Editori Mihaela Aluaş Simion Simon

Metode experimentale avansate pentru studiul şi analiza bio-nano-sistemelor

1

2

Editori Mihaela Aluaş Simion Simon

METODE EXPERIMENTALE AVANSATE
PENTRU STUDIUL ŞI ANALIZA BIO-NANO-SISTEMELOR

Casa Cărţii de Ştiinţă Cluj-Napoca, 2012 3

Coperta: Patricia Puşcaş

Editură acreditată CNCSIS (24)

© Universitatea „Babeş-Bolyai”, 2012

Material editat în cadrul proiectului „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, ID 36154

Descrierea CIP a Bibliotecii Naţionale a României Metode experimentale avansate pentru studiul şi analiza bio-nanosistemelor / ed.: Mihaela Aluaş, Simion Simon. - Cluj-Napoca : Casa Cărţii de Ştiinţă, 2012 Bibliogr. ISBN 978-606-17-0115-5 I. Aluaş, Mihaela (ed.) II. Simon, Simion (ed.) 53

4

Prefaţă
În calitate de director al proiectului cu titlul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract” POSDRU/21/1.5/G/36154, doresc să mulţumesc tuturor colaboratorilor care au contribuit prin expertiza şi profesionalismul lor la realizarea acestui volum şi, implicit, la dezvoltarea programului doctoral. Mulţumirile mele se îndreaptă de asemenea către echipa de management a proiectului, în următoarea componenţă: Prof. dr. Simion Simon, coordonator ştiinţific program doctoral Prof. dr. Octavian Popescu, coordonator ştiinţific relaţii internaţionale Cristina Dominic, asistent manager Andra Ghira, responsabil logistic şi asistent manager Jr. Alexandru Braşoveanu, consilier juridic Ec. Gelu Silviu Moldovan, responsabil financiar Ing. Carmen Ciplea, expert IT Ec. István Püsök, expert contabil Am convingerea că informaţia cuprinsă în această lucrare va sprijini generaţiile prezente şi viitoare de conducători de doctorat în activitatea lor de cercetare. De asemenea, va facilita orientarea doctoranzilor în lumea minunată a ştiinţei contribuind la determinarea acestora de a face din meseria de cercetător o vocaţie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract POSDRU/21/1.5/G/36154, a fost cofinanţat din Fondul Social European prin Programul Operaţional Sectorial Dezvoltarea Resurselor Umane 2007-2013. C.S.III. dr. Mihaela ALUAŞ 5

6

Cuvânt înainte
Institutul de Cercetări Interdisciplinare a fost înfiinţat prin Hotărârea Senatului Universităţii Babeş-Bolyai din data de 30.05.2001, ca unitate de cercetare şi transfer tehnologic, având ca obiectiv de activitate atât realizarea de studii şi cercetări interdisciplinare în domeniile biologie moleculară, biomateriale şi sisteme biologice, materiale avansate şi mediu ambiant, sisteme nanostructurate natural şi artificial, cât şi transferul rezultatelor obţinute către beneficiari locali, naţionali sau internaţionali. Institutul beneficiază de o clădire proprie, cu o suprafaţă desfăşurată de peste 3000 mp, modernizată la nivelul standardelor internaţionale din punct de vedere al dotărilor conexe şi având laboratoare de cercetare structurate în acord cu nevoile cercetărilor interdisciplinare menţionate. Între timp institutul, prin efortul conjugat al celor care au decis să-şi dedice energia şi cunoştinţele cercetărilor la interfaţa Bio-NanoSistemelor, a devenit Institutul de Cercetări Interdisciplinare în Bio-NanoŞtiinţe (ICI-BNS). În cadrul acestuia îşi desfăşoară activitatea în prezent 12 profesori universitari (dintre care 10 conducători de doctorat), 25 alte cadre didactice şi cercetători şi peste 40 de doctoranzi cu frecvenţă. Aceştia aparţin domeniilor Fizică, Chimie, Biologie, Informatică, Ştiinţa mediului şi Psihologie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară” a oferit posibilitatea de a mobiliza un set de cercetători valoroşi, cu experienţă deosebită în tehnicile experimentale frecvent utilizate în cercetările interdisciplinare din domeniul Bio-Nano-Ştiinţelor. Marea majoritate a experţilor a beneficiat de stagii doctorale sau postdoctorale în prestigioase laboratoare din lume unde au dobândit o bogată experienţă în utilizarea echipamentelor de înaltă performanţă de care dispune Institutul nostru. Studenţii doctoranzi, dar şi specialişti din domenii ca: fizică, chimie, biologie, geologie sau ştiinţa mediului interesaţi în studii experimentale interdisciplinare vor găsi în materialele incluse în prezentul volum date teoretice dar mai ales practice, despre tehnici experimentale avansate prezentate într-o formă accesibilă, cu exemple semnificative, menite a facilita înţelegerea fenomenelor studiate şi a contribui la creşterea aportului fiecărui cercetător la dezvoltarea domeniului în care îşi va desfăşura activitatea ştiinţifică. Prof. Dr. Simion SIMON Director ICI-BNS

7

8

CUPRINS
I. ANALIZE GENETICE ................................................................................................. 13 Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine.......................................................................................................................... 13 Asist. univ. dr. Iulia Lupan Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare ........... 36 Asist. univ. dr. Iulia Lupan II. CULTURI CELULARE ............................................................................................... 64 Culturi celulare ........................................................................................................... 64 Lect. dr. Mircea Teodor Chiriac Culturi celulare – partea a II-a .................................................................................... 82 Lect. dr. Mircea Teodor Chiriac III. MICROSCOPUL CONFOCAL RAMAN............................................................ 101 Microspectroscopia Raman....................................................................................... 101 Conf. dr. Monica Maria Baia Microspectroscopia Raman – partea a II-a................................................................ 121 Conf. dr. Monica Maria Baia IV. SPECTROMETRUL IR........................................................................................... 134 Spectroscopia de absorbţie în infraroşu .................................................................. 134 Lect. dr. Nicolae Leopold Tendinţe moderne în spectroscopia de absorbţie IR ............................................. 147 Lect. dr. Nicolae Leopold V. SPECTROFLUORIMETRUL .................................................................................. 160 Spectrofluorimetria .................................................................................................... 160 Conf. dr. Dana Maniu Spectrofluorimetria - aplicaţii ................................................................................... 172 Conf. dr. Dana Maniu VI. SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ ......... 191 Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) .................. 191 C.S.I. dr. Claudiu Filip, C.S.III. dr. Mihaela Aluaş Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă .......................................................................................................... 216 C.S.I. dr. Claudiu FILIP, C.S.III. dr. Mihaela Aluaş

9

Rezonanţa magnetică nucleară pe sisteme lichide ................................................ 246 Lect. dr. Mihai Vasilescu VII. MĂSURĂTORI TERMICE .................................................................................. 266 Analiză termică diferenţială. Analiză calorimetrică diferenţială......................... 266 Conf. dr. Raluca Ciceo-Lucăcel Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială. Ghid de interpretare a măsurătorilor DTA/TG şi DSC........................................................................................................................... 275 Conf. dr. Raluca Ciceo-Lucăcel VIII. DIFRACTOMETRUL DE RAZE X ................................................................... 286 Difracţie de raze X pe pulberi ................................................................................... 286 C.S.I. dr. Gheorghe Borodi Determinarea structurii cristaline prin difracţie de raze X................................... 305 C.S.I. dr. Gheorghe Borodi IX. MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE ........... 327 Microscopia electronică ............................................................................................. 327 şef lucrări dr. Lucian Barbu-Tudoran Microscopia electronică - partea a II-a .................................................................... 347 şef lucrări dr. Lucian Barbu-Tudoran X. MICROSCOPUL DE FORŢĂ ATOMICĂ ............................................................ 365 Microscopia de forţă atomică ................................................................................... 365 Conf. dr. Ioan Burda Microscopia de forţă atomică – partea a II-a ........................................................... 378 Conf. dr. Ioan Burda XI. SPECTROMETRUL DE FOTOELECTRONI DE RAZE X ŞI ULTRAVIOLETE .......................................................................................................... 394 Spectroscopia fotoelectronică ................................................................................... 394 C.S.III. dr. Maria Teodora Radu Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale ................................................................................... 424 C.S.III. dr. Teodora Maria Radu, C.S.dr. Emilia Sabina Varga XII. SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN .......... 437 Spectroscopia de rezonanţă electronică de spin ................................................... 437 C.S. dr. Milica Todea Spectroscopia de rezonanţă electronică de spin – partea a II- a ............................ 452 C.S. dr. Milica Todea

10

......................... ing....... dr. 490 Conf.................... dr.............XIII. Graziella Liana Turdean XIV............... testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice ............................. ing....... Réka Barabás     11 ......... METODE ELECTROCHIMICE ........... 509 Lect........ Studiu de caz .. 509 Sisteme de analiză a suprafeţei specifice şi a dimensiunii particulelor ............... ing.. Graziella Liana Turdean Electrochimia unei substanţe cu potenţial biologic activ. 467 Conf............................... 467 Elaborarea.... SISTEME DE ANALIZĂ A SUPRAFEŢEI SPECIFICE ŞI A DIMENSIUNII PARTICULELOR ..... dr....

  12 .

....................................................... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot ADN în sine are doar 2 funcţii importante şi anume păstrarea informaţiei genetice şi furnizarea acesteia pentru sinteza de proteine....... de la proteine la ADN............. Iulia Lupan Cuprins 1........ Păstrarea include transmiterea materialului genetic nemodificat de la o generaţie la alta........ Acest fapt este realizat prin replicarea ADN şi împărţirea egală a celor două copii în timpul diviziunii celulare...... Mesagerul informaţiei între ADN şi proteine este ARN...... Dogma centrală a biologiei presupune transmiterea unidirecţională a informaţiei de la ADN la proteine prin intermediul ARN (Figura 1)......... 33 4. ARNm rezultat serveşte ca matriţă în procesul de traducere a ADN (sinteza proteinelor) care are loc în ribozomi...................... ANALIZE GENETICE Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine Asist. Informaţia genetică nu poate fi transmisă invers....... univ............ Informaţia genetică poate fi transmisă de la ARN la ADN în cazul retrovirusurilor la care materialul genetic este ARN... 31 3........... 13 2............................ care este sintetizat în procesul de transcriere a ADN de către o enzimă numită ARN polimerază... Bibliografie .................... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot ....................................................I........ Nu există cazuri de transmitere a informaţiei de la ADN direct la proteine................ dr........ Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare ..... Practic ARN este cărăuşul informaţiei din nucleu în citoplasmă unde are loc sinteza proteinelor......... 13 ................. Infrastructura existentă în cadrul Centrului de Biologie Moleculară .... A doua funcţie este legată de descifrarea informaţiei pentru sinteza de proteine........................ 34 1..

Prin multiplicarea celulelor cu genele clonate se pot obţine milioane de copii ale unei singure gene. iar numărul moleculelor deci şi cantitatea de ADN este mică. De cele mai multe ori genele de interes care sunt scopul clonării codifică un polipeptid. ARN informaţional este ARN mesager (ARNm) care codifică un polipeptid şi serveşte ca matriţă în procesul de traducere (sinteză a proteinelor). ci un fragment de ADN care nu poate fi separat dintr-un amestec heterogen de molecule apropiate ca mărime. Deoarece fragmentul ADN de interes sau ţintă se află într-un genom este necesară extragerea acestuia. fie prin tăierea acestuia din genom. • verificarea moleculelor recombinate Amplificarea genei de interes. fie prin copierea acestuia. Sumar. procesul clonării constă din următoarele etape: • amplificarea genei de interes • introducerea genei de interes într-un vector de clonare • introducerea moleculelor recombinate în celule gazdă • selecţia celulelor transformate (purtătoare ale moleculei recombinate) Figura 1. Dogma centrală a biologiei. Din această cauză în continuare se va utiliza doar termenul fragment ADN de interes pentru a evita confuziile.Clonarea genelor constă în izolarea unei gene dintr-un genom şi introducerea ei în alte celule gazdă pentru multiplicare şi în unele cazuri pentru exprimare. Moleculele de ARN rezultate în urma transcrierii pot fi împărţite în 2 categorii: • ARN funcţional • ARN informaţional ARN funcţional este ARN care nu se traduce. A doua opţiune de copiere a fragmentului din genom este cea mai des 14 . În alte cazuri scopul clonării nu este obligatoriu o genă. îndeplineşte anumite funcţii în celulă (în cea mai mare parte participă la procesul de traducere) şi ocupă cea mai mare parte din ARN total din celulă: ARN ribosomal (ARNr) şi ARN de transport (ARNt). Există 2 modalităţi de a obţine fragmentul dorit. care necesită apoi o izolare din amestecul de fragmente generate. Tăierea fragmentului din genom este mai dificilă deoarece necesită prezenţa unor situsuri (secvenţe specifice) la capetele fragmentului. O genă este considerat orice fragment de ADN care se transcrie într-o moleculă de ARN.

utilizată. e nevoie de mai mult timp. Etapele de denaturare după primul ciclu sunt mai scurte. Această tehnică poate fi considerată un adevărat copiator de gene. Tehnica este pe larg utilizată. temperatura este coborâtă la 40-60ºC timp de câteva zeci de secunde. În acest scop se utilizează tehnica PCR (Polymerase Chain Reaction). Pentru alinierea amorselor la secvenţele complementare. Există mai multe formule de calcul. denumite şi oligonucleotide. Amorsele (termenul englezesc este primer). în special la capetele acesteia. Denaturarea ADN presupune separarea celor două catene. doar de 30-45 sec. O condiţie obligatorie pentru o amplificare reuşită este cunoaşterea secvenţei ţintă. este rapidă şi sensibilă deoarece necesită cantităţi foarte mici de ADN matriţă. Temperatura de topire se calculează în dependenţă de lungimea amorsei şi de compoziţia ei. cum ar fi spre exemplu denaturarea ADN. Aceste amorse sunt complementare cu extremităţile secvenţei ţintă şi formează cu acestea porţiuni scurte dublu catenare. iar după 35-40 de cicluri se obţin milioane de copii ale fragmentului ţintă pornind de la o singură copie. Ca agent denaturant se utilizează temperaturi înalte de 94-98ºC. Reacţia de amplificare este una ciclică. fiecare ciclu fiind alcătuit din 3 etape: • denaturarea ADN • alinierea amorselor • sinteza catenei complementare de către ADN polimerază După fiecare ciclu practic cantitatea de ADN se dublează. Dacă în celule pentru replicare se foloseşte o întreagă serie de proteine. Denaturarea din primul ciclu durează câteva minute (2-6) deoarece pentru denaturarea moleculelor de ADN genomic. cea mai simplă formulă de calcul pentru o amorsă de până în 25 de nucleotide este: Tm = 4 (G + C) + 2(A + T) 15 . Procesul este reversibil. catenele complementare formând molecula dublu catenară după înlăturarea agentului de denaturare. Denaturarea ADN este necesară pentru separarea celor 2 catene. aici rolul unora dintre ele este preluat de unii factori fizici. Principiul tehnicii PCR este o imitaţie a procesului de replicare a ADN care are loc în celule. Dacă secvenţa este necunoscută. care sunt foarte mari. Temperatura de aliniere se stabileşte la câteva grade (2-5ºC) mai puţin decât temperatura de topire (Tm) a amorsei. sunt secvenţe scurte de ADN monocatenar. Această etapă este numită de aliniere sau hibridizare. atunci se vor analiza cel puţin secvenţe ADN omoloage de la alte specii sau secvenţa de aminoacizi a proteinei dacă este vorba despre o genă.

care are activitatea optimă de sinteză la 37°C. care nu poate porni sinteza de la zero şi are nevoie de un capăt liber 3'. Numărul de G şi C se înmulţeşte dublu faţă de A şi T deoarece între acestea există 3 legături de hidrogen. Taq polimeraza are activitatea optimă la 72°C şi nu se denaturează la temperaturi ridicate de peste 90°C foarte repede. în caz contrar amorsa poate forma secvenţe interne dublu catenare care au aspect de stem sau buclă • cele două amorse sens (forward) şi antisens (reverse) nu trebuie sa fie complementare între ele. izolată de la o bacterie termofilă Thermococcus aquaticus (de unde şi denumirea ei). ADN polimeraza catalizează sinteza catenei complementare în direcţia 5'→3' (Figura 2). Iniţial la originea tehnicii PCR se folosea ADN polimeraza izolată de la bacteria Escherichia coli. De la aceste porţiuni dublu catenare formate între catena matriţă şi amorsa ADN. polimeraza poate iniţia sinteza catenei complementare. astfel după câteva ore la 95°C pierderea de activitate este nesemnificativă. A şi T sunt numărul de nucleotide ce conţin aceste baze azotate. Există câteva reguli pentru construirea amorselor şi anume: • numărul de nucleotide este de 15-35 • temperatura de topire a amorselor trebuie să fie între 40 şi 70ºC • conţinutul de G şi C nu trebuie să depăşească 50-55% • la capătul 3' al amorsei este de dorit să fie o G sau C. pe larg utilizată şi astăzi este Taq polimeraza. C. care sintetizează polimerizarea nucleotidelor trifosfat într-un lanţ polinucleotidic în direcţia 5′→3′. dar şi ca punct start pentru ADN polimerază. În acest fel tuburile de reacţie trebuiau schimbate de la o temperatură la alta şi după fiecare ciclu era nevoie de un surplus de ADN polimerază. Această enzimă este o ADN polimerază. Amorsele servesc în primul rând la delimitarea fragmentului amplificat. Enzima revoluţionară în acest sens. în consecinţă moleculele bogate în G şi C au o temperatură mai mare de topire. Salvarea acestei metode a venit după descoperirea şi descrierea ADN polimerazelor de la bacteriile termofile. Cel mai mare dezavantaj al utilizării acestei enzime era inactivarea termică în timpul denaturării ADN. Astfel amplificarea fragmentelor de ADN era una foarte costisitoare. Viteza de polimerizare a Taq polimerazei este de 16 .Unde G. iar ca rezultat se vor amplifica porţiunile scurte rămase monocatenare. deoarece oferă o stabilitate mai mare • amorsele nu trebuie să prezinte complementaritate internă. altfel se vor forma porţiuni dublu catenare sau dimeri de amorse.

Pentru un fragment de 500 de nucleotide vor fi suficiente 30 sec. Etapa iniţială de denaturare 5' 3' ADN genomic cu fragmentul ţintă 3' 5' 5' 3' 3 5' Alinierea amorselor la capetele fragmentului ţintă 3' 5' 3 ' 5' Ciclu I 5' 3' Etapa de elongare sau sinteză a catenei complementare de către ADN polimerază 3' 5' 5' 3' Sfârşitul primului ciclu 3' 5' 5' 3' 3' 5' 5' 3' 3' 5' 5' 3' 5' 3' 3' 3' 5' Ciclu II 5' 3' 5' 3' 3' 3' 5' 17 . Durata elongării necesare sintezei va fi în dependenţă de mărimea fragmentului ţintă. iar pentru un fragment de 2000 de nucleotide – 2minute.aproximativ 1000 de nucleotide per minut.

În ambele cazuri se porneşte de la ARNm (ARN informaţional care codifică proteine). Taq polimeraza este o ADN polimerază deoarece sintetizează ADN şi este ADN dependentă deoarece utilizează o matriţă ADN pentru sinteză. În mo18 . RT-PCR se utilizează pentru obţinerea copiilor de gene eucariote care nu conţin introni şi analiza exprimării de gene. Transcriptaza inversă a fost izolată de la virusurile care au material genetic ARN şi în momentul intrării în celulă necesită sinteza unei copii a materialului său genetic. Enzime de restricţie Enzimele de restricţie sau restrictazele sunt enzime care taie molecule monocatenare sau dublu catenare de ADN la anumite situsuri specifice. Ele pot fi numite cu alte cuvinte adevărate foarfece de ADN. Enzima responsabilă de această sinteză este transcriptaza inversă. Acest tip este asemănător PCR obişnuit. Restrictazele recunosc doar anumite secvenţe scurte numite situsuri specifice de recunoaştere. doar că foloseşte o matriţă de ARN pentru a sintetiza ADN. care este de fapt o ADN polimerază ARN-dependentă. Aceste enzime au fost descoperite la bacterii şi se presupune că funcţia lor este de apărare contra bacteriofagilor (virusuri ale bacteriilor).5' 3' 5' 3' 3' 5' 3' 5' 5' 3' 3' 5' 3' 3' Ciclu III 5' 3' 3' 5' 3' 5' 3' 5' 5' 3' 3' 5' 5' 3' 3' Taq polimeraza amorsă amorsă ce indică direcţia de sinteză Figura 2. Reprezentarea schematică a primelor cicluri de PCR. Un tip special de PCR este RT-PCR sau PCR de transcriere inversă. se fixează de acestea şi taie legăturile fosfoesterice între nucleotide.

Astfel. Această clasificare este în dependenţă de cofactorul utilizat şi de secvenţa de recunoaştere.mentul intrării ADN fagic în bacterii. enzimele de restricţie digeră aceste molecule. enzimele de restricţie. Până acum au fost descrise 4000 de enzime de restricţie de la câteva sute de specii bacteriene. Cu ajutorul unor programe speciale se pot alcătui hărţi de restricţie care reprezintă situsurile de recunoaştere pentru diferite restrictaze într-o secvenţă (Figura 4). iar EcoRI de la Escherichia coli tulpina RY13. Capetele libere după tăierea de către enzimele de restricţie pot fi de 2 feluri: coezive sau drepte. în general. ADN bacterian propriu este protejat contra enzimelor de restricţie prin metilarea unor baze azotate. nu taie ADN metilat. Nomenclatura enzimelor de restricţie porneşte de la denumirea bacteriei de la care a fost izolată. II şi III. Enzima BamHI şi EcoRI generează capete coezive după tăiere. Toate aceste enzime se împart în 3 clase: I. iar enzimele SmaI şi EcoRV generează capete drepte sau netede (Figura 3). Enzimele cele mai utilizate în tehnicile moleculare sunt cele de tip II. Secvenţele de recunoaştere pentru enzimele EcoRI (A) şi SmaI (B) şi capetele libere după tăiere. care au secvenţa de recunoaştere un palindrom şi utilizează ioni de Mg2+ ca şi cofactor. Secvenţa palindrom este alcătuită din 4-6 nucleotide şi citită pe ambele catene în direcţia 5′→3′ este identică. Locurile de tăiere sunt indicate cu săgeţi. A EcoRI B SmaI 5′ GAATTC CTTAAG 3′ 3′ 5′ 5′ GGGCCC CCCGGG 3′ 3′ 5′ 5′ G CTTAA 3′ AATTC G 3′ 5′ 5′ GGG CCC 3′ CCC GGG 3′ 5′ Figura 3. HindIII este izolată de Heamophilus influenzae tulpina Rd. 19 .

ADN ligaza T4 utilizează ATP ca şi cofactor. Figura 5. plasmide şi vectori artificiali. închisă şi capabilă de replicare autonomă în celule 20 . bacteriofagi. Această enzimă reface legăturile fosfoesterice între gruparea hidroxil a unui nucleotid (capătul 3′) şi gruparea fosfat de la nucleotidul altui fragment (capătul 5′) (Figura 5). Vectori de clonare Prin vectori de clonare subînţelegem molecule de ADN transportatoare ale fragmentului de ADN străin în celulele gazdă. Un plasmid este o moleculă dublu catenară de ADN.B am H I (533) H inf I (7 5) E co RV (5 8) H inf I (32) H inf I (461) E co RI (605) H inf I (616) E co RI (633) B am H I (7 7 3) NcoI (7 7 7 ) H inf I (942 Y LR3 7 7 C 1047 bp Figura 4. Cea mai des utilizată este ADN ligaza T4 izolată de la bacteriofagul T4. Vectorii sunt de mai multe tipuri: cosmide. Cele mai pe larg utilizate sunt plasmidele. Reprezentarea schematică de legare de către ADN ligază a două fragmente ADN care au capete netede. Cu cifre în paranteze sunt indicate situsurile enzimelor de restricţie. Aceşti vectori sunt utilizaţi în dependenţă de scopul clonării. Pentru legarea fragmentelor de ADN se utilizează o enzimă numită ADN ligază. recombinării şi după repararea ADN. care este circulară. Funcţia ligazei în celule vii este legarea fragmentelor în timpul replicării. Ligarea fragmentelor de ADN Deşi moleculele de ADN pot fi asemănate cu nişte fire. acestea nu pot fi legate prin creare de noduri sau nu există nici un lipici special. Harta de restricţie a unei gene de la drojdia Saccharomyces cerevisiae.

Atât vectorul cât şi fragmentul ADN sunt tăiate cu aceleaşi enzime de restricţie şi legate împreună cu ajutorul ligazei. atunci produsul acestei gene împreună cu subunităţile codificate din genomul celulei gazdă bacteriene vor forma o enzimă activă capabilă să metabolizeze un derivat al galactozei numit X-Gal (bromo-cloro-indolil galactopiranozid) care este adăugat în mediu şi este incolor. Dacă în SMC nu a fost introdus niciun fragment ADN atunci gena este intactă. a căror produs (enzimă) fac posibilă selectarea celulelor cu plasmid de cele fără plasmid care sunt mai numeroase. În acest scop situsul multiplu de clonare se află într-o genă ce codifică o enzimă. În această regiune se introduce fragmentul ţintă de ADN cu ajutorul enzimelor de restricţie şi a ligazei. se însămânţează pe un mediu cu ampicilină. cât şi fără plasmid. clonării. Un alt fel de selecţie este selecţia celulelor transformate cu plasmid recombinat adică cu insert de cele cu plasmid fără insert. Cei mai frecvenţi markeri utilizaţi sunt genele ce conferă rezistenţă la antibiotice. Plasmidele au nişte secvenţe specifice necesare replicării. produsul ei este o proteină activă. Nicio moleculă de ADN nu poate fi replicată fără o origine de replicare. O regiune foarte importantă într-un vector de clonare este Situsul Multiplu de Clonare (termenul englezesc este Multiple Cloning Site). Pentru replicarea autonomă în celule gazdă plasmidele conţin secvenţa ori. SMC conţine secvenţele de recunoaştere pentru mai multe enzime de restricţie care nu se conţin în altă regiune a vectorului. Spre exemplu. Dacă în SMC a fost introdus un fragment ADN atunci gena este modificată şi produsul ei este inactiv. vor supravieţui doar celulele care conţin plasmidul.gazdă. Plasmidele care conţin gena pentru această enzimă vor proteja celulele bacteriene de efectul antibioticului. Dacă β-galactozidaza este activă atunci va metaboliza acest substrat. Originea de replicare este o regiune a moleculei de ADN de unde poate începe replicarea şi care este recunoscută de anumite proteine care iniţiază replicarea. În acest fel coloniile re21 . iar produsul format în urma reacţiei va avea o culoare albastră. Spre exemplu dacă SMC se află în gena lacZ′ care codifică subunitatea α a enzimei β-galactozidază. Plasmidele comerciale utilizate pe larg sunt plasmide naturale izolate de la bacterii care au fost modificate. mai corect spus produsul genei conferă rezistenţă. care este originea de replicare. selecţiei şi uneori exprimării genelor. O altă componentă foarte importantă a plasmidelor sunt markerii de selecţie care sunt de obicei nişte gene. β-lactamaza conferă rezistenţă la ampicilină. Astfel dacă un amestec de celule transformate cu plasmide care vor conţine atât celule cu. Insert se referă la fragmentul de ADN ţintă clonat.

Codonul STOP este inclus şi el de obicei în situsul de clonare. MBP este termenul în engleză). Aceste elemente sunt cele care se găsesc şi în genom şi fac parte dintr-o genă: promotorul. Cele mai des utilizate sunt eticheta de 6 histidine (His-tag). Etichetele facilitează purificarea proteinelor recombinate prin cromatografie de afinitate. Vectorii de clonare au de obicei mărime mică. Ribosomii se leagă la acest situs şi se deplasează de-a lungul ARNm până întâlnesc primul codon START de unde începe traducerea. care se fixează la nivelul promotorului şi iniţiază transcrierea. doar de câteva mii de pb şi în care pot fi inserate fragmente de ADN de la 100 pb până la 2000-3000 pb (Figura 6: A. în caz contrar acesta se poate introduce în fragmentul ţintă cu ajutorul amorselor. Vectorii de clonare mai mici au de obicei un număr mai mare de copii per celulă. Un alt tip de selecţie utilizează o enzimă toxică pentru celulele bacteriene. Aceste etichete vor fi parte integrantă a proteinelor la 22 . În unele cazuri acesta este prezent după regiuni care codifică anumite aşa-zise etichete. Acest fapt permite obţinerea unei cantităţi mari de ADN plasmidic dintr-o cultură mică de bacterii (din 3-5 ml de cultură se pot obţine câteva μg de ADN plasmidic). Codonul START la procariote este în cele mai dese cazuri ATG. B).zultate după transformare care conţin vectorul fără insert vor fi albastre. deoarece ele nu produc enzimă activă capabilă de metabolizarea substratului X-Gal. de aceea situsul de legare al ribozomilor (termenul englezesc este Ribosome Binding Site) este o secvenţă care se transcrie dar care nu se traduce şi care este recunoscută de ribosomi. codonii START şi STOP care delimitează cadrul deschis de citire (termenul englezesc este Open Reading Frame). Celulele bacteriene care au plasmidul cu insert vor avea gena nefuncţională şi vor supraveţui. Promotorul este o secvenţă care se află în amonte de genă şi este recunoscut de factorii de transcriere. în consecinţă şi pentru a obţine o cantitate mai mare de ADN este necesară o cantitate mai mare de cultură. Vectorii de exprimare sunt de asemenea vectori de clonare dar care oferă în plus posibilitatea exprimării genei clonate (Figura 6 C). Plasmidele de exprimare trebuie să mai conţină câteva elemente în plus faţă de vectorii de clonare. Glutation S-transferaza (GST) şi proteina de legare a maltozei (Maltose Binding Protein. iar cele ce conţin vector recombinat vor fi albe. celulele cu plasmid fără insert au gena funcţională care va provoca moartea celulelor. Numai în prezenţa promotorului exprimarea va fi foarte scăzută. Pentru vectorii mai mari numărul copiilor per celulă este mai mic. Acest codon este de obicei inclus în situsul multiplu de clonare. O caracteristică importantă pentru plasmide este numărul de copii per celulă. Astfel. situsul de legare al ribosomilor.

Etichetele vor conferi proteinelor recombinate afinitate faţă de anumite răşini cromatografice. în dependenţă de gena selectată pentru inserare. iar situsul multiplu de clonare se află în gena lacZ' care oferă selecţia alb-albastră a clonelor pozitive. A – harta plasmidului pBR322 include 2 gene de rezistenţă la antibiotice: Apr conferă rezistenţă la ampicilină. 23 . C – harta vector de exprimare pET21a de la Novagen care include gena bla care conferă rezistenţă la ampicilină. B – harta plasmidului de clonare pTZ57R comercializat de firma Fermentas.capătul ei C-terminal sau N-terminal dacă secvenţa ce codifică eticheta este prezentă după sau înainte de situsul de clonare respectiv. promotorul de la fagul T7 care este inductibil cu IPTG. Hărţile unor vectori plasmidici. iar TCr rezistenţă la tetraciclină. situsul multiplu de clonare care conţine un codon START şi un codon STOP după eticheta de 6 histidine. A Eco RI (4360) Sca I (3847) Pvu I (3737) Cla I (25) HindIII (30) Eco RV (188) Bam HI (376) Sph I (567) Sal I (652) B LacZ Eco RI Sac I (6 AP r Pst I (3612) bla(AmR) Kpn I (6 TC r pTZ57R 2886 bp Xba I (6 Bam HI pBR322 4361 bp MCS Apa I (6 Sal I (6 Pst I (6 Hin dI ORI Bst Z17I (2247) T7 p T7 terminator C f1 origin His tag XhoI (159) Not I (167) HindIII (174) Sal I (180) Sac I (191) Ori M CS Eco RI (193) bla (Ap) Bam HI (199 Nde I (239 pET-21a 5443 bp T7 prom Bgl II (34 lacI ColE1 pBR322 origin Figura 6. rezistenţa la antibioticul respectiv se va pierde . situsul multiplu de clonare îl poate constitui oricare dintre cele două gene de rezistenţă. Plasmidul are rezistenţă la ampicilină.

coli şi prin tratarea celulelor cu clorură de calciu la rece se poate induce transformarea celulelor bacteriene (Figura 7 A). adică fără plasmid. deoarece E. timp de maxim 2 minute. o valoare foarte mare ţinând cont de faptul că avem nevoie de o singură colonie 24 . Transformarea în câmp electric este mai eficientă decât transformarea chimică. Aceste spălări repetate vor asigura eliminarea ionilor care pot afecta transformarea. ai cărei pereţi laterali sunt electrozii. ceea ce înseamnă ca la transformarea unui μg de plasmid s-ar obţine 1 milion de colonii. Prepararea celulelor competente presupune doar creşterea lor până în faza logaritmică (D=600nm = 0. În acest scop se realizează o cultură de E. Pentru acest tip de transformare este necesar un aparat numit electroporator. Ambele tipuri de transformare necesită inducerea unei competenţe de transformare.Introducerea moleculelor recombinate în celule gazdă Introducerea plasmidelor recombinate în celule gazdă se numeşte transformare dacă sunt utilizate celule bacteriene sau transfecţie dacă sunt celule eucariote. Celulele sunt şocate termic foarte scurt. Numărul de colonii va corespunde numărului de celulele transformate deoarece fiecare colonie ia naştere dintr-o singură celulă. Amestecul de celule competente şi plasmide recombinate vor fi depuse într-o cuvă specială de electroporare. O eficienţă bună de transformare este 106.6-0. Acest timp este suficient pentru intrarea moleculelor recombinate în celulele bacteriene.8) şi înlăturarea prin spălări repetate a mediului de cultură. care va crea câmpul electric între doi electrozi. acestea având cea mai mare aplicabilitate şi simplitate în scopul obţinerii clonelor şi proteinelor recombinate. Această competenţă în cazul transformării chimice este indusă cu CaCl2. cea mai mare parte dintre ele fiind netransformate. la 42°C. Numărul obţinut de la transformarea a 1 ng de ADN plasmidic se raportează la 1 μg de ADN (înmulţind valoarea la 1000). După transformare celulele şocate sunt preluate în mediu de cultură şi apoi însămânţate pe mediu selectiv cu antibiotice. În continuare se va detalia doar transformarea celulelor procariote. Transformarea are loc la o tensiune de 1800 sau 2500 V timp de câteva msec (Figura 7 B). Doar unele celule bacteriene sunt transformate. coli nu are proprietăţi de transformare naturală. Există două tipuri de transformare a celulelor bacteriene pe larg utilizate în laboratoarele de biologie moleculară: • transformarea chimică • transformare sub influenţa câmpului electric. Eficienţa de transformare a celulelor se poate măsura efectuând o transformare cu o cantitate de 1 ng de ADN plasmidic şi apoi numărând coloniile rezultate.

