3' 3' 3' 5' Ciclu II 5' 3' 5' 3' 3' 3' 5' 17 . Pentru un fragment de 500 de nucleotide vor fi suficiente 30 sec.

Acest tip este asemănător PCR obişnuit. Aceste enzime au fost descoperite la bacterii şi se presupune că funcţia lor este de apărare contra bacteriofagilor (virusuri ale bacteriilor). care este de fapt o ADN polimerază ARN-dependentă. RT-PCR se utilizează pentru obţinerea copiilor de gene eucariote care nu conţin introni şi analiza exprimării de gene. În mo18 . Restrictazele recunosc doar anumite secvenţe scurte numite situsuri specifice de recunoaştere. Un tip special de PCR este RT-PCR sau PCR de transcriere inversă. se fixează de acestea şi taie legăturile fosfoesterice între nucleotide. Ele pot fi numite cu alte cuvinte adevărate foarfece de ADN. doar că foloseşte o matriţă de ARN pentru a sintetiza ADN. Enzime de restricţie Enzimele de restricţie sau restrictazele sunt enzime care taie molecule monocatenare sau dublu catenare de ADN la anumite situsuri specifice. Enzima responsabilă de această sinteză este transcriptaza inversă. Reprezentarea schematică a primelor cicluri de PCR. Taq polimeraza este o ADN polimerază deoarece sintetizează ADN şi este ADN dependentă deoarece utilizează o matriţă ADN pentru sinteză. În ambele cazuri se porneşte de la ARNm (ARN informaţional care codifică proteine).5' 3' 5' 3' 3' 5' 3' 5' 5' 3' 3' 5' 3' 3' Ciclu III 5' 3' 3' 5' 3' 5' 3' 5' 5' 3' 3' 5' 5' 3' 3' Taq polimeraza amorsă amorsă ce indică direcţia de sinteză Figura 2. Transcriptaza inversă a fost izolată de la virusurile care au material genetic ARN şi în momentul intrării în celulă necesită sinteza unei copii a materialului său genetic.

Până acum au fost descrise 4000 de enzime de restricţie de la câteva sute de specii bacteriene. Astfel. ADN bacterian propriu este protejat contra enzimelor de restricţie prin metilarea unor baze azotate. A EcoRI B SmaI 5′ GAATTC CTTAAG 3′ 3′ 5′ 5′ GGGCCC CCCGGG 3′ 3′ 5′ 5′ G CTTAA 3′ AATTC G 3′ 5′ 5′ GGG CCC 3′ CCC GGG 3′ 5′ Figura 3. enzimele de restricţie. II şi III. Secvenţele de recunoaştere pentru enzimele EcoRI (A) şi SmaI (B) şi capetele libere după tăiere. Această clasificare este în dependenţă de cofactorul utilizat şi de secvenţa de recunoaştere. 19 . în general. Secvenţa palindrom este alcătuită din 4-6 nucleotide şi citită pe ambele catene în direcţia 5′→3′ este identică. Nomenclatura enzimelor de restricţie porneşte de la denumirea bacteriei de la care a fost izolată. iar EcoRI de la Escherichia coli tulpina RY13. nu taie ADN metilat. Capetele libere după tăierea de către enzimele de restricţie pot fi de 2 feluri: coezive sau drepte. Cu ajutorul unor programe speciale se pot alcătui hărţi de restricţie care reprezintă situsurile de recunoaştere pentru diferite restrictaze într-o secvenţă (Figura 4). Locurile de tăiere sunt indicate cu săgeţi. care au secvenţa de recunoaştere un palindrom şi utilizează ioni de Mg2+ ca şi cofactor. iar enzimele SmaI şi EcoRV generează capete drepte sau netede (Figura 3). HindIII este izolată de Heamophilus influenzae tulpina Rd. enzimele de restricţie digeră aceste molecule. Toate aceste enzime se împart în 3 clase: I. Enzimele cele mai utilizate în tehnicile moleculare sunt cele de tip II.mentul intrării ADN fagic în bacterii. Enzima BamHI şi EcoRI generează capete coezive după tăiere.

Figura 5. plasmide şi vectori artificiali.B am H I (533) H inf I (7 5) E co RV (5 8) H inf I (32) H inf I (461) E co RI (605) H inf I (616) E co RI (633) B am H I (7 7 3) NcoI (7 7 7 ) H inf I (942 Y LR3 7 7 C 1047 bp Figura 4. Vectori de clonare Prin vectori de clonare subînţelegem molecule de ADN transportatoare ale fragmentului de ADN străin în celulele gazdă. ADN ligaza T4 utilizează ATP ca şi cofactor. Un plasmid este o moleculă dublu catenară de ADN. Harta de restricţie a unei gene de la drojdia Saccharomyces cerevisiae. Cea mai des utilizată este ADN ligaza T4 izolată de la bacteriofagul T4. care este circulară. închisă şi capabilă de replicare autonomă în celule 20 . Reprezentarea schematică de legare de către ADN ligază a două fragmente ADN care au capete netede. acestea nu pot fi legate prin creare de noduri sau nu există nici un lipici special. Funcţia ligazei în celule vii este legarea fragmentelor în timpul replicării. recombinării şi după repararea ADN. Cele mai pe larg utilizate sunt plasmidele. Ligarea fragmentelor de ADN Deşi moleculele de ADN pot fi asemănate cu nişte fire. bacteriofagi. Pentru legarea fragmentelor de ADN se utilizează o enzimă numită ADN ligază. Cu cifre în paranteze sunt indicate situsurile enzimelor de restricţie. Vectorii sunt de mai multe tipuri: cosmide. Această enzimă reface legăturile fosfoesterice între gruparea hidroxil a unui nucleotid (capătul 3′) şi gruparea fosfat de la nucleotidul altui fragment (capătul 5′) (Figura 5). Aceşti vectori sunt utilizaţi în dependenţă de scopul clonării.

mai corect spus produsul genei conferă rezistenţă. În acest fel coloniile re21 . SMC conţine secvenţele de recunoaştere pentru mai multe enzime de restricţie care nu se conţin în altă regiune a vectorului. se însămânţează pe un mediu cu ampicilină. Astfel dacă un amestec de celule transformate cu plasmide care vor conţine atât celule cu. Plasmidele care conţin gena pentru această enzimă vor proteja celulele bacteriene de efectul antibioticului. care este originea de replicare. vor supravieţui doar celulele care conţin plasmidul.gazdă. Plasmidele au nişte secvenţe specifice necesare replicării. Plasmidele comerciale utilizate pe larg sunt plasmide naturale izolate de la bacterii care au fost modificate. clonării. Nicio moleculă de ADN nu poate fi replicată fără o origine de replicare. O regiune foarte importantă într-un vector de clonare este Situsul Multiplu de Clonare (termenul englezesc este Multiple Cloning Site). Atât vectorul cât şi fragmentul ADN sunt tăiate cu aceleaşi enzime de restricţie şi legate împreună cu ajutorul ligazei. Insert se referă la fragmentul de ADN ţintă clonat. În acest scop situsul multiplu de clonare se află într-o genă ce codifică o enzimă. cât şi fără plasmid. produsul ei este o proteină activă. iar produsul format în urma reacţiei va avea o culoare albastră. Cei mai frecvenţi markeri utilizaţi sunt genele ce conferă rezistenţă la antibiotice. Originea de replicare este o regiune a moleculei de ADN de unde poate începe replicarea şi care este recunoscută de anumite proteine care iniţiază replicarea. selecţiei şi uneori exprimării genelor. Pentru replicarea autonomă în celule gazdă plasmidele conţin secvenţa ori. Dacă în SMC a fost introdus un fragment ADN atunci gena este modificată şi produsul ei este inactiv. Spre exemplu. O altă componentă foarte importantă a plasmidelor sunt markerii de selecţie care sunt de obicei nişte gene. Spre exemplu dacă SMC se află în gena lacZ′ care codifică subunitatea α a enzimei β-galactozidază. Dacă β-galactozidaza este activă atunci va metaboliza acest substrat. Dacă în SMC nu a fost introdus niciun fragment ADN atunci gena este intactă. β-lactamaza conferă rezistenţă la ampicilină. a căror produs (enzimă) fac posibilă selectarea celulelor cu plasmid de cele fără plasmid care sunt mai numeroase. Un alt fel de selecţie este selecţia celulelor transformate cu plasmid recombinat adică cu insert de cele cu plasmid fără insert. În această regiune se introduce fragmentul ţintă de ADN cu ajutorul enzimelor de restricţie şi a ligazei. atunci produsul acestei gene împreună cu subunităţile codificate din genomul celulei gazdă bacteriene vor forma o enzimă activă capabilă să metabolizeze un derivat al galactozei numit X-Gal (bromo-cloro-indolil galactopiranozid) care este adăugat în mediu şi este incolor.

Celulele bacteriene care au plasmidul cu insert vor avea gena nefuncţională şi vor supraveţui. Aceste etichete vor fi parte integrantă a proteinelor la 22 . Plasmidele de exprimare trebuie să mai conţină câteva elemente în plus faţă de vectorii de clonare. care se fixează la nivelul promotorului şi iniţiază transcrierea. codonii START şi STOP care delimitează cadrul deschis de citire (termenul englezesc este Open Reading Frame). Pentru vectorii mai mari numărul copiilor per celulă este mai mic. de aceea situsul de legare al ribozomilor (termenul englezesc este Ribosome Binding Site) este o secvenţă care se transcrie dar care nu se traduce şi care este recunoscută de ribosomi. În unele cazuri acesta este prezent după regiuni care codifică anumite aşa-zise etichete. Aceste elemente sunt cele care se găsesc şi în genom şi fac parte dintr-o genă: promotorul. Promotorul este o secvenţă care se află în amonte de genă şi este recunoscut de factorii de transcriere. în caz contrar acesta se poate introduce în fragmentul ţintă cu ajutorul amorselor. Codonul START la procariote este în cele mai dese cazuri ATG. Numai în prezenţa promotorului exprimarea va fi foarte scăzută. Acest codon este de obicei inclus în situsul multiplu de clonare. Cele mai des utilizate sunt eticheta de 6 histidine (His-tag). Astfel. Un alt tip de selecţie utilizează o enzimă toxică pentru celulele bacteriene. Etichetele facilitează purificarea proteinelor recombinate prin cromatografie de afinitate. situsul de legare al ribosomilor. O caracteristică importantă pentru plasmide este numărul de copii per celulă. B). Glutation S-transferaza (GST) şi proteina de legare a maltozei (Maltose Binding Protein. Vectorii de exprimare sunt de asemenea vectori de clonare dar care oferă în plus posibilitatea exprimării genei clonate (Figura 6 C). Codonul STOP este inclus şi el de obicei în situsul de clonare. deoarece ele nu produc enzimă activă capabilă de metabolizarea substratului X-Gal. Vectorii de clonare mai mici au de obicei un număr mai mare de copii per celulă. celulele cu plasmid fără insert au gena funcţională care va provoca moartea celulelor. Acest fapt permite obţinerea unei cantităţi mari de ADN plasmidic dintr-o cultură mică de bacterii (din 3-5 ml de cultură se pot obţine câteva μg de ADN plasmidic). iar cele ce conţin vector recombinat vor fi albe. în consecinţă şi pentru a obţine o cantitate mai mare de ADN este necesară o cantitate mai mare de cultură. doar de câteva mii de pb şi în care pot fi inserate fragmente de ADN de la 100 pb până la 2000-3000 pb (Figura 6: A. Ribosomii se leagă la acest situs şi se deplasează de-a lungul ARNm până întâlnesc primul codon START de unde începe traducerea. MBP este termenul în engleză).zultate după transformare care conţin vectorul fără insert vor fi albastre. Vectorii de clonare au de obicei mărime mică.

A Eco RI (4360) Sca I (3847) Pvu I (3737) Cla I (25) HindIII (30) Eco RV (188) Bam HI (376) Sph I (567) Sal I (652) B LacZ Eco RI Sac I (6 AP r Pst I (3612) bla(AmR) Kpn I (6 TC r pTZ57R 2886 bp Xba I (6 Bam HI pBR322 4361 bp MCS Apa I (6 Sal I (6 Pst I (6 Hin dI ORI Bst Z17I (2247) T7 p T7 terminator C f1 origin His tag XhoI (159) Not I (167) HindIII (174) Sal I (180) Sac I (191) Ori M CS Eco RI (193) bla (Ap) Bam HI (199 Nde I (239 pET-21a 5443 bp T7 prom Bgl II (34 lacI ColE1 pBR322 origin Figura 6. C – harta vector de exprimare pET21a de la Novagen care include gena bla care conferă rezistenţă la ampicilină. Hărţile unor vectori plasmidici. iar TCr rezistenţă la tetraciclină. promotorul de la fagul T7 care este inductibil cu IPTG. 23 . Plasmidul are rezistenţă la ampicilină. situsul multiplu de clonare care conţine un codon START şi un codon STOP după eticheta de 6 histidine. Etichetele vor conferi proteinelor recombinate afinitate faţă de anumite răşini cromatografice. situsul multiplu de clonare îl poate constitui oricare dintre cele două gene de rezistenţă. rezistenţa la antibioticul respectiv se va pierde . B – harta plasmidului de clonare pTZ57R comercializat de firma Fermentas.capătul ei C-terminal sau N-terminal dacă secvenţa ce codifică eticheta este prezentă după sau înainte de situsul de clonare respectiv. în dependenţă de gena selectată pentru inserare. iar situsul multiplu de clonare se află în gena lacZ' care oferă selecţia alb-albastră a clonelor pozitive. A – harta plasmidului pBR322 include 2 gene de rezistenţă la antibiotice: Apr conferă rezistenţă la ampicilină.

Doar unele celule bacteriene sunt transformate. Există două tipuri de transformare a celulelor bacteriene pe larg utilizate în laboratoarele de biologie moleculară: • transformarea chimică • transformare sub influenţa câmpului electric. Aceste spălări repetate vor asigura eliminarea ionilor care pot afecta transformarea. ceea ce înseamnă ca la transformarea unui μg de plasmid s-ar obţine 1 milion de colonii. Prepararea celulelor competente presupune doar creşterea lor până în faza logaritmică (D=600nm = 0. Numărul de colonii va corespunde numărului de celulele transformate deoarece fiecare colonie ia naştere dintr-o singură celulă. care va crea câmpul electric între doi electrozi. o valoare foarte mare ţinând cont de faptul că avem nevoie de o singură colonie 24 . După transformare celulele şocate sunt preluate în mediu de cultură şi apoi însămânţate pe mediu selectiv cu antibiotice. Ambele tipuri de transformare necesită inducerea unei competenţe de transformare. Celulele sunt şocate termic foarte scurt.8) şi înlăturarea prin spălări repetate a mediului de cultură.Introducerea moleculelor recombinate în celule gazdă Introducerea plasmidelor recombinate în celule gazdă se numeşte transformare dacă sunt utilizate celule bacteriene sau transfecţie dacă sunt celule eucariote. timp de maxim 2 minute. Eficienţa de transformare a celulelor se poate măsura efectuând o transformare cu o cantitate de 1 ng de ADN plasmidic şi apoi numărând coloniile rezultate. la 42°C. adică fără plasmid. Pentru acest tip de transformare este necesar un aparat numit electroporator. Acest timp este suficient pentru intrarea moleculelor recombinate în celulele bacteriene. Această competenţă în cazul transformării chimice este indusă cu CaCl2. În acest scop se realizează o cultură de E. cea mai mare parte dintre ele fiind netransformate.6-0. Amestecul de celule competente şi plasmide recombinate vor fi depuse într-o cuvă specială de electroporare. Transformarea are loc la o tensiune de 1800 sau 2500 V timp de câteva msec (Figura 7 B). În continuare se va detalia doar transformarea celulelor procariote. O eficienţă bună de transformare este 106. ai cărei pereţi laterali sunt electrozii. deoarece E. acestea având cea mai mare aplicabilitate şi simplitate în scopul obţinerii clonelor şi proteinelor recombinate. coli şi prin tratarea celulelor cu clorură de calciu la rece se poate induce transformarea celulelor bacteriene (Figura 7 A). Transformarea în câmp electric este mai eficientă decât transformarea chimică. coli nu are proprietăţi de transformare naturală. Numărul obţinut de la transformarea a 1 ng de ADN plasmidic se raportează la 1 μg de ADN (înmulţind valoarea la 1000).

Primul loc în utilizarea vizualizării acizilor nucleici aparţine electroforezei în gel de agaroză. A CaCl2 2 min 42ºC B Celule de E. B – electroporarea celulelor bacteriene. Această matrice este folosită mai rar în laboratoarele de analize genetice. Pentru proteine se aplică cel mai des electroforeza proteinelor în condiţii denaturante în gel de poliacrilamidă (termenul englezesc SDS-PAGE). Această sarcină face posibilă migrarea moleculelor de ADN şi ARN 25 .coli Însămânţarea celulelor transformate pe mediu selectiv Spălarea celulelor bacteriene 1800 V 5 msec Figura 7. mai ales în cazul fragmentelor mici. dar mai ieftină deoarece nu necesită aparatură şi cuve costisitoare. ea este utilizată cu succes deoarece este mai simplă. Migrarea moleculelor se realizează printr-o matrice specifică. Fiecare dintre cele două metode de transformare prezintă avantaje şi dezavantaje legate de eficienţa de transformare şi de costuri. A – transformarea chimică cu CaCl2. Poliacrilamida se poate utiliza ca matrice şi pentru electroforeza acizilor nucleici care oferă o rezoluţie foarte bună a separării fragmentelor de ADN. Transformarea celulelor bacteriene cu ADN plasmidic. Electroforeza acizilor nucleici Electroforeza este procesul de migrare a moleculelor cu sarcină într-un câmp electric. Metoda este aplicată pentru analiza proteinelor şi a acizilor nucleici. deoarece este mai laborioasă. Transformarea chimică este mai puţin eficientă decât electroporarea.coli Celule transformate de E. Deşi metoda oferă o rezoluţie inferioară celei din poliacrilamidă. Moleculele de acizi nucleici sunt încărcate negativ datorită grupărilor fosfat.sau de câteva când avem un amestec eterogen de molecule ţintă. Desigur în amestecul de ligare numărul de molecule recombinate este mic şi din această cauză este recomandată o eficienţă cât mai mare a celulelor competente.

cu atât mărimea porilor va fi mai mică. porii vor fi mai mari şi migrarea moleculelor mai rapidă. Gelurile de agaroză sunt plasate între cei doi electrozi în cuve speciale care conţin tampon de migrare. Bromura de etidiu se intercalează între bazele azotate din molecula dublu catenară de ADN. Gelurile de agaroză de 1% sunt cel mai des utilizate. Moleculele mici se vor deplasa mai repede prin porii matricei. B – fotografia aceluiaşi gel. Gelurile de agaroză se realizează prin încălzirea agarozei într-un tampon specific. Agaroza este un poliglucid extras din alge marine roşii.1 şi 10 kpb. iar concentraţii mari pentru fragmente mici. Acest tampon este acelaşi folosit şi pentru realizarea gelului. Pentru estimarea aproximativă a mărimii fragmentelor în acelaşi gel. Vizualizarea ne oferă informaţii despre integritatea ADN 26 . Amestecul de molecule nu se va deplasa în câmp electric cu aceeaşi viteză. iar cele mai mari vor avansa mai lent. A B Figura 8. Deoarece ADN nu poate fi vizualizat cu ochiul liber este necesară utilizarea unui colorant. Cele mai folosite tampoane sunt TAE (Tris/Acetat/EDTA) şi TBE (Tris/Borat/EDTA). A – imaginea gelului la expunerea în UV. Cel mai des folosită în acest scop este bromura de etidiu. Concentraţia agarozei în gel poate fi între 1 şi 3% în dependenţă de scopul urmărit. Lungimea de undă a luminii ultraviolete la care este expus gelul trebuie să fie cuprinsă între 260 şi 300 nm. dar în godeu separat se va migra un amestec de molecule cu mase moleculare diferite dar cunoscute. Separarea unor fragmente de ADN cu ajutorul electroforezei în gel de agaroză.într-un câmp electric de la catod la anod. Cu cât concentraţia agarozei este mai mare. Astfel separarea moleculelor va fi în dependenţă de masa lor moleculară. care fixată de ADN în lumină ultravioletă devine fluorescentă şi are o culoare portocalie (Figura 8). În concluzie concentraţii mai mici se folosesc pentru fragmente mari (câteva mii de pb). La concentraţii mai mici de agaroză. Acest amestec de molecule se numeşte marker molecular ADN. oferind separarea moleculelor între 0. Electroforeza în gel de agaroză este utilizată pentru vizualizarea şi purificarea ADN.

dar nu va furniza nicio informaţie despre secvenţa fragmentului clonat. Matriţa ADN ce urmează a fi secvenţiată este denaturată. dar asigură de obicei randamente de sinteză mai mari. Ambele aparate utilizează principiul Sanger de secvenţiere. Această digestie va confirma prezenţa insertului în plasmid şi aproximativ mărimea acestuia. În unele cazuri se utilizează un amestec de 2 polimeraze (3 părţi de Taq polimerază şi o parte Pfu polimerază) pentru a combina un randament mai mare cu o fidelitate crescută. rezultatul digestiilor enzimatice. Astfel de ADN polimeraze sunt Vent polimeraza. Tli polimeraza ş. estimarea cantităţii de ADN obţinută în reacţiile PCR sau de extracţie. Cultura se va incuba peste noapte cu agitare la 37°C. Apariţia coloniilor nu indică neapărat şi o reuşită deplină a clonării. Taq polimeraza nu are activitate de corectare a erorilor. Ziua următoare din bacteriile rezultate se va purifica ADN plasmidic cu ajutorul unor metode clasice sau cu ajutorul unor kituri speciale. acestea necesită totuşi o dovadă în plus a prezenţei plasmidului recombinat. Această verificare este necesară deoarece ADN polimeraza utilizată pentru amplificarea insertului prin PCR poate introduce erori de sinteză. a. Applied Biosystems. Verificarea moleculelor recombinate Rezultatul ligării şi transformării se poate vedea doar după 12-18 ore de la transformare când apar coloniile de E. ADN plasmidic etc). ADN poate fi purificat din gel de agaroză după migrare prin excizarea fragmentului ţintă şi purificarea din gel cu kituri special predestinate acestui tip de purificări. Chiar dacă se foloseşte un sistem alb-albastru de selecţie a coloniilor pozitive. deoarece acestea pot conţine un amestec de colonii pozitive şi colonii cu plasmid fără insert. ADN plasmidic urmează a fi analizat iniţial prin digestie enzimatică şi apoi prin secvenţializare. Analizor Genetic CEQ™ 8800 Genetic Analysis System (laser cu detecţie pentru 4 fluorocromi). Pentru a evita erorile în produşii PCR se poate utiliza o ADN polimerază care are proprietatea de a corecta erorile introduse. Secvenţializarea fragmentului ţintă este verificarea definitivă a clonării. În acest scop se va efectua o cultură lichidă de 3-5 ml de mediu cu antibiotic care se va însămânţa cu o singură colonie. Acest principiu presupune utilizarea unei variante de PCR pentru secvenţiere.(ADN genomic. Pfu polimeraza. coli pe mediu selectiv. SUA (laser cu detecţie pentru 5 fluorocromi). În cadrul Centrului de Biologie Moleculară există 2 secvenţiatoare: Analizorul Genetic ABI Prism 310. Digestia ADN plasmidic se va realiza cu enzimele de restricţie cu care acesta a fost introdus în vector sau care se află la extremele situsului multiplu de clonare. apoi la unul din capetele sale are loc ataşarea 27 .

unei amorse de la care ADN polimeraza va porni sinteza catenei complementare. iar clonele pozitive sunt apoi secvenţializate. Amestecul de fragmente rezultate sunt separate cu ajutorul electroforezei capilare. Clonarea în scopul multiplicării fragmentului este utilizată atunci când ADN supus analizei este de fapt un amestec de fragmente care nu pot fi separate cu ajutorul electroforezei şi la care se urmăreşte cunoaşterea secvenţei. fiecare ddNTP este marcat cu un fluorocrom. care presupune utilizarea unui capilar cu un diametru de ordinul micrometrilor. În acest scop amestecul de fragmente se clonează într-un vector de clonare. cele mai mici vor fi primele. Numărul de cicluri este de 40. În ultima parte a capilarului există o fereastră transparentă prin care un fascicol laser va excita fluorocromii. Electroforegramele sunt apoi analizate şi comparate cu secvenţa existentă în bazele de date. 28 . O cantitate de câţiva microlitri vor fi separaţi în gelul din capilar. Exprimarea genelor în sistem procariot Clonarea genelor vizează în principal două obiective posibile: multiplicarea unui fragment ADN sau exprimarea genei clonate. Lipsa acestei grupări va face imposibilă continuarea sintezei ADN. Amestecul PCR conţine dezoxiribonucleozide trifosfat (dNTP) dar şi di-dezoxiribonucleozide trifosfat (ddNTP) care nu conţin gruparea OH în poziţia 3' a dezoxiribozei. ceea ce permite sinteza tuturor fragmentelor care se opresc în toate punctele matriţei de ADN. Electroforegrama unei secvenţe obţinută cu ajutorul analizorului ABI Prism 310. Pentru detecţia fragmentelor. Figura 9. Mărimea fragmentelor de ADN care pot fi secvenţializate variază între 600 şi 800 pb. Migrarea fragmentelor în gel este în dependenţă de mărimea lor. iar la final cele mai mari. Rezultatul acestui PCR vor fi fragmente monocatenare (deoarece se foloseşte o singură amorsă) de diferite mărimi. deoarece ADN polimeraza nu poate adăuga următorul nucleotid. iar fluorescenţa emisă va fi captată şi prezentată sub forma unei electroforegrame (Figura 9). Pentru fragmente mai mari sau pentru matriţe dificile (cu secvenţe repetitive) este necesară utilzarea unor kituri speciale.

care este un analog al galactozei. Ele pot fi numite adevărate fabrici de proteine la comandă. un situs de legare a ribosomilor (rbs). atunci în genă se va păstra codonul STOP şi traducerea se va opri înainte de etichetă. Vectorii pET necesită tulpini de E. care însă câteodată „refuză” să sintetizeze proteinele comandate şi de ce cele mai dese ori străine celulei bacteriene. Promotorii din aceste tipuri de plasmide sunt de tip inductibil. Plasmidul pET21 conţine promotorul de la fagul T7. atunci din genă se va înlătura codonul STOP. Promotorul T7 nu este recunoscut de către ARN polimeraza de la E. adică împărţirea exactă pe codoni a genei de la primul codon tradus până la ultimul. situsul de recunoaştere a ribosomilor. coli sunt utilizate pe larg în obţinerea de proteine recombinate. coli în lipsa inductorului. Cel mai des utilizat inductor este IPTG (isopropil-tio-galactozid). Spre exemplu. coli şi simpla prezenţă a plasmidului în celulele bacteriene nu va sigura o exprimare a genei. Clonarea în scopul exprimării genei şi obţinerii de proteină recombinată include câteva aspecte care sunt importante pentru exprimare. 29 . Această genă se află sub controlul promotorului lac UV5 şi a operatorului lac (Figura 10). Gena codificatoare poate fi clonată direct în vectorul de exprimare. Dacă această etichetă nu este necesară. Inhibiţia exprimării genei pentru ARN polimeraza de la fagul T7 şi a genei ţintă în celulele gazdă de E. coli care conţin gena pentru ARN polimerază de la fagul T7. vectorii de tip pET de la Novagen asigură de obicei o supraexprimare a genelor clonate. un codon START şi unul STOP la capetele situsului multiplu de clonare. Foarte important în acest caz este păstrarea cadrului deschis de citire. Figura 10. Dacă se optează pentru prezenţa unei etichete 6×His la capătul C-terminal a proteinei pentru facilitarea purificării. codonul START în situsul multiplu de clonare şi codonul STOP după o etichetă de 6 histidine. Plasmidele de exprimare conţin neapărat un promotor recunoscut de ARN polimeraza celulei gazdă.Celulele de E.

30 . Purificarea proteinelor recombinate Proteinele recombinate pot fi purificate prin metode cromatografice. Represorul lac este codificat de gena lacI care se află atât în genomul bacteriei gazdă cât şi în plasmidul de exprimare. Pentru o purificare cât mai bună din amestecul total de proteine este necesară purificarea în cel puţin 2 etape prin metode cromatografice diferite. Dacă eticheta deranjează în analiza ulterioară a proteinei. coli care va transcrie gena pentru T7 ARN polimerază. Reprezentarea schematică a purificării de proteine recombinate prin cromatografie de afinitate. În absenţa T7 ARN polimerazei nu va exista nici transcrierea genei ţintă din plasmid. A – încărcarea amestecului total de proteine pe coloana cu răşină. Agentul care induce exprimarea este un analog al galactozei IPTG. cum este spre exemplu situsul pentru trombină în cazul plasmidului pET28. B – spălarea coloanei cu tampon şi fixarea proteinei ţintă de răşină. atunci se poate recurge la înlăturarea acesteia prin digestie cu peptidaze. În acest scop pentru clonare şi exprimare se va alege un plasmid care conţine situsul pentru peptidază.Operatorul lac este o secvenţă recunoscută de către o proteină numită represorul lac. ceea ce reduce timpul necesar şi asigură randamente de purificare mai mari (Figura 11). Moleculele de IPTG se fixează de represorul lac şi cauzează disocierea acestuia de la operatorul lac. care în acest caz este gena pentru T7 ARN polimerază. Ataşarea unor etichete la proteinele recombinate asigură purificarea proteinelor într-o singură etapă. Acest sistem de exprimare este unul foarte puternic şi care poate asigura o producţie de proteină care va alcătui până la 50% din proteinele totale bacteriene. Aceasta din urmă va recunoaşte promotorul T7 din plamsid şi va transcrie gena ţintă. A B C Figura 11. Atunci când în mediu nu există lactoză (sau analogi ai lactozei) represorul lac se fixează la operatorul lac şi împiedică transcrierea genei pe care o reglează. C – eluarea proteinei ţintă de pe coloană. astfel promotorul lac devine accesibil pentru ARN polimeraza de E.

• proteinele recombinate pot fi marcate. cum ar fi spre exemplu cazul unor proteine umane. spre exemplu cum este cazul unor bacterii pe care nu putem să le cultivăm în condiţii de laborator. dar şi pentru studii interdisciplinare este utilizarea ei în scopul obţinerii de proteine recombinate. importante nu numai pentru biologie. iar rezultatul purificărilor în câteva etape pot fi sub 100 mg de proteină.2. Clonarea genelor şi exprimarea lor în celule gazdă reprezintă o sursă foarte preţioasă de proteine. În cele mai multe cazuri purificarea unei proteine din celulele în care aceasta se exprimă în mod firesc natural prezintă mai multe dificultăţi: • cantitatea de proteine în ţesuturi este foarte mică. Prin intermediul tehnicilor de mutageneză pot fi introduse mai multe tipuri de mutaţii: • mutaţii missens care schimbă un aminoacid cu altul. • inserţii care constau în introducerea de fragmente noi în gena codificatoare şi respectiv în proteina recombinată. obţinerea de proteine din celule umane ar fi imposibilă. Una dintre aplicaţiile acestei tehnici. Aceste dezavantaje ale purificării direct din material biologic sunt eliminate în cazul exprimării genelor în celule gazdă. • obţinerea unei cantităţi mari de ţesut pentru purificare este aproape imposibil. • purificarea se face în mai multe etape care necesită timp. Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare Clonarea genelor în ultimii ani a devenit o tehnică indispensabilă în laboratoarele de biologie moleculară. consumabile şi are randamente mai mici. spre exemplu regiunea N-terminală a unei proteine de la o specie se poate fuziona cu capătul C-terminal al aceleiaşi proteine de la o specie înrudită. se pot fuziona proteine între ele sau regiuni ale unei proteine cu regiuni ale altei proteine. • obţinerea materialului pentru purificare implică probleme etice. • fuzionării. spre exemplu pentru purificarea unei proteine din bacterii este necesară o cantitate de zeci de litri de cultură bacteriană. • deleţii în care porţiuni întregi din lanţul polipeptidic pot fi înlăturate. Un mare avantaj al acestei metode este posibilitatea introducerii de mutaţii care pot dezvălui rolul unor domenii sau aminoacizi particulari în activitatea proteinei. Proteinele pot fi marcate 31 .

coli nu reuşesc să adopte o structură secundară corectă. Cauzele neexprimării pot fi toxicitatea proteinei asupra celulelor gazdă. iar ca rezultat polipeptidele acumulate în citoplasmă formează corpi de incluziune. astfel o proteină are structură: primară. 32 . în alte cazuri este nevoie de condiţii speciale şi alte proteine care contribuie la adoptarea conformaţiei proteinei active. O altă problemă care poate apărea este neexprimarea genei. Corpii de incluziune oferă posibilitatea unei purificări printr-o singură etapă în condiţii denaturante. Unele proteine atât de la eucariote cât şi de la procariote sintetizate în celule gazdă de E. deoarece este mai rapidă şi mai puţin costisitoare. a. Un alt exemplu este marcarea proteinelor prin fuziunea lor cu proteine fluorescente. Exprimarea proteinelor sub forma corpilor de incluziune nu poate fi prezisă pe baza apartenenţei genei sau pe baza analizei structurii primare. în mod specific sau randomic. Majoritatea proteinelor de la eucariote necesită nu numai adaptări conformaţionale dar şi modificări post-traducere cum ar fi fosforilări. Proteinele sunt structuri cu mai multe nivele de organizare. Cel mai important aspect pentru imunizare este secvenţa de aminoacizi a proteinei şi nu structura ei secundară sau terţiară. În acest fel proteina recombinată nu va fi modificată şi se va putea deduce rolul acestor grupări în activitatea proteinei. atunci se va recurge la clonarea genei în sistem procariot şi exprimarea ei în celule gazdă eucariote.cu anumite molecule care sunt introduse în proteine în procesul lor de sinteză sau pot fi fuziuni. Lipsa modificărilor post-traducere este un avantaj atunci când este cunoscută funcţia proteinei active şi se doreşte să se cunoască rolul grupărilor care sunt adăugate după sinteză. Exprimarea genelor şi sinteza proteinelor în celulele procariote asigură doar structura primară exactă a polipeptidului sintetizat. Un exemplu în acest sens este marcarea proteinelor cu izotopi stabili sau radioactivi. glicozilări ş. Dacă prezenţa acestor modificări este absolut necesară. Un alt dezavantaj (deşi în unele cazuri este un avantaj) este lipsa modificărilor post-traducere a polipeptidelor sintetizate în celule bacteriene. care apoi facilitează detecţia lor. Proteinele denaturate purificate în acest mod pot fi utilizate pentru imunizarea de animale în scopul producerii de anticorpi. În unele cazuri proteinele adoptă structura secundară independent după sinteză. terţiară şi cuaternară. Clonarea genelor şi exprimarea lor în sistem procariot este tehnica la care se apelează cel mai des. Există cazuri când acumularea proteinei sub forma corpilor de incluziune este un avantaj. secundară.

Germania Centrifugă de masă Sigma 1-13. 198-1000 nm. Marea Britanie Spectrofotometru Jasco V-530 dublu-fascicul cu termostatare. Elga-Lab Water. 70 litri. interfaţă pentru calculator şi imprimantă Incubarea culturilor bacteriene şi a probelor moleculare de la temperatura camerei la 70ºC Incubarea probelor biologice pana la 100ºC. 32 probe Electroforeza orizontală în gel de agaroză. rotor 8x50ml şi rotor 4x250ml Fără răcire cu rotor Eppendorf (12 tuburi. Infrastructura existentă în cadrul Centrului de Biologie Moleculară Denumire echipament Instalaţie de preluare şi prelucrare a imaginilor Ced Limited. Germania Două incubatoare bacteriologice. Belgia Şase instalaţii electroforeza acizi nucleici. răcire de la temperatura camerei la 0°C. Marea Britanie Instalaţie de apă ultrapură. Japonia Congelator temperaturi foarte scăzute. 198-1000 nm. Jasco. Japonia Patru instalaţii electroforeză proteine.2ml la 1 litru. Germania Doua bai de apa cu agitare. Scaltec. 100 litri. Consort. Olanda Două balanţe analitice.1mg la 160g. Germania Spectrofotometru UV-Vis monofascicul M301. maximum 28000xg. Australia Electroporator Eppendorf. cu termostatare. Memmert.2ml şi plăci ELISA cu 96 de godeuri. 0. max.2ml. Sigma.2 MΩ/cm (apa MilliQ) Centrifugarea probelor. Germania “Thermocycler”. Snijders Scientific. Consort. Consort. autocalibrare. 13000xg) Pentru amplificarea ADN-ului prin PCR în tuburi de 0. Marea Britanie Centrifugă cu răcire Sigma 3K18 (4 rotoare). Germania Caracteristici Achiziţia şi interpretarea imaginilor de pe geluri de poliacrilamidă sau geluri de agaroză Purificarea apei până la o rezistivitate de 18. pentru cinetică enzimatică Electroforeză verticală în gel de poliacrilamidă. Sanyo. gradient de temperatură în tub Pentru amplificarea ADN-ului prin PCR în tuburi de 0. de la 0.5ml şi placi ELISA cu 96 de godeuri. rezoluţie 1 nm. Eppendorf. Corbett Research. Belgia Congelator temperaturi foarte scăzute. 48 probe Masurarea pH-ului. Belgia pH-metru P901 (două bucăţi). Germania “Thermocycler”.3. rotor 6x30ml. rotor Eppendorf (24 tuburi). Memmert. electrod combinat prevăzut cu senzor de temperatură Congelare probe biologice la -82ºC Congelare probe biologice la -82ºC Domeniul de măsurare de la 0. max. (3%) 33 . CamSpec. Sigma. gradient de temperatură Transformarea celulelor electrocompetente – bacterii şi drojdii Interval de fotometrare. rezoluţie 1 nm Interval de fotometrare.

97%).3 um 99. DNA Cloning: A Practical Approach: Expression Systems (The Practical Approach Series). Nikon. Freeman Company.. Lewis J. (1999). Jasco. gradient binar de înaltă presiune şi gradient cuaternar de joasă presiune Microscop inversat NIKON Studiul preparatelor celulare şi tisulare în lumina normaEclipse TE2000S.. 5th edition. (2002). 4th edition. Freeman Company.3 Hota flux laminar biohazard µm 99. 34 . preparare probe PCR (4% Filtru exahustare HEPA (0. 2. 5.. Amplificarea ADN-ului în timp real. Roberts K. Selecta. New York: W. Raff M. 2d edition. Zipursky L. Molecular Cell Biology.. Spania Sterilizarea umedă sau uscată a mediilor de cultură. Matsudaira P.. (2000). Australia Secvenţierea fragmentelor de ADN.R. 3. 6. ASM Press. ţesuturilor animale şi Sonics & Materials vegetale în volume de la 1ml până la 1 litru Hota PCR cu flux laminar Flux laminar vertical... detecţia simultană a 4 fluorocromi Separarea probelor prin cromatografie de înaltă perforInstalaţie HPLC. Tymoczko J. 7th edition... New York: Garland Science. (1995). 5th edition New York: W. prefiltru reciclabil (3-30 µm). 4. Spania re. New York: W.. identificare umană şi determinarea polimorfismelor genetice. Telstar. An Introduction to Genetic Analysis. H. rialelor şi instrumentelor Spania Ultrasonicator cu patru sonde.. and Robertson D.A. flux de aer 100. Coreea de Sud reglabil în 9 trepte (0.J.C. and Gelbart W.. 9.. H.T. Japolă. Wiley-Blackwell Publishing. Molecular Biotechnology: Principles and Applications of Recombinant DNA.. H. Suzuki D. 4. Gelbart W. Dezintegrarea celulelor bacteriene. filtru HEPA (0.. Oxford University Press.L. New York: W. Glover D. 7. 2nd Edition. 4th edition. Manipulation and Expression of Recombinant DNA. Applied Biosystems.. Corbett Research.D...97%). (2005)... and Stryer L. Lewontin R. Gene Cloning and DNA Analysis: An Introduction.. Lodish H. Johnson A....M. Patten C. Miller J. mateAutoclav AE-75-DRY Raypa.L....M. Glick B. Carson S.Bibliografie 1.M.. Berg J. Molecular Biology of the Cell. (2006). iluminasteril.. (2000). Freeman Company. Griffiths A.C. Pasternak J. Brown T. Academic Press... soft-uri speciale pentru secvenţiere şi genotipare. Japonia manţă. Griffiths A.M. Alberts B. Baltimore D. electroforeza capilară la 15kV.5 m/s). Freeman Company. Hames B.. (2009).Analizor Genetic ABI Prism 310. Miller J. contrast de fază şi fluorescenţă nia Autoclav 80l. Darnell J. and Walter P. H. (2002). and Lewontin R. Modern Genetic Analysis. SUA laser cu detecţie pentru 5 fluorocromi Analizor Genetic CEQ™ 8800 Genetic Analysis System laser cu detecţie pentru 4 fluorocromi Instalaţie Real Time PCR.35-0. Berk A. 4th edition. 8. Biochemistry. filtru bacteriologic HEPA.

(2006). (2000).. Electroforeza proteinelor în geluri de poliacrilamidă..A. Popescu O. 1st edition. Basics: from Background to Bench. 12.J.. (2007). 35 . Metzenberg S. 1990. Working with DNA (THE BASICS (Garland Science)). Springer-Verlag Telos. 13. H. Recombinant DNA: Genes and Genomes . 1 edition.A. Bucureşti..M. 3rd Edition. 11.G. Mǿller S..A Short Course.. PCR. Editura Tehnică. Caudy A. W. Taylor & Francis. Watson J.10. Witkowski J..D. McPherson M. Freeman Company.. Myers R. and.

......... deoarece: • izomerii optici ai aminoacizilor se pot obţine direct din substratele corespunzătoare.......................... din cauza costurilor prea mari a substratelor... La început.... • sintezele sunt uşor de manipulat.. • se pot obţine derivaţi ai aminoacizilor sau aminoacizi rari.. şi de derivaţi ai acizilor aminaţi.. pH. enzimele nu se purificau şi se folosea lizatul celular ce conţinea enzime specifice... • necesită condiţii blânde de temperatură......... care nu se aplică la scară industrială la fel ca în fermentarea directă.. O sursă de triptofanază 36 ................. Tendinţe actuale în aplicarea bionanotehnologiilor .... pentru producerea acizilor aminaţi pe cale enzimatică.... se foloseau enzime nerecombinate produse de microorganisme..................... Această metodă capătă o amploare mai mare pe an ce trece datorită cererii mari de aminoacizi... • se pot sintetiza D-izomeri.. 60 1............ Pentru a reduce costul sintezelor.....Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare Asist......... presiune...... Sinteza enzimatică continuă prin imobilizarea enzimelor a fost aplicată în producerea L-tirozinei cu β-tirozinază şi a triptofanului cu triptofanază........ folosite în exces. Iulia Lupan Cuprins 1.. • cantităţile produse şi concentraţiile sunt mai mari..... Bibliografie . Metoda enzimatică de sinteză a acizilor aminaţi...... Metoda enzimatică de sinteză a acizilor aminaţi Un număr mare de aminoacizi se pot obţine prin sinteză enzimatică.................... pornind de la indol... univ... care nu se găsesc în natură.. Imobilizarea enzimelor în sintezele enzimatice prezintă două avantaje importante şi anume reutilizarea multiplă a enzimelor costisitoare şi recuperarea substratelor rămase.. fiind stimulată sinteza lor prin diverse metode.. Totuşi metoda enzimatică prezintă unele avantaje faţă de alte metode.. dr... care nu se pot obţine prin fermentare directă sau prin extracţie........ 57 3... piruvat şi săruri de amoniu................. 36 2.........

. utilizând leucin dehidrogenază de la Bacillus stearothermophilus [Oshima şi colab... 1974].. NADPH). iar ionul formiat pentru reacţia de regenerare a NADH [Oshima şi colab.coli. Utilizarea de cofactori (NADH. Aceeaşi metodă de imobilizare a fost folosită şi în sinteza alaninei cu celule de Pseudomonas dacunhae care prezentau o activitate mare a L-aspartat β-carboxilazei [Fusee şi Weber. folosite în exces [Deconttignies-Le Maréchal şi colab. [1990] au sintetizat L-alanina şi L-valina folosind sistemul cuplat de alanin dehidrogenază. reacţie catalizată de alanin dehidrogenază într-un sistem cuplat cu formiat dehidrogenaza pentru regenerarea NADH. În strategia de sinteză s-au utilizat enzime provenite de la un singur microorganism şi anume Bacillus megaterium. în cazul folosirii lizatului brut până la 92%. 1990]. S-a testat eficienţa sintezelor în cazul folosirii lizatelor şi a enzimelor purificate. 3-fluoroalanina s-a obţinut din 3-fluoropiruvat. Acest impediment a cauzat folosirea sistemelor enzimatice cuplate. în cazul folosirii fracţiunilor purificate.poate fi lizatul brut de E .. Utilizarea enzimelor de la microorganismele termofile prezintă avantajul că au o stabilitate mai mare. 1988.. 1985] şi formiat dehidrogenaza de la Candida boidinii. 1976]. Mediul de sinteză mai conţine formiat de amoniu. 1984].. 1988]. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab. 1976]. la care s-a indus sinteza acestei enzime. Honorat-Pascal şi colab. Astfel. respectiv valin dehidrogenază. nu permite extinderea sintezelor la scară industrială.. 1979. 37 . cu glucozo dehidrogenază pentru regenerarea NADH. Tosa şi colab. 1981. Imobilizarea asigură sinteza continuă a aminoacizilor şi reciclarea amoniului şi piruvatului neutilizate. Fukui şi colab. Celule imobilizate de E. Numai în cazul sintezei alaninei s-a evidenţiat o creştere a randamentului sintezei de la 80%. Sistemul multienzimatic a fost utilizat şi în sinteza L-leucinei din α-cetoisocaproat. Producerea continuă de L-valină folosind valin dehidrogenaza şi glucozo dehidrogenaza pentru regenerarea NADH a fost studiată detailat [Monot şi colab... pentru regenerarea NADH [Schütte şi colab. în care se utilizează enzime pentru regenerarea cofactorilor. ionul de amoniu fiind necesar în reacţia de sinteză a aminoacidului. costisitori în sintezele enzimatice. Sinteza continuă a fost realizată prin încorporarea enzimelor în gel de poliacrilamidă. Honorat şi col. 1973]. Producerea acidului aspartic la scară industrială s-a realizat enzimatic pornind de la fumarat şi săruri de amoniu şi utilizând aspartaza ca şi catalizator [Chibata şi colab.

alanin dehidrogenazele şi suprafamilia de aminoacid dehidrogenaze au evoluat separat [Baker şi colab. 38 ..4. Ele au fost folosite la construirea biosenzorilor.X) sunt enzime care fac parte din familia oxidoreductazelor. această caracteristică fiind foarte importantă pentru industria farmaceutică.. Alanin dehidrogenaza Aminarea reductivă a cetoacizilor la L-aminoacizi în procese NAD(P)H-dependente este catalizată de o suprafamilie de enzime omoloage de aminoacid dehidrogenaze. dar există şi câteva enzime care reacţionează şi cu aminoacizii β. Această enzimă a fost purificată şi studiată în principal la mai multe specii din genul Bacillus.4. 1994]. caracteristic în unele patologii. enzimele produc L-izomeri ai aminoacizilor naturali puri. Alanin dehidrogenaza (L-alanin oxidoreductază NAD+ dependentă. Aminoacid + NAD+ + H2O ↔ α-cetoacid + NADH + H+ + NH3 Majoritatea aminoacid dehidrogenazelor sunt specifice pentru α-aminoacizi. Aceste enzime catalizează eliminarea grupării amino din L-aminoacizi cu formare de cetoacizi corespunzători.1) catalizează reversibil reacţia de dezaminare a L-alaninei cu formare de piruvat. cu excepţia domeniului de legare a cofactorului.Aminoacid dehidrogenaze Aminoacid dehidrogenazele (EC 1. Aminoacid dehidrogenazele au fost intens studiate în vederea utilizării lor în diverse ramuri industriale. leucin dehidrogenaza (LeuDH). valin. Enzima are un rol important în furnizarea energiei necesare germinării sporilor. Aceste enzime au întrebuinţare şi în sinteza industrială de aminoacizi. 1. leucin-. Deşi realizează unul şi acelaşi proces biologic. valin dehidrogenaza (ValDH) şi glutamat dehidrogenaza (GluDH). 1998]. Deoarece ele acţionează stereospecific.. L-alanina + NAD+ + H2O ↔ piruvat + NADH + H+ + NH3 Alanin dehidrogenaza a fost descrisă de către Wiame şi Piérard în 1955 [Norbert şi colab.1. care este comun pentru toate aceste enzime.şi glutamat dehidrogenaza). Cele mai bine studiate aminoacid dehidrogenaze sunt cele care au importanţă industrială (fenilalanin-. care pot să monitorizeze nivelul ridicat de aminoacizi din plasma sanguină. în prezenţă de NAD(P)+.1. care include fenilalanin dehidrogenaza (PheDH). S-a demonstrat că în lipsa enzimei sporularea avea loc cu mari dificultăţi [Siranosian şi colab. Nu există asemănări semnificative între secvenţele alanin dehidrogenazelor (AlaDH) şi membrii acestei familii de aminoacid dehidrogenaze. alanin-.

dar care nu este specifică altor aminoacid dehidrogenaze..4. Majoritatea enzimelor studiate sunt hexameri. prin denaturare termică.. a cărei genă codificatoare a fost clonată. deoarece sunt mai stabile.. Enzimele termostabile nu prezintă numai avantajul termostabilităţii. Diferenţele de termostabilitate ale proteinelor totale de E. Leucin dehidrogenaza Leucin dehidrogenaza (EC 1. detergenţi. solvenţi organici.. Una din aceste enzime este cea de la B.. Mycobacterium. Aspartat amoniu-liaza L-aspartat amoniu-liaza (AAL) sau aspartaza (EC 4. cum ar fi cele de la B.1) catalizează reversibil transformarea acidului L-aspartic la fumarat şi NH4+.. Alanin dehidrogenaza este o enzimă NAD+ dependentă. Aminoacizii din vecinătatea acestei lizine prezintă o regiune conservată. 1994]. coli. Leucin dehidrogenazele studiate provin în mare parte de la genul Bacillus precum şi de la Thermoactinomyces [Ohshima şi colab.3. Leucina + NAD+ + H2O ↔ α-cetoisocaproat + NADH + NH4+ + H+ Echilbrul reacţiei este deplasat spre formarea aminoacidului. stearothermophilus. Lizina din poziţia 74 din secvenţa de aminoacizi a AlaDH de la B. fiind. 1997]. Thermus. B. B. stabile şi la alţi factori care afectează proteinele. LeuDH intervine în catabolismul unor aminoacizi. coli şi proteina recombinată de LeuDH permit purificarea acesteia într-o singură etapă. subtilis. [Delforge şi colab. subtilis este esenţială în cataliză şi este conservată şi la alte alanin dehidrogenaze. iar NADH în reacţia de aminare. Această 39 .1. Alanin dehidrogenaza este o enzimă oligomerică. 1989]. iar proteina exprimată în celule de E. cum ar fi enzime proteolitice. cât şi 3-hidroxipiruvatul. 1988]. 2003]. Această enzimă poate fi foarte utilă în sinteza de L-serină din 3-hidroxipiruvat [Nagata şi colab. în general. care catalizează reversibil dezaminarea L-leucinei şi a unor L-aminoacizi alifatici la cetoacizii corespunzători. B. Un caz unic printre alanin dehidrogenazele bacteriene este cea de la Bacillus sp DSPM730 care reacţionează în egală măsură cu ambele substrate.1. mediu acid sau alcalin.9) (LeuDH) este o oxidoreductază NAD+-dependentă. Ca şi majoritatea aminoacid dehidrogenazelor. cereus. 1989]. [Nagata şi colab. Enzima nu-şi pierde activitatea după incubare timp de 30 min la 70ºC [Oka şi colab. O mare atenţie s-a acordat leucin dehidrogenazelor provenite de la microorganisme mezotermofile. Natronobacterium magadii MS-3 [Katoh şi colab. NAD+ se leagă înaintea piruvatului în reacţia de dezaminare oxidativă. AlaDH poate utiliza ca substrate în reacţia de aminare atât piruvatul. sphaericus. cu ultimul reacţia fiind mult mai lentă. Mecanismele cinetice ale AlaDH au fost studiate la mai multe specii. Anabaena. stearothermophilus.1993].

Produşii de digestie (produşii PCR şi vectorii) au fost separaţi cu ajutorul electroforezei în gel de agaroză. Acest vector oferă posibilitatea exprimării genelor la inducere cu IPTG. Enzima este activată în prezenţă de ioni de Mg2+ la un pH alcalin. Pentru inserarea genelor în vectori s-a utilizat ADN ligaza. Produşii PCR au fost purificaţi din gel şi digeraţi cu enzimele de restricţie corespunzătoare (Tabel 1). alanin dehidrogenaza şi aspartaza s-a utilizat vectorul de exprimare pET21b (Novagen). Majoritatea aspartazelor studiate au masa moleculară în jur de 200 kDa şi sunt alcătuite din patru monomeri identici. Metode Clonarea genelor pentru aminoacid dehidrogenaze Genele ce codifică leucin dehidrogenaza de la Bacillus sterothermophilus. la pH mai mic ea nu necesită ioni de metal [Karsten şi Viola. 1991]. Tabelul 1. Pentru clonarea genelor ce codifică leucin dehidrogenaza. de circa 50 kDa. În secvenţa amorselor au fost incluse situsurile pentru enzime de restricţie necesare inserării genei în vectorul de exprimare. Amorsele utilizate pentru amplificarea prin PCR a genelor. glucoz dehidrogenaza de la Bacillus subtilis şi aspartaza de la Escherichia coli au fost amplificate prin metoda PCR utilizând amorse specifice.enzimă joacă un rol important în metabolsimul azotului la bacterii. alanin dehidrogenaza de la Bacillus subtilis. Vectorii de exprimare au fost digeraţi cu aceleaşi enzime de restricţie. care are proprietatea de a 40 . Enzima AlaDH Q08352 LeuDH P13154 ALL (P0AC38) Amorsele utilizate 5΄-GAGGGATCCGATGATCATAGGGGTTCCTAAAG-3΄ 5΄-GGTCTCGAGTATAGCACCCGCCACAGATGATT-3΄ 5΄-GGTGGATCCGATGGAATTGTTCAAATATATGG-3’ 5΄-TATTCTCGAGTATTGCCGAAGCACCTGC-3΄ 5' –GGTAGGATCCGATGTCAAACAACATTCGTATCG– 3' 5' –GCTACTCGAGTTACTGTTCGCTTTCATCAGTA– 3' Escherichia coli Bacillus subtilis Bacillus stearothermophilus Organism sursă Enzime de restricţie BamHI XhoI BamHI XhoI NdeI BamHI NdeI BamHI NdeI BamHI Vector utilizat pET21b pET21b pET21b 5'-GGAATTCCATATGCTGAACGAAACTCCCGCAC-3' GalM Escherichia coli (P0A9C3) 5'-CGCGGATCCTCACTCAGCAATAAACTGATATTCCG-3' GlucDH P12310 5΄-GGAATTCCATATGTATCCGGATTTAAAAGGAAAAG-3΄ 5΄-CGCGGATCCTCAACCGCGGCCTGCCTGG-3΄ Bacillus subtilis pET24a pET24a Fragmentele ADN au fost purificate din gelul de agaroză.

Analiza exprimării genelor şi sintezei de proteine recombinate în celulele de E. Sinteza de proteine recombinate în celulele gazdă de E. După sonicare extractul bacterian a fost centrifugat (20 min la 21 000 ×g la 4°C). Sintezele enzimatice au fost realizate cu extracte celulare bacteriene.4→ 30 20. O purificare a proteinelor recombinate ar implica costuri şi timp suplimentar. s-a indus exprimarea genelor cu izopropil-β D-tiogalactopiranozid (IPTG) 1 mM. coli a fost urmărită cu ajutorul electroforezei în gel de poliacrilamidă în condiţii denaturante în prezenţă de SDS (Figura 1). Moleculele recombinate rezultate după ligare (vector + gena) au fost introduse prin transformare în tulpina de Escherchia coli DH5α. După câteva ore de la inducere (3-5 ore) bacteriile au fost centrifugate şi păstrate la -80°C până la utilizare. AlaDH 1 2 3 94 67 43 LeuDH 1 2 3 AAL 1 94→ 67→ 43→ ←54 2 ← ← 42→ ← ← ← ← 94 67 43 → → → → → ← 42 30 20.1 14. Cu cifre sunt indicate masele moleculare ale proteinelor din markerul molecular. După ce densitatea optică (DO) la 600 nm a atins valorile de ~1.5-1L). Pentru obţinerea de proteine recombinate s-au realizat culturi mai mari (0. Pereţii celulelor bacteriene au fost distruse prin sonicare. Se poate observa cantitatea mare de proteine recombinate raportată la cantitatea de proteine totale din celulele bacteriene. iar orice proces biotehnologic este cu atât mai valoros cu cât implică mai puţine costuri. Secvenţele genelor clonate au fost verificate prin secvenţializare cu un aparat ABI Prism 310 Genetic Analyzer utilizând kitul de secvenţializare BigDye Terminator v3. 41 . preum şi masele moleculare ale proteinelor recombinate. iar supernatantul cu proteinele solubile a fost utilizat pentru măsurarea activităţii enzimatice.0 50 mM.1 (Applied Biosystems). coli. Producerea de proteine recombinate Pentru exprimarea genelor.1→ 14.4 30→ 20.1 Figura 1. Celulele bacteriene au fost preluate în tampon Tris HCl pH=8. moleculele corect recombinate au fost introduse prin transformare în tulpina de Escherichia coli BL21(DE3).reface legăturile fosfoesterice.

L-alanină 10 mM.0 în reacţia de aminare.15 mM. Tris HCl 50 mM pH 8. Tris HCl 50 mM pH 8. Tris HCl 50 mM pH 8. Tris HCl 50 mM pH 8. glicocol 50 mM pH 10.Măsurarea activităţii enzimatice a enzimelor Măsurătorile de activitate enzimatică a dehidrogenazelor s-au efectuat la 30ºC cu un spectrofotometru Jasco V-530 urmărindu-se scăderea absorbanţei NADH (reacţia de aminare a cetoacizilor) sau formarea acestuia (reacţia de dezaminare a aminoacizilor) la 340nm.05 şi 0. L-leucină 10 mM.54 ·103 ·M-1 ·cm-1.0 f) AAL (aspartat amoniuliaza): acid L-aspartic 100 mM. NADH 0. NAD 2 mM.5 în reacţia de dezaminare c) GDH (glucozo dehidrogenaza): glucoză 10 mM. care are un coeficient molar de extincţie la aceasă lungime de undă egal cu 2.5. GDH 1 U e) LDH (lactat dehidrogenaza): piruvat 1 mM.15 mM. Tris HCl 50 mM pH 8. glicocol 50 mM pH 10. MgCl2 6 mM Pentru măsurarea activităţii enzimatice a aspartzei s-a urmărit formarea acidului fumaric la 240 nm.0 în reacţia de aminare.22 ·103 ·M-1 ·cm-1. Activitatea enzimatică s-a calculat după formula: A=[(DO/min)/6.5 în reacţia de dezaminare b) AlaDH (alanin dehidrogenaza): piruvat 10 mM.22]*(Vr/Vp) *FD *103 U/l DO/min – variaţia densităţii optice pe minut la 340 nm Vr – volumul reacţiei Vp – volumul probei FD – factorul de diluţie O unitate enzimatică (1U) corespunde formării unui µmol de produs într-un minut. NAD 2 mM. astfel încât valorile DO/min să fie cuprinse între 0. NH4Cl 1 M. La această lungime de undă NADH prezintă maximul de absorbanţă şi are un coeficient molar de extincţie de 6.15 mM. Sinteza de aminoacizi marcaţi cu 15N Mediul de reacţie pentru sintezele de aminoacizi marcaţi cu 15N a conţinut: 42 . NAD 2 mM.3. Mediile de reacţie pentru enzime au fost următoarele: a) LeuDH (leucin dehidrogenaza): cetoacid 10 mM. NAD 2 mM. NADH 0. NADH 0. S-a ales porţiunea dreptei cu activitatea cea mai mare. NH4Cl 1 M.0. Tris HCl 50 mM pH8.0 d) GalM (galacto mutarotaza): glucoză 10 mM. Pentru măsurarea activităţii enzimatice s-au folosit câţiva µl de enzimă purificată sau extract brut bacterian.

Sintezele de aminoacizi marcaţi au fost efectuate la 30ºC cu urmărirea pH-lui şi agitare. după care s-a spălat până la un pH neutru. Curba etalon de la sinteza [15N] L-Metionină.• cetoacid 100 mM • 15NH4Cl 100 mM • NADH 1 mM • glucoză 670 mM Amestecul de sinteză a fost ajustat la pH 8. 200 µl de hipoclorit de sodiu şi 590 µl apă.8 0. Amestecul de sinteză filtrat s-a încărcat pe coloană şi apoi s-a spălat cu apă (10 volume).4 0. timp de 15 min la 85ºC. Pe parcursul sintezei s-a urmărit consumul de NH4Cl prin metoda Berthelot.6 0. Pe baza curbelor etalon s-a calculat cantitatea de ion de amoniu rămas în mediul de sinteză. Înainte de declanşarea sintezelor s-a preluat o probă care a servit la alcătuirea unei curbe etalon. Aminoacidul s-a eluat cu NH4OH 1M. Activarea umpluturii s-a făcut prin tratare cu HCl 2N. Developarea culorii s-a făcut prin incubarea probelor timp de 2-3 min la 100ºC. Controlul eluării s-a făcut cu ninhidrină pentru aminoacizi. Probele s-au preparat după următoarea procedură: 10 µl de probă diluată de 20 ori.013334x R= 0. y = 0. S-a măsurat absorbanţa la 623 nm.99935 1. a fenolnitroprusiatului şi a cloraminei. Purificarea aminoacizilor sintetizaţi Aminoacizii sintetizaţi au fost purificaţi pe o coloană cu răşină schimbătoare de ioni Dowex 50W x 8. Sintezele au fost oprite prin denaturarea termică a enzimelor. Fracţiunea cu aminoacid s-a concentrat pe 43 . Ca martor a servit amestecul de sinteză fără clorură de amoniu (din care cauză se adăuga la sfârşit). la interacţiunea ionului de amoniu. Reacţia s-a declanşat prin adăugarea enzimelor. Această metodă constă în formarea unui compus de culoare.2 0 0 20 40 60 80 100 120 DO 623nm NH Cl (% ) 4 Figura 2.068852 + 0.4 1. În Figura 2 este prezentată curba etalon de la sinteza de [15N]-L-metionină. în forma H+.0 cu NaOH. 200 µl de fenolnitroprusiat.2 1 0.

Separarea gaz-cromatografică a produşilor de sinteză sub formă de TBDMS-derivaţi s-a făcut pe o coloană capilară cu fază staţionară DB5 de 30 m lungime. 44 . reactivul având şi un conţinut de 1% terţ-butil-dimetil-clorsilan. obţinerea racemicului. datorită substituentului terţ-butil voluminos. În primele etape de marcare a acizilor aminaţi cu izotopi stabili s-au folosit metode de sinteză chimică. la 120ºC timp de 20 minute. iar prin ruperea legăturii dintre carboxil şi atomul de carbon alfa. cu hidrogen ca şi gaz purtător şi cu temperatură programată între 55 şi 250ºC. În continuare. iar spectrele s-au înregistrat cu un spectrometru de masă cuadrupolar HP 5985. după care s-a precipitat cu etanol absolut. Analiza aminoacizilor sintetizaţi prin spectrometrie de masă Pentru analiza calitativă prin metoda spectrometriei de masă a aminoacizilor este necesară o derivatizare a produsului de reacţie. Masele ionilor fragment fiind caracteristice fiecărui aminoacid. Derivatizarea. M-57 şi M-85. iar precipitatul obţinut s-a filtrat şi uscat. La ionizarea cu impact de electroni. Pentru analize s-a utilizat un cromatograf de gaze Hewlett Packard 5840 A. randamente scăzute datorită mai multor etape de sinteză. la carboxil şi amină. cum ar fi consumul unei cantităţi mari de amoniac. Derivatizarea s-a făcut pe cantitaţi de probă de ordinul 0.baia de apă. cu 150 µl de acetonitril ca solvent şi 50 µl reactiv MTBSTFA. Precipitarea s-a lăsat peste noapte. care introduce la fiecare funcţiune polară din moleculă câte o grupare terţ-butil-dimetilsilil (TBDMS). şi nu una sau două în mod statistic. cum se întâmplă în cazul derivatizării cu grupări trimetilsilil. purităţii şi concentraţiei izotopice. Aceste metode prezintă un şir întreg de dezavantaje. care trebuie facută la ambele funcţiuni polare ale moleculei de aminoacid. Prin ruperea în diferite poziţii din gruparea tert-butildimetilsilil se formează ioni cu masele M-43. la amină se introduce o singură grupare silil.5-1 mg de probă. utilizând metoda Das Neves şi Vasconcelos. Sinteza de aminoacizi marcaţi cu 15N Marcarea aminoacizilor cu izotopi stabili se poate realiza prin sinteze chimice şi enzimatice. aminoacizii sub formă de TBDMS-derivaţi se produc în cea mai mare parte sub formă de ioni prin fragmentarea moleculelor. în calitate de catalizator. adiacent. Derivatizarea s-a făcut utilizând ca reactiv N-metil-N-(terţ-butil-dimetilsilil) triflouroacetamida (MTBSTFA) în calitate de donor al grupării silil. s-a facut prin sililare. aminoacizii astfel obţinuţi au fost supuşi determinării structurii. Acest tip de derivatizare are avantajul că. ia naştere un fragment cu masa M-159.

15NH4Cl Cetoacid NADH AADH Acid gluconic GDH GalM β-glucoză -glucoză L-(15N)aminoacid NAD+ Figura 3. cu utilizare de celule în creştere.Folosirea enzimelor în sinteze de aminoacizi marcaţi cu izotopi stabili prezintă mai multe avantaje faţă de metodele chimice. Un dezavantaj al metodei îl prezintă specificitatea şi viteza de regenerare reduse. O metodă relativ simplă şi mai utilizată pentru obţinerea de aminoacizi marcaţi cu 15N este sinteza enzimatică pornind de la cetoacizi şi săruri de amoniu (15N). 1989). Piridin nucleotid transhidrogenaza de la Pseudomonas fluorescens a fost utilizată în regenerarea atât a NAD cât şi a NADP pentru producerea de hidromorfonă [Boonstra şi colab. Schema de sinteză a acizilor aminaţi cu 15N. AADH – aminoacid dehidrogenză Aminoacid dehidrogenazele catalizează reacţia de formare a aminoacizilor pornind de la 15NH4Cl şi cetoacizii corespunzători.. Majoritatea enzimelor utilizate în sinteza diverşilor compuşi necesită coenzime (NADH sau NADP). • regenerarea enzimatică în vitro. 2000]. datorită faptului că decurg stereoselectiv şi au randamente superioare. marea majoritate provenind de la bacterii. Schema de sinteză a aminocizilor marcaţi cu 15N utilizată în prezenta lucrare este reprezentată în Figura 3. Sinteza de aminoa45 . Reacţiile de sinteză sunt cuplate cu reacţii de regenerare a cofactorilor costisitori. Această metodă prezintă dezavantajul manipulării laborioase a celulelor şi caracterul enantioselectiv scăzut al reacţiei. care constă în oxidarea unui mediator şi transferul electronului la NAD(P)+. • regenerarea electrochimică. Modalitatea cea mai eficientă pentru regenerarea coenzimelor rămâne metoda enzimatică. Din cauza preţului mare a acestora utilizarea lor în cantităţi stoichiometrice nu este eficientă. cele mai utilizate enzime pentru regenerarea coenzimelor în sinteze fiind alcool dehidrogenaza şi formiat dehidrogenaza (Hummel şi Kula. Pentru a evita acest fenomen există câteva căi de regenerare continuă a coenzimelor pe parcursul sintezelor: • regenerarea în vivo. Sursele enzimelor utilizate în regenerarea coenzimelor sunt destul de variate.

După purificarea aminoacidului randamentul sintezei a fost de 60%. Sinteza de L-alanină marcată cu 15N s-a realizat pentru o cantitate de 8 mmol. Astfel. cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. Sinteza de [15N]-alanină. la concentraţii mari de substrat activitatea enzimei este redusă. glucoză 670 mM.25 mM. utilizând ca substrat glucoza cu formare de acid gluconic. Purificarea acestora este o etapă suplimentară care. Sinteza de [15N] L-Ala Amestecul de sinteză a fost ajustat la pH 8. reprezintă aproximativ 50% din proteinele totale existente în lizatul bacterian. subtilis este inhibată de piruvat. înainte de adăugarea enzimelor.0. 15NH4Cl pe parcursul sintezei de [15N]-alanină. M = 318. nu conduce la mărirea randamentului reacţiei. 15NH4Cl 130 mM. coli. Honorat şi colab. GlucDH a servit la regenerarea NADH. exprimate în celule de E. O soluţie în acest 46 . constanta de inhibiţie calculată de noi Ki=4. în general. (B) Spectrul de masă al [15N]-Alaninei. (A) Consumul.cizi a fost cuplată cu reacţia catalizată de glucozo-dehidrogenaza (GlucDH) de la B. Activitatea alanin dehidrogenazei din B. NADH 1 mM. Enzimele recombinate. subtilis. Mediul de reacţie utilizat a conţinut: piruvat de Na 150 mM. Pe tot parcursul sintezei alaninei s-a urmărit consumarea clorurii de amoniu prin metoda Berthelot (Figura 4 A) care este o metodă colorimetrică foarte sensibilă de dozare a amoniacului. Reacţia s-a declanşat la adăugarea enzimelor (115 U de leucin dehidrogenază şi 60 U de glucozo-dehidrogenază). Figura 4. DMTBS derivat. [1990] au testat sinteza de L-alanină şi L-valină cu enzime (alanin dehidrogenază şi valin dehidrogenază) purificate şi în lizat bacterian. În unele sinteze s-a folosit galactozo-mutarotaza pentru transformarea α-glucozei în β-glucoză. Acest fapt nu a influenţat randamentul sintezelor. Enzimele utilizate în sintezele de aminoacizi marcaţi nu au fost purificate.

4 (10) 7. pH 8. masa moleculară exactă pentru leucină fără marcare izotopică la azot este M=359. Mediul de reacţie pentru sinteza de [15N]-leucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. În ambele cazuri este necesară o urmărire minuţioasă a consumului clorurii de amoniu. Sinteza de [15N]-L-Leu Leucin dehidrogenazele au specificitate pentru un număr mai mare de cetoacizi. În sintezele de aminoacizi la care enzima are o specificitate mai mică pentru precursorul acestora. şi respectiv 200. α-cetoacid 10 mM. 260.0. Activitatea specifică (U/mg de proteină) a LeuDH din B. Masa moleculară a alaninei fără marcare izotopică este 317. Masele fragmentelor ion ale alaninei cu conţinut izotopic natural sunt m/z 274. stearothermophilus în prezenţa diferiţilor α-cetoacizi α-cetoacid Acid α-cetoisovaleric Acid α ceto-β-metilvaleric Acid α-cetoizocaproic Acid α-cetocaproic Acid α-ceto-γ-metiltiobutiric Acid α-cetobutiric LeuDH429 168 (100) 46. 274. În cazul aminoacizilor mar47 .7 (2.8) Activitatea enzimatică a fost determinată la 30°C în tampon Tris-HCl 50 mM. stearothermophilus sunt prezentate în Tabelul 2.5 (28) 36.8 (22) 17. 232 şi 158. NH4Cl 1M şi NADH 0. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele menţionate mai sus.8 (4.6) 4.15 mM. În cazul leucinei derivatizate cu două grupări silil. a fost necesară o cantitate mai mare de enzimă. Masele caracteristice ale ionilor fragment ale leucinei cu conţinut izotopic natural au valorile m/z 316. Specificităţile de substrat ale leucin dehidrogenazei native din B. Între paranteze este exprimată activitatea procentuală considerând rezultatul obţinut cu acid α-cetoisovaleric ca 100%. ceea ce demonstrează marcarea alaninei nu 15N (Figura 4 B).caz ar fi declanşarea reacţiei de sinteză cu cantităţi mai mari de enzimă. O altă soluţie poate fi adăugarea piruvatului în mai multe etape. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 5 A). De aceste valori ale activităţii enzimatice s-a ţinut cont în sintezele de aminoacizi marcaţi cu izotopul stabil al 15N. Enzima are cea mai mare specificitate de substrat pentru acidul α-cetoisovaleric. Tabelul 2. 302.

DMTBS derivat. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo-dehidrogenază. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. Sinteza de [15N]-leucină (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-leucină. S-au realizat câteva sinteze. Din fiecare reactant s-a utilizat o cantitate de 8. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă (Figura 5 B). (B) Spectrul de masă al [15N]-Leucinei. M = 346.2 mmol. M = 360.0 mmol. Din fiecare reactant s-a utilizat o cantitate de 8. cca 97 atom % 15N. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-valină. Figura 6. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 6 A). Sinteza de [15N]-valină. (B) Spectrul de masă al [15N]-valinei. Figura 5. Raportul molar al reactanţilor (acid α-ceto isovaleric:15NH4Cl )a fost de 1:1. înainte de adăugarea enzimelor. Sinteza de [15N]-L-Val Mediul de reacţie pentru sinteza de [15N]-valină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. DMTBS derivat. înainte de adăugarea enzimelor. Sinteza s-a declanşat cu 205 U de leucin dehidrogenază şi 110 U de glucozo dehidrogenază. raportul reactan48 .caţi cu 15N.

Cel mai mare randament s-a constatat în cazul sintezei de 12 mmol. Masele caracteristice ale ionilor fragment a valinei cu conţinut izotopic natural au valorile m/z 302. masa moleculară exactă pentru valina fără marcare izotopică la azot este M=345 . Din această cauză a fost nevoie de o cantitate mai mare de proteină. În cazul metioninei marcate cu 15N. Scăderea vitezei de reacţie se poate explica prin scăderea concentraţiei substratelor. Pentru consumarea celorlalte 20% NH4Cl au fost necesare 100 min. Astfel. Masele caracteristice ale ionilor fragment ale metioninei fără marcare izotopică au valorile m/z 320. Viteza reacţiei a scăzut foarte mult după primele 10 min când s-au consumat 50% din substrate (Figura 7 A). Sinteze de [15N]-L-valină Reactanţi (mmol) Acid cetoisovaleric 3.0 8. acumularea de produşi de sinteză care pot inhiba activitatea enzimelor.0 12. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 7 A). Tabelul 3. după 10 min s-a consumat 50% clorură de amoniu. 260 şi respective 186.0 Randamentul sintezei (%) 79 86 92 Viteza de reacţie este. 288. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-γ-metiltiobutiric este aproximativ 8 U/mg proteină.0 12. În cazul valinei derivatizate cu două grupări silil.0 15NH 4Cl 3. După purificarea aminoacidului s-a constatat un randament al sintezei de 94%. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. Sinteza de [15N]-L-Met Mediul de reacţie pentru sinteza de 15N-metionină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. viteza reacţiei fiind direct proporţională cu concentraţia de substrat până la anumite valori. Viteza a scăzut mult după încă 10 min (în primele 20 min ale sintezei s-au consumat 80% clorură de amoniu).ţilor şi randamentele sintezelor sunt prezentate în Tabelul 3. 292. atât masa moleculară cât şi 49 . Spectrul de masă al valinei marcate isotopic este prezentat în Figura 6 B. şi 218.0 8. şi deci şi consumul de clorură de amoniu este foarte mare în primele minute de sinteză. iar în cazul valinei marcate cu 15N. Masa moleculară a metioninei derivatizată cu două grupări silil este de 377. În continuare viteza reacţiei a scăzut. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice.

(A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norleucină. cca 97 atom % 15N Sinteza de [15N]-L-NorLeu Mediul de reacţie pentru sinteza de [15N]-norleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa metioninei marcate cu 15N în produsul sintezei enzimatice. DMTBS derivat. Sinteza de [15N]-norleucină. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo dehidrogenază. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-metionină. Raportul molar al reactanţilor (acid α-ceto caproic:15NH4Cl )a fost de 1:1. Din fiecare reactant s-a utilizat o cantitate de 4. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. Din fiecare reactant s-a utilizat o cantitate de 5.8 mmol. % 50 40 30 20 10 0 4 40 57 75 147 133 275 303 15 20 346 0 50 100 150 200 m/z 250 300 350 400 0 0 5 10 20 min 30 70 90 120 Figura 8. înainte de adăugarea enzimelor. înainte de adăugarea enzimelor. cca 97 atom % 15N 50 . Sinteza de [15N]-metionină. M = 378. Sinteza s-a declanşat cu 106 U de leucin dehidrogenază şi 86 U de glucozo dehidrogenază şi 39 U de galacto mutarotază. 100 A 100 90 80 70 60 73 201 B 80 NH Cl (%) 60 I.masele ionilor fragment cresc cu o unitate de masă. Spectrul de masă al metioninei marcate isotopic este prezentat în Figura 7 B. DMTBS derivat. Figura 7. (B) Spectrul de masă al [15N]-metioninei. Raportul molar al reactanţilor (acid α-ceto-γ-metiltiobutiric:15NH4Cl )a fost de 1:1. (B) Spectrul de masă al [15N]-norleucinei. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero.7 mmol. M = 360.

NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero.8% din activitatea pentru acidul cetoisovaleric). Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele mai menţionate mai sus.0 4. Din fiecare reactant s-a utilizat o cantitate de 8. Tabelul 4. % 60 50 40 261 147 57 133 303 331 0 50 100 150 200 250 300 350 289 15 40 30 20 20 10 0 0 0 5 15 30 m in 60 90 120 m/z Figura 9. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetobutiric este cea mai mică dintre substratele analizate (4.03 mmol. cca 97 atom % 15N 51 . înainte de adăugarea enzimelor. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norvalină. 100 A 100 90 80 187 73 B 80 NH4Cl (%) 70 60 I. 274 şi 200. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 9 A). Raportul molar al reactanţilor (acid α-ceto butiric:15NH4Cl)a fost de 1:1. Raportul reactanţilor şi randamentele sintezelor sunt prezentate în Tabelul 4.4 U/mg proteină). Masele fragmentelor ion ale norleucinei cu conţinut izotopic natural sunt sunt m/z 316.Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetocaproic este relativ mică (17.7 U/mg proteină. 302.7 Masa moleculară a norleucinei fără marcare izotopică este 359. M = 346. Sinteza de [15N]-norvalină. (B) Spectrul de masă al [15N]-norvalinei. ceea ce demonstrează marcarea norleucinei nu 15N (Figura 8 B). Sinteze de [15N]-L-norleucină Reactanţi (mmol) Acid cetocaproic 2.0 4. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 8 A). DMTBS derivat. Sinteza s-a declanşat cu 310 U de leucin dehidrogenază şi 204 U de glucozo dehidrogenază.7 15NH 4Cl Randamentul sintezei (%) 78 78 2. ceea ce constituie 2. Sinteza de [15N]-L-Norval Mediul de reacţie pentru sinteza de [15N]-norvalină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode.

5 U/mg proteină) este mai mare decât pentru acidul cetoisocaproic (36. 288. este M=345. cca 97 atom % 15N În cazul izoleucinei derivatizate cu două grupări silil.8 U/mg proteină). 52 . 302. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice. Masele fragmentelor ion obţinute prin spectrometrie de masă sunt mai mari cu o unitate. DMTBS derivat. Sinteza s-a declanşat cu 290 U de leucin dehidrogenază şi 221 U de glucozo dehidrogenază. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-β-metilvaleric (46. M = 360. În cazul aminoacizilor marcaţi cu 15N. Spectrul de masă al norvalinei marcate isotopic este prezentat în Figura 9 B. înainte de adăugarea enzimelor. Sinteza de [15N]-isoleucină. Sinteza de [15N]-L-Ile Mediul de reacţie pentru sinteza de [15N]-izoleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. masa moleculară exactă pentru norvalină fără marcare izotopică la azot. % 60 4 50 40 15 303 57 75 147 133 275 40 30 20 20 10 0 0 0 5 10 20 40 min 60 90 120 345 50 100 150 200 250 300 350 400 0 m/z Figura 10. şi respectiv 200. 260 şi 186. iar în cazul norvalinei marcate cu 15N . Din fiecare reactant s-a utilizat o cantitate de 5. ceea ce demonstrează marcarea izoleucinei cu 15N (Figura 10 B).În cazul norvalinei derivatizate cu două grupări silil. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. 274. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 10). Masele caracteristice ale ionilor fragment ale izoleucinei cu conţinut izotopic natural au valorile m/z 316. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. Masele caracteristice ale ionilor fragment ale valinei cu conţinut izotopic natural au valorile m/z 302. (B) Spectrul de masă al [15N]-izoleucinei. masa moleculară exactă pentru izoleucină fără marcare izotopică la azot este M=359. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă.27 mmol. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-isoleucină. A 100 80 NH Cl (%) 100 90 80 70 60 201 73 B I.

Producerea acidului aspartic la scară industrială s-a realizat enzimatic din fumarat şi săruri de amoniu utilizând aspartaza ca şi catalizator [Chibata şi colab..53).352 4.0 10.. care este deplasat spre formarea de acid aspartic. Concentraţiile la echilibru de L-Asp şi NH4Cl se calculează din concentraţiile lor iniţiale şi concentraţia la echilibru de acid fumaric.69 mM (sau 3. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab.5). Dozarea activităţii enzimatice a aspartazei s-a făcut de asemenea la temperatura camerei. 53 .35 4.0 20. La echilibru nu se mai observă nici o variaţie de extincţie..432 3. Celule imobilizate de E.Sinteza de acid L-aspartic Aspartaza este folosită cu succes în sinteza de acid aspartic din acid fumaric şi clorură de amoniu.69 x 10 –3 M).251 0. Tabelul 5. metoda fiind foarte eficientă şi simplă.566 30.Asp NH4Cl Fumarat (mM) 1. MgCl2 6mM.749 10. iar la diferite intervale de timp se citeşte extincţia la 240 nm. între cei doi reactanţi (fumarat şi acid aspartic) se stabileşte un echilibru.648 20.251 3.0 10. Pentru a determina concentraţiile reactanţilor la care se stabileşte echilibrul reacţiei am făcut mai multe determinări ale constantei de echilibru.0 0 0. Se adaugă apoi 1 U de aspartază recombinată.0 0 1. diverse concentraţii de acid aspartic şi NH4Cl. care este proporţională cu concentraţia de acid fumaric format (εmM = 2.28 2.43 2. 1976].523 10.0 40. Rezultatele şi condiţiile acestor determinări sunt prezentate în Tabelul 5. 1973]. iar acidul aspartic având o cerere mare pe piaţa de aminoacizi.Asp NH4Cl Fumarat L.70 Mediul de reacţie conţine la un volum de 1 ml următorii reactivi: tampon Tris-HCl 50 mM (pH 8. În cazul reacţiilor reversibile nu se consumă tot substratul şi ca rezultat randamentul sintezelor scade.477 0.Media celor 4 măsurători au indicat o valoare a Keq = 3.0 0 3. Reacţia de sinteză s-a oprit prin denaturarea termică a enzimei. coli Concentraţia iniţială (mM) Concentraţia de echilibru (mM) Keq L.352 0. Acid L-aspartic ↔ Acid fumaric + NH4+ După o anumită perioadă de timp.477 3. indicate în partea stângă a tabelului. Tosa şi colab.434 0. Sinteza de acid aspartic s-a realizat la temperatura camerei. Pe tot parcursul sintezei s-a urmărit consumul de acid fumaric prin citirea absorbanţei la 240 nm (Figura 11 A). 1981. Determinarea constantei de echilibru (Keq = [NH3] [acid fumaric] / [acid aspartic]) a reacţiei catalizate de aspartaza din E. Reacţia de formare a acidului aspartic din fumarat este reversibilă.0 0 1.

418. Acest fapt ne-a determinat să testăm o sinteză de acid cetoisocaproic (Figura 12). Leucin dehidrogenaza de la B.Fumarat mM Aspartat mM 1000 100 90 80 73 Fumarat/Aspartat (mM) 800 70 60 600 I. Până acum nu a fost descrisă o metodă enzimatică eficientă de producere a cetoacizilor. Reacţia s-a declanşat cu aspartază 2 U/ml. fapt care explică şi costurile mari a acestora. NH4Cl 0. coli. DMTBS derivat. (A) Consumul de acid fumaric şi formarea de acid aspartic în cursul reacţiei de sinteză a acidului aspartic. fără marcare cu 15N. Acesta reprezintă cel mai mare impediment în utilizarea AADH în sinteza enzimatică a cetoacizilor. M = 457. stearothermophilus cu 9 aminoacizi lipsă la capătul C-terminal are o activitate specifică în reacţia de dezaminare a L-leucinei. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa acidului aspartic în produsul sintezei enzimatice. Sinteza de acid α-cetoisocaproic Sinteza chimică a cetoacizilor este dificil de realizat. pH s-a ajustat la valoarea de 8. Masele caracteristice ale ionilor fragment ale acidului aspartic fără marcare izotopică au valorile m/z 432. Reacţiile sunt reversibile.8 M. catalizată de aspartaza recombinată din E. După purificare s-a constat un randament de 70%. aproape de două ori mai mare decât enzima nativă.5 cu NaOH. % 50 40 400 30 20 75 200 10 0 0 50 100 147 202 244 150 200 250 302 316 300 350 418 390 400 450 460 500 0 0 50 100 150 200 min 250 300 350 m/z Figura 11. Masa moleculară a acidului aspartic derivatizat cu trei grupări silil este de 457. Pentru sinteză am utilizat şi aspartază recombinată de la E. coli. Spectrul de masă al acidului aspartic fără marcare izotopică este prezentat în Figura 11 B. 390 şi 316. Sinteza de acid aspartic. (B) Spectrul de masă al acidului aspartic. Componenţa mediului de sinteză a fost: acid fumaric 1 M. iar echilibrul este deplasat spre formarea de aminoacid. Aspartaza a servit la înlăturarea ionului de amoniu format în urma reacţiei 54 . Aminoacid dehidrogenazele (AADH) catalizează dezaminarea L-aminoacizilor cu formare de cetoacizi corespunzători.

L-leucină

NAD+ LeuDH358 NADH LDH

Lactat

Acid αcetoisocaproic NH4+

Piruvat

+
Fumarat AAL Acid aspartic

Figura 12. Schema de sinteză a acidului cetoisocaproic.

de dezaminare a L-leucinei. Reacţia catalizată de aspartază este şi ea reversibilă, dar în acest caz echilibrul reacţiei este deplasat spre formarea de acid aspartic, deci spre consumarea de NH4+. Pentru regenerarea coenzimei am utilizat lactat dehidrogenaza din muşchi de bovine. Un impediment care poate apărea pe parcursul sintezelor de acest gen (cu mai multe enzime) este reacţionarea enzimelor secundare cu produsul sintezei. Este cunoscută specificitatea strictă a aspartazei pentru acid aspartic, de aceea am testat numai activitatea LDH cu diferiţi cetoacizi (Tabelul 6). Surprinzător este faptul că, totuşi, unii cetoacizi sunt substrate pentru LDH. Pentru sinteza cetoacizilor ce servesc ca substrate şi pentru LDH trebuie căutate alte enzime pentru regenerarea coenzimei.
Tabelul 6. Activitatea LDH din muşchi de bovine (Boehringer) în prezenţa diferiţilor α-cetoacizi în raport cu substratul fiziologic (acid piruvic) α cetoacid Acid piruvic Acid hidroxipiruvic Acid fluoropiruvic Acid α cetobutiric Acid α cetocaproic Acid α cetovaleric Acid α ceto γ metiltiobutiric Acid α cetoizocaproic Acid α ceto β metilvaleric Activitate U/mg proteină 140 69 38 10 0,38 0,13, 0,02 0,00 0,00 % 100 49 27 7,1 0,27 0,093 0,014 0,00 0,00

Mediul de reacţie conţine în volumul final de 1 ml: tampon Tris–HCl 50 mM (pH 8,5), MgCl2 6 mM, NADH 0,15 mM, α-cetoacid 1 mM.

55

Sinteza de acid isocaproic s-a realizat pentru o cantitate de 5 mmol. Temperatura la care a fost efectuată sinteza a fost de 35ºC. Reacţiile au fost oprite prin denaturarea termică a enzimelor (15 min la 85ºC). Formarea acidului cetosiocaproic s-a urmărit prin consumarea piruvatului (Figura 13).
Piruvat mM cetoisocaproat mM 120

100 Piruvat/cetoisocaproat (mM)

80

60

40

20

0 0 50 100 min 150 200 250

Figura 13. Consumul de acid piruvic şi formarea de acid α-cetoisocaproic în cursul reacţiei de sinteză a acidului α-cetoisocaproic în sistemul cuplat LeuDH/AAL/LDH. Componenţa mediului de sinteză a fost: acid fumaric 150 mM, acid piruvic 120 mM, L-leucină 100 mM, NAD 1 mM, pH-ul s-a ajustat la valoarea de 8,5 cu NaOH. Reacţia s-a declanşat cu 2 U/ml aspartază, lactat dehidrogenază şi leucin dehidrogenază (LeuDH358).

Din amestecul de sinteză s-a purificat leucina rămasă după sinteză. Cantitatea de leucină recuperată a servit la calcularea randamentului sintezei, care a fost de 30%. Deşi randamentul este mic, sinteza este rentabilă din punctul de vedere al preţului reactanţilor, cei folosiţi sunt mai ieftini decât produsul final. În concluzie, tehnicile care utilizează ADN recombinat au aplicaţiile cele mai diverse în biotehnologie. Aplicarea lor cere însă expertize variate cum sunt: - calcularea randamentelor de reacţie pe baza echilibrelor termodinamice şi a parametrilor cinetici a enzimelor implicate, - utilizarea unor procedee rapide de purificare prin cristalizare sau cromatografie, dar nu în ultimul rând şi cunoaşterea pieţei internaţionale privind cererea şi oferta produselor. Piaţa moleculelor marcate cu 15N este redusă dar interesantă, considerând valoarea ridicată a acestor compuşi. Pentru comparaţie, 1 kg 56

de acid L-glutamic valorează în prezent ~1 €, în timp ce 1 g acid [15N]-L-glutamic valorează ~150 €

2. Tendinţe actuale în aplicarea bionanotehnologiilor
Bionanotehnologiile moderne se inspiră din organizarea celulară a lumii vii. Astfel, structurile nano la fel ca şi structurile vii, sunt alcătuite din componente de natură organică şi anorganică. Aceste structuri sunt speranţa pentru tratarea a numeroase cancere, existând în prezent deja aplicaţii ale nanoparticulelor în tratamentul unor cancere. Nanoparticulele sunt o speranţă nu numai pentru tratamentul numeroaselor boli, dar şi pentru stabilirea unor diagnostice. Utilizarea nanoparticulelor în medicină este axa prioritară în aplicarea bionanotehnologiilor. Limitările bionanotehnologiilor sunt: incapacitatea de a sintetiza particule de aceleaşi dimensiuni cu aceeaşi suprafaţă, controlul organizării lor. Ţesuturile tari, cum ar fi ţesutul osos, cochiliile la moluşte, conţin una sau mai multe componente organice de natură proteică care controlează organizarea structurală . Aplicaţii ale bionanotehnologiilor Nanoparticulele de aur (NP-Au) sunt o adevărată speranţă în diagnosticul şi tratamentul cancerelor. Au a fost utilzat timp de câteva decenii în diverse aplicaţii în medicină (implanturi dentare) datorită caractersticilor sale neutre. Nanoparticulele de Au au început să fie din ce în ce mai des utilizate în depistarea şi chiar tratamentul unor celule canceroase datorită faptului că acestea sunt inerte, non-toxice, au stabilitate mare, dimensiuni mici şi capacitate de legare mare. NP-Au sunt capabile de a acţiona asupra unor anumite tipuri de celule chiar în absenţa oricăror grupe funcţionalizate. NP-Au induc moartea celulară liniei de celule de carcinom pulmonar A549 de la om, dar nu au nici un efect asupra altor linii de celule HepG2 (carcinom hepatic hepatocelular uman) şi BHK21 (celule juvenile din rinichi de hamster) (Patra şi col., 2007). Diagnostic Diagnosticul nanomolecular al cancerului poate asigura depistarea celulelor canceroase în faze incipiente ale bolii. Nanoparticule de aur derivatizate cu nucleotide tiolate au fost utilizate pentru depistarea celulelor canceroase (Conde şi col., 2010). NP-Au la care s-au ataşat oligonucleotide de ADN au fost utilizate pentru diagnosticul timpuriu al leucemiilor mieloide acute. Oligonucleotidele ADN utilizate în acest scop 57

reprezentau un fragment din joncţiunea care rezultă în urma translocaţiiei t(9;22)(q34;q11). Un fragment dintr-un cromozom este translocat la un alt cromozom, în acest caz fragmentul de la cromozomul 9 este transferat pe cromozomul 22, cromozomul find cunoscut sub denumirea de cromozom Philadelphia. Această translocaţie este cauza leucemiilor mieloide cronice şi care sunt cauzate de fuziunea a 2 gene BCR(22)-Abl(9) (Figura 14).

Figura 14. Formarea cromozomului Philadelphia – translocaţia reciprocă între cromozomul 9 şi 22.

Produsul acestei gene este o proteină himeră cu activitate tirozin-kinazică. Metoda de detecţie cu ajutorul nanoparticulelor se bazează pe formarea de porţiuni hibride ADN:ARN (ADN sonda: ARNm din celulele canceroase) dublu catenare, care vor împiedica agregarea nanoparticulelor de Au odată cu creşterea concentraţiei de săruri. Metoda nanosondelor pentru diagnosticul acestui tip particular de cancer oferă avantaje faţă de metodele utilizate actual în diagnostic (FISH, transcrierea inversă a ARNm şi amplificarea prin PCR) prin faptul că este mai ieftină şi mai rapidă (~30 min) şi necesită cantităţi mici de ARNm (10 ng/μl). Diagnosticul timpuriu în asemenea cazuri este foarte important, în fazele ulterioare celulele canceroase devenind rezistente la chemoterapice. Nanoparticulele de argint (NP-Ag) au devenit atractive în domeniul bionanotehnologic după descoperirea efectului lor antibactericid (Sondi şi Salopek-Sondi, 2004). Acest efect este unul de importanţă majoră datorită faptului că bacteriile capătă din ce în ce mai multă rezistenţă la antibiotice. Nanoparticulele de argint par a avea o influenţă nu numai asupra bacteriilor, dar şi asupra virusurilor. Astfel NP-Ag la concentraţii non-toxice pentru celule inhibă replicarea virală (sinteza materialului genetic ai virusului) 58

atunci când nanoparticulele sunt administrate înainte de infectare sau imediat după (2-4 ore) aceasta (Speshock şi col., 2010). Unele substanţe chimice s-au dovedit a avea un efect inhibitor asupra proliferării celulare, angiogenezei şi rol antiinflamator. Un astfel de exemplu este colorantul DCPIP (2,6-diclorofenol-indofenol) care induce apoptoza (moartea celulară) în celule umane de melanom A375 şi G361 (Cabello şi col., 2009). DCPIP s-a dovedit a avea acţiune antiangiogeneză şi antiinflamatoare asupra celulelor canceroase umane de colon HCT116. Efectul acestuia este mai intens dacă este încapsulat în particule de poliacizi (lactic şi glicolic). Concentraţiile de ≥6 μg/ml de colorant (DCPIP) induc moartea celulară prin apoptoză (Mondalek şi col., 2010). Nanobiotehnologiile urmăresc nu numai crearea de nano-vehicule pentru transportarea diferitor substanţe, dar şi crearea şi manipularea unor adevărate nano-motoare, utile în nanomanipulare celulară. F1-ATP-aza este un veritabil nano-motor rotativ, a cărei mişcări pot fi controlate cu ajutorul unor stimuli optici şi chimici (Ristic şi col., 2009). Sisteme particulare capabile de transport ţintit şi eficient a diferitor substanţe, cu puţine efecte adverse, se datorează probabil endocitozei transportorilor. Nanoparticule cationice formate din lipide cationice şi polielectroliţi s-au dovedit a fi cărăuşi excelenţi pentru transportul amfotericinei B – un antifungicid pentru Candida albicans (Vieira şi Carmona-Ribeiro, 2008). Nanodiscurile de HDL (High Density Lipoprotein) sunt un strat bifosfolipidic cu aspect de disc (ND-HDL). Este cunoscut faptul că HDL este numit “colesterolul bun” deoarece este implicat în transportul moleculelor hidrofobe (colesterol) în fluxul sangvin care este un mediu hidrofil. Structura HDL (liporoteine cu densitate mare) este una simplă, fiind alcătuit din fosfolipide şi apolipoproteină (apo). Cea mai abundentă formă de lipoproteină din plasma sanguină umană este apoA-I, care este alcătuită din 243 de aminoacizi, este bine caracterizată şi la incubarea cu vezicule de fosfolipide în vitro formează HDL revers, capabil de transportul moleculelor hidrofobe (Ryan, 2010). Fosfolipidele cele mai frecvent utilizate pentru asamblarea veziculelor sunt DMPC (dimirisstoil-fosfatidil colina) şi DMPG (dimirisstoil-fosfatidil glicerol). Incubarea acestor vezicule cu apoA-I se autoasamblează ND-HDL. Aceste nano-discuri se pot autoasambla chiar dacă nu este utilizată enzima integrală, ci numai fragmente de apolipoproteine (Weers şi col., 2001). ND-HDL reprezintă astfel un mediu favorabil pentru studierea proteinelor transmembranare, transportul unor substanţe hidrofobe. 59

Stratul bilipidic este un mediu natural pentru proteinele transmembranare care îşi păstrează proprietăţile sale conformaţionale şi activitatea. Suprafaţa unui nanodisc cu diametrul de 20nm este de ~300 nm2, o suprafaţă suficientă pentru integrarea câtorva molecule proteice. Avantajul utilizării acestor structuri comparativ cu miceliile de detergenţi, este că asigură un mediu natural apropiat, fără prezenţa detergenţilor care pot schimba conformaţiile proteinelor. ND-HDL au fost utilizate în studierea a numeroase proteine transmembranare cum ar fi bacteriorodopsina (Bayburt ţi col., 2006; Blanchette şi col., 2008), citoromul p450 3A4 (Baas şi col., 2004), toxina antraxului (Katayama şi col., 2010), hidrogenaze enzime de membrană produse de Pyrococcus furiosus care pot sintetiza H2 (Baker şi col., 2009). ND-HDL au fost testate în utilizarea lor pentru transportul diferitor substanţe hidrofobe, care sunt insolubile în mediu sangvin hidrofil. Un exemplu în acest sens este transportul de către ND-HDL a amfotericinei B un potenţial antifungicid care inhibă creşterea Saccharomyces cerevisiae şi a altor fungi patogene, care administrat sub această formă nu mai este toxic la anumite concentraţii (Oda şi col., 2006). ND-HDL ce conţineau cucurmină (un polifenol hidrofob natural obţinut din Curcuma longa) au inhibat creşterea liniei celulare hepatice HepG2 comparativ cu administrarea curcuminei libere (Ghosh şi col., 2010). O altă aplicaţie a nanodiscurilor de HDL a fost încorporarea de lipide cu ioni bivalenţi de Ni2+, care au capacitatea de a fixa proteinele cu etichetă de 6-His (histidine). Proteina din învelişul virusului West Nile (Fischer şi col., 2010)

3. Bibliografie
1. Baas B. J., Denisov I. G., Sligar S. G., (2004). Homotropic cooperativity of monomeric cytochrome P450 3A4 în a nanoscale native bilayer environment, Archives of Biochemistry and Biophysics, 430(2), 218-28. Baker S. E., Hopkins R. C., Blanchette C. D., Walsworth V. L., Sumbad R., Fischer N. O., Kuhn E. A., Coleman M., Chromy B. A., Letant S. E., Hoeprich P. D., Adams M. W., Henderson P. T., (2009). Hydrogen production by a hyperthermophilic membrane-bound hydrogenase în water-soluble nanolipoprotein particles, Journal of the American Chemical Society, 131(22), 7508-7509. Baker P., Sawa Y., Shibata H., Sedelnikova S., Rice D., (1998). Analysis of the structure and substrate binding of Phormidium lapideum alanine dehydrogenase. Nature Structural Biology, 5, 561-67. Bayburt T. H., Grinkova Y. V., Sligar S. G., (2006). Assembly of single bacteriorhodopsin trimers în bilayer nanodiscs, Archives of Biochemistry and Biophysics, 450(2), 215-22. Blanchette C. D., Cappuccio J. A., Kuhn E. A., Segelke B. W., Benner W. H., Chromy B. A., Coleman M. A., Bench G., Hoeprich P. D., Sulchek T. A., (2008). Atomic force microscopy differentiates discrete size distributions between membrane protein

2.

3.

4.

5.

60

6.

7.

8. 9. 10.

11.

12. 13. 14.

15. 16.

17.

18.

19.

20. 21.

containing and empty nanolipoprotein particles, Biochimica et Biophysica Acta, 1788(3), 724-31. Boonstra B., Rathborne D. A., French C. E., Walker E. H., Bruce N. C., (2000). Cofactor regeneration by a soluble pyridine nucleotide transhydrogenase for biological production of hydromorphone. Applied Enviromental Microbiology, 66, 5161-66. Cabello C. M., Warner B. Bair W. B., Bause A. S., Wondrak G. T., (2009). Antimelanoma activity of the redox dye DCPIP (2,6-Dichlorophenolindophenol) is antagonized by NQO1, Biochemical Pharmacology, 78(4), 344-54. Chibata I., Tosa T., Sato T., (1976). Production of L-aspartic acid by microbial cells entrapped în polyacrylamide gels. Methods în Enzymology, 44, 739-746. Conde J., de la Fuente J. M., Baptista P. V., (2010). RNA quantification using gold nanoprobes - application to cancer diagnostics, Journal of Nanobiotechnology, 8:5. Deconttignies-Le Maréchal P., Calderon-Seguin R., Vandecasteele J.,P., Azerad R., (1979). Synthesis of L-tryptophan by immobilized Escherichia coli cells. European Jornal of Applied Microbiology and Biotechnology, 7, 33-44. Delforge D., Devreese B., Dieu M., Delaivre E., Beeumen J., Remacle J., (1997). Identification of lysine 74 în pyruvate bineding of alanine dehydrogenase from Bacillus subtilis. Journal of Biological Chemistry, 272, 2276-84. Ghosh M., Singh A. T., Xu W., Sulchek T., Gordon L. I., Ryan R. O., (2010). Curcumin nanodisks: formulation and characterization, Nanomedicine: Nanotechnology, Biology and Medicine, Honorat A., Monot F., Ballerini D., (1990). Synthesis of L-alanine and L-valine by enzyme system from Bacillus megaterium. Enzyme and Microbial Technology, 12, 515-20. Honorat-Pascal A., Monot F., Ballerini D., (1990). Coparative stady of the enzymatic synthesis of L-valine by purified enzymes, crude extract or permeabilized cells from Bacillus megaterium. Applied Microbiology and Biotechnology, 34, 236-41. Hummel W., Kula M-R., (1989). Dehydrogenases for the synthesis of chiral compounds. European Journal of Biochemistry, 184, 1-13. Fischer N.O., Infante E., Ishikawa T., Blanchette C.D., Bourne N., Hoeprich P.D., Mason P.W., (2010). Conjugation to nickel-chelating nanolipoprotein particles increases the potency and efficacy of subunit vaccines to prevent West Nile encephalitis, Bioconjugate Chemistry, 21(6), 1018-22. Fukui S., Ikeda S., Fujimura M., Yamada H., Kumagai H., (1974). Production of L-tryptophan, L-tyrosine and their analogues by immobilized tryptophanase and immobilized β-tyrosinase. European Journal of Applied Microbiology, 1, 25-39. Fusee M., Swann W., Calton G., (1981). Immobilization of Escherichia coli cells containing aspartase activity with polyurethane and its application for L-aspartic acid production. Applied Enviromental Microbiology, 42, 672-76. Fusee M., Weber J., (1984). Immobilization by polyurethane of Pseudomonas dacunhae cells containing L-aspartat β-decarboxylase activity and application to L-alanine production. Applied Enviromental Microbiology, 48, 694-98. Karsten W.E., Viola R.E., (1991). Kinetic studies of L-aspartase from Escherichia coli: pH-dependent activity changes. Archives of Biochemistry and Biophysics, 287, 60-67. Katayama H., Wang J., Tama F., Chollet L., Gogol E. P., Collier R. J., Fisher M. T., (2010). Three-dimensional structure of the anthrax toxin pore inserted into lipid nanodiscs and lipid vesicles, Proceedings of the National Academy of Sciences of the USA, 107(8), 3453-57.

61

22. Katoh R., Nagata S., Ozawa A., Ohshima T., Kamekura M., Misono H., (2003). Purification and characterization of leucine dehydrogenase from an alkaliphilic halophile, Natronobacterium magadii MS-3. Journal of Molecular Catalysis, 23, 231-38. 23. Mondalek F. G., Ponnurangam S., Govind J., Houchen C., Anant S., Pantazis P., Rama P Ramanujam R. P., (2010). Inhibition of angiogenesis- and inflammation-inducing factors în human colon cancer cells în vitro and în ovo by free and nanoparticle-encapsulated redox dye, DCPIP, Journal of Nanobiotechnology, 8:17, 1-9. 24. Monot F., Benoit Y., Lemal J., Honorat A., Ballerini D., (1988). Simultaneous production of amino acid dehydrogenase and glucose dehydrogenase by Bacillus megaterium and their utilization for L-valine synthesis with NADH regeneration. Biocatalysis, 2, 161-74. 25. Nagata S., Misono H., Nagasaki S., Esaki N., Tanaka H., Soda K., (1989). Thermostable alanine dehydrogenase of Bacillus sp.DSM730: gene cloning, purification, and characterization. Biochemistry, 71, 559-63. 26. Nagata S., Tanizawa K., Esaki N., Sakamoto Y., Ohshima T., Tanaka H., Soda K., (1988). Gene cloning and sequence determination of leucine dehydrogenase from Bacillus stearothermophilus and structural comparison with other NAD(P)+-dependent dehydrogenases. Biochemistry, 27, 9056-62. 27. Norbert M., Brunhuber W., Blanchard J.S., (1994). The biochemistry and enzymology of amino acids dehydrogenases. Critical Reviews în Biochemistry and Molecular Biology, 29, 415-67. 28. Oda M. N., Hargreaves P. L., Beckstead J. A., Redmond K. A., van Antwerpen R., Ryan R. O., (2006). Reconstituted high density lipoprotein enriched with the polyene antibiotic amphotericin B, Journal of Lipid Research, 47(2), 260-67. 29. Ohshima T., Nishida N., Bakthavatsalam S., Kataoka K., Takada H., Yoshimura T., Esaki N., Soda K., (1994). The purification, characterization, cloning and sequencing of the gene for a halostable and thermostable leucine dehydrogenase from Thermoactinomyces intermedius. European Journal of Biochemistry, 222, 305-12. 30. Ohshima T., Wandrey C., Conrad D., (1988). Continous production of 3-fluoro-L-alanine with alanine dehydrogenase. Biotechnology and Bioengineering, 34, 394-97. 31. Ohshima T., Wandrey C., Kula M-R., Soda K., (1985). Impovement for L-leucine production în a continously operated enzyme membrane reactor. Biotechnology and Bioengineering, 26, 1616-18. 32. Oka M., Yang Y.S., Nagata S., Esaki N., Tanaka H., Soda K., (1989). Overproduction of thermostable leucine dehydrogenase of Bacillus stearothermophilus and its one-step purification from recombinant cells of Escherichia coli. Biotchnology and Applied Biochemestry, 11, 307-11. 33. Patra H.K., Banerjee S., Chaudhuri U., Lahiri P., Dasgupta A., (2007). Cell selective response to gold nanoparticles, Nanomedicine: Nanotechnology, Biology, and Medicine, 3, 111–19 34. Ristic Z., Vitali M., Duci A., Goetze C., Kemnitz K., Zuschratter W., LillH., Bald D., (2009). Two-stimuli manipulation of a biological motor, Journal of Nanobiotechnology, 7:3. 35. Ryan R. O., (2010). Nanobiotechnology applications of reconstituted high density lipoprotein, Journal of Nanobiotechnology, 8:28. 36. Schütte H., Flossdorf J., Sahm H., Kul, M. R., (1976). Purification and properties of formaldehyde dehydrogenase and fromate dehydrogenase from Candida boidinii. European Journal of Biochemistry, 62, 151.

62

37. Siranosian J.K., Ireton, K., Grossamn D.A., (1993). Alanine dehydrogenase (ald) is required for normal sporulation în Bacillus subtilis. Journal of Bacteriology. 175, 6789-96. 38. Sondi I., and Salopek-Sondi B., (2004). Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria, Journal of Colloid and Interface Science, 275, 177–82. 39. Speshock J. L., Murdock R. C., Braydich-Stolle L. K., Schrand A. M., Hussain S. M., (2010). Interaction of silver nanoparticles with Tacaribe virus, Journal of Nanobiotechnology, 8:19. 40. Tosa T., Sato T., Mori T., Chibata I., (1974). Basic studies for continous production of L-aspartic acid by immobilized Escherichia coli Cells. Applied Microbiology, 27, 886-89. 41. Vieira D. B., and Carmona-Ribeiro A. M., (2008) Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity în vitro, Journal of Nanobiotechnology, 6:6. 42. Weers P. M., Narayanaswami V., Ryan R. O., (2001). Modulation of the lipid binding properties of the N-terminal domain of human apolipoprotein E3, European Journal of Biochemistry, 268, 3728-35.

63

II. CULTURI CELULARE Culturi celulare
Lect. dr. Mircea Teodor Chiriac Cuprins
1. Prezentarea principiului tehnicii experimentale .................................................... 64 2. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu ............. 67 3. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente .................................................. 71 3.1. Echiparea laboratorului de culturi celulare ..................................................... 71 3.2. Strategii de lucru ............................................................................................ 74 3.3. Instruirea personalului ................................................................................... 75 3.4. Cultivarea celulelor ......................................................................................... 78 3.5. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora .......................................................................................... 78 3.6. Îngheţarea şi dezgheţarea celuluor .................................................................. 79 3.7. Subclonarea; tripsinizarea............................................................................... 81 4. Bibliografie ............................................................................................................. 81

1. Prezentarea principiului tehnicii experimentale
Multe dintre tehnicile introduse la un moment dat în diferite ştiinţe au revoluţionat felul în care acea ştiinţă a fost percepută ulterior. Culturile celulare sunt un asemenea exemplu în biologie. Introducerea acestei tehnici în urmă cu aproximativ 100 de ani a permis practic importul naturii în laborator, ceea ce a dus la standardizarea tehnicilor şi generalizarea strategiilor de studiu între cercetătorii din diverse instituţii, urmată de o explozie informaţională în lumea biologică. Avansarea cunoaşterii bio-medicale din ultimele decenii nu ar fi fost posibilă fără dezvoltarea printre altele a metodelor de lucru cu celulele. Cercetarea bio-medicală actuală foloseşte tehnicile de lucru cu celulele pentru investigarea unor probleme din domenii ca: biofizica, biochimie, biologie celulară şi moleculară, genetica, biologia dezvoltării organismelor, evolutionism, medicina moleculară, farmacologia, bio-nano-tehnologia, inteligent drug design etc. 64

celulele pot fi folosite ca şi model pentru studiul răspunsurilor fiziologice la diferiţi factori de stres din mediu. studii de genomică. . producţia glico-proteinelor recombinante (cytokine. eritropoietina). interferoni.Este practic de neimaginat desfăşurarea activităţii într-un centru de cercetare bio-medical lipsit de laboratorul de culturi celulare. Avansarea cercetării din domeniul celulelor stem şi lucrul cu celulele embrionare face posibilă. cancere şi altele. Din punct de vedere al tipului de cultură se poate vorbi despre: . Tabel 1. Pe de altă parte. secundare şi imortale/canceroase Proprietăţi Inhibiţia de contact1 Fenotipul faţă de situaţia in vivo Genotipul faţă de situaţia in vivo Necesarul factorilor de creştere Diferenţiate Număr de diviziuni Timp necesar cultivării Reproductibilitatea rezultatelor 1 primare da identic identic crescut da 2-3 crescut scăzută secundare da asemănător identic crescut da <100 scăzut crescută imortale/canceroase unele/nu asemănător/rotunde asemănător/diferit crescut/limitat da/nediferenţiate nelimitat scăzut crescută în mod normal. hormoni.presupune prelevarea şi cultivarea unui organ în totalitate.cultura de ţesuturi . Dacă ne referim la cultura de celule. anticorpi monoclonali folosiţi în cercetare şi clinica medicală. deocamdată teoretic. Aplicaţii curente sunt legate de: folosirea culturilor celulare pentru elaborarea vaccinurilor. Într-un sens mai larg.cultura de celule .presupune prelevarea unor fragmente de ţesuturi şi cultivarea lor. celulele cresc în vasul de cultură până când stabilesc contact cu vecinele lor. există trei tipuri de celule animale care sunt cultivate în laborator: primare.presupune prelevarea unor ţesuturi şi digestia lor pentru obţinerea unei suspensii unicelulare care este apoi cultivată mai departe. Aceasta include şi cultivarea unor embrioni întregi.cultura de organe . apoptoză. testarea agenţilor anticanceroşi. Celulele canceroase pierd această caracteristică fenotipică şi după ce ajung să fie confluente încep să crească una peste cealaltă formând ghemuri de celule uşor de distins la microscopul optic. cultivarea organelor şi ţesuturilor cu aplicaţii în bolile cronice degenerative. metabolism. cultura celulară poate cuprinde cultura ţesuturilor şi organelor. . Caracteristicile celulelor primare. moment în care îşi opresc creşterea. secundare şi imortalizate (tabel 1). 65 .

fibroblaste) se face prin biopsierea ţesutului şi formarea unei suspensii unicelulare. Aceste celule vor creşte aderente de suprafaţa vasului de cultură. cultivarea celulelor prelevate din sângele periferic se face într-o manieră care nu necesită ancorarea acestora de pereţii vasului de cultură. După cum se poate observa din tabelul 1. Diferite substanţe (factori de creştere ai diferitelor populaţii leucocitare şi/sau mitogeni – substanţe care stimulează mitoza) pot fi utilizate pentru diferenţierea şi înmulţirea celulelor în cultură. subcultura are ca scop menţinerea celulelor în faza logaritmică de creştere. Pe lângă derivarea culturilor secundare. Culturi secundare Prin subcultivarea celulelor dintr-o cultură primară se pot obţine aşa-numitele culturi secundare. evitarea confluenţei care poate avea ca rezultat inhibarea creşterii. Unele dintre aceste celule imortale (transformate) pot avea caracter oncogenic.Culturi primare Majoritatea celulelor din culturile primare necesită ancoraj. Aceste celule pot apărea ca urmare a unor modificări (transformări) la nivelul cromozomului prin factori chimici. Pe de altă parte. celulele canceroase au unele proprietăţi care le diferenţiază de celelalte celule imortale necancreoase: nu mai prezintă inhibiţia de contact. Cultivarea celulelor provenite din piele (keratinocite. 66 . pot creşte cu mai puţini nutrienţi etc. fizici (radiaţii) sau biologici (virusurile oncogene). Pentru a le separa de acesta şi pentru separarea celulelor unele de altele se folosesc de obicei enzime proteolitice (tripsina). Deşi nu prezintă alterări ale setului de cromozomi (karyotipului). Este posibil ca celulele să formeze aderenţe între ele dar de obicei acestea sunt de o mică intensitate. cu alte cuvinte transplantarea lor la animalele de laborator este urmată de apariţia tumorilor la acestea. Celulele dintr-o cultură secundară pot parcurge până la 100 de diviziuni înainte de a-şi pierde potenţialul proliferativ. îndepărtarea celulelor moarte şi a produşilor de metabolism celular şi adăugarea substanţelor nutritive. Culturi de celule imortalizate Este posibil ca unele celule din culturile secundare să sufere anumite transformări care le conferă caracterul de imortalitate adică posibilitatea de a se divide la nesfârşit. aceste celule acumulează anumite caracteristici fenotipice care le fac să devină o linie celulară distinctă.

Prin diferite metode de screening se pot găsi aceste celule care sunt ulterior subclonate dând naştere astfel unor linii celulare pure şi stabile are produc anticorpii monoclonali. factorilor de coagulare. îmbătrânirii şi apoptozei. ciclului celular. Mai mult. anticorpii monoclonali şi-au găsit foarte rapid aplicaţii în domenii variate cum ar fi: diagnosticul şi trata67 . antirabic). diferenţierii. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Aplicaţiile culturilor celulare îşi găsesc utilitatea în producerea: vaccinurilor (antirubeolic. antiparotidita epidemică. Această tehnologie a fost pusă la punct de către Milstein şi Koehler în urma cu aproape patru decenii. antivaricela. agenţilor anticanceroşi etc. dezvoltarea în ultimii ani a cunoştinţelor şi tehnologiei de lucru cu celulele stem constituie una dintre temele cele mai actuale în domeniul biomedical. celulele animale sunt deosebit de utile în testarea citotoxicităţii diferitelor substanţe incluzând noile terapii anticanceroase. hormonilor şi factorilor de creştere (insulina. În plus. traficului de membrană. Anticorpii monoclonali Una dintre aplicaţtiile culturilor celulare cu cel mai mare impact pentru societate la ora actuală este reprezentată de tehnologia de obţinere a anticorpilor monoclonali prin folosirea hibridoamelor. În 1975 cei doi cercetători au publicat rezultatele prin care pot fi obtinuţi anticorpii monoclonali. Aceste celule sunt fuzionate apoi în prezenţa poli-etilen-glicolului (PEG) cu o linie celulară canceroasă de mielom (cancer al plasmocitelor). Este de aşteptat ca acest domeniu să revoluţioneze tratamentul diferitelor afecţiuni. Pe scurt tehnica presupune imunizarea unui animal de experienţă cu un antigen şi recoltarea celulelor B (cele care produc anticorpii) la un anumit interval de timp după imunizare (figura 1).2. enzimelor. se formează celule hibrid (de unde şi numele de hibridoame) dintre care unele produc anticorpii cu specificitatea dorită (caracter dobândit de la celula B a animalului imunizat) într-o manieră continuă (dobândind caracterul imortal de la celulele de mielom). Nu în ultimul rând. anticorpilor monoclonali şi altor substanţe imunomodulatoare (interferoni. eritropoietina). Datorită specificităţii deosebit de mari (se consideră că un anticorp poate distinge antigenul pereche între 108 molecule). prin folosirea tehnologiei AND-ului recombinat este posibilă crearea celulelor transgene care constituie per se un model de studiu pentru investigarea metabolismului energetic. În urma acestei fuziuni. interleukine).

Celulele B sunt izolate şi combinate cu mieloamele (partea stângă) în prezenţa PEG care mediază fuziunea celulelor. Screeningul face posibilă identificarea coloniilor care produc anticorpi faţă de antigenul dorit. catalizatori ai reacţiilor chimice (abzymes). Urmează apoi subclonarea realizată prin diluarea celulelor din coloniile producătoare în aşa fel încât fiecare 68 .mentul clinic. antigen PEG HAT Screening Subclonare Linie celulară producatoare de anticorp monoclonal Figura 1 Producerea anticorpilor monoclonali Splina este izolată la câteva saptămâni (timp necesar pentru îmbogăţirea repertoriului de celule B specifice) după imunizarea animalului cu antigenul faţă de care se doreşte producerea anticorpilor monoclonali. cercetare fundamentală şi aplicată (metode de izolare a diferitelor substanţe recunoscute). Celulele hibrid sunt singurele care vor supravieţui în mediul suplimentat cu Hypoxanthine Aminopterin Thymidine (HAT). Folosirea terapeutică a anticorpilor monoclonali în diferite afecţiuni umane urmează două direcţii: markeri diagnostici care pot identifica diferite tipuri de antigene din populaţii celulare in vivo şi terapia ţintită a diferitelor afecţiuni în care anticorpului monoclonal îi sunt ataşate substanţe chimice toxice sau radioactive.

Această abordare a permis medicilor oncologi să obţină rezultate spectaculoase în diferite forme de cancere. Există la ora actuală şi peste 30 de anticorpi monoclonali folosiţi ca şi agenti terapeutici în diferite afecţiuni umane. Din acest motiv. pluripotente. Deşi nu sunt toxici. Aceste celule sunt reprezentate de către ovulul fertilizat şi celulele obţinute din primele diviziuni ale acestuia. După sursa de provenienţă există două tipuri de celule stem: celule stem embrionare şi celule stem adulte. anticorpii de şoarece au fost umanizaţi. Cu timpul anticorpii umani pot neutraliza şi distruge anticorpii monoclonali injectaţi anulându-le efectele terapeutice. Ajunşi în organism aceşti anticorpi ca orice altă substanţă străină iniţiază un răspuns imun din partea gazdei care se poate manifesta prin secreţia de anticorpi umani anti-anticorpi monoclonali de şoarece. O schiţă a diferenţierii celulare se găseşte în figura 2. După numărul de precursori ai liniilor diferenţiate pe care le poate produce. numărul celor aflaţi în diferite stadii de testare depăşeşte 100.recipient să conţină teoretic o singură celulă. multipotente. celulele totipotente sunt capabile să formeze un organism în totalitate. Prin definiţie celulele stem sunt acele celule care prin diviziune dau naştere unei celule fiică identică şi unei alte celule care poate fi diferită. După cum implică numele. Tehnologia ADN-ului recombinat a făcut posibilă ataşarea părţii specifice (cea care recunoaşte antigenul) derivată de la şoarece cu un braţ constant (care consituie cea mai mare parte) de la om. Se obţin în acest fel colonii în care toate celule provin dintr-o singură celulă mamă şi deci vor produce acelaşi anticorp ca şi aceasta. anticorpii monoclonali produşi în şoarece prezintă neajunsul de a fi străini organismului uman. cercetătorii au reuşit să izoleze şi cultive cu succes 69 . Celule stem Următorul pas în revoluţia din domeniul biomedical a fost reprezentat de posibilitatea cultivării celulelor stem în laborator. Se poate vorbi la ora actuală de cancere tratate cu anticorpi monoclonali în care pacienţii supravieţuiesc fără recidivă la 30 de ani de la administrarea terapiei. oligopotente. celule stem pot fi clasificate în: totipotente. Cele mai bine studiate celule stem sunt cele derivate din măduva osoasă şi care constituie precursorii tuturor celulelor din sânge. Interesul major pentru biologia celulelor stem este explicat de potenţialul de diferenţiere al acestora în orice tip de ţesuturi şi organele dintr-un organism. Deşi cercetarea în acest domeniu este relativ la început. în ultimii ani.