A CaCl2 2 min 42ºC B Celule de E. Primul loc în utilizarea vizualizării acizilor nucleici aparţine electroforezei în gel de agaroză. ea este utilizată cu succes deoarece este mai simplă. Transformarea chimică este mai puţin eficientă decât electroporarea.coli Însămânţarea celulelor transformate pe mediu selectiv Spălarea celulelor bacteriene 1800 V 5 msec Figura 7. Migrarea moleculelor se realizează printr-o matrice specifică. Desigur în amestecul de ligare numărul de molecule recombinate este mic şi din această cauză este recomandată o eficienţă cât mai mare a celulelor competente. Metoda este aplicată pentru analiza proteinelor şi a acizilor nucleici. Electroforeza acizilor nucleici Electroforeza este procesul de migrare a moleculelor cu sarcină într-un câmp electric. A – transformarea chimică cu CaCl2.coli Celule transformate de E. Pentru proteine se aplică cel mai des electroforeza proteinelor în condiţii denaturante în gel de poliacrilamidă (termenul englezesc SDS-PAGE). Această matrice este folosită mai rar în laboratoarele de analize genetice. Această sarcină face posibilă migrarea moleculelor de ADN şi ARN 25 . Moleculele de acizi nucleici sunt încărcate negativ datorită grupărilor fosfat.sau de câteva când avem un amestec eterogen de molecule ţintă. Deşi metoda oferă o rezoluţie inferioară celei din poliacrilamidă. Poliacrilamida se poate utiliza ca matrice şi pentru electroforeza acizilor nucleici care oferă o rezoluţie foarte bună a separării fragmentelor de ADN. B – electroporarea celulelor bacteriene. deoarece este mai laborioasă. mai ales în cazul fragmentelor mici. dar mai ieftină deoarece nu necesită aparatură şi cuve costisitoare. Fiecare dintre cele două metode de transformare prezintă avantaje şi dezavantaje legate de eficienţa de transformare şi de costuri. Transformarea celulelor bacteriene cu ADN plasmidic.

În concluzie concentraţii mai mici se folosesc pentru fragmente mari (câteva mii de pb). Gelurile de agaroză de 1% sunt cel mai des utilizate. La concentraţii mai mici de agaroză. Lungimea de undă a luminii ultraviolete la care este expus gelul trebuie să fie cuprinsă între 260 şi 300 nm. Vizualizarea ne oferă informaţii despre integritatea ADN 26 . Amestecul de molecule nu se va deplasa în câmp electric cu aceeaşi viteză. B – fotografia aceluiaşi gel. Concentraţia agarozei în gel poate fi între 1 şi 3% în dependenţă de scopul urmărit.1 şi 10 kpb. dar în godeu separat se va migra un amestec de molecule cu mase moleculare diferite dar cunoscute. cu atât mărimea porilor va fi mai mică. iar cele mai mari vor avansa mai lent. Cu cât concentraţia agarozei este mai mare. oferind separarea moleculelor între 0. Gelurile de agaroză se realizează prin încălzirea agarozei într-un tampon specific. Bromura de etidiu se intercalează între bazele azotate din molecula dublu catenară de ADN. A B Figura 8. Separarea unor fragmente de ADN cu ajutorul electroforezei în gel de agaroză. Deoarece ADN nu poate fi vizualizat cu ochiul liber este necesară utilizarea unui colorant. porii vor fi mai mari şi migrarea moleculelor mai rapidă. Gelurile de agaroză sunt plasate între cei doi electrozi în cuve speciale care conţin tampon de migrare. Moleculele mici se vor deplasa mai repede prin porii matricei.într-un câmp electric de la catod la anod. Cel mai des folosită în acest scop este bromura de etidiu. Acest amestec de molecule se numeşte marker molecular ADN. A – imaginea gelului la expunerea în UV. Electroforeza în gel de agaroză este utilizată pentru vizualizarea şi purificarea ADN. iar concentraţii mari pentru fragmente mici. Pentru estimarea aproximativă a mărimii fragmentelor în acelaşi gel. Acest tampon este acelaşi folosit şi pentru realizarea gelului. Cele mai folosite tampoane sunt TAE (Tris/Acetat/EDTA) şi TBE (Tris/Borat/EDTA). care fixată de ADN în lumină ultravioletă devine fluorescentă şi are o culoare portocalie (Figura 8). Astfel separarea moleculelor va fi în dependenţă de masa lor moleculară. Agaroza este un poliglucid extras din alge marine roşii.

dar asigură de obicei randamente de sinteză mai mari. Tli polimeraza ş. Pentru a evita erorile în produşii PCR se poate utiliza o ADN polimerază care are proprietatea de a corecta erorile introduse. Cultura se va incuba peste noapte cu agitare la 37°C. apoi la unul din capetele sale are loc ataşarea 27 . Apariţia coloniilor nu indică neapărat şi o reuşită deplină a clonării. În unele cazuri se utilizează un amestec de 2 polimeraze (3 părţi de Taq polimerază şi o parte Pfu polimerază) pentru a combina un randament mai mare cu o fidelitate crescută. estimarea cantităţii de ADN obţinută în reacţiile PCR sau de extracţie. Acest principiu presupune utilizarea unei variante de PCR pentru secvenţiere. Matriţa ADN ce urmează a fi secvenţiată este denaturată. Chiar dacă se foloseşte un sistem alb-albastru de selecţie a coloniilor pozitive. Ambele aparate utilizează principiul Sanger de secvenţiere. Această verificare este necesară deoarece ADN polimeraza utilizată pentru amplificarea insertului prin PCR poate introduce erori de sinteză. deoarece acestea pot conţine un amestec de colonii pozitive şi colonii cu plasmid fără insert. Taq polimeraza nu are activitate de corectare a erorilor. Digestia ADN plasmidic se va realiza cu enzimele de restricţie cu care acesta a fost introdus în vector sau care se află la extremele situsului multiplu de clonare. coli pe mediu selectiv. rezultatul digestiilor enzimatice. ADN plasmidic urmează a fi analizat iniţial prin digestie enzimatică şi apoi prin secvenţializare. a. dar nu va furniza nicio informaţie despre secvenţa fragmentului clonat. Ziua următoare din bacteriile rezultate se va purifica ADN plasmidic cu ajutorul unor metode clasice sau cu ajutorul unor kituri speciale. Această digestie va confirma prezenţa insertului în plasmid şi aproximativ mărimea acestuia. Analizor Genetic CEQ™ 8800 Genetic Analysis System (laser cu detecţie pentru 4 fluorocromi). acestea necesită totuşi o dovadă în plus a prezenţei plasmidului recombinat. Astfel de ADN polimeraze sunt Vent polimeraza. În cadrul Centrului de Biologie Moleculară există 2 secvenţiatoare: Analizorul Genetic ABI Prism 310. SUA (laser cu detecţie pentru 5 fluorocromi). În acest scop se va efectua o cultură lichidă de 3-5 ml de mediu cu antibiotic care se va însămânţa cu o singură colonie. ADN plasmidic etc).(ADN genomic. Verificarea moleculelor recombinate Rezultatul ligării şi transformării se poate vedea doar după 12-18 ore de la transformare când apar coloniile de E. Pfu polimeraza. ADN poate fi purificat din gel de agaroză după migrare prin excizarea fragmentului ţintă şi purificarea din gel cu kituri special predestinate acestui tip de purificări. Applied Biosystems. Secvenţializarea fragmentului ţintă este verificarea definitivă a clonării.

Clonarea în scopul multiplicării fragmentului este utilizată atunci când ADN supus analizei este de fapt un amestec de fragmente care nu pot fi separate cu ajutorul electroforezei şi la care se urmăreşte cunoaşterea secvenţei. Amestecul PCR conţine dezoxiribonucleozide trifosfat (dNTP) dar şi di-dezoxiribonucleozide trifosfat (ddNTP) care nu conţin gruparea OH în poziţia 3' a dezoxiribozei. fiecare ddNTP este marcat cu un fluorocrom. În acest scop amestecul de fragmente se clonează într-un vector de clonare. O cantitate de câţiva microlitri vor fi separaţi în gelul din capilar. Lipsa acestei grupări va face imposibilă continuarea sintezei ADN. deoarece ADN polimeraza nu poate adăuga următorul nucleotid. cele mai mici vor fi primele. Rezultatul acestui PCR vor fi fragmente monocatenare (deoarece se foloseşte o singură amorsă) de diferite mărimi. ceea ce permite sinteza tuturor fragmentelor care se opresc în toate punctele matriţei de ADN. iar clonele pozitive sunt apoi secvenţializate. Numărul de cicluri este de 40. În ultima parte a capilarului există o fereastră transparentă prin care un fascicol laser va excita fluorocromii. Pentru detecţia fragmentelor. Pentru fragmente mai mari sau pentru matriţe dificile (cu secvenţe repetitive) este necesară utilzarea unor kituri speciale.unei amorse de la care ADN polimeraza va porni sinteza catenei complementare. iar fluorescenţa emisă va fi captată şi prezentată sub forma unei electroforegrame (Figura 9). Figura 9. Exprimarea genelor în sistem procariot Clonarea genelor vizează în principal două obiective posibile: multiplicarea unui fragment ADN sau exprimarea genei clonate. Electroforegramele sunt apoi analizate şi comparate cu secvenţa existentă în bazele de date. care presupune utilizarea unui capilar cu un diametru de ordinul micrometrilor. Electroforegrama unei secvenţe obţinută cu ajutorul analizorului ABI Prism 310. Amestecul de fragmente rezultate sunt separate cu ajutorul electroforezei capilare. Migrarea fragmentelor în gel este în dependenţă de mărimea lor. iar la final cele mai mari. 28 . Mărimea fragmentelor de ADN care pot fi secvenţializate variază între 600 şi 800 pb.

29 . Spre exemplu. care este un analog al galactozei. atunci în genă se va păstra codonul STOP şi traducerea se va opri înainte de etichetă. Plasmidele de exprimare conţin neapărat un promotor recunoscut de ARN polimeraza celulei gazdă. Cel mai des utilizat inductor este IPTG (isopropil-tio-galactozid). coli în lipsa inductorului. coli şi simpla prezenţă a plasmidului în celulele bacteriene nu va sigura o exprimare a genei. Dacă această etichetă nu este necesară. Promotorul T7 nu este recunoscut de către ARN polimeraza de la E. Această genă se află sub controlul promotorului lac UV5 şi a operatorului lac (Figura 10). adică împărţirea exactă pe codoni a genei de la primul codon tradus până la ultimul. Inhibiţia exprimării genei pentru ARN polimeraza de la fagul T7 şi a genei ţintă în celulele gazdă de E. codonul START în situsul multiplu de clonare şi codonul STOP după o etichetă de 6 histidine. Foarte important în acest caz este păstrarea cadrului deschis de citire. Dacă se optează pentru prezenţa unei etichete 6×His la capătul C-terminal a proteinei pentru facilitarea purificării. vectorii de tip pET de la Novagen asigură de obicei o supraexprimare a genelor clonate. un codon START şi unul STOP la capetele situsului multiplu de clonare. Figura 10. un situs de legare a ribosomilor (rbs). coli sunt utilizate pe larg în obţinerea de proteine recombinate. Vectorii pET necesită tulpini de E. care însă câteodată „refuză” să sintetizeze proteinele comandate şi de ce cele mai dese ori străine celulei bacteriene. atunci din genă se va înlătura codonul STOP. Plasmidul pET21 conţine promotorul de la fagul T7. situsul de recunoaştere a ribosomilor. Gena codificatoare poate fi clonată direct în vectorul de exprimare. Ele pot fi numite adevărate fabrici de proteine la comandă. Promotorii din aceste tipuri de plasmide sunt de tip inductibil.Celulele de E. Clonarea în scopul exprimării genei şi obţinerii de proteină recombinată include câteva aspecte care sunt importante pentru exprimare. coli care conţin gena pentru ARN polimerază de la fagul T7.

În absenţa T7 ARN polimerazei nu va exista nici transcrierea genei ţintă din plasmid. cum este spre exemplu situsul pentru trombină în cazul plasmidului pET28. care în acest caz este gena pentru T7 ARN polimerază. Aceasta din urmă va recunoaşte promotorul T7 din plamsid şi va transcrie gena ţintă. 30 . astfel promotorul lac devine accesibil pentru ARN polimeraza de E. C – eluarea proteinei ţintă de pe coloană. Agentul care induce exprimarea este un analog al galactozei IPTG. În acest scop pentru clonare şi exprimare se va alege un plasmid care conţine situsul pentru peptidază. Ataşarea unor etichete la proteinele recombinate asigură purificarea proteinelor într-o singură etapă. Represorul lac este codificat de gena lacI care se află atât în genomul bacteriei gazdă cât şi în plasmidul de exprimare. Dacă eticheta deranjează în analiza ulterioară a proteinei. Pentru o purificare cât mai bună din amestecul total de proteine este necesară purificarea în cel puţin 2 etape prin metode cromatografice diferite. coli care va transcrie gena pentru T7 ARN polimerază. A – încărcarea amestecului total de proteine pe coloana cu răşină. A B C Figura 11. Purificarea proteinelor recombinate Proteinele recombinate pot fi purificate prin metode cromatografice. ceea ce reduce timpul necesar şi asigură randamente de purificare mai mari (Figura 11). atunci se poate recurge la înlăturarea acesteia prin digestie cu peptidaze. Acest sistem de exprimare este unul foarte puternic şi care poate asigura o producţie de proteină care va alcătui până la 50% din proteinele totale bacteriene. B – spălarea coloanei cu tampon şi fixarea proteinei ţintă de răşină. Reprezentarea schematică a purificării de proteine recombinate prin cromatografie de afinitate. Moleculele de IPTG se fixează de represorul lac şi cauzează disocierea acestuia de la operatorul lac. Atunci când în mediu nu există lactoză (sau analogi ai lactozei) represorul lac se fixează la operatorul lac şi împiedică transcrierea genei pe care o reglează.Operatorul lac este o secvenţă recunoscută de către o proteină numită represorul lac.

• obţinerea unei cantităţi mari de ţesut pentru purificare este aproape imposibil. • purificarea se face în mai multe etape care necesită timp. • proteinele recombinate pot fi marcate. Aceste dezavantaje ale purificării direct din material biologic sunt eliminate în cazul exprimării genelor în celule gazdă. Un mare avantaj al acestei metode este posibilitatea introducerii de mutaţii care pot dezvălui rolul unor domenii sau aminoacizi particulari în activitatea proteinei. spre exemplu regiunea N-terminală a unei proteine de la o specie se poate fuziona cu capătul C-terminal al aceleiaşi proteine de la o specie înrudită. Proteinele pot fi marcate 31 . spre exemplu cum este cazul unor bacterii pe care nu putem să le cultivăm în condiţii de laborator. consumabile şi are randamente mai mici. importante nu numai pentru biologie. se pot fuziona proteine între ele sau regiuni ale unei proteine cu regiuni ale altei proteine. • fuzionării. Clonarea genelor şi exprimarea lor în celule gazdă reprezintă o sursă foarte preţioasă de proteine. cum ar fi spre exemplu cazul unor proteine umane. • obţinerea materialului pentru purificare implică probleme etice.2. Una dintre aplicaţiile acestei tehnici. dar şi pentru studii interdisciplinare este utilizarea ei în scopul obţinerii de proteine recombinate. Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare Clonarea genelor în ultimii ani a devenit o tehnică indispensabilă în laboratoarele de biologie moleculară. • inserţii care constau în introducerea de fragmente noi în gena codificatoare şi respectiv în proteina recombinată. În cele mai multe cazuri purificarea unei proteine din celulele în care aceasta se exprimă în mod firesc natural prezintă mai multe dificultăţi: • cantitatea de proteine în ţesuturi este foarte mică. obţinerea de proteine din celule umane ar fi imposibilă. Prin intermediul tehnicilor de mutageneză pot fi introduse mai multe tipuri de mutaţii: • mutaţii missens care schimbă un aminoacid cu altul. spre exemplu pentru purificarea unei proteine din bacterii este necesară o cantitate de zeci de litri de cultură bacteriană. iar rezultatul purificărilor în câteva etape pot fi sub 100 mg de proteină. • deleţii în care porţiuni întregi din lanţul polipeptidic pot fi înlăturate.

iar ca rezultat polipeptidele acumulate în citoplasmă formează corpi de incluziune. Corpii de incluziune oferă posibilitatea unei purificări printr-o singură etapă în condiţii denaturante. Un alt dezavantaj (deşi în unele cazuri este un avantaj) este lipsa modificărilor post-traducere a polipeptidelor sintetizate în celule bacteriene. care apoi facilitează detecţia lor. Clonarea genelor şi exprimarea lor în sistem procariot este tehnica la care se apelează cel mai des. secundară.cu anumite molecule care sunt introduse în proteine în procesul lor de sinteză sau pot fi fuziuni. atunci se va recurge la clonarea genei în sistem procariot şi exprimarea ei în celule gazdă eucariote. Exprimarea proteinelor sub forma corpilor de incluziune nu poate fi prezisă pe baza apartenenţei genei sau pe baza analizei structurii primare. Există cazuri când acumularea proteinei sub forma corpilor de incluziune este un avantaj. în alte cazuri este nevoie de condiţii speciale şi alte proteine care contribuie la adoptarea conformaţiei proteinei active. În acest fel proteina recombinată nu va fi modificată şi se va putea deduce rolul acestor grupări în activitatea proteinei. astfel o proteină are structură: primară. Proteinele sunt structuri cu mai multe nivele de organizare. Un alt exemplu este marcarea proteinelor prin fuziunea lor cu proteine fluorescente. Dacă prezenţa acestor modificări este absolut necesară. Exprimarea genelor şi sinteza proteinelor în celulele procariote asigură doar structura primară exactă a polipeptidului sintetizat. Majoritatea proteinelor de la eucariote necesită nu numai adaptări conformaţionale dar şi modificări post-traducere cum ar fi fosforilări. terţiară şi cuaternară. în mod specific sau randomic. a. Cauzele neexprimării pot fi toxicitatea proteinei asupra celulelor gazdă. glicozilări ş. În unele cazuri proteinele adoptă structura secundară independent după sinteză. Unele proteine atât de la eucariote cât şi de la procariote sintetizate în celule gazdă de E. Proteinele denaturate purificate în acest mod pot fi utilizate pentru imunizarea de animale în scopul producerii de anticorpi. coli nu reuşesc să adopte o structură secundară corectă. deoarece este mai rapidă şi mai puţin costisitoare. Lipsa modificărilor post-traducere este un avantaj atunci când este cunoscută funcţia proteinei active şi se doreşte să se cunoască rolul grupărilor care sunt adăugate după sinteză. Cel mai important aspect pentru imunizare este secvenţa de aminoacizi a proteinei şi nu structura ei secundară sau terţiară. O altă problemă care poate apărea este neexprimarea genei. 32 . Un exemplu în acest sens este marcarea proteinelor cu izotopi stabili sau radioactivi.

2ml şi plăci ELISA cu 96 de godeuri. Germania Spectrofotometru UV-Vis monofascicul M301. Marea Britanie Spectrofotometru Jasco V-530 dublu-fascicul cu termostatare. rezoluţie 1 nm. interfaţă pentru calculator şi imprimantă Incubarea culturilor bacteriene şi a probelor moleculare de la temperatura camerei la 70ºC Incubarea probelor biologice pana la 100ºC. pentru cinetică enzimatică Electroforeză verticală în gel de poliacrilamidă.2ml la 1 litru. Australia Electroporator Eppendorf. 32 probe Electroforeza orizontală în gel de agaroză. Germania “Thermocycler”. electrod combinat prevăzut cu senzor de temperatură Congelare probe biologice la -82ºC Congelare probe biologice la -82ºC Domeniul de măsurare de la 0. Snijders Scientific. Sigma. Germania Doua bai de apa cu agitare. cu termostatare.2 MΩ/cm (apa MilliQ) Centrifugarea probelor. Memmert.3. Sigma. Marea Britanie Instalaţie de apă ultrapură. Japonia Patru instalaţii electroforeză proteine. Germania Două incubatoare bacteriologice. Jasco. Consort. gradient de temperatură în tub Pentru amplificarea ADN-ului prin PCR în tuburi de 0. de la 0. autocalibrare. 48 probe Masurarea pH-ului. Belgia Şase instalaţii electroforeza acizi nucleici. Consort. Infrastructura existentă în cadrul Centrului de Biologie Moleculară Denumire echipament Instalaţie de preluare şi prelucrare a imaginilor Ced Limited. rotor 8x50ml şi rotor 4x250ml Fără răcire cu rotor Eppendorf (12 tuburi. Belgia pH-metru P901 (două bucăţi). rotor 6x30ml.5ml şi placi ELISA cu 96 de godeuri. Japonia Congelator temperaturi foarte scăzute. 198-1000 nm. 13000xg) Pentru amplificarea ADN-ului prin PCR în tuburi de 0. Olanda Două balanţe analitice. rezoluţie 1 nm Interval de fotometrare. maximum 28000xg. 100 litri. Corbett Research. max. 70 litri. Germania Caracteristici Achiziţia şi interpretarea imaginilor de pe geluri de poliacrilamidă sau geluri de agaroză Purificarea apei până la o rezistivitate de 18. CamSpec. gradient de temperatură Transformarea celulelor electrocompetente – bacterii şi drojdii Interval de fotometrare. max. (3%) 33 . rotor Eppendorf (24 tuburi). Germania “Thermocycler”. Germania Centrifugă de masă Sigma 1-13.2ml. Memmert. Marea Britanie Centrifugă cu răcire Sigma 3K18 (4 rotoare). Elga-Lab Water. Consort. 0. Belgia Congelator temperaturi foarte scăzute. Eppendorf. Sanyo. răcire de la temperatura camerei la 0°C.1mg la 160g. Scaltec. 198-1000 nm.

Lewontin R.97%).. (2005). 4th edition. (2000). Modern Genetic Analysis. Zipursky L. identificare umană şi determinarea polimorfismelor genetice. Australia Secvenţierea fragmentelor de ADN. 7th edition. iluminasteril. 34 . Roberts K. (1999)..3 um 99.3 Hota flux laminar biohazard µm 99. Glover D. Lewis J... DNA Cloning: A Practical Approach: Expression Systems (The Practical Approach Series)... Dezintegrarea celulelor bacteriene. contrast de fază şi fluorescenţă nia Autoclav 80l. Academic Press. Wiley-Blackwell Publishing. Coreea de Sud reglabil în 9 trepte (0. Nikon.C. 5th edition New York: W. Miller J. Amplificarea ADN-ului în timp real. Darnell J. and Stryer L. (1995).. and Gelbart W. mateAutoclav AE-75-DRY Raypa. Manipulation and Expression of Recombinant DNA. Spania Sterilizarea umedă sau uscată a mediilor de cultură. H... 8. SUA laser cu detecţie pentru 5 fluorocromi Analizor Genetic CEQ™ 8800 Genetic Analysis System laser cu detecţie pentru 4 fluorocromi Instalaţie Real Time PCR.J.. Griffiths A. Freeman Company.. Suzuki D.97%).D. Patten C. An Introduction to Genetic Analysis. rialelor şi instrumentelor Spania Ultrasonicator cu patru sonde..M. Jasco. H. Freeman Company. 4. Selecta... Berk A. (2002).R.M. New York: W. Johnson A... Pasternak J. ţesuturilor animale şi Sonics & Materials vegetale în volume de la 1ml până la 1 litru Hota PCR cu flux laminar Flux laminar vertical. Baltimore D.. Applied Biosystems. Telstar. prefiltru reciclabil (3-30 µm). Carson S. filtru HEPA (0. Spania re.Analizor Genetic ABI Prism 310... Matsudaira P.Bibliografie 1. Alberts B. and Robertson D. gradient binar de înaltă presiune şi gradient cuaternar de joasă presiune Microscop inversat NIKON Studiul preparatelor celulare şi tisulare în lumina normaEclipse TE2000S. Biochemistry.M. Gene Cloning and DNA Analysis: An Introduction. Griffiths A.M. H. ASM Press. and Walter P.. 2nd Edition.. Glick B. Japonia manţă. 9. detecţia simultană a 4 fluorocromi Separarea probelor prin cromatografie de înaltă perforInstalaţie HPLC.. (2002).. Molecular Biology of the Cell.A. 7.5 m/s). H. Japolă. Gelbart W. 6. Berg J. Tymoczko J. preparare probe PCR (4% Filtru exahustare HEPA (0.L..L. New York: Garland Science.. Molecular Cell Biology. 4. (2009).. 5th edition. 2.. Molecular Biotechnology: Principles and Applications of Recombinant DNA. 3. (2006). Hames B.C. Raff M. 5.T. Freeman Company. Freeman Company. soft-uri speciale pentru secvenţiere şi genotipare. 4th edition. and Lewontin R. New York: W... Oxford University Press.. Lodish H. Corbett Research. (2000). Miller J. electroforeza capilară la 15kV.35-0. Brown T. 2d edition. 4th edition. flux de aer 100. New York: W... filtru bacteriologic HEPA.

McPherson M.. Recombinant DNA: Genes and Genomes .A. Freeman Company. Metzenberg S.. Springer-Verlag Telos. Mǿller S. Taylor & Francis.D. and.. 3rd Edition. 1 edition.M.10.. (2000). 11.. Caudy A. 12. Witkowski J. Popescu O.G.A. H. (2007). Editura Tehnică.. Electroforeza proteinelor în geluri de poliacrilamidă.J. Working with DNA (THE BASICS (Garland Science)).. Myers R. 13. 1990. (2006). Watson J. 1st edition. W. Bucureşti. Basics: from Background to Bench. PCR. 35 .A Short Course..

deoarece: • izomerii optici ai aminoacizilor se pot obţine direct din substratele corespunzătoare........ Imobilizarea enzimelor în sintezele enzimatice prezintă două avantaje importante şi anume reutilizarea multiplă a enzimelor costisitoare şi recuperarea substratelor rămase.. • se pot obţine derivaţi ai aminoacizilor sau aminoacizi rari.............................. pornind de la indol. • cantităţile produse şi concentraţiile sunt mai mari..... pentru producerea acizilor aminaţi pe cale enzimatică........ 36 2..Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare Asist.......... La început.. care nu se pot obţine prin fermentare directă sau prin extracţie.... Tendinţe actuale în aplicarea bionanotehnologiilor ............ 60 1..... presiune....... O sursă de triptofanază 36 ......................... piruvat şi săruri de amoniu... fiind stimulată sinteza lor prin diverse metode. enzimele nu se purificau şi se folosea lizatul celular ce conţinea enzime specifice..... Sinteza enzimatică continuă prin imobilizarea enzimelor a fost aplicată în producerea L-tirozinei cu β-tirozinază şi a triptofanului cu triptofanază................ şi de derivaţi ai acizilor aminaţi................. Bibliografie .......... Iulia Lupan Cuprins 1..... • sintezele sunt uşor de manipulat... se foloseau enzime nerecombinate produse de microorganisme. Metoda enzimatică de sinteză a acizilor aminaţi.. univ... Pentru a reduce costul sintezelor.. Această metodă capătă o amploare mai mare pe an ce trece datorită cererii mari de aminoacizi..... 57 3........ folosite în exces... dr..... din cauza costurilor prea mari a substratelor.... Totuşi metoda enzimatică prezintă unele avantaje faţă de alte metode....... • se pot sintetiza D-izomeri......... • necesită condiţii blânde de temperatură... pH... care nu se aplică la scară industrială la fel ca în fermentarea directă.. care nu se găsesc în natură... Metoda enzimatică de sinteză a acizilor aminaţi Un număr mare de aminoacizi se pot obţine prin sinteză enzimatică..

S-a testat eficienţa sintezelor în cazul folosirii lizatelor şi a enzimelor purificate. la care s-a indus sinteza acestei enzime.. 1973]. Fukui şi colab. Acest impediment a cauzat folosirea sistemelor enzimatice cuplate. Imobilizarea asigură sinteza continuă a aminoacizilor şi reciclarea amoniului şi piruvatului neutilizate.poate fi lizatul brut de E . 1976]. reacţie catalizată de alanin dehidrogenază într-un sistem cuplat cu formiat dehidrogenaza pentru regenerarea NADH. Mediul de sinteză mai conţine formiat de amoniu. Aceeaşi metodă de imobilizare a fost folosită şi în sinteza alaninei cu celule de Pseudomonas dacunhae care prezentau o activitate mare a L-aspartat β-carboxilazei [Fusee şi Weber. 1990]. NADPH). 37 . Producerea acidului aspartic la scară industrială s-a realizat enzimatic pornind de la fumarat şi săruri de amoniu şi utilizând aspartaza ca şi catalizator [Chibata şi colab. în care se utilizează enzime pentru regenerarea cofactorilor. iar ionul formiat pentru reacţia de regenerare a NADH [Oshima şi colab.. 1979. Astfel. în cazul folosirii lizatului brut până la 92%. Producerea continuă de L-valină folosind valin dehidrogenaza şi glucozo dehidrogenaza pentru regenerarea NADH a fost studiată detailat [Monot şi colab. Celule imobilizate de E. 1988. ionul de amoniu fiind necesar în reacţia de sinteză a aminoacidului... folosite în exces [Deconttignies-Le Maréchal şi colab.. 1984]. 1981. 1974].. Utilizarea de cofactori (NADH. costisitori în sintezele enzimatice.. [1990] au sintetizat L-alanina şi L-valina folosind sistemul cuplat de alanin dehidrogenază. Honorat-Pascal şi colab. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab. în cazul folosirii fracţiunilor purificate. cu glucozo dehidrogenază pentru regenerarea NADH. pentru regenerarea NADH [Schütte şi colab. Honorat şi col. Sinteza continuă a fost realizată prin încorporarea enzimelor în gel de poliacrilamidă. Tosa şi colab. Numai în cazul sintezei alaninei s-a evidenţiat o creştere a randamentului sintezei de la 80%. În strategia de sinteză s-au utilizat enzime provenite de la un singur microorganism şi anume Bacillus megaterium. 3-fluoroalanina s-a obţinut din 3-fluoropiruvat.coli.. nu permite extinderea sintezelor la scară industrială. 1976]. utilizând leucin dehidrogenază de la Bacillus stearothermophilus [Oshima şi colab... Sistemul multienzimatic a fost utilizat şi în sinteza L-leucinei din α-cetoisocaproat. respectiv valin dehidrogenază. 1985] şi formiat dehidrogenaza de la Candida boidinii. 1988]. Utilizarea enzimelor de la microorganismele termofile prezintă avantajul că au o stabilitate mai mare.

. 38 . Deoarece ele acţionează stereospecific. 1998].4. alanin-. Alanin dehidrogenaza (L-alanin oxidoreductază NAD+ dependentă.1) catalizează reversibil reacţia de dezaminare a L-alaninei cu formare de piruvat.. dar există şi câteva enzime care reacţionează şi cu aminoacizii β. 1994]. valin. Ele au fost folosite la construirea biosenzorilor. care este comun pentru toate aceste enzime. Nu există asemănări semnificative între secvenţele alanin dehidrogenazelor (AlaDH) şi membrii acestei familii de aminoacid dehidrogenaze.4. Alanin dehidrogenaza Aminarea reductivă a cetoacizilor la L-aminoacizi în procese NAD(P)H-dependente este catalizată de o suprafamilie de enzime omoloage de aminoacid dehidrogenaze. care include fenilalanin dehidrogenaza (PheDH). leucin dehidrogenaza (LeuDH). S-a demonstrat că în lipsa enzimei sporularea avea loc cu mari dificultăţi [Siranosian şi colab.şi glutamat dehidrogenaza). cu excepţia domeniului de legare a cofactorului.1. Aminoacid + NAD+ + H2O ↔ α-cetoacid + NADH + H+ + NH3 Majoritatea aminoacid dehidrogenazelor sunt specifice pentru α-aminoacizi. L-alanina + NAD+ + H2O ↔ piruvat + NADH + H+ + NH3 Alanin dehidrogenaza a fost descrisă de către Wiame şi Piérard în 1955 [Norbert şi colab. Aceste enzime catalizează eliminarea grupării amino din L-aminoacizi cu formare de cetoacizi corespunzători. Aceste enzime au întrebuinţare şi în sinteza industrială de aminoacizi.X) sunt enzime care fac parte din familia oxidoreductazelor.1. Deşi realizează unul şi acelaşi proces biologic. Aminoacid dehidrogenazele au fost intens studiate în vederea utilizării lor în diverse ramuri industriale.. leucin-.Aminoacid dehidrogenaze Aminoacid dehidrogenazele (EC 1. în prezenţă de NAD(P)+. care pot să monitorizeze nivelul ridicat de aminoacizi din plasma sanguină. caracteristic în unele patologii. Această enzimă a fost purificată şi studiată în principal la mai multe specii din genul Bacillus. valin dehidrogenaza (ValDH) şi glutamat dehidrogenaza (GluDH). enzimele produc L-izomeri ai aminoacizilor naturali puri. alanin dehidrogenazele şi suprafamilia de aminoacid dehidrogenaze au evoluat separat [Baker şi colab. Cele mai bine studiate aminoacid dehidrogenaze sunt cele care au importanţă industrială (fenilalanin-. Enzima are un rol important în furnizarea energiei necesare germinării sporilor. această caracteristică fiind foarte importantă pentru industria farmaceutică. 1.

Leucin dehidrogenazele studiate provin în mare parte de la genul Bacillus precum şi de la Thermoactinomyces [Ohshima şi colab. stearothermophilus. [Nagata şi colab. Această enzimă poate fi foarte utilă în sinteza de L-serină din 3-hidroxipiruvat [Nagata şi colab. iar NADH în reacţia de aminare. sphaericus. Leucina + NAD+ + H2O ↔ α-cetoisocaproat + NADH + NH4+ + H+ Echilbrul reacţiei este deplasat spre formarea aminoacidului. Lizina din poziţia 74 din secvenţa de aminoacizi a AlaDH de la B. cu ultimul reacţia fiind mult mai lentă..1. B. Enzimele termostabile nu prezintă numai avantajul termostabilităţii. cum ar fi cele de la B. 2003]. Enzima nu-şi pierde activitatea după incubare timp de 30 min la 70ºC [Oka şi colab. care catalizează reversibil dezaminarea L-leucinei şi a unor L-aminoacizi alifatici la cetoacizii corespunzători. Alanin dehidrogenaza este o enzimă NAD+ dependentă. Mycobacterium. 1997]. B. stabile şi la alţi factori care afectează proteinele. Anabaena. AlaDH poate utiliza ca substrate în reacţia de aminare atât piruvatul.. solvenţi organici. Un caz unic printre alanin dehidrogenazele bacteriene este cea de la Bacillus sp DSPM730 care reacţionează în egală măsură cu ambele substrate. 1994].. detergenţi.1993]. subtilis este esenţială în cataliză şi este conservată şi la alte alanin dehidrogenaze. 1988]. Alanin dehidrogenaza este o enzimă oligomerică. B.. cum ar fi enzime proteolitice. Aminoacizii din vecinătatea acestei lizine prezintă o regiune conservată. deoarece sunt mai stabile. Mecanismele cinetice ale AlaDH au fost studiate la mai multe specii. iar proteina exprimată în celule de E. fiind. cât şi 3-hidroxipiruvatul. coli. Thermus. Ca şi majoritatea aminoacid dehidrogenazelor. a cărei genă codificatoare a fost clonată. coli şi proteina recombinată de LeuDH permit purificarea acesteia într-o singură etapă. în general. Natronobacterium magadii MS-3 [Katoh şi colab. Majoritatea enzimelor studiate sunt hexameri. Diferenţele de termostabilitate ale proteinelor totale de E. Aspartat amoniu-liaza L-aspartat amoniu-liaza (AAL) sau aspartaza (EC 4. dar care nu este specifică altor aminoacid dehidrogenaze. subtilis. stearothermophilus.. 1989].4. Leucin dehidrogenaza Leucin dehidrogenaza (EC 1. cereus. LeuDH intervine în catabolismul unor aminoacizi. prin denaturare termică. Una din aceste enzime este cea de la B. O mare atenţie s-a acordat leucin dehidrogenazelor provenite de la microorganisme mezotermofile. 1989].1) catalizează reversibil transformarea acidului L-aspartic la fumarat şi NH4+.1.3. mediu acid sau alcalin. Această 39 . [Delforge şi colab.9) (LeuDH) este o oxidoreductază NAD+-dependentă. NAD+ se leagă înaintea piruvatului în reacţia de dezaminare oxidativă..

În secvenţa amorselor au fost incluse situsurile pentru enzime de restricţie necesare inserării genei în vectorul de exprimare. Enzima AlaDH Q08352 LeuDH P13154 ALL (P0AC38) Amorsele utilizate 5΄-GAGGGATCCGATGATCATAGGGGTTCCTAAAG-3΄ 5΄-GGTCTCGAGTATAGCACCCGCCACAGATGATT-3΄ 5΄-GGTGGATCCGATGGAATTGTTCAAATATATGG-3’ 5΄-TATTCTCGAGTATTGCCGAAGCACCTGC-3΄ 5' –GGTAGGATCCGATGTCAAACAACATTCGTATCG– 3' 5' –GCTACTCGAGTTACTGTTCGCTTTCATCAGTA– 3' Escherichia coli Bacillus subtilis Bacillus stearothermophilus Organism sursă Enzime de restricţie BamHI XhoI BamHI XhoI NdeI BamHI NdeI BamHI NdeI BamHI Vector utilizat pET21b pET21b pET21b 5'-GGAATTCCATATGCTGAACGAAACTCCCGCAC-3' GalM Escherichia coli (P0A9C3) 5'-CGCGGATCCTCACTCAGCAATAAACTGATATTCCG-3' GlucDH P12310 5΄-GGAATTCCATATGTATCCGGATTTAAAAGGAAAAG-3΄ 5΄-CGCGGATCCTCAACCGCGGCCTGCCTGG-3΄ Bacillus subtilis pET24a pET24a Fragmentele ADN au fost purificate din gelul de agaroză. Tabelul 1. Acest vector oferă posibilitatea exprimării genelor la inducere cu IPTG. Amorsele utilizate pentru amplificarea prin PCR a genelor. de circa 50 kDa. Majoritatea aspartazelor studiate au masa moleculară în jur de 200 kDa şi sunt alcătuite din patru monomeri identici. alanin dehidrogenaza şi aspartaza s-a utilizat vectorul de exprimare pET21b (Novagen). glucoz dehidrogenaza de la Bacillus subtilis şi aspartaza de la Escherichia coli au fost amplificate prin metoda PCR utilizând amorse specifice. 1991]. care are proprietatea de a 40 . Enzima este activată în prezenţă de ioni de Mg2+ la un pH alcalin.enzimă joacă un rol important în metabolsimul azotului la bacterii. Vectorii de exprimare au fost digeraţi cu aceleaşi enzime de restricţie. Metode Clonarea genelor pentru aminoacid dehidrogenaze Genele ce codifică leucin dehidrogenaza de la Bacillus sterothermophilus. alanin dehidrogenaza de la Bacillus subtilis. Produşii PCR au fost purificaţi din gel şi digeraţi cu enzimele de restricţie corespunzătoare (Tabel 1). la pH mai mic ea nu necesită ioni de metal [Karsten şi Viola. Pentru inserarea genelor în vectori s-a utilizat ADN ligaza. Pentru clonarea genelor ce codifică leucin dehidrogenaza. Produşii de digestie (produşii PCR şi vectorii) au fost separaţi cu ajutorul electroforezei în gel de agaroză.

iar orice proces biotehnologic este cu atât mai valoros cu cât implică mai puţine costuri.1 14. moleculele corect recombinate au fost introduse prin transformare în tulpina de Escherichia coli BL21(DE3). coli. După sonicare extractul bacterian a fost centrifugat (20 min la 21 000 ×g la 4°C).4→ 30 20. Cu cifre sunt indicate masele moleculare ale proteinelor din markerul molecular. AlaDH 1 2 3 94 67 43 LeuDH 1 2 3 AAL 1 94→ 67→ 43→ ←54 2 ← ← 42→ ← ← ← ← 94 67 43 → → → → → ← 42 30 20. Producerea de proteine recombinate Pentru exprimarea genelor. După câteva ore de la inducere (3-5 ore) bacteriile au fost centrifugate şi păstrate la -80°C până la utilizare. Moleculele recombinate rezultate după ligare (vector + gena) au fost introduse prin transformare în tulpina de Escherchia coli DH5α. Sintezele enzimatice au fost realizate cu extracte celulare bacteriene. După ce densitatea optică (DO) la 600 nm a atins valorile de ~1.5-1L). s-a indus exprimarea genelor cu izopropil-β D-tiogalactopiranozid (IPTG) 1 mM.reface legăturile fosfoesterice.1 (Applied Biosystems). coli a fost urmărită cu ajutorul electroforezei în gel de poliacrilamidă în condiţii denaturante în prezenţă de SDS (Figura 1). preum şi masele moleculare ale proteinelor recombinate. Pereţii celulelor bacteriene au fost distruse prin sonicare. Sinteza de proteine recombinate în celulele gazdă de E. 41 .4 30→ 20.1→ 14. Pentru obţinerea de proteine recombinate s-au realizat culturi mai mari (0.0 50 mM.1 Figura 1. Secvenţele genelor clonate au fost verificate prin secvenţializare cu un aparat ABI Prism 310 Genetic Analyzer utilizând kitul de secvenţializare BigDye Terminator v3. Analiza exprimării genelor şi sintezei de proteine recombinate în celulele de E. O purificare a proteinelor recombinate ar implica costuri şi timp suplimentar. Se poate observa cantitatea mare de proteine recombinate raportată la cantitatea de proteine totale din celulele bacteriene. iar supernatantul cu proteinele solubile a fost utilizat pentru măsurarea activităţii enzimatice. Celulele bacteriene au fost preluate în tampon Tris HCl pH=8.

3.5 în reacţia de dezaminare b) AlaDH (alanin dehidrogenaza): piruvat 10 mM.0 d) GalM (galacto mutarotaza): glucoză 10 mM. La această lungime de undă NADH prezintă maximul de absorbanţă şi are un coeficient molar de extincţie de 6. Tris HCl 50 mM pH 8.15 mM. NAD 2 mM. NAD 2 mM.15 mM. glicocol 50 mM pH 10.0 în reacţia de aminare.5 în reacţia de dezaminare c) GDH (glucozo dehidrogenaza): glucoză 10 mM.05 şi 0. MgCl2 6 mM Pentru măsurarea activităţii enzimatice a aspartzei s-a urmărit formarea acidului fumaric la 240 nm. NADH 0. L-alanină 10 mM. S-a ales porţiunea dreptei cu activitatea cea mai mare.0. Pentru măsurarea activităţii enzimatice s-au folosit câţiva µl de enzimă purificată sau extract brut bacterian. NADH 0. L-leucină 10 mM.Măsurarea activităţii enzimatice a enzimelor Măsurătorile de activitate enzimatică a dehidrogenazelor s-au efectuat la 30ºC cu un spectrofotometru Jasco V-530 urmărindu-se scăderea absorbanţei NADH (reacţia de aminare a cetoacizilor) sau formarea acestuia (reacţia de dezaminare a aminoacizilor) la 340nm. NADH 0. Tris HCl 50 mM pH8. care are un coeficient molar de extincţie la aceasă lungime de undă egal cu 2. Tris HCl 50 mM pH 8. Tris HCl 50 mM pH 8. Sinteza de aminoacizi marcaţi cu 15N Mediul de reacţie pentru sintezele de aminoacizi marcaţi cu 15N a conţinut: 42 . astfel încât valorile DO/min să fie cuprinse între 0.0 în reacţia de aminare.0 f) AAL (aspartat amoniuliaza): acid L-aspartic 100 mM. NAD 2 mM.5. Tris HCl 50 mM pH 8. NH4Cl 1 M.22 ·103 ·M-1 ·cm-1. Tris HCl 50 mM pH 8. Mediile de reacţie pentru enzime au fost următoarele: a) LeuDH (leucin dehidrogenaza): cetoacid 10 mM.15 mM. Activitatea enzimatică s-a calculat după formula: A=[(DO/min)/6. NAD 2 mM. GDH 1 U e) LDH (lactat dehidrogenaza): piruvat 1 mM. NH4Cl 1 M.54 ·103 ·M-1 ·cm-1.22]*(Vr/Vp) *FD *103 U/l DO/min – variaţia densităţii optice pe minut la 340 nm Vr – volumul reacţiei Vp – volumul probei FD – factorul de diluţie O unitate enzimatică (1U) corespunde formării unui µmol de produs într-un minut. glicocol 50 mM pH 10.

S-a măsurat absorbanţa la 623 nm. 200 µl de fenolnitroprusiat. Sintezele de aminoacizi marcaţi au fost efectuate la 30ºC cu urmărirea pH-lui şi agitare. Purificarea aminoacizilor sintetizaţi Aminoacizii sintetizaţi au fost purificaţi pe o coloană cu răşină schimbătoare de ioni Dowex 50W x 8. Înainte de declanşarea sintezelor s-a preluat o probă care a servit la alcătuirea unei curbe etalon. Amestecul de sinteză filtrat s-a încărcat pe coloană şi apoi s-a spălat cu apă (10 volume).013334x R= 0. Probele s-au preparat după următoarea procedură: 10 µl de probă diluată de 20 ori.068852 + 0.2 1 0. după care s-a spălat până la un pH neutru.99935 1. 200 µl de hipoclorit de sodiu şi 590 µl apă. la interacţiunea ionului de amoniu. Pe baza curbelor etalon s-a calculat cantitatea de ion de amoniu rămas în mediul de sinteză. Pe parcursul sintezei s-a urmărit consumul de NH4Cl prin metoda Berthelot. Această metodă constă în formarea unui compus de culoare. a fenolnitroprusiatului şi a cloraminei. Sintezele au fost oprite prin denaturarea termică a enzimelor. În Figura 2 este prezentată curba etalon de la sinteza de [15N]-L-metionină. Activarea umpluturii s-a făcut prin tratare cu HCl 2N. Developarea culorii s-a făcut prin incubarea probelor timp de 2-3 min la 100ºC. Ca martor a servit amestecul de sinteză fără clorură de amoniu (din care cauză se adăuga la sfârşit).6 0. Curba etalon de la sinteza [15N] L-Metionină.2 0 0 20 40 60 80 100 120 DO 623nm NH Cl (% ) 4 Figura 2.4 0. Reacţia s-a declanşat prin adăugarea enzimelor. Aminoacidul s-a eluat cu NH4OH 1M. timp de 15 min la 85ºC. Controlul eluării s-a făcut cu ninhidrină pentru aminoacizi.4 1.0 cu NaOH. Fracţiunea cu aminoacid s-a concentrat pe 43 .• cetoacid 100 mM • 15NH4Cl 100 mM • NADH 1 mM • glucoză 670 mM Amestecul de sinteză a fost ajustat la pH 8.8 0. în forma H+. y = 0.

cum se întâmplă în cazul derivatizării cu grupări trimetilsilil. randamente scăzute datorită mai multor etape de sinteză. la amină se introduce o singură grupare silil. obţinerea racemicului. La ionizarea cu impact de electroni. adiacent. Aceste metode prezintă un şir întreg de dezavantaje. 44 . Analiza aminoacizilor sintetizaţi prin spectrometrie de masă Pentru analiza calitativă prin metoda spectrometriei de masă a aminoacizilor este necesară o derivatizare a produsului de reacţie. Derivatizarea. aminoacizii astfel obţinuţi au fost supuşi determinării structurii.baia de apă. Precipitarea s-a lăsat peste noapte. ia naştere un fragment cu masa M-159. Masele ionilor fragment fiind caracteristice fiecărui aminoacid. şi nu una sau două în mod statistic. care trebuie facută la ambele funcţiuni polare ale moleculei de aminoacid. În continuare. cu hidrogen ca şi gaz purtător şi cu temperatură programată între 55 şi 250ºC. purităţii şi concentraţiei izotopice. la 120ºC timp de 20 minute. cu 150 µl de acetonitril ca solvent şi 50 µl reactiv MTBSTFA. care introduce la fiecare funcţiune polară din moleculă câte o grupare terţ-butil-dimetilsilil (TBDMS). datorită substituentului terţ-butil voluminos. reactivul având şi un conţinut de 1% terţ-butil-dimetil-clorsilan. În primele etape de marcare a acizilor aminaţi cu izotopi stabili s-au folosit metode de sinteză chimică. Sinteza de aminoacizi marcaţi cu 15N Marcarea aminoacizilor cu izotopi stabili se poate realiza prin sinteze chimice şi enzimatice. Separarea gaz-cromatografică a produşilor de sinteză sub formă de TBDMS-derivaţi s-a făcut pe o coloană capilară cu fază staţionară DB5 de 30 m lungime. Derivatizarea s-a făcut pe cantitaţi de probă de ordinul 0. Prin ruperea în diferite poziţii din gruparea tert-butildimetilsilil se formează ioni cu masele M-43. Acest tip de derivatizare are avantajul că. Pentru analize s-a utilizat un cromatograf de gaze Hewlett Packard 5840 A. Derivatizarea s-a făcut utilizând ca reactiv N-metil-N-(terţ-butil-dimetilsilil) triflouroacetamida (MTBSTFA) în calitate de donor al grupării silil. iar prin ruperea legăturii dintre carboxil şi atomul de carbon alfa. iar spectrele s-au înregistrat cu un spectrometru de masă cuadrupolar HP 5985. M-57 şi M-85. s-a facut prin sililare. utilizând metoda Das Neves şi Vasconcelos. la carboxil şi amină. aminoacizii sub formă de TBDMS-derivaţi se produc în cea mai mare parte sub formă de ioni prin fragmentarea moleculelor. iar precipitatul obţinut s-a filtrat şi uscat. în calitate de catalizator. cum ar fi consumul unei cantităţi mari de amoniac.5-1 mg de probă. după care s-a precipitat cu etanol absolut.

Schema de sinteză a aminocizilor marcaţi cu 15N utilizată în prezenta lucrare este reprezentată în Figura 3.Folosirea enzimelor în sinteze de aminoacizi marcaţi cu izotopi stabili prezintă mai multe avantaje faţă de metodele chimice. O metodă relativ simplă şi mai utilizată pentru obţinerea de aminoacizi marcaţi cu 15N este sinteza enzimatică pornind de la cetoacizi şi săruri de amoniu (15N). Sinteza de aminoa45 . cele mai utilizate enzime pentru regenerarea coenzimelor în sinteze fiind alcool dehidrogenaza şi formiat dehidrogenaza (Hummel şi Kula. AADH – aminoacid dehidrogenză Aminoacid dehidrogenazele catalizează reacţia de formare a aminoacizilor pornind de la 15NH4Cl şi cetoacizii corespunzători. 1989). Schema de sinteză a acizilor aminaţi cu 15N. marea majoritate provenind de la bacterii. cu utilizare de celule în creştere. care constă în oxidarea unui mediator şi transferul electronului la NAD(P)+. Sursele enzimelor utilizate în regenerarea coenzimelor sunt destul de variate. Pentru a evita acest fenomen există câteva căi de regenerare continuă a coenzimelor pe parcursul sintezelor: • regenerarea în vivo. 2000]. • regenerarea enzimatică în vitro. Piridin nucleotid transhidrogenaza de la Pseudomonas fluorescens a fost utilizată în regenerarea atât a NAD cât şi a NADP pentru producerea de hidromorfonă [Boonstra şi colab. Reacţiile de sinteză sunt cuplate cu reacţii de regenerare a cofactorilor costisitori. Un dezavantaj al metodei îl prezintă specificitatea şi viteza de regenerare reduse. Majoritatea enzimelor utilizate în sinteza diverşilor compuşi necesită coenzime (NADH sau NADP). • regenerarea electrochimică. Modalitatea cea mai eficientă pentru regenerarea coenzimelor rămâne metoda enzimatică. datorită faptului că decurg stereoselectiv şi au randamente superioare. 15NH4Cl Cetoacid NADH AADH Acid gluconic GDH GalM β-glucoză -glucoză L-(15N)aminoacid NAD+ Figura 3.. Această metodă prezintă dezavantajul manipulării laborioase a celulelor şi caracterul enantioselectiv scăzut al reacţiei. Din cauza preţului mare a acestora utilizarea lor în cantităţi stoichiometrice nu este eficientă.

25 mM. constanta de inhibiţie calculată de noi Ki=4. 15NH4Cl pe parcursul sintezei de [15N]-alanină. Enzimele utilizate în sintezele de aminoacizi marcaţi nu au fost purificate. Reacţia s-a declanşat la adăugarea enzimelor (115 U de leucin dehidrogenază şi 60 U de glucozo-dehidrogenază). Sinteza de [15N]-alanină. subtilis. [1990] au testat sinteza de L-alanină şi L-valină cu enzime (alanin dehidrogenază şi valin dehidrogenază) purificate şi în lizat bacterian. După purificarea aminoacidului randamentul sintezei a fost de 60%. utilizând ca substrat glucoza cu formare de acid gluconic. glucoză 670 mM. Sinteza de L-alanină marcată cu 15N s-a realizat pentru o cantitate de 8 mmol. Enzimele recombinate. Mediul de reacţie utilizat a conţinut: piruvat de Na 150 mM. Astfel. (A) Consumul.cizi a fost cuplată cu reacţia catalizată de glucozo-dehidrogenaza (GlucDH) de la B. Figura 4. înainte de adăugarea enzimelor. Honorat şi colab. Acest fapt nu a influenţat randamentul sintezelor. Sinteza de [15N] L-Ala Amestecul de sinteză a fost ajustat la pH 8. subtilis este inhibată de piruvat.0. exprimate în celule de E. M = 318. Purificarea acestora este o etapă suplimentară care. NADH 1 mM. reprezintă aproximativ 50% din proteinele totale existente în lizatul bacterian. nu conduce la mărirea randamentului reacţiei. DMTBS derivat. în general. (B) Spectrul de masă al [15N]-Alaninei. GlucDH a servit la regenerarea NADH. Pe tot parcursul sintezei alaninei s-a urmărit consumarea clorurii de amoniu prin metoda Berthelot (Figura 4 A) care este o metodă colorimetrică foarte sensibilă de dozare a amoniacului. O soluţie în acest 46 . cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. În unele sinteze s-a folosit galactozo-mutarotaza pentru transformarea α-glucozei în β-glucoză. Activitatea alanin dehidrogenazei din B. la concentraţii mari de substrat activitatea enzimei este redusă. 15NH4Cl 130 mM. coli.

15 mM. Sinteza de [15N]-L-Leu Leucin dehidrogenazele au specificitate pentru un număr mai mare de cetoacizi. În cazul leucinei derivatizate cu două grupări silil. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele menţionate mai sus. Între paranteze este exprimată activitatea procentuală considerând rezultatul obţinut cu acid α-cetoisovaleric ca 100%. α-cetoacid 10 mM. De aceste valori ale activităţii enzimatice s-a ţinut cont în sintezele de aminoacizi marcaţi cu izotopul stabil al 15N.5 (28) 36. NH4Cl 1M şi NADH 0.7 (2. Masele fragmentelor ion ale alaninei cu conţinut izotopic natural sunt m/z 274. pH 8. 232 şi 158. În sintezele de aminoacizi la care enzima are o specificitate mai mică pentru precursorul acestora. Masele caracteristice ale ionilor fragment ale leucinei cu conţinut izotopic natural au valorile m/z 316.0. Masa moleculară a alaninei fără marcare izotopică este 317. O altă soluţie poate fi adăugarea piruvatului în mai multe etape. Enzima are cea mai mare specificitate de substrat pentru acidul α-cetoisovaleric. 260. a fost necesară o cantitate mai mare de enzimă. Mediul de reacţie pentru sinteza de [15N]-leucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode.8) Activitatea enzimatică a fost determinată la 30°C în tampon Tris-HCl 50 mM.6) 4.caz ar fi declanşarea reacţiei de sinteză cu cantităţi mai mari de enzimă. ceea ce demonstrează marcarea alaninei nu 15N (Figura 4 B). Specificităţile de substrat ale leucin dehidrogenazei native din B. stearothermophilus în prezenţa diferiţilor α-cetoacizi α-cetoacid Acid α-cetoisovaleric Acid α ceto-β-metilvaleric Acid α-cetoizocaproic Acid α-cetocaproic Acid α-ceto-γ-metiltiobutiric Acid α-cetobutiric LeuDH429 168 (100) 46. stearothermophilus sunt prezentate în Tabelul 2. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 5 A). 302. 274. masa moleculară exactă pentru leucină fără marcare izotopică la azot este M=359. În ambele cazuri este necesară o urmărire minuţioasă a consumului clorurii de amoniu. Activitatea specifică (U/mg de proteină) a LeuDH din B.8 (4. Tabelul 2. şi respectiv 200. În cazul aminoacizilor mar47 .4 (10) 7.8 (22) 17.

înainte de adăugarea enzimelor. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-valină.0 mmol. Raportul molar al reactanţilor (acid α-ceto isovaleric:15NH4Cl )a fost de 1:1. M = 360. Sinteza s-a declanşat cu 205 U de leucin dehidrogenază şi 110 U de glucozo dehidrogenază. cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. S-au realizat câteva sinteze. (B) Spectrul de masă al [15N]-valinei. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo-dehidrogenază. Sinteza de [15N]-L-Val Mediul de reacţie pentru sinteza de [15N]-valină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. Figura 6. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 6 A). atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă (Figura 5 B). Din fiecare reactant s-a utilizat o cantitate de 8. Din fiecare reactant s-a utilizat o cantitate de 8. M = 346. Figura 5. Sinteza de [15N]-leucină (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-leucină. raportul reactan48 .2 mmol. DMTBS derivat. (B) Spectrul de masă al [15N]-Leucinei. DMTBS derivat. cca 97 atom % 15N. Sinteza de [15N]-valină. înainte de adăugarea enzimelor.caţi cu 15N.

Viteza reacţiei a scăzut foarte mult după primele 10 min când s-au consumat 50% din substrate (Figura 7 A). Pentru consumarea celorlalte 20% NH4Cl au fost necesare 100 min. iar în cazul valinei marcate cu 15N. Scăderea vitezei de reacţie se poate explica prin scăderea concentraţiei substratelor. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 7 A). Sinteza de [15N]-L-Met Mediul de reacţie pentru sinteza de 15N-metionină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. Masele caracteristice ale ionilor fragment a valinei cu conţinut izotopic natural au valorile m/z 302. În cazul metioninei marcate cu 15N. Masele caracteristice ale ionilor fragment ale metioninei fără marcare izotopică au valorile m/z 320. 288. viteza reacţiei fiind direct proporţională cu concentraţia de substrat până la anumite valori. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice. Astfel.0 12. În cazul valinei derivatizate cu două grupări silil. după 10 min s-a consumat 50% clorură de amoniu. Masa moleculară a metioninei derivatizată cu două grupări silil este de 377.ţilor şi randamentele sintezelor sunt prezentate în Tabelul 3. acumularea de produşi de sinteză care pot inhiba activitatea enzimelor. 292.0 15NH 4Cl 3. atât masa moleculară cât şi 49 . În continuare viteza reacţiei a scăzut.0 Randamentul sintezei (%) 79 86 92 Viteza de reacţie este. Spectrul de masă al valinei marcate isotopic este prezentat în Figura 6 B. Sinteze de [15N]-L-valină Reactanţi (mmol) Acid cetoisovaleric 3. Viteza a scăzut mult după încă 10 min (în primele 20 min ale sintezei s-au consumat 80% clorură de amoniu). Tabelul 3. şi deci şi consumul de clorură de amoniu este foarte mare în primele minute de sinteză. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-γ-metiltiobutiric este aproximativ 8 U/mg proteină.0 8. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. şi 218. Din această cauză a fost nevoie de o cantitate mai mare de proteină.0 12.0 8. 260 şi respective 186. După purificarea aminoacidului s-a constatat un randament al sintezei de 94%. masa moleculară exactă pentru valina fără marcare izotopică la azot este M=345 . Cel mai mare randament s-a constatat în cazul sintezei de 12 mmol.

NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. DMTBS derivat. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norleucină.7 mmol. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. Din fiecare reactant s-a utilizat o cantitate de 5. M = 378. cca 97 atom % 15N 50 . Sinteza s-a declanşat cu 106 U de leucin dehidrogenază şi 86 U de glucozo dehidrogenază şi 39 U de galacto mutarotază. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo dehidrogenază. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa metioninei marcate cu 15N în produsul sintezei enzimatice. (B) Spectrul de masă al [15N]-norleucinei. Raportul molar al reactanţilor (acid α-ceto-γ-metiltiobutiric:15NH4Cl )a fost de 1:1. % 50 40 30 20 10 0 4 40 57 75 147 133 275 303 15 20 346 0 50 100 150 200 m/z 250 300 350 400 0 0 5 10 20 min 30 70 90 120 Figura 8. Sinteza de [15N]-norleucină. Sinteza de [15N]-metionină. cca 97 atom % 15N Sinteza de [15N]-L-NorLeu Mediul de reacţie pentru sinteza de [15N]-norleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. (B) Spectrul de masă al [15N]-metioninei.8 mmol. Raportul molar al reactanţilor (acid α-ceto caproic:15NH4Cl )a fost de 1:1. 100 A 100 90 80 70 60 73 201 B 80 NH Cl (%) 60 I. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-metionină. Figura 7.masele ionilor fragment cresc cu o unitate de masă. M = 360. Din fiecare reactant s-a utilizat o cantitate de 4. Spectrul de masă al metioninei marcate isotopic este prezentat în Figura 7 B. înainte de adăugarea enzimelor. înainte de adăugarea enzimelor. DMTBS derivat.

274 şi 200. Din fiecare reactant s-a utilizat o cantitate de 8. Sinteza de [15N]-norvalină.7 15NH 4Cl Randamentul sintezei (%) 78 78 2. M = 346. Masele fragmentelor ion ale norleucinei cu conţinut izotopic natural sunt sunt m/z 316.8% din activitatea pentru acidul cetoisovaleric). Raportul molar al reactanţilor (acid α-ceto butiric:15NH4Cl)a fost de 1:1. Tabelul 4. ceea ce demonstrează marcarea norleucinei nu 15N (Figura 8 B). (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norvalină. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele mai menţionate mai sus.7 U/mg proteină. Sinteza de [15N]-L-Norval Mediul de reacţie pentru sinteza de [15N]-norvalină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode.0 4.4 U/mg proteină).7 Masa moleculară a norleucinei fără marcare izotopică este 359. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 9 A).Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetocaproic este relativ mică (17. ceea ce constituie 2.0 4. DMTBS derivat. 302. cca 97 atom % 15N 51 . Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 8 A). (B) Spectrul de masă al [15N]-norvalinei.03 mmol. înainte de adăugarea enzimelor. Sinteza s-a declanşat cu 310 U de leucin dehidrogenază şi 204 U de glucozo dehidrogenază. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetobutiric este cea mai mică dintre substratele analizate (4. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. 100 A 100 90 80 187 73 B 80 NH4Cl (%) 70 60 I. % 60 50 40 261 147 57 133 303 331 0 50 100 150 200 250 300 350 289 15 40 30 20 20 10 0 0 0 5 15 30 m in 60 90 120 m/z Figura 9. Raportul reactanţilor şi randamentele sintezelor sunt prezentate în Tabelul 4. Sinteze de [15N]-L-norleucină Reactanţi (mmol) Acid cetocaproic 2.

înainte de adăugarea enzimelor. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 10). 302. cca 97 atom % 15N În cazul izoleucinei derivatizate cu două grupări silil. 52 . (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-isoleucină. 260 şi 186.În cazul norvalinei derivatizate cu două grupări silil. Masele caracteristice ale ionilor fragment ale izoleucinei cu conţinut izotopic natural au valorile m/z 316. Din fiecare reactant s-a utilizat o cantitate de 5. Sinteza s-a declanşat cu 290 U de leucin dehidrogenază şi 221 U de glucozo dehidrogenază. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-β-metilvaleric (46. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. 288. Sinteza de [15N]-L-Ile Mediul de reacţie pentru sinteza de [15N]-izoleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. 274. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. M = 360. DMTBS derivat. masa moleculară exactă pentru norvalină fără marcare izotopică la azot. Masele fragmentelor ion obţinute prin spectrometrie de masă sunt mai mari cu o unitate. iar în cazul norvalinei marcate cu 15N . ceea ce demonstrează marcarea izoleucinei cu 15N (Figura 10 B). este M=345. şi respectiv 200. % 60 4 50 40 15 303 57 75 147 133 275 40 30 20 20 10 0 0 0 5 10 20 40 min 60 90 120 345 50 100 150 200 250 300 350 400 0 m/z Figura 10. masa moleculară exactă pentru izoleucină fără marcare izotopică la azot este M=359. (B) Spectrul de masă al [15N]-izoleucinei. Masele caracteristice ale ionilor fragment ale valinei cu conţinut izotopic natural au valorile m/z 302.5 U/mg proteină) este mai mare decât pentru acidul cetoisocaproic (36.27 mmol. Sinteza de [15N]-isoleucină. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice. Spectrul de masă al norvalinei marcate isotopic este prezentat în Figura 9 B.8 U/mg proteină). A 100 80 NH Cl (%) 100 90 80 70 60 201 73 B I. În cazul aminoacizilor marcaţi cu 15N. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă.

care este deplasat spre formarea de acid aspartic. indicate în partea stângă a tabelului. Tabelul 5.648 20.35 4. Se adaugă apoi 1 U de aspartază recombinată. iar la diferite intervale de timp se citeşte extincţia la 240 nm.53). Determinarea constantei de echilibru (Keq = [NH3] [acid fumaric] / [acid aspartic]) a reacţiei catalizate de aspartaza din E.. Rezultatele şi condiţiile acestor determinări sunt prezentate în Tabelul 5.0 20.28 2.432 3. 1976]. metoda fiind foarte eficientă şi simplă.434 0.523 10. Dozarea activităţii enzimatice a aspartazei s-a făcut de asemenea la temperatura camerei.749 10.Asp NH4Cl Fumarat (mM) 1. Reacţia de sinteză s-a oprit prin denaturarea termică a enzimei. diverse concentraţii de acid aspartic şi NH4Cl. coli Concentraţia iniţială (mM) Concentraţia de echilibru (mM) Keq L. Acid L-aspartic ↔ Acid fumaric + NH4+ După o anumită perioadă de timp. Tosa şi colab. 1973].Sinteza de acid L-aspartic Aspartaza este folosită cu succes în sinteza de acid aspartic din acid fumaric şi clorură de amoniu. În cazul reacţiilor reversibile nu se consumă tot substratul şi ca rezultat randamentul sintezelor scade. iar acidul aspartic având o cerere mare pe piaţa de aminoacizi.0 40. care este proporţională cu concentraţia de acid fumaric format (εmM = 2. La echilibru nu se mai observă nici o variaţie de extincţie.352 4.251 0. Reacţia de formare a acidului aspartic din fumarat este reversibilă. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab.Asp NH4Cl Fumarat L. 1981.0 10.69 mM (sau 3.43 2.5).352 0. Producerea acidului aspartic la scară industrială s-a realizat enzimatic din fumarat şi săruri de amoniu utilizând aspartaza ca şi catalizator [Chibata şi colab.0 0 1. între cei doi reactanţi (fumarat şi acid aspartic) se stabileşte un echilibru.0 0 3. Concentraţiile la echilibru de L-Asp şi NH4Cl se calculează din concentraţiile lor iniţiale şi concentraţia la echilibru de acid fumaric.69 x 10 –3 M). Pentru a determina concentraţiile reactanţilor la care se stabileşte echilibrul reacţiei am făcut mai multe determinări ale constantei de echilibru.566 30.251 3. Celule imobilizate de E. Pe tot parcursul sintezei s-a urmărit consumul de acid fumaric prin citirea absorbanţei la 240 nm (Figura 11 A)..0 0 1. Sinteza de acid aspartic s-a realizat la temperatura camerei..0 0 0.477 3.0 10.477 0. MgCl2 6mM.70 Mediul de reacţie conţine la un volum de 1 ml următorii reactivi: tampon Tris-HCl 50 mM (pH 8. 53 .Media celor 4 măsurători au indicat o valoare a Keq = 3.

Reacţia s-a declanşat cu aspartază 2 U/ml. % 50 40 400 30 20 75 200 10 0 0 50 100 147 202 244 150 200 250 302 316 300 350 418 390 400 450 460 500 0 0 50 100 150 200 min 250 300 350 m/z Figura 11. fapt care explică şi costurile mari a acestora. pH s-a ajustat la valoarea de 8. Masa moleculară a acidului aspartic derivatizat cu trei grupări silil este de 457. Aminoacid dehidrogenazele (AADH) catalizează dezaminarea L-aminoacizilor cu formare de cetoacizi corespunzători.5 cu NaOH. iar echilibrul este deplasat spre formarea de aminoacid. După purificare s-a constat un randament de 70%. Componenţa mediului de sinteză a fost: acid fumaric 1 M. fără marcare cu 15N. DMTBS derivat. Spectrul de masă al acidului aspartic fără marcare izotopică este prezentat în Figura 11 B.Fumarat mM Aspartat mM 1000 100 90 80 73 Fumarat/Aspartat (mM) 800 70 60 600 I. Aspartaza a servit la înlăturarea ionului de amoniu format în urma reacţiei 54 . Masele caracteristice ale ionilor fragment ale acidului aspartic fără marcare izotopică au valorile m/z 432. Reacţiile sunt reversibile. (B) Spectrul de masă al acidului aspartic. aproape de două ori mai mare decât enzima nativă. NH4Cl 0. Până acum nu a fost descrisă o metodă enzimatică eficientă de producere a cetoacizilor. M = 457. (A) Consumul de acid fumaric şi formarea de acid aspartic în cursul reacţiei de sinteză a acidului aspartic. catalizată de aspartaza recombinată din E. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa acidului aspartic în produsul sintezei enzimatice. Sinteza de acid aspartic. Acest fapt ne-a determinat să testăm o sinteză de acid cetoisocaproic (Figura 12). coli. coli. Leucin dehidrogenaza de la B.8 M. stearothermophilus cu 9 aminoacizi lipsă la capătul C-terminal are o activitate specifică în reacţia de dezaminare a L-leucinei. 418. Sinteza de acid α-cetoisocaproic Sinteza chimică a cetoacizilor este dificil de realizat. 390 şi 316. Pentru sinteză am utilizat şi aspartază recombinată de la E. Acesta reprezintă cel mai mare impediment în utilizarea AADH în sinteza enzimatică a cetoacizilor.