Pe lângă potenţialul terapeutic enorm. Se pot produce astfel animale „chimera” care exprimă genele implantate în diferite organe. celulele stem prezintă şi aplicaţii diagnostice.anumite celule stem din diferite surse unele dintre ele fiind apoi diferenţiate în numeroase celule finale. Dacă aceste organe sunt chiar gonadele. tehnologia cultivării celulelor stem embrionare este puternic îngrădită de normele actuale ale eticii cercetării. postmitotică Figura 2 Celulele stem pot da nastere unui numar mare de celule diferentiate final 70 . Celula stem Pluripotentă Celula stem Multipotentă Celula stem cu potenţial limitat Celula diferenţiată Parţial Celula diferenţiată final. Folosirea acestor celule face posibilă şi obţinerea animalelor modificate genetic prin introducerea unor gene în embrionul tânăr. atunci urmaşii unei împerecheri dintre doi astfel de şoareci chimera pot produce un knock-out/knock-in pentru acea genă. Deşi deosebit de atractivă. Este posibil ca una dintre cele opt celule ale embrionului rezultat în urma fertilizării in vitro a unui ovul să fie îndepărtată şi analizată din punct de vedere genetic (celula este dispensabilă deoarece restul celulelor rămase refac embrionul). În urma analizelor care pot să depisteze diferite defecte genetice se poate decide neimplantarea embrionului în uterul viitoarei mame.

• tipul de hotă folosită pe scară largă în cultura celulelor animale este hota cu flux de aer vertical care oferă o protecţie bună atât pentru celule cât şi pentru operator. Echiparea laboratorului de culturi celulare Organizarea generală a laboratorului de culturi celulare include următoarele echipamente de bază (figura 3): a. Experimental s-a dovedit că un număr de doar 200 de celule considerate ca fiind celule stem canceroase este suficient pentru a transfera cancerul de la un animal la un altul în timp ce un număr de câteva sute de ori mai mare de celule canceroase care nu prezintă caracteristicile celulelor stem sunt incapabile să transfere boala. în funcţie de tipul de celulp. Hota cu flux laminar • Serveşte lucrului efectiv cu celulele. 71 . Recent au fost descrise şi celule stem canceroase. b. Incubator cu sursa de CO2 • creşterea celulelor. aranjarea spaţiului de lucru este descrisă în figura 4.1. concentraţia de CO2 este în general ajustată între 5% şi 7% pentru a obţine un sistem tampon optimal în combinaţie cu substanţele din mediul de cultură. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente 3. 3. • este prevazută în mod obligatoriu cu o lampă de UV care va fi pornită 5-10 minute înainte de începerea lucrului şi repornită pentru 5-10 minute după încheierea lucrului. calitatea celulelor şi a reactivilor. Această nouă descoperire pune sub semnul întrebării principiile actuale care stau la baza tratamentului cancerului. Succesul în lucrul cu celule depinde de factori variaţi cum ar fi: utilarea laboratorului.Disputele asupra aspectelor etice ale lucrului cu celule stem embrionare au încurajat dezvoltarea tehnicilor de lucru cu celulele stem adulte. Rămâne de văzut dacă potenţialul unor astfel de celule stem adulte este la fel de nelimitat ca şi al celor embrionare. Existenţa acestor celule canceroase stem poate explica apariţia recidivelor prin participarea unui număr redus de celule care nu pot fi distinse/distruse prin tehnicile actuale. tehnica asepteică (prezentate în cele ce urmează) şi experienţa personală a operatorului care contribuie decisiv la primele trei.

• 72 . • Autoclav şi sterilzor cu aer uscat o Folosite pentru sterilizarea diferitelor soluţii şi recipiente folosite. halat). Pompa de vid şi sisteme de sterilfiltrare o pentru lichidele instabile la autoclavare (de ex. f. d. stabilitate în timp. • contrastul de fază îmbunătăţeşte vizualizarea specimenelor transparente (celulelor). DMSO) se poate folosi şi ca sistem de aspirare a mediilor folosite. • deoarece în cultura de celule animale. Frigider/congelator • stocarea reactivilor L-glutamina etc. celulele sunt în general situate pe suprafaţa bazei recipientului se foloseşte microscopul inversat.• responsabil pentru menţinerea unei atmosfere sterile (filtre HEPA. e. • o precauţie deosebită trebuie acordată faptului că recipientul este extrem de rece (-196 grade Celsisus) şi azotul poate produce arsuri în urma contactului cu pielea sau mucoasele. igienizare uşoară. Microscop optic inversat cu contrast de fază (opţional aparat foto) • serveşte la observarea celulelor.) (medii cultură. umede şi cu temperatura constantă. Alte componente • Baie de apă o păstrarea mediilor şi altor reactivi la temperatura de 37 grade Celsius. c. Recipient cu azot lichid • stocarea celulelor pe termen lung. o o alternativă este înlocuirea apei cu perle metalice care prezintă următoarele avantaje: reducerea contaminării reactivilor cu care vin în contact. de obicei se găseşte într-o incintă anexată. stocuri de antibiotice. de aceea este necesară utilizarea echipamentului de protecţie (ochelari/mască facială. high efficiency particulate air). economisirea consumului de energie. manuşi. Centrifuga de masă cu răcire • centrifugarea suspensiilor de celule în diverse scopuri.

73 .Figura 3. • vase de cultură . • medii de cultură (multe celule pot fi cultivate în DMEM/RPMI+10%FBS la care se adaugă diferite concentraţii de L-glutamina şi antibiotice). Organizarea laboratorului de culturi celulare Consumabile • pipete serologice. pot fi din plastic (de unică folosinţă) sau din sticlă (refolosibile după sterilizare).codate în funcţie de aria utilă de cultivare şi de volumul maxim de mediu care poate fi conţinut.

• toate mediile şi suplimentele care urmează a fi folosite în cultura celulară trebuie să fie certificate pentru lucrul pe culturi de celule (indicaţia cell culture certified/approved trebuie să apară pe ambalaj/descrierea produsului). • suplimente pentru mediile de cultură: antibiotice – uzual se foloseşte un ameste de penicilină/streptomicină. Cele mai multe medii conţin şi phenol red. hormoni. • spre deosebire de celulele vegetale şi bacterii. glucoză şi altele în funcţie de particularităţile experimentului. săruri. există riscul contaminării cu diferite microorganisme care datorită ratei 74 . microelemente. celulele animale sunt pretenţioase în ceea ce priveşte condiţiile în care pot sa crească. factori de creştere şi alte componente.Strategii de lucru Din punct de vedere tehnic. bicarbonat. de aceea se va permite doar accesul celor care sunt direct implicaţi în procesul de lucru cu celulule. La ora actuală. vitamine. 3. Na-pyruvat. cu unele excepţii serul este considerat un component de bază.2. un indicator al pH-ului care trebuie să rămână între 7 şi 7. acizi graşi. cele naturale care includ serul sanguin şi alte secreţii de origine animală şi medii sintetice în care componentele de bază sunt produse separat şi apoi amestecate de obicei de către firme specializate.de unde şi numele de fetal bovine serum (FBS). • personalul care urmează să lucreze cu celulele va fi instruit corespunzător (vezi mai jos). de aceea încăperile vor fi semnalizate corespunzător. Compoziţia mediilor de cultură este complexă incluzând: aminoacizi. Dacă acesta virează spre galben indicând un mediu acid este cazul ca mediul să fie schimbat. există câteva principii de bază ale lucrului cu celulele: • culturile celulare vor fi făcute într-o cameră dedicată acestui scop.Conologic se poate vorbi de existenţa a două categorii de medii.4. toate acestea trebuie adaptate liniilor celulare cu care urmează a se lucra în laborator. Este de dorit ca această încapere să fie oarecum izolată faţă de restul laboratoarelor pentru a limita riscul de contaminare. accesul personalului în această cameră va fi restricţionat pe cât posibil. Chiar dacă este vorba de un mediu sintetic. L-glutamină. serul provine de la animale mari. Tot din acest motiv. Mediile de cultură sunt soluţii saline tamponate. în general de la vacă . carbohidraţi. • acele încăperi care sunt dedicate lucrului cu celule prezintă risc infecţios pentru cei implicaţi.

contaminarea se poate propaga din aproape în aproape şi duce în final la compromiterea nu doar a celulelor la care contaminarea a fost iniţial sem75 . înainte de scoaterea din hotă se verifică etanşeitatea închiderii. creşterii densităţii peste un nivel critic. oricine poate învaţa să menţină culturile de celule după doar câteva zile petrecute în laborator dacă respectă protocoalele şi are la dispoziţie echipamentul necesar. şi o concentraţie a CO2 între 5 şi 7% condiţionează clutura celulelor animale (sistemul de tampon cel mai frecvent utilizat este cel cu bicarbonat de sodiu sau potasiu din mediul de cultură + CO2 din incubatorul folosit). Instruirea personalului Cultivarea celulelor este un lucru care se poate învaţa repede. o faza de inhibare a creşterii datorită inhibiţiei de contact. o imediat după adăugarea suplimentelor în mediile de cultură se notează acest fapt pe recipientul respectiv. se poate porni un cronometru pentru a evita „uitarea” mediilor pentru un timp îndelungat şi degradarea lor (L-glutamina. substanţele pot fi preîncălzite fie la 22.. scăderii potenţialului de metabolizare a mediului.3. Cu alte cuvinte. în plus factori ca spre exemplu temperatura (37 de grade Celsius pentru celule mamifere). fie la 37 grade Celsius (10-20 min e suficient. De aceea desfăşurarea activităţii în linişte este esenţială în laboratorul de culturi celulare. lucrul bine organizat şi desfăşurat fără grabă este esenţial pentru o eficienţă maximă: o mişcările vor fi măsurate şi sigure. Chiar şi în condiţii optime. osmolaritatea (290-310mOsm). Singurul lucru care este şi mai uşor şi nici măcar nu necesită învatare este să contaminezi celulele. 3. o nimic din ceea ce vine în contact direct cu celulele nu se deschide în afara hotei sterile. tripsina). celulele animale sunt limitate în ceea ce priveşte numărul de generaţii pe care le produc. pH-ul. Odată aparută. o faza de creştere exponenţială care durează în jur de 7-10 zile. creşterea celulelor animale urmează o curbă cu trei faze: o faza de echilibrare (primele 24h) în care celulele se acomodează cu noul mediu în care sunt introduse.• • • • de creştere mult superioară celulelor animale vor deveni majoritare în scurt timp. celulele animale se vor opri din creştere după un număr de generaţii care depinde de sursa primară a celulelor.

nalată ci a întregului stoc de celule. ei vor începe prin a observa manoperele de lucru şi a le discuta cu un coleg familiarizat deja cu tehnicile. 1 În categoria substanţelor cu efect antimicrobian sunt incluse alături de antisepticele aplicate pe ţesuturi vii. antibioticele care acţionează în interiorul organismului şi de asemenea dezinfectantele care distrug microorganismele aflate pe suprafeţele neaparţinând fiinţelor vii. contaminarea recipientelor cu conţinut original (celule produse în laborator şi care nu pot fi achiziţionate de la companiile specializate sau transferate de la alţi investigatori) reprezintă cel mai neplăcut aspect care poate afecta un laborator de culturi celulare. 76 .pentru evitarea contaminării celulelor şi operatorului: o halat cu mâneci lungi o pantofi închişi o mănuşi de unică folosinţă • Spălatul pe mâini înainte şi după lucrul cu celulele. • O soluţie antimicrobiană1 de ethanol 70% trebuie să fie în permaneţă la îndemână. Toţi cei care urmează să lucreze cu celule vor fi în prealabil instruiţi teoretic înainte de a pătrunde pentru prima dată în laborator. mai întâi sub supravegherea directă a celor familiarizaţi şi mai apoi în mod independent. • Orice lichid care ajunge în contact cu suprafaţa de lucru sterilă va fi îndepărtat imediat cu ajutorul unui prosop de hârtie îmbibat în ethanol 70%. Doar după această perioadă este permis lucrul direct. • Orice pipetă trebuie folosită o singură dată2.) care urmează să fie introdus în hota pentru lucrul steril trebuie dezinfectat înainte sau imediat după introducere. recipient etc. 3 Este vorba despre acele medii/suplimente/alte substanţe care nu mai pot fi sterilizate (fie prin sterilfiltrare fie prin autoclavare) şi respectiv obiecte care nu mai pot fi sterilizate. • Instrumentele de lucru trebuie igienizate la intervale regulate. Pe lângă considerentele financiare. Asigurarea asepsiei şi antisepsiei Există anumite măsuri care asigură igiena în lucrul cu celulele: • Utilizarea echipamentului de protecţie . Chiar şi după câştigarea independenţei în lucru. Practic. • Orice mediu sau obiect contaminat din greşeală va fi aruncat3. 2 Excepţie fac pipetele de sticlă care pot fi spălate şi sterilizate. cel proaspăt iniţiat va fi supravegheat din umbră de către un coleg cu experienţă care ar putea observa anumite manopere executate neconform cu normele curente. Orice obiect (pipeta. nu este permisă păstrarea pipetei în mediu sau folosirea unei pipete pentru a transfera mediu de la un recipient la altul.

Trebuie evitată supraîncărcarea spaţiului de lucru care poate duce pe de o parte la blocarea fluxului de aer şi pe de altă parte la accidente nedorite care pot produce contaminarea celulelor sau reactivilor.• Este necesară investigarea stării de sănătate a celulelor în fiecare zi. Se pot astfel observa caracteristicile normale sau abateri de la acestea. WASTE Figura 4 . Se pot de asemenea observa contaminări cu alte celule sau microorganisme. Figura nu este la scală. Organizarea spaţiului pentru lucrul steril Pentru reducerea la maxim a pericolului de contaminare este esenţială aranjarea locului de muncă sub hotă într-un mod care să evite încrucişarea mâinilor deasupra vaselor de cultură/mediilor. Pentru organizarea eficientă a „mesei” de lucru se poate consulta figura 4. Figura corespunde pentru persoanele care folosesc cu precădere mâna dreaptă. Linia din faţă: Dreapta – pipeta/pompa aspirare medii prevazută la capăt cu pipetă de unică folosinţă Centru – recipientul cu celule În plan posterior: Stânga – vasele cu resturi lichide şi respeciv solide etichetate corespunzător 77 . Organizarea spaţiului de lucru steril Figura prezintă organizarea de bază a spaţiului. Se pot lua probe care sunt analizate pentru stabilirea prin diferite tehnici a gradului de puritate/contaminare. aşa cum este ea întalnită în mod frecvent în majoritatea laboratoarelor.

o culoare care virează spre galben indică necesitatea schimbării mediului. 3. culoarea standard a mediilor este roşu-orange. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora Pentru a subcultiva celulele/folosi celulele într-un anumit protocol este nevoie de stabilirea numărului de celule pe unitatea de volum. flacon cu ethanol 70%. de asemenea se pot planifica în acest fel anumite experimente pentru anumite date.4. în anumite situaţii este nevoie de utilizarea unor soluţii de tripsina/EDTA pentru crearea suspensiilor unicelulare (vezi Tripsinizarea). celulele eucariote pot fi împarţite în două mari categorii: cele care cresc aderent pe vasul de cultură şi cele care cresc în suspensie. Modul de lucru este asemănător pentru toate celulele dar există anumite particularităţi de care trebuie ţinut cont în cazul fiecărei grupe. se recomandă ca celulele să fie subcultivate. evaluarea celulelor se face în mod normal în fiecare zi prin vizualizarea lor sub microscopul optic. există anumite formule de calcul care permit aflarea cu precizie a combinaţiilor optime.pipete serologice de diferite mărimi. starea de sănătate a celulelor este confirmată şi de creşterea numărului de la o zi la alta. iar celulele care cresc în suspensie rămân rotunde şi uneori (în funcţie de linia cultivată) pot forma aglomerări de celule (asemănător cu o ciorchină de struguri).Dreapta – mediile de cultură Centru.5. celulele care cresc aderent trebuie să apară distribuite pe suprafaţa de contact cu vasul în care cresc şi de cele mai multe ori capătă o formă poligonală. Mediul de 78 .suport pentru tuburi În afara hotei la îndemană . subcultivarea celulelor: deoarece aglomerarea celulară poate influenţa negativ vitalitatea celulelor (a se vedea mai sus). o evaluare de primă instanţă a celulelor se realizează prin vizualizarea macroscopică a culorii mediului din sticlele de cultură. această procedură care se aplică în faza logaritmică de creştere a celulelor permite obţinerea unor cantităţi crescute de celule prin împărţirea/transferul acestora dintr-un recipient de cultură în mai multe recipiente fiecare reprezentând o nouă sursă de celule. • • • 3. Cultivarea celulelor • după felul în care cresc în flacoanele de cultură.

Pentru o separare bună este nevoie de 10 minute la 200-250g/min (într-o centrifugă de masă cu rotor standard 1000rpm).dacă avem un singur tub cu celule va trebui să folosim un al doilea tub cu aceeaşi greutate care poate să conţină apă distilată sau orice alt lichid cu densitate asemănătoare). Sub microscopul optic. Celulele vor sedimenta ca şi în figura 5. În funcţie de tipul camerei de numărăt. Soluţia de trypan blue va pătrunde în celulele moarte care apar albastre.cultură conţinând celulele este transferat unor tuburi în care se centrifughează (centrifuga trebuie echilibrată în prealabil . există formule de calcul după care putem să aflăm numărul total de celule. O viabilitate de peste 90-95% este în general acceptată pentru toate manipulările ulterioare. • În plus. de aseme79 . De aceea cea mai sigură metodă de prezervare a liniilor celulare este cryoprezervarea care opreşte procesele metabolice nelăsând astfel loc modificărilor genotipului. Îngheţarea şi dezgheţarea celuluor Doi paşi critici ai lucrului cu celulele sunt constituiţi de către îngheţarea şi dezgheţarea celulelor. cryoconservarea este o metodă practică din punct de vedere economic: este mult mai simplu să păstrezi un tub cu celule îngheţate care nu au nevoie decât de o completare periodică a rezervei de azot decât să cultivi în mod repetat celulele în laborator. leucocitele apar ca şi celule gălbui/transparente cu o membrană brună.5% şi pipetate în camera de numărat. Figura 5 .6. După centrifugare celulele se resuspendă în mediu proaspăt şi apoi 10 microlitri sunt combinaţi cu 10 microlitri de soluţie Trypan blue 0. Aspectul celulelor în tub după centrifugare 3. Îngheţarea este indispensabilă din următoarele considerente: • Celulele sunt supuse în permanenţă variaţiilor în compoziţia cromozomilor.

autoclavat). direct în baia de apă la 37 de grade Celsius. 4 5 80 . Există dispozitive speciale care permit coborarea temperaturii cu un grad pe minut. Dezgheţarea celulelor trebuie făcută extrem de rapid (ideal în mai puţin de un minut) prin transferul acestora din recipientul cu azot. Se centrifughează în general la 200rpm timp de 2-5 min pentru a elimina urmele mediului de îngheţare. numărul de pasaj şi data la care a fost creat stocul. celulele vor fi resuspendate direct în mediul de îngheţare răcit în prealabil la 4 grade la o concentraţie de 1x106-1x107/ml6 şi transferate imediat7 la -20 de grade C pentru 1-2 ore. Odată ce dezgheţarea permite pipetarea suspensiei (>75% dezgheţată) aceasta se transferă într-un tub de 15ml peste care se adaugă picătură cu picătură8 o cantitate de mediu preîncălzit echivalentă cu de două-trei ori cantitatea suspensiei. Prin mişcări fine se distribuie celulele. Mediul de îngheţare5 cel mai frecvent folosit conţine mediul de cultură recomandat pentru linia celulară + 20% FCS + 5-10% cryoprotector -Dimethyl sulfoxid (DMSO) sau 10-15% glycerol care are rolul de a scădea temperatura de îngheţ permiţând apei să iasă din celulă şi împiedicând astfel formarea cristalelor de gheaţă care ar putea distruge membrana. numărul de celule. Există linii celulare la care se preferă folosirea altor substanţe în locul DMSO. după care se poate adăuga mai rapid mediu până la 10ml. este important să avem o suspensie omogenă unicelulară. Se resuspendă în 10 ml de mediu şi se transfera în sticlele de culturp etichetate. 7 DMOS este toxic pentru celuele la temperatura camerei. metoda face posibilă revenirea la celule cu un număr mai mic de pasaje. Urmează apoi transferul peste noapte la -80 de grade Celsius şi apoi stocarea de lungă durată în azot lichid. la îngheţare apa iese din celule unde presiunea osmotică va creşte. De aceea trebuie limitat contactul acestuia cu celulele. 6 Numărul de celule/aliquot variază În funcţie de tipul de celule. Mediul va fi schimbat pentru a înlătura celulele moarte şi resturile de cryoprotector (DMSO – sterilfiltrat sau glycelor . pe gheaţa uscată. După centrifugarea şi verificarea vitalităţii (se recomandă folosirea celulelor vitale în proporţie de >90-95% la colorarea cu trypan blue).nea transportul între laboratoare este mai uşor dacă celulele sunt îngheţate. După câteva ore (cel târziu a doua zi dimineaţa) se verifică starea celulelor prin vizualizarea la microscop. 8 Pentru a preveni socul osmotic. • Nu în ultimul rând. Este esenţial ca înainte de începerea procedurii respective să notăm următoarele detalii pe fiecare tub: tipul de celulă. Îngheţarea4 va fi lentă şi constantă pentru a minimaliza efectele adverse asupra viabilităţii celulelor.

Raff M. celule pot fi direct numărate iar densitatea lor este ajustată prin adăugarea mediului proaspăt. 6. Bonifacino JS. Celulele devin rotunde odată ce pierd aderenţele.protocol-online. La fiecare 2-4 săptămâni se centrifughează şi resuspendă celulele neaderente în mediu proaspăt.7. John Wiley & Sons 2004 Zell. Harford JB. Walter P . 2002 Short Protocols în Cell Biology – 1st ed. acţiunea trispinei este antagonizată prin adăugarea de ser urmată de transferul într-un tub adecvat şi centrifugarea. John Wiley & Sons 5th Edition 2005 Molecular Biology of the Cell – 4th ed. Alberts B.com 9 Acesti ioni pot scadea eficienţa tripsinei/EDTA 81 . Dasso M. Culture of Animal Cells: A Manual of Basic Technique. Lewis J. Cea mai frecventă combinaţie folosită în acest scop este tripsina/EDTA. Imediat. Pentru a ajuta separarea este posibilă uşoara bătaie a sticlei de podul palmei. Lindl T. Lippincott-Schwartz J. 5. Urmărind sub microscop separarea celulelor (durează câteva minute) se poate evita efectul nociv al unei incubări prea îndelungate. celulele sunt apoi transferate vaselor noi de cultură şi incubate până a doua zi. După centrifugare celulele sunt resuspendate în mediu pentru a obţine o suspensie unicelulară şi apoi numărate/investigate la microscop prin colorarea cu trypan blue (proporţia celulelor moarte). spălarea cu o soluţie salină tampon fără9 calciu şi magneziu şi adăugarea unei cantităţi de trispină/EDTA care să acopere stratul de celule. Auflage. Dacă este vorba de celule aderente protocolul de lucru presupune îndepărtarea mediului. tripsinizarea Celulele formează aderenţe între ele şi suprafaţa vasului de cultură (celule aderente) şi/sau între ele (celulele aderente. La celulele neaderente nu se face tripsinizarea.org www. Subclonarea.. 4. Roberts K. se urmează paşii din protocolul respectiv.invitrogen. Celulele nu trebuie lăsate neacoperite timp îndelungat.Bibliografie 1. 3.Garland Science.und Gewebekultur – 4. Yamada KM. Pentru cele mai multe protocoale/manopere este necesară obţinerea unei suspensii unicelulare. 4.3. Dacă tripsinizarea s-a făcut în cadrul protocolului de subcultivare.. 2. Dacă manopera s-a făcut în alt scop. Freshney RI. Johnson A. Spektrum Akademischer Verlag 2000 www. A doua zi se recomandă schimbarea mediului care permite înlăturarea celulelor moarte şi a resturilor de tripsină/EDTA. unele celule care cresc în suspensie).

. 99  1.......... De asemenea dezvoltarea industriei farmaceutice a profitat din plin de avansarea tehnicilor de lucru cu celulele...... medicina moleculară..... Studiul de literatură privind cercetări exploratorii recente ..... Adaptarea/importul acestora la tematicile de cercetare ale platformei ...... culturile celulare sunt folosite fie ca mini-bioreactoare pentru producerea diverselor produse biotehnologice fie ca şi model organismic pentru testarea efectelor/toxicităţii noilor medicamente............... 93  3.. evoluţionism........ Anticorpii monoclonali bio-nano-functionalizaţi ............ Mircea Teodor Chiriac Cuprins 1......... biochimie.Culturi celulare – partea a II-a Lect......... Producerea proteinelor recombinate în celule mamifere..... Recomandări pentru abordarea de noi tipuri de experimente şi metodologii ..... Dintre aplicaţiile moderne ale culturilor celulare. dr.... 88  1... genetică.............. biologie celulară şi moleculară.......... vom discuta în cele ce urmează folosirea celulelor ca şi entităţi de producţie a proteinelor recombinate cu aplicaţii în autoimunitate şi producerea şi caracterizarea anticorpilor monoclonali bio-nano-funcţionalizaţi cu aplicaţii în cancere şi boli autoimune........ Bibliografie ................... farmacologia. ţesuturilor şi proceselor biochimice care au funcţia de a ne proteja faţă de efectele nedorite ale agenţilor patogeni din mediu şi/sau acţiunii dăunătoare a structurilor proprii 82 .................... inteligent drug design etc... 94  4....... Acesta este reprezentat de către totalitatea celulelor.................................... bio-nano-tehnologia............ Studiul de literatură privind cercetări exploratorii recente Culturile celulare reprezintă una dintre cele mai puternice tehnologii/metodologii utilizate de către comunitatea ştiinţifică internaţională din domenii ca: biofizică. biologia dezvoltării organismelor...1..... Imunologia este ştiinţa care se ocupă cu studiul sistemului imun............... 82  1.. 88  2..2....... În acest context.......

răspunsul imun poate cuprinde două variante: • răspunsul înnăscut care reprezintă o primă barieră întâmpinată de către agenţii patogeni veniţi din afară (acest tip de răspuns apare pe scara evolutivă încă de la bacterii şi plante şi este păstrat şi la mamiferele superioare inclusiv la om).) într-o formă finită. • răspunsul adaptativ numit şi specific care este iniţiat atunci când răspunsurile înnăscute nu reuşesc să producă efectul dorit. Deşi mecanismul apariţiei acestor boli nu este pe deplin înţeles. Se consideră că bolile autoimune constituie un grup heterogen de afecţiuni care apar la aproximativ 5% din populaţie. celulele B1. După cum menţionam anterior. Se vorbeşte despre un sistem imun cu componente umorale adică cel în care produşii celulelor imune circulă prin sânge sau secreţii (lacrimi. Din punct de vedere didactic.alterate (cum ar fi celulele tumorale). de sine stătătoare şi cel cu componente celulare în care celulele sunt cele care îndeplinesc funcţia majoră de apărare (Figura 1. Celulele ca şi macrofagele. recunoaşterea structurilor străine se face într-un mod indirect. Ele pot fi clasificate în boli specifice pentru anumite organe aşa cum este spre exemplul pemfigusul vulgar care interesează pielea 83 . Deoarece sistemul imun adapatativ nu apare în urma unui salt brusc de la sistemul imun înnăscut. Tabel 1). sudoare etc. În ciuda specificităţii remarcabile a răspunsurilor imune. Datorită diversităţii extraordinare pe care mediul o oferă. NKT sunt considerate a fi cele care prin diverşi receptori şi căi de semnalizare celulară fac posibilă comunicarea între sistemul adaptativ şi cel înnăscut. Se poate vorbi în acest context despre o împărţire judicioasă a sarcinilor în sistemul imun al mamiferelor. Acest fapt permite apariţia unor erori care au ca şi rezultat declanşarea unor reacţii împotriva propriilor structuri. există diverse mecanisme care au evoulat cu timpul pentru a satisface cu eficienţă maximă rezolvarea fiecărei situaţii ivite. Există aşa-numitele celule. celulele dendritice. celulele natural killer etc. există din ce în ce mai multe date care au permis elaborarea unor teorii şi modele experimentale care s-au dovedit utile în caracterizarea acestor boli. Răspunsurile adaptative apar pentru prima dată pe scara evolutivă la peştii cartilaginoşi ca o completare a sistemului imun înnăscut. funcţia sistemului imun este să ne protejeze faţă de patogenii din mediu şi faţă de structurile proprii modificate. există diferite structuri care asigură trecerea lină de la un sistem la altul asigurând astfel o continuitate între cele două sisteme. fenomen caracteristic bolilor autoimune. cum ar fi granulocitele. care aparţin sistemului imun înnăscut şi alte celule cum sunt limfocitele care aparţin sistemului adaptativ.

Peptide antimicrobiene Anticorpii (imunoglobulinele) celulele dendritice şi monocitele/macrofagele aparţin didactic imunităţii înnăscute dar se găsesc din punct de vedere funcţional la graniţa dintre acesta şi sistemul adaptativ în sensul că fac legătura dintre antigen şi centrul de comandă reprezentat de limfocite. NK. sistem complement Tc B (Ig) Figura 1 Organizarea ierarhică a sistemului imun al mamiferelor. şi boli autoimnune generalizate care interesează mai multe organe sau ţesuturi aşa cum este spre exemplu lupusul sistemic eritematos în care unul dintre au84 . produsi de secretie ai celulelor imune care mijlocesc schimbul de informatii intre acestea (sageata cu doua sensuri). şi mucoasele. celule natural killer. sistemul imun este organizat ierarhic în sensul ca există o unitate de control care integreaza informatiile primite de la toate celelalte componente şi pe baza lor stabileşte care este cea mai bună soluţie de urmat. diabetul zaharat de tip I care afectează celule beta ale pancreasului sau tiroidita Hashimoto care apare la glanda tiroida. Tabel 1 Componente ale sistemului imun al mamiferelor Linia de apărare Primară = imunitatea înnăscută Secundară = imunitatea dobândită (adaptativă sau specifică) 1 Imunitate celulară Granulocite. Exista totodata schimburi directe intre sistemul innascut şi cel adaptativ care au loc cel mai adesea prin intermediul citokinelor. Acesta primeşte informaţii de la sistemul imun înnăscut. Acest centru de control şi decizie este reprezentat de către celula (limfocitul) T helper (Th). La mamifere. coordoneaza activarea sistemului imun adaptativ şi controleaza mecanismele efectoare ale sistemului innascut inchizand astfel circuitul. macrofage.Th Imunitate înnăscută Imunitate adaptativă Granulocyte. 1 Limfocitele B şi limfocitele T Imunitate umorală Sistemul complement.

Dezavantajul major al acestui tip de tratament se manifestă prin apariţtia multiplelor „atacuri” din partea microorganismelor patogene din mediu care găsesc un teren propice pentru dezvoltare într-un organism în care sistemul imun este deprimat. majoritatea pacienţilor sunt tratati cu ajutorul cortizonului şi derivaţilor acestuia. lipsa unei înţelegeri depline a mecanismelor care iniţiază şi mai apoi întreţin distrucţia ţesuturilor proprii se repercută nefavorabil asupra prognosticului şi totodată calităţii vieţii celor afectaţi. O grupă de boli autoimune care se manifestă la nivelul pielii şi mucoaselor este caracterizată de prezenţa autoanticorpilor şi celulelor T autoreactive îndreptate faţă de autoantigenele de la nivelul pielii şi mucoaselor. Din punct de vedere clinic aceste boli se caracterizează prin prezenţa bulelor la nivelul pielii şi mucoaselor. Cercetările din ultimii ani au reuşit să precizeze o parte dintre mecanismele efectoare responsabile de patologia observată. Anticorpii recrutează şi activează fie direct fie prin intermediul complementului granulocitele in situ. substanţe care produc deprimarea sistemului imun ca mijloc de aparare împotriva celulelor hiperreactive care întreţin distrucţia tisulară.toantigenele ţintă este reprezentat de cromatina [1]. Deoarece cromatina se găseşte practic în toate celulele nucleate. printre care se numară epidermoliza buloasă dobândită şi pemfigoidul bulos/pemfigoidul cicatricial sunt caracterizate de prezenţa anticorpilor circulanţi şi a anticorpilor legaţi la nivelul joncţiunii dermo-epidermale care fixează complementul in situ. bule care se sparg lasând în urmă eroziuni acoperite parţial de cruste. Fie că este vorba despre boli specifice de organ fie că este vorba despre cele generalizate. autoanticorpii prezintă reactivitate cu forme recombinate ale autoantigenelor ţintă atât în ELISA cât şi în imunoblot. serurile majorităţii pacienţilor recunosc fomele native ale autantigenelor ţintă atât în imunoblot cât şi pe secţiuni de piele îngheţată. Bolile din această grupă. La ora actuală. adică răspunsul autoimun este întreţinut în permanenţă de existenţa unui anumit nivel rezidual al autoantigenului. Scenariul fazei efectoare propune o succesiune de evenimente care debutează cu legarea autoanticorpilor la nivelul autoantigenelor ţintă urmată de fixarea componentelor sistemului complement. Necesitatea înţelegerii mecanismelor patogenetice la nivel molecular este esenţială nu doar din punctul de vedere al tratamentului dar şi din perspectiva unei depistări precoce sau chiar a posibilelor mijloace de prevenţie a unor asemenea afecţiuni. De asemenea. bolile din grupa celor generalizate au tendinţa de a se croniciza. Paraclinic. Aceste celule odată activate produc şi eliberează specii reactive de oxigen care activează enzime 85 .

caracterizarea exclusivă a fazei efectuare a răspunsului autoimun nu generează nici o indicaţie asu86 .10.4.proteolitice prezente în veziculele granulocitare fie direct fie indirect. Deşi deosebit de utilă în precizarea posibilelor ţinte terapeutice specifice lipsite de efectele adverse ale terapiilor actuale. două enzime care sunt responsabile pentru conversia superoxidului în peroxid de hidrogen şi respectiv a celui din urmă în apă şi oxigen nu rezultă în inhibarea producerii separării dermo-epidermale. e Figura 2. (a) Secţiunile incubate cu granulocite în lipsa altor substanţe rezultă în apariţia bulei experimentale. Reprezentare schematică a implicării speciilor reactive de oxigen în patogeneza bolilor subepidermale.7. arată lipsa separării dintre derm şi epiderm. Odată eliberate aceste enzime digeră structurile proteice responsabile de asigurarea joncţiunii derm-epiderm [2. prin degradarea inhibitorilor acestor enzime.9.12] (Figura 2).6.11. mărire 200x (după [13]). Folosirea unui amestec de granulocite cu (b) superoxid dismutază sau (c) catalază. criosecţiuni de piele umană sunt incubate cu anticorpi de la (a-c) pacienţi cu boli autoimune subepidermale şi apoi cu granulocite amestecate sau nu cu diferite substanţe capabile să influenţeze nivelul producţiei de specii reactive de oxigen în granulocite. Într-un model experimental ex vivo. în care am folosit un ser de la un donator sănătos în loc de ser de la bolnavi.8. (d) Controlul nostru negativ.3. (e) Diagrama prezintă lanţul de reacţii care produce speciile reactive de oxigen cu enzimele implicate (fundal roz şi albastru) şi respectiv inhibitori ai acestora (pe fundal verde) a-d.5.

Imunoglobulinele sunt glicoproteine heterogene alcătuite din două lanţuri grele (cu masa moleculară mai mare. sau cu receptorii de pe celulele placentei – permit trecerea anticorpilor de la 87 . caracterizării şi utilizării anticorpilor (Figura 3) monoclonali ca mijloace moderne de combatere a diverselor afecţiuni mergând de la cancer la boli autoimune sau boli degenerative va fi descrisă în cele ce urmează. proteinele sunt produse prin tehnologia ADN-ului recombinat şi exprimate apoi în celulele mamifere care oferă un sistem de expresie superpozabil cu cel întâlnit in vivo. imunoglobulina (numită şi anticorp când se gaseşte sub formă circulantă în sânge/secreţii) are două porţiuni: zona superioară (N-terminală) Fab are rolul de a recunoaşte specific antigenul iar zona inferioară (C-terminală) Fc are rolul de a îndeplini funcţiile efectoare. Din punct de vedere funcţional. În cele ce urmează vor fi descrise anumite caracteristici şi metode utile pentru înţelegerea acestor tehnologii. -COOH Fab Fc -NH2 Figura 3. Lanţurile grele sunt identice între ele la fel cum lanţurile uşoare sunt identice între ele. De asemenea tehnologia producerii. Prezentare schematică a unei imunoglobuline.pra cauzelor care declanşează reacţia autoimună. interacţiunea cu diverse componente ale sistemului imun (cum ar fi complementul. receptorii pentru porţiunea Fc de pe fagocite. Pentru aceste modele active de boală. situate spre interior în această figură) şi două lanţuri uşoare (situate înspre exterior în partea de sus). De aceea eforturile din ultima perioadă urmăresc reproducerea bolii prin imunizarea activă a animalelor cu proteine recombinate.

Pe scurt. acestea vor fi utilizate fie la imunizarea pentru modelul activ de boală fie pentru cel pasiv. 1. Din punct de vedere istoric. 1. După clonarea acestor fragmente în celule. Apoi în funcţie de aplicaţia dorită.15]. prevenţia/terapia cu ajutorul anticorpilor este o procedură folosită de câteva mii de ani.mamă la făt). După întocmirea strategiei de lucru. fragmentele de interes sunt amplificate prin tehnica PCR.15]. folosind acest ADN complementar pot fi amplificate secvenţele de interes prin reacţia de PCR. se găsesc reziduuri de glucide care au rol în modularea interacţiunii dintre Fc şi receptorii sistemului imun (vezi text). • dificultăţilor tehnice în izolarea/producerea lor şi • necunoaşterea posibilelor ţinte terapeutice esenţiale pentru diferite afecţiuni. În urmă cu câteva secole. Chinezii şi indienii sunt cei cărora li se atribuie folosirea terapeutică a serurilor (fracţiunea sângelui în care se găsesc anticorpii alături de alte proteine) încă înaintea erei noastre. folosirea anticorpilor a fost însă limitată de anumite aspecte dintre care cele mai neconvenabile au fost: • lipsa unei surse constante de anticorpi omogeni. • anumite aspecte adverse (apriţia unui răspuns imun faţă de însuşi anticorpii) datorită utilizării anticorpilor de la alte specii. Cu ajutorul amorselor specifice.1. Ataşat de aceste cozi Fc.2. În ciuda efectelor terapeutice extraordinare. Producerea proteinelor recombinate în celule mamifere Tehnica de bază pentru producerea acestor proteine implică mai multe etape care sunt menţionate în tabelul 3. Totusi folosirea pe scară mai largă a anticorpilor în scop terapeutic a început să fie practicată începând cu secolul XX. ţesutul care conţine antigenul ţintă este prelevat de la sursa de interes după care ARN-ul mesager obţinut în urma extracţiei este folosit ca şi matriţă pentru sinteza ADN-ului complementar [14. Anticorpii monoclonali bio-nano-functionalizaţi Terapia biologică cu ajutorul anticorpilor este considerată la ora actuală ca fiind cea mai activă branşă a industriei farmaceutice[16]. 88 . urmează exprimarea proteinelor codate şi purificarea acestora [14. este semnalată folosirea serurilor pentru protejarea persoanelor în Turcia şi apoi odată cu experimentele doctorului Edward Jenner de la sfârşitul secolului al XVIII şi în Anglia.

Această temere a fost dublată şi de avansarea tehnicilor industriale de producere a moleculelor cu masă moleculară mică care păreau să fi rezolvat în sfârşit problema inexistenţei unor medicamente perfecte. chiar şi numai pentru a face lucrurile mai uşor de înţeles. potenţialul imens al noii tehnologii a incitat atât curiozitatea comunităţii ştiinţifice (interesată în definirea noilor aplicaţii pentru care anticorpii monoclonali reprezentau unealta mult-căutată. cu timpul. începând de la lenjerie şi până la ultimul nasture al paltonului. forme şi culori şi a doua purtând haine personalizate de către un croitor profesionist. a dus la înlăturarea primului din cele două mari dezavantaje ale folosirii anticorpilor policlonali. 89 . prima purtând haine de diferite mărimi. noua tehnologie a premis obţinerea lor prin tehnici relativ simple şi cu costuri substanţial diminuate înlăturând astfel cel de-al treilea dintre dezavantajele amintite anterior. Diferenţa între anticorpii policlonali (cei care erau la acea oră în uz medical) şi noii anticorpi (numiţi monoclonali) poate fi comparată. doi cercetători anunţă în revista Nature [17] o metodă prin care se pot obţine cantităţi teoretic nelimitate de anticorpi cu specificitatea dorită. Chiar dacă uşor exagerată şi poate nu cea mai potrivită din punct de vedere bio-medical.Descoperirea antibioticelor în anii 30-40 ai secolului trecut alături de celelalte inconveniente amintite au dus la intrarea anticorpilor într-un con de umbră. lumea bio-medicală şi industria farmaceutică a fost în prima instanţă rezervată la posibila utilizare a acestora pe scară largă. Dezvoltarea acestei noi tehnici. cel de-al patrulea neajuns amintit mai sus) cât şi de către pragmatismul industriei farmaceutice (care găsea o nouă mină de aur în comercializarea noilor „gloanţe magice” aşa cum le numea Paul Ehrlich. Cel mai probabil din acest motiv. de asemenea. Anticorpii monoclonali produşi iniţial au păstrat neajunsul de a fi produşi în alte specii ducând la declanşarea unui răspuns imun masiv din partea primitorului (cel de-al doilea neajuns). În ciuda acestor piedici. Într-o lucrare de referinţă pentru literatura biomedicală. Totuşi în anii care au urmat. Începând cu 1975 situaţia avea însă să se schimbe. cu diferenţa dintre două persoane. şi anume lipsa unei surse constante de anticorpi cu caracteristici omogene. folosirea acesteia are un substrat uşor de înţeles şi anume în literatura de specialitate de limba engleză termenii „tailor made antibodies” sunt folosiţi pentru a descrie producerea de anticorpi monoclonali specifici pentru diferite situaţii [18]. entuziaştii au continuat însă lucrul la producerea anticorpilor monoclonali ducând la aprobarea utilizării primului anticorp produs în acest fel nu însă mai repede de un deceniu de la publicarea metodologiei de către Koehler şi Milstein [16].

În 1997. După unii. Mai mult. rituxan (rituximab). Dintre cei peste 25 de anticorpi monoclonali aflaţi la ora actuală pe lista medicamentelor aprobate pentru tratamentul afecţiunilor umane. Datorită eşecului relativ al utilizării acestui medicament şi datorită timpului îndelungat necesar dezvoltării unui nou medicament. Aceste date au menirea de a sublinia interesul major al comunităţii bio-medicale şi al guvernelor statelor industrializate (din moment ce majoritatea studiilor sunt finanţate din bani publici) pentru găsirea unor strategii terapeutice specifice pentru tratarea acestei maladii. doar substanţe cu greutate moleculară mică. tehnici care au cunoscut o dezvoltare extraordinară în ultimele două – trei decenii. un anticorp monoclonal împotriva CD20 de pe celulele 90 . se estimează că cinci din cele zece substanţe vor fi reprezentate de anticorpi în 2014 [16]. cu mai bine de un secol în urmă) [19]. urmaţi de cei conjugaţi cu material radioactiv şi o mică proporţie sunt reprezentaţi de cei conjugaţi cu toxine. Folosirea pe scară largă a Orthoclone OKT3 (muronomab CD3) a fost însă limitată de faptul că acest anticorp de origine murină (produs în celule de şoarece care diferă suficient de celulele umane) induce un răspuns imun amplu în organismul uman [20]. La ora actuală. diagnostică şi preventivă a îmbolnăvirilor umane [16]. De asemenea dintr-un total de 1500 de studii clinice în care sunt testaţi noi anticorpi monoclonali peste75% sunt axate pe folosirea acestora în tratarea cancerelor. în 1986 este aprobată utilizarea primului anticorp monoclonal pentru prevenirea rejetului de transplant. După cum aminteam anterior la 11 ani de la publicarea lucrării lui Koehler şi Milstein. administrarea acestui anticorp a dus la apariţia sindromului eliberării sistemice de cytokine [21] datorită interacţiunii OKT3 cu receptorii pentru porţiunea Fc a IgG. Desigur această turnură a fost posibilă prin îmbunătăţirea permanentă a protocoalelor de lucru şi obţinerea unor anticorpi modificaţi prin tehnologia ADN recombinat.părintele hematologiei şi chemoterapiei (acesta din urmă fiind un termen pe care l-a introdus chiar el). în topul primelor zece produse folosite în tratamentul diverselor afecţiuni existau. Dacă în anul 2000. anticorpii sunt în aproape toate situaţiile luaţi în calcul la stabilirea strategiei terapeutice alternative sau câteodată constituie chiar terapia de primă alegere. cu o singură excepţie. timpul scurs până la aprobarea celui de-al doilea anticorp monoclonal a fost de încă opt ani de la aprobarea OKT3. majoritatea sunt destinaţi tratării cancerelor. dezvoltarea tehnologiei producerii anticorpilor monoclonali reprezintă inovaţia secolului trecut în ceea ce priveste importanţa terapeutică. Majoritatea sunt folosiţi ca atare (neconjugati).

bolile buloase (pemfigusul. anemia hemolitică autoimună. anticorpul păstrează specificitatea pentru care a fost creat pe unul dintre fragmentele Fab cu care se va lega de ţinta dorită urmând ca pe celalalt fragment Fab să lege un receptor de pe o celulă efectoare (spre exemplu CD3 de pe celula T) care are proprietatea de a distruge celula recunoscută specific. prelungirea duratei de injumătăţire cu efecte favorabile datorate reducerii dozajului fie prin PEG-ylarea fragmentelor (scFv. vasculita autoimună etc. alături de un mecanism de inducere a apoptozei celulelor care exprimă CD20 pe suprafaţă. Acest anticorp chimer (combinaţie între uman şi murin) are multiple mecanisme de acţiune dintre care merită amintite: inducerea toxicităţii celulare indusă de anticorpi (ADCC) şi citotoxicitatea mediată de complement (CDC). anticorpii sunt substanţe care interacţionează cu structuri extracelulare sau de pe suprafaţa celulelor. Între timp acest medicament este folosit şi în tratamentul unor boli autoimune cum ar fi artrita reumatoidă. În plus dacă anticorpii iniţiali aparţineau clasei IgG1. diabetul zaharat de tip I. pemfigoidul).îmbunătăţirea proprietăţilor efectoare prin optimizarea interacţiunii cu sistemul complement. o multispecificitatea. Utilitatea acestei modificări poate fi exemplificată ca şi în figura 4. Fab) fie prin fuzionarea lor pe domenii de Ig.îmbunătăţirea interacţiunii cu receptorii Fc sau Fc de tip neonatal (FcRn) de pe celulele efectoare. Mare parte dintre eforturile actuale au menirea de a creşte penetranţa acestor glicoproteine pentru ţinte din interiorul celulelor. Pe scurt. o 91 . În general. .B devine cel de-al treilea medicament admis pe piaţa din SUA pentru tumori ale celulelor B. adică adăugarea unei alte specificităţi în zona de recunoaştere a Fab. există câteva direcţii prin care se urmăreşte creşterea posibilelor interacţiuni terapeutice. Dintre acestea amintim: o modificarea porţiunii Fc a anticorpilor pentru: . Mai mult. investigaţii actuale sunt concentrate asupra diversificării activităţii prin schimbarea clasei şi deci a paletei de efecte posibile.

o toxină. 92 . anticorpul monoclonal recunoaşte antigenul specific. (D) Este de asemenea posibil ca nanosfera să conţină un material radioactiv. (C) Alternativ porţiunea Fc poate fi modificată (funcţionalizată) prin ataşarea unei nanosfere care poate avea ca atare un efect toxic asupra celulei tumorale. Puntea creată are ca efect reducerea dramatică a spaţiului dintre cele două celule permiţând celulei imune să distrugă celula canceroasă în condiţii optime. o enzimă sau chiar o cytokină care să crească puterea distructivă a anticorpului fie direct. Celula imună figurată cu linie punctată ramasă la distanţă nu este capabilă să distrugaă celula tumorală. de care se leagă. fie. Existenţa a două fragmante Fab duce la legarea unui anticorp de două antigene invecinate. (B) Modificarea unuia dintre fragmentele Fab poate fi făcută în aşa fel încât acesta să nu mai recunoască ţinta iniţială ci un receptor de pe o celulă imună efectoare aducând-o în imediata vecinătate a celulei tumorale. Modul de acţiune al anticorpilor bispecifici. în cazul cytokinei prin recrutarea altor celule imune în zona respectivă. în acest caz de pe celula tumorală. (A) Clasic.A Celula tumorala B Celula tumorala Celula imun Celula imun C Celula tumorală D Celula tumorală Celula Celula imun imun nano nano + Figura 4.

Odată produse aceste fragmente vor fi caracterizate din punct de vedere bio-chimic şi folosite apoi fie separat fie în diferite combinaţii pentru producerea de anticorpi şi/sau pentru reproducerea bolii umane în animalele de experienţă. în paralel este de dorit abordarea acestei problematici din punct de vedere terapeutic. De altfel. utilizând tehnicile şi aparatura specifică culturilor celulare vor fi produse diverse fragmente recombinate ale unor proteine cu rol cheie în asigurarea adeziunii dintre derm şi epiderm.2. Într-un set de experimente menite să caracterizeze potenţialul anticorpilor specifici faţă de diferiţi receptori de pe suprafaţa celulelor B de a determina distrugerea acestora. 93 . vor fi luaţi în calcul anticorpi consacraţi cum ar fi anti-human CD20 alături de alţi anticorpi a căror ţintă se află tot pe celulele B dar a căror eficienţă în distrugerea acestor celule este încă necunoscută. Tehnicile de lucru cu celulele mamifere sunt puse la punct în laborator. De asemenea protocoale specifice a căror necesitate poate să apară pe parcursul desfăşurării experimentelor pot fi obtinute de la colaboratorii din afara Institutului. Într-o primă fază. De aceea. un diagnostic precoce şi un tratament specific al acestor afecţiuni. celule cu rol cheie în patogeneza autoimună a acestor boli. Este de aşteptat ca o caracterizare precisă a mecanismelor patogenetice să necesite o perioadă relativ lungă de timp. Adaptarea/importul acestora la tematicile de cercetare ale platformei Este de dorit ca în viitor. De asemenea instruirea personalului şi co-interesarea şi implicarea cercetătorilor externi în tematicile de cercetare ale platformei este esenţială pentru întărirea resursei umane cu expertiză în domeniu. un deziderat este reprezentat de funcţionalizarea anticorpilor îndreptaţi faţă de molecule de pe celulele B. grupul de cercetare include în preocupările sale problematica legată de caracterizarea răspunsului autoimun în diferite modele de boală. În vederea atingerii acestui obiectiv. implementarea metodologiei şi tehnicilor moderne este un deziderat al activităţii prezente şi viitoare a grupului de cercetare. Desigur importul premanent de know-how relevant pe plan internaţional este esenţial pentru consolidarea cercetării locale şi recunoaşterea validităţii datelor obţinute de către comunitatea ştiinţifică internaţională. caracterizarea precisă a mecanismelor patogenetice implicate în distrucţia tisulară din bolile autoimune sa permită o prevenţie. În acest context. Potenţialul acestor anticorpi va fi studiat fie în preparaţii care conţin doar anticorpul pur fie în alte instanţe cu anticorpul funcţionalizat (Tabelul 2). la ora actuală.

Un interes primar pentru preocupările noastre îl constituie producerea fragmentelor recombinate ale proteinelor care asigură adeziunea keratinocitelor de stratul dermal. Ca şi metodologie de lucru. la funcţii de recrutare şi transducerea semnalului. 3. contribuind astfel într-un mod inovativ la definirea naturii autoimune a diferitelor entităţi clinice. De aceea. Strategiile de lucru abordate pentru atingerea celor două obiective majore. odată produse aceste fragmente ar putea fi folosite în diferite combinaţii pentru a reproduce caracteristicile bolii umane în animalele de experienţă. Obiective Stablilirea dozei 50%1 Model de studiu Culturi celulare ex vivo Strategie Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Stabilirea potenţialului preventiv/curativ al anticorpilor funcţionalizaţi 1 Model animal în vivo Este vorba despre doza care provoacă moartea a 50% dintre celule. Defecte ale acestor integrine sunt considerate a fi implicate în patogeneza bolilor autoimune. Integrinele sunt o clasă heterogenă de proteine implicate în diverse procese de la asigurarea contactelor dintre celule şi mediul înconjurător. Nu este deocamdată clar în ce fel şi în ce masură autoanticorpii faţă de aceste molecule sunt implicaţi în patogeneza autoimună. 94 . Atenţia va fi concentrată pe producerea acelor autoantigene a cpror patogenitate este încă incomplet elucidată. Un exemplu în acest sens îl constituie clonarea fragmentelor de integrine.Tabel 2. Recomandări pentru abordarea de noi tipuri de experimente şi metodologii Una dintre direcţiile de cercetare care vor fi abordate în viitor se va concentra pe producerea de fragmente recombinate ale diferitelor proteine autoantigen cu ajutorul culturilor celulare eucariote. producerea unui model de boală şi modularea acestuia în scop preventiv/terapeutic implică mai multe etape (Tabelul 3).

folosirea anticorpilor monoclonali cruzi sau funcţionalizaţi cu nanosfere . Etape recomandate pentru modelare în scop preventiv/terapeutic a unei boli autoimune în animalele de experienţă Denumire etapă Obţinerea fragmentelor recombinate ale autoantigenului Activităţi Stabilirea planului de clonare Designul şi producerea de amorse specifice Izolarea ARN-ului mesager RT-PCR Clonarea produşilor obtinuţi prin PCR Exprimarea proteinelor recombinate Imunizarea animalelor de experienţă cu diferite combinaţii de proteine recombinate Evaluarea clinică şi paraclinică a inducerii bolii Dezvoltarea unor strategii de prevenţie.Tabel 3.folosirea nanosferelor direcţionate specific împotriva celulelor imune autoreactive Imunizarea unor animale intermediare cu diferite combinaţii de proteine recombinate şi izolarea anticorpilor specifici produşi Transferul pasiv al acestor anticorpi în şoarecii de laborator Dezvoltarea strategiilor de prevenţie.modificarea anticorpilor prin tehnica ADN-ului recombinat (se urmăreşte în acest fel modularea interacţiunii cu diferite mecanisme efectoare prin modificarea spre exemplu a porţiunii Fc a anticorpului) Producerea modelului activ de boală Producerea modelului pasiv de boală 95 . diagnostic şi tratament a bolii induse: . adjuvanţi.folosirea diverselor căi de administrare. folosirea autoantigilor modificaţi .folosirea anticorpilor din diferite surse şi evaluarea mecanismelor patogenetice specifice fiecăruia (sistem complement. granulocite prin FcR etc.) . diagnostic şi tratament: .izolarea claselor şi subclaselor din sursa de anticorpi policlonali şi investigarea mecanismelor efectoare prin care aceştia produc boala . cantităţi variabile de autoanitgen.

Deşi acest lucru era cunoscut de mai multă vreme. patra etc. anticorpii multispecifici posedă şi alte specificităţi care să le crească capacitatea funcţională benefică. Se vorbeşte în acest sens despre anticorpi trispecifici/multispecifici în care pe lângă specificitatea porţiunii Fab pentru ţinta dorită. S-a dovedit astfel existenţa unei concordanţe între aceste secvenţe şi capacitatea lanţurilor codate de a activa anumite mecanisme efectoare. Pe lângă specificitatea pentru celula tumorală ţintă şi cea pentru nanoparticule. Cercetări recente au arătat că există diferenţe esenţiale între acţiunea diverşilor anticorpi care la prima vedere sunt identici. un accent deosebit a fost pus pe studierea interacţiunilor dintre porţiunea Fc a anticorpilor şi alte proteine efectoare din sistemul imun (receptorii pentru Fc de la nivelul celulelor imunităţi înnăscute. S-a dovedit recent că o scădere a syalilarii lanţului glucidic din această porţiune duce la creşterea activării celulelor efectoare cu receptror Fcgamma. specificitate pentru un alt receptor de pe o celulă citotoxică spre exemplu). De asemenea structura primară a lanţului polipeptidic care formează porţiunea Fc a anticorpilor este implicată în reactivităţile diferite observate la folosirea diverselor preparaţii de anticorpi. prin modificarea 96 . Spre exemplu. semnificaţia funcţională a acestui detaliu structural a rămas un mister până de curând. Explicaţia propusă a fost că diferenţa este datorată unor modificări postranslaţionale apărute în porţiunea Fc a anticorpilor. cea de-a doua porţiune Fab poartă specificitatea agentului terapeutic (nanosfera radioactivă sau toxina. Ideea de bază este că un sistem imun „acordat” perfect reuşeşte să distrugă celulele nedorite prin implicarea la timpul şi momentul potrivit a potenţialului uriaş pe care celulele imunităţii il posedă. iar o a treia. Tendinţa actuală este de a grupa aceste polimorfisme de la nivelul ADN în funcţie de capacitatea anticorpilor de a activa/inhiba o anumită clasă de celule efectoare cu implicare în terapia afecţiunilor autoimune şi cancerelor. sistemul complement). specificitate este adusă de către modificarea/modificările din porţiunea Fc astfel încât acestea să poată activa cu succes diverse mecanisme imune (Figura 5). interesul extraordinar în găsirea combinaţiilor optime de anticorpi care să identifice celulele tumorale ţintă şi în acelaşi timp să angajeze un răspuns prin modificare celui de-al doilea fragment Fab a început să fie balansată de interesul pentru modificarea porţiunii Fc în vederea creşterii efectivităţii.În ultimii ani. Este vorba despre adăugarea diferitelor lanţuri glucidice care fac anticorpii entităţi glicoproteice. De altfel interesul tot mai mare în explicarea la nivel molecular a susceptibilităţii la anumite afecţiuni a dus din ce în ce mai frecvent la obţinerea secvenţelor de nucleotide care codează pentru anticorpi. Astfel.

timpul de înjumătăţire crescut faţă de moleculele cu greutate moleculară mică ceea ce face posibilă scăderea dozei utilizate .Celula imună Celula tumorală/ autoimună 4 5. Numeroşi membri ai acestuia se află în prezent în diverse laboratoare partenere unde deprind metode şi tehnici noi pe care dorim să le implementăm odată cu reintegrarea acestora în laboratorul de origine. prin „personalizarea” interacţiunii fragmentului Fc cu celulele care poartă receptori pentru acesta (partea dreapta jos) sunt transduse semnale puternice care pot avea ca rezultat o activare crescută a acestor celule cu producerea speciilor reactive de oxigen şi eliberarea proteazelor efectoare (5. În prezent se urmăreşte lărgirea paletei de experimente şi metodologii care pot fi oferite la nivelul laboratorului.6…). Dintre avantajele folosirii anticorpilor ca şi agenţi biologici în tratamentul cancerului amintim: . anticorpul capătă proprietăţi sporite de activare a sistemului complement care fie direct (2) fie indirect (3) duce la distrugerea celulei canceroase/autoimune. proteaze CDC Figura 5. porţiunii Fc pe partea stângă a figurii. Mecanisme de acţiune ale anticorpilor multispecifici.specificitatea şi afinitatea mare 97 . folosirea unei duble specificităţi a porţiunii variabile a fragmentului Fab face posibilă recrutarea în vecinătatea tumorii a celulelor T citotoxice (4).6… Celula imună 3 2 1 nano-r x/tox ROS. De asemenea. În plus.

toxine. Tabel 4.29] [22] Majoritatea anticorpilor monoclonali utilizaţi acţionează asupra ţintelor specifice prin acest mecanism. legarea concomitentă a Fv (partea a Fab) de antigenul ţintă şi a Fc de o celulă cum ar fi macrofagul sau celula NK care posedă receptori pentru această porţiune duce la activarea celulei imune urmată de distrugerea celulei ţintită specific. Diferite mecanisme de acţiune ale anticorpilor monoclonali Mecanism de acţiune propus ADCC1 CDC Inducerea apoptozei Blocarea interacţiunii factorilor de creştere cu receptorii specifici Blocarea fizică a dimerizării receptorilor pentru factorii de creştere Inhibarea neoformării vaselor sangvine Blocarea factorilor de creştere în forma solubilă Funcţionalizarea/conjugarea cu radioizotopi. Cercetări recente au arătat că ADCC este mai eficientă la acei indivizi care prezintă anumite polimorfisme în porţiunea Fc (respondenţi cu grad înalt) [23. fie prin inducerea apoptozei fie prin antagonizarea efectelor factorilor de creştere [22].24] [22] [25] [26] [26] [27] [28. 98 . enzime sau cytokine 1 Reprezentant Anti-CD20 Anti-CD20 Anti-CD20 Anti-EGFR Anti-EGFR Anti-Her2/neu Anti-EGFR Anti-VEGF-A AntiDiverşi Referinţa bibliografică [23.- - multiple mecanisme de acţiune care pot fi combinate (vezi anticorpi multispecifici pentru ADCC şi CDC) posibilitatea folosirii acestora ca şi terapie complementară/alternativă oricărei forme de terapie anti-canceroasă tradiţională utilizarea lor ca şi vehicul specific pentru transportul diverselor substanţe anticanceroase spre diverse destinaţii (vezi anticorpi bispecifici) utilizarea lor ca şi markeri de diagnostic/prognostic pentru diferite afecţiuni în anumite cazuri anticorpii pot per se să controleze creşterea tumorii prin interferarea cu căile de semnalizare celulară.24].

Sesarman A. Nishie W. (2005) Induction of dermal-epidermal separation în mice by passive transfer of antibodies to type VII collagen. (2007) NADPH oxidase is required for neutrophil-dependent autoantibody-induced tissue damage. editor. 19. (2007) IgG4 autoantibodies induce dermal-epidermal separation. Norman DJ. J Autoimmun. et al. (2009) A novel humanized neonatal autoimmune blistering skin disease model induced by maternally transferred antibodies. Zhao M. Kohler G. Schroeder TJ. Li Z. 1st ed. Shibaki A. 10. 17. Oswald E. Wang G. 13. Nishie W. Takahashi K. Nishie W. (1995) The OKT3 4. Sitaru C. Goto M. Exp Dermatol 14: 861-875. Sui W. 120 p. J Immunol 178: 6514-6521. Haußer I. et al. Shimizu H (2010) What's new în bullous pemphigoid. Cluj-Napoca: Babes-Bolyai University. Sitaru C. Thurman JM. Sawamura D. 9. (2009) Pathogenicity of IgG subclass autoantibodies to type VII collagen: Induction of dermal-epidermal separation. (2010) A novel active mouse model for bullous pemphigoid targeting humanized pathogenic antigen. (2007) Humanization of autoantigen. Methods 36: 11-24. (2008) Subepidermal blistering induced by human autoantibodies to BP180 requires innate immune players în a humanized bullous pemphigoid mouse model. Ujiie H. 16. Sawamura D. J Clin Invest 115: 870-878.Bibliografie 1. et al. Wu H (2005) Tailor-made antibody therapeutics. Kimball JA. 3. Chowdhury PS. Sindrilaru A. Goodall M. Ito K. Otto C. Scharffetter-Kochanek K. In: Zhiqiang A. 11. et al. Ujiie H. Jefferis R. et al. Mihai S. 20. Mihai S. New York and London: Garland. 2. Milstein C (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. J Immunol 183: 4088-4093. Liu Z. et al. Chiriac MT. Chiriac MT. J Cell Mol Med 11: 462-481. Fritsch A. Cell Mol Life Sci 67: 1343-1351. 18. J Pathol 212: 56-65. et al. Nat Med 13: 378-383. 6. et al. J Dermatol 37: 194-204. Roesler J. 99 . Recke A. (2007) The alternative pathway of complement activation is critical for blister induction în experimental epidermolysis bullosa acquisita. Sawamura D. Nishie W. 14. New Jersey: Wiley. Chiriac MT. Evensen M. Shibaki A. Shinkuma S. Chiriac MT. et al. N Engl J Med 350: 1079-1080. Shibaki A. Sitaru C. Holers VM. Natsuga K. Schwartz RS (2004) Paul Ehrlich's magic bullets. Murphy KM. Zhiqiang A (2009) Therapeutic Monoclonal Antibodies: From Bench to Clinic.4. Zillikens D (2005) Mechanisms of blister induction by autoantibodies. 8. Herrero-Gonzalez JE. (2010) Cross-reactivity of autoantibodies from patients with epidermolysis bullosa acquisita with murine collagen VII. Nature 256: 495-497. Li N. Goto M. Vidarsson G. Sitaru C (2007) Immunopathology and molecular diagnosis of autoimmune bullous diseases. 15. Feldrihan V. et al. Walport M (2007) Janeway's Immunobiology. Zillikens D. J Cell Mol Med 11: 1117-1128. et al. 7. 12. Shield CF. J Autoimmun 31: 331-338. Mihai S. Chiriac MT (2007) Inflammatory Mechanisms of Tissue Damage Induced by Antibodies. Travers P. 5. Lisi P. Csorba K. J Immunol 184: 2166-2174. Chiriac MT. Mihai S.

Weng WK. Cartron G. (1993) Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth în vivo.21. Blood 99: 754-758. 100 . Biochem Soc Trans 32: 742-745. Albanell J. 27. an anti-VEGF antibody for treating cancer. Michaeli Y. Adv Exp Med Biol 532: 253-268. Nature 362: 841-844. Chatenoud L. 23. Solal-Celigny P. Armanini M. Transplantation 49: 697-702. Salles G. Ferrara N. Systemic cytokine release and modulation by corticosteroids. Winer J. J Clin Oncol 21: 3940-3947. Kim KJ. Transpl Immunol 3: 212-221. 26. Hillan KJ. 29. Gillett N. Nat Rev Drug Discov 3: 391-400. 25. Novotny W (2004) Discovery and development of bevacizumab. (1990) în vivo cell activation following OKT3 administration. Ferran C. Cancer Immunol Immunother 48: 673-683. Ferguson KM (2004) Active and inactive conformations of the epidermal growth factor receptor. 28. Bardos P. (2002) Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism în IgG Fc receptor FcgammaRIIIa gene. Merite S. Ledbetter JA. Oncogene 26: 3714-3733. Codony J. Levy R (2003) Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab în patients with follicular lymphoma. Zafir-Lavie I. 24. Mellado B. Reiter Y (2007) Novel antibodies as anticancer agents. Gerber HP. et al. 22. Dacheux L. Li B. Rovira A. Gascon P (2003) Mechanism of action of anti-HER2 monoclonal antibodies: scientific update on trastuzumab and 2C4. et al. Thouard I. Legendre C. Shan D. Antibody Response Study: a multicentre study of human anti-mouse antibody (HAMA) production following OKT3 use în solid organ transplantation. et al. Press OW (2000) Signaling events involved în anti-CD20-induced apoptosis of malignant human B cells.

..3.......... Înregistrarea spectrelor Raman confocale ...1......3. 111 3........... 112 3................. 102 1....... Aplicaţii în ştiinţa materialelor ...................................... Monica Maria Baia Cuprins 1....... Celula Linkam ................. 109 2.............3......................... 115 3................................................................................................................1.3........................................ 111 2.......... Analiza domeniilor amorfe ...... Accesorii ..1....................................................2. Efectul Raman rezonant............... MICROSCOPUL CONFOCAL RAMAN Microspectroscopia Raman Conf.........................3........ Microspectroscopia Raman confocală ............... Aplicaţii ale microspectroscopiei Raman............2........................................................... Analiza medicamentelor anticanceroase ............ 107 2................... 119 4.. Aplicaţii bio-medicale .2.1..........3... dr. 107 2...2.... 104 1............III........................................3.................... Cipuri ADN ............................................. 103 1................ Identificarea fazelor cristaline şi a tranziţiilor de fază... Imagistica Raman confocală............ Efectul Raman ......................1..1...................3.................... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii ...3...................2................. 117 3..... Localizarea şi identificarea unor bacterii ........................... 105 2............ 109 2..........................2.................. 117 3........ Detecţia poluanţilor din apă................... 113 3...................1.............2.......................................2................................................. Bibliografie .......... 108 2................................................1.............................................. Parametrii optimi de funcţionare ...................................................................1................................2..................................................................... Studii structurale ale componentelor solului: Acidul humic ... 107 2............. Spectroscopia Raman amplificată de suprafaţă .......2...............................................4...... Aplicaţii în stiinta mediului............................................. Structuri alotrope de carbon ............................... Aspecte generale ale spectroscopiei Raman ........ 113 3..1.. 111 2..................................2.......................... 112 3..................... 119 101 ............... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 ..2..... 110 2..................2..................... 109 2.......... Modul de microscopie de forţă atomică model alpha 300 ... 102 1...................................1................... 108 2.................

2].1. în urma căruia este eliberată o cuantă de energie hν 0 − hν s (linii Stokes). şi care poartă numele de împrăştiere Rayleigh. 1). Liniile Raman denumite Stokes şi anti-Stokes se găsesc simetric. un material. De aceea. de o parte şi de cealaltă a liniei Rayleigh [1. pe nivelele vibraţionale ale stării fundamentale cu energii mai mari se va găsi un număr mult mai mic de electroni. hν 0 . un micro-organism. Efectul Raman O rază de lumină incidentă pe o probă (de exemplu o celulă biologică. aşa încât.h ν s hν0 h ν0 hν0 hν0 + hνs v=1 v=0 Imprastiere Rayleigh Imprastiere Raman (Stokes) Imprastiere Rayleigh Imprastiere Raman (anti-Stokes) Figura 1. 102 . etc. are o probabilitate de apariţie mult mai mare decât cel în urma căruia se eliberează o cuantă de energie hν 0 + hν s (linii anti-Stokes). procesul Raman.) interacţionează cu atomii sau moleculele constituiente şi poate fi absorbită sau împrăştiată [1. în conformitate cu legea de distribuţie a lui Boltzmann. în urma căruia rezultă o cuantă a cărei energie rămâne neschimbată. Aspecte generale ale spectroscopiei Raman 1. fie un proces de împrăştiere inelastică care este cunoscut sub denumirea de împrăştiere Raman şi în urma căruia sunt emise cuante de energie hν 0 ∓ hν s (Fig.1. Dacă o cuantă de lumină hν 0 nu este absorbită de o moleculă ea poate să sufere fie un proces de împrăştiere elastică. Diagrama tranziţiilor care au loc între diferite nivele energetice vibraţionale şi care corespund proceselor de împrăştiere Rayleigh şi Raman La temperatura mediului ambiant cea mai mare parte a electronilor se află pe nivelele vibraţionale ale stării electronice fundamentale cu energiile cele mai mici. Nivel electronic excitat Energie hν0 hν0 hν0 h ν0 . 2].

dacă energia laserului este apropiată de valoarea energiei necesare unei tranziţii electronice (efect Raman rezonant). 3]. Diagrama tranziţiilor care au loc între diferite nivele energetice în cazul (a) efectului Raman convenţional. (c) efectului Raman rezonant. Efectul Raman rezonant În spectroscopia Raman se folosesc în mod curent ca surse de excitare lasere cu lungimi de undă situate în domeniul vizibil (verde şi rosu) şi infraroşu-apropiat care nu au energie suficientă pentru a produce prima tranziţie electronică a majorităţii moleculelor. h ν0 h ν0 h ν0 . ceea ce limitează detecţia unor molecule aflate în concentraţie mică. Se face distincţie între două tipuri de efecte Raman rezonant: efectul pre-rezonant şi efectul rezonant (vezi Fig. Totuşi există substanţe care au capacitatea de a împrăştia radiaţia laser cu o intensitate de până la 106 ori mai mare decât cea a semnalului Raman normal.Intensitatea benzilor Raman este în general de 3 ÷ 5 ordine de mărime mai mică decât intensitatea liniei Rayleigh. 2). În unele cazuri observarea efectului Raman este impiedicată de apariţia fluorescenţei. În cele mai multe cazuri.10-8 din fotonii incidenţi sunt transformaţi în fotoni Raman. 2.h ν s h ν0 hν0 .h ν s h ν0 .hνs (a) (b) (c) Figura. 1. cu cât energia de excitare este mai apropiată de energia necesară tranziţiei electronice cu atât este mai mare intensitatea 103 . (b) efectului Raman pre-rezonant. care la rândul său reprezintă aproximativ 10-4 . evitându-se astfel excitarea fluorescenţei [1.10-3 din intensitatea radiaţiei incidente excitatoare.2. Aceste neajunsuri pot fi înlăturate prin utilizarea unei surse de excitare (laser) cu lungimea de undă situată în domeniul infraroşu-apropiat (NIR) sau prin utilizarea unor tehnici speciale cum ar fi cea bazată pe efectul Raman rezonant sau spectroscopia Raman amplificată de suprafaţă (surface-enhanced Raman spectroscopy SERS) [1-4]. care este mai intensă cu câteva ordine de mărime decât semnalul Raman şi care apare mai ales la investigarea biomoleculelor şi a sistemelor biologice. deci doar 10-6.

se folosesc doar lasere cu lungime de undă variabilă care să permită ajustarea energiei de excitare la valoarea necesară unei absorbţii electronice. sunt deseori observabile într-un spectru Raman rezonant. chimie. O amplificare suplimentară apare datorită excitării plasmonilor de suprafaţă de către radiaţia Raman emisă de molecule. proteine). Astfel. săi în 1974 [5]. Modificarea regulilor de selecţie precum şi amplificarea tranziţiilor vibraţionale specifice de până la 106 ori permit utilizarea spectroscopiei Raman pre-rezonantă cât şi rezonanţa la un număr mare de aplicaţii din fizicp. în lipsa unor semnale spectrale datorate mediului înconjurător (ex. se modifică regulile de selecţie şi vor fi amplificate doar anumite tranziţii vibraţionale Raman. Efectul chimic al amplificării este asociat suprapunerii funcţiilor de undă ale metalului şi adsorbatului. În plus.benzilor observate. Amplificarea semnalului Raman (de 106-108 ori) este explicată cu ajutorul a două mecanisme principale de amplificare [1. Spectroscopia Raman amplificată de suprafaţă Efectul amplificării semnificative a semnalului Raman al moleculelor adsorbite pe suprafaţa rugoasă a unui electrod de argint a fost descoperit de Fleischman şi colab. O contribuţie majoră la amplificarea electromagnetică este datorată plasmonilor de suprafaţă. cum sunt cele biologice. care de obicei nu se observă într-un spectru Raman convenţional. Câmpurile locale rezultate amplifică intensitatea radiaţiei Raman emise. biochimie şi biologie. 4. apar benzi noi din analiza cărora se pot obţine informaţii structurale suplimentare. unde absorbţia este localizată într-o anumită zonă a moleculei. Ionul negativ obţinut are configuraţii geometrice de echilibru diferite faţă de cele 104 . care este proporţională cu pătratul amplitudinii câmpului electric incident pe moleculă.3. 5]: electromagnetic (amplificare a semnalului Raman de 104÷106 ori) şi chimic (amplificare a semnalului Raman de 10÷102 ori). Amplificarea semnalului Raman rezultă din excitarea acestor plasmoni de suprafaţă de către radiaţia incidentă. care duce la procese de transfer de sarcină între nivelele fundamentale şi cele excitate ale moleculelor adsorbite [6]. Spectroscopia Raman rezonantă se foloseşte mai ales la investigarea moleculelor poliatomice mari. care sunt asociaţi oscilaţiilor colective ale electronilor de conducţie de pe suprafaţa particulelor metalice. Tranziţiile de ordin superior. 1. la aşa numiţii cromofori. Amplificarea Raman rezonantă permite izolarea benzilor Raman datorate acestor cromofori şi a unităţilor structurale situate în vecinătatea lor facilitând astfel analizarea zonei cromoforice care este de obicei zona activă. Pentru folosirea efectului Raman rezonant nu este necesar un echipament special.

Astfel.Microspectroscopia Raman confocală În urmă cu aproximativ două decenii au fost efectuate primele măsurători Raman cu ajutorul unui microscop. Pentru realizarea unui experiment SERS se foloseşte în principiu acelaşi echipament ca şi în cazul realizării unui experiment Raman convenţional. antrax [12]. şi de securitate globală şi naţională [9]. Astfel de exemple sunt analiza unor cantităţi reduse de pesticide [11]. filmele metalice de Au şi Ag. Pentru a optimiza amplificarea electromagnetică frecvenţa laserului trebuie să coincidă cu frecvenţa de rezonanţă plasmonică. SERS a fost utilizată ca un mecanism de transpunere a semnalului în senzori chimici. sunt utilizate mai multe tipuri de substrate active SERS. Regulile de selecţie ale spectroscopiei Raman amplificată de suprafaţă (SERS surface-enhanced Raman spectroscopy) sunt în principiu aceleaşi ca şi în cazul spectroscopiei Raman convenţionale [7. glucoza [14] şi a unor reziduuri nucleare [15].ale moleculei neutre neadsorbite. transferul de sarcină duce la apariţia unei molecule neutre excitată vibraţional şi la emisia unui foton Raman. Acest lucru combinat cu faptul că intensitatea câmpului electromagnetic scade cu creşterea distanţei faţă de suprafaţă permite determinarea orientării speciilor adsorbite în raport cu suprafaţa. Îmbunătăţirea majoră era dată de folosirea unui obiectiv de microscop prin intermediul căruia se realiza atât iluminarea probei cât şi colectarea luminii împrăştiate.4. 8]. etc. Cu. Pentru a întelege mai bine raţiunile care au stat la baza evoluţiei spectroscopiei micro-Raman este foarte importantă cunoaşterea tuturor factorilor care contribuie la modificarea intensităţii semnalului ( S ) „livrat” de detectorul unui spectrometru în cazul unei linii Raman înregistrată la o lungime de undă λ . Datorită sensibilităţii de detecţie remarcabile şi a flexibilităţii sale de aplicare tehnică SERS este utilizată în mod frecvent pentru a soluţiona o mare varietate de probleme cu caracter analitic. Cele mai des folosite sunt electrozii de Au. SERS poate fi exploatată la identificarea selectivă a unor specii moleculare precum şi la detecţia unei singure molecule [10]. a unor antigene specifice prostatei [13]. Ag. 1. Recent. de mediu. biomedical. Deoarece amplificarea depinde de proprietăţile substratului. În particular. 105 . De aceea. modurile de vibraţie care rezultă dintr-o modificare a polarizabilităţii perpendicular pe suprafaţă vor fi amplificate. suspensiile coloidale de Au şi Ag. deoarece intensitatea câmpului electromagnetic local este maximă pe direcţia perpendiculară la suprafaţă.

Ω este unghiul solid din care se face colectarea luminii împrăştiate Raman. În numeroase studii micro-Raman apare un neajuns deoarece informaţia spectrală obţinută nu este culeasă dintr-un volum suficient de mic (referirea se face în termeni de rezoluţie spaţială perpendiculară la axa optică sau rezoluţie laterală. şi rezoluţie spaţială paralelă la axa optică sau rezoluţie axială).) impune utilizarea unor obiective speciale care posedă caracteristici diferite pentru fiecare mediu. În microscopul convenţional întregul câmp vizual este uniform 106 . σ λ este secţiunea specifică de împrăştiere Raman (cm2⋅sterad-1⋅molecula-1). care focalizează radiaţia laser şi culege lumina împrăştiată sub un unghi solid mare. duce atât la obţinerea unui spectru Raman mai bun din punct de vedere calitativ cât şi la localizarea unei anumite zone de interes comparativ cu cazul în care acesta este înregistrat fără obiectiv de microscop [16]. utilizarea unei linii laser. Aceştia sunt intensitatea radiaţiei laser incidentă pe proba I L şi unghiul solid Ω din care se face colectarea luminii împrăştiate Raman. unde I L este intensitatea radiaţiei laser incidentă pe probă (W⋅cm-2). doar câţiva parametrii pot fi modificaţi astfel încât să se compenseze reducerea numărului de molecule N m . specificate foarte exact de către producător. etc. N m reprezintă numărul de molecule din volumul de probă investigat V P . Astfel. Eficienţa de colectare a luminii este aproape în totalitate influenţată de apertura numerică NA a obiectivului de microscop care este definită de relaţia NA = n sin θ max în care n este indicele de refracţie al mediului dintre obiectiv şi probă iar θ max este unghiul maxim de colectare al obiectivului. Se poate observa că în cazul unor măsurători efectuate cu un obiectiv de microscop imersat într-un mediu al cărui indice de refracţie este apropiat de cel al probei investigate (nu există o modificare a drumului razelor de lumină la trecerea într-un mediu cu indice de refracţie diferit) apare o îmbunătăţire a eficienţei de colectare şi a rezoluţiei spaţiale. Se poate observa că atunci cand se doreşte examinarea unui volum V P foarte mic dintr-o probă. iar Tλ and s λ reprezintă capacitatea de înregistrare a instrumentului şi respectiv sensibilitatea detectorului la lungimea de undă λ .S ∝ I L ⋅ σ λ ⋅ N m ⋅ Ω ⋅ Tλ ⋅ s λ . ulei. Utilizarea unui astfel de mediu (apă. Important în astfel de situaţii ramâne faptul ca mediul în care se face imersarea să nu influenţeze structura şi proprietăţile probei investigate. a cărei putere poate fi reglată într-un domeniu relativ larg. şi a unui obiectiv de microscop.

iluminat şi observat. această tehnică spectroscopică poate fi considerată. Confocalitatea poate fi de asemenea obţinută şi prin restrângerea ariei de pe detector unde intensitatea radiaţiei Raman este mare (realizarea unei ”aperturi electronice”).9 – 0. Aplicaţii bio-medicale 2. nedistructivă şi extrem de puţin sensibilă la prezenţa apei. Analiza medicamentelor anticanceroase Producerea unor structuri moleculare capabile să se ataşeze de diferite secvenţe ale unui lanţ de ADN reprezintă un domeniu de cercetare intens datorită importanţei pe care o are acest subiect în obţinerea unor compuşi noi cu potenţial terapeutic. în cazul unor medicamente anticanceroase care nu prezintă fluorescenţă. În paragrafele următoare sunt prezentate succint principalele informaţii care se pot obţine în urma aplicării microspectroscopiei Raman pe diferite sisteme de studiu. Astfel. Astfel. în cele mai multe cazuri aplicarea ei nu necesită prepararea prealabilă a probei. prin prezenţa pinholului se realizează o filtrare spaţială a radiaţiei. Experimentele iniţiale constă în înregistrarea spectrelor medicamentelor în soluţie în vederea realizării unei caracterizări Raman fundamentale. în funcţie de tipul aplicaţiei. spectroscopia Raman poate fi singura metodă care să permită detecţia lor în interiorul celulelor în absenţa unor marcări fluorescenţi. ca fiind neinvazivă. 2. Spectroscopia Raman poate fi utilizată pentru a examina interacţiunile dintre molecule mici şi ADN. Utilizarea primei metode de obţinere a confocalităţii necesită în general folosirea unor obiective de microscop cu apertură numerică mare (NA = 0. Astfel.1.1.95) şi poate conduce la obţinerea de informaţie spectrală dintr-un tub focal cu un diametru de 1.22λ/NA şi o adâncime de 4λ/NA2 [17]. la detector ajungând doar radiaţia din volumul în care a fost focalizat laserul [17]. 2. Aplicaţii ale microspectroscopiei Raman Spectroscopia Raman este o tehnică care pe lângă faptul că permite obţinerea de informaţii extrem de rapide despre structura. Spre deosebire de acesta. 107 . În plus.1. modificările structurale şi morfologice care apar în diferite tipuri de probe poate oferi şi unele avantaje unice în comparaţie cu alte tehnici. microscopul confocal utilizează o diafragmă (pinhol) care izolează radiaţia luminoasă care provine din zona marginală a volumului în care a fost focalizat fascicolul laser (zona din afara focarului).

bacterii sau viruşi. pentru a detecta cantităţi extrem de reduse ale unui anumit lanţ de ADN existent într-o probă se foloseşte tehnica SERS [18].3. microscopia Raman se poate utiliza pentru a studia medicamentele în interiorul celulelor şi a furniza informaţii despre: (a) interacţiunea dintre compus şi mediul celular. În cele din urmă. Tehnica SERS poate fi utilizată în semnalarea unirii unui lanţ de ADN cu lanţul complementar şi formarea structurii dublu elicoidale. Prin înregistrarea spectrului Raman este posibilă diferenţierea marcărilor fluorescenţi care dau benzi Raman specifice. Localizarea şi identificarea unor bacterii Cercetările din medicină şi biologie se confruntă cu necesitatea identificării precise a unor micro-organisme. nucleu sau citoplasmă). Cipuri ADN Biocipurile revoluţionează diagnosticarea clinică modernă şi tehnicile farmaceutice datorită rapidităţii de testare a probelor şi de livrare a rezultatelor. suprafaţa cipului se foloseşte atât ca imobilizator al lanţului de ADN cât şi ca substrat activ SERS pentru lanţul de ADN marcat care va fi adus în vecinătate datorită procesului de hibridizare cu lanţul imobilizat.1. Acest fenomen este cunoscut sub denumirea de hibridizare şi stă la baza tehnologiei de obţinere a cipurilor ADN. 2. Metoda standard de detecţie a procesului de hibridizare foloseşte marcări fluorescenţi. în care diagnosticarea pe baza hibridizării este utilizată în mod eficient pentru a obţine informaţii despre secvenţele de ADN.1. dacă există o secvenţă cunoscută de ADN fixată într-o anumită zonă a suprafeţei cipului şi dacă apare procesul de hibridizare al unui lanţ de ADN în acea poziţie. ca de ex.2. (b) localizarea sa într-o anumită regiune sub-celulară (de ex. dacă sunt posibile formele protonate sau neprotonate) [18]. se poate determina secvenţa de ADN din acel lanţ [18]. (c) forma chimică a compusului în interiorul celulei (de ex. În plus. În aceste experimente.Următorul pas constă în efectuarea de studii Raman ale medicamentelor ataşate de anumite secvenţe ale unor oligonucleotide pentru a obţine informaţii de bază care vor fi mai apoi utilizate când se studiază in vitro aceste procese [18]. fapt care face posibilă testarea diferitelor secvenţe care există într-o zonă a cipului. Majorita108 . dacă în spectrul SERS se observă benzile moleculei folosite ca marker înseamnă că s-a produs hibridizarea ADN-ului. Astfel. 2. Astfel.

1. Pentru aceasta au fost cultivate mai multe bacterii Rhodotorula rubra şi Micrococcus luteus. care uneori este în strânsă corelare cu tranziţiile de fază. Spectroscopia Raman confocală oferă posibilitatea identificării unor bacterii individuale.2. obţinuţi prin depunere din faza gazoasă. existent în Micrococcus luteus. Atât studiile cristalografice cât şi 109 . sarcinaxantin) în citoplasma membranei. Cunoaşterea spectrelor Raman ale diferitelor faze cristaline permite caracterizarea tranziţiilor de fază care apar la modificarea temperaturii sau a presiunii prin analiza comparativă a modificărilor care apar în cazul modurilor de vibraţie. Este cazul structurilor preponderent amorfe. s-a reuşit identificarea celor două bacterii.tea metodelor de identificare folosesc o evaluare morfologică combinată cu teste specifice în care se urmăreşte dezvoltarea micro-organismelor în diferite medii şi care durează până la 72 de ore. apoi au fost amestecate şi o mostră de analiză a fost investigată cu ajutorul unui echipament Raman confocal. contribuţiile celorlalte componente nefiind prezente în spectru [3].2. După înregistrarea spectrelor Raman şi analizarea benzilor date de β-carotina. poate fi de asemenea evidenţiată prin spectroscopia Raman. De exemplu. ceea ce facilitează identificarea directă a fazelor cristaline [19]. Analiza domeniilor amorfe Informaţiile obţinute prin aplicarea spectroscopiei micro-Raman sunt uneori mult mai utile decât cele determinate din analiza de raze X. Un alt studiu a dovedit că temperatura la care are loc tranziţia de fază ortorombic-tetragonal a structurii ceramice de BaTiO3 depinde de mărimea grăunţilor [21]. observarea unor moduri vibraţionale interzise în spectrele Raman reprezintă o dovadă a distorşilor care apar la nivelul reţelei cristaline [19].2. 2. Existenţa unei diferenţe în energia de suprafaţă ca urmare a modificării dimensiunii nanoparticulelor. Aplicaţii în ştiinţa materialelor 2. s-a reuşit identificarea unor bacterii care conţin un cromofor (β-carotina. care este prezentă în Rhodotorula rubra şi a benzilor date de sarcinaxantin. suferă o tranziţie de la faza de rutil la anatas atunci când dimensiunile lor depăşesc 5 nm [20]. Identificarea fazelor cristaline şi a tranziţiilor de fază Spectrul Raman a diverse nanostructuri este asemănător spectrului unui monocristal.2. În plus. 2. S-a arătat faptul că structura cristalină a clusterilor nanometrici de TiO2. Trebuie menţionat faptul că prin folosirea laserului care excită rezonant cromoforii se obţin doar benzile acestora.

în spectrele Raman ale acestor structuri 110 . sau cu cele obţinute prin simulări teoretice [25. Astfel. Cel mai rapid mod de a obţine componenta amorfă şi cea cristalină este de a deconvoluţiona modurile Raman situate la numere de undă mici în vecinătatea liniei Rayleigh care conţin cele două componente [23]. în prima sferă de coordinare (0.5-5 nm) [19].cele de spectroscopie Raman se bazează pe a interpreta măsura dezordinii în termeni de lărgime a benzii. mai exact atunci când apar modificări structurale în ordinea la mică distanţă. modurile Raman de deformare sunt influenţate de dezordinea geometriei locale. cu precădere în cazul structurilor dominate de legături covalente puternice. dar nu poate fi facută o separare spaţială a acestora [22]. 26]. în cazul spectroscopiei Raman doar modurile de vibraţie ale reţelei şi cele de libraţie (care se găsesc la numere mici de undă) sunt afectate de dezordinea la mare distanţă. de la structuri cu grad de cristalinitate extrem de ridicat la structuri amorfe. Este una dintre puţinele tehnici sensibile la modificările structurale care apar în aceste tipuri de materiale. Atribuirea benzilor în aceste cazuri se face pe baza comparaţiei cu spectrele experimentale obţinute pe faze cristaline similare compoziţional structurii sticlelor sau vitroceramicilor investigate. Dacă se ţine seama de descrierea moleculară a vibraţiilor.3. Structuri alotrope de carbon Microspectroscopia Raman a fost des utilizată la studiul structurilor alotrope ale carbonului (diamant. 2.5 nm) şi respectiv în cea de a doua (0. fulerene. Lărgimea celorlalte benzi Raman este în principal afectată atunci când au loc modificări ale câmpului cristalin local.). Din datele obţinute în urma analizei de difracţie de raze X se poate evidenţia faptul că există domenii cu structura periodică şi dezordonată. grafit. în timp ce modurile de intindere sunt afectate de dezordinea vecinătăţilor. nanotuburi. care sunt reprezentate de anumiţi atomi ai altor subreţele sau de defecte care apar ca urmare a substituţiei de atomi sau a prezenţei vacanţelor.1-0. Aplicarea spectroscopiei micro-Raman la studiul materialelor şi în special al polimerilor poate face uneori distincţie între domeniile conformaţionale submicrometrice cristaline şi amorfe. Raportul ariilor celor două benzi oferă o bună estimare a gradului de cristalinitate al probei.2. etc. În timp ce în cazul difracţiei de raze X apariţia lărgimii benzii este asociată cu abaterile de la periodicitate a reţelei cristaline pentru un număr însemnat de atomi. Separarea fazelor poate fi de asemenea studiată în cazul sticlelor unde valoarea numărului de undă la care apare semnalul Raman este strâns legată de conectivitatea unităţilor structurale poliedrice constitutive [24].

111 . fenolii sau derivaţii naftalinei sunt prezenţi în mediile acvatice datorită utilizării lor ca pesticide sau în procesele industriale. derivaţii toxici de azot. Acestea au stabilit o concentraţie maximă permisă a acestor compuşi în apa potabilă de < 1 μg/l.3. Cu ajutorul acestei tehnici este posibilă determinarea orientării şi a modului de adsorbţie al acestor molecule pe suprafaţa substratului activ SERS [27]. Extrem de important este faptul că în cazul nanotuburilor de carbon apar.1.apar clar definite benzi datorate vibraţiilor date de structuri grafitice (notate G) şi de structuri dezordonate (notate D şi D’). Tehnica SERS datorită sensibilităţii sale este capabilă să detecteze concentraţii extrem de scăzute ale acestor substanţe. Persistenţa precum şi efectele toxicologice ale acestor compuşi şi ale produşilor lor intermediari sunt semnale de alarmă pentru agenţiile de resort din lume.3.3. Compuşi chimici precum hidrocarburile aromatice. Pentru a detecta aceste concentraţii mici este necesară folosirea unor tehnici instrumentale extrem de sensibile. Cunoaşterea proprietăţilor chimice este esenţială pentru dezvoltarea unor modele ecologice folosite pentru remedierea şi detoxificarea de compuşi antropogenici sau chiar de reziduuri nucleare [3]. Studii structurale ale componentelor solului: Acidul humic Caracterizarea structurală a acidului humic precum şi determinarea comportamentului lui de complexare sunt extrem de importante în ştiinţa mediului. Acidul humic apare în sol şi în apele subterane şi este implicat în numeroase procese chimice şi biologice care au loc în mediul terestru şi acvatic. benzile datorate modurilor de respiraţie radială (Radial Breathing Mode) cu ajutorul cărora se poate determina diametrul nanotubului (relaţie de inversă proporţionalitate cu valoarea frecvenţei Raman) [19].2. în regiunea numerelor mici de undă (< 200 cm-1). 2. 2. Studiile SERS ale acidului humic au condus la obţinerea unor informaţii legate de mecanismele de legare şi/sau configuraţiile de complexare ale acidului humic. Detecţia poluanţilor din apă Prezenţa poluanţilor organici în apă a devenit o problemă de actualitate pentru comunitatea internaţională. Determinarea substratului SERS cel mai potrivit pentru fiecare tip de poluant reprezintă un prim pas în dezvoltarea unui senzor bazat pe metoda SERS. Aplicaţii în ştiinţa mediului 2.

9 HDDIC. 50X şi respectiv 100X (uscat şi în ulei de imersie). Rezoluţia optică laterală la linia laserului de 532 nm este de 250 nm. x-z şi y-z (pănă la 1024 x 1024 pixeli) .1. domeniul lungimilor de undă de excitaţie 442-785 nm. posibilitate de poziţionare a probei în planul x-y într-o regiune de 20 mm x 20 mm cu o rezoluţie mai mică de 1 μm.45. Sistemul de microscopie Raman confocală lucrează în următoarele moduri de operare: . spectrometru UHTS 300.8 şi 1. reflector de câmp intunecat . 3) [28]. fibre optice multimod (100.imagistica de fluorescenţă confocală (prin montare de filtre adecvate) Sistemul dispune în prezent de 2 lasere. Dimensiunea maximă a probelor care pot fi măsurate este de 120 mm în diametru şi 20 mm înălţime.microscopie de câmp întunecat cu obiectiv EC Epiplan-Neofluar 100X/0. Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii 3. detector CCD cu răcire Peltier (1340 x 100 pixeli) şi iluminare prin spate tip Marconi. 0. cuplaj cu fibră optică standard SMA.achiziţie de spectru/pixel (scanare) .achiziţie de spectre din arii selectate (confocal micro-Raman) . 50 şi 25 μm). 0.3. incluzând de asemenenea un obiectiv (cu cantilever ataşat) pentru analiza AFM în lichide şi o cameră video color. conectori. pe direcţiile x-y. 112 . Echipamentul mai conţine un sistem de focalizare motorizat cu posibilitate de deplasare pe o distanţă de 30 mm şi o rezoluţie de 50 nm (un pas) şi o platformă de scanare prin acţionare piezo-electrică cu următoarele caracteristici: suprafaţa de scanare de 200 μm x 200 μm x 20 μm. două reţele de difracţie cu 600 şi respectiv 1800 linii/mm.25 şi mărire 10X. un YAG 532 nm şi un He-Ne 633 nm.3. acurateţe de poziţionare pe direcţiile x şi y sub 4 nm iar pe direcţia z sub 1 nm. Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este dotat cu un microscop optic care este echipat cu 4 obiective plan acromatizate de apertura numerică (NA) 0.microscopie confocală în reflexie .imagistica spectrală Raman la lungimi de undă fixe. detecţie Raman între 150-3500 cm-1. Drumul razelor în interiorul echipamentului CRM 200 este prezentat în schema de mai jos (Fig. 20X.

Partea stângă a ecuaţiei este legată doar de parametrii obiectivului de microscop.2. obiectivul 04. Diametrul acestei fibre joacă rolul pinholului cu ajutorul căruia se realizează confocalitatea [29]. pentru a obţine cea mai mare rezoluţie laterală vPmax ≤ 0. colectată cu ajutorul obiectivului de microscop. iar pentru vPmax ≤ 4 nu se modifică semnificativ rezoluţia axială). 3.01.5. platforma de scanare 05. NA apertura numerică a obiectivului de microscop. 113 . Echipamentul CRM 200 are în dotarea standard trei fibre multimod cu diametre de 100. este transmisă spectrometrului echipat cu o cameră CCD prin intermediul unei fibre optice multimod.2. fibra optică standard 03. sistem de focalizare motorizat pe axa z 09. spectrometru UHTS 300 07. lampa cu lumină albă pentru iluminare 08. Fibra este montată în planul imagine al microscopului şi poate fi ajustataă astfel încât să se obţină eficienţa maximă de colectare. camera video Figura. Relaţia care trebuie îndeplinită în cazul măsurătorilor Raman confocal este πd 0 M . iar vPmax este un parametru variabil a cărui valoare trebuie stabilită în funcţie de tipul de informaţie spectrală care se doreşte a fi obţinută (ex. Înregistrarea spectrelor Raman confocale În echipamentul CRM 200 radiaţia laser ajunge în microscop printr-o fibră optică standard iar radiaţia Raman împrăştiată. unde M este mărirea obiectivului. Parametrii optimi de funcţionare 3. 50 şi 25 μm. fibra optică multimod 06. λ lungimea de undă. 3. laserul 02. d0 diametrul ≥ NA v P max λ pinholului.1. Drumul razelor în microscopul Raman WITec CRM 200.

Raportul M/NA pentru diferite tipuri de obiective de microscop. Dacă proba de interes nu este predispusă la transformări din cauza laserului. De exemplu. fiind indicat să fie chiar mai mică de 200 ccd cts. în experimente SERS pe molecule biologice se foloseşte o putere a laserului sub 1 mW.pentru a stabili puterea laserului. Înaintea efectuării măsurătorilor propriu-zise.25 80 100 / 1.se lucrează cu fibra de 100 şi cu obiectivul de 20X sau 50X. Dacă semnalul Raman obţinut este bun. un obiectiv de microscop cu mărire de 100 şi o apertură numerică de 0.8 75 100 / 0.Tabelul 1. se schimbă obiectivul de 100X. . în cazul în care nu se obţine semnal Raman se creşte puterea laserului). se parcurg următoarele etape: . se foloseşte intensitatea liniei Rayleigh (ar fi bine să nu depăşească 400 ccd cts.6 67 60 / 0. Obiectiv microscop M/NA 10 / 0. cea mai mare rezoluţie axială s-ar obţine pentru un diametru optim al pinholului de 50 μm.9 111 100 / 1.9.). În caz contrar. apare riscul de a obţine semnal de la contaminanţi sau se poate degrada molecula.5λ pentru diferite lungimi de undă şi diametre ale pinholului. Raportul πd0/2. Lungime de undă [nm] d0 = 10 μm d0 = 25 μm d0 = 50 μm d0 = 100 μm d0 = 200 μm 440 29 71 142 286 571 488 26 64 129 258 515 532 24 59 118 236 472 633 20 50 99 199 397 785 16 40 80 160 320 Cu ajutorul celor două tabele poate fi determinată mărimea corectă a pinholului în măsurătorile Raman confocal efectuate cu echipamentul CRM 200. etc. Astfel. Puterea laserului trebuie aleasă astfel încât să nu inducă transformări probei (fotodegradare.4 71 Tabelul 2. În anumite situaţii se poate schimba şi fibra (vezi detaliile despre confocalitate prezentate mai sus) .4 50 40 / 0. se pot utiliza puteri mai mari (≤ 3 mW). în timp ce cea mai mare rezoluţie laterală s-ar obţine pentru un diametru optim al pinholului de 10 μm. iar spectrele obţinute să aibă un raport semnal/zgomot multumitor. pentru măsurători în care este utilizat un laser cu lungimea de undă de 532 nm. în vederea stabilirii parametrilor optimi.25 53 20 / 0.stabilirea timpului de înregistrare se face în funcţie de intensitatea semnalului Raman obţinut (se poate alege de ordinul milisecundelor sau de ordinul minutelor) 114 .

în general pentru o arie de 10 μm x 10 μm se utilizeazp minim 75 linii şi 75 de puncte pentru fiecare linie (la un număr prea mic de linii şi de puncte imaginea este de proastă calitate). ideal este să fie cât mai mic cu puţinţă (între 0.8 nm • puterea laserului 640 μW • timp de integrare/măsurare 60 s 3. Înaintea efectuării unei scanări se stabilesc parametrii optimi de înregistrare (puterea laserului şi timpul de integrare) prin măsurarea spectrelor individuale şi time series. Harta spectrală a intensităţii benzii Raman de la 737 cm-1 din spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenina pe o sticlă de microscop.2. de puterea laserului şi de aria scanată. Imagistica Raman confocală Pentru imagistică este indicată utilizarea obiectivului de 100X (în aer sau cu imersie în ulei). Exemplu.2. 35000 30000 25000 Intensity [ccd cts] 20000 15000 10000 5000 0 400 600 800 1000 1200 -1 1400 1600 1800 Raman shift [cm ] Parametrii folosiţi: • fibra multimode de 100 μm • obiectivul 100X aer • linia laser 632. iar stabilirea lui depinde de tipul probei.Exemplu: Spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenină pe o sticlă de microscop.1 s şi 1 s). În ceea ce priveşte stabilirea numărului de linii şi de puncte pentru suprafaţa pe care dorim s-o scanpm. 115 . Referitor la timpul de integrare.

500

737

400

Intensity [ccd cts]

300

200

100

0 500 1000 1500
-1

Raman shift [cm ]

În spectrul selectat din imaginea scanată se poate observa semnalul “curat” de la adenină. Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 632.8 nm • puterea laserului: 640 μW • suprafaţa scanată: 10 μm x 10 μm • 75 linii; 75 puncte/linie • timp de integrare 0.5 s/punct (softul calculează timpul de integrare pentru o linie – în acest caz 37,5 s (trace) şi 0.075 s (retrace) Exemplu. Imagistica Raman pe o secţiune dintr-un dinte, la interfaţa dintre dinte şi plombă

116

Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 532 nm • putere laser 3 mW. • suprafaţa scanată 10 μm x 10 μm • nr. de linii 150, puncte 150/linie • timp de integrare 0.2 s/punct

3.3. Accesorii
3.3.1. Modul de microscopie de forţă atomică model alpha 300 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300.

01. camera video 02. unitatea de deflexie a razelor 03. lampa cu lumină albă pentru iluminare 04. obiectivul AFM cu cantilever 05. platforma de scanare 06. masa antivibraţie

Figura 4. Drumul razelor în microscopul de forţă atomică alpha300.

Microscopul AFM alpha 300 lucrează în următoarele moduri: contact mod, forţă laterală, acustic (tapping) mod, contact mod intermitent cu imagistica în fază şi amplitudine cu o rezoluţie de 16 bit, digitizare 5 MHz, şi frecvenţa 10-500 KHz. Sistemul dispune de un laser de deflexie 980 nm, o unitate de detecţie a deflexiei, masa antivibraţie 0.7 – 1000 Hz, > 1000 Hz pasivă. Aria de scanare este de 100 μm x 100 μm x 20 μm. Drumul razelor în interiorul microscopului de forţă atomică alpha 300 este prezentat în schema de mai sus (Fig. 4) [30]. 117

Parametrii optimi de funcţionare 1. Modul acustic (AFM AC-Mode) • Este modul de operare uzual, utilizat mai ales în cazul probelor moi (probe biologice). • Se folosesc tip-uri de Si3N4 fixate pe cantilever-uri cu frecvenţa de rezonanţă mare (200 – 300 kHz). • În vederea realizării alinierii se efectuează următorii paşi: • Se determină frecvenţa liberă de oscilaţie a cantileverului aplicând o tensiune de 0.05 –0.1 V • Se ajustează amplitudinea oscilaţiilor libere ale cantilever-ului până la o tensiune de 2 V • Se setează un setpoint de 1.5 V • Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. • Valorile tipice ale parametrilor pentru scanare sunt: • Număr puncte pe linie: 256 • Număr linii pe imagine: 256 • Timpul scanare pe linie: 0.5 – 2 s • În timpul scanării se ajustează P-gain şi I-gain astfel încât drumul înainte şi drumul înapoi să coincidă. • Apropierea tip-ului de substrat se face automat.

Imagine topografică AFM

Imagine fază AFM

2. Modul contact (AFM contact mode) - Permite înregistrarea de imagini, scanarea de-a lungul unei singure linii sau înregistrarea curbelor de forţă. - în vederea realizării alinierii se efectuează următorii paşi: - Se utilizează tip-ul de AFM dorit. 118

Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. - Apropierea tip-ului de substrat se face automat. - Valori tipice ale parametrilor pentru scanare: - Număr puncte pe linie: 256 - Număr linii pe imagine: 256 - Timpul scanare pe linie: 0.5 – 2 s peraturi.
• • • • •

3.3.2. Celula Linkam pentru efectuarea unor măsurători la diferite temDomeniul de temperatură: -196 - 600 °C. Stabilitate < 0.1 °C. Rata de încălzire: max 150 °C/min. Senzor din platină 100 Ω. Sistem de răcire a corpului celulei cu apă pentru temperaturi > 300 °C.

4.Bibliografie
I. R. Lewis, H. G.M. Edwards (Eds.), Handbook of Raman Spectroscopy, Marcel Dekker Inc. New York, 2001. 2. S. Astilean, Metode şi tehnici moderne de spectroscopie optica, Spectroscopia IR şi Raman, Editura Casa Cartii de Stiinta, Cluj-Napoca, 2002. 3. R. Petry, M. Schmitt, J. Popp, Raman Spectroscopy–A Prospective Tool în the Life Sciences, ChemPhysChem, 4, 14, 2003. 4. S. Schluecker, (Ed.), Surface Enhanced Raman Spectroscopy: Analytical, Biophysical and Life Science Applications, Wiley VCH, 2010. 5. M. Fleischmann, P. J. Hendra, A. J. McQuillan, Raman spectra of pyridine adsorbed at a silver electrode, Chem. Phys. Lett., 26, 163, 1974. 6. T. Vo-Dinh, SERS chemical sensors and biosensors: new tools for environmental and biological analysis, Sensors and Actuators B, 29, 183, 1995. 7. J. A. Creighton în Spectroscopy of Surfaces, Vol. 21 (Eds.: R. J. H. Clark, R. E. Hester), John Wiley & Sons, New York, 1988. 8. D. A. Weitz, M. Moskovits, J. A. Creighton în Surface-Enhanced Raman Spectroscopy with Emphasis on Liquid - Solid Interfaces, Vol. 2 (Eds.: R. B. Hall, A. B. Ellis),VCH, Deer field Beach, FL, pp. 197- 243, 1986. 9. G. A. Baker, D. S. Moore, Progress în plasmonic engineering of surface-enhanced Raman-scattering substrates toward ultra-trace analysis, Anal. Bioanal. Chem. 382, 1751, 2005. 10. K. Kneipp, H. Kneipp, P. Corio, S. D. M. Brown, K. Shafer, J. Motz, L. T. Perelman, E. B. Hanlon, A. Marucci, G. Dresselhaus, M. S. Dresselhaus, Surface-Enhanced and Normal Stokes and Anti-Stokes Raman Spectroscopy of Single-Walled Carbon Nanotubes, Phys. Rev. Let. 84, 3470, 2000. 11. N. Weissenbacher, B. Lendl, J. Frank, H. D. Wanzenboeck, B. Mizaikoff, R. Kellner, Continuous Surface Enhanced Raman Spectroscopy for the Detection of Trace Organic Pollutants în Aqueous Systems, J. Mol. Struct. 539, 410, 1997. 1.

119

12. X. Zhang, M. A. Young, O. Lyandres, R. P. Van Duyne, Rapid Detection of an Anthrax Biomarker by Surface-Enhanced Raman Spectroscopy, J. Am. Chem. Soc. 127, 4484, 2005 13. D. S. Grubisha, R. J. Lipert, H. Y. Park, J. Driskell, M. D. Porter, Femtomolar detection of prostate-specific antigen: an immunoassay based on surface-enhanced Raman scattering and immunogold labels, Anal. Chem., 75, 5936, 2003. 14. K. E. Shafer-Peltier, C. L. Haynes, M. R. Glucksberg, R. P. Van Duyne, Toward a Glucose Biosensor Based on Surface-Enhanced Raman Scattering, J. Am. Chem. Soc., 125, 588, 2003; C. R. Yonzon, C. L. Haynes, X. Zhang, J. T. Jr. Walsh, R. P. Van. Duyne, A glucose biosensor based on surface-enhanced Raman scattering: improved partition layer, temporal stability, reversibility, and resistance to serum protein interference, Anal. Chem. 76, 78, 2004. 15. L. Bao, S. M. Mahurin, R. G. Haire, S. Dai, Silver-doped sol-gel film as a surface-enhanced Raman scattering substrate for detection of uranyl and neptunyl ions, Anal. Chem. 75, 6614, 2003. 16. J. M. Chalmers and P. R. Griffiths, (Eds.), Handbook of Vibrational Spectroscopy, John Wiley and Sons, Chichester, pp. 1419-1428, 2002. 17. N. J., Everall, Depth Profiling with Confocal Raman Microscopy, Part II, Spectroscopy 19, 16, 2004. 18. C. G. Coates, J. J. McGarvey, On the Pulse: Andor tehchnology, 1(8), 2001. 19. G. Gouadec, P. Colomban, Raman Spectroscopy of nanomaterials: How spectra relate to disorder, particle size and mechanical properties, Progress în Crystal Growth and Characterization of Materials 53, 1, 2007. 20. E. Barborini, I. N. Kholmanov, P. Piseri, C. Ducati, C.E. Bottani, P. Milani, Engineering the nanocrystalline structure of TiO2 films by aerodynamically filtered cluster deposition, Appl. Phys. Lett. 81, 3052, 2002. 21. M. H. Frey, D. A. Payne, Grain-size effect on structure and phase transformations for barium titanate, Phys. Rev. B, 54, 3158, 1996. 22. A. Guinier, Théorie et Technique de la Radiocristallographie, Dunod, Paris, 1956. 23. M. F. Cerqueira, L. Rebouta, M. Andritschky, J.A. Ferreira, M. F. Da-Silva, Microcrystalline silicon thin films prepared by RF reactive magnetron sputter deposition, Vacuum 46, 1385, 1995. 24. D. G. Georgiev, M. Mitkova, P. Boolchand, G. Brunklaus, H. Eckert, M. Micoulaut, Molecular structure, glass transition temperature variation, agglomeration theory, and network connectivity of binary P-Se glasses, Phys. Rev. B, 64, 134204, 2001. 25. D. G. Georgiev, P. Boolchand, K.A. Jackson, Intrinsic nanoscale phase separation of bulk As2S3 glass, Phil. Mag., 83, 2941, 2003. 26. Y. Wang, J. Wells, D. G. Georgiev, P. Boolchand, K. Jackson, M. Micoulaut, Sharp Rigid to Floppy Transition Induced by Dangling Ends în a Network Glass, Phys. Rev. Lett., 87, 185503, 2001. 27. E. A. Carrasco, M. Campos-Vallette, P. Leyton, G. Diaz, R. E. Clavijo, J. V. Garcıa-Ramos, N. Inostroza, C. Domingo, S. Sanchez-Cortes, R. Koch, Study of the Interaction of Pollutant Nitro Polycyclic Aromatic Hydrocarbons with Different Metallic Surfaces by Surface-Enhanced Vibrational Spectroscopy (SERS and SEIR), J. Phys. Chem. A, 107, 9611, 2003. 28. http://www.witec.de/en/company/witecnews/19/crm200flyer.pdf 29. Manual WITec CRM200. 30. www.witec.de/en/download/AFM/alpha300Aflyer.pdf

120

Microspectroscopia Raman – partea a II-a
Conf. dr. Monica Maria Baia Cuprins
1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman................... 121 1.1. Substrate SERS ............................................................................................. 122 1.2. Identificarea unor bacterii ............................................................................. 122 1.3. Caracterizarea celulelor ................................................................................. 123 1.4. Diagnosticarea unor boli ............................................................................... 124 1.5. Aplicaţii în domeniul farmaceutic................................................................. 125 1.6. Aplicaţii în domeniul alimentar .................................................................... 125 1.7. Nanotuburi de carbon ................................................................................... 126 2. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS................................................................................... 126 3. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS .......................................... 128 4. Bibliografie ........................................................................................................... 130

1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman
În ultima perioadă, odată cu dezvoltarea tehnologică a aparaturii aferente care permite înregistrarea rapidă a spectrelor Raman folosind diferite linii de excitare laser precum şi vizualizarea zonelor cu ajutorul microscopiei de forţă atomică sau a celei electronice de baleiaj, microspectroscopia Raman este din ce în ce mai mult aplicată în diverse domenii cum ar fi: medicină, biologie, studiul materialelor, geologie şi mineralogie, arta, ştiinţa mediului, controlul calităţii alimentelor, etc. [1]. Datele bibliometrice furnizate de Thomson Reuters ISI Web of Science confirmă faptul că în perioada 2001-2009 numărul publicaţiilor referitoare la spectroscopia Raman şi aplicaţiile ei s-a dublat de la 1931 înregistrate în 2001 la 4078 apărute în 2009 [1]. Această creştere a numărului de publicaţii este datorată, în principiu, următoarelor motive: (a) dezvoltării continue a metodei SERS; (2) progresului extraordinar înregistrat în domeniul fabricării controlate a nanomaterialelor şi a nanostructurilor; (3) creşterii eficienţei în imagistica biomedicală şi de diagnosticare a bolilor; (4) numărului tot 121

mai mare de aplicaţii în afara laboratorului (artă, arheologie, criminalistică, farmaceutice), (5) designului tot mai sofisticat şi controlat al pulsurilor laser ultrarapide utilizate în aplicaţii care exploatează efectele Raman neliniare. Din domeniul vast de aplicabilitate al spectroscopiei Raman se remarcă cu precădere aplicaţiile biomedicale, axate pe diagnosticarea unor boli, de identificare a unor bacterii, de investigare a unor celule vii, cele din domeniul nanoparticulelor şi nanomaterialelor, precum şi cele din domeniul artei şi arheologiei, farmaceutic şi alimentar. Astfel, în continuare vom face o trecere în revistă a principalelor domenii de aplicabilitate, făcând o referire concretă la cele mai recente cercetări.

1.1. Substrate SERS
În ultimii ani, metoda SERS s-a dezvoltat considerabil datorită obţinerii unor substrate SERS capabile să producă o amplificare importantă a semnalului Raman al speciilor adsorbite, reproductibilă şi stabilă în timp. Uniformitatea răspunsului SERS al substratelor depinde de morfologia lor. Astfel, s-a dovedit că gradul de amplificare poate fi controlat prin utilizarea unor metode de nanofabricare a structurii suprafeţei în termeni de mărime, formă şi distanţa dintre formaţiunile de pe suprafaţă, pe care adsorb speciile moleculare. Astfel, în ultima perioadă pe lângă substratele SERS obţinute prin litografie cu fascicul de electroni, litografie cu nanosfere de polistiren [2-4] au fost preparate şi substrate constând din nanoparticule anizotrope de forme diferite [5, 6]. De asemenea, au fost realizate noi substrate constând din nanotuburi de TiO2 pe care a fost depus Ag, sau nanofire de ZnO pe care a fost depus Au [7, 8] toate manifestând o activitate SERS remarcabilă.

1.2. Identificarea unor bacterii
Identificarea rapidă şi precisă a micro-organismelor a devenit o cerinţă importantă nu numai pentru analizele clinice, sau cele ale unor materiale frauduloase, ci şi în diferite aplicaţii cum ar fi producţia de medicamente sau tehnologia de procesare a mâncării. În toate aceste aplicaţii este de dorit ca timpul de cultivare a micro-organismelor să fie minimizat pentru a prescrie pacienţilor în timp util tratamentul corespunzător sau pentru a reduce timpul în care unităţile de producţie sunt închise din cauza unor disfuncţionalităţi. Majoritatea metodelor convenţionale de identificare a bacteriilor se bazează pe efectuarea unor teste chimice după cultivarea microorganismelor în diferite medii şi necesită timp îndelungat. Dintre tehnicile 122

care permit identificarea rapidă a micro-organismelor spectrosopia Raman a devenit una dintre cele mai promiţătoare metode [9] . Procedura de caracterizare a unei celule bacteriene cu ajutorul spectroscopiei Raman constă în patru etape: colectarea micro-organismelor, localizarea moleculelor biologice cu ajutorul unor markeri fluorescenţi, înregistrarea spectrelor Raman şi compararea lor cu alte spectre existente în baze de date în scopul identificării bacteriilor. Combinând rezultatele Raman cu o metodă de clasificare bazată pe chemometrie s-a reuşit identificarea subspeciei unor bacterii cu o probabilitate de 98% [10]. O altă modalitate de identificare a bacteriilor şi/sau a sporilor este cu ajutorul metodei SERS. În acest caz, se detectează prezenţa unui compus chimic, cunoscut ca biomarker al sporilor sau al bacteriei [11]. Relativ recent, a fost dezvoltată o metodă de identificare a unor bacterii pe un cip microfluidic [12]. Prin aplicarea unui câmp electric pe un electrod de aur s-a reuşit sortarea bacteriilor, concentrarea lor şi apoi, prin înregistrarea specrelor SERS în cip, cercetătorii au fost capabili să identifice fiecare bacterie pe baza semnăturii sale spectrale. Testele au fost efectuate pentru două tipuri de bacterii Gram positive (Staphylococcus aureus) şi Gram negative (Pseudomonas aeruginosa). Cu ajutorul acestei metode se îmbunătăţeste semnificativ timpul şi efortul necesar identificării diferitelor bacterii din mâncare sau altă materie organică.

1.3. Caracterizarea celulelor
Spectroscopia Raman este o metodă sensibilă pentru studiul biochimic al celulei fiind capabilă să pună în evidenţă modificări care apar în urma interacţiunii cu diferiţi agenţi [13]. Pe de altă parte, microscopia de forţă atomică oferă informaţii despre topografia suprafeţei, adeziunea şi elasticitatea celulară a unei celule. Prin utilizarea combinată a celor două metode pot fi investigate proprietăţile biomecanice şi biochimice ale celulelor vii în diferite condiţii fiziologice [14]. Spectrele Raman ale celulelor vii constă din benzi corespunzătoare biopolimerilor existenţi în celule (lipide, proteine, ADN, ARN). Cu ajutorul spectrelor Raman este posibilă discriminarea celulelor vii de cele moarte. Acest lucru este extrem de important în realizarea unui biosenzor. De asemenea, cu ajutorul spectroscopiei Raman este posibilă monitorizarea în timp a interacţiunii dintre celule şi diverse medicamente, precum şi diferite elemente toxice folosite în bioterorism, în vederea stabilirii efectelor acestei interacţiuni.

123

1.4. Diagnosticarea unor boli
După introducerea spectroscopiei Raman în studiul pielii de către Williams et all în 1992 [15] utilizarea ei în acest domeniu a devenit tot mai frecventă. În prezent, spectrele Raman înregistrate pe piele sunt bine analizate şi pe baza diferenţelor s-a pus în evidenţă existenta unor boli [16, 17]. Deoarece intensitatea semnalului Raman este scăzută, timpii de achiziţie sunt extrem de lungi şi din această cauză aplicaţiile clinice sunt reduse. Relativ recent, s-a reuşit implemetarea spectroscopiei Raman în aplicaţii clinice prin intermediul unui sistem capabil să înregistreze şi să analizeze în timp real spectre Raman in vivo [18]. Cu ajutorul acestui sistem s-a reuşit efectuarea unei evaluări a pielii unor voluntari precum şi diagnosticarea unor boli ale pielii. S-a constatat că există regiuni spectrale care prezintă benzi specifice pentru piele provenită din diferite regiuni ale corpului. De asemenea, s-a constatat că semnăturile spectrale specifice ale pielii diferă de la un individ la altul. Astfel, prin evaluarea raportului dintre conţinutul de lipide şi proteine se poate face o evaluare a pielii precum şi o diagnosticare cu ajutorul spectroscopiei Raman [19]. De asemenea spectroscopia Raman permite identificarea şi monitorizarea melaninei, un pigment natural care acţionează ca un scut împotriva radiaţiei solare, înlătură speciile chimice active şi produce radicali activi care afectează ADN-ul. Cancerul este o boală complexă indusă de o instabilitate genetică şi o acumulare a unor alternări moleculare multiple [20]. Deoarece diagnosticarea timpurie implică o rată de supravieţuire ridicată, un interes deosebit l-a avut dezvoltarea unor metode de detecţie moleculară care să permită vizualizarea unor biomarkeri sau a unor evenimente celulare şi să indice starea de fapt a cancerului. Spectroscopia Raman este o metodă utilă în diagnosticarea cancerului datorită sensibilităţii sale de a detecta modificări moleculare extrem de mici care sunt asociate cu cancerul, cum ar fi o creştere a raportului dintre nucleu şi citoplasmă, existenţa cromatinei dezordonate, o activitate metabolică crescută şi modificări ale cantităţilor de lipide şi proteine [21]. În principal spectroscopia Raman a fost aplicată la diagnosticarea cancerului de piele, de sân, de tract gastrointestinal şi cervical sau de col uterin [21]. Senzorii optici bazaţi pe metoda SERS au fost în ultima perioadă destul de des folosiţi pentru diagnosticarea in vitro şi in vivo a cancerului [22]. Ei sunt capabili să ofere informaţii moleculare specifice despre moleculele ţintă de interes, fără o marcare prealabilă a acestora.