L-leucină

NAD+ LeuDH358 NADH LDH

Lactat

Acid αcetoisocaproic NH4+

Piruvat

+
Fumarat AAL Acid aspartic

Figura 12. Schema de sinteză a acidului cetoisocaproic.

de dezaminare a L-leucinei. Reacţia catalizată de aspartază este şi ea reversibilă, dar în acest caz echilibrul reacţiei este deplasat spre formarea de acid aspartic, deci spre consumarea de NH4+. Pentru regenerarea coenzimei am utilizat lactat dehidrogenaza din muşchi de bovine. Un impediment care poate apărea pe parcursul sintezelor de acest gen (cu mai multe enzime) este reacţionarea enzimelor secundare cu produsul sintezei. Este cunoscută specificitatea strictă a aspartazei pentru acid aspartic, de aceea am testat numai activitatea LDH cu diferiţi cetoacizi (Tabelul 6). Surprinzător este faptul că, totuşi, unii cetoacizi sunt substrate pentru LDH. Pentru sinteza cetoacizilor ce servesc ca substrate şi pentru LDH trebuie căutate alte enzime pentru regenerarea coenzimei.
Tabelul 6. Activitatea LDH din muşchi de bovine (Boehringer) în prezenţa diferiţilor α-cetoacizi în raport cu substratul fiziologic (acid piruvic) α cetoacid Acid piruvic Acid hidroxipiruvic Acid fluoropiruvic Acid α cetobutiric Acid α cetocaproic Acid α cetovaleric Acid α ceto γ metiltiobutiric Acid α cetoizocaproic Acid α ceto β metilvaleric Activitate U/mg proteină 140 69 38 10 0,38 0,13, 0,02 0,00 0,00 % 100 49 27 7,1 0,27 0,093 0,014 0,00 0,00

Mediul de reacţie conţine în volumul final de 1 ml: tampon Tris–HCl 50 mM (pH 8,5), MgCl2 6 mM, NADH 0,15 mM, α-cetoacid 1 mM.

55

Sinteza de acid isocaproic s-a realizat pentru o cantitate de 5 mmol. Temperatura la care a fost efectuată sinteza a fost de 35ºC. Reacţiile au fost oprite prin denaturarea termică a enzimelor (15 min la 85ºC). Formarea acidului cetosiocaproic s-a urmărit prin consumarea piruvatului (Figura 13).
Piruvat mM cetoisocaproat mM 120

100 Piruvat/cetoisocaproat (mM)

80

60

40

20

0 0 50 100 min 150 200 250

Figura 13. Consumul de acid piruvic şi formarea de acid α-cetoisocaproic în cursul reacţiei de sinteză a acidului α-cetoisocaproic în sistemul cuplat LeuDH/AAL/LDH. Componenţa mediului de sinteză a fost: acid fumaric 150 mM, acid piruvic 120 mM, L-leucină 100 mM, NAD 1 mM, pH-ul s-a ajustat la valoarea de 8,5 cu NaOH. Reacţia s-a declanşat cu 2 U/ml aspartază, lactat dehidrogenază şi leucin dehidrogenază (LeuDH358).

Din amestecul de sinteză s-a purificat leucina rămasă după sinteză. Cantitatea de leucină recuperată a servit la calcularea randamentului sintezei, care a fost de 30%. Deşi randamentul este mic, sinteza este rentabilă din punctul de vedere al preţului reactanţilor, cei folosiţi sunt mai ieftini decât produsul final. În concluzie, tehnicile care utilizează ADN recombinat au aplicaţiile cele mai diverse în biotehnologie. Aplicarea lor cere însă expertize variate cum sunt: - calcularea randamentelor de reacţie pe baza echilibrelor termodinamice şi a parametrilor cinetici a enzimelor implicate, - utilizarea unor procedee rapide de purificare prin cristalizare sau cromatografie, dar nu în ultimul rând şi cunoaşterea pieţei internaţionale privind cererea şi oferta produselor. Piaţa moleculelor marcate cu 15N este redusă dar interesantă, considerând valoarea ridicată a acestor compuşi. Pentru comparaţie, 1 kg 56

de acid L-glutamic valorează în prezent ~1 €, în timp ce 1 g acid [15N]-L-glutamic valorează ~150 €

2. Tendinţe actuale în aplicarea bionanotehnologiilor
Bionanotehnologiile moderne se inspiră din organizarea celulară a lumii vii. Astfel, structurile nano la fel ca şi structurile vii, sunt alcătuite din componente de natură organică şi anorganică. Aceste structuri sunt speranţa pentru tratarea a numeroase cancere, existând în prezent deja aplicaţii ale nanoparticulelor în tratamentul unor cancere. Nanoparticulele sunt o speranţă nu numai pentru tratamentul numeroaselor boli, dar şi pentru stabilirea unor diagnostice. Utilizarea nanoparticulelor în medicină este axa prioritară în aplicarea bionanotehnologiilor. Limitările bionanotehnologiilor sunt: incapacitatea de a sintetiza particule de aceleaşi dimensiuni cu aceeaşi suprafaţă, controlul organizării lor. Ţesuturile tari, cum ar fi ţesutul osos, cochiliile la moluşte, conţin una sau mai multe componente organice de natură proteică care controlează organizarea structurală . Aplicaţii ale bionanotehnologiilor Nanoparticulele de aur (NP-Au) sunt o adevărată speranţă în diagnosticul şi tratamentul cancerelor. Au a fost utilzat timp de câteva decenii în diverse aplicaţii în medicină (implanturi dentare) datorită caractersticilor sale neutre. Nanoparticulele de Au au început să fie din ce în ce mai des utilizate în depistarea şi chiar tratamentul unor celule canceroase datorită faptului că acestea sunt inerte, non-toxice, au stabilitate mare, dimensiuni mici şi capacitate de legare mare. NP-Au sunt capabile de a acţiona asupra unor anumite tipuri de celule chiar în absenţa oricăror grupe funcţionalizate. NP-Au induc moartea celulară liniei de celule de carcinom pulmonar A549 de la om, dar nu au nici un efect asupra altor linii de celule HepG2 (carcinom hepatic hepatocelular uman) şi BHK21 (celule juvenile din rinichi de hamster) (Patra şi col., 2007). Diagnostic Diagnosticul nanomolecular al cancerului poate asigura depistarea celulelor canceroase în faze incipiente ale bolii. Nanoparticule de aur derivatizate cu nucleotide tiolate au fost utilizate pentru depistarea celulelor canceroase (Conde şi col., 2010). NP-Au la care s-au ataşat oligonucleotide de ADN au fost utilizate pentru diagnosticul timpuriu al leucemiilor mieloide acute. Oligonucleotidele ADN utilizate în acest scop 57

reprezentau un fragment din joncţiunea care rezultă în urma translocaţiiei t(9;22)(q34;q11). Un fragment dintr-un cromozom este translocat la un alt cromozom, în acest caz fragmentul de la cromozomul 9 este transferat pe cromozomul 22, cromozomul find cunoscut sub denumirea de cromozom Philadelphia. Această translocaţie este cauza leucemiilor mieloide cronice şi care sunt cauzate de fuziunea a 2 gene BCR(22)-Abl(9) (Figura 14).

Figura 14. Formarea cromozomului Philadelphia – translocaţia reciprocă între cromozomul 9 şi 22.

Produsul acestei gene este o proteină himeră cu activitate tirozin-kinazică. Metoda de detecţie cu ajutorul nanoparticulelor se bazează pe formarea de porţiuni hibride ADN:ARN (ADN sonda: ARNm din celulele canceroase) dublu catenare, care vor împiedica agregarea nanoparticulelor de Au odată cu creşterea concentraţiei de săruri. Metoda nanosondelor pentru diagnosticul acestui tip particular de cancer oferă avantaje faţă de metodele utilizate actual în diagnostic (FISH, transcrierea inversă a ARNm şi amplificarea prin PCR) prin faptul că este mai ieftină şi mai rapidă (~30 min) şi necesită cantităţi mici de ARNm (10 ng/μl). Diagnosticul timpuriu în asemenea cazuri este foarte important, în fazele ulterioare celulele canceroase devenind rezistente la chemoterapice. Nanoparticulele de argint (NP-Ag) au devenit atractive în domeniul bionanotehnologic după descoperirea efectului lor antibactericid (Sondi şi Salopek-Sondi, 2004). Acest efect este unul de importanţă majoră datorită faptului că bacteriile capătă din ce în ce mai multă rezistenţă la antibiotice. Nanoparticulele de argint par a avea o influenţă nu numai asupra bacteriilor, dar şi asupra virusurilor. Astfel NP-Ag la concentraţii non-toxice pentru celule inhibă replicarea virală (sinteza materialului genetic ai virusului) 58

atunci când nanoparticulele sunt administrate înainte de infectare sau imediat după (2-4 ore) aceasta (Speshock şi col., 2010). Unele substanţe chimice s-au dovedit a avea un efect inhibitor asupra proliferării celulare, angiogenezei şi rol antiinflamator. Un astfel de exemplu este colorantul DCPIP (2,6-diclorofenol-indofenol) care induce apoptoza (moartea celulară) în celule umane de melanom A375 şi G361 (Cabello şi col., 2009). DCPIP s-a dovedit a avea acţiune antiangiogeneză şi antiinflamatoare asupra celulelor canceroase umane de colon HCT116. Efectul acestuia este mai intens dacă este încapsulat în particule de poliacizi (lactic şi glicolic). Concentraţiile de ≥6 μg/ml de colorant (DCPIP) induc moartea celulară prin apoptoză (Mondalek şi col., 2010). Nanobiotehnologiile urmăresc nu numai crearea de nano-vehicule pentru transportarea diferitor substanţe, dar şi crearea şi manipularea unor adevărate nano-motoare, utile în nanomanipulare celulară. F1-ATP-aza este un veritabil nano-motor rotativ, a cărei mişcări pot fi controlate cu ajutorul unor stimuli optici şi chimici (Ristic şi col., 2009). Sisteme particulare capabile de transport ţintit şi eficient a diferitor substanţe, cu puţine efecte adverse, se datorează probabil endocitozei transportorilor. Nanoparticule cationice formate din lipide cationice şi polielectroliţi s-au dovedit a fi cărăuşi excelenţi pentru transportul amfotericinei B – un antifungicid pentru Candida albicans (Vieira şi Carmona-Ribeiro, 2008). Nanodiscurile de HDL (High Density Lipoprotein) sunt un strat bifosfolipidic cu aspect de disc (ND-HDL). Este cunoscut faptul că HDL este numit “colesterolul bun” deoarece este implicat în transportul moleculelor hidrofobe (colesterol) în fluxul sangvin care este un mediu hidrofil. Structura HDL (liporoteine cu densitate mare) este una simplă, fiind alcătuit din fosfolipide şi apolipoproteină (apo). Cea mai abundentă formă de lipoproteină din plasma sanguină umană este apoA-I, care este alcătuită din 243 de aminoacizi, este bine caracterizată şi la incubarea cu vezicule de fosfolipide în vitro formează HDL revers, capabil de transportul moleculelor hidrofobe (Ryan, 2010). Fosfolipidele cele mai frecvent utilizate pentru asamblarea veziculelor sunt DMPC (dimirisstoil-fosfatidil colina) şi DMPG (dimirisstoil-fosfatidil glicerol). Incubarea acestor vezicule cu apoA-I se autoasamblează ND-HDL. Aceste nano-discuri se pot autoasambla chiar dacă nu este utilizată enzima integrală, ci numai fragmente de apolipoproteine (Weers şi col., 2001). ND-HDL reprezintă astfel un mediu favorabil pentru studierea proteinelor transmembranare, transportul unor substanţe hidrofobe. 59

Stratul bilipidic este un mediu natural pentru proteinele transmembranare care îşi păstrează proprietăţile sale conformaţionale şi activitatea. Suprafaţa unui nanodisc cu diametrul de 20nm este de ~300 nm2, o suprafaţă suficientă pentru integrarea câtorva molecule proteice. Avantajul utilizării acestor structuri comparativ cu miceliile de detergenţi, este că asigură un mediu natural apropiat, fără prezenţa detergenţilor care pot schimba conformaţiile proteinelor. ND-HDL au fost utilizate în studierea a numeroase proteine transmembranare cum ar fi bacteriorodopsina (Bayburt ţi col., 2006; Blanchette şi col., 2008), citoromul p450 3A4 (Baas şi col., 2004), toxina antraxului (Katayama şi col., 2010), hidrogenaze enzime de membrană produse de Pyrococcus furiosus care pot sintetiza H2 (Baker şi col., 2009). ND-HDL au fost testate în utilizarea lor pentru transportul diferitor substanţe hidrofobe, care sunt insolubile în mediu sangvin hidrofil. Un exemplu în acest sens este transportul de către ND-HDL a amfotericinei B un potenţial antifungicid care inhibă creşterea Saccharomyces cerevisiae şi a altor fungi patogene, care administrat sub această formă nu mai este toxic la anumite concentraţii (Oda şi col., 2006). ND-HDL ce conţineau cucurmină (un polifenol hidrofob natural obţinut din Curcuma longa) au inhibat creşterea liniei celulare hepatice HepG2 comparativ cu administrarea curcuminei libere (Ghosh şi col., 2010). O altă aplicaţie a nanodiscurilor de HDL a fost încorporarea de lipide cu ioni bivalenţi de Ni2+, care au capacitatea de a fixa proteinele cu etichetă de 6-His (histidine). Proteina din învelişul virusului West Nile (Fischer şi col., 2010)

3. Bibliografie
1. Baas B. J., Denisov I. G., Sligar S. G., (2004). Homotropic cooperativity of monomeric cytochrome P450 3A4 în a nanoscale native bilayer environment, Archives of Biochemistry and Biophysics, 430(2), 218-28. Baker S. E., Hopkins R. C., Blanchette C. D., Walsworth V. L., Sumbad R., Fischer N. O., Kuhn E. A., Coleman M., Chromy B. A., Letant S. E., Hoeprich P. D., Adams M. W., Henderson P. T., (2009). Hydrogen production by a hyperthermophilic membrane-bound hydrogenase în water-soluble nanolipoprotein particles, Journal of the American Chemical Society, 131(22), 7508-7509. Baker P., Sawa Y., Shibata H., Sedelnikova S., Rice D., (1998). Analysis of the structure and substrate binding of Phormidium lapideum alanine dehydrogenase. Nature Structural Biology, 5, 561-67. Bayburt T. H., Grinkova Y. V., Sligar S. G., (2006). Assembly of single bacteriorhodopsin trimers în bilayer nanodiscs, Archives of Biochemistry and Biophysics, 450(2), 215-22. Blanchette C. D., Cappuccio J. A., Kuhn E. A., Segelke B. W., Benner W. H., Chromy B. A., Coleman M. A., Bench G., Hoeprich P. D., Sulchek T. A., (2008). Atomic force microscopy differentiates discrete size distributions between membrane protein

2.

3.

4.

5.

60

6.

7.

8. 9. 10.

11.

12. 13. 14.

15. 16.

17.

18.

19.

20. 21.

containing and empty nanolipoprotein particles, Biochimica et Biophysica Acta, 1788(3), 724-31. Boonstra B., Rathborne D. A., French C. E., Walker E. H., Bruce N. C., (2000). Cofactor regeneration by a soluble pyridine nucleotide transhydrogenase for biological production of hydromorphone. Applied Enviromental Microbiology, 66, 5161-66. Cabello C. M., Warner B. Bair W. B., Bause A. S., Wondrak G. T., (2009). Antimelanoma activity of the redox dye DCPIP (2,6-Dichlorophenolindophenol) is antagonized by NQO1, Biochemical Pharmacology, 78(4), 344-54. Chibata I., Tosa T., Sato T., (1976). Production of L-aspartic acid by microbial cells entrapped în polyacrylamide gels. Methods în Enzymology, 44, 739-746. Conde J., de la Fuente J. M., Baptista P. V., (2010). RNA quantification using gold nanoprobes - application to cancer diagnostics, Journal of Nanobiotechnology, 8:5. Deconttignies-Le Maréchal P., Calderon-Seguin R., Vandecasteele J.,P., Azerad R., (1979). Synthesis of L-tryptophan by immobilized Escherichia coli cells. European Jornal of Applied Microbiology and Biotechnology, 7, 33-44. Delforge D., Devreese B., Dieu M., Delaivre E., Beeumen J., Remacle J., (1997). Identification of lysine 74 în pyruvate bineding of alanine dehydrogenase from Bacillus subtilis. Journal of Biological Chemistry, 272, 2276-84. Ghosh M., Singh A. T., Xu W., Sulchek T., Gordon L. I., Ryan R. O., (2010). Curcumin nanodisks: formulation and characterization, Nanomedicine: Nanotechnology, Biology and Medicine, Honorat A., Monot F., Ballerini D., (1990). Synthesis of L-alanine and L-valine by enzyme system from Bacillus megaterium. Enzyme and Microbial Technology, 12, 515-20. Honorat-Pascal A., Monot F., Ballerini D., (1990). Coparative stady of the enzymatic synthesis of L-valine by purified enzymes, crude extract or permeabilized cells from Bacillus megaterium. Applied Microbiology and Biotechnology, 34, 236-41. Hummel W., Kula M-R., (1989). Dehydrogenases for the synthesis of chiral compounds. European Journal of Biochemistry, 184, 1-13. Fischer N.O., Infante E., Ishikawa T., Blanchette C.D., Bourne N., Hoeprich P.D., Mason P.W., (2010). Conjugation to nickel-chelating nanolipoprotein particles increases the potency and efficacy of subunit vaccines to prevent West Nile encephalitis, Bioconjugate Chemistry, 21(6), 1018-22. Fukui S., Ikeda S., Fujimura M., Yamada H., Kumagai H., (1974). Production of L-tryptophan, L-tyrosine and their analogues by immobilized tryptophanase and immobilized β-tyrosinase. European Journal of Applied Microbiology, 1, 25-39. Fusee M., Swann W., Calton G., (1981). Immobilization of Escherichia coli cells containing aspartase activity with polyurethane and its application for L-aspartic acid production. Applied Enviromental Microbiology, 42, 672-76. Fusee M., Weber J., (1984). Immobilization by polyurethane of Pseudomonas dacunhae cells containing L-aspartat β-decarboxylase activity and application to L-alanine production. Applied Enviromental Microbiology, 48, 694-98. Karsten W.E., Viola R.E., (1991). Kinetic studies of L-aspartase from Escherichia coli: pH-dependent activity changes. Archives of Biochemistry and Biophysics, 287, 60-67. Katayama H., Wang J., Tama F., Chollet L., Gogol E. P., Collier R. J., Fisher M. T., (2010). Three-dimensional structure of the anthrax toxin pore inserted into lipid nanodiscs and lipid vesicles, Proceedings of the National Academy of Sciences of the USA, 107(8), 3453-57.

61

22. Katoh R., Nagata S., Ozawa A., Ohshima T., Kamekura M., Misono H., (2003). Purification and characterization of leucine dehydrogenase from an alkaliphilic halophile, Natronobacterium magadii MS-3. Journal of Molecular Catalysis, 23, 231-38. 23. Mondalek F. G., Ponnurangam S., Govind J., Houchen C., Anant S., Pantazis P., Rama P Ramanujam R. P., (2010). Inhibition of angiogenesis- and inflammation-inducing factors în human colon cancer cells în vitro and în ovo by free and nanoparticle-encapsulated redox dye, DCPIP, Journal of Nanobiotechnology, 8:17, 1-9. 24. Monot F., Benoit Y., Lemal J., Honorat A., Ballerini D., (1988). Simultaneous production of amino acid dehydrogenase and glucose dehydrogenase by Bacillus megaterium and their utilization for L-valine synthesis with NADH regeneration. Biocatalysis, 2, 161-74. 25. Nagata S., Misono H., Nagasaki S., Esaki N., Tanaka H., Soda K., (1989). Thermostable alanine dehydrogenase of Bacillus sp.DSM730: gene cloning, purification, and characterization. Biochemistry, 71, 559-63. 26. Nagata S., Tanizawa K., Esaki N., Sakamoto Y., Ohshima T., Tanaka H., Soda K., (1988). Gene cloning and sequence determination of leucine dehydrogenase from Bacillus stearothermophilus and structural comparison with other NAD(P)+-dependent dehydrogenases. Biochemistry, 27, 9056-62. 27. Norbert M., Brunhuber W., Blanchard J.S., (1994). The biochemistry and enzymology of amino acids dehydrogenases. Critical Reviews în Biochemistry and Molecular Biology, 29, 415-67. 28. Oda M. N., Hargreaves P. L., Beckstead J. A., Redmond K. A., van Antwerpen R., Ryan R. O., (2006). Reconstituted high density lipoprotein enriched with the polyene antibiotic amphotericin B, Journal of Lipid Research, 47(2), 260-67. 29. Ohshima T., Nishida N., Bakthavatsalam S., Kataoka K., Takada H., Yoshimura T., Esaki N., Soda K., (1994). The purification, characterization, cloning and sequencing of the gene for a halostable and thermostable leucine dehydrogenase from Thermoactinomyces intermedius. European Journal of Biochemistry, 222, 305-12. 30. Ohshima T., Wandrey C., Conrad D., (1988). Continous production of 3-fluoro-L-alanine with alanine dehydrogenase. Biotechnology and Bioengineering, 34, 394-97. 31. Ohshima T., Wandrey C., Kula M-R., Soda K., (1985). Impovement for L-leucine production în a continously operated enzyme membrane reactor. Biotechnology and Bioengineering, 26, 1616-18. 32. Oka M., Yang Y.S., Nagata S., Esaki N., Tanaka H., Soda K., (1989). Overproduction of thermostable leucine dehydrogenase of Bacillus stearothermophilus and its one-step purification from recombinant cells of Escherichia coli. Biotchnology and Applied Biochemestry, 11, 307-11. 33. Patra H.K., Banerjee S., Chaudhuri U., Lahiri P., Dasgupta A., (2007). Cell selective response to gold nanoparticles, Nanomedicine: Nanotechnology, Biology, and Medicine, 3, 111–19 34. Ristic Z., Vitali M., Duci A., Goetze C., Kemnitz K., Zuschratter W., LillH., Bald D., (2009). Two-stimuli manipulation of a biological motor, Journal of Nanobiotechnology, 7:3. 35. Ryan R. O., (2010). Nanobiotechnology applications of reconstituted high density lipoprotein, Journal of Nanobiotechnology, 8:28. 36. Schütte H., Flossdorf J., Sahm H., Kul, M. R., (1976). Purification and properties of formaldehyde dehydrogenase and fromate dehydrogenase from Candida boidinii. European Journal of Biochemistry, 62, 151.

62

37. Siranosian J.K., Ireton, K., Grossamn D.A., (1993). Alanine dehydrogenase (ald) is required for normal sporulation în Bacillus subtilis. Journal of Bacteriology. 175, 6789-96. 38. Sondi I., and Salopek-Sondi B., (2004). Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria, Journal of Colloid and Interface Science, 275, 177–82. 39. Speshock J. L., Murdock R. C., Braydich-Stolle L. K., Schrand A. M., Hussain S. M., (2010). Interaction of silver nanoparticles with Tacaribe virus, Journal of Nanobiotechnology, 8:19. 40. Tosa T., Sato T., Mori T., Chibata I., (1974). Basic studies for continous production of L-aspartic acid by immobilized Escherichia coli Cells. Applied Microbiology, 27, 886-89. 41. Vieira D. B., and Carmona-Ribeiro A. M., (2008) Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity în vitro, Journal of Nanobiotechnology, 6:6. 42. Weers P. M., Narayanaswami V., Ryan R. O., (2001). Modulation of the lipid binding properties of the N-terminal domain of human apolipoprotein E3, European Journal of Biochemistry, 268, 3728-35.

63

II. CULTURI CELULARE Culturi celulare
Lect. dr. Mircea Teodor Chiriac Cuprins
1. Prezentarea principiului tehnicii experimentale .................................................... 64 2. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu ............. 67 3. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente .................................................. 71 3.1. Echiparea laboratorului de culturi celulare ..................................................... 71 3.2. Strategii de lucru ............................................................................................ 74 3.3. Instruirea personalului ................................................................................... 75 3.4. Cultivarea celulelor ......................................................................................... 78 3.5. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora .......................................................................................... 78 3.6. Îngheţarea şi dezgheţarea celuluor .................................................................. 79 3.7. Subclonarea; tripsinizarea............................................................................... 81 4. Bibliografie ............................................................................................................. 81

1. Prezentarea principiului tehnicii experimentale
Multe dintre tehnicile introduse la un moment dat în diferite ştiinţe au revoluţionat felul în care acea ştiinţă a fost percepută ulterior. Culturile celulare sunt un asemenea exemplu în biologie. Introducerea acestei tehnici în urmă cu aproximativ 100 de ani a permis practic importul naturii în laborator, ceea ce a dus la standardizarea tehnicilor şi generalizarea strategiilor de studiu între cercetătorii din diverse instituţii, urmată de o explozie informaţională în lumea biologică. Avansarea cunoaşterii bio-medicale din ultimele decenii nu ar fi fost posibilă fără dezvoltarea printre altele a metodelor de lucru cu celulele. Cercetarea bio-medicală actuală foloseşte tehnicile de lucru cu celulele pentru investigarea unor probleme din domenii ca: biofizica, biochimie, biologie celulară şi moleculară, genetica, biologia dezvoltării organismelor, evolutionism, medicina moleculară, farmacologia, bio-nano-tehnologia, inteligent drug design etc. 64

cultura de organe .Este practic de neimaginat desfăşurarea activităţii într-un centru de cercetare bio-medical lipsit de laboratorul de culturi celulare. eritropoietina). Aplicaţii curente sunt legate de: folosirea culturilor celulare pentru elaborarea vaccinurilor. interferoni.cultura de celule . . cultivarea organelor şi ţesuturilor cu aplicaţii în bolile cronice degenerative. 65 .presupune prelevarea unor ţesuturi şi digestia lor pentru obţinerea unei suspensii unicelulare care este apoi cultivată mai departe. cultura celulară poate cuprinde cultura ţesuturilor şi organelor. cancere şi altele. testarea agenţilor anticanceroşi. producţia glico-proteinelor recombinante (cytokine. secundare şi imortale/canceroase Proprietăţi Inhibiţia de contact1 Fenotipul faţă de situaţia in vivo Genotipul faţă de situaţia in vivo Necesarul factorilor de creştere Diferenţiate Număr de diviziuni Timp necesar cultivării Reproductibilitatea rezultatelor 1 primare da identic identic crescut da 2-3 crescut scăzută secundare da asemănător identic crescut da <100 scăzut crescută imortale/canceroase unele/nu asemănător/rotunde asemănător/diferit crescut/limitat da/nediferenţiate nelimitat scăzut crescută în mod normal. Tabel 1. Celulele canceroase pierd această caracteristică fenotipică şi după ce ajung să fie confluente încep să crească una peste cealaltă formând ghemuri de celule uşor de distins la microscopul optic. Avansarea cercetării din domeniul celulelor stem şi lucrul cu celulele embrionare face posibilă. Din punct de vedere al tipului de cultură se poate vorbi despre: . Aceasta include şi cultivarea unor embrioni întregi. Pe de altă parte.presupune prelevarea şi cultivarea unui organ în totalitate. metabolism. există trei tipuri de celule animale care sunt cultivate în laborator: primare. anticorpi monoclonali folosiţi în cercetare şi clinica medicală. celulele cresc în vasul de cultură până când stabilesc contact cu vecinele lor. Caracteristicile celulelor primare. Dacă ne referim la cultura de celule. deocamdată teoretic. studii de genomică. moment în care îşi opresc creşterea. apoptoză. . secundare şi imortalizate (tabel 1). celulele pot fi folosite ca şi model pentru studiul răspunsurilor fiziologice la diferiţi factori de stres din mediu. Într-un sens mai larg.presupune prelevarea unor fragmente de ţesuturi şi cultivarea lor. hormoni.cultura de ţesuturi .

Cultivarea celulelor provenite din piele (keratinocite. Culturi de celule imortalizate Este posibil ca unele celule din culturile secundare să sufere anumite transformări care le conferă caracterul de imortalitate adică posibilitatea de a se divide la nesfârşit. subcultura are ca scop menţinerea celulelor în faza logaritmică de creştere. evitarea confluenţei care poate avea ca rezultat inhibarea creşterii. Aceste celule vor creşte aderente de suprafaţa vasului de cultură. Pentru a le separa de acesta şi pentru separarea celulelor unele de altele se folosesc de obicei enzime proteolitice (tripsina). Unele dintre aceste celule imortale (transformate) pot avea caracter oncogenic. Culturi secundare Prin subcultivarea celulelor dintr-o cultură primară se pot obţine aşa-numitele culturi secundare. cultivarea celulelor prelevate din sângele periferic se face într-o manieră care nu necesită ancorarea acestora de pereţii vasului de cultură. celulele canceroase au unele proprietăţi care le diferenţiază de celelalte celule imortale necancreoase: nu mai prezintă inhibiţia de contact. Celulele dintr-o cultură secundară pot parcurge până la 100 de diviziuni înainte de a-şi pierde potenţialul proliferativ. fibroblaste) se face prin biopsierea ţesutului şi formarea unei suspensii unicelulare. Este posibil ca celulele să formeze aderenţe între ele dar de obicei acestea sunt de o mică intensitate. După cum se poate observa din tabelul 1. Diferite substanţe (factori de creştere ai diferitelor populaţii leucocitare şi/sau mitogeni – substanţe care stimulează mitoza) pot fi utilizate pentru diferenţierea şi înmulţirea celulelor în cultură. 66 . Deşi nu prezintă alterări ale setului de cromozomi (karyotipului). Pe de altă parte. îndepărtarea celulelor moarte şi a produşilor de metabolism celular şi adăugarea substanţelor nutritive.Culturi primare Majoritatea celulelor din culturile primare necesită ancoraj. aceste celule acumulează anumite caracteristici fenotipice care le fac să devină o linie celulară distinctă. Pe lângă derivarea culturilor secundare. pot creşte cu mai puţini nutrienţi etc. fizici (radiaţii) sau biologici (virusurile oncogene). cu alte cuvinte transplantarea lor la animalele de laborator este urmată de apariţia tumorilor la acestea. Aceste celule pot apărea ca urmare a unor modificări (transformări) la nivelul cromozomului prin factori chimici.

În 1975 cei doi cercetători au publicat rezultatele prin care pot fi obtinuţi anticorpii monoclonali. enzimelor. interleukine). îmbătrânirii şi apoptozei. Mai mult. Este de aşteptat ca acest domeniu să revoluţioneze tratamentul diferitelor afecţiuni. eritropoietina). În plus. celulele animale sunt deosebit de utile în testarea citotoxicităţii diferitelor substanţe incluzând noile terapii anticanceroase. Prin diferite metode de screening se pot găsi aceste celule care sunt ulterior subclonate dând naştere astfel unor linii celulare pure şi stabile are produc anticorpii monoclonali. ciclului celular. prin folosirea tehnologiei AND-ului recombinat este posibilă crearea celulelor transgene care constituie per se un model de studiu pentru investigarea metabolismului energetic. Nu în ultimul rând. traficului de membrană. antirabic).2. Pe scurt tehnica presupune imunizarea unui animal de experienţă cu un antigen şi recoltarea celulelor B (cele care produc anticorpii) la un anumit interval de timp după imunizare (figura 1). factorilor de coagulare. anticorpii monoclonali şi-au găsit foarte rapid aplicaţii în domenii variate cum ar fi: diagnosticul şi trata67 . anticorpilor monoclonali şi altor substanţe imunomodulatoare (interferoni. hormonilor şi factorilor de creştere (insulina. Această tehnologie a fost pusă la punct de către Milstein şi Koehler în urma cu aproape patru decenii. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Aplicaţiile culturilor celulare îşi găsesc utilitatea în producerea: vaccinurilor (antirubeolic. antiparotidita epidemică. agenţilor anticanceroşi etc. Datorită specificităţii deosebit de mari (se consideră că un anticorp poate distinge antigenul pereche între 108 molecule). antivaricela. diferenţierii. În urma acestei fuziuni. dezvoltarea în ultimii ani a cunoştinţelor şi tehnologiei de lucru cu celulele stem constituie una dintre temele cele mai actuale în domeniul biomedical. Anticorpii monoclonali Una dintre aplicaţtiile culturilor celulare cu cel mai mare impact pentru societate la ora actuală este reprezentată de tehnologia de obţinere a anticorpilor monoclonali prin folosirea hibridoamelor. Aceste celule sunt fuzionate apoi în prezenţa poli-etilen-glicolului (PEG) cu o linie celulară canceroasă de mielom (cancer al plasmocitelor). se formează celule hibrid (de unde şi numele de hibridoame) dintre care unele produc anticorpii cu specificitatea dorită (caracter dobândit de la celula B a animalului imunizat) într-o manieră continuă (dobândind caracterul imortal de la celulele de mielom).

Celulele B sunt izolate şi combinate cu mieloamele (partea stângă) în prezenţa PEG care mediază fuziunea celulelor. Folosirea terapeutică a anticorpilor monoclonali în diferite afecţiuni umane urmează două direcţii: markeri diagnostici care pot identifica diferite tipuri de antigene din populaţii celulare in vivo şi terapia ţintită a diferitelor afecţiuni în care anticorpului monoclonal îi sunt ataşate substanţe chimice toxice sau radioactive. catalizatori ai reacţiilor chimice (abzymes). Screeningul face posibilă identificarea coloniilor care produc anticorpi faţă de antigenul dorit. Urmează apoi subclonarea realizată prin diluarea celulelor din coloniile producătoare în aşa fel încât fiecare 68 . Celulele hibrid sunt singurele care vor supravieţui în mediul suplimentat cu Hypoxanthine Aminopterin Thymidine (HAT). antigen PEG HAT Screening Subclonare Linie celulară producatoare de anticorp monoclonal Figura 1 Producerea anticorpilor monoclonali Splina este izolată la câteva saptămâni (timp necesar pentru îmbogăţirea repertoriului de celule B specifice) după imunizarea animalului cu antigenul faţă de care se doreşte producerea anticorpilor monoclonali. cercetare fundamentală şi aplicată (metode de izolare a diferitelor substanţe recunoscute).mentul clinic.

recipient să conţină teoretic o singură celulă. Se poate vorbi la ora actuală de cancere tratate cu anticorpi monoclonali în care pacienţii supravieţuiesc fără recidivă la 30 de ani de la administrarea terapiei. Se obţin în acest fel colonii în care toate celule provin dintr-o singură celulă mamă şi deci vor produce acelaşi anticorp ca şi aceasta. Interesul major pentru biologia celulelor stem este explicat de potenţialul de diferenţiere al acestora în orice tip de ţesuturi şi organele dintr-un organism. O schiţă a diferenţierii celulare se găseşte în figura 2. Deşi nu sunt toxici. oligopotente. în ultimii ani. Cu timpul anticorpii umani pot neutraliza şi distruge anticorpii monoclonali injectaţi anulându-le efectele terapeutice. Celule stem Următorul pas în revoluţia din domeniul biomedical a fost reprezentat de posibilitatea cultivării celulelor stem în laborator. Prin definiţie celulele stem sunt acele celule care prin diviziune dau naştere unei celule fiică identică şi unei alte celule care poate fi diferită. celule stem pot fi clasificate în: totipotente. Această abordare a permis medicilor oncologi să obţină rezultate spectaculoase în diferite forme de cancere. Tehnologia ADN-ului recombinat a făcut posibilă ataşarea părţii specifice (cea care recunoaşte antigenul) derivată de la şoarece cu un braţ constant (care consituie cea mai mare parte) de la om. Deşi cercetarea în acest domeniu este relativ la început. Cele mai bine studiate celule stem sunt cele derivate din măduva osoasă şi care constituie precursorii tuturor celulelor din sânge. numărul celor aflaţi în diferite stadii de testare depăşeşte 100. Din acest motiv. celulele totipotente sunt capabile să formeze un organism în totalitate. pluripotente. După cum implică numele. Ajunşi în organism aceşti anticorpi ca orice altă substanţă străină iniţiază un răspuns imun din partea gazdei care se poate manifesta prin secreţia de anticorpi umani anti-anticorpi monoclonali de şoarece. Aceste celule sunt reprezentate de către ovulul fertilizat şi celulele obţinute din primele diviziuni ale acestuia. După numărul de precursori ai liniilor diferenţiate pe care le poate produce. Există la ora actuală şi peste 30 de anticorpi monoclonali folosiţi ca şi agenti terapeutici în diferite afecţiuni umane. multipotente. anticorpii monoclonali produşi în şoarece prezintă neajunsul de a fi străini organismului uman. cercetătorii au reuşit să izoleze şi cultive cu succes 69 . După sursa de provenienţă există două tipuri de celule stem: celule stem embrionare şi celule stem adulte. anticorpii de şoarece au fost umanizaţi.

anumite celule stem din diferite surse unele dintre ele fiind apoi diferenţiate în numeroase celule finale. Este posibil ca una dintre cele opt celule ale embrionului rezultat în urma fertilizării in vitro a unui ovul să fie îndepărtată şi analizată din punct de vedere genetic (celula este dispensabilă deoarece restul celulelor rămase refac embrionul). Deşi deosebit de atractivă. tehnologia cultivării celulelor stem embrionare este puternic îngrădită de normele actuale ale eticii cercetării. Dacă aceste organe sunt chiar gonadele. Celula stem Pluripotentă Celula stem Multipotentă Celula stem cu potenţial limitat Celula diferenţiată Parţial Celula diferenţiată final. celulele stem prezintă şi aplicaţii diagnostice. atunci urmaşii unei împerecheri dintre doi astfel de şoareci chimera pot produce un knock-out/knock-in pentru acea genă. În urma analizelor care pot să depisteze diferite defecte genetice se poate decide neimplantarea embrionului în uterul viitoarei mame. Pe lângă potenţialul terapeutic enorm. Se pot produce astfel animale „chimera” care exprimă genele implantate în diferite organe. Folosirea acestor celule face posibilă şi obţinerea animalelor modificate genetic prin introducerea unor gene în embrionul tânăr. postmitotică Figura 2 Celulele stem pot da nastere unui numar mare de celule diferentiate final 70 .

Existenţa acestor celule canceroase stem poate explica apariţia recidivelor prin participarea unui număr redus de celule care nu pot fi distinse/distruse prin tehnicile actuale. concentraţia de CO2 este în general ajustată între 5% şi 7% pentru a obţine un sistem tampon optimal în combinaţie cu substanţele din mediul de cultură. • tipul de hotă folosită pe scară largă în cultura celulelor animale este hota cu flux de aer vertical care oferă o protecţie bună atât pentru celule cât şi pentru operator. Experimental s-a dovedit că un număr de doar 200 de celule considerate ca fiind celule stem canceroase este suficient pentru a transfera cancerul de la un animal la un altul în timp ce un număr de câteva sute de ori mai mare de celule canceroase care nu prezintă caracteristicile celulelor stem sunt incapabile să transfere boala.1. 3.Disputele asupra aspectelor etice ale lucrului cu celule stem embrionare au încurajat dezvoltarea tehnicilor de lucru cu celulele stem adulte. Succesul în lucrul cu celule depinde de factori variaţi cum ar fi: utilarea laboratorului. Hota cu flux laminar • Serveşte lucrului efectiv cu celulele. Incubator cu sursa de CO2 • creşterea celulelor. • este prevazută în mod obligatoriu cu o lampă de UV care va fi pornită 5-10 minute înainte de începerea lucrului şi repornită pentru 5-10 minute după încheierea lucrului. 71 . Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente 3. b. în funcţie de tipul de celulp. Această nouă descoperire pune sub semnul întrebării principiile actuale care stau la baza tratamentului cancerului. aranjarea spaţiului de lucru este descrisă în figura 4. calitatea celulelor şi a reactivilor. Rămâne de văzut dacă potenţialul unor astfel de celule stem adulte este la fel de nelimitat ca şi al celor embrionare. tehnica asepteică (prezentate în cele ce urmează) şi experienţa personală a operatorului care contribuie decisiv la primele trei. Echiparea laboratorului de culturi celulare Organizarea generală a laboratorului de culturi celulare include următoarele echipamente de bază (figura 3): a. Recent au fost descrise şi celule stem canceroase.

halat).• responsabil pentru menţinerea unei atmosfere sterile (filtre HEPA. f. e. Centrifuga de masă cu răcire • centrifugarea suspensiilor de celule în diverse scopuri. Recipient cu azot lichid • stocarea celulelor pe termen lung. • Autoclav şi sterilzor cu aer uscat o Folosite pentru sterilizarea diferitelor soluţii şi recipiente folosite. d. o o alternativă este înlocuirea apei cu perle metalice care prezintă următoarele avantaje: reducerea contaminării reactivilor cu care vin în contact. • o precauţie deosebită trebuie acordată faptului că recipientul este extrem de rece (-196 grade Celsisus) şi azotul poate produce arsuri în urma contactului cu pielea sau mucoasele. igienizare uşoară. Pompa de vid şi sisteme de sterilfiltrare o pentru lichidele instabile la autoclavare (de ex. stabilitate în timp. c. Alte componente • Baie de apă o păstrarea mediilor şi altor reactivi la temperatura de 37 grade Celsius. celulele sunt în general situate pe suprafaţa bazei recipientului se foloseşte microscopul inversat. Frigider/congelator • stocarea reactivilor L-glutamina etc. • contrastul de fază îmbunătăţeşte vizualizarea specimenelor transparente (celulelor). economisirea consumului de energie. • deoarece în cultura de celule animale. stocuri de antibiotice. Microscop optic inversat cu contrast de fază (opţional aparat foto) • serveşte la observarea celulelor. • 72 . DMSO) se poate folosi şi ca sistem de aspirare a mediilor folosite. de aceea este necesară utilizarea echipamentului de protecţie (ochelari/mască facială. umede şi cu temperatura constantă. de obicei se găseşte într-o incintă anexată. high efficiency particulate air). manuşi.) (medii cultură.

• medii de cultură (multe celule pot fi cultivate în DMEM/RPMI+10%FBS la care se adaugă diferite concentraţii de L-glutamina şi antibiotice). pot fi din plastic (de unică folosinţă) sau din sticlă (refolosibile după sterilizare).codate în funcţie de aria utilă de cultivare şi de volumul maxim de mediu care poate fi conţinut. Organizarea laboratorului de culturi celulare Consumabile • pipete serologice. 73 .Figura 3. • vase de cultură .

3. un indicator al pH-ului care trebuie să rămână între 7 şi 7. de aceea se va permite doar accesul celor care sunt direct implicaţi în procesul de lucru cu celulule. factori de creştere şi alte componente. Compoziţia mediilor de cultură este complexă incluzând: aminoacizi. cu unele excepţii serul este considerat un component de bază. cele naturale care includ serul sanguin şi alte secreţii de origine animală şi medii sintetice în care componentele de bază sunt produse separat şi apoi amestecate de obicei de către firme specializate. • suplimente pentru mediile de cultură: antibiotice – uzual se foloseşte un ameste de penicilină/streptomicină.Strategii de lucru Din punct de vedere tehnic. Chiar dacă este vorba de un mediu sintetic. accesul personalului în această cameră va fi restricţionat pe cât posibil. există câteva principii de bază ale lucrului cu celulele: • culturile celulare vor fi făcute într-o cameră dedicată acestui scop. bicarbonat. Dacă acesta virează spre galben indicând un mediu acid este cazul ca mediul să fie schimbat. L-glutamină. celulele animale sunt pretenţioase în ceea ce priveşte condiţiile în care pot sa crească.Conologic se poate vorbi de existenţa a două categorii de medii. • spre deosebire de celulele vegetale şi bacterii. glucoză şi altele în funcţie de particularităţile experimentului. în general de la vacă . hormoni. serul provine de la animale mari. Cele mai multe medii conţin şi phenol red. La ora actuală. există riscul contaminării cu diferite microorganisme care datorită ratei 74 . carbohidraţi. Tot din acest motiv.de unde şi numele de fetal bovine serum (FBS). vitamine. săruri. Mediile de cultură sunt soluţii saline tamponate. acizi graşi. toate acestea trebuie adaptate liniilor celulare cu care urmează a se lucra în laborator. Este de dorit ca această încapere să fie oarecum izolată faţă de restul laboratoarelor pentru a limita riscul de contaminare. microelemente. Na-pyruvat.2. de aceea încăperile vor fi semnalizate corespunzător.4. • toate mediile şi suplimentele care urmează a fi folosite în cultura celulară trebuie să fie certificate pentru lucrul pe culturi de celule (indicaţia cell culture certified/approved trebuie să apară pe ambalaj/descrierea produsului). • acele încăperi care sunt dedicate lucrului cu celule prezintă risc infecţios pentru cei implicaţi. • personalul care urmează să lucreze cu celulele va fi instruit corespunzător (vezi mai jos).

o nimic din ceea ce vine în contact direct cu celulele nu se deschide în afara hotei sterile. creşterii densităţii peste un nivel critic.. Odată aparută. Cu alte cuvinte. contaminarea se poate propaga din aproape în aproape şi duce în final la compromiterea nu doar a celulelor la care contaminarea a fost iniţial sem75 . Chiar şi în condiţii optime. Instruirea personalului Cultivarea celulelor este un lucru care se poate învaţa repede. o faza de creştere exponenţială care durează în jur de 7-10 zile. tripsina). înainte de scoaterea din hotă se verifică etanşeitatea închiderii. De aceea desfăşurarea activităţii în linişte este esenţială în laboratorul de culturi celulare. lucrul bine organizat şi desfăşurat fără grabă este esenţial pentru o eficienţă maximă: o mişcările vor fi măsurate şi sigure. şi o concentraţie a CO2 între 5 şi 7% condiţionează clutura celulelor animale (sistemul de tampon cel mai frecvent utilizat este cel cu bicarbonat de sodiu sau potasiu din mediul de cultură + CO2 din incubatorul folosit). o faza de inhibare a creşterii datorită inhibiţiei de contact. o imediat după adăugarea suplimentelor în mediile de cultură se notează acest fapt pe recipientul respectiv. fie la 37 grade Celsius (10-20 min e suficient.3. celulele animale se vor opri din creştere după un număr de generaţii care depinde de sursa primară a celulelor. pH-ul. scăderii potenţialului de metabolizare a mediului.• • • • de creştere mult superioară celulelor animale vor deveni majoritare în scurt timp. celulele animale sunt limitate în ceea ce priveşte numărul de generaţii pe care le produc. se poate porni un cronometru pentru a evita „uitarea” mediilor pentru un timp îndelungat şi degradarea lor (L-glutamina. în plus factori ca spre exemplu temperatura (37 de grade Celsius pentru celule mamifere). Singurul lucru care este şi mai uşor şi nici măcar nu necesită învatare este să contaminezi celulele. 3. oricine poate învaţa să menţină culturile de celule după doar câteva zile petrecute în laborator dacă respectă protocoalele şi are la dispoziţie echipamentul necesar. substanţele pot fi preîncălzite fie la 22. creşterea celulelor animale urmează o curbă cu trei faze: o faza de echilibrare (primele 24h) în care celulele se acomodează cu noul mediu în care sunt introduse. osmolaritatea (290-310mOsm).

contaminarea recipientelor cu conţinut original (celule produse în laborator şi care nu pot fi achiziţionate de la companiile specializate sau transferate de la alţi investigatori) reprezintă cel mai neplăcut aspect care poate afecta un laborator de culturi celulare. • Orice pipetă trebuie folosită o singură dată2. Orice obiect (pipeta. mai întâi sub supravegherea directă a celor familiarizaţi şi mai apoi în mod independent.) care urmează să fie introdus în hota pentru lucrul steril trebuie dezinfectat înainte sau imediat după introducere. • O soluţie antimicrobiană1 de ethanol 70% trebuie să fie în permaneţă la îndemână.nalată ci a întregului stoc de celule. Asigurarea asepsiei şi antisepsiei Există anumite măsuri care asigură igiena în lucrul cu celulele: • Utilizarea echipamentului de protecţie . ei vor începe prin a observa manoperele de lucru şi a le discuta cu un coleg familiarizat deja cu tehnicile. • Orice mediu sau obiect contaminat din greşeală va fi aruncat3. nu este permisă păstrarea pipetei în mediu sau folosirea unei pipete pentru a transfera mediu de la un recipient la altul.pentru evitarea contaminării celulelor şi operatorului: o halat cu mâneci lungi o pantofi închişi o mănuşi de unică folosinţă • Spălatul pe mâini înainte şi după lucrul cu celulele. recipient etc. Doar după această perioadă este permis lucrul direct. 1 În categoria substanţelor cu efect antimicrobian sunt incluse alături de antisepticele aplicate pe ţesuturi vii. • Instrumentele de lucru trebuie igienizate la intervale regulate. Practic. 2 Excepţie fac pipetele de sticlă care pot fi spălate şi sterilizate. 76 . antibioticele care acţionează în interiorul organismului şi de asemenea dezinfectantele care distrug microorganismele aflate pe suprafeţele neaparţinând fiinţelor vii. Chiar şi după câştigarea independenţei în lucru. Pe lângă considerentele financiare. Toţi cei care urmează să lucreze cu celule vor fi în prealabil instruiţi teoretic înainte de a pătrunde pentru prima dată în laborator. cel proaspăt iniţiat va fi supravegheat din umbră de către un coleg cu experienţă care ar putea observa anumite manopere executate neconform cu normele curente. 3 Este vorba despre acele medii/suplimente/alte substanţe care nu mai pot fi sterilizate (fie prin sterilfiltrare fie prin autoclavare) şi respectiv obiecte care nu mai pot fi sterilizate. • Orice lichid care ajunge în contact cu suprafaţa de lucru sterilă va fi îndepărtat imediat cu ajutorul unui prosop de hârtie îmbibat în ethanol 70%.

Figura nu este la scală. Se pot astfel observa caracteristicile normale sau abateri de la acestea. Organizarea spaţiului pentru lucrul steril Pentru reducerea la maxim a pericolului de contaminare este esenţială aranjarea locului de muncă sub hotă într-un mod care să evite încrucişarea mâinilor deasupra vaselor de cultură/mediilor. Organizarea spaţiului de lucru steril Figura prezintă organizarea de bază a spaţiului.• Este necesară investigarea stării de sănătate a celulelor în fiecare zi. Linia din faţă: Dreapta – pipeta/pompa aspirare medii prevazută la capăt cu pipetă de unică folosinţă Centru – recipientul cu celule În plan posterior: Stânga – vasele cu resturi lichide şi respeciv solide etichetate corespunzător 77 . Se pot lua probe care sunt analizate pentru stabilirea prin diferite tehnici a gradului de puritate/contaminare. aşa cum este ea întalnită în mod frecvent în majoritatea laboratoarelor. Pentru organizarea eficientă a „mesei” de lucru se poate consulta figura 4. Figura corespunde pentru persoanele care folosesc cu precădere mâna dreaptă. Trebuie evitată supraîncărcarea spaţiului de lucru care poate duce pe de o parte la blocarea fluxului de aer şi pe de altă parte la accidente nedorite care pot produce contaminarea celulelor sau reactivilor. Se pot de asemenea observa contaminări cu alte celule sau microorganisme. WASTE Figura 4 .

5. subcultivarea celulelor: deoarece aglomerarea celulară poate influenţa negativ vitalitatea celulelor (a se vedea mai sus). o culoare care virează spre galben indică necesitatea schimbării mediului. starea de sănătate a celulelor este confirmată şi de creşterea numărului de la o zi la alta. 3. o evaluare de primă instanţă a celulelor se realizează prin vizualizarea macroscopică a culorii mediului din sticlele de cultură.pipete serologice de diferite mărimi. Modul de lucru este asemănător pentru toate celulele dar există anumite particularităţi de care trebuie ţinut cont în cazul fiecărei grupe. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora Pentru a subcultiva celulele/folosi celulele într-un anumit protocol este nevoie de stabilirea numărului de celule pe unitatea de volum. există anumite formule de calcul care permit aflarea cu precizie a combinaţiilor optime. se recomandă ca celulele să fie subcultivate. flacon cu ethanol 70%. Cultivarea celulelor • după felul în care cresc în flacoanele de cultură. Mediul de 78 . celulele care cresc aderent trebuie să apară distribuite pe suprafaţa de contact cu vasul în care cresc şi de cele mai multe ori capătă o formă poligonală.Dreapta – mediile de cultură Centru. evaluarea celulelor se face în mod normal în fiecare zi prin vizualizarea lor sub microscopul optic. de asemenea se pot planifica în acest fel anumite experimente pentru anumite date.4. această procedură care se aplică în faza logaritmică de creştere a celulelor permite obţinerea unor cantităţi crescute de celule prin împărţirea/transferul acestora dintr-un recipient de cultură în mai multe recipiente fiecare reprezentând o nouă sursă de celule. culoarea standard a mediilor este roşu-orange. în anumite situaţii este nevoie de utilizarea unor soluţii de tripsina/EDTA pentru crearea suspensiilor unicelulare (vezi Tripsinizarea). iar celulele care cresc în suspensie rămân rotunde şi uneori (în funcţie de linia cultivată) pot forma aglomerări de celule (asemănător cu o ciorchină de struguri). • • • 3. celulele eucariote pot fi împarţite în două mari categorii: cele care cresc aderent pe vasul de cultură şi cele care cresc în suspensie.suport pentru tuburi În afara hotei la îndemană .

De aceea cea mai sigură metodă de prezervare a liniilor celulare este cryoprezervarea care opreşte procesele metabolice nelăsând astfel loc modificărilor genotipului. cryoconservarea este o metodă practică din punct de vedere economic: este mult mai simplu să păstrezi un tub cu celule îngheţate care nu au nevoie decât de o completare periodică a rezervei de azot decât să cultivi în mod repetat celulele în laborator. În funcţie de tipul camerei de numărăt. Aspectul celulelor în tub după centrifugare 3. • În plus. de aseme79 .6.dacă avem un singur tub cu celule va trebui să folosim un al doilea tub cu aceeaşi greutate care poate să conţină apă distilată sau orice alt lichid cu densitate asemănătoare). Soluţia de trypan blue va pătrunde în celulele moarte care apar albastre. Sub microscopul optic.5% şi pipetate în camera de numărat. există formule de calcul după care putem să aflăm numărul total de celule. O viabilitate de peste 90-95% este în general acceptată pentru toate manipulările ulterioare. Îngheţarea şi dezgheţarea celuluor Doi paşi critici ai lucrului cu celulele sunt constituiţi de către îngheţarea şi dezgheţarea celulelor.cultură conţinând celulele este transferat unor tuburi în care se centrifughează (centrifuga trebuie echilibrată în prealabil . Îngheţarea este indispensabilă din următoarele considerente: • Celulele sunt supuse în permanenţă variaţiilor în compoziţia cromozomilor. leucocitele apar ca şi celule gălbui/transparente cu o membrană brună. Pentru o separare bună este nevoie de 10 minute la 200-250g/min (într-o centrifugă de masă cu rotor standard 1000rpm). Celulele vor sedimenta ca şi în figura 5. După centrifugare celulele se resuspendă în mediu proaspăt şi apoi 10 microlitri sunt combinaţi cu 10 microlitri de soluţie Trypan blue 0. Figura 5 .

Este esenţial ca înainte de începerea procedurii respective să notăm următoarele detalii pe fiecare tub: tipul de celulă. metoda face posibilă revenirea la celule cu un număr mai mic de pasaje. Există linii celulare la care se preferă folosirea altor substanţe în locul DMSO. Îngheţarea4 va fi lentă şi constantă pentru a minimaliza efectele adverse asupra viabilităţii celulelor. celulele vor fi resuspendate direct în mediul de îngheţare răcit în prealabil la 4 grade la o concentraţie de 1x106-1x107/ml6 şi transferate imediat7 la -20 de grade C pentru 1-2 ore. De aceea trebuie limitat contactul acestuia cu celulele. Se resuspendă în 10 ml de mediu şi se transfera în sticlele de culturp etichetate. numărul de celule. Mediul va fi schimbat pentru a înlătura celulele moarte şi resturile de cryoprotector (DMSO – sterilfiltrat sau glycelor . După câteva ore (cel târziu a doua zi dimineaţa) se verifică starea celulelor prin vizualizarea la microscop. după care se poate adăuga mai rapid mediu până la 10ml. 4 5 80 . Există dispozitive speciale care permit coborarea temperaturii cu un grad pe minut. Dezgheţarea celulelor trebuie făcută extrem de rapid (ideal în mai puţin de un minut) prin transferul acestora din recipientul cu azot. este important să avem o suspensie omogenă unicelulară.autoclavat). Odată ce dezgheţarea permite pipetarea suspensiei (>75% dezgheţată) aceasta se transferă într-un tub de 15ml peste care se adaugă picătură cu picătură8 o cantitate de mediu preîncălzit echivalentă cu de două-trei ori cantitatea suspensiei. numărul de pasaj şi data la care a fost creat stocul. 8 Pentru a preveni socul osmotic. 7 DMOS este toxic pentru celuele la temperatura camerei. la îngheţare apa iese din celule unde presiunea osmotică va creşte. direct în baia de apă la 37 de grade Celsius. Urmează apoi transferul peste noapte la -80 de grade Celsius şi apoi stocarea de lungă durată în azot lichid. • Nu în ultimul rând. După centrifugarea şi verificarea vitalităţii (se recomandă folosirea celulelor vitale în proporţie de >90-95% la colorarea cu trypan blue). Se centrifughează în general la 200rpm timp de 2-5 min pentru a elimina urmele mediului de îngheţare. 6 Numărul de celule/aliquot variază În funcţie de tipul de celule. Prin mişcări fine se distribuie celulele. pe gheaţa uscată. Mediul de îngheţare5 cel mai frecvent folosit conţine mediul de cultură recomandat pentru linia celulară + 20% FCS + 5-10% cryoprotector -Dimethyl sulfoxid (DMSO) sau 10-15% glycerol care are rolul de a scădea temperatura de îngheţ permiţând apei să iasă din celulă şi împiedicând astfel formarea cristalelor de gheaţă care ar putea distruge membrana.nea transportul între laboratoare este mai uşor dacă celulele sunt îngheţate.

Johnson A.protocol-online. Spektrum Akademischer Verlag 2000 www.3. celulele sunt apoi transferate vaselor noi de cultură şi incubate până a doua zi. Dacă manopera s-a făcut în alt scop. se urmează paşii din protocolul respectiv. Yamada KM.Bibliografie 1. unele celule care cresc în suspensie).Garland Science. La fiecare 2-4 săptămâni se centrifughează şi resuspendă celulele neaderente în mediu proaspăt. Bonifacino JS. 2. Harford JB. Lindl T.com 9 Acesti ioni pot scadea eficienţa tripsinei/EDTA 81 . Celulele devin rotunde odată ce pierd aderenţele. 4. Walter P . Cea mai frecventă combinaţie folosită în acest scop este tripsina/EDTA. 6. John Wiley & Sons 5th Edition 2005 Molecular Biology of the Cell – 4th ed.invitrogen. acţiunea trispinei este antagonizată prin adăugarea de ser urmată de transferul într-un tub adecvat şi centrifugarea.org www.. La celulele neaderente nu se face tripsinizarea. 2002 Short Protocols în Cell Biology – 1st ed. După centrifugare celulele sunt resuspendate în mediu pentru a obţine o suspensie unicelulară şi apoi numărate/investigate la microscop prin colorarea cu trypan blue (proporţia celulelor moarte). John Wiley & Sons 2004 Zell. Dacă este vorba de celule aderente protocolul de lucru presupune îndepărtarea mediului.7. 5. tripsinizarea Celulele formează aderenţe între ele şi suprafaţa vasului de cultură (celule aderente) şi/sau între ele (celulele aderente. Raff M. 3. Culture of Animal Cells: A Manual of Basic Technique.und Gewebekultur – 4. celule pot fi direct numărate iar densitatea lor este ajustată prin adăugarea mediului proaspăt. Dacă tripsinizarea s-a făcut în cadrul protocolului de subcultivare. Lippincott-Schwartz J. Freshney RI. Lewis J. Auflage. Pentru cele mai multe protocoale/manopere este necesară obţinerea unei suspensii unicelulare. Dasso M.. 4. spălarea cu o soluţie salină tampon fără9 calciu şi magneziu şi adăugarea unei cantităţi de trispină/EDTA care să acopere stratul de celule. Alberts B. Subclonarea. Imediat. Celulele nu trebuie lăsate neacoperite timp îndelungat. Pentru a ajuta separarea este posibilă uşoara bătaie a sticlei de podul palmei. A doua zi se recomandă schimbarea mediului care permite înlăturarea celulelor moarte şi a resturilor de tripsină/EDTA. Roberts K. Urmărind sub microscop separarea celulelor (durează câteva minute) se poate evita efectul nociv al unei incubări prea îndelungate.

Culturi celulare – partea a II-a Lect. Studiul de literatură privind cercetări exploratorii recente Culturile celulare reprezintă una dintre cele mai puternice tehnologii/metodologii utilizate de către comunitatea ştiinţifică internaţională din domenii ca: biofizică. Studiul de literatură privind cercetări exploratorii recente . inteligent drug design etc................1. Bibliografie ........... 94  4............. Adaptarea/importul acestora la tematicile de cercetare ale platformei .. biologia dezvoltării organismelor..................2..................... biochimie... medicina moleculară....... bio-nano-tehnologia............. 88  2.... genetică........ vom discuta în cele ce urmează folosirea celulelor ca şi entităţi de producţie a proteinelor recombinate cu aplicaţii în autoimunitate şi producerea şi caracterizarea anticorpilor monoclonali bio-nano-funcţionalizaţi cu aplicaţii în cancere şi boli autoimune..... Acesta este reprezentat de către totalitatea celulelor.............. În acest context..... culturile celulare sunt folosite fie ca mini-bioreactoare pentru producerea diverselor produse biotehnologice fie ca şi model organismic pentru testarea efectelor/toxicităţii noilor medicamente...... dr..... Imunologia este ştiinţa care se ocupă cu studiul sistemului imun...... farmacologia......... Anticorpii monoclonali bio-nano-functionalizaţi ... evoluţionism....... Producerea proteinelor recombinate în celule mamifere... 93  3.......... Mircea Teodor Chiriac Cuprins 1................... 88  1....... biologie celulară şi moleculară........ 99  1.. Recomandări pentru abordarea de noi tipuri de experimente şi metodologii ......... 82  1........................ De asemenea dezvoltarea industriei farmaceutice a profitat din plin de avansarea tehnicilor de lucru cu celulele...... Dintre aplicaţiile moderne ale culturilor celulare..... ţesuturilor şi proceselor biochimice care au funcţia de a ne proteja faţă de efectele nedorite ale agenţilor patogeni din mediu şi/sau acţiunii dăunătoare a structurilor proprii 82 ......

alterate (cum ar fi celulele tumorale). răspunsul imun poate cuprinde două variante: • răspunsul înnăscut care reprezintă o primă barieră întâmpinată de către agenţii patogeni veniţi din afară (acest tip de răspuns apare pe scara evolutivă încă de la bacterii şi plante şi este păstrat şi la mamiferele superioare inclusiv la om). care aparţin sistemului imun înnăscut şi alte celule cum sunt limfocitele care aparţin sistemului adaptativ. recunoaşterea structurilor străine se face într-un mod indirect. Ele pot fi clasificate în boli specifice pentru anumite organe aşa cum este spre exemplul pemfigusul vulgar care interesează pielea 83 . fenomen caracteristic bolilor autoimune. După cum menţionam anterior. de sine stătătoare şi cel cu componente celulare în care celulele sunt cele care îndeplinesc funcţia majoră de apărare (Figura 1. Din punct de vedere didactic. Deşi mecanismul apariţiei acestor boli nu este pe deplin înţeles. Se poate vorbi în acest context despre o împărţire judicioasă a sarcinilor în sistemul imun al mamiferelor. Tabel 1). Se consideră că bolile autoimune constituie un grup heterogen de afecţiuni care apar la aproximativ 5% din populaţie.) într-o formă finită. celulele B1. există diferite structuri care asigură trecerea lină de la un sistem la altul asigurând astfel o continuitate între cele două sisteme. există diverse mecanisme care au evoulat cu timpul pentru a satisface cu eficienţă maximă rezolvarea fiecărei situaţii ivite. Răspunsurile adaptative apar pentru prima dată pe scara evolutivă la peştii cartilaginoşi ca o completare a sistemului imun înnăscut. celulele natural killer etc. Celulele ca şi macrofagele. Datorită diversităţii extraordinare pe care mediul o oferă. Acest fapt permite apariţia unor erori care au ca şi rezultat declanşarea unor reacţii împotriva propriilor structuri. • răspunsul adaptativ numit şi specific care este iniţiat atunci când răspunsurile înnăscute nu reuşesc să producă efectul dorit. există din ce în ce mai multe date care au permis elaborarea unor teorii şi modele experimentale care s-au dovedit utile în caracterizarea acestor boli. NKT sunt considerate a fi cele care prin diverşi receptori şi căi de semnalizare celulară fac posibilă comunicarea între sistemul adaptativ şi cel înnăscut. funcţia sistemului imun este să ne protejeze faţă de patogenii din mediu şi faţă de structurile proprii modificate. sudoare etc. Deoarece sistemul imun adapatativ nu apare în urma unui salt brusc de la sistemul imun înnăscut. cum ar fi granulocitele. Există aşa-numitele celule. În ciuda specificităţii remarcabile a răspunsurilor imune. celulele dendritice. Se vorbeşte despre un sistem imun cu componente umorale adică cel în care produşii celulelor imune circulă prin sânge sau secreţii (lacrimi.

NK. Exista totodata schimburi directe intre sistemul innascut şi cel adaptativ care au loc cel mai adesea prin intermediul citokinelor. coordoneaza activarea sistemului imun adaptativ şi controleaza mecanismele efectoare ale sistemului innascut inchizand astfel circuitul.Th Imunitate înnăscută Imunitate adaptativă Granulocyte. Acest centru de control şi decizie este reprezentat de către celula (limfocitul) T helper (Th). Peptide antimicrobiene Anticorpii (imunoglobulinele) celulele dendritice şi monocitele/macrofagele aparţin didactic imunităţii înnăscute dar se găsesc din punct de vedere funcţional la graniţa dintre acesta şi sistemul adaptativ în sensul că fac legătura dintre antigen şi centrul de comandă reprezentat de limfocite. produsi de secretie ai celulelor imune care mijlocesc schimbul de informatii intre acestea (sageata cu doua sensuri). Acesta primeşte informaţii de la sistemul imun înnăscut. macrofage. 1 Limfocitele B şi limfocitele T Imunitate umorală Sistemul complement. Tabel 1 Componente ale sistemului imun al mamiferelor Linia de apărare Primară = imunitatea înnăscută Secundară = imunitatea dobândită (adaptativă sau specifică) 1 Imunitate celulară Granulocite. La mamifere. şi mucoasele. sistem complement Tc B (Ig) Figura 1 Organizarea ierarhică a sistemului imun al mamiferelor. şi boli autoimnune generalizate care interesează mai multe organe sau ţesuturi aşa cum este spre exemplu lupusul sistemic eritematos în care unul dintre au84 . sistemul imun este organizat ierarhic în sensul ca există o unitate de control care integreaza informatiile primite de la toate celelalte componente şi pe baza lor stabileşte care este cea mai bună soluţie de urmat. diabetul zaharat de tip I care afectează celule beta ale pancreasului sau tiroidita Hashimoto care apare la glanda tiroida. celule natural killer.

printre care se numară epidermoliza buloasă dobândită şi pemfigoidul bulos/pemfigoidul cicatricial sunt caracterizate de prezenţa anticorpilor circulanţi şi a anticorpilor legaţi la nivelul joncţiunii dermo-epidermale care fixează complementul in situ. serurile majorităţii pacienţilor recunosc fomele native ale autantigenelor ţintă atât în imunoblot cât şi pe secţiuni de piele îngheţată. Cercetările din ultimii ani au reuşit să precizeze o parte dintre mecanismele efectoare responsabile de patologia observată. Scenariul fazei efectoare propune o succesiune de evenimente care debutează cu legarea autoanticorpilor la nivelul autoantigenelor ţintă urmată de fixarea componentelor sistemului complement. Paraclinic. Aceste celule odată activate produc şi eliberează specii reactive de oxigen care activează enzime 85 .toantigenele ţintă este reprezentat de cromatina [1]. lipsa unei înţelegeri depline a mecanismelor care iniţiază şi mai apoi întreţin distrucţia ţesuturilor proprii se repercută nefavorabil asupra prognosticului şi totodată calităţii vieţii celor afectaţi. Bolile din această grupă. bule care se sparg lasând în urmă eroziuni acoperite parţial de cruste. Deoarece cromatina se găseşte practic în toate celulele nucleate. Anticorpii recrutează şi activează fie direct fie prin intermediul complementului granulocitele in situ. La ora actuală. substanţe care produc deprimarea sistemului imun ca mijloc de aparare împotriva celulelor hiperreactive care întreţin distrucţia tisulară. De asemenea. Necesitatea înţelegerii mecanismelor patogenetice la nivel molecular este esenţială nu doar din punctul de vedere al tratamentului dar şi din perspectiva unei depistări precoce sau chiar a posibilelor mijloace de prevenţie a unor asemenea afecţiuni. O grupă de boli autoimune care se manifestă la nivelul pielii şi mucoaselor este caracterizată de prezenţa autoanticorpilor şi celulelor T autoreactive îndreptate faţă de autoantigenele de la nivelul pielii şi mucoaselor. Dezavantajul major al acestui tip de tratament se manifestă prin apariţtia multiplelor „atacuri” din partea microorganismelor patogene din mediu care găsesc un teren propice pentru dezvoltare într-un organism în care sistemul imun este deprimat. adică răspunsul autoimun este întreţinut în permanenţă de existenţa unui anumit nivel rezidual al autoantigenului. Fie că este vorba despre boli specifice de organ fie că este vorba despre cele generalizate. majoritatea pacienţilor sunt tratati cu ajutorul cortizonului şi derivaţilor acestuia. bolile din grupa celor generalizate au tendinţa de a se croniciza. autoanticorpii prezintă reactivitate cu forme recombinate ale autoantigenelor ţintă atât în ELISA cât şi în imunoblot. Din punct de vedere clinic aceste boli se caracterizează prin prezenţa bulelor la nivelul pielii şi mucoaselor.

mărire 200x (după [13]). Reprezentare schematică a implicării speciilor reactive de oxigen în patogeneza bolilor subepidermale.5. Într-un model experimental ex vivo. caracterizarea exclusivă a fazei efectuare a răspunsului autoimun nu generează nici o indicaţie asu86 . prin degradarea inhibitorilor acestor enzime.proteolitice prezente în veziculele granulocitare fie direct fie indirect.7.8.11.12] (Figura 2).3. criosecţiuni de piele umană sunt incubate cu anticorpi de la (a-c) pacienţi cu boli autoimune subepidermale şi apoi cu granulocite amestecate sau nu cu diferite substanţe capabile să influenţeze nivelul producţiei de specii reactive de oxigen în granulocite. e Figura 2. Deşi deosebit de utilă în precizarea posibilelor ţinte terapeutice specifice lipsite de efectele adverse ale terapiilor actuale.6. (d) Controlul nostru negativ. (e) Diagrama prezintă lanţul de reacţii care produce speciile reactive de oxigen cu enzimele implicate (fundal roz şi albastru) şi respectiv inhibitori ai acestora (pe fundal verde) a-d.9. două enzime care sunt responsabile pentru conversia superoxidului în peroxid de hidrogen şi respectiv a celui din urmă în apă şi oxigen nu rezultă în inhibarea producerii separării dermo-epidermale. în care am folosit un ser de la un donator sănătos în loc de ser de la bolnavi.10. Odată eliberate aceste enzime digeră structurile proteice responsabile de asigurarea joncţiunii derm-epiderm [2. Folosirea unui amestec de granulocite cu (b) superoxid dismutază sau (c) catalază. (a) Secţiunile incubate cu granulocite în lipsa altor substanţe rezultă în apariţia bulei experimentale.4. arată lipsa separării dintre derm şi epiderm.