124

1.5. Aplicaţii în domeniul farmaceutic
Spectroscopia Raman a devenit o metodă rapidă, directă şi nedistructivă în analizele farmaceutice, odată cu dezvoltarea aparatelor şi a metodelor chemometrice de analiză. Majoritatea studiilor se bazează pe investigarea ingredientului farmaceutic activ şi în consecinţă, bazele de date existente conţin informaţii referitoare la aceste ingrediente. Reletiv recent [23] a fost publicată o bază de date cu spectre Raman ale mediului excipient în care este înglobat ingredientul farmaceutic activ, astfel încât se pot realiza analize complete ale produselor farmaceutice. În ultima perioadă, creşterea cantităţii de medicamente contrafăcute pe piaţă pune în pericol sănătatea cetăţenilor şi ridică un semnal de alarmă. Aceste produse pot fi dăunătoare sănătăţii deoarece conţin impurităţi inodore, pot fi inactive şi/sau să aibă o absorbabilitate scăzută sau chiar inexistentă. De asemenea, aceste medicamente pot conţine alte ingrediente decât cele dorite, cantităţi incorecte ale agenţilor farmaceutici activi sau ambalaje necorespunzătoare. Cu ajutorul spectroscopiei Raman se pot obţine informaţii specifice legate de identificarea ingredientului farmaceutic activ, a mediului excipient, precum şi informaţii utile legate de identificarea elementelor necunoscute [24].

1.6. Aplicaţii în domeniul alimentar
Melamina este un ingredient folosit la obţinerea plasticului, dar este frecvent adăugat în mod abuziv şi în mâncare, pentru a crea impresia falsă a unui conţinut ridicat de proteine, deoarece această moleculă conţine un număr mare de atomi de azot. În anul 2007, aproximativ 1700 de câini şi pisici din SUA au murit ca urmare a consumului de mâncare contaminată cu melamină [25]. În ţesuturile şi urina animalelor moarte au fost detectate, pe lângă melamină, şi cantităţi reduse de acid cianuric, amelina şi amelida, care au rezultat cel mai probabil din descompunerea unor derivaţi ai melaminei [26]. În anul 2008, 54000 de copii au fost intoxicaţi iar 5 au murit ca urmare a consumului de lapte contaminat, produs în China. Mai târziu s-a aflat că melamina a fost introdusă intenţionat în multe alte produse lactate produse în China şi destinate exportului [25]. Spectroscopia Raman a fost utilizată în analizarea melaminei din gluten, hrana pentru pui, prăjituri şi tăiţei [27]. A fost de asemenea identificată melamina din făina contaminată, gluten din porumb, hrana pe bază de soia, lapte praf şi a fost stabilit un algoritm de analiză calitativă şi cantitativă a melaminei din amestecuri [26]. În plus, spectroscopia Raman împreună cu 125

În plus. 1.imagistica Raman au fost utilizate pentru o testare rapidă a hranei în vederea detecţiei melaminei pentru a creşte siguranţa şi securitatea publică. Spectroscopia micro-Raman confocală a fost utilizată şi la stabilirea compoziţiei unor sucuri de fructe [28]. carbon poros grafitizat şi grafit. această metodă ar putea oferi informaţii şi despre caracteristicile lor biochimice. Spectroscopia Raman a fost de asemenea aplicată la investigarea nanomaterialelor încapsulate în nanotuburi de carbon pentru a determina procesul de umplere a nanotuburilor cu C60. nanotuburi de carbon cu un perete sau cu mai mulţi pereţi. C59N şi antracena. Acest fapt ar permite utilizarea acestei metode pentru monitorizarea on-line a conţinutului acestor substanţe în sucurile aflate în diferite stagii de producţie. Astfel. în special [30]. Astfel. Heise şi colaboratorii săi [31] au caracterizat materiale pe bază de carbon utilizând spectroscopia Raman prin compararea spectrelor înregistrate pe filtre cu nanotuburi de carbon. 2. precum şi a unor 126 . În toate aceste studii s-a urmărit banda caracteristică a melaminei de la 676 cm-1.7. pe lângă faptul că ar detecta particule nedorite. Prin utilizarea combinată a spectroscopiei Raman cu alte tehnici de analiză se pot obtine informaţii cantitative referitoare la particulele nedorite prezente în sucurile de fructe [29]. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS În prezent. S-a determinat existenţa a trei componente importante ale sucurilor de fructe şi anume pectina. microspectroscopia Raman poate fi o metodă de analiză complementară sau alternativă măsurătorilor de turbiditate care sunt de obicei utilizate în industria alimentară în producţia berii. monitorizarea apei. S-a demonstrat modul în care deschiderea sau închiderea reversibilă a nanotuburilor poate fi utilizată pentru a monitoriza cu succes procesul de umplere [32]. se desfăşoară cercetări interdisciplinare axate pe fabricarea şi biofuncţionalizarea unor nanoparticule de metal nobil. Limita de detecţie a melaminei a fost de 1%. fructoza şi β-carotenul. etc. printre tematicile de cercetare ale platformei se regăsesc multe dintre cele prezentate anterior. în general şi a celor funcţionalizate. Nanotuburi de carbon Spectroscopia Raman este o metodă consacrată pentru caracterizarea nanotuburilor de carbon. în cadrul grupului care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300.

O mare parte a activităţii de cercetare este concentrată pe obţinerea de noi substrate SERS. cu scopul de a permite dezvoltarea unor noi aplicaţii spectroscopice şi plasmonice. În cadrul unui studiu. 1b). O parte a substratelor SERS obţinute. Prin combinarea imagisticii AFM cu imaginile SERS înregistrate prin microspectroscopie Raman confocală s-a reusit evidenţierea implicării mecanismului plasmonic de amplificare la semnalul de bază SERS [36]. Selecţie de imagini a substratelor SERS ordonate (a) şi a nanoparticulelor de metal nobil sintetizate (b). mai ales cele constând din nanoparticule de metal nobil. s-a reuşit corelarea activităţii SERS cu topologia substratului cu ajutorul imagisticii Raman [35]. 41. 1a) şi a nanoparticulelor sintetizate şi testate din punct de vedere a capacităţii lor de amplificare a semnalului Raman al unor specii moleculare adsorbite pe suprafaţa lor (Fig. chimice 127 . 42]. chitosan. Astfel. proteine şi biopolimeri relevanţi (PEG. 44]. iar în cazul celor dezordonate au fost obţinute diferite tipuri de nanoparticule metalice care au fost asamblate pe substrate solide funcţionalizate/nefuncţionalizate anterior [37-45]. Câteva dintre nanoparticulele obţinute au fost utilizate în aplicaţii biomedicale cu impact în nanomedicină bazate pe proprietăţile optice. ordonate şi dezordonate. 1. 1) este prezentată o selecţie a tipurilor de substrate SERS ordonate obţinute (Fig. (a) (b) Figura. S-a studiat interacţiunea diferitelor biomolecule (triptofan. s-a dovedit a avea proprietăţi multifuncţionale atât ca senzor SERS cât şi ca senzor LSPR [33.).) cu nanoparticule metalice de forme şi dimensiuni diferite [39-41.nanostructuri hibride. În figura de mai jos (Fig. albumină. folosind metode de auto-asamblare. glutation etc. Toate aceste studii contribuie la înţelegerea mecanismelor care stau la baza amplificării SERS. în cazul substratelor ordonate s-au folosit nanosfere de polistiren peste care au fost depuse filme metalice [33-36]. 43. etc.

s-a demonstrat că o serie de nanobastonaşe de aur sau alte nanoparticule de metal nobil anizotrope. s-ar putea aborda noi tipuri de experimente bio-medicale de diagnosticare a unor boli cum ar fi cele ale sistemului osos sau arteroscleroza. pot fi utilizate în terapia fototermică a cancerului [40]. 47]. caracteristici care conferă acestui tip de markeri SERS aplicabilitate ca şi agenţi imagistici în interiorul organismelor vii [44].şi termice ale nanoparticulelor de aur în detecţia şi tratamentul la nivel celular al cancerului (hipertermie locală indusă laser) sau în evaluarea profilului de toxicitate a nanopartirculelor în medii celulare. Astfel. În cadrul unui alt studiu s-a dovedit că o serie de nanoparticule de argint de formă triunghiulară invelite în chitosan posedă activitate bactericidală. cercetătorii au considerat spectroscopia vibraţională ca o metodă capabilă să furnizeze informaţii legate de diagnosticarea bolilor care apar la nivelul ţesuturilor muscularo-scheletale [46. Se ştie că 128 . la animale şi în câteva cazuri şi la oameni. Au fost investigate două dintre cele mai importante boli ale oaselor şi anume osteoporoza. şi osteogeneza imperfectă. care constă dintr-o serie de defecte genetice care afectează scheletul. În majoritatea studiilor spectroscopia Raman a fost acompaniată de imagistica Raman sau AFM. în grupul de cercetare care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu modulul de microscopie de forţă atomică (AFM) model alpha 300. realizându-se şi studii complementare de absorbţie în IR. Au fost efectuate numeroase investigaţii cu scopul înţelegerii spectrelor. şi corelării caracteristicilor spectrale cu modificările care apar datorită vârstei sau a diverselor boli. conservându-şi identitatea Raman in vitro. Există numeroase studii în literatură referitoare la utilizarea metodelor spectroscopice complementare Raman şi de absorbţie în IR în analizarea osului şi a cartilajelor. Doar în ultimii ani. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS Având în vedere stadiul actual al cercetărilor exploratorii prin spectroscopie Raman precum şi dotările existente în cadrul platformei. 3. fiind capabile să distrugă Staphylococcus aureus [45]. o boală metabolică. de obicei învelite într-un strat polimeric biocompatibil. Au fost de asemenea efectuate studii de detecţie SERS intracelulare utilizând nanoparticule de aur PEGylate şi marcate cu coloranţi [44] Rezultatele obţinute demonstrează faptul că nanoparticulele prezintă stabilitate.

47]. Aceste plăci se formează datorită colesterolului şi grăsimilor prezente în cantităţi excesive în sânge (datorită greşelilor de alimentaţie) care se "infiltrează" în pereţii arterelor. Osteogeneza imperfectă este o maladie genetică al cărei principal semn clinic este fragilitatea osoasă crescută. Studii efectuate pe nanostructuri poroase 129 . Această confinare duce la modificări ale spectrului de vibraţie al materialelor nanostructurate în comparaţie cu cel al materialului bulk. Ele stânjenesc din ce în ce mai mult circulaţia liberă a sângelui prin artera afectată: din laminară şi fluentă. Metodele spectroscopice complementare Raman şi de absorbţie în IR sunt capabile să coreleze informaţiile histopatalogice ale unei aorte afectate de arteroscleroză cu compoziţia chimică a unei aorte sănătoase [49-51]. Se pot monitoriza benzile caracteristice proteinelor (colagen.). În ultima perioadă. Această boala apare ca urmare a mutaţiilor de la nivelul genelor care codifică producerea de colagen tip I. actina. S-a constatat că în principiu metodele spectroscopice vibraţionale pot fi atât un instrument de diagnosticare cât şi o metodă care să monitorizeze progresul tratamentului asupra bolii.) şi lipidelor. De asemenea au fost investigate prin spectroscopie Raman efectele de confinare a fononilor optici în materialele nanostructurate [53]. Ea se datorează prezenţei aşa-numitelor plăci ateromatoase pe pereţii arterelor. vor exista contribuţii ale fotonilor din afara acestei zone. şi se pot localiza plăcile ateromatoase prin prezenţa benzilor caracteristice carbonatului de calciu [49-51]. cardiopatie ischemică. deoarece absenţa periodicităţii la dimesiuni sub cele ale particulei relaxează regulile de selecţie ale fononilor optici în regiunea centrală a zonei Brillouin şi prin urmare. maladia se tratează medical cu aminobisfosfonaţi iar spectroscopia poate juca un rol important în urmărirea progresului tratamentului. accident vascular cerebral. elastina. În prezent.un os afectat de osteoporoză are un grad de cristalinitate crescut şi un domeniu mai îngust de cristalinitate decât osul sănătos. Metodele spectroscopice vibraţionale sunt capabile să identifice ţesuturile anormale afectate de această boală [48]. Arteroscleroza stă la baza apariţiei majorităţii bolilor cardiovasculare (angina pectorală. În timp. infarct miocardic. prin depunerea de calciu se formează plăcile ateromatoase. ea devine turbulentă şi inegală. spectroscopia Raman s-a dovedit a fi o metodă fezabilă în studiul materialelor nanostructurate. arteriopatie obliterantă etc. manifestată în special prin fracturi la nivelul oaselor lungi. etc. Aceste modificări ale structurii sunt reflectate în spectrele Raman şi IR ale probelor [46. în spectrul Raman. În cadrul unui studiu a fost analizată dependenţa deplasării benzilor Raman în funcţie de dimensiunea unor nanocristale [52].

2002. forma şi compoziţia nanofirelor [55]. S. s-au dovedit a fi pictate la sfârşitul secolului al 19-lea sau începutul secolului 20. 41. Raman Spectrosc. D. Nanostructured Gold Surfaces as 3. J. J. 853. Astilean. L. În acest mod. 4. a devenit o metodă de investigare extrem de utilă în domeniul patrimoniului cultural. 23982. A. L. spectroscopia Raman. Acest lucru a fost confirmat cu ajutorul microspectroscopiei Raman [57]. sculpturi. Gold Films Deposited over Regular Arrays of Polystyrene Nanospheres as Highly Effective SERS Substrates from Visible to NIR. presupuse a fi lucrări medievale autentice. R. ceramici. 130 . 2010. aşa cum au fost observate în cazul şi sau Ge poros. 2006. Studii Raman ale nanofirelor sau nanoconurilor de GaP au dovedit faptul că există o dependenţă între intensitatea spectrală şi caracterul spaţial al radiaţiei Raman împrăştiate şi dimensiunea. L. P Van Duyne. B 110. Sackmann. T. B 106. McFarland. Chem. un număr de cinci picturi în miniatură achiziţionate de Muzeul Victoria şi Albert în 2008. M. pot fi diferenţiate operele de artă veritabile de cele contrafăcute sau falsificate. 4. Bom. A. Balster. efectele de confinare pot fi utilizate pentru a determina dimensiunea acestora [54]. J. printre tematicile de cercetare care ar putea fi abordate în viitor s-ar putea regăsi atât studiul unor materiale nanostructurate de tipul nanofirelor şi a filmelor nanostructurate cât şi al unor obiecte din patrimoniul cultural. utilizate în artifacte ca de exemple manuscrise. Phys. 2. A. Metal Film over Nanosphere (MFON) Electrodes for Surface-Enhanced Raman Spectroscopy (SERS): Improvements în Surface Nanostructure Stability and Suppression of Irreversible Loss. Nafie.Bibliografie 1. Dick. L. Baia. M. A. de la pigmenţi anorganici la biomateriale. Haynes. Pe de altă parte. având în vedere aceste considerente şi ţinând seama de echipamentele existente în cadrul platformei. Li şi colaboratorii săi [58] au realizat analiza decoraţiunilor şi au identificat pigmenţii folosiţi la decorarea unui covor chinezesc din secolul al 5-lea cu ajutorul tehnicilor complementare micro-Raman şi FT-IR. Metoda este prezentă în departamentele de conservare şi restaurare a celor mai recunoscute muzee şi librării din lume şi este utilizată pentru identificarea unor materiale. C. acompaniată în ultimii ani de microscopie şi de tehnica SERS. S. 1566. De exemplu. picturi. Part IV. textile. Baia. Recent advances în linear and nonlinear Raman spectroscopy.semiconductoare au dovedit faptul că în cazul unor unităţi structurale de câţiva nanometri. J. sticle. Cu ajutorul acestei metode se obţin informaţii despre compuşii moleculari aflaţi în probele supuse analizei. Chem. Popp. Astfel. Materny. Phys. monumente de piatră [56].

P. Hogan. D. Edwards. 57. Hanahan. Williams. Cell 100. 2007..1117/2. Méndez-Vilas and J. Z. M. A. Witkowski. D. Hofer. Popp. P. Ellis. B. Y. Wiley-VCH. A. 2009. A. Chang. Lasers în Surgery and Medicine. 16. Lieber. 86. Ed.Wuttig. Harz. pp. Identification of micro-organisms by Raman spectroscopy. Chem Soc Rev. 37. Chem. 2009. D. pp. D. I. J. Wu. Lankers. D. Raman Spectrosc. S. Barry. 24. 17. M. 183. 40. 2009. Combined AFM/Raman microspectroscopy for characterization of living cells în near physiological conditions. J. FORMATEX 2010. 1992. R11. 2008. SPIE Proceeding. H. M. Vo-Dinh. Billheimder. S. 7. The Hallmarks of Cancer. Applications and Education A. Single-molecule and single-nanoparticle SERS: from fundamental mechanisms to biomedical applications. B. Ronneberger. 297.). Raman Spectrosc. J. 912. Petry. M. Microscopy: Science. Zhou. T. Domenico Campolo. Notingher. C. 20. C. Integrated real time Raman system for clinical în vivo skin analysis. A. Zeng. R. Pharm. C. A. G. 2008. R. J. Raman Spectrosc. Reference database of Raman spectra of pharmaceutical excipients. Zhao. 22. Vandenabeele.. I. Weinberg. InTech. Lui. Reproducible Substrates for Surface Enhanced Raman Spectroscopy. And Tech. 2003.. Raman Spectrosc. R. J. 40. Rocha. 2009. J. J. Puppels. P. A. M. 40. Popp. A. 40. M. 2006. Temperini. McLean. H. A. P. Lin. H. Shanker. în vivo nonmelanoma skin cancer diagnosis using Raman microspectroscopy. T. 15. Burkhardt. H. Yu. pp. Zanchet. Technology. G. P. McLean. 1343.-C. Raman investigations of TiO2 nanotube substrates covered with thin Ag or Cu deposits. M.5. Esenturk. 2009. M. pp. Zeng. Surface-enhanced Raman spectroscopic detection of a bacteria biomarker using gold nanoparticle immobilized substrates. T. 1539. HightWalker. 81. 11. 81. Motzkus. D. M. 12. G.. Lin. L. M. 2010.-L. 7. în Biomedical Photonics Handbook. E. Zhao.A. 2010. Lui. J. Raman Spectrosc. Gold-coated zinc oxide nanowire-based substrate for surface-enhanced Raman spectroscopy. Skin Res. (CRC Press. D. Dolata. Sant’Ana. 38. T. H. Raman Spectroscopy Cell-based Biosensors. 2008. I-F. R. Kudelski. New Developments în Biomedical Engineering. J. P. 21. J. Mahadevan-Jansen. Díaz (Eds. Santos. R. 572.-Y. Biomicrofluidics 4. 455-474. 2007. Schuele. ch. 19. 85. 14. The use of Raman spectroscopy în the detection of counterfeit 131 . N. A dielectrophoretic chip with a roughened metal surface for on-chip surface-enhanced Raman scattering analysis of bacteria. Size-dependent SERS enhancement of colloidal silver nanoplates: the case of 2-amino-5-nitropyridine. Ed. Mahadevan-Jansen. 034104. A. Online monitoring and identification of bioaerosols (OMIB). Peschke. H.-Y.. L. A. Riesenberg. 9902. Roesch. 2000.. Anal. Raman Spectrosc. 515-522. X. 30:1–30:27.Weinheim.-W. C. S. Qian. D. 6. Moens. Int. R. Schmautz. Remon. 23. A. Caspers. S. Roguska.-D. K. J. Combined în Vivo Confocal Raman Spectroscopy and Confocal Microscopy of Human Skin. de Veij. O. M. Sensors. 89–165. Fourier transform Raman spectroscopy a novel application for examining human stratum corneum. Cheng. Khan.-C.1200708. Lewandowska. McEwen. A. Janik-Czachor. 40. I.. M.0856. 2009. 1652. Washington DC.-W. S. 40. 8. 9. 13. Lucassen. Wu. Shen. 2003). H. Pisarek. M. 10. G. J. 14. 277. J. Nie. Surface-enhanced Raman scattering spectroscopy via gold nanostars. H. 18. H. R. Thiele. Biophys. Cheng. Krause. 484. H.-L. H. Biophotonics: Vision for a better Health Care. Majumder. De Beer. 10. H. Huan. 461.-Q. G.

W. S. 29. J Food Sci. M. 673. Yang. A. P. A. Commun. Mita. Ojha. F. 2008. Hasi. Astilean. B. M. Noes. 3861. fluorescence. R. J. 420. 2009. 39. 73. ChemPhysChem 10. G. 34. L. D. Raman Spectrosc. J. Li. 2007. dual LSPR-SERS plasmonic sensors of high sensitivity and stability based on chitosan coated anisotropic silver nanoparticles. C. 2010. Kuckuk. He. January/February 2005. 704. American Pharmaceutical Review. F. Iosin. 21. S. 33. N. 406. Srivastava. Graupner. Y. H. S. Srivastava. and SERS spectroscopyJ. Lin. Astilean. Raman Spectrosc. Mol. Zenone. Nanotechnology 21. Farcau. Mater. Raman Spectrosc. S. 2009. Chem. Investigation on Clarified fruit juice composition by using visible light micro-Raman spectroscopy. M. Localized surface plasmon resonance (LSPR) and surface-enhanced Raman scattering (SERS) studies of 4-aminothiophenol adsorption on gold nanorods. J. Baia. D. and Processed Foods Using Surface Enhanced Raman Spectroscopy and HPLC. S. Chicken Feed. Multifunctional plasmonic sensors on low-cost subwavelength metallic nanoholes arrays. 2011. 2008. 2843. Chem. M. The study of Raman enhancement efficiency as function of nanoparticle size and shape.. S. D. Astilean. Farcau . 1106. G. S. Baia. 2049. Multivariate Calibration. 2009. R. Astilean. 41. Canpean. 35. Sensors. H. 28. S. 38. Raman spectroscopy of covalently functionalized single-wall carbon nanotubes. Martens. S. Lett. 95. M. Pfeiffer. T129. Awika. J. 36. Evidence of a surface plasmon-mediated mechanism în the generation of the SERS background. Appl. 2010. 47. 3625. F. 31. Sect. Biro. Appl. 63. S. H. A. V. Liu. S. Boca. Chem C 114. Pagona. Astilean. Potara. R. 1993. Formation 132 . Y. 2007. Kim. Lancet. Y. J. Chen. M. K. Silver half-shell arrays with controlled plasmonic response for fluorescence enhancement optimization. 7. Asthana. Delfino. 2011. 235601. 2007. Heise. W. Gabudean. Astilean. 2009. Detoxification of gold nanorods by conjugation with thiolated poly(ethylene glycol) and their assessment as SERS-active carriers of Raman tags. Res. Raman scattering from nanomaterials encapsulated into single wall carbon nanotubes. 2011. T. Ch. Res. 11717. 372. Plank. Potential of Raman spectroscopy and imaging methods for rapid and routine screening of the presence of melamine în animal feed and foods. Maniu.and multi-walled nanotubes. C. I. Baldeck. Camerlingo. Struct. A. K. D. C. 27. Kuzmany. Schaman. Tuschel. D. Ledoux. Farcau. 2009. Public-health risks of melamine în milk products.. Wiley: New York. R. 2009. H. Spectrosc. Toderas. Lab Chip 9. Lepore. 477. Astilean. Multilayer Structures of Self-Assembled Gold Nanoparticles as a Unique SERS and SEIRA Substrate. A. J. Phys. 12. A. Chao. E. Nanopart. V. 40. M. Astilean. Nucl. 2010. 38. graphitised porous carbon and graphite. Solution-phase. Focsan (Iosin). F. Priore. Gabudean. 3574. M. V. S. Phys. 1444. 42. Detection of Melamine în Gluten. M. 37. 193110. C. Canpean. 993. Chan. 32. S. L. Study of tryptophan assisted synthesis of gold nanoparticles by combining UV–Vis. Astilean. Mustapha. Olkhovyk. Boca.. M. B 267. Methods Phys. Astilean. 40. S. Diano. L. N. Astilean. J. P. Gabudean. single. 26. and adulterated pharmaceutical products. C. 30. 43. Tagmatarchis. G. Griffiths. 344. J. O.25. R. Maniu. Characterisation of carbonaceous materials using Raman spectroscopy: a comparison of carbon nanotube filters. Rotas. D. Simon. Instrum. 38. S. C. Farcau. Mapping the SERS Efficiency and Hot-Spots Localization on Gold Film over Nanospheres Substrates.

G. of size and shape tunable gold nanoparticles în solution by bio-assisted synthesis with bovine serum albumin în native and denaturated state. V. M. B. Jr. T. A.. 58. T. B. K. X. Xie.SPIE 2004. J. J. Anedda. D. J. Rajalakshmi. 133 . Transcutaneous fiber optic Raman spectroscopy of bone using annular illumination and a circular array of collection fibers. 38. C. 54. Arora. Raman Spectrosc. J. Adar. 604. Ravindran. A. 2009. Raman spectroscopy study of atherosclerosis în human carotid artery. Astilean. 060502. 697. J. Silveira. R. în situ investigation of the chemical composition of ceroid în human atherosclerosis by Raman spectroscopy. C. Biomed. Applied Spectroscopy. Yeh. Appl. Laim. 33. E. Roessler. A.G. Inverse Spatially Offset Raman Spectroscopy for Deep Noninvasive Probing of Turbid Media. 2031.. He. H. Sivasubramanian. Astilean. Opt. Biomed. 2005. 129. Salis. Raman scattering of nanoporous semiconductors. Yang. Q. H. 2007.1 of 9). P. Goldstein. Zângaro. N. “Raman Spectroscopy în Art and Archaeology: A New Light on Historical Mysteries” în Frontiers of Molecular Spectroscopy.-M. pp. 49. 2011. J. J. V. 2009. C. Spanier. 52. C.. van de Poll. An analytical form for the Raman shift dependence on size of nanocrystals. Naudin. Raman Spectrosc. Rousseau. D. Pacheco. 2011. M. J. Y. 38. 57. Damert. . Vanasse. Edwards. Phys. Elucidation of the atherosclerostic disease process în apo E and wild type mice by vibrational spectroscopy. Raman spectroscopy of optical phonon confinement în nanostructuredmaterials. 1911. S.-L. L. M. G. 50. L. 2006. Martin. Mat.-Y. 40. R. D. P. W. McHugh.. V. Wang. A. 1134.. T. B. E. 55. T. Ricci. Jakab. Dooley. S.44. R.. Spectrosc. P. 40. 56. Raman Spectrosc. D.M. Hark. 1341. Potara. Morris. Pintea. G.. Bakker Schut. F. Spectroscopic investigation of modern pigments on purportedly medieval miniatures by the "Spanish Forger". 64. Nabet. Dehring. Popescu. 51. Boca. Raman Spectroscopy. Crane. On the Raman scattering from semiconductor nanowires. S. S. characterization and their application as SERS-active tags inside living cells. Optics. 135101. R. 2009. V. A. 2002. Canpean. K. M. Laane Ed. van der Laarse. E. 60. Flower-shaped gold nanoparticles: synthesis. J. 939. Nanotechnology 22. 2007.-J. O. 60. Y. L. M. 2007.133-173. Valenzuela. 2006. L. 38. Nanotechnology 22. V. J. Irmer. Pigment identification and decoration analysis of a 5th century Chinese lacquer painting screen: a micro-Raman and FTIR study. 634. 7 5321A-11 (p.-F. Barbu-Tudoran. A.. 055702. M. R. J. T. Morris. S. 10. C. Cao. 46. Burgio. T. Pasqualucci. L. J. J. L. R. J. J. K A.-S. Raman Spectrosc. Shi. Fang. Matousek. M. Raman Spectrosc. Li. 031117. 11. A. Nogueira. Synergistic Antibacterial Activity of Chitosan–Silver Nanocomposites on Staphylococcus Aureus. 47. Identifying chemical changes în subchondral bone taken from murine knee joints using Raman spectroscopy. Puppels. S. M. 2006. Smukler. D. J. A. Chem. 45. 544. Chavantes. 2011. Raman Spectrosc. Jelicks. 40. Elsevier 2009. M. C. 53. A. Rugina. Schulmerich. 48. Clark. A. A. A.

........................... nuclee.. 137 4. ceea ce înseamnă că modificarea distribuţiei de sarcină va avea loc 134 .... Oscilatorul armonic ........... Instrumentaţia şi metodologia obţinerii spectrelor IR ................................................................................................. Introducere Materia este formată din electroni.............................................. cum ar fi un atom.. dr............................. Bibliografie ............ Legea Lambert-Beer .... 138 5...................... În interacţiunea luminii cu materia..... Aceste sarcini nu sunt doar sarcini izolate (monopoli).... sau un solid prezintă o distribuţie de sarcină specifică. Fiecare subdiviziune a materiei................................................... ioni pozitivi şi negativi...................... 141 7.......................................... Nicolae Leopold Cuprins 1........... Reguli de selecţie pentru spectroscopia IR .................... ci sunt sarcini pozitive şi negative ce formează dipoli şi multipoli electrici........ SPECTROMETRUL IR Spectroscopia de absorbţie în infraroşu Lect...... 139 6.... câmpul electric (şi într-o măsură mai mică şi cel magnetic) al undei electromagnetice poate să modifice distribuţia de sarcină şi în acest fel să inducă un moment de dipol.........IV........ câmpul electric oscilează cu o frecvenţă de aproximativ 1015 Hz..................... Introducere ............................................. Moduri de vibraţie ...... 146 1.... o moleculă............................... 134 2........................ 135 3.................... În unda de lumină........................

la rându-i. procesele sunt descrise de anihilarea unui foton. schimbul de energie între unda electromagnetică şi materie este de asemenea specifică. precum şi spectroscopia Raman oferă informaţii despre modurile vibraţionale şi vibraţional-rotaţionale ale moleculelor. Pe de altă parte. Gradele de libertate rămase corespund numărului modurilor de vibraţie: 3N-5 pentru molecule liniare. şi alte două (molecule liniare) sau trei (molecule neliniare) grade sunt necesare pentru a specifica mişcarea de rotaţie. Molecula are aşadar 3N grade de libertate. Astfel. Numărul modurilor de vibraţie posibile al unei molecule poate fi determinat din numărul atomilor N din moleculă şi geometria moleculară. sau generarea unui foton când sistemul trece de la o stare energetică ridicată la una joasă. Moduri de vibraţie Spectroscopia de absorbţie în infraroşu. modificări (oscilaţii) ale distribuţiei de sarcină. pot fi observate doar frecvenţele de vibraţie ale probei. oferind informaţii unice despre materie. în cazul moleculelor cu centru de simetrie. Geometria moleculară este specificată de coordonatele carteziene ale fiecărui atom. urmate de tranziţia în stări de energie mai mari. 135 . vibraţiile active Raman nu sunt active IR. precum un dipol oscilator poate genera. ca fotonii să interacţioneze cu materia este descrisă de aşa numita “secţiune eficace “ a efectului spectroscopic. un câmp electric. 2. şi 3N-6 pentru moleculele neliniare.cu aceeaşi frecvenţă în materie. O regulă simplă de simetrie este aşa numita “regula excuziunii mutuale”. molecula unei anumite substanţe de exemplu. trei dintre aceste grade fiind folosite pentru specificarea mişcării de translaţie a moleculei în spaţiu. Probabilitatea specifică. IR şi Raman. În schimb. cele două tehnici. acele vibraţii care duc la o modificare a polarizabilităţii moleculare vor fi active Raman. pe scurt spectroscopia IR. De vreme ce distribuţia de sarcină este specifică pentru un anumit tip de materie. În fazele condensate (lichidă sau solidă). sunt în tratarea clasică procesele de bază ale fiecărei metode spectroscopice. Aceste procese. În funcţie de simetria moleculei. În teoria cuantică. activitatea unui mod vibraţional depinde de simetria lui şi de simetria moleculei. şi invers. ce apar la interacţiunea luminii cu materia. Benzile vibraţional-rotaţionale sunt observate doar când proba se află în stare de gaz. O vibraţie va fi activă IR dacă are loc o variaţie a momentului de dipol în timpul vibraţiei. unde moleculele se pot roti liber. Conform acesteia. pot fi privite ca fiind complementare.

De exemplu, vibraţiile fundamentale ale moleculei de apă, H2O, sunt prezentate în Figura 1. Apa, fiind o moleculă neliniară prezintă trei vibraţii fundamentale:

întindere simetrică

întindere asimetrică

deformare (forfecare)

Figura 1. Moduri de vibraţie de întindere şi deformare ale H2O.

Dioxidul de carbon, CO2, este o moleculă liniară, astfel că va prezenta patru vibraţii fundamentale (Figura 2). Vibraţia de întindere asimetrică a CO2 generează o bandă intensă în spectrul IR la 2350 cm-1. De menţionat este că această bandă se observă de regulă în spectrul IR al background-ului, datorită prezenţei CO2 în atmosferă.

întindere asimetrică

deformare (forfecare) perpendiculară pe planului foii

întindere simetrică

deformare (forfecare) în planul foii

Figura 2. Moduri de vibraţie de întindere şi deformare ale CO2.

Cele două vibraţii de deformare (forfecare) sunt echivalente, vibraţia acestora având loc la aceeaşi frecvenţă, fiind astfel numite degenerate, şi apar în spectrul IR la 666 cm-1. Vibraţia de întindere simetrică a CO2 este inactivă IR deoarece această vibraţie nu produce modificare în momentul de dipol al moleculei.

136

3. Oscilatorul armonic
Cel mai simplu model pentru vibraţia unei molecule diatomice este oscilatorul armonic. În acest model se consideră cei doi atomi de mase m1 şi m2 ai moleculei legaţi printr-un resort elastic. Descrierea matematică a mişcării de vibraţie a acestor două corpuri cu masele m1 şi m2 poate fi simplificată prin considerarea unui singur corp cu masa redusă µ=m1*m2/(m1+m2), ce oscilează în jurul centrului de masă al moleculei biatomice, într-un câmp potenţial de tipul kx2/2.

Figura 3. Modelul oscilatorului armonic pentru molecula diatomică. Variaţia energiei potenţiale cu distanţa internucleară.

Din punct de vedere fizic, aşa cum se poate deduce din Figura 3, o energie mai mare a oscilatorului armonic corespunde unei amplitudini mai mari a oscilaţiei, frecvenţa fiind aceeaşi pentru toate nivelele de energie. Energiile vibraţionale cuantificate se obţin în urma rezolvării ecuaţiei Schrödinger pentru oscilatorul armonic: Ev=hν(v+

1 ) , v=0,1,2…. 2

(1.1)

unde v este numărul cuantic de vibraţie, ν este frecvenţa de vibraţie şi h este constanta lui Planck. Frecvenţa de vibraţie a oscilatorului armonic depinde de puterea legăturii (constanta de forţă a legăturii k) şi masa redusă µ: ν=

1 2π

k

μ

(1.2)

137

Nivelele de energie vibraţionale sunt la distanţe egale (echidistante) în modelul oscilatorului armonic, diferenţa între două nivelele de energie adiacente E fiind: ΔE=hν=ћ k μ (1.3)

4. Reguli de selecţie pentru spectroscopia IR
O moleculă diatomică va absoarbe radiaţie IR numai dacă momentul ei de dipol se modifică în urma variaţiei distanţei internucleare. Probabilitatea de tranziţie depinde de diferenţa de populaţie ΔN dintre două stări cuantice şi pătratul momentului de dipol al tranziţiei, M: probabilitatea de tranziţie ~ ΔN M
2

(1.4)

unde, pentru o moleculă aflată într-o stare electronică dată, momentul de dipol al tranziţiei pentru o tranziţie vibraţională este dat de:
* (e) M= Ψν " μ 0 Ψν ' d τ

(1.5)

Funcţiile de undă ψ ν " şi ψ ν ' reprezintă stările vibraţionale finală şi respec(e) tiv iniţială, iar μ 0 este momentul de dipol electric permanent în această stare electronică. Pentru vibraţia unei molecule diatomice, momentul de dipol electric permanent poate fi extins într-o serie Taylor după distanţa internucleară de echilibru re :

∂μ ⎞ (e) =µe+ ⎛ μ0 ⎜ ⎟ q+ ⎝ ∂r ⎠ re

1 2

⎛ ∂ 2 μ ⎞ q2+ … ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

(1.6)

Aici q=r-re, iar r este distanţa internucleară la un moment dat, şi µe este momentul de dipol când legatura se află în poziţia de echilibru. Probabilitatea apariţiei unei tranziţii vibraţionale într-o moleculă diatomică poate fi obţinută substituind forma extinsă a momentului de dipol electric permanent în ecuaţia momentului de dipol pentru tranziţia vibraţională:

∫ Ψν

*
'

(e) μ0 Ψν d τ =
'

* µe Ψν " Ψν ' d τ + ⎜

⎛ ∂μ ⎞ 1 * ⎟ ∫ Ψν ' q Ψν d τ + 2 ⎝ ∂r ⎠ re
'

⎛ ∂2μ ⎞ ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

∫ Ψν

*
"

q2 Ψν ' d τ + … (1.7)

138

Primul termen din această ecuaţie este egal cu zero de vreme ce funcţiile de undă vibraţionale ψ ν " şi ψ ν ' sunt ortogonale. Al doilea termen este diferit de zero doar dacă momentul de dipol depinde de distanţa internucleară r

⎛ ∂μ ⎞ ⎜ ⎟ ≠0 ⎝ ∂r ⎠

(1.8)

De aceea, moleculele biatomice prezintă absorbţie vibraţională în spectrul IR doar atunci când există o modificare a momentului de dipol în cadrul mişcării de vibraţie. Moleculele diatomice homonucleare au momentele de dipol zero pentru toate lungimile legăturilor, astfel nu prezintă spectru de absorbţie vibraţional. Astfel, teoria mecanicii cuantice specifică faptul că absorbţia luminii infraroşii va apărea doar dacă un mod vibraţional implică o modificare a momentului de dipol şi că nivelele de energie vibraţionale în moleculă sunt cuantificate. Teoria ne spune de asemenea şi faptul că tranziţiile pot avea loc doar între nivele de energie adiacente, deoarece integrala din cel de-al doilea termen pentru polinoamele Hermite care descrie funcţia de undă a oscilatorului armonic, este diferită de zero doar dacă Δv= ± 1.

5. Legea Lambert-Beer
Domeniul spectral IR al radiaţiei electromagnetice este poziţionat între domeniul vizibil şi cel al microundelor. Prin convenţie, domeniul spectral IR este subdivizat în domeniul IR apropiat (Near Infrared Region - NIR), IR mijlociu (Mid Infrared Region - MIR) şi IR îndepărtat (Far Infrared Region FIR) (Figura 4). Spectrele IR discutate în această lucrare sunt toate din domeniul spectral MIR.

Figura 4. Domeniile spectrului electromagnetic şi subdiviziunile domeniului IR.

139

Spectrul IR se obţine prin înregistrarea intensităţii radiaţiei în lipsa probei de analiză (spectrul background) şi a intensităţii radiaţiei IR după ce aceasta trece prin probă. În urma trecerii prin probă, intensitatea fasciculului se va atenua datorită absorbţiei de radiaţie de către analit, precum şi a împrăştierii radiaţiei la interfaţa şi în interiorul probei (Figura 5a). Astfel, spectrul IR reprezentat va fi dat de mărimea: T= Is/IR unde, T este transmitanţa, Is intensitatea radiaţiei IR după, iar IR înainte de a traversa radiaţia proba. Valorile transmitanţei sunt între 0 şi 1, sau 0–100% pentru transmitanţa exprimată în procente. Între transmitanţă şi concentraţia unui compus relaţia este logaritmică. De aceea, pentru o reprezentare mai convenientă, în majoritatea cazurilor, în locul transmitanţei se foloseşte o altă mărime, absorbanţa A:

A = lg

1 = − lg T T

Relaţia dintre transmitanţă şi absorbanţă în funcţie de concentraţie este reprezentată în Figura 5b

Figura 5. (a) Atenuarea unui fascicul de radiaţie la refelexia interfeţei probei, împrăştierea de către particule şi absorbţia analitului. (b) Relaţia dintre transmitanţă, T, şi absorbanţă, A, în funcţie de concentraţia unui compus ipotetic.

În mod independent, Bouguer în 1729 şi Lambert în 1760, au stabilit că la concentraţie constantă, absorbanţa este direct proporţională cu grosimea probei, iar Beer în 1852 a observat că dacă grosimea probei este constantă, absorbanţa este proporţională cu concentraţia. Combinarea acestor observaţii a dus la legea Lambert-Beer, ce exprimă absorbanţa: 140

(I.2) unde a este absorbtivitatea – o constantă de proporţionalitate a moleculei la o lungime de undă specifică, d este lungimea drumului optic prin probă, iar c reprezintă cocentraţia substanţei analizate. Concluzionând, spectroscopia IR oferă atât informaţii moleculare calitative, prin modurile de vibraţie specifice fiecărei molecule, cât şi informaţii cantitative, aşa cum rezultă din legea Lambert-Beer.

A = a⋅d ⋅c

6. Instrumentaţia şi metodologia obţinerii spectrelor IR
Odată cu introducerea spectroscopiei transformată Fourier (FTIR) principalele dezavantaje ale spectroscopiei ”clasice” dispersive IR au putut fi înlăturate. Pe scurt, spectroscopia FTIR nu mai înregistrează intensitatea la fiecare lungime de undă, în mod secvenţial, la o lungime de undă după alta, şi de asemenea, spre deosebire de spectrometrele dispersive nu necesită prismă sau reţea de difracţie monocromatoare, unde apar pierderi majore în energia emisă de sursa IR la trecerea prin diferite fante de intrare şi ieşire. În spectroscopia FTIR, se aplică modularea interferometrică a radiaţiei (Figura 6). Pentru aceasta, un divizor de undă, de regulă din KBr acoperit cu un film de germaniu, împarte radiaţia în două fascicule, un fascicul fiind direcţionat către o oglindă fixă, iar celălalt fascicul către o oglindă mobilă (Figura 6). Aceste două fascicule sunt reflectate înapoi pe divizorul de undă, după care se recombină, intensitatea fasciculului variind în timp, datorită alternării interferenţei constructive şi destructive în funcţie de diferenţa de drum optic dintre cele două oglinzi, la fiecare moment de timp. Astfel, fiecare parcurs al oglinzii mobile este caracterizat de o interferogramă în funcţie de timp. Diferenţa de drum δ este proporţională cu timpul t, deoarece oglinda mobilă se deplasează cu viteză constantă v, astfel că δ = 2vt. Prin folosirea unui algoritm de transformată Fourier rapidă (Fast Fourier Transform - FFT algorithm), interferograma în funcţie de timp, I(δ), este convertită într-o interferogramă în funcţie de frecvenţă, I( v ), folosind următoarea relaţie:

I (δ ) = 0.5 H (v ) I (v ) cos 2πvδ I (δ )
unde H( v ) este un factor de corecţie dependent de numărul de undă şi de caracteristicile spectrometrului. Interferograma convertită în domeniul frecvenţelor se numeşte spectru de tip single-beam.

141

IR-light source

Figura 6. Spectrometrul FTIR. (a) Schema bloc a componentelor de bază ale unui spectrometru IR. (b) Principiul de funcţionare a unui interferometru Michelson format din sursă de lumină, divizor de undă, oglindă fixă, oglindă mobilă, detector şi probă (panel sus). Oglinda mobilă a interferometrului (panel sus) produce un semnal sinusoidal la detector pentru fiecare frecvenţă modulată (panel central). Pentru sursa IR, cu domeniu spectral de frecvenţe larg, semnalele modulate se suprapun şi formează o interferogramă complexă (panel jos).

Spectrometrele FTIR prezintă mai multe avantaje faţă de instrumentele convenţionale IR dispersive, incluzând o îmbunătăţire dramatică a raportului semnal-zgomot (S/N), obţinută prin multiplexare (detectarea simultană a tuturor frecvenţelor), reducerea timpului de scanare, precum şi un câştig mai mare în energia radiativă. Un alt avantaj important este reproductibilitatea excelentă în lungimea de undă a spectrometrelor FTIR, datorită utilizării unui laser de referinţă intern (de regulă HeNe, 632.8 nm ), ceea ce permite manipularea datelor spectrale, cum ar fi scăderea, adunarea sau scalarea spectrelor cu un grad foarte ridicat de acurateţe. De asemenea, progresul spectroscopiei FTIR a fost facilitat şi de dezvoltarea calculatoarelor personale, ce permit utilizarea de programe soft complexe, pentru aplicaţii calitative şi cantitative. Pentru partea practică a acestei lucrări, spectrele au fost înregistrate cu un spectrometru Jasco FTIR-6200 cuplat cu un microscop IR Jasco IRT-5000 (Figura 7). 142

Figura 7. Aparatura IR Jasco: spectrometrul FTIR-6200 şi microscopul IRT-5000.

Principalele părţi componente ale spectrometrului FTIR sunt sursa de emisie, interferometrul şi detectorul. Sursa de emisie IR este componenta cea mai simplă a instrumentului, constând într-un filament incadescent (10000C). Interferometrul este de tip Michelson, iar parcursul maxim al oglinzii mobile determină rezoluţia spectrală a spectrometrului. Alegerea detectorului este legată de aplicaţiile abordate. Astfel dacă se urmăreşte de exemplu cinetica unei reacţii chimice, este absolut necesară folosirea unui detector de tip MCT (Mercury Cadmium Telluride). Acestea sunt de două tipuri: MCT A, detector de foarte înaltă sensibilitate în domeniul spectral 650-7800 cm-1 ce permite înregistrarea rapidă a spectrelor (până la ns), şi MCT B, detector de înaltă sensibilitate în domeniul spectral 400-7800 cm-1, de asemena pentru înregistrări rapide. De menţionat că detectoarele MCT necesită răcirea cu azot lichid. Detectoarele de tip DTGS (Deuterated L-Alanine doped Triglycene Sulphate) lucrează la temperatura camerei într-un domeniu spectral larg 10-7800 cm-1, însă sensibilitatea acestora este de până la două ordine de mărime mai mică faţă de detectoarele MCT. De menţionat însă că domeniul spectral de detecţie al spectrometrului este limitat de fereastra din faţa detectorului (de regulă KBr) precum şi de divizorul de undă (beamsplitter, de regulă din KBr acoperit cu un strat de Ge), astfel că spectrometrele IR uzuale nu permit înregistrarea spectrelor sub 400 cm-1. Spectrometrul FTIR-6200 permite înregistrarea spectrelor IR în modul transmisie, pentru acest mod fiind necesară prepararea în prealabil a probe143

lor sub formă de dispersie în pastile KBr. Tot pentru măsurători IR în transmisie se poate presa proba între două discuri/ferestre dintr-un material ce nu absoarbe (este transparent) în domeniul IR mijlociu, de exemplu ZnSe, Si, Ge, KBr etc. Microscopul IRT-5000 este dotat cu un obiectiv tip Cassegrain şi unul de tip ATR (Attenuated Total Reflectance). Obiectivul de tip Cassegrain se pretează doar pentru probe plane (filme, suprafeţe lucioase etc.). În prealabil, la folosirea obiectivului Cassegrain, se înregistrează spectrul background prin focalizarea pe oglinda de aur, un accesoriu din dotare. Modul de analiză ATR (Attenuated Total Reflection) este utilizat pentru investigarea probelor lichide şi solide. De asemenea, modul ATR se pretează pentru caracterizarea materialelor care sunt fie prea groase sau prea puternic absorbante pentru a fi analizate prin spectroscopie în transmisie. În modul de analiză ATR, radiaţia IR trece printr-un cristal transparent în infraroşu, cu un indice de refracţie ridicat, astfel că fasciculul IR va efectua reflexii interne succesive în cristalul ATR, aşa cum este prezentat schematic în Figura 8.

Figura 8. Prezentare schematică a tehnicii de analiză ATR-IR.

În vederea analizei, suprafaţa probei este presată astfel încât să fie în contact optic cu suprafaţa superioară a cristalului ATR. La reflexia internă a fasciculului, aşa numita undă evanescentă IR pătrunde în afara cristalului ATR, astfel că o mică parte din radiaţie penetrează proba. În modul de analiză ATR nu este necesară o preparare în prealabil a probei în vederea analizei. Dezavantajul constă în limitarea spectrală datorită cristalului ATR, de exemplu pentru un cristal ATR din ZnSe spectrele se pot înregistra începând de la 650 cm-1. De regulă, în prealabil, la folosirea modului ATR, se înregistrează spectrul background al atmosferei, cristalul ATR fiind în aer. Folosind microscopul IRT-5000 în modul de analiză ATR, au fost înregistrate spectrele FTIR/ATR a următoarelor substanţe de interes farmaco144

logic: aspirina, paracetamol şi deferoxamina. Structurile moleculare ale acestora sunt prezentate mai jos.

Aspirina

Paracetamol

Deferoxamina Tabloul spectral din Figura 9 prezintă spectrele de absorbţie în IR ale celor trei substanţe analizate.

Figura 9 Spectrele FTIR/ATR ale substanţelor de interes farmacologic: aspirina, paracetamol şi deferoxamina.

145

9. 2005. J. O. 2007. Casa Cărţii de Ştiinţă. N. Cluj-Napoca. L. Schrader. Smith and G.Methods and Applications.M. Spectroscopie Optică Moleculară. Wiley. V. Aştilean. Aştilean. Surface-Enhanced Raman Spectroscopy. Spectroscopia IR şi Raman. Cluj-Napoca. Ed. 1992. Probleme de Fizica Moleculei. Cluj-Napoca. Selected Applications. Iliescu. Teubner. Dent. Bibliografie 1. Wiley. UK. 7. R. Aplicaţii ale spectroscopiei vibraţionale. 2002. VCH. 2. Stuttgart. Iliescu. UK. 2002. Cîntă-Pînzaru. 2000. 5. Hollas. W. F. I. Aufbau der Moleküle. Cozar. Chichester. 1998. Litografia Universităţii Babeş-Bolyai. S. Modern Raman Spectroscopy – A Practical Approach. N. Simetrie Moleculară. Modern Spectroscopy. O. Cluj-Napoca. T. 6. 10. Leopold. David. Infrared and Raman Spectroscopy . Napoca Star. S. Cluj-Napoca. 8.Spectrele din Figura 9 sunt caracteristice structurilor moleculare corespunzătoare. 11. Atribuirea benzilor de vibraţie se poate face pe baza literaturii de specialitate comparând spectrele cu cele ale compuşilor asemănători sau prin calcularea teoretică a spectrelor IR folosind programe dedicate de chimie cuantică. 146 . 2004. Casa Cărţii de Ştiinţă. Chichester. 2009. Casa Cărţii de Ştiinţă. Chiş. T. Cluj-Napoca. Chiş. Leopold. Metode şi tehnici moderne de spectroscopie optică. Cluj-Napoca. Litografia Universitatii Babes-Bolyai. Germany. Maniu. 7. Engelke. Cozar. Weinheim. S. D. B. Germany. Teoria Grupurilor în Fizica Atomului şi Moleculei. 4. Napoca Star. 3. Simon.E. Grecu. 1986. pentru fiecare substanţă putându-se identifica o amprentă spectrală caracteristică. 2001. Vol.

.... 149 2... Cuplajul on-line cromatografia de lichide (lc)-IR ..................... 147 2....................... dr......... 150 3................ Introducere .............1...... 151 4........Tendinţe moderne în spectroscopia de absorbţie IR Lect............................... Aplicaţii analitice ale spectroscopieie IR .....1......................... Spectroscopia IR în calitatea şi siguranţa alimentelor ............... 157 1..................... Bibliografie ............... 147 .. 154 5............ Introducere Spectroscopia de absorbţie în infraroşu (IR) reprezintă o metodă analitică de investigaţie moleculară utilizată într-un număr vast de domenii..................... Cuplajul on-line electroforeza capilară (CE)-IR .............. Aplicaţii ale spectroscopiei IR în geoştiinţe............................................... Îmbunăţiri tehnice recente în cuplajul LC-IR........................................................... Publicaţiile din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR pot fi clasificate pe domenii ştiinţifice după cum este prezentat în Figura 1..................................................... 148 2.......... 155 6........ Nicolae Leopold Cuprins 1........ 150 2...................1.....2.............................................................................. Aplicaţii biomedicale ale spectroscopiei IR .......................

Aplicaţii analitice ale spectroscopieie IR Aplicaţiile analitice ale spectroscopiei IR sunt extrem de diversificate.Figura 1. astfel că pot fi foarte greu cuprinse într-o prezentare unitară. De aceea s-a ales în mod reprezentativ cuplarea on-line a detecţiei IR în metodele de separare cromatografie de lichide (LC) şi electroforeza capilară (CE). Clasificarea pe domenii a numărului de publicaţii din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR (www.scopus.com) Este evident din numărul mare al publicaţiilor în domeniile chimiei şi a fizicii că spectroscopia de absorbţie IR este în continuare o metodă experimentală de bază în cercetarea fundamentală. 2. 148 .

În dectecţia off-line folosirea interfeţelor de înlăturare a solventului duce la îmbunătăţirea senzitivităţii. fiind pusă la îndoială în mod frecvent viabilitatea acestui cuplaj. aceste metode de separare sunt cuplate cu metode de detecţie ca. şi ii) senzitivitatea redusă datorată utilizării unui drum optic redus al celulor pentru a evita saturarea semnalului ce intervine datorită absorbţiei eluentului. aceste metode prezintă avantaje şi dezavantaje în funcţie de analizele efectuate. în mod special a celei cu transformată Fourier (FTIR) ca şi mijloc de detecţie on-line în urma separării cromatografice a fost demonstrată în mod repetat în ultimii ani [1-3]. Totuşi.Metodele de separare cromatografice şi electroforetice sunt tehnici standard în laboratoare analitice privind siguranţa şi autenticitatea alimentelor. Utilitatea spectroscopiei de absorbţie IR. sau laboratoare pentru studii farmacologice. Cele două subiecte sunt strâns corelate. abordarea on-line este de preferat datorită unor avantaje majore. incluzând o rezoluţie cromatografică îmbunătăţită. furnizarea de informaţii în timp real.1. identificare şi cuantificare. 2. absorbţia UV-VIS sau spectrometria de masă. laboratoare medicale. Cuplarea cromatografiei de lichide cu un sistem de detecţie IR se poate realiza fie în modul off-line după înlăturarea solventului. Cuplarea on-line permite totodată înregistrarea de spectre IR pentru analiţi fără o anumită orientare. detecţia substanţelor interzise. precum şi posibilitatea de a utiliza soluţii tampon nevolatile [3-4]. Cuplajul on-line cromatografia de lichide (lc)-IR Cromatografia de lichide este cea mai uzuală metodă instrumentală folosită în laboratoarele analitice pentru separarea amestecurilor fizice. fie on-line folosind celule de curgere (flow-through cells) transparente pentru radiaţia infraroşie. De regulă. Două dintre cele mai citate dezavantaje ale cuplajului LC-FTIR sunt următoarele: i) dificultatea de a corecta absorbţia de fond a solvenţilor şi a aditivilor folosiţi pentru prepararea fazei mobile. Cert este faptul că în ultimii ani sunt depuse eforturi pentru a cupla cu spectrometria de masă şi alte metode de detecţie cum ar fi spectroscopia Raman sau spectroscopia de absorbţie IR. 149 . iar atunci când sunt ambele luate în considerare este uşor de înţeles numărul limitat de referinţe cu privire la cuplarea on-line a spectroscopiei de absorţie IR cu cromatografia de lichide. cristalizare sau degradare oxidativă. Desigur. Detecţia on-line LC-FTIR a fost limitată în trecut de un anumit număr de restricţii privind aplicabilitatea în problemele analitice de tip real-life. aspecte ce pot interveni la înlăturarea solvenţilor.

Kuligowski et al. facilitând o serie de noi aplicaţii.quantum-cascade laser. Un alt factor de limitare pentru detecţia IR cuplată cu cromatografia de lichide este legată de absorbţia puternică a apei în domeniul spectral MIR. Avantajul surselor IR de tip QCL constă în posibilitatea reglării lungimii de undă a laserului prin reglarea temperaturii de funcţionare [12]. 2. Folosind tehnica gradienţilor s-au putut obţine spectre de înaltă calitate ale analiţilor în urma aplicării unei corecţii ale fondului (semnal background) la datele înregistrate. Dezvoltarea din ultimii ani a unei noi tehnologii laser pentru surse IR.2. Urmând studii anterioare [7].1. Separarea apare în urma aplicării unei tensiuni înalte. 150 . Sistemul a fost utilizat pentru separarea a opt constituenţi ai vinului şi ai sucului de struguri. pe coloană. Îmbunăţiri tehnice recente în cuplajul LC-IR Pentru a creşte senzitivitatea cuplajului LC-FTIR şi pentru a obţine astfel o limită de detecţie mai bună s-a realizat interfaţarea unui sistem de cromatografie capilară pentru lichide cu spectrometrul FTIR.2. Au fost puşi în mişcare gradienţi liniari în limitele 50:50-35:65 [apă(0. mai ales în analizele bio-chimice din cauza eficienţei mari a separării cât şi consumului redus de substanţă [13-15]. limite de detecţie între 35-94 ng.1. fapt care duce la o curgere electro-osmotică în capilar.5 nL. duce la o nouă abordare a detecţiei IR on-line [7-10] folosind noi dispozitive [11]. [5] folosind o micro-celulă de curgere [6] cu ferestre transparente în IR mijlociu din CaF2. cu un volum intern al celulei de 7. QCL . care a fost plasat pe un condensor al fasciculului optic ataşat spectrometrului. Prin reducerea dimensiunii şi a costurilor aparaturii se conturează o direcţie clară în ceea ce priveşte detecţia on-line IR dedicată cromatografiei de lichide. Un set-up optic bazat pe trei oglinzi de aur şi un separator de fascicule din ZnSe a fost folosit pentru a direcţiona lumina emisă de laser printr-o celulă fluidică cu un drum optic de 52 µm către un detector MCT (mercury-cadmium-telluride). Cuplajul on-line electroforeza capilară (CE)-IR Electroforeza capilară (CE) a devenit o tehnică de separare importantă. [12] au folosit două lasere QCL pentru detecţia on-line în cromatografia de lichide de înaltă performanţă. Acest lucru a fost evidenţiat de coeficienţii de corelare cuprinşi între 89-96% (în regiunea spectrală 1700-1050 cm-1) şi utilizaţi pentru compararea spectrelor de referinţă cu cele obţinute în urma injectării în sistemul cromatografic a unei cantităţi între 230-270 ng din analiţi.05% TFA-acid trifluoroacetic):acetonitril] timp de 15 min pentru separarea soluţiilor standard de nitrofenoli. obţinându-se astfel on-line.

limfoid [51]. aşa cum s-a arătat la discriminarea on-line de enantiomeri în timpul separării chirale într-un mediu neapos. 3. Interacţiunea moleculelor analit cu selectorul chiral a produs diastereomeri cu un spectru IR clar. distinct. colon [56-59].De obicei. creier [47-49]. din cauza concentraţiei mici de substanţă disponibilă pentru detecţie. Spectrele înregistrate 151 . Maturitatea cuplajului CE-FTIR on-line este considerată prin separarea şi cuantificarea cu succes a glucidelor din băuturi răcoritoare [18]. tot mai multe studii arată că detecţia on-line FTIR este utilizată cu succes. limfocite [52]. permiţând discriminarea moleculelo analit [19]. col uterin [26-34]. Wood et al. Aplicaţiile principale în acest domeniu sunt cele privind dinamica proteinelor şi elucidarea structurii secundare. os [61] sau ţesut tumoral [62]. Recent însă. guaninei şi a adenosinei-5’ monofosfat în domeniul ng folosind electroforeza capilară convenţională [16]. gastrointestinal [43-46]. Aplicaţii biomedicale ale spectroscopiei IR Analiza FTIR este folosită într-o serie largă de studii biologice cuprinzând măsurători pe diverse ţesuturi ca: piele [21-25]. Pentru detecţia prin spectroscopia infraroşie mijlocie s-au raportat măsurători atât off-line cât şi on-line. detecţia în CE este dificilă. medicamente anti-cancer [66]. iar în cazul detecţiei UV-Vis sensitivitatea este limitată de diametrul mic al capilarului. În măsurători de transmisie folosind celule transparente manufacturate special pentru IR o parte din spectru este blocat din cauza absorbţiei puternice a fazei lichide. plămân [35-37]. Informaţia moleculară specifică livrată de spectrul IR poate fi interpretată în mod avantajos. Acest ultim aspect este cel care face spectroscopia FTIR o metodă de analiză biomoleculară foarte atrăgătoare [20]. rezultatele fiind foarte bune din punct de vedere calitativ şi cantitativ [17]. sân [38-42]. limfon non-Hodgkin’s [53]. bucal [50]. prostată [54-55]. Acest articol raportează prima separare a unor proteine în electroforeza capilară cu detecţia FTIR on-line. [26] au evidenţiat potenţialul spectroscopiei FTIR ca instrument de biodiagnostic în cancerul de col uterin. fibroblast [60]. Detecţia on-line bazată pe tehnica reflexiei totale atenuate ocoleşte această problemă prin reducerea eficientă a drumului optic. Un alt studiu prezintă separarea şi detecţia IR a 5 analiţi. Alte studii relevante au fost efectuate pe bacterii [63-64] ADN [65]. Un alt domeniu în care spectrometria IR poate furniza informaţii importante este analiza proteinelor. Utilitatea detecţiei FTIR on-line a fost demonstrată prin separarea şi cuantificarea adenosinei. sau pentru monitorizarea glucozei [67].

a culturilor celulare şi a xenogrefelor de acest tip. respectiv limfocitele au o caracteristică spectrală în zona legăturii fosfodiester (1300-900 cm-1). Acest studiu a demonstrat potenţialul de aplicabilitate a tehnologiei automatizate FTIR în monitorizarea cancerului de col uterin în mediul clinic. încercând astfel diferenţierea ţesutului canceros de cel normal. sugerând prin aceasta modificări spre malignitate. ARN. Într-un alt studiu. Un avantaj major al acestei metode îl reprezintă posibilitatea de a obţine rezultate determinante foarte rapid. Caracteristicile spectrale care sugerează transformări de malignitate sunt în principal modurile de vibraţie simetrice şi antisimetrice ale grupării fosfat precum şi reducerea în intensitate a benzii atribuite glicogenului. [28] au investigat cu microspectroscopia FTIR tipurile de celule şi potenţialele variabile care ar duce la confuzii în diagnosticarea malignităţii acestui ţesut. atribuită glicogenului şi grupării fosfat din acizii nucleici. [35] s-au concentrat asupra studiilor microscopice FTIR ale celulelor canceroase din fluidul pleural. fosfaţi şi carbohidraţi. Acestea reprezintă un factor discriminant privind ţesutul de plămân canceros şi cel normal. atribuite glicogenului şi colesterolului. [36] se bazează pe posibilitatea de achiziţie directă de pe ţesut de plămân canceros sau normal prin microscopia FTIR. Privind aceeaşi afecţiune. [30] pe melanom fixat cu formalină şi pe celule canceroase de col uterin bazat pe microspectroscopia FTIR a urmărit detecţia unor biomarkeri comuni care apar în cele două afecţiuni. şi totodată o pronunţată bandă atribuită întinderii simetrice a grupării fosfat la 1078 cm-1. Yano et al. în vederea implementării acesteia ca şi tehnică medicală în acest domeniu. [38] a fost reprezentată de cancerul la sân.pe celule epiteliale normale prezintă benzi intense ale glicogenului la 1022 cm-1 şi 1150 cm-1. probele păreau să fie 152 . Studiul iniţiat de Mordechai et al. Spectrele înregistrate au fost analizate privind posibilele modificări în ceea ce priveşte nivelul biomoleculelor: ADN. La nivel macroscopic. Rezultatele lor demonstrează că sunt diferenţe semnificative între celulele normale din plămân şi cele tumorale. Nivelul acestora din urmă s-a dovedit a fi un bun indicator în diagnosticarea şi detecţia cancerului de col uterin. Diferenţa considerabilă este reprezentată de raportul benzilor de la 1030 şi 1080 cm-1. Zona de interes a studiilor comparative de spectroscopie IR pentru Fabian et al. Wang et al. Wood et al. Scopul acestui studiu a fost determinarea eficienţei spectroscopiei IR în diagnosticare şi în acest sens s-a descoperit că leucocitele. Pentru evaluarea cantitativă a malignităţii s-au ales intensităţile benzilor de la 1045 şi 1465 cm-1.

rect. Utilizând spectroscopia FTIR s-a realizat această discriminare cu o acurateţe de 88. Ulterior s-au detectat modificări în conţinutul de colagen şi a depozitării celulelor lipidice. însă foarte rar în cele de ţesut tumoral. Fujioka et al. dar acest stu153 . Andrus şi Strickland [51] au monitorizat gradual tumori limfoide cu ajutorul spectroscopiei FTIR.omogene din punct de vedere al ţesutului conjunctiv care a fost ales ca şi amprentă spectrală. Astfel. respectiv să diferenţieze materia albă de cea cenuşie cu acurateţe de 90%. 74%. Dovbeshko et al. Weng et al. cancer de stomac şi gastrită cronică prin comparare cu ţesut normal şi a obţinut o acurateţe în diagnostic de 90%. [46] au realizat o investigare a biopsiilor cu spectroscopia ATR-FTIR privind afecţiuni ca şi: gastrită superficială. [43] au raportat diferenţierea spectroscopică între ţesutul gastric normal şi cel tumoral. Fukuyama et al. [50] au folosit spectroscopia FTIR pentru a studia diferenţele între celule canceroase gingivale şi celulele epiteliale gingivale normale. Se presupune că pentru această apreciere este necesară obţinerea de informaţii fundamentale privind pătrunderea şi pierderea lichidului apos de la nivelul corneei. achiziţia de informaţii având loc la contactul cu o sondă ATR. urmărind absorbţia atribuită colagenului. Li et al. Rezultatele au indicat faptul că banda atribuită întinderii C=O a adipozei poate fi identificată în spectrele probelor de ţesut normal. urmărind vibraţia de deformare a apei în combinaţie cu cea de întindere a legăturii OH în cazul unei suprafeţe normal hidratată de cornee şi a uneia nehidratate suficient din cauza unor ocluzii. ficat şi a altor părţi ale sistemului digestiv cu ajutorul fibrei optice FTIR şi a spectroscopiei FT-Raman.6%. S-a concluzionat că un studiu de spectroscopie IR poate deveni foarte util în interpretarea corectă şi înţelegerea pe deplin a patologiei acestui ţesut. 66%. Choo et al. Prin utilizarea mai multor metode multivariate au arătat că este posibil să se clasifice datele spectroscopice non-subiectiv. Prin comparare cu spectre ale cheratinei pure şi ale colagenului s-au obţinut rezultate care să susţină introducerea acestor investigaţii în clinici. [44] au studiat tumori de stomac. colon. intestin subţire. [47] au aplicat spectroscopia IR în diagnosticarea afecţiunii Alzheimer investigând spectre achiziţionate pe ţesut uman de sistem nervos central. urmărindu-se raportul benzilor de la 1460 şi 1400 cm-1. s-a reuşit determinarea cantitativă a apei în fiecare caz. [62] au ales un studiu de reflexie FTIR prin absorpţie amplificată la suprafaţă a acizilor nucleici din celulele tumorale. [23] a utilizat spectroscopia ATR-FTIR (spectroscopia IR cu tranformată Fourier în reflexie totală atenuată) pentru a măsura gradul de hidratare al corneei. Lucassen et al. respectiv 90%.

Autorii au 154 . iar pentru fiecare produs s-au stabilit limite inferioare ale acestuia.diu a ridicat anumite probleme. În concluzie. până la părţi pe milliard (ppb). nectar de prune şi sucuri de mere de la diferiţi producători. În mod similar. Rodiile sunt foarte apreciate pentru activitatea lor antioxidantă cât şi pentru potenţialele efecte chemopreventive împotriva cancerului de prostată [68]. He et al. respectiv apariţia prin interpretarea spectrelor a unor configuraţii “ciudate” de baze şi zaharuri. Datorită utilizării tehnicii FTIR în aplicaţii de control a calităţii şi a procesării. preparatelor şi a gemurilor de fructe este procentul care desemnează conţinutul de fructe. 4. rapide şi nedistructive ale compuşilor chimici. Progresul în instrumentaţia FTIR combinat cu dezvoltarea unor metode statistice multivariate de analiză a datelor fac această tehnologie ideală pentru monitorizare rapidă cât şi caracterizarea compuşilor din alimente la nivel de urme. industria agroalimentară este deja familiarizată cu această tehnologie şi cu potenţialul ei de implementare în monitorizarea alimentelor. atribuită în principal întinderii C=O [68]. Spectre înregistrate după extracţia fazei solide din sucuri a îmbunătăţit puterea de modelare pentru compararea cu sucul pur şi a recunoaşterii prin folosirea unui tipar (soft independent analysis of class analogy (SIMCA)) şi a permis diferenţierea sucurilor de origini diferite. Spectre MIR au fost folosite pentru a diferenţia sucurile concentrate pure din rodii de cele contrafăcute cu suc de struguri concentrat (2%-14% v/v) folosind analiza de componente principale (PCA) în regiunea IR 1780-1685 cm-1. merişor. Extracţia fazei solide a minimizat interferenţa zahărului cu spectrele şi a izolat componentele fenolice care au oferit o amprentă unică în autentificarea sucurilor. Spectroscopia MIR a fost folosită în autentificarea sucurilor cu ingrediente de înaltă calitate contrafăcute din surse inferioare. spectroscopia de absorbţie IR reprezintă o metodă senzitivă în ceea ce priveşte analiza malignităţii ţesuturilor cu potenţial real pentru aplicaţii clinice în detecţia şi diagnosticarea a diverse afecţiuni. Un parametru important în monitorizarea autenticităţii piureurilor. Regresia de tip parţial least-squares (PLS) ce corelează conţinutul de fructe şi spectrele FTIR centrate pe o bandă la 1729 cm-1 a asigurat o bună calibrare statistică la analizarea gemului de căpşuni [69].Spectroscopia IR în calitatea şi siguranţa alimentelor Spectroscopia FTIR este o tehnologie promiţătoare pentru industria agroalimentară deoarece permite măsurători simple. struguri Concord. [70] au analizat afine. spectroscopia MIR a fost de mare succes în diferenţierea varietăţilor de fructe şi a originilor geografice.

Până în 2009 nu a fost o metodă standardizată în industria viticolă care să permită determinarea eficientă a compoziţiei şi autenticităţii vinurilor organice [71]. rezultatul analizei PCA a separat vinurile organice de cele anorganice.2-1.4 % (wt) H2O. folosesc solvenţi dăunători şi monitorizează doar un parametru la un moment dat. iar LDA a reuşit să clasifice 75%. Autorii aduc la cunoştinţă că spectroscopia MIR combinată cu tehnici chemometrice au permis o discriminare bună între probele produse în sisteme de producţie organică şi anorganică. estimată la circa 5µm [72]. 155 . şi analiza discriminantă liniară (LDA). Consumatorii sunt tot mai interesaţi de produse organice şi sunt dispuşi să plătească un preţ mai mare pentru aceste produse. Cozzolino et al. [71] au fost primii care au folosit tehnologia IR pentru a clasifica vinuri comerciale provenite de la sisteme de producţie organică şi anorganică.atras atenţia asupra limitărilor acestei metode. niciuna dintre ele fiind foarte practică pentru că sunt costisitoare din punct de vedere al timpului necesar efectuării lor şi al setărilor pentru controlul de calitate. Aplicaţii ale spectroscopiei IR în geoştiinţe Concentraţia şi distribuţia apei în rocile vulcanice din Sumisu Caldera şi Vulcanul Torishima din arcul Izu-Bonin (Japonia) au fost studiate de Wysoczanski şi Tani [72]. DPLS a clasificat corect 85% din vinurile organice. valori corespunzătoare cu saturarea apei la presiunile de erupţie. ci mai degrabă mai mulţi compuşi chimici. Metodele tradiţionale pentru autentificarea sucurilor de fructe includ cromatografia sau analiza raportului izotopilor de carbon. 5.2 % (wt) H2O. Masa brută a dacitelor din Sumisu Caldera conţine între 1. inclusiv în procesul de extracţie şi asupra nevoii unui spectru larg de probe pentru a îmbunătăţi repetabilitatea acestui model. incluzând compuşi fenolici volatili şi nevolatili. rezultând o precizie similară şi o rezoluţie spaţială chiar mai bună. iar pentru obsidian 0. Rezultatele au fost comparabile cu cele obţinute prin metoda convenţională bazată pe micro-FTIR. dar a existat o uşoară suprapunere [71]. Industria de vinuri a recunoscut acest trend şi astfel în multe podgorii se pune accentul pe vinuri organice. regresia PLS discriminantă (DPLS). Explorarea rezultatelor analizei PLS nu a desemnat un parametru chimic individual care să fi explicat diferenţierea vinurilor. Aproape 200 de soiuri de vinuri roşii şi albe din 13 regiuni din Australia au fost analizate folosind spectroscopia MIR combinată cu PCA. dar au subliniat că această metodă este o îmbunătăţire reală comparativ cu încercărilor anterioare [70]. care ar contribui la discriminarea vinurilor. În general.

la 3500 cm-1 şi la 3245 cm-1. O microanaliză preliminară a acestor probe a dezvăluit o absorpţie în regiunea 3000-4000 cm-1 datorată vibraţiilor de întindere a apei. Nicoleta E. Krisztian Herman la redactarea acestui material. a fost că imagistica FTIR a distribuţiei apei în leucite reprezintă un instrument valoros în monitorizarea evoluţiei sistemelor magmatice. Pe lângă caracterizarea cristalo-chimică. analiza spectroscopică a CO2 fiind comună în studiul rocilor. dar teste efectuate pe incluziunile de fluide din minerale sunt rare [81]. precum era de aşteptat. în special privind studiile arheologice şi problemele de conservare. conţinutul de CO2 din lazurite a fost propus ca şi indicator al sursei naturale ultramarine de pigmenţi. Mircescu şi Mast. Analiza apei în minerale [79] şi roci [80] cu ajutorul spectroscopiei FTIR este aproape o tehnică de rutină. Mulţumiri pentru suportul acordat de Drd. fiind 3 peak-uri bine definite la 3604 cm-1. Concluzia lui Della Ventura et al. În acest context. Della Ventura et al. Aceste incluziuni determină totodată şi dezvoltarea modelelor restrictive în geneza depozitării minereurilor şi oferă informaţii pentru exploatarea geotermală şi petrolieră în producţia la nivel industrial. Aplicând fluorescenţa de raze X.Este bine cunoscut faptul că mineralele anhidride nominale formate în condiţii de înaltă presiune conţin urme de specii hidride [73-74]. colecţia de imagini obţinute prin scanare a arătat. 156 . Astfel se susţine ideea că o analiză amănunţită a speciilor volatile din minerale poate oferi informaţii cantitative şi calitative privind activitatea apei şi a CO2. fugacitatea oxigenului şi compoziţia fluidelor în sistemele minerale. [76] au studiat un set de cristale leucite transparente atent selecţionate provenind din vulcanul Alban Hills (Roma. Numeroase studii recente au arătat că specii volatile ca şi CO2 şi specii hidride ca şi OH şi H2O pot fi de asemenea încorporate în circumstanţe speciale în majoritatea mineralelor din crustă [75-77]. faptul că acel conţinut de CO2 depinde puternic de faza mineralului [82]. de aceea aceste materiale merită ca toată atenţia. procesele de deformare cât şi a unui “geotermometru” privind rocile din crusta terestră [83]. Italia). De fapt. studiul speciilor volatile în minerale are aplicaţii şi în alte domenii. aceste studii fiind folositoare în determinarea genezei şi a evoluţiei sistemelor magmatice [78]. mineralele au o largă răspândire în istoria rocilor ornamentale sau a pigmenţilor utilizaţi în operele de artă. Studiile care tratează incluziunile de fluide sunt foarte utile în definirea rolului fluidelor în geneza.

Lammerhofer. A. M. B. McNaughton. 7. 2. H. N. Journal of Microscopy-Oxford 215 (2004) 86-91. Edwards and A. Biospectroscopy 2 (1996) 143-153. R. 13. A. A. Lendl. Journal of Chromatography A 1068 (2005) 3-30. B. C. Edelmann. 8. Chiriboga. M. Kolhed. Svasek. L. Vigorita. Journal of Raman Spectroscopy 23 (1992) 641-645. J. F. M. L. A. Talanta 64 (2004) 1127-1146. E. P. C. Sukuta and R. T. Hinsmann. J. Lasers în Surgery and Medicine 24 (1999) 382-388. M. R. W. N. Haberkorn. Analytical Chemistry 74 (2002) 3843-3848. 30. P. G. Karlberg. 27. M.6. Quintas. B. Crowson. S. D. N. Quarterly Reviews of Biophysics 35 (2002) 369-430. Sahu. Jackson. V. Hislop. Z. B. M. Arce. R. Diem. Lendl. Wood. B. Applied Spectroscopy 58 (2004) 662-666. 28.com J. P. 25. Svasek. 21. Journal of Chromatography A 1079 (2005) 24-40. Frank. Zarou. Quinn. C. J. M. Frank. 22. Cancer Research 53 (1993) 762-765. R. P. Applied Spectroscopy 58 (2004) 667-670. R. 5. Analyst 130 (2005) 772-778. Stranc. Sensors and Actuators a-Physical 115 (2004) 591-599. 18. Somsen. Frank. F. B. P. Kuligowski and B. Lewis. Analyst 128 (2003) 2-6. I. 15. Xie. Frank. Dusitsin. 14. Karlberg. Lendl. Surowiec. Schaden. T. Kuligowski. T. http://www. Lendl. 19. Podshyvalov. Beck and J. Sindhuphak. J. K. Kolhed. J. 12. Goldstein and S. Ruzicka. Baena. Laurell. Hinsmann. Biospectroscopy 4 (1998) 47-53. R. Baena and B. Hammody. A. Talanta 67 (2005) 269-279. 4. 157 . Zscherp. Hinsmann. Bruch. Analytical Chemistry 72 (2000) 1645-1648. M. Svasek. 10. 26. M. R. Vellekoop. Pivik and B. A. G. L. Journal of Chromatography A 1080 (2005) 132-139. Righetti. R. Ashdown. S. P. B. Journal of Biomedical Optics 3 (1998) 267-280. Lendl. Gynecologic Oncology 90 (2003) 10-14. Williams. Udomprasertgul. 17. Barnett and S. M. 6. Austria http://daylightsolutions. D. M. Argov. S. W. M. McIntosh. R. Lendl. Faist. J. Karlberg. Godwin. Mantsch. Lendl and B. A. Sindhuphak. D. M. Brinkman. 20. Journal of Chromatography A 934 (2001) 123-128. Barth and C. Gornik and G. W. C. Pilavdzic and A. B. W. Srisookho. H. S. 24. J. W. Lendl. 16. K. Romeo and D. Guterman. Lammerhofer and B. B. H. M. Rigas. Wong. Lucassen. Trojanowicz and B. Frank. Svasek. J. G. Lendl. G. Biospectroscopy 4 (1998) 75-91. Barry. Burden and D. A.com Vienna. Grekin. C. Warakamin. T. 11. Goldstein. 3. Schindler. Karlberg and B. Boonbundarlchai and N. Anastos. Zakim and M. Lendl and B. Quintas and B. B. Journal of Chromatography A 856 (1999) 213-242. J. Kolhed. H. V. Tait. R. V. S. Veen and J. D. S. N. P. T. Yee. 9. Kolhed and B. S. J. Kantarovich. Jansen. Mordechai. Applied Physics B-Lasers and Optics 99 (2010) 833-840. Journal of Investigative Dermatology 112 (1999) 951-956. P. M. Gooijer and U. H.quantared. Nilsson. M. G. Lendl and M. Analytical Chemistry 81 (2009) 3746-3753. Gallignani and M. Mark. Wood. Brunetto. Quinn. G. M. Muller. Schrenk. McNaughton. E. P. Strasser. S. Electrophoresis 24 (2003) 687-692. Issaravanich. A. W. 23. G. Bibliografie 1. M. T. M. P. 29.

Shimizu. J. Salman. S. N. Z. R. S. Diem. J. Wu. M. B. Takeshita. A. A. C. J. J. P. Utzinger. Mordechai. L. Zhang. A. F. S. Proceedings of the SPIE 3918 (2000) 66-77. W. 55. M. P. H. M. P. Chiriboga. Fitzmaurice. Mordechai. Weng. 37. L. Sahu. E. U. S. K. J. T. S. W. A. L. 48. 41. 46.31. Feld. O. J. Shi and J. V. Argov. Journal of Pathology 201 (2003) 99-108. H. Mikhael. Shanks. Senterman. Sun. G. Wang. Fabian. J. Fung. Biospectroscopy 2 (1996) 155-165. X. Chaims and Z. K. 33. L. Hart and M. Ohoshima. D. G. Dovbeshko. Biopolymers 78 (2005) 311-317. 158 . Lacelle. X. Weng. M. H. Strickland. Huang. J. M. Jackson. R. Y. Mantsch. S. Journal of Raman Spectroscopy 33 (2002) 552-563. Goldstein. J. Q. Myles. Z. K. 42. Zelig and S. Vibrational Spectroscopy 27 (2001) 165-173. D. Li. M. Gotou. Yoshida. Z. Dwyer. Biospectroscopy 1 (1995) 141-148. A. 39. T. P. Jackson. Salman. C. Mordechai. Wade. Treado. R. Wong. Manfait and A. 53. Y. Kwiatek. K. N. H. Guan. M. Clarke. E. Li. Xu. 51. C. T. J. L. Sakai. Zakim and M. Choo. 34. Murphy. U. C. K. F. Ling. Lockyer. 49. Ghanbari-Siahkali. Ramesh. S. P. H. N. Miyazaki. 44. G. 38. Biopolymers 75 (2004) 384-392. G. J. Morimoto. N. Gardner. Pizzi. Vickerman. Brown. Andrus. Mahadevan-Jansen. Somorjai. R. F. Haka. Yoshida. 36. Biospectroscopy 1 (1995) 357-364. Mordehai. P. Journal of Raman Spectroscopy 28 (1997) 119-&. 54. El Haj. S. Moriguchi and H. D. E. Science of the Total Environment 204 (1997) 283-287. M. B. A. Y. N. V. Biospectroscopy 4 (1998) 37-46. A. S. Bernshtain. M. Analytical Biochemistry 287 (2000) 218-225. Shafer-Peltier. Yang. Cohen. J. X. Crowe. 45. C. P. Hammody. I. J. R. Sun. Richards-Kortum. Yano. Katayama. Watson. A. M. Levi. Kikuchi. Kegelaer. W. Sato. P. Kobayashi. Y. J. A. X. Yanagisawa and M. H. Biospectroscopy 3 (1997) 281-290. L. Wu. L. I. Zhang. Kruglova and O. G. T. J. Application of FTIR microspectroscopy for the follow-up of childhood leukemia chemotherapy 4491 (2001) 243-250. Biospectroscopy 4 (1998) 55-59. 50. B. Paluszkiewicz and W. 40. I. Argov. Biospectroscopy 1 (1995) 37-45. Malpica. F. Moser and J. X. S. Andrus and R. Technology în Cancer Research & Treatment 5 (2006) 157-167. 56. 43. Z. Lacelle and P. Fung. Wong. R. Redd. Erukhimovitch. Talanta 53 (2000) 233-246. M. H. Y. Biospectroscopy 5 (1999) 117-126. H. Y. S. H. W. Applied Spectroscopy 55 (2001) 955-959. Y. A. Dasari and M. Kline and P. K. American Clinical Laboratory 19 (2000) 20. J. Mantsch. Fukuyama. Analytical Chemistry 67 (1995) 777-783. McCreery and D. L. D. L. G. Nguyen. M. C. E. Gridina. P. Fujioka. X. 47. Mikhael. Xu. D. O. S. Erukhimovitch. Che and W. K. 35. Clinical Chemistry 51 (2005) 346-350. Song. C. F. Huleihel. Frank. D. Hu. Wang and Y. Shohat. Okuyama. 52. V. Scott. Eckel. Yang. Y. S. C. S. N. Zhou and J. Follen and R. Mansfield. Arai and M. S. J. W. Senterman and N. Yang. Y. Xie. Y. Fichtner and H. P. R. Sockalingum. Gazi. Sule-Suso. Zarou. T. Watanabe and H. Kapelushnik C. B. F. Kumaido. Yuasa. Miyan. N. M. Heintzelman. J. Huo. Vigorita. S. H. Huang. 32. M. G. P. S. T. Journal of Molecular Structure 565 (2001) 329-334. Cancer Detection and Prevention 28 (2004) 32-36. J. K. Pashchuk. T. Halliday and H.

P. Journal of Biochemical and Biophysical Methods 50 (2002) 111-121. Smith and I. L. B. Johannsen. D. J. G. Dovbeshko. Skogby. G. Jung. Shirshov. F. S. H. Degtyarenko. Pettit and O. A. Beran and E. Todor and C. Rahim. T. Mossoba. T. 82. Water în natural mantle minerals II: Olivine. 66. A. Rigas. M. K. Ihinger. M. Keppler. Sterner. Repnytska. Infrared and NIR raman spectroscopy în medical microbiology 3257 (1998) 245-257. I. G. 83. Z. Rendiconti Lincei-Scienze Fisiche E Naturali 19 (2008) 141-159. 77. T. Bellatreccia and M. Niehaus. F. R. 73. I. Abu-Id. A. H. I. R. H. T. F. 60. M. Ozen and L. R. Mantsch. Chegel. A. R. 61. A. M. P. Journal of Agricultural and Food Chemistry 55 (2007) 4443-4452. R. J. L. Vibrational Spectroscopy 38 (2005) 229-235. Vibrational Spectroscopy 28 (2002) 103-110. Richter. Della Ventura. Ismail. 76. Hervig and P. R. Johnson. K. M. 67. N. J. G. Physics and Chemistry of Minerals 23 (1996) 319-327. Mordechai. M. Cavallo and M. O. A. B. Suhai. Holdstock. E. Abraham. S. M. 58. B. Elements 1 (2005) 19-24. Piccinini. Knapp-Mohammady. Piccinini. M. A. R. M. Herrmann. Vardin. R. R. D. Claussen. Mineral. 73 (2009) 399-413. Water în Nominally Anhydrous Minerals 62 (2006) 155-167. Piccinini. 65. 80. 59. Journal of Materials Science-Materials în Medicine 5 (1994) 775-778. Journal of Raman Spectroscopy 35 (2004) 939-946. A. P. E. Cynkar and P. T. Jurgensen. Rodig and B. 62. Frezzotti and E. Tani. P. S. G. H. Giusti. Murakami. Brilli. Smith. G. J. Bellatreccia. D. H. M. M. Rigas and P. I. 69. I. Hammody and S. I. McMillan. Sedman and A. Della Ventura. Al-Khaldi. G. Rodriguez-Saona and M. Tryndiak. Trends în Food Science & Technology 16 (2005) 433-441. Cancer Research 52 (1992) 84-88. R. Webster. F. A. Morgello. T. Libowitzky and G. Frimand and S. J. F. K. M. Shimada. Huleihel. E. Mag. 64. M. F. H. S. R. Ramesh. F. Yamada. Nardi. Keppler and S. Wong. Jayakumar. U. Dambergs. 72. H. Goldman and P. A. 70. V. A. C. D. F. V. Physics în Medicine and Biology 48 (2003) 2373-2390. Y. Journal of Volcanology and Geothermal Research 156 (2006) 302-314. Bellatreccia and M. Wong. 71. De Vivo. Libowitzky H. B. Andersen. Della Ventura. Canadian Mineralogist 42 (2004) 1275-1282. 81.57. J. Nieminen. J. V. Jalkanen. S. W. H. Y. Water în Nominally Anhydrous Minerals 62 (2006) 117-154. T. Lima and J. Salzer. 68. Tarumi. T. Arimoto and Y. Joe. Gridina. G. R. Food Chemistry 108 (2008) 742-748. garnet and accessory minerals 62 (2006) 169-191. Nielsen. Lithos 55 (2001) IX-XI. M. Carle and A. Schieber. A. Cozzolino. Burke. Linnen. R. Fry. Rehman. 75. Food Chemistry 116 (2009) 761-765. J. I. J. American Mineralogist 93 (2008) 1538-1544. Wysoczanski and K. Rossman. 63. Erukhimovich. L. M. International Journal of Quantum Chemistry 106 (2006) 1160-1198. 74. R. Wade. Steiner. Jensen. Tamura. Volatiles în Magmas 30 (1994) 67-121. Mauer. Salman. 78. M. 159 . Proceedings of the National Academy of Sciences of the United States of America 87 (1990) 8140-8144. V. He. J. Fugel. Kirkwood. S. F. Biopolymers 67 (2002) 470-486. V. L. M. Solyanik. Bergmann. M. W. Binoy. A. Naumann H. M. C. 79. Tay.

Aparatura disponibilă .......................... dr...... 160 2........ De aceea ele 160 ....................................... Prin absorbţie de radiaţie luminoasă moleculele pot fi excitate prin trecerea unui electron de pe nivelul fundamental pe un nivel excitat........... Consideraţii teoretice................... În starea electronică fundamentală moleculele fluorescente se află într-o configuraţie stabilă... deci nu emit radiaţie de fluorescenţă..................................... se numesc molecule fluorescente sau fluorofori.......................................... Atunci când radiaţia luminoasă ajunge pe o moleculă fluorescentă........ 166 4............................................... Tehnica experimentală ............... 169 6...V................................... Avantajele spectrofluorimetriei ..... Aplicaţii ale spectrofluorimetriei ......... 164 3. Dacă molecula se dezexcită (electronul trece din starea excitată în starea fundamentală) prin emisie de lumină.. Din aceeaşi clasă fac parte şi fosforescenţa şi fosforescenţa întârziată...................... Moleculele fluorescente sunt instabile atunci când se află pe un nivel vibraţional al stării electronice excitate................................................. Bibliografie ........ SPECTROFLUORIMETRUL Spectrofluorimetria Conf................. molecula dezexcitându-se............................ Consideraţii teoretice Fluorescenţa este un fenomen de fotoluminiscenţă (procesul prin care substanţele absorb lumină şi după aceea reemit lumină cu o lungime de undă diferită). Energia stării excitate nu poate fi menţinută decât o perioadă foarte scurtă.............. Dana Maniu Cuprins 1.......... Moleculele care au această proprietate......................... aceasta poate trece într-o stare electronică excitată (cu energie mai mare) în urma absorbţiei de energie de la radiaţia luminoasă..... 171 1...... procesul se numeşte fluorescenţă... 166 5.. Există o mulţime de nivele vibraţionale ale stării electronice excitate pe care se poate afla o moleculă fluorescentă................................. Energia acestor nivele depinde de energia (lungimea de undă) radiaţiei luminoase care produce excitarea................

De fapt. Acest proces este numit “photobleaching“. O tranziţie triplet-singlet este mult mai puţin probabilă decât o tranziţie singlet-singlet. care este semi-stabilă. moleculele fluorescente trec din stare electronică excitată în stare electronică fundamentală. Acest proces se poate observa la atomii grei (Br. Radiaţia luminoasă de fluorescenţă are energie mai mică decât radiaţia luminoasă absorbită de moleculă. pot trece în prima stare de triplet (T1). Această proprietate face ca fluorescenţa să fie o tehnică foarte senzitivă (chiar şi o mică cantitate de substanţă poate fi detectată).10-11 s). relaxarea vibraţională se face prin pierderea de energie în urma ciocnirilor dintre molecule (10-14 . deoarece înseamnă că o moleculă poate emite radiaţie de fluorescenţă de mai multe ori.moleculele aflate în starea de triplet pot să se dezexcite prin emisia unui foton.trec în cea mai joasă stare electronică excitată. sunt posibile următoarele procese (ilustrate în figura 1): . ceea ce face posibilă degradarea ei. care să excite molecula. De obicei fosforescenţa apare doar la temperaturi scăzute sau în medii cu vâscozitate mare (dezexcitatea nivelului T1 se poate face şi prin conversie internă sau alte procese neradiative). După acest interval. procesul de fluorescenţă este ciclic şi are loc atâta timp cât există o radiaţie luminoasă. Acest fapt este deosebit de util.conversia internă (IC) . excesul de energie dintre cele două stări regăsindu-se în energia radiaţiei luminoase emise în procesul de dezexcitare. . În realitate. stare de singlet (S1).fosforescenţa . 161 . deci emisia de fosforescenţă poate continua şi după încetarea iradierii iniţiale. Molecula fluorescentă poate absorbi energie luminoasă din nou. Timpul de viaţă a unei stări excitate de triplet poate ajunge până la 10 s. pierderea de energie este neradiativă. astfel încât aceasta să nu mai emită radiaţie de fluorescenţă. În urma absorbţiei unui foton de către o moleculă. O radiaţie luminoasă de mare intensitate poate provoca modificarea structurii moleculei fluorescente. deci procesul descris mai sus poate fi repetat. I) sau la metale.unele molecule aflate în prima stare electronică excitată. moleculele fluorescente sunt instabile structural în intervalul de timp cât se află în stare de excitaţie (timpul de viaţă). .intersystem crossing (ISC) . Deci lungimea de undă a radiaţiei emise este totdeauna mai mare decât lungimea de undă a radiaţiei absorbite datorită energiei pierdute de moleculă în timpul trecerii pe cea mai joasă stare electronică excitată. făcându-se prin ciocnirea cu alte molecule. Intervalul de timp în care o moleculă fluorescentă se află în stare excitată se numeşte “timp de viaţă“ şi are o valoare foarte mică (între 10-15 şi 10-9 s).moleculele aflate pe diferite nivele vibraţionale se relaxează pe nivelul fundamental al stării electronice respective.

. moleculele fluorescente au spectre de absorbţie şi de fluorescenţă caracteristice. Diagrama Perrin-Jablonski. valoarea maximă fiind 1. 162 . Fluorescenţa observată cu ajutorul spectrofluorimetrelor este cunoscută ca Fluorescenţa de tip Stokes. Majoritatea moleculelor nu sunt fluorescente deoarece starea excitată S1 se suprapune cu nivelele vibraţionale ale stării fundamentale S0. Lumina emisă are totdeauna lungime de undă mai mare decât lumina absorbită (figura 2). este proprietatea moleculelor de a emite radiaţie electromagnetică la trecerea de pe prima stare excitată de singlet S1 pe un nivel vibraţional al stării electronice fundamentale S0. De aceea. Fluorescenţa se poate măsura cu ajutorul eficienţei cuantice Q (randament cuantic): Q = (numărul de fotoni emişi) / (numărul de fotoni absorbiţi) Q are o valoare fixă pentru fiecare moleculă (pentru aceleaşi condiţii).fluorescenţa. În acest caz relaxarea vibraţională este mai rapidă decât relaxarea prin fluorescenţă.Figura 1. Fluorescenţa de tip Stokes reprezintă emisia de fotoni cu lungime de undă mai mare (frecvenţă mai mică) de către o moleculă ce a absorbit fotoni cu o lungime de undă mai mică (frecvenţă mai mare). Atât absorbţia cât şi emisia de fluorescenţă sunt unice pentru fiecare moleculă. Fluorescenţa poate să apară doar în timpul absorbţiei (timpul de viaţă a unei stări excitate de singlet este între 10-9 şi 10-15 s).

atunci printr-o simplă înlocuire se obţine legea fluorescenţei: F = K' I0 (1 .10-εbc) Figura 3. Intensitatea radiaţiei fluorescente este proporţională cu intensitatea radiaţiei absorbită de o moleculă fluorescentă: F = K'(I0-I) unde I0 este intensitatea radiaţiei incidente pe probă.Figura 2. I este intenstitatea radiaţiei după ce a traversat un strat de substanţă de lungime b. Dacă ţinem cont de legea Beer: I/I0 = 10-εbc . iar K' este o constantă ce depinde de condiţiile experimentale şi de eficienţa cuantică a fluorescenţei. Curba de calibrare 163 . Spectru de fluorescenţă (emisie) şi de absorbţie (excitaţie) caracteristic. unde A = bcε este absorbanţa.

Tehnica experimentală Pentru a măsura fluorescenţa există două tipuri de instrumente: fluorimetre şi spectrofluorimetre.3 ⋅ ε ⋅ b ⋅ c)3 − ..3·K'·ε·b·c·I0 Relaţia de mai sus ne arată ca pentru concentraţii suficient de mici intensitatea de fluorescentă este proporţională cu concentraţia şi cu intensitatea radiaţiei excitatoare la frecvenţa de absorbţie. Părţile principale ale unui spectrofluorimetru sunt: sursa. unul pentru lumina excitatoare şi unul pentru radiaţia de fluorescenţă emisă. Spectrofluorimetrele folosesc două monocromatoare.05) termenii de ordin superior pot fi consideraţi nuli. monocromator al radiaţiei emise. Avantajul spectrofluorimetrelor este faptul că permit variaţia controlată a lungimii de undă a radiaţiei excitatoare.Spre deosebire de legea Beer. avem: ⎡ (2. Dacă folosim o descompunere în serie Taylor. Fluorimetrele se folosesc pentru măsurători cantitative pentru compuşi specifici (măsurători de rutină). Radiaţia emisă este colectată la un 164 .. camera probei. iar celalalt analizează lungimea de undă a radiaţiei de fluorescenţă (emise). monocromator a radiaţiei excitatoare. Primul monocromator analizează lungimea de undă a radiaţiei excitatoare. intensitatea radiaţiei de fluorescenţă nu depinde liniar de concentraţie. orice spectrofluorimetru modern este interfaţat cu un computer cu ajutorul căruia se setează parametrii de măsurare. Semnalul detectat poate fi reprezentat în funcţie de cele două lungimi de undă sau numai în funcţie de una din cele două lungimi de undă. deci putem scrie: F = 2. proprietăţile fluorescente ale probei pot fi scanate pentru un domeniu larg de lungimi de undă ale radiaţiei excitatoare (200-1000 nm). Pentru o concentraţie mai mare decât c1 curba de calibrare nu mai este liniară. detector (figura 4). se înregistrează şi se prelucrează datele.3 ⋅ ε ⋅ b ⋅ c − ⎥ 2! 2! ⎣ ⎦ Dacă εbc are o valoare suficient de mică (< 0.⎤ F = K ' I 0 ⎢2. Un fluorimetru măsoară abilitatea unei probe de a absorbi lumină la o anumită lungime de undă şi de a emite lumină la o lungime de undă mai mare.. Bineînţeles.3 ⋅ ε ⋅ b ⋅ c)2 + (2. Astfel. 2.

Atât intensitatea luminoasă a radiaţiei incidente. Fanta de intrare este ajustabilă continuu (cu ajutorul soft-ului) pentru a se asigura maximul de rezoluţie şi reproductibilitate. Lumina emisă de probă este focalizată pe fanta de intrare al celui de-al doilea monocromator. Deoarece radiaţia de fluorescenţă are totdeauna lungime de undă mai mare decât radiaţia excitatoare. Astfel radiaţia luminoasă incidentă pe probă poate să aibă lungime de undă fixă pentru tot timpul măsurătorii. sau poate să se modifice continuu pe tot domeniul de emisie al sursei. sau pentru controlarea temperaturii probei. Primul monocromator descompune radiaţia excitatoare în culorile componente. elementul dispersiv al celui de-al doilea monocromator este astfel conceput încât să aibă maximul de eficienţă în domeniul vizibil. pentru a permite instalarea diferitelor accesorii pentru probe solide. Schema bloc pentru un spectrofluorimetru Sursa unui spectrofluorimetru emite în domeniul UV şi vizibil (de obicei se folosesc lămpi cu Xenon). 165 . lichide şi gazoase. Lumina emisă de sursă este focalizată pe fanta de intrare a primului monocromator cu ajutorul unei oglinzi sferice sau eliptice. Camera probei este de obicei destul de spaţioasă. Prin fanta de ieşire a monocromatorului radiaţiei excitatoare iese lumină cu lungimea de undă dorită. cât şi lungimea de undă a acesteia este monitorizată şi controlată cu ajutorul unui fotodetector suplimentar situat între monocromator şi camera probei. Detectorul este poziţionat la ieşirea din cel de-al doilea monocromator. sursă monocromator detector probă monocromator Figura 4. Acesta descompune radiaţia de fluorescenţă emisă de probă în culorile componente.unghi de 90° faţă de radiaţia excitatoare pentru a preveni orice interferenţă între radiaţia excitatoare şi cea emisă.

3.) folosind probe foarte mici. studiile pot fi efectuate în soluţii apoase fără a fi nevoie ca probele să fie tratate. 4. Specificitatea: Spectrofotometrele măsoară doar lumina absorbită. Spectrofluorometrele au o specificiate ridicată şi apar mult mai puţine probleme de interferenţă deoarece substanţele fluorescente pot fi incluse în solvenţi sau matrici care nu sunt fluorescente. Fluorimetria poate fi folosită pe un domeniu mare de concentraţii fără a fi nevoie de diluţia eşantioanelor sau de modificarea celulei în care se pune eşantionul. Aplicaţii ale spectrofluorimetriei Medicină şi farmacologie Sensitivitatea deosebită a spectroscopiei de fluorescenţă. Fluorescenţa oferă informaţii asupra dinamicii. face ca această tehnică să fie folosită atât pentru cercetări avansate cât şi pentru analize de rutină sau controlul calităţii în domeniile farmaciei şi medicinii. Tehnicile spectrofotometrice au probleme de interferenţă deoarece multe materiale absorb lumina. De asemenea. Astfel. vi166 . sau chiar dacă au fluorescentă este puţin probabil ca două substanţe să absoarbă şi să emită radiaţie de fluorescenţă în acelaşi domeniu. Această extraordinară senzitivitate permite detecţia sigură a substanţelor fluorescente (clorofilă. hidrocarburi aromatice. Avantajele spectrofluorimetriei Senzitivitatea: Limitele de detecţie depind în mare măsură de proprietăţile probei de măsurat. prin intermediul computerului se pot seta toţi parametri necesari derulării diferitelor tipuri de măsurători. ceea ce face dificil izolarea semnalului de la materialul de analizat din matricea în care se află. Senzitivitatea şi specificitatea mare a acestei tehnici reduce sau chiar elimină procedurile de preparare a probelor. Domeniu de concentraţie: Intensitatea semnalului de fluorescenţă este direct proporţional cu concentraţia substanţei fuorescente pe un domeniu larg. rigidităţii şi structurii proteinelor. Pentru multe substanţe fluorescente este obişnuită o limită de detecţie de părţi/miliard sau chiar părţi/triliard.Toate spectrofluorimetrele moderne sunt controlate de computer. Datele obţinute în urma măsurătorilor efectuate se pot prelucra cu ajutorul programelor speciale. etc. Viteză şi simplitate: spectrofluorimetria este o tehnică analitică relativ simplă. Spectrofluorimetrele au limite de detecţie mult mai bune decât spectrofotometrele.

momentul de dipol al stării excitate .efectul temperaturii .timpul de viaţă şi randamentul cuantic . Chimia analitică În chimia analitică se studiază spectrele de luminescenţă precum şi eficienţa cuantică a speciilor flourescente în funcţie de matriţa în care sunt puse. Prin determinări de fluorescenţă pot fi determinate: . emisie.ruşilor. etc. Calitatea ambalajelor este de asemenea importantă atât ca membrană protectoare împotriva oxidării alimentelor cât şi datorită faptului că sunt o posibilă sursă de contaminare cu urme de plastic sau de polimeri. microorganisme. Spectrele de fluorescenţă 3D pot fi folosite ca o amprentă unică care duce la identificarea calitativă a compuşilor. Culturile de bacterii ce pot să apară pe alimente sunt distructive şi periculoase datorită potenţialului de contaminare şi îmbolnăvire pe care îl au. mutageni sau substanţe canceroase. pot fi elaborate metode şi teste de rutină pentru analizele de laboratoar. Cu ajutorul fluorescenţei se poate identifica prezenţa unui număr foarte mare de analiţi chiar dacă aceştia sunt în cantităţi foarte mici (sub picomolar). După ce sunt determinate caracteristicile de bază (excitaţie. Deoarece probele preluate din mediul înconjurător sunt deosebit de complexe. Fluores167 . fapt ce are deosebite aplicaţii în imunologie. randament cuantic) ale unei substanţe fluorescente. şi chiar pesticide utilizate în mod normal pentru a preveni răspândirea unor boli. a apei şi a solului prin detectarea urmelor de substanţe organice sau inorganice. AND-ului.efectul general de solvent .efectul prezenţei atomilor grei . De asemenea măsurătorile de fluorescenţă 3D sunt folosite pentru determinarea surselor geologice a diferitelor eşantioane de petrol. Pentru a asigura calitatea produselor alimentare. mucegaiuri. toxine. creşterea termenului de garanţie precum şi a calităţii ambalajelor. producătorii trebuie să identifice contaminanţi.reacţia la diferite suprafeţe Industria alimentară şi agricultura În industria alimentară este importantă îmbunătăţirea calităţii nutriţionale a alimentelor. Mediul înconjurător Cu ajutorul fluorescenţei se poate monitoriza calitatea aerului. pentru detectarea diferitelor substanţe sunt necesare tehnici de mare senzitivitate şi selectivitate care să evite multiplele surse de interferenţă.

168 . . . vitaminelor. a plascticelor. Aceştia pot fi caracterizaţi cu ajutorul spectrelor de fluorescenţă de excitaţie şi de emisie. carotenoide. şi a altor substanţe biologice. Biologie celulară În studiul proceselor biologice sunt implicaţi o largă varietate de markeri fluorescenţi. De asemenea. a polimerilor. hormonilor. pentru analiza medicamentelor. Industrie Producătorii folosesc fluorescenţa pentru a monitoriza calitatea vopselelor. emolientele pe bază de lipide şi cremele anti-rid. Aplicaţiile fotochimice ale fluorescenţei includ: . Una din tehnicile cele mai folosite în acest domeniu este determinarea raportului dintre intensităţile semnalului de fluorescenţă emis de markerul folosit la diferite lungimi de undă. Fabricanţii de instrumentar medical şi clinic studiază sistemele invazive pe bază de fibre optice (ce pot fi introduse în interiorul arterelor sau a altor orificii).capturează energie luminoasă şi o foloseşte pentru a transfera protoni în exteriorul celulei). tehnică mai avantajoasă decât cea clasică în care se măsoară intensitatea absolută de fluorescenţă la o singură lungime de undă. etc). înălbitorilor optici şi suprafeţelor fosforescente.cenţa poate fi folosită şi în determinarea randamentului şi calităţii anumitor culturi în urma aplicării fertilizatorilor.caracterizarea substanţelor fotoreceptoare (flavine. . identificarea şi controlul tumorilor. fluorescenţa este folosită ca instrument de cercetare în domeniul biotehnologiilor. . Companiile de cosmetice şi produse pentru îngrijirea sănătăţii evaluează eficacitatea unor noi produse cum ar fi loţiunile pentru protecţie solară.conversia biologică de energie în fotosinteza plantelor verzi.mecanismul molecular de transfer prin membrana de proteină a bacteriorhodopsinei (o membrană integrală de proteină care acţionează ca o pompă de protoni .folosirea "quantum dots"-urilor ca probe biologice în diagnosticarea cancerului şi studierea ţesuturilor. proteinelor.terapia fotodinamică .o tehnică pentru localizarea. Fotochimie Mecanismul absorbţiei luminii precum şi proprietăţile fotofizice ale unei substanţe determină rolul său în procesele biologice şi chimice.

precum şi cu suporturi pentru diferite tipuri de probe (solide. . atât ca lăţime cât şi ca înălţime. Calibrarea spectrofluorimetrului se face cu ajutorul kit-ului inclus ce utilizează ca probă standard Rodamina B.determinarea spectrului de fluorescenţă a unei probe.rezoluţia monocromatoarelor este de 1 nm.măsurători la lungimi de undă fixă. 169 . . lichide şi gazoase).acurateţea lungimii de undă este ±2 nm pentru ambele monocromatoare.viteza de scanare este între 20 şi 10. Cele două monocromatoare sunt echipate cu reţele de difracţie holografice concave (1500 trăsături/mm) cu unghi de "blaze" optimizat. Fantele monocromatoarelor au dimensiuni reglabile. . Aparatura disponibilă Spectrofluorimetru Jasco FP 6500 Spectrofluorimetrul Jasco 6500 are următoarele caracteristici: Sursa este o lampă cu xenon de 150 W dotată cu un fotomultiplicator ce monitorizează şi compensează orice variaţie în intensitate asigurându-se astfel maximul de stabilitate. . . ceea ce asigură maxim de senzitivitate pe întregul domeniu de lungimi de undă (200-850 nm).determinarea spectrului de fosforescenţă a unei probe. Alte caracteristici ale spectrofluorimetrului Jasco FP 6500 sunt: . Cu ajutorul spectrofluorimetrului Jasco 6500 pot fi efectuate următoarele tipuri de măsurători: .determinarea stabilităţii intensităţii de fluorescenţă în timp.măsurători de cinetică. . . .5. .000 nm/ min pentru ambele monocromatoare.determinarea concentraţiei de substanţă fluorescentă (analiză cantitativă).măsurători 3D de fluorescenţă.determinarea timpului de viaţă în cazul probelor fosforescente. Spectrofluorimetrul este echipat cu accesorii pentru modificarea controlată a temperaturi probei şi pentru polarizarea luminii incidente. .raportul semnal .zgomot este 200:1 sau mai mare.

Controlul acestor măsurători se face folosind programul "Spectra manager" Modul "Quantitative analysis": pentru a efectua o analiză cantitativă trebuie trasată o curbă de calibrare. Astfel. fie pe emisie. 170 . fapt deosebit de util pentru probe necunoscute. Se obţin spectre tridimensionale (pe o axă este reprezentată intensitatea semnalului de fluorescenţă şi pe celelalte două axe avem lungimea de undă de excitaţie. selectabile fie pe excitaţie. respectiv de emisie. Se pot face spectre de excitaţie sau de emisie. Modul "3D Fluorescence measurements" permite măsurarea în acelaşi timp a (i) spectrului de fluorescenţă a unei probe în timp ce se modifică lungimea de undă a radiaţiei excitatoare şi (ii) măsurarea spectrului de excitaţie în timp ce se modifică lungimea de undă de emisie. Se face citirea la o lungime de undă selectabilă într-un interval de timp selectabil. se pot face spectre pe tot domeniul sau pe un domeniu selectat de utilizator. Modul "Time course measurement" permite verificarea stabilităţii în timp a intensităţii fluorescenţei soluţiilor.) Analiza acestor spectre permite determinarea poziţiei maximului de excitaţie şi de emisie. Modul "Spectrum measurement" permite măsurarea fluorescenţei probelor prin scanare de spectru. Modul "Fixed wavelength measurement" permite efectuarea măsurării fluorescenţei probelor la maxim 4 lungimi de undă simultan. Această acţiune presupune măsurarea soluţiilor etalon. construirea şi stocarea curbei de calibrare. Rezultatele măsurătorilor probelor de concentraţie necunoscută vor fi date în unitatea de măsură de concentraţie în care a fost construită curba de calibrare. la viteze diferite de scanare.

2002 Joseph Lakowicz. Principles of Fluorescence Spectroscopy. Springer. Molecular Fluorescence: Principles and Applications. Ed.com/Products/Spectroscopy/FP-6000-Series-Spectrophotom eters. 2006 http://www.aspx 171 . 3. Bernard Valeur. Bibliografie 1. Wiley-VCH. spectrum measurement" permite măsurarea spectrului de fosforescenţă al probelor. Ed. 2.jascoinc.Modul "Phospho. 6.

...... Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului ............ 190 1...... 176 2........................ ........... Fluorescenţa în timp real furnizează mai multe informaţii despre moleculele ce se află în imediata vecinătate a fluoroforului............ Microscopia de fluorescenţă avansată ....................................................................... 180 3............1..... Bibliografie ........2...................... pentru a obţine informaţii chimice mai amănunţite trebuie determinată variaţia în timp a fluorescenţei.................................... 174 2................3.........................3........... în urma modificărilor de temperatură şi pH.... Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur........ spectroscopia de fluorescenţă în timp real poate fi utilizată pentru a investiga aceste procese şi a obţine informaţii despre vecinătatea chimică a fluoroforului.......... 187 4........... Multe evenimente macromoleculare....................................... determinarea acestui timp de viaţă este deosebit de util în determinarea stării fluoroforului............... 175 2....... apar pe aceeaşi scară temporală cu emisia de fluorescenţă.. 180 3................................ Fluorescenţa în timp real Deşi măsurătorile normale de fluorescenţă pot fi folosite ca o sondă non-invazivă extrem de selectivă şi sensibilă....................... Este important să ne amintim că timpul de viaţă de fluorescenţă este timpul mediu pentru ca o moleculă să rămână în stare excitată înainte de a emite un foton......... 172 2.. Exemple de aplicaţii ale spectrofluorimetriei ................ Astfel.......................... Fluorescenţa în timp real .... Deoarece timpul de viaţă de fluorescenţă a unei molecule este foarte sensibil la vecinătatea sa moleculară........ dr...2........... cum ar fi difuzia rotaţională.. Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) ........................ Fiecare moleculă individuală emite aleatoriu după excitaţie........... Unele molecule excitate vor emite radiaţie de fluorescenţă înainte de durata 172 ........ transferul rezonant de energie şi stingerea dinamică..... Dana Maniu Cuprins 1.................... Determinarea interacţiunii dintre albumina bovină şi nanoparticule de aur .. Microscopia confocală de fluorescenţă ......................... 178 3.............................................aplicaţii Conf............. Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) ..........................................................Spectrofluorimetria ................1................. 184 3...............................

iar pulsul de frecvenţă ω2 este focalizat pe probă (flow cell). cristalele neliniare sunt confecţionate din potasiu-dihidrogen-fosfat (KDP) sau borat de bariu (BBO). 173 . de ordinul 1-10 ns. În figura 1 este prezentat un montaj experimental folosit pentru determinări de fluorescenţă în timp real. numai pentru un domeniu îngust din spectrul de fluorescenţă apare coincidenţa temporală şi spaţială cu pulsul de frecvenţă. Intensitatea Isum a pulsului cu frecvenţa ωsum pentru un anumit decalaj temporar între pulsul de frecvenţă ω1 şi emisia de fluorescenţă de frecvenţă ωfl este proporţională cu funcţia de corelaţie dintre intensitatea de fluorescenţă Ifl şi intensitatea I1 a pulsului de frecvenţă ω1: I sum (τ ) ≈ ∫ I fl (t ) I1 (t − τ )dt −∞ ∞ În acest fel se poate determina dependenţa intensităţii de fluorescenţă de timp prin modificarea timpului de întârziere (prin intermediul dispozitivului "optical delay line"). Armonica a doua a acestui puls (frecvenţa ω2) este generat într-un cristal neliniar. fiind separat de fundamentală cu ajutorul unui divizor de undă dicroic. Pentru o poziţie dată a cristalului. Din această cauză este foarte important ca aparatura experimentală folosită pentru acest tip de masurători să aibă rezoluţie temporală foarte bună. Timpii de viaţă de fluorescenţă sunt. deşi în unele cazuri pot avea ordinul sutelor de nanosecunde sau să fie mai mici decat 1 ns (sute de femtosecunde). De obicei. iar alte molecule excitate vor emite radiaţie de fluorescenţă mult timp după durata medie de viaţă. Cu cât este mai mare decalajul temporar dintre pulsul ω1 şi emisia de fluorescenţă ωfl. Deci dacă interesează întreg domeniu de fluorescenţă. O sursă laser emite un puls ultra scurt (de ordinul femtosecundelor) cu lungimea de undă λ1 corespunzătoare frecvenţei ω1. Această mixare ("fluorescence up-conversion") generează lumină cu frecvenţa ωsum = ω1 + ωfl . cristalul trebuie rotit la diferite unghiuri. cu atât intensitatea de fluorescenţă este mai mică.medie de viaţă. Cristalele din borat de bariu au avantajul transparenţei în UV şi eficienţei cuantice mai mare (cu un factor de 4-6). în general. Emisia de fluorescenţă incoerentă emisă de probă este colectată şi mixată cu pulsul de frecvenţă ω1 într-un cristal neliniar. Pulsul de frecvenţă ω1 trece printr-un dispozitiv optic ce produce o întârziere de fază (optical delay line). ceea ce ne demonstrează că există o coincidenţă temporală şi spaţială între ω1 şi ωfl.

2.fotomultiplicator. proton transfer etc. în principal. proteina albastră fluorescentă.coupled device). colorarea fibrelor etc. 2001). GG420 . fluorescenţa în timp real a fost folosită cu succes în studii ale proceselor biologice care au loc în prezenţa luminii (proteina galbenă fotoactivă. Observarea emisiei de fluorescenţă poate fi efectuată cu ajutorul ochiului observatorului. HW . (DM .numărător) Măsurătorile de fluorescenţă în timp real sunt foarte potrivite pentru investigarea proceselor intramoleculare fotoinduse (charge transfer.placă semi-undă. Set-up experimental pentru fluorescenţă în timp real (Mialocq and Gustavsson.oglindă dicroică. Lungimea de undă de excitaţie este selectată cu ajutorul unui filtru de interferenţă sau a unui monocromator.). CCD . PM . Microscopia de fluorescenţă avansată Microscopia de fluorescenţă convenţională este folosită. M .). pentru a investiga celulele şi ţesuturile vii. 174 . a unui film fotografic sau a unei camere cu detector CCD (charge. De asemenea.Figura 1. proteina verde fotoactivă etc. dar este de asemenea folosită pentru a studia diferite sisteme chimice cum ar fi coloizi. lockin . fotodegradarea polimerilor naturali.cameră video. iar rezoluţia maximă este aproximativ egală cu jumatatea lungimii de undă a radiaţiei folosite la excitare. Un microscop de fluorescenţă convenţional diferă de un microscop standard prin faptul că este folosită o sursă de lumină (lampă cu mercur sau oxigen) ce emite şi în domeniu UV. cristale lichide. BBO -cristal neliniar.) şi a proceselor intermoleculare (elctron transfer etc.monochromator. Profunzimea de câmp a unui microscop convenţional cu fluorescenţă este 2-3 µm.filtru. mixturi polimerice.

De asemenea.5 µm. În acest caz imaginea se poate îmbunătăţi cu ajutorul computerului. Deoarece în microscopia confocală de fluorescenţă se colectează numai 175 . Microscopia confocală de fluorescenţă În cazul unui microscop confocal.În cazul în care proba este mai subţire decît valoarea profunzimii de câmp. Astfel. grosimea secţiunilor confocale poate atinge limita teoretică de aproximativ 0. este de preferat folosirea altor tehnici. Emisia de fluorescenţă este separată de lumina excitatoare cu ajutorul unei oglinzi dicroice şi este focalizată cu ajutorul lentilelor obiectivului pe fanta unui fotomultiplicator. Figura 2.1. dar. de obicei. Principiul microscopiei confocale (stânga) comparativ cu microscopia convenţională (dreapta). cum ar fi microscopia confocală (confocal microscopy) sau microscopia prin excitaţia cu doi fotoni (two-photon excitation microscopy). Emisia de fluorescentă produsă de proba situată în afara planului de focalizare nu va trece prin fanta multiplicatorului deoarece se va lovi de tubul ocularului (figura 2). 2. deci prin deplasarea probei pe verticală se obţine imaginea tridimensională a acesteia. Una din caracteristicile microscopiei confocale de fluorescenţă este faptul că se pot obţine imaginile unor straturi cu o grosime bine definită. imaginea este neclară datorită defocalizării. prin folosirea microscopiei optice în câmp apropiat (near-field scanning optical microscopy (NSOM)) se poate lucra dincolo de limita de difracţie optică. fasciculul de lumină este focalizat pe probă. folosind o lentilă cu apertură numerică mare.

). Reducerea efectelor nedorite datorate fenomenului de photobleaching se face prin utilizarea de fluorofori stabili şi prin folosirea unui microscop confocal echipat cu detector cu sensibilitate mare şi obiectiv cu apertură numerică mare. posibilă prin absorbţia simultană a doi fotoni de energie mai mică (lungime de undă mai mare) prin intermediul unei stări virtuale cu timp de viaţă foarte scurt (Figura 3). Secţiunea eficace a procesului de absorbţie a doi fotoni este foarte mică (10-50 cm4·s/foton·moleculă pentu rodamina B). fenomen numit photobleaching. Excitaţia fluoroforului este. a cristalelor lichide şi a amestecurilor de polimeri. Excitaţia cu doi fotoni este un proces neliniar. fluoroforul este excitat prin absorbţia unui foton a cărui energie corespunde cu diferenţa de energie dintre starea electronică fundamentală şi starea electronică excitată. de asemenea. Creşterea energiei fasciculului de excitare duce la descompunere fotochimică a fluoroforului. microscopia confocală de fluorescenţă a fost folosită în studii din domeniul coloizilor. Probabilitatea absorbţiei a doi fotoni depinde de coincidenţa temporală şi spaţială a fotonilor incidenţi (diferenţa dintre timpul în care cei doi fotoni ajung la fluorofor trebuie să fie sub 10-18 s). De exemplu. energia de excitare necesară trebuie să fie mai mare decât în microscopia de fluorescenţă convenţională. Dacă este folosit un singur laser. imagistica Ca2+. 2. imagistica pH. Microscopia confocală de fluorescenţă este o tehnică utilizată pe scară largă în biologia celulară (vizualizarea celulelor. atunci fotonii sunt diferiţi (1/λe = 1/λ1 + 1/λ2).o parte din fasciculul de fluorescenţă emis. cei doi fotoni absorbiţi sunt identici. De asemenea. determinarea distribuţiei potenţialului electric. În consecinţă. iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu două culori (two-color excitation fluorescence microscopy). pentru a putea folosi unui fascicul excitator cu putere mai mică. Dacă se folosesc două lasere. absorbţia depinde de pătratul intensităţii luminii folosite la excitaţie. Microscopia confocală de fluorescenţă poate fi combinată cu tehnicile domeniu-timp şi frecvenţă-timp (time-domain.2. Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) În spectroscopia de fluorescenţă convenţională. iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy). absorbţia a doi fotoni din domeniul roşu poate excita o moleculă care absoarbe în domeniul UV. frequency-domain) pentru a se obţine imagini din perioada numită timp de viaţă al fluoroforului (lifetime imaging). vor fi excitaţi numai fluoroforii situaţi într-o 176 . etc.