imunoglobulina (numită şi anticorp când se gaseşte sub formă circulantă în sânge/secreţii) are două porţiuni: zona superioară (N-terminală) Fab are rolul de a recunoaşte specific antigenul iar zona inferioară (C-terminală) Fc are rolul de a îndeplini funcţiile efectoare. În cele ce urmează vor fi descrise anumite caracteristici şi metode utile pentru înţelegerea acestor tehnologii. interacţiunea cu diverse componente ale sistemului imun (cum ar fi complementul.pra cauzelor care declanşează reacţia autoimună. Din punct de vedere funcţional. proteinele sunt produse prin tehnologia ADN-ului recombinat şi exprimate apoi în celulele mamifere care oferă un sistem de expresie superpozabil cu cel întâlnit in vivo. sau cu receptorii de pe celulele placentei – permit trecerea anticorpilor de la 87 . -COOH Fab Fc -NH2 Figura 3. receptorii pentru porţiunea Fc de pe fagocite. Lanţurile grele sunt identice între ele la fel cum lanţurile uşoare sunt identice între ele. Pentru aceste modele active de boală. Prezentare schematică a unei imunoglobuline. caracterizării şi utilizării anticorpilor (Figura 3) monoclonali ca mijloace moderne de combatere a diverselor afecţiuni mergând de la cancer la boli autoimune sau boli degenerative va fi descrisă în cele ce urmează. Imunoglobulinele sunt glicoproteine heterogene alcătuite din două lanţuri grele (cu masa moleculară mai mare. situate spre interior în această figură) şi două lanţuri uşoare (situate înspre exterior în partea de sus). De aceea eforturile din ultima perioadă urmăresc reproducerea bolii prin imunizarea activă a animalelor cu proteine recombinate. De asemenea tehnologia producerii.

folosind acest ADN complementar pot fi amplificate secvenţele de interes prin reacţia de PCR. Cu ajutorul amorselor specifice. Chinezii şi indienii sunt cei cărora li se atribuie folosirea terapeutică a serurilor (fracţiunea sângelui în care se găsesc anticorpii alături de alte proteine) încă înaintea erei noastre. 1.1. acestea vor fi utilizate fie la imunizarea pentru modelul activ de boală fie pentru cel pasiv. fragmentele de interes sunt amplificate prin tehnica PCR. urmează exprimarea proteinelor codate şi purificarea acestora [14. • anumite aspecte adverse (apriţia unui răspuns imun faţă de însuşi anticorpii) datorită utilizării anticorpilor de la alte specii. 88 . se găsesc reziduuri de glucide care au rol în modularea interacţiunii dintre Fc şi receptorii sistemului imun (vezi text). Ataşat de aceste cozi Fc. Din punct de vedere istoric. Totusi folosirea pe scară mai largă a anticorpilor în scop terapeutic a început să fie practicată începând cu secolul XX. folosirea anticorpilor a fost însă limitată de anumite aspecte dintre care cele mai neconvenabile au fost: • lipsa unei surse constante de anticorpi omogeni. În urmă cu câteva secole.15]. • dificultăţilor tehnice în izolarea/producerea lor şi • necunoaşterea posibilelor ţinte terapeutice esenţiale pentru diferite afecţiuni. ţesutul care conţine antigenul ţintă este prelevat de la sursa de interes după care ARN-ul mesager obţinut în urma extracţiei este folosit ca şi matriţă pentru sinteza ADN-ului complementar [14. Anticorpii monoclonali bio-nano-functionalizaţi Terapia biologică cu ajutorul anticorpilor este considerată la ora actuală ca fiind cea mai activă branşă a industriei farmaceutice[16]. După întocmirea strategiei de lucru.15]. După clonarea acestor fragmente în celule. Apoi în funcţie de aplicaţia dorită. 1. prevenţia/terapia cu ajutorul anticorpilor este o procedură folosită de câteva mii de ani. Pe scurt. În ciuda efectelor terapeutice extraordinare. este semnalată folosirea serurilor pentru protejarea persoanelor în Turcia şi apoi odată cu experimentele doctorului Edward Jenner de la sfârşitul secolului al XVIII şi în Anglia. Producerea proteinelor recombinate în celule mamifere Tehnica de bază pentru producerea acestor proteine implică mai multe etape care sunt menţionate în tabelul 3.2.mamă la făt).

forme şi culori şi a doua purtând haine personalizate de către un croitor profesionist.Descoperirea antibioticelor în anii 30-40 ai secolului trecut alături de celelalte inconveniente amintite au dus la intrarea anticorpilor într-un con de umbră. Această temere a fost dublată şi de avansarea tehnicilor industriale de producere a moleculelor cu masă moleculară mică care păreau să fi rezolvat în sfârşit problema inexistenţei unor medicamente perfecte. cu timpul. Chiar dacă uşor exagerată şi poate nu cea mai potrivită din punct de vedere bio-medical. cu diferenţa dintre două persoane. potenţialul imens al noii tehnologii a incitat atât curiozitatea comunităţii ştiinţifice (interesată în definirea noilor aplicaţii pentru care anticorpii monoclonali reprezentau unealta mult-căutată. Diferenţa între anticorpii policlonali (cei care erau la acea oră în uz medical) şi noii anticorpi (numiţi monoclonali) poate fi comparată. 89 . şi anume lipsa unei surse constante de anticorpi cu caracteristici omogene. noua tehnologie a premis obţinerea lor prin tehnici relativ simple şi cu costuri substanţial diminuate înlăturând astfel cel de-al treilea dintre dezavantajele amintite anterior. lumea bio-medicală şi industria farmaceutică a fost în prima instanţă rezervată la posibila utilizare a acestora pe scară largă. doi cercetători anunţă în revista Nature [17] o metodă prin care se pot obţine cantităţi teoretic nelimitate de anticorpi cu specificitatea dorită. folosirea acesteia are un substrat uşor de înţeles şi anume în literatura de specialitate de limba engleză termenii „tailor made antibodies” sunt folosiţi pentru a descrie producerea de anticorpi monoclonali specifici pentru diferite situaţii [18]. începând de la lenjerie şi până la ultimul nasture al paltonului. Începând cu 1975 situaţia avea însă să se schimbe. entuziaştii au continuat însă lucrul la producerea anticorpilor monoclonali ducând la aprobarea utilizării primului anticorp produs în acest fel nu însă mai repede de un deceniu de la publicarea metodologiei de către Koehler şi Milstein [16]. Cel mai probabil din acest motiv. În ciuda acestor piedici. de asemenea. Dezvoltarea acestei noi tehnici. prima purtând haine de diferite mărimi. chiar şi numai pentru a face lucrurile mai uşor de înţeles. Totuşi în anii care au urmat. a dus la înlăturarea primului din cele două mari dezavantaje ale folosirii anticorpilor policlonali. cel de-al patrulea neajuns amintit mai sus) cât şi de către pragmatismul industriei farmaceutice (care găsea o nouă mină de aur în comercializarea noilor „gloanţe magice” aşa cum le numea Paul Ehrlich. Într-o lucrare de referinţă pentru literatura biomedicală. Anticorpii monoclonali produşi iniţial au păstrat neajunsul de a fi produşi în alte specii ducând la declanşarea unui răspuns imun masiv din partea primitorului (cel de-al doilea neajuns).

în 1986 este aprobată utilizarea primului anticorp monoclonal pentru prevenirea rejetului de transplant. În 1997. se estimează că cinci din cele zece substanţe vor fi reprezentate de anticorpi în 2014 [16]. După unii. cu mai bine de un secol în urmă) [19]. De asemenea dintr-un total de 1500 de studii clinice în care sunt testaţi noi anticorpi monoclonali peste75% sunt axate pe folosirea acestora în tratarea cancerelor. Desigur această turnură a fost posibilă prin îmbunătăţirea permanentă a protocoalelor de lucru şi obţinerea unor anticorpi modificaţi prin tehnologia ADN recombinat. După cum aminteam anterior la 11 ani de la publicarea lucrării lui Koehler şi Milstein. urmaţi de cei conjugaţi cu material radioactiv şi o mică proporţie sunt reprezentaţi de cei conjugaţi cu toxine. Aceste date au menirea de a sublinia interesul major al comunităţii bio-medicale şi al guvernelor statelor industrializate (din moment ce majoritatea studiilor sunt finanţate din bani publici) pentru găsirea unor strategii terapeutice specifice pentru tratarea acestei maladii. cu o singură excepţie. tehnici care au cunoscut o dezvoltare extraordinară în ultimele două – trei decenii. Datorită eşecului relativ al utilizării acestui medicament şi datorită timpului îndelungat necesar dezvoltării unui nou medicament. Dacă în anul 2000. Mai mult. un anticorp monoclonal împotriva CD20 de pe celulele 90 . timpul scurs până la aprobarea celui de-al doilea anticorp monoclonal a fost de încă opt ani de la aprobarea OKT3. doar substanţe cu greutate moleculară mică. dezvoltarea tehnologiei producerii anticorpilor monoclonali reprezintă inovaţia secolului trecut în ceea ce priveste importanţa terapeutică. majoritatea sunt destinaţi tratării cancerelor. La ora actuală. în topul primelor zece produse folosite în tratamentul diverselor afecţiuni existau. Folosirea pe scară largă a Orthoclone OKT3 (muronomab CD3) a fost însă limitată de faptul că acest anticorp de origine murină (produs în celule de şoarece care diferă suficient de celulele umane) induce un răspuns imun amplu în organismul uman [20]. Majoritatea sunt folosiţi ca atare (neconjugati).părintele hematologiei şi chemoterapiei (acesta din urmă fiind un termen pe care l-a introdus chiar el). administrarea acestui anticorp a dus la apariţia sindromului eliberării sistemice de cytokine [21] datorită interacţiunii OKT3 cu receptorii pentru porţiunea Fc a IgG. diagnostică şi preventivă a îmbolnăvirilor umane [16]. Dintre cei peste 25 de anticorpi monoclonali aflaţi la ora actuală pe lista medicamentelor aprobate pentru tratamentul afecţiunilor umane. anticorpii sunt în aproape toate situaţiile luaţi în calcul la stabilirea strategiei terapeutice alternative sau câteodată constituie chiar terapia de primă alegere. rituxan (rituximab).

. În plus dacă anticorpii iniţiali aparţineau clasei IgG1.îmbunătăţirea proprietăţilor efectoare prin optimizarea interacţiunii cu sistemul complement. bolile buloase (pemfigusul. investigaţii actuale sunt concentrate asupra diversificării activităţii prin schimbarea clasei şi deci a paletei de efecte posibile. pemfigoidul). Dintre acestea amintim: o modificarea porţiunii Fc a anticorpilor pentru: . Mare parte dintre eforturile actuale au menirea de a creşte penetranţa acestor glicoproteine pentru ţinte din interiorul celulelor.B devine cel de-al treilea medicament admis pe piaţa din SUA pentru tumori ale celulelor B. anticorpii sunt substanţe care interacţionează cu structuri extracelulare sau de pe suprafaţa celulelor. Fab) fie prin fuzionarea lor pe domenii de Ig. Mai mult. alături de un mecanism de inducere a apoptozei celulelor care exprimă CD20 pe suprafaţă.îmbunătăţirea interacţiunii cu receptorii Fc sau Fc de tip neonatal (FcRn) de pe celulele efectoare. anemia hemolitică autoimună. adică adăugarea unei alte specificităţi în zona de recunoaştere a Fab. vasculita autoimună etc. Utilitatea acestei modificări poate fi exemplificată ca şi în figura 4. Acest anticorp chimer (combinaţie între uman şi murin) are multiple mecanisme de acţiune dintre care merită amintite: inducerea toxicităţii celulare indusă de anticorpi (ADCC) şi citotoxicitatea mediată de complement (CDC). o 91 . o multispecificitatea. există câteva direcţii prin care se urmăreşte creşterea posibilelor interacţiuni terapeutice. Pe scurt. În general. diabetul zaharat de tip I. anticorpul păstrează specificitatea pentru care a fost creat pe unul dintre fragmentele Fab cu care se va lega de ţinta dorită urmând ca pe celalalt fragment Fab să lege un receptor de pe o celulă efectoare (spre exemplu CD3 de pe celula T) care are proprietatea de a distruge celula recunoscută specific. Între timp acest medicament este folosit şi în tratamentul unor boli autoimune cum ar fi artrita reumatoidă. prelungirea duratei de injumătăţire cu efecte favorabile datorate reducerii dozajului fie prin PEG-ylarea fragmentelor (scFv.

92 . Modul de acţiune al anticorpilor bispecifici. anticorpul monoclonal recunoaşte antigenul specific. de care se leagă. (B) Modificarea unuia dintre fragmentele Fab poate fi făcută în aşa fel încât acesta să nu mai recunoască ţinta iniţială ci un receptor de pe o celulă imună efectoare aducând-o în imediata vecinătate a celulei tumorale. în cazul cytokinei prin recrutarea altor celule imune în zona respectivă. (D) Este de asemenea posibil ca nanosfera să conţină un material radioactiv. în acest caz de pe celula tumorală. o enzimă sau chiar o cytokină care să crească puterea distructivă a anticorpului fie direct. (A) Clasic. Existenţa a două fragmante Fab duce la legarea unui anticorp de două antigene invecinate. o toxină. (C) Alternativ porţiunea Fc poate fi modificată (funcţionalizată) prin ataşarea unei nanosfere care poate avea ca atare un efect toxic asupra celulei tumorale. fie. Puntea creată are ca efect reducerea dramatică a spaţiului dintre cele două celule permiţând celulei imune să distrugă celula canceroasă în condiţii optime.A Celula tumorala B Celula tumorala Celula imun Celula imun C Celula tumorală D Celula tumorală Celula Celula imun imun nano nano + Figura 4. Celula imună figurată cu linie punctată ramasă la distanţă nu este capabilă să distrugaă celula tumorală.

Odată produse aceste fragmente vor fi caracterizate din punct de vedere bio-chimic şi folosite apoi fie separat fie în diferite combinaţii pentru producerea de anticorpi şi/sau pentru reproducerea bolii umane în animalele de experienţă. Potenţialul acestor anticorpi va fi studiat fie în preparaţii care conţin doar anticorpul pur fie în alte instanţe cu anticorpul funcţionalizat (Tabelul 2). implementarea metodologiei şi tehnicilor moderne este un deziderat al activităţii prezente şi viitoare a grupului de cercetare. Adaptarea/importul acestora la tematicile de cercetare ale platformei Este de dorit ca în viitor. De asemenea instruirea personalului şi co-interesarea şi implicarea cercetătorilor externi în tematicile de cercetare ale platformei este esenţială pentru întărirea resursei umane cu expertiză în domeniu. De altfel. 93 . Într-un set de experimente menite să caracterizeze potenţialul anticorpilor specifici faţă de diferiţi receptori de pe suprafaţa celulelor B de a determina distrugerea acestora. în paralel este de dorit abordarea acestei problematici din punct de vedere terapeutic. În vederea atingerii acestui obiectiv. În acest context. un diagnostic precoce şi un tratament specific al acestor afecţiuni. Este de aşteptat ca o caracterizare precisă a mecanismelor patogenetice să necesite o perioadă relativ lungă de timp.2. vor fi luaţi în calcul anticorpi consacraţi cum ar fi anti-human CD20 alături de alţi anticorpi a căror ţintă se află tot pe celulele B dar a căror eficienţă în distrugerea acestor celule este încă necunoscută. un deziderat este reprezentat de funcţionalizarea anticorpilor îndreptaţi faţă de molecule de pe celulele B. Desigur importul premanent de know-how relevant pe plan internaţional este esenţial pentru consolidarea cercetării locale şi recunoaşterea validităţii datelor obţinute de către comunitatea ştiinţifică internaţională. caracterizarea precisă a mecanismelor patogenetice implicate în distrucţia tisulară din bolile autoimune sa permită o prevenţie. utilizând tehnicile şi aparatura specifică culturilor celulare vor fi produse diverse fragmente recombinate ale unor proteine cu rol cheie în asigurarea adeziunii dintre derm şi epiderm. De aceea. De asemenea protocoale specifice a căror necesitate poate să apară pe parcursul desfăşurării experimentelor pot fi obtinute de la colaboratorii din afara Institutului. Într-o primă fază. Tehnicile de lucru cu celulele mamifere sunt puse la punct în laborator. grupul de cercetare include în preocupările sale problematica legată de caracterizarea răspunsului autoimun în diferite modele de boală. la ora actuală. celule cu rol cheie în patogeneza autoimună a acestor boli.

odată produse aceste fragmente ar putea fi folosite în diferite combinaţii pentru a reproduce caracteristicile bolii umane în animalele de experienţă.Tabel 2. 94 . 3. Nu este deocamdată clar în ce fel şi în ce masură autoanticorpii faţă de aceste molecule sunt implicaţi în patogeneza autoimună. De aceea. contribuind astfel într-un mod inovativ la definirea naturii autoimune a diferitelor entităţi clinice. Atenţia va fi concentrată pe producerea acelor autoantigene a cpror patogenitate este încă incomplet elucidată. Obiective Stablilirea dozei 50%1 Model de studiu Culturi celulare ex vivo Strategie Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Stabilirea potenţialului preventiv/curativ al anticorpilor funcţionalizaţi 1 Model animal în vivo Este vorba despre doza care provoacă moartea a 50% dintre celule. Strategiile de lucru abordate pentru atingerea celor două obiective majore. Un interes primar pentru preocupările noastre îl constituie producerea fragmentelor recombinate ale proteinelor care asigură adeziunea keratinocitelor de stratul dermal. la funcţii de recrutare şi transducerea semnalului. producerea unui model de boală şi modularea acestuia în scop preventiv/terapeutic implică mai multe etape (Tabelul 3). Recomandări pentru abordarea de noi tipuri de experimente şi metodologii Una dintre direcţiile de cercetare care vor fi abordate în viitor se va concentra pe producerea de fragmente recombinate ale diferitelor proteine autoantigen cu ajutorul culturilor celulare eucariote. Un exemplu în acest sens îl constituie clonarea fragmentelor de integrine. Defecte ale acestor integrine sunt considerate a fi implicate în patogeneza bolilor autoimune. Integrinele sunt o clasă heterogenă de proteine implicate în diverse procese de la asigurarea contactelor dintre celule şi mediul înconjurător. Ca şi metodologie de lucru.

folosirea diverselor căi de administrare. diagnostic şi tratament: .izolarea claselor şi subclaselor din sursa de anticorpi policlonali şi investigarea mecanismelor efectoare prin care aceştia produc boala .folosirea nanosferelor direcţionate specific împotriva celulelor imune autoreactive Imunizarea unor animale intermediare cu diferite combinaţii de proteine recombinate şi izolarea anticorpilor specifici produşi Transferul pasiv al acestor anticorpi în şoarecii de laborator Dezvoltarea strategiilor de prevenţie.folosirea anticorpilor monoclonali cruzi sau funcţionalizaţi cu nanosfere . cantităţi variabile de autoanitgen. Etape recomandate pentru modelare în scop preventiv/terapeutic a unei boli autoimune în animalele de experienţă Denumire etapă Obţinerea fragmentelor recombinate ale autoantigenului Activităţi Stabilirea planului de clonare Designul şi producerea de amorse specifice Izolarea ARN-ului mesager RT-PCR Clonarea produşilor obtinuţi prin PCR Exprimarea proteinelor recombinate Imunizarea animalelor de experienţă cu diferite combinaţii de proteine recombinate Evaluarea clinică şi paraclinică a inducerii bolii Dezvoltarea unor strategii de prevenţie.) .folosirea anticorpilor din diferite surse şi evaluarea mecanismelor patogenetice specifice fiecăruia (sistem complement. diagnostic şi tratament a bolii induse: . adjuvanţi.modificarea anticorpilor prin tehnica ADN-ului recombinat (se urmăreşte în acest fel modularea interacţiunii cu diferite mecanisme efectoare prin modificarea spre exemplu a porţiunii Fc a anticorpului) Producerea modelului activ de boală Producerea modelului pasiv de boală 95 . granulocite prin FcR etc. folosirea autoantigilor modificaţi .Tabel 3.

Ideea de bază este că un sistem imun „acordat” perfect reuşeşte să distrugă celulele nedorite prin implicarea la timpul şi momentul potrivit a potenţialului uriaş pe care celulele imunităţii il posedă. Este vorba despre adăugarea diferitelor lanţuri glucidice care fac anticorpii entităţi glicoproteice. iar o a treia. sistemul complement). specificitate este adusă de către modificarea/modificările din porţiunea Fc astfel încât acestea să poată activa cu succes diverse mecanisme imune (Figura 5). interesul extraordinar în găsirea combinaţiilor optime de anticorpi care să identifice celulele tumorale ţintă şi în acelaşi timp să angajeze un răspuns prin modificare celui de-al doilea fragment Fab a început să fie balansată de interesul pentru modificarea porţiunii Fc în vederea creşterii efectivităţii. De asemenea structura primară a lanţului polipeptidic care formează porţiunea Fc a anticorpilor este implicată în reactivităţile diferite observate la folosirea diverselor preparaţii de anticorpi. Pe lângă specificitatea pentru celula tumorală ţintă şi cea pentru nanoparticule. Deşi acest lucru era cunoscut de mai multă vreme. Spre exemplu. anticorpii multispecifici posedă şi alte specificităţi care să le crească capacitatea funcţională benefică. Astfel. Cercetări recente au arătat că există diferenţe esenţiale între acţiunea diverşilor anticorpi care la prima vedere sunt identici. Se vorbeşte în acest sens despre anticorpi trispecifici/multispecifici în care pe lângă specificitatea porţiunii Fab pentru ţinta dorită. S-a dovedit recent că o scădere a syalilarii lanţului glucidic din această porţiune duce la creşterea activării celulelor efectoare cu receptror Fcgamma. cea de-a doua porţiune Fab poartă specificitatea agentului terapeutic (nanosfera radioactivă sau toxina.În ultimii ani. un accent deosebit a fost pus pe studierea interacţiunilor dintre porţiunea Fc a anticorpilor şi alte proteine efectoare din sistemul imun (receptorii pentru Fc de la nivelul celulelor imunităţi înnăscute. semnificaţia funcţională a acestui detaliu structural a rămas un mister până de curând. patra etc. specificitate pentru un alt receptor de pe o celulă citotoxică spre exemplu). S-a dovedit astfel existenţa unei concordanţe între aceste secvenţe şi capacitatea lanţurilor codate de a activa anumite mecanisme efectoare. De altfel interesul tot mai mare în explicarea la nivel molecular a susceptibilităţii la anumite afecţiuni a dus din ce în ce mai frecvent la obţinerea secvenţelor de nucleotide care codează pentru anticorpi. prin modificarea 96 . Tendinţa actuală este de a grupa aceste polimorfisme de la nivelul ADN în funcţie de capacitatea anticorpilor de a activa/inhiba o anumită clasă de celule efectoare cu implicare în terapia afecţiunilor autoimune şi cancerelor. Explicaţia propusă a fost că diferenţa este datorată unor modificări postranslaţionale apărute în porţiunea Fc a anticorpilor.

folosirea unei duble specificităţi a porţiunii variabile a fragmentului Fab face posibilă recrutarea în vecinătatea tumorii a celulelor T citotoxice (4).6…).specificitatea şi afinitatea mare 97 .6… Celula imună 3 2 1 nano-r x/tox ROS. Mecanisme de acţiune ale anticorpilor multispecifici. De asemenea. proteaze CDC Figura 5. anticorpul capătă proprietăţi sporite de activare a sistemului complement care fie direct (2) fie indirect (3) duce la distrugerea celulei canceroase/autoimune. În prezent se urmăreşte lărgirea paletei de experimente şi metodologii care pot fi oferite la nivelul laboratorului.Celula imună Celula tumorală/ autoimună 4 5. În plus. porţiunii Fc pe partea stângă a figurii. Dintre avantajele folosirii anticorpilor ca şi agenţi biologici în tratamentul cancerului amintim: .timpul de înjumătăţire crescut faţă de moleculele cu greutate moleculară mică ceea ce face posibilă scăderea dozei utilizate . Numeroşi membri ai acestuia se află în prezent în diverse laboratoare partenere unde deprind metode şi tehnici noi pe care dorim să le implementăm odată cu reintegrarea acestora în laboratorul de origine. prin „personalizarea” interacţiunii fragmentului Fc cu celulele care poartă receptori pentru acesta (partea dreapta jos) sunt transduse semnale puternice care pot avea ca rezultat o activare crescută a acestor celule cu producerea speciilor reactive de oxigen şi eliberarea proteazelor efectoare (5.

98 . Cercetări recente au arătat că ADCC este mai eficientă la acei indivizi care prezintă anumite polimorfisme în porţiunea Fc (respondenţi cu grad înalt) [23. legarea concomitentă a Fv (partea a Fab) de antigenul ţintă şi a Fc de o celulă cum ar fi macrofagul sau celula NK care posedă receptori pentru această porţiune duce la activarea celulei imune urmată de distrugerea celulei ţintită specific. fie prin inducerea apoptozei fie prin antagonizarea efectelor factorilor de creştere [22]. toxine. Diferite mecanisme de acţiune ale anticorpilor monoclonali Mecanism de acţiune propus ADCC1 CDC Inducerea apoptozei Blocarea interacţiunii factorilor de creştere cu receptorii specifici Blocarea fizică a dimerizării receptorilor pentru factorii de creştere Inhibarea neoformării vaselor sangvine Blocarea factorilor de creştere în forma solubilă Funcţionalizarea/conjugarea cu radioizotopi. Tabel 4.- - multiple mecanisme de acţiune care pot fi combinate (vezi anticorpi multispecifici pentru ADCC şi CDC) posibilitatea folosirii acestora ca şi terapie complementară/alternativă oricărei forme de terapie anti-canceroasă tradiţională utilizarea lor ca şi vehicul specific pentru transportul diverselor substanţe anticanceroase spre diverse destinaţii (vezi anticorpi bispecifici) utilizarea lor ca şi markeri de diagnostic/prognostic pentru diferite afecţiuni în anumite cazuri anticorpii pot per se să controleze creşterea tumorii prin interferarea cu căile de semnalizare celulară.29] [22] Majoritatea anticorpilor monoclonali utilizaţi acţionează asupra ţintelor specifice prin acest mecanism.24] [22] [25] [26] [26] [27] [28.24]. enzime sau cytokine 1 Reprezentant Anti-CD20 Anti-CD20 Anti-CD20 Anti-EGFR Anti-EGFR Anti-Her2/neu Anti-EGFR Anti-VEGF-A AntiDiverşi Referinţa bibliografică [23.

editor. Fritsch A. Sawamura D. J Dermatol 37: 194-204. Sitaru C. Goto M. N Engl J Med 350: 1079-1080. Shimizu H (2010) What's new în bullous pemphigoid. (2009) Pathogenicity of IgG subclass autoantibodies to type VII collagen: Induction of dermal-epidermal separation. Kohler G. Goto M. 13. J Pathol 212: 56-65. Nishie W. 2. 120 p. (2007) The alternative pathway of complement activation is critical for blister induction în experimental epidermolysis bullosa acquisita. Travers P. 14. Milstein C (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. Oswald E. Chowdhury PS. Nishie W. Mihai S. Zillikens D (2005) Mechanisms of blister induction by autoantibodies. Methods 36: 11-24. (2010) Cross-reactivity of autoantibodies from patients with epidermolysis bullosa acquisita with murine collagen VII. 8. et al. Sui W. J Clin Invest 115: 870-878. 10. (2010) A novel active mouse model for bullous pemphigoid targeting humanized pathogenic antigen. Mihai S. J Autoimmun 31: 331-338. 11. (1995) The OKT3 4. 20. Vidarsson G. J Cell Mol Med 11: 462-481. Sitaru C. Cluj-Napoca: Babes-Bolyai University. Zillikens D. et al. 5. Shinkuma S. Zhao M. 18. (2007) IgG4 autoantibodies induce dermal-epidermal separation. Otto C. et al.Bibliografie 1. Ujiie H. 16. J Immunol 178: 6514-6521. Zhiqiang A (2009) Therapeutic Monoclonal Antibodies: From Bench to Clinic. J Autoimmun. et al. Ujiie H. Takahashi K. Shibaki A. Holers VM. Li Z. 6. New Jersey: Wiley. Liu Z. New York and London: Garland. Kimball JA. Chiriac MT (2007) Inflammatory Mechanisms of Tissue Damage Induced by Antibodies. Wang G. Haußer I. Sindrilaru A. Schroeder TJ. Sesarman A. (2005) Induction of dermal-epidermal separation în mice by passive transfer of antibodies to type VII collagen. Feldrihan V. et al. Natsuga K.4. J Immunol 184: 2166-2174. Exp Dermatol 14: 861-875. Lisi P. Shield CF. et al. 99 . Sawamura D. Norman DJ. Recke A. Ito K. Walport M (2007) Janeway's Immunobiology. 12. Chiriac MT. (2007) Humanization of autoantigen. Li N. Mihai S. Murphy KM. 15. Sitaru C (2007) Immunopathology and molecular diagnosis of autoimmune bullous diseases. Nat Med 13: 378-383. Schwartz RS (2004) Paul Ehrlich's magic bullets. Chiriac MT. et al. Herrero-Gonzalez JE. et al. (2008) Subepidermal blistering induced by human autoantibodies to BP180 requires innate immune players în a humanized bullous pemphigoid mouse model. 19. et al. 7. Chiriac MT. 3. Nature 256: 495-497. Shibaki A. Nishie W. Csorba K. Wu H (2005) Tailor-made antibody therapeutics. Thurman JM. 1st ed. Jefferis R. Sitaru C. J Immunol 183: 4088-4093. Mihai S. Roesler J. Chiriac MT. Nishie W. In: Zhiqiang A. Evensen M. et al. 17. (2007) NADPH oxidase is required for neutrophil-dependent autoantibody-induced tissue damage. 9. Sawamura D. J Cell Mol Med 11: 1117-1128. Chiriac MT. (2009) A novel humanized neonatal autoimmune blistering skin disease model induced by maternally transferred antibodies. et al. Cell Mol Life Sci 67: 1343-1351. Scharffetter-Kochanek K. Shibaki A. Goodall M.

Biochem Soc Trans 32: 742-745. Zafir-Lavie I. Ledbetter JA. Cartron G. Solal-Celigny P. (1990) în vivo cell activation following OKT3 administration. 26. Dacheux L. Press OW (2000) Signaling events involved în anti-CD20-induced apoptosis of malignant human B cells. Novotny W (2004) Discovery and development of bevacizumab. Transplantation 49: 697-702. Michaeli Y. Shan D. Ferran C. et al. an anti-VEGF antibody for treating cancer. Salles G. Weng WK. Merite S. (2002) Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism în IgG Fc receptor FcgammaRIIIa gene. Li B. 29. Antibody Response Study: a multicentre study of human anti-mouse antibody (HAMA) production following OKT3 use în solid organ transplantation. Transpl Immunol 3: 212-221. (1993) Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth în vivo. et al. Adv Exp Med Biol 532: 253-268. Levy R (2003) Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab în patients with follicular lymphoma. Codony J. Nat Rev Drug Discov 3: 391-400. Cancer Immunol Immunother 48: 673-683. Mellado B. 24. Chatenoud L. 27. Hillan KJ. 22. J Clin Oncol 21: 3940-3947. Systemic cytokine release and modulation by corticosteroids. Ferrara N. 28. Reiter Y (2007) Novel antibodies as anticancer agents. Bardos P. 100 . Ferguson KM (2004) Active and inactive conformations of the epidermal growth factor receptor. Gerber HP. 23.21. 25. Legendre C. et al. Gillett N. Rovira A. Blood 99: 754-758. Oncogene 26: 3714-3733. Albanell J. Gascon P (2003) Mechanism of action of anti-HER2 monoclonal antibodies: scientific update on trastuzumab and 2C4. Thouard I. Kim KJ. Armanini M. Winer J. Nature 362: 841-844.

................................................................2..................... Studii structurale ale componentelor solului: Acidul humic ................ 109 2............................................ 110 2........2............3............ 105 2...................... Aspecte generale ale spectroscopiei Raman ... Spectroscopia Raman amplificată de suprafaţă .........1......................................................................................... Modul de microscopie de forţă atomică model alpha 300 ......................... Structuri alotrope de carbon ......................1..........2............. 111 2.................... Aplicaţii ale microspectroscopiei Raman...................................... 108 2..................1.. 108 2............................... Cipuri ADN . 113 3........................ dr............................ Localizarea şi identificarea unor bacterii ............ Microspectroscopia Raman confocală ......1... 111 2............ Înregistrarea spectrelor Raman confocale ........................................................................................2...1............................................................... 102 1.. 102 1.................2.. 111 3......................... Imagistica Raman confocală... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 ................................................ Aplicaţii bio-medicale ..4.......2.......2................... Analiza domeniilor amorfe ......................1.3............. 117 3................. 115 3................................... Aplicaţii în stiinta mediului.3...... Identificarea fazelor cristaline şi a tranziţiilor de fază.....................3.... 112 3..1........... Parametrii optimi de funcţionare ......................2.......3...... 104 1... 113 3............. 117 3...3.................................3................................ 107 2.......1....................1................................... 119 4................2.................... 103 1................ Detecţia poluanţilor din apă... MICROSCOPUL CONFOCAL RAMAN Microspectroscopia Raman Conf..........3.......2.............................................. 109 2..........................3... Bibliografie ................. 119 101 ............... Accesorii ....... 109 2............ 107 2.............................................................................. Aplicaţii în ştiinţa materialelor ................. 112 3.................................... 107 2........................ Analiza medicamentelor anticanceroase ... Celula Linkam ..............................1......................... Efectul Raman rezonant.......................III............... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii ...2.........2.........2.... Monica Maria Baia Cuprins 1................................1......... Efectul Raman ......................................