(Linia punctată reprezintă starea virtuală care mediază absorbţia a doi fotoni. 177 . Volumul de excitaţie este de ordinul a 0. în ambele tipuri de excitari (cu doi fotoni sau cu două culori). Folosind un obiectiv cu o apertură numerică de 1. în cazul excitării cu doi fotoni avem următoarele avantaje: (i) deoarece fasciculul de excitare este concentrat atât în timp cât şi în spaţiu nu apare fenomenul de photobleaching în afara focarului şi (ii) fasciculul excitator nu este atenuat de abosorbţia din afara focarului. ceea ce duce la obţinerea unui contrast mai bun pentru obiecte de mici dimensiuni. deci trebuie folosiţi laseri cu putere mare şi funcţionare în impulsuri. Deci.regiune unde fluxul de fotoni este foarte mare. Comparaţie între excitaţia cu doi fotoni şi excitaţia cu un foton. ceea ce duce la creşterea adâncimii de penetrare a fasciculului excitator. Deşi. acesta reprezintă o reducere a volumului de excitare de 1010 ori. peste 80% din intensitatea totală de fluorescenţă va fi emisă dintr-o zonă situată la 1 mm în jurul focarului. Excitarea cu două culori se foloseşte atunci când se doreşte observarea unor obiecte microscopice situate în medii puternic difuzante.) Deoarece intensitatea fasciculului de excitare variază cu pătratul distanţei de la planul focal. în cazul excitarii cu două culori nu apare decât o creştere minimală a background-ului de fluorescenţă. Excitarea cu doi fotoni permite obţinerea unei rezoluţii tridimensională deosebită în microscopia de fluorescenţă.1-1 femptolitri. nedorit.25 şi un fascicul de excitare având 780 nm. cum ar fi laserul cu Ti-safir. Comparativ cu fluorometrele convenţionale. fenomenul de difuzie duce la scăderea intensităţii fasciculului de fluorescenţă emis din focar. Deşi efectul secţionării 3-D este comparabil cu cel din microscopia confocală. excitarea cu doi fotoni a fluoroforului poate avea loc doar în focar. Figura 3. probabilitatea de absorbţie a doi fotoni în afara regiunii focale scade cu puterea a patra a distanţei.

Majoritatea instrumentelor NSOM sunt construite în jurul unui microscop cu fluorescenţă inversat. Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) Rezoluţia unui microcop convenţional este limitată datorită fenomenelor de interferenţă şi difracţie. Suprafaţa probei este poziţionată în imediata apropiere a fantei.axa Oz). unde λ este lungimea de undă a sursei de luminii. Vârful este montat într-un cap piezo. H. Fanta acţionează ca o sondă luminoasă de dimensiune sub-lungime de undă care poate fi folosită pentru a lumina suprafaţa probei înainte ca lumina să fie difractată. Lumina din vârful NSOM ataşat fibrei optice excită proba. Fasciculul laser trece printr-o fibră optică uni-modală la ataşată de un vârf special pentru determinările în câmp apropiat (vârf NSOM). de tip NSOM (Figura 5). iar emisia de fluorescenţă este colectată de obiectivul cu apertură numerică mare. Synge (figura 4).3. montat sub suportul pe care se află proba şi detec178 .2. Figura 4. Această tehnică are o rezoluţie spaţială foarte mare (de ordinal sub-micrometrilor) şi o sensibilitate foarte bună. care oferă avantajul de a furniza imagini normale şi permite ca regiunea de studiat să fie localizată cu rezoluţie mare. astfel încât fasciculul emergent este forţat să interacţioneze cu proba. care permite deplasarea pe verticală . Principiul scanării în câmp apropiat (conform ideii lui Synge) Ideea de optică în "câmp apropiat" este atribuită cercetătorului E. care permite deplasarea ei în planul xy. Limita de rezoluţie este de aproximativ λ/2. Această limită poate fi depăşită prin utilizarea unei surse de lumină cu lungime de undă mai mică şi prin plasarea probei foarte aproape de această sursă (în câmp apropiat). Radiaţia luminoasă incidentă trece printr-o fantă cu dimensiuni sub-lungime de undă. Proba se află pe un suport piezo.

). Alternativ. Instrument NSOM construit în jurul unui microscop de fluorescenta inversat . Acest mod este numit modul iluminare.mod iluminare. localizarea proteinelor. etc. Această amplitudine poate fi monitorizată şi folosită pentru a genera un semnal de feedback cu ajutorul căruia se controlează distanţa dintre probă şi vârf în timpul scanării. Cu ajutorul tehnicii NSOM au fost investigate cu succes sisteme fotosintetice. 179 . proba este iluminată de la un câmp îndepărtat şi emisia de fluorescenţă este colectată de către un vârf NSOM. Tehnica NSOM este remarcabilă pentru analiza filmelor subtiri. Figura 5. Microscopia de fluorescenţă prin scanare optică în câmp apropiat poate oferi noi perspective în studiul sistemelor biologice complexe din cauza rezoluţiei mai mari decât în microscopia confocală. cartografierea cromozomilor şi microstructura membranelor. Acest lucru poate fi realizat cu ajutorul feedback-ului bazat în general pe metoda de forţă-forfecare: vârful este intercalat lateral la una dintre frecvenţele sale de rezonanţă cu o amplitudine de aproximativ 2-5 nm. Când vârful NSOM interacţionează cu câmpul de forţe Van der Waals a probei. Sistemele care scanează piezo şi înregistrează imaginile sunt similare cu cele utilizate în microscopia de forţă atomică. cristale lichide. a capacităţii de cartografiere a topografiei suprafeţei şi datorită faptului că fenomenul de photobleaching este redus. forţele de forfecare atenueză amplitudinea vibraţiilor acestuia.tată printr-un filtru (pentru a elimina lumina reziduală de la laserul folosit pentru excitare) şi un detector. (polimeri electroluminiscenţi. în modul colectare. Pentru a obţine imagini de înaltă rezoluţie este necesară poziţionarea precisă a vârfului NSOM (de ordinul nm) faţă de suprafaţa probei.

II şi III). Iosin şi colaboratorii [4] au înregistrat spectrele de fluorescenţă ale bioconjugatelor BSA-nanoparticule de aur cu ajutorul unui Spectrofluorimetru Jasco LP-6500 cuplat cu un dispozitiv pentru controlarea temperaturii (ADP-303T). ce le permite conjugarea uşoară cu diferite biomolecule. cu formă aproximativ elipsoidală (4nm×4nm×14nm). cu ajutorul căruia temperatura poate fi modificată controlat de la −10 °C la +110 °C. Structura nativă a albuminei bovine (BSA) este caracterizată de un singur lanţ polipeptidic compus din 583 reziduri de aminoacizi. stabilizate de o reţea internă de 17 legături disulfide. şi joacă un rol important în procesele fiziologice.1. În unele cazuri interacţiunea dintre proteină şi suprafaţa nanoparticulelor de aur poate determina modificări de structură ce duc la alterarea proprietăţilor proteinei. Semnalul de fluorescenţă al albuminei (BSA) a fost obţinut la 337 nm prin excitarea reziduului de triptofan cu o radiaţie având lungimea de undă 280 nm. Deoarece interacţiunea dintre proteine şi nanoparticulele de aur este foarte sensibilă la starea conformaţională a proteinei şi la chimia suprafeţei nanoparticulelor. datorită prezenţei celor două reziduuri de triptofan din structura ei. Albumina bovină (BSA) se găseşte în cantităţi mari în plasmă. 180 . ci determină biocompatibilizarea (funcţionalizarea) acestor nanoparticule pentru alte interacţiuni sau cuplaje cu mediul biologic. structura terţiară cuprinde trei domenii omoloage (I. Cunoaşterea efectelor biologice ale nanoparticulelor de aur necesită determinarea legăturilor ce apar între nanoparticule şi proteinele cu care interacţionează. Exemple de aplicaţii ale spectrofluorimetriei 3. Albumina bovina (Bovine Serum Albumin) este o proteină globulară. Nanoparticulele de aur (GNP) sunt sonde ideale pentru investigarea proceselor biologice datorită biocompatibilităţii lor. Albumina bovină (BSA) este utilizată ca proteină model în studiile biologice deoarece are o structură bine cunoscută şi posedă proprietăţi de fluorescenţă specifice. Soluţia de bioconjugate (nanoparticule de aur şi BSA) a fost pusă într-o cuvă de cuarţ având dimensiunea de 10 mm. Determinarea interacţiunii nanoparticule de aur dintre albumina bovină şi Iosin şi colaboratorii [4] au demonstrat interacţiunea directă dintre nanoparticulele de aur şi albumina bovină.3. folosită des în aplicaţii din domeniul bio-nanotehnologiilor. fiecare domeniu fiind format din şase elice. este foarte importantă determinarea modificărilor conformaţionale pe care le suferă proteina în urma adsorbţiei la suprafaţa nanoparticulei. Pe de altă parte conjugarea dintre proteină şi nanoparticulele de aur nu are ca efect doar stabilizarea sistemului proteină-nanoparticulă.

Albumina bovină (BSA) conţine trei cromofori: triptofan. carboxyl sau triptofan. deoarece fenilalanina are un randament cuantic foarte mic. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. (c) 1. Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii ale nanosferelor de aur: (a) 0. Pe langă efectul evident Figura 6.65×10-11 M. Soluţia apoasă de BSA are o bandă puternică de fluorescenţă cu maximul situat la 336 nm. Măsurătorile de fluorescenţă au fost efectuate cu o radiaţie excitatoare de 280 nm.Din spectrele de fluorescenţă se pot obţine informaţii importante (constanta de legătură şi numărul ”siturilor” de legătură) referitoare la modul de legare a proteinelor de suprafaţa nanoparticulelor de aur. fluorescenţa intrinsecă a BSA-ului este dată în principal de reziduurile de triptofan. (d) 1. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanosfere de aur. Spectrele de fluorescenţă ale unor soluţii având diferite concentraţii de nanoparticule de aur şi albumină bovină (BSA) au fost monitorizare în domeniul 290-450 nm. regiune ce coincide cu banda de emisie a triptofanului. lungime de undă ce este departe de banda plasmonică de rezonanţă a nanoparticulelor de aur. (e) 2.2×10-11 M. au monitorizat stingerea semnalului de fluorescenţă prin creşterea concentraţiei nanoparticulelor de aur de formă sferică. bandă ce este datorată emisiei reziduurilor de triptofan.55×10-11 M. Iosin şi colaboratorii [4]. tirosina şi fenilalanina a căror emisie de fluorescenţă poate fi stinsă. iar nanoparticulele de aur nu prezintă emisie de fluorescenţă. După cum se poate observa în figura 6.1×10-11 M. Triptofanul este deosebit de senzitiv la modificarea vecinătăţii locale. (b) 0. iar fluorescenţa tirosinei este aproape stinsă dacă este ionizată sau dacă este aproape de un grup amino. În realitate. de aceea studiul emisiei de fluorescenţă a acestuia este deosebit de utilă în determinarea modificărilor conformaţionale ale proteinei şi adsorbţia la nanoparticule. F – concentraţii intermediare. 181 .

În figura 7 sunt prezentate spectrele de fluorescenţă ale complexului BSA-nanobastonaşe de aur. adaugarea în continuare a nanoparticulelor nu duce la apariţia de noi legături BSA-nanoparticule). În cazul complexului BSA-nanobastonaşe nu se observă nici o deplasare a maximului benzii de fluorescenţă odată cu modificarea concentraţiei. Această comportare se datorează unui efect de saturaţie (când toate moleculele de BSA sunt legate de nanoparticulele de aur. (c) 2.06×10-14 M. autorii au observant şi o deplasare spre roşu a maximului benzii de fluorescenţă cu 4 nm (de la 336 nm la 340 nm).12×10-14 M. (b) 1. în ambele cazuri. (d) 3. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii de nanobastonaşe de aur: (a) 0. Se observă că intensitatea benzii de fluorescenţă descreşte odată cu creşterea concentraţiei de nanobastonaşe de aur.de stingere a fluorescenţei. [6]: (F0 – Fsat)/(F – Fsat) = ([M]/Kdiss)n unde F0. F – concentraţii intermediare. pentru diferite concentraţii. deplasare ce indică o modificare a polarităţii din jurul reziduului de triptofan. Din spectrele de fluorescenţă de mai sus autorii au determinat constanta de legătură (Kb) precum şi numărul siturilor de legătură dintre nanoparticulele de aur şi BSA. (e) 4. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanobastonaşe de aur.24×10-14 M. Fsat şi F sunt intensităţile de fluorescenţă datorate reziduurilor de triptofan din BSA: 182 . intensitatea emisiei de fluorescenţă rămâne constantă după atingerea unui nivel de concentratie a nanoparticulelor de aur.18×10-14 M. Figura 7. folosind metoda descrisă de Tedesco et al.

Fsat)] = 0 au obţinut constanta de disociere (Kdiss).F0 este intensitatea de fluorescenţă a soluţiei apoase de BSA pur.5 × 105 n 1. În plus nanobastonaşele sunt stabilizate cu citrat de sodiu pe când nanosferele sunt stabilizate cu CTAB.F)/ (F . [M] este concentraţia particulelor (în moli). indus de suprafaţa metalică a nanoparticulei comjugată. Constanta de legătură (Kb) şi numărul siturilor de legatură (n) pentru complexul BSA-nanoparticule de aur.Fsat)] în funcţie de log([M]).F)/(F . interacţiunea locală dintre nanoparticulele de aur şi albumina bovină a fost investigată cu ajutorul spectroscopiei de fluorescenţă. nanosfere de aur nanobastonaşe de aur Kb 2. F este F intensitatea de fluorescenţă a soluţiilor de BSA având concentraţii intermediare. iar din valoarea lui log[M] pentru care log[(F0 . Tabelul 1. iar nanosferele au sarcină electrică negativă. Fsat este intensitatea de fluorescenţă a soluţiei de BSA saturată cu nanoparticule de aur. n reprezintă numărul ”siturilor” de legătură dintre nanoparticulele de aur şi BSA Kdiss este valoarea reciprocă a constantei de legătură Kb.34 × 1011 0. folosind efectul de stingere a emisiei de fluorescenţă a triptofanului din BSA. d este grosimea cuvei folosită pentru înregistrarea spectrelor. În concluzie. [M] reprezintă concentraţia nanoparticulelor de aur. e reprezintă coeficientul de extincţie molară Pentru a calcula parametrii ‘‘n” şi ‘‘Kb” autorii au reprezentat grafic log[(F0 . Din panta graficului au calculat numărul siturilor de legătură ‘‘n”.37 0. Valorile astfel calculate se găsesc în tabelul 1. Concentraţia nanoparticulelor de aur a fost estimată cu ajutorul relaţiei A = [M]dε unde: A este absorbanţa soluţiei.38 Valoarea mai mare a constantei de legatură în cazul nanosferelor este datorată faptului că cele două tipuri de nanoparticule au sarcinii electrice şi o chimie a suprafeţei diferite: nanobastonaşele au sarcină electrică pozitivă. 183 .

Spectroscopia de fluorescenţă. punctul izoelectric este 4. în principal printr-un mecanism static (constanta de legatură Kb este dependentă de valoarea pH-ului). Deplasarea maximul benzii de emisie indică faptul că modificarea pH-ului soluţiei duce la obţinerea de stări con184 . în soluţie. spectrul de fluorescenţă al soluţiei pure de BSA (pH = 6. Spectrele înregistrate sugerează faptul că nanoparticulele de aur inhibă emisia de fluorescenţă a reziduurilor de triptofan din BSA. atracţia sau respingerea nanoparticulelor de aur. grupărilor de triptofan ce sunt localizate pe suprafaţa proteinei (în domeniul I: Trp-134. 336 nm respectiv 339 nm. grupare expusă mai puternic influenţei vecinătăţii hidrofilice) şi în interiorul proteinei (în domeniul II: Trp-213. grupare aflată într-o poziţie hidrofobică). după cum am mai amintit. M.3. în urma modificărilor de temperatură şi pH. spectrul c) are maximul benzii de emisie la 337 nm. unde pI reprezintă punctul izoelectric [6]. Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur. Modificări conformaţionale ale proteinelor pot fi induse de variaţii ale temperaturii şi ale pH-ului. a diabetului şi a afecţiunilor cardiovasculare. determinând. 5 (spectrul b) şi 9 (spectrul d) au maximul benzii de emisie la 324 nm. având o influenţă majoră asupra interfeţei dintre nanoparticule şi substanţele biologice. neutră pentru pH= pI şi negativă pentru pH> pI. fiecare stare conformaţională având formă şi dimensiune proprie. în consecinţă. fiind pozitivă pentru pH< pI. iar spectrele de fluorescenţă ale soluţiilor de BSA cu valori ale pH-ului 2 (spectrul a). Structura albuminei bovine este puternic dependentă de pH şi temperatură. Iosin şi colaboratorii [5] au monitorizat mecanismul de interactiune între albumina bovină (BSA) şi nanoparticulele de aur cu ajutorul spectroscopiei de fluorescenţă. Valoarea pH-ului afectează atât structura albuminei bovine cât şi sarcina grupării funcţionale a proteinei.7 [7].2. Sarcina netă a albuminei bovine este puternic dependentă de pH-ul soluţiei. poate fi folosită pentru a obţine informaţii legate de modificările coinformaţionale ale proteinelor induse de interacţiunea cu nanoparticulele de aur la diferite valori ale pH-ului şi la diferite temperaturi. datorită senzitivităţii mari. După cum se observă în figura 8. În cazul albuminei bovine. Proprietăţile fluorescente ale albuminei bovine (BSA) sunt datorate. Aceste modificări ale structurii proteinelor pot duce la apariţia cancerului. Nanoparticulele de aur folosite sunt încărcate negativ la suprafaţă datorită faptului că sunt acoperite cu citrat pentru a prevenii agregarea lor.

în timp ce la pH = 2 şi pH = 9 albumina bovină are formă extinsă (‘E-form’) respectiv bazică (‘B. pH 6 (c) şi pH 9 (d). Figura 8. în comparaţie cu emisia albuminei bovine de tipul ‘N-form’. la pH neutru albumina bovină are o formă nativă (‘N-form’). Spectrele de fluorescenţă înregistrate (figura 9) demonstrează scăderea drastică a emisiei de fluorescenţă (quenching) a triptofanului din albumina bovină la pH = 2 odată cu creşterea concentraţiei nanoparticulelor de aur (de la 0.form’). iar deplasarea maximului benzii de emisie spre lungimi de undă mari ne indică faptul că triptofanul este mai expus solventului. Iosin şi colaboratorii [5] au folosit o concentraţie fixă de BSA titrată în cantităţi diferite de soluţie de nanoparticule de aur. 185 . pH 5 (b).75×10−11 M). Deplasarea maximului benzii de emisie spre lungimi de undă mai mici indică faptul că triptofanul din albumina bovină are o vecinătate mai hidrofobică (se modifică structura terţiară). Pentru a obţine informaţii legate de emisia de fluorescenţă a triptofanului din albumina bovină la diferite valori ale pH-ului în prezenţa nanoparticulelor de aur. autorii au calculat constanta de stingere a fluorescenţei (KSV) folosind ecuaţia Stern–Volmer: F0/F = 1 + Kqτ0[GNPs] = 1 + KSV[GNPs] unde: F0 şi F sunt intensităţile relative de flkuorescenţă ale triptofanului în absenţa şi în prezenţa nanoparticulelor de aur. datorită creşterii separaţiei inter-domeniu şi schimbării configuraţiei proteinei astfel încât gruparea triptofan are o vecinătate mai hidrofobică.55×10−11 M la 2. Spectre de fluorescenţă ale albuminei bovine la pH 2 (a). Din spectrele de fluorescenţă.formaţionale diferite ale albuminei. Emisia de fluorescenţă a albuminei bovine de tipul ‘E-form’ are maximul deplasat spre albastru. Astfel.

55×10−11 M.65×10−11 M. precum şi numărul siturilor de legătură (n) dintre nanoparticule şi BSA conform relaţiilor din pargraful anterior. KSV este constanta de stingere Stern–Volmer. Valoarea obţinută pentru constanta de stingere bimoleculară Kq este mai mare decât valoarea obţinută (2.0×1010 M−1 s−1) în cazul stingerii emisiei de fluorescenţă a macromoleculelor biologice datorită mecanismului de ciocnire. Astfel.11×109 M−1. Spectre de fluorescenţă ale grupării triptofan din BSA la pH = 2 pentru diferite concentraţii ale nanoparticulelor de aur: (a) 0. τ0 = 5×10−9 s este timpul de viaţă mediu al albuminei bovine în absenţa nanoparticulelor de aur.97 la 186 . obţinându-se valorile KSV = 1.75×10−11 M.Kq este constanta de stingere bimoleculară.7×109 M−1 pentru pH = 6 şi KSV = 1. obţinându-se valorile: Kq = 0. 1. Graficul inserat reprezintă curba Stern–Volmer.1×10−11 M. În urma calculelor s-au obţinut următoarele valori pentru numărul siturilor de legătură (n): 1.22×1018 M−1 s−1 pentru bioconjugatele BSA– GNPs la pH = 2.32×1018 M−1 s−1 la pH = 9. Figura 9. Prin fitare liniară s-a obţinut KSV = 1. (b) 0. În mod similar au fost calculate constantele de stingere Stern–Volmer pentru pH = 6 şi pH = 9. în cazul bioconjugatelor BSA–GNPs stingerea emisiei de fluorescenţă nu este iniţiată de ciocniri dinamice ci de formarea unui complex nefluorescent în urma unui mecanism de stingere static.77 la pH 2.34×1018 M−1 s−1 la pH = 6. (e) 2. (c) 1. [GNPs] reprezintă concentraţia nanoparticulelor de aur. Iosin şi colaboratorii [5] au determinat constanta de legătură la echilibru Kb (indică echilibrul dintre speciile adsorbante şi cele resorbante). Deci. respectiv Kq = 0. constanta de stingere bimoleculară Kq a fost calculată.6×109 M−1 pentru pH = 9.2×10−11 M şi (f) 2. ce indică senzitivitatea fluoroforului la molecula ce determină stingerea fluorescenţei (quencher). (d) 1. Kq = 0.

1. De menţionat că valorile mai mari ale constantei de legătură indică o atracţie mai puternică între cele două specii. analizând emisia de fluorescenţă a triptofanuluui din BSA. soluţia apoasă pură de BSA are o emisie de fluorescenţă puternică. Pentru a mima o vecinătate biologică reală. maximul benzii de fluorescenţă datorată triptofanului se deplasează spre numere de undă mai mici. deci determinarea condiţiilor în care are loc acest proces este foarte importantă pentru înţelegerea stabilităţii proteinelor. valori ce indică faptul că adsorbţia maximă a moleculelor de albumină la suprafaţa nanoparticulelor de aur apare pentru o valoare a pH-ului apropiată de punctul izoelectric (pI) al BSA-ului.03×109 M−1 la pH 9. Platoul curbei de denaturare indică faptul că albumina îşi menţine starea nativă pînă la aproximativ 42 ºC. După cum observă şi autorii. respectiv pentru constanta de legătură Kb: 2. deci creşterea temperaturii duce la apariţia de modificări structurale ale proteinei.82×109 M−1. autorii au studiat formarea bioconjugatelor la pH = 5. La aceste temperaturi apare o modificare a vecinătăţii triptofanului din albumină. iar cealaltă la 65 ºC.85 şi Kb = 2.6×109 M−1 la pH 2. În acest scop. curba de denaturare a albuminei bovine pure sugerează existenţa a două temperaturi de tranziţie: una la 43 ºC. sau regiunile hidrofobice devin predispuse la interacţiuni intermoleculare noi.3. au fost monitorizate modificările emisiei de fluorescenţă a triptofanului din BSA pentru temperaturi cuprinse între 22 ºC şi 85 ºC (domeniu în care apare o modificare importantă a structurii terţiare a albuminei). cerntrată la 337 nm. prima temperatură de tranziţie apărând în 187 . Iosin şi colaboratorii [5] au studiat modificările structurale ce apar în cazul denaturării termice a albuminei bovine. Graficul inserat (denaturation curve) indică o relaţie neliniară între deplasarea maximului benzii de absorbţie şi temperatură. Ca urmare a acestui fapt. Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului Denaturarea termică a proteinelor este un proces intrinsec.81×109 M−1 la pH 6 şi 2.76 la pH 9. La temperatura camerei. Odată cu creşterea temperaturii. Numărul siturilor de legătură şi constanta de legătură pentru pH = 5 este: n = 1.pH 6 şi 1. înainte şi după absorbţia la suprafaţa nanoparticulelor de aur. ajungând până la 330 nm (figura 10).348×1018 M−1 s−1. De fapt. prin creşterea temperaturii forma nativă a proteinei devine mai flexibilă.74×109 M−1 şi Kq = 0. Constanta de stingere Stern–Volmer şi constanta de stingere bimoleculară obţinute pentru această valoare a pH-ului sunt: KSV = 1. 3. grupările –SH libere.

Denaturarea completă a proteinei se face după 65 ºC. în mediu acid (pH mic) proteina este mai stabilă termic. Astfel. s-a determinat faptul că procesul de denaturare termică a albuminei bovine este ireversibil. pe lângă denaturarea proteinei. Prin măsurarea emisiei de fluorescenţă a triptofanului din albumină în procesul de răcire. În urma măsurătorilor efectuate s-a observat o dependenţă accentuată de valoarea pH-ului a temperaturii de tranziţie la care proteina îşi modifică conformaţia. Autorii au studiat efectul combinat al pH-ului şi al temperaturii înainte şi după conjugarea albuminei bovine cu nanoparticulele de aur. prin compararea denaturării termice (între 22 ºC şi 85 ºC) a proteinei în soluţie pentru diferite valori ale pH-ului (2 . apare şi scăderea în intensitate a emisiei de fluorescenţă a triptofanului. În mod contrar.jurul pragului maxim admis al febrei ce apare în condiţii de boală (42 ºC). deplasare ce sugerează tranziţia albuminei de la starea nativă (compactă) la o stare cu o structură mai deschisă. creşterea temperaturii de la 22 ºC la 85 ºC determină descreşterea cu 72% a emisiei de fluorescenţă. în mediu alcalin (pH mare) temperatura de tranziţie este mult mai scăzută (32 °C) decât în mediu neutru (pH = 6) ceea ce indică o denaturare termică mult mai rapidă în mediu bazic. Inserat: curba de denaturare termică (variaţia maximului benzii de fluorescenţă în funcţie de temperatură . temperatura de tranziţie la care începe denaturarea termică este mai mare (46 °C) decât în mediu neutru. Astfel. După cum se observă în figu188 . la pH 6. O dată cu creşterea temperaturii. Dependenţa de temperatură a emisiei de fluorescenţă a grupărilor de triptofan din albumina bovină. valoare la care apare un al doilea platou în curba de denaturare. datorită expunerii triptofanului la moleculele de solvent. Figura 10.9).la creşterea şi descreşterea temperaturii). Între 43 ºC şi 65 ºC se observă o deplasare spre albastru a maximului emisiei de fluorescenţă a albuminei bovine.

189 . Inserat: dependenţa constantei de stingere Stern–Volmer de temperatură. Pentru a investiga efectul temperaturii asupra fenomenului de stingere a fluorescenţei albuminei bovine de către nanoparticulele de aur a fost calculată constanta de stingere KSV pentru diferite temperaturi. rezultând creşterea temperaturii de tranziţie indiferent de valoarea pH-ului. Figura 12. Figura 11. prezenţa nanoparticulelor de aur îmbunătăţeşte stabilitatea termică a proteinei. Variaţia maximului emisiei de fluorescenţă a triptofanului din BSA. De exemplu. spre numere de undă mari. Deci. în funcţie de temperatură pentru diferite valori ale pH-ului. pentru pH = 6 temperatura de tranziţie creşte de la 42 °C la 47 °C. bioconjugarea albuminei bovine cu nanoparticule de aur. După cum se observă şi din figura 11. deci modifică comportarea termică a proteinei.ra 11. respectiv din bioconjugatul BSA-nanoparticule. Curbele Stern–Volmer pentru stin gerea fluorescenţei BSA-ului de către nanoparticule de aur (pH = 6). prezenţa nanoparticulelor induce o deplasare. a emisiei de fluorescenţă. modifică forma curbei de denaturare.

0700 R 0. 4. Crystal structural analysis of human serum albumin complexed with hemin and fatty acid. Constanta de stingere KSV şi parametrii termodinamici pentru complexul BSA-nanoparticule de aur. 3 (2003) 1–9. 358 K) ne indică faptul că constanta de stingere KSV scade odată cu creşterea temperaturii (figura 12). Combining conformational flexibility and continuum electrostatics for calculating pKas în proteins. Springer.96 81. Gunner. M.and thermally induced conformational changes of Bovine Serum Albumin adsorbed onto gold nanoparticles. (2011). P. Ed.59 55. Toderas. Astilean. Iosin. Struct. Joseph Lakowicz. J.R. R .87 53. 2. “Principles of Fluorescence Spectroscopy”. Biol.deviaţia standard pentru valorile coeficientului KSV. S. Eds B. Baldeck. 217. J. 924–926 (2009) 196–200.9994 0.0782 0.9988 0. la pH 6 pentru diferite temperaturi (295. R.29 -28.9982 0. E. V. 4. 3. Biophys. Fluorescence Spectroscopy: New Trends în Fluorescence Spectroscopy.0721 0. 190 .11 10. Valeur. P. Journal of Photochemistry and Photobiology A: Chemistry. Curry.A. Bibliografie 1. 7. J. Tsuchida.32 51. Study of protein-gold nanoparticle conjugates by fluorescence and surface-enhanced Raman scattering. Wiley-VCH.88x109 5. Berlin (2001).9983 0. F. BMC Struct. Spectroscopic studies on pH. Ed.0601 0. Mialocq and T. J.79 132. 83 (2002) 1731–1748. Investigation of femtosecond chemical reactivity by means of fluorescence up-conversion. Tabelul 2. 5.0683 0. E.41x109 9. M.-C. J. M. Zunszain. (2006). “Molecular Fluorescence: Principles and Applications”. Canpean. S. Bernard Valeur. (2002).-C. Gustavsson.60x109 1. 338. Alexov. 6.9975 ΔH(kJ/mol) ΔS(J/mol K) ΔG(kJ/mol) -48.coeficientul de corelaţie) pH 6 T (K) 295 318 338 295 318 338 KSV (L/mol) 1. confirmă faptul că mecanismul de stingere a fluorescenţei triptofanului din albumina bovină de către nanoparticulele de aur este iniţiat de formarea unui complex ne-fluorescent prin adiţia moleculelor de albumină bovină la nanoparticulele de aur. Astilean. Springer Verlag. T.70x109 1. Georgescu.35 -54.Graficul Stern-Volmer ce caracterizează stingerea emisie de fluorescenţă a triptofanului din albumina bovină de către nanoparticulele de aur. Iosin. (SD .22 2 Proporţionalitatea inversă dintre constanta de stingere KSV şi temperatură (tabelul 2).9980 0. Komatsu.E.70 -64. 395-401. Brochon.05x109 SD 0. Ghuman. Mol. S. 318.11x109 6.0651 0.G.

................ dr.VI.................. 191 2......γiB0..................... în jurul direcţiei câmpului magnetic static (direcţia z). are două efecte majore: (i) axa polarizării de spin efectuează o mişcare de precesie cu frecventa Larmor.. 202 4......................... Principiul metodei Generarea semnalului RMN Spectroscopia RMN se bazează pe fenomenul de rezonanţă magnetică aplicat asupra momentelor magnetice nucleare μi = γiS.....i = . Infrastructura existentă la UBB Cluj pentru exprimente RMN-S ....... Principiul metodei....... Mihaela Aluaş Cuprins 1...... iar γ i reprezintă factorul giromagnetic.......... se vor reorienta sub acţiunea câmpurilor magnetice locale fluctuante uşor datorită mişcării termice.. Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice .. ω0...........III............. unde S este numărul cuantic de spin........ Claudiu Filip C..... Plasarea probei care conţine momente magnetice nucleare într-un camp magnetic extern intens................... cu relevanţă în special pentru sisteme moleculare organice.... SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) C........... asociate speciei nucleare i. B0 ~ 7-23 T (generat cu ajutorul unei bobine supraconductoare).... şi (ii) polarizările spinilor........ 196 3............ Principalele proprietăţi ale câtorva nuclee active RMN............... sunt prezentate în tabelul de mai jos: 191 .. Bibliografie .. dr..........I........... distribuite izotrop în momentul aplicării lui B0........ proba va fi caracterizată de o magnetizare macroscopică orientată de-a lungul direcţiei câmpului magnetic extern..... astfel încât după o perioadă de ordinul aşa numitului timp de relaxare longitudinal............... T1..S.....S...... 215 1....

frecvenţa de nutatie ν1.02 1.i /2π este de ordinul zecilor de kHz.98 0.Specia nucleară. şi amplitudinea B1.i.7 1. sau este apropiată de aceasta: în literatura RMN această precesie este deseori denumită nutaţie.6 0. este necesară mai întâi rotirea polarizării de spin în planul transversal. ωrf = ω0.7 225 63. câmpul oscilant (numit şi câmp de radiofrecvenţă. perpendicular pe câmpul magnetic extern: el este generat de curentul aplicat asupra unei bobine de transmisie în interiorul căreia este plasată proba. adică sub forma unui puls. Deşi în practică B1 << B0. i 1H 2H 13C 14N 15N γ iγ S 1/2 1 1/2 1 1/2 [ 107 rad s-1T-1] 26. Pentru valori tipice ale lui B1 utilizate în spectroscopia RMN-S.8 4.5 125 35. După încetarea acţiunii pulsului rf magnetizarea Figura 1 192 .9 -2.i [MHz] B0 = 11.i tp = π/2) necesită aplicarea câmpului rf pe durata tp de ordinul câtorva µs.9 90 Deoarece magnetizarea longitudinală nu poate genera un semnal RMN.i = γiB1 a polarizării spinilor i în jurul direcţiei lui B1 dacă ωrf satisface condiţia de rezonanţă.37 ν0. rf) va determina o mişcare de precesie cu frecvenţa ω1.1 99.7 Abundenţa naturală [%] 99.7 T 500 76.1 6. xy. astfel încât rotirea magnetizării în plan transversal (ω1.5 50 B0 = 21 T 900 137. Acest lucru se realizează prin aplicarea unui câmp magnetic oscilant cu frecvenţa ωrf.i = ω1.

prezenţa aşa-numitor interacţiuni de spin interne conduce la valori ale câmpului magnetic local la poziţiile diferitor spini i uşor diferite de B0. ω0. precum este cel ilustrat în Fig. După o perioadă de aproximativ t0 ~ 5T1 polarizarea de spin se reconstruieşte de-a lungul direcţiei z şi experimentul poate fi repetat. B0. numit timp de achiziţie.i. FID-ul este înregistrat în intervalul de timp t2. corespunzător modului de detecţie în cuadratură. Cu ajutorul experimentului din Fig.transversală va precesa liber în jurul lui B0. Detecţia semnalului RMN Aplicând transformata Fourier asupra FID-ului se obţine reprezentarea acestuia în domeniul de frecvenţă. Această mişcare induce un curent electric oscilant pe bobina de detecţie (aceeaşi cu bobina de transmisie) ce poartă numele de semnal RMN. ceea ce face ca pentru fiecare specie nucleară i. 2 în cazul nucleelor 13C: 193 . Atât semnalul în domeniul temporal.i care conţine întregul spectru RMN-1D al speciei nucleare respective. adică înregistrarea de spectre RMN distincte pentru fiecare specie nucleară în parte. adică spectrul RMN. şi este ilustrat schematic în Fig. În acest context. astfel încât amplitudinea lui se apropie de zero. 1 se obţine un spectru RMN 1D (unidimensional) ale cărui proprietăţi (poziţii. ştiinţa materialelor. şi deci implicit la apariţia mai multor linii în spectrul RMN 1D. Frecvenţele asociate interacţiunilor de spin interne sunt mult mai mici decât frecvenţele Larmor. să existe o fereastră spectrală de lărgime limitată. iar conţinutul lui de informaţii ar fi extrem de sărac. sau FID (free-induction decay). pe durata căruia se produce defazarea polarizării transversale. forme şi intensităţi de linie) depind în mod esenţial de interacţiunile la care sunt supuşi spinii nucleari pe durata t2. etc. conţin o parte reală şi una imaginară. în jurul lui ω0. 1. Descrierea de mai sus se referă la aşa-numitul experiment RMN de “un puls”.i. În realitate. spectrul asociat speciei nucleare i ar conţine o singură linie la poziţia frecvenţei Larmor asociate. cât şi cel în domeniul de frecvenţă. despicările şi/sau lărgirile liniilor individuale sunt în directă conexiune cu elemente de structură chimică/spaţială bine determinate. şi constituie astfel baza multiplelor aplicaţii ale spectroscopiei RMN în (bio)chimie. Considerând doar interacţiunea cu câmpul static extern. ΔΩi << ω0.i). de exemplu deplasările (faţă de ω0. soluţia practică utilizată în spectroscopia RMN modernă corespunde aşa-numitului mod de lucru pe canale rf distincte. Parametrii spectrali.

De exemplu. 2 sunt utile pentru determinarea structurii chimice. sunt interacţiunea dipolară (homo. poziţiile liniilor în spectrul 13C din Fig. aşa-numitele deplasări chimice. prin identificarea grupărilor chimice distincte din moleculă în funcţie de regiunea spectrală specifică în care se plasează liniile RMN.C ca urmare a diferenţelor în intensitatea câmpului magnetic local indus de distribuţia electronică din vecinătate. cu linii suficient de înguste încât să permită identificarea componentelor izotrope ale acestora. Primele două sunt dominante în cazul nucleelor cu spin ½ (având constante de cuplaj de la câţiva kHz până la aproximativ 100 kHz) şi au un caracter anizotrop. spectre RMN 1D precum cel ilustrat în Fig. Ele produc în general spectre cu linii foarte largi caracterizate prin suprapuneri severe ce fac imposibilă extragerea de informaţii utile.Figura 2 Interacţiunile de spin cu relevanţă în aplicaţiile spectroscopiei RMN-S pe probe organice. Deplasările chimice reflectă deplasările frecvenţei de precesie la diferite poziţii ale nucleelor 13C în sistemul molecular investigat faţă de valoarea ω0. şi interacţiunea scalară (cuplajul J). 194 . 2 sunt determinate de valorile izotrope ale ecranării chimice. şi sunt prin urmare reprezentative pentru gruparea chimică din care nuceele respective fac parte. interacţiunea de ecranare chimică. au fost dezvoltate o serie de tehnici speciale numite de decuplare: ele acţionează în sensul atenuării efectului produs de anizotropia interacţiunilor de spin şi conduc la spectre RMN-S de înaltă rezoluţie. În acest mod.şi heteronucleara). În consecinţă.

• Un puls rf se caracterizează prin trei parametri distincţi: (i) unghiul α de rotire a magnetizării faţă de direcţia z – aşa-numitul unghi de tilt (de exemplu α = π/2. Pentru exemplificare. 1). în cazul în care ωrf nu este exact în rezonanţă cu frecvenţa de precesie Larmor a speciei nucleare i. (ii) faza pulsului. fie în unităţi relative numite părţi pe milion (ppm) care reprezintă raportul dintre această deplasare faţă de frecvenţa de referinţă şi frecvenţa Larmor a speciei respective.ω0. în timp ce pentru un spectru 1H de calitate este suficientă înregistrarea unui singur scan. cu un timp de repetiţie determinat de valoarea lui t0 (conform Fig. care vor fi adunate pentru a genera semnalul RMN final. spectrul RMN-S 13C a unui compus în faza policristalină cu izotopul 13C în abundenţă naturală şi cu un număr de până la 10 poziţii chimice distincte a carbonilor din moleculă necesită acumularea unui număr de ordinul miilor de scanuri pentru a obţine un raport semnal/zgomot acceptabil (> 30). Δωi = ωrf . abundenţa izotopică şi numărul de poziţii chimice distincte în sistemul studiat. • Fiecare specie nucleară distinctă este caracterizată de o aşa-numită fereastră spectrală de lărgime limitată în interiorul căreia se plasează toate liniile RMN posibile: de exemplu lărgimile tipice ale acestei 195 . Aceasta din urmă este dată în principal de cantitatea de probă.). care reprezintă unghiul φ pe care îl face B1 faţă de axa Ox.Noţiunile introductive vor fi completate în final cu câteva precizări utile. şi (iii) frecvenţa de offset. • Poziţiile liniilor într-un spectru RMN sunt date fie în unităţi absolute de frecvenţă (Hz). menite să asigure legătura între baza conceptual-teoretică prezentată mai sus şi elementele concrete cu caracter aplicativ.7 T va fi denumit spectrometru de 500 MHz) • Pentru a obţine un spectru RMN de calitate (cu raport semnal/zgomot cât mai mic) este în general nevoie de înregistrarea unui număr N de FID-uri. privind implementarea lor concretă în practica curentă: • Un spectrometru RMN este caracterizat în mod tradiţional prin valoarea frecvenţei Larmor a spinilor 1H în câmpul magnetic al acestuia (de exemplu un spectrometru cu un criomagnet care produce un câmp B0 = 11. factorul giromagnetic. ca şi deplasare faţă de o linie de referinţă caracteristică fiecărei specii nucleare. câmpul magnetic static. Valoarea optimă a lui N (denumit număr de scanuri în terminologia de specialitate) depinde pentru fiecare specie nucleară de sensibilitatea asociată.i. etc. π. Cel de-al doilea mod este de obicei preferat pentru că poziţiile liniilor într-un compus dat vor fi aceleaşi indiferent de valoarea câmpului magnetic .

şi se realizează utilizând aşa-numitul algoritm FFT (fast Fourier transform). respectiv 14. simultan pe mai multe canale rf. transformarea Fourier se va aplica asupra acestui semnal digitizat. precum şi la implementarea lor experimentală. şi 500 ppm (pentru 15N). iar câmpul generat de acesta este de 9. Achiziţionarea directă a semnalului RMN (pe durata lui t2 în Fig. 300 ppm (pentru 13C). 1) se realizează în mod discret (digital) cu un timp de eşantionare numit dwell time. În consecinţă.1 Tesla cu frecvenţa de rezonanţă pentru nucleii de hidrogen de 400 MHz şi 600MHz. Exemplul prezentat în Fig. Magnetul acestora este autoecranat. şi permit extragerea selectivă a informaţiilor dorite. 2.• • ferestre spectrale sunt de aproximativ 20 ppm (pentru 1H). Spectrometrul Bruker DRX 400 din dotarea CNRM 196 . Infrastructura existentă la UBB Cluj pentru experimente RMN-S Descrierea componentelor hardware Laboratoarele Centrului Naţional de Rezonanţă Magnetică (CNRM) sunt dotate cu două spectrometre Bruker. achiziţionate în anii 2002 şi 2009. Referinţe detaliate cu privire la fundamentarea teoretică a acestor tehnici moderne. 1 prezintă cel mai simplu experiment posibil în spectroscopia RMN. pot fi găsite în literatura de specialitate. De-a lungul timpului a fost dezvoltată o diversitate foarte mare de tehnici RMN complexe care presupun aplicarea de secvenţe multi-puls extrem de sofisticate. această tehnologie fiind introdusă chiar de firma Bruker în 1996.4 Tesla.

57Fe. Pentru studiul probelor solide există în dotare mai multe capete de sondă care permit efectuarea experimentelor la temperaturi între -80 °C şi 200 °C. iar rotirea mecanică a probei se poate face la o frecvenţă de rotatie de până la 35 kHz. 69Ga etc. Ambele sisteme pot analiza atât probe în stare condensată cât şi probe în stare lichidă. Pot fi efectuate măsurători spectroscopice de rezonanţă magnetică nucleară pe o gamă foarte largă de nuclee: 1H. 15N. 27Al. 13C. Magnetul spectrometrului Bruker DRX 600 din dotarea CNRM Unitatea MAS folosită pentru controlul automat sau manual al rotirii probelor solide la unghiul magic 197 .Spectrometrele Bruker DRX 400 şi Bruker DRX 600 sunt complet digitale iar controlul acestora se face în totalitate prin intermediul unui calculator de tip PC.

Corespunzător echipamentelor existente la UBB Cluj. a vitezei de rotaţie a probei. începând cu generaţia de spectrometre Avance III. Descrierea componentelor software Pentru comanda modulelor electronice ale unui spectrometru RMN există pachete software specializate prin intermediul cărora elementele distincte ale unui experiment RMN sunt transpuse în comenzi specifice. În imaginea de mai sus se poate observa rotorul şi instrumentaţia specifică. prin intermediul fibrei optice. Se pot observa conectările acestui cap de probă la surse de aer necesar atât pentru rotirea probei la unghiul magic cât şi pentru controlul temperatuii probei. primul este instalat pe spectrometrul Bruker DRX 400. necesară introducerii şi tasării substanţei de măsurat precum şi scoaterii acesteia din rotor. În cazul spectrometrelor Bruker.Capul de probă folosit pentru măsurătorile pe probe solide introdus în câmpul magnetic static. Se mai poate observa şi conexiunea cablului care serveşte la detectarea. şi respectiv TopSpin. iar programul TopSpin comandă spectrometrul Bruker DRX 600. soft-ul de comandă se numeşte XWin NMR (până la generaţia Avance II). Cele două versiuni ale soft-ului de comandă Bruker diferă prin interfaţa grafică şi prin numărul 198 .

Pentru o privire completă a modului de lucru cu fazele. prin intermediul unor variabile care poartă acelaşi nume. 1). calibrarea acestui puls se realizează prin fixarea duratei lui p1. comune ambelor programe: • Comanda unui experiment RMN se realizează prin intermediul aşa numitului program de pulsuri (pulse program) care specifică acţiunile aplicate în cadrul experimentului.. În practică. 180 şi respectiv 2700. Faza ph1 este în schimb explicitată la sfârşitul programului de pulsuri (valorile corespund convenţiei Bruker în care 0. perioade de evoluţie liberă şi perioada de achiziţie directă. în rest. n = 0 . reprezintă fazele 0. dn (d – delay. -x şi –y). o serie de proprietăţi specifice • Primul tip de acţiuni corespunde elementelor standard ale unui experiment RMN (precum cel ilustrat în Fig. 31 – indicele asociat). Ea specifică durata acestuia. 31 – indicele asociat). după care se ajustează puterea la ieşire a transmiţătorului astfel încât curentul transmis pe bobină să producă o intensitate B1 a câmpului rf care să corespundă unui puls de 900 (în cazul exemplificat. iar în reprezentarea modelului vectorial. Valorile lui p1 şi f1 sunt introduse explicit de către utilizator în aşa numita tabela de achiziţie (acquisition table). în continuare vom face o foarte scurtă prezentare axată pe evidenţierea principiior fundamentale. x. 1). de exemplu la 2. 199 . p1.. precum şi faptul caă este aplicat pe canalul f1.. cu faza ph1. conform relaţiei 2πν1tp = π/2). De aceea. n = 0 . incluzând cazul general în care acestea nu sunt multipli de 900. Ele au asociate următoarele comenzi specifice în programul de pulsuri: pn (p – puls. 2 şi 3. iar n este eticheta liniei de comandă care va fi efectuată după încheierea achiziţiei) • În programul de pulsuri prezentat mai jos (care implementează experimentul RMN de un puls în Fig. În mod similar se procedează şi în cazul în care se calibrează un puls cu orice altă valoare a unghiului de tilt. se recomandă consultarea manualului de utilizare Bruker. în funcţie de tipul acţiunii. necesar în experimentul considerat. ele sunt echivalente la nivel conceptual. α. ν1 trebuie să fie 100 kHz. respectiv: pulsuri rf. durata fiecăruia dintre acestea şi. 1.sporit de scripturi pentru calibrarea parametrilor experimentali existente în TopSpin dar. comanda referitoare la aplicarea pulsului rf este p1:f1 ph1. y. 90.5 μs.. • Sensibilitatea spectrală maximă se obţine pentru o valoare α = 900 a unghiului de tilt pentru pulsul p1 (asa-numitul puls de 900). şi go=n (go – este un script care transmite comenzi specifice receptorului pentru achiziţionarea digitală a semnalului RMN.

iar în exemplul nostru concret d1 corespunde unei valori rezervate. În experimente multi-puls mai complexe. de exemplu între pulsuri rf consecutive. Ele corespund în general unor comenzi care se aplică asupra modulelor electronice. linia de comandă are în faţă indicele 2.) şi au asociat un timp (ideal cât mai scurt) pe durata căruia comutarea se poate realiza din punct de vedere fizic. În convenţia Bruker. adică timpul necesar reconstruirii magnetizării longitudinale după detecţia sa. şi corespund atenuării care trebuie aplicată la ieşirea transmiţătorului pentru a obţine valoarea dorită a câmpului rf pe bobina. valorile pln sunt date în decibeli (dB). 200 . pl1. scrierea datelor achiziţionate etc. Al doilea tip de acţiuni specificate într-un program de pulsuri nu au echivalent în schema standard a unui experiment RMN. care vor fi specificate prin comenzi de tipul dn. unde ph31 este faza receptorului).• • • Nivelul de putere al unui puls rf este cel specificat în programul de pulsuri anterior comenzii de aplicare a pulsului respectiv. aceste tipuri de acţiuni sunt reprezentate de comenzile: 1 ze (efectuează resetarea tuturor modulelor electronice la valorile lor iniţiale). respectiv recycle delay. Din acest motiv. wr #0 (scrie în memorie datele achiziţionate. 2us pl1:f1 (pe durata unui delay fixat la 2 μs se setează atenuatorii la ieşirea transmiterului la valoarea specificată prin parametrul de achiziţie pl1. cu scopul comutării lor între diferite regimuri de funcţionare. iar valoarea lui este introdusă explicit în tabela de achiziţie. a fazelor. Ea reprezintă aşa numitul delay. astfel încât orice comandă pn care apare după aceasta linie va aplica un puls rf de durata pn şi cu un nivel de putere pl1). adică semnalul RMN digitizat). Linia de comandă 2 d1 din programul de pulsuri de mai jos reprezintă o perioadă de durată d1 (a cărei valoare este introdusă explicit în tabela de achiziţie) în care intensitatea câmpului rf transmis/receptat este zero. în exemplul nostru. În exemplul de mai jos. go=2 ph31. în afară de recycle delay vor exista mai multe perioade de evoluţie liberă a sistemului. şi sunt necesare pentru implementarea practică a elementelor componente în experimentul RMN dat (de exemplu comutarea frecvenţelor de offset. a nivelurilor de putere la ieşirea transmiţătorului. pentru a achiziţiona un nou scan: acest fapt este explicitat în linia de comandă asociată achiziţiei semnalului RMN. şi exit (comanda de încheiere a experimentului). ce reprezintă punctul de unde experimentul RMN se repetă.

După achiziţionarea semnalului RMN. reprezintă linii de comentarii: ele sunt necesare (în special în cazul experimentelor multi-puls mai complexe) pentru a explicita semnificaţia parametrilor incluşi în programul de pulsuri asociat. dewll time (dw) – durata de eşantionare a semnaluilui RMN digitizat. de asemenea.). : pentru fiecare nucleu aceasta este fixată în momentul configurării spectrometrului). domeniul temporal (td) – numărul de puncte achiziţionate. dar colectând altenativ puncte în partea reală şi imaginară a semnalului RMN. În afară de aceştia. numele programului de pulsuri utilizat în experimentul considerat (pulprog). colectând simultan puncte în partea reală şi imaginară a semnalului RMN. sf2. tipul de achiziţie directă (qsim – în cuadratură. Pentru o descriere detaliată.). qseq – în cuadratură. se recomandă consultarea manualelor Bruker. numărul de scanuri (ns) – numărul de semnale RMN achiziţionate direct şi adunate între ele în scopul reducerii nivelului de zgomot la un nivel acceptabil.). acesta trebuie supus transformării Fourier pentru a genera spectrul RMN. etc. o2. Parametri specifici acestui proces sunt incluşi în aşa numita tabelă de procesare. etc.• • • Liniile care încep cu . însă reprezintă doar o mică parte din numărul total de parametri posibili (câţi anume dintre aceştia sunt utilizaţi efectiv într-un experiment dat depinde de complexitatea lui). adică durata între două puncte consecutive. Aceştia sunt parametri cei mai importanţi în cadrul unui experiment RMN tipic. frecvenţele de offset pe canalele pe care se lucrează (o1.) – se exprimă în Hz sau ppm. etc. etc. Pentru detalii. şi reprezintă devierea (cu + sau -) faţă de frecvenţa de bază pe canalul respectiv (sf1. se recomandă consultarea manualelor Bruker. iar tipul şi numărul acestor parametri depinde de complexitatea experimentului avut în vedere. etc. exprimate de obicei în multiplii de 16. După cum s-a precizat mai sus. 201 . tabela de achiziţie va mai conţine în mod obligatoriu şi alţi parametri caracteristici experimentelor RMN. f2. 2D. care oferă informaţii cu privire la: tipul de experiment (1D. pe canalul f1. tipul nucleului asociat cu canalele rf utilizate în experimentul dat ( f1. pe canalul f2. valorile numerice ale parametrilor incluşi în programul de pulsuri sunt specificate în tabela de achiziţie.

high power pulse . la lărgirea liniilor de rezonanţă. şi spectrul aceluiaşi compus aflat în stare solidă. 1-5 * T1 3.p1 : f1 channel . adică un spectru cu linii de rezonanţă înguste şi bine separate în funcţie de deplasările chimice izotrope. caracterizat de rezoluţie înaltă. Anizotropia interacţiunilor prezintă pe de o parte dezavantajul de a conduce la pierderea rezoluţiei prin suprapunerea liniilor RMN: în Fig.power level for pulse (default) . fapt care duce la menţinerea caracterului anizotrop al interacţiunilor de spin şi. respectiv lichidă sau solidă. În stare solidă mişcarea rapidă de reorientare moleculară este absentă. în 202 . decuplarea homonucleară.incl 1 ze 2us pl1:f1 2 d1 p1:f1 ph1 go=2 ph31 wr #0 exit ph1=0 2 2 0 1 3 3 1 ph31=0 2 2 0 1 3 3 1 . implicit. datorată mişcării moleculare rapide: prin aceasta. Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice Tehnici specifice de înaltă rezoluţie în solide: rotirea în jurul unghiului magic (MAS – Magic Angle Spinning). şi decuplarea heteronucleară Aspectul liniilor de rezonanţă dintr-un spectru RMN 1D.pl1 : f1 channel .# 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/zg" . Spectrele compuşilor în soluţie sunt caracterizate de o rezoluţie foarte bună. 1 diferă fundamental în funcţie de starea de agregare a probei.d1 : relaxation delay. efectul componentelor anizotrope ale interacţiunilor de spin prezente în sistem este mediat la zero.1D sequence # 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/Avance.incl" 1 . obţinut spre exemplu cu ajutorul experimentului de un puls ilustrat în Fig. păstrându-se doar partea lor izotropă.Avance2. 3 este ilustrată comparaţia dintre un spectru 1H RMN tipic al unui compus organic în soluţie.

care să conducă la separarea liniilor RMN-S în funcţie de deplasările chimice izotrope ale diferitelor grupări chimice din sistemul molecular investigat.care se observă cu usurinţă pierderea completă a rezoluţiei prin suprapunerea severă a liniilor RMN. adică la rezoluţie spectrală înaltă şi (ii) reintroducerea selectivă pe durata celorlate perioade ale exeprimentului a unor componente anizotrope ale interacţiunilor de spin (care să afecteze mărimi spectrale altele decât lărgimile de linie). pentru a codifica în spectrul obţinut şi informaţii specifice cu privire la structura şi/sau dinamica moleculară din sistem – în acest scop sunt aplicate aşa numitele metode de recuplare. manifestarea caracterului anizotrop al interacţiunilor de spin în probe solide prezintă şi avantaje de ordin practic. Pentru a diminua efectul negativ al anizotropiei interacţiunilor de spin în spectroscopia RMN-S. În mod explicit. Având în vedere toate aceste considerente. iar anizotropia cuplajului dipolar conţine informaţii despre distanţele internucleare. la mijlocul anilor ’50 a fost introdusă tehnica MAS 203 . care vor fi introduse în raportul următor. rezultă necesitatea dezvoltării de metode specifice ale spectroscopiei RMN-S care să conducă în cadrul aceluiaşi experiment la două efecte distincte: (i) pe durata anumitor perioade ale experimentului să se obţină medierea componentelor anizotrope ale interacţiunilor de spin. Figura 3 Comparaţie între spectrul 1H RMN static al unui compus organic tipic în stare solidă (a) şi în stare lichidă (b) Pe de altă parte. anizotropia ecranării chimice furnizează informaţii despre structura electronică (prin tipul orbitalilor moleculari) şi legăturile dintre atomi. deoarece componentele anizotrope conţin informaţii importante cu privire la structura şi dinamica din sistem.

permiţând rotaţii de până la 70 kHz ale probei în jurul unghiului magic. se pot evidenţia două cazuri distincte: (i) interacţiuni neomogene (deplasarea chimică şi interacţiunea dipolară heteronucleară pentru care [ H (t1 ). şi două componente dependente de timp ce corespund unei modulări periodice cu frecvenţele υR. Din acest punct de vedere. trebuie menţionat că. şi implicit asupra lărgirii liniilor RMN. Această metodă. efectul lor asupra dinamicii de spin. în raport cu direcţia câmpului magnetic static. va fi diferit. Conform descrierii teoretice de mai sus. efectul termenilor modulaţi devine din ce în ce mai mic cu creşterea frecvenţtei de rotaţie a probei: în perioada scursă de la introducerea metodei MAS şi până în prezent tehnologia în domeniu a avansat extrem de mult. care devine zero când axa de rotaţie este înclinată la unghiul magic în raport cu direcţia câmpului magnetic static. De asemenea. t2 şi (ii) interacţiuni omogene (interacţiunea dipola204 . mecanismul de îngustare prin MAS a liniilor RMN în solide se bazează pe manipularea părţii spaţiale a hamiltonianului de interacţiune: termenii anizotropi ai acestuia în proba rotită se descompun într-o componentă statică. în funcţie de forma explicită a hamiltonienilor asociaţi acestor interacţiuni.(Magic Angle Spinnining) în cadrul căreia proba este rotită în jurul unei axe înclinate la un unghi. Figura 4 Majoritatea metodelor RMN-S moderne de înaltă rezoluţie sunt aplicate în condiţii de rotaţie a probei în jurul unghiului magic. H (t2 )] = 0. şi respectiv 2υR. mediază efectul anizotropiei interacţiunilor de spin prin faptul că rotaţia mecanică a probei determină oscilaţia în timp a termenilor anizotropi şi prin aceasta micşorează efectul lor de lărgire asupra liniilor RMN. ∀ t1 . ilustrată schematic în Fig. 4. După cum se va prezenta în continuare. numit “unghiul magic”.

Astfel. în cazul static se obţine doar un spectru foarte larg. ∀ t1 . sisteme multi-spin) pentru care Pentru a ilustra efectul interacţiunilor omogene asupra formei şi lărgimii liniilor de rezonanţă. fără rezoluţie. caracterizaţi prin dinamica moleculară complet diferită. Mergând spre limita superioară a frecvenţei de rotaţie. se consideră acţiunea Hamiltonienilor de tip omogen. exemplifică modalitatea prin care frecvenţa de rotaţie acţionează asupra caracterului omogen al interacţiunilor de spin din sistem. datoraţi interacţiunii dipolare homonucleare în sisteme multi-spin. Figura 5 Spectele 1H RMN-MAS ale adamantanului (a).ră homonucleară în [ H (t1 ). forma spectrelor se apropie de cea întalnită în cazul în care predomină interacţiunile neomogene. încep să se contureze atât linia centrală de rezonanţă. care apar la multiplii întregi ai frecvenţei de rotaţie. H (t2 )] ≠ 0. respectiv adamantanul şi policarbonatul. iar pentru υR ~ 3 kHz. în care datorită numărului mare de protoni inter205 . pornind de la cazul static până la domeniul de frecvenţe înalte (35 kHz). 5 sunt prezentate spectrele 1H RMN pentru diferite frecvenţe de rotaţie υR în cazul a doi compuşi organici. respectiv ale policarbonatului (b). t2 . Evoluţia lărgimii liniilor RMN. precum şi benzile de rotaţie laterale. pentru frecvenţe de rotatie în intervalul 0 – 35 kHz Un pas foarte important în îmbunătăţirea rezoluţiei spectrale pentru sisteme de tip multi-spin. În aceste două cazuri. în Fig.

Acestea presupun aplicarea pe canalul 1H (care este şi canalul de detecţie) a unor secvenţe de pulsuri adecvate care să conducă la medierea efectului produs de interacţiunile dipolare homonucleare. la 0. De exemplu. una dintre secvenţele intens utilizate în prezent. constă în combinarea tehnicii MAS cu metode de decuplare homonucleară. PMLG. ultimele două metode fiind aplicate în timpul perioadei de evoluţie indirectă a experimentelor de tip bidimensional. 206 . de tip omogen. Figura 6 În clasa metodelor de decuplare homonucleră. În cazul sistemelor de spini cu factor giromagnetic mic (de exemplu 13C sau 15N) în abundenţă naturală (adică separaţi prin distanţe mari) cuplajele dipolare devin neglijabile.acţiunea dipolară homonucleară. iar apoi prin aplicarea celor două tehnici . pe lângă mai sus amintita metodă DUMBO. precum şi RNnυ şi SAM (Smooth Amplitude Modulation).32 ppm în cazul (b). mai pot fi enumerate şi FSLG. se numeşte DUMBO. 6 este prezentat spectrul 1H al dipeptidei β-L-Asp-L-Ala obţinut rotind proba cu υR= 65 kHz (a). astfel încât lărgimea liniei grupării metil scade de la 1. Comparând spectrele obţinute se observă o creştere apreciabilă a rezoluţiei spectrale în cazul decuplării homonucleare. astfel încât interacţiunea dominantă din sistem rămâne ecranarea chimică (cu componentele ei izotropa.1 ppm în cazul (a). deoarece este aplicabilă în cazul rotirii probei cu frecvenţe înalte de ordinul a 65 – 70 kHz. respectiv anizotropa). este predominantă. În Fig.MAS şi decuplare homonucleră cu ajutorul secvenţei DUMBO (b).

Pentru a creşte rezoluţia spectrală în aceste cazuri este nevoie de combinarea teh207 . astfel încât efectul spectrul RMN 13C al L-alaninei. υR= 1 kHz. Odată cu creşterea lui υR până la valori mari. 0.3 pentru CH3. liniile de rezonaţă fiind largi. adică η =1 în cazul grupării COO-. Forma liniilor este dată de valoarea parametrului de asimetrie. 7 corespunde unui model teoretic idealizat. situate la multiplii întregi ai frecvenţei de rotaţie. Situaţia prezentată în Fig.În acest caz. care ilustrează comportarea în condiţii de MAS a unor interacţiuni de spin de tip pur neomogen: în realitate. în care se consideră doar efectul ecranării chimice. intensităţile benzilor rotaţionale se reduc semnificativ astfel încât un spectru MAS de înaltă rezoluţie va conţine cu o bună aproximaţie doar linii poziţionate la valori ale deplasărilor chimice izotrope corespunzătoare grupărilor chimice din probă. liniile celor trei grupări se descompun într-o serie de benzi de rotaţie laterale. este de aşteptat în principiu ca odată cu creşterea frecvenţei de rotaţie a probei să se obţină spectre cu rezoluţie şi sensibilitatea spectrală din ce în ce mai înalte. nucleele 13C (15N) sunt Figura 7 Evoluţia cu frecvenţa de înconjurate în compuşii organici de un rotaţie a liniilor de rezonanţă din număr mare de protoni. Spectrul static al L-Alaninei prezintă caracteristicile tipice întâlnite în cazul unui sistem de spini izolaţi. 7. La o frecvenţă de rotaţie mică. Chiar şi în cazul frecvenţelor de rotaţie mari se vor obţine linii de rezonanţă ale 13C (15N) cu lărgimi reziduale mari dacă se foloseşte doar tehnica MAS.5 pentru CH2. în interacţiunilor suplimentare datorate acesprezenţa ecranării chimice tora nu poate fi neglijat în practică. centrate la valori ale deplasării chimice izotrope asociate fiecărei grupări chimice. evoluţia cu frecvenţa de rotaţie a liniilor într-un spectru RMN 1D într-un sistem de trei spini 13C care nu interacţionează dipolar dar sunt supuşi ecranării chimice este prezentată în Fig. respectiv 0. Din punct de vedere teoretic.

cu o diferenţă de un ordin de mărime faţă de valorile întâlnite în mod uzual în cazul compuşilor în stare lichidă.nicii MAS cu o tehnică suplimentară numită decuplare heteronucleară în scopul de a se limita efectul de lărgire produs de protonii din vecinătate. Din punct de vedere practic. Calibrarea parametrilor pe canalul 1H cu ajutorul experimentului de un puls Pentru calibrarea nivelului de putere (sau echivalent. poziţionate la valori ale deplasării chimice izotrope caracteristice fiecărei grupări structurale. sub formă continuă sau de pulsuri cu modulaţie în fază. Figura 8 După cum se observă în Fig. 8 pentru cazul spectrului RMN pe 13C al L-alaninei măsurat la o frecvenţă de rotaţie de 10 kHz. al cărui program de pulsuri este listat la finalul Secţiunii 2. valoarea B1 a câmpului rf exprimat în kHz) generat de transmiter pe canalul 1H în funcţie de valoarea atenuării (in dB) se utilizează experimentul simplu de un puls din Fig. în timpul achiziţionării semnalului RMN pe canalul 13C (15N). această tehnică constă în aplicarea pe canalul 1H a unui câmp rf intens. bine separate. procedura constă în următoarele: • Se utilizează adamantanul drept probă standard pentru calibrarea nivelurilor de putere pe canalul protonilor deoarece spectrul 208 . Lărgimile liniilor pentru toate cele trei grupări sunt în intervalul 20 – 50 Hz. În esenţă. utilizarea decuplării heteronucleare în condiţii de MAS conduce la linii de rezonanţă înguste. 7). 1. asemănătoare celor simulate pentru cazul idealizat al interacţiunilor pur neomogene (Fig.

şi stabilizarea rotaţiei la frecvenţa aleasă. p1) considerate.1 dB) în jurul valorii pentru care acesta s-a obţinut.5 dB) până se constată anularea (sau inversarea) liniei RMN-S. Pentru fiecare dintre aceste valori fixe se baleiează parametrul pl1 până când intensitatea liniei din spectrul RMN-S înregistrat devine zero. se recomandă utilizarea unor frecvenţe de rotaţie cuprinse între 10 şi 30 kHz Se începe apoi procedura de calibrare a puterilor pe canalul protonilor prin rularea repetată a experimentului de un puls (programul de pulsuri redat mai sus.67. pentru câmpuri de 100. sau direct prin comenzile p1 <valoare> (in us). Se repetă apoi în mod identic procedura de baleiere a nivelurilor de putere pl1 descrisă mai sus pentru toate valorile câmpului rf (implicit. Modificarea acestor parametri se poate face înscriind valorile dorite în tabela de achiziţie. şi respectiv pl1 <valoare> (in dB) Mai întâi se fixează durata pulsului p1 astfel încât aceasta să corespundă unui puls de 1800 pentru un set de valori dorite ale câmpului rf pe canalul 1H (de exemplu. se procedează la operaţiunile preliminare standard de acordare a frecvenţei de rezonanţă şi a impedanţelor (aşa numitele tuning şi matching). Se recomandă calibrarea în ordinea descrescătoare a câmpului rf . şi 10 us. În cazul inversării. cu lărgime mai mică decât a altor compuşi organici în fază solidă (sub 1 kHz pentru frecvenţe de rotaţie a probei mai mari decât 10 kHz). şi se determină în final valoarea exactă a pl1 pentru care intensitatea liniei se anulază complet: această valoare va corespunde deci pulsului de 1800 pentru câmpul rf considerat. p1 = 5. se scanează pl1 cu paşi mai mici (0. caz în care se va putea începe cu o valoare de strat pl1 = 2-0 dB care va fi scăzută în paşi mai mari la început (de exemplu 0. Aceste proprietăţi favorabile conduc la o sensitivitate şi o rezoluţie foarte bună care permit calibrarea rapidă şi precisă a pulsului de 1800 (după cum se va descrie mai jos). şi se utilizează comanda zg). ceea ce reduce foarte mult tăria cuplajelor dipolare 1H-1H După plasarea probei în magnet. şi se datorează faptului că molecula de adamantan nu este rigidă în reţeaua cristalină ci efectuează mişcări rapide de rotaţie simultan în jurul a trei axe de simetrie.• • • • RMN-S 1H al acestui compus constă dintr-o singură linie. 75 şi 50 kHz). Trebuie avut însă în vedere că scăzând câmpul 209 . 6. în cadrul căruia se modifică durata pulsului (p1) şi nivelul de putere asocial (pl1) şi se înregistrează spectrul RMN-S 1H al adamantanului. În funcţie de capul de probă folosit.

phn.cp (TopSpin 2. deoarece monitorizarea rezultatului prin intermediul unui semnal care se anulează este mai sensibilă decât dacă s-ar urmări valoarea maximă a acestuia. Calibrarea parametrilor pe canalul 13C cu ajutorul experimentului CP-MAS Secvenţa de pulsuri asociată experimentului de Cross-Polarizare în condiţii MAS (CP-MAS) este ilustrată în Fig. pentru a se evita de exemplu să se pornească cu o valoare care deja corespunde unui puls > 1800. În practică se preferă calibrarea prin intermediul pulsului de 1800 şi nu 900. descrisă în Fig. şi respectiv de fază. şi implementarea ei pe spectrometrul Bruker. 9 utilizând reprezentarea schematică convenţională din RMN. şi delay-uri. 9. şi listat mai jos. Pentru a face mai uşoară o comparaţie directă între aceasta reprezentare schematică. pln. sau <valoare> us).basic cp experiment 1 ze 2 d1 do:f2 210 . incluşi în programul de pulsuri cp-const asociat acestei secvenţe. pn.0) . în figură sunt menţionaţi explicit parametrii de timp (pulsuri. dn. de putere. Figura 9 # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-const" .• rf valoarea de start a parametrului pl1 creşte în mod corespunzător.

pl12 is used here with tppm. El este un experiment standard în spectroscopia RMN-S care se utilizează atât pentru înregistrarea spectrelor 1D convenţionale ale nucleelor cu factor giromagnetic mic.2. 1m exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 .pl12 is used here with cw . se va considera în detaliu doar primul aspect.1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u pl12:f2 . Procesul de transfer de polarizare 1H <-> 13C(15N) prin aşa-numitul mecanism de polarizare încrucişată (cross-polarization. ν1H = ν13C +(-) nνR. la condiţia de matching n =1: aceasta înseamnă că valoarea câmpului pe canalul 13C(15N) va fi astfel calibrată încât să fie mai mare (sau mai mică) cu valoarea frecvenţei de rotaţie a probei. În general se lucrează cu valori ale câmpului în jur de 50 kHz pe canalul protonilor. deoarece presupune aplicarea de câmpuri rf (pulsuri) simultan pe două canale distincte (f1: 13C şi f2: 1H în cazul particular ilustrat mai sus).13C(15N) şi se desfăşoară în condiţiile iradierii simultane cu câmpuri rf pe canalele asociate (aşa numitele pulsuri de contact: Fig. şi vom începe prin a explica de ce se preferă în practică experimentul CP-MAS pentru a înregistra spectre RMN-S 1D ale 13C(15N) în locul experimentului mult mai simplu de un puls. cât şi ca parte componentă în experimente multi-dimensionale mai complexe. Procesul de transfer prezintă maxime de eficienţă dacă amplitudinile celor două câmpuri rf de contact satisfac aşa-numita condiţie Hartmann-Hahn de matching. În cadrul prezentului raport. and p30 the pulse CP-MAS este un experiment de dublă rezonanţă.go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. unde n=1. De exemplu. precum 13C sau 15N. CP) este un proces coerent generat de interacţiunile dipolare heteronucleare 1H. pentru o rotaţie cu νR = 15 kHz (o valoare uzuală pentru înregistrarea spectrelor 13C) a probei în jurul unghiului magic. este necesară calibrarea unui câmp rf pe canalul carbonului de 35 sau 65 kHz pentru a asigura un transfer maxim de 211 . 9).

până la 1-2 ms: această durată depinde direct de tăria medie a cuplajelor dipolare dintre fiecare spin 13C din probă şi protonii cei mai apropiaţi. un experiment CP/MAS standard (sau convenţional) se derulează în modul următor: mai întâi se aduce polarizarea longitudinală a spinilor nucleari 1H în planul transversal (de exemplu de-a lungul direcţiei x.13C este de aproximativ 2. Ambele mecanisme conduc la creşterea substanţială a sensibilităţii spectrale în cazul utilizării metodei CP/MAS. Deoarece. 9. De asemenea. prin aplicarea pulsului p3 de 900 cu faza y pe canalul f2 asociat protonilor). însă şi în aceste condiţii câştigul în intensitate al semnalului RMN este semnificativ. Această polarizare este apoi „blocată” – aşa-numitul „spin locking” – cu ajutorul pulsului de contact p15 aplicat pe canalul f2 cu faza x (deoarece direcţia câmpului rf asociat şi direcţia polarizării trebuie să coincidă). d1. Plecând de la secvenţa de pulsuri ilustrată schematic în Fig.15N la aceeaşi distanţă internucleară.5 ori mai mare decât cuplajul 1H. Deoarece la echilibru termic raportul dintre aceste polarizări este proporţional cu raportul factorilor giromagnetici corespunzători. În realitate aceşti factori teoretici sunt rareori obţinuţi în practică datorită proceselor de relaxare care se desfăşoară pe durata pulsului de contact. în Fig. şi nu polarizarea asociată nucleelor 13C(15N). Polarizarea transferată pe 212 . Simultan se aplică pulsul de contact de aceeaşi durată p15 şi pe canalul carbonului cu un nivel de putere corespunzător unui transfer maxim de polarizare 1H->13C (adică să satisfacă una dintre condiţiile de matching Hartmann-Hahn descrise mai sus). 9). Utilizarea polarizării transferate de la protoni mai are încă un avantaj important care este determinat de valorile mult mai mici ale timpului de relaxare longitudinal T1 în cazul nucleelor 1H în comparaţie cu cei asociaţi 13C(15N): deoarece aceşti timpi practic guvernează valoarea duratei de repetiţie a experimentului (aşa-numita recycle delay. cuplajul dipolar 1H. rezultă că într-un anumit interval dat se pot acumula mult mai multe scanuri cu ajutorul CP/MAS decât ar fi posibile în cazul utilizării experimentului simplu de un puls.polarizare 1H -> 13C. comparativ cu intensitatea care s-ar obţine printr-un experiment de un puls. şi valoarea optimă a pulsului de contact va creşte corespunzător (în acest caz se obţine un transfer maxim de polarizare la valori ale p15 cuprinse între 3-7 ms). şi respectiv de zece ori în cazul spinilor 15N. şi respectiv programul de pulsuri asociat. valorile optime pentru durata pulsului de contact (p15) în cazul nucleelor de 13C este cuprinsă între câteva sute de μs. Avantajele principale ale unui experiment CP-MAS rezultă din faptul că polarizarea iniţială care conduce la formarea semnalului RMN-S este cea transferată de la spinii 1H. rezultă o amplificare de aproximativ patru ori în intensitatea semnalului RMN-S 13C.

cu performanţe îmbunătăţite. adamantanul este considerat un compus ideal pentru procesul de calibrare a experimentului CP/MAS. cu Δφ având valori cuprinse în general între 15 şi 300. ceea ce conduce la o sensibilitate spectrală foarte bună. respectiv la un timp de acumulare scurt. toate tehnicile de decuplare heteronucleară constau în aplicarea unui câmp rf pe canalul protonilor de-a lungul întregii durate de achiziţie a semnalului RMN. TPPM este tehnica de decuplare heteronucleară cel mai des utilizată pentru înregistrarea de spectre 13C RMN-S pe compuşi organici cristalini. Pentru a obţine spectre RMN-S 13C de calitate ale compusului studiat. care conţine două subcicluri suprapuse: (i) alternarea cu 1800 a fazei pulsului p3. În final trebuie menţionat că detecţia FID-ului se face în condiţii de decuplare heteronucleară. iar în cadrul unei metode mai recente. respectiv 0. adică în cazurile în care nu este necesar aplicarea unor câmpuri rf de decuplare foarte intense. respectiv ph3 = 90 şi 2700. numita TPPM (Two Pulse Phase Modulation) câmpul se aplică sub formă de trenuri de două pulsuri cu faze alternante. adică prin utlizarea unor tehnici speciale care au drept scop minimalizarea efectelor produse de interacţiuniile dipolare 1H-13C şi 1H-1H (în special efectul de lărgire a liniilor spectrale) pe durata achiziţionării semnalului RMN 13C. pentru un experiment CP/MAS: în acest fel. φ = φ + Δφ. Compuşii standard cel mai des utilizaţi în acest scop sunt adamantanul (calibrarea nivelelor de putere pe canalul carbonului) şi glicina (ajustarea valorii unghiului magic). În mod uzual un experiment CP/MAS se efectuează cu un phase cycling de 8 paşi. câmp ce trebuie să satisfacă anumite cerinţe în funcţie de condiţiile experimentale concrete: în cadrul celei mai simple metode.durata lui p15 se construieşte de-a lungul direcţiei câmpului de contact aplicat pe canalul f1: aceasta reprezintă în fapt o polarizare transversală a spinilor 13C astfel că. a fazei receptorului în sincronie cu faza ph1 a pulsului de contact pe canalul f1 (aşa-numitul Cyclops phase cycling) pentru a elimina eventualele imperfecţiuni ale circuitelor de detecţie în cuadratură. în momentul încetării acţiunii pulsului de contact. parametrii caracteristici ai experimentului CP/MAS trebuie mai întâi calibraţi cu ajutorul unor compuşi de referinţă (standard). ea evoluează liber şi poate fi achiziţionată ca şi semnal RMN (FID). câmpul se aplică în mod continuu cu faza arbitrară. deoarece acesta necesită în general 213 . numite Continuous Wave – CW. şi (ii) alternarea în paşi de 900. 180 şi 2700. Ca şi în cazul calibrării puterilor pe canalul 1H. 90. de ordinul zecilor de secunde. însă şi metoda CW este preferată uneori. pentru a elimina contribuţia polarizării iniţiale a spinilor 13C la semnalul detectat. de exemplu în scopul calibrării experimentului CP/MAS. adamantanul prezintă avantajul că se obţin linii 13C RMN-S relativ înguste (2-3 Hz). sau la înregistrarea de spectre 15N RMN-S. În principiu.

5 ppm. determinate de grupările CH şi CH2 din moleculă). se porneşte de la valori mari ale lui pl1 (de exemplu. Corespunzător acestor elemente. cu n = 0. respectiv a eficienţei procesului de transfer de polarizare prin CP. 2. Valorile particulare ale parametrului pl1 pentru care se obţin aceste maxime se transformă în valori ale câmpului rf asociat utilizând relaţia ν13C = 50 kHz +(-) nνR. 9.1 dB mergând înspre valori mici. Conform schemei experimentale din Fig. astfel încât acestea să corespundă unei valori a câmpului rf de 50 kHz: şi în acest caz se utilizează rezultatele anterioare ale calibrării puterilor pe canalul 1H. • Se setează valorile pl2 şi pl12. Setul de spectre obţinut astfel furnizează aşa-numită curba de matching Hartmann-Hahn. Curba de matching Hartmann-Hahn prezintă cinci maxime corespunzătoare celor cinci condiţii menţionate anterior.5 şi 38. pl2 şi pl12 (în condiţiile în care se consideră fixate valorile pulsurilor p3 şi p15. şi respectiv câmpul de decuplare prin CW. trebuie deci calibrate puterile pl3. respectiv dependenţa puterii pe canalul 13C a intensităţii spectrale. • Se ajustează valoarea puterii pl1 a câmpului de contact pe canalul carbonului până când se obţine o intensitate maximă a liniilor RMN în spectrul CP/MAS achiziţionat. 1. Aceasta este etapa cea mai laborioasă din cadrul procedurii. frecvenţa de iradiere pe canalul f2 va fi cea corespunzătoare frecvenţei de rezonanţă a liniei adamantanului din spectrul 1H RMN-S. Plecând de la aceste considerente. iar metoda de decuplare utilizată pentru adamantan este CW). (ii) nivelurile de putere ale pulsurilor de contact p15 pe cele două canale sunt astfel ajustate încât să îndeplinească condiţia Hartmann-Hahn de matching descrisă mai sus. 5 dB) şi se scanează acest parametru în paşi de 0. procedura de calibrare a experimentului CP/MAS poate fi descrisă pe scurt în felul următor: • Pentru valorarea fixată a lui p3 se setează puterea pl3 (determinată anterior în procesul de calibrare a puteriolor pe canalul protonului) astfel încât aceasta să corespundă unui puls de 900. 214 . pl1. şi (iii) tehnica de decuplare utilizată să conducă la îngustarea maximă posibilă pentru compusul dat. În particular.achiziţionarea unui număr mare de spectre până când sunt determinate valorile optime ale tuturor parametrilor de interes. În cazul fiecărui parametru optimizarea se face prin maximizarea intensităţii liniilor RMN în spectrul achiziţionat (în cazul particular al adamantanului avem două linii poziţionale la 29. intensitatea spectrală obţinută este maximă dacă sunt îndeplinite simultan următoarele trei condiţii: (i) pulsul p3 pe canalul protonilor este un puls 900. Pentru a evita posibile efecte de offset. pentru pulsul de contact pe canalul protonului.

Oxford University Press.• În final. Bodenhousen. Guenther. 2008 215 . R. Keeler. Principles of Nuclear Magnetic Resonance în One and Two Dimensions. Spin Dynamics: Basics of Nuclear Magnetic Resonance. Wiley 2001 Bruker Biospin Group. Elsevier Science 2007 H. 3.5 ppm) are lărgime minimă (implicit. Wokaun. TOPSPIN User Manual. de ordinul a 50 kHz. prin modificarea uşoară a puterii pl3 în jurul valorii fixate iniţial. Această etapă este necesară deoarece valorile câmpului rf pe canalul 1H în general sunt determinate cu un grad de eroare mai mare prin experimentul de un puls decât cu ajutorul experimentului CP/MAS. 6. şi se reţine acea valoare pentru care intensitatea spectrală atinge un maxim absolut. În practică.Bibliografie 1. Ernst. Alegerea acestui compus standard este motivată de faptul că el are un spectru RMN-S simplu care conţine doar două linii (deci sensibilitate spectrală mare) dintre care una corespunde grupării carbonil a cărei lărgime este foarte sensibilă la deplasări mici ale înclinării axei de rotaţie a probei faţă de valoarea unghiului magic: acest efect se datorează anizotropiei mari a deplasării chimice.H. Oxford 1987 M. amplitudine maximă). pentru o ajustare mai fină a pulsului iniţial de 900 pe canalul protonului se revine la primul pas. Experimentul CP/MAS cu parametri calibraţi pe adamantan din punct de vedere al nivelurilor de putere. se utilizează în continuare pe glicină pentru ajustarea valoarii unghiului magic şi pentru optimizarea pulsurilor p31 asociate decuplării prin metoda TPPM. se modificăa uşor înclinarea axei rotorului până ce se obţine un spectru 13C RMN-S a glicinei în care linia carbonilului (de la 176. 4. Pentru valoarea setată a lui pl12. nu mai poate produce o rezoluţie spectrală satisfăcătoare. G. astfel încât calibrarea lui p31 se face pornind de la această valoare de referinţă. 5. Gullion. A. Wiley 2008 J. astfel încât se preferă metoda TPPM la câmpuri intense (ideal pl12 ar trebui să corespundă unor câmpuri de cel puţin 100 kHz). Levitt. Datorită faptului că glicina este o moleculă relativ rigidă în reţeaua cristalină (aşa cum sunt majoritatea compuşilor organici) decuplarea prin CW la câmpuri mici. 4. Understanding NMR Spectroscopy. După acest pas este trecut se procedează în continuare la ajustarea pulsului p31 în secvenţa de decuplare heteronucleară prin TPPM pentru a se obţine în final îngustarea maximă posibilă a liniilor spectrale. 2. NMR Spectroscopy. Wiley 2010 T. Introduction to High-Resolution Solid-State NMR. durata optimă a pulsului p15 se apropie în general de cea a unui puls de 1800.R.

........................................ dar care nu necesită transformarea lor în spectre 2D............. în ordinea creşterii complexităţii lor: se vor descriere mai întâi experimente care necesită înregistrarea de seturi de date bidimensionale (2D)........................... Bibliografie ...... nu vor putea fi prezentate o serie de metode RMN-S intensiv utilizate în domeniu.... însă doar în cazul acelor compuşi unde se obţine o rezoluţie spectrală satisfăcătoare în condiţiile tehnice date.. Vor fi ilustrate de asemenea tehnici bazate pe detecţia 1H.........I............................ Accentul va fi pus pe experimente RMN-S de dublă rezonanţă pe 13C.. şi vom ajunge în final la prezentarea de metode care 216 ..............S.........Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă C.... care să permită rotaţii ale probei până la 70 kHz................... Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C ..219 3........ metode ce au fost până în prezent implementate şi testate experimental pe infrastructura existentă la UBB Cluj......... Introducere În acest raport se vor prezenta în mod detaliat o serie de experimente RMN-S avansate................. sau metode de înaltă rezoluţie pe 1H................ chiar dacă nu pot fi utilizate în practică la UBB Cluj.............................. Introducerea metodelor se va face progresiv............III....... Deoarece acestea sunt considerate ca făcând parte din „arsenalul de bază” al metodologiei moderne RMN-S pe sisteme moleculare organice.................. dr......... cu aplicaţii în investigarea structurii sistemelor moleculare organice cristaline...............216 2. dr....... care necesită o electronică adaptată secvenţelor de decuplare homonucleară [2] şi/sau capuri de probă de tip „ultra-fast MAS”.......237 5. recomandăm studenţilor aprofundarea lor cel puţin la nivel teoretic (consultând bibliografia indicată mai sus).. Drept urmare............. Introducere . Claudiu Filip C..........245 1..... Metode RMN-S 2D de corelare 13C-13C ........................... Mihaela Aluaş Cuprins 1.............................S......................... Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) ............................226 4.. de exemplu cele care implică lucrul simultan pe trei canale rf [1] (metode de triplă rezonanţă)..

Figura 1: Schema de principiu a unui experiment RMN bidimensiuonal (2D) În prima perioadă. polarizare transversală. t1 şi t2. 1. în urma cărora se generează o mărime fizică asociată sistemului de spini (de ex. în afară de aspecte pur practice se va face şi o scurtă prezentare a fundamentelor teoretice pe care aceasta se bazează. De asemenea. şi va depinde explicit de ambele variabile temporale. pentru fiecare tehnică RMN-S avută în vedere. prin intermediul semnalul RMN. Pentru a se obţine spectrul în frecvenţă. 3Δt1…nΔt1. cea de preparare. 217 . 2Δt1. unde spectrul RMN se obţine prin transformarea Fourier a FID-ului. semnalul RMN bidimensional constă dintr-un set de n FID-uri. se înregistrează şi se stochează FID-ul corespunzător acestei valori. deoarece ea defineşte corelaţiile care se stabilesc între mărimile care evoluează în t1 şi polarizarea transversală asociată fiecărui spin care se detectează în mod direct.) care va evolua pe durata t1. pe durata lui t2. este de menţionat că. în spectroscopia RMN bidimensională (2D). în acest caz transformata Fourier trebuie aplicată de două ori. respectiv că toţi parametri experimentali relevanţi. În fiecare caz. unde n este de obicei cuprins între câteva zeci şi câteva sute). coerente de mai multe cuante. se aplică unul sau mai multe pulsuri rf. Un spectru RMN 2D se obţine în următorul mod: se aplică secvenţa de pulsuri pentru t1 = 0. şi în special nivelurile de putere pe fiecare canal rf.furnizează informaţii structurale pe bază de spectre RMN-S 2D de corelaţie. Apoi se repetă aceeaşi procedură pentru t1 egal cu multiplii întregi ai perioadei de sampling Δt1 (adica Δt1. au fost calibrate corespunzător. Spre deosebire de varianta unidimensională. Secvenţa de mixing are rolul cel mai important într-un experiment 2D. Schema generală pentru un experiment RMN bidimensional este redată în Fig. se presupune că mai întâi au fost parcurşi paşii prezentaţi în raportul anterior. Următoarea perioadă – perioada de mixing. semnalul RMN este descris de o funcţie care depinde de două variabile de timp. Această succesiune de perioade poartă denumirea de secvenţă de pulsuri 2D. t1 (corespunzător dimensiunii indirecte F1) şi t2 (corespunzător dimensiunii directe F2). iar informaţia care se regăseşte în spectrul RMN depinde concret de tipul interacţiunii care a fost selectată în perioadele de preparare şi de mixing. etc. constă în aplicarea celui de-al doilea puls (sau pulsuri) de radiofrecvenţă. În consecinţă.

Figura 2: Exemple de spectre RMN 2D şi modalitatea în care apar peakurile diagonale. în funcţie de succesiunea de pulsuri aleasă. se obţine spectrul anizotrop al interacţiunii recuplate. şi respectiv de corelare [3]. iar în dimensiunea indirectă. generează spectre care conţin ambele tipuri de peak-uri. Spre deosebire de spectrele RMN 2D de separare. iar interacţiunea recuplată va genera peakuri de corelatie (cross-peakuri) între nucleele diferitelor grupări chimice dintr-un anumit compus. 2(c). numite peak-uri diagonale. separat. pentru fiecare linie izotropă. Un alt tip de peak-uri care se pot obţine într-un spectru RMN 2D. dacă într-un spectru 2D va apărea un peak poziţionat la ωA în dimensiunea F1 şi la ωB în dimensiunea F2 (aşa numitele cross-peakuri). Conform schemei generale a unui experiment 2D. iar pe durata perioadei de mixing acelaşi semnal a fost transformat cu ajutorul unei anumite secvenţe de pulsuri într-un alt semnal care evoluează cu frecvenţa ωB pe durata t2. vor exista diferenţe în ceea ce priveşte (i) mărimea fizică asociată sistemului de spini (de exemplu coerente de una sau mai multe cuante). De 218 . de exemplu Fig. F1. În cazul spectrelor bidimensionale de separare. respectiv cross-peakurile Modul de apariţie a peak-urilor în spectre RMN bidimensionale şi interpretarea acestora vor fi descrise pe scurt în cele ce urmează. o secvenţă de pulsuri specifică spectroscopiei RMN 2D de separare corespunde cazului particular în care domeniul temporal indirect. şi perioada de mixing coincid. Multe dintre tehnicile RMN 2D utilizate în mod curent. în dimensiunea F2 se obţine spectrul izotrop al compusului studiat. care va evolua în dimensiunea indirectă F1. În practică. În funcţie de tipul de experiment RMN de corelare utilizat. atunci pe durata perioadei de preparare s-a format un semnal care a evoluat cu frecvenţa ωA de-a lungul lui t1. ilustrată în Fig. se pot obţine două tipuri distincte de spectre RMN 2D: de separare. t1. Astfel. corespund cazului în care frecvenţa de rezonanţă a unui semnal generat în timpul perioadei de preparare va rămâne neafectată de pulsul (sau pulsurile) care alcătuieşte perioada de mixing. şi (ii) interacţiunea de spin recuplată pe durata perioadei de mixing. 1. în cazul spectrelor de corelare ambele dimensiuni codifică deplasările chimice izotrope.

variabilele notate cu albastru. parametri adimensionali. niveluri de putere ale pulsurilor rf. de putere. şi anume. incluşi în programul de pulsuri cp-var asociat acestei secvenţe.) sunt reprezentate cu negru. se foloseşte aceeaşi convenţie ca şi în raportul anterior. Pentru a face mai uşoară o comparaţie directă între această reprezentare schematică. în figură sunt mentionaţi explicit parametrii de timp (pulsuri. şi listat mai jos. pln. etc. experimentele bidimensionale pot fi clasificate şi în funcţie de tipul de nuclee implicate. Toate celelalte elemente (comenzi. utilizând reprezentarea schematică convenţională din RMN. şi delay-uri.asemenea. şi implementarea ei pe un spectrometru Bruker. şi anume experimente de corelare homonucleare sau heteronucleare. roşu şi verde reprezintă durate. sau <valoare> us). phn. Figura 3: Reprezentarea schematică a experimentului RMN 2D de investigare a transferului de polarizare 1H-13C prin intermediul secvenţei CP-MAS clasice 219 . Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C Metoda RMN-S 2D bazată pe secvenţa CP-MAS clasică Exemplul cel mai ilustrativ al unei metode RMN-S 2D de separare este reprezentat de experimentul de recuplare a interacţiunii dipolare heteronucleare C – H cu ajutorul secvenţei clasice CP-MAS ce are drept efect un transfer de polarizare între protoni şi nucleele 13C din vecinătate. Referitor la notaţiile atât în reprezentarea schematică. şi respectiv de fază. descrisă în raportul anterior. cu eficienţe care depind de distanţele dintre spinii nucleari implicaţi. dn. cât şi în programul de pulsuri. 3. şi respectiv faze asociate acestor pulsuri. 2. pn. Secvenţa de pulsuri asociată acestui experiment este redată mai jos în Fig.

se aplică transformata Fourier de-a lungul dimensiunii directe (F2) prin intermediul comenzii xf2. 1m 1m if 1m ivp lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 . În programul de pulsuri. şi se obţine astfel 220 . secvenţele CP-MAS efectiv utilizate diferă între ele prin durata pulsului de contact.pl12 is used here with tppm. modul de achiziţie 2D este specificat prin comenzile de incrementare şi de repetiţie (loop) specifice: if (increment file – trece la un nou fişier unde va fi stocat următorul FID din cadrul setului de date 2D). experimentul descris în Fig. urmează procesarea datelor: concret.cp (TopSpin 2.pl12 is used here with cw . lo to 2 times td1 (loop la linia 2.0) . Lista este cuprinsă în fişierul care este specificat în tabela parametrilor de achiziţie.basic cp experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (vp ph1):f1 (vp ph2):f2 1u pl12:f2 .go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. După achiziţionarea celor N semnale RMN distincte. achiziţionate prin intermediul secvenţei CP-MAS clasice: la fiecare dintre cele N repetiţii ale experimentului. 3 presupune înregistrarea unui set de date 2D. ivp (increment variable pulse – trece la următoarea valoare a pulsului de contact specificată în lista de pulsuri). de un număr de ori specificat prin parametrul de achiziţie td1) – repetă experimentul de N ori (N = td1) pentru a acumula toate datele prevăzute în experimentul 2D.# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-var" . care constă dintr-un număr N de semnale RMN 13C distincte. Valorile acestor pulsuri sunt stocate într-o aşa-numită listă de pulsuri (variable pulse list) care este apelată în cadrul programului de pulsuri prin comanda vp (variable pulse). and p30 the pulse În esenţă.

Astfel. dinamica procesului de transfer de polarizare de la protonii învecinaţi (în principiu. cu cât rata de creştere a unei astfel de curbe CP este mai mare şi oscilaţiile dipolare mai pronunţate (vezi curba CP corespunzătoare grupării CH comparativ cu cele pentru CH3. pentru durate ale pulsului de contact p15 cuprinse în intervalul 0 – 200 μs e preferabilă utilizarea unei eşantionări în paşi egali (de exemplul. Pentru fiecare dintre liniile RMN din spectru. În Fig. Transformata Fourier s-a aplicat doar în dimensiunea directă. Acesta este format din N spectre 13C CP-MAS. cu atât cuplajul dipolar heteronuclear asociat este mai puternic. cu cele trei linii de rezonanţă caracteristice grupărilor CH. Peste această valoare a lui p15 se pot utiliza creşteri cu paşi din ce în ce mai mari. care coincide cu numărul de puncte ce definesc curbele CP-MAS înregistrate. obţinându-se în final aşa-numitele curbe CP-MAS. contribuţii însemnate vor avea cei situaţi până la o distanţă de 2. 4 este prezentat un set de date bidimensional înregistrat utilizând tehnica descrisă mai sus în cazul particular al L-Alaninei. se reprezintă grafic evoluţia intensităţii de linie în funcţie de durata lui p15. Pentru a putea caracteriza şi parametrii relaxării spin-reţea în sistemul rotitor. Dacă transformata Fourier se aplică şi de-a lungul lui t1.5-3 Å). care afectează dinamica procesului de transfer de polarizare 1H -> 13C la durate de ordinul milisecundelor. astfel încât numărul de N de repetiţii ale experimentului. aşezate în ordinea crescătoare a duratei pulsurilor de contact p15 utilizate.setul de date 2D. proprietăţile caracteristice ale unei asemenea curbe descriu. CH3. obţinându-se spectrul izotrop al compusului. respectiv COOH. 5 – 10 μs). pentru fiecare poziţie chimică distinctă a atomilor de carbon din sistemul molecular investigat. să fie menţinut la o valoare rezonabilă. Procedura descrisă mai sus face parte dintr-o clasă mai largă de metode RMN-S numite 221 . în locul curbelor CP se vor obţine aşa-numitele spectre dipolare: cele două modalităţi de a extrage informaţii despre parametrii interacţiunii dipolare sunt însă echivalente. 30-50. şi se manifestă prin apariţia aşa-numitelor oscilaţii dipolare în curbele CP-MAS corespunzătoare. ţinând cont de caracteristicile procesului de transfer de polarizare 1H -> 13C. Considerând variaţia intensităţilor de linie cu poziţia spectrului CP-MAS din setul de date 2D. deoarece în interiorul acestui domeniu temporal caracterul coerent al procesului de transfer este dominant. se recomandă de asemenea înregistrarea curbei până la valori ale pulsului de contact de 3 – 5 ms. în dimensiunea indirectă se obţin curbele de transfer de polarizare (CP) corespunzătoare fiecărei grupări chimice: forma specifică a fiecărei dintre aceste curbe reflectă tăria cuplajelor dipolare heteronucleare recuplate. În practică. respectiv COOH).

însă extinde domeniul acesteia de aplicabilitate prin încorporarea unei noi secvenţe în perioada de preparare. care să ţină cont de detaliile structurale dorite. cum ar fi metodele LG (Lee-Goldburg) sau FSLG (Frequency-Switched Lee-Goldburg). Aceste curbe au fost înregistrate după ce în prealabil puterile pe cele două canale rf au fost calibrate la condiţia n = -1 de matching Hartmann-Hahn. În general. 5]. prin combinarea tehnicii de recuplare heteronucleară CP cu metode de decuplare homonucleară a protonilor.de tip SLF (Separated Local Field Spectroscopy): în cadrul acestora. Figura 4: Set de date 2D obţinut în cazul compusului L-alanina. se obţine o recuplare eficientă a interacţiunii dipolare heteronucleare. şi de prezenţa sau nu a ordonării în probele investigate. Metoda Remote Protons CP-MAS O nouă metodă RMN-S 2D de separare este bazată pe experimentul anterior. în condiţii de rotire a probei la unghi magic. tehnica CP-MAS de recuplare a interacţiunii dipolare heteronucleare este în general înlocuită cu tehnici mai sofisticate [4. În dimensiunea directă se aplică transformata Fourier şi se obţin liniile de rezonanţă ale grupărilor chimice din compus. această secvenţă numită CPPI (Cross-Polarization Polarization-Inversion) are drept scop generarea unei 222 . iar în dimensiunea indirectă sunt ilustrate curbele CP corespunzătoare acestor grupări.

cp (TopSpin 2. cum este cazul experimentului CP-MAS clasic. and p30 the pulse 223 . iar faza celui de-al doilea bloc este inversată în raport cu faza primului.remote protons CP-MAS experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 (p16 ph1):f1 (p16 ph6):f2 (vp ph1):f1 (vp ph8):f2 1u pl12:f2 .go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. care poate fi creată cu ajutorul configuraţiei experimentale formată din cele două blocuri CP ale secvenţei CPPI de durate bine determinate.0) . p15 şi p16. Noua stare iniţială constă într-o distribuie neuniformă a polarizării protonilor.stări iniţiale diferită de polarizarea uniformă 1H.pl12 is used here with cw . Figura 5: Reprezentarea schematică a experimentului RMN 2D „Remote Protons CP-MAS” de investigare a transferului de polarizare 1H-13C de la protonii nelegaţi chimic de catonii din probă # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/rem_prot_cp" .pl12 is used here with tppm. 1m 1m if 1m ivp .

lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph4= 2 ph31= 0 2 2 0 1 3 3 1

Alternând fazele celor două pulsuri CP care formează secvenţa CPPI se creează o stare iniţială de polarizare egală cu zero atât pentru nucleul 13C, cât şi pentru protonii direct legaţi chimic de acesta. Ca o condiţie necesară pentru ca în curbele de transfer de polarizare să fie cuantificat doar procesul de transfer de la protonii îndepărtaţi, secvenţa CPPI trebuie să aducă simultan la zero polarizarea spinului central 13C şi a protonilor direct ataşaţi, în timp ce polarizarea protonilor îndepărtaţi este menţinută la o valoare cât mai mare. Pentru a verifica în ce măsură această condiţie este îndeplinită, am efectuat simulări numerice utilizând programul Spinevolution. În acest scop, sistemul de spini ales este format dintr-un nucleu 13C înconjurat de 7 protoni, care aparţin moleculei de L-Alanina. Pentru cazul grupării CH rezultatele analizei sunt prezentate în Fig. 6: în aceste grafice este ilustrată evoluţia polarizării pentru fiecare spin din sistem în funcţie de creşterea timpului de inversie, p17, şi pentru trei valori diferite ale frecvenţei de rotaţie, νR = 5; 8, respectiv 15 kHz. Pentru sistemul de spini utilizat, primul bloc CP are o durata fixă, p16 = 70 μs, corespunzătoare transferului maxim de polarizare de la protonul legat chimic de spinul central 13C. Dependenţa curbelor de polarizare

Figura 6: Simulări ale dependenţei polarizării de spin de timpul de inversie τ2 din secvenţa de pulsuri CPPI pentru υR = 5; 8 respectiv 15 kHz, în cazul grupării CH din L-Alanina. Prin linie continuă sunt reprezentate curbele de inversie ale polarizării pentru spinul 13C (cu negru), respectiv a protonului legat chimic de acesta (cu roşu). Cu linie punctată este reprezentată polarizarea remanentă pe protonii îndepărtaţi, care aparţin grupării CH3 (albastru), respectiv NH3 (verde) din sistemul de spini considerat.

224

din Fig. 6 arată că polarizările din cadrul grupării CH (adică nucleului 13C şi a protonul sau direct ataşat) pot fi aduse simultan la zero pentru frecvenţe de rotaţie a probei mai mari decât 5 kHz, iar valoarea efectivă a duratei pulsului p17 pentru care această condiţie este îndeplinită depinde în mod explicit de valoarea frecvenţei de rotaţie: de exemplu pentru νR = 8 kHz se obţine un puls de contact p17 cu o durată de 42 μs. În măsura în care starea iniţială dorită poate fi generată cu ajutorul secvenţei CPPI, curbele de transfer de polarizare înregistrate experimental prin incrementarea duratei celui de-al treilea bloc CP din Fig. 5 se consideră ca reflectă doar contribuţia protonilor îndepărtaţi. Pentru a verifica acest lucru, predicţiile teoretice referitoare la procesul de transfer de polarizare de la protonii îndepărtaţi realizat prin noua metodă Remote Protons CP-MAS, au fost testate experimental [6]. În acest scop, am extins configuraţia utilizată în simulări numerice la un sistem de 10 spini (9 protoni şi un nucleu 13C) din L-Alanina, iar curbele CP simulate au fost comparate cu cele experimentale. Molecula de L-Alanina a fost alesă deoarece poziţiile protonilor, şi implicit distanţele H-H şi C-H, sunt determinate precis, prin difracţie de neutroni (cu precizie de ±0.003 Å). Simulările numerice au fost efectuate considerând două cazuri distincte şi anume: în primul caz se consideră gruparea NH3 ca fiind rigidă, iar în cel de-al doilea caz aceeaşi grupare se consideră în regim de rotaţie rapidă în jurul axei sale. În ambele situaţii gruparea CH3 este considerată a efectua o mişcare de rotaţie rapidă. Prin compararea curbelor CP-MAS simulate cu cele experimentale (Fig. 7)

Figura 7: Comparaţia între curbele CP/MAS teoretice şi experimentale corespunzătoare nucleului 13C din gruparea CH din L-Alanina, obţinute prin utilizarea secvenţei CP clasice (curbele roşii), respectiv a secvenţei de transfer de la protonii nelegaţi (curbele cu albastru). Curbele experimentale sunt reprezentate prin cercuri, iar cele simulate prin linie punctată (pe un sistem format din 8 spini), respectiv linie continuă (sistem format din 10 spini). Gruparea CH3 se consideră a efectua o mişcare de rotaţie rapidă în ambele cazuri, iar gruparea NH3 se consideră în aproximaţie rigidă în (a), respectiv în regim de rotaţie rapidă în (b).

225

se observă o foarte bună concordanţă în cazul în care gruparea NH3 este considerată quasi-rigidă. Totuşi, există unele mici diferenţe între curba calculată şi cea măsurată, diferenţe care cel mai probabil se datorează faptului că gruparea NH3 efectuează în realitate o mişcare de rotaţie lentă (la scală de timp a procesului de transfer de polarizare, de ordinul µs). Cea mai importantă concluzie care rezultă în urma comparării efectuate este sensibilitatea crescută a curbei Remote CP-MAS la dinamica moleculară prezentă în sistemul molecular studiat, în timp ce curba CP clasică nu este atât de sensibilă la detalii ale mişcării moleculare caracteristice grupării NH3.

3. Metode RMN-S 2D de corelare 13C-13C
Metoda Proton Driven Spin-Diffusion Metoda RMN-S 2D numită Proton Driven Spin Diffusion (PDSD) este o metodă de corelare: după cum se observă din schema experimentală asociată acestui experiment (Fig. 8), pe durata ambelor perioade de evoluţie indirectă şi directă, t1 şi t2, magnetizarea transversală 13C evoluează în condiţii de decuplare heteronucleară prin TPPM aplicată pe canalul protonilor şi rotaţie a probei în jurul unghiului magic, astfel încât ambele dimensiuni spectrale în spectrul RMN 2D vor codifica preponderent informaţii cu privire la deplasările chimice izotrope ale carbonilor din sistemul molecular investigat (cu o lărgire reziduală determinată de imperfecţiunea metodei de decuplare). Pe durata perioadei de mixing, se generează o stare de polarizare longitudinală

Figura 8: Reprezentarea schematică a experimentului RMN 2D „Proton Driven Spin-Diffusion” (PDSD) de investigare a transferului de polarizare 13C-13C mediat de interacţiunea dipolară cu protonii

226

diferenţială, care va fi transferată între spinii 13C între care există cuplaje dipolare suficient de puternice. Din această cauză, în afară de peakurile diagonale, în spectrul RMN 2D obţinut prin metoda PDSD apar şi cross-peakuri de corelaţie între oricare două poziţii chimice distincte între care se stabileşte transfer de polarizare (spin diffusion), cu intensităţi care depind de distanţa la care se află nucleele 13C corespunzătoare.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/sp-diff" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 pl4:f1 1u do:f2 (p1 ph4):f1 d5 (p1 ph5):f1 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0 lo to 2 times td1 exit

; tau mix ;pl12 is used here with tppm, and p30 the pulse

ph3= 1 3 ph1= (4) 0 0 2 2 ph2= 0 ph4= 0 0 0 0 0 0 0 0 2 2 2 2 2 2 2 2 ph5= 1 1 1 1 3 3 3 3 ph31= 0 2 2 0 1 3 3 1

Transferul de polarizare 13C-13C în experimentul PDSD este iniţiat de interacţiunile dipolare homonucleare între spinii nucleari corespunzători, însă el se produce prin intermediul protonilor situaţi între aceşti carboni. Deoarece aceste cuplaje dipolare C-C sunt în general slabe, durata perioadei de mixing, d5 – în secvenţa de pulsuri ilustrată mai sus, trebuie să fie 227

relativ mare, între câteva sute de µs până la 10-100 ms, pentru a avea un transfer eficient în domeniul de distante 2-5 Å. Din această cauză, metoda este preponderent utilizată pe probe marcate uniform cu 13C: cu toate acestea, există şi câteva cazuri în care PDSD a fost demonstrat şi pe probe cu 13C în abundenţă naturală, însă în aceste cazuri este nevoie de durate de mixing de ordinul secundelor pentru a identifica cross-peakuri cu intensităţi măsurabile. Cu privire la implementarea practică a unui experiment RMN 2D, introduse prin acest exemplu, trebuie menţionate următoarele aspecte: (i) sintaxa ph1= (4) 0 0 2 2 utilizată în programul de pulsuri asociat secvenţei PDSD pentru faza pulsului de contact p15 pe canalul 13C specifică procedura numită TPPI (Time Proportional Phase Incrementation) aplicată pentru înregistarea semnalului în cuadratură pe dimensiunea indirectă – în practică înseamnă că la fiecare experiment nou în dimensiunea indirectă fazele vor fi incrementate cu 3600/4 = 900 faţă de experimentul anterior (adică dacă pentru primul FID din setul de date 2D se utilizează fazele 0 0 2 2 pentru pulsul p15, al doilea FID va avea fazele 1 1 3 3, şi aşa mai departe; (ii) pasul temporal în dimensiunea indirecta este denumit in0 (increment delay 0), iar durata totală de achiziţie indirectă este notată cu aq1, şi se calculează înmulţind incrementul in0 cu numărul de puncte al semnalului înregistrat în dimensiunea indirectă, respectiv td1.

Figura 9: Spectru 13C CP-MAS pe L-Tirozina HCl, şi o reprezentare schematica a atribuirii liniilor pentru cele 7 poziţii chimice distincte ale carbonilor din molecula

228

În final vom ilustra utilizarea metodei PDSD cu rezultatele experimentale obţinute în cazul particular al compusului L-Tirozina HCl, marcată uniform cu 13C. Mai întâi prezentăm în Fig. 9 spectrul 13C RMN-S 1D obţinut prin CP-MAS la o frecvenţă de rotaţie a probei de 10 kHz. Atribuirea liniilor spectrale corespunde indexării poziţiilor de carbon din reprezentarea schematică a moleculei de L-Tirozina inclusă în aceeaşi figură. Am ales acest caz particular pentru că ne permite comportaţii în cadrul unor domenii de distanţe internucleare 13C-13C scurte (1.5 Å – între carboni direct legaţi chimic), medii (3-4 Å, de exemplu între carbonii alifatici şi cei de pe inelul benzenic), şi respectiv lungi (4-5.5 Å, între C1 şi C7 sau C8). Posibilitatea de a estima astfel de distante C-C din spectre PDSD de corelaţie 13C-13C este ilustrată în continuare prin exemplele prezentate în Fig. 10. Primul corespunde unei durate de mixing scurte, de 300 µs, şi evidenţiază faptul că la această scală de timp transferul de polarizare este eficient doar pe distanţe scurte, între carbonii direct legaţi chimic. Utilitatea practică a unui asemenea spectru este evidentă, respectiv identificarea conectivităţilor chimice în cazul unui compus nou, şi pe această cale este un instrument extrem de util în procesul de atribuire spectrală.

Figura 10: Spectre RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina aplicând metoda PDSD; ele ilustrează dinamica procesului de transfer de polarizare la durate de mixing scurte (300 μs), şi respectiv lungi (5 ms)

Cel de-al doilea spectru PDSD ilustrat în Fig. 10 corespunde unei perioade de mixing mult mai mari, de 5 ms, şi este reprezentativ pentru situaţia în care transferul de polarizare se reduce pe distanţe mult mai mari, până la 5 Å, după cum se poate observa din prezenţa peakului de corelaţie C1-C7. Astfel de spectre sunt utile pentru a extrage constrângeri structurale utile pentru investigarea conformaţiei moleculare în sistemul investigat. 229

Metoda CHHC Metoda CHHC pe care o vom discuta în continuare permite determinarea distanţelor 1H-1H, cu rezoluţie înaltă datorită implementării în cadrul spectroscopiei RMN-S 2D de corelaţie 13C-13C. Metoda este demonstrată efectiv pe L-Tirozina·HCl sintetizată sub formă poli-cristalină şi marcată uniform cu 13C. L-Tirozina·HCl a fost aleasă drept sistem model deoarece spectrul 13C RMN-S 1D prezintă o rezoluţie suficient de bună pentru a putea separa liniile corespunzătoare tuturor grupărilor chimice din molecula (Fig. 9), iar structura sa cristalină este bine caracterizată. În Fig. 11 este ilustrată secvenţa de pulsuri asociată metodei CHHC. Experimentul începe cu prepararea unei stări iniţiale prin transfer de polarizare prin CP de la 1H la 13C. Polarizarea transversală astfel creată evoluează sub influenţa deplasărilor chimice izotrope al carbonilor pe durata perioadei de evoluţie indirectă, t1, în condiţii de decuplare heteronucleară prin TPPM pe canalul 1H. Polarizarea 13C care a evoluat cu deplasările chimice izotrope corespunzătoare fiecărei poziţii distincte din moleculă este apoi transferată prin intermediul unei perioade scurte (65 μs) de cross-polarizare (CP) a protonilor direct conectaţi chimic. Polarizarea transversală astfel obţinută este apoi adusă de-a lungul direcţiei z (este transformată în polarizare longitudinală) prin aplicarea unui puls π/2 asupra spinilor 1H. Deoarece polarizările 1H astfel obţinute nu au aceeaşi valoare la toţi protonii, pe durata perioadei de mixing, tmix, se va realiza o redistribuire a acestora prin intermediul aşa-numitului proces de schimb de magnetizare, şi se generează astfel cross-peakuri a căror intensitate este proporţională cu cantitatea de

Figura 11: Reprezentarea schematică a experimentului RMN 2D CHHC de investigare a transferului de polarizare 1H-1H codificat în spectre de corelaţie 2D 13C-13C

230

polarizare schimbată de protonii corelaţi. Deoarece schimbul de magnetizare se datorează interacţiunilor dipolare 1H-1H, intensitatea fiecărui cross-peak obţinut codifică informaţii cu privire la tăria cuplajului dipolar dintre protonii implicaţi si, implicit, cu privire la distanţele internucleare dintre aceştia. După parcurgerea etapei de mixing urmează transformarea polarizării longitudinale în polarizare 1H transversală (prin aplicarea a incă unui puls π/2 pe canalul 1H), iar aceasta apoi transferată către nucleele 13C direct conectaţi chimic (prin intermediul unei perioade scurte de CP, similară celei prin care s-a realizat transferul 13C->1H iniţial). În final, polarizarea transversală 13C este detectată sub formă de semnal RMN pe durata perioadei de evoluţie directă, t2. Detecţia semnalului se face de asemenea în condiţii de înaltă rezoluţie, adică se urmăreşte evoluţia polarizării transversale 13C sub acţiunea deplasărilor chimice izotrope asociate carbonilor din probă, în condiţii de decuplare heteronucleară prin TPPM.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chhc" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f2 1u pl3:f2 p3:f2 ph8 d5 p3:f2 ph9 1u pl2:f2 (p16 ph7):f1 (p16 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0

; tau mix

;pl12 is used here with tppm, and p30 the pulse

231

lo to 2 times td1 exit ph3= 0 0 2 2 1 1 3 3 ph1= (4) 1 ph2= 3 3 3 3 0 0 0 0 ph4= 3 1 ph5= 1 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph8= 0 ph9= 2 ph31= 3 1 3 1 0 2 0 2

Un spectru CHHC tipic este ilustrat în Fig. 12, unde este considerat cazul particular al spectrului 2D de corelaţie 13C-13C înregistrat la o valoare tmix de 50 μs, utilizând o fereastră spectrală care se limitează la carbonii protonaţi (indexaţi conform schemei din Fig. 9). Corelaţiile care se stabilesc între protonii asociaţi diferitelor poziţii de carbon din moleculă sunt identificate în spectrul CHHC prin apariţia cross-peakurilor care conectează poziţiile chimice corespunzătoare. Deoarece mecanismul de stabilire a corelaţiilor în spectre CHHC se bazează pe schimbul de magnetizare longitudinală 1H-1H determinat de interacţiunea dipolară, amplitudinea fiecărui cross-peak va fi o măsură a tăriei acestui cuplaj şi, implicit, a distanţei internucleare dintre protonii asociaţi poziţiilor de carbon corelate. Acest mecanism este exemplificat în Fig. 12 cu corelaţii ale carbonului A (a se vedea liniile punctate). În particular, se observă apariţia unui cross-peak intens între A şi carbonul C, însă este de remarcat de asemenea lipsa uni peak de corelaţie similar cu carbonul din poziţia B. Din punct de vedere calitativ, acest rezultat este în perfectă concordanţă cu distanţele intra-moleculare dintre protonii conectaţi chimic de aceştia, şi anume: 3.2 Å între protonii cei mai apropiaţi de carbonii A şi C, şi respectiv de 4.8 Å pentru ceilalţi doi protoni prezentaţi în exemplul din Fig. 12. O analiză cu caracter cantitativ relevantă pentru determinarea de distanţe 1H-1H cu ajutorul metodei CHHC trebuie însă să ia în considerare şi alte efecte care influenţează intensităţile cross-peakurilor din spectru: pentru aceasta am elaborat un model teoretic al dinamicii de spin în condiţii specifice experimentului CHHC [7]. Rezultatele modelării ne-au permis îmbunătăţirea procesului de analiză a datelor experimentale, prin introducerea de corecţii adecvate pentru o serie de procese perturbative, şi anume: (i) caracterul neselectiv al transferului de polarizare 1H<->13C pe durata blocurilor CP care “flanchează” perioada de transfer de magnetizate (tmix în Fig. 11), (ii) efectul protonilor care nu contribuie direct la semnalul RMN-S detectat (protonii care nu sunt legaţi chimic de carbon, şi respectiv protonii din molecule nemarcate izotopic cu 13C), şi 232

Figura 12: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcată uniform cu 13C aplicând metoda CHHC; spectrul a fost obţinut pentru o durată de mixing de 50 µs şi ilustrează modul în care dinamica procesului de transfer de polarizare 1H-1H (si implicit distanţa dintre protonii implicaţi) este codificată prin intensitatea cross-peakurilor corespunzătoare din spectrul de corelaţie 2D.

Figura 13: Curbe CHHC reprezentative pentru protoni cu contacte intermoleculare scurte (de exemplu protonul legat de C5 de pe inelul aromatic), şi respectiv lungi (protonii ataşaţi lui C2) în urma împachetării moleculelor de L-Tirozina în reţeaua cristalină (figura din dreapta)

233

CH2. unde transferul de polarizare este utilizat pentru a codifica cuplajele dipolare 1H-1H. În această figură ilustrăm comportamentul observat pentru transferul de polarizare în care sunt implicaţi protonii ataşaţi poziţiilor de carbon C2. Figura 14: Reprezentarea schematică a experimentului RMN 2D CHCC de investigare a transferului de polarizare 1H-13C codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chcc" . iar procesul care stă la baza experimentului CHCC este şi în acest caz transferul de polarizare proton-carbon. adică spectre de înaltă rezoluţie. Informaţia codificată în acest tip de spectre se referă tot la cuplajele dipolare 1H-13C. în particular prin intermediul aşa-numitelor curbe CHHC extrase dintr-un set de astfel de spectre înregistrate pentru diferite valori ale timpului de mixing (Fig. În mod similar cu metoda CHHC. 13). metoda CHCC se aplică în cazul compuşilor uniform marcaţi cu 13C. Metoda CHCC Având în vedere rezoluţia spectrală limitată a protonilor în experimente RMN-S 2D de tip HETCOR.0) 234 . numit CHCC: acesta prezintă avantajul de a cuantifica pe ambele dimensiuni spectrale deplasări chimice ale nucleelor 13C. Corecţiile introduse conduc la creşterea semnificativă a gradul de precizie cu care sunt estimate distanţele proton-proton din spectre RMN-S de tip CHHC. am proiectat şi implementat practic un nou tip de experiment de corelare 13C-13C. CH3). şi respectiv C5 din molecula de L-Tirozină.cp (TopSpin 2.(iii). care sunt utilizate în mod tradiţional pentru investigaţii structurale bazate pe determinarea de distante C-H. efectul multiplicităţii protonice pentru diferite grupări chimice din sistem (CH.

astfel încât liniile de rezonanţă specifice fiecărei grupări chimice să fie separate. Pentru a obţine rezoluţie înaltă. Primul bloc CP din perioada de mixing este unul de durată scurtă. and p30 the pulse Secvenţa de pulsuri corespunzătoare metodei CHCC (Fig.13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f1 (p17 ph7):f1 (p17 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 3 1 3 1 3 1 3 ph1= (4) 0 ph2= 0 ph4= 1 ph5= 0 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 .pl12 is used here with tppm. Pe durata celui de-al doilea bloc CP din secvenţa de mixing transferul de polarizare 1H-13C se realizează în mod clasic. atât în dimensiunea directă. polarizarea de spin va evolua în condiţii de decuplare heteronucleară prin TPPM. Informaţii cu privire la eficienţa procesului de transfer de polarizare de la nuclee individuale 1H la toate nucleele 13C aflate în vecinătate sunt codificate în perioada de mixing. dintre care ultimele două formează perioada de mixing a experimentului. astfel încât polarizarea fiecărui 13C este transferată în mod selectiv doar către protonul (protonii) direct legaţi. 14) constă în trei blocuri CP distincte. 235 . cât şi în cea indirectă..