Efectul Raman O rază de lumină incidentă pe o probă (de exemplu o celulă biologică. 2]. în urma căruia rezultă o cuantă a cărei energie rămâne neschimbată. un micro-organism.h ν s hν0 h ν0 hν0 hν0 + hνs v=1 v=0 Imprastiere Rayleigh Imprastiere Raman (Stokes) Imprastiere Rayleigh Imprastiere Raman (anti-Stokes) Figura 1. şi care poartă numele de împrăştiere Rayleigh.1. Nivel electronic excitat Energie hν0 hν0 hν0 h ν0 . 1). 2]. de o parte şi de cealaltă a liniei Rayleigh [1. etc. Diagrama tranziţiilor care au loc între diferite nivele energetice vibraţionale şi care corespund proceselor de împrăştiere Rayleigh şi Raman La temperatura mediului ambiant cea mai mare parte a electronilor se află pe nivelele vibraţionale ale stării electronice fundamentale cu energiile cele mai mici. 102 .) interacţionează cu atomii sau moleculele constituiente şi poate fi absorbită sau împrăştiată [1. hν 0 . De aceea. fie un proces de împrăştiere inelastică care este cunoscut sub denumirea de împrăştiere Raman şi în urma căruia sunt emise cuante de energie hν 0 ∓ hν s (Fig. Aspecte generale ale spectroscopiei Raman 1. un material. în conformitate cu legea de distribuţie a lui Boltzmann. Dacă o cuantă de lumină hν 0 nu este absorbită de o moleculă ea poate să sufere fie un proces de împrăştiere elastică. are o probabilitate de apariţie mult mai mare decât cel în urma căruia se eliberează o cuantă de energie hν 0 + hν s (linii anti-Stokes). procesul Raman. pe nivelele vibraţionale ale stării fundamentale cu energii mai mari se va găsi un număr mult mai mic de electroni. în urma căruia este eliberată o cuantă de energie hν 0 − hν s (linii Stokes). Liniile Raman denumite Stokes şi anti-Stokes se găsesc simetric.1. aşa încât.

care este mai intensă cu câteva ordine de mărime decât semnalul Raman şi care apare mai ales la investigarea biomoleculelor şi a sistemelor biologice.2. (c) efectului Raman rezonant. 1. deci doar 10-6.h ν s h ν0 hν0 .Intensitatea benzilor Raman este în general de 3 ÷ 5 ordine de mărime mai mică decât intensitatea liniei Rayleigh. Totuşi există substanţe care au capacitatea de a împrăştia radiaţia laser cu o intensitate de până la 106 ori mai mare decât cea a semnalului Raman normal.h ν s h ν0 . În unele cazuri observarea efectului Raman este impiedicată de apariţia fluorescenţei. cu cât energia de excitare este mai apropiată de energia necesară tranziţiei electronice cu atât este mai mare intensitatea 103 . h ν0 h ν0 h ν0 . care la rândul său reprezintă aproximativ 10-4 .10-3 din intensitatea radiaţiei incidente excitatoare.10-8 din fotonii incidenţi sunt transformaţi în fotoni Raman. (b) efectului Raman pre-rezonant. evitându-se astfel excitarea fluorescenţei [1. Efectul Raman rezonant În spectroscopia Raman se folosesc în mod curent ca surse de excitare lasere cu lungimi de undă situate în domeniul vizibil (verde şi rosu) şi infraroşu-apropiat care nu au energie suficientă pentru a produce prima tranziţie electronică a majorităţii moleculelor. Diagrama tranziţiilor care au loc între diferite nivele energetice în cazul (a) efectului Raman convenţional. 2). Aceste neajunsuri pot fi înlăturate prin utilizarea unei surse de excitare (laser) cu lungimea de undă situată în domeniul infraroşu-apropiat (NIR) sau prin utilizarea unor tehnici speciale cum ar fi cea bazată pe efectul Raman rezonant sau spectroscopia Raman amplificată de suprafaţă (surface-enhanced Raman spectroscopy SERS) [1-4]. 2.hνs (a) (b) (c) Figura. 3]. ceea ce limitează detecţia unor molecule aflate în concentraţie mică. În cele mai multe cazuri. Se face distincţie între două tipuri de efecte Raman rezonant: efectul pre-rezonant şi efectul rezonant (vezi Fig. dacă energia laserului este apropiată de valoarea energiei necesare unei tranziţii electronice (efect Raman rezonant).

3. care duce la procese de transfer de sarcină între nivelele fundamentale şi cele excitate ale moleculelor adsorbite [6]. săi în 1974 [5]. chimie. la aşa numiţii cromofori. O contribuţie majoră la amplificarea electromagnetică este datorată plasmonilor de suprafaţă. Spectroscopia Raman rezonantă se foloseşte mai ales la investigarea moleculelor poliatomice mari. 4. 5]: electromagnetic (amplificare a semnalului Raman de 104÷106 ori) şi chimic (amplificare a semnalului Raman de 10÷102 ori). Pentru folosirea efectului Raman rezonant nu este necesar un echipament special. apar benzi noi din analiza cărora se pot obţine informaţii structurale suplimentare. Amplificarea semnalului Raman rezultă din excitarea acestor plasmoni de suprafaţă de către radiaţia incidentă. Câmpurile locale rezultate amplifică intensitatea radiaţiei Raman emise. proteine). care este proporţională cu pătratul amplitudinii câmpului electric incident pe moleculă. Ionul negativ obţinut are configuraţii geometrice de echilibru diferite faţă de cele 104 . Amplificarea Raman rezonantă permite izolarea benzilor Raman datorate acestor cromofori şi a unităţilor structurale situate în vecinătatea lor facilitând astfel analizarea zonei cromoforice care este de obicei zona activă. 1. În plus. O amplificare suplimentară apare datorită excitării plasmonilor de suprafaţă de către radiaţia Raman emisă de molecule. în lipsa unor semnale spectrale datorate mediului înconjurător (ex. Tranziţiile de ordin superior. Spectroscopia Raman amplificată de suprafaţă Efectul amplificării semnificative a semnalului Raman al moleculelor adsorbite pe suprafaţa rugoasă a unui electrod de argint a fost descoperit de Fleischman şi colab. biochimie şi biologie. Astfel.benzilor observate. Efectul chimic al amplificării este asociat suprapunerii funcţiilor de undă ale metalului şi adsorbatului. Amplificarea semnalului Raman (de 106-108 ori) este explicată cu ajutorul a două mecanisme principale de amplificare [1. care sunt asociaţi oscilaţiilor colective ale electronilor de conducţie de pe suprafaţa particulelor metalice. care de obicei nu se observă într-un spectru Raman convenţional. cum sunt cele biologice. unde absorbţia este localizată într-o anumită zonă a moleculei. sunt deseori observabile într-un spectru Raman rezonant. se folosesc doar lasere cu lungime de undă variabilă care să permită ajustarea energiei de excitare la valoarea necesară unei absorbţii electronice. Modificarea regulilor de selecţie precum şi amplificarea tranziţiilor vibraţionale specifice de până la 106 ori permit utilizarea spectroscopiei Raman pre-rezonantă cât şi rezonanţa la un număr mare de aplicaţii din fizicp. se modifică regulile de selecţie şi vor fi amplificate doar anumite tranziţii vibraţionale Raman.

sunt utilizate mai multe tipuri de substrate active SERS. Pentru a optimiza amplificarea electromagnetică frecvenţa laserului trebuie să coincidă cu frecvenţa de rezonanţă plasmonică. deoarece intensitatea câmpului electromagnetic local este maximă pe direcţia perpendiculară la suprafaţă. Ag. biomedical. SERS a fost utilizată ca un mecanism de transpunere a semnalului în senzori chimici. glucoza [14] şi a unor reziduuri nucleare [15]. Îmbunătăţirea majoră era dată de folosirea unui obiectiv de microscop prin intermediul căruia se realiza atât iluminarea probei cât şi colectarea luminii împrăştiate. Astfel de exemple sunt analiza unor cantităţi reduse de pesticide [11]. Pentru realizarea unui experiment SERS se foloseşte în principiu acelaşi echipament ca şi în cazul realizării unui experiment Raman convenţional. 8]. etc. Astfel. transferul de sarcină duce la apariţia unei molecule neutre excitată vibraţional şi la emisia unui foton Raman. SERS poate fi exploatată la identificarea selectivă a unor specii moleculare precum şi la detecţia unei singure molecule [10]. De aceea. 1. 105 . Deoarece amplificarea depinde de proprietăţile substratului. antrax [12]. modurile de vibraţie care rezultă dintr-o modificare a polarizabilităţii perpendicular pe suprafaţă vor fi amplificate. Recent. În particular.Microspectroscopia Raman confocală În urmă cu aproximativ două decenii au fost efectuate primele măsurători Raman cu ajutorul unui microscop. şi de securitate globală şi naţională [9]. a unor antigene specifice prostatei [13]. filmele metalice de Au şi Ag. Acest lucru combinat cu faptul că intensitatea câmpului electromagnetic scade cu creşterea distanţei faţă de suprafaţă permite determinarea orientării speciilor adsorbite în raport cu suprafaţa. Cu. Regulile de selecţie ale spectroscopiei Raman amplificată de suprafaţă (SERS surface-enhanced Raman spectroscopy) sunt în principiu aceleaşi ca şi în cazul spectroscopiei Raman convenţionale [7. de mediu.4.ale moleculei neutre neadsorbite. Cele mai des folosite sunt electrozii de Au. Datorită sensibilităţii de detecţie remarcabile şi a flexibilităţii sale de aplicare tehnică SERS este utilizată în mod frecvent pentru a soluţiona o mare varietate de probleme cu caracter analitic. Pentru a întelege mai bine raţiunile care au stat la baza evoluţiei spectroscopiei micro-Raman este foarte importantă cunoaşterea tuturor factorilor care contribuie la modificarea intensităţii semnalului ( S ) „livrat” de detectorul unui spectrometru în cazul unei linii Raman înregistrată la o lungime de undă λ . suspensiile coloidale de Au şi Ag.

specificate foarte exact de către producător. şi rezoluţie spaţială paralelă la axa optică sau rezoluţie axială). Aceştia sunt intensitatea radiaţiei laser incidentă pe proba I L şi unghiul solid Ω din care se face colectarea luminii împrăştiate Raman. Important în astfel de situaţii ramâne faptul ca mediul în care se face imersarea să nu influenţeze structura şi proprietăţile probei investigate. N m reprezintă numărul de molecule din volumul de probă investigat V P .S ∝ I L ⋅ σ λ ⋅ N m ⋅ Ω ⋅ Tλ ⋅ s λ . unde I L este intensitatea radiaţiei laser incidentă pe probă (W⋅cm-2). doar câţiva parametrii pot fi modificaţi astfel încât să se compenseze reducerea numărului de molecule N m . Se poate observa că în cazul unor măsurători efectuate cu un obiectiv de microscop imersat într-un mediu al cărui indice de refracţie este apropiat de cel al probei investigate (nu există o modificare a drumului razelor de lumină la trecerea într-un mediu cu indice de refracţie diferit) apare o îmbunătăţire a eficienţei de colectare şi a rezoluţiei spaţiale. a cărei putere poate fi reglată într-un domeniu relativ larg. Astfel. şi a unui obiectiv de microscop. care focalizează radiaţia laser şi culege lumina împrăştiată sub un unghi solid mare. etc. Utilizarea unui astfel de mediu (apă. Se poate observa că atunci cand se doreşte examinarea unui volum V P foarte mic dintr-o probă. În microscopul convenţional întregul câmp vizual este uniform 106 . duce atât la obţinerea unui spectru Raman mai bun din punct de vedere calitativ cât şi la localizarea unei anumite zone de interes comparativ cu cazul în care acesta este înregistrat fără obiectiv de microscop [16]. Eficienţa de colectare a luminii este aproape în totalitate influenţată de apertura numerică NA a obiectivului de microscop care este definită de relaţia NA = n sin θ max în care n este indicele de refracţie al mediului dintre obiectiv şi probă iar θ max este unghiul maxim de colectare al obiectivului. utilizarea unei linii laser. iar Tλ and s λ reprezintă capacitatea de înregistrare a instrumentului şi respectiv sensibilitatea detectorului la lungimea de undă λ . ulei. Ω este unghiul solid din care se face colectarea luminii împrăştiate Raman.) impune utilizarea unor obiective speciale care posedă caracteristici diferite pentru fiecare mediu. În numeroase studii micro-Raman apare un neajuns deoarece informaţia spectrală obţinută nu este culeasă dintr-un volum suficient de mic (referirea se face în termeni de rezoluţie spaţială perpendiculară la axa optică sau rezoluţie laterală. σ λ este secţiunea specifică de împrăştiere Raman (cm2⋅sterad-1⋅molecula-1).

Confocalitatea poate fi de asemenea obţinută şi prin restrângerea ariei de pe detector unde intensitatea radiaţiei Raman este mare (realizarea unei ”aperturi electronice”).iluminat şi observat.1. 2. Spectroscopia Raman poate fi utilizată pentru a examina interacţiunile dintre molecule mici şi ADN.9 – 0. nedistructivă şi extrem de puţin sensibilă la prezenţa apei. Astfel.1.95) şi poate conduce la obţinerea de informaţie spectrală dintr-un tub focal cu un diametru de 1. această tehnică spectroscopică poate fi considerată. la detector ajungând doar radiaţia din volumul în care a fost focalizat laserul [17]. în funcţie de tipul aplicaţiei. microscopul confocal utilizează o diafragmă (pinhol) care izolează radiaţia luminoasă care provine din zona marginală a volumului în care a fost focalizat fascicolul laser (zona din afara focarului). 107 .1. în cele mai multe cazuri aplicarea ei nu necesită prepararea prealabilă a probei. Astfel. Aplicaţii bio-medicale 2. Analiza medicamentelor anticanceroase Producerea unor structuri moleculare capabile să se ataşeze de diferite secvenţe ale unui lanţ de ADN reprezintă un domeniu de cercetare intens datorită importanţei pe care o are acest subiect în obţinerea unor compuşi noi cu potenţial terapeutic. 2. modificările structurale şi morfologice care apar în diferite tipuri de probe poate oferi şi unele avantaje unice în comparaţie cu alte tehnici.22λ/NA şi o adâncime de 4λ/NA2 [17]. Aplicaţii ale microspectroscopiei Raman Spectroscopia Raman este o tehnică care pe lângă faptul că permite obţinerea de informaţii extrem de rapide despre structura. prin prezenţa pinholului se realizează o filtrare spaţială a radiaţiei. ca fiind neinvazivă. În plus. Experimentele iniţiale constă în înregistrarea spectrelor medicamentelor în soluţie în vederea realizării unei caracterizări Raman fundamentale. în cazul unor medicamente anticanceroase care nu prezintă fluorescenţă. Utilizarea primei metode de obţinere a confocalităţii necesită în general folosirea unor obiective de microscop cu apertură numerică mare (NA = 0. spectroscopia Raman poate fi singura metodă care să permită detecţia lor în interiorul celulelor în absenţa unor marcări fluorescenţi. Spre deosebire de acesta. În paragrafele următoare sunt prezentate succint principalele informaţii care se pot obţine în urma aplicării microspectroscopiei Raman pe diferite sisteme de studiu. Astfel.

pentru a detecta cantităţi extrem de reduse ale unui anumit lanţ de ADN existent într-o probă se foloseşte tehnica SERS [18]. Prin înregistrarea spectrului Raman este posibilă diferenţierea marcărilor fluorescenţi care dau benzi Raman specifice. Localizarea şi identificarea unor bacterii Cercetările din medicină şi biologie se confruntă cu necesitatea identificării precise a unor micro-organisme. Metoda standard de detecţie a procesului de hibridizare foloseşte marcări fluorescenţi. microscopia Raman se poate utiliza pentru a studia medicamentele în interiorul celulelor şi a furniza informaţii despre: (a) interacţiunea dintre compus şi mediul celular. În plus.1. se poate determina secvenţa de ADN din acel lanţ [18]. În cele din urmă. Majorita108 . În aceste experimente. nucleu sau citoplasmă).3. ca de ex. (c) forma chimică a compusului în interiorul celulei (de ex.1. dacă există o secvenţă cunoscută de ADN fixată într-o anumită zonă a suprafeţei cipului şi dacă apare procesul de hibridizare al unui lanţ de ADN în acea poziţie. Acest fenomen este cunoscut sub denumirea de hibridizare şi stă la baza tehnologiei de obţinere a cipurilor ADN. Cipuri ADN Biocipurile revoluţionează diagnosticarea clinică modernă şi tehnicile farmaceutice datorită rapidităţii de testare a probelor şi de livrare a rezultatelor.Următorul pas constă în efectuarea de studii Raman ale medicamentelor ataşate de anumite secvenţe ale unor oligonucleotide pentru a obţine informaţii de bază care vor fi mai apoi utilizate când se studiază in vitro aceste procese [18]. în care diagnosticarea pe baza hibridizării este utilizată în mod eficient pentru a obţine informaţii despre secvenţele de ADN. Tehnica SERS poate fi utilizată în semnalarea unirii unui lanţ de ADN cu lanţul complementar şi formarea structurii dublu elicoidale. 2. 2. fapt care face posibilă testarea diferitelor secvenţe care există într-o zonă a cipului. dacă sunt posibile formele protonate sau neprotonate) [18]. bacterii sau viruşi. Astfel. suprafaţa cipului se foloseşte atât ca imobilizator al lanţului de ADN cât şi ca substrat activ SERS pentru lanţul de ADN marcat care va fi adus în vecinătate datorită procesului de hibridizare cu lanţul imobilizat. dacă în spectrul SERS se observă benzile moleculei folosite ca marker înseamnă că s-a produs hibridizarea ADN-ului.2. (b) localizarea sa într-o anumită regiune sub-celulară (de ex. Astfel.

Atât studiile cristalografice cât şi 109 . suferă o tranziţie de la faza de rutil la anatas atunci când dimensiunile lor depăşesc 5 nm [20]. Este cazul structurilor preponderent amorfe. sarcinaxantin) în citoplasma membranei. contribuţiile celorlalte componente nefiind prezente în spectru [3]. care este prezentă în Rhodotorula rubra şi a benzilor date de sarcinaxantin.2.tea metodelor de identificare folosesc o evaluare morfologică combinată cu teste specifice în care se urmăreşte dezvoltarea micro-organismelor în diferite medii şi care durează până la 72 de ore. apoi au fost amestecate şi o mostră de analiză a fost investigată cu ajutorul unui echipament Raman confocal. După înregistrarea spectrelor Raman şi analizarea benzilor date de β-carotina. care uneori este în strânsă corelare cu tranziţiile de fază. Aplicaţii în ştiinţa materialelor 2.2. observarea unor moduri vibraţionale interzise în spectrele Raman reprezintă o dovadă a distorşilor care apar la nivelul reţelei cristaline [19]. S-a arătat faptul că structura cristalină a clusterilor nanometrici de TiO2. Existenţa unei diferenţe în energia de suprafaţă ca urmare a modificării dimensiunii nanoparticulelor. Trebuie menţionat faptul că prin folosirea laserului care excită rezonant cromoforii se obţin doar benzile acestora. poate fi de asemenea evidenţiată prin spectroscopia Raman. Cunoaşterea spectrelor Raman ale diferitelor faze cristaline permite caracterizarea tranziţiilor de fază care apar la modificarea temperaturii sau a presiunii prin analiza comparativă a modificărilor care apar în cazul modurilor de vibraţie. s-a reuşit identificarea unor bacterii care conţin un cromofor (β-carotina. Un alt studiu a dovedit că temperatura la care are loc tranziţia de fază ortorombic-tetragonal a structurii ceramice de BaTiO3 depinde de mărimea grăunţilor [21].2. Identificarea fazelor cristaline şi a tranziţiilor de fază Spectrul Raman a diverse nanostructuri este asemănător spectrului unui monocristal. De exemplu. s-a reuşit identificarea celor două bacterii. Analiza domeniilor amorfe Informaţiile obţinute prin aplicarea spectroscopiei micro-Raman sunt uneori mult mai utile decât cele determinate din analiza de raze X. Pentru aceasta au fost cultivate mai multe bacterii Rhodotorula rubra şi Micrococcus luteus. obţinuţi prin depunere din faza gazoasă. În plus. Spectroscopia Raman confocală oferă posibilitatea identificării unor bacterii individuale.2. 2. ceea ce facilitează identificarea directă a fazelor cristaline [19].1. 2. existent în Micrococcus luteus.

în timp ce modurile de intindere sunt afectate de dezordinea vecinătăţilor.5 nm) şi respectiv în cea de a doua (0. cu precădere în cazul structurilor dominate de legături covalente puternice. Raportul ariilor celor două benzi oferă o bună estimare a gradului de cristalinitate al probei. Astfel. În timp ce în cazul difracţiei de raze X apariţia lărgimii benzii este asociată cu abaterile de la periodicitate a reţelei cristaline pentru un număr însemnat de atomi.2. fulerene. nanotuburi.3. Separarea fazelor poate fi de asemenea studiată în cazul sticlelor unde valoarea numărului de undă la care apare semnalul Raman este strâns legată de conectivitatea unităţilor structurale poliedrice constitutive [24]. dar nu poate fi facută o separare spaţială a acestora [22]. Aplicarea spectroscopiei micro-Raman la studiul materialelor şi în special al polimerilor poate face uneori distincţie între domeniile conformaţionale submicrometrice cristaline şi amorfe. Din datele obţinute în urma analizei de difracţie de raze X se poate evidenţia faptul că există domenii cu structura periodică şi dezordonată. Dacă se ţine seama de descrierea moleculară a vibraţiilor. 26]. sau cu cele obţinute prin simulări teoretice [25. 2. în prima sferă de coordinare (0. Structuri alotrope de carbon Microspectroscopia Raman a fost des utilizată la studiul structurilor alotrope ale carbonului (diamant. care sunt reprezentate de anumiţi atomi ai altor subreţele sau de defecte care apar ca urmare a substituţiei de atomi sau a prezenţei vacanţelor. modurile Raman de deformare sunt influenţate de dezordinea geometriei locale. Cel mai rapid mod de a obţine componenta amorfă şi cea cristalină este de a deconvoluţiona modurile Raman situate la numere de undă mici în vecinătatea liniei Rayleigh care conţin cele două componente [23]. în cazul spectroscopiei Raman doar modurile de vibraţie ale reţelei şi cele de libraţie (care se găsesc la numere mici de undă) sunt afectate de dezordinea la mare distanţă. grafit. Atribuirea benzilor în aceste cazuri se face pe baza comparaţiei cu spectrele experimentale obţinute pe faze cristaline similare compoziţional structurii sticlelor sau vitroceramicilor investigate. Este una dintre puţinele tehnici sensibile la modificările structurale care apar în aceste tipuri de materiale.5-5 nm) [19]. Lărgimea celorlalte benzi Raman este în principal afectată atunci când au loc modificări ale câmpului cristalin local.cele de spectroscopie Raman se bazează pe a interpreta măsura dezordinii în termeni de lărgime a benzii. etc. în spectrele Raman ale acestor structuri 110 . mai exact atunci când apar modificări structurale în ordinea la mică distanţă.1-0.). de la structuri cu grad de cristalinitate extrem de ridicat la structuri amorfe.

Acidul humic apare în sol şi în apele subterane şi este implicat în numeroase procese chimice şi biologice care au loc în mediul terestru şi acvatic.1. benzile datorate modurilor de respiraţie radială (Radial Breathing Mode) cu ajutorul cărora se poate determina diametrul nanotubului (relaţie de inversă proporţionalitate cu valoarea frecvenţei Raman) [19]. Determinarea substratului SERS cel mai potrivit pentru fiecare tip de poluant reprezintă un prim pas în dezvoltarea unui senzor bazat pe metoda SERS. Aplicaţii în ştiinţa mediului 2.apar clar definite benzi datorate vibraţiilor date de structuri grafitice (notate G) şi de structuri dezordonate (notate D şi D’). Cu ajutorul acestei tehnici este posibilă determinarea orientării şi a modului de adsorbţie al acestor molecule pe suprafaţa substratului activ SERS [27]. Acestea au stabilit o concentraţie maximă permisă a acestor compuşi în apa potabilă de < 1 μg/l. Tehnica SERS datorită sensibilităţii sale este capabilă să detecteze concentraţii extrem de scăzute ale acestor substanţe.2. Studiile SERS ale acidului humic au condus la obţinerea unor informaţii legate de mecanismele de legare şi/sau configuraţiile de complexare ale acidului humic. în regiunea numerelor mici de undă (< 200 cm-1). Extrem de important este faptul că în cazul nanotuburilor de carbon apar. Compuşi chimici precum hidrocarburile aromatice. Studii structurale ale componentelor solului: Acidul humic Caracterizarea structurală a acidului humic precum şi determinarea comportamentului lui de complexare sunt extrem de importante în ştiinţa mediului. derivaţii toxici de azot. Cunoaşterea proprietăţilor chimice este esenţială pentru dezvoltarea unor modele ecologice folosite pentru remedierea şi detoxificarea de compuşi antropogenici sau chiar de reziduuri nucleare [3]. 2. 2. Detecţia poluanţilor din apă Prezenţa poluanţilor organici în apă a devenit o problemă de actualitate pentru comunitatea internaţională. Pentru a detecta aceste concentraţii mici este necesară folosirea unor tehnici instrumentale extrem de sensibile. 111 .3. fenolii sau derivaţii naftalinei sunt prezenţi în mediile acvatice datorită utilizării lor ca pesticide sau în procesele industriale. Persistenţa precum şi efectele toxicologice ale acestor compuşi şi ale produşilor lor intermediari sunt semnale de alarmă pentru agenţiile de resort din lume.3.3.

detector CCD cu răcire Peltier (1340 x 100 pixeli) şi iluminare prin spate tip Marconi.imagistica de fluorescenţă confocală (prin montare de filtre adecvate) Sistemul dispune în prezent de 2 lasere. x-z şi y-z (pănă la 1024 x 1024 pixeli) . Echipamentul mai conţine un sistem de focalizare motorizat cu posibilitate de deplasare pe o distanţă de 30 mm şi o rezoluţie de 50 nm (un pas) şi o platformă de scanare prin acţionare piezo-electrică cu următoarele caracteristici: suprafaţa de scanare de 200 μm x 200 μm x 20 μm.achiziţie de spectre din arii selectate (confocal micro-Raman) . Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este dotat cu un microscop optic care este echipat cu 4 obiective plan acromatizate de apertura numerică (NA) 0.microscopie de câmp întunecat cu obiectiv EC Epiplan-Neofluar 100X/0.9 HDDIC. incluzând de asemenenea un obiectiv (cu cantilever ataşat) pentru analiza AFM în lichide şi o cameră video color.25 şi mărire 10X. spectrometru UHTS 300. Dimensiunea maximă a probelor care pot fi măsurate este de 120 mm în diametru şi 20 mm înălţime. un YAG 532 nm şi un He-Ne 633 nm.8 şi 1. Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii 3.imagistica spectrală Raman la lungimi de undă fixe.3. 50X şi respectiv 100X (uscat şi în ulei de imersie). Rezoluţia optică laterală la linia laserului de 532 nm este de 250 nm.achiziţie de spectru/pixel (scanare) . Sistemul de microscopie Raman confocală lucrează în următoarele moduri de operare: . conectori. reflector de câmp intunecat . fibre optice multimod (100. două reţele de difracţie cu 600 şi respectiv 1800 linii/mm. 112 . Drumul razelor în interiorul echipamentului CRM 200 este prezentat în schema de mai jos (Fig. cuplaj cu fibră optică standard SMA. 0. acurateţe de poziţionare pe direcţiile x şi y sub 4 nm iar pe direcţia z sub 1 nm.45. posibilitate de poziţionare a probei în planul x-y într-o regiune de 20 mm x 20 mm cu o rezoluţie mai mică de 1 μm. 3) [28]. 0. pe direcţiile x-y. 50 şi 25 μm).1. domeniul lungimilor de undă de excitaţie 442-785 nm. detecţie Raman între 150-3500 cm-1.microscopie confocală în reflexie .3. 20X.

50 şi 25 μm. Echipamentul CRM 200 are în dotarea standard trei fibre multimod cu diametre de 100.1. 113 . Parametrii optimi de funcţionare 3. unde M este mărirea obiectivului. fibra optică standard 03. camera video Figura. este transmisă spectrometrului echipat cu o cameră CCD prin intermediul unei fibre optice multimod. sistem de focalizare motorizat pe axa z 09. NA apertura numerică a obiectivului de microscop. 3. Partea stângă a ecuaţiei este legată doar de parametrii obiectivului de microscop. iar pentru vPmax ≤ 4 nu se modifică semnificativ rezoluţia axială). Fibra este montată în planul imagine al microscopului şi poate fi ajustataă astfel încât să se obţină eficienţa maximă de colectare. laserul 02.2. Înregistrarea spectrelor Raman confocale În echipamentul CRM 200 radiaţia laser ajunge în microscop printr-o fibră optică standard iar radiaţia Raman împrăştiată. spectrometru UHTS 300 07. Relaţia care trebuie îndeplinită în cazul măsurătorilor Raman confocal este πd 0 M . 3. Drumul razelor în microscopul Raman WITec CRM 200. fibra optică multimod 06. obiectivul 04. Diametrul acestei fibre joacă rolul pinholului cu ajutorul căruia se realizează confocalitatea [29].01. λ lungimea de undă.5. colectată cu ajutorul obiectivului de microscop. lampa cu lumină albă pentru iluminare 08. platforma de scanare 05. pentru a obţine cea mai mare rezoluţie laterală vPmax ≤ 0. d0 diametrul ≥ NA v P max λ pinholului. iar vPmax este un parametru variabil a cărui valoare trebuie stabilită în funcţie de tipul de informaţie spectrală care se doreşte a fi obţinută (ex.2.

în experimente SERS pe molecule biologice se foloseşte o putere a laserului sub 1 mW. se schimbă obiectivul de 100X.25 80 100 / 1. În caz contrar. Raportul πd0/2.). Dacă proba de interes nu este predispusă la transformări din cauza laserului. Puterea laserului trebuie aleasă astfel încât să nu inducă transformări probei (fotodegradare. Astfel. se parcurg următoarele etape: . apare riscul de a obţine semnal de la contaminanţi sau se poate degrada molecula. în timp ce cea mai mare rezoluţie laterală s-ar obţine pentru un diametru optim al pinholului de 10 μm.4 71 Tabelul 2.pentru a stabili puterea laserului. fiind indicat să fie chiar mai mică de 200 ccd cts.stabilirea timpului de înregistrare se face în funcţie de intensitatea semnalului Raman obţinut (se poate alege de ordinul milisecundelor sau de ordinul minutelor) 114 .9 111 100 / 1. De exemplu. un obiectiv de microscop cu mărire de 100 şi o apertură numerică de 0. În anumite situaţii se poate schimba şi fibra (vezi detaliile despre confocalitate prezentate mai sus) . cea mai mare rezoluţie axială s-ar obţine pentru un diametru optim al pinholului de 50 μm.6 67 60 / 0. Lungime de undă [nm] d0 = 10 μm d0 = 25 μm d0 = 50 μm d0 = 100 μm d0 = 200 μm 440 29 71 142 286 571 488 26 64 129 258 515 532 24 59 118 236 472 633 20 50 99 199 397 785 16 40 80 160 320 Cu ajutorul celor două tabele poate fi determinată mărimea corectă a pinholului în măsurătorile Raman confocal efectuate cu echipamentul CRM 200.4 50 40 / 0. în vederea stabilirii parametrilor optimi.8 75 100 / 0.5λ pentru diferite lungimi de undă şi diametre ale pinholului. Înaintea efectuării măsurătorilor propriu-zise.9. Raportul M/NA pentru diferite tipuri de obiective de microscop. Dacă semnalul Raman obţinut este bun. Obiectiv microscop M/NA 10 / 0. se foloseşte intensitatea liniei Rayleigh (ar fi bine să nu depăşească 400 ccd cts.25 53 20 / 0. în cazul în care nu se obţine semnal Raman se creşte puterea laserului). iar spectrele obţinute să aibă un raport semnal/zgomot multumitor.se lucrează cu fibra de 100 şi cu obiectivul de 20X sau 50X. pentru măsurători în care este utilizat un laser cu lungimea de undă de 532 nm. .Tabelul 1. etc. se pot utiliza puteri mai mari (≤ 3 mW).

8 nm • puterea laserului 640 μW • timp de integrare/măsurare 60 s 3. ideal este să fie cât mai mic cu puţinţă (între 0.Exemplu: Spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenină pe o sticlă de microscop. Imagistica Raman confocală Pentru imagistică este indicată utilizarea obiectivului de 100X (în aer sau cu imersie în ulei). Înaintea efectuării unei scanări se stabilesc parametrii optimi de înregistrare (puterea laserului şi timpul de integrare) prin măsurarea spectrelor individuale şi time series.2.2. Referitor la timpul de integrare. 35000 30000 25000 Intensity [ccd cts] 20000 15000 10000 5000 0 400 600 800 1000 1200 -1 1400 1600 1800 Raman shift [cm ] Parametrii folosiţi: • fibra multimode de 100 μm • obiectivul 100X aer • linia laser 632. Exemplu. în general pentru o arie de 10 μm x 10 μm se utilizeazp minim 75 linii şi 75 de puncte pentru fiecare linie (la un număr prea mic de linii şi de puncte imaginea este de proastă calitate). iar stabilirea lui depinde de tipul probei.1 s şi 1 s). de puterea laserului şi de aria scanată. 115 . În ceea ce priveşte stabilirea numărului de linii şi de puncte pentru suprafaţa pe care dorim s-o scanpm. Harta spectrală a intensităţii benzii Raman de la 737 cm-1 din spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenina pe o sticlă de microscop.

500

737

400

Intensity [ccd cts]

300

200

100

0 500 1000 1500
-1

Raman shift [cm ]

În spectrul selectat din imaginea scanată se poate observa semnalul “curat” de la adenină. Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 632.8 nm • puterea laserului: 640 μW • suprafaţa scanată: 10 μm x 10 μm • 75 linii; 75 puncte/linie • timp de integrare 0.5 s/punct (softul calculează timpul de integrare pentru o linie – în acest caz 37,5 s (trace) şi 0.075 s (retrace) Exemplu. Imagistica Raman pe o secţiune dintr-un dinte, la interfaţa dintre dinte şi plombă

116

Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 532 nm • putere laser 3 mW. • suprafaţa scanată 10 μm x 10 μm • nr. de linii 150, puncte 150/linie • timp de integrare 0.2 s/punct

3.3. Accesorii
3.3.1. Modul de microscopie de forţă atomică model alpha 300 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300.

01. camera video 02. unitatea de deflexie a razelor 03. lampa cu lumină albă pentru iluminare 04. obiectivul AFM cu cantilever 05. platforma de scanare 06. masa antivibraţie

Figura 4. Drumul razelor în microscopul de forţă atomică alpha300.

Microscopul AFM alpha 300 lucrează în următoarele moduri: contact mod, forţă laterală, acustic (tapping) mod, contact mod intermitent cu imagistica în fază şi amplitudine cu o rezoluţie de 16 bit, digitizare 5 MHz, şi frecvenţa 10-500 KHz. Sistemul dispune de un laser de deflexie 980 nm, o unitate de detecţie a deflexiei, masa antivibraţie 0.7 – 1000 Hz, > 1000 Hz pasivă. Aria de scanare este de 100 μm x 100 μm x 20 μm. Drumul razelor în interiorul microscopului de forţă atomică alpha 300 este prezentat în schema de mai sus (Fig. 4) [30]. 117

Parametrii optimi de funcţionare 1. Modul acustic (AFM AC-Mode) • Este modul de operare uzual, utilizat mai ales în cazul probelor moi (probe biologice). • Se folosesc tip-uri de Si3N4 fixate pe cantilever-uri cu frecvenţa de rezonanţă mare (200 – 300 kHz). • În vederea realizării alinierii se efectuează următorii paşi: • Se determină frecvenţa liberă de oscilaţie a cantileverului aplicând o tensiune de 0.05 –0.1 V • Se ajustează amplitudinea oscilaţiilor libere ale cantilever-ului până la o tensiune de 2 V • Se setează un setpoint de 1.5 V • Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. • Valorile tipice ale parametrilor pentru scanare sunt: • Număr puncte pe linie: 256 • Număr linii pe imagine: 256 • Timpul scanare pe linie: 0.5 – 2 s • În timpul scanării se ajustează P-gain şi I-gain astfel încât drumul înainte şi drumul înapoi să coincidă. • Apropierea tip-ului de substrat se face automat.