şi de polarizarea rămasă pe canalul carbonilor după pulsul CP scurt (din cauza că această polarizare nu se transferă în întregime protonilor direct legaţi) se impune ca asupra secvenţei CHCC să se aplice procedeul de ”phase cycling”. (iii) incrementând durata ultimului puls CP (tmix) polarizarea 1H Figura 15: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcata uniform cu 13C aplicând metoda CHCC pentru valori ale ultimului puls de contact (p17) de 0. 236 . Deoarece selectivitatea metodei CHCC poate fi afectată de influenţa polarizării iniţiale a carbonului. în funcţie de distanţele carbon-proton individuale. iar prin asterisk este marcat în fiecare caz evoluţia cross-peakului specificat. (ii) aplicarea unui bloc CP de durată scurtă. Sz. spectrele 1D de mai jos reprezintă felii de-a lungul dimensiunii directe ce corespund poziţiilor de carbon C2 şi C8. şi respectiv 1 ms (b). informaţiile extrase în urma aplicării schemei experimentale CHCC sunt codificate în spectre 2D de corelaţie 13C-13C. Cross-peakurile CHCC sunt generate conform următoarei scheme: (i) primul pas este format dintr-un bloc CP standard. aleasă astfel încât polarizarea de spin să fie transferată de la nucleele de 13C doar la protonii direct legaţi. 15.5 ms (a).către toate nucleele de carbon aflate în vecinătate. conform programului de pulsuri asociat schemei experimentale din Figura 14. Ca şi în cazul celorlalte două metode de corelare prezentate mai sus. Fig. urmat de evoluţia pe durata t1 a polarizării 13C sub acţiunea interacţiunii de ecranare chimică şi în condiţii de decuplare heteronucleră prin TPPM.

rata de transfer fiind proporţională cu 1/r3. aceste coerenţe evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor corelaţi. La o analiză atentă a spectrelor CHCC se poate observa că cross-peakurile cele mai intense (C7-C8. Experimentul generează polarizare transversală a spinilor 13C prin secvenţa CP-MAS: cu ajutorul pulsului de 900 aplicat după pulsul de contact pe canalul carbonului.5 ms. C3-C4 (3. Totuşi. la 5. 5.6 b). 16b) pentru a genera coerenţele DQ.se transferă atât nucleelor 13C direct legate de protonii polarizaţi.7 Å). Spectrele bidimensionale CHCC ale L-Tyrozinei·HCl uniform marcate 13 cu C pentru timpi de mixing de 0.9 Å). cât şi celor aflate în vecinătate. C3-C5.6(a).68 Å). respectiv 1 ms) spectrele codifică informaţii structurale despre contactele intramoleculare scurte. 4. de la 2. În prealabil. fiind în bună concordanţă cu datele teoretice (Figura 5. şi C2-C7 (4. C2-C4) corespund celor mai mici distanţe internucleare 1H-13C. Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) Metoda INADEQUATE Metoda numită INADEQUATE (Incredible Natural Abundance Double Quantum Transfer Experiment) este o metodă RMN-S 2D de corelatie 13C-13C în cadrul căreia în perioada de preparare se generează coerente de două cuante (DQ – Double Quantum). aceasta este transformată în polarizare longitudinală care apoi este utilizată pe durata aplicării secvenţei INADEQUATE (Fig.13 Å (H7-C8). respectiv 1 ms sunt prezentate în Fig.13Cj. unde r este disţanta 1Hi .15 – 2. 16. iar la jumătatea acestei perioade se aplică un puls de 1800. Secvenţa de pulsuri asociată experimentului INADEQUATE este redată în Fig. se mai aplică o dată secvenţa INADEQUATE care va reconverti coerenţele DQ care au evoluat pe durata lui t1 în coerenţe 237 .20 Å. respectiv (b).5.65 Å (H3-C8). Discuţia rezultatelor experimentale se va concentra doar pe distanţe intermoleculare proton-carbon mai mici de 6 Å. adică ω1 şi ω2. cross-peakurile datorate corelaţiilor între spini aflaţi la distanţe mai mari sunt şi ele bine conturate. situate în intervalul 2. pentru a refocaliza evoluţia cu deplasarea chimică 13C la sfârşitul procesului de generare a coerenţelor DQ. iar în dimensiunea directă ele dau naştere semnalelor izotrope corespunzătoare ambilor spini. tmix. Eficienţa transferului de polarizare către nuclee 13C individuale este reflectată în intensitatea cross-peakurilor obţinute. Distanţele intra-moleculare 1H-13C acoperă un interval larg de valori. Acest lucru arată că pentru timpii de mixing aleşi (tmix = 0. Secvenţa INADEQUATE constă în două pulsuri de 900 separate de o evoluţie liberă pe durata perioadei de mixing. utilizând cuplajul J dintre diferite poziţii chimice în molecula investigată. ω1+ω2. spre exemplu C7-C5(C4) (pentru distanţa C7-H5(H4) de 2. În dimensiunea indirectă.

în exemplul de spectru INADEQUATE prezentat în Fig.de tip Single Quantum (SQ). cuplajul J are valori semnificative pentru a produce coerente DQ în general între poziţii direct conectate prin legături chimice: din aceasta cauză. adică între nucleele C1 şi C3. În cazul nucleelor 13C. 17 nu va apărea cross-peakul corespunzător coerentei ω1+ω3.13C-13C INADEQUATE experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u (pl12:f2) (pl4:f1) (p1 ph4):f1 1u cpd2:f2 (p1 ph5):f1 d5 (2p1 ph6):f1 d5 (p1 ph7):f1 238 . Figura 16: Reprezentarea schematică a experimentului RMN 2D INADEQUATE utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 13C-13. codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/inadequate" .0) .cp (TopSpin 2.

d0 (p1 ph8):f1 d5 (2p1 ph9):f1 d5 (p1 ph10):f1 1m do:f2 wr #0 HaltAcqu. 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 1 1 1 3 3 3 3 ph1= 0 ph2= 0 ph4= 3 3 3 3 1 1 1 1 ph5= (8) 0 2 4 6 ph6= (8) 0 2 4 6 ph7= (8) 4 6 0 2 ph8= 1 ph9= 1 ph10= 3 ph31= 0 2 0 2 2 0 2 0 Figura 17: Exemplu ilustrativ de spectru RMN 2D INADEQUATE: peakurile de corelaţie între două poziţii chimice. ωi şi ωj. corespund formării unei coerenţe DQ care evoluează în dimensiunea indirectă cu frecvenţa ωi + ωj şi indică conectivitatea chimică directă între carbonii corespunzători 239 .

Figura 18: Spectrul RMN 2D de corelare corespunzător acetatului de colesteril în abundenţă naturală (2 molecule pe unitatea asimetrică) obţinut cu ajutorul secvenţei de pulsuri INADEQUATE 240 . concluzionându-se asupra acurateţei metodei INADEQUATE în caracterizarea conectivităţilor chimice în sisteme moleculare complexe. majoritatea situate în regiunea spectrală 10 – 60 ppm. În stare solidă. în abundenţă naturală [8]. spectrul 13C unidimensional conţine 58 de linii RMN (fiecărei poziţii individuale a unui nucleu 13C ii va aparţine o linie de rezonanţă dublată).Datorită particularităţilor sale. Datorită acestui fapt. care conţine două molecule în unitatea asimetrică. 18 corespunde spectrului 13C INADEQUATE înregistrat pe acetatul de colesteril (C29H48O2). această moleculă prezintă o structură cristalină puternic ordonată. în scopul stabilirii conectivităţilor chimice dintre diferitele grupări prezente în molecula investigată. metoda INADEQUATE este intens utilizată în investigaţiile structurale din chimia organică. în abundenţă naturală. Un exemplu relevant pentru acest tip de aplicaţii practice ilustrat în Fig. În urma analizei spectrului 2D INADEQUATE s-au determinat toate corelaţiile posibile între nucleele de carbon din moleculă.

şi respectiv de a le reconverti la coerenţe SQ. În practică. Drept urmare. BABA2.Metoda 1H-1H DQ-MAS Metodele bazate pe excitarea coerentelor DQ se pot aplica şi în cazul protonilor. care conţine două cicluri BABA cu fazele relative astfel proiectate încât să minimizeze efectul evoluţiei sub acţiunea deplasărilor chimice 1H pe Figura 19: Reprezentarea schematică a experimentului RMN 2D 1H-1H DQ-MAS utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 1H-1H . unele implicând acţiunea continuă a câmpurilor rf. schema generală a experimentului 1H-1H DQ-MAS (Fig. În prezentul raport vom considera aşa-numita secvenţă BABA (Back to Back) [9]. iar altele aplicarea de pulsuri rf intense: toate au însă în comun sincronizarea duratei secvenţei de excitare DQ cu perioada de rotaţie a probei în jurul unghiului magic. 19) este aceeaşi ca şi în cazul INADEQUATE. codificat în spectre de corelaţie 2D 1H-1H. unde rezoluţia spectrală este asigurată prin rotaţia rapidă în jurul unghiului magic. şi respectiv o versiune perfecţionată a ei. singura deosebire fiind secvenţa de pulsuri aplicată pentru a genera coerenţe DQ. au fost dezvoltate numeroase metode de excitare DQ pentru protoni. Spre deosebire de experimentul INADEQUATE prezentat anterior. pentru excitarea coerenţelor ilizează secvenţa numita BABA2 241 . condiţie necesară pentru a realiza o recuplare eficientă a interacţiunilor dipolare 1H-1H. detectabile direct. în cazul metodelor 1H-1H DQ-MAS coerenţele de două cuante se generează interacţiunile dipolare homonucleare 1H-1H recuplate pe durata perioadei de excitare şi reconversie cu ajutorul unor secvenţe de pulsuri specifice.

1H-1H DQ-MAS experiment 1 ze 2 d1 1u pl1:f1 (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph2):f1 d1 (p1 ph3):f1 1u (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph3):f1 d1 (p1 ph2):f1 d0 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph5):f1 d1 (p1 ph6):f1 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph6):f1 d1 242 . 19 sunt tmix = 2tBABA = 2τR # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/dq-baba" . având o separare între ele egală cu o jumătate de perioadă de rotaţie.0) .cp (TopSpin 2. astfel încât duratele implicate în Fig. Fiecare ciclu BABA conţine două perechi de pulsuri de 900 alipite între ele.durata perioadei de excitare/reconversie.

evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor. dar şi din cauza tăriei mari a cuplajelor dipolare 1H-1H care permit evidenţierea corelaţiilor dintre protonii CH (ω2) aparţinând la două molecule vecine (corelaţii intermoleculare): în cazul peakurilor diagonale ωj. 1m 1m if 1m in0 lo to 2 times td1 exit ph1= (4) 0 2 4 6 ph2= (4) 2 4 6 0 ph3= (4) 4 6 0 2 ph4= 0 ph5= 1 ph6= 3 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 Aplicaţiile practice ale metodei 1H-1H DQ-MAS vor fi ilustrate în continuare.ω3) corespunzătoare coerenţelor DQ care se generează între protoni aparţinând grupărilor (CH3. Concret.ω3) şi (ω2. (ω1. NH3). dar şi deosebiri. 20. 243 . ωi+ωj. 20). Analizând spectrul se constată şi similarităţi cu un spectru tipic INADEQUATE. Eficienţa maximă s-a obţinut pentru o singură secvenţă BABA2. cum este cazul grupărilor CH3 (ω1) şi NH3 (ω3) în spectrul din Fig. asemănările sunt legate de faptul că liniile de rezonanţă corespunzătoare spinilor 1H corelaţi.(p1 ph5):f1 go=2 ph31 wr #0 HaltAcqu. CH). şi respectiv (CH. în dimensiunea indirectă (DQ). de exemplu ωi şi ωj în dimensiunea directă.ω2). În spectrul DQ-MAS al L-alaninei acesta este cazul pakurilor de corelaţie (ω1. considerând cazul relativ simplu al spectrului de corelaţie 1H-1H înregistrat pe L-alanina (Fig. frecvenţa de evoluţie în dimensiunea DQ va fi de 2ωj. (CH3. datorită multiplicităţii protonilor dintr-o anumită grupare chimică. Deosebirile sunt legate de faptul că în spectre 1H-1H DQ-MAS pot apărea şi peakuri diagonale. NH3). la o frecvenţă de rotaţie a probei în jurul unghiului magic de νR = 30 kHz. unde am utilizat secvenţa BABA2.

obţinută pentru peakul diagonal (ω2.a. ω2) şi (ω3+ ω2.3 Å. reflectă o distanţă semnificativ mai mare de ~2. ω2). intensităţile sunt comparabile.a în cazul grupărilor CH-NH3 cu distanţa intramoleculara de ~2.6 Å. corespunde unor distanţe intranucleare mici.. care implică o distanţă intramoleculară de ~2. Informaţii mai cantitative cu privire la distanţele internucleare dintre protonii din probă se pot obţine din analiza spectrelor 1H-1H DQ-MAS comparând intensităţile relative ale peakurilor de corelaţie.Figura 20: Spectrul RMN 2D de corelare 1H-1H DQ-MAS achiziţionat utilizând secvenţa BABA2 pe L-Alanina. ω2).a.5 u. ω1) a cărui intensitate în unităţi arbitrare este de 20 u.3 Å între protonii grupării CH aparţinând la două molecule vecine din reţeaua cristalină a L-Alaninei.7 Å.a. şi anume 19 u. care formează o reţea compactă de spini. Pentru cross-peakurile (ω1+ ω2. De exemplu. intensitatea de ~ 4 u. În consecinţă. peakului diagonal (2ω1. de ~1. În primul caz. pentru coerenţele de două cuante generate între grupările CH-CH3. şi respectiv de 18. o analiză riguroasă a intensităţilor relative ale peakurilor din spectrul 2D 1H-1H DQ-MAS ne poate conduce la 244 . Prin comparaţie. între protonii grupării CH3.

J.R. Bodenhousen. Principles of Nuclear Magnetic Resonance în One and Two Dimensions. Opella. 199 (2009) 173. Lett. Madhu. Magn. Reson. K. A.. S.J. Steuernagel. Magn. Chem. J.W. C.G. Aluas. X. 5. J. Griffin.. A 122 (1996) 214. SolidSate Nuclear Magnetic Resonance 35 (2009) 2-11 R. De Paepe. Bibliografie 1. D. A. Gullion. Wu. Ramamoorthy. Reson. C. M. J. 5. C. H. D. 9. C. A. Magn. 408 (2005) 118-122. T. Spiess. Reson. T.. Lee. P. Griffin. L. A. Introduction to High-Resolution Solid-State NMR. Brown. 7. Hafner. Filip.E.K.M. Elsevier Science 2007 P. Graf. S. S. J. Tripon. Filip. R.cuantificarea tuturor proximităţilor proton-proton din proba investigată. 183 (2006) 68. V. Feike. Ernst. Aluas. M. 4. X. Filip. Narasimhaswami. Reson A 109 (1994) 270-272.H. G. Demco. Ladizhansky. Filip. rezultând caracterul aplicativ al acestei metode în caracterizarea structurală a compuşilor moleculari în fază solidă. Oxford University Press. Magn. 8. ChemPhysChem 5 (2004) 869-875. Tripon. 2. S. 3. 245 . 6. Wokaun. Phys. Ramamoothy. M. Lesage. R. G. Oxford 1987 C. Emsley.

.... Bibliografie .........spectrometrul Bruker Avance 400 cu câmp central de 9........Rezonanţa magnetică nucleară pe sisteme lichide Lect.... Deoarece legăturile chimice sunt asociate cu valenţa ionilor şi structura moleculară......................... doar acele spectroscopii care au scala lungimilor apropiată frecvenţelor de rezonanţă caracteristice......... Mihai Vasilescu Cuprins 1.................spectrometrul Bruker Avance 600 cu câmp central de 14 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide Utilizarea acestor spectrometre de către studenţii Facultăţii de Fizică presupune o stăpânire temeinică a noţiunilor şi principiilor de bază din RMN.......................................... vor răspunde acestor efecte........................ Prezentarea principiului tehnicii experimentale Rezonanţa magnetică nucleară este un fenomen ce apare atunci când nucleele de un anumit tip se găsesc într-un câmp magnetic static şi sunt expuse la un al doilea câmp magnetic. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente ...........265 În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca se află două spectrometre de rezonanţă magnetică nucleară (RMN) performante şi anume: ............... Prezentarea principiului tehnicii experimentale .. oscilant................... cunoaşterea părţilor componente ale unui spectrometru....... Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu ..... În scopul facilitării activităţilor de practică experimentală pentru utilizarea acestor echipamente de ultimă generaţie. 1...................253 3..... prezentăm mai jos protocolul de lucru pentru aceste echipamente... dr................... Spectroscopia de rezonanţă magnetică nucleară are loc în regiunea undelor radio şi este asociată cu tranziţiile energetice ale spinilor nucleari..... O particularitate importantă asociată cu tehnica RMN este sensibilitatea sa la mediul chimic........ precum şi înţelegerea modului în care acestea funcţionează şi a rolului fiecărei părţi.............. 246 .264 4...................4 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide .......246 2................

despre atomii învecinaţi (din prima şi a doua sferă de coordinare). Domeniul corespunzător pentru C13 este 25-150MHz. presupune reprezentarea grafică a unui bilanţ energetic. precum şi despre procesele dinamice.037 100 75. Spectroscopia RMN este o metodă foarte utilă pentru studiul structurii locale şi a dinamicii constituenţilor compuşilor. în diverse medii chimice. Astfel se pot obţine date despre unghiurile dintre legături şi lungimea legăturilor. Într-un spectru RMN pot fi înregistrate semnale de la un singur tip de nuclee.108 99.37 0. ele vor fi multe de acest fel. ca orice metodă spectroscopică. Valorile frecvenţelor cu care se lucrează în RMN fac însă folosirea lor foarte anevoioasă. De obicei. Pentru proton aceasta corespunde unor frecvenţe de rezonanţă între 100-600MHz. Toate nucleele cu moment magnetic sunt capabile să ofere informaţii detaliate despre ordinea locală.98 0. simetria locală şi numerele de coordinare. Pe lângă câmpul magnetic static. alte posibile nuclee rezonante fiind excluse prin reglarea spectrometrului pe domeniul de frecvenţe de interes. Cele mai importante interacţii sunt interacţia de deplasare chimică pentru toate nucleele şi interacţia cuadrupolară pentru nucleele cu I>1/2. Aceste diferenţe mari ale frecvenţelor de rezonanţă (unele exemple sunt date în Tabelul 1) fac posibilă observarea nucleelor diferitelor elemente relativ independent unele de altele.Spectroscopia RMN dă date despre toate nucleele rezonante din sistem.015 1. Proprietăţi RMN ale unor nuclee într-un câmp de 9.3-14 T.395 T: Izotop 1H 2H 13C 14N 15N 17O 31P 35Cl 37Cl 43Ca Frecvenţa RMN (MHz) 400 61 100 29 40 54 161 39 32 27 Abundenţa naturală (%) 99. tipic.63 0. Pentru 247 . câmpul magnetic este în domeniul 2.145 Rezonanţa magnetică nucleară. în experimentele de RMN.47 0. Tabel 1. care conţin informaţii specifice structurii locale. câmpul efectiv din zona nucleului este influenţat şi de câmpurile locale interne.53 24.

De obicei. De obicei. Acesta este cunoscut ca sistemul rotativ (“the rotating frame”). ci prin iradierea cu un câmp electromagnetic slab. Îngustimea liniilor în cazul lichidelor se datorează mişcării moleculare rapide [1]. o scală a deplasărilor chimice date de formula: δ = ν −ν 0 ν0 Unitatea de măsură pentru deplasările chimice este "partea per milion" sau "ppm". ea fiind rezultatul energiei foarte joase implicate în experimentele RMN. Baza experimentului de rezonanţă magnetică este plasarea probei într-un câmp magnetic uniform intens şi asigurarea iradierii ei cu un câmp electromagnetic printr-un sistem potrivit de emisie şi recepţie a frecvenţelor radio sau de microunde. Prima este similară ca şi concepţie cu alte forme dispersive de spectroscopii şi implică o analiză (“sweep”) spectrală în care fiecare condiţie de rezonanţă posibilă (echivalentă absorbţiei) este căutată secvenţial. substanţe de referinţă. Această abordare este mai uşoară din punct de vedere tehnic şi are la bază ecuaţia: ω0 = -γB0 echivalentă cu parcurgerea frecvenţelor. de obicei. pentru rezonanţa magnetică nucleară. a căror frecvenţă de rezonanţă să fie considerată nivelul zero al scalei energetice. de ordinul zecilor sau sutelor de ppm. Deplasările chimice întâlnite în RMN sunt. dar a devenit rară în spectroscopia RMN. Această abordare este adesea utilizată în RES. şi modificând câmpul magnetic principal. acum reprezentându-se în loc de scală energetică propriu-zisă.simplificare s-a ales ca primă soluţie folosirea unor etaloane. Pentru a observa semnalele pot fi urmate două strategii. Pentru a urmări experimentul este necesar să folosim un sistem de coordonate care se roteşte cu frecvenţa Larmor ω0. Îngustimea extraordinară a liniilor RMN este cea care face ca efectele deplasărilor chimice mici să fie măsurabile şi utile. Ulterior s-a recurs la un artificiu. A doua abordare demonstrează chiar mai clar distincţia dintre rezonanţa magnetică nucleară şi alte spectroscopii şi exemplifică folosirea descrierii clasice a câmpului de radiaţie. de frecvenţă fixată. În aceste 248 . acesta va fi un sistem de bobine acordate. aceasta nu se face prin parcurgerea domeniului de frecvenţe.

atunci magnetizarea se roteşte cu 90 de grade în planul x’y’. Când aplicăm B1 magnetizarea răspunde precesând în jurul lui B1 cu o frecvenţă ω1 dată de: ω1 = . în loc să aplicăm un puls de 180. aplicăm un puls cu durata jumătate.condiţii magnetizarea nucleară poate fi descrisă de un vector paralel cu direcţia z. Figura 1(b) ilustrează acest proces pentru un unghi de 1800. Revenirea la echilibru este caracterizată de un timp. în mod clar. După un “puls de 180” sensul magnetizării se inversează complet. În această situaţie fiecare vector nuclear individual (vectori care sunt însumaţi pentru a da magnetizarea macroscopică) 249 . Radiaţia electromagnetică este descrisă de componenta sa magnetică ca un vector la un anumit unghi faţă de direcţia câmpului.γ B1 Unghiul la care se mişcă magnetizarea este θ. o situaţie de non-echilibru. B0 poate fi ignorat şi este necesar doar să considerăm efectele câmpului de radiaţie. În sistemul rotativ. Figura 1. Dacă. (a) Magnetizarea (M0) în sistemul rotativ în prezenta câmpului de radiofrecvenţa (B1). cunoscut ca timp de relaxare spin-reţea sau timp de relaxare longitudinală. dat de: θ = ω1 t = . B1. (c) Magnetizarea după un puls de 900. T1.γ B1 t aşa că magnetizarea poate fi înclinată la orice unghi doar prin simpla aplicare a unui puls electromagnetic de putere şi durată cunoscute. care este direcţia câmpului magnetic principal. cunoscut ca plan transversal (fig 1c). Aceasta corespunde unei inversii a populaţiei nivelelor energetice şi este. Situaţia este ilustrată în figura 1(a) [2]. Dacă radiaţia electromagnetică este de aceeaşi frecvenţă cu frecvenţa Larmor. atunci va părea statică în sistemul de coordonate astfel ales. (b) Magnetizarea după un puls de 1800.

T2 este legat de lărgimea liniei la jumătatea înălţimii peak-ului. vom avea tot atâtea nuclee ce se mişcă mai rapid ca şi numărul celor ce se mişcă mai lent. Relaxarea transversală – fiecare săgeată reprezintă un vector magnetizare nucleară. este ilustrat în figura 2. numit timp de relaxare spin-spin sau timp de relaxare transversală.este forţat de câmpul de radiaţie să se rotească coerent cu frecvenţa Larmor ω0. Există o relaţie importantă între relaxarea transversală şi lărgimea liniei. Acest proces este ilustrat în figura 3. Pentru o descreştere exponenţiala spre echilibru. sistemul începe să se relaxeze. oscilează cu o frecvenţa egală cu diferenţa dintre frecvenţa de referinţă şi frecvenţa de rezonanţă a semnalelor deplasate. Cum aceste câmpuri sunt aleatoare. Efectele de câmp aleatoare. Figura 2. dependente de timp. Pe măsura trecerii timpului suma vectorilor se va reduce la zero. care vor face ca vectorii nucleari individuali să se mişte cu viteze diferite faţă de viteza sistemului rotativ. numit relaxare spin-spin sau transversală. Acolo unde avem un număr de rezonanţe deplasate se obţine un semnal oscilator complicat al relaxării. Imediat după ce aplicarea pulsului încetează. (c) şi (d) arată evoluţia în timp după un puls de 900. (a). corespunzând liniilor deplasate. această relaxare poate fi adesea caracterizată ca un proces exponenţial cu constanta de timp T2. vor produce variaţii aleatoare ale frecvenţei Larmor. prin: 250 . Acest proces. FID) şi poate fi transformat într-un spectru printr-un proces matematic cunoscut sub numele de transformare Fourier. (b). ν½ . Semnalul obţinut prin relaxare se referă de obicei la relaxarea liberă a magnetizării (free induction decay. În lichide. atunci setul de spini nucleari. Când apar deplasarea chimică (“chemical shift”) sau rezonanţele cuplate scalar.

Principiul unei astfel de metode este ca.ν½ = 1/(πT2) de aceea. din cauza lărgimii liniei deplasarea chimică sau informaţiile privind cuplajul sunt obscure sau chiar pierdute. cu atât linia observată este mai largă. În multe cazuri. cu cât relaxarea se produce mai rapid. Transformarea Fourier a unui FID (a) într-un spectru (b) Tehnica transformării Fourier. intensitate (a) timp (b) frecventa Figura 3. toate frecvenţele sunt excitate în mod 251 . este un exemplu de metodă multiplex. care este acum metoda aleasă în cele mai multe experimente RMN. respectând condiţia ca pulsul excitaţiei să acopere o lărgime de bandă potrivită.

CW tinde să fie mult mai lentă decât metoda transformatei Fourier. atunci când se fac analize pe alimente. Aceasta poate fi o problemă importantă în spectrele RMN pentru protoni. deoarece semnalele mici. iar partea iniţială a semnalului este distorsionată de revenirea sistemului de recepţie după pulsul de radiaţie. atunci contribuţia semnalelor mici poate fi pierdută cu totul. Ca rezultat al acestei metode. Deoarece N este de obicei mii sau zeci de mii. în metoda undelor continue (continous wave. În cazuri ideale. CW) frecvenţele sunt excitate secvenţial. Ca o consecinţă. de exemplu. acest avantaj este foarte consistent. avantajul semnal/zgomot al metodei transformatei Fourier asupra metodei CW pentru acelaşi timp de achiziţie este N unde N este numărul de frecvenţe. atunci liniile spectrale sunt foarte largi şi digitizarea devine o problemă. Metoda transformatei Fourier nu este însă lipsită de probleme. Dimpotrivă. de interes. Dacă aceasta este foarte scurtă. pot apărea probleme cu digitizarea semnalului. un semnal foarte intens în anumite părţi ale spectrului va creşte intensitatea tuturor punctelor din FID. cu linii foarte înguste. Prima este durata FID-ului. În cazul RES. Cum toate frecvenţele contribuie la fiecare punct. A doua problemă este direct legată de avantajul multiplexului. În RMN pot apare dificultăţi cu semnalele solidelor. Dacă nu avem o rezoluţie suficientă în convertorul analog – digital. unde apa este adesea componentul majoritar şi poate domina spectrul. Vedere generala asupra spectrometrului 252 .egal şi toate contribuie la toate punctele din FID. Figura 4. În aceste condiţii s-ar putea să fie avantajoasă folosirea metodei CW cuplată cu tehnici de scanare rapidă. aceasta limitează metoda transformatei Fourier la doar un grup restrâns de sisteme. vor avea doar o mică contribuţie la FID.

2 K) • straturi termoizolante şi ecranante • azot lichid (T = 77. Dizolvarea probelor se face în solvenţi deuteraţi.4 K) • straturi termoizolante şi ecranante • orificiu central vertical (îngust sau larg) Figura 5. bobine helmholtz • heliu lichid (T = 4. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Cel mai adesea analizele probelor lichide se concentrează pe studiul spectrului RMN corespunzător nucleelor de hidrogen sau carbon.Magnetul • cea mai scumpă parte a spectrometrului • electromagnet din fire supraconductoare • câţiva km de fir • solenoid. bobina. Interpretarea acestor spectre ne permite identificarea structurii probelor analizate. spectrometrul realizând fixarea câmpului cu ajutorul nucleelor de deuteriu. eprubete de quartz de 5 mm diametru. Secţiune schematică printr-un magnet RMN 2. Analizele se fac utilizând recipienţi speciali pentru analize RMN. anume a izotopilor 1H şi 13C. 253 .

• DMSO (dimetilsulfoxid deuterat) are frecvenţa de rezonanţă de 2.47 ppm pentru 13C.032 ppm pentru 13C. • C6D6 (benzen deuterat) are frecvenţa de rezonanţă de 7. solvenţii au şi rol de referinţă. respectiv triplet la 77. respectiv 128. Solvent: CDCl3 254 .78 ppm pentru 1H. Solvent: CDCl3 Figura 7.26 ppm pentru 1H.156 ppm pentru 1H.16 ppm pentru 1H.În acelaşi timp. • D2O (apa deuterată) are frecvenţa de rezonanţă de 4. Astfel: • CDCl3 (cloroform deuterat) are frecvenţa de rezonanţă de 7. Redăm mai jos şi câteva exemple de analize 1H NMR pe probe relativ simple [3]: Figura 6. • C3D6O (acetona deuterata) are frecvenţa de rezonanţă de 2. respectiv 30 ppm şi 206 ppm pentru 13C.512 ppm pentru 1H.01 ppm pentru 13C. Proba: benzen (C6H6). Proba: ciclohexan (C6H12) . respectiv 0 ppm pentru 13C şi 0 ppm pentru 29Si. respectiv 39. • TMS (tetrametilsilandeuterat) are frecvenţa de rezonanţă de 0 ppm pentru 1H.

Proba: toluen (C6H5CH3). Proba: acetona (CH3(C=O)CH3) . Solvent: CDCl3 Figura 10.Figura 8. Solvent: CDCl3 Figura 9. Solvent: CDCl3 255 . Proba: etil benzen (C6H5CH2CH3).

Solvent: CDCl3 Figura 12. Solvent: D2O Figura 13. Proba: etanol (CH3CH2OH) . Proba: apa (H2O) . Solvent: CDCl3 256 .Figura 11. Proba: metil etil cetona (CH3(C=O)CH2CH3).

Solvent: D2O Figura 15. Solvent: CDCl3 257 . Proba: etanol (CH3CH2OH).Figura 14. Proba: 2-propanol ((CH3 )2CHOH). Proba: 1-propanol (CH3CH2CH2OH). Solvent: CDCl3 Figura 16.

Proba: piridina (C5H5N).Figura 17. Solvent: CDCl3 Figura 19. Solvent: CDCl3 Figura 18. Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Solvent: CDCl3 258 . Proba: t-butanol ((CH3 )3COH).

proporţionale cu numărul de nuclee care produc semnalele respective. De asemenea. în general. Integrarea semnalelor pentru proba: metil etil cetona (CH3(C=O)CH2CH3). Senzitivitatea spectrometrului RMN este o măsură a numărului minim de spini detectabili. Analizele de tip 13C NMR vor utiliza diferite metode ce conduc la îmbunătăţirea semnalului RMN. diferenţa de populaţie poate fi crescută prin scăderea temperaturii probei. deci triplet. senzitivitatea este îmbunătăţită de creşterea câmpului magnetic utilizat [5]. Informaţii suplimentare se obţin dacă calculăm integralele liniilor de rezonanţă. în timp ce protonii grupării legate de CH2 dau semnal despicat (n+1). identificarea corespondenţei celor trei semnale de rezonanţă este completă. Redăm mai jos şi câteva exemple de analize 13C NMR pe probe relativ simple: 259 . Pentru a identifica semnalele celor doua grupări CH3 vom ţine cont de faptul că protonii grupării legate de C=O dau semnal simplu (singlet). corespunzător numărului de protoni legaţi de fiecare dintre nucleele de carbon.Pentru aceste exemple identificarea corespondenţei între semnalele de rezonanţă şi poziţia protonilor în moleculă se face relativ simplu. Cum semnalul RMN creşte odată cu creşterea diferenţei de populaţie dintre nivelele energetice. aşa cum se vede în figura 20: Figura 20. Solvent: CDCl3 Raportul relativ al celor trei integrale este 2:3:3. acestea reprezentând de fapt intensitatea relativă a semnalelor şi fiind. Astfel.

Proba: toluen (C6H5CH3). Solvent: CDCl3 260 . Solvent: CDCl3 Figura 22. Proba: ciclohexan (C6H12) . Proba: benzen (C6H6). Solvent: CDCl3 Figura 23.Figura 21.

Proba: acetona (CH3(C=O)CH3) . Proba: etil benzen (C6H5CH2CH3). Proba: metil etil cetona (CH3(C=O)CH2CH3). Solvent: CDCl3 Figura 25. Solvent: CDCl3 Fiurag 26.Figura 24. Solvent: CDCl3 261 .

Solvent: D2O Figura 29. Proba: etanol (CH3CH2OH). Solvent: CDCl3 Figura 28. Proba: 1-propanol (CH3CH2CH2OH). Proba: etanol (CH3CH2OH) . Solvent: CDCl3 262 .Figura 27.

Figura 30. Proba: t-butanol ((CH3 )3COH). Solvent: CDCl3 Figura 32. Solvent: CDCl3 Figura 31. Proba: 2-propanol ((CH3 )2CHOH). Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Solvent: CDCl3 263 .

• se pune solventul în eprubetă.4Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide. • se agită pentru dizolvarea probei. se observă şi semnalul corespunzător solventului la 77. Solvent: CDCl3 În toate spectrele de mai sus. 3. se află spectrometrul de rezonanţă magnetică nucleară (RMN) Bruker Avance 400 cu câmp central de 9.1-0. Etapele înregistrării spectrului RMN pe probe lichide la spectrometrul Bruker Avance 400 din dotarea laboratorului: • se ia o eprubeta de 5 mm diametru. specială pentru analize RMN. peste probă. • se dă comanda „lift on” de la BSMS pentru a crea perna de aer pentru eprubeta.5 ml solvent). semnal foarte util şi pentru a calibra spectrul în funcţie de referinţă. Proba: piridina (C5H5N). utilizabil pentru analiza probelor lichide. acolo unde s-a utilizat ca solvent CDCl3. curată • se pune proba în eprubetă (circa 0. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca. 264 . • se pune eprubeta în suportul special: • se aşează eprubeta cu suportul în dispozitivul special de reglaj al distanţei şi se aşează eprubeta astfel încât ulterior proba să fie în centrul câmpului magnetic.Figura 33. până când coloana de lichid are aproximativ 4 cm înălţime (circa 0.01 ppm. la nevoie se încălzeşte uşor eprubeta pentru a facilita dizolvarea.4 grame proba).

edu/htbooks/nmr/ Mihai Vasilescu. • • • • 4. Blumich. • se dă comanda „efp” pentru a trece din semnal timp (FID) în semnal frecvenţa (spectru). • se alege programul de pulsuri dorit şi nucleul pe care se doreşte realizarea analizei RMN.rit. 1-60. Teza de doctorat. R. A. Chapman and Hall. Aceasta se realizează cu comanda „popt” şi se referă în general la setarea duratei pulsului de excitare (p1) şi respectiv a timpului de relaxare dintre două achiziţii consecutive (d1). 4. • se realizează măsurătoarea efectivă alegând un număr de achiziţii potrivit pentru obţinerea unui raport semnal/zgomot suficient de bun. p.D. Hornak. făcându-se automat corecţiile variaţiilor externe.se aşează eprubeta pe perna de aer. • se dă comanda „wobb” şi din şuruburile speciale ale capului de sondă se reglează frecvenţa de rezonanţă pentru nucleul studiat. McLachlan. Z4. 31. • se calibrează spectrul în funcţie de referinţa aleasă. spectrometrul va intra în modul „lock”. se dă comanda „lock” şi se alege solventul potrivit. Bibliografie 1. (1994). Vol. Academic Press.cis. 3. deci câmpul va fi fixat şi stabilizat. se centrează semnalul de „lock” în fereastra de control a BSMS-ului. • se analizează spectrul. Anterior înregistrării unui spectru este posibil ca parametrii de achiziţie să necesite o optimizare. marcând peak-urile de rezonanţă. 1-18. Introduction to Magnetic Resonance. • se realizează reglajele de „shimm” făcând corecţiile necesare de la BSMS. 2. P. Grimmer and B. http://www. p. Annual Reports on NMR Spectroscopy. Joseph P. modificând în principal câmpurile Z1 şi Z2. măsurând integrala lor şi atribuind în final semnalele nucleelor. 30. funcţie de structura moleculară. Belton. • se fazează corespunzător.S. 5. (1995). 2007 Carrington. se dă comanda „lift off” şi proba coboară în magnet. Vol. X sau Y. la nevoie se modifică şi Z3. London (1967) 265 . NMR Basic Principles and Progress. • se setează parametrii de achiziţie.

reducerea.C. Raluca Ciceo-Lucăcel Analiza termică a materialelor acoperă o categorie largă de metode prin care sunt determinate proprietăţile fizice şi chimice ale acestora. • puritatea şi compatibilitatea materialelor. Analiză calorimetrică diferenţială Conf. sublimare.Robert Austin în anul 1899. dr. • căldurile de topire. în funcţie de temperatură sau timp pe baza efectelor termice care însoţesc transformările din probă în timpul supunerii acesteia la procese de încălzire. hidratarea – dehidratarea etc. MĂSURĂTORI TERMICE Analiză termică diferenţială. Termenul de “metoda diferenţială” provine de la fap266 . răcire. tratamente izoterme. • capacităţi calorice. de-vitrificare etc. de reacţie etc. fierbere. cristalizare.. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire.. etc. cristalizare. • cinetica reacţiilor şi a formării fazelor. • coroziunea metalelor în diferite atmosfere. Fenomenele fizice şi chimice. descompunerea.. • re-cristalizarea sticlelor metalice etc. • tranziţii vitroase ale solidelor ne-cristaline. • oxidarea. • temperaturile caracteristice ale transformărilor de fază.VII. călduri specifice. Metodele de analiză termică diferenţială reprezintă varianta modernă a metodelor clasice de investigare a efectelor termice induse de variaţia temperaturii unui corp fiind pentru prima dată folosite de către W.

De aceea. Cuptorul.tul că aceste tehnici permit determinarea diferenţelor dintre variaţiile unor mărimi fizice ale probei în raport cu cele ale unui etalon. Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme. metoda constă în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic. Suportul pentru probe conţinând termocuplurile şi containerele pentru probe plasate într-un bloc ceramic sau metalic. [1] Concret. Principalele componente ale unui sistem termic diferenţial Principalele componente ale unui sistem termic diferenţial (Fig. 3. 1) sunt: 1. Suprafaţa de sub aria curbei este proporţională cu modificarea entalpiei şi nu depinde de capacitatea calorică a probei. 2. 1.[2] Figura. DTA poate fi folosită si pentru a studia proprietăţile termice şi transformările de faze care nu se produc cu modificarea entalpiei materialului. 267 . Programatorul de temperatură. iar panta curbei în orice punct va depinde de microstructura probei la temperatura respectivă. Analiza termică diferenţială (DTA) este suficient de sensibilă pentru a determina variaţii foarte mici de temperatură şi este capabilă să sesizeze transformările lente ce se produc în intervale largi de temperatură. concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă. Linia de bază a unei înregistrări DTA prezintă astfel discontinuităţi la temperaturile de tranziţie.

Termenul calorimetrie se referă exclusiv la măsurarea căldurii. Orice proces endoterm sau exoterm (cum ar fi topirea sau cristalizarea) care are loc în probă la încălzire este înregistrat ca un peak în direcţia negativă. Efectul termic care se produce în cazul unei tranziţii termice sau a unui proces fizico-chimic este înregistrat ca diferenţă de flux caloric între probă şi referinţă şi la rândul lui este tradus în semnal electronic. 2). Căldura poate fi o cantitate de energie schimbată sub forma unui flux de căldură între două corpuri într-un interval de timp. pe care este reprezentată diferenţa de temperatură (semnalul DTA) (Fig. nu de temperatură. Sistemul de furnizare a gazelor. Sistemul de înregistrare. eliminarea volatilelor şi asigurarea unui transfer termic cât mai bun). respectiv pozitivă a axei X.4. amplificat şi 268 .conform IUPAC (International Union of Pure and Applied Chemistry). 5. Figura. în scopul menţinerii unei atmosfere inerte în cuptor (pentru inhibarea oxidării probei. 2 Schema idealizată a unei curbe DTA Calorimetria dinamică diferenţială (DSC) este o tehnică în care diferenţa de energie dintre o substanţă (şi/sau produşii de reacţie) şi un material de referinţă este măsurată ca funcţie de temperatură (sau timp) în timp ce substanţa şi materialul de referinţă sunt supuse unui program de temperatură controlat . Calorimetrele cu baleiaj diferenţial sunt tehnici îmbunătăţite ale DTA (analiza termică diferenţială) în sensul că ele au fost calibrate pentru măsurători de energie calorică.

atunci semnalul DSC va arăta ca o linie dreaptă. Semnalul măsurat redat în termograma DSC este direct proporţional cu capacitatea calorică a probei. iar „power compensated” DSC transformă această diferenţă de temperatură în puterea calorică necesară restabilirii echilibrului termic dintre probă şi referinţă. • calorimetre DSC cu compensarea puterii calorice („power compensated” DSC).apoi prelucrat de componenta software a instrumentului. 3). 269 . 3 Tipuri de procese care pot apărea într-o înregistrare DSC Există două tipuri de tehnici DSC utilizate în analizele termice: • calorimetre DSC cu flux de căldură („heat flux” DSC). Faţă de această linie se vor măsura intensitatea şi temperatura la care se manifestă procesele termice din probă. În continuare vom prezenta pe scurt câteva detalii pentru fiecare tehnică in parte. drept pentru care linia serveşte ca şi referinţă şi este numită linie de bază. astfel că orice diferenţă ce apare în capacitatea calorică a probei conduce la modificarea termogramei DSC. Înregistrarea se redă sub forma unei curbe numită termogramă DSC care reprezintă o dependenţă a fluxului caloric măsurat funcţie de temperatură (analiză în regim dinamic) sau timp (analiză în regim izotermal). Deşi în ambele tipuri semnalul măsurat reprezintă diferenţa de temperatură generată de senzori. Dacă proba de analizat nu suferă o transformare fizico-chimică sau o tranziţie termică. Sistemul „heat flux” DSC înregistrează diferenţa de temperatură între probă şi referinţă care apare în cursul unei transformări fizico-chimice. Schematic este prezentată o termogramă DSC în care linia de bază prezintă multiple modificări datorate proceselor şi tranziţiilor termice din probă (fig. fluxul diferenţial de căldură de la cuptor spre probă şi referinţă este măsurat pe căi complet diferite. Figura.

Dacă în cuptor fluxul de căldură este echilibrat. 4. care este şi parte integrantă a sistemului de înregistrare a temperaturii. în funcţie de tipul procesului. Schema de principiu a metodei heat flux DSC Power compensated DSC (Fig. 5) – măsoară diferenţa de flux termic proba-etalon indirect. Căldura transportată la probă şi referinţă printr-un platan din argint sau constantan. 270 . pentru a menţine diferenţa de temperatură zero. 4). este controlată în timp ce se înregistrează diferenţa de temperatură dintre cele două. prin diferenţa de putere electrică introdusă în rezistenţele de încălzire aşezate în imediata vecinătate a probei şi etalonului. Semnalul măsurat este folosit ulterior la măsurarea diferenţei de flux de căldură. iar graficul înregistrează aşa-numita linie de bază în funcţie de timp sau temperatură. Figura. Dacă în probă au loc transformări de fază sau alte procese care se produc la o anumită temperatură. diferenţa de temperatură este zero. Proba şi referinţa sunt menţinute la aceeaşi temperatură printr-un sistem electric format din două rezistenţe de încălzire.Heat flux DSC – măsoară diferenţa de temperatură dintre probă şi etalon. iar în grafic apare o deviere de la linia de bază sub forma unor peak uri endoterme sau exoterme. se modifică gradientul de temperatură al probei faţă de etalon. care este convertită în flux de căldură printr-o construcţie specială (Fig.

Semnalul electric dat de diferenţa de putere dintre cele 2 rezistenţe este proporţional cu diferenţa de flux termic şi este înregistrat sub forma curbei de analiză termică.Figura. Metalele cele mai frecvente utilizate le temperaturi înalte sunt nichelul. pentru ca temperatura probei să nu difere de cea a referinţei se cuplează sau decuplează rezistenţa de încălzire a acesteia până la egalizarea temperaturilor. Influenţa vitezei de încălzire asupra curbelor se explică prin aceea că odată cu creşterea ei creşte şi cantitatea de produşi sub formă de gaz care generează o diferenţă de temperatură mai mare între probă şi cuptor. dar peak-urile înregistrate sunt mai largi. La o viteză mai mică efectele termice au loc la temperatură mai joasă. Materialele ceramice utilizate la confecţionarea locaşurilor sunt 271 . Principalii astfel de factori de influenţă sunt [3]: 1.sau endoterm). metalele nobile şi seminobile. 2. La viteze de încălzire mai mari efectele termice sunt evidenţiate mai bine. însă pot apărea suprapuneri de peak-uri. Din punct de vedere experimental. Schema de principiu a metodei power compensated DSC Dacă în probă are loc un proces (exo. există o serie de factori care influenţează în mod direct efectele termice analizate şi implicit forma termogramelor. Viteza de creştere sau descreştere a temperaturii în cuptor: viteza de încălzire afectează înălţimea şi lăţimea efectelor termice înregistrate de curbele DTA şi DTG. Rolul formei şi al materialului din care este format locaşul pentru probe Materialele folosite la construcţia locaşelor sunt de două categorii: metalice sau ceramice. cu peak-uri mai înguste. oţelul inoxidabil la temperaturi înalte. 5.

pe de altă parte. sticle rezistente la temperatură şi. deci ale liniei de bază a curbei DTA. grafitul. 6. aşezarea lor în cuptor este dificilă din cauza faptului că au o slabă conductibilitate termică iar atunci trebuie foarte bine centrate. dau efecte termice cu intensităţi mari. ele pot influenţa forma efectelor termice sau să se impurifice. Rolul acoperirii sau descoperirii probei Acoperirea probei poate să ajute. 3. Cu toate acestea este bine să se lucreze. la obţinerea unei linii de bază a curbei DTA sub forma unei linii drepte sau prin acoperirea probei se protejează unele reacţii violente ca de exemplu: fierberile sau descompunerile în urma cărora ar ieşi o cantitate de probă afară din locaş. Această precauţie de a se lucra cu proba descoperită se ia pentru a nu influenţa admisia şi emisia gazelor şi a vaporilor de apă care însoţesc reacţiile termice şi care dacă ar fi într-un sistem închis ar duce la suprimarea unor reacţii. pe cât posibil. în timpul procesului termic. din cauză că transferul de căldură care are loc se face rapid prin pereţii lor şi între aceşti pereţi şi masa probei. Un alt dezavantaj este acela că datorită structurilor poroase. în decursul timpului. în anumite cazuri. care sunt mai frecvent utilizate. Cum ar fi. au avantajul că pot fi mult mai uşor de confecţionat. din cauză că transferul de căldură are loc încet prin pereţii lor. Densitatea sau gradul de tasare a probei în locaş: diferenţele în densitatea sau gradul de tasare a probei în locaş sunt cauzele cele mai obişnuite ale devierilor de la linia de bază a curbei DTA.2 şi 1g. s-au impus două tendinţe: utilizarea locaşurilor în formă de blocuri şi utilizarea locaşurilor în formă de creuzet. iar suprafeţele efectelor termice sunt mai mici (cu excepţia oxidărilor). 4. Locaşurile metalice. Dar dezavantajul lor este că intensitatea efectelor termice tinde să fie mică. Dar au şi acestea dezavantajele lor . fără ca această variaţie să aibă prea mare influenţă asupra rezultatelor. Cantitatea de probă ce trebuie luată în lucru este de 272 . Influenţa gradului de mojarare a probei: cu cât granulaţia probei este mai mică cu atât temperaturile de descompunere sunt mai joase. argilă arse. de multe ori. pentru aceeaşi cantitate de material reactant ca şi în cazul celor metalice. în cazul când în probă se află un compus care se topeşte. cu probele descoperite. Cantitatea de probă luată în lucru: greutatea probei luată în lucru poate să varieze între 0. Locaşurile ceramice. 5. fapt ce denaturează foarte mult forma curbelor termice. În ceea se priveşte forma locaşelor pentru probe. nu sunt poroase şi dau mici deviaţii ale fluxului de căldură.alumină cu adaus de silice.

Termocuplele ideale sunt cele constituite din metale nobile. între 100-800˚C se pot folosi termocuple confecţionate din aliaje speciale de Ni şi Cr. Natura şi proprietăţile termocuplelor: un termocuplu este format din doi conductori de compoziţie diferită. Substanţa termică inertă. Materialul de referinţă şi probele de analizat sunt puse în celule standard din alumină (având dimensiunile Ø: 5.5 mm). presiunea trebuie menţinută constantă pe tot parcursul determinărilor. comparativ cu această substanţă termică inertă. Măsurătorile de analiză calorimetrică se realizează pe un calorimetru diferenţial Shimadzu tip DSC-60. Materialul de referinţă şi probele de analizat sunt puse în celule standard din 273 . Pentru temperaturi cuprinse între 100-2200˚C se folosesc termocuple confecţionate dintr-un fir de Pt şi celălalt dintr-un aliaj de Pt cu rodiu. Cele mai bune materiale inerte sunt acelea care au aceeaşi conductivitate termică ca şi materialul de cercetat. Măsurătorile de analiză termică diferenţială se realizează cu un derivatograf termic Shimadzu tip DTG-60/60H. oricare ar fi materialul folosit. Acţiunea atmosferei din cuptor asupra desfăşurării reacţiilor: oricare ar fi procedeul experimental de reglare a presiunii din cuptor. În analiza termică se foloseşte o substanţă termică inertă în vederea determinărilor fenomenelor care au loc la încălzirea unui produs solid. fiecare. Alegerea substanţei termice inerte este foarte importantă. 8. Institutului de Cercetări Experimentale Interdisciplinare în Bio-Nano-Ştiinţe deţine două aparate performante destinate analizelor termice. care sunt rezistente la atacul termic şi au o durată de utilizare lungă în comparaţie cu cele confecţionate din metale inferioare. Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min. 9.8 mm x h: 2. dar. el trebuie să aibă aceeaşi mărime granulară şi să se ia aceeaşi cantitate în lucru ca şi proba de cercetat.obicei determinată de sensibilitatea aparaturii şi de intensitatea proceselor termice care au loc în substanţa cercetată. cu o rată de încălzire a cuptorului de 5-10ºC/min (uzual) în domeniul maxim de temperatură de la 23 ºC (sau temperatura camerei) până la 1600 ºC. sudaţi la un capăt între ei şi care au proprietatea ca prin încălzire la locul sudurii să dea naştere unui curent electric proporţional cu cantitatea de căldură aplicată. 7.

Informaţii importante privind proprietăţile termice ale unor materiale.N. Rata de încălzire a cuptorului este de 5-10ºC/min (uzual). Tehnică. Todor D. camerei) până la 600ºC. Second edition. 1972. N. cercetătorilor din UBB sau din Universităţi. doctoranzilor.Pop. Michael E. V. Ed. I. Brown. Bucureşti. 2001. Jumate. Centre de Cercetare partenere. teze de doctorat si lucrări ştiinţifice cotate ISI (anexa I).8 mm x h: 1.. Clujeană. O baie de azot lichid permite determinări la temperaturi scăzute (de la -150ºC). Analiza termică a mineralelor. Presa Univ. Chicinaş. Fizica Materialelor. 2. 3.5 mm). Introduction to thermal analysis: techniques and applications. Bibliografie 1. masteranzilor. obţinute prin măsurători efectuate la ICIBNS se regăsesc în o serie de lucrări de licenţă. în domeniul maxim de temperatură 23ºC (sau temp. dizertaţie . Accesul la aceste aparate este deschis tuturor studenţilor. Kluwer Academic Publishers. Ed. cadrelor didactice.aluminiu Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min fiecare (având dimensiunile Ø: 5.Metode Experimentale. 2001. Cluj Napoca. 274 .

...... în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic........... Ghid de interpretare a măsurătorilor DTA/TG şi DSC ............ raportat la cele două aparate de măsura existente în cadrul Institutului de Cercetări Interdisciplinare în Bio-Nano-Ştiinţe.. Analiza termică diferenţială simultan (DTA/TG) – aparat Shimadzu tip DTG-60/60H cu termogravimetria Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp.Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială........ dr......... ca principiu...... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială Metodele termice diferenţiale constau............ Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme. care prezintă pe abscisă timpul sau temperatura iar pe ordonată diferenţa de temperatura probă-referinţă (la DTA) sau diferenţa de flux termic (la DSC)............................. Cluj Napoca..................... concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă....................... 285 1.............. 275 2............ camerei – 1500ºC • Acurateţea balanţei: ± 1% • Detectorii: termocuplu de Pt plus 10% Pt/Rh 275 . Ghid de interpretare a măsurătorilor DTA/TG si DSC Conf.... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială....... 279 3................................... Bibliografie .................... În cele ce urmează sunt prezentaţi paşii necesari efectuării măsurătorilor DTA/TG şi DSC........ Raluca Ciceo-Lucăcel Cuprins 1......

6.• • • Interval măsurabil semnal DTA: ± 1 la ± 1000 µV Nivel de zgomot: < 1µV Materialul de referinţă (α-alumina) şi proba de analizat se pun în cellule standard din alumină (având dimensiunile Ø 5. • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min. Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor.0ºC/min pe un domeniu de temperatură de la temperatura camerei (minim) până la 1500 ºC (maxim). Se apasă tasta [OPEN/CLOSE] de pe afişajul digital al aparatului pentru a închide cuptorul. • Rata de încălzire a cuptorului: 0. 2. 7. apoi se apasă tasta [ZERO] pentru aducerea la valoarea zero a balanţei. 1 g Paşi în efectuarea unei măsurători DTA: 1. Se deschide cuptorul apăsând pe tasta [OPEN/CLOSE] de pe afişajul digital al aparatului. • Cantitatea de probă folosită: max. iar creuzetul gol pe suportul din partea dreaptă. 8. Se deschid recipientele de gaze pentru a asigura atmosfera în cuptor. 5. 3. Se pregătesc două creuzete curate: unul pentru proba de referinţă (α-alumina) altul pentru proba de analizat.5 mm). se ia creuzetul 276 . Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. 4. Se apasă o dată pe tasta [DISPLAY] când ecranul digital al aparatului afişajează valoarea masei.8 mm x h 2. Se aşteaptă un timp pentru stabilizarea semnalului. Se deschide cuptorul apăsând tasta [OPEN/CLOSE].1÷50.

TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. ca şi greutatea probei. Aparatul este conectat la un sistem de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare. asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). Analiza calorimetrică (DSC) – calorimetru diferenţial Shimadzu tip DSC-60. unde se poate alege numele fişierului şi directorul unde va fi salvat. Se deschide programul de analiză al aparatului. existând posibilitatea salvării datelor înregistrate până în acel moment. 9.gol de pe suport şi se pune în el o cantitate optimă de probă. Se apasă de două ori pe tasta [DISPLAY]. Analiza datelor (pierderi de masă. ecranul digital al aparatului afişează valoarea semnalului DTA. • Interval măsurabil semnal DSC: ± 40 mW • Nivel de zgomot flux de căldură: < 1µW 277 . 13. fişierul de analiză fiind salvat automat în directorul specificat. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP]. Valoarea afişată după stabilizarea semnalului TG reprezintă masa de probă. Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp. dar şi la un sistem de gaz care asigură evacuarea elementelor volatile. 10. care se aduce la zero prin apăsarea tastei [ZERO]. Oprirea măsurătorii se face în condiţii normale. apoi se pune din nou creuzetul pe suportul de probă. Se închide cuptorul. camerei – 500ºC sau minus 150ºC – 500ºC când se foloseşte baia de azot lichid.) se poate face din programul de analiză TA60 care permite asemenea prelucrări ale termogramelor ca şi convertirea şi salvarea datelor în format text pentru prelucrări ulterioare în alte tipuri de programe de prelucrare date. 12. Pornirea măsurătorii se face cu butonul [Start]. 11. identificare temperaturi evenimente termice etc.

asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor. Se deschid recipientele de gaze pentru a asigura formarea atmosferei în cuptor.8 mm x h 1. 3. Paşi în efectuarea unei măsurători DSC: 1. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. 6. 278 . cântărită în prealabil pe o balanţă digitală. Şi acest aparat este conectat la sistemul de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare. Se apasă o dată pe tasta [DISPLAY]. Se deschide programul de analiză al aparatului. Se apasă tasta [ZERO] pentru aducerea la valoarea zero a semnalului. iar în celălalt creuzet se pune proba. • Rata de încălzire a cuptorului: 1 ÷ 50 ºC/min. Într-un creuzet se pune o cantitate de referinţă (α-alumina). 4. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă.5 mm). şi la sistemul de gaz care asigură evacuarea elementelor volatile. • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min. Se pregătesc două creuzete curate. ecranul digital al aparatului afişează valoarea semnalului DSC. 5.• Materialul de referinţă (α-alumina) şi proba de analizat se pun în celule standard din aluminiu (având dimensiunile Ø 5. • Proba: substanţe în formă solidă sau lichidă la temperatura camerei. 2. iar creuzetul gol pe suportul din partea dreaptă.

ca şi greutatea probei. sublimare. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. În mod identic cu datele obţinute de la analiza DTATG. • temperaturile caracteristice ale transformărilor de fază.. mai jos fiind prezentate câteva exemple semnificative cu scopul de a oferi o imagine cât mai exactă a modului de intepretare a datelor furnizate de metodele termice diferenţiale: 279 . iar proba eliberează mai multă căldură decât în referinţa. • cinetica reacţiilor şi a formării fazelor. • căldurile de topire. datele salvate într-o măsurătoare DSC pot fi analizate cu programul TA60. cristalizare. • capacităţi calorice. existând posibilitatea salvării datelor înregistrate până în acel moment. • puritatea şi compatibilitatea materialelor. Ghid de interpretare a măsurătorilor DTA/TG şi DSC La modul general. călduri specifice.. cristalizare. În cadrul laboratorului de analize termice de la Institutul de Cercetare Interdisciplinară în Bio-Nano-Ştiinţe au fost abordate o parte din aceste tipuri de măsurători. Oprirea măsurătorii se face în condiţii normale. • oxidarea. descompunerea. • cristalizarea sticlelor metalice etc. 2. Când probele cristalizează. Modificări subtile ale semnalului DTA pot indica prezenţa unui peak exotermic asociat cu o separare de faze. unde se poate alege numele fişierului şi directorul unde va fi salvat. de reacţie etc. reducerea. fenomenele fizice şi chimice. 8. rearanjarea atomic este un proces exotermic. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP].. fişierul de analiză fiind salvat automat în directorul specificat.7. Pornirea măsurătorii se face cu butonul [Start]. hidratarea-dehidratarea etc. • tranziţii vitroase ale solidelor ne-cristaline. de-vitrificare etc. • coroziunea metalelor în diferite atmosfere. fierbere.

• Tendo = 132ºC. 280 .4 10. fără pierdere de masă → transformare structurală a NH4NO3 format în probă din precursorii azotaţi şi hidroxidul de amoniu introdus pentru cataliza bazică a hidrolizei din procesul sol-gel • Tendo = 169. identificate prin analiza XRD după un tratament termic la 500ºC.8 169.38% → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei. pierdere de masă de ~ 52%→ suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3.00 274.5 TGA mg 12.4ºC. fără pierdere de masă → începutul procesului de cristalizare a fazelor magnetit şi hematit.382% -1.00 -20.00 DTA uV -1.00 8.00 6.7ºC.7 -10. • Texo = 274.00 132 57. eliminarea altor reziduuri volatile din probă.00 0. pierdere de masă în TG ~ 1. fără pierdere de masă → topirea NH4NO3 • Tendo = 260ºC.37 C 10. Analiza DTA/TG a unui sistem aluminosilicatic cu Fe60SiO2·20Al2O3·20Fe2O3 preparată prin metoda sol-gel la pH 8.38% Weight Loss -52% -52.00 274.094 % 20.1.00 260 100 200 Temp [C] 300 Semnalul DTA prezintă patru peak-uri endoterme: • Tendo = 58ºC.

5) cu acidul azotic. x = 0. 281 .4 56 129 171 221 241.7 x=15 55 x=20 93. la pH 8.6 169. indicând faptul că prezenţa în matrice a unei cantităţi mai mari de Fe influenţează schimburile energetice şi cauzează întârzierea producerii anumitor evenimente termice în probă. rezultat din precursorul folosit pentru Al [Al(NO3)3·9H2O]: • NH4OH + HNO3 → NH4NO3 + H2O • Tendo = 128ºC şi 129ºC → transformare structurală a NH4NO3 • Tendo = 169. cele pentru 20% Fe fiind deplasate mai sus cu câteva grade. prin metoda sol-gel. diferind doar temperaturile la care au loc evenimentele (în special cele două evenimente care indică descompunerea. eliminarea altor reziduuri volatile din probă.4ºC → eliminarea apei rezultate din reacţia hidroxidului de amoniu (introdus în soluţie pentru obţinerea unui pH de 8. DSC mW x=0 129 230 93 128. • Tendo = 93.6 0 100 200 300 Temp [C] 400 500 Semnalele DSC ale probelor prezintă cinci peak-uri endoterme: • Tendo = 54ºC şi 56ºC → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei. respectiv topirea NH4NO3).7ºC şi 171ºC → topirea NH4NO3 • Tendo = 221ºC şi 241ºC → suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3. 15. HNO3. 20.5. Linia semnalului DSC pentru cele 2 probe ce conţin Fe este aceeaşi.2. Analiza DSC a unor sisteme aluminosilicatice cu Fe(80-x)[SiO2]· 20Al2O3· x[Fe2O3].

Si3Al4O12.50 0 500 Temp [C] 1000 • Pierderea iniţială de masă de ~0.3% în intervalul de temperatură 30-109ºC corespunde dehidratării probei prin pierderea apei adsorbite la suprafaţa probei.00 505 -0. o conversie structurală a metakaolinitului în altă stare polimorfă aluminosilicatică. fără pierdere de masă în TG. se transformă la temperatura la 995.00 6. care corespunde unui proces tipic de dehidratare prin dehidroxilarea caolinitului cu producerea fazei dezordonate metakaolinit.353% -14. Al2Si2O7. Faza dezordonată de metakaolin. • În intervalul 977 ºC – 1007 ºC.765% 993. corespunzător unei tranziţii structurale de stare solidă.542% -20.3.00 7. semnalul DTA etalează un peak exoterm (cu maximul la 993. care este considerată o structură tip γ-alumină [1]: 2 Al2Si2O7 –> Si3Al4O12 + SiO2 282 . Dar pierderi continue de hidroxil sunt observate până la 900°C (~0. Analiza DTA/TG a unei argile minerale cu structură majoritară de caolinit TGA mg 8.00 7.00 DTA uV -0. Al2Si2O7. • În intervalul de temperatură 354–660ºC se observă un peak endoterm foarte larg.50 1046 0.4 10.4ºC).5%) şi pot fi atribuite deprotonării graduale prin oxolare a metakaolinitului. având un maxim la 505ºC şi însoţit de o pierdere de masă de ~14 % din totalul masei probei.00 -10.5 ºC (unde apare peak-ul exoterm îngust) într-o fază aluminiu-siliciu spinel.

18C HA+50%Fe .00 -12.907% -20.00 400.00 85 84.00 200.554% 507 507.00 Semnalul DTA prezintă două peak-uri endotermice clare: • la 83.838% 50.00 -22.00 -13.00 4.68C -30.00 400.00 445.00 DTA uV 20.00 10.417% 5.00 83.026% 15.786% 20. cu pierdere de masă – descompunerea termică propriu-zisă în TCP (fosfat tricalcic) şi TTCP ( fosfat tetracalcic): Ca 10 ( PO 4 ) 6 ( OH ) 2 → 2 Ca 3 ( PO 4 ) 2 + Ca 4 P2 O 9 + H 2 O gas 5.00 800.94C 445 7.5 491 491.530% 8. Analiza DTA/TG a unei probe de corn de cerb deproteinată TGA mg 9.ºC şi 100ºC.00 -8.00 0.00 5.00 0.00 283 .t HA+30%Fe-t 0.00 100 200.00 Temp [C] 600.00 1000.00 6.4.00 -10. cu pierderi de masă în TG – dehidroxilare • la 491 ºC şi la 507 ºC.00 Temp [C] 600.00 DTA uV 371 371.90C -13.32C -6.00 10.00 -50. Analiza DTA/TG a două probe de hidroxiapatită (cu 30%Fe şi 50%Fe) – tratate termic la 450º C TGA mg -12.

eveniment care ar corespunde denaturării structurii triplu helix a colagenului din matricea osoasă. apoi uscare în cuptor la 40ºC până la îndepărtarea completă a solventului. însoţite de pierderi de masă considerabile. Analiza DTA/TG a unor materiale compozite polimer-sticle[5] Semnalele TG prezintă patru trepte de pierdere de masă: • I – intervalul de temperatură 20-400°C – volatilizarea apei de pe suprafaţa probelor 284 . Semnalul DTA etalează trei evenimente termice: • un peak endoterm având maximul la 85ºC.3.[2.Procedeul de deproteinare a probei a constat în degresare în acetonă timp de 48 h şi cu eter etilic timp de 30 min. format din două peak-uri cu maximele la 371ºC şi la 446ºC.4] 6. Aceste evenimente pot corespunde degradării şi respectiv arderii matricii organice a osului însoţită de volatilizarea compuşilor gazoşi rezultaţi din acest proces. eveniment dependent şi de gradul de hidratare al materialului. asociat cu o scădere a masei probei în curba TG (pe intervalul 50ºC–150ºC). dar şi eliminării apei libere ataşate în matricea de hidroxiapatită. • un eveniment exoterm de intensitate mare în intervalul de temperatură 350–500ºC.

Silaghi-Dumitrescu.E. L. Ma. Tămăşan. 129-138. 207-214 . 4 (2008). 4 (2009). Kinetic study of the kaolinite-mullite reaction sequence. 2 (2009). cel mai probabil datorat formării unei faze cristaline în structura compozitelor. Acesta este. vol. 5. Băciuţ. No. M. Simon. 10. and Clark. Velazquez. A. M. A. S. no. III – intervalul de temperatură 500-800°C curba DTA prezintă la T ~ 740 °C un peak endotermic pronunţat care poate fi atribuit unui proces de disociere fără pierdere de masă IV – la aproximativ 810-830 °C apare un peak exotermic mic. Journal of Optoelectronics and Advanced Materials. Vol. Pe de altă parte.M. Simon. 3. S. Colceriu. Thermal kinetics analysis of bone tissue organic phase.• • • II – intervalul de temperatură 400-500°C – însoţită în DTA de un peak exoterm cu maximul la ~T = 450ºC – o reacţie de dehidroxilare aferentă restructurării reţelei polimerice a compozitelor. Radu. Heredia.. Ocotlan-Flores. A. Gomez-Cortes. M. 1995.A.. Coman.. Gualtieri. Part I: kaolinite dehydroxylation. Bellotto. V. Thermal Analysis study of human bone.F. 11. Journal of Ceramic Processing Research. C. Thermoanalytical characterisation of new dental ionomer biocomposites. Javadpour. 285 . intensitatea acestor peak-uri poate fi legată de efectul interacţiunii mutuale dintre produşii de hidratare cu polimerul utilizat în sinteză. Pena-Rico. A. M. Belio. 3.Bibliografie 1. Javidi. Bucio. Journal of Materials Science 38 (2003) 4777-4782 M. Minerals 22. J.. S. J. M. Characterisation of natural hydroxyapatite extracted from bovine cortical bone ash. L. 958-960. I. 10. Tamas. acompaniat de o pierdere de masă. Bahrololoom. Prejmerean. Artioli.A. 4. Journal of Optoelectronics and Advanced Materials. Vol. V. Menţionăm că toate aceste măsurători au fost publicate şi/sau prezentate în cadrul unor conferinţe naţionale/internaţionale de specialitate. Simon. Phys. V. R. G. T. Lozano. L. 2. No. 479-483. C. Chem.

........1................. DIFRACTOMETRUL DE RAZE X Difracţie de raze X pe pulberi C..........................................................................1....................4.. Metoda Scherrer ............300 3.............. Analiza cantitativă de faze ....................................................... Rafinarea structurilor cristaline prin metoda Rietveld .... Principiul metodei Difracţia de raze X este una dintre metodele cele mai utilizate pentru investigarea compuşilor în faza solidă cristalină...............295 2................ Principiul metodei .........2.........................................................2............4.............................290 2...303 1................... Rafinarea Pawley sau Le Bail . Metode bazate pe utilizarea de standarde ..........293 2..... Metoda Warren-Averbach..........I. Aplicarea unor procedee de calcul pe monocristale la pulberi ...........286 2..........294 2..........290 2.............................................296 2..... Metoda bazată pe analiza Rietveld ....................4............................................................ Analiza microstructurală............................289 2...4.........................................302 4.......................289 2................................292 2....... Această tensiune se aplică între catodul şi anodul tubului de raze X........2...4........................VIII...................................2................................................................1......... dr.......2..... Metoda de căutare în spaţiul direct......................................................... Informaţiile care se obţin din difracţia de raze X pe pulberi ...........3....................................................................299 2........1. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente ....... Analiza calitativă de faze cristaline ......3.....3................ Indexarea Difractogramelor ....................................................................2....... Bibliografie . Determinarea structurii cristaline din pulberi .......................292 2..................................3........... Principiul de funcţionare a unui difractometru de raze X este următorul: Cu ajutorul unui generator de înaltă tensiune se obţine tensiune de ordinul zecilor de kV. Gheorghe Borodi Cuprins 1................1............................3.............S.3.........................................292 2...294 2.........................4........297 2...................4.......... Metode bazate pe analiza Rietveld ... 286 ...................2................................................3.

2 θ . dar există şi alte tipuri de montaje experimentale. Proba este aşezată pe un suport plan. Anozii tuburilor de raze sunt din următoarele materiale: Cu. Se poate considera difracţia pe astfel de plane cristalografice după cum este arătat în figura următoare: 287 . Liniile caracteristice pentru elementele grele cum sunt Mo şi Ag au lungimi de undă mică. trece printr-un sistem de fante care sunt montate pe goniometru după care radiaţiile X ajung la detector unde este înregistrată. c/l. Orice compus cristalin cristalizează într-un anumit sistem cristalografic cu parametrii de reţea bine precizaţi. Mo. Pentru aplicaţiile practice de difracţie pe pulberi este necesar să folosim o radiaţie cât mai monocromatică. Electronii respectivi sunt acceleraţi între catodul şi anodul tubului. Cu are lungimea de undă intermediară şi este cel mai utilizat. Difracţia razelor X se poate explica în mai multe feluri. un anumit grup spaţial şi un mod de aranjare a atomilor în celula elementară. Cea mai uzuală interpretare este difracţia Bragg pe planele cristalografice. În celula elementară se pot construi diverse seturi de plane cristalografice fiecare set fiind caracterizat prin indicii Miller corespunzători. Radiaţia X emisă de tubul de raze X intră într-un goniometru. Electronii care lovesc anodul fac să se emită radiaţii X sub forma unui spectru continuu şi a unui spectru caracteristic. Acest lucru se realizează în cazul montajului θ . l) dacă cel mai apropiat plan cristalografic faţă de origine intersectează axele cristalografice la distanţele: a/h. Cr. Co. unghiul dintre radiaţia incidentă şi probă este egal cu unghiul dintre radiaţia difractată şi planul probei. iar liniile caracteristice pentru Cr si Co au lungimi de undă mari. Fe. Dintre lungimile de undă emise de un tub de raze X cea mai intensă este radiaţia K α . k. detectorul se roteşte cu un unghi dublu în aşa fel încât tot timpul unghiul de incidenţă este egal cu unghiul de reflexie. Monocromatizarea radiaţiei X se face cu ajutorul filtrelor de raze X sau cu ajutorul monocromatoarelor de raze X. Astfel.Catodul tubului de raze X este alcătuit dintr-un filament care este de asemenea alimentat la o sursă de joasă tensiune şi care face ca filamentul să emită electroni. un set de plane cristalografice echidistante are indicii Miller (h. Spectrul continuu nu depinde de natura anodului în schimb spectru caracteristic depinde de anodul folosit. În timp ce proba se roteşte cu un anumit unghi. b/k. Ag etc.

iar în cazul acesta.Condiţia de difracţie este dată de relaţia: 2dsin θ = λ (1) unde d este distanţa interplanară. De exemplu. iar λ lungimea de undă. Expresia factorului de structură este dată de relaţia: Fhkl= ∑ fj exp π 2 i(hxj+kj+lzj) (2) Intensităţile de difracţie sunt proporţionale cu pătratul factorilor de structură. Intensitatea radiaţiei X împrăştiate de către un singur atom este caracterizată prin factorul de împrăştiere atomic. De aici rezultă că poziţiile maximelor de difracţie depind exclusiv de tipul reţelei cristaline şi de parametrii celulei elementare. Factorii de împrăştiere atomici depind de numărul de electroni din componenta atomului dat. de parametrii celulei elementare şi de indicii Miller. Factorii de împrăştiere atomici scad cu unghiul de împrăştiere. θ unghiul de difracţie. pentru sistemul ortorombic avem 1/d2 = h2/a2 + k2/b2 + l2/c2. intensităţile de difracţie vor depinde de natura şi 288 . Pentru alte sisteme cristalografice avem alte formule de calcul a distanţelor interplanare. Vibraţiile vectorului câmpului electric produc oscilaţii ale electronilor atomilor. Aceste unde electromagnetice produse de atomii din celula elementară se suprapun şi se compun. radiaţii X. Prin urmare. Dacă radiaţia X cade pe probă. Radiaţia X constă din unde electromagnetice în care componenta vectorului câmp electric şi magnetic oscilează perpendicular pe direcţia de propagare a undei. iar rezultanta este dată de factorul de structură. Distanţa interplanară este determinată de sistemul cristalografic. atunci fiecare atom din celula elementară împrăştie radiaţiile incidente. Dependenţa intensităţii factorilor de împrăştiere de sin θ / λ este dată în tabelele internaţionale sub forma unor relaţii empirice. Să vedem în continuare de cine depind intensităţile de difracţie. Dar orice sarcină care oscilează produce la rândul ei unde electromagnetice. De aici se observă că fiecare set de plane cristalografice corespunde unui anumit unghi de difracţie.

În felul acesta intensitatea de difracţie corespunzătoare unui set de plane cristalografice este dată de relaţia: Ihkl=K·m·Lp·A·T·I·Fhkl·I2 (4) În această relaţie s-a introdus şi m care este factorul de multiplicitate. m masa acestuia. Deoarece în general λ . Probele se pun de obicei pe suporturi plane. toate acestea se pot grupa împreună sub forma unei constante notată cu K. ω .poziţia atomilor în celula elementară. I0 sunt constante pentru un experiment de difracţie. Intensităţile de difracţie depind şi de alţi factori. iar Fhkl este factorul de structură.1. iar (e2/mc2) sunt constante universale. Analiza calitativă de faze cristaline Analiza cantitativă de compuşi chimici în faza solidă se poate face prin metode chimice. Vom obţine difracţie numai de la planele cristalografice care sunt paralele cu suprafaţa suportului de probă. Vcr. Acesta rezultă din aceea că pot să existe mai multe plane cristalografice care să producă difracţie la acelaşi unghi θ . numărul de cristalite care participă la difracţie este foarte mic. e fiind sarcina electronului. poziţiile maximelor de difracţie depind de celula elementară. Astfel se demonstrează că intensitatea radiaţiei difractate de către un mic monocristal care se roteşte cu viteza unghiulară ω este dată de relaţia [1] : Ihkl = ( λ 3/ ω V2). 289 . În concluzie. Pulberile constau din foarte multe cristalite mici de ordinul zecilor până la ordinul miilor de Å orientate haotic unele în raport cu altele. V. iar c viteza luminii. Informaţiile care se obţin din difracţia de raze X pe pulberi 2. De aceea.(e2/mc2)2·Vcr·I0·Lp·A·T·I·FhklI2 unde (3) λ este lungimea de undă ω viteza unghiulară cu care se roteşte monocristalul V volumul celulei elementare I0 intensitatea fasciculului incident Lp este factorul Lorentz-polarizare A factorul de absorbţie T factorul de temperatură. iar intensităţile de difracţie de poziţiile atomilor în celula elementară. dar acestea necesită o abordare mai laborioasă şi timp mai mult. 2.

Compararea difractogramei experimentale cu cele din catalog se face utilizând bazele de date. cum se mai spune. iar dacă avem mai multe faze. cu luarea în considerare a coeficienţilor de absorbţie a fazelor componente. difractograma rezultată va fi o suprapunere a difractogramelor individuale. Analiza de faze cristaline se bazează pe compararea difractogramei de raze X experimentală cu difractogramele care se găsesc în bazele de date. Se ştie că acelaşi compus chimic poate să se prezinte în diferite forme polimorfice sau. Dacă avem la dispoziţie baza de date CSD sau o altă bază de date. Difracţia de raze X pe pulberi deosebeşte cu uşurinţă diferite forme polimorfice ale unui anumit compus. 2. Obţinerea componentei procentuale a fazelor dintr-un amestec se poate face atât prin metode chimice. când avem un amestec de faze cristaline. cât şi prin difracţie de raze X. Analiza cantitativă de faze În foarte multe cazuri. care ne dă datele cristalografice complete pentru compuşii care ne interesează. Identificarea fazelor cristaline se bazează pe următoarele considerente: fiecare fază cristalină aparţine unui anumit sistem cristalografic.În prezent. 2. Aceasta face ca fiecare fază cristalină să aibă intensităţile de difracţie şi unghiurile la care apar aceste intensităţi bine determinate. în special PDF-2. iar atomii compusului se plasează în anumite poziţii în celula elementară. Deci. în diferite faze cristaline. Metode bazate pe utilizarea de standarde Între intensităţile de difracţie şi fracţia în greutate Wα. atunci putem să simulăm difractograma acelui compus şi să o comparăm cu difractograma experimentală. ne interesează compoziţia procentuală a fiecărei faze din amestec. deoarece proprietăţile fizico-chimice depind de compoziţia procentuală. are parametrii de reţea bine determinaţi sau care variază într-un interval relativ mic. analiza calitativă de produşi chimici cristalini se face în cea mai mare măsură prin difracţie de raze X pe pulberi.2. În anumite cazuri difracţia de raze X pe pulberi cristaline poate să fie o metodă rapidă şi eficientă. PDF-4. pentru o anumită fază α există relaţia: 290 .1. din analiza de faze putem să identificăm o anumită fază numai dacă aceasta a fost catalogată în prealabil.2. aparţine unui anumit grup spaţial. Analiza cantitativă de faze se bazează pe faptul că fiecare fază cristalină produce propria difractogramă.

standard (ii). x ρα este densitatea fazei α. şi de raportul dintre intensitatea liniei i a probei de analizat şi intensitatea liniei j a probei standard după relaţia: Wα = I iα W s I js RIRαs (8) 291 . I jsWd Fracţia Wα pentru faza necunoscută se determină în funcţie de fracţia Ws pentru proba standard. O altă metodă este aceea a raportului intensităţii de referinţă (RIR) (Reference Intensity Ratio). măsurarea lui Iiα şi estimarea lui μ m O altă metodă este aceea a standardului intern care presupune includerea unui standard intern în proba de compoziţie procentuală cunoscută Ws. Pentru aplicarea acestei relaţii este necesară (i) determinarea constantei Ciα prin prepararea de standarde cu compoziţie procentuală a fazei α bine x a probelor determinată şi estimarea coeficientului de absorbţie masic μ m x pentru probe necunoscute. iar μ m este coeficientul de absorbţie masic pentru întreaga probă [2]. Ca standard extern se alege în general corundum. Intensitatea de reflexie Ijs este dată de relaţia: I js = C js Ws x ρsμm (6) Împărţind cele două relaţii rezultă: is Wα = K α sWs I iα I js (7) ij unde K α s = C js ρα Ciα ρ s ij poate fi determinat făcând un amestec cunoscut de fază standard şi Kα s fază de analizat. Se defineşte RIRαs = I isWs .I iα = C i α Wα x ρα μ m (5) unde Ciα este o constantă pentru reflexie (sau un grup de reflexii) i a fazei α.

distribuite haotic unele în raport cu altele. Dar la lărgimea liniilor de difracţie contribuie şi deformările reţelei cristaline şi probabilităţile de defecte. din analiza Rietveld rezultă fracţia de faze din probă.1. inclusiv procentul de fază necunoscută. 2. Factorii care limitează precizia analizei de fază sunt: dimensiunea diferită pentru particulele aparţinând la diferite faze de analizat. Dimensiunile acestor cristalite sunt de ordinul zecilor până la ordinul miilor de Å. microabsorbţia. liniile de difracţie de asemenea se lărgesc. Reducerea coeficienţilor de absorbţie se poate face prin utilizarea tuburilor de raze X cu lungime de undă mai mică. Erorile sunt cu atât mai mici cu cât dimensiunea particulelor este mai mică şi cu cât coeficienţii de absorbţie vor fi mai mici. Intensităţile de reflexie pentru probele cu coeficient mai mare de absorbţie vor fi mai intense. Dacă dimensiunile cristalitelor sunt sub 20 Å. Metoda Scherrer Scherrer a arătat pentru prima dată că dimensiunile cristalitelor sunt legate de lărgimea de difracţie prin relaţia [2]: D= Kλ β cos θ (9) D este dimensiunea microcristalitelor. Se ştie că pulberile cristaline sunt formate din mici monocristale. Astfel. 2. Trebuie menţionat că dimensiunile particulelor sunt diferite de dimensiunile cristalitelor. Se filtrează toţi parametrii de care depinde intensitatea de difracţie.3.3.2. a deformării reţelei cristaline şi a probabilităţilor de defecte. Analiza microstructurală Analiza microstructurală include determinarea dimensiunilor microcristalitelor şi eventual distribuţia acestora după dimensiune. Metoda bazată pe analiza Rietveld Analiza cantitativă de faze se poate face şi cu analiza Rietveld [3]. orientarea preferenţială a cristalitelor. Dacă reţeaua este mai deformată sau dacă avem mai multe defecte. Într-o particulă pot să existe mai multe cristalite (monocristale) orientate diferit între ele. Cu cât dimensiunile cristalitelor sunt mai mici cu atât liniile de difracţie sunt mai largi.2. β este lărgimea liniilor de difracţie 292 . numite cristalite. se consideră că compusul respectiv este sub formă amorfă.2.

iar b este lărgimea de difracţie instrumentală. deoarece cu cât dimensiunile sunt mai mari lărgimea liniilor de difracţie se apropie de lărgimea instrumentală şi depinde foarte mult cât de corect am ales lărgimea instrumentală. Cea mai utilizată valoare a lui K = 0.3. unde ε este un parametru care reflectă deformaţia reţelei cristaline şi reprezintă deplasarea medie a atomilor faţă de poziţia de echilibru. iar θ este unghiul de difracţie.89. Dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată dimensiunilor cristalitelor este diferită de dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată deformării reţelei cristaline. Ca măsură a lărgimii liniilor de difracţie se consideră lărgimea la semiînălţime. Lărgimea liniilor de difracţie creşte cu unghiul. În această relaţie B este lărgimea de difracţie măsurată. Astfel avem relaţia: β cosθ = 0.corectată de lărgimea instrumentală. dacă aceasta se defineşte ca fiind dimensiunea liniară sau rădăcina de ordinul 3 din volum. 2. până la 1000Ǻ. dacă profilul de difracţie este o funcţie de tip Lorentz şi β2 = B2 –b2.2. Metoda Warren-Averbach Am amintit că lărgimea liniilor de difracţie scade atât cu scăderea cristalitelor cât şi cu creşterea deformaţiilor reţelei cristaline.9λ + 4ε sinθ D (10) în cazul în care profilul liniei de difracţie este de tip Lorentz. 293 . precum şi de alţi factori. Pentru a obţine b. care se defineşte ca fiind aria maximului de difracţie împărţită la intensitatea maximă pentru maximul respectiv. Lărgimea instrumentală se obţine din lărgimea de difracţie experimentală astfel: β = B-b. Unii autori iau ca lărgime a liniilor de difracţie lărgimea integrală. Domeniul pe care precizia determinării dimensiunilor cristalitelor se consideră acceptabilă este de la aproximativ 20Å. Precizia legată de determinarea dimensiunilor cristalitelor scade odată cu creşterea acestora. dacă profilul de difracţie este o funcţie de tip Gauss. se foloseşte o probă foarte bine cristalizată şi se măsoară lărgimea maximelor de difracţie pentru unghiurile de difracţie apropiate cu cele ale probei de măsurat. K este o constantă care depinde de modul cum se defineşte dimensiunea D.

atunci avem relaţia: β 2 cos 2 θ = λ2 D2 + 16ε 2 sin 2 θ (11) Din reprezentarea grafică a lui β2cos2θ. dacă considerăm diferite linii de difracţie. Dimensiunile cristalitelor se mai pot determina şi din analiza Fourier a liniilor de difracţie. Conform formulei lui Caglioti. Determinarea structurii cristaline din pulberi Determinarea structurii cristaline se face în general din datele de difracţie obţinute din monocristale. astfel: ΓL = X + Y tgθ cosθ (12) pentru un profil de tip Lorentz. V. U. De aici putem să determinăm ε şi D. W si P. Dacă profilul liniilor de difracţie este de tip Gauss. Metode bazate pe analiza Rietveld O altă modalitate de determinare a dimensiunilor cristalitelor şi a deformării reţelei cristaline se poate face prin analiza [4] Rietveld. dar poate ajunge şi până la 200. În continuare dimensiunile cristalitelor şi deformaţiile reţelei se calculează în funcţie de aceşti parametrii. Pentru un profil de tip Gauss avem: ΓG = Utg 2θ + Vtgθ + W + P cosθ (13) Din fitarea Rietveld rezulta X.9λ . Numărul intensităţilor de difracţie care se pot obţine din difracţia pe monocristale este de ordinul zecilor de mii. 2. în funcţie de sin2θ.3. iar panta D dreptei reprezintă 4ε.Reprezentând grafic βcosθ în funcţie de sinθ. Se obţin mai puţine intensităţi de difracţie deoarece liniile de difracţie pot să se suprapună şi de ase294 . Numărul intensităţilor de difracţie care se pot obţine din pulberi cristaline este de ordinul zecilor. 2. unde ΓL este lărgimea la semiînălţime. Y. iar X si Y parametrii de fit. lărgimea la semiînălţime depinde de unghiul θ. rezultă dimensiunile cristalitelor şi deformările reţelei. Ordonată la origine pentru această dreaptă reprezintă 0. ar trebui să obţinem o dreaptă.4.3.

Un plan cristalografic de indicii Miller h. Orice compus este caracterizat de o anumită celulă elementară care este un paralelipiped cu muchiile a. β. γ. a determina parametrii celulei elementare şi a atribui fiecărui maxim de difracţie indicii Miller corespunzători. Etapele principale pentru determinarea structurii cristaline din pulberi sunt: 2. k. Pentru o anumită celulă elementară putem să definim planele cristalografice. c şi unghiurile dintre ele α. Concordanţa dintre poziţiile maximelor de difracţie calculate şi obser295 . Numărul mai mic de maxime de difracţie observat în cazul pulberilor precum şi suprapunerea unor maxime provenite de la plane cristalografice diferite este motivul pentru care este mult mai dificil de determinat structura cristalină din pulberi faţă de monocristale. γ.4. Numărul de maxime de difracţie în cazul pulberilor care se observă este foarte mic comparativ cu numărul de maxime de difracţie observate pentru monocristal. unele maxime de difracţie se suprapun în cazul pulberilor. b/c si c/l de origine. avem şapte sisteme cristalografice. Parametrii care caracterizează celula elementară se numesc parametrii celulei elementare. difracţia razelor X poate fi privită ca difracţia de pe planele cristalografice. β. Determinarea structurii cristaline pentru un anumit compus înseamnă determinarea sistemului cristalografic. În acest caz se apelează la determinarea structurii cristaline din pulberi.1 Indexarea Difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic în care cristalizează compusul. Se obţin maxime de difracţie dacă este îndeplinită condiţia lui Bragg: Maximele de difracţie au intensităţi mai mari sau mai mici în funcţie de modul de distribuţie a atomilor în celula elementară.menea unele intensităţi de difracţie sunt foarte slabe şi nu se pot observa. Din reflexiile interzise se pot atribui grupurile spaţiale cele mai probabile. a grupului spaţial şi a poziţiilor atomilor în celula elementară. α. După cum se ştie. b. Dar există situaţii când anumiţi compuşi nu se pot cristaliza şi totuşi ne interesează structura lor cristalină. a parametrilor celulei elementare. b. determinarea structurii cristaline este mult mai dificilă pentru pulberi decât pentru monocristale. Se ştie că difracţia razelor X pe atomi poate fi privită ca difracţie pe planele cristalografice. Deoarece numărul de intensităţi de difracţie care se pot colecta din difractograma pe pulberi este mult mai mic decât pentru monocristale. În funcţie de a. l este un plan care intersectează axele cristalografice la distanţele a/h. De asemenea. c.

reflexiile 333 şi 511 pentru sistemul cubic sau 43l şi 50l pentru sistemul tetragonal. Suprapunerea exactă a intensităţilor de difracţie are loc mai ales pentru sistemele cristalografice de înaltă simetrie. iar <Q> este abaterea medie dintre liniile de difracţie calculate şi observate. Au fost dezvoltate două metode de extragere a intensităţilor de difracţie din pulberi. metoda Dicvol [8] X-Cel [9] si metoda Treor [10]. Există mai multe metode de indexare dintre care cele mai importante sunt: Metoda Ito[7]. de Woolf [5]: M 20 = Q 20 2 < Q > N 20 (14) Q20 este valoarea lui Q pentru a 20-a linie de difracţie. 2. Un alt factor de încredere datorat lui Smith si Snyder [6] se defineşte astfel: FN= N < Δ 2θ > .M. < Δ 2 θ > este abaterea medie dintre liniile de difracţie calculate şi observate. Suprapunerea reflexiilor este cu atât mai probabilă cu cât celula elementară are volumul mai mare. De exemplu. Suprapunerea accidentală are loc atât pentru sisteme cu simetrie ridicată. Rafinarea Pawley sau Le Bail Rafinarea Pawley sau Le Bail este utilizată pentru extragerea intensităţilor de difracţie. rafinarea celulei elementare şi atribuirea grupului spaţial cel mai probabil. Dacă avem M20 > 10. şi anume: Metoda Le Bail şi metoda propusă de Pawley. N20 este numărul de linii diferite calculate până la linia corespunzătoare lui Q20. care este valoarea în θ pentru limita superioară selectată. Metoda Le Bail [11] de extragere a intensi296 . dar mai ales pentru sisteme cristalografice cu simetrie joasă şi se datoreşte creşterii numărului de reflexii independente.4. Există mai multe moduri de definire ale figurilor de merit sau gradului de încredere în indexarea respectivă.N (θg ) (15) unde N( θg ) este numărul de linii de difracţie calculate până la θ g.vate se caracterizează şi prin aşa numite figuri de merit.2. Există o suprapunere sistematică a intensităţilor de difracţie şi o suprapunere accidentală. Cea mai utilizată figură de merit este M20. Una dintre figurile de merit se datorează lui P. indexarea este probabil corectă.

297 . maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative. octaedrii etc.5 dintr-un pas de înregistrare a difractogramei.4. mai ales atunci când fondul de difracţie este supraestimat. În timp ce metoda Le Bail este o metodă iterativă.4. 2.3. există şi cazuri când prezintă instabilităţi. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare.1. Deşi procesul de rafinare este în general stabil. Pawley [12] a elaborat o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X fără a avea un model structural. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală.14] au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură în schimbul intensităţilor de difracţie. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. în care mărimile care trebuie determinate sunt intensităţile de difracţie. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. tetraedrii. Aceasta este o metodă de analiză prin cele mai mici pătrate. grupe de atomi aranjaţi într-o anumită configuraţie. fragmente din molecule. Putem să avem atomi. Obţinerea unui model structural 2. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale. Unii autori [13. molecule. Ca intensităţi de pornire se pot considera valorile calculate ale intensităţilor de difracţie. Deşi metoda este în general robustă.tăţilor de difracţie este inspirată din metoda Rietveld. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. Această metodă nu cere extragerea factorilor de structură din difractogramă.3. ca de exemplu.

Una dintre posibilităţi este să se aleagă ca fiind rezidiul R. dintre care amintim: Răcire simulată (simulated annealing). În timpul procesului de căutare temperatura se scade treptat. Fox [16. atunci se reţine noua configuraţie. şi anume Parallel Tempering (PT) [18]. în faza iniţială a procesului de căutare a configuraţiei optime se poate uşor trece de la un minim local la un alt minim în scopul determinării minimului absolut. Dacă CF este mai mare decât cea precedentă.Δ CF/T). eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. Astfel. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2 = exp[(CF2-CF1)/T]. cu descreşterea temperaturii se aleg de la 298 . Pentru moleculele organice. Funcţia de cost CF se poate alege în diverse moduri. În schimbul utilizării unui singur lanţ de configuraţii. definit în felul următor: Σ i wi ( y Rwp=[ obd i − i y calc i )2 ]1/2 (16) Σ i wi ( y ) 2 obs Dacă funcţia de cost CF este mai mică decât cea precedentă. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. când T este foarte mic. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. Totuşi. o variantă a acesteia numită Parallel tempering şi Tehnica algoritmilor genetici. se consideră funcţia de cost CF. probabilitatea de a găsi un alt minim este de asemenea mică. Astfel pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. dintre care amintim Powder Solve [15]. se testează potrivirea dintre difractograma calculată şi cea experimentală. În cazul metodei de răcire simulată se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. dar în faza finală. T fiind temperatura distribuţiei. pentru a evita să cădem într-un minim local. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime.Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. un alt algoritm a fost dezvoltat.17]. atunci se reţine noua configuraţie cu probabilitatea exp(.

factorul de extincţie. deci în acest caz factorii de structură sunt numere reale pozitive sau negative. factorul de absorbţie. Determinarea factorului de scală şi a factorului global de temperatură. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul zecilor. Deoarece intensităţile de difracţie se măsoară în unităţi arbitrare. dintre care amintim: Factorul Lorentz.3. Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley.2. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice aplicate invarianţilor şi semiinvarianţilor. intensităţile acestora se reduc cu un factor de temperatură. Cu toate acestea. factorul de polarizare. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. Dacă se fac corecţiile intensităţilor de difracţie. se obţine modulul factorilor de structură. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi. Dar factorii de structură sunt numere complexe. Datorită faptului că atomi oscilează în jurul poziţiilor de echilibru. până la 3 sau 4 sute.început mai multe configuraţii (un număr mic de configuraţii). 2. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie.20]. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. se determină factorul de scală şi de temperatură. Cunoscând factorii de struc299 . În felul acesta. Determinarea fazei factorilor de structură [19. intervine un factor de scală K care trebuie determinat. Paşii care trebuie urmaţi sunt: corectarea intensităţilor de difracţie de diverşi factori.4. Sinteza Fourier şi sinteza Patterson. posibilitatea de a se obţine minime locale este mai mică. în unele cazuri s-au obţinut rezultate bune.

l ∑F 2 h . În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. k . după relaţia: P(u.v. . Dintre programele de calcul cel mai utilizat este GSAS [22]. În cazul obţinerii modelului structural s-a făcut o căutare globală potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată.Rafinarea modelului structural prin metoda celor mai mici pătrate. 300 .4. putem să determinăm densitatea electronică de sarcină în celula elementară cu ajutorul următoarei relaţii: ρ ( x. Pe baza densităţii electronice se poate construi un model structural aproximativ. 2. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate. există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. Funcţia ce trebuie minimizată este: S y = ∑ wi ( y i − y ci ) 2 i (19) unde: wi . k . de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate.tură. Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară dacă aceştia există. deoarece nu sunt necesare variaţii mari ale acestor parametrii.w)= 1 V h .4. atunci putem face sinteza Patterson.factorul de pondere şi este wi=1/yi. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [21]. z ) = 1 V ∑F hkl hkl exp( −2πi ( hx + ky + lz )) (17) Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât.l cos( 2π ( hx + ky + lz )) (18) Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi mai ales distanţele dintre atomii grei. y . unde densitatea electronică este mai mare.

Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma[24]. fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. yci . în general trebuie impuse constrângeri. Urmează rafinarea deplasării punctului de zero pentru difractogramă. deformaţiile de reţea. exprimată prin funcţia lui Caglioti [23]: H 2 = U tan 2 θ + V tanθ + W (20) unde. La început se rafinează factorul de scală. În ultimele etape. mai ales dacă avem un număr mare 301 . V. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RP = ∑| y − y ∑y i i ci | (21) 1/ 2 RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ (22) unde wi=1/yi şi se numesc factori de pondere.intensitatea calculată la pasul i. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. Pentru o difractogramă oricât de perfectă maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. Calitatea rafinării se apreciază pe baza unor indici de rezidiu. se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. În general. Din literatură şi din experienţă proprie am constatat că este necesar să se adopte următoarea strategie. şi factorul de polarizare. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. W sunt parametri care se pot rafina. H este lărgimea la semiînălţime şi U.intensitatea observată la pasul i. factorul de temperatură şi coeficienţii polinomului care descriu fondul. Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară. factorul care descrie absorbţia razelor X.yi . În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. factorii care descriu asimetria liniilor de difracţie etc.

Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente Aparatura de difracţie disponibilă este un difractometru Shimadzu XRD–600 prevăzut cu un monocromator pentru fasciculul difractat. dar forma ansamblului să nu se schimbe. De exemplu. timpul de înregistrare este suficient să fie 0 2 /minut. Aceasta ar trebui făcută săptămânal. Este recomandat ca difractometrul să fie aliniat în fiecare dimineaţă înainte de a începe experimentele. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain” [25] şi “rigid body“ [26]. Modul de aliniere şi calibrarea lunară se găsesc în documentaţia de folosire a difractometrului. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi.de atomi pe celula elementară. mai este necesară o calibrare mai complectă la fiecare lună. permiţând translaţia şi rotaţia acestora. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. este necesar ridicarea unei difractograme pentru un etalon de siliciu. 3. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei împreună cu atomii de oxigen secundari au fost considerate ca “rigid body”. au fost adaptaţi alţi suporţi de probă care să permită difracţie pentru cantităţi foarte mici de probă. Pentru analiza calitativă. aceste distanţe pot să varieze între anumite limite. De exemplu. în procesul de rafinare a complecşilor de incluziune. Totuşi. Pentru o mai mare siguranţă referitoare la punctul de zero al difractometrului. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu [27]. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. Pe lângă aceasta. C–O pentru legături simple sau duble. de aceea. Suporţii de probă aduşi de firmă nu au permis analiza unor cantităţi mici de probă. Unităţile glicozidice au fost legate între ele prin constrângeri slabe. Difractometru este prevăzut cu o bază de date pentru efectuarea de analize calitative şi cu software pentru determinarea raportului cristalin-amorf. Timpul de înregistrare pentru difractograme şi fantele folosite depind de tipul de măsurători efectuate. de exemplu C–C. În cazul în care se fac măsurători pentru compuşi anorganici cu 302 .

Dinnebier and S. când dorim să vedem efectele structurale de suprafaţă sau când avem probă puţină.E. 4. 8. Smith and R. Klug and L. adâncimea de pătrundere a razelor X este mult mai mică în cazul utilizării tubului de Cr. Powder diffraction. 108-113 (1968). Oxford University Press 2002.Louer J. R. să fie curăţate. 252-255 (1977). G. Appl. Ed. Appl. 356-365 (2003). este avantajos utilizarea tubului de Cr. 9. În acest caz. Neumann J. iar pentru compuşi organici care au celula elementară mai mare între 3 si 450. dacă este cazul. D. Pentru analiza microstructurală nu este necesară înregistrarea difractogramei pe întreg domeniul. Powder Diffraction Reviews in Mineralogy Vol 20 1989. este indicat să se controleze filtrele pentru apă odată la 3 luni şi. Nu este indicată achiziţionarea de tuburi de raze X care să nu se utilizeze deoarece tuburile de raze X se deteriorează în timp. Appl. de aceea.E. R. eventual să se lase aparatul să funcţioneze şi peste noapte. De asemenea. Post. J.C Publishing 2008. de Woolff. H. 5. 89 (1969). Alexander X-Ray Diffraction Procedures J. Billinge. Eds D. timpul de înregistrare trebuie să fie mare. Giacovazzo. 7.celula elementară mică. 10. M.P. Pentru analiza cantitativă de faze este indicat să se lucreze cu metoda standardului intern. Appl. Ed. 2. măsurătorile trebuie să se facă aproximativ între 10 si 800. Snyder J. 6.E. Cryst. ci doar înregistrarea maximelor de difracţie care trebuie să se facă cât mai precis. Willey& Sons. În cazul în care se încearcă determinarea structurii pentru un nou compus. Tubul de Cu dă fluorescenţă pentru probele care conţin Fe sau Mn. Fundamentals of crystallography. 1. P. Cryst.L. Boultif. C.W. A. 2. Bibliografie 1. Pentru indexarea compuşilor şi determinarea parametrilor de reţea este indicat să se folosească şi standard intern deoarece în acest caz se poate evalua mai precis punctul de zero al difractometrului şi se pot determina mai exact poziţiile liniilor de difracţie. Dacă se lucrează cu probe care conţin Fe sau Mn este de dorit să se folosească tub de Cr care există în dotarea laboratorului. care poate fi chiar proba cântărită din etalonul de Si. 36. 3. Cryst. fantele trebuie să fie cât mai înguste.L. Appl.M.S.L.J.Bish and J. 987-993 (1991). adică timpul de înregistrare să fie în jur de 20 ore. Din punct de vedere tehnic. Cryst. 303 . 4. Visser J. Inc 1974. J. 24. Cryst.S. chiar dacă acestea nu funcţionează.

36-50 (1999). Le Bas. 110. Res. S. 2. Von Dreele. R.B. 26.D.B. 23. A. 13. 65-71 (1969). F. Cryst. 14. G. Appl. Crystallogr.E. M. Phys. Larson & R. Koning. Coelho J. Westdahl J. D.L.W. Tsoucaris Acta. Oxford Science Publications 1999.E. Ed. Konig. Leusen J. 32. Giacovazzo. 35. C. L. Report LAUR 86-748. Mavridis. 18. Cryst. 19. Pawley J. V. 899-908 (2000). S. V. 447-452 (1988). Appl. Direct phasing in crystallography. Appl. McCusker. R. J. 835-840 (2002). C. Appl. NM. Cerny Z. D. 27. H.Wilke.C. M. 23. H. Fourquet Mater. 32. K. 219. 746-757 (1991). Kristallogr. Nowell. Appl.10. H. 1169-1179 (1999). 734-743 (2002). Ed.J. 24. 84-92 (1999). G.M.M. 1754-1766 (1999).E. F. 357-361 (1981). 847-856 (2004). 15. Cole Acta Cryst. G. Appl. G. Louer and P. I.A. Cryst. G.S. Oxford University Press 2002. D. Deem J. Leuse. Cryst. M. 367-370 (1985). L. Crystallogr. Cox. K. J.Harris. Chem. Wike. Engel.Engel. Crystallogr. The Rietveld Method. Dinnebier Powder Diffraction 14. B B58. Favre-Nicolin and R. 17. Von Dreele General Structure Analysis System (GSAS).Scardi J. B47. Young Oxford University Press (1993). 25.C. P. 20. 33. Attfield and J. Cryst. Favre-Nicolin and R. Werner. Giacovazzo. 32. 14.P. 16.E. O. Mentzafos.Eriksson. Bull. 12. Appl.E.D. Cerny J. J. 22. USA. 1169 (1999). Los Alamos National Laboratory.B. Fundamentals of crystallography. 304 . A. Cryst. R. O. 18. Falcioni. Le Bail. Duroy. 87545. 21. 11. Harris. Appl.M Rietveld J.

....................2.................. 312 2.........1........ structura cristalină se determină din monocristale..... Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect ............................................ În cazul în care nu se pot obţine monocristale se încearcă determinarea structurii cristaline din pulberi........................................ 319 4... Determinarea structurii cristaline din pulberi este mai dificilă deoarece....... 316 4................................... Indexarea difractogramelor ......1. Obţinerea modelului structural . Pe lângă aceasta........................................ 307 1.... a grupului spaţial şi a poziţiilor atomilor în celula elementară..... în cazul pulberilor........................ 307 1........ Structura cristalină pentru N-(5-etil-[1................................2..............................I......... foarte multe intensităţi de difracţie se suprapun........................................ 325 Determinarea structurii cristaline este foarte importantă.......... iar extragerea acestora este dificilă şi afectată de erori..................... A determina structura cristalină pentru un anumit compus înseamnă determinarea sistemului cristalografic în care acesta cristalizează. dar de foarte mare ajutor sunt metodele spectroscopice şi de modelare moleculară care pot să furnizeze informaţii structurale deosebit de utile...............3........................ a parametrilor celulei elementare.................... 311 2....S.......................................... în timp ce la monocristale se pot colecta mii de intensităţi de difracţie.4]-tiadiazol-2-il0-toluensulfonamida...... 311 2...................... Extragerea intensităţilor de difracţie........... Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina........... În general.................................................................. 311 2. Metoda de căutare în spaţiul direct .......................................1......................1............. ..... Determinarea structurii cristaline se face în principal prin difracţie de raze X............ 306 1......................... Câteva metode uzuale de idexare ..Determinarea structurii cristaline prin difracţie de raze X C.................... se obţin doar câteva zeci............................................ Algoritmi de indexare ......2............................................ Gheorghe Borodi Cuprins 1...................................3........... Bibliografie .......... deoarece proprietăţile materialelor în stare solidă depind de structura cristalină şi moleculară a acestora....... 305 ....1.. Pentru orice compus nou preparat într-un anumit fel este de dorit să se determine structura cristalină............. cât şi în industrie şi tehnologie............ Rafinarea structurilor cristaline prin metoda Rietveld .2................. 314 3...... Exemple privind determinarea structurii cristaline din pulberi ........... Metodele pentru monocristale aplicate la pulberi ........ Aplicarea unor procedee de calcul pe monocristale la pulberi . 309 2.. 322 5......... dr.... atât în diferitele ramuri ale ştiinţei...............1........... 319 4............. Totuşi..

Etapele principale pentru determinarea structurii cristaline din pulberi sunt: indexarea difractogramelor. dacă aceasta nu este făcută corect. nu se poate determina structura cristalină. Astfel. Aceasta deoarece. o celulă elementară se poate defini în mai multe moduri. Aceasta este total diferită faţă de cazul determinării structurii cristaline din monocristale. iar la final se vor da câteva exemple de determinare a structurii cristaline din pulberi. în cazul pulberilor. cât şi direcţia pentru un număr foarte mare de vectori din reţeaua reciprocă.în ultimul timp. Indexarea difractogramelor este primul pas în determinarea structurii cristaline. în timp ce în cazul difracţiei pe monocristale se obţin mii de vectori din reţeaua reciprocă. În general. Dificultăţile în indexarea difractogramelor provin din erorile legate de determinarea poziţiilor maximelor de difracţie. Astfel. cel mai dificil. Vom descrie aceste etape. datorită creşterii puterii de calcul şi rezoluţiei difractometrelor. De asemenea. datele experimentale sunt proiecţia unidimensională a reţelei reciproce care este tridimensională. atunci se obţin poziţiile tuturor atomilor din celula elementară. obţinerea modelului structural şi rafinarea Rietveld a modelului obţinut. parametrii celulei elementare şi atribuirea fiecărei linii de difracţie a indicilor Miller corespunzători. Astfel. Deoarece în cadrul ICE există difractometru pentru pulberi ne vom ocupa doar de determinarea structurii cristaline din pulberi cristaline. trebuie menţionat că indexarea este cu atât mai dificilă cu cât simetria este mai scăzută. dar se alege acea celulă care are volumul cât mai mic şi simetria cât mai mare. unde se determină atât modulul. foarte multe structuri cristaline au fost determinate din pulberi. din difractogramele pe pulberi se determină unghiurile de difracţie din care rezultă modulul unui număr limitat de vectori din reţeaua reciprocă din care se doreşte să se reconstituie întreaga reţea reciprocă. cu cât sistemul cristalografic are simetrie mai joasă. dintre care unele se suprapun 306 . compuşii care cristalizează în sistemul triclinic. indexarea ar fi imediată. la difracţia pe pulberi se obţin doar câteva zeci de unghiuri de difracţie din care se determină modulul vectorilor corespunzători din reţeaua reciprocă. Celula elementară este un paralelipiped în interiorul căruia se găsesc atomii sau moleculele şi dacă acesta se translatează după cele 3 direcţii. Indexarea difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic. cel mai uşor se indexează compuşii care cristalizează în sistemul cubic şi. cu atât are mai multe linii de difracţie. Dificultatea indexării provine din faptul că. 1. dacă poziţiile maximelor de difracţie ar fi determinate exact.

cât şi standard intern. c) Să avem o precizie mare pentru determinarea poziţiilor de difracţie. În programele de calcul elaborate în ultimul timp se poate face indexarea chiar când există un număr mic de reflexii care aparţin impurităţilor şi acestea sunt excluse dacă celelalte linii de difracţie se potrivesc cu celula elementară găsită. unul dintre indicii Miller este tot timpul par din cauza reflexiilor interzise. Cele mai importante erori sistematice sunt poziţia de zero a difractometrului şi deplasarea probei. de exemplu. ceea ce face ca să nu se poată determina precis poziţiile maximelor de difracţie. obţinem o celulă elementară incorectă. Erorile sistematice sunt mai nefavorabile pentru indexare decât erorile întâmplătoare.1 Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect sunt: a) Să existe linii de difracţie observabile la unghiuri cât mai mici. Indexarea este cu atât mai dificilă cu cât simetria reţelei cristaline este mai joasă. Cea mai precisă corecţie se face prin utilizarea de standard intern. b) Numărul de extincţii pentru maximele de difracţie la unghiuri mici să nu fie foarte mare. Dacă. Erorile sistematice pot să fie minimizate prin alinierea difractometrului. În cazul căutării în spaţiul direct. definirea celulei elementare pentru sistemul cubic depinde de un singur parametru. atunci la indexare s-ar putea să avem o celulă cu o constantă de reţea dublă faţă de cea reală. Aceasta presupune introducerea în proba de analizat a unui compus pentru care se ştiu exact poziţiile maximelor de difracţie.parţial. 1. se variază parametrii celulei elementare într-un anumit mod şi se aleg acele 307 . 1. iar pentru sistemul triclinic depinde de şase parametrii. Acest lucru este foarte important deoarece nu se poate distinge între liniile de difracţie ale compusului şi liniile de difracţie ale impurităţii. Aceasta deoarece la unghiuri mici peak-urile de difracţie sunt mai rare şi şansele de a se suprapune sunt mai mici. Indexarea difractogramelor se face în mod automat folosind diferiţi algoritmi de calcul[1]. d) Să nu existe impurităţi în proba de analizat. Astfel. În general. Pentru corectarea erorilor sistematice se poate folosi atât standard extern. dacă avem impurităţi. pentru sistemul ortorombic depinde de trei parametrii.2 Algoritmi de indexare Există două abordări pentru algoritmii de indexare şi anume căutarea în spaţiul direct şi în spaţiul reciproc.

dacă se lucrează în spaţiul direct. pentru sistemul triclinic fiind 6. este o metodă iterativă şi Monte Carlo ce utilizează poziţiile liniilor de difracţie pe baza descompunerii difractogramei şi extragere a intensităţilor de difracţie LSI (Least Square Indexing) and LP-Search [5]. În cazul indexării. γ cu 0. Timpul de calcul. se variază parametrii celulei elementare a. este 2 şi aşa mai departe. pentru sistemul cubic numărul unghiurilor din setul de bază este 1 pentru sistemul tetragonal.valori pentru care poziţiile maximelor de difracţie calculate se potrivesc cât mai bine cu cele observate. Deci se cunosc un număr limitat de vectori ai reţelei reciproce şi se urmăreşte să se găsească vectorii elementari ai reţelei reciproce care să genereze întreaga reţea reciprocă. Dintre programele de calcul care utilizează căutarea în spaţiul direct. Vectorii reţelei reciproce sunt legaţi de unghiurile de difracţie prin relaţia (2sin θ )/ λ =1/d. O altă posibilitate de căutare este utilizarea metodei Monte Carlo. Există şi posibilitatea utilizării algoritmilor genetici pentru indexarea difractogramelor. în special pentru sistemul triclinic şi monoclinic. β . Metoda de încercare şi eroare se bazează pe atribuirea de indici Miller la un număr minim de peak-uri de difracţie. mai ales în cazul compuşilor cu simetrie scăzută. este mult mai mare decât în spaţiul reciproc. Valoarea indicilor Miller variază între 0 308 . iar a doua variantă este mai eficientă pentru sisteme cu simetrie joasă.c cu aproximativ 0. utilizând spaţiul direct. şi anume: metoda de încercare şi eroare şi metoda de căutare pe zone. Din vectorii elementari ai reţelei reciproce rezultă imediat vectorii elementari ai reţelei directe. Aceasta este tot o variantă a metodei Monte Carlo. McMaille [3] şi SVDIndex [4] care se bazează pe metode de căutare de tip Monte Carlo.10 şi se caută cea mai bună potrivire dintre poziţiile calculate şi observate ale unghiurilor de difracţie. Numărul unghiurilor de difracţie din setul de bază este egal cu numărul parametrilor ce caracterizează celula elementară. O altă tehnică de indexare foarte puternică şi care este implementată în programul de calcul de către firma Bruker Topas. Astfel. Această metodă este metoda directă de căutare în spaţiul direct. care se numeşte setul de bază şi care sunt liniile de difracţie cu cele mai mici unghiuri.01 Å şi unghiurile α. Prima este mai eficientă pentru sisteme cu simetrie ridicată de la cubic la ortorombic. Metodele de indexare care utilizează spaţiul reciproc sunt mai eficiente decât cele de căutare în spaţiul direct. Căutarea în spaţiul reciproc poate fi implementat în două variante. merită menţionate următoarele: Autox [2]. La căutarea în spaţiul reciproc se caută să se găsească vectorii elementari ai celulei reciproce folosind unghiurile de difracţie.b.

dar cele mai bune rezultate se obţin pentru sistemele cu simetrie ridicată. 1. după care se calculează factorul de încredere. h. după care se calculează parametrii celulei elementare [6].l.0.şi valori maxime preselectate pentru h. l notate cu hm. adică de tipul h. care este de simetria cea mai ridicată şi termină cu sistemul triclinic. Metoda căutării pe zone începe prin căutarea zonelor unidimensionale.0.k. Se reţin acei parametrii de reţea pentru care unghiurile calculate se potrivesc cel mai bine cu unghiurile experimentale şi care indexează toate sau aproape toate unghiurile experimentale. Când o zonă tridimensională (reţeaua) a fost construită. lm. dacă în intervalul respectiv se găseşte soluţia elementară.h.l şi bidimensionale. se generează toate poziţiile posibile ale maximelor de difracţie şi se verifică dacă poziţiile unghiulare ale maximelor de difracţie observate sunt incluse în cele calculate în limita unor erori de măsură. Această metodă este o metodă de căutare în spaţiul reciproc şi se bazează pe atribuirea unor indici Miller la primele linii de difracţie.l şi construirea zonelor tridimensionale utilizând liniile comune din zonele bidimensionale. atunci această metodă nu poate să facă corect indexarea deoarece nu are posibilitatea să dis309 . Operaţia se repetă atribuind alţi indici Miller primelor maxime de difracţie şi se ordonează soluţiile în ordinea descrescătoare a factorilor de încredere. Aceste valori sunt între 2 şi 4. Se testează toate sistemele cristalografice începând de la sistemul cubic până la sistemul triclinic.0.0.0. Cu acest program se poate indexa orice sistem cristalografic. adică de tipul h. se încearcă atribuirea indicilor Miller pentru toate reflexiile Bragg observate.k.3 Câteva metode uzuale de idexare Metoda Treor. Programele de calcul care fac indexarea prin metoda Dicvol încep de la sistemul cubic. 0. km. Se reţin acele valori ale parametrilor de reţea care se potrivesc cel mai bine cu valorile experimentale şi se calculează pentru acestea factorul de încredere. 0. Dacă difractograma experimentală are şi impurităţi.0. Metoda Dicvol [7] este o metodă de căutare în spaţiul direct şi se bazează pe metoda dihotomiei care constă în variaţia lungimilor celulei elementare şi a unghiurilor dintre axe între anumite limite şi reducerea intervalelor respective. 0. Metoda Dicvol. Având parametrii celulei elementare. Pentru fiecare permutare a indicilor se determină parametrii celulei elementare.k. se generează unghiurile de difracţie şi se verifică dacă unghiurile calculate se potrivesc cu cele experimentale.

b) Construirea reţelelor tridimensionale prin găsirea de zone bidimensionale care au o zonă unidimensională comună. Această metodă de calcul. cu atât şansa de a obţine mai repede soluţia corectă la indexare este mai mare. În general. O metodă asemănătoare cu Dicvol şi care se bazează tot pe procedeul dihotomiei. s-ar putea ca soluţia să fie corectă. Ca o remarcă generală: cu cât poziţiile liniilor de difracţie sunt determinate mai precis şi cu cât proba de analizat este mai pură. Se ordonează soluţiile în ordinea descrescătoare a erorii medii.tingă între liniile de difracţie ale compusului şi ale impurităţilor. Cu această metodă de indexare se obţine şi grupul spaţial la care aparţine compusul. Programul cere cel puţin 20 de reflexii Bragg şi nu funcţionează cu mai puţine linii de difracţie. Programul Ito este folosit în special pentru indexarea sistemelor cu simetria joasă. Metoda Ito. Programul mai ţine cont de densitatea aproximativă a compusului şi de numărul posibil de molecule pe celula elementară. realizează o căutare a zonelor în spaţiul reciproc şi transformare a axelor celulei pentru a găsi o celulă cât mai potrivită [9]. împreună cu programul aferent. în special triclinic şi monoclinic. dar care nu este foarte sensibilă la impurităţi se numeşte X-cel [8]. cu condiţia ca liniile de difracţie neindexate să fie de mică intensitate şi. dar aceasta trebuie confirmată. Cele mai comune versiuni sunt ITO13 şi ITO15. în acest caz. c) Reducerea celulei găsite şi transformarea acesteia în una din cele 14 reţele Bravais. Pentru a se indexa cu această metodă se parcurg următorii paşi: a) Găsirea potenţialelor zone utilizând primele 20 unghiuri Bragg. acestea să aparţină unor impurităţi. Pentru fiecare combinaţie de parametrii ai celulei elementare se generează poziţiile maximelor de difracţie. O altă observaţie în alegerea soluţiei corecte se referă la densitatea calculată. Maximelor de difracţie experimentale li se pun în corespondenţă cele mai apropiate maxime de difracţie calculate. se calculează eroarea medie dintre poziţiile maximelor calculate şi cele experimentale şi se trece la pasul următor. După indexare cunoaştem volu310 . d) Atribuirea indicilor Miller pentru toate maximele observate şi calcularea figurilor de merit. din programele de indexare rezultă mai multe soluţii foarte diverse între ele. Un număr de 30-35 de reflexii Bragg este recomandat. O primă observaţie este că dacă nu au fost indexate toate liniile de difracţie. Pe lângă aceste programe de calcul am mai elaborat şi noi un program [10] care se bazează pe căutarea în spaţiul direct pentru parametrii reţelei cuprinşi într-un anumit interval şi cu un anumit pas. rămânând una sau două linii de difracţie neindexate.

mai întâi se extrag intensităţile de difracţie deoarece se ştie că în cazul difracţiei pe pulberi foarte multe intensităţi de difracţie se suprapun. Dacă indexarea se face cu Dicvol. Dacă s-a determinat densitatea experimentală. atunci putem să mergem mai departe pentru a obţine modelul structural şi să-l rafinăm. Deşi metoda este în general robustă. există şi cazuri când prezintă instabilităţi. figura de merit trebuie să fie neapărat mai mare ca 4. Un alt criteriu foarte important este valoarea figurii de merit. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei 311 . şi anume. Vom descrie pe scurt cele două metode. 2. Le Bail a extins această metodă pentru estimarea valorilor absolute a factorilor de structură. metoda Le Bail şi metoda Pawley. 2. Intensităţile de difracţie pentru iteraţia (r+1) se exprimă în funcţie de intensităţile de difracţie pentru iteraţia r. atunci o putem compara cu densitatea calculată şi să confirmăm dacă indexarea poate fi corectă cu soluţia aleasă. Vom descrie pe scurt cele două tipuri de metode. Obţinerea modelului structural Pentru obţinerea modelului structural există două posibilităţi. Dacă indexarea este corectă.mul celulei elementare şi dacă presupunem un anumit grup spaţial putem determina numărul de molecule pe celula elementară şi de aici densitatea.1 Extragerea intensităţilor de difracţie Metoda Le Bail de extragere a intensităţilor de difracţie este inspirată din metoda Rietveld.1 Metodele pentru monocristale aplicate la pulberi În acest caz. se pot considera valorile calculate ale intensităţilor de difracţie.1. Există două tehnici de extragere a intensităţilor de difracţie. când nu există un model structural. 2. Densitatea calculată trebuie să aibă o valoare rezonabilă în funcţie de elementele care se găsesc în compus. Treor sau Ito. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie. în caz contrar. Ca intensităţi de pornire. mai ales atunci când fondul de difracţie este supraestimat. Le Bail a propus o metodă iterativă de determinare a intensităţilor de difracţie observate. modelul structural obţinut nu va putea fi rafinat. şi anume: metode utilizate în cazul monocristalelor şi metode de căutare în spaţiul direct.

care nu necesită un model structural. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială.2 Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley.5 dintr-un pas de înregistrare a difractogramei. Dacă se fac corecţiile intensităţilor de difracţie. Metoda Pawley este o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X. în unele cazuri s-au obţinut rezultate bune. Deşi procesul de rafinare este în general stabil. intensităţile acestora se reduc cu un factor de temperatură. factorul de polarizare. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. 2. (iii) Determinarea fazei factorilor de structură. Primul pas. Dar factorii de 312 . termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul a zecilor până la 3 sau 4 sute. Cu toate acestea. se determină factorul de scală şi de temperatură şi se obţine modulul factorilor de structură. este corectarea acestora de factori fizici sau geometrici care afectează intensităţile de difracţie. (ii) Determinarea factorului de scală şi a factorului global de temperatură.Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative. În timp ce metoda Le Bail este o metodă iterativă. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. Paşii care trebuie urmaţi sunt: (i) Corectarea intensităţilor de difracţie. factorul de absorbţie şi factorul de extincţie. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. Unii autori au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură. în schimbul intensităţilor de difracţie.1. Datorită faptului că atomii oscilează în jurul poziţiilor de echilibru. Aceştia sunt: Factorul Lorentz. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. după ce au fost obţinute intensităţile de difracţie. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi.

structură sunt numere complexe. (iv) Sinteza Fourier şi sinteza Patterson. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice şi probabilităţi condiţionate. deci în acest caz factorii de structură sunt numere reale pozitive sau negative. putem să determinăm densitatea electronică de sarcină în celula elementară. Pe baza densităţii electronice se poate construi un model structural aproximativ. k . Δ z. v. Δ y. cu ajutorul relaţiei: 1 ∑ Fhkl exp( −2πi(hx + ky + lz )) V hkl Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. ρ ( x. (v) Rafinare Fourier. Cele mai importante tehnici de rafinare Fourier sunt: Sinteze Fourier succesive şi Sinteza Diferenţă. Modelele structurale obţinute prin metodele directe sau metoda Patterson sunt adesea incomplete chiar şi pentru monocristale. iar pentru pulberi cu atât mai mult pentru că numărul de intensităţi experimentale este mult mai mic. există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. atunci putem face sinteza Patterson. Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară. mai ales. dacă densitatea electronică este mai mare.w) = ∑ Fh . dacă aceştia există. Pentru a îmbunătăţi şi completa modelul se apelează la tehnici de rafinare Fourier. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. Cunoscând factorii de structură.v. y . k . după relaţia: 2 1 P(u. Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi. w reprezintă respectiv Δ x.l cos( 2π ( hx + ky + lz )) V h . z ) = 313 . distanţele dintre atomii grei.l unde u.

Pentru moleculele organice. fragmente din molecule. Să presupunem că la cele 6 grade de libertate (translaţii şi rotaţii) se adaugă doar 4 grade de libertate interne şi să avem în total 10 grade de libertate. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. mai rar. eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. avem în mod obligatoriu 3 grade de libertate de translaţie. o variantă a acesteia numită parallel tempering şi tehnica algoritmilor genetici. 3 grade de libertate de rotaţie. rezultă că numărul total de configuraţii care trebuie să fie testat este de 10x10=1010. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. ca de exemplu. La aceasta se adaugă gradele de libertate interne legate de modificarea configuraţiei moleculare prin modificarea unghiurilor de torsiune. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. Aceasta înseamnă că nu se pot testa toate configuraţiile şi de aceea se apelează la metode probabilistice. de exemplu. Putem să avem atomi. metoda Monte Carlo inversă [11]. ceea ce cere un timp foarte mare de calcul. Să presupunem că avem doar o moleculă pe celula elementară.2. În cazul metodei de răcire simulată. distanţe. se testează potrivirea dintre difractograma calculată şi cea expe314 . În acest caz. dintre care amintim: Răcire simulată (simulated annealing). Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. grupe de atomi aranjaţi într-o anumită configuraţie. Astfel. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. Această metodă nu cere extragerea factorilor de structură din difractogramă. ca de exemplu. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. presupunem că pentru fiecare grad de libertate corespunde doar 10 zece paşi de căutare. octaedrii etc. pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. tetraedrii. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. Dacă.2. unghiurilor de legătură dintre atomi şi. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală. molecule.

în faza iniţială a procesului de căutare a configuraţiei optime. şi anume. în afară de potrivirea dintre difractograma calculată şi cea observată. probabilitatea de a găsi un alt minim este de asemenea mică. dar în faza finală. se consideră funcţia de cost CF. poate să se introducă ca şi criteriu pentru modelul obţinut. Parallel Tempering (PT) [15].şi intramoleculară. Orientarea preferenţială poate fi descrisă prin funcţii de tip March-Dollase. Profilul liniilor de difracţie se descrie de obicei prin funcţii standard de tipul Gaussiana. se poate uşor trece de la un minim local la un alt minim. un alt algoritm a fost dezvoltat. T fiind temperatura distribuţiei. Fox [13. Lorentziana sau pseudos-Voigt. atunci se reţine noua configuraţie. În procesul de căutare a minimului global ca şi Cost Function. şi anume.rimentală. dintre care amintim. În timpul procesului de căutare. temperatura se scade treptat. Una dintre posibilităţi este să se aleagă ca fiind reziduul R. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2=exp[(CF2-CF1)/T]. 315 . se poate introduce un factor numit ‘anti-bump’. se aleg de la început mai multe configuraţii (un număr mic de configuraţii). minimizarea energiei potenţiale de interacţiune inter . Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. în scopul determinării minimului absolut. Funcţia de cost CF se poate alege în diverse moduri. Pentru ca unităţile structurale să nu se apropie foarte mult unele de altele. cu probabilitatea exp(. Dacă CF este mai mare decât cea precedentă. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. Powder Solve [12].14]. În felul acesta. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. funcţia care descrie fondul (background) şi o funcţie care sumează liniile de difracţie. În schimbul utilizării unui singur lanţ de configuraţii cu descreşterea temperaturii. posibilitatea de a se obţine minime locale este mai mică.Δ CF/T). atunci se reţine noua configuraţie. Totuşi. fiecare linie de difracţie fiind centrată corespunzător. pentru a evita probabilitatea să cădem într-un minim local. Astfel. Difractogramele pot fi modelate ca o sumă de două funcţii. definit în felul următor: Rwp=[ Σ i wi ( y obd i − i y calc i )2 Σ i wi ( y ) obs 2 ]1/2 Dacă funcţia de cost CF este mai mică decât cea precedentă. când T este foarte mic.

cel mai utilizat este GSAS [17]. yci depind de o serie de factori. ϕ. Expresia factorilor de structură este dată de relaţia: Fhkl ⎛ B sin 2 θ ⎞ = ∑ N j f j exp[2Π(hx j + ky j + lz j )]exp⎜ ⎟ ⎜ − λ2 ⎟ j ⎠ ⎝ (2) unde: Nj . fj . care este descrisă ca fiind o combinaţie a funcţiei Gauss şi Lorentz: 316 . Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural. factorul de absorbţie. s-a făcut o căutare globală. Dintre acestea. xj. pV. dându-se intensitatea de difracţie la fiecare pas.factorul de structură pentru atomul j. În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim. factorul de scală. yj.coordonatele atomului j.factorul de temperatură (care se datoreşte vibraţiilor termice). B . Cu alte cuvinte. Funcţia ce trebuie minimizată este: (1) S y = wi ( y i − y ci ) 2 ∑ i unde yi si yci sunt intensităţile observate şi calculate la pasul i. deoarece nu sunt necesare variaţii mari ale acestor parametrii. Dintre programele de calcul. zj .factorul de ocupare. În cazul obţinerii modelului structural. Profilul liniei de difracţie. etc. pseudo-Voigt. factorul Lorentz–polarizare. şi anume: de factorii de structură şi indicii Miller corespunzători factorilor de structură respectivi. potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată. funcţia de profil pentru liniile de difracţie. fondul de difracţie în punctul respectiv etc. iar wi=1/yi este factorul de ponderare. yci este difractograma care se calculează la pasul i pentru că difractograma se calculează în paşi. Lorentz. cea mai utilizată este funcţia pseudo Voigt. Forma liniilor de difracţie este o convoluţie datorată probei şi efectelor instrumentale. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate. de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate. este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [16].3. se poate aproxima prin diverse funcţii: de tip Gauss.

coeficientul March care variază între 0 şi 1. G funcţia Gaus iar η parametru de amestecare a celor două funcţii.intensitatea măsurată. H este lărgimea la semiînălţime şi U. March-Dollase [19]: I cor = I obs (G 2 cos2 α K + 1 2 sin α K ) −3 / 2 G (4) unde. Aceasta face ca unele maxime de difracţie să fie mai intense. G .funcţia pseudo-Voigt . iar altele mai puţin intense faţă de cazul când nu ar exista orientare preferenţială.unghiul ascuţit dintre vectorul de împrăştiere pentru reflexia K şi direcţia preferenţială de orientare a planului cristalitelor faţă de planul probei. Icor . αK . care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RB = RP = ∑| I K ( obs ) ∑| y − y ∑y i i ∑I − I K ( calc) | (5) (6) K ( obs ) ci | 317 . Iobs . Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective. Orientarea preferenţială poate fi modelată matematic cu ajutorul unor funcţii.pV = ηL + (1-η)G unde: pV . V. L fiind funcţia Lorentz. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară. Orientarea preferenţială are loc când cristalitele din probă tind să se orienteze preferenţial după anumite direcţii. unde 0 se referă la 100% orientare preferenţială a cristalitelor în probă şi 1 se referă la orientare complet întâmplătoare a cristalitelor.intensitatea corectată pentru orientare preferenţială. ca de exemplu. Calitatea rafinării se apreciază pe baza unor indici de rezidiu. exprimată prin funcţia lui Caglioti[18]: H 2 = U tan 2 θ + V tanθ + W (3) unde. PK este funcţia care descrie orientarea preferenţială. W sunt parametri care se pot rafina.

De exemplu. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. am constatat că este necesar să se adopte următoarea strategie. care trebuie minimizată. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. În general fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40.RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ 1/ 2 (7) Cei mai utilizaţi indici sunt RP si RWP. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu. Din literatură şi din experienţa proprie. deformaţiile de reţea. factorii care descriu asimetria liniilor de difracţie etc. Totuşi. Urmează rafinarea deplasării punctului de zero pentru difractogramă. mai trebuie să adăugăm şi termenii care iau în considerare constrângerile slabe. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma [20]. Dacă rafinarea se face ţinând cont de constrângerile slabe. wj=1/ σ 2 (Roj) (8) (yoi) j unde yoi şi yci sunt intensităţile observate şi calculate la pasul i. factorul de temperatură şi coeficienţii polinomului care descriu fondul. de exemplu C-C. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain”[21] şi “rigid body“[22]. σ 318 este . maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. C-O. atunci la funcţia din formulă (5). În acest caz. wi=1/ σ 2 (yoi) . funcţia ce trebuie minimizată este: SyR= ∑ w (y i i oi-yci) 2+C w ∑ w (R -R j oj cj(x)) 2 . La început se rafinează factorul de scală. mai ales dacă avem un număr mare de atomi pe celula elementară. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. aceste distanţe pot să varieze între anumite limite. Pentru o difractogramă oricât de perfectă. în general trebuie impuse constrângeri. factorul care descrie absorbţia razelor X şi factorul de polarizare. pentru legături simple sau duble. În ultimele etape se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi.

unghiuri etc (aşa numita pseudo observabilă). De exemplu. în procesul de rafinare a complecşilor de incluziune.deviaţia standard a intensităţii lor măsurate. 4. ca de exemplu. se porneşte cu un cw mare. împreună cu atomii de oxigen secundari. Unităţile glicozidice au fost legate între ele prin constrângeri slabe. Roj este valoarea aşteptată pentru mărimea stereochimică respectivă care poate fi lungime de legătură. şi se tot reduce în procesul de rafinare. pentru ciclu benzenic. permiţând translaţia şi rotaţia acestora. În cazul programului de rafinare GSAS [17]. au fost considerate ca “rigid body”. Complecşii de incluziune cu β -ciclodextrina se folosesc pentru a îmbunătăţi biodisponibilitatea. când în afară de constrângerile slabe se aplică şi constrângeri ca molecula să fie planară. aceasta înseamnă că atomilor care aparţin unui corp rigid nu le pot fi aplicate constrângerile slabe în acelaşi timp. δ (Roj) este deviaţia standard a pseudo-observabilei. Cu cât cw este mai mare. de ordinul miilor.y. atunci este necesară aplicarea constrângerilor de planeitate [23]. Exemple privind determinarea structurii cristaline din pulberi 4. solubilitatea şi stabilitatea diferitelor medicamente în soluţii apoase. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei. cw este un factor de ponderare care permite să se varieze contribuţia constrângerilor în procesul de rafinare. cu atât constrângerile sunt mai puternice. una dintre aceste unităţi este prezentată în figura 1. iar Rcj(x) este valoarea calculată din poziţiile atomilor (x. constrângerile puternice “rigid bodies” sunt incompatibile cu constrângerile slabe. În cazul în care există şi grupări plane. În general.z). Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. 319 . Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi dar forma ansamblului să nu se schimbe. β -ciclodextrina este compusă din 7 unităţi glicosidice.1 Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina. Aceasta are o formă toroidală în care se pot încapsula diferiţi compuşi bioactivi şi se poate realiza eliberarea treptată a acestora.

Figura 1 Unitate glicozidică din componenta β Ciclodextrina Noi am urmărit să determinăm structura cristalină pentru Atenolol cu β -Ciclodextrina. configuraţia moleculară pentru atenolol a fost calculată cu ajutorul programului de modelare moleculară Cerius 2. În urma indexării s-a stabilit că. Figura 2 Formula structurală pentru Atenolol După determinarea poziţiilor maximelor de difracţie. celula elementară şi modul în care interacţionează şi se cuplează cele două molecule pentru a forma complexul de incluziune. adică să determinăm sistemul cristalografic. Structura cristalină pentru atenolol nu a fost cunoscută la acel moment.0 [20]. grupul spaţial. indexarea s-a făcut cu ajutorul programului de calcul Ito [9]. celula elementară şi configuraţia moleculară. Structura cristalină pentru β Ciclodextrină se cunoştea. complexul de incluziune cristalizează în sistemul monoclinic având grupul spaţial C2 cu 4 molecule de 320 . De aceea. Dar la interacţiunea cu atenololul structura cristalină se modifică total în sensul că se schimbă grupul spaţial. Configuraţia moleculară pentru β ciclodextrină a fost luată din baza de date Cambridge Structural Database [29]. Formula structurală pentru Atenolol este prezentată în figura 2.

împreună cu atomii de oxigen O4. fa pentru restrângerile de unghiuri. H.649Å . N. restrângerile slabe referitoare la planeitatea atomilor (O4)n a fost în cazul ciclodextrinei de 0. Profilul de difracţie a fost aproximat prin funcţii de tip pseudo-Void. Pentru unităţile glicozidice. Fiecare unitate glicozidică. c=15. În continuare. Volumul celulei elementare este V=6772. s-a permis rotaţia şi translaţia. Pentru obţinerea unui model structural realist s-a procedat la aplicarea unor serii de restrângeri şi constrângeri. dar între anumite limite. pentru restrângerile slabe este permisă mişcarea atomilor. parametrii de reţea. rigidizarea este cu atât mai mare cu cât factorii de pondere pentru restrângerile slabe sunt mai mari. De asemenea. Iniţial. unele în raport cu altele. factorii de pondere pentru restrângerile slabe au fost: fd=fa=fp=5000. iar oxigenii de la capătul grupărilor glicozidice au fost legaţi între ei prin restrângeri slabe (soft restrains). Pentru aceasta s-a utilizat programul de calcul GSAS.914Å. Reamintim că în cadrul unui grup de atomi care au fost definiţi ca “rigid bodies” nu se permite nici o mişcare a atomilor din cadrul grupului. s-a pus condiţia ca toţi cei 7 atomi de oxigen O4 să fie aproximativ în acelaşi plan.05 Å. unghiurile de torsiune pentru molecula de atenolol. a fost considerată ca “rigid bodies”.55Å3. Ca grade de libertate au fost translaţiile şi rotaţiile pentru molecula de ciclodextrină şi molecula de atenolol. Densitatea calculată este ρ =1. utilizând tehnica ”simulated anealling” şi ”paralel tempering”. background-ul. b=24. s-a procedat la rafinarea modelului structural prin metoda Rietveld. În schimb. O. iar fp pentru restrângerile de planeitate. o valoare plauzibilă pentru compuşii organici care conţin C.640. cu ajutorul restrângerilor de planeitate. Astfel. Obţinerea modelului structural s-a făcut cu ajutorul programului de calcul. De asemenea. Au fost rafinaţi de asemenea parametrii termici. unghiurile de torsiune dintre unităţile glicizidice şi unghiurile dintre unităţile glicozidice.375g/cm3. α =900. punctul de zero pentru 321 . adică fondul de difracţie care a fost aproximat cu un polinom. fd fiind factorul de pondere pentru restrângerile de distanţe.. În urma modelării s-a constatat că molecula de atenolol intră în cavitatea β -ciclodextrinei.ciclodextrină şi 4 molecule de atenolol pe celula elementară şi următorii parametrii de reţea: a= 18. Restrângerile slabe nu se pot aplica pentru atomii din cadrul unui grup aparţinand la “rigid body”. β =110. Pentru funcţiile de profil s-au folosit 12 parametrii. Au fost aplicate restrângeri de planeitate pentru gruparea fenil din cadrul atenololului. au fost aplicate restrângeri slabe pentru toate distanţele dintre atomi şi unghiurile de legătura dintre aceştia.450Å. γ =900.

În mod asemănător s-a determinat structura cristalină pentru complexul de incluziune Acid Mefenamic. În final.difractogramă şi. formând un fel de dimeri.58%. s-a obţinut un rezidiu Rp=7.2. 4. vedere după axa b şi c.β -Ciclodextrina.4]-tiadiazol-2-il0-toluensulfonamida Structura cristalină pentru acest compus a fost determinată prin combinarea difracţiei de raze X pe pulberi cu informaţii obţinute din RMN pen322 .8% şi Rwp=11. Structura cristalină pentru N-(5-etil-[1. Figura 3 Configuraţia moleculară pentru complexul de incluziune atenolol. Configuraţia moleculară pentru complexul de incluziune văzut după axa b şi după axa c este prezentată în figura 3.β CD. parametrii de poziţie. Se observă ca moleculele de ciclodextrină şi cele de atenolol se grupează între ele prin legături de hidrogen. care au fost în număr de 288.3. bineînţeles.

Modelul obţinut în acest mod a fost în continuare rafinat prin metoda Rietveld. Considerând 8 molecule pe celula elementară. rezultă că numărul de molecule pe celula elementară este 8.3846 Å şi volumul celulei elementare fiind V=2740. Indexarea compusului s-a făcut utilizând programul de calcul Dicvol [9]. Difractograma de raze X pe pulberi a fost obţinută cu difractometrul de raze X. prin urmare. S-a obţinut un fit cu Rp=0. s-au aplicat o serie de restrângeri slabe pentru distanţe.5364Å.0148 Å si c=21.tru 13C şi din modelare moleculară.072.54056Å. Deoarece nu există nici un motiv ca moleculele să se plaseze în poziţii speciale. S-a lucrat varianta geometria Bragg-Brentano θ -2 θ prin reflexie. b=15. echipat cu un monocromator de Ge (111) pentru fasciculul incident pentru înlăturarea radiaţiei K α 2 şi. cel mai probabil grup spaţial a fost găsit ca fiind Pbca.914 Å3. Prin examinarea difractogramei cu ajutorul programului de calcul Checkcell [28]. s-a utilizat radiaţia Cu K α 1 9 λ =1. utilizând programul de calcul GSAS [17] combinat cu interfaţa grafică EXPGUI [31] . care reprezintă o valoare rezonabilă. Menţionăm că. Un factor de temperatură global a fost rafinat pentru toţi atomii. dintre care 6 corespund pentru poziţia moleculei şi orientarea acesteia. ceea ce confirmă grupul spaţial ales din reflexiile interzise.37g/cm3. în cele mai multe cazuri. se obţin informaţii structurale foarte importante. În continuare s-a făcut fitarea Le Bail a difractogramei experimentale pentru confirmarea grupului spaţial selectat. Modelul structural de pornire a fost obţinut cu ajutorul programului de calcul Molden. Determinarea structurii cristaline s-a făcut prin metoda căutării în spaţiul direct. pentru un anumit grup de reflexii interzise corespund mai multe grupuri spaţiale. Profilul maximelor de difracţie de pe întregul interval 2 θ = 3. folosind programul de calcul Dash [30]. Factorii de pondere corespunzători restrângerilor pentru distanţe fd. s-a calculat densitatea ca fiind ρ =1. D8 Advance.05 şi Rwp=0. unghiuri fa şi planeitate fp au fost reduşi treptat în cursul ciclurilor de rafinare de la 500 la 100. Pentru a avea un model structural realist în timpul rafinării. unghiuri şi planeitate a grupării fenil. Noi vom descrie în special aportul difracţiei de raze X la determinarea structurii cristaline pentru acest compus. prin ajustarea a 10 grade de libertate. iar 4 la unghiurile de torsiune pentru moleculă. La acest grup spaţial corespund un număr de 8 poziţii generale.5-500 au fost modelate cu funcţii de profil de 323 . Deoarece deplasarea chimică obţinută din RMN pe solide este sensibilă chiar şi la mici modificări de împachetare moleculară şi modificare conformaţională din spectrul RMN. Cea mai bună soluţie corespunde sistemului ortorombic cu următorii parametrii de reţea: a=8.

difractograma calculată şi diferenţa dintre difractograma calculată şi cea experimentală. Rexp= 0.113. Fondul de difracţie a fost modelat cu un polinom Chebyshev de ordinul întâi. deci modelul structural este corect. Rwp=0. Se observă o potrivire foarte bună între cele două difractograme.053. χ 2=6. În final. În continuare.tipul pseudo-Voight cu 18 termeni. În figura 5 este prezentată difractograma experimentală. 324 . Figura 4 Împachetarea în celula elementară şi aranjarea supramoleculară Un alt compus pentru care s-a determinat structura cristalină prin combinarea difracţiei pe pulberi cu spectroscopie RMN şi modelare moleculară a fost Etoxiazolamida [27]. modelul a fost îmbunătăţit utilizând tehnici de modelare moleculară combinată cu informaţii obţinute din măsurători de deplasare chimică din spectul RMN.71.079. s-au obţinut următorii factori care caracterizează figura de merit a modelului structural: Rp=0. În figura 4 este prezentată împachetarea în celula elementară pentru compusul studiat şi aranjarea supramoleculară sub formă de două şuviţe formate din molecule puse cap la cap.

Simul. M. A. 249 (2004) J. Cryst. K. Giacovazzo. Bratu. I. Gavira Roumanian Reports in Physics.W. 219. 10. Appl. Rizzi.L. Cryst. Guagliardi.Chem. F. Bibliografie 1.E. 2. New York (2002) J. A. P. Cryst.Leusen. 1180 (2000). 35. Kern. (2002) V. 9.W. Appl. Le Bail. 110 . 86 (2003). A.Kristallogr. Appl.Falcioni. and Ch.(1999) V. (1969) 2.-E. 51(7-10) 983 (1999) R. 36. 13.B. 3. 1.Koning. 724 (2004) J.Werner.A. Eds. J. S. K. 19. 7. 65. McCusker. (2004). 89 (1969) Gh.M.359 (1988) G. Lou¨er. David. 325 .Engel. Appl. Baerlocher. Werner J.Deem J. I. J.Cerny Z. Boultif and D. The Third Pharmaceutical Powder X-ray Symposium (PXRD-3). 356 (2003).G. IUCr monographs on crystallography .-E. L.Appl. Cryst. 5 Comparaţie dintre difractograma observată şi cea calculată 5. J.Figura. Cryst. 12.Favre-Nicolin and R. 36. 847-856.Harris . 69 (1992). Monte Carlo indexing with McMaille. Mihailescu. Shankland.Cerny J. 32. Oxford. Cryst.J. 16. 5.Pusztai . 25. Crystallogr.M Rietveld . Appl. 15. 4. 11. A. L.Appl.D. A. (2004) M. 1169. Borodi.A.. 2.Favre-Nicolin and R. Moliterni. Autoindexing. 14. Coelho. Gh. J.Mol. F.Phys. Powder Diffraction. 6. P.Appl. Oxford University Press. Altomare. 33.Cryst. R. A. W. 37.G. Cryst. C. Visser. in: Structure determination from powder diffraction data. J. O. 8.McGreevy. Appl. 734. 1754 (1999) H.Wilke .

D. K. (1001) 326 . Dollase. X.Pop. De Ridder. G. Dinnebier Powder Diffraction 14.E. Hernanz. Koeller J. 26. Bratu. Borodi. 21. le Bas. 1036. NM.. Young Oxford University Press (1993) 19.Scardi J. Cryst. Filip. F. K. (2006). Phys. R. Mentzafos.A. 31. (2010) 27. Appl.M. 34.70. A. Toby. 36. E. 18. Tripon. 910.210. 32. Cryst.J. M. J. Hangan. David. R. J. Oprean and C. B. D. Acta Cryst. Cryst. J. Von Dreele. 615.Cole.Appl. 746 (1991) 24. France.Am. 19. Chem. Phys. Helmbholdt.B. Chem.(2002 22. Cryst. W.Shankland. Peschar. Motherwell. G. 28. 10. (1999) 23. J. X. C.I.17. Tsoucaris.39. D. J. Steiner and G. DOI. J. Attfield and J. R. Cox. H. L. Appl. 87545. 267.Larson & R. Spectrochimica Acta A.H.E. Borodi.D. T.B.Pidcock. (2002). M.C.. G. Acta Cryst. The Rietveld Method edited by R.. (2008) 25.A. (1986) 20.Laugier. G.F.Mavridis. Bogdan. Filip. USA.C. L. McCusker.B B58 835. Filip. Report LAUR 86-748.1039/c1cp21878f.Appl. Von Dreele General Structure Analysis System (GSAS).Nowell. Goubitz. W. C. Filip. G. Soc. Acta. 116. D. B47.Chem. A. Shenk Acta Cryst. Borodi and C.C. 84.B. A. Peschar. Laboratoire des Materaux et du Genie Physique de l’Ecole Superieur de Physique de Grenoble. B58.and B.A. W.5122. G. R. Colaborative Computational Project Number 14 (CCP14). 29. Borodi. Van de Streek.(1994) 30. B66. Dragan.S.Louer and P. Morari.Cole. I. R. J.Bochu CHECKCELL. 1041. B. H. Los Alamos National Laboratory.P.Cryst. I.

....... 327 . Compania Siemens a patentat invenţia celor doi germani. Doi ani mai târziu.... MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE Microscopia electronică şef lucrări dr..... 338 1... Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) ... fizicianul Ernst Ruska şi inginerul Max Knoll au construit un microscop electronic prototip......... Lucian Barbu-Tudoran Cuprins 1.. 327 2. Microscoapele optice (figura 1) sunt instrumente mai complexe care conţin un set de lentile care măresc imaginea... Pentru observarea detaliilor mai mici a fost necesar crearea unui microscop care să utilizeze o sursă de iluminare caracterizată printr-o lungime de undă mult mai mică.. Cel mai comun microscop este lupa...... ceea ce înseamnă că două caracteristici aflate la o distanţă mai mică de 250 nm nu vor putea fi diferenţiate..... iar în 1939 primul microscop electronic de transmisie a fost produs în scopuri comerciale.................. Ruska a creat primul microscop a cărui rezoluţie era superioară unui microscop optic..... Accelerarea electronilor permite reducerea lungimii de undă a unui fascicul de electroni ceea ce face posibila vizualizarea detaliilor cele mai fine..... Generalităţi Microscoapele sunt instrumente utilizate pentru a facilita observarea unor obiecte la o mărire mai mare decât cea a obiectului observat..... Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) .......IX... obiect ce utilizează lentila pentru a focaliza lumina reflectată de un obiect într-o imagine mai mare..... 328 3... 250 nm)..... Rezoluţia este limitată de lungimea de undă a fotonilor utilizaţi ca sursă de iluminare a specimenului....................... Limitările microscopiei optice constă în rezoluţia obţinută prin această tehnică (aprox.......... În 1931............................... Printre alte surse se numără razele X şi neutronii... Generalităţi ...

Organizarea unui microscop electronic 328 .diafragma şi lentila condensor Figura 1. Probele analizate trebuie să fie foarte subţiri deoarece ar absorbi o mare parte a fasciculului de electroni. Ca limitare se aminteşte natura bidimensională a proiecţiei rezultate.1 – ocular 2 – revolver 3 – obiective 4 – viza macrometrică 5 – viza micrometrică 6 – platina 7 – sursă de lumină 8 . incluzând suprafaţa şi structurile interne. aceştia putând fi deviaţi sau nu. Electronii pătrund prin probă. Microscopul optic 2. Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) Prin intermediul TEM imaginea observată este proiecţia probei în grosimea ei. informaţiile aparţinând axei z se vor pierde. Astfel obiectele având structură internă diferită pot fi diferenţiate deoarece proiecţiile acestora vor fi diferite. interacţionează cu aceasta în grosimea ei.

Cele mai comune microscoape sunt cele de emisie termionică si FEG (Field Emission Guns). Prin conectarea filamentului de partea negativă a generatorului de energie. Tunul de electroni are mai multe componente: filamentul. de obicei tungsten sau hexaborid de lantaniu. Electronii emişi au o distribuţie Boltzman a energiei şi trebuie să fie concentraţi pentru ca fasciculul rezultat să străbată coloana. iar în final vor fi focalizaţi pe ecranul situat la capătul coloanei. care este încărcat mult mai negativ decât filamentul în sine. prin probă. Aceşti electroni vor penetra proba şi vor trece printr-o serie de lentile magnetice. astfel circuitul fiind complet. Tunul de electroni Electronii sunt emişi de un filament supraîncălzit de un curent electric până când suficientă energie va fi produsă (aprox. 2500K) pentru a învinge ’’the work function’’ a metalului. 329 . circuitul de interferenţă (biasing circuit). În interiorul coloanei se va stabili un vid înalt pentru a minimaliza interacţiunile dintre electroni şi molecuFigura 2 . Aperturile de pe traseul fasciculul de electroni au rolul de a schimba contrastul şi rezoluţia imaginii. Pentru a modifica mărirea şi punctul focal al unei imagini se pot utiliza diferite lentile. un vârf Wehnelt şi un anod de extracţie. se asigură convergenţa optimă a electronilor încă din momentul emisiei.Principiile funcţionării unui croscop electronic de transmite nu diferă cu mult faţă de cele ale unui microscop optic. lentile şi aperturi. Prin construirea unui cilindru Wehnelt. electronii pot fi pompaţi de către filament spre placa anodică şi coloana microscopului. În vârful coloanei există un emiţător de electroni cu voltaj înalt care va genera fasciculul de electroni care va traversa coloana.Secţiune prin coloana unui TEM lele de aer.

Emisia de electroni este asigurată de aplicarea unui puternic câmp electric imediat în vecinătatea vârfului filamentului. iar principiul de funcţionare se aseamănă cu cel al funcţionării unui bec. pe măsură ce filamentul se încălzeşte electronii vor fi emişi. Figura 4. Tipuri de tunuri de electroni: filament de tungsten şi cristal de hexaborid de lantaniu 330 . Schema unui tun de electroni Tipuri de tunuri de electroni Tungsten: filamentul este fabricat din tungsten. dar are ”the work function” mai mică.Figura 3. Mărimea şi gradul de apropiere a câmpului electric cauzează desprinderea electronilor de pe filament. FEG: filamentul nu este unul termic. de aceea este mai eficient. Hexaborid de lantaniu: este tot un filament de emisie termionică.

apertura condensator. A doua apertură. Dacă electronii sunt defazaţi. Deoarece electronii emişi sunt supraîncălziţi. distribuţia energiei nu este sub forma unui singur peak. adică distribuţia energiei să fie o mică fracţiune din energia medie a electronilor. Pentru formarea imaginii se folosesc 3 tipuri de lentile. În cazul prismei lumina este refractată sub diferite unghiuri. Lentila intermediară controlează. Prin urmare în urma trecerii fasciculului printr-o lentilă acesta va suferi o scindare. Coerenţa temporală. în schimb distribuţia este de tip Boltzman şi diferă în funcţie de natura filamentului. Coerenţa spaţială. mărirea imaginii sau pattern-ul de difracţie. apertura obiectiv. Deoarece lentilele sunt reglate pentru o anumită lungime de undă acestea vor concentra electronii cu alte lungimi de undă mai puţin uniforme. 331 . Prima apertură. Lentila obiectiv are rolul de a realiza primul pas de mărire şi focalizare a unei imagini. Lentilele Lentilele utilizate în microscopia electronică sunt bobine magnetice care au scopul de a focaliza şi direcţiona fasciculul de electroni. este localizată sub probă imediat după lentila obiectiv. ideal toţi electronii emişi ar trebui să fie în fază. iar fasciculul va pierde din intensitate. Această aberaţie cromatică se aseamănă cu scindarea luminii când o rază traversează o prismă. Aperturile Aperturile sunt găuri de-a lungul coloanei microscopului care pot limita mărimea fasciculul de electroni. În cazul lentilelor electro-magnetice acestea pot roti fasciculul de electroni dacă sunt ajustate corespunzător. Dacă electronii emişi sunt paraleli atunci fasciculul va fi coerent o mai multă perioadă. Se referă la intensitatea fasciculului. Dacă electronii sunt în fază ei vor interfera constructiv. Cuplată cu apertura obiectiv va genera contrastul de amplitudine. Ultima lentilă – lentila proiector . În cazul unui microscop performant se doreşte ca raportul ∆E/E să fie cât mai mic.focalizează şi proiectează imaginea finală pe suprafaţa folosită pentru vizualizare. Funcţia unei aperturi este determinată de poziţia acesteia în coloana microscopului. Faza electronilor afectează coerenţa fasciculul. Când acest fenomen are loc imaginea se va roti pe măsură ce vor fi introduse în coloană alte lentile.Fasciculul de electroni se caracterizează prin coerenţă. prin poziţia şi puterea ei. Această apertură controlează contrastul unei imagini. vor interfera distructiv. este localizată în vecinătatea tunului de electroni şi este utilizată pentru concentrarea electronilor şi menţinerea coerenţei fasciculului. lumina fiind descompusă în radiaţii cu lungimi de undă diferite.

Acest electron va cauza apariţia zgomotului în imagine. iar legea conservării momentului va determina unghiul la care acesta a fost deviat de la traiectorie. Pe consolă se mai află butoane care controlează poziţia specimenului în interiorul coloanei. Dacă electronul nu loveşte un atom din probă acesta va avea o traiectorie nedeviată până la ecranul care va colecta imaginea. voltajul curentului etc. goniometrul se poate roti pentru a schimba unghiul probei. Principii ale formării imaginii În momentul în care fasciculul trece prin grosimea unui specimen au loc mai multe fenomene. 332 . Microscoapele electronice de nouă generaţie au interfeţe cu computerele ceea ce conferă utilizatorului o mai mare flexibilitate şi control. va asigura introducerea probei în vidul din coloana microscopului cu o scădere minimă a presiunii din interiorul coloanei. Dacă electronul intră în contact cu atomi din probă poate suferi o ciocnire elastică. În cazul microscopiei electronice de transmisie proba analizată este depusă pe o grilă de metal.Holder utilizat în microscopia electronică de transmisie Dacă se doreşte vizualizarea unei probe sub diferite unghiuri sau realizarea unei tomograme.5). curentul. Acest electron va conferi o rezoluţie înaltă imaginii. astfel când electronul va ajunge la nivelul ecranului va avea energia diminuată şi un unghi de incidenţă necunoscut. Acest holder de metal. nu va pierde din energie. valoarea defocalizării. iar aceasta într-un holder de metal (fig. alinierea. luminozitatea fasciculului. focalizarea şi mărirea. Figura 5 . prin intermediul goniometrului. În cazul unei ciocniri inelastice electronul va ceda o cantitate variabilă de energie specimenului.Exteriorul microscopului Consola utilizatorului constă dintr-un ecran pe care se vor afişa parametrii sub care funcţionează microscopul precum: mărirea.

Lentila intermediară determină vizualizarea imaginii sau a pattern-ului de difracţie pe ecran. Spre exemplu. de exemplu din cristale bidimensionale. iar contrastul este îmbunătăţit. 333 . Electronii cu deflecţie mare conţin informaţii importante legate de rezoluţie.Electronii pot fi deviaţi la unghiuri mai mari de 90°. marginea fiind cea mai închisă. Electronii care vor fi deviaţi de la traiectoria iniţială în urma interacţiunii cu atomii specimenului vor interfera constructiv sau distructiv cu fasciculul principal de electroni. aceste informaţii fiind pierdute. proiecţiile acestora vor diferi (figura 6). Un pattern de difracţie poate fi colectat din probe care conţin un motiv care se repetă. Colectarea imaginilor se poate face în diverse moduri. astfel de electroni nu sunt folosiţi în microscopia electronică. dacă privim o sferă goală pe dinăuntru sau una plină. Aceste proiecţii diferă deoarece gradul de întunecare a unei imagini este direct proporţional cu capacitatea materialului de a absorbi electronii. Diferenţa dintre proiecţiile unei sfere solide şi a unei sfere goale în momentul vizualizării la TEM Microscoapele electronice pot fi utilizate pentru vizualizarea pattern-urilor de difracţie a probelor. În cazul sferei goale gradientul va fi în direcţia opusă. Sfera solidă va genera un disc întunecat la interior. Contrastul dintr-o imagine ia naştere în urma interferenţei electronilor ce au unghiuri diferite. intensitatea diminuându-se spre marginile discului. Pattern-ul de difracţie se formează ” in the back focal plane” al lentilei obiectiv. Observarea directă a imaginii de către utilizator are loc la nivelul unui ecran de fosfor. Figura 6. Dacă se utilizează o apertură obiectiv mică electronii care sunt deviaţi sub un unghi mare nu vor contribui la formarea imaginii. Pentru a înregistra imaginea se utilizează negative care sunt impresionate de fasciculul de electroni sau camere CCD (Charge Coupled Device) care traduc în format digital interacţiunile electronilor cu senzorul camerei. Într-un microscop electronic de transmisie electronii trec prin probă înainte de a impresiona ecranul şi conţin informaţii cu privire la structura internă a acestei probe.

Figura 7. Ochiurile reţelei pot avea diferite dimensiuni şi forme (pătrat.Tehnici de preparare a probelor Grile În cazul microscopiei electronice de transmisie specimenele sunt depozitate pe grile. Grilele sunt discuri de metal (cupru. O foaie de mică este proaspăt clivată. Grilă de microscopie electronică. Pentru a obţine un film continuu de Formvar o lamă de sticlă pentru microscopia optică este curăţată şi scufundată uniform în soluţia de Formvar. Filmele de carbon sunt foarte stabile. fiind des folosit în microscopia electronică. iar a doua depunerea pe grile a filmului flotat. cei mai utilizaţi fiind cloroformul şi dioxanul. iar noile plăci sunt introduse cu partea proaspăt clivată în interiorul unei camere în care se va stabili un vid înalt. vedere superioară şi secţiune Filme de suport Filmul Formvar este un film de natură polimerică (formal de polivinil). platină) având un diametru de 3. După stabilirea vidului un 334 . Deasupra platoului pe care sunt aşezate cele două foiţe de mică se află un fragment de sfoară de carbon conectată la un circuit de mare voltaj. Pe această grilă se va depozita un film care va conferi suport specimenului. Substanţa se găseşte sub formă solidă şi este solubilă în solvenţi organici. Feţele proaspăt clivate ale micăi sunt perfect plate din punct de vedere atomic ceea ce îmbunătăţeşte proprietăţile filmului de carbon. Există două metode pentru depozitarea filmului pe grile: una implică aşezarea grilelor pe suprafaţa filmului flotat pe apă. nichel. Filmele de carbon Probele trebuie depuse pe un film care este foarte stabil sub acţiunea fasciculului de electroni. hexagon). Principiul evaporării carbonului este unul foarte simplu. aur.05 mm care prezintă o reţea.

datorită descoperirii graphene-ului şi a remarcabilelor sale proprietăţi se investighează aplicaţia acestui film în microscopia electronică. Coloraţia în cazul microscopiei electronice de transmisie se bazează pe săruri de metale grele derivate din molibden. Pentru ca o coloraţie să aibă efect trebuie să se lege de preferenţial anumite părţi ale probei. contrastul specimenului este prea slab pentru ca ochiul uman să diferenţieze marginile şi detaliile probei observate. Aceasta se poate realiza fie prin tratarea cu UV a grilelor sau prin glow discarching. Coloranţii se bazează fie pe vopsele sau pe materiale foarte absorbante. în cazul acestei tehnici lumina care penetrează proba suferă o schimbare a fazei. Pentru a face filmele mai accesibile substanţelor aflate în soluţie apoasă carbonul trebuie hidrofilizat. Ionii negativi se vor depozita pe suprafaţa filmului de carbon. Pentru a îmbunătăţi contrastul se folosesc diferite tehnici. acestea nefiind foarte dense. În funcţie de cantitatea de energie absorbită intensitatea fasciculului care va impresiona ecranul diferă şi se va forma o imagine. În ultimii ani. în acest moment carbonul se va evapora şi depozita pe mică formând un film continuu. În cazul probelor biologice care sunt formate din atomi precum carbon. Plăcile de mică sunt imersate treptat în apă ceea ce permite filmului hidrofob să se desprindă. Alte metode se bazează pe colorarea probelor pentru evidenţierea unor caracteristici. Ionii de 335 . azot şi hidrogen. cantitatea de energie absorbită este foarte mică comparativ cu energia fasciculului. iar dacă o picătură de apă este depusă pe suprafaţa unui astfel de film aceasta va avea tendinţa de a-şi micşora suprafaţa care întră în contact cu carbonul. Grilele sunt aşezate pe o sită de metal într-un vas plin cu apă. Microscopia electronică de transmisie utilizează un fascicul de electroni de înaltă energie pentru a bombarda specimenul. această nouă rază va interfera cu fasciculul iniţial şi contrastul se creează. În cazul glow discharching grilele sunt introduse într-o cameră parţial evacuată. uraniu sau tungsten. iar când voltajul este aplicat între anod şi catod potenţialul electronic ionizează aerul din încăpere. Coloraţia negativă În cazul microscopiei. pentru o vizualizare mai bună.curent se aplică sforii de carbon până când aceasta devine incandescentă. De aceea. În cazul microscopiei optice se aplica contrastul de fază. Depozitarea filmului de carbon are loc prin evacuarea vasului de apă. proba se va usca şi va putea fi examinată la microscop. După coloraţie. Carbonul este o substanţă hidrofobă. probele sunt impregnate cu săruri de metale grele. oxigen.

Excesul va fi îndepărtat cu ajutorul unei hârtii de filtru. de aceea diferite regiuni ale probei pot avea diferite densităţi de electroni şi pot fi diferenţiate în proiecţiile obţinute. electronii ce vor interacţiona cu atomii de metale grele vor fi puternic deviaţi. În cazul proteinelor menţinerea unei stări hidratate este importantă pentru păstrarea configuraţiei. În timpul uscării specimenul îşi pierde învelişul hidratant. Figura 8. Contrastul optim se obţine când coloraţia înconjoară complet specimenul si zonele adiacente. 336 Contra În timpul colorării particulele pot fi distorsionate. Aceasta corespunde cu mărimea granulei sării folosite pentru coloraţia negativă. iar după uscare grila poate fi examinată. Alterarea datorită radiaţiei este irelevantă deoarece sărurile metalice nu sunt la fel de susceptibile la efectele electronilor precum molecule organice. Tehnica este una simplă: proba este depusă pe grilă şi lăsată câteva zeci de secunde urmată fiind de ‘’spălarea’’ grilei cu 3 picături de colorant. Zona este neacoperită deoarece proba (proteina de exemplu) împiedică depunerea sării pe filmul de carbon. Colorantul absoarbe electronii mult mai bine decât mediul înconjurător. Ca urmare a distribuţiei inegale a coloraţiei pot să apară artefacte.metale grele vor interacţiona cu electronii. Interacţiunea dintre un specimen (coloraţie negativă) şi fasciculul de electroni Avantaje şi dezavantaje ale coloraţiei negative Pro Contrast foarte mare. Coloraţia cu aceşti atomi grei se numeşte coloraţie negativă deoarece în microscop se va observa o zona neacoperită de colorant înconjurată de coloraţia negativă. Pregătirea probei nu necesită aparatură şi nu ia mult timp (aprox. iar apertura obiectiv îi va elimina pe cei care vor fi deviaţi la un unghi prea mare. 4 minute). Contrastul apare în urma interacţiunii electronilor cu specimenul. În figura 8 se observă o proteină colorată negativ. ceea ce va determina contrastul şi rezoluţia imaginii. . Rezoluţia este limitată la 20 Å în condiţii optime.

Înregistrarea imaginilor pentru tomografie e dificilă deoarece prin rotire stratul de gheaţă expus este prea gros. Doza recomandată e de 6-10 electroni/Å2. cristaline care va estompa detaliile specimenului. în momentul introducerii unei grile aflate la temperatura camerei fierbe ceea ce favorizează formarea gheţii cristaline.Îngheţarea probei – metoda cryo Microscopia cryo este o tehnică prin care proba este îngheţată într-un refrigerent pentru o mai bună păstrare şi protecţie în timpul observaţiei. Procesul este laborios deoarece plonjarea grilei în recipientul de etan lichid trebuie să fie suficient de rapidă pentru a împiedica formarea gheţii cubice. Schemă a instalaţiei utilizate pt. Avantaje şi dezavantaje ale cryo-electronmicroscopiei faţă de coloraţia negativă Avantaje Specimenul este tot timpul în soluţie şi nu intră în contact cu suprafeţe. -195˚). apa din jurul probei va îngheţa. De aceea se preferă utilizarea etanului lichid. Pentru a vizualiza proba în cryo-electronmicroscopie trebuie foloFigura 9. iar proba va fi protejată. dar capacitatea calorică este foarte mică. Proba poate să aibă o orientare preferenţială pe grilă în cazul Dezavantaje Raportul semnal/zgomot este foarte mic deoarece absorbţia electronilor e scăzută. sită o doză minimă de electroni penîngheţarea probei tru a evita alterarea probei datorită radiaţiei. Nu există colorant care să distorsioneze preparatul. Îngheţarea se face prin dropping a unei grile pe care proba este deja depozitată. Pregătirea probelor necesită mult 337 . Azotul lichid are o temperatură ideală (aprox. prin urmare forma observată este cea reală în stare nativă.

ceea ce se evită timp. ceea se asigură prezervarea probei. SEM-ul are o adaptabilitate mare. iar obţinerea gheţii vitroase în cazul cryo. 338 . astfel se evită încărcarea electrică a probei.coloraţiei negative. Deşi principala lui utilizare este de a obţine imagini topografice la o mărire cuprinsă între de 10-10000 de ori. Fasciculul de electroni este concentrat şi utilizat pentru a scana suprafaţa obiectului observat. 3. poate fi problematică. specimenele sunt acoperite cu un strat subţire de metal pentru ca electronii să fie reflectaţi. Imaginea se formează pe un ecran datorită electronilor care sunt reflectaţi de învelişul metalic. Se foloseşte doza minimă de electroni. Microscopul electronic scanning (SEM) permite observarea şi caracterizarea materialelor organice şi anorganice heterogene la o scară cuprinsă între nanometri (nm) şi micrometri (µm). Prin intermediul microscopiei electronice de baleiaj se pot observa detalii de pe suprafaţa unui specimen. Acest înveliş metalic asigură o suprafaţă conductoare. Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) În cazul SEM. iar informaţiile privitoare la structura internă lipsesc. Popularitatea SEM-ului e datorată capacităţii sale de a obţine imagini aparent tridimensionale ale suprafeţelor unei game largi de materiale. de la jurnale ştiinţifice la reviste de popularizare şi filme. Imaginile SEM sunt utilizate într-o mare varietate media.

ca şi rezultat al bombardamentului de electroni. precum şi efectului de umbră dat de contrastul electronilor secundari şi reflectaţi. suprafaţa de examinat sau microvolumul de analizat este iradiată cu un fascicol îngust de electroni. pentru că aceştia variază în primul rând datorită diferenţelor topografice. care e cea responsabilă în parte pentru aparenţa tridimensională a imaginii specimenului. Capacităţi de imagistică Microscopul electronic scanning este unul dintre cele mai versatile instrumente disponibile pentru examinarea şi analizarea caracteristicilor microstructurale ale obiectelor solide. din regiuni ale unui specimen având mărimea de 1µm în diametru şi 1µm în adâncime (în condiţii normale de operare). Tipurile de semnale rezultate din interacţiunea fascicolului cu probă includ electroni secundari. aleasă la diferite valori ale energiei razei de electroni. rezoluţii instrumentale cu ordin de 1-5 nm (10-50 Å) se folosesc azi ca rutină la instrumente comerciale. O altă caracteristică importantă a SEM-ului este adâncimea câmpului.). regăsiţi într-un volum foarte mic în apropierea zonei de impact a fascicolului. Cu cât e mai mare această adâncime a câmpului cu atât se furnizează mai multe informaţii despre specimen. Analiza acestor raze emise de către probă poate scoate în evidenţă atât caracteristici calitative cât şi informaţii cantitative de element. Aparenţa tridimensională a imaginii se datorează unei adâncimi mari a câmpului microscopului electronic. compoziţia etc. raze X caracteristice şi alţi fotoni cu energii variate. se emit şi raze X caracteristice. cristalografia. Evoluţia SEM-ului şi capacităţile specifice ale instrumentelor comerciale moderne se vor discuta în cele ce urmează. Emisia de electroni secundari. Aceste semnale se obţin din emisii de volum specifice probei şi pot fi folosite pentru a examina multe caracteristici ale probei (topografia. La SEM. Semnalele de imagine de cel mai mare interes sunt electronii secundari şi reflectaţi. această calitate a SEM-ului fiind cea mai apreciată de către un utilizator. unde aparatul ope339 . Cele mai multe micrografii SEM se efectuează la măriri sub 8000 de ori. Un motiv puternic pentru utilitatea SEM-ului este rezoluţia mare ce poate fi obţinută când sunt examinate obiecte voluminoase. electroni reflectaţi. permite formarea de imagini la o rezoluţie apropiată de cea a mărimii fascicolului de electroni. care poate fi trecut în raster (linie cu linie) deasupra suprafeţei specimenului pentru a forma mai multe imagini. sau care poate fi static pentru a obţine analiza unei singure poziţii.La SEM.

de către Everhart şi Thornley (1960). Primul SEM utilizat să examineze specimene dense a fost descris de Zwokyn şi col. 1956) Următorul pas înainte a fost refacerea detectorului secundar de electroni. Schimbarea multiplicatorului de electroni cu mult mai eficientul fotomultiplicator a crescut cantitatea semnalului colectat şi a rezultat un mai bun raport semnal-zgomot. Ei au adăugat un scintilator pentru a converti electronii în lumină. prin comparaţie cu performanţele obţinute atunci cu TEM-ul în continuă perfecţionare. De asemenea a îmbunătăţit sistemul de scanare prin introducerea de scanare prin dublă deflecţie. mecanisme de contrast mai slab ar putea fi mai bine studiate.Mullan au construit primul lor SEM care până în 1952 a atins rezoluţia de 50 nm. iar aparatul său includea multe instrumente care de atunci au devenit standard. Autorii au realizat că emisia de electroni secundari este cea responsabilă pentru contrastul topografic. Dar. Colectorul a fost înclinat pozitiv aproximativ cu 50 V înspre specimen şi al doilea curent acumulat în el a produs o cădere de tensiune de-a lungul unui rezistor. W. Spre exemplu. Mc. şi părţile electronice asociate. C.Mullan a fost urmat de Smith (1956) care a observat că procesarea semnalului ar putea îmbunătăţi micrografiile. În plus. Alte utilizări ale SEM-ului au fost dezvoltate în această perioadă. Astfel. pentru că imaginea SEM vine cu informaţii adiţionale imaginii obţinute la microscopul optic.rează bine în limitele propriilor capacităţi de rezoluţie. şi a fost primul care a inclus un stigmator în SEM. care a fost apoi transmisă printr-o ţeavă de lumină direct pe suprafaţa fotomultiplicatorului. colectorul de electroni. proprietate foarte utilă în studii de criminalistică şi nu numai. Mc. Principalele componente ale SEM-ului sunt sistemele de lentile. Atât aspectele teoretice cât şi cele practice ale STEM-ului au fost explicate în detaliu de către von Ardenne. tubii catodici fotocolectori de raze. astfel s-a obţinut o rezoluţie de aproximativ 50 nm. Oatley şi studentul său D. şi a introdus amplificarea neliniară a semnalului. (1942). A urmat apoi von Ardenne (1938) care a construit microscopul electronic scanning de transmisie (STEM) prin adăugarea unei lentile de baleiere la microscopul electronic de transmisie (TEM). Oatley şi Everhart au putut observa pentru prima dată contrastul de voltaj. mai târziu Wells (1959) a făcut primele studii ale efectelor penetrării fascicolului cu scopul formării imaginii la SEM. În următorii câţiva ani. (Smith. şi primul care a utilizat perechi 340 . tunul. Prima lucrare recunoscută ca descriind conceptul de microscop electronic scanning este cea a lui Knoll (1935). această metodă a fost considerată neincitantă şi dezvoltarea pe această ramură a stagnat. SEM-ul are capacitatea de a analiza la măriri foarte mici.

A.U. Alte avansări în utilizarea SEM-ului includ mecanismele de contrast precum contrastul prin canalizarea electronilor produs prin variaţii în orientarea cristalografică şi contrast magnetic produs din domenii magnetice din materiale uniaxiale şi cubice. A. Stewart şi coechipierii de la compania Cambridge Scientific Instrument au finalizat design-ul comercial şi împachetarea produsului (Oatley. Cu toate că au crescut costurile şi complexitatea SEM-urilor cu emisie de curent.stereografice pentru a produce imagini tridimensionale la SEM. Avantajul tunului de emisie este dimensiunea sa mică astfel încât poate fi obţinută o imagine a unei probe de 1 nm. Olanda.. Imaginile pot fi observate pe un ecran. diferenţiere etc.. decât filamentele convenţionale de tungsten.Stereoscan” (Cambridge Scientific Instruments Mark I). Cu această sursă o mai mare cantitate de electroni au putut fi concentraţi pe o suprafaţă mai mică. Sursa de emisie de electroni. De la primul aparat comercial din 1965 s-au făcut numeroase îmbunătăţiri. Marea Britanie. 1960) Pease a construit un sistem cunoscut ca SEM V. una din ele fiind dezvoltarea surselor de lumină puternică precum catodul de hexaborid de lantan (LaB6). Germania şi Franţa. utilizată pentru prima dată la SEM în 1942. oferă microscopistului o mare flexibilitate şi uşurinţă în utilizarea SEM-ului. cu trei lentile magnetice. Odată stocată în format digital imaginea poate fi procesată în multe moduri. precum prin amplificare non-lineară. Acest aparat a devenit primul prototip comercial numit . Japonia. 341 . obţinându-se astfel o rezoluţie mai bună. În anii ce au urmat mai mult de 50 000 de unităţi SEM au fost vândute de către producători din S. aceste microscoape şi-au găsit utilitatea în numeroase domenii de cercetare şi tehnologie în care rezoluţia înaltă şi energia mică a sursei sunt importante. şi astfel de nevoi cer o atenţie specială tehnologiei de vidare. D. G. Această lumină puternică permite pătrunderea a de 1000 de ori mai mulţi electroni pe cele mai mici dintre probe. la nivel de rutină. Sursele de electroni au nevoie totuşi de vid de ordinul a cel puţin 10-8 Pa pentru a opera într-un mod de încredere. Majoritatea SEM-urilor sunt dotate cu capacitatea de a stoca imagini digitale. s-a dezvoltat în aşa măsură încât poate fi acum folosită pentru imagini de cea mai înaltă rezoluţie. deşi în aparatele mai vechi imaginile încă se mai fac prin fotografierea tubului catodic de raze. (Wells. 1972). Disponibilitatea unor computere puternice şi ieftine dotate cu capacitate de stocare mare şi pachete de soft capabile de o varietate mare de procesări şi funcţii pentru imagini digitale. printate sau reţinute pe un CD sau alte unităţi de memorie. care conţinea şi sistemul detector Everhart-Thornley.

Probele biologice sunt ideale pentru studiul la acest aparat. suprafaţa specime342 . Majoritatea materialelor biologice sunt umede. 1955). Dezvoltarea procesărilor la temperaturi scăzute a ajutat la reducerea pierderii de masă şi a distrugerilor termice la specimenele sensibile (Echlin. Una dintre cele mai importante descoperiri recente este microscopul electronic scanning cu presiune variabilă (VPSEM). 1992). termolabile. uscat sau umed.. Dimensiunea mare a adâncimii câmpului întâlnită la SEM face posibilă observarea tridimensională a obiectelor utilizând stereoscopia. 1993). Acest tip de aparat permite examinarea suprafeţelor a aproape oricărui tip de specimen. sensibile la radiaţii. care au fost suficient de puternice pentru a rezista procesului de vidare fără să se deformeze (Smith şi Oatley. Analiza structurală Una din cele mai promiţătoare dezvoltări din domeniul SEM-ului este abilitatea de a determina structura cristalină şi orientarea lor pe suprafaţa specimenelor preparate. de contrast mic şi emisivitate de electroni slabă şi sunt. se pot efectua experimente în aparat în care suprafaţa specimenului poate interacţiona cu atmosfera gazoasă. aşadar. Imaginile tridimensionale permit interpretarea corectă a caracteristicilor morfologice şi măsurarea lor. Mediul poate fi alcătuit din vapori de apă sau alte gaze în intervalul de 25-2500 Pa (0. pentru că mediul înconjurător specimenului nu mai este nevoie să fie la vid înalt (Danilatos. S-a dat multă atenţie la stabilizarea materialelor organice delicate. dezvoltările în domeniul biologic au depins de avansarea în prepararea specimenului. şi este cunoscută sub numele de difracţie electrono-reflectată (EBSD). îndepărtării sau imobilizării fluidelor celulare.2.Printre primele micrografii scanate au fost câteva materiale biologice precum carcasa unor insecte sau fibre lemnoase. slabi conductori.20 torri). Au apărut echipamente care permit evaluarea cantitativă a suprafeţei şi urmărirea în timp real şi de înaltă rezoluţie a specimenului prin intermediul SEM-ului. Pentru a colecta maximum de intensitate în modelul de difracţie. 2000). În formatul său modern. VPSEM-ul poate detecta electroni secundari şi retroîmprăştiaţi la fel de bine precum razele X. În plus. Un sistem diferenţial de pompare a vidului este folosit pentru a menţine tunul de electroni la vid înalt în timp ce specimenul este sub o presiune mai mare. Totuşi. 1991. Mai târziu Thornley a prezentat imagini SEM ale materialelor uscate prin îngheţare şi analizate la 1 keV pentru a evita încărcarea electrostatică. şi acoperirii lor cu un strat subţire de material conductor. Această capacitate se foloseşte de difracţia electronilor reflectaţi de pe suprafaţa specimenului (Schwartz şi col.

. 1947). Cosslett şi Duncumb (1956) au construit primul microanalizor electronic scanning de probe la Laboratoarele Cavendish în Cambridge. Cea mai recentă descoperire în aplicaţia modelului Kikuchi la volume de analizat este dezvoltarea sistemului de înregistrare a modelului folosind o cameră video de înaltă sensibilitate sau mai recent o cameră video tensio-cuplată (CCD). Aceste pattern-uri sunt mai apoi analizate printr-o metodă de indexare asistată de computer. Conceptul unui microanalizator electronic de probe a apărut în anii 1940 (Hillier. aşa cum se face azi în SEM-rile actuale. În teza sa de doctorat. adăugarea 343 . Castaing nu numai că a demonstrat că o analiză chimică localizată poate fi desfăşurată pe suprafaţa specimenului. precum şi contrastul semnalului. Optica electronică era formată dintr-un tun electronic urmat de lentile convergente ce formau o sondă electronică cu un diametru de 0. Indexarea automată a modelelor şi cartarea orientării straturilor de cristale asistată electronic permite identificarea fazelor de cristalizare şi arată orientarea greşită printre limitele cristalelor.U. dar a şi subliniat modul în care această informaţie poate fi cuantificată.microsondă electronica”(Castaing. cei doi oameni de ştiinţă treceau fascicolul brusc pe suprafaţa probei. Analiza elementală SEM-ul poate fi utilizat pentru a obţine informaţii legate de compoziţie folosind razele X caracteristice. Recunoaşterea complexităţii transformării intensităţii razelor X în compoziţie chimică a dus la perfecţionarea analizei cantitative de către numeroşi investigatori pe parcursul ultimilor 50 de ani. Dacă până atunci microprobele electronice operau cu fascicole statice de electroni. În timpul anilor 1950 câteva aparate EPMA au fost dezvoltate în laboratoare din Europa şi S. Deşi conceptul de analiză locală cu raze X este în sine un stimulent pentru folosirea microanalizatorului. Dezvoltarea unui instrument de analiza chimică localizată a probelor solide (EPMA) s-a produs deodată cu apariţia SEM-ului. 1951).Guinier au descris şi construit un instrument numit . Intensitatea modelului reflectat Kikuchi este relativ mică. de aceea e nevoie de camere ultrasensibile şi senzori fini de captare a contrastului. iar primul aparat comercial a fost introdus de CAMECA în Franţa în 1956.1. şi de abia în 1949 R.1 µm pe specimen.nului este dintr-o dată răsucită la un unghi de 70º faţă de orizontală.A. Castaing sub îndrumarea lui A.. De asemenea mai făcea parte din aparat şi un microscop optic pentru găsirea corectă a punctului de analiză şi una sau mai multe spectrometre WDS pentru analizarea intensităţii radiaţiei X emise în funcţie de energie.

şi utilizarea de spectrometre de cristale plate împreună cu optică capilară X-ray. la curenţi tipici utilizaţi la imagistica electronică secundară a SEM-ului. pe lângă analiza calitativă rapidă. În plus. În anii ce au urmat de la prima apariţie a EPMA-ului. Detectorii de raze X se bazau pe o formă solidă de silicon derivat de litiu [Si (Li)]. O altă însuşire importantă a SEM-ului cu EDS şi WDS este capacitatea de cartare compoziţională folosind raze X caracteristice. dar azi EPMA-ul este considerat a fi un echipament aparţinând SEM-ului. Spectrometrele dispersive de energie moderne sunt capabile de detectarea razelor X caracteristice ale tuturor elementelor cu număr atomic mai mare decât 4.. SEM-ul şi EPMA-ul au fost considerate aparate separate pentru încă un deceniu. s-au făcut numeroase îmbunătăţiri. două sau mai multe spectrometre de lungime de undă (WDS). printr-o analiză normală cu fascicolul de electroni se obţine o acurateţe de 1-2% (5-10% la probele biologice) din cantitatea respectivului element prezent.conceptului de scanare a fost o contribuţie foarte semnificativă. Câteva dintre acestea cuprind microcalorimetria în raze X.1968). Într-un SEM tipic echipat cu detectori EDS şi WDS. Adăugarea unui spectrometru EDS la microanalizorul electronic pentru a măsura razele X a atras atenţia asupra nevoii utilizării lui şi în cadrul SEM-ului (Fitzgerald şi col. un microscop optic pentru observarea suprafeţei specimenului şi un fascicol de curent de electroni care se stabilizează prin analiza de raze X. Marea majoritate a SEM-urilor vândute azi sunt echipate cu capacităţi EDS. printre care o descoperire a fost de mare importanţă: difracţia cristalelor din moleculele organice cu spaţieri mari interplanare 344 . Un EPMA modern are în mod normal capacităţile unui SEM. Pentru probe plate şlefuite. Proba este analizată fără a fi afectată şi analiza cantitativă poate fi obţinută la o rezoluţie spaţială de 1 µm pe probă. După ce pentru mulţi ani principalele linii de concentrare au fost în direcţia dezvoltării tehnologiilor existente. detectorii din derivaţi de silicon. câteva descoperiri recente au dat noi tendinţe în conceptele de detectori şi design. pe când WDS-ul este utilizat pentru detecta razele X ale elementelor minore (<10 wt%) sau chiar pentru a le recunoaşte în probă. Atracţia acestei forme de acumulare a informaţiei este detaliul microcompoziţional ce poate fi corelat cu metalografia optică şi electronică. prin spectrometrie EDS de raze X se mai poate realiza şi o analiză cantitativă foarte fină. EDS-ul e utilizat pentru a analiza razele X caracteristice elementelor majore (>10 wt%). Sistemul EDS oferă o modalitate rapidă de analiză a elementelor constituente în probă. toate găsind o tot mai mare utilizare în cadrul SEM-ului. având şi lentile optice şi una şi mai multe unităţi WDS.

(Henke. Avantajul energiei mici a fascicolului de electroni este că apare posibilitatea minimizării dimensiunii sursei de raze X şi a minimizării efectului de absorbţie în procedura cantitativă. 1966). 1965). în primul rând datorită faptului că unii parametri de corecţie sunt funcţie de concentraţie şi. prin urmare. Deşi prepararea specimenului biologic este mult mai exactă decât procedura pentru alte ştiinţe. În plus. Microanaliza în raze X a materialelor biologice şi polimerice întâlneşte aceiaşi problemă în examinarea probelor la SEM. în plus preparatorul trebuie să fie foarte atent ca elementele pentru măsurat să rămână în cadrul punctului de analiză şi să nu se îndepărteze sau să dispară pe parcursul preparării. O) ce pot fi măsurate de spectrometre dispersive de lungime de undă. se mai poate studia şi emisia de fotoni vizibili din recombinarea excesului de perechi de goluri de electroni dintr-un semiconductor (Kyser şi Wittry. produsă din interacţiunea electronilor cu specimenul a fost asociată cu prezenţa unor impurităţi în material (Long şi Agrell. 1965). N. culoarea luminii vizibile (catodluminiscenţa). Recent au fost dezvoltaţi difractori mari de spaţii interplanare ce utilizează depunerea fizică alternativă de straturi de vapori de elemente grele şi uşoare. deşi intervine problema contaminării cu carbon din cauza vacumizării slabe a SEM-ului. Utilizarea tot mai intensă a computerului împreună cu SEM-ul a crescut calitatea şi cantitatea de informaţii adunate prin intermediul aparatului. fac aproximările succe345 . în care efectele absorbţiei şi de fluorescenţă sunt neglijabile. aparatele au fost construite să permită posibilitatea unei analize de încredere cu fascicol de electroni si raze X de energie mică. C. Aceste cristale eliberează raze X cu lungime mare de undă din elementele cu număr atomic mic (B. metodele cantitative sunt în principiu simple. S-au creat programe care pot să convertească raportul intensităţii razelor X în compoziţii chimice. După ce s-a observat capacitatea de măsurare a razelor X care poate fi extinsă şi la specimene nonmetalice. În ultima vreme. De exemplu. Totuşi materialele biologice sunt mult prea uşor afectate de fascicolul de electroni şi astfel că în deceniile trecute s-a depus mult efort în instrumentare precum şi în procedurile preparative şi analitice cum sunt analiza la temperatură scăzută. Efectele de suprafaţă pot fi mai uşor de măsurat. a apărut ipoteza folosirii şi altor tipuri de fenomene de excitaţie. Capacitatea de a detecta elemente cu număr atomic mic le dă utilizatorilor de EPMA posibilitatea de a investiga numeroase noi probleme ale aparatului. Ele se bazează pe analiza unor secţiuni subţiri. Măsurarea catoluminiscenţei a devenit azi o parte importantă a SEM-ului mai ales în industria microelectronicelor.

pentru fiecare rază discretă din suprafaţa scanată. În acest fel analistul poate să revadă analizele corespunzătoare fiecărui pixel sau şir de pixeli. iar hărţile pot fi corelate cu imagini SEM preparate prin oricare alt fel de semnal. 346 . În plus programele pot acum să controleze fascicolul de electroni. Dezvoltarea cartării compoziţiei cantitative este un alt punct forte în legătura dintre imagistică. Valorile concentraţiilor corespunzătoare poziţiei razelor pe specimen sunt asamblate într-o imagine digitală cu un procesor de imagini prin codificarea axelor concentraţiei cu nuanţa de gri corespunzătoare. la cartarea cantitativă de compoziţie. şi spectrometrele.sive necesare. capacitatea de analiză cantitativă a elementelor şi utilizarea automatizată computaţională a SEM-ului. mişcarea specimenului. creşte numărul analizelor efectuate. şi îi permite operatorului să se concentreze pe evaluarea analizelor. Aceste programe derulează calcularea compoziţiei în câteva secunde şi astfel operatorul se bucură de mai multă flexibilitate în obţinerea rezultatelor. Imaginile rezultate sunt hărţi compoziţionale şi au la fiecare element constitutiv (pixel) valoare numerică completă a concentraţiei. Automatizarea e de mare ajutor în operaţiunile repetitive. Se face câte o analiză completă executată de calculator.

.partea a II-a şef lucrări dr.. virusuri cu ultrastructuri similare pot fi diferenţiaţi cu sensibilitate mare........ Depăşirea barierei de 1...... fiind necesară.... Lucian Barbu-Tudoran Cuprins 1. performanţă uşor de atins acum pentru materiale anorganice... iar marcarea antigenilor de suprafaţă se poate realiza cu uşu347 .....0 nm...... iar înţelegerea acestora este esenţială pentru extrapolarea detaliilor oferite de microscop la situaţia existentă in vivo.................. organitelor celulare izolate (inclusiv membrane) şi macromoleculelor. Pe lângă metodele clasice de contrastare a probelor biologice....2 nm) a permis vizualizarea unui singur atom de metal greu. deci. problemele preparării probelor biologice au rămas mult în urma îmbunătăţirilor aduse performanţelor microscoapelor electronice..... coloraţia negativă este cea mai utilizată metodă pentru vizualizarea topografiei şi structurii bacteriilor....... ce oferă un contrast superior şi mai multe tipuri de informaţii simultan sau prin utilizarea câmpului întunecat într-un TEM convenţional... Când microscopia imunoelectronică este folosită în conjuncţie cu coloraţia negativă.................... virusurilor.. fiind una din cele mai uşoare şi mai rapide proceduri pentru detectarea virusurilor...5 nm pentru specimenele biologice s-ar putea realiza prin utilizarea acestui STEM......... luarea în calcul a tratamentelor la care este supusă proba până la ajungerea în faza de examinare............ Plaja efectelor induse de diferitele tratamente premergătoare analizei electronomicroscopice este foarte largă......5 – 2............ eliminându-se astfel nevoia contrastării.. acestea sunt acceptate.. Dezvoltarea unui microscop electronic de baleiaj şi transmisie (STEM) de înaltă rezoluţie (0... în timp ce detaliile probelor biologice......... în general... O imagine electronomicroscopică este diferită de situaţia reală din organismul viu. răspunzătoare de acurateţea interpretării imaginilor.. absolut necesare pentru obţinerea unor imagini utilizabile....... 359 Din păcate......... Microscopia electronică de baleiaj .... Microscopia electronică de transmisie.. nu sunt mai bune de 1..... Atâta vreme cât artefactele inevitabile sunt interpretabile.. gradul alterării probei depinzând foarte mult de tehnica de pregătire a materialului biologic..... 349 2....Microscopia electronică .....

Cea mai bună soluţie rămâne combinarea celor două metode. iar ca dezavantaje: deteriorarea eritrocitelor din ţesuturile nefixate. Fixarea pieselor de dimensiuni mari prin metode convenţionale prezintă un gradient de calitate a fixării. antigenilor virali şi a anticorpilor. Criotehnicile. Un marker de aur coloidal este util. în special. în timp ce cele din zona profundă vor fi subfixate. În plus. deşi. dar suficientă pentru a interacţiona cu cele necovalente cum sunt legăturile sterice (legături de H şi interacţiuni van der Waals). astfel.rinţă prin colorarea imunonegativă. pe lângă beneficiile crioprotecţiei.microscopia probelor colorate negativ este o metodă importantă pentru investigarea structurii tridimensionale a proteinelor cristalizate. straturile superficiale pot fi suprafixate. chiar la 370C. scopul acestora fiind de a stabiliza ultrastructura celulei aşa cum există in vivo. şi aici există pericolul producerii de artefacte în intervalul de temperatură dintre cea fiziologică şi cea de imobilizare. vitrificarea nefiind uşor de realizat. obişnuit. ce includ răcirea ultrarapidă a celulelor şi ţesuturilor. pentru detecţia virusurilor foarte mici. Unele din acestea pot fi evitate prin fixarea cu aldehide într-un cuptor cu microunde. fixarea cu glutaraldehidă într-un cuptor cu microunde. energie prea mică pentru a afecta legăturile covalente.45 GHz (1 GHz = 109 cicluri / sec) şi prezentând o lungime de undă de 12. sunt o alternativă la fixarea chimică. esenţiale funcţiilor biologice. apar destul de des. O altă abordare este utilizarea coloraţiei negative în combinaţie cu vitrificarea pentru realizarea unui contrast crescut. 348 . Marcarea imunogold în combinaţie cu coloraţia negativă au un potenţial considerabil în detectarea virusurilor. Microundele sunt unde electromagnetice generate. dilatarea excesivă a secţiunilor anumitor ţesuturi (limfoid). cu o frecvenţă de 2. Undele electromagnetice sunt radiaţii neionizante ce produc deplasări moleculare prin migrarea ionilor şi rotirea moleculelor dipolare. Coloraţia negativă a probelor deshidratate prin îngheţare ar putea evidenţia ultrastructura virusurilor şi a membranelor fără colapsul specimenului. precum şi în cazul nivelelor scăzute de virusuri. De asemenea. cum ar fi contractarea sau umflarea probelor şi extracţia componentelor celulare datorate difuziei lente a fixatorilor. picornavirus şi parvovirus. Dintre avantajele fixării cu căldura microundelor menţionăm: capilarele pulmonare interstiţiale nu colapsează cum se întâmplă în cazul fixării cu formaldehidă.4 cm. oscilaţia dielectrică a moleculelor de apă şi o energie a fotonului de 10-5 eV. artefactele dependente de timp. respectiv. crioelectron . cromatina este mult mai distinctă în ţesuturile tumorale.

7%) în Tampon fosfat 0. Se realizează o fixare chimică a pieselor. Acesta nu fixează corespunzător la o profunzime mai mare de 0. fragmentele recoltate la rece (pe gheaţă). Pentru decuparea cuburilor se recomandă folosirea a două lame de ras noi. deshidratarea. Microscopia electronică de transmisie Principalele etape de a căror acurateţe depinde foarte mult obţinerea unor informaţii cât mai apropiate de situaţia reală din celula vie.5 mm. datorită toxicităţii mari a reactivilor cu care se lucrează. examinarea şi developarea suporturilor fotografice. cu ajutorul unor agenţi capabili să creeze legături încrucişate între moleculele constitutive ale materialului prelucrat. sunt următoarele: recoltarea. înainte de recoltare. acţionate în sens contrar pentru a se evita lezarea mecanică (zdrobirea/sfâşierea) ţesutului. Din fragmentele aflate pe glutaraldehidă se taie foarte repede cuburi mici. până la secţionare. se pipetează soluţia de glutaraldehidă pe suprafaţa organului de inte349 .7-3% (primul agent fixator).1.1 M. Prefixarea Prefixarea se efectuează cu o soluţie de glutaraldehidă 2-6% (2. cu doi agenţi fixatori la 4ºC. Pentru menţinerea neschimbată a ultrastructurii – deci păstrarea ei identică cu cea din momentul sacrificării animalului. nepermiţându-se deteriorarea arhitectonicii ultrastructurale. includerea. FIXAREA Procesul de fixare asigură stabilizarea structurii biologice cât mai aproape de starea nativă. toate celelalte operaţii. cu latura de maxim 1 mm. se trec rapid pe glutaraldehidă 2. principalul agent de fixare utilizat în microscopia electronică de transmisie. Este indicată pipetarea soluţiei de glutaraldehidă peste organul ce urmează a fi recoltat. Rezultate foarte bune se obţin dacă. Începând cu această etapă. Dimensiuni mai mari nu ar permite penetrarea pieselor de către tetraoxidul de osmiu. Se prelevează fragmente suficiente pentru prepararea a câte 3 blocuri/probă (adică cel puţin 6 cuburi). contrastarea. modelarea. încapsularea. fixarea. se vor desfăşura sub nişă. înainte de prelevarea acestuia din organismul animal. secţionarea. A. RECOLTAREA Recoltarea fragmentelor de ţesut trebuie efectuată foarte rapid (1-2 min) după sacrificarea animalelor pentru a se împiedica instalarea unor alterări morfo-funcţionale la nivelul ţesutului.

permite o mai uşoară manipulare a preparatului.NaH2PO4 · H2O (NaH2PO4 · 2H2O) .1 M pH 7. formând punţi încrucişate şi punţi intermoleculare. în special de la alcooli şi grupările amino. acestea sunt trecute în tuburi de sticlă şi păstrate timp de 15-30 minute în 1-1.2 ml . Glutaraldehida [O=CH-(CH2)3-CH=O] are proprietatea de a lega grupările active de hidrogen.Na2HPO4 anhidru (Na2HPO4 · 12H2O) . iar fixarea se va face la 4ºC. respectiv introducerea fixatorului în circulaţie.res. Prin urmare va prezerva foarte bine ultrastructura celulară şi activitatea enzimatică a celulelor. Glutaraldehida pură prezintă un singur vârf de absorbţie în UV. Glutaraldehida este primul fixator utilizat curent. Deci glutaraldehida 25% (sau 50%) stoc se va păstra numai la frigider.1 M se prepară după reţeta: . care vor avea un nou vârf de absorbţie la 235 nm. urmate de spălare abundentă cu apă distilată).apă distilată 350 1. deoarece este mai puţin toxic. Dacă este ţinută la temperatura camerei.7% preparată extemporaneu după reţeta: .Apă distilată Tamponul fosfat 0.Tampon fosfat 0.036 g) Până la 500 ml 2 ml 10 ml 4.Glutaraldehidă (25%) pentru microscopie electronică . După obţinerea cuburilor de ţesut. la 280 nm. După 15-30 minute se schimbă glutaraldehida şi se continuă fixarea timp de încă 1-2-3 ore în funcţie de consistenţa ţesutului. de asemenea. posibilitatea perfuziei ţesuturilor cu fixator. Ele se acoperă cu dop (de cauciuc rezistent) – care nu se va fărâmiţa sub acţiunea substanţelor ce se vor folosi. asigurându-se astfel o răspândire rapidă a acestuia la nivelul ţesuturilor. prepararea soluţiei 2. conferind astfel o mare stabilitate structurilor celulare cu care vine în contact. Există.154 g (18. pătrunde mai uşor şi acţionează rapid asupra ultrastructurii preparatului.56 g) 7.37 g (1.5 ml glutaraldehidă. Glutaraldehida se utilizează în soluţie apoasă 2.(din moleculele proteice) şi imino-. în soluţie apar polimeri ai glutaraldehidei.4 . Tuburile de sticlă cu care se lucrează vor fi foarte curate (bine spălate cu detergent şi amestec sulfocromic.7% se va face extemporaneu.

Prin reacţia posibilă între cele două substanţe fixatoare aplicate succesiv. este foarte important a se înlătura prin spălare orice urmă de glutaraldehidă. Rolul acidului osmic este de a stabiliza atât proteinele cât şi bistraturile lipidice.apă distilată Până la 500 ml OsO4 2% se prepară astfel: 1 g OsO4 se trece într-o sticlă foarte curată. poate rezulta un precipitat electron-dens care dăunează calităţii preparatului. După îndepărtarea glutaraldehidei se adaugă peste piese (care nu vor rămâne niciodată neacoperite) tampon fosfat 0. pe care o colorează prin depunerea osmiului. ale cărei reziduuri vor împiedica legarea osmiului.15 M pH 7.4. Tamponul fosfat 0. la post-fixare lipidele din membrane nu se vor fixa bine cu OsO4. C. în tuburile cu piesele prefixate şi spălate se adaugă cel de-al doilea agent fixator.765 g (27.Na2HPO4 anhidru (Na2HPO4 · 12H2O) 10. iar trecerea soluţiei în alte flacoane se va face numai prin răsturnare. Spălarea După prefixare. Postfixarea Postfixarea se realizează cu tetraoxid de osmiu (OsO4) 1-4% în funcţie de consistenţa ţesutului de studiat. şi anume. În plus. conţinând 50 ml tampon fosfat 0. se adaugă o soluţie proaspătă de OsO4 în care piesele vor mai sta timp de 85 minute. prezervarea structurii fine a celulelor şi stabilizarea acestora pentru a face posibile etapele ulterioare de preparare în scopul vizualizării în microscopul electronic de transmisie.1 M. cu dop rodat.064 g (2. Culoarea unei soluţii proaspete de OsO4 este galben pal.15 M.NaH2PO4 · H2O (NaH2PO4 · 2H2O) 2. 351 . Prin procedura de fixare menţionată se urmăreşte stoparea proceselor metabolice din ţesturi. şi spălarea se va face în aceleaşi condiţii.366 g) . După înlăturarea tamponului fosfat.139 g) . Dacă prefixarea s-a făcut la frigider. după care se lasă 24 ore la 4ºC pentru dizolvarea completă. Se închide sticla şi se agită puternic până la spargerea fiolei. pentru 15 minute. o soluţie 1% (sau 2%) de OsO4 în Tampon Fosfat 0. pH 7.4. Se înlătură această soluţie.4 în 4 băi succesive a câte o oră (în a patra baie piesele se pot ţine peste noapte).15 M se prepară după reţeta: . Există cazuri când fixarea a fost prelungită peste noapte pentru fiecare fixator. Se va evita contactul soluţiei cu obiecte metalice. dacă urmele de aldehide nu sunt eliminate din ţesut. pH 7. dar şi de a mări contrastul la nivelul ultrastructurii ţesutului.B.

în soluţii apoase de concentraţii crescătoare: 30% timp de 15 minute.4. 80% timp de 30 minute. 100% (anhidră) timp de 15 minute. deoarece alcoolul sau acetona se evaporă uşor şi piesele pot suferi procese 352 . Pentru deshidratare se utilizează acetona (pentru epon se poate folosi şi alcoolul etilic) şi în unele cazuri oxidul de propilen. dioxan sau toluol în etapele finale. spălarea trebuie efectuată după fiecare fixator folosit. 90% timp de 30 minute. 70% timp de 30 minute. cu urmări asupra polimerizării blocurilor la includere. este necesar ca toată apa introdusă în timpul spălării în piese să fie extrasă fără a produce modificări în structura moleculară a celulelor.15 M. Spălarea După terminarea procesului de fixare pe cale chimică trebuie să urmeze imediat spălarea pentru înlăturarea totală a excesului de fixator din ţesut. înlocuirea solventului trebuie făcută foarte rapid. 50% timp de 15 minute. Dacă fixarea s-a făcut la frigider. în 4 băi succesive de câte o oră (în a patra baie piesele se pot ţine peste noapte). 100% (anhidră) timp de 15 minute. Deci. În cazul fixărilor succesive duble. pentru o cât mai bună includere.D. La includerea în Epon 812 pot urma două băi de oxid de propilen de câte 15 minute fiecare. Cantitatea de soluţie folosită pentru fiecare etapă de deshidratare trebuie să fie de 2-5 ml în funcţie de numărul pieselor din fiecare flacon. şi spălarea se va face în aceleaşi condiţii. Până la concentraţia de 70% se lucrează la temperatura de 4ºC după care tuburile vor putea fi păstrate la temperatura camerei. Extragerea apei se face treptat şi în timpi scurţi pentru ca procesul să nu fie însoţit de alterări structurale (eventuale extracţii de proteine din ţesut). 100% (anhidră) timp de 15 minute. Prezenţa urmelor de fixator în ţesut facilitează reacţii între acesta şi soluţiile de solvenţi organici folosite la deshidratare. pH 7. După îndepărtarea tetraoxidului de osmiu se adaugă peste piese (care nu vor rămâne niciodată neacoperite) Tampon Fosfat 0. DESHIDRATAREA În vederea includerii pieselor (pentru a se putea efectua secţiunile ultrafine) se utilizează răşini epoxidice: Vestopal W sau Epon 812 care sunt substanţe organice hidrofobe. Când se ajunge la etapele finale.

etc. fără dop. Vestopal W Vestopalul W este o răşină poliesterică – un copolimer format dintr-un poliester nesaturat şi stiren. cel mai frecvent utilizat este Vestopalul W. 3:1 şi în Vestopal (Epon) pur. răşini poliesterice şi unele răşini epoxidice. INCLUDEREA Obţinerea secţiunilor ultrafine care. Din categoria mediilor de includere hidrofobe fac parte cele pe bază de metacrilat. din aceeaşi clasă mai fac parte lacul poliesteric ME 6611.de strângere. fiind foarte fluid şi miscibil cu aceste răşini. Specimenele sunt infiltrate în toată masa lor cu materialul de includere. Este recomandabil ca alcoolul sau acetona folosite în ultimele băi să fie anhidre. Epon 812 –Araldită. selectronul etc. urmate de modificări nedorite. Dintre răşinile poliesterice. prepolimerizaţi împreună până la starea unui 353 . acest solvent trebuie evitat deoarece inhibă unele enzime. Între soluţiile de deshidratare şi cele de includere este bine să se intercaleze câteva băi cu solvenţi de tranziţie. Pentru includera în Vestopal sau Epon piesele sunt ţinute câte 1 oră în soluţii de Vestopal (Epon)/acetonă (anhidră) în concentraţii crescătoare: 1:2. În paralel cu deshidratarea se prepară soluţie de Vestopal sau Epon pentru includere. ceea ce se poate realiza introducând în vase o cantitate oarecare de sulfat de sodiu anhidru. peste noapte. Dintre răşinile epoxidice se pot enumera: Araldita. 2:1. cel mai bun intermediar este oxidul de propilen care acţionează ca deshidratant şi fixator şi. Tot ca intermediar este recomandat xilolul sau toluolul. rigolacul. A. să nu altereze structurile. În cazul cercetărilor de localizare enzimatică. dar care. DER 332 – DER 732. Din această categorie pot fi amintite: durcupanul. prin infiltrarea în ţesut. glicol-metacrilatul sau aquonul. Eponul 812. Maraglas 655 – DER 732. prin grosimea lor redusă să permită transmisia electronilor şi deci obţinerea imaginilor în TEM este condiţionată de includerea pieselor într-un mediu suficient de dur care să faciliteze secţionarea pieselor. Toate operaţiile de includere şi încapsulare se desfăşoară în nişă. care înlocuieşte substanţa în care se efectuează deshidratarea. asigură o foarte bună infiltrare a ţesuturilor. respectiv acetona (sau dacă este cazul – alcoolul etilic). fiind mai volatil. Există şi medii de includere hidrofile. În cazul includerii cu răşini epoxidice. 1:1. care nu necesită deshidratarea pieselor după fixare şi spălare.

ţesuturile au un contrast ridicat şi sunt excelent prezervate. nu produce procese de strângere a ţesuturilor. pătrunde repede în ţesuturi. obţinută prin condensarea epiclorohidrinei cu glicerol. De aceea. B. aceştia din urmă trebuie reînnoiţi în fiecare lună. se omogenizează din nou foarte bine şi se adaugă 8 picături de activator (la 3 probe) (octoat de cobalt) cu o pipetă la care 1 ml corespunde pentru 20 de picături.4 ml) Peroxidul de benzoil se activează în prealabil prin recristalizarea din cloroform. Atât răşinile cât şi iniţiatorul şi activatorul se pot păstra la rece. Secţiunile sunt rezistente la fasciculul de electroni. Ca amestec de includere. Blocurile se pot secţiona uşor cu cuţitul de sticlă. Epon 812 Eponul 812 este o răşină epoxi-alifatică pe bază de glicerol. duritatea blocurilor poate fi modificată după dorinţă.Octoat de cobalt preparat astfel: 1 ml α-metil stiren + 7 picături de octoat de cobalt 15 g 150 mg 8 picături (0. cristale care se răzuiesc şi se mărunţesc. chiar la rece. se pot monta pe grile fără pelicule suport şi permit obţinerea unei înalte rezoluţii. stirenul. Pentru includere şi încapsulare. În timpul lucrului se va avea grijă să nu se amestece direct iniţiatorul cu activatorul. Pentru 3 probe (15 blocuri) reţeta de preparare a Vestopalului este următoarea: . îşi pierd activitatea în decurs de o lună. altfel blocurile vor fi moi şi de slabă calitate. Fiind parţial polimerizat. care îşi schimbă culoarea. iar secţiunile sunt foarte rezistente la fascicolul de electroni. Substanţa activată se depune sub formă de cristale incolore pe pereţii vasului respectiv.Peroxid de benzoil . dioxanul sau chiar glicometacrilatul. iniţiatorul şi activatorul. se adaugă Vestopal în cantitate de 1 g/bloc. Vestopalul W nu este miscibil cu alcoolul. se secţionează uşor cu cuţitul de sticlă.Vestopal W . Cel care expiră mai repede este activatorul. după care se pun în tuburi. În timp ce răşina poate fi păstrată câteva luni la rece. deoarece amestecul este exploziv.sirop consistent. şi pentru deshidratare trebuie să se folosească acetona. uşor gălbui. 354 . se prepară vestopalul astfel: se adaugă în puţin Vestopal peroxidul de benzoil (iniţiator al polimerizării Vestopalului) pentru predizolvare şi se amestecă foarte bine cu o baghetă de sticlă.

Ulterior se face etichetarea capsulelor (pe etichete se scrie cu creionul chimic pentru Vestopal şi cu creion obişnuit pentru Epon – pentru a se evita ştergerea simbolurilor la contactul cu mediul de includere) şi completarea concomitentă a tuturor capsulelor de gelatină.Reţeta de preparare a Eponului este următoarea: Soluţia A Epon 812 (Epitoke 212) DDSA (anhidrida dodecenil-succinică) ml 66 100 Soluţia B (dă duritatea) Epon 812 NMA (anhidrida metil-nadică) ml 100 84 Soluţiile A şi B pot fi păstrate timp de peste 6 luni la 4ºC în sticle bine închise şi ferite de umezeală. În vârful blocurilor. transparente. blocurile vor fi mai moi. ceea ce ar afecta polimerizarea. 355 . Pentru două probe (6 blocuri). În urma polimerizării se obţin blocuri dure. conţinând în interior piesele – de culoare neagră. sau chiar la spargerea acestora. cu preponderenţă la periferia blocurilor. iar dacă predomină soluţia B (3:7). MODELAREA BLOCURILOR Blocurile de răşină se fasonează cu ajutorul unei lame de ras nouă. deci includerea corectă. sub o lupă binoculară cu posibilităţi de mărire de 70-100×. Raportul 5:5 duce la obţinerea unor blocuri potrivit de dure.6-dimetil-aminometil fenol) – acceleratorul polimerizării. Înainte de amestecarea celor două soluţii. După încapsulare se induce polimerizarea mediului de includere prin introducerea capsulelor la etuvă la o temperatură de 60ºC timp de 24-48 de ore. ele trebuie scoase de la frigider şi ţinute la temperatura camerei timp de câteva ore pentru a evita condensarea vaporilor de apă pe ele. Se completează cu Vestopal (Epon) circa 3/4 din volumul capsulelor. blocurile vor fi mai dure. raportul de combinare A:B = 5:5 la care se adaugă 150 μl DMP 30 (2. spre a intra aproape în întregime în suportul ultramicrotomului. pentru ca blocul să fie relativ scurt.4. ÎNCAPSULAREA Încapsularea specimenelor se face în capsule de gelatină foarte bine uscate (ţinute câteva ore la etuvă la 60°C) – în fiecare capsulă se pune o picătură de mediu de includere şi apoi câte două cuburi dintr-o probă pentru fiecare bloc. dacă predomină soluţia A (7:3). Se amestecă foarte bine cu o baghetă de sticlă şi apoi se centrifughează pentru eliminarea bulelor de aer. Temperatura mai ridicată poate duce la polimerizarea neomogenă.

lungi de 400 mm. Cu cât secţiunile sunt mai groase. Se modelează câte două blocuri pentru fiecare probă. rezultând câte două cuţite de formă triunghiulară. sticla pentru cuţite. La marginea 356 . Înainte de confecţionarea cuţitelor. în timp ce zonele învecinate prezintă dinţi de fierăstrău. Din cauza tensiunii de fracturare. pe diagonala cărora se va face o nouă tăietură. Folosirea knife-maker-ului are ca rezultat obţinerea de cuţite cu tăiş drept. prismatică. strălucitoare. Aceasta începe în punctul unde linia Wallner se curbează: zona cea mai ascuţită examinată la microscopul stereoscopic al ultramicrotomului. mult mai accesibile.1-0. SECŢIONAREA Această operaţie este necesară pentru obţinerea secţiunilor ultrafine. Apăsarea pe foaia de sticlă trebuie să fie uşoară. poate fi folosită orice sticlă albă plană. Pentru secţionare se pot folosi cuţite de diamant sau cele de sticlă. late de 25 mm şi groase de 5. cu grosimea de 5-8 mm. câte un bloc fiind păstrat ca rezervă. de aceeaşi intensitate pe toată linia de tăiere. în cazul tăierii manuale. asigurându-se astfel o tăiere uşoară şi o rupere a benzilor de sticlă fără tensiuni. cuţitele pot avea muchia de tăiere oblică. apare ca o linie albă. cu ajutorul căreia se poate detecta zona utilă a cuţitului. barele de sticlă se curăţă uşor cu un tampon de vată cu acetonă anhidră după care se şterg cu o bucată de tifon curat. cu atât tensiunea de accelerare a electronilor va trebui să fie mai mare pentru a se putea obţine imaginea pe ecranul fluorescent al microscopului. deoarece acestea pătrund prea adânc. Pentru tăierea sticlei nu se folosesc cuţite de diamant. Tăierea se va face pe o folie de cauciuc. sub formă de bare. şi la fracturare sticlei se produc tensiuni care afectează calitatea cuţitului. imediat sub tăişul cuţitului se formează o linie curbă. Se poate întinde înainte de tăiere o urmă de petrol cu ajutorul unui tampon de vată. Cele mai potrivite sunt rondelele de metal din comerţ. Operaţiunea de modelare a blocurilor este necesară pentru ca în momentul secţionării să se obţină secţiuni trapezoidale care vor forma benzi rectilinii. pentru care se foloseşte ca materie primă. Cuţitele selecţionate pentru secţionare se păstrează ferite de praf. la o mărire de 50-100×. S-a demonstrat că dacă nu există sticlă specială pentru cuţite.la nivelul probei se execută un trunchi de piramidă care să poarte în vârf o suprafaţă trapezoidală cu laturile de aproximativ 0. cu o grosime care să permită străbaterea lor de către fasciculul de electroni acceleraţi la tensiuni de 50-100 kW în TEM. Pentru realizarea cuţitelor se poate utiliza aparatul special conceput pentru aceasta (knife maker). aşa-zisa linie Wallner.2 mm.5 mm. Înainte de folosire este necesară pregătirea suplimentară a cuţitelor. Din barele de sticlă se vor tăia în prima fază pătrate.

în paralel. Bara de înaintare va efectua mişcări succesive în plan vertical. ceea ce ar putea determina udarea blocului şi compromiterea secţionării. Pentru secţionare blocurile se montează pe rând în dispozitivul barei de înaintare al ultramicrotomului LKB. grosimea acestora fiind apreciată după culoarea lor: Cenuşie Cenuşiu-argintie Argintie Argintiu-gălbuie Galben pai 100-200 Å 300-400 Å 500 Å 600 Å 650-700 Å Galben intens-maroniu Maro Maro – albăstrui Albăstrui Verde 700-800 Å 800-850 Å 900-1000 Å 1000-1100 Å 1300-1500 Å 357 . piramida realizată la nivelul probei trebuie să se afle la nivelul gurii cuţitului (în plan vertical). pe o suprafaţă cât mai mare posibilă (ideal este completă) a acesteia. oglinda de apă trebuie să fie orizontală. apoi se face oglinda.prismei unde se află suprafaţa de secţionare se construieşte un bazin prin lipirea unei benzi adezive în poziţie perfect orizontală. Cuţitul se instalează în ultramicrotom raportat la limitatorul din stânga locaşului cuţitului şi la un unghi de 3º. Se apropie cât mai mult posibil cuţitul de bloc prin manevrarea voxelor macrometrică. astfel încât suprafaţa de secţionare a blocului cade pe faţa de tăiere a cuţitului de sticlă sau de diamant. Se spală de cel puţin 3 ori cu alcool (10% sau acetonă 10%) sau cu apă distilată. şi apoi micrometrică a ultramicrotomului. bara înaintează cu o distanţă reglabilă. în zona cea mai ascuţită a acestuia. Pentru aceasta. La nivelul bazinului se va ajusta cantitatea de alcool 10% astfel încât. bara de înaintare în sus şi în jos prin acţionarea manuală a acesteia – de la viza de pe panoul de comandă. reflexia luminii să se realizeze cât mai uniform la suprafaţa băii. De asemenea. egală cu grosimea secţiunii (500-1000 Å). Pentru realizarea acestui lucru se reglează angrenajele intermediare care ajută la fixarea suportului care poartă blocul de bară de înaintare a ultramicrotomului. mişcând uşor. În poziţia blocată a barei de înaintare. să nu prezinte menisc. prin reglarea poziţiei lămpii fluorescente. În cazul ultramicrotomului LKB avansul este controlat prin dilatarea termică a unei tije metalice (aliaj de nichel). Secţiunile obţinute vor pluti la suprafaţa apei distilate din baia cuţitului (care formează oglinda). temperatura camerei trebuie să fie cât mai scăzută posibil. Blocurile se montează astfel ca baza mare a trapezului din vârful piramidei să fie perfect paralelă cu lama cuţitului. După fiecare mişcare de tăiere.

Grilele electrolitice sunt reţele de cupru cu cadrul de 3 mm. Se evaporă diluantul rămânând o peliculă de 100 Å grosime. În cazul de faţă contrastarea se face în două etape.Acetat de uranil . Contrastarea urmăreşte creşterea capacităţii de împrăştiere diferenţiată a electronilor de către materialul biologic secţionat.Alcool etilic 50% în apă distilată 358 2. în mijlocul unui cristalizor cu apă bidistilată se pipetează o picătură de parlodion. Numărul de ochiuri pe care le poate avea o grilă variază între 50 şi 1000. Soluţia de acetat de uranil se prepară după reţeta: . au putere mică de împrăştiere a electronilor. Grilele se păstrează în cutii Petri cu capac pentru a fi ferite de praf (pe hârtie de filtru pe care se trec simbolurile corespunzătoare specimenelor). secţiunile de culoare argintie sunt foarte convenabile. cu doi contrastanţi diferiţi: A. Pe această peliculă se aşează grilele. şi ca urmare. Secţiunile sunt preluate pe grile electrolitice de cupru (200 mesh) acoperite în prealabil cu o peliculă fină de parlodion. grilele fiind ferite de praf. Stratul de carbon are rolul de a proteja pelicula de parlodion de acţiunea distrugătoare a fasciculului de electroni. O.Pentru cercetări de rutină. se trece la acoperirea cu carbon (un strat de circa 100 Å) a grilelor într-un evaporator cu vid (metalizor). Grilele sunt apoi scoase cu ajutorul unor rondele de hârtie. datorită fineţei lor şi a compoziţiei chimice. După uscarea peliculei la temperatura camerei. contrastul acestora este foarte scăzut. CONTRASTAREA Ţesuturile biologice incluse în mase plastice. cu atât dispersia electronilor şi implicit contrastul imaginii sunt mai mari. însă în mod curent sunt folosite grile cu 100-200 de ochiuri. cu faţa în jos. pentru a le evidenţia sunt contrastate cu săruri ale metalelor grele. Contrastarea cu acetat de uranil. N. Deoarece moleculele din structurile biologice sunt constituite din atomi cu număr atomic mic (C. H). Din fiecare bloc se vor culege secţiuni pe cel puţin câte 2 grile. Grosimea secţiunilor se va alege şi ţinând cont de caracteristicile microscopului în care se va face examinarea. Pentru obţinerea peliculei de parlodion. Uscarea grilelor se face cu hârtie de filtru prin tamponarea laterală a grilelor. Contrastul imaginii obţinute în microscopul electronic depinde de numărul atomic al elementelor din care este alcătuit specimenul: cu cât acest număr este mai mare.6 g 20 ml . obţinute prin electroliză.

410 g 8 ml Se dizolvă în 30 ml apă distilată şi se agită puternic timp de 5-10 minute 2. imaginea se formează punct cu punct în forma rasterului.Se pipetează acetatul de uranil în godeurile unei plăci de parafină (ceară). În microscopul electronic de transmisie clasic imaginea se formează în întregime. într-un fascicul îngust al cărui diametru în locul de încrucişare are. Se ţin grilele pe acetat de uranil 15-20 minute după care se spală la jet de pisetă cu apă distilată-alcool şi se iau pe hârtie de filtru spre a nu adera la vârful pensei fine cu care se lucrează. Soluţia de citrat de plumb se prepară după reţeta: Citrat de plumb (GM 1053. Raza primară (incidentă) a electronilor acceleraţi şi concentraţi ce cade pe suprafaţa probei. interacţiune în urma căreia apar următoarele semnale: 359 . Pentru evitarea apariţiei precipitatelor (reprezentate de carbonatul de plumb ce apare la contactul citratului de plumb cu CO2 atmosferic). filtrată. după care s-au lăsat grilele cu secţiunile în jos pe picăturile de contrastant. pe suprafaţa probei cercetate. Electronii emişi de tunul de electroni al microscopului şi acceleraţi de o tensiune înaltă (0. simultan. care se compune din numărul total al liniilor. Se pipetează citratul de plumb în godeurile plăcii de parafină (ceară). se va evita contactul contrastantului cu aerul atmosferic. interacţionează cu materialul. după care se lasă grilele cu secţiunile în jos pe picăturile de contrastant. se numeşte raster. Imaginea finală. Cel mai bine este să se folosească o soluţie proaspătă preparată. sub 10 nm.5–30 kV) sunt concentraţi. după care se spală la jet de apă distilată. B. în timp ce la cel de baleiaj. Contrastarea cu citrat de plumb. Se ţin grilele pe citratul de plumb maxim 9 minute (timp după care apar precipitate).85) NaOH 1N Se agită timp de 5 minute Apă distilată Se aduce pH-ul la valoarea 12 Se completează până la 50 ml 1. iar colorarea să se facă în apropierea câtorva granule de NaOH care să absoarbă CO2. Microscopia electronică de baleiaj Microscopul electronic de baleiaj sau scanning (SEM) diferă fundamental de microscopul electronic de transmisie în privinţa modului de formare a imaginii. într-un sistem cu mai multe lentile.

15M.4 pentru 60 – 90 minute la 4 0C.1M. . toate la 4 0C. suficient de profunde pentru a nu mai înregistra un aspect normal al acestora. pH 7. Deşi rezoluţia acestui microscop nu permite observarea unor detalii de ordinul celor din TEM. 360 .15M. dar pentru probele biologice este necesară acoperirea acestora cu un strat foarte subţire de metal (prin evaporare în vid).trei băi consecutive a câte 60 minute fiecare. în condiţii de vacuum înalt. . şi aici probele trebuiesc deshidratate.îndepărtarea fixatorului în exces prin trecerea probei în tampon fosfat 0. pH 7. de asemenea la 4 0C.prefixarea cu glutaraldehidă 2. examinarea desfăşurându-se. DESHIDRATAREA LA PUNCT CRITIC Deshidratarea la punct critic reprezintă o metodă de eliminare a oricărei substanţe volatile. a patra peste noapte.• Electroni secundari (SE) • Electroni reflectaţi (BE) • Electroni Auger • Electroni absorbiţi de probă (AE) • Electroni transmişi prin probă (TE) • Fotoni • Radiaţii X. pentru SEM dimensiunile preparatelor pot depăşi 3 cm grosime. pH 7. capabil de a genera electroni secundari sub impactul fasciculului incident provenit din filamentul microscopului. o deshidratare naturală a materialului biologic produce alterări ale suprafeţei probelor datorate tensiunii superficiale. dimensiunilor probei. Timpii de lucru ai acestor etape vor fi adaptaţi tipului de ţesut organic şi. generatoare de vapori (ce pot diminua nivelul vidului din microscop) dintr-o probă biologică în vederea examinării acesteia la microscopul electronic cu baleiaj. Ca şi în cazul TEM. limitarea fiind dată doar de mărimea incintei probei. în special.postfixarea cu acid osmic (Os O4) 1% în tampon fosfat 0.4 . Neavând de a face cu electroni transmişi prin probă.7% în tampon fosfat 0.4 timp de 75-90 minute. Pentru fixarea probelor biologice cu conţinut ridicat de apă se foloseşte aceeaşi combinaţie de fixatori ca şi pentru microscopia electronică de transmisie: . îndepărtându-se orice urmă de solvent sau a vreunei substanţe volatile din materialul biologic. de asemenea.

Dacă proba biologică a fost în lichid. suprafaţa lichidului devine foarte instabilă şi. care prezintă o tensiune superficială la aer foarte mare. Anderson a dezvoltat această metodă folosind CO2 lichid. indicând o reducere a tensiunii superficiale. spre deosebire de acetonă. trece în faza de gaz. Deshidratarea normală prin evaporare la temperatura camerei induce deformări ale majorităţii specimenelor. studierea morfologiei suprafeţelor probelor biologice implică prezervarea detaliilor de suprafaţă. Tensiunea superficială poate fi redusă prin substituirea cu un lichid ce are o tensiune superficială mult mai mică decât a apei. În acest sens. Cel mai comun mediu al probelor biologice este apa. în final. proba fiind supusă forţelor prezente la limita fazei lichid – vapori.În 1952. cu păstrarea nealterată a detaliilor de suprafaţă. meniscul devine plat. metodă superioară sublimării apei în vid. va parcurge această tranziţie spre un mediu gazos “uscat” fără a fi în contact cu suprafaţa. Când este atins punctul critic este posibilă trecerea de la faza de lichid la faza de gaz fără modificări dramatice. dar se pot folosi şi alte gaze lichefiate ca şi fluid de tranziţie. cauza primară a acestora fiind efectele tensiunii superficiale. Prin creşterea temperaturii gazului lichefiat. Totuşi. evitând astfel posibilitatea apariţiei deformărilor datorate tensiunii superficiale. Dacă tensiunea superficială scade foarte mult. 361 . aşteptându-se deformări minore ale suprafeţei probei în timpul deshidratării. intervenţia aşa-numitei continuităţi de fază sugerează o metodă de deshidratare pentru care tensiunea superficială poate fi redusă la zero. unde aceasta este de câteva ori mai mică.

coincid.1 APĂ +374 Presiunea critică (atm) 20 50 33 73 36 219 Deci. unde poate fi lichefiată. valori la care are loc tranziţia. o substanţă poate fi clasificată drept gaz doar deasupra temperaturii critice. orice menisc vizibil va dispărea.1 oC pentru CO2. Deasupra acestei temperaturi gazul nu poate fi lichefiat prin aplicarea presiunii. Aşa cum s-a menţionat. Nefiind miscibil cu apa. în cazul probelor biologice la unele dintre acestea ar interveni modificări termice suplimentare.1 MONOXID DE CARBON -141. Dacă lichidul a fost încălzit într-o incintă închisă. proprietăţile stării de lichid şi ale stării de gaz (vapori) ale aceleiaşi substanţe. sub această valoare. Acest fluid intermediar. tipic pentru microscopia electronică. în consecinţă. procedura glutaraldehidă – osmium. Chiar dacă valorile critice ale diferitelor substanţe pot fi atinse practic. este mult mai precis termenul de vapori. Înaintea acestor etape se realizează fixarea probei.Graficul indică faptul că. de regulă. CONSTANTE CRITICE Substanţa Temperatura critică (oC) HIDROGEN -234. devin similare şi. astfel. schimbă apa din ţesut şi este miscibil cu CO2. deşi se pot utiliza şi variante cu două fluide intermediare. în final. CO2 rămâne cel mai utilizat mediu pentru deshidratarea la punct critic şi este numit fluid de tranziţie. o continuitate de stare. dioxidul de carbon. apa din proba biologică trebuie înlocuită cu un alt fluid miscibil cu CO2. tensiunea superficială fiind zero având. aceasta fiind temperatura critică căreia i se asociază o presiune critică. aşa încât presiunea critică să poată fi atinsă la temperatura critică. deci. Acest fapt este realizat pe izoterma de 31.5 OXIGEN -118 AZOT -146 DIOXID DE CARBON +31. cel mai utilizat fiind. stadiul intermediar implică deshidratarea probei biologice cu ajutorul lichidului intermediar: (proba umedă) H2O > Acetonă > CO2 > DPC (proba uscată) 362 . la atingerea punctului critic (caracterizat de valori ale presiunii şi temperaturii foarte precise).

încălzirea incintei până la atingerea punctului critic.trei schimbări FLUIDE INTERMEDIARE / DESHIDRATANTE Substanţa ETANOL ACETONĂ FREON (113) APĂ Tensiunea superficială (dyne/cm) 23 24 19 73 Principalele etape ale deshidratării la punct critic: 1.câte 10 minute fiecare ---------------------¤ . _______________acetonă________________________ H2O > 30% > 50% > 60% > 70% > 80% > 90% > 100% > CO2 ¤ ------------------. ACOPERIREA CU METALE Toate probele neconductive necesită acoperirea cu un film subţire de material conductiv.7% şi OsO4 1% în tampon fosfat. 363 . proba acţionând în acest caz ca oglindă pentru electroni. fiind mai puţin susceptibil deformărilor datorate evaporării fluidului de tranziţie ce-l va înlocui. fixarea probei cu glutaraldehidă 2. 2. deshidratarea cu acetonă. Această acoperire este necesară pentru eliminarea sau reducerea încărcării electrice ce se instalează rapid la suprafaţa unei probe neconductive la baleierea acesteia de către un flux de electroni de energie înaltă. imersia probei în acetonă în incinta aparatului. având drept rezultat pierderi semnificative de material din probă. 5. În absenţa stratului de acoperire. deoarece prezintă o tensiune superficială foarte scăzută. substituirea acetonei cu CO2 lichid sub presiune – operaţie repetată în funcţie de dimensiunile probelor. 3. 4. eliberarea vaporilor de CO2. Materialul uzual pentru acoperirea probelor este aurul. specimenul poate acumula o încărcătură suficient de mare pentru a decelera fluxul primar. culminând cu înlocuirea completă a apei din ţesut cu acest fluid. 6. specimenele nonconductive examinate la parametri optimi prezintă invariabil fenomenul încărcării electrice ce conduce la distorsionarea imaginii şi la distrucţii termice.Specimenul este trecut prin diferite concentraţii crescătoare ale fluidului intermediar. În situaţii extreme.

vor fi presărate pe suportul adeziv.Când scopul analizei nu este achiziţia unui spectru de raze X. palpi (insecte). surplusul fiind îndepărtat în momentul introducerii în vid pentru metalizare. sporii sau alte probe ce nu pot fi manipulate cu pensa. aşa încât zona de interes să fie expusă direct fasciculului de electroni ce balează proba. Pulberile. Astfel. în timp ce. Orientarea probei pe suport în aceasta fază este foarte importantă. de câteva sute de nanometri. montarea probelor se va realiza sub lupa binocular unde. Acoperirea se realizează prin evaporarea metalului în vid. probe de tipul microfosilelor (foraminifere) sau segmente de aparate bucale. 364 . imaginile fiind preluate în format digital sau clasic pe film. Probele astfel pregătite se introduc în microscop si se examinează la diferite măriri. la capete aplicându-se o tensiune continuă de 1 – 3 kV. precum şi cele cu un conţinut nesemnificativ de apă (frunze uscate) pot fi montate pe suport şi metalizate fără deshidratare. pe baza radiaţiei X (specifică fiecărei specii chimice) generate din probă. ce presupune legarea metalului la polul pozitiv şi a probei la cel negativ. compoziţia chimică a probei analizate atât calitativ cât şi cantitativ. la celelalte probe este obligatorie uscarea la punct critic pentru prevenirea deformărilor datorate unei deshidratări brutale în aer. pot fi aranjate în ordine pe un singur suport. antene. aurul este cel mai utilizat element pentru acoperirea probelor. putându-se realiza chiar hărţi cu distribuţia fiecărui element chimic în zona luată în studiu. Detectorul special al EDX identifică. Probe biologice de tipul insectelor chitinoase. abia apoi realizându-se acoperirea cu metale a acestora. EXAMINAREA DIFERITELOR PROBE IN SEM Probele pentru examinarea în SEM sunt montate pe suporturi conductive din cupru cu ajutorul unor discuri de carbon adezive pe ambele feţe. O anexă importantă a SEM este sistemul de microanaliza elementală cu raze X (EDX). ţinând cont de posibilitatea limitată de înclinare a probei în microscop. dispozitiv instalat într-o incintă ce menţine un nivel de vacuum (10-2 Pa) suficient pentru a asigura o depunere a atomilor de aur într-un strat uniform şi foarte subţire.

....... Nanomanipularea cu ajutorul Microscopului de Forţă Atomică .................................SPM) este o microscopie mecanică ce acoperă câteva tehnici de vizualizare a suprafeţei unui eşantion (morfologia suprafeţei) cu o rezoluţie la nivelul moleculelor sau a grupurilor de atomi...................... Avantajele şi Limitele Microscopiei de Forţă Atomică ..... se poate vizualiza dintr-un eşantion maxim 150 X 150 um dacă rugozitatea în zona scanată este 365 Figura 1.... Ch..... 371 4... Aplicaţii ale Microscopiei de Forţă Atomică ......... dr....X............... Microscopia de Forţă Atomică .. În cazul celor mai performante echipamente SPM disponibile în prezent....... 365 2............. 375 8...... An observation of this dependence between a W-tip and Pt surface by G......... Spectroscopia de Forţă Atomică ................... 374 7................................. Nanolitografie cu Microscopul de Forţă Atomică ..... 1............................................ Binnig......................... 376 Quantum mechanics predicts an exponential dependence of tunneling current with a separate distance between the two electrodes......... Gerber and E................................................................... H..................... 371 5................. MICROSCOPUL DE FORŢĂ ATOMICĂ Microscopia de forţă atomică Conf........................................... Microscopia de Scanare a Probei .............. Ioan Burda Cuprins 1.................... Bibliografie . Rohrer................................ ..................................................................................... Imagine SEM x1000 pentru un cantiliver – tip.... 369 3................... Weibel in 1981 was marked as the invention of STM............... 373 6................... Microscopia de Scanare a Probei Microscopia cu scanarea probei (Scanning Probe Microscopy .............

În funcţie de mecanismul de interacţiune dintre probă (vârf. Cunoaşterea acestor forţe este unui fascicul laser şi a unui fotodetector.mai mică de 10 um. respectiv cu polaritatea acesteia. Cu ajutorul unui astfel de sistem de detecţie este posibilă măsurarea indirectă a forţei dintre tip şi suprafaţa eşantionului studiat.electrice ale scanner-ului piezoelectric depind în ceea mai mare măsura performanţele întregului SPM. tip) şi eşantionul scanat. Pentru a calcula forţa de interacţie utilizăm legea lui Hook (F = kz). se definesc tehnicile SPM. Mai mult. Scanner-ele sunt caracterizate Figura 3. Scanner-ul SPM este realizat din material piezoelectric (PZT) care se expandează şi contractă proporţional cu tensiunea aplicată. vârf cu raza de curbură de circa 3-50 nm. Detecţia deflexiei cu ajutorul deflexie. Y şi Z iar cu ajutorul lui se poate poziţiona proba (tip-ul) cu extremă precizie în 3D (3 Dimensiuni). Acest fascicul laser se reflectă de partea opusă tip-ului (fabricat din Si sau Si3N4) pe un fotodetector sensibil la poziţie (Figura 2). iar z este distanţa pe care cantilever-ul a suferit o Figura 2. Scanner piezoelectric de forma prin sensibilitatea lor (raportul dintre tubulara. cele mai multe sisteme SPM utilizează un fascicol laser pentru a determina deflexia cantilever-ului. Un alt element de bază al unui SPM este scanner-ul piezoelectric. scanner-ul este construit sub forma unui tub (Figura 3) cu electrozi pentru deplasarea pe X. Acest tip este ataşat de o grindă (cantilever) flexibilă. atât cât se extinde sau contractă un material piezoelectric per volt. importantă pentru interpretarea imaginilor SPM sau pentru a determina proprietăţi mecanice locale ale eşantionului. deplasarea nu este 366 . De regulă. astfel încât să poată fi urmărit profilul suprafeţei scanate. Pentru valori mari ale tensiunii. unde k este constanta de elasticitate a cantilever-ului. De performanţele mecan. În prezent. deplasarea pe o direcţie şi tensiunea aplicată pe acea direcţie) adică. Tehnologia SPM are la bază un concept simplu: scanarea unei suprafeţe cu ajutorul unui vârf (tip) foarte ascuţit (sharp. se poate spune că este singurul element puternic limitativ în evoluţia viitoare a microscopiei mecanice. Figura 1).

toate eşantioanele de material de orice tip (inclusiv de natură biologică) pot fi investigate/măsurate cu AFM. o recalibrare frecventă a scanner-ului se impune mai ales în primul an de utilizare. Practic. poate fi obţinută o rezoluţie dincolo de limita de difracţie. Prin utilizarea unei surse cvasi-punctiforme. Efectul final al acestei situaţii este identificat prin rezultate diferite funcţie de direcţia de scanare. Din această cauză. Principiul STM-ului este dat de efectul de tunelare al electronilor între doi electrozi în prezenţa unui câmp electric. • Near-Field Scanning Optical Microscopy (NSOM) utilizează o sursă de lumină de foarte mici dimensiuni ca mecanism de formare a imaginii. Cu toate acestea. magnetice si mecanice. Pe lângă morfologia suprafeţei. Poate cel mai neplăcut lucru legat de scanner este procesul exponenţial de îmbătrânire ce determină o scădere a sensibilităţii în timp. Această diversitate este bazată pe principiul de funcţionare care implică existenţa unui tip (probă) în contact sau foarte apropiat de suprafaţa eşantionului. fiind extrem de utilă în multe domenii de cercetare. AFM-ul a fost dezvoltat în ultimele decenii pentru a măsura o mare varietate de proprietăţi pe suprafaţa eşantionului cum ar fi proprietăţile electrice. 367 . aşa că. • Atomic Force Microscopy (Microscopia de Forţă Atomică) a apărut ca o extensie în utilizarea microscopiei mecanice (1986) pentru eşantioanele nu foarte conductoare. orice interacţiune dintre tip şi suprafaţa eşantionului este măsurabilă. această tehnică a cunoscut o dezvoltare rapidă (în comparaţie cu STM). Desigur că acest efect poate fi limitat prin aplicarea unei tensiuni neliniare pentru scanare (identificată în procesul de calibrare a scanner-ului). Pentru a limita efectele date de procesul de îmbătrânire. cu un diametru mai mic decât lungimea de undă. fabricantul utilizează cel putin 48 de ore scanner-ul înainte de a fi livrat pentru o aplicaţie. Proba (un tip de fibră optică plus o apertură) trebuie să fie foarte aproape de suprafaţa eşantionului.liniară cu tensiunea aplicată şi această dependenţă diferă de la scanner la scanner. Cele mai comune tehnici SPM sunt: • Scanning Tunneling Microscopy (STM) este tehnica SPM de bază care a generat întreg domeniul acoperit azi de microscopia mecanică. Această situaţie experimentală este posibilă în cazul unor suprafeţe conductoare curate (practic fără rugozitate) precum şi în lipsa vibraţiilor ambientale. Pentru a putea măsura efectul de tunelare distanţă dintre cei doi electrozi trebuie să fie de aproximativ 1 nm.

De regulă. sunt necesare eşantioane transparente. • Iluminare/Colectare: Proba este responsabilă atât de iluminare. cum ar fi indicele de refracţie. Tipic. dar intensitatea lumini este scăzuta si dependentă de forma probei. În funcţie de modul de obţinere a imaginii. parcurge o apertură realizată prin acoperirea ei cu metal (cum ar fi Al) şi microfabricată la fel ca o probă AFM. eşantionul poate fi opac. 368 . • Reflexie: lumina care vine prin apertura probei se reflectă pe suprafaţa eşantionului. pentru a menţine o distanţă de lucru dintre probă şi suprafaţa eşantionului. tub fotomultiplicator sau CCD (Charge Coupled Devices). Detecţia semnalului se realizează prin: spectrometru. Rezoluţia imaginii este limitată de dimensiunea aperturii detectorului şi nu de lungimea de undă a luminii incidente. APD (Avalanche Photo Diode). mecanismele de contrast pot fi uşor adaptate pentru studierea diferitelor proprietăţi. topografie. O prima metodă este echivalentă cu cea din cazul AFM. sunt utilizate câteva mecanisme de contrast: polarizare. lumina laserului. birefringenta. Mutarea laterală a tip-ului este denumită “shear-force” feedback. În cazul NSOM. feedback-ul necesar în sistem. iar proba colectează lumina reflectată. indice de refracţie. • Colectare: eşantionul este iluminat dintr-o sursă externă cu arie mare de iluminare. se realizează prin două metode. adică prin intermediul unui cantilever şi a unui sistem de detecţie al deflexiei cu fascicul laser. dependenţa de lungimea de undă şi reflectivitate. fluorescenţă. avem mai multe moduri de operare: • Transmisie: lumina care vine prin apertura probei este transmisă prin eşantion.mai aproape decât lungimea de undă. Dimensiunea punctului de lumină determină rezoluţia maximă ce poate fi obţinută. În acest caz. în cazul unui NSOM avem o rezoluţie laterală de circa 20 nm şi o rezoluţie verticală de 2-5 nm. structura chimică si stress-ul local. şi în acest caz. Această regiune limitată de proba şi eşantion este numită “Near-Field” de unde şi numele acestei microscopii. cât şi de colectarea luminii reflectate. Un al doilea mod este un mod rezonant (tuning fork) şi este monitorizată amplitudinea oscilaţiei când tip-ul se mişcă deasupra suprafeţei eşantionului. prin intermediul unei fibre optice. La fel ca în orice microscopie optică. Pentru a vizualiza imaginile.

tocmai de aceea. precum şi pentru a pune în evidenţă muchiile de pe suprafaţa eşantionului. Se poate. Modul de operare LFM este 369 . dacă eşantionul este special preparat. Relativ la natura forţelor implicate şi interacţiunea dintre tip şi suprafaţa eşantionului definim cele mai importante moduri AFM de operare (clasice): • Contact Mode (modul contact). tip-ul este menţinut (de obicei) la o forţă constantă puternic de respingere. pentru suprafeţe ale eşantionului cu rugozitate scăzuta să se opereze în modul distanţă constantă. Marele avantaj al AFM-ului este capacitatea acestuia de a investiga practic orice tip de suprafaţă inclusiv polimeri. LFM este util în vizualizarea forţelor de frecare pe suprafaţa eşantionului. Capabilitatea de a urmării suprafaţa eşantionului în acest mod este limitată doar de circuitul de feedback. Aceste forţe sunt măsurate indirect prin deflecţia laterală (twist) a cantilever-ului. În acest scop. iar cantilever-ul este mutat în sus sau în jos pe timpul scanării.LFM) măsoară forţele de frecare dintre tip şi suprafaţa eşantionului. Tip-ul este în contact puternic cu suprafaţa eşantionului şi în modul distanţă constantă este posibilă rezoluţia atomică. atracţie) al forţei Van der Waals ca o funcţie de distanţă.2. de asemenea. cantilever-ul este optimizat pentru sensibilitate mare la forţele de frecare laterală. Potentialul Lennard-Jones versus modurile de operare AFM. Potenţialul Lennard-Jones (Figura 4) este un model aproximativ pentru cazul izotropic (repulsie şi Figura 4. Microscopia de Forţă Atomică Microscopia de Forţă Atomică (AFM. Acesta a fost de altfel primul mod de operare AFM implementat ca o adaptare la STM. cantilever-ul este foarte subţire. modificări la situaţii specifice: măsurători in lichide. 1986) a fost dezvoltată ca o soluţie tehnică pentru STM. • Microscopia de Forţă Laterală (Lateral Force Microscopy . materiale compozite. sticle şi materiale biologice. Versatilitatea AFM-ului a dus în timp la o diversitate de moduri de operare şi adaptări. care sunt determinate de neomogenităţile materialului. în medii chimice corozive sau medii biologice termostatate. ceramici. de a măsura prin microscopie mecanică eşantioanele neconductoare.

în aşa fel încât. Detecţia se bazează pe măsurarea diferenţelor de cuplaj cu suprafaţa eşantionului care determină schimbarea frecvenţei de rezonanţă a cantilever-ului şi/sau a amplitudinii de oscilaţie. Phase Imaging este un mod în care sunt culese informaţii despre shift-ul de fază a cantilever-ului aflat în oscilaţie în raport cu semnalul de excitaţie. cantilever-ul este oscilat în apropierea suprafeţei eşantionului.• • • • un mod derivat din modul de operare Contact Mode. Avantajul acestui mod de operare este legat de rezoluţia laterală mai ridicată fără apariţia unor forţe de dragare. ceea ce înseamnă că tip-ul este apropiat de suprafaţa eşantionului. Tapping Mode) este denumirea clasică. Desigur că forţele de interacţiune dintre tip şi suprafaţa eşantionului sunt foarte mici. în fiecare an se adăuga noi moduri de operare sau noi versiuni ale acestora. Acest shift de fază se corelează cu proprietăţi specifice suprafeţei eşantionului (frecare. în acest caz. iar mai recent este denumit DFM (Dynamic Force Mode). forţa-distanţă este măsurată determinând astfel elasticitatea eşantionului. Aceste date pot fi culese simultan cu topografia suprafeţei eşantionului. Tip-ul este oscilat şi pus în regim de respingere. dar părţi ale oscilaţiei sunt extinse în regimul de respingere. cantilever-ul este oscilat îin regim de atracţie. tip-ul intră intermitent în contact cu suprafaţa eşantionului. În acest caz. tipul este în contact constant cu suprafaţa eşantionului. Prin acest mod de operare AFM se pot determina şi compara simultan morfologia şi proprietăţile locale. dar nu este în contact cu aceasta. 370 . Tabelul 1 este departe de a fi complet (doar modurile esenţiale) şi mai mult. vîscoelastice). Acest mod de operare este un mod măsurat simultan cu modurile AC enumerate mai sus. Force Modulation este un mod AFM de operare ce se referă la utilizarea proprietăţilor materialului probei pentru a controla interacţiunea cu suprafaţa eşantionului. NonContact Mode este un concept ce descrie familia modurilor AC (moduri de curent alternativ). Modurile de operare din Microscopia de Forţă Atomică sunt rezumate în Tabelul 1 cu referire la forţa de interacţiune pentru fiecare mod. de ordinul pN. adeziune. Şi în acest mod. iar slop-ul. Contact Intermitent (Dynamic Force.

megapascali) care produce un shift în semnalul Raman corelat cu stresul aplicat. iar deflexia cantilever-ului este monitorizată în funcţie de deplasarea scanner-ului. Limita de măsurare este în domeniul pN. Această metodă este utilă în măsurarea contactului la dimensiune nano (legături atomice. Aceasta tehnică inovativă este combinată cu probe specializate şi este corelată cu intensitatea spectrală (Raman) în timp real pentru a vizualiza legăturile chimice. Mod de Operare contact mode non-contact mode intermittent contact mode lateral force mode magnetic force thermal scanning Forţa de Interacţie puternic de respingere – forţa constantă sau distanţa constantă slabă de atracţie . În această metodă. Spectroscopia de Forţă Atomică O altă aplicaţie majoră AFM este Spectroscopia de Forţă Atomică (FS.1 nm. tip-ul este împins în faţă şi apoi retras de la suprafaţa eşantionului. forţe Casimir) cum ar fi forţa de rupere a moleculelor de suprafaţa eşantionului. această tehnică experimentală a devenit în timp cea mai utilizată tehnică în studierea macromoleculelor sau 371 . 3.vibrarea probei puternică de respingere . O altă metodă modernă de investigare mediată de AFM este nanoidentarea (nanoidentation). forţe Van der Waals. Spectroscopia de Forţă Atomică poate fi implementată ca şi deflexie statică sau mai recent în mod dinamic. AFM-ul poate aplica un stres mecanic controlat pe suprafaţa eşantionului (raza de curbură a tip-ului este de câţiva nm aşa că P = F/A determină presiuni ridicate. Force Spectroscopy) şi se referă la măsurarea directă a interacţiunii dintre tip şi suprafaţa eşantionului în funcţie de distanţa de separare.Tabelul 1. situaţie în care cantilever-ul este vibrat (metoda AC). iar distanţa pe axa Z este mai bună de 0. 4.vibrarea probei forţele de frecare exercită o torsiune a cantileverului folosit în scanare câmpul magnetic de la suprafaţa eşantionului poate fi vizualizat distribuţia conductivităţii termice pe suprafaţa eşantionului este vizualizată. Aplicaţii ale Microscopiei de Forţă Atomică Datorită faptului că AFM-ul poate investiga practic orice tip de material fără o preparare specială a eşantionului.

încât multe din articolele ştiinţifice de ieri au devenit azi automatizare. cromozomi. calitatea tip-ului. reţele de difracţie. Modul contact este o bună alegere pentru suprafeţele dure. dar nu este o alegere potrivită pentru suprafeţele moi. Murdăria şi efectele de capilaritate induse de apa de pe suprafaţa eşantionului vor avea un rol dominat si. este importantă cunoaşterea formei tip-ului (geometria acestuia) pentru o interpretare corectă a imaginilor obţinute. Acest lucru nu este posibil în cazul AFM şi este limitat atât fizic (Van der Waals). Calibrarea automată tridimensională a uşurat mult munca operatorului. precum şi în studierea unor nanostructuri (suprafaţa polimerilor. Performanţele unui AFM sunt limitate de un număr de factori dintre care amintim: capacitatea elementelor mecanice de a muta tip-ul cu precizie şi de a măsura poziţia acestuia. Modurile AC (cu vibrarea probei) sau intermitente au fost imaginate pentru a investiga suprafaţa unor eşantioane biologice. dar va deforma mai puţin sau deloc eşantioanele moi. este frecvent utilizată în studierea suprafeţelor în industria electronică (Silicon wafers. cât şi tehnologic prin limita de ascuţire a tip-ului. imaginea obţinută este practic convoluţia dintre forma tip-ului şi morfologia locală. vor degrada calitatea imaginii obţinute. de exemplu. Modul de lucru AFM trebuie ales în funcţie de caracteristicile ce prezintă interes în investigare. În aceste situaţii. ¾ Restaurarea Imaginii (Deconvoluţia Probei). liniaritatea scanner-ului şi vibraţiile ambientale. De asemenea. precum şi de natura suprafeţei eşantionului. ceea ce vedem într-o imagine AFM este mai degrabă o imagine mediată a morfologiei suprafeţei eşantionului. Reţinem din aceste timpuri istorice câteva distorsiuni induse de forma tip-ului care merită înţelese. ADN.eşantioanelor biologice (proteine. deoarece poate produce o contaminare a tip-ului sau poate îndepărta material de pe suprafaţa eşantionului. ¾ Distorsiuni ale imaginii induse de probă. răşini naturale). bacterii). Vizualizarea cu AFM a suprafeţelor pentru eşantioane cu relief înalt implică utilizarea unui 372 . în final. Marii producători de echipamente de microscopie mecanicp au reuşit în ultimul timp să elimine o mare parte din limitările anterioare prin îmbunătăţirea componentelor mecanice şi electronice. circuite integrate). medii de stocare a datelor. în general. ceramici. Dacă alegem un contact apropiat atunci AFM-ul va deveni foarte sensibil la zgomote (vibraţii) externe. Aşa că. La rezoluţii ridicate. Pentru a vizualiza atomi sau molecule este necesar ca interacţiunea să fie numai între tip şi atomul/molecula cea mai apropiată (acest lucru se poate realiza pentru rezoluţia atomică numai în tehnologia STM).

această tehnică de utilizare a unui AFM este utilizată (nu foarte frecvent) în realizarea de circuite integrate (nanocircuite) sau de sisteme nanoelectromecanice (NEMS). În aceste situaţii. litografie AFM (5 um). se pot vedea câteva exemple clasice de nanolitografie. • Atomic Force Microscopic Nanolithography (AFMN) este o metodă de pattering pe o suprafaţă chimică-mecanică pentru AFM. 373 . Nanolitografie vectorială de la procedeu (a) la rezultat (b). În prezent. 5. De exemplu. atomi individuali pot fi manipulaţi prin utilizarea tip-ului unui STM. În caz contrar. aşa că. ceea ce vedem poate fi imaginea tip-ului reflectată de suprafaţă. trebuie să apelam la metode matematice pentru a restaura imaginea (deconvoluţie). Dip-Pen Nanolithography (DPN) a fost prima metodă SPL disponibilă comercial pentru AFM. o descriere sumară a principalelor tehnici este utilă: • Scanning Probe Lithography (SPL) este o unealtă/tehnologie promiţătoare pentru realizarea de pattering la scală nano. Nanolitografia nu se rezumă la utilizarea AFM. Trebuie menţionat că pe lângă nanolitografia de scanare a mai fost dezvoltată în ultimul timp şi litografia vectorială.tip foarte ascuţit. În figura 5. Metoda efectivă de deconvoluţie depinde de caracteristicile suprafeţei eşantionului şi de geometria tip-ului (un subiect frecvent prezent în literatura ştiinţifică). Figura 5. Patter-ul poate fi creat manual sau automat. Nanolitografie cu Microscopul de Forţă Atomică Nanolitografia se referă la fabricarea de structuri nanometrice mai mici de 100 nm.

Trebuie menţionat că AFM-ul poate fi utilizat ca un robot 3D (manipulator 3D) care are spaţiul de lucru la scală nano. Nanomanipularea unor particule de latex cu diametrul de 100 nm. nanomanipularea poate deveni o operaţie relativ uşor de realizat. Figura 6.6. pattern-ul poate fi realizat manual sau automat. Nanomanipularea cu ajutorul Microscopului de Forţă Atomică Diverse structuri nanometrice. Un alt exemplu de nanomaipulare este prezentat în figura 7 a unor particule de latex cu diametrul de 100 nm într-o structură complicată. Prin utilizarea AFM-ului ca sistem nanorobotic. prin utilizarea unei interfeţe haptic şi a unei aplicaţii de realitate îmbunătăţită. Figura 7. implicate în manipularea lor. pot fi manipulate pentru a realiza circuite electrice sau pentru a măsura proprietăţile lor mecanice. cum ar fi nanotuburi şi nanofire care sunt pe suprafaţa unui eşantion. sau mai recent. Un exemplu de nanomanipulare a unor particule de aur (nano cuburi) cu diametrul de 100 nm pe o suprafaţă de sticlă se poate vedea în figura 6. 374 . După cum am menţionat. Nanomanipularea unor nano cuburi de aur pe o suprafaţă de sticlă.

Elucidarea acestor situaţii nu se poate face decât prin experienţe de nanomanipulare a ADN-ului. Avantajele şi Limitele Microscopiei de Forţă Atomică La fel ca orice alt echipament. iar altele ca un izolator. Mai mult.6 nm) care se repetă. În acelaşi timp. în ultimul timp. respectiv a avantajelor.4 nm şi este în esenţă o structură scurtă (3. Cunoaşterea acestor limite. După aproximativ 15 ani de controverse relativ la mecanismul de conducţie (transfer de sarcină) este acum bine demonstrată dependenţa de distanţă (tunelarea într-un singur pas sau hopping termic mai mulţi paşi). în cazul AFM avem un profil 3D. hopping termal) au fost studiate şi verificate indirect experimental. Figura 8. pentru aplicaţii în nanotehnologie.AFM-ul ca nano robot este extrem de util în nanomaipularea unor celule sau molecule. Microscopul de Forţă Atomică are în aceeaşi măsură avantaje şi limite. 7. eşantionul nu necesită un tratament special (acoperirea cu metal sau carbon) care poate compro375 . unele rezultate sugerează că avem un bun conductor (chiar supraconductor la temperaturi joase). în literatura de specialitate ADN-ul rămâne pentru moment un subiect neelucidat. cum ar fi realizarea unor circuite electronice (motivată de studierea proprietăţilor electrice). Aceste molecule cunoscute de mai mult de o jumătate de secol au atras atenţia. Microscopia concurenta SPM (AFM) este SEM (Scanning Electron Microscopy) dar spre deosebire de SEM unde avem o proiecţie 2D sau mai exact o imagine 2D pentru eşantion. Ambele mecanisme (tunelarea sarcinii. alte rezultate îl prezintă ca fiind un semiconductor. Nanomanipularea ADN-ului pe o placă de polycarbonat (aria de scanare este de 5 um). Molecula de AND are un diametru de circa 2. un exemplu este prezentat în figura 8. în special nanomanipularea moleculelor ADN. este importantă în luarea unei decizii corecte înainte de a apela la acest echipament pentru investigarea unui eşantion.

La fel ca şi în orice altă tehnică bazată pe realizarea de imagini este posibilă apariţia de artefacte care pot fi induse de tip-ul instabil sau mediul ambiental impropriu sau chiar de eşantionul studiat. în unele situaţii. Peter (2001). Un alt avantaj este posibilitatea de a investiga eşantionul în condiţii ambientale. Hoffmann. Minko. Aceste limitări sunt un subiect fierbinte în cercetarea instrumentală din acest domeniu şi câteva succese au fost obţinute prin utilizarea în paralel a mai multor cantilevere sau. Ralph A. lucru foarte important pentru eşantioanele biologice. Aceste limitări au fost eliminate în cazul microscoapelor AFM moderne prin scannere în bucla închisă sau scanner-e ortogonale. Journal of the American Chemical Society 127 (45): 15688–9 Zhong. eşantionul. mai recent. asigurând în principiu o rezoluţie mai bună decât SEM. drift-ul termic poate induce distorsiuni pe imagine. Bibliografie 1. Franz J. Imaginile obţinute cu AFM pot fi. Este. această post-filtrare poate elimina unele caracteristici ale eşantionului. Din păcate. Proceedings of the Royal Society a Mathematical Physical and Engineering Sciences 457: 1161. Datorită faptului că timpul de scanare în cazul AFM-ului este mare.mite. M. "Fractured polymer/silica fiber surface studied by tapping mode atomic force microscopy". de asemenea. Y. Surface Science Letters 290: L688. comparabilă cu rezoluţia unui TEM (Transmission Electron Microscopy).Z care necesită refacerea în software a imaginii. bine cunoscută limitarea puternică indusă de existent pe eşantion a unor pereţi drepţi sau şanţuri foarte adânci şi înguste a căror morfologie nu poate fi pusă în evidenţă decât prin utilizarea unor tip-uri speciale şi extrem de scumpe. 4. S (Nov 2005). distorsionate de efectul de hysteresis al materialului piezoelectric. cu posibilitatea de scanare simultană a unor arii diferite. de asemenea. toate acestea la o viteză mult mai mare. AFM cu rata de scanare video. 2. Ahmet Oral. 8. Marele dezavantaj al AFM faţă de SEM se referă la aria scanată. care în cazul SEM este de ordinul milimetrilor. precum şi de efectele de mixare între axele X. Q (1993). "AFM single molecule experiments at the solid-liquid interface: în situ conformation of adsorbed flexible polyelectrolyte chains". Reviews of Modern Physics 75: 949. 3. Roiter. făcând lipsită de precizie măsurarea unor structuri. "Advances în atomic force microscopy". G. Giessibl. 376 .Y. (2003). "Direct measurement of interatomic force gradients using an ultra-low-amplitude atomic force microscope".

Goolsby. M. Proceedings of the 2001 1st IEEE Conference on Nanotechnology 10.5. N. Salam. Xi. "Neutral particle lithography: a simple solution to charge-related artefacts în ion beam proximity printing". 377 . Phys. Ayres. Fung. F.M. "Chemomechanical surface patterning and functionalization of silicon surfaces using an atomic force microscope". Yu. V.Saglik and D. May. Appl. V. Davis et al. 82 (5): 808–810. D: Appl. Taiwan. V. 41 (2008) 024007 (12pp) 7. Review of Scientific Instruments (USA: AIP) 69 (9): 3268–3276. 8. October. 9. 2000. 6. C. 2003. (2003). Proceeding of the 2003 IEEE International Conference on Robotics and Automation. "Automatic lateral calibration of tunneling microscope scanners". Proceedings of International Symposium on Smart Structures and Microsystems. F. W. J C Wolfe and B P Craver. Phys. Xi. H. Lett. J. G. M. H. Wang. 3-D nanomanipulation using atomic force microscopy. Lapshin (1998). R. R.Y. K. Hummert. B. Ayres. Hong Kong. Salam. Phys. Ning Xi “Micro/Nano Motion Control for Biological Specimen Handling”. “SPM-Based Investigation of Site Specific Biological Interactions”. Li. N.Gilgenbach. K.

Microscopia de forţă atomică – partea a II-a Conf......... Dintre acestea.......................393 1.....................378 2.............. în microscopia modernă prelevate odată cu informaţia topografică............... Optical microscope Scanning electron microscope Electron scattering Transmission electron microscope Electron absorption Atomic force microscope Forces of probe-sample interaction 1Å-200 μm 0...................................................386 4........ Tehnici Experimentale ......................................................................Scanning Probe Microscopy ......................... dr..... Ioan Burda Cuprins 1............................ Bibliografie .............. scattering etc) or fluorescence 200nm – 1mm 500nm – 10 mm 1nm-10 mm 1Å-100μm What is studied Complicated sample preparation optical slice optional 10 nm-1 mm limited by ultratome (10 nm-1 μm) surface real thin slice necessary necessary surface optional 378 .................5Å-20 μm Mechanism of contrast formation Range in XY Range in Z Light absorption (diffraction............... Implementarea Noilor Tehnologii.... Tabel 1...........Scanning Probe Microscopy Introducere.. Bibliografie ............ Tehnici Experimentale ................ în primul rând merită remarcată informaţia 3D reală a topologiei suprafeţei dublată de măsurarea unor mărimi fizice pe suprafaţă.............. de regulă............385 3... polarization......... O evaluare obiectivă a tehnicilor microscopice (Tabelul 1) pune în evidenţă elemente de performanţă favorabile pentru SPM (Scanning Probe Microscopy)..........

acest lucru nu este posibil datorită lipsei de rigiditate a acestora. Merită să reţinem că detectorul este mecanic şi de asemenea. Performanţa sistemului de control şi achiziţie este esenţială în performanţa finală a SPM-ului. ne obligă să apelăm la o preparare complexă a eşantioanelor. nu ne putem aştepta să vedem diferite domenii în moleculele de proteină. Viteza de scanare depinde de caracteristicile mecanice ale scanner-ului şi tot de calităţile mecanice ale acestuia depinde şi aria maximă ce poate fi scanată. Aşa că. Consecinţa acestei situaţii se reflectă în performanţa finală a experimentelor în care apelăm la un SPM şi putem spune că în mare măsură performanţa este dependentă de iscusinţa experimentatorului. Sistemul optic nu are alt rol decât de a măsura deflexia cantileverului. Scaning Probe Microscope. La o extremă. Fasciculul este poziţionat în centrul unui foto-detector cu patru cadrane (fotodiodă). …).1. un fir de păr) este suficient de potrivit dacă nu are o rugozitate comparabilă cu capacitatea de deplasare a scanner-ului pe direcţia Z (perpendicular pe eşantion). să reţinem că acest detector mecanic este capabil să pună în evidenţă atomii. subsistem pentru (din construcţie). Tehnica experimentală la nivel de detecţie a interacţiunii dintre un tip (sondă) şi eşantion se bazează pe un cantilever. respectiv amplitudinea de oscilaţie sau fază. dar nu poate elimina limitările mecanice Figura 1. nici limitădetectia inneractiuni sonda (tip) si esantion. orice material (de exemplu. Obţinerea unor imagini unice în conţinut si performanţă. 379 . Digital Anolog Converter DAC) cantilever şi sondă (tip). nu de puţine ori. dar în cazul unor eşantioane biologice (molecule). temperatură scăzută. respectiv apelarea la instrumente SPM complexe (izolare la vibraţii avansată. În condiţii experimentale adecvate.1) de un sistem opto-electronic bazat pe reflexia unui fascicul laser pe cantilever. mari schimbări de conformaţie (myosin) sau forme spiralate ale moleculelor DNA.Dacă ne referim la modul de preparare a probelor pentru SPM. Rezoluţia sistemului este asigurată de sistemul de control (electronic. SPM-urile moderne pot pune în evidenţă un singur atom. Mărimea specifică de interes într-o situaţie particulară este detectată (Figura 1. atmosferă controlată. atunci cuvântul „optional” nu sugerează întotdeauna ceva facil.

Treponema Pallidum (Tp) antigens). cum ar fi: AFM plus microscopie laser confocală. Informaţiile care se pot obţine pe diferite sisteme de studiu cu ajutorul unui SPM. cu o mai Figura 1. Latice HPOG (stanga) grafia moleculară. respectiv imagine 3D.rile induse de proprietăţile materialelor folosite la construcţia SPM-ului. performanţa unei tehnici experimentale sau a unui echipament modern este complet definită de imaginea obţinută pentru un eşantion dat. Tocmai de aceea. Tehnologia experimentală actuală se bazează masiv pe conceptul de imagine. SPM poate include în platforma sa tehnici optice în special în cazul AFM. Această situaţie este produsul unei lungi evoluţii a tehnologiilor de laborator şi asigură maximul de informaţie posibil în acest moment. imagini SNOM. DNA (sus).3. imaginea celulelor. în general. Virus Ebola. Bacterii (Anabaena Variabils. moleculare. o imagine mai bună este echivalentă cu mai multă informaţie. după cum rezultă din Tabelul 1. acestea fiind parte din limitele fizice ale unui SPM. Helicobacter Pilory). 380 . Specific şi unic în cazul SPM este capacitatea acestuia de a pune în evidenţă topoFigura 1.2. sau imagine şi spectroscopie Raman. Proteine (Seleno Protein. interacţiunile respective latice MoTe2. nu pot fi considerate complementare cu alte tehnici experimentale. reconstrucţia 3D şi nanomanipularea.

capacitatea de nanomanipulare simultană a acestor eşantioane asigură premisele unui nano laborator într-un singur echipament. exemple cu ceea ce poate „vedea” un SPM (Figura 1. baza funcţionării SPM-ului. În acest sens.4. adică toate mărimile fizice istorice se regăsesc în final în calitatea imaginii. două situaţii distincte pot fi observate în interacţiunea dintre sondă (tip) şi eşantionul studiat: a) nu există o adeziune la suprafaţa eşantionului. Interacţiunea dintre sondă (tip) şi eşantion. dat fiind interesul crescut pentru biologie şi biotehnologii. După cum se poate vedea în Figura 1. Lărgirea platformei cu elemente specifice microscopiei optice.y).3). De mare interes sunt imaginile ce pot fi obţinute pe eşantioane biologice. SPM-ul a fost primul echipament (STM) care a pus în evidenţă atomii şi acest lucru este posibil fără echipamente complexe pe eşantioane cu rugozitate scăzută (monostrat atomic). sunt prezentate în continuare. Într-o măsurătoare locală. este exploatată şi în spectroscopia locală de distanţă. cu o mai bună liniaritate în sistemul de măsură. În acest sens. cu un mai bun raport semnal zgomot.bună calitate. într-o poziţie dată (x. este pusă în evidenţă o adeziune. respectiv HOPG. eşantionului. b) între sondă şi suprafaţa Figura 1. 381 . SPM are un rol bine definit prin capacitatea sa unică de a putea asigura o rezoluţie ridicată pentru eşantioane superficial pregătite (Figura 1.2 se poate vedea la rezoluţie atomică o latice de MoTe2. prin imagini. Nu exista adesiune (jos). adesiune intre sonda si suprafta esantionului.3).4. În Figura 1. SNOM şi spectroscopiei Raman întregeşte această tehnică modernă. este uşor de pus în evidenţă curba forţă– distanţă atunci când o legătură specifică apare. De asemenea.

este cel mai recent echipament şi singurul 382 . generând astfel un nou şi performant echipament în acest domeniu. se poate imagina un sistem de recunoaştere moleculară. acizi nucleici) a unui vârf AFM a deschis o cale promiţătoare pentru recunoaşterea unor molecule particulare. Sistemul NTegra produs de NT-MDT Inc. depind în mod esenţial de experienţa utilizatorului. Toate aceste rezultate au fost obţinute prin observarea unor probe corespunzător preparate pe suprafeţe substrat şi nu în condiţii fiziologice. Progresele recente privind rezoluţia spaţială a tehnologiei AFM au făcut din obţinerea unor imagini topografice a unei singure proteine o operaţiune de rutină. În general. În Figura 1. plecând de la tăria adeziunii pentru o situaţie dată. b) acest lucru este dificil şi în cazul unei topologii moleculare. Deoarece interacţiunea dintre liganzi şi receptori este foarte specifică. S-a dovedit că receptori independenţi pot fi recunoscuţi de un vârf AFM funcţionalizat cu anticorpi. în final. avem câteva reguli generale. cum sunt receptorii. tuia. din Figura 1. Sunt încă dificil de recunoscut proteine specifice. Platforma Integrată pentru Nanotehnologii combină toate tehnologiile cunoscute în Scanning Probe Microscopy (SPM) într-un singur produs. Discriminarea unor receptori pe suprafaţa unei perspectiva utilizării acescelule.Bazat pe observaţia anterioară. cum ar fi: a) celula este un sistem prea labil pentru a putea observa o singură proteină pe suprafaţa ei.5. are multe elemente particulare care. tehnica funcţionalizării cu anumite biomolecule (proteine. glicani. Tehnica sondă-ligant şi analiza unei situaţii particulare prin intermediul curbelor locale forţă – distanţă sunt de mare folos în diferite experimente de recunoaştere a proteinelor. numai pe baza acestor informaţii topografice.5 este reprezentat schematic un astfel de experiment care printr-o tehnică specifică permite discriminarea unor receptori pe suprafaţa unei celule. fiecare experiment în care este implicat SPM – ul. printr-o tehnică de cartare a forţei. sonda funcţionalizată (molecula ligant) interacţionează cu un eşantion biologic special preparat. proteoglicani. Cu toate acestea.

de la achiziţia de imagine la arhivarea acesteia. Nu în ultimul rând. astfel încât. Toate sistemele integrate în platforma NTegra utilizează acelaşi suport electronic şi acelaşi program. Sistemul NTegra se prezintă utilizatorului ca fiind o soluţie completă pentru cercetare. Acest concept este sugerat şi prin numele echipamentului format din grupul de litere cheie NT care sunt prescurtarea de la NanoTechnology şi un al doilea grup de litere cheie care sunt prescurtarea de la intEGRA. 383 .7). acesta este uşor de înţeles şi utilizat. care înseamnă perfect. Subsitem scanner integrat le (scratching.pe plan mondial care poate fi încadrat în conceptul de NanoLaborator. Laboratorul de Nanotehnologii Fizice are în dotare un sistem NTegra Vita care integrează două microscoape optice performante. chiar dacă sistemul este foarte complex. Sitemul nând simplitatea utilizării cu facilităţile oferite. Programul NOVA (NT-MDT) controlează întreaga platformă. industrie şi nanotehnologie.6) a fost special proiectat pentru a permite înglobarea unor tehnici de analiză ştiinţifică (spectroscopie si/sau prepararea probelor) pe lângă cele specifice SPM. îmbiFigura 1. Programul de aplicaţie înglobează lunga experienţă NT-MDT Inc.7.6. in microscopul optic. pentru litografie. inclusiv procesarea de imagine 3D. Ntegra. În acest moment. current).Vita. măsurarea caracteristicilor probei şi generarea automată de rapoarte. cu posibilitatea schimbării acestuia pe durata măsurătorilor). un sistem SPM şi un controler de temperatură pentru măsurarea probelor biologice în aer sau lichid (inclusiv în mediul de cultură. Aproape toate setările sistemului sunt controlate de programul NOVA. doar prin program (mouse . în producerea de echipamente şi programe pentru nanotehnologii. Rezultatul acestui concept permite reconfigurarea sistemului pentru orice aplicaţie particulară (Figura 1. Sistemul NTegra (Figura 1.click). trebuie menţionate metodele avansate de litografie disponibiFigura 1.

Kelvin Probe Microscopy. realizarea unor extensii sau automatizarea unor secvenţe de genul măsurare. Electrostatic Force Microscopy. facilităţi de generare automată de imagini sau mai mult. procesare imagine şi generare de rapoarte.01 ˚ C in air only Sample size in air in liquid Scan Range Temperature control (for operation in fluid environment ) Range Stability O pagină help bine documentată cu descrierea funcţiilor de bază şi câteva exemple de utilizare asigură accesul utilizatorului la semnale de bază din sistem. Tabel 2 SPM methods in air and liquid AFM(contact. AFM Lithography (scratching).programul NOVA are aplicaţii. programul poate fi extins pentru orice aplicaţie utilizator fără a fi nevoie de cunoştinţe de programare avansată.5 mm and by probe up to 15x15x3 mm 100x100x10 μm up to 200x200x20 μm in DualScan mode from RT to 60˚ C +/. utilizăm intensiv facilitatea open software a programului NOVA care permite. pot fi preluate imagini „gray level” şi transpuse pe suprafaţa de investigat. Spreading Resistance Imaging.005˚ C (typically).0. Scanning Capacitance Microscopy. 384 . cât şi unele performanţe ale sistemului NTegra Vita sunt enumerate in Tabelul 2. Metodele de bază SPM. Ntegra Vita are facilitaţi de excepţie pentru investigarea de probe biologice cum ar fi: incinte închise/deschise stabile chimic care pot opera cu discuri Petri. semi-contact.0. prin Vbscript. Lithography: AFM (current). În acest fel. Force Modulation. 15 mm in height by probe by sample up to 14x14x2. 15 mm in height and Φ 100mm . AFI(Adhesion Force Imaging). Phase Imaging. sau între experimente. diverse tipuri de încălzitoare pentru lichid şi măsurarea probelor biologice cu schimbarea lichidului cu flux controlat pe parcursul experimentului. Forces-Distance Curves STM/MFM (Magnetic Force Microscopy). STM by sample Φ 40 mm. <= +/. controlul temperaturii pentru lichide. non-contact). LFM (Lateral Force Microscopy). În proiectele noastre.

Hench LL. 394. 451. Virtual reality and haptics for nanorobotics. Drexler KE. Peng L. Strick TR. 124-126. Ye M. Revyakin A. Nanomanipulation by atomic force microscopy. Tan Z. 295. IEEE Robot Autom Mag. Stem cells and tissue engineering: past. 23. Heckl WM. Single-molecule cut-and-paste surface assembly. 38. Molecular nanomachines: physical principles and implementation strategies. Misevic GN. 377-405. 10. 13. An H. Recent progress in AFM molecular recognition studies. Nature. 2. Liu Y. 7. Hu J. Rubio-Sierra FJ. 2007. Nanodissection. Lu J. Maye MM. Nature. Polak JM. Dufrene YF. 1010-1013. Sun L. 8. Adv Eng Mater. and differentiation of bone marrow mesenchymal stem cells. 15. Gang O. Popescu O. Polak JM. New Jersey.Eur J Physiol. J Mater Chem. Positioning scission of single DNA molecules with nonspecific endonuclease based on nanomanipulation. Design and self-assembly of two-dimensional DNA crystals. Dammer U. 1014-1017. Zhang M. Ferreira A. 456. 549-552. Science. 193-196. Yan SH. 19. Molecular self-assembly and nanomanipulation . van der Lelie D. 2008. Li B. 237-245. Bonin K. Song Y. A combined atomic force/fluorescence microscopy technique to select apatamers in a single cycle from a small pool of random oligonucleotides. Lu JH. Li H. Li MQ. Hards A. 372-381. Hinterdorfer P. 352–366. Brauchle C. Manipulation. Golden handshake. 129.2. Li M. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Kufer SK. 451. Wang L. Wenzler LA. Ann Rev Biophys Biomol Struct. 1994. Anselmetti D. 7. Liedl T. 2005. 6668-6669. DNA-guided crystallization of colloidal nanoparticles. Gaub HE. Nanomanipulation of single DNA molecules and its applications. Liu Z. and future. 2004. Guntherodt HJ. Ebright RH. Wei G. Hu J. J Am Chem Soc. 1068. Science. 14. 78-92. 4. Xu X. 2008. 998-1004. 2002. Simultaneous AFM manipulation and fluorescence imaging of single DNA strands. 69. 534-540. 127-138. 2005. 17. Zhang Y. Bionanotechnology: lessons from nature. Nykypanchuk D. 6. 13. 2006..two key technologies in nanoscience and templating. Tang R. 2006. Li B. 21. 1998. 539-544. Surf Interface Anal. 70. Chem Phys Chem. Heckl WM. Science. Effect of crystallinity of calcium phosphate nanoparticles on adhesion. Gumpp H. Surf Interface Anal. 1995. Li Z. Hu Q. isolation. Microsc Res Tech. Inc. and PCR amplification of single DNA molecules. Binding strength between cell adhesion proteoglycans measured by atomic force microscopy. Guthold M. Li MQ. Wang Y. Hu J. Wagner P. Seeman NC. Zhang Y. Bishop AE. and lithography using modified tapping mode atomic force microscope. Zhang Y. 2. Pflugers Arch . 2007. 12. 267. 20. Cai Y. 385 . Li X. 2004. Crocker JC. Winfree E. Third-generation biomedical materials. 2006. 5. present. 843-847. 2008. Ann NY Acad Sci. Stephens BJ. 1173-1175. 2007. Mavroidis C. Hoboken. 18. Zhou C. Goodsell DS. Zumbusch A. Adv Eng Mater. 11. Bibliografie 1. Wiley-Liss. 2006. 2008. proliferation. 2005. 319. 3. Nature. Nat Methods. Microsc Res Tech. Tao J. 36. 6. Liu F. Puchner EM. Seitz M. 2004. Stark RW. Hartmann U. 16. 6. 9. Gao HB. Cubicciotti R. 4690-4698. 17. Pan H. 528-529. 594-596. dissection.

unde prin haptic înţelegem ştiinţa pipăitului. Aceste dispozitive bazate pe interfaţa haptica prezintă o mare oportunitate în dezvoltarea unor aplicaţii generic asistative care să permită manipularea nano-obiectelor precum şi imersia totală în realitatea virtuală a utilizatorului. utilizatorul primeşte informaţii despre forţe sau coliziuni ale mâinilor sale. spre deosebire de alte modalităţi de interacţiune: percepţia vizuală. Când este utilizat un astfel de sistem. Implementarea Noilor Tehnologii Introducere. O problemă majoră legată de sistemul tactil uman constă în faptul că nu este foarte bine cunoscut. simţim lucruri interesante cu ajutorul mâinilor. privim comportamentul lucrurilor care se mişcă sau se schimbă. Când noi suntem prezenţi undeva. putem lua lucrurile pentru a le rearanja şi putem interacţiona cu acestea pentru a vedea răspunsul lor.3. Studiul abilitaţilor tactile umane este o încercare recentă şi multe din sistemele disponibile astăzi nu incorporează cunoştinţe din domeniile psihofizicii. Deoarece cercetările iniţiale au fost promiţătoare. Mişcarea naturală a capului sau mâinilor poate fi utilizată pentru a investiga şi modifica suprafaţa care este afişata la scala cercetătorului. noi vom avea mult de învăţat despre lumea la scală 386 . acestea au generat o adevărata competiţie în încercarea de a dezvolta o interfaţă haptică naturală. Aceste maşini sunt denumite interfeţe haptice. În acelaşi timp. vorbirea sau sistemul motor. Această metodă va asigura cercetătorului posibilitatea de a se concentra pe investigarea suprafeţei şi proprietarilor asociate şi nu asupra programării unei interfeţe. biomecanicii şi elemente neurologice ale percepţiei haptice. Dezvoltarea unor interfeţe şi dispozitive haptice moderne necesită studii extensive pentru a înţelege legătura dintre fenomenele perceptuale şi măsurătorile biologice. privim în jurul nostru. privim către lucruri din diverse unghiuri. Sistemul de control va translata mişcarea uneltei în mişcarea sondei SPM-ului şi va translata parametrii măsuraţi ai suprafeţei sub forma unei forţe aplicate uneltei simultan cu informaţii vizuale şi/sau audio despre parametrii suprafeţei. intuitive şi a unui feedback senzorial multi-modal a determinat proiectarea unor maşini care asigură utilizatorului generarea unor comenzi prin mişcarea mâinilor. Nevoia unei interacţiuni om-maşină naturale. cercetătorul percepe că poate interacţiona direct cu suprafaţa de investigat. urmată de încorporarea acestor cunoştinţe în ingineria interfeţelor haptice. Motivare. În viitorul apropiat. pentru a crea acestuia o percepţie naturală. Interfaţa ideală dintre om şi SPM trebuie să prezinte utilizatorului suprafaţa investigată ca o reprezentare 3D mărită pe care să o poată pipăi şi care să poată fi modificată cu ajutorul unor unelte controlate de mână.

Sistemul de Nanomanipulare. oferind cercetătorului posibilitatea de a fi virtual în dimensiune nano. inclusiv despre modul cum proprietăţile mecanice.nano. oferindu-ne posibilitatea de a investiga individual nano-obiecte cu facilitaţi de excepţie obţinute prin combinarea caracteristicilor unor proprietăţi fizice cu informaţiile structurale. Scopul unei interfeţe SPIDAR este de a asigura cercetătorului imersia virtuală în lumea la scală nano. Nanomanipulatorul este obţinut prin integrarea unui microscop de scanare a probei împreună cu controller-ul. precum şi un control natural al funcţiilor acestuia.1) cu feedback de forţă împreună cu controller-ul şi o reţea de calculatoare PC cu facilităţi grafice avansate. Acest cluster local format din cel puţin trei calculatoare comunică printr-o reţea IP. un dispozitiv SPIDAR (Space Interface Devices for Artificial Reality. transportul de sarcină şi dinamica acestor proprietăţi sunt afectate de structura la scală atomică a nano-obiectelor. Interfaţa utilizator avansată va juca un rol crucial prin modul transparent de a experimenta la scală nano. Prin combinarea unui SPM cu o interfaţă de realitate virtuală asigurăm o afişare intuitivă a datelor produse de instrument. Beneficiile unei asemenea tehnologii sunt: 387 . Figura 3. Interfaţa SPIDAR. Nanomanipularea dă o semnificaţie aparte acestor probleme. precum şi legat de interfaţa cu obiectele la scală nano. Figura 3. Semnificaţia interfeţei de realitate virtuală a SPM-ului este aceea de a simula prezenţa cercetătorului pe suprafaţa de investigat.1.

pe măsura ce se colectează datele. SPM-ul poate colecta multe alte date despre parametrii fizici specifici eşantionului. În acest caz. Multe experimente au fost realizate prin controlul preprogramat sau în buclă deschisă a probei SPM-ului. într-un mod nerealist. transmisia laser a diverse lungimi de undă şi polarizări (NFOM – near field optical microscopy).a) îmbunătăţirea percepţiei structurilor 3D. Interfaţa SPIDAR. forţe laterale şi de adeziune (AFM). Câţiva dintre aceşti parametri sunt reprezentaţi natural pe canalele vizuale ca informaţie de culoare sau înălţime. proprietăţi magnetice (MFM – magnetic force microscopy). 388 . dar această afişare nu permite cercetătorului să vadă corelarea dintre aceste informaţii şi topografia suprafeţei. dar într-o manieră utilă. Pentru vizualizarea ştiinţifică. Figura 3.1. Acestea includ măsurători de conductanţă şi măsurarea de curbe curent/distanţă (STM). Microscopul de scanare a probei (SPM) este un instrument extrem de rafinat pentru explorarea şi manipularea la scală nanometrică. Pe lângă datele despre topografia suprafeţei. temperatură sau alţi parametri fizici. utilitatea unei tehnici este mult mai importantă decât realismul. c) abilitatea de a observa procese dinamice aproape în timp real d) şi posibilitatea de a modifica interactiv suprafaţa. urmat de un feedback al parametrilor pe durata modificărilor şi utilizând pseudo-culori sau imagini ale liniilor. b) explorarea efectivă a suprafeţei de investigat. este util să afişăm aceşti parametri într-un spaţiu virtual.

setul de date pentru o abordare prin interfaţa SPIDAR este de fapt topografia suprafeţei (Figura 3. A fost revăzută problema relativ simplă a rendering-ului 3D pentru o suprafaţă. este acum posibil să creăm un rendering în timp real al suprafeţei. Într-un caz simplu. Se poate asigura interacţiunea în timp real cu parametrii de vizualizare cum ar fi direcţia iluminării. prin combinarea unui rendering grafic computerizat cu elementele ascunse. Figura 3. Implementarea unei componente de vedere cu raze X la programul nanomanipulatorului SPM. a feedback-ului de forţă. ca un exemplu a consideraţiilor implicate. Au fost studiate şi dezvoltate câteva moduri de vizualizare a unor seturi de date. 389 . acest concept este foarte elegant în simplitatea sa şi foarte util pentru o unitate de nanomanipulare. O afişare naturală a unui set de date 3D este posibilă prin iluminarea direcţionată a suprafeţei. În această etapă tehnologică.2). tehnologie bine cunoscută în câteva aplicaţii de avionică.Sistemul Multimodal. Utilizând procesarea de imagine 3D. prin interfaţa haptică.2. Interfaţa SPIDAR in timpul unei operaţii de nano-manipulare. Acest concept generează noi aplicaţii în nanomanipulare şi asigură. introduce conceptul de realitate îmbunătăţită. pe timpul unor situaţii complexe. pe măsură ce datele sunt achiziţionate de SPM. unghiul de vizualizare şi scalarea. O procesare de imagine 3D utilizează un mixaj de imagini într-un head-mounted display (HMD). efectiv o vedere cu raze X utilizatorului.

pentru cercetător este mai uşor să perceapă adâncimea obiectelor virtuale apropiate. utilizând numai o lumină ambientală cu intensitatea funcţie de înălţime. De asemenea. Această tehnologie poate lucra bine pentru imagini lipsite de zgomot. Abilitatea cercetătorului de a recunoaşte structuri moleculare specifice în prezenţa zgomotului este îmbunătăţită prin vedere stereoscopică. grafica 3D bazată pe umbre cu hărţi de culoare iluminate puternic. netezite micile fluctuaţii cauzate de zgomotul conţinut în imaginea suprafeţei. o suprafaţă plată are un mare conţinut de zgomot şi acesta este exprimat ca o fracţie. Acest lucru este adevărat din două considerente: pseudo-colorarea dedică întreg domeniul de intensitate adâncimii şi sunt. uneori reuşind. Pentru imaginile SPM. cum ar fi controlul unghiului de vizualizare a suprafeţei. Poziţia o-ring-ului în spaţiu poate controla diferite caracteristici afişate. spre deosebire de sistemele tele-robot utilizate în chirurgie. un feedback de forţă asigură un control intuitiv al probei şi permite sesizarea contururilor de pe suprafaţă. din păcate. Acest zgomot va determina o fluctuaţie a iluminării caracteristicilor cu aceeaşi magnitudine. de regulă o vedere prin pseudo-culoare este superioară unei vizualizări 3D prin umbre. imaginile pseudo-colorate au dedicat întreg domeniul de intensităţi pentru a evidenţia aceste diferenţe. Asigurând afişarea stereoscopică şi nu cea monoscopică. dar să şi acţioneze asupra lor şi să le atingă. pe perioada modificărilor suprafeţei. Pentru caracteristicile care sunt semnificative numai prin diferenţa mare de înălţime faţă de suprafaţa imaginii. din caracteristicile imaginii. Este neaşteptat să ne imaginăm că putem acum oferi posibilitatea cercetătorului nu numai de a vedea nano suprafeţe cu ajutorul SPM.Vizualizarea 3D nu este întotdeauna cea mai bună soluţie pentru suprafeţe cu mici denivelări. Percepţia spaţială 3D a datelor SPM cu acurateţe face posibilă pentru cercetător utilizarea cunoştinţelor sale ştiinţifice la recunoaşterea unor structuri şi caracteristici de interes. micile caracteristici de pe suprafaţă conţinute în alte mari variaţii sunt mai bine puse în evidenţă prin utilizarea unei hărţi de culoare şi iluminarea puternică a suprafeţei 3D (acestea ar fi imperceptibile într-o reprezentare 2D). acest sistem este echivalent cu un sistem tele-robotic care operează între două scale foarte diferite. să le facă neobservabile. Această abilitate 390 . Noi utilizăm o interfaţă haptică cu feedback de forţă care sesizează poziţia 3D a o-ring-ului SPIDAR (cu capabilităţi adiţionale pentru a sesiza 3DOF – grade de libertate) şi aplică forţele de la nivel nano adecvat scalate în mâna utilizatorului. Folosirea umbrelor este echivalentă cu desenarea suprafeţei. de asemenea. De asemenea. dar imaginile din lumea reală conţin întotdeauna zgomot. Conceptual.

391 . Percepţia Multimodală şi Intermodală. incluzând topografia suprafeţei şi canalele externe. O abilitate deosebită a oamenilor este aceea de a dezvolta capabilităţi de coordonare intermodală şi de procesare a modelelor.3) este extrem de importantă în activităţile zilnice cum ar fi conducerea maşinilor. descrierea formelor. Cu toate acestea. Mai mult. navigaţia şi aşa mai departe. De exemplu. Acest fişier poate fi redat mai târziu pentru a revedea întregul experiment. fedback-ul de forţă asigură utilizatorului posibilitatea de a localiza obiecte şi caracteristici ale suprafeţei. sistemul de nanomanipulare înregistrează toate datele. Feedback-ul de forţă este esenţial în găsirea structurilor ce urmează a fi modificate. inclusiv corelarea cu proprietăţile măsurate cu o up-datare a imaginilor structurii. Un sistem automat cu abilitatea de a face o predicţie despre cum simţim obiectele de tipul celor reprezentate prin valori ale pixelilor are multiple aplicaţii în generarea automată a datelor haptice. În al doilea rând.asigură controlul precis al suprafeţei şi deschide calea unor noi experimente. Vederea asigură fiecăruia abilitatea de a plănui şi executa activităţi spaţiale (zonă cunoscută ca fiind kinesferă). cum ar fi conductanţa cu secvenţa de timp pe care o numim fişier stream. în descrierea acestora. Utilizatorului ii este extrem de util să revadă experimentul pentru a vedea ce decizii a luat pe parcursul desfăşurării acestuia (analiza post-expriment). numai dacă privim un obiect. persoanele nevăzătoare construiesc modele intercorelate între canalul auditiv şi cel haptic. corelarea dintre văz . o limitare majoră a percepţiei tactile este dată de dimensiunea kinesferei. în special în discriminarea texturilor. În final. Abilitatea de a sesiza şi percepe obiecte dincolo de zona accesibilă (Figura 3. Studiile efectuate pe persoane nevăzătoare arată că au abilitaţi eficiente în câteva activităţi spaţiale. simţind când proba SPM se apropie de punctul de la care sunt posibile modificările. De asemenea. discriminarea formelor. găsirea traseului pentru modificare şi asigurarea unei atingeri fine care să permită începerea unui ciclu experimental în secvenţa scanare-modificare-scanare. iar cercetările psihologice au arătat că aceste modele nu sunt adaptate pentru percepţia de stimuli la distanţă. noi putem face o predicţie despre caracteristicile lui tactile cu o acurateţe rezonabilă. auz şi senzaţiile tactile determină redundanta în reprezentarea spaţială care asigură fiecăruia dintre noi utilizarea transferului intermodal şi coordonarea mecanică pentru activităţile spaţiale. Un astfel de sistem poate fi de exemplu unul care construieşte nano-blocuri şi un dispozitiv care asistă cercetătorul şi asigură generarea de date haptice despre nano-mediul apropiat. aşa cum avem în cazul văzului. recunoaşterea obiectelor şi descrierea acestora.

dimensiunea. utilizatorul urmează să categorisească perceptual forma. în faza de antrenament. audio şi haptic este un domeniu fascinant de cercetare.Figura 3. Feedback-ul de forţă capturează procese din SPM şi acest lucru este denumit în literatura „explorare haptică a nano-obiectelor”. Captura vizuală SPM poate fi ajutată prin stocarea profilului haptic sau de atingere al unui obiect sub forma miscărilor mâinii. Nevoia de noi experimente şi dezvoltarea de algoritmi care pot îmbunătăţi percepţia în lumea de scală nano prin stimulare în timp real vizual. Aceste prototipuri stocate într-o bază de obiecte haptice împreună cu strategiile de explorare haptic 392 . Explorarea haptică a nano-obiectelor se referă în esenţă la mişcarea mâinii. Interfata SPIDAR in timpul unei operatii de recunoastere haptica a unei structuri create anterior prin nano-manipulare. greutatea. Gesturile utilizate de cercetător pentru a percepe caracteristicile unui nano-obiect au o structură logică şi asigură înţelegerea caracteristicilor unui nano-obiect. Odată ce un obiect a fost capturat vizual.3. Aceste structuri de date care stochează atât caracteristicile vizuale cât şi pe cele haptice ale obiectului sunt baza dezvoltării unor cartografieri automate dintre diferite caracteristici vizuale şi haptice. Modelele computaţionale sunt dezvoltate la nivelul tehnologic actual ca şi prototipuri vizual-haptice. utilizată de cercetător pentru a percepe un nano-obiect. textura şi materialul nano-obiectului haptic. Aceste modele computaţionale sunt dezvoltate pe baza modelelor neuropsihologice şi cognitiv psihologice ale analizei caracteristicilor vizual-haptice.

. Microsc. E.. M. Science 266 (December 23). Structural plasticity of single chromatin fibers revealed by torsional manipulation. Vincent Croquette. Ludwig Brehmer.450 (01 May 2006). R.703 (01 Sep 2005). 8. 393 ..dimensional structures of nanoparticles using scanning force microscopy. Burkhard Stiller. Aurélien Bancaud. Ullrich Pietsch. Microanal. 1998. 504-512. and Superfine. From anisotropic photo-fluidity towards nanomanipulation in the optical near-field. Peter Karageorgiev. H. Madhukar.. S.. Ariel Prunell. Taylor II. H. Christophe Lavelle. Gaudeline Wagner. R.. 127 . G.. Jeffrey W... Natalia Conde e Silva. 699 .138 (01 Feb 2005).. R. Andrey Revyakin. Gutmannsbauer. Meyer. 444 . Roberts. 1999. Falvo. Academic Press. Requicha. Washburn. Dieter Neher. a Scrunching Machine. Brooks Jr. R. C. 1998.1981.. Science 17 November 2006 314: 1097-1098. Luthi. Haefke. 4. Burkhard Schulz. A. Paulson. S. and Guntherodt. 2. Nature Materials 4. Jean-Louis Viovy. 5. Science 18 April 2003 300: 472-474. in Handbook of Nanostructured Materials and Nanotechnology... Jean-François Allemand. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. R. Clary. Baur. Nature Methods 2.. 3. 9. M.. Taylorr II. Nalwa. Advanced Interfaces to Scanning Probe Microscopes. Bugacov. Langmuir 14 (23).. P.asigură baza de date pentru nano-spaţiu. 4. F.. Resch. V. S. A. E. 1994. 7. Guangyu Zhang. P. and Enge Wang. Nanomanipulation experiments exploring frictional and mechanical properties of carbon nanotubes. W. Howald.. 271-308. Richard H Ebright.. L.. R. Chi. Building and manipulating three-dimensional and linked two. pp. and Superfine. Xin Jiang. Sled-Type Motion on the Nanometer Scale: Determination of Dissipation and Cohesive Energies of C60. A. A. Terence R Strick.. BIOCHEMISTRY: RNA Polymerase. 1979 . Julien Mozziconacci. H. New York... Nature Structural & Molecular Biology 13. 66136616. 6. Koel. Tubular Graphite Cones.. M. Jean-Marc Victor. B. J. Helser. fiind suportul oferit de tehnologia actuală pentru viitoare aplicaţii în nano-robotică. G. Michael Giersig. 4. A. and Will. Bibliografie 1. Maria Barbi. S.

.................... 396 2........2..................... Design-ul şi principiul de funcţionare al spectrometrului de electroni .................................... Sistemul de lentile ..........2............................................................................................ 400 II............................................................ Izolarea Magnetică ......... Monocromatorul ........................3...........................III...... 395 1... Bibliografie . Spectrele UPS şi energia de rezoluţie ... 417 2.............................. Descrierea sursei . Descrierea Analizorului ... 402 1..........2......................1............. 412 1..1................... Detector Multicanal MCD ........................................1.1... 421 2. 401 1........5.........2............ 414 1...... Generarea fotonilor de raze X ..........................................2.........................................................3........................ dr................................................. Coerenţa între şi pas .............. Principiu de funcţionare........................2.......................................... 415 2................. SPECTROMETRUL DE FOTOELECTRONI DE RAZE X (XPS) ŞI ULTRAVIOLETE (UPS) Spectroscopia fotoelectronică C......2.......................................2........... 395 2......................2.................... Analizorul de energie emisferic de tip PHOIBOS ..........................2............. Analiza de suprafaţă .....................................2.............1..... 402 1.................................. Modul de focalizare.....................2.........1............ 417 2.......... 416 2........................................1.................... Componente ........... 422 3......................................................3........... 410 1.........5......XI.............................. Maria Teodora Radu Cuprins I..............2................ 417 2............................1....................... 422 3..2.............................................2.....................................1.........2..............................................2.. Spectroscopia fotoelectronică cu radiaţie UV (UPS) .... Multiplicarea Electronică ...............S.............................................................. 398 3.......... 416 2............... 402 1...............2...........5....... Informaţii generale ....3.......... 421 2............................................................................................................... Caracteristici generale .... Mecanismul de tăiere a orbitei ......... Răcirea cu apă ........................ 422 4.......................... Sursa de raze X pentru FOCUS 500 (XR50 M) ..........2............5...... 422 3...................4.1......... Caracteristici generale ...... 397 2........................................ 423 394 ........................................Concepte de bază ... Spectroscopia fotoelectronică de raze X ..........................2...................... 415 1...... 405 1........................................................ 414 1........................... 412 1..........................3.......................... Principiile Detecţiei ............................. Informaţii generale în legătură cu sursa XR 50 M ............. Analizorul Emisferic (HSA) ...... Flood-Gun 15/40 .................

de ex. Electronii cu energia de legătura EB pot fi excitaţi deasupra nivelului E de către fotoni cu energia hν > EB + Φ0. suprapunerea dintre rezultatele experimentele de spectroscopie de fotoemisie şi teorie este necesară pentru investigarea a numeroase proprietăţi a stării solide.V.23 eV si He II: 40.2: 1486.1 Această figură simplificată arată atractivitatea spectroscopiei de fotoemisie.82 eV) şi liniile ceraracteristice ale unei surse de raze X care utilizează de obicei ca materiale pentru anod aluminiul (Al . În general. Distribuţia fotoelectronilor I(Ekin) poate fi măsurată de analizor şi reprezintă în prima aproximaţie o imagine a densităţii stărilor electronice ocupate N(EB) în proba analizată. Concepte de bază 1. Mai mult. Principiul fundamental al procesului de fotoemisie este prezentat schematic în fig. la energii de legătură mai mari. are pe scară largă implicaţii practice în diferite domenii ca de exemplu fizica şi chimia suprafeţelor sau ştiinţa materialelor. În principiu se poate face distincţie între fotoemisia cu radiaţie în ultraviolet (UPS) utilizată în principal pentru investigaţii ale stărilor din benzile de valentă şi spectroscopia de fotoemisie cu raze X (XPS) care permite identificarea atomilor la suprafaţa solidelor şi determinarea deplasărilor în energiile de legătură ale core-level-urilor care sunt legate de diferite moduri de legături chimice. pentru că proprietăţile fotoelectronilor emişi reflectă în principal stările electronice proprii ale sistemului investigat. Analiza de suprafaţă Spectroscopia fotoelectronică a fost stabilită ca una din cele mai importante metode de studiu a structurii electronice a moleculelor. solidelor şi suprafeţelor [1-2].6 eV).I. 1 eV pentru anozii sursei de raze X. inclusiv dispersia benzii de valenţă magnetismul 395 . folosirea unui monocromator suplimentar poate fi un avantaj atât pentru energia de rezoluţie cât mai ales pentru suprimarea background-ului şi a intensităţilor sateliţilor care pot să apară în spectru. Deşi lărgimea liniei este de obicei suficient de mică pentru multe aplicaţii. câţiva meV pentru lampa de descărcare şi aprox.Kα1. Această separare se bazează în principal pe cele două tipuri diferite de sursă de excitare cvazi-monocromatică disponibile în laboratoarele de cercetare şi anume: spectrul liniei UV a lampei de descărcare pentru energii în domeniul de aproximativ 10-50 e. cu gaze rare ca heliu (He I: 21. şi a contribuit semnificativ la înţelegerea principiilor fundamentale din fizica corpului solid [1-5].6 eV) sau magneziul (Mg Kα1.2:1253.

Mai mult. în ultimii ani s-au efectuat îmbunătăţiri remarcabile d. şi suprafaţa Fermi. Prezentare schematică a procesului de fotoemisie în modelul uni-particulă. În acest context. tehnic în domeniul spectrometrelor de înaltă rezoluţie. Turner pentru studierea moleculelor în faza gazoasă[6] şi ulterior dezvoltată până la nivelul actual. 2. aproape la fel ca difracţia de neutroni. Investigarea experimentală a acestor proprietăţi necesită o energie de rezoluţie de ordinul meV. Spectroscopia fotoelectronică cu radiaţie UV (UPS) Această tehnică este folosită pentru a studia nivelele de energie din banda de valenţă şi legăturile chimice corespunzătoare. Metoda a fost dezvoltată iniţial în 1962 de David W. UPS joacă un rol important în obţinerea structurii benzii de valenţă a unui număr mare de solide şi suprafeţe.v. gap-ul supraconductor al unui supraconductor conven396 .d. În prezent.p. trebuie menţionate câteva exemple pentru caracteristici “many-body” ce pot fi puse în evidenţă pe scala meV în spectrele de fotoemisie UPS a sistemelor solide: (111) stări de suprafaţă de tip Shockley pentru Cu(1 1 1) [7-8].Figura 1. furnizând informaţii despre dispersia fononilor în solide. De asemenea. în cazul chemosorbţiei metoda ne permite studierea nivelelor electronice de energie derivate din orbitali moleculari ai sistemului substrat absorbit.

unde (4) I.randamentul total de electroni 397 .1.distanţa de la capilar la probă (aprox 40 mm).unghiul solid (sr-1).curentul fotonic pe probă.densitatea fotonilor (sec-1sr-1). Schema pentru aproximaţia unghiului solid Fluxul de fotoni poate fi calculat folosind formula: Φ= 1 e*r . d . 2. Aceste exemple sunt reprezentative pentru înţelegerea unor probleme mult mai complexe în fizica stării solide cum ar fi supraconductivitatea de temperatură înaltă (HTSC) şi compuşii cu fermioni grei. dc . η .diametrul capilarului (1.raza ariei excitate din proba. Iph . unde (1) Φ. (CeCu2Si2) [10-11]. Ω.ţional (V3Si). Caracteristici generale Fluxul fotonilor emişi de sursa de-a lungul axei optice poate fi determinat utilizând formula Φ = I ph * Ω . Figura 2. [9] şi rezonanţă Kondo în sistemele cu fermioni grei. În prima aproximaţie unghiul solid rezultă din zona iluminată a probei şi distanţa dintre capilar şi probă: Ω= π + r2 d2 (2 ) (3 ) R= d (1 − 2d*cr ) R .fluxul fotonilor (sec-1).3 mm).

Spectrele UPS şi energia de rezoluţie Sursa UV de tipul UVS 10/35 este în principal utilizată pentru studiul densităţii de stări a electronilor de valentă. Pentru energiile fotonilor VUV în intervalul 20 . cu UPS 398 .40 eV structurile electronilor de valenţă s-like sunt suprimate în comparaţie cu orbitalii p-like. Determinarea funcţiei de lucru. 2. densitatea fotonilor este calculată ca fiind: Iph= 8. Dacă energia fotonilor este 40 eV structurile d-like sunt generate cu o probabilitate de excitare mare. 0.3 * 1015 fotoni sr-1sec-1 2.22 mm diametru şi un curent pe proba de 55 nA. Figura 3. Φ.Din (1) si (4) rezultă: ⎛ d ⎞ 2 ⎟ I ph = I * ⎜ ⎜ 1 − dc ⎟ / e *π * r *η ⎝ 2*r ⎠ 2 (5) Pentru o arie iluminată a probei de aprox. De aceea. Datorită caracterului cvasimonocromatic al liniilor de excitare se poate obţine energie de rezoluţie înaltă (aprox. forma şi structura lor. spectrele UV ale fotoelectronilor exciţi pot fi comparate cu rezultatele teoretice obţinute din calculul structurilor de benzi.01 eV) ceea ce permite rezolvarea structurilor vibraţionale moleculare. este în general de câţiva meV de aceea monocromatizarea suplimentară nu este necesară în cele mai multe cazuri.2. Lăţimea liniei de excitare. sau< 12 eV energie a fotonilor) spectrele fotoelectronilor UV excitaţi. şi folosite pentru determinarea unor informaţii specifice suplimentare în analiza de suprafaţă. În intervalul VUV de energii joase (<20 ev. Descărcarea VUV acoperă un interval de energie al fotonilor de la 10 la 50 eV. în plus faţă de XPS. depind puternic de energia fotonilor excitanţi.

Potrivit figurii 3. unde (6 ) Evac. Un electron emis de la un nivel de energie Ex < Ef (figura 3C) are o energie cinetică minimă (Emin= 0). Prin urmare. pentru un electron emis de la un nivel de energie EB < EF: Ekin= h * ν – (EB .Emin adică: Emax . funcţia de lucru poate fi calculată folosind formula: Φ= h * ν – (Emax .Emin= h * ν – Φ (10) Această diferenţă este egală cu distanţa de la A la B. Φ. Acest electron ar apărea în poziţia A în figura 4. În general. unde Emax este cea mai mare energie cinetică.nivelul Fermi. Determinarea funcţiei de lucru. (8 ) (9 ) Figura 4.Φ) (7 ) unde. pentru energia de legătură şi energia cinetică avem: EB= 0 Emax= h * ν – Φ. este exprimată astfel: Φ= Evac . EF.nivelul de energie al vidului. Φ. prin măsurători UPS Diferenţa dintre energiile cinetice ale electronilor la poziţiile A şi B este Emax . adică lăţimea spectrului cu ΔE= constant în figura 4.EF. funcţia de lucru.Emin) (11) 399 . Pentru un electron emis de la nivelul Fermi (figura 3B). hν este energia fotonului.

Odată ce fotoelectronul a fost emis. spectrul XPS al plumbului este suprapus pe o reprezentare a orbitalilor electronici. Relaţia dintre parametrii implicaţi în XPS este: EB = hv . Acest lucru poate fi realizat prin emisia unui foton de raze X. EK este energia cinetică a electronilor şi W (cst) este funcţia de lucru a spectrometrului. atomul ionizat trebuie să se relaxeze. acest lucru va fi efectuat de către sistemul de control sau de sistemul de date asociat cu spectrometrul. dar acest lucru depinde de energia fotonilor razelor X implicate şi de aceea nu este o proprietate a materialelor intrinseci. cunoscut sub 400 . Cantităţile din dreapta relaţiei sunt cunoscute sau măsurabile. în general suntem preocupaţi de o formă specială de fotoemisie.3.W. care este considerată mai adecvată. contribuind la vârfuri discrete.Spectroscopia fotoelectronică de raze X În XPS. spectrul este suprapus pe o structură electronică schematică a plumbului pentru a studia modul în care fiecare orbital dă naştere la linii fotoelectronice. Energia de legătură a electronilor (EB) este parametrul care identifică specificul electronilor. unde hv este energia fotonilor. sau pot suferi pierderi de energie şi să contribuie la fundal. adică de emiterea unui electron de la un nivel de bază datorită acţiunii unui foton de raze X de energie hv. Energia cinetică a electronilor (EK) este experimental măsurată cantitativ de spectrometru. contribuie la vârfurile caracteristice în spectru.EK . Aceşti electroni care sunt excitaţi şi scapă fără a pierde energie. Spectrul de fotoelectroni va reproduce structura electronică a unui element destul de precis. Operatorul doar selectează o scală de energie cinetică sau de legătură. Energia fotoelectronului emis este apoi analizată de un spectrometru de electroni şi datele sunt prezentate ca un grafic de intensitate funcţie de energia fotoelectronilor emişi. Acest lucru este ilustrat în figura următoare. În practică. cei care sunt supuşi unei împrăştieri inelastice şi suferă pierderi de energie. deoarece toţi electronii cu o energie de legătură mai mică decât energia fotonilor vor fi cuprinşi în spectru. Figura 5. contribuie la fondul spectrului. Spectru fotoelectronic al plumbului care arată modul în care electronii scapă din solid. unde.

O altă posibilitate o constituie ejecţia unui electron Auger. sistem de curăţare cu ioni de Ar etc. Camera de vid si de preparare poate fi dotată cu diferite instalaţii pentru prepararea probelor şi facilitaţi analitice auxiliare (neutralizator de sarcină. poate conduce la informaţii chimice valoroase despre un atom. Design-ul şi principiul de funcţionare al spectrometrului de electroni Figura 6. II. 401 . în general cu catodul de aluminilu (Al Kα) sau catodul de magneziu (Mg Kα). spectrometrul de electroni conţine următoarele componente: • Analizor de energie a electronilor de tip PHOIBOS 150 • Sursa de raze X.). Un sistem computerizat este folosit pentru achiziţia datelor şi de procesarea ulterioară. care funcţionează în regim de vid ultra-înalt (UHV). Astfel. XR50 • Sursa de raze X cu monocromator FOCUS 500 • Sursa UV UVS 10/35 • Sursa sputter IQE 11/35 cu ioni de Ar • Neutralizator de tip Flood Gun FG 15/40 Acestea sunt cuprinse într-o cameră de vid. X-AES. cu toate că nu se practică la scară largă. sistem de tăiere a probelor. Sistemul de analiză a suprafeţelor SPECS În cel mai simplu mod.numele de fluorescenţă de raze X. Sursa de radiaţii primare pentru spectroscopia fotoelectronilor de raze X face uz de razele X. adesea denumit X-AES (X-ray induced Auger electron spectroscopy). electronii Auger sunt produşi ca urmare a procesului XPS.

1. nefiind necesară intervenţia celui care o foloseşte. Voltajul emisferelor (între -400 şi 400 V) şi voltajul de întârziere (între -400 şi 400 V) sunt schimbate independent. Analizorul PHOIBOS 150.Intervalul 3500 V. Acesta are patru moduri de operare pentru diferite intervale de voltaj: . Voltajul emisferelor (între -400 şi 400 V) variază cu voltajul de întârziere (între -1500 şi 1500 V). Analizorul de energie emisferic de tip PHOIBOS 1. Generatorul HSA3500 pentru analizatorul PHOIBOS este controlat în totalitate cu ajutorul computerului.2. . Partea electronică de detecţie este alimentată împreună cu unitatea analizoare de control. Unitatea poate fi folosită şi pentru aplicaţii la nivele mai mari de energie folosind un mod de operare corespunzător.1.Intervalul 400 V. De aceea. este echipat cu 9 canale detectoare. cercetarea unor suprafeţe largi asociate diferitelor unghiuri de recepţie ale lentilelor. de asemenea. Toate componentele sunt controlate de un program SPECS.400 şi 400 V) variază cu voltajul de întârziere (între -3500 şi 3500 V). un numerator şi o interfaţă bus. Analizorul de acest tip poate detecta energii ale electronilor şi ionilor în intervalul 0-3500 eV cu o lărgime minimă a pasului de 7 meV.Intervalul 40 V. 1. analizorul permite măsurători rezolvate spaţial cu un diametru minim de 100 µm şi.Intervalul 1500 V. Un ansamblu de lentile de transfer în doi paşi poate fi folosit în diferite moduri pentru rezolvarea spaţială şi unghiulară. Toate modurile lentilei pot fi setate electronic. Voltajul emisferelor (intre -40 si 40 V) ţi voltajul de întârziere (între -40 şi 40 V) sunt schimbate independent. Lentilele de intrare sunt proiectate pentru a se potrivi cu o gamă largă de aplicaţii. . . Caracteristici generale Analizorul SPECS de energie emisferic electrostatic de tip PHOIBOS permite înregistrarea spectrelor de energie pentru particulele negative (electroni) şi particulele pozitive (ioni) în intervalul energiilor cinetice de la 0 eV la 3. Partea electronică pentru detecţie include un discriminator. Toate aceste 402 . Un mecanism de tăiere a orbitei şi o lentilă multi-mod fac selectabile zona de pe proba de analizat şi unghiul de recepţie.5 keV. Toate părţile sunt integrate într-o singură cutie compactă din aluminiu protejată RF. Descrierea Analizorului Analizorul PHOIBOS este format dintr-un sistem de vidare şi patru componente majore interne care sunt arătate în figurile de mai jos. Voltajul emisferelor (între . un preamplificator.

403 . Schema de conectare a componentelor PHOIBOS Figura 8: Principalele componente ale analizorului şi principiul voltajului U0 – voltajul principal de întârziere. U0 = –Ekin(kinetic energy) + Ep(pass energy) + WF(work function). Figura 7.componente sunt introduse într-un mediu de vid ultra-înalt (UHV). pentru a evita ciocnirea particulelor emise de pe suprafaţa probei cu moleculele de gaz. Uchannel HV/ Base – potenţialul pe anod/catod pentru canale.

IH. panourile de lentile definesc acceptanţa unghiulară şi suprafaţa pentru o anumită mărime a tăierii de intrare. • Mecanism de tăiere a orbitei cu o interconexiune rotaţională exterioară.UHV–UBase – voltajul detectorului. • Analizorul emisferic de 180° (HSA) cu un diametru de 150 mm pentru măsurători spectroscopice de energie. OH – emisfera interioară/exterioară. Pentru obţinerea unei imagini nedegenerate. C1…C9 . sau electroni.detectori mono/multi-canal de colecţie discretă (1. În plus. Sistemul de lentile poate fi operat în diferite moduri pentru situaţii de rezolvare spaţială şi unghiulară pentru a adapta analizorul la diferite cerinţe. Înainte ca particulele să treacă prin analizorul semisferic. trec mai întâi printr-un sistem de lentile electronic care taie fasciculul de particule. sistemul de lentile nu conţine sau nu are interfranje. dar de obicei se folosesc razele X sau alte tipuri de fotoni. LA…LE – potenţialele pe lentile. unde sunt întârziate în lentile pentru o analiză energetică ulterioară. Pentru analiza cu un spot mic este disponibilă o rezoluţie colaterală de până la 100 µm. În modurile de amplificare rezolvarea unghiulară este realizată cu o apertură iris în planul de difracţie al sistemului de lentile. Toate modurile lentilei pot fi setate electronic. S1 – intrarea de tăiere a capacitorului emisferic. ioni. S2 – planul de ieşire al capacitorului emisferic. 404 . Succesiunea de lentile defineşte suprafaţa de analiză şi acceptanţa unghiulară prin imagistica particulelor emise la intrarea în analizor. Componentele interne sunt: • Sistemul lentilelor de intrare. Sursa excitatoare depinde de tehnica folosită. folosind modul de amplificare puternică si o apertură iris corespunzătoare. Sistemul de lentile electronic şi părţile tăiate (intrarea şi ieşirea) au efecte importante asupra împrăştierii energiei detectate de analizor. pentru recepţionarea particulelor încărcate. r0 – raza nominală a capacitorului (100 sau 150 mm). Sistemul de lentile de intrare include zece segmente de lentile. T1…T10 – electrozi ai lentilei de transfer multi-mod. • Apertură iris cu interconexiune rotaţională exterioară. • Ansamblul detector pentru particule individuale. Particulele care trec prin lentile sunt focalizate în poarta de tăiere S1. UChannelBase-U0 – voltajul de conversie.5 sau 9 canale).

Cu detectorul multi-canal. Poziţia radială a imaginii tăiate în planul S2 depinde de energia cinetică a particulelor în capacitor. Modurile de transmisie sunt optimizate pentru transmisii înalte la mărimi diferite ale spotului. suprafeţelor Fermi sau experimente similare. 1. Aceasta permite posibilitatea folosirii detectorilor multi-canal.1. informaţia dată de unghiurile de emisie este obţinută uşor. montat în afara vidului. cu interfaţa pentru programul de achiziţie de date SPECS. sunt focalizate mai în interiorul planului S2. Un sistem de lentile cu un mecanism variabil de tăiere a orbitei este necesar pentru: • a vizualiza planul probei pe intrarea plană HSA. fiecare canal este conectat la un preamplificator separat. Particulele cu o energie cinetică mai mare sunt focalizate mai departe spre exterior. Rezoluţia colaterală este înrăutăţită şi suprafaţa de recepţie nu este definită în mod normal de lentile. dar. Particulele de pe traiectoria centrală au energia de trecere optimă. pentru rezolvarea spaţială şi unghiulară. rezoluţia unghiulară poate fi ajustată continuu menţinând suprafaţa de recepţie a probei constantă. Distanţa standard de lucru de 40 mm şi partea frontală de formă conică la un unghi de 44° al lentilei furnizează accesul optim la probă pentru toate tipurile de surse excitatoare. Particulele care trec prin planul de ieşire al capacitorului S2 sunt accelerate în sistemul de detectori C. • a accelera/decelera particulele la energia de trecere. iar particulele cu o energie cinetică mai mică. Sistemul de lentile Ansamblul de lentile de transfer în doi paşi a fost conceput pentru a oferi randament de transmisie foarte bun şi proprietăţi optice bine definite. Ele sunt focalizate pe poziţia centrală radială a ieşirii plane S2. distribuţia emisiei după unghiuri este vizualizată în locul imaginii reale.Folosind irisul. particulele care intră în S1 sunt focalizate în planul de ieşire al capacitorului S2. În modurile unghiulare dispersive. La nivelul lentilei particulele ce ies de pe pro405 . Acesta poate fi folosit în diferite moduri care pot fi setate electronic. Toată rezoluţia colaterală este pierdută. • a defini zona probei analizată şi unghiul solid de recepţie de pe probă. Aceste moduri sunt concepute pentru schiţarea benzilor UPS.2. cu înregistrarea simultană a unei benzi de energie în jurul valorii de trecere optime a energiei. În capacitorul semisferic. Preamplificatorii sunt citiţi de către detectorii multi-canal (MCD).

conectând la electrozii lentilelor voltajul optim. Gradul de difuzie creşte. Dacă S1 are diametrul D1. Ekin este negativă pentru electroni şi pozitivă pentru ioni. particulele trec printr-o imagine intermediară înainte să fie focalizate în intrarea de tăiere S1 a capacitorului emisferic (figura 4). atunci. Amplificarea este schimbată electric. Valorile voltajului sunt dependente de voltajul spectrometrului U0 care este preponderant egal cu Ekin . Planul imaginii probei este în coincidenţă cu planul intrării analizorului. 40 mm în faţa primului electrod al lentilei T1.Epas + funcţie de lucru. R fiind rata de întârziere. ţinând aberaţia sferică la o valoare cunoscută şi acceptabilă. Cu toate acestea. imaginea în planul de intrare este difuză. La nivelul S1 particulele sunt întârziate de diferenţa de energie dintre particulele cu energia cinetică preponderentă Ekin şi energia preponderentă de trecere Epas. Amplificarea înaltă. pentru o amplificare dată. (figura 9). cu unghiul de recepţie al intrării lentilei.ba S sunt vizualizate în intrarea de tăiere S1. suprafaţa vizualizată a probei va avea dimensiunea DS egală cu: DS = D1 / M (1) Puterea de amplificare a planului de lentile poate fi selectată. În modul FAT. este în mod special potrivită pentru studii de rezolvare spaţială. conform teoriei. voltajul aplicat pe emisfere este dat de ecuaţia: Epas = (-q)kΔV În modul FRR. proba fiind în planul focal al sistemului de lentile. Din această cauză unghiul de recepţie al lentilei este selectabil prin modurile de amplificare. Utilizatorul poate defini zona de recepţie a analizorului cu ajutorul intrării de tăiere deoarece traiectoriile electronilor emişi 406 . de exemplu. În interiorul primei lentile. Aceasta înseamnă că zona observată în planurile focale ale intrării sistemului de lentile este tot mai împrăştiată cu creşterea unghiului. Mărimea reală a suprafeţei probei de analizat DS este în principiu dată de ecuaţia (1). datorită aberaţiei sferice a intrării lentilei. Sistemul PHOIBOS poate funcţiona într-un nivel stabilit de întârziere (fixed retarding ratio – FRR) sau în transmisie stabilită de analiză (fixed analyzer transmission – FAT). energia de trecere are valoarea: Epas = Ekin / R. rezultând astfel dimensiuni mai mari ale probei decât cele date de ecuaţia (1).

Pentru analiza cu spoturi mici. Mod de arie medie de către probă sunt influenţate de către câmpurile electrice din jurul probei. Cu o apertură iris. aceste raze rele pot fi eliminate. rezoluţia unghiulară este realizată cu ajutorul aperturii iris în planul de difracţie al sistemului de lentile. apertura iris poate fi utilizată pentru ajustarea unghiului de recepţie a analizorului. Razele apropiate de axa 407 . Folosind irisul. Mod de transmisie înaltă Figura 10. În aceste moduri. Modurile de amplificare au fost optimizate pentru a permite unghiuri foarte mari de recepţie pentru surse punctiforme cu transmisie puternică (moduri de transmisie punctiformă). Datorită aberaţiilor lentilei. utilizând modul de amplificare înaltă şi apertură iris. Mai mult. razele care intră în lentilă depărtate faţă de axa ei la unghiuri mari. rezoluţia unghiulară poate fi încontinuu ajustată între ± 10 şi ± 90 . o rezoluţie laterală de până la 100 µm este disponibilă. menţinând zona de recepţie a probei constantă.Figura 9.T1 având un potenţial fix care este setat ca fond la schimbarea sursei de alimentare. pot să găsească un drum spre intrarea analizorului.

Focalizări mici sub lentilă. în planul imaginii. Razele care intră în lentilă la unghiuri mai mari. implică deplasarea discului de cea mai mică dezordine.lentilei (raze paraxiale) sunt focalizate în focarul Gaussian. ISS şi studii de sincroton. Discul cu cea mai mică dezordine se află unde tubul de raze emergente are cel mai mic diametru. dar rezoluţia spaţială este înrăutăţită.5 mm 7 mm 10 mm 13 mm 15. electronii care părăsesc proba la o anumită distanţă unghiulară sunt focalizaţi pe aceeaşi 408 .5 mm 17. converg mai puternic. De aceea este realizat un unghi mare de recepţie. Figura 11. Asta face ca modurile de transmisie punctuale să fie cele mai potrivite pentru AES.5 mm În noul mod de suprafaţă medie cu unghiuri rezolvate. Modul de amplificare înaltă Tabelul 1: Unghiul de recepţie versus diametrul irisului pentru o sursă punctiformă Unghiul de recepţie ± 1º ± 2º ± 3º ± 4º ± 5º ± 6º Diametrul irisului 3.

Profilul tipic intensitate-poziţie cu apertură iris Cozile de intensitate mică formează un disc. amplificarea şi apertura unghiulară sunt selectabile. Modurile unghiulare permit utilizatorului să optimizeze rezoluţia unghiulară până la ± 0. Suprafaţa de analizat a fost definită pentru a include între 90-99% din totalitatea semnalului fotoelectric. Setarea optimă a aperturii iris depinde de mărimea tăierii şi de calitatea dorită a suprafeţei de analizat. La PHOIBOS. Folosind apertura iris.050 cu mecanismul de tăiere a orbitei. Figura 12. aceste intensităţi pot fi suprimate. dar cu intensităţi mai mari în regiunile de margine. aceste intensităţi pot fi suprimate. fără restricţionarea unghiului de recepţie. Intensitatea sa integrată poate atinge acelaşi ordin de magnitudine ca intensitatea peak-ului. Pentru o analiză cu spoturi mici. apertura iris poate fi folosită pentru micşorarea suprafeţei de analizat. rezultând astfel un număr de combinaţii egal cu produsul dintre modurile de setare a lentilei şi numărul de tăieri. Cu un sistem de detecţie 2-D se pot obţine unghiuri de rezoluţie mare pe direcţia dispersiei. Folosind apertura iris. Funcţia intensitate-poziţie a analizorului este o Gaussiană. Există mai multe combinaţii diferite disponibile. Setările lentilelor pot fi combinate cu diferite combinaţii ale tăierii.zonă a intrării analizorului indiferent de poziţia lor din probă. acest mod este alegerea ideală pentru studii de dependenţă unghiulară. 409 . a analizorului.

q – sarcina electrică a particulei. FWHMtotal observat este dat de convoluţia FWHM . parcurgând un arc de cerc de rază R0. Particulele încărcate care intră în HSA prin intrarea de tăiere S1. numai particulele cu energie cinetică cuprinsă într-un anumit interval.2. Particulele cu energie cinetică mai mare se vor apropia de emisfera exterioară în timp ce particulele cu energie cinetică mai mică sunt deviate spre emisfera interioară. a liniei transmise ΔEan este dată de : ΔEan S α2 = + Epas 2R0 4 (5) unde S = (S1 + S2)/2. Acele particule care intră în HSA perpendicular pe S1 şi se mişcă prin emisfere pe o traiectorie circular centrală. Dacă HSA acceptă jumătatea unghiului α pe direcţia dispersiei. Al Kα). de exemplu. pot să treacă integral prin devierea unghiulară de la intrarea de tăiere S1 la planul de ieşire S2.9375 2R0 (Rout − R in ) (3) (4) Aceste particule ajung pe S2. Razele emisferelor PHOIBOS sunt 1. Există contribuţii în plus la lărgimea liniei observate în spectru. au energia de trecere preponderentă Epass: Epass = (-q) kΔV. sunt deviate pe traiectorii eliptice de câmpul electric radial între emisfera internă Rin şi emisfera externă Rout. Analizorul Emisferic (HSA) Analizorul emisferic PHOIBOS (HSA) cu o rază R0 (100mm/150mm) măsoară energia particulelor încărcate. rezoluţia HSA sau FWHM (full width at half maximum).1.Vin).75 R0. k= R in R out = 0. Această valoare (S) este o constantă a analizorului. pentru lărgimea Gaussiană a liniilor: (6) FWHMtotal =(ΔEan 2 +ΔElevel2 +ΔEphoto2 )1/2 =ΔE 410 . Intrarea de tăiere S1 şi planul de ieşire S2 sunt centrate în jurul razei R0: R0 = R in + R out = 150 mm 2 (2) Pentru un gradient fix al câmpului electric. C 1s).2.25 R0 şi 0. b) Lărgimea naturală a liniei pentru radiaţia caracteristică folosită la excitare ΔEphoto (de exemplu Mg Kα. Pentru liniile de fotoemisie cele mai importante contribuţii adiţionale sunt: a) Lărgimea proprie a liniei pentru nivelul atomic ΔElevel (de exemplu O 1s.urilor individuale. k – constanta de calibrare. ΔV – diferenţa de potenţial aplicată pe emisfere (Vout .

rezoluţia HSA la nivelele joase ale energiei de trecere pentru Ag 3d5/2 este : HMMgKa= 0. Pentru radiaţia monocromatică. de unde rezultă valori mai mici pentru FWHMextreme. De aceea.44 eV Pentru a atinge rezoluţia extremă de 0.8 eV (7) În practică. Analizorul poate fi operat în două moduri diferite: a) Gradul de întârziere fix (Fixed retarding ratio (FRR)). FWHMtotal este uneori determinat înregistrând nivelul Si 2p3/2 în loc la Ag 3d5/2.9 eV este de obicei suficientă pentru măsurători la rezoluţie mare. de exemplu radiaţie Al Kα monocromatică în mare parte. Pentru o rezoluţie mai mare a instrumentului. Pentru radiaţie Al Kα monocromatică şi pentru nivelul Ag 3d5/2 rezoluţia extremă este: (8) FWHMextreme = 0. o rezoluţie de 0. după extracţia liniară a fondului.FWHMtotal este de obicei stabilit folosind o probă de argint curăţată prin împrăştiere ionică şi înregistrarea nivelului Ag 3d5/2. Ele sunt constante ale unde analizatorului. suprafaţa de recepţie a probei AS şi rezoluţia HSA.65 eV este de obicei suficientă pentru studii de înaltă rezoluţie cu o excitare monocromatică a Al Kα. Pentru excitarea Mg Kα. Ecuaţia rezultă din teorema lui Liouville. (11) 411 . Intensitatea semnalului integral I al particulelor măsurate (suprafaţa cuprinsă în interiorul peak-ului până la nivelul fondului) este proporţională cu produsul dintre unghiul solid de recepţie ΩS. folosind doar o mică parte din suprafaţa spotului monocromatic de radiaţii X (datorită dispersiei energiei pe suprafaţa spotului). FWHM-ul razelor X trebuie să fie foarte mic. În practică. datorită îngustării lărgimii liniei proprii a nivelului Si 2p. ΔEan : I:ΔEan ΩSAS =ΔEan Ω0A0 Epass Epass 2 . o rezoluţie de 0. este posibilă folosirea radiaţiei X monocromatice de excitare. cu costul unei mari pierderi în intensitate. energia de trecere este proporţională cu energia cinetică.44 eV. gradul de întârziere R este definit ca: R= Ekin Epas (10) În acest mod toate particulele sunt decelerate cu acelaşi factor constant. Intensitatea creşte cu creşterea energiei cinetice: I ∼ Ekin . în timp ce rezoluţia energetică scade. : Ekin Ekin (9) sunt valorile de recepţie pentru HSA.

sunt măsurate cu aceeaşi scădere a rezoluţiei şi intensităţii cu energia cinetică: I∼ 1 Ekin (12) Cele două moduri sunt disponibile pentru toate tipurile de măsurători. rezultă că: I ∼ Epass 2 1. Modul FAT este folosit preponderent în XPS şi UPS. Factorul de izolare pentru regiunea analizatorului este de aproximativ 35. în timp ce tăierea anterioară serveşte la compararea împrăştierii unghiulare pentru analizor.2. Pentru o rezoluţie energetică dată. indiferent de energia lor cinetică.5 mm grosime µ-metal pentru a ecrana câmpurile magnetice la un nivel minim. Mecanismul de tăiere a orbitei Mecanismul de tăiere a orbitei este folosit pentru a schimba manual deschiderea intrării şi ieşirii analizorului.2. (inclusiv câmpul magnetic al pământului) de aceea este esenţial să eliminăm aceste câmpuri în volumul închis al analizatorului. sistemul de lentile şi detectorul sunt înconjurate de un strat de 1. din materiale non-magnetice într-o carcasa de µ-metal. Inelul de intrare poate fi poziţionat direct prin rotirea cadranului (vezi fi412 . Analizatorul. Izolarea Magnetică (13) Particulele încărcate sunt influenţate de câmpul magnetic rezidual. în întregime. Tăierea posterioară se află în planul intrării şi defineşte energia de rezoluţie a analizorului (vezi ecuatia (5)).3. Semnalele date de toate particulele. 1. o zonă de analiză tolerată şi un unghi de recepţie. acestea sunt construite. tăierea maximă posibilă poate fi selectată. Există unele aplicaţii în care unul dintre ele este de obicei preferabil. unde este necesară o informaţie detaliată şi rezoluţia nu trebuie să depindă de energie. Pentru o performanţă maximă a analizatorului şi sistemului de lentile. Modul FRR este folosit cel mai mult în AIS. Raza de intrare este definită de două secţiuni care sunt la circa 6 mm depărtare. ISS şi este preferabil pentru măsurători ale survey-ului.4. Dacă Ekin este constantă şi acelaşi peak este măsurat pentru diferite energii de trecere. în care Epass şi ΔEan din ecuaţia (5) sunt constante ajustabile.b) Transmisie fixă a analizorului (fixed analyzer transmission(FAT)). Aceasta face posibilă cea mai mare rată de numărare permisă pentru aceşti parametrii şi de aceea rezultă un timp scurt de măsurare şi un raport bun semnal-zgomot. Mecanismul poziţionează o deschidere de intrare şi ieşire de o mărime adecvată în planul de intrare şi ieşire al analizorului.

au 8 tăieri de intrare şi 2 de ieşire în configuraţia standard. Poziţiile tăierii de intrare sunt indicate cu numere (1-8) pe cadranul rotaţional exterior. Prin acest aranjament se pot alege puterile de intrare şi ieşire independent. Poziţiile tăierilor de ieşire sunt indicate cu litere (A-B. Aranjamentul propriu-zis în analizor apare în secţiunea de tăiere a programului de control livrat împreună cu analizorul. sau A. Analizorii PHOIBOS. Aceşti indicatori corespund celor care apar în setările programului de control al analizatorului SpecsLab2. începând cu ieşirea 5. Când deschiderea intrării şi ieşirii este schimbată. poziţiile trebuie introduse în zona de editare a datelor. Selecţia fantei de ieşire 413 . folosind acelaşi sistem rotaţional.B sau C). Pe de altă parte. Figura 13.gura 10). inelul de ieşire este poziţionat indirect prin intermediul inelului de intrare (vezi figura 11).

este selectată pentru a corespunde cerinţelor unei diferenţe de energie cinetică constantă între canalele vecine ΔEk.5. Principiile Detecţiei Datorită simetriei sferice a HSA. baleând spectrul odat peste suprafaţa detectorului. având diferite energii în HSA. iar aceste numere sunt stocate şi procesate într-o unitate de achiziţie a datelor. 414 . 5 sau 9 spectre paralele sunt înregistrate simultan. 1. fiind ştiută din ecuaţia (16). aparţinând aceleiaşi energii cinetice. rezultând numărul total de particule pentru fiecare energie cinetică. de voltaj înalt. Numărul particulelor Nn care sosesc la fiecare colector Cneste numărat separat. În principiu. numărul particulelor din fiecare canal. Energia cinetică En a particulelor ce ajung la colectorul Cn. în principal datorită câmpurilor de refringenţă existente pe marginea analizorului. cu 9 ieşiri de tăiere în cercuri concentrice în planul de ieşire. sunt cercuri concentrice. poate fi adăugat. Detecţia multicanal se realizează aranjând corespunzător 9 CEMs (multiplicator de electroni cu canale) ca şi colectori. în planul ieşirii pentru electroni monocromatici cu energia preponderentă de trecere Epass. şi în acest fel fiecare colector înregistrează un spectru corect. există o imagine 1:1 a intrării circulare de tăiere cu o rază de curbură R0.2. traiectoria electronului este mutată între fiecare analizor pas cu pas. Într-o primă aproximaţie raza de poziţie R a electronilor cu energia cinetică Ek. cu o compensare fixă a energiei între canalele vecine. situată în vid • Preamplificatori MCD.1. este dată de: R − R0 Ek − Epass D = × R0 E pass R0 unde D este dispersia la HSA. Distanţa radială între ieşiri de tăiere vecine ΔR.2. Schimbând tensiunea spectrometrului U0.1. Imaginile electronilor. Detector Multicanal MCD Detectorul este format din următoarele părţi: • Un aranjament de multiplicatori de electroni MCD • O punte ceramică multi-pin.5. Valoarea teoretică a lui D este: D = 2R0 (16) (17) Valoarea experimentală determinată pentru dispersie poate fi puţin diferită.

2. Impactul particulelor încărcate formează electroni secundari care sunt eliberaţi din peretele CEM. la energia cinetică nominală. este: ΔEk = ΔR D D ΔR Epass (18) sau: Epass = ΔEk (19) unde D este dispersia pe analizor. CEM este format dintr-un tub mic şi curbat de sticlă. câştigul trebuie selectat destul de înalt pentru a folosi CEMs în modul 415 . Algoritmul este uniechivoc. sau radiaţia. nu există o restricţie a pasului energiei datorată performanţei analizorului. Multiplicarea Electronică Un multiplicator de electroni cu canale (CEM) este un dispozitiv de achiziţie înaltă pentru detectarea particulelor energetice. Aceşti electroni sunt acceleraţi de către voltajul înalt. deoarece nu există niciodată mai mult decât o energie nominală între două poziţii ale energiei măsurate. la distanţa ΔR unul de celălalt. Pentru asta.2. conectat la CEM.1. se numeşte câştigul G. Coerenţa între Epass şi pas Din ecuaţia de dispersie energetică pentru analizor. până când. unde energia de trecere se schimbă în spectru (şi diferenţa de energie dintre canalele învecinate). cum ar fi electronii şi ionii. În special în modul FRR. un calcul al energiei detectate a particulelor este necesar.2. Pentru detectarea unei singure particule. un program calculează numărul de particule Nn în canalul Cn. Peretele interior este căptuşit cu un material de rezistenţă înaltă. Numărul mediu de electroni care pleacă din ansamblul CEM pe particula incidentă. în final. Datorită procesului de interpolare. Programul validează valorile la cele mai apropiate valori. un “nor electronic” se formează la ieşirea din CEM. etc) limitează lărgimea şi distanţa posibilă a paşilor. şi eliberează noi electroni secundari prin impactul în continuare de-a lungul peretelui CEM. Acest efect este repetat succesiv.5. Performanţa acumulatorului (DAC steps. diferenţa de energie Δ între canalele vecine. 1. prin interpolarea între numerele măsurate în canalul Cn la energiile măsurate cel mai apropiat dedesubt şi deasupra energiei nominale.3. Materialul rezistiv devine o dinodă (o serie de electrozi incorporaţi într-un fotomultiplicator) continuă când un potenţial este aplicat la capetele acestui tub.5.

de exemplu.5 x 1 mm2 pe probă) şi sursa de raze X poate fi operată la puterea maximă de 400 W ( 600 W pentru Ag Lα) la lărgimea liniei de 0.1. La fel ca şi XR 50. este accelerat în electrodul conectorului CEM. Fiecare anod poate fi operat în modul de focalizare sau non-focalizare.4 eV pentru Al Kα.saturat. Cum este menţionat mai sus. fie radiaţia Ag Lα la 2984. 416 . şi pulsul sarcinii purtate de norul electronic este detectat ca provenind de la una din particulele incidente şi numărate în canalul preamplificatorului. Puterea maximă este restricţionată la 150 W în modul de focalizare. rezoluţia maximă a monocromatorului de 0.5 x 0. Toate CEMs sunt montate într-o unitate paralelă pe o flanşă cu rol de punte. Unul sau un grup de CEM este folosit într-un aranjament special. Datorită mărimii mici a sursei. În modul de non-focalizare. mărimea spotului de raze X pe anod este de 3. având ca materiale constituente Al şi Ag. De obicei.5 x 4 mm2 (corespunde la 3. în detectarea unei singure particule.2 mm2 pe probă). modul focalizare/non-focalizare este utilizabil pe amândoi anozii.3 eV. Dacă anodul de argint este activat. fiecare particulă incidentă eliberează un nor electronic la ieşirea aranjamentului CEM.25 eV poate fi atinsă pentru Al Kα. câştigul minim pentru operaţia de saturare este de aproximativ 107. a cărui sarcină este independentă de micile schimbări în voltajul multiplicator.74 eV. sunt accelerate la o energie cinetică corespunzătoare în interiorul CEM. ca o componentă de multiplicare electronică pentru analizorii PHOIBOS. 2. monocromatorul este folosit în reflexia Bragg de ordinal 2. această sursă este o sursă cu doi anozi. Principiu de funcţionare Monocromatorul FOCUS 500 de raze X este echipat cu o versiune specială a sursei de raze X XR-50. Dacă modul de focalizare este activat de către acumulatorul XRC 1000 M. Particulele ce trec de ieşirea aperturii. Sursa de raze X pentru FOCUS 500 (XR50 M) 2. numită XR 50 M. Selecţia între anodul 1 şi anodul 2 accesează fie radiaţia Al Kα la 1486.5 x 0. iar XR 50 M trebuie să fie mutat cu 16 mm. Operaţia de saturare este necesară pentru o reflexie a zgomotului suficientă. spotul sursei de raze X pe anod este de 3. Norul electronic emis.5 mm2 (corespunde la 3. un nor electronic format din mai mult de 107 electroni părăseşte CEM. de exemplu.

de către electronii întârziaţi. vor fi generate raze X sau electroni Auger.Efectul de focalizare este obţinut cu ajutorul unei lentile electronice adiţionale. 417 . Figura 14. permiţând o operaţie UHV. amplasată în capul sursei.2.2. Diagrama bloc a principiului de funcţionare a sursei 2. În afară de aceste două procese.2. Voltajul de focalizare este generat de către un amplificator XRC 1000 M şi este transferat la sursa de raze X printr-un cablu de filament prin cele 4 punţi. arătând voltajul şi curenţii pe sursă.1. 2.2. Conectorii de filtrare rapidă permit îndepărtarea rapidă a liniilor de răcire cu apă şi HV (de înaltă tensiune). Aceasta este reflectată după legea lui Bragg pe oglinda elipsoidală din cuarţ în monocromatorul FOCUS 500 şi focalizată pe probă. Modulul XR-50 M (cu alimentarea de apă şi protecţia HV scoase) poate fi încălzit până la 250°C. Dacă aceste locuri vacante sunt umplute cu electroni cu o caracteristică energetică mai înaltă. va fi produsă şi o radiaţie cu o frecvenţă continuă a spectrului. Generarea fotonilor de raze X Dacă un material în stare solidă este bombardat cu electroni de înaltă energie. Diagrama bloc a sursei de raze X este prezentată mai jos. Descrierea sursei 2. care nu există în XR-50 standard. Monocromatorul Radiaţia caracteristică este generată pe anodul XR-50 M şi pleacă de la sursă sub un unghi de 15°. are loc un proces de ionizare al nivelelor electronice.

• Un spot de raze X focalizat pe probă creşte sensibilitatea în XPS pe probe mici. care reduce semnificativ uzajul indus asupra sursei. Prezentarea schematica a monocromatorului FOCUS 500 În anodul dual sunt produse raze X Al Kα (1486. • Eliminarea Bremsstrahlung şi a radiaţiei termale de la sursa de raze X. Monocromatorul aduce următoarele avantaje sursei de raze X: • Distribuţia energetică a razei X cu benzi energetice înguste îmbunătăţeşte selectivitatea chimică.74 eV) sau Ag Lα (2984. Sursa de raze X XR 50 M este montată pe un manipulator după cele trei axe. Sursa este alimentată de către un acumulator XRC 1000 M şi de către o unitate de răcire CCX60.3 eV). • Eliminarea razelor X nedorite de la sateliţi şi impurităţile anodului. Oglinda este făcută dintr-un suport monolitic de încălzire. Manipulatorul oglinzii poate genera trei moduri de mişcare: translaţie (focalizare) şi două direcţii de înclinare.A) Descrierea generală a monocromatorului: Ansamblul cristalului este compus dintr-o oglindă din cristal de cuarţ şi un manipulator al oglinzii. • Un background mai mic. 418 . care simplifică analiza spectrală. Figura 15. îngustând peak-urile spectrului. Este folosit pentru poziţionarea oglinzii în vederea obţinerii unui fascicul de raze X monocromatic. cu plane de cristal monoatomice orientate precis.

de lungime de undă λ cad pe cristal sub unghiul de incidenţă θ. Toate punctele de pe suprafaţă şi unghiul de reflexie 2θ al razei. se află pe un cerc. 2θ = 25. Cercul Rowland este o condiţie geometrică pentru reflexie. Toate punctele de pe suprafaţa cristalului. pentru Al Kα unghiul de difracţie 2θ = 23.149° şi pentru Ag Lα. Configuraţia monocromatorului cristalin elipsoidal Cristalele de cuarţ individuale sunt folosite în procesul de monocromatizare. 419 .851243 nm. 2. Există două cerinţe pentru ca difracţia de raze X să aibă loc în concordanţă cu legea lui Bragg: 1.096°. trebuie să fie constante. va fi focalizată dacă sursa. luând 2d = 0. Când razele X. unghiurile de incidenţă θ1 şi unghiurile de reflexie θ2. Situaţia este explicată de ecuaţia lui Bragg: 2d cosθ = n λ În termenii energiei avem: 2dE cosθ = n 1239. focarul şi suprafaţa oglinzii.8419 nm eV Din cele două ecuaţii rezultă. are loc o interferenţă constructivă după împrăştiere numai dacă drumurile parţiale ale undelor pe plane diferă printr-un număr întreg de lungimi de undă. O sursă de raze X divergentă.B) Monocromatizarea prin difracţia pe cristal Figura 16. trebuie să fie la fel ca şi cele din planul de reflexie.

lărgirea datorată sursei este neglijabilă. poate fi operată în modul non-focalizare.7 eV Pentru Al Kα. Pentru fluxuri înalte. Legea lui Bragg presupune ca unghiul de reflexie să fie independent de punctul reflexiei. Figura 17. Pentru monocromatorul elipsoidal FOCUS 500 sunt folosite doar cristale cu Δθ = ±10" . Aliniatorul sursei de raze X îi dă voie utilizatorului să poziţioneze anodul pe cercul Rowland. Există numeroase ajustări date pentru montajul optic. În modul de focalizare. rezoluţia energetică intrinsecă a FWHM este 167 meV.Condiţia de reflexie necesită ca sursa şi proba să se afle pe cercul Rowland. Diferenţa din ecuaţia Bragg duce la expresia pentru rezoluţia intrinsecă a oglinzii: Rezoluţia energetică intrinsecă la o anumită aliniere a planurilor cristalelor este ΔE=n Δθ (cosθ)2 1456. iar pentru Ag Lα este de 344 meV. Sursa de raze X. cu raza egală cu diametrul cercului Rowland şi să fie tangenţiale la cercul Rowland în punctul c (figura 15). Profilul Gaussian al peak-ului de difracţie al unei raze monocromatice (Al Kα) Curba intensitate-unghi de difracţie pentru un anumit tip de cristal este cunoscută sub numele de “rocking curve”. unde se produce o lărgire datorată diametrelor finite ale spotului sursei de raze X. iar planele reflectoare ale cristalului să fie concave. Poate fi operată în două moduri diferite. XR M 50 este echipată cu o lentilă electrostatică care focalizează electronii pe anod. Ambele condiţii sunt îndeplinite doar pentru reflexia simetrică din punctul c. Ansamblul cristalului poate fi înclinat în două direcţii şi mutat pe direcţia y pentru a duce suprafaţa cristalului pe cercul Rowland. 420 .

mărimea spotului de raze X pe anod este 3. Această lentilă poate focaliza electronii care se fixează pe anod şi astfel este obţinut un spot de raze X de mărime variabilă. Informaţii generale în legătură cu sursa XR 50 M 2.2. Lărgimea spotului de raze X în functie de Puterea maximă şi tensiunea corespunzătoare UL pentru anozii de Al şi Ag.1. UL: Figura 18.5 x 4 mm2 şi sursa de raze X poate fi folosită la putere maximă. Pentru condiţiile optime de focalizare. Datorită mărimii mici a sursei. Figura următoare arată lărgimea spotului pe probă în funcţie de tensiunea de focalizare. Fiecare anod poate opera în modul de focalizare sau non-focalizare. sursa XR-50 M este echipată cu o lentilă electronică în capul sursei. pot fi setate în interiorul sursei XRC 1000 M. Al focalizat (anod 2F). Ag non-focalizat (anod 1N). Aceasta dă un total de patru moduri de operare pe anod: 1. Modul de focalizare În contrast cu sursa standard XR-50. În modul non-focalizare.5 x 0. Dacă modul de focalizare este activat. 2.5 mm2. Această relaţie este setată automatic de către sursa XRC 1000 M. Al non-focalizat (anod 2N).2. Ag focalizat (anod 1F). 3. rezoluţia maximă a monocromatorului de 0. spotul sursei de raze X pe anod este de 3.25 eV poate fi atinsă pentru Al Kα.2. 421 . UL trebuie să varieze liniar cu tensiunea pe anod. 4.3.3.

3. a izolatorilor încărcaţi pozitiv. Temperaturile înalte au ca şi consecinţă suprasolicitarea.1. 2. Componente: 1. Curentul de emisie poate varia de la 0 la 5 mA. fisurarea anodului şi eliberarea apei în camera de vid.2. Informaţii generale Flood-Gun–ul FG 15/40 a fost conceput pentru neutralizarea generală a sarcinilor probelor. . sau semiconductorilor. Diagrama operaţională şi conexiunile electrice ale Flood-Gun-ului sunt arătate în figura următoare: Figura 19. Temperaturi mai mici decât temperatura camerei vor duce la condensarea apei şi fenomene de descărcare în interiorul conductei de apă sau al învelişului de protecţie.2.1. Disiparea maximă de putere pe anod a sursei de raze X. Filament. şi este folosit special pentru aplicaţii XPS.1. Fasciculul de energie poate varia între 0 şi 500 eV. 3. Flood-Gun 15/40 3. Tensiunea şi curenţii necesari pentru operaţia FG-ului sunt asigurate cu PS FG 20.2.5 bar (de obicei 5-6 bar) şi dacă debitul este de aproximativ 2. poate fi obţinută doar dacă presiunea de răcire a apei este mai mare decât 3. Lentile extractoare. Diagrama operaţională • 422 Energia este controlată manual.5 l/m.5-3. de exemplu evaporarea materialului anodului sau în cel mai rău caz.3. Anod. Răcirea cu apă Ca agent de răcire pentru XR-50 M se foloseşte apa. 3.

PA: Saunders College) 11. Schattke W and Van Hove M A (ed) 2003 Solid-State Photoemission and Related Methods: Theory and Experiment (Weinheim: Wiley-VCH Dec. Fitton B and Willis R F 1978 Photoemission and the Electronic Properties of Surfaces (Chichester: Wiley) 4. Sci. Davison S G and Steslicka M 1992 Basic Theory of Surface States (Oxford: Oxford University Press) 9. Meister G and Goldmann A 1993 Temperature-dependent photoemission spectra from Cu(1 0 0) and Cu(1 1 1) surfaces Surf. 56 317-23 8. Bibliografie Cardona M and Ley L (ed) 1978 Photoemission în Solids I (Topics în Applied Physics vol 26) (Berlin: Springer) 2. W.Principles and Applications 3rd edn (Berlin: Springer) 3. Nicolay G. M. Feuerbacher B.. Al (1962). Forster F. Jobory. I.• • Voltajul de extracţie nu este selectabil de către utilizator. Turner.Theory and Current Applications (Studies în Surface Science and Catalysis) 74) (Amsterdam: Elsevier) 5. Eltner B. Schmidt S and Hüfner S 2004 The electron-phonon selfenergy of metallic systems determined by angular resolved high resolution photoemission Physica B 351 229-34 10. Matzdorf R. "Determination of Ionization Potentials by Photoelectron Energy Measurement". Curentul de emisie este independent de energie şi este controlat manual 4. Hüfner S 2003 Photoelectron Spectroscopy. The Journal of Chemical Physics 37:3007 7. Reinert F. Kevan S D (ed) 1992 Angle Resolved Photoemission . 286 56-65 1.) 6. Rev. 423 . D. Ashcroft N W and Mermin N D 1988 Solid State Physics (Philadelphia. Shockley W 1939 On the surface states associated with a periodic potential Phys.

.. Toţi electronii fotoemişi de la adâncimi mai mari în urma penetrării materialului de către radiaţia X (aprox.. 1-5 µm) sunt recapturaţi sau blocaţi în diferite stări de excitare în interiorul materialului..................... Instrumentul de bază pentru măsurarea numărului de 424 .. De asemenea se poate folosi în analiza modificărilor care apar în chimia suprafeţei unui material după ce acesta a fost supus unor tratamente fizico-chimice.. Introducere Spectroscopia XPS este o tehnică de analiză foarte utilă în domeniul cercetării avansate în ştiinţa şi tehnologia materialelor... Emilia Sabina Varga Cuprins 1... măsurătorile XPS trebuie efectuate în condiţii de vid ultra-înalt (UHV) din cauza distanţei la care se află instrumentele de detecţie în instalaţiile XPS.............. C................................... Introducere ..................... faţă de suprafaţa iradiată cu raze X.. La baza cuantificării unui spectru XPS obţinut stă presupunerea că numărul electronilor înregistraţi este proporţional cu numărul de atomi într-o stare dată..... Bibliografie ....... Este important de reţinut că XPS detectează numai acei electroni care ajung în vidul din incinta echipamentului.......436 1...............424 2..S.........................dr. dr...................III................S........... Această metodă permite determinarea elementelor care contaminează o suprafaţă şi uniformitatea compoziţiei elementale la suprafaţă sau în adâncime (depth profiling)............. mai exact cei care pleacă din material de la o adâncime de aproximativ 10-12 nm...... Teodora Maria Radu.............. Pentru a detecta numărul de electroni la fiecare valoare a energiei de legătură (energie cinetica) cu eroare minimă.. Pentru majoritatea aplicaţiilor este de fapt o metodă nedistructivă prin care se determină chimia suprafeţei oricărui material.........Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale C. Înregistrarea energiei cinetice şi a numărului de electroni emişi de la suprafaţa materialului datorită acţiunii razei X de energie hν duc la obţinerea spectrului XPS....... Fiecare element determină un număr caracteristic de vârfuri XPS la valori caracteristice ale energiei de legătură care ne permit identificarea directă a elementelor care există pe suprafaţa investigată...

În aceste spectre de înaltă rezoluţie apar structurările secundare care ne permit studiul complex al elementelor în înconjurarea lor chimică şi structurală. Cu excepţia cazului când electronii emişi sunt înlocuiţi. În marea majoritate a cazurilor primul pas în analiza probei este acela de a înregistra spectrul pe scala energetică maximă disponibilă a spectrometrului pentru a determina elementele prezente pe suprafaţă (survey analysis). Cu ajutorul acestor spectre (“high resolution” spectra) se identifică stările chimice ale elementelor detectate (deplasările chimice) din poziţia şi forma liniilor spectrale. În figura 1 este ilustrat un spectru survey analizat folosind un tabel de cuantificare din baza de date a software-ului de prelucrare a datelor (Casa XPS) pentru regiunile selectate. t%Si1+) sau concentraţiile relative ale stărilor chimice prezente pe suprafaţă (x%Si4+. în consecinţă. Trebuie menţionat că acest tip de analiză se realizează maximizând semnalul obţinut (sensibilitatea) cu preţul degradării rezoluţiei. z%O. Obiectivele principale ale regiunii de cuantificare sunt: definirea domeniului de energie în care semnalul poate fi atribuit tranziţiei de interes şi specificarea tipului de aproximaţie adecvat pentru eliminarea semnalului de fond care nu aparţine vârfului de interes. Pentru a realiza măsurători de încredere şi pentru a putea face intercompararea rezultatelor cu alte laboratoare.electroni înregistraţi pentru o stare atomică este regiunea de cuantificare. Spectrele de înaltă rezoluţie se înregistrează pe domenii energetice restrânse (10-15 eV) micşorând fereastra energetică. capacitatea de calibrare a scalei de energie este dependentă de capacitatea de compensare a sarcinii pozitive acumulate la suprafaţa probei în timpul măsurătorii şi de disponibilitatea unei linii spectrale la o energie de legătură cunoscută care să poată constitui un etalon pentru deplasarea scalei de energie. Aşadar. proba se va încărca relativ la suportul de probă având ca efect apariţia unui câmp electric de întârziere la suprafaţa probei care determină deplasarea spectrului spre energii cinetice 425 . Mai mult. Z%O. Y%Si3+. prin aceasta micşorând transmisia analizorului şi. y%Si3+. Resursele software ajută la o analiză cantitativă (concentraţia relativă a tuturor elementelor prezente pe suprafaţă ) cu o precizie acceptabilă după 2-3 baleiaje a scalei energetice. z%Si2+. crescând rezoluţia energetică. calibrarea cu exactitate a scalei energetice şi a scalei de intensitate este crucială. Y%C. t% C-C). În acest caz numărul de “scan”-uri pe această plajă energetică îngustă va fi mai mare (10–20 baleiaje) pentru că sensibilitatea scade cu creşterea rezoluţiei.. concentraţiile relative ale stărilor de oxidare ale unui singur element ( x% Si4+. din spectrele XPS se pot obţine concentraţiile relative ale elementelor pe suprafaţă ca de exemplu: x%Si. etc.

v. Pentru ilustrarea acestui efect. forma liniilor spectrale sa fie cea mai bună concomitent cu asigurarea că distanţa dintre vârfuri între tranziţii este inde426 .p. Este important de menţionat că. În absenţa compensării efective de sarcină . compensarea de sarcină nu înseamnă neapărat neutralizarea suprafeţei probei ci mai mult stabilizarea suprafeţei probei a.un tun de electroni de energie joasă (flood gun) pentru a restabili o stare de echilibru d. este deplasată cu 120 eV între cele doua situaţii (cu compensare de sarcina şi fără).Figura 1 Exemplificare spectru XPS cuantificat pe o probă cu conţinut de C. pentru materialele izolatoare electronii emişi trebuie înlocuiţi de la o sursă externă .d. Ca. Si şi Mg. C1s. O. î. figura 2 prezintă spectrul unei probe înregistrat înainte şi după compensarea de sarcină [1]. electric. B. mai mici (energii de legătură mai mari). energia masurată pentru o linie fotoelectrică poate varia în funcţie de energia cinetică a electronilor. Linia spectrală a carbonului. Pentru probe conductoare conectate electric la suport echilibrul de sarcină este restabilit uşor.

vârfurile au forma foarte îngustă Măsurătorile XPS prezentate mai jos reprezintă sinteza unor studii complexe pe diferite tipuri de materiale.6 eV). concretizate deja în lucrări ştiinţifice importante. Obţinerea unei energii de legătură corecte pentru o tranziţie cunoscută nu e neapărat un indicator al unei bune neutralizări de sarcină. Măsurătorile au fost realizate cu ajutorul unui echipament de tip SPECS PHOIBOS 150 MCD echipat cu o sursă AlKα monocromatică (hν=1486. Si şi O: a) În absenta neutralizării (flood gun off). [1]. metalul Al oxidează chiar şi în vid iar stratul subţire de oxid se comportă ca un izolator. Figura 2 Efectul compensării de sarcină în spectrul XPS. pe o proba cu conţinut de C. spectrul este deplasat cu 120eV şi distorsionat b) În prezenţa neutralizatorului de sarcina dar cu parametrii de lucru selectaţi incorect. vârfurile sunt largi. acumularea de sarcina este compensată insuficient c) Suprafaţa probei neutralizată corect.pendentă de energia la care sunt măsuraţi electronii. Mai mult. De exemplu. aceste măsurători furnizează informaţii relevante despre limitele şi posibilităţile de îmbunătăţire ale acestei tehnici de analiză. însă forma vârfurilor este bună şi poziţiile relative ale vârfurilor sunt stabile. Avantajele utilizării monocromatorului sunt: reduce semni427 . cu scopul de a pune în evidenţă performanţele tehnice ale echipamentului folosit. Straturile de oxid pe materialele metalice pot transforma un material conductor într-o suprafaţă izolatoare care astfel necesita tratarea lor ca un material izolator. Casa XPS. Un experiment în care compensarea de sarcină este făcută corespunzător necesită de obicei deplasarea în energia de legătură folosind pagina “ Calibration property” din programul de cuantificare al spectrelor.

prezenţa O1s as prep x=0. Presiunea în camera de analiză este în intervalul 10-9. indicată în fig. În acest studiu sunt comparate rezultatele XPS obţinute pentru sistemul (1-x) B2O3·xBi2O3 cu x = 25 – 65 cu echipamentul descris mai sus. a. 3a este prezentată descompunerea spectrului O1s urmărind scenariul propus în literatură. Autorii au propus descompunerea spectrelor O1s obţinute pentru acest sistem în două componente : O1 – asociată legăturilor de tip B-O-B şi O2 atribuită legăturilor B-O-Bi şi Bi-O-Bi. (b) propusă în studiul nostru 428 . ) x=0.6 x=0. cu cele obţinute şi publicate recent [2] în literatura de specialitate cu un echipament similar.6 x=0.875 Intensitate ( u. cu creşterea lui x. În Fig.375 O3 O2 x=0. temperatură de topire joasă. Materialele oxidice cu structură vitroasă pe bază de Bi2O3 prezintă interes foarte mare atât din punct de vedere ştiinţific cât şi tehnologic deoarece prezintă proprietăţi fizice mai bune decât alte sticle: coeficienţi de expansiune termică mari. Prin măsurarea probei B2O3 autorii au determinat poziţia vârfului O1s la o valoare a energiei de legătură de 533.375 (a) O1 (b) 540 535 530 525 520 Energie de legatura (eV) 540 535 530 525 520 Energie de legatura (eV) Figura 3 Deconvoluţia spectrului O1s de înaltă rezoluţie: (a) aşa cum a fost sugerată in literatură. transmisie în ultraviolet (UV) şi caracteristici optice. Proba care urmează a fi analizată este fixată pe un suport de molibden cu ajutorul unei benzi dublu adezive de carbon.3a prin linia punctată. asigură o rezoluţie energetică şi spaţială foarte bună.2 eV. elimină sateliţii din spectru (vârfuri secundare care însoţesc tranziţiile de interes) . a. Măsurătorile se realizează utilizând o sursă de raze X de putere 250 W.ficativ fondul de radiaţie. î.10-10 mbar. spectrul O1s se deplasează spre energii de legătură mai mici. pe acelaşi tip de probe.875 O1s as prep x=0. Se observă că.

în timp ce componenta atribuită legăturilor de tip B-O-B scade continuu a. Rezultatele XPS obţinute pentru sistemul cu raport Ti:Si 1:2.monocromata) în laboratorul nostru. iar spectrul de înaltă rezoluţie corespunzător Ti 2p pentru substratul de Ti:Si 1:2 (Fig. Bi-O-B şi Bi-O-Bi. pentru proba cu x = 0. deoarece prezintă o fotoactivitate mult crescută faţă de oxidul de titan pur. Astfel. după cum se poate observa din spectrul survey prezentat în Fig. cu creşterea conţinutului de Bi. Bi2O3 devine aşadar formator de reţea vitroasă ceea ce determina creşterea stabilităţii chimice a probelor. cu preponderenţa fazei de siliciu la suprafaţă.875. 4B). Fotopicul O1s prezintă o formă complexă. indică prezenţa TiO2 evidenţiat 429 . Spectrul O1s pentru această probă constă din două componente atribuite legăturilor de tipul Bi-O-B şi Bi-O-Bi. O categorie de probe pe care au fost efectuate măsurători XPS în scopul evaluării modificărilor structurale induse la suprafaţa acestor sisteme prin aplicarea tratamentelor termice o reprezintă nanocompozitele pe bază de Si şi Ti preparate prin combinarea metodei sol-gel cu metoda uscării prin pulverizare. indică prezenţa oxigenului şi a carbonului de contaminare. spre deosebire de [3]. Acest tip materiale a atras o atenţie deosebită în ultimii ani [4. 5] în special pentru aplicaţii de fotocataliză. s-a reuşit o analiză mult mai detaliată a tipurilor de legături şi a modificărilor care apar la nivelul acestora în probe cu creşterea conţinutului de Bi. Începând cu proba tratată termic la 700°C. 4B). împreună cu Ti. Analiza fotopicului Si 2p (102 eV) identifică formarea SiO2 (Fig.componentei B-O-B în spectru. la 532.83 eV pentru cea tratată la 1400 eV. nu mai poate fi clar evidenţiată. acest studiu confirmă faptul că rezoluţia spectrelor înregistrate are un rol foarte important în analiza şi modul de interpretare a datelor. Prin creşterea temperaturilor de tratament termic acesta se deplasează de la 530.84 eV pentru proba netratată termic. asimetrică datorită suprapunerii mai multor componente specifice oxigenului din structura sistemului investigat (Fig. concentraţia legăturilor de tip Bi-O-Bi creşte. Ţinând cont de echipamentul de înaltă rezoluţie utilizat în achiziţionarea acestor spectre (sursa -AlKα. vârful corespunzător oxigenului din reţeaua TiO2 (Ti-O-Ti) prezent în jurul valorii de 530. î. În Fig.5 eV şi cel corespunzător oxigenului în reţeaua SiO2 (Si-O-Si) observat la 532. Si şi Gd. 4A.8 eV sunt bine separate (Fig. 4C). Se observă că. O2 şi O3 atribuite legăturilor de tipul B-O-B. 4D). 3b este prezentată deconvoluţia spectrului O1s cu trei componente: O1. şi de valorile energiilor de legătură ale oxigenului în B2O3 şi Bi2O3 raportate în literatură [3]. indicând o segregare a celor doua faze. această componentă nu mai poate fi pusă în evidenţă.

a.28 % pentru proba netratată termic. 4B). (e) 1100°C şi (f) 1400°C.) Ti 2p (f) (e ) (d ) (c ) (b ) (a ) 1200 900 600 300 0 E n e r g ie d e le g a t u r a ( e V ) Energie de legatura (eV) (C) (D) (f) (e) (d) (c) (b) (a) Intensitate (u.89 % pentru proba tratată termic la 1100°C. (c) 700°C. fapt datorat îndepărtării oxigenului specific compuşilor organici sau grupărilor OH.0 eV (Ti 2p3/2) şi 464. (C) Si 2p.) (f) (e) (d) (c) (b) (a) 110 105 100 95 90 470 465 460 455 450 Energie de legatura (eV) Energie de legatura (eV) Figura 4A: Spectrele XPS survey pentru sistemul Ti:Si 1:2 (a) netratat termic. 430 . (c) 700°C.05 %. După cum se poate observa din Tabelul 1. (d) 900°C. cantitatea de Ti 2p la suprafaţă descreşte de la 12. pentru (a) proba netratată termic precum şi pentru probele tratate termic la (b) 350°C. la 2.87 % la 38. cum sunt atomii de Si în reţeaua SiO2. Formarea celor doi oxizi (SiO2 şi TiO2) este confirmată şi de forma vârfului O 1s (Fig. prin peak-ul de la 459. Acest fapt poate fi explicat printr-o migrare a titanului de la suprafaţă spre interior şi a siliciului din interior spre suprafaţă. respectiv tratat termic la (b) 350°C.Ti LMM C KLL Gd 3d O KLL O 1s Gd 4d (A ) Si 2p C 1s (B) (f) (e) (d) (c) (b) (a) 545 540 535 530 525 Intensitate (u. (d) 900°C. dar mai ales separării celor două faze. (D) Ti 2p. în timp ce cantitatea de Si 2p creşte de la 16.Spectrele XPS de înaltă rezoluţie corespunzătoare (B) O 1s. Cantitatea de oxigen la suprafaţa probelor descreşte odată cu creşterea temperaturii de tratament.5 eV (Ti 2p1/2). (e) 1100°C şi (f) 1400°C . reflectându-se astfel o substituţie a atomilor de Ti de către atomi cu o electronegativitate mai mare şi polarizabilitate mai mică.a.

excepţie făcând fotopicul de C 1s (Fig.498 Si 2p 16. După procedura de imersie.640 58.156 0. Pentru măsurători ulterioare pe probe funcţionalizate cu diverse tipuri de proteine este reco431 .688 64. Concentraţia relativă a principalelor componente. BSA şi Fg reprezintă principalele componente plasmatice şi proteinele relevante care se adsorb la suprafaţa biomaterialelor care intră în contact cu sângele.829 59. Pentru exemplificare sunt prezentate caracteristicile de adsorbţie a albuminei serice bovice (BSA) şi a fibrinogenului (Fg) la suprafaţa unui compus aluminosilicatic cu conţinut de Fe şi Y preparat prin metoda sol-gel (60%SiO220%Al2O310%Fe2O310%Y2O3 .22 0. B)).148 0.18 0.164 27. 5 (A. Ceramicele vitroase aluminosilicatice sunt foarte stabile în organism iar prin adăugarea oxidului de fier şi ytriu ele pot fi optimizate pentru aplicaţii simultane de hipertermie şi radioterapie [6]. Biocompatibilitatea este dictată de modul în care proteinele se adsorb la suprafaţa materialului odată ce acesta intră în contact cu mediul biologic. XPS ne permite de asemenea studiul biocompatibilităţii diferitelor tipuri de materiale. 4B) sunt de asemenea deplasate spre energii de legătură mai mari. de la 101. Spectrul XPS survey înregistrat înainte de imersie prezintă doar fotopicuri corespunzătoare elementelor care intră în compoziţia sistemului (Y 3p.875 24.procente molare). Temperatura de tratament termic (ºC) Netratat termic 350 700 900 1100 1400 Compoziţia elementală (% at. Motivul acestei deplasări este corelat cu deplasarea spectrelor O1s şi cu migrarea atomilor de Si spre suprafaţă odată cu creşterea temperaturii de tratament termic. Fe 2p.331 Ti 2p 12.684 62. probele spălate şi uscate au fost analizate cu ajutorul spectroscopiei XPS. Experimentele de adsorbţie a proteinelor s-au realizat prin imersarea compusului aluminosilicatic în lichid biologic simulat (SBF) îmbogăţit cu BSA.653 38.9 eV pentru proba tratată termic la 1400°C. dar şi datorită benzii dublu adezive de carbon pe care a fost imobilizată proba pentru măsurare.Tabel 1. Prezenţa carbonului se explică prin expunerea probei la atmosferă.428 62.) O 1s 70.76 29.549 2.37 Spectrele de înaltă rezoluţie corespunzătoare Si 2p (Fig. pentru sistemul Ti:Si 1:2.057 34.260 9.367 7.281 11.894 5. precum şi în soluţie tampon fosfatică (PBS) îmbogăţită cu Fg. înainte şi după tratamentul termic.43 eV pentru proba netratată termic la 102. Si 2p şi Al 2p) pentru toate probele investigate.798 Gd 3d 0.15 0.

2 23 Fe 0.21 35. azotul poate fi utilizat ca un indicator sigur al ataşării proteinelor. Rezultate similare au fost obţinute pentru ambele proteine (BSA/Fg) utilizate pentru funcţionalizare.) (d) (c) (b) (a) Si 2s Si 2p Al 2p O 2s (d) (c) (b) (a) 1200 800 400 0 1200 1000 800 600 400 200 0 Energie de legatura (eV) Energie de legatura (eV) Figura 5 Spectrele XPS survey înainte de imersie (a) şi după 5 minute (b). Este de remarcat faptul că pentru suprafeţele funcţionalizate cu proteine.68 6. concentraţia de azot a fost practic zero înainte de imersie în soluţiile cu proteină (Tabel 2. 3).3 2.46 0.54 36.a. Deoarece. Rapoartele N:C de 0. Fe 2p. Timpul de imersie 0 5 min 2 ore 24 ore C 6.08 37.75 0. denotă o ataşare rapidă a proteinei la suprafaţa compusului. Tabel 2.92 28. Si 2p şi Al 2p a fost mai puţin evidentă datorită stratului de proteină format (Tabel 1. Concentraţia relativă a principalelor componente. 2 ore (c) şi 24 ore (d) de imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). centrate la 398.04 0.2 şi 400 eV. Fotopicul N 1s înregistrat la aproximativ 400 eV este tipic pentru azotul din compuşii organici [8].71 1.46 6. detecţia elementelor Y 3p. În acelaşi timp.) O Al Si 53.49 0. 6) de înaltă rezoluţie scoate în evidenţă două componente.16 2. 2). înainte şi după imersia în soluţiile de SBF/BSA.67 Compoziţia elementală (% at.18 0.mandată utilizarea benzii de In în locul celei de C.21 N 5.7 37.43 28.a.03 Y 0.) Fe 2p Y 3p Intensitate (u. înregistrate deja după un timp de imersie de 5 minute.19 1.2 respectiv 0. caracteristice grupărilor C-NH2.93 33.42 432 .47 25. Măsurătorile XPS de concentraţie de azot pot fi utilizate şi ca metodă indirectă de determinare a cantităţii de proteină adsorbită la suprafaţă [7]. datorită azotului prezent în fiecare aminoacid component al proteinelor. O 1s O KLL C KLL N 1s Y 3p C 1s Si 2s Si 2p Al 2p (A) O KLL C KLL Fe 2p O 1s C 1s (B) N 1s Intensitate (u.77 25.5. Deconvoluţia spectrelor de N 1s (Fig. analiza spectrelor survey indică fotopicuri corespunzătoare N 1s.

02 0.92 43.) 405 400 395 Energie de legatura (eV) 390 (a) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) Figura 6 Deconvoluţia spectrelor XPS de înaltă rezoluţie ale N 1s pentru BSA/Fg liofilizat (a) după 5 minute (b).18 0.11 51. proteina mai mare. înainte şi după imersia în soluţiile de PBS/Fg. (Fg).83 Al 2.96 13.81 48.75 0.5 13.) (c) (c) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) (b) (b) Intensitate (u. şi 24 ore (c) imersie în soluţiile de SBF/BSA (coloana stângă) şi PBS/Fg (coloana dreapta).02 10.52 O 53.3 0.41 0. În plus.a.) C 6. produce un semnal de azot mai intens decât proteina mai mică. Timpul de imersie 0 5 min 2 ore 24 ore Compoziţia elementală (% at.8 0. Intensitate (u.08 29.Tabel 3.16 - Analizele XPS confirmă creşterea conţinutului de azot după diferite perioade de imersie.69 11.02 Fe 0. (BSA).1 Si 36.a.26 23. Concentraţia relativă a principalelor componente.) 410 405 400 395 390 410 Energie de legatura (eV) (a) Intensitate (u. aşa cum este de aşteptat.01 Y 0. 433 .53 N 10.77 15.a.25 27.

este un indicativ al formării unui monostrat complet de proteină [9]. evidenţiind ataşarea proteinelor la suprafaţa materialului şi totodată biocompatibilitatea materialului investigat [10-12]. datorită ataşării la suprafaţă a BSA/Fg-ului cu un conţinut scăzut în oxigen faţă de compusul oxidic utilizat (Fig. conţinutul semnificativ diminuat al O 1s (Tabel 2. 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B).) (e) (d) (c) (b) (a) 292 288 284 280 276 272 Energie de legatura (eV) 292 288 284 280 276 272 Energie de legatura (eV) Figura 7 Spectrele XPS de înaltă rezoluţie ale C 1s înainte de imersie (a). După imersia în soluţiile cu proteină.Potrivit rezultatelor publicate anterior privind adsorbţia proteinelor. (A) (B) Intensitate (u.) (e) (d) (c) (b) Intensitate (u. o cantitate de 14% N.) (B) (e) (d) (c) (b) (a) 545 540 535 530 525 545 540 535 530 (a) 525 Energie de legatura (eV) Energie de legatura (eV) Figura 8 Spectrele XPS de înaltă rezoluţie ale O1s înainte de imersie (a).a. După imersia în soluţiile cu proteine. respectiv Fg-ului la 531. pe baza componentei BSA-ului de la 530. ale C 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c). 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). În cazul probelor imersate în soluţiile cu proteină. 3) corespunde în mare parte oxigenului peptidic constituent al proteinelor. (A) Intensitate (u.2 eV (Fig. 7) sunt mai largi şi prezintă o formă asimetrică. ale O 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c).3 eV.a.8). în cazul Fg-ului (Tabel 3). semnalele de înaltă rezoluţie ale C 1s (Fig.) (e) (d) (c) (b) (a) Intensitate (u.a.8B) Astfel spectroscopia XPS a fost utilizată cu succes în acest studiu. 434 .a. semnalând formarea unor noi tipuri de legături specifice carbonului în proteine [8]. fotopicul O 1s este evident lărgit şi se deplasează spre energii de legătură mai mici.

300 şi 500°C. Linia gri reprezintă spectrul obţinut pentru fiecare din cele trei probe fără nanoparticule de Au. Au0 şi Auδ. având despicarea. Acest tip de materiale furnizează avantaje valoroase şi în diagnosticarea cancerului sau imagistica biomedicală.Biomaterialele dopate cu particule nano ( Au. Ag) prezintă un interes crescut datorită caracteristicilor remarcabile ale acestora.7[61.0 0. [14]. Au0 şi Auδ+. 435 . Au 4f7/2 şi Au 4f5/2. Spectrul Au4f este caracterizat de două componente spin-orbită. Mai jos sunt prezentate rezultatele XPS cu privire la nucleaţie şi procesul de creştere a nanoparticulelor de Au în sticla bioactivă CaO-SiO2-P2O5 tratată termic la diferite temperaturi.0 0.6 0.6 T (°C) Au 5d T(°C) 500 δ+ 500 0. are importanţă ştiinţifică mare datorită faptului că demonstrează foarte clar legătura care există între dimensiunea nanoclasterilor care se formează în matrice şi modificările observate în spectrul Au4f şi cel al benzii de valenţă cu creşterea temperaturii de tratament a probei. Identificarea speciilor de Au prezente în probe este foarte importantă deoarece studii recente au demonstrat faptul că toxicitatea nanoparticulelor de Au în tratamentul cancerului depinde de sarcina acestora [13]. 83. Aceste rezultate furnizează dovezi experimentale complete pentru corelaţia dintre dimensiunea şi structura electronică a nanoparticulelor de Au care a fost prezisă teoretic.95 eV.72 şi 85. ce deschid noi oportunităţi în medicină.3 0.5SiO2·30. Deconvoluţia liniilor spectrale indica prezenţa speciilor de Au Auδ+.3 0. ΔE = 3.3 0.7P2O5] tratată termic la 110.3Au2O3·99. Au4f δ0 ΔE 0. Deconvoluţia spectrului Au4f înregistrat pentru probele tratate termic la 300 şi respectiv 500 °C prezintă trei dubleţi la energiile de legătură: 82. Acest studiu publicat recent. (b) Spectrul XPS al benzii de valenţa (Au 5d) obţinut pe aceleaşi probe.8CaO·7.0 16 (b) 110 (a) 92 90 88 86 84 82 110 80 12 8 4 0 Energie de legatura (eV) Energie de legatura ( eV ) Figura 9(a) Spectrul XPS obţinut pentru Au 4f pe proba 0.67 eV.în fiecare proba. atribuiţi la trei specii de Au diferite: Auδ-.6 Intensitate (u. a. ) 300 300 0.

R. Bibliografie 1. 10. Y. 169-183.. 2006. (2008) 2325 Oana Ponta. P. E. J. 257(2011) 2346-2352 L. Simon.. J. Bickford. Simon. Honma et al. Arvidsson. West. 764–76. Y. D. Radu. C. A New Era for Cancer Treatment: Gold-Nanoparticle-Mediated Thermal Therapies.P. Cavalu. Currie. Kennedy. 2009. Dahl O. 8. L. Mocuta. Vanea. 9. Simon. Saramago. 436 . Coughlin. Hulshof MCCH. 21:12327–12332. 9. Langmuir 2005. Phys. Applied Surface Science. Simon. “Dual-Beam” Charge Neutralisation for monoXPS T. Cavalu. Structural characterization of some silicate xerogels and microspheres. S. Hu. Vanea. Simon. 10. 2011 T. Appl. Glasses. M.. 180. S. Neumann. Gispert. Benea. doi:10. No. Day. 6. Pasche S. R. L. Ciceo-Lucacel. B. Simon. J. Solid State Ionics. D. 43.L. V. of Solid State Chem. O. 55. N.78A:581-589. V. 2008. S. Textor. Chem. A. A. et al. Castner. Simon. 163. Stenport. Int J Hyperther 2009. J Mater Sci: Mater Med. XPS study of protein adsorption onto nanocrystalline aluminosilicate microparticles. Ponta. 2. G. Sul. Gonzalez Gonzalez D.. O. J. 13. Martins. M. Neumann. Small 7. S1. M. Prinz. M. Lewinski. 5. M. Serro. E.1063/1.3681307 14. 16. 7. R. J Biomed Mater Res. Neumann. 4.32-40. 3. Ponta and S. Prinz. Colaco. S.C. PhD Thesis. A. V. Simon. 11. Adv. vol. A. Opt. M. 2009. E. E. Vanea. S. December 2010 Overgaard J. Dimitrov et al. 25:323-334.T. Kjellin. R. Brogueira. Mat. F. 2002. European Cells & Materials. Drezek. A. V. J. P. V. 12. R. 100-112 (2002). Michel. V. P. M. H. Arcangeli G. S.2. S. M. Phys. Mella O. 20:1869-1879.

........... 447 3.... 449 4...... SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN Spectroscopia de rezonanţă electronică de spin C........................2.2......................... 438 1............................S.......................................................................................................................... 443 3..............................................3........ Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 ... RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale......................XII.......................................................................................... Caracterizarea instalaţiei experimentale RES ......................................................................... Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1................... 451 1............. Spectrometrul portabil RES ADANI PS8400 .... 447 3..................... 441 2................................. 447 3....... Principiul de funcţionare al unui spectrometrul RES.. Bibliografie ................... Interacţiunea Zeeman ..........1....... dr...1........... Metoda constă 437 ........................................................................................... Consideraţii teoretice Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor energetice ale centrilor paramagnetici.......................................................................... Consideraţii teoretice ...... Hamiltonianul de Spin ... Obţinerea şi analiza spectrelor RES ..................... 437 1..

procesele electrochimice.în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi (de exemplu. sub acţiunea unui câmp de microunde cu o anumită frec438 . Prin utilizarea unor tehnici specializate variate (cum ar fi metoda capcanelor de spin şi a radicalilor nitroxidici. atomii interstiţiali dintr-un cristal sau matricea unei sticle. geologie. cel mai cunoscut din această clasă este centrul F. Astfel. este folosită în cazul experimentelor RES. Frecvenţa de ordinul gigahertzilor (GHz).). ştiinţele medicale. etc. 2]. De exemplu. schimbul electronic. 5. De-a lungul anilor. 1. în domeniul microundelor. Sisteme cu trei sau mai mulţi electroni neîmperecheaţi. Sisteme cu stare fundamentală de triplet (cu doi electroni neîmperecheaţi care interacţionează puternic). un electron prins într-o vacanţă ionică negativă. 6. ESEEM şi ENDOR) în conjuncţie cu RES este posibil să se obţină informaţii detaliate privind unele teme de interes ştiinţific.1. 4. spectroscopia RES a fost cu succes aplicată în diverse domenii ca biologie. astfel încât interacţiunea lor să fie slabă). structura cristalină. Sisteme cu electroni de conducţie (metale şi semiconductori). lichidă sau gazoasă. 2. Biradicalii (molecule ce conţin doi electroni neîmperecheaţi. Ioni ai metalelor tranziţionale şi ai pământurilor rare [1. antropologie.2]. cataliza şi reacţiile de polimerizare au fost toate studiate cu mare succes. Radicalii liberi în stare solidă. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. Solidele. ştiinţa materialelor. În cazul experimentelor de Rezonanţă Magnetică Nucleară (RMN). Interacţiunea Zeeman Metoda RES constă în studiul tranziţiilor induse între două subnivele Zeeman vecine. suficient de depărtaţi unul de altul. fizică. chimie. Defecte punctuale (imperfecţiuni localizate în cristale) în solide. etc. procesele de cinetică. Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. frecvenţele utilizate sunt de ordinul megahertzilor (MHz) din domeniul vizibil la cel ultraviolet. lichidele şi gazele sunt deopotrivă accesibile spectroscopiei RES. 7. Sistemele tipice care pot fi studiate prin RES sunt: 1. 3.

venţă numită frecvenţă de rezonanţă [1]. efect denumit efect Zeeman. În urma absorbţiei de energie electronii trec de pe nivelul de energie inferior pe unul superior. în energie. care este privită clasic ca o rotaţie în jurul propriei axe. 439 . Asemenea tranziţii corespund la o schimbare în momentul unghiular de spin de ( ± ). Astfel. ecuaţia (2) poate avea doar două forme pentru o orientare dată a câmpului magnetic B: ⎛ 1⎞ E↑ = +⎜ ⎟ ⋅ β ⋅ g ⋅ B ⎝ 2⎠ . Diferenţa de energie în spectroscopia RES este predominant datorată interacţiunii electronilor neîmperecheaţi din probe cu câmpul magnetic produs de un magnet.este momentul cinetic de spin. orientarea spinului trecând din cea paralelă cu câmpul în poziţia antiparalelă cu acesta. paralelǎ sau antiparalelǎ cu câmpul magnetic. Un foton are momentul unghiular intrinsec egal cu . iar γ este raportul giromagnetic electronic. se cunoaşte faptul că electronul posedă o proprietate cuantică numită “spin”. ⎛ 1⎞ E↓ = −⎜ ⎟⋅ β ⋅ g ⋅ B ⎝ 2⎠ (3) Regula de selecţie pentru tranziţia unui spin electronic este Δ M S = ± 1 . netic de spin care poate lua valoarea M S → → (2) β = γ ⋅ . Ca urmare a acestei rotaţii electronul posedă un moment cinetic de spin S căruia i se asociază un moment magnetic μ S : → → μ S = −g ⋅γ ⋅ S → → (1) unde g este factorul Landé care pentru electronul liber are valoarea 2. Din această cauză dacă Δ M S = + 1 când un foton este absorbit M I (numărul cuantic magnetic nuclear) trebuie să rămână neschimbat pentru ca momentul unghiular total să se conserve. depinde de intensitatea câmpului magnetic aplicat.0023. Introdus într-un câmp magnetic static B. S . Astfel. Energia interacţiunii Zeeman a unui electron într-un câmp magnetic aplicat B este dată de relaţia: E Zeeman = − μ s ⋅ B = g ⋅ β ⋅ B⋅ M S unde β este magnetonul Bohr. Diferenţa dintre cele două direcţii ale spinului. Astfel regulile de selecţie impuse sunt Δ M S = ± 1 şi Δ M I = 0 . iar MS este numărul cuantic mag= ± 1 2 . spinul electronului poate avea două orientări.

Figura 1. iar B câmpul magnetic aplicat. Această energie.Cu alte cuvinte. 1) sunt reprezentate schematic energiile Zeeman funcţie de magnetizarea câmpului aplicat B. de obicei se obţine de la o sursă de energie electromagnetică. Rezultă de aici condiţia de rezonanţă: h ⋅ν = g ⋅ β ⋅ B (4) unde h este constanta lui Planck. în cazul unui electron neîmperecheat (S=1/2). spectrul RES măsoară energia necesară tranziţiei electronului (ΔE) între cele două nivele energetice. De asemenea. Parametrul g determină poziţia liniei de absorbţie. într-un câmp magnetic exterior. De obicei linia de absorbţie nu este singulară apărând uneori un spectru de multipleţi datorită existenţei nucleelor magnetice în specia paramagnetică. Nivelele energetice şi absorbţia de rezonanţă RES pentru interacţia Zeeman a unui electron (S = 1/2) În (Fig. având o frecvenţă fixă de oscilaţie ν şi deci energia (h·ν). 440 . figura ilustrează tranziţia între nivelul de energie inferior « spin jos » şi nivelul de energie superior « spin sus » indusă prin introducerea probei în câmpul de microunde de frecvenţă ν. Spectrul de absorbţie măsurat la condiţia de rezonanţă este schematic reprezentat în partea de jos a figurii. ν frecvenţa de rezonanţă.

reprezintă energia ionului liber care nu depinde de spin. HSS – reprezintă interacţiunea de structură fină în aproximaţia de ordin II (sau termenul de despicare în câmp nul). termenul E fiind 0. Dacă simetria este axială. deci depind de forma funcţiei de undă şi de câmpul cristalin. Hamiltonianul de spin conţine o serie de coeficienţi care sunt mărimi tensoriale. Hamiltonianul de Spin Fenomenul RES poate fi tratat teoretic prin două metode: tratarea clasică cu ajutorul teoriei lui Bloch şi tratarea cuantică. D şi E reprezintă constantele de despicare în câmp nul. iar ultimii doi sunt termenii ce dau structura fină.1. axială. ƒ HC – termenul câmpului cristalin şi reprezintă influenţa câmpului electrostatic cristalin. Folosind teoria perturbaţiilor se ajunge la forma bine cunoscută a hamiltonianului de spin: 1 ⎤ 2 2 2 Hs = β ⋅ ( g xx S x Bx + g yy S y By + g zz S z Bz ) + D ⋅ ⎡ ⎢S z − 3 S (S + 1)⎥ + E ⋅ (S x − S y ) (6) ⎣ ⎦ Primul termen din acest hamiltonian este aşa numita interacţiune Zeeman.2. HLS – este interacţiunea spin – orbită. ƒ HN – reprezintă termenul interacţiunii hiperfine. ƒ HD – descrie proprietăţile diamagnetice. Toţi coeficienţii tensoriali din expresia hamiltonianului de spin se exprimă prin matrici care pot fi diagonalizate. respectiv rombică. ƒ HZ – reprezintă interacţiunea electronului cu câmpul magnetic exterior (termenul Zeeman). ƒ HQ – interacţiunea electrostatică cu momentul de cuadrupol q al nucleului. În esenţă hamiltonianul de spin este un operator echivalent care acţionează numai asupra coordonatelor de spin conducând la aceleaşi rezultate ca şi hamiltonianul total al sistemului. rămân în hamiltonian numai termenul Zeeman şi termenul în D. este descrisă printr-un hamiltonian compus din mai mulţi termeni [1]. H0 . şi anume: H=H0+HLS+HSS+HZ+HN+HQ+HD+HC unde. Starea unui ion paramagnetic având spinul nuclear nenul. Cel mai simplu formalism pentru interpretarea spectrelor RES este cel al hamiltonianului de spin. introdus într-o reţea cristalină şi aşezat într-un câmp magnetic static. 441 (5) ƒ ƒ ƒ .

442 . Interacţiunea dintre momentul magnetic de spin şi un moment magnetic nuclear se numeşte interacţiune hiperfină. Dacă câmpul magnetic este direcţionat paralel cu direcţia axelor moleculare atunci situaţia este identică cu relaţia (7). SZ este operatorul de spin corespunzător proiecţiei acestuia după axa z. pentru o simetrie axială hamiltonianul de spin are următoarea formă: H = g // ⋅ β ⋅ B Z ⋅ S Z + g ⊥ ⋅ β ⋅ B X ⋅ S X (8) unde BZ este componenta câmpului magnetic de-a lungul axei z (paralel).Cea mai simplă formă a hamiltonianului de spin este pentru un singur electron cu g izotrop. Acest termen reprezintă interacţiunea momentului cinetic de spin I cu momentul de spin electronic S . descrisă de hamiltonianul de mai sus. Tocmai această interacţiune produce structura hiperfină a nivelelor energetice de spin. BX este componenta câmpului magnetic de-a lungul direcţiei perpendiculare (x). Termenul HN (ecuaţia 5) reprezintă termenul interacţiunii hiperfine. Hamiltonianul de spin care descrie starea energetică a unui centru paramagnetic electronic în interacţiune cu n nuclee cu spinul nuclear diferit de zero va fi: H = → → ~⋅ S + S ⋅ A ⋅ I i β ⋅ B⋅ g ∑ i i =1 → → n → ~ → (10) unde. Ordinul de mărime al energiei hiperfine este de 0 ÷ 10-2 cm-1. Pentru un singur electron cu g anizotrop hamiltonianul de spin este mai complicat din cauza diferiţilor operatori ai proiecţiei spinului. în cazul unor simetrii nesferice atât g. şi are următoarea formă: H = g ⋅ β ⋅ B ⋅ SZ (7) unde direcţia câmpului magnetic este aleasă ca fiind axa z. cât şi Ai sunt mărimi tensoriale. De exemplu. fără interacţiuni hiperfine corespunzător ecuaţiei (4). Hamiltonianul de structură hiperfină produce o despicare simetrică a nivelelor energetice şi are următoarea formă: HN → ~ → = S⋅ A ⋅ I (9) unde A este tensorul interacţiunii hiperfine.

Deoarece sensibilitatea instrumentului creşte proporţional cu pătratul frecvenţei. trebuie luate în considerare contribuţiile la momentul magnetic ale mişcării orbitale a electronului. Pentru un electron liber. Pentru radicalii liberi. ceea ce duce la scăderea sensibilităţii. există limitări tehnice legate de utilizarea benzilor de frecvenţă ridicate: folosirea de probe de dimensiuni mici. Tuburile au diametre de câţiva milimetri şi lungimi de ordinul centimetrilor. În sistemele chimice. Acest câmp perturbator se poate adăuga sau scădea la câmpul exterior. Măsurătorile RES se pot efectua pe probe gazoase. Valoarea lui g definită prin 443 . soluţii îngheţate. pulberi şi monocristale. obţinând o valoare a lui Δg pozitivă sau negativă. se datorează unui slab câmp perturbator indus. este indicat a se folosi cuarţul. având în vedere posibilităţile de absorbţie şi de a da semnal RES al sticlei obişnuite. abaterea factorului g de la valoarea 2. rezultă că se obţine o rezoluţie spectrală mult mai bună o dată cu creşterea frecvenţei de microunde. Probele se introduc de obicei în tuburi şi.2. Spectrul RES al unui centru paramagnetic cu spinul ½ este bine definit dacă se cunosc tensorii g (factorul de despicare spectroscopică) şi A (constanta de despicare hiperfină).0023. g rămâne apropiat de valoarea electronului liber.0023. creşterea absorbţiei o dată cu creşterea frecvenţei. pentru probe sub formă de soluţii. Totuşi. Cu toate acestea în probele care conţin centri paramagnetici intervin o serie de factori care abat valoarea factorului g de la valoarea amintită mai sus. valoarea factorului g este ge = 2. Factorul g este o mărime tensorială caracterizată prin trei valori principale. Aceşti tensori dau cele mai importante informaţii cu privire la structura centrului paramagnetic studiat. electronii neîmperecheaţi ocupă un orbital care poate fi localizat pe un singur atom sau poate fi delocalizat pe o întreagă moleculă sau pe un radical. dificultăţi de obţinere a omogenităţii câmpului (δH/H) la frecvenţe mari. provocat de mişcarea orbitală. În expresia factorului g. în afara unei mărimi constante intervine o mărime care dă abaterea factorului g de la valoarea corespunzătoare electronului liber. notată Δg.5 GHz) şi Q (∼ 35 GHz). Unul din factori este datorat faptului că electronul posedă în plus un moment unghiular orbital căruia i se asociază un moment magnetic. Astfel. În celelalte cazuri. Obţinerea şi analiza spectrelor RES În experimentele RES cele mai utilizate benzi de frecvenţe de microunde sunt benzile X (∼ 9. În felul acesta în sisteme cu un electron neîmperecheat şi legătură π. momentul de spin şi cel orbital se pot combina.

S – numărul cuantic de spin. Liniile de rezonanţă ale probelor solide sunt considerabil distorsionate de anizotropia factorului g sau de cuplajul dintre spinii electronici şi nucleari. deoarece ambele depind de saturaţie [3].00 sau mai mult. pentru care g = 2.relaţia g = h ⋅ν . Acestea sunt exemple de tehnici neliniare. Astfel. utilizând valorile măsurate ale frecvenţei şi câmpului la rezonanţă. L – numărul cuantic orbital. factorul g este calculat din condiţia de rezonanţă. Valoarea lui g depinde de orientarea câmpului magnetic extern în raport cu cel electric cristalin şi este o mărime tensorială. De obicei se lucrează în banda X. dar poate ajunge la 9.0. 444 . pentru semnale cu g ~ 2. valoarea lui g pentru un sistem paramagnetic oarecare se calculează utilizând următoarea relaţie: g = g etalon ⋅ B etalon B proba (12) Există posibilitatea de a combina metode în care pot fi îndeplinite mai multe condiţii de rezonanţă pe lângă cele referitoare la spinul electronic. cât şi de condiţiile experimentale. Prezenţa anumitor tipuri de interacţiuni are ca efect lărgirea sau îngustarea liniei de rezonanţă. În acest caz valoarea factorului g depinde de numerele cuantice J. poate fi β ⋅B diferită de 2. acestea sunt influenţate atât de caracteristicile fizico-chimice ale substanţei paramagnetice. În ceea ce priveşte forma şi lărgimea semnalului RES. mai rar scade mult sub această valoare.00 .0036. cunoscută şi sub denumirea de g efectiv (gef ). Pentru a determina valoarea factorului g mai uşor. se poate introduce în cavitatea de rezonanţă pe lângă proba de studiat şi un etalon. L şi S astfel: g =1+ J ⋅ ( J + 1) + S ⋅ ( S + 1) − L ⋅ ( L + 1) 2 J ⋅ ( J + 1) (11) unde J – numărul cuantic total. Impurităţile paramagnetice pot de asemenea distorsiona semnalul RES. în particular prin alterarea timpului de relaxare spin-reţea. de exemplu ENDOR (Electron Nuclear DOuble Resonance) şi ELDOR (Electron Electron DOuble Resonance). Cel mai uzual radical utilizat ca etalon pentru marcarea câmpului magnetic este DPPH (difenilpicrilhidrazil). iar această ecuaţie reprezintă formula lui Lande. În experimentele RES uzuale efectuate în undă continuă se fixează frecvenţa şi se variază inducţia câmpului magnetic aplicat. fiind necesar un câmp magnetic de ∼ 3300 G. Astfel.

interacţiunea dintre spinul electronic şi câmpul de microunde. neliniaritatea amplificatorului sau a detectorului. Pentru sistemele reale. 445 . sunt simetrice şi au o formă aproximativ Lorentziană (Fig. Această linie este îngustă în zona centrală şi are o descreştere lentă spre extreme. relaxarea spin – reţea. avem: neomogenitatea câmpului magnetic static B0. Cauzele lărgirii neomogene sunt fluctuaţii spaţiale de câmp magnetic şi sunt datorate prezenţei unor interacţiuni hiperfine.2). Figura. Lărgirea liniei RES poate fi omogenă sau neomogenă. Cauzele care determină lărgirea neomogenă sunt : interacţiunea dipolară între spinii de acelaşi tip.2 Forma Lorentzianǎ şi gaussianǎ a liniilor RES Dacă numai anumite grupuri de spini sau pachete de spini din probă pot absorbi direct cuantele de o frecvenţă particulară. saturarea sistemului de spini cu o putere excesivă. difuzia de spin. absorbind cuantele la o valoare bine determinată a câmpului magnetic. În cazul lărgirii omogene toţi spinii din probă răspund ca o unitate acţiunii cuantelor de microunde. neomogenităţilor câmpului magnetic static. anizotropiei tensorilor g şi de structura fină. atunci când lărgirea nu este provocată de interacţiunile anizotrope. apărute în urma unor fluctuaţii dinamice în sistemul de spini (variabile în timp). atunci linia este lărgită neomogen. linii care au maxime de absorbţie uşor diferite între ele datorită distribuţiei de câmp magnetic local în probă. diversele scheme de modulaţie utilizate pentru a creşte detecţia. Liniile lărgite neomogen sunt înfăşurătoarele liniilor lărgite omogen corespunzătoare diferitelor pachete de spini. dipolare dintre spini cu frecvenţe Larmour diferite. se apropie de o formă Gaussiană. Liniile lărgite omogen.Dintre factorii instrumentali care pot influenţa forma semnalului RES. linia de rezonanţă are în general o formă intermediară între cele două cazuri limită. Liniile lărgite neomogen. fluctuaţiile datorate mişcării spinilor în câmpul magnetic local.

căci apar (2I1+1)(2I2+1)…. descifrarea structurii hiperfine a spectrelor este destul de complicată. Lărgimea liniei este de obicei mică. Prin aceasta. Factorul g nu permite identificarea radicalilor liberi. Fiecare radical liber are o structură hiperfină caracteristică. II. spectrul va avea (2nI+1) linii de structură hiperfină. dar situate la intervale neegale.(2In+1) linii de egală intensitate. care permite în multe cazuri identificarea radicalilor liberi. foarte precise. arată că la radicalii liberi există o interacţiune spin-orbită foarte slabă şi electronii cu spinii neîmperecheaţi au un grad mare de localizare. identificarea radicalului liber studiat. de faptul dacă aceste nuclee sunt identice sau nu. iar poziţia spectrelor este aproximativ aceeaşi în câmpul magnetic [4]. Prezenţa unei structuri hiperfine caracteristice.0023). structura hiperfină permite. totuşi unele măsurători RES. intensitatea lor şi valoarea despicării hiperfine depind de numărul nucleelor cuprinse în orbita electronului paramagnetic. deoarece majoritatea radicalilor detectaţi sunt radicali centraţi pe carbon sau azot.În cazul radicalilor liberi generaţi prin iradiere γ în sisteme biofarmaceutice şi de interes biomedical. structura fină lipseşte pentru că spinul este egal cu ½ . În cazul când electronii paramagnetici înconjoară mai multe nuclee cu spini nucleari diferiţi.. I. şi de densitatea de electroni cu spini neîmperecheaţi la fiecare dintre aceste nuclee. caracterizate printr-un număr cuantic I. Numărul liniilor de structură hiperfină. Factorul de despicare spectroscopică g are valoarea foarte apropiată de cea corespunzătoare electronului liber (g = 2. Valoarea factorului de despicare spectroscopică g apropiată de cea a electronului liber. aşezate la intervale egale şi cu intensităţi care sunt mai mari în centrul spectrului şi descresc spre margini. Studiile efectuate au pus în evidenţă la spectrele de rezonanţă ale radicalilor liberi. 446 . structura hiperfină a spectrelor RES (când este bine rezolvată) furnizează informaţii mai importante despre radicali decât valoarea factorului g. în majoritatea cazurilor. o serie de particularităţi [1]: I. determinată de numărul de nuclee cuprinse în orbita electronului şi de gradul de localizare al electronului la fiecare dintre aceste nuclee. II. III. au reuşit să pună în evidenţă dependenţa factorului g de structură într-o serie de substanţe organice [2]. Prezenţa structurii hiperfine la radicalii liberi se datorează interacţiunii magnetice a electronului cu spin neîmperecheat cu momentul magnetic al nucleelor cuprinse în orbita acestui electron. Când orbita electronului cuprinde cu egală probabilitate un număr n de nuclee identice.

1. Astfel. 3. De asemenea lărgimea mică a liniilor facilitează studiul structurii hiperfine. Interacţiunea hiperfină anizotropă este interacţiunea de tip dipol magnetic între electronul cu spin neîmperecheat şi nucleul cu moment magnetic diferit de zero.1 GHz ÷ 9. un generator de microunde. III. care operează în banda X (9. are loc între nucleul cu moment magnetic nenul şi electronii cu spini neîmperecheaţi. Structura fină lipseşte în cazul radicalilor liberi cu un singur electron neîmperecheat. Toate aceste elemente se găsesc cuplate prin intermediul probei de studiat care se află sub acţiunea câmpului magnetic static şi al câmpului de microunde. în care se introduce proba. un detector. Spectrele RES se înregistrează la temperatura camerei cu ajutorul spectrometrului “ADANI Portable EPR Spectrometer PS8400”. măsurătorile se efectuează folosind capilare speciale de sticlă. spectrometrul RES se compune dintr-un electromagnet capabil să creeze un câmp magnetic static B.Există două tipuri de interacţiuni hiperfine: interacţiunea hiperfină anizotropă şi interacţiunea hiperfină izotropă. o cavitate de microunde şi un sistem computerizat pentru înregistrarea şi observarea fenomenului de rezonanţă. Lărgimea liniei fiind mică permite determinări foarte precise de concentraţie a radicalilor liberi şi separarea efectelor diferiţilor radicali prezenţi în acelaşi timp în proba studiată. Principiul de funcţionare al unui spectrometru RES Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static al polarizării induse de o probă electromagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale particulelor paramagnetice. cu lungimea de 20 cm şi diametrul interior de 1mm.6 GHz) şi 447 . 3. Caracterizarea instalaţiei experimentale RES 3. în general despicarea hiperfină fiind mai mare decât lărgimea componentelor hiperfine. Interacţiunea hiperfină izotropă este partea principală a interacţiunii hiperfine în radicali liberi. Spectrometrul portabil RES ADANI PS8400 În cazul tuturor experimentelor. deoarece în multe cazuri interacţiunea hiperfină anizotropă nu se rezolvă şi are ca efect doar o lărgire a liniilor de rezonanţă sau o anizotropie a formei şi lărgimii liniei. Structura hiperfină a spectrelor apare în special în cazurile când electronii cu spin neîmperecheat sunt electroni s sau σ. a căror densitate la locul nucleului este diferită de zero.2. Interacţiunea hiperfină izotropă sau interacţiunea hiperfină de contact (interacţiunea de contact Fermi).

şi presiunea atmosferică (840 GPa – 1066 GPa). 4). computerizat.800mmHg) (Fig. lucrează în modul TE102 şi are un factor de calitate Q = 5000.3). O baleiere a câmpului este divizată în 4096 de paşi discreţi. iar Δν lărgimea la semiînălţime a rezonanţei. “ADANI PS8400” Figura. Valorile de “offset” ale câmpului magnetic şi timpul de baleiere sunt controlate de către sistemul de achiziţionare computerizat. Spectrometrul poate opera în următoarele condiţii : temperatura mediului cuprinsă între (+18°C) şi (+28°C) . Factorul de calitate este dat de relaţia Q = ν res . în funcţie de probele care urmează a fi studiate. Parametrii spectrometrului utilizaţi la achiziţionarea spectrelor RES sunt diferiţi. Sursa de microunde este reprezentată de un oscilator “GUNN”. Sursa de radiaţie electromagnetică şi detectorul de află într-o cavitate numită “punte de microunde”.care este echipat cu un sistem de achiziţie al datelor. Puntea de microunde este o cutie de metal care ajută la amplificarea semnalelor slabe provenite de la probe. 3 ADANI Portable EPR Spectrometer PS8400 Cavitatea de microunde este de formă rectangulară. unde νres este frecvenţa Δν de rezonanţă.07 Gauss /cm. Canalul de semnal cuprinde partea electronică necesară detectării senzitive în fază. sensibilitatea spectrometrelor creşte. Schema bloc a spectrometrului portabil “ADANI PS8400” este redată în (Fig. 448 . Modulaţia se realizează cu un semnal de frecvenţă ν = 100 kHz. Cu creşterea factorului de calitate Q. (630 mmHg . iar rezoluţia este de 0. umiditatea relativă între 20% şi 80%. Sensibilitatea spectrometrului RES tip “ADANI PS8400” este 5×106 spin /Gauss. Factorul de calitate Q indică cât de eficient stochează cavitatea energia de microundă.

Figura. Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 a) spectrele RES ale unor probe de hidroxiapatită cu fier 449 .4 Schema bloc a spectrometrului “Portable ADANI PS8400” La fiecare pas. o tensiune de referinţă corespunzătoare valorii de “offset” a câmpului magnetic este trimisă către acea parte a controlerului care reglează bobinele de baleiere.3. 3. Rata de baleiere este controlată prin varierea timpului de aşteptare între paşii individuali. Toate aceste componente lucrează împreună pentru achiziţionarea unui spectru de rezonanţă electronică de spin (RES).

0 30 20 10 Camp magnetic (G) 1000 2000 3000 4000 5000 Camp magnetic (G) c) spectrele RES ale unor medicamente: spectrul experimental spectrul experimental spectrul simulat spectrul simulat 3250 3300 3350 B(G) 3400 3450 3250 3300 3350 B(G) 3400 3450 d) spectrele RES ale unor radicali liberi [6]: T im p (zile) 7 E (92 z) 5 1 E (ini) 0 3320 3340 3360 B (G ) 3380 3400 3250 3300 3350 B (G) 3400 3450 450 .a.3 x (mol %) 70 60 Intensitate (u.3 x (mol %) 70 60 g = 4.) Intensitate (u.b) spectrele RES ale unor probe vitroase şi vitroceramice care conţin fier [5]: g = 4.a.) 50 40 30 20 10 1000 2000 3000 4000 5000 50 40 g = 2.

Cozar. Bucureşti. Non-Cryst. Solids. Crucq. 2. Spectroscopic study on iron doped silica-bismuthate glasses and glass ceramics. Rezonanţa electronică de spin. Chimie Nouvelle. Crăciun. 12: 1356 -1359. Todea.România. Ed. 6. Bibliografie 1. 28-29. Dina Petrişor. Chiş.S. 4. (2001) A-S. (1994) S. V. Rezonanţa magnetică. 5. Rezonanţa electronică de spin. C. Gamma-irradiated ExtraVit M nutritive supplement studied by EPR spectroscopy . G. 352. submis la Radiation Physics and Chemistry. M. Simon. David. Damian. O.4. (2006) 2947. Academiei R. (1965) Al. 3. Simon. Study of radicalizing mechanisms of irradiated drugs (Radiosterilization of pharmaceuticals: radicals). J. I. 2007 451 . Nicula. Cluj-Napoca.Ursu. Presa Universitară Clujeană. 61-64 (1980) L. S. Editura Didactică şi Pedagogică.

......... Introducere Spectroscopia de rezonanţă electronică de spin (RES) este una dintre cele mai eficiente metode...452 2........465 1............ Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) ................... Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1.......... Spectrele RES înregistrate de asemenea în cazul: sistemelor necristaline..................................... Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor 452 .........a C........... pulberilor policristaline........ monocristalelor. mineralogiei si geologiei.454 4....... fizicii........ dr................................ non-distructive si non-invazive..453 3...... soluţiilor congelate sau în cazul soluţiilor lichide aduc contribuţii importante cercetărilor din domeniul materialelor.................................. care pot fi investigaţi prin RPE sunt ionii metalelor de tranziţie şi elemente ale pământurilor rare sau centrii asociaţi cu sarcinile electrice sau cu defectele neutre... biologiei....... Centrii paramagnetici................................... chimiei........................... Bibliografie: ..................Spectroscopia de rezonanţă electronică de spin – partea a II.. folosită pentru caracterizarea ordinii locale şi a interacţiunilor magnetice în materiale organice si anorganice.........S.......... Introducere ....... Exemple de aplicaţii ale rezonanţei electronice de spin .......................

pământurilor rare şi actinidelor • defecte paramagnetice. Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) Spectroscopia RES are aplicaţii în cadrul cercetărilor din diferite domenii cum sunt: fizică. Metoda constă în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. biologie. NO în sisteme biologice • fotosinteza 453 . chimie. nanoştiinţelor. medicină.2].energetice ale centrilor paramagnetici. Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. radicali ai oxigenului. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi. aplicaţiile industriale etc. studiul materialelor. centrii de culoare. mediu. medicinii şi mediului • markeri de spin • antioxidanţi şi agenţi de contrast • oximetrie • radicali liberi în ţesuturi. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. nanomateriale. 2. Astfel. geologie. RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale. În domeniul biologiei. deformări locale • electroni de conducţie în conductori şi semiconductori • interacţii magnetice şi cristaline • procese de recombinare la temperaturi scăzute b. În domeniul fizicii • concentraţii de spin • ioni paramagnetici ai metalelor de tranziţie. În domeniul chimiei • radicali liberi • cataliza • procese de oxidare si reducere • stări de triplet a moleculelor • compuşi organo-metalici şi zeoliţi • cinetica de reacţie şi reacţii de polimerizare c. Cu ajutorul rezonanţei paramagnetice electronice (RES) pot fi studiate: a.

Exemple de aplicaţii ale rezonanţei electronice de spin Spectrele RES au fost înregistrate pe pulberi la temperatura camerei cu ajutorul unui spectrometru portabil RES “ADANI Portable EPR Spectrometer PS8400”. care operează în banda X (9. optoelectronică • manganiţi cu magnetorezistenţa colosală • supraconductori oxidici cu temperatură de tranziţie ridicată • semiconductori f.1 GHz – 9.• detecţie de droguri. nanocompozite • efecte miez interior .6 GHz) şi este 454 . geologie • detecţia radicalilor în polimeri iradiaţi şi procese de coroziune • prospeţimea uleiurilor vegetale • controlul calităţii sticlelor optice speciale • procese oxidative în vopsele utilizate în industria auto e. În domeniul aplicaţiilor industriale • controlul calităţii produselor alimentare iradiate • dozimetrie pentru procesele de iradiere • vârste şi datări de materiale cu aplicaţii în arheologie. În domeniul nanomaterialelor şi nanoştiinţelor • efecte ale reducerii dimensionalităţii • dinamica de spin în nanomateriale. fullerene şi compuşi derivaţi • proprietăţi ale conducţiei electrice şi transportului polaronic 3.strat superficial ale nanoparticulelor magnetice • proprietăţi ale nanoparticulelor şi nanofirelor magnetice • interacţii magnetice dipolare şi de schimb: efectele dimensiunii • nanometrologie: dimensiune medie a nanoparticulelor metalice şi magnetice • caracterizare nanotuburi de carbon. În domeniul caracterizării materialelor • proprietăţi ale polimerilor • defecte în fibre optice • materiale laser • conductori organici şi anorganici cu dimensionalitate redusă • influenţa impurităţilor şi defectelor în semiconductori • proprietăţi ale noilor materiale magnetice • proprietăţi ale materialelor utilizate în spintronică. metabolism şi toxicitate • factori poluanţi d.

sunt reprezentate în figura 1. Linia de la gef ≅ 4.99[xSiO2·(100-x)Bi2O3]. pentru care termenul Zeeman este dominant .echipat cu un sistem de achiziţie a datelor.a. 2). Exemplul1.0.01Fe2O3·0.) 50 40 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura. Fe3+ Spectrele RES înregistrate. 1) arătând că vecinătatea ionilor Fe3+ nu depinde foarte mult de compoziţia matricilor vitroase. Observăm că linia de rezonanţă de la gef=4. Liniile de la gef=2. computerizat. Sticlele şi vitroceramicile studiate conţin ionul paramagnetic Fe3+ (3d5 6S5/2). 2.0 sunt atribuite ionilor paramagnetici aflaţi în poziţii caracterizate de câmp cristalin relativ puternic unde termenii de câmp cristalin sunt comparabili sau mai mari decât termenii Zeeman [9.3 şi o linie foarte slab rezolvată la gef ≅ 2. Îngustarea liniei de 455 .0 sunt atribuite ionilor paramagnetici izolaţi în poziţii caracterizate de câmpuri cristaline relativ slabe. Spectrul conţine o linie principală de rezonanţă relativ largă cu gef ≅ 4. Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static a polarizării induse de o probă paramagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale centrilor paramagnetici.3 x (mol %) 70 60 Intensitate (u.3 se îngustează pe măsură ce înlocuim Bi2O3 cu SiO2 (Fig. în timp ce liniile cu gef>2.3 de compoziţia probelor este ilustrată în Fig. 12]. pentru probele vitroase din sistemul 0.3 este specifică tuturor sticlelor ce conţin ioni Fe3+ ca impuritate sau ca dopant în concentraţii mici [5-8]. g = 4. 1 Spectrele RES înregistrate pentru probele netratate termic Caracteristicile spectrului RES pentru diferite rapoarte Bi2O3/SiO2 sunt complet similare pentru toate probele netratate termic (Fig. Dependenţa lărgimii acestor linii de la gef ≅ 4. acesta fiind în stare S şi frecvent utilizat în investigaţiile RES ale sticlelor.

scade cu x aşa cum se observă în Fig. Caracteristicile spectrelor RES pentru ionii Fe3+ în probele tratate termic sunt evident modificate aşa cum se poate vedea în Fig.3.3 este înregistrat pentru toate probele şi lărgimea liniei este de aproximativ 200 G pentru toate compoziţiile. 456 . 230 220 210 200 ΔB (G) 190 180 170 160 10 20 30 40 50 60 70 x (mol%) Figura. Acest rezultat indică faptul că ordinea la scurtă distantă.6Si0. 3) arată schimbările apărute în ordinea locală în jurul ionilor de fier. este caracterizată de un câmp cristalin relativ puternic şi poate fi asociat cu poziţiile fierului în reţeaua necristalină bogată în siliciu.0 este slab evidenţiat iar linia dominantă fiind cea de la gef ≅ 4. semnalul de la gef ≅ 2. Semnalul de la gef = 4.0 cât şi cea de la gef ≅ 4. În probele tratate termic.0 în timp ce linia mai puţin intensă se situează la gef ≅ 4. Forma liniilor RES descrie şi dezordinea din jurul ionilor de fier rezonanţi şi caracteristicile structurale ale matricilor vitroase în care sunt încorporaţi aceşti ioni de fier.3 de compoziţia probelor Pentru probele cu un conţinut mai ridicat de SiO2 (40 ≤ x ≤ 50) şi în cazul cărora a fost identificată prin difracţia de raze X faza cristalină Bi5. În cazul probelor cu conţinut ridicat de siliciu (60 ≤ x ≤ 70) sunt prezente ambele linii.0. spectrele RES ale Fe3+ (Fig. înregistrată pentru probele cu un conţinut scăzut de SiO2. din jurul ionilor Fe3+ responsabili pentru acest semnal.5O9. Pentru un conţinut scăzut de SiO2 (x ≤ 30) linia dominantă se găseşte la gef ≅ 2.3. atât cea de la gef ≅ 2. Lărgimea liniei de la gef ≅ 2. 4.4. 3. 2 Dependenţa lărgimii liniilor de rezonanţă de la gef ≅ 4.3.rezonanţa pentru x>20 indică o vecinătate a ionilor Fe3+ mai uniformă în sticlele bogate în siliciu.

4 Dependenţa lărgimii liniei de la g ≅ 2. 4) ceea ce denotă tendinţa de ordonare structurală în jurul ionilor Fe3+ rezonanţi dispuşi în aceste poziţii. 3 Spectrele RES pentru probele vitroceramice Linia cu gef = 2. este de aşteptat ca ionii Fe3+ să ocupe poziţiile Bi3+ din faza cristalină Bi12SiO20. 160 150 140 ΔB (G) 130 120 110 100 90 10 20 30 x (mol %) Figura. până la x = 30 şi este atribuit ionilor Fe3+ situaţi în poziţii cu câmp cristalin slab cu simetrie octaedrală.0 de compoziţia probelor 457 . Luând în considerare razele ionice pentru ionii Bi3+ şi Fe3+ şi starea lor identică de valentă.3 x (mol %) 70 60 Intensitate (u.0 este linie rezolvată numai pentru conţinut scăzut de SiO2 .a. Remarcăm de asemenea că linia se îngustează cu creşterea conţinutului de SiO2 (Fig.g = 4.0 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura.) 50 40 g = 2.

5).14 x = 0.6Si 0.6Si0.8 5.0 x=0 x=0 x = 0.9 2.3 x = 0.4 (Fig. 10. După tratamentul termic la 400oC ionii de gadoliniu ocupă poziţii în interiorul fazei cristaline de tip Bi5. Acestea indică faptul că există poziţii în matricea amorfă unde ionii de Gd3+ se află în 458 . 70) spectrele RES prezintă atât linia cu g ≅ 4.33 x = 0.33 x = 0.4).5O9.5O9.5 1000 2000 3000 4000 5000 B(G) 1000 2000 3000 4000 5000 B(G) Figura 5 Spectrele RES ale probelor preparate prin metoda sol-gel Figura 6 Spectrele RES ale probelor tratate termic 30 minute la 400oC b) Gd3+. Ti3+.14 spectrele RES ale ionilor de Gd3+ sunt similare şi reflectă o vecinătate relaxată a acestora în matricea amorfă.0 specifică ionilor din poziţii în câmp cristalin slab dar în vecinătate distorsionată sau între care se manifestă interacţiuni dipolare [15].8 2. 4.0 care reflectă o vecinătate relaxată în matricea amorfă. pe lângă asemenea poziţii. Astfel.Linia de rezonanţă slab rezolvată atribuită ionilor de fier dispuşi în câmp cristalin slab pentru probele vitroceramice cu 40 ≤ x ≤ 50 mol % arată că doar o mică parte dintre ionii de Fe3+ sunt situaţi în poziţiile Bi3+ ale fazei δ (Bi5. odată cu creşterea conţinutului de bismut.14 x = 0. 14]. vacante de oxigen Spectrele RES înregistrate în cazul microsferelor netratate termic sunt dominate de o linie largă centrată la g ≈ 2.5 4.8. 2. 11]. dar se observă şi linii mici la ≈ 5. În probele în care se dezvoltă faza cristalină de tipul Bi2SiO5 ( x = 60. Exemplul 2: Gd3+ a) Analizele de rezonanţă paramagnetică electronică au pus în evidenţă compoziţii diferite ale ionilor de gadoliniu în probe cu conţinut mai mare de bismut (Fig. Probabil că majoritatea ionilor Fe3+ să fie dispuşi în faza rămasă necristalină bogată în Si [13.9 2. cât şi o linie largă la g ≅ 2.3 specifică ionilor de Fe3+ în poziţii cu câmp cristalin intens din matrici necristaline. gadoliniul ocupă poziţii in regiuni cvasicristaline în acord cu modificarea difractogramelor acestor probe. 6).0 5.9 şi2. vecinătatea lor fiind puternic distorsionată [3. dacă în probele cu x = 0 şi x = 0.

0 din spectrele probelor tratate termic la 350. care creşte în intensitate odată cu creşterea temperaturii de tratament. Unul dintre aceşti atomi de Ti captează un electron şi rămâne în configuraţia tetraedrală. În timp ce atomul de O difuzează el generează doi atomi de titan cu configuraţie incomplete. Linia largă de la g ≈ 2. Se observă şi spectrul în ‘‘U’’ cu linii la g ≈ 5. suprapus peste componenta spectrală. Modificările structurale induse în probele titano-silicatice amorfe prin tratamentele termice sunt bine puse în evidenţă în spectrele RES ale probelor parţial şi total cristaline (Fig. oxigenul difuzează din interior spre suprafaţă şi se formează în regiunea de sub-suprafaţă vacante de oxigen. la g ∼ 2. se modifică în intervalul de temperatură investigat [16]. specific matricelor policristaline dezordonate care conţin ioni de Gd3+ destul de omogen distribuiţi. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g. Prin aplicarea tratamentului termic. Lărgimea liniei spectrelor RES. Lărgimea liniei de la g ≈ 2.3 este atribuită fierului (III) şi apare datorită tuburilor de sticlă în care se pune proba pentru a efectua măsurătoarea RES. în câmp cristalin slab. 7-14).0. rezultat în urma relaxării structurale dar încă cu un grad mare de dezordine în jurul lor. În conformitate cu Kolodiazhnyi şi Petric am atribuit aceste linii vacanţelor de oxigen la titan (VTi) cu spin electronic neîmperecheat. în timp ce titaniul difuzează de la suprafaţă spre interior. Spectrele RES prezintă o uşoara asimetrie a liniei de rezonanţă (se abat de la o funcţie pur Lorentziană) care poate fi explicată prin prezenţa unei anizotropii uşoare şi/sau a unui fundal de rezonanţă relativ larg de o foarte joasă amplitudine. 700 şi 900°C ne indică că ionii de Gd3+ sunt preponderent dispuşi în faza reziduală necristalină. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g. 459 . Spectrele RES pentru microsferele tratate termic în intervalul 350 – 1400°C sunt caracterizate printr-un semnal îngust. legaţi anterior de atomul de oxigen. Linia de la g ≈ 4. g ≈ 2.9.câmp intermediar. g ≈ 2.0 din spectrele RES. unde se formează ionii de Ti3+. se modifică în intervalul de temperatură investigat. iar celălalt atom de Ti se relaxează într-o configuraţie planar trigonală.8.

Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 9 Spectrele RES ale microsferelor tratate termic la 700°C.0 5. 30 minute.004 1. 30 minute.8 2.98 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 11 Spectrele RES ale microsferelor tratate termic la 1100°C. Figura 8 Spectrele RES ale microsferelor tratate termic la 350°C. 30 minute. (b) 600 G. (a) (b) 2. Figura 10 Spectrele RES ale microsferelor tratate termic la 900°C.98 Ti:Si 1:2 Ti:Si 1:2 2.2. utilizând un baleiaj de (a) 4000 G.3 Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 7 Spectrele RES ale microsferelor preparate prin metoda sol gel.9 4. 460 . 30 minute.004 1.

1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 14 Spectrele RES ale sistemului Ti:Si 1:1 preparate prin metoda sol gel şi supuse diferitelor tratamente termice. atribuit ionilor de Ti3+. 30 minutes.98 1400oC 1100oC 900oC 700oC 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 13 Spectrele RES ale sistemului Ti:Si 1:2 preparate prin metoda sol gel si supuse diferitelor tratamente termice. (b) 2. (b) 600 G.(a) (b) Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 12 Spectrele RES ale microsferelor tratate termic la 1400°C.98 o 1400 C o 1100 C o 900 C o 700 C as-prep. (a) o 1400 C o 1100 C o 900 C o 700 C o 350 C (b) 2.004 1. utilizând un baleiaj de (a) 4000 G şi respectiv (b) 600 G. neexistând vacanţe de O din cauza atmosferei reducătoare.98. (a) o 1400 C 1100oC o 900 C 700oC o 350 C as-prep. utilizand un balaj de (a) 4000 G. dar au mai fost detectaţi în literatura de specialitate [19] la temperatura camerei. Centrii de Ti3+ sunt de obicei detectaţi la temperaturi sub 120K [17.18]. utilizand un baleaj de (a) 4000 G si respectiv (b) 600 G. Spectrele RES ale probelor tratate termic la 1400°C sunt caracterizate doar prin semnalul din jurul valorii g∼1. 461 .004 1.

Pentru microsferele tratate termic la 1100°C si 1400°C se observă efectul galiului în sensul prevenţiei formării vacanţelor de oxigen. Vor fi prezentate doar spectrele RES ale sistemului Ti:Si 1:2. Acest studiu este focusat în special pe efectul adiţiei oxidului de galiu în sisteme. cel mai probabil un electron captat la o vacanţă de oxigen. ambele sisteme având o dependenţă oarecum similară în raport cu tratamentul termic. 700.98). [20] au raportat faptul că semnalul RES la g∼2. Ga2TiO5. în concordanţă cu difracţiile de raze X. În cazul microsferelor cu conţinut de galiu se dezvoltă după tratamentul termic la 1400°C o nouă faza. 462 . În cazul microsferelor preparate prin metoda sol gel. în bună concordanţă cu literatura de specialitate şi rezultatele obţinute prin spectroscopie Raman unde a fost obţinut un semnal de fluorescenţă în cazul probelor tratate termic până la temperatura de 900°C.003 – 2. în urma tratamentelor termice. Serwicka [21] a observat un astfel de semnal la g∼2. cât si în TiO2 dopat cu B [25]. [26] în probe de TiO2 dopat cu N.004) şi Ti3+ (g∼1. semnalul RES provine numai de la ionii de Gd3+. după ce au fost folosite în teste fotocatalitice.004) si Ti3+ (pentru g∼1. Semnale similare au fost observate şi în TiO2 – anatase dopate cu C [22-24]. [22] la g∼2. Au mai fost raportate astfel de semnale RES de către Li şi col. 14 se observă faptul că tratamentul termic joacă un rol important în formarea de centrii paramagnetici adiţionali. cât şi de către Feng şi col.005 unui electron captat la o vacanţă de oxigen.004 poate fi atribuit vacanţelor de oxigen.003 pe TiO2 redus în vid şi l-a atribuit unui defect. deoarece evoluţia defectelor: vacanţe de oxigen (g∼2. În cazul microsferelor tratate termic la 350. deoarece sistemul Ti:Si 1:1 nu prezintă modificări esenţiale. iar Serpone [27] a atribuit semnalele din intervalul g = 2. Figura 16 Spectrele RES ale microsferelor tatate termic la 350°C.98) este similară cu cea discutată anterior.Din spectrele RES prezentate în Fig. În Figurile 13 si 14 sunt evidenţiate evoluţiile vacanţelor de oxigen (pentru g∼2. 900 si 1100°C.13.004 detectat pe plasma de TiO2 tratată termic provine de la un electron captat la o vacanţă de oxigen. Spectrele RES evidenţiază integrarea ionilor de Ti3+ în această fază. Ga2O3 Ga2O3 20% 10% 5% 1% 0% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 1000 2000 3000 4000 5000 B(G) B(G) Figura 15 Spectrele RES ale microsferelor preparate prin metoda sol gel. Nakamura şi col.0055 în spectrele RES în probe de titan dopat cu C. peak-ul de la g∼2.

utilizand un baleaj de (a) 4000 G. utilizand un baleaj de (a) 4000 G.Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 5% 10% 5% 1% 0% 1% 0% 3000 3200 3400 3600 3800 1000 2000 3000 4000 5000 B(G) B(G) Figura 17 Spectrele RES ale microsferelor tatate termic la 700°C. utilizand un baleaj de (a) 4000 G. (b) 600 G. (b) 600 G. Ga2O3 (a) 20% (b) 20% 10% 10% 5% 5% 1% 0% 1000 2000 3000 4000 5000 1% 0% Ga2O3 3000 3200 3400 3600 3800 B(G) B(G) Figura 18 Spectrele RES ale microsferelor tatate termic la 900°C. Ga2O3 (a) Ga2O3 (b) 20% 10% 5% 1% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 0% 3000 3200 3400 3600 3800 B(G) B(G) Figura 19 Spectrele RES ale microsferelor tatate termic la 1100°C. (b) 600 G. 463 .

unde efectul interacţiunii de schimb este clar evidenţiat [33]. dar şi dezordinii locale [29-32]. introduse în aceeaşi matrice. utilizand un baleaj de (a) 4000 G. Spectrele RES ale probelor investigate sunt prezentate în figura 21. Liniile largi preconizate pentru o concentraţie atât de scăzută (0. Diferenţele observate în forma liniilor. considerând că gadoliniu ar fi distribuit omogen în întregul volum de probă. În acest caz.0 fapt ce denotă că vecinătatea ionilor de Gd3+ se confruntă cu câmpuri cristaline slabe. ceea ce înseamnă că aceştia nu sunt incluşi în reţeaua silicatică sau germanată unde au avut o vecinătate mult mai distorsionată [28].Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 10% 5% 5% 1% 1% 0% 0% 1000 2000 3000 4000 5000 3000 3200 3400 3600 3800 B(G) B(G) Figura 20 Spectrele RES ale microsferelor tatate termic la 1400°C. Această lărgire a liniei de rezonanţă este în mod normal atribuită interacţiunii dipol-dipol dintre ionii de Gd3+. (b) 600 G. în funcţie de compoziţia probelor. arată că această distribuţie pe suprafaţa nanoparticulelor nu este uniformă. distanţa medie dintre ionii de gadoliniu este mai mică decât în cazul distribuţiei uniforme în întregul volum şi se confruntă cu interacţiuni magnetice puternice. fiind mult mai grupată pentru probele cu raportul Si/Ge 1:2 şi 1:3. Prezenţa în probe a ionilor de Gd3+ ne dă informaţii cu privire la modificările structurale care au loc în vecinătatea lor.5% mol Gd2O3). c) Gd3+ Prin rezonanţa paramagnetică electronică a fost investigată ordinea structurală din jurul ionilor de Gd3+ si interacţiunea magnetică dintre ei. în funcţie de compoziţia matricii şi este utilă în caracterizarea locurilor în care s-ar putea distribuii alte pământuri rare neparamagnetice. 464 . sprijină ipoteza distribuţiei sale pe suprafaţa nanoparticulelor. Spectrele constau din linii relativ largi cu g = 2.

H. S. 161 (2000) 205–212. 22. 5. Nanba. Non-Cryst.J. Lee. Soc. Serwicka. Nguyen.M. DiCicco.. 17. Simon. Volume 20.. Yabuta. Chem. Rezonanţa magnetică. 9. 12. 112. Phys. Glastechn. Wu. C. S. Proceedings of XX Int. J. Bull. Coldea. M. Optoelectronics and Advanced Materials. 11. Micic. 6. Solids. Todea. 9 (2007). Schlichter.K.S. 20. Cromack. 3. Karkas. Glass Sci. R. Hwang. Simon. Spectrele RES ale probelor aparţinând sistemului 0. C. Typek. Notz. A. Forbess. I. P-10-011 R. Chem. S. 947-949(3). Anagnostakis.-C. Trifunac. (1965) Al. A. Ber. Zhang. Sugihara. Simon. Miura. Berger. K. Negishi. S. 15. Non-Cryst. P. A. (1993). 32 (1960) 668d Y.Figura. M. Chem. 27Oct. Guskos. E. Rybicki. V. Yahiaoui. 3336 – 3340. D. Solids.S. 97. K. N. T. Rev. M. 10-13 September 2001 T. Simon. 99 (1955) 1222 R. Bucureşti. 90. 621-624. K. Rezonanţa electronică de spin. V. Colloids Surf. Editura Didactică şi Pedagogică. Adv. Kubokawa. Appl. A. Mol. 4. Kliava. I. Nakamura. Ed. Phys. Congress. 7. M. A. Chem. E. Phys.995[(1−x)SiO2·xGeO2] 4. No. 16. Peteanu. 19.Konstantiniva. Catal. Y. J. J. Ioncu. Figiel. Y. 3 (2000) 1503 I. 2. Castner. A. D. S. Bibliografie: 1. Ardelean. A: Chem. F. J. Y. C. Ghosh. N. S. Guskos. Gdańsk – Poland. Thurnauer. M. J. W. 331 (2003) 1 R. Simon. 67 (1994) 156 S. J. Mater. Sands. Nicula. Journal of Materials Science Letters. Lett. Kodama.. 7277. Optoelectronics and Advanced Materials. G. J. Sakthivel. V. Lips. R. Beziade. 8. Chem. M. P. M. 13 (1985) 287–293. A. 18. E.J. Kokorin. 1. T. Japan 59 (1986) 259. Takeuchi. Holton. Zolnierkiewicz.. Simon. O. Witkowska. Vol. I. S. A. Seraji. Japan. Y. Stößer. 404 (2005) 25–29. Kutsuna. J. Sept. Phys. Simon. K. J. Anpo. Bissey. Sci. 21.P. V.H. Rev. Phys. N. 61-64 (1980) A. 14. M. J. Solids 180 (1995) 151 T. Todea. 465 . Newell. E.005Gd2O3·0. 13. 6-thInternational Conference on Intermolecular Interactions în Matter. Chimia 12 (2007) 61. Cao. P. Tokyo. Kim. J. Academiei R. 10. Phys.P. Ihara. S. 10. I. 23 (2010) 189-195. Chou. A . 352 (2006) 2947.J.C. Li. Todea. Ciorcas. 12 (2008). Limmer.Ursu. Kisch. H. 2001. J. Biedunkiewicz. J. 10 (2001) 5296 Pan. Zinsou. J. Number 10. Tabuchi.S.H.România. 2004. S. Technol. S. C. G. M. M. Pop. Non-Cryst. 21. Glass.

V.V. Chem. Materials Science and Engineering B 172 (2010) 68–71 466 . M. 26. Zarubina. Melnikova. Petrovskii. Inorg. 29. Kliava. Petrakovskaja. B 71 (2005) 104406. A. 30.V. Bruckental. Mater. E. Magn. Z. Filip. G. N.V. T. Y. Serpone. P. R. Adv. M. A. Zarubina. Potseluyko. Reson. Diana-Louisa Trandafir. T. 25. Solid State Nucl. Edelman. Barreca. Wang. Yeshurun. Raftery. Balducci. Simon. I. Gasparotto. Graziani. Sun. E. 8 (2006) 99–101. I. S. A. J.F. Kliava. Z. 33. E. T. 272–276 (2004) 1647–1649. K. Edelman. Kliava. Zhang. Phys. Fornasiero. T. J. Phys. 339 (2007) 111–123. 24. Gombac. Zhang. S. T. Matter 15 (2003) 6671–6681. Tondello. New J. G. Edelman. Feng. I. Rogatis.23. Montini. P. Simon. I. Chem. Magn. Bruckental. R. J. Y. Chim. Gombac. A. Vicario. D. Turcu. A. J. Bruckental. Malakhovskii.: Condens. Petrakovskaja.A. Wu. Potseluyko. Malakhovskii. S. D. R. Y. 35 (2009) 74–81. Berger. Zarubina. Phys. Yeshurun. 32 (2008) 1038–1046. E. M. 27.M. S. I. Acta 361 (2008) 3980–3987. I. A. Zhang. Mag. E. R. Z. S. Mater. 116 (2000) 83–86. S. Bratu. R. C 113 (2009) 15110–15123. 32. Chem. Garcia. G. Y. Kuznetsov. L. V. Montini. N. Yeshurun. R. J.S. I. J. Gil. Jin. J. 28. Graziani. Phys. Optoelectr. A. Fittipaldi. A. D. Fornasiero. C. Y. Rev. Solid State Commun. I. Ardelean. Simon. Cosma. Y. 31. Potseluyko. Petrakovskaja. Berger. J. Malakhovskii. V.

...................................... 2.................... ing.. 467 2....................................XIII...... Voltametria ciclică cu un cuplu redox activ..................... 488 1.......................... Voltametria ciclică fără cuplu redox activ...................................... Introducere Metodele electrochimice moderne oferă chimistului electroanalist o varietate de tehnici pentru a rezolva problemele analitice.......................................................... Bibliografie ...................................... 467 ........ În principal.......... Introducere ......................... dr........ Voltametrie cu baleiaj liniar de potenţial (LSV) ...................... 474 6.................. 467 3................................... 474 5....... există două tipuri de metode voltametrice: * voltametrie cu baleiaj liniar de potenţial (LSV). Voltametria ciclică (sau CV) ......................... aşa cum se arată in figura 1.................... Graziella Liana Turdean Cuprins 1............................................... testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice Conf. de obicei..... potenţialul este baleiat într-un domeniu fix de potenţial cu o viteză constantă......... * voltametrie ciclică (CV).............. Una dintre aceste metode este voltametria.... 471 4......... în care curnetul este măsurat ca o funcţie de potenţialul aplicat şi este utilizată la studiul cineticii reacţiei de transfer de electroni şi proprietăţile de transport ale reacţiilor...... de la o limită inferioară la o limită superioară a potenţialului.........Voltametrie cu baleiaj liniar de potenţial (LSV) În voltametria cu baleiaj liniar de potenţial (LSV)...... METODE ELECTROCHIMICE Elaborarea....

Dacă avem în vedere reducerea electrochimica a Fe3+ la Fe2+. Când potenţialul este baleiat spre dreapta (spre valori de reducere). Pentru sistemul Fe3+/Fe2+. trebuie să se ia în considerare influenţa potenţialului asupra echilibrului stabilit la suprafaţa electrodului. Exemplu: Rezultatul măsurătorilor de LSV este rRESezentarea grafică a curentului obţinut versus potenţialul baleiat cu o viteză constantă. poate atinge şi un maxim înainte să scadă. Forma semnalului de excitare în voltametria cu baleiaj liniar de potenţial. eventual. unda aparută se datorează reacţiei 1. Pentru a înţelege acest comportament. În mod clar prin schimbarea timpului necesar pentru a baleia domeniul de potenţial se modifică viteza de baleiaj (scanare). începe să apară un curent care. cum ar fi: * viteza reacţiei de transfer de electroni. Prin urmare. conform ecuaţiei 2: 468 . * reactivitatea chimică a speciilor electroactive.Figura 1. ecuaţia lui Nernst este cea care prezice relaţia dintre concentraţie şi potenţial (diferenţă de potenţial). * viteza de baleiaj a potenţialului. (1) Presupunem că scanarea începe din partea stângă a graficului curent/potenţial. unde iniţial nu este curent. Caracteristicile voltamogramei înregistrate (figura 2) depind de o serie de factori. Viteza de scanare (v) se calculează din panta dreptei din figura 1. unde E este diferenţa de potenţial aplicat şi Eo este potenţial standard de electrod. Figura 2. În echilibrul electrochimic. Voltamograma cu baleiaj liniar de potenţial. viteza reacţiei de transfer de electroni este mai rapidă în comparaţie cu viteza de baleiaj a potenţialului. la suprafaţa electrodului se stabileşte un echilibru identic cu cel prezis de termodinamică.

poziţia de echilibru se deplasează continuu în sensul conversiei reactantului. alura voltamogramei se modifică şi ea (Figura 3). Peak-ul (vârful.(2) Deci. Fiecare curbă are aceeaşi formă. În cazul în care se modifică viteza de baleiaj. Influenţa vitezei de baleiaj asupra voltamogramelor cu baleiaj liniar de potenţial. Când potenţialul este baleiat de la valoarea iniţiala V1. când potenţialul este baleiat de la valoarea V1 la V2. În această situaţie curentul începe să scadă. dar este evident că curentul creşte cu creşterea vitezei de baleiaj. datorită dimensiunilor stratului de difuzie şi a 469 . ca urmare. apare un curent. conform ecuaţiilor 3: (3) Aşa cum curentul creşte cu potentialul. maximul) apare deoarece la un moment dat stratul de difuzie a crescut suficient încât fluxul de reactant la electrod nu este suficient de rapid pentru a satisface cerinţele impuse de ecuaţia lui Nernst. scăderea curentului urmează acelaşi comportament ca şi cel estimat prin ecuaţia Cottrell. echilibrul la suprafaţa electrodului începe să se modifice şi. De fapt. Forma exactă a voltamogramei poate fi înţeleasă prin luarea în considerare şi a efectelor potenţialului şi transportului în masă. poziţia de echilibru se modifică de la nici o conversie (la V1) la conversia completă (la V2) a reactantului la suprafaţa electrodului. Figura 3.

În mod clar. Acest lucru evidenţiază un punct important atunci când se examinează LSV (şi CV): deşi nu există o axă a timpului pe grafic. Figura 4 arată o serie de voltamograme înregistrate la o singură viteză de baleiaj pentru diferite valori ale constantei vitezei reacţiei de reducere (kred). Conditii experimentale: viteza de baleiaj identica. potenţialul aplicat nu va duce la generarea concentraţiilor la suprafaţa electrodului conform estimărilor din ecuaţia Nernst. grosimea stratului de difuzie de la suprafaţa electrodului va fi diferită în funcţie de viteza de baleiaj folosită. Pentru aceste cazuri. reacţiile sunt menţionate ca reacţii cvasi-reversibile sau ireversibile de transfer de electroni. O altă observaţie este poziţia curentului de peak: este clar că peak-ul apare la aceeaşi valoare de potenţial (figura 3) şi aceasta este o caracteristică a reacţiilor de electrod. La o viteză de baleiaj mică. În consecinţă. voltamograma se va obţine mai încet. Aceste procese rapide sunt adesea menţionate ca reacţii reversibile de transfer de electroni. prin urmare. deoarece 470 . viteza de balaiaj a potenţialului (şi. stratul de difuzie va creşte mai mult în comparaţie cu cazul în care viteza de scanare este mare. timpul necesar pentru a înregistra o voltamogramă) influenţează puternic comportamentele observate. cu cât viteza de baleiaj este mai mică. În consecinţă. valoarea curentului va fi mai mică la valori mici ale vitezei de baleiaj. Cum mărimea curentului este proporţională cu fluxul spre electrod. care au o cinetică rapidă de transfer de electroni. Figura 4. faţă de cele de la viteze de baleiaj mari. fluxul de la suprafaţa electrodului este considerabil mai mic la viteze de baleiaj mici.timpului necesar pentru a înregistra voltamograma. Voltamograma cu baleiaj liniar de potential. În aceast caz. se poate formula întrebarea referitoare la ce s-ar întâmpla în cazul în care procesele de transfer de electroni au fost "lente" (în raport cu viteza de baleiaj a potenţialului). pentru diferite constante ale vitezei reactiei de reducere. Prin urmare.

Această inversare se poate produce de mai multe ori în timpul unui singur experiment. ca şi în cazul voltametriei liniare. care se încheie atunci când se ajunge la un potenţial stabilit (V2). În această situaţie. 3. Dacă transferul de electroni la suprafaţă este rapid şi curentul este limitat de difuzia speciilor spre suprafaţa electrodului. forma generală a voltamogramei înregistrate este similară cu cea de mai sus.Voltametria ciclică (sau CV) Este metoda electrochimică potenţiodinamică foarte similară cu LSV. atunci când potenţialul aplicat este invers. Într-un experiment de voltametrie ciclică. peak-ul de reducere va avea o formă similară cu peak-ul de oxidare. iar curentul este măsurat între electrodul de lucru şi electrodul auxiliar. în scanarea în sens direct se obţine un curent de peak pentru orice specie care poate fi oxidată în domeniul de potenţial baleiat. Potenţialul este măsurat între electrodul de referinţă şi electrodul de lucru. potenţialul de electrod este baleiat liniar faţă de timp (figura 5). Curentul va creşte pe măsură ce potenţialul atinge potenţialul de oxidare a analitului. Acesta are loc deoarece curentul apare mai încet decât în cazurile reversibile. se va ajunge la potenţialul la care se va reduce produsul format în prima reacţie de oxidare şi se va produce un curent de polaritate inversă faţă de scanarea directă. dar apoi va scădea deoarece concentraţia analitului se va epuiza în vecinătatea suprafeţei electrodului. panta dreptei fiind cunoscută ca viteza de baleiaj (v [V/s]). De obicei. în general.cinetica de reacţie este "lentă" şi. în cazul CV. potenţialul electrodului de lucru este baleiat liniar în funcţie de timp. Voltamograma ciclică obţinută este rRESezentarea grafică a curentul obţinut la electrodul de lucru (i) faţă de potenţialul aplicat (E). iar potenţialul este baleiat înapoi la V1. de asemenea. de viteza de baleiaj a potenţialului). când potenţialul atinge V2 sensul de baleiaj este inversat. astfel. Voltametria ciclică este folosită. pentru a studia proprietăţile electrochimice ale unui analit într-o soluţie. Spre deosebire de voltametria cu baleiaj linear. deşi potenţialul este baleiat tot între două valori (V1 şi V2). poziţia curentului de peak/maxim se schimbă în funcţie de constanta vitezei de reducere (şi. În cazul în care cuplul redox este reversibil. atunci curentul de peak 471 . din astfel de experimente se obţin informaţii despre potenţialul redox şi despre vitezele reacţiilor electrochimice. După cum se observă în voltamograma din figura 6. dar spre deosebire de reacţia reversibilă. echilibrele nu sunt stabilite rapid (în comparaţie cu viteza de baleiaj). Ca urmare. În voltametrie ciclică.

Figura 5. ionii se mişcă spre suprafaţa electrodului pentru a forma un strat dublu electric. convertind produsul (Fe2+) înapoi la reactant (Fe3+). primeşte un electron şi difuzează de la suprafaţă. ci se comportă mai degrabă ca şi cum ar fi. Când potenţialul electrodului este variat. specia (Ox) capabilă de a primi un electron de la electrod difuzează spre suprafaţă. Figura 6. la potenţialul de interes? Răspunsul este că un curent tranzitoriu poate circula deoarece interfaţa electrod-soluţie se va comporta ca un condensator. Semnalul de excitare în cazul voltametriei ciclice. iar pentru descrierea sistemelor electrochimice se preferă acest model 472 . În cazul reducerii. Curentul de la suprafaţă este generat prin transferul de electroni de la electrod la speciile redox. în absenţa unui cuplu redox nu este un condensator cu plăci paralele pur. poziţia echilibrului se modifică în sens invers. Curentul apare din nou datorită speciilor din soluţie care difuzează spre electrod şi are sens invers decât procesul din prima etapă. Răspunsul la baleiajul în sens direct este identic cu cel de la LSV. Voltamograma ciclică pentru un rectant participând la o reacţie monoelectronică de transfer de electroni.(vârf) va fi proporţional cu rădăcina pătrată a vitezei de scanare. Când sensul de baleiaj este inversat. Reacţia de electrod şi capacitatea electrodului Figura 7 descrie procesul care are loc în reacţii de electrod simple. În soluţie. Se pune întrebarea dacă un curent poate apărea dacă nu există nici o specie în soluţia care poate transfera electroni la suprafaţă electrodului. aşa cum se arată în figura 8. curentul este transportat prin migraţia ionilor. O interfaţă electrod-soluţie. O voltamogramă ciclică tipică. Această relaţie este descrisă de ecuaţia Cottrell. înregistrată pentru o reacţie reversibilă monoelectronică. este prezentată în figura 6.

ℓ este distanţa de separare între plăcile paralele. Pentru a calcula mărimea acestui curent. Cea mai simplă descriere a capacităţii electrochimice este dată de modelul Helmholtz: C εε 0 = A (5) unde: ε este constantă dielectrică a materialului de separare a plăcilor. iar A este aria de electrod. Figura 8. se diferenţiază ecuaţia (1) în raport cu t şi presupune că capacitatea este o mărime constantă: dQ dE =C dt dt (6) 473 . Figura 7. pentru un condensator cu plăci paralele. Capacitatea este un factor esenţial în experimentele electrochimice pentru că dă naştere la un curent în timpul de încărcare al condensatorului. Acest model nu descrie în mod adecvat toate interfeţele electrochimice dacă capacitatea depinde atât de potenţial. Schema stratului dublu electric. Astfel. Destul de logic (şi fără imaginaţie). Sistem electrochimic care include transferul de electroni şi circuitul echivalent corespunzător. sarcina condensatorului (Q) este proporţională cu căderea de tensiune în condensator (E): Q=CE (4) Constanta de proporţionalitate C este capacitatea mediului.care permite să se înţeleagă comportamentul electrozilor în absenţa unui cuplu redox. εo este permitivitatea spaţiului liber. numim această mărime curent de încărcare. cât şi de electrolitul suport.

Curentul atinge o stare de echilibru. curentul îşi schimbă semnul. se poate determina capacitatea sistemului. se vor folosi condiţii în care curentul capacitiv este mic în comparaţie cu curentul de transfer de electroni (denumit curent faradaic). puterea reală a acestei tehnici constă în capacitatea sa de a investiga mecanismul reacţiei de electrod. Voltametria ciclică cu un cuplu redox activ Deşi curenţii capacitivi în voltametrie ciclică sunt o realitate. Figura 9. La inversarea vitezei de scanare. atunci acest curent este singurul care va fi observat. şi se aplică semnalul de excitare a potenţialului având forma din figura 9a. 474 . se obţine: I = C*v (7) Prin această derivare simplă. în care nu este prezent nici un cuplu redox activ (experimentul prezentat în figura 9). Dacă nu există nici o posibilitate de transfer de electroni între soluţie şi electrod (nu există un cuplu redox). Rezultatul excitării sistemului este o creştere bruscă a curentului din cauza schimbării bruşte a vitezei de scanare (ν). Experiment de voltametrie ciclică.Identificând dQ/dt ca o expresie a curentului şi dE/dt cu viteza de baleiaj a potenţialului (v). se obţine o expresie pentru curentul de încărcare în stare staţionară. Curentul faradaic depinde de doi factori: cinetica transferului de electroni şi viteza la care specia redox difuzează spre suprafaţa electrodului. prin măsurarea curentului de încărcare la o anumită viteză de scanare. voltamograma obţinută are forma din figura 9b. De obicei. atunci când se aplică o treaptă de potenţial. curentul revine la zero. în absenţa speciei redox active. care se menţine atât cât se menţine variaţia de potenţial. iar când se opreşte scanarea. Voltametria ciclică fără cuplu redox activ Dacă se consideră cazul foarte simplu al voltametriei ciclice. 4. Astfel. 5.

C* este concentraţia de specie oxidată în volumul soluţiei.respectă ecuaţia lui Nernst 9: Fe (CN)6 3. cu atât este mai mare curentul catodic. După cum se observă din ecuaţia 11. cu atât este mai mare fluxul J şi. εo’ = 0. Dacă presupunem că concentraţiile de la suprafaţa electrodului sunt reglementate prin ecuaţia lui Nernst. Chem. Presupunând că viteza de transfer de electroni este foarte rapidă. concentraţia de specii oxidate la suprafaţă va scădea odată cu negativarea potenţialului. prin urmare.. concentraţia de Fe(CN)63. conform ecuaţiei 10. (Detalii cu privire la simulări în voltametria ciclică pot fi găsite în Anal. Chiar şi în cazul asumării comportamentului nernstian. 1964. Interpretări calitative.0592 log 4− [Fe(CN)6 ] − [Fe(CN)3 6 ] unde: E este potenţialul aplicat şi E0’ este potenţialul formal de electrod. 1351). concentraţiile de Fe(CN)63.şi Fe(CN)64.trebuie să scadă la suprafaţa electrodului. 706 şi Anal. Se poate observa că. 1965. (dC/dx)x=0 este gradientul de concentraţie la suprafaţa electrodului. rRESoducerea fidelă a voltamogramei cuplului Fe(CN)63-/4(figura 6) necesită o soluţie analitică la două ecuaţii diferenţiale. aşa că se presupune că la suprafeţele electrodului. curentul i care este măsurat când potenţialul scade va fi direct proporţional cu fluxul speciilor oxidate care difuzează spre suprafaţa electrodului. ENH (8) (9) E = E o' − 0.+ 1 e. Chem.Pentru cuplul redox Fe(CN)63-/4-. 36. prin reacţia de reducere la Fe(CN)64-. care participă la reacţia 8 a cărei cinetică de transfer de electroni este destul de rapidă. cu cât este mai mare gradientul de concentraţie.356 V vs. conform ecuaţiei 10: i=nFAJ Fluxul este guvernat de legea lui Fick: (10) (C * −C x = 0 ) ⎛ dC ⎞ ≅D J = −D ⎜ ⎟ Δx ⎝ dx ⎠ x = 0 (11) unde: D este coeficientul de difuzie a speciilor. deoarece potenţialul aplicat devine mai negativ.→ Fe(CN)6 4. 475 .. şi Cx=0 este concentraţia sa la suprafaţa electrodului. x este distanţa de la suprafaţa electrodului. 37.

Se va obţine un curent de peak negativ şi apoi curentul va scădea în amplitudine. astfel încât în conformitate cu legea de difuzie a lui Fick (ec. Parametrii electrochimici caracteristici. curentul catodic vor fi mai mari. cu cât epuizarea stratului de specie redusă va creşte. Dacă se inversează potenţialul de scanare (nu este arătat în figura 10). curentul va scădea în continuare. vom ajunge la o regiune unde curentul anodic începe să domine (figura 11). încă mai există un strat epuizat de specie oxidată. Toate acestea vor duce la obţinerea unei curbe curent-potenţial care are forma din figura 11. prin urmare. fluxul spre suprafaţă şi. Apoi sistemul va trece prin intermediul profilelor de concentraţie similare pentru speciile reduse.Schimbarea gradientului de concentraţie pentru regiunea catodică din voltamograma ciclică este prezentată în figura 10. concentraţia speciei oxidate se epuizează la suprafaţă. Dacă se va continua negativarea potenţialului. cu atât va scădea fluxul spre suprafaţa electrodului şi curentul va începe să scadă. Această concentraţie mai mică la suprafaţă dă un gradient de concentraţie mai mare (cel puţin iniţial). Figura 11. faza de volum a soluţiei care este epuizată în specia oxidată va creşte şi gradientul de concentraţie va începe să scadă. În cele din urmă. Profilul de concentraţie la diferite momente de timp. Cu cât scade gradientul de concentraţie. concentraţia speciilor oxidate la suprafaţa electrodului va tinde spre zero. în cadrul experimentului de CV (numai baleiaj negativ). Figura 10. iar soluţia are concentraţia uniformă din faza de volum C*. dar concentraţia de suprafaţă începând să crească. Înainte ca un potenţial să fie aplicat la electrod (t = 0). În acelaşi timp. nu există nici un gradient de concentraţie. În momentul în care se aplică un potenţial. 476 . 11). Alura voltamogramei ciclice pentru o reacţie electrochimică nernstiană.

13). Acest suprapotenţial reiese dintr-o combinaţie a vitezelor de difuzie a analitului şi bariera intrinsecă de activare a transferului de electroni de la electrod la analit. la 25 °C: ip = (2.687 *105) n3/2 A D1/2 v1/2 C* (13) unde: ip este curentul de peak (în A). Nicholson şi Shain au efectuat simulări cantitative ale voltametriei care au dus la schimbări majore în domeniul electrochimiei. la toate vitezele de scanare. Separarea potenţialului de peak ΔEp (= Epc . În 1964. conform reacţiei 12: Ox + e- → Red (12) Toate voltamogramele reversibile arată la fel şi au forma tipică indicată în figura 11. este foarte de dorit ca analitul să prezinte peak-uri reversibile. care se cuantifică conform figurii 11. la 25 oC. Chiar şi cuplurile reversibile conţin suprapotenţiale de polarizare şi astfel prezintă o histereză între potenţialul absolut de reducere (Epc) şi de oxidare (Epa). Este foarte dificil pentru a atinge o sepa477 . A este aria electrodului (în cm2). O descriere teoretică a suprapotenţialului de polarizare este inclusă în ecuaţia Butler-Volmer şi ecuaţia Cottrell. Dacă un sistem redox rămâne în echilibru pe întreg domneiul de potenţial scanat. n este numărul de electroni transferaţi. Simulările cantitative arată mai multe aspecte pentru un sistem nernstian. v este viteza de baleiaj (în V/s) şi C* este concentraţia în faza de volum a speciei (în mol/cm3). D este coeficientul de difuzie (în cm2 s-1). procesul redox este numit reversibil (echilibru impune ca concentraţiile de suprafaţă de Ox şi Red să fie menţinute la valorile prezise prin ecuaţia Nernst). De asemenea. Analitul trebuie să fie o specie redox în domeniul de potenţial experimentat.Epa) = 59/n [mV]. Curentul de peak într-o voltamogramă ciclică care conţine o singură specie este descrisă de ecuaţia Randles-Sevcik (ec. Următorii parametrii sunt folosiţi pentru a caracteriza voltamograma ciclică a unui proces reversibil: a. Proces redox reversibil Utilitatea voltametriei ciclice este foarte dependentă de analitul studiat. Un peak reversibil se obţine atunci când un analit este redus sau este oxidat pe un sens al baleiajului de potenţial şi apoi este reoxidat sau redus pe sensul invers al baleiajului. Parametrii importanţi pentru o voltamogramă ciclică sunt potenţialele de vârf (Ep ) şi curenţii de vârf (ip).Caracterizarea Aceasta a fost o descriere foarte calitativă a voltametriei ciclice.

poate fi explicată ca şi în cazul LSV. În cazul în care valorile constantelor de difuzie pentru speciile oxidate şi reduse sunt similare. este de 56. Atunci când se obţin peak-uri reversibile. iar conform ecuaţiei 13. cum ar fi: potenţialul de semi-undă (E01/2). Diferenţa între potentialul de peak (Ep) şi potentialul la care curentul este jumătate decât la Ep. ca funcţie de grosimea stratului de difuzie. 478 . funcţia ip/v1/2 este independentă de v. Aceasta este o funcţie de pregătire a electrozilor. b. ilustrat în figura 12. e. Influenţa vitezei de baleiaj asupra voltamogramelor ciclice ale unui cuplu redox monoelectronic reversibil. pe majoritatea electrozilor solizi. în experimentele de stripare sau în prezenţa unui fenomen de nucleaţie. Voltamograma pentru o reacţie cvasi-reversibilă pentru diferite valori ale constantelor vitezelor de reducere şi de oxidare. Poziţia potenţialului de peak nu se modifică cu viteza de scanare. se pot determina informaţii termodinamice. curentul este controlat atât de transferul de încărcare. Figura 12. valoarea Eo’ poate fi estimată ca media aritmetică a valorilor potenţialelor de peak anodic şi catodic (Eo’ = (Epa + Epc )/2). f. cât şi de transportul de masă. Influenţa vitezei de scanare asupra curentului pentru un transfer de electroni reversibil. (Ep/2). Acest raport poate fi perturbat pentru cuplurile reversibile în prezenţa unei reacţii chimice. Figura 13. Procese redox cvasi-reversibile Pentru sistemele cvasi-reversibile (cu 10-1> k °> 10-5 cm/s). unde: n este numărul de electroni transferaţi. Raportul curenţilor de peak este unitar (ipa/ipc = 1) la toate vitezele de scanare.5/n [mV] la 25 °C. c. (Se consideră o valoare mulţumitoare aceea de 70 mV. d. Curenţii de peak (ip) sunt proporţionali cu rădăcina pătrată a vitezei de scanare (v). precum şi de viteză de scanare). g.rare a peak-urilor în valoare de 59/n [mV].

În aceste cazuri se observă că separarea de peak este o funcţie de viteză constantă a transferului de electroni. reversibilitatea impune ca cinetica de transfer de electroni să fie suficient de rapidă pentru a menţine concentraţiile de suprafaţă ale Ox şi Red. Un proces cvasi-reversibil se caracterizează prin: A) Separarea potenţialelor de peak are o valoare care depaşeşte 58/n mV şi care creşte cu creşterea v (ΔEp > 58/n mV). Există două cazuri de comportament ireversibil descrise mai jos. potenţial de peak în comparaţie cu un sistem reversibil. Cu toate acestea. De asemenea. Pe măsură ce acest raport creşte. viteza de transfer de electroni are o şansă mai mare de a fi mai rapidă.Forma voltamogramei ciclice este funcţie de raportului k°/(πνnFD/RT)1/2. Dacă raportul ks/v este suficient de mic încât concentraţiile nernstiene nu pot fi menţinute. În general. Când se efectuează o voltamogramă ciclică pe un electrod modificat cu un monostrat auto-asamblat. sistemele devin mai lente şi sunt apte să prezinte control cinetic. se poate demonstra rolul esenţial pe care îl joacă curăţenia electrodului prin compararea voltamogramelor obţinute cu electrodul curat şi modificat. este posibil ca în scopul de a schimba un proces cvasi-reversibil într-unul reversibil să se micşoreze viteza de baleiaj v (ceea ce permite ca într-un timp mai îndelungat concentraţiile superficiale să se ajusteze la noile valori ce479 . v). Deviaţiile de la comportamentul reversibil sunt identificate prin variaţii de la parametrii expuşi anterior (a-g). care scade când cuplurile redox nu sunt în măsură să ajungă la suprafaţa electrodului. atunci procesul se spune că este cvasi-reversibil. dacă electrozii nu sunt curăţati (sau sunt acoperiţi cu monostraturi). Sistemele nernstiane de transfer de electroni la electrod complete sunt greu de găsit în practică şi moleculele redox-active sunt adesea destul de lente. comparativ cu difuzia. Comportamentul unui electrod se poate apropia de cel al un sistem nernstian prin încetinirea vitezei de scanare. procesul se apropie de cazul reversibil. Prin urmare. la valorile cerute de ecuaţia lui Nernst. pentru valori mici ale acestuia. Atâta timp cât reversibilitatea depinde de valoarea raportului ks/v. Cu cât curentul este mai mic. 1) Cinetica transferului de electroni lent Aşa cum s-a menţionat anterior. sistemul va prezenta un comportament ireversibil. voltamogramele unui sistem cvasi-reversibil sunt mai extinse şi prezintă o separare mai mare. reversibilitatea depinde de valorile relative ale constantelor de viteză a transferului de electroni eterogen (ks) şi viteza de schimbare a potenţialului (viteza de scanare.

în cazul în care reducerea de la Red la Ox este urmată de conversia lui Red la P. atât de oxidare. afectată de reacţii chimice care urmează după transferul de electroni. ΔEp depinde de valoarea ks/v şi. În aceste cazuri. dar variază în funcţie de viteza de scanare. adică raportul ipa/ipc este diferit (mai mare sau mai mic) de 1. Cele două efecte pot fi distinse prin varierea concentraţiei de analit (scăderea potenţialului datorită rezistenţei necompensate a soluţiei şi astfel. cât şi de reducere sunt încă rapide. curentul de peak variază în funcţie de rădăcina pătrată a ratei de scanare. este posibil să se determine mai multe informaţii. în special despre procesul cinetic care urmează după cel electrochimic.rute de schimbările de potenţial). În plus. 480 . viteza de reducere creşte şi potenţialul de peak (Epc) se deplasează spre o valoare mai pozitivă. În mod similar cu cazul de reversibilitate. În figura 13. C) Atunci când peak-urile sunt semi-reversibile. B) Din păcate. De exemplu. în timp ce valoarea ks este independentă de concentraţia de analit). Valoarea curentului poate fi. separarea potenţialelor de peak nu mai este fixă. de asemenea. ks poate fi calculată din variaţiile Ep cu v. Prin analizarea variaţiei potenţialului de peak. Din nou. de asemenea. dacă ambele specii Ox şi Red sunt stabile în timpul experimentului. cu toate acestea. atunci mai mult Red trebuie generat pentru a compensa pierderea de Red. potenţialele de peak se deplasează spre valori mai pozitive/negative. Efectul unei reacţii chimice depinde de valoarea raportului k/v (unde k este constanta de viteză a reacţiei chimice). prin compensare electronică cu feedback pozitiv şi prin manipularea ulterioară a datelor. valoarea ΔEp rezultată creşte cu creşterea curentului. prima curbă prezintă cazul în care constantele de viteză ale proceselor. prin urmare. Efectul Ru poate fi minimizat printr-un design experimental atent. când constantele de viteză sunt reduse. În plus. în funcţie de viteza de scanare este posibil să se obţină o estimare pentru constantele vitezelor de transfer de electroni. creşterea ΔEp cu creşterea v poate fi. cauzată de rezistenţa necompensată a soluţiei (Ru). 2) Reacţiile chimice ale Ox şi Red Valorile de echilibrul pentru Ox şi Red pot fi menţinute în timpul unui experiment de voltametrie ciclică. Dacă această valoare este mare. Prin urmare. raportul ipa/ipc este mai mic decât unitatea (din moment ce doar o parte din moleculele care au fost reduse prin baleiajul direct sunt disponibile pentru reoxidation prin baleiajul invers). acest lucru poate fi înţeles în termeni de echilibru la suprafaţă care nu este stabilit atât de rapid.

Dacă este acesta cazul. în timp ce un efect mai redus apare în cazul în care acest raport este mai mic. este posibil să se elimine efectul reacţiei chimice (deci să se restabilească reversibilitatea). cel mai frec481 . prin cresterea v. voltameteria ciclică nu poate determina dacă peak-ul este la potenţialul său termodinamic sau s-a deplasat la un potenţial mai extrem. un exemplu comun pentru metale tranziţionale este o schimbare în geometria sferei de coordonare. Dacă ambele efecte sunt prezente. datorită unui suprapotenţial. este posibil ca peak-ul să fie ireversibil din cauza unui proces fizic. În plus. atunci viteze mari de scanare pot arăta peak-uri reversibile. există o serie de dezavantaje inerente în cadrul acestui procedeu: a. plasând o limită superioară a lui v decât poate fi utilizată. există diferenţe considerabile în ceea ce priveşte parametrii voltamogramei. De asemenea. fie prin investigarea efectului vitezei de baleiaj asupra raportului ipa/ipc. raportul dintre curentul de peak faradaic şi curentul de încărcare scade cu creşterea v (în timp ip este proporţional cu v1/2). În ciuda acestor limitări. Există un curent rezidual de încărcare în timpul experimentului. în unele domenii de cercetare. Acesta poate fi însă determinat. b. Procese redox ireversibile (control de transfer de sarcină) În cazul transferului de electroni ne-reversibil. cu toate acestea el necesită adesea existenţa de cantităţi egale de analit. în ambele stări de oxidare. Acest fapt restrânge limita de detecţie la aproximativ 10-5 M. voltametria ciclică este una din tehnicile standard utilizate pentru caracterizare. Când un peak este ne-reversibil. voltametria ciclică este foarte potrivită pentru o gamă largă de aplicaţii. Cuplul redox ar putea fi ireversibil din cauza unui proces chimic care urmează. Valoarea lui k poate fi calculată fie prin studii de simulare. Prin urmare. atunci constantele de viteză pentru aceste procese nu pot fi calculate folosind metode de simulare.atunci reacţia chimică are un efect semnificativ. Efectele transferului eterogen de electroni lent şi reacţiile chimice nu pot fi separate. Într-adevăr. exprimat prin vCdl (unde: Cdl este capacitatea la interfaţa electrodului de lucru). Deşi voltametria ciclică este foarte utilizată pe scară largă pentru caracterizarea speciilor redox (de exemplu: potenţiale redox şi stabilitatea diferitelor stări de oxidare) şi de investigare calitativă a reacţiilor chimice care însoţesc transferul de electroni. Când peak-urile sunt ne-reversibile este imposibil să se determine parametrul E01/2.

un electrod de referinţă şi un contraelectrod (figura 14). electrozii sunt statici şi aşezaţi în soluţii negitate. după reducere sau oxidare.vent. Combinaţia dintre solvent. electrolit şi electrodul de lucru specific determină intervalul de potenţial baleiat. Această stratificare a analitului poate izola suprafaţa electrodului. de obicei. o formă de precipitare. În timpul voltametriei ciclice. cu toate acestea. Această metodă cu soluţie staţionară are ca şi consecinţă apariţia caracteristicilor de peak controlate de difuzie. electrolitul este adăugat la soluţia de testat pentru a asigura o conductivitate suficientă. Solubilitatea unui analit se poate schimba drastic dacă se schimbă sarcina totală a acestuia. acolo unde poate afişa în continuare activitate redox. De obicei. sarcina analitului. de asemenea. ele sunt în general în afara domeniului de aplicare al voltametriei ciclice. Deoarece voltametria ciclică modifică. Figura 14. ca o parte din analit să rămână. cel puţin. Condiţii experimentale Metoda utilizează o combinaţie de trei electrozi: electrodul de lucru. Unele speculaţii pot fi făcute în ceea ce priveşte peak-urile ireversibile. evidenţiind propria activitate redox în scanările ulterioare sau. este uzual pentru analitul redus sau oxidat să precipite pe electrod. Această metodă permite. poate modifica 482 . Celula electrochimică pentru experimentul de voltametrie liniară sau ciclică. Agitarea soluţiei între trasarea voltamogramelor este importantă pentru ca să furnizeze suprafaţei electrodului analit proaspăt în fiecare nou experiment.

Exemplu Se realizează o soluţie de hexacianoferat de potasiu 0. Din acestea sau alte motive. Utilizând voltametria ciclică să sa investigheze comportamentul cuplului redox Fe(CN)63-/4.5 mM K3Fe(CN)6 prin dizolvarea cantităţii corespunzătoare de sare în 100 ml de KCl 1 M. fluxul spre suprafaţa electrodului este realizat prin agitare. Pentru a minimiza curentul şi rezistenţa. 483 . Electrozii de referinţă uzuali sunt cei de calomel sau de Ag/AgCl saturaţi cu KCl. de asemenea. Într-o tehnică hidrodinamică. uneori separaţi de soluţia testată prin capilare Luggin care să împiedice infestarea electrolitului cu KCl. platina şi aurul. Pentru a executa experimente de voltametrie ciclică la viteze de scanare mari este insuficient un electrod de lucru obişnuit. pompare a soluţiei sau rotaţia electrodului. Remarci Voltametrie ciclică nu este o tehnică hidrodinamică. atâta timp cât este asigurată o conducţie bună a curentului. Un electrod de lucru obişnuit are o rază de un ordin de mărime de câţiva mm. adesea este necesară curăţarea electrozilor între scanări.suprafaţa electrodului. Pentru interpretarea rezultatelor de voltametrie ciclică este important ca electrodul să posede o arie a suprafaţei controlată cu o formă definită. Aceste tehnici ţintesc condiţiile de stare de echilibru. în general. care au ca rezultat creşterea rezistenţei. sub numele de electrod auxiliar. Celula electrochimică conţine 10 ml soluţie de analit şi este echipată cu 3 electrozi: electrod de lucru din grafit. încastraţi într-un material izolator inert. poate fi orice material care conduce cu uşurinţă şi nu va reacţiona cu volumul soluţiei. pot fi folosiţi ultramicroelectrozi. Pentru a menţine curentul observat la contraelectrod. ceea ce duce la denaturarea formei voltamogramei. Materialele uzuale pentru electrozii de lucru sunt: cărbunele sticlos. ipa/ipc. ceea ce le limitează la voltametria cu baleiaj liniar de potenţial. Aceşti electrozi sunt. precum şi D.şi să se determine parametrii electrochimici: Eo’. se vor oxida sau reduce adesea electrolitul sau solventul. Reacţiile care apar la suprafaţa contraelectrodului sunt lipsite de importanţă. Vitezele mari de scanare creează peak-uri având intensităţi mari de curent. Contraelectrodul cunoscut. care apar oricum indiferent dacă baleiajul se face dinspre valori pozitive sau negative. contraelectrodul de platină şi electrodul de referinţă Ag/AgCl/KClsat. ΔEp. cum este în cazul electrozilor disc-rotitor şi disc-inel-rotitor. având doar un disc expus la unul dintre capete.

potenţialul de întoarcere. La rularea softului GPES se deschid 3 ferestre (figura 16). Figura 15.+ e(13) (14) Aparatura folosită este un potenţiostat Autolab PGStat 10 (EcoChimie. Softul GPES pentru pilotarea potenţiostatului. În fereastra «Data presentation» va apărea voltamograma on-line. Eventual.+ e. În fereastra «Manual Control» se bifează toată gama de curenţi pentru ca rRESezentarea grafică on-line să se autoscaleze. după ce s-a dat comanda “Start”. În fereastra «Edit Procedure» se fixează parametrii experimentului: potenţialul de start.→ [FeIII(CN)6]4[FeII(CN)6]4.Procesele de electrod sunt: reducere: oxidare: [FeII(CN)6]3. 484 . Potenţiostat Autolab PGStat 10.→ [FeIII(CN)6]3. numărul de cicluri şi viteza de baleiaj. Olanda) pilotat de computer (figura 15). se fixează şi parametrii pretratamentului (depinde de sistemul studiat). Figura 16.

303 0. Voltamograma ciclică pe CV/NP (0.00025 -0.050 ipa/ipc 0. Tabelul 1.2 0.00050 -0.253 0.254e-4 Ipc (A) -1. -0. Ca şi toate tehnicile cu puls de potenţial.00050 anodic catodic 1E-3 0.Pentru sistemul studiat. 2 cicluri. -0. KClsat log v Figura 17. tampon fosfat 0.815 0. Cronoamperometrie Cronoamperometria este o tehnică electrochimică în care potenţialul electrodului de lucru este variat după un semnal tip treaptă. care scade exponenţial cu timpul. tampon fosfat 0.8.00075 log I 1E-4 I/A 0.4 0. Parametrii electrochimici ai sistemului studiat în figura 17. ca orice circuit RC. se observă ca mărimile ΔEp şi ipa/ipc au valori care plasează sistemul studiat în cazul sistemelor monoelectronice. pH = 6. se obţin voltamogramele din figura 17. cronoamperometria generează un curent mare.303 Epc (V) 0.1 M. Condiţii experimentale: electrolit.253 Ipa (A) 1. Log v pentru electrodul CV/NP (0.050 0. Figura 18.255e-4 -2.0 0. Ag/AgCl.00025 -0. pH = 6.278 ΔEp (V) 0.00075 20 mV/s 50 mV/s 70 mV/s 100 mV/s 200 mV/s 0.753e-4 Eo’ (V) 0.278 0. curentul faradic rezultat la electrod este monitorizat ca funcţie de timp. Condiţii experimentale: electrolit. 0.8. Din panta rRESezentării log I vs log v (figura 18) se stabileşte puterea lui v şi astfel se verifică posibilitatea de a utiliza ecuaţia Randles-Sencik pentru calculul coeficientului de difuzie.1 M.818 Din datele prezentate în tabelul 1.6 10 E/ V vs. v (mV/s) 50 100 Epa (V) 0. reversibile (conform Anexei 1). potenţial de start. KClsat. potenţial de start. la diferite viteze de baleiaj. Curentul obţinut (figura 19) are două componente: un curent datorat încărcării stratului dublu (figura 20) şi altul datorat transferului de electroni. 485 .023e-4 2.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl.1 V/ Ag/AgCl. 2 cicluri.00000 0. KClsat.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl. Dependenţa log I vs.1 V/ Ag/AgCl.

dar în sens opus există pentru Red. şi se lucrează în acele condiţii experimentale care să asigure că fluxul spre electrod să fie strict controlat de difuzie. Aşa cum s-a discutat anterior. ∂Ci/∂x. care după formarea sa este liber să difuzeze departe de suprafaţa electrodului. de ex. în faza de volum de 1 mM. Cu cât electrodul rămâne mai mult la acest potenţial de reducere. Astfel. în faza de volum. Soluţia conţine. prin care Ox din cea mai mare parte a soluţiei trebuie să difuze la suprafaţa electrodului. Profilul curentului stratului dublu electric Considerând o situaţie în care un electrod solid este cufundat într-o soluţie care conţine forma oxidată (Ox) a unui cuplu redox la concentraţie iniţială cunoscută (C0). de asemenea.Figura 19. cu atât stratul de difuzie sărăcit în Ox. Iniţial. unde este imediat redusă la Red. Ca urmare a transformării. 486 . evaluate la x = 0. Cronoamperograma Figura 20. acelaşi lucru se va observa şi în cazul curentului. potenţialul este modificat după un semnal de tip treaptă până la o valoare semnificativ mai negativă decât E0’ pentru cuplu redox (Es). electrodul este fixat la un potenţial (Ei) mult mai pozitiv decat ale E0’ a cuplului Red/Ox. iar forma Ox din vecinătatea electrodului este imediat transformată (după o cinetică reversibilă) la forma Red. Un gradient similar. Aceasta duce la formarea unui gradient de concentraţie pentru Ox. cum panta profilului de concentrare pentru Ox scade cu timpul în urma excitării sub formă de treaptă de potenţial. La un moment t0. Această situaţie este prezentată în Figura 21. un exces de electrolit inert. pe măsură ce trece timpul. curentul faradaic în condiţii controlate de difuzie este direct legat cu gradientul de concentraţie. se extinde. concentraţia de Ox din vecinătatea electrodului este redusă la zero faţă de concentraţia iniţială. asigurându-ne că doar Ox este prezent în soluţie.: 1 mM.

pentru un sistem reversibil (de reducere). si D0 = constanta de difuzie pentru specia electroactiv (cm /s). adică cel cu o singură treaptă de potenţial. În exemplul de mai sus.485 C/echivalent). ic. concentraţia de Ox la suprafaţă a atins imediat valoarea zero pentru o treaptă de potenţial mult mai negativă decât E0’ a cuplului redox. scade ca funcţie de 1/t si are valori semnificative numai în perioada iniţială (de câteva ms) imediat după aplicarea semnalului treaptă.uoa.gr/applets/AppletDiffus/Appl_Diffus2. în care potenţialul revine la o valoare finală (Ef) după ce este menţinut o perioadă de timp τ. Prin natura lui acest curent capacitiv.Figura 21. la potenţialul Es. În general. Pe lângă cel mai frecvent experiment de cronoamperometrie. pot fi găsite la (http://www. această influenţă poate fi evitată numai luând în considerare datele i-t în ultimele 90% din timp. care descrie curentul observat (electrodul planar) în orice moment. raportul [Red] la [Ox] la suprafaţa electodului este dat de ecuaţia lui Nernst la orice potenţial. A = aria electrodului (cm ). Curentul datorat încărcării stratului dublu. în care numai curentul rezultat este înregistrat. Semnalul de excitare in cronoamperometrie si evolutia profilului de concentratie la suprafata electodului. De obicei. cu raportul 100:1 ajungând la o valoare de 118 mV mai negativă decât E0’. F = constanta Faraday (96. C0 = concentraţia speciei electroactiv (mol/cm ).html). Informaţii suplimentare cu privire la formarea de gradienţilor de concentrare. în urma unui trepte de potenţial într-o reacţie redox reversibilă (sau la suprapotenţial mare) în funcţie de t-1/2. 487 2 3 . Ecuaţia cea mai utilă în cronoamperometria este ecuaţia Cottrell. i = n F A Co Do1/2 π-1/2 t-1/2 [A] 2 (15) unde n = numărul de electroni implicaţi în reactie. contribuie la curentul total observat după aplicarea unei treapte de potenţial.chem. Acesta poate fi uşor înregistrat prin efectuarea experimentului într-o celulă care conţine doar electrolit. există şi cele cu treaptă dublă de potenţial.

Faulkner L.Cronoamperometria cu pas dublu de potenţial este ilustrată în figura 22.. curentul observat pentru prima treaptă scade cu t-1/2. după fiecare treaptă de potenţial. Oxford University Press. Cum era de aşteptat din ecuaţia Cottrell. 1993. Figura 22.. fie de n. transferul de electroni este reversibil atât chimic. M. USA. 2. John Wiley and Sons Publishers. În partea stângă a figurii este arătat felul cum se aplică treapta de potenţial de la Ei la Es. valorile curentului măsurat la un moment egal cu τ/2. Electrochemistry: Principles. Brett Oliveira A. sunt uşor de realizat măsurători. Semnalul de excitare şi răspunsul în cronoamperometria cu treaptă dublă . De exemplu.. Cronoamperometria se pretează bine la măsurarea exactă a ariei electrodului (A) prin utilizarea unui cuplu redox bine-definit (cu n. 6. 2001. În general. 488 . A. curentul din perioada de întoarcere este înregistrat tot pentru un inte rval de timp τ. Co si Do cunoscute]. cât şi electrochimic. fie de D0 pentru o specie electroactivă. unde este menţinut un timp τ.Bibliografie 1. Curentul apărut la treapta de întoarcere este conceptual mai dificil de explicat decât cel de la prima treaptă.293 pentru raportul dintre [-ir (2τ)/if (τ). . J. Metoda dublei trepte de potenţial este deseori aplicată în măsuratori de constante de viteză pentru reacţii chimice (inclusiv produşi de adsorbţie) care apar în urma primei trepte de potenţial. după fiecare treaptă (notat ir şi if în figura 22) pentru un astfel de sistem ar duce la o valoare egală cu 0. Pentru cei interesaţi detaliile se află în Bard şi Faulkner. Electrochemical Methods: Fundamentals and Applications. pentru ca apoi să revină la Ef = Ei. R. reversibil poate fi identificat prin compararea valorile curentului direct şi invers măsurat în acelaşi interval de timp. În acest exemplu. New York. Brett C. Un sistem simplu. Methods and Applications. Cu o suprafaţă de electrod cunoscută.Prezenţa unei reacţii chimice după etapa de transfer de electroni va duce la un raport diferit de această valoare teoretică. Bard A. M.

36. 1351] E p .99 *105) n(αna)1/2 A D1/2 v1/2 C* [A]. Lovrić: Square-Wave Voltammetry... 706.. Chem. Experimental Techniques and Applications. 9. 6.09⎜ ⎟ = E1 / 2 + n ⎝ nF ⎠ ΔEp (= Epc . Chem..7 [mV]. (Editor) Bioelectrochemistry: Fundamentals. Ltd. S. 37. 1351 (https://twiki. edt) Springer-Verlag. Anal. α )⎜ ⎟ ⎝ nF ⎠ ⎛ ⎜ ⎜ ko Λ=⎜ nF ⎜ ⎡D1−α Dα ⎜ ⎢ Ox Red RT ⎝⎣ ⎞ ⎟ ⎟ 1/2 ⎟ ⎤ v⎥ ⎟ ⎟ ⎦ ⎠ 1/2 ⎛ ⎛ D ⎞α/2 ⎞ ⎜ ⎜ ox ⎟ k ⎟ . Nicholson R . S. 1965. 10.E p/2 = 489 . Scholz. Singapore. se calculeaza D na = număr de 1/2 o ⎞ ⎛ 1/2 ⎞ RT ⎛ αn F ⎞ 1/2 .Ep = (Λ .687 *105) n3/2 AD1/2 v1/2C* [A]. Anal. Bartlett P..E1/2 = .78 + ln ⎜ D Ox ⎟ + ln ⎛ electroni transferaţi în E p = E o' ⎜ a ⎟ + lnv ⎟ o ⎜ ⎟ ⎜ ⎟ αn a F ⎝ RT ⎠ ⎝ k ⎠ etapa determinată de ⎝ ⎠ viteză 47. Shain I.3.. E. 1965... Anal. Chem. 2007.co.. M. se calculează ks s ⎟ ⎟ ⎜ ⎜D ⎟v −1 / 2 Ψ = ⎜ ⎝ Re d ⎠ 1/2 ⎜ ⎡ nF ⎤ ⎟ D π ⎜ ox ⎥ ⎟ ⎜⎢ RT ⎦ ⎟ ⎠ ⎝⎣ Sisteme ireversibile. John Wiley & Sons. Chem. 37. V. ISBN 981-270-625-9 5.Epa) = 59/n ipa/ipc = 1 Sisteme cvasi-reversibile ⎛ nF ⎞ i p = nFAC* D1/2 Ψ(E) v1/2 Ox ⎜ RT ⎟ ⎝ ⎠ ⎛ RT ⎞ Ep/2 ..N. se calculeaza k ⎜ 0. se calculeaza αna αn a [Pentru identificarea notaţiilor şi detalii vezi: Nicholson.. 1964. Shain I. 7.1. S. G. 2007. Nicholson R. Berlin. Chem. Anal..ogt. Anal. Mirčeski. ISBN 978-3-540-73739-1.109⎜ ⎟=− n ⎝ nF ⎠ RT 28. Chem. se calculează D Sisteme reversibile 28.. 8. S.(ISBN 978-0470843642) 4.5 [mV] ⎛ RT ⎞ E p . Š. 37(11). 190. 37. 1965. 2008. 1965.uk/twiki/pub/People/ElectrochemistryPapers/TheoryandApplicationofC yclicVoltammetryforMeasurementofElectrodeReactionKinetics. Nicholson R. Anal.. 667. Banks C. ip = (2. In: Monographs in Electrochemistry (F.pdf) Anexa 1.. Criterii de identificare pentru voltametria ciclică cu specia redox în soluţie ip = (2. Understanding voltammetry. Nicholson R. Compton R. Shain I.5 [mV] ⎛ ⎞ E p/2 = E1/2 + 1.. 1965.S. Nicholson R. 371 + XII p. 37. 178. Theory and Application. World Scientific. Komorsky-Lovrić.

....155 mA si Ipc = 0................................. Se trasează voltamogramele ciclice la diferite viteze de baleiaj pe electrodul de platină în soluţia de 5 mM K3[Fe(CN)6] care conţine 0.........................109 V.........................................................245 V....157 mA) având parametrii electrochimici (ΔE = 0.....................................493 2..................... Studiu de caz Conf..................................2.. Estimarea stabilităţii sistemului G/SWCNT–Fe(III)P-Nafion la funcţionare continuă ...............................................................494 2....Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie ..............................................................................498 3.......... prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj................. prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj............505 5...........1 M KCl ca şi fond electrolitic pentru îmbunătăţirea conducţiei (Figura 1A)...................... Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) imobilizată în polimeri ....... Eo’ = 0......................... dr............................................................................3.. Ec = 0...........................4.. Calculul constantei eterogene de transfer de electroni pentru sistemul G/SWCNT–Fe(III)P-Nafion ...506 6....... ........... Anexă ................................................Electrochimia unei substanţe cu potenţial biologic activ.................5.. Bibliografie ..1..499 3.....507 1.............. ing............. Studiul integrităţii filmului de Fe(III)P pentru sistemul G/SWCNT–Fe(III)P-Nafion prin calculul ariei suprafeţei active ................ 490 .... Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie.. Influenţa vitezei de baleiaj asupra comportării heminei adsorbită (G/SWCNT–Fe(III) P-Nafion) pe electrod de grafit .....495 3..... Comportamentul redox al acestei substanţe considerată standard este descris de ecuaţia 1: Fe(CN)6 + e -3 - → Fe(CN)6 -4 (1) şi se manifestă prin apariţia unei perechi de picuri bine conturate (poziţionate la Ea = 0............1.............................. Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie.......497 3............... Influenţa pHului asupra comportării sistemului G//Fe(III)P pe electrod de grafit ......... Influenţa vitezei de baleiaj asupra comportării heminei in soluţie (G//Fe(III)P) pe electrod de grafit........................501 3...............987. a.......................................502 3. pentru o viteză de baleiaj de 50 mV/s.......300 V si Ipa/Ipc = 0.2............354 V. Influenţa pH-ului asupra comportării sistemului adsorbit (G/SWCNT– Fe(III)P-Nafion) pe electrod de grafit ............. Ipa = 0.. Concluzii .490 2.. Graziella Liana Turdean Cuprins 1..............504 4.......................................

cu ajutorul curenţilor de peak anodic şi catodic (Ipa. J.5.0 v 1 /2 / (V /s ) b.4 0 .(A) 800 600 400 200 0 -2 0 0 -4 0 0 -6 0 0 -0 . (B) Dependenta log I vs. ESC (C) Figura 1. Astfel. ESC.0 0 . log v (figura 1B). A = aria electrodului (cm2). 500 / μA anodic 400 300 200 100 I / μA I 0 -1 0 0 -2 0 0 -3 0 0 -4 0 0 0 . respec491 .6 0 . log v pentru voltamogramele din fig 1A. dependenţa I vs.6 E / V vs. Intensitatea curentului de peak (Ip) depinde de viteza de baleiaj (v) în conformitate cu ecuaţia Randles-Sevcic (ecuatia 2) pentru un sistem reversibil sub control difuziv [Bard A. iar intensitatea curentului. (A) Voltamograma ciclica a 5 mM K3[Fe(CN)6]+ 0.2 0 . D0 = coeficientul de difuzie (cm2/s). panta în jur de 0.2 (B) 5 m V /s 1 0 m V /s 2 5 m V /s 5 0 m V /s 7 5 m V /s 1 0 0 m V /s 2 5 0 m V /s 5 0 0 m V /s 7 5 0 m V /s 9 0 0 m V /s anodic catodic I / μA I/A 1E-4 10 100 1000 -1 v / (mV *s ) 0 . Ipc). se află în soluţie. C0* = concentraţia soluţiei în fază de volum (mol/cm3). v = viteza de baleiaj (V/s) . Condiţii experimentale: potenţial iniţial.4 0 .2 0 . –0. panta în jur de 1).69*105 n3/2 A D01/2 v1/2 Co* (2) unde: Ip = curentul de peak (A). Panta acestor regresii ne dă indicii despre tipul de transfer de sarcină difuziv (specia în soluţie. (C) Influenta vitezei de baleiaj asupra curentului de peak I pentru voltamogramele din fig 1A.8 1/2 catodic 1 . v1/2. n = numărul de