Imagine topografică AFM

Imagine fază AFM

2. Modul contact (AFM contact mode) - Permite înregistrarea de imagini, scanarea de-a lungul unei singure linii sau înregistrarea curbelor de forţă. - în vederea realizării alinierii se efectuează următorii paşi: - Se utilizează tip-ul de AFM dorit. 118

Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. - Apropierea tip-ului de substrat se face automat. - Valori tipice ale parametrilor pentru scanare: - Număr puncte pe linie: 256 - Număr linii pe imagine: 256 - Timpul scanare pe linie: 0.5 – 2 s peraturi.
• • • • •

3.3.2. Celula Linkam pentru efectuarea unor măsurători la diferite temDomeniul de temperatură: -196 - 600 °C. Stabilitate < 0.1 °C. Rata de încălzire: max 150 °C/min. Senzor din platină 100 Ω. Sistem de răcire a corpului celulei cu apă pentru temperaturi > 300 °C.

4.Bibliografie
I. R. Lewis, H. G.M. Edwards (Eds.), Handbook of Raman Spectroscopy, Marcel Dekker Inc. New York, 2001. 2. S. Astilean, Metode şi tehnici moderne de spectroscopie optica, Spectroscopia IR şi Raman, Editura Casa Cartii de Stiinta, Cluj-Napoca, 2002. 3. R. Petry, M. Schmitt, J. Popp, Raman Spectroscopy–A Prospective Tool în the Life Sciences, ChemPhysChem, 4, 14, 2003. 4. S. Schluecker, (Ed.), Surface Enhanced Raman Spectroscopy: Analytical, Biophysical and Life Science Applications, Wiley VCH, 2010. 5. M. Fleischmann, P. J. Hendra, A. J. McQuillan, Raman spectra of pyridine adsorbed at a silver electrode, Chem. Phys. Lett., 26, 163, 1974. 6. T. Vo-Dinh, SERS chemical sensors and biosensors: new tools for environmental and biological analysis, Sensors and Actuators B, 29, 183, 1995. 7. J. A. Creighton în Spectroscopy of Surfaces, Vol. 21 (Eds.: R. J. H. Clark, R. E. Hester), John Wiley & Sons, New York, 1988. 8. D. A. Weitz, M. Moskovits, J. A. Creighton în Surface-Enhanced Raman Spectroscopy with Emphasis on Liquid - Solid Interfaces, Vol. 2 (Eds.: R. B. Hall, A. B. Ellis),VCH, Deer field Beach, FL, pp. 197- 243, 1986. 9. G. A. Baker, D. S. Moore, Progress în plasmonic engineering of surface-enhanced Raman-scattering substrates toward ultra-trace analysis, Anal. Bioanal. Chem. 382, 1751, 2005. 10. K. Kneipp, H. Kneipp, P. Corio, S. D. M. Brown, K. Shafer, J. Motz, L. T. Perelman, E. B. Hanlon, A. Marucci, G. Dresselhaus, M. S. Dresselhaus, Surface-Enhanced and Normal Stokes and Anti-Stokes Raman Spectroscopy of Single-Walled Carbon Nanotubes, Phys. Rev. Let. 84, 3470, 2000. 11. N. Weissenbacher, B. Lendl, J. Frank, H. D. Wanzenboeck, B. Mizaikoff, R. Kellner, Continuous Surface Enhanced Raman Spectroscopy for the Detection of Trace Organic Pollutants în Aqueous Systems, J. Mol. Struct. 539, 410, 1997. 1.

119

12. X. Zhang, M. A. Young, O. Lyandres, R. P. Van Duyne, Rapid Detection of an Anthrax Biomarker by Surface-Enhanced Raman Spectroscopy, J. Am. Chem. Soc. 127, 4484, 2005 13. D. S. Grubisha, R. J. Lipert, H. Y. Park, J. Driskell, M. D. Porter, Femtomolar detection of prostate-specific antigen: an immunoassay based on surface-enhanced Raman scattering and immunogold labels, Anal. Chem., 75, 5936, 2003. 14. K. E. Shafer-Peltier, C. L. Haynes, M. R. Glucksberg, R. P. Van Duyne, Toward a Glucose Biosensor Based on Surface-Enhanced Raman Scattering, J. Am. Chem. Soc., 125, 588, 2003; C. R. Yonzon, C. L. Haynes, X. Zhang, J. T. Jr. Walsh, R. P. Van. Duyne, A glucose biosensor based on surface-enhanced Raman scattering: improved partition layer, temporal stability, reversibility, and resistance to serum protein interference, Anal. Chem. 76, 78, 2004. 15. L. Bao, S. M. Mahurin, R. G. Haire, S. Dai, Silver-doped sol-gel film as a surface-enhanced Raman scattering substrate for detection of uranyl and neptunyl ions, Anal. Chem. 75, 6614, 2003. 16. J. M. Chalmers and P. R. Griffiths, (Eds.), Handbook of Vibrational Spectroscopy, John Wiley and Sons, Chichester, pp. 1419-1428, 2002. 17. N. J., Everall, Depth Profiling with Confocal Raman Microscopy, Part II, Spectroscopy 19, 16, 2004. 18. C. G. Coates, J. J. McGarvey, On the Pulse: Andor tehchnology, 1(8), 2001. 19. G. Gouadec, P. Colomban, Raman Spectroscopy of nanomaterials: How spectra relate to disorder, particle size and mechanical properties, Progress în Crystal Growth and Characterization of Materials 53, 1, 2007. 20. E. Barborini, I. N. Kholmanov, P. Piseri, C. Ducati, C.E. Bottani, P. Milani, Engineering the nanocrystalline structure of TiO2 films by aerodynamically filtered cluster deposition, Appl. Phys. Lett. 81, 3052, 2002. 21. M. H. Frey, D. A. Payne, Grain-size effect on structure and phase transformations for barium titanate, Phys. Rev. B, 54, 3158, 1996. 22. A. Guinier, Théorie et Technique de la Radiocristallographie, Dunod, Paris, 1956. 23. M. F. Cerqueira, L. Rebouta, M. Andritschky, J.A. Ferreira, M. F. Da-Silva, Microcrystalline silicon thin films prepared by RF reactive magnetron sputter deposition, Vacuum 46, 1385, 1995. 24. D. G. Georgiev, M. Mitkova, P. Boolchand, G. Brunklaus, H. Eckert, M. Micoulaut, Molecular structure, glass transition temperature variation, agglomeration theory, and network connectivity of binary P-Se glasses, Phys. Rev. B, 64, 134204, 2001. 25. D. G. Georgiev, P. Boolchand, K.A. Jackson, Intrinsic nanoscale phase separation of bulk As2S3 glass, Phil. Mag., 83, 2941, 2003. 26. Y. Wang, J. Wells, D. G. Georgiev, P. Boolchand, K. Jackson, M. Micoulaut, Sharp Rigid to Floppy Transition Induced by Dangling Ends în a Network Glass, Phys. Rev. Lett., 87, 185503, 2001. 27. E. A. Carrasco, M. Campos-Vallette, P. Leyton, G. Diaz, R. E. Clavijo, J. V. Garcıa-Ramos, N. Inostroza, C. Domingo, S. Sanchez-Cortes, R. Koch, Study of the Interaction of Pollutant Nitro Polycyclic Aromatic Hydrocarbons with Different Metallic Surfaces by Surface-Enhanced Vibrational Spectroscopy (SERS and SEIR), J. Phys. Chem. A, 107, 9611, 2003. 28. http://www.witec.de/en/company/witecnews/19/crm200flyer.pdf 29. Manual WITec CRM200. 30. www.witec.de/en/download/AFM/alpha300Aflyer.pdf

120

Microspectroscopia Raman – partea a II-a
Conf. dr. Monica Maria Baia Cuprins
1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman................... 121 1.1. Substrate SERS ............................................................................................. 122 1.2. Identificarea unor bacterii ............................................................................. 122 1.3. Caracterizarea celulelor ................................................................................. 123 1.4. Diagnosticarea unor boli ............................................................................... 124 1.5. Aplicaţii în domeniul farmaceutic................................................................. 125 1.6. Aplicaţii în domeniul alimentar .................................................................... 125 1.7. Nanotuburi de carbon ................................................................................... 126 2. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS................................................................................... 126 3. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS .......................................... 128 4. Bibliografie ........................................................................................................... 130

1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman
În ultima perioadă, odată cu dezvoltarea tehnologică a aparaturii aferente care permite înregistrarea rapidă a spectrelor Raman folosind diferite linii de excitare laser precum şi vizualizarea zonelor cu ajutorul microscopiei de forţă atomică sau a celei electronice de baleiaj, microspectroscopia Raman este din ce în ce mai mult aplicată în diverse domenii cum ar fi: medicină, biologie, studiul materialelor, geologie şi mineralogie, arta, ştiinţa mediului, controlul calităţii alimentelor, etc. [1]. Datele bibliometrice furnizate de Thomson Reuters ISI Web of Science confirmă faptul că în perioada 2001-2009 numărul publicaţiilor referitoare la spectroscopia Raman şi aplicaţiile ei s-a dublat de la 1931 înregistrate în 2001 la 4078 apărute în 2009 [1]. Această creştere a numărului de publicaţii este datorată, în principiu, următoarelor motive: (a) dezvoltării continue a metodei SERS; (2) progresului extraordinar înregistrat în domeniul fabricării controlate a nanomaterialelor şi a nanostructurilor; (3) creşterii eficienţei în imagistica biomedicală şi de diagnosticare a bolilor; (4) numărului tot 121

mai mare de aplicaţii în afara laboratorului (artă, arheologie, criminalistică, farmaceutice), (5) designului tot mai sofisticat şi controlat al pulsurilor laser ultrarapide utilizate în aplicaţii care exploatează efectele Raman neliniare. Din domeniul vast de aplicabilitate al spectroscopiei Raman se remarcă cu precădere aplicaţiile biomedicale, axate pe diagnosticarea unor boli, de identificare a unor bacterii, de investigare a unor celule vii, cele din domeniul nanoparticulelor şi nanomaterialelor, precum şi cele din domeniul artei şi arheologiei, farmaceutic şi alimentar. Astfel, în continuare vom face o trecere în revistă a principalelor domenii de aplicabilitate, făcând o referire concretă la cele mai recente cercetări.

1.1. Substrate SERS
În ultimii ani, metoda SERS s-a dezvoltat considerabil datorită obţinerii unor substrate SERS capabile să producă o amplificare importantă a semnalului Raman al speciilor adsorbite, reproductibilă şi stabilă în timp. Uniformitatea răspunsului SERS al substratelor depinde de morfologia lor. Astfel, s-a dovedit că gradul de amplificare poate fi controlat prin utilizarea unor metode de nanofabricare a structurii suprafeţei în termeni de mărime, formă şi distanţa dintre formaţiunile de pe suprafaţă, pe care adsorb speciile moleculare. Astfel, în ultima perioadă pe lângă substratele SERS obţinute prin litografie cu fascicul de electroni, litografie cu nanosfere de polistiren [2-4] au fost preparate şi substrate constând din nanoparticule anizotrope de forme diferite [5, 6]. De asemenea, au fost realizate noi substrate constând din nanotuburi de TiO2 pe care a fost depus Ag, sau nanofire de ZnO pe care a fost depus Au [7, 8] toate manifestând o activitate SERS remarcabilă.

1.2. Identificarea unor bacterii
Identificarea rapidă şi precisă a micro-organismelor a devenit o cerinţă importantă nu numai pentru analizele clinice, sau cele ale unor materiale frauduloase, ci şi în diferite aplicaţii cum ar fi producţia de medicamente sau tehnologia de procesare a mâncării. În toate aceste aplicaţii este de dorit ca timpul de cultivare a micro-organismelor să fie minimizat pentru a prescrie pacienţilor în timp util tratamentul corespunzător sau pentru a reduce timpul în care unităţile de producţie sunt închise din cauza unor disfuncţionalităţi. Majoritatea metodelor convenţionale de identificare a bacteriilor se bazează pe efectuarea unor teste chimice după cultivarea microorganismelor în diferite medii şi necesită timp îndelungat. Dintre tehnicile 122

care permit identificarea rapidă a micro-organismelor spectrosopia Raman a devenit una dintre cele mai promiţătoare metode [9] . Procedura de caracterizare a unei celule bacteriene cu ajutorul spectroscopiei Raman constă în patru etape: colectarea micro-organismelor, localizarea moleculelor biologice cu ajutorul unor markeri fluorescenţi, înregistrarea spectrelor Raman şi compararea lor cu alte spectre existente în baze de date în scopul identificării bacteriilor. Combinând rezultatele Raman cu o metodă de clasificare bazată pe chemometrie s-a reuşit identificarea subspeciei unor bacterii cu o probabilitate de 98% [10]. O altă modalitate de identificare a bacteriilor şi/sau a sporilor este cu ajutorul metodei SERS. În acest caz, se detectează prezenţa unui compus chimic, cunoscut ca biomarker al sporilor sau al bacteriei [11]. Relativ recent, a fost dezvoltată o metodă de identificare a unor bacterii pe un cip microfluidic [12]. Prin aplicarea unui câmp electric pe un electrod de aur s-a reuşit sortarea bacteriilor, concentrarea lor şi apoi, prin înregistrarea specrelor SERS în cip, cercetătorii au fost capabili să identifice fiecare bacterie pe baza semnăturii sale spectrale. Testele au fost efectuate pentru două tipuri de bacterii Gram positive (Staphylococcus aureus) şi Gram negative (Pseudomonas aeruginosa). Cu ajutorul acestei metode se îmbunătăţeste semnificativ timpul şi efortul necesar identificării diferitelor bacterii din mâncare sau altă materie organică.

1.3. Caracterizarea celulelor
Spectroscopia Raman este o metodă sensibilă pentru studiul biochimic al celulei fiind capabilă să pună în evidenţă modificări care apar în urma interacţiunii cu diferiţi agenţi [13]. Pe de altă parte, microscopia de forţă atomică oferă informaţii despre topografia suprafeţei, adeziunea şi elasticitatea celulară a unei celule. Prin utilizarea combinată a celor două metode pot fi investigate proprietăţile biomecanice şi biochimice ale celulelor vii în diferite condiţii fiziologice [14]. Spectrele Raman ale celulelor vii constă din benzi corespunzătoare biopolimerilor existenţi în celule (lipide, proteine, ADN, ARN). Cu ajutorul spectrelor Raman este posibilă discriminarea celulelor vii de cele moarte. Acest lucru este extrem de important în realizarea unui biosenzor. De asemenea, cu ajutorul spectroscopiei Raman este posibilă monitorizarea în timp a interacţiunii dintre celule şi diverse medicamente, precum şi diferite elemente toxice folosite în bioterorism, în vederea stabilirii efectelor acestei interacţiuni.

123

1.4. Diagnosticarea unor boli
După introducerea spectroscopiei Raman în studiul pielii de către Williams et all în 1992 [15] utilizarea ei în acest domeniu a devenit tot mai frecventă. În prezent, spectrele Raman înregistrate pe piele sunt bine analizate şi pe baza diferenţelor s-a pus în evidenţă existenta unor boli [16, 17]. Deoarece intensitatea semnalului Raman este scăzută, timpii de achiziţie sunt extrem de lungi şi din această cauză aplicaţiile clinice sunt reduse. Relativ recent, s-a reuşit implemetarea spectroscopiei Raman în aplicaţii clinice prin intermediul unui sistem capabil să înregistreze şi să analizeze în timp real spectre Raman in vivo [18]. Cu ajutorul acestui sistem s-a reuşit efectuarea unei evaluări a pielii unor voluntari precum şi diagnosticarea unor boli ale pielii. S-a constatat că există regiuni spectrale care prezintă benzi specifice pentru piele provenită din diferite regiuni ale corpului. De asemenea, s-a constatat că semnăturile spectrale specifice ale pielii diferă de la un individ la altul. Astfel, prin evaluarea raportului dintre conţinutul de lipide şi proteine se poate face o evaluare a pielii precum şi o diagnosticare cu ajutorul spectroscopiei Raman [19]. De asemenea spectroscopia Raman permite identificarea şi monitorizarea melaninei, un pigment natural care acţionează ca un scut împotriva radiaţiei solare, înlătură speciile chimice active şi produce radicali activi care afectează ADN-ul. Cancerul este o boală complexă indusă de o instabilitate genetică şi o acumulare a unor alternări moleculare multiple [20]. Deoarece diagnosticarea timpurie implică o rată de supravieţuire ridicată, un interes deosebit l-a avut dezvoltarea unor metode de detecţie moleculară care să permită vizualizarea unor biomarkeri sau a unor evenimente celulare şi să indice starea de fapt a cancerului. Spectroscopia Raman este o metodă utilă în diagnosticarea cancerului datorită sensibilităţii sale de a detecta modificări moleculare extrem de mici care sunt asociate cu cancerul, cum ar fi o creştere a raportului dintre nucleu şi citoplasmă, existenţa cromatinei dezordonate, o activitate metabolică crescută şi modificări ale cantităţilor de lipide şi proteine [21]. În principal spectroscopia Raman a fost aplicată la diagnosticarea cancerului de piele, de sân, de tract gastrointestinal şi cervical sau de col uterin [21]. Senzorii optici bazaţi pe metoda SERS au fost în ultima perioadă destul de des folosiţi pentru diagnosticarea in vitro şi in vivo a cancerului [22]. Ei sunt capabili să ofere informaţii moleculare specifice despre moleculele ţintă de interes, fără o marcare prealabilă a acestora.

124

1.5. Aplicaţii în domeniul farmaceutic
Spectroscopia Raman a devenit o metodă rapidă, directă şi nedistructivă în analizele farmaceutice, odată cu dezvoltarea aparatelor şi a metodelor chemometrice de analiză. Majoritatea studiilor se bazează pe investigarea ingredientului farmaceutic activ şi în consecinţă, bazele de date existente conţin informaţii referitoare la aceste ingrediente. Reletiv recent [23] a fost publicată o bază de date cu spectre Raman ale mediului excipient în care este înglobat ingredientul farmaceutic activ, astfel încât se pot realiza analize complete ale produselor farmaceutice. În ultima perioadă, creşterea cantităţii de medicamente contrafăcute pe piaţă pune în pericol sănătatea cetăţenilor şi ridică un semnal de alarmă. Aceste produse pot fi dăunătoare sănătăţii deoarece conţin impurităţi inodore, pot fi inactive şi/sau să aibă o absorbabilitate scăzută sau chiar inexistentă. De asemenea, aceste medicamente pot conţine alte ingrediente decât cele dorite, cantităţi incorecte ale agenţilor farmaceutici activi sau ambalaje necorespunzătoare. Cu ajutorul spectroscopiei Raman se pot obţine informaţii specifice legate de identificarea ingredientului farmaceutic activ, a mediului excipient, precum şi informaţii utile legate de identificarea elementelor necunoscute [24].

1.6. Aplicaţii în domeniul alimentar
Melamina este un ingredient folosit la obţinerea plasticului, dar este frecvent adăugat în mod abuziv şi în mâncare, pentru a crea impresia falsă a unui conţinut ridicat de proteine, deoarece această moleculă conţine un număr mare de atomi de azot. În anul 2007, aproximativ 1700 de câini şi pisici din SUA au murit ca urmare a consumului de mâncare contaminată cu melamină [25]. În ţesuturile şi urina animalelor moarte au fost detectate, pe lângă melamină, şi cantităţi reduse de acid cianuric, amelina şi amelida, care au rezultat cel mai probabil din descompunerea unor derivaţi ai melaminei [26]. În anul 2008, 54000 de copii au fost intoxicaţi iar 5 au murit ca urmare a consumului de lapte contaminat, produs în China. Mai târziu s-a aflat că melamina a fost introdusă intenţionat în multe alte produse lactate produse în China şi destinate exportului [25]. Spectroscopia Raman a fost utilizată în analizarea melaminei din gluten, hrana pentru pui, prăjituri şi tăiţei [27]. A fost de asemenea identificată melamina din făina contaminată, gluten din porumb, hrana pe bază de soia, lapte praf şi a fost stabilit un algoritm de analiză calitativă şi cantitativă a melaminei din amestecuri [26]. În plus, spectroscopia Raman împreună cu 125

în cadrul grupului care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300. în general şi a celor funcţionalizate. pe lângă faptul că ar detecta particule nedorite. etc. această metodă ar putea oferi informaţii şi despre caracteristicile lor biochimice. Limita de detecţie a melaminei a fost de 1%. fructoza şi β-carotenul. printre tematicile de cercetare ale platformei se regăsesc multe dintre cele prezentate anterior. Spectroscopia Raman a fost de asemenea aplicată la investigarea nanomaterialelor încapsulate în nanotuburi de carbon pentru a determina procesul de umplere a nanotuburilor cu C60.imagistica Raman au fost utilizate pentru o testare rapidă a hranei în vederea detecţiei melaminei pentru a creşte siguranţa şi securitatea publică. Spectroscopia micro-Raman confocală a fost utilizată şi la stabilirea compoziţiei unor sucuri de fructe [28]. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS În prezent. În plus. Prin utilizarea combinată a spectroscopiei Raman cu alte tehnici de analiză se pot obtine informaţii cantitative referitoare la particulele nedorite prezente în sucurile de fructe [29]. monitorizarea apei.7. Astfel. se desfăşoară cercetări interdisciplinare axate pe fabricarea şi biofuncţionalizarea unor nanoparticule de metal nobil. C59N şi antracena. Acest fapt ar permite utilizarea acestei metode pentru monitorizarea on-line a conţinutului acestor substanţe în sucurile aflate în diferite stagii de producţie. 2. Heise şi colaboratorii săi [31] au caracterizat materiale pe bază de carbon utilizând spectroscopia Raman prin compararea spectrelor înregistrate pe filtre cu nanotuburi de carbon. nanotuburi de carbon cu un perete sau cu mai mulţi pereţi. în special [30]. precum şi a unor 126 . microspectroscopia Raman poate fi o metodă de analiză complementară sau alternativă măsurătorilor de turbiditate care sunt de obicei utilizate în industria alimentară în producţia berii. carbon poros grafitizat şi grafit. 1. S-a demonstrat modul în care deschiderea sau închiderea reversibilă a nanotuburilor poate fi utilizată pentru a monitoriza cu succes procesul de umplere [32]. Nanotuburi de carbon Spectroscopia Raman este o metodă consacrată pentru caracterizarea nanotuburilor de carbon. Astfel. În toate aceste studii s-a urmărit banda caracteristică a melaminei de la 676 cm-1. S-a determinat existenţa a trei componente importante ale sucurilor de fructe şi anume pectina.

nanostructuri hibride. ordonate şi dezordonate. 1. O parte a substratelor SERS obţinute. iar în cazul celor dezordonate au fost obţinute diferite tipuri de nanoparticule metalice care au fost asamblate pe substrate solide funcţionalizate/nefuncţionalizate anterior [37-45]. Toate aceste studii contribuie la înţelegerea mecanismelor care stau la baza amplificării SERS. cu scopul de a permite dezvoltarea unor noi aplicaţii spectroscopice şi plasmonice. chitosan. (a) (b) Figura. 44]. Astfel. 42]. 41. mai ales cele constând din nanoparticule de metal nobil. S-a studiat interacţiunea diferitelor biomolecule (triptofan. Selecţie de imagini a substratelor SERS ordonate (a) şi a nanoparticulelor de metal nobil sintetizate (b).) cu nanoparticule metalice de forme şi dimensiuni diferite [39-41. etc. albumină. 1b). O mare parte a activităţii de cercetare este concentrată pe obţinerea de noi substrate SERS. 1) este prezentată o selecţie a tipurilor de substrate SERS ordonate obţinute (Fig. Câteva dintre nanoparticulele obţinute au fost utilizate în aplicaţii biomedicale cu impact în nanomedicină bazate pe proprietăţile optice. În cadrul unui studiu. s-a dovedit a avea proprietăţi multifuncţionale atât ca senzor SERS cât şi ca senzor LSPR [33. în cazul substratelor ordonate s-au folosit nanosfere de polistiren peste care au fost depuse filme metalice [33-36]. proteine şi biopolimeri relevanţi (PEG. folosind metode de auto-asamblare. Prin combinarea imagisticii AFM cu imaginile SERS înregistrate prin microspectroscopie Raman confocală s-a reusit evidenţierea implicării mecanismului plasmonic de amplificare la semnalul de bază SERS [36]. 1a) şi a nanoparticulelor sintetizate şi testate din punct de vedere a capacităţii lor de amplificare a semnalului Raman al unor specii moleculare adsorbite pe suprafaţa lor (Fig. glutation etc. s-a reuşit corelarea activităţii SERS cu topologia substratului cu ajutorul imagisticii Raman [35]. În figura de mai jos (Fig.). 43. chimice 127 .

la animale şi în câteva cazuri şi la oameni. Există numeroase studii în literatură referitoare la utilizarea metodelor spectroscopice complementare Raman şi de absorbţie în IR în analizarea osului şi a cartilajelor. caracteristici care conferă acestui tip de markeri SERS aplicabilitate ca şi agenţi imagistici în interiorul organismelor vii [44]. 47]. şi corelării caracteristicilor spectrale cu modificările care apar datorită vârstei sau a diverselor boli. s-ar putea aborda noi tipuri de experimente bio-medicale de diagnosticare a unor boli cum ar fi cele ale sistemului osos sau arteroscleroza. s-a demonstrat că o serie de nanobastonaşe de aur sau alte nanoparticule de metal nobil anizotrope.şi termice ale nanoparticulelor de aur în detecţia şi tratamentul la nivel celular al cancerului (hipertermie locală indusă laser) sau în evaluarea profilului de toxicitate a nanopartirculelor în medii celulare. Se ştie că 128 . Astfel. pot fi utilizate în terapia fototermică a cancerului [40]. realizându-se şi studii complementare de absorbţie în IR. care constă dintr-o serie de defecte genetice care afectează scheletul. şi osteogeneza imperfectă. 3. Doar în ultimii ani. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS Având în vedere stadiul actual al cercetărilor exploratorii prin spectroscopie Raman precum şi dotările existente în cadrul platformei. Au fost investigate două dintre cele mai importante boli ale oaselor şi anume osteoporoza. Au fost de asemenea efectuate studii de detecţie SERS intracelulare utilizând nanoparticule de aur PEGylate şi marcate cu coloranţi [44] Rezultatele obţinute demonstrează faptul că nanoparticulele prezintă stabilitate. Au fost efectuate numeroase investigaţii cu scopul înţelegerii spectrelor. în grupul de cercetare care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu modulul de microscopie de forţă atomică (AFM) model alpha 300. În majoritatea studiilor spectroscopia Raman a fost acompaniată de imagistica Raman sau AFM. conservându-şi identitatea Raman in vitro. fiind capabile să distrugă Staphylococcus aureus [45]. cercetătorii au considerat spectroscopia vibraţională ca o metodă capabilă să furnizeze informaţii legate de diagnosticarea bolilor care apar la nivelul ţesuturilor muscularo-scheletale [46. o boală metabolică. În cadrul unui alt studiu s-a dovedit că o serie de nanoparticule de argint de formă triunghiulară invelite în chitosan posedă activitate bactericidală. de obicei învelite într-un strat polimeric biocompatibil.

Studii efectuate pe nanostructuri poroase 129 . arteriopatie obliterantă etc. S-a constatat că în principiu metodele spectroscopice vibraţionale pot fi atât un instrument de diagnosticare cât şi o metodă care să monitorizeze progresul tratamentului asupra bolii. ea devine turbulentă şi inegală. elastina. accident vascular cerebral. De asemenea au fost investigate prin spectroscopie Raman efectele de confinare a fononilor optici în materialele nanostructurate [53]. Osteogeneza imperfectă este o maladie genetică al cărei principal semn clinic este fragilitatea osoasă crescută. 47]. În cadrul unui studiu a fost analizată dependenţa deplasării benzilor Raman în funcţie de dimensiunea unor nanocristale [52]. etc. Ele stânjenesc din ce în ce mai mult circulaţia liberă a sângelui prin artera afectată: din laminară şi fluentă. vor exista contribuţii ale fotonilor din afara acestei zone. În prezent. infarct miocardic.).) şi lipidelor. deoarece absenţa periodicităţii la dimesiuni sub cele ale particulei relaxează regulile de selecţie ale fononilor optici în regiunea centrală a zonei Brillouin şi prin urmare. Arteroscleroza stă la baza apariţiei majorităţii bolilor cardiovasculare (angina pectorală. Aceste modificări ale structurii sunt reflectate în spectrele Raman şi IR ale probelor [46. actina. Metodele spectroscopice vibraţionale sunt capabile să identifice ţesuturile anormale afectate de această boală [48]. Metodele spectroscopice complementare Raman şi de absorbţie în IR sunt capabile să coreleze informaţiile histopatalogice ale unei aorte afectate de arteroscleroză cu compoziţia chimică a unei aorte sănătoase [49-51]. maladia se tratează medical cu aminobisfosfonaţi iar spectroscopia poate juca un rol important în urmărirea progresului tratamentului. prin depunerea de calciu se formează plăcile ateromatoase.un os afectat de osteoporoză are un grad de cristalinitate crescut şi un domeniu mai îngust de cristalinitate decât osul sănătos. în spectrul Raman. Aceste plăci se formează datorită colesterolului şi grăsimilor prezente în cantităţi excesive în sânge (datorită greşelilor de alimentaţie) care se "infiltrează" în pereţii arterelor. spectroscopia Raman s-a dovedit a fi o metodă fezabilă în studiul materialelor nanostructurate. Această boala apare ca urmare a mutaţiilor de la nivelul genelor care codifică producerea de colagen tip I. În ultima perioadă. Ea se datorează prezenţei aşa-numitelor plăci ateromatoase pe pereţii arterelor. În timp. manifestată în special prin fracturi la nivelul oaselor lungi. Se pot monitoriza benzile caracteristice proteinelor (colagen. şi se pot localiza plăcile ateromatoase prin prezenţa benzilor caracteristice carbonatului de calciu [49-51]. cardiopatie ischemică. Această confinare duce la modificări ale spectrului de vibraţie al materialelor nanostructurate în comparaţie cu cel al materialului bulk.

M. Bom. sculpturi. Baia. J. textile. utilizate în artifacte ca de exemple manuscrise. Nafie. 23982. Baia. presupuse a fi lucrări medievale autentice. Acest lucru a fost confirmat cu ajutorul microspectroscopiei Raman [57]. Astilean. B 106. 4. L. M. A. 853. printre tematicile de cercetare care ar putea fi abordate în viitor s-ar putea regăsi atât studiul unor materiale nanostructurate de tipul nanofirelor şi a filmelor nanostructurate cât şi al unor obiecte din patrimoniul cultural. Haynes. În acest mod. 130 . Sackmann. 2010. P Van Duyne. B 110. de la pigmenţi anorganici la biomateriale. s-au dovedit a fi pictate la sfârşitul secolului al 19-lea sau începutul secolului 20. ceramici.Bibliografie 1. pot fi diferenţiate operele de artă veritabile de cele contrafăcute sau falsificate. Part IV. S. având în vedere aceste considerente şi ţinând seama de echipamentele existente în cadrul platformei. R. picturi. spectroscopia Raman. 2006. 2. J. A. Popp. Metoda este prezentă în departamentele de conservare şi restaurare a celor mai recunoscute muzee şi librării din lume şi este utilizată pentru identificarea unor materiale. a devenit o metodă de investigare extrem de utilă în domeniul patrimoniului cultural. A. Phys. Nanostructured Gold Surfaces as 3. 41. monumente de piatră [56]. J. 2002. Chem. Raman Spectrosc. C. Cu ajutorul acestei metode se obţin informaţii despre compuşii moleculari aflaţi în probele supuse analizei. Balster. Gold Films Deposited over Regular Arrays of Polystyrene Nanospheres as Highly Effective SERS Substrates from Visible to NIR. Recent advances în linear and nonlinear Raman spectroscopy. Chem.semiconductoare au dovedit faptul că în cazul unor unităţi structurale de câţiva nanometri. un număr de cinci picturi în miniatură achiziţionate de Muzeul Victoria şi Albert în 2008. L. Materny. Li şi colaboratorii săi [58] au realizat analiza decoraţiunilor şi au identificat pigmenţii folosiţi la decorarea unui covor chinezesc din secolul al 5-lea cu ajutorul tehnicilor complementare micro-Raman şi FT-IR. McFarland. Studii Raman ale nanofirelor sau nanoconurilor de GaP au dovedit faptul că există o dependenţă între intensitatea spectrală şi caracterul spaţial al radiaţiei Raman împrăştiate şi dimensiunea. aşa cum au fost observate în cazul şi sau Ge poros. J. Metal Film over Nanosphere (MFON) Electrodes for Surface-Enhanced Raman Spectroscopy (SERS): Improvements în Surface Nanostructure Stability and Suppression of Irreversible Loss. T. S. acompaniată în ultimii ani de microscopie şi de tehnica SERS. D. A. Dick. efectele de confinare pot fi utilizate pentru a determina dimensiunea acestora [54]. Astfel. 1566. Pe de altă parte. forma şi compoziţia nanofirelor [55]. Phys. De exemplu. 4. L. sticle. L.

1652. H. Zanchet. Remon. Majumder. InTech. 515-522. McEwen. P. Khan. 10. T. 15. O. Lui. Lewandowska. A. The Hallmarks of Cancer. Harz. H. Raman Spectrosc. 297. ch. Santos. J. Biophys. J. 16. H. McLean. G. K.. New Developments în Biomedical Engineering. 85. 2009. M. A. 10. Peschke. Puppels. în vivo nonmelanoma skin cancer diagnosis using Raman microspectroscopy. R. J. Lieber. T. Lin. D. C. (CRC Press. Petry. B. A. Zeng. P. McLean. 17.. A dielectrophoretic chip with a roughened metal surface for on-chip surface-enhanced Raman scattering analysis of bacteria. Reference database of Raman spectra of pharmaceutical excipients. Size-dependent SERS enhancement of colloidal silver nanoplates: the case of 2-amino-5-nitropyridine. Motzkus. 40. Rocha. 2009. Cell 100. Y. 2009. Witkowski. Williams. Combined în Vivo Confocal Raman Spectroscopy and Confocal Microscopy of Human Skin. L. pp. Identification of micro-organisms by Raman spectroscopy. 461. 9902. Notingher. Online monitoring and identification of bioaerosols (OMIB). S.. J. Skin Res. Vandenabeele. Roesch.-Y. 455-474. 89–165.1117/2. Ed. Caspers. 2010. Barry. Applications and Education A. 277. I. 86. 40. S. Combined AFM/Raman microspectroscopy for characterization of living cells în near physiological conditions.-Y. I. Qian. D.5. 2006. Int. D. Lankers. M.-D. Sensors. Raman Spectrosc. A. Fourier transform Raman spectroscopy a novel application for examining human stratum corneum. Lucassen. Shen. 2010. 40. C.-L. H. J. J. A. H. Cheng. D. Zeng. 2007.A.. 13. A. Billheimder. Lasers în Surgery and Medicine. M. 20. Chem Soc Rev. M. Chem. Krause. Hogan. 30:1–30:27.-C. H. 912. 19. de Veij. B. pp. Yu. R. Z. J. Burkhardt. Mahadevan-Jansen. Wiley-VCH.. T. 38. Zhou. R. Raman Spectrosc. J. Mahadevan-Jansen. 1539. Microscopy: Science. Riesenberg. S. 9.-W. Integrated real time Raman system for clinical în vivo skin analysis. R. Gold-coated zinc oxide nanowire-based substrate for surface-enhanced Raman spectroscopy. Huan. G. J. 2003). Raman Spectrosc. 14. Moens. D. 81. M. R. Biophotonics: Vision for a better Health Care. C. Zhao. 40. Díaz (Eds. Raman Spectrosc. P. 2008. I. 1343. 7. J. G. Edwards. H. C. HightWalker. D. Pisarek. 81. 2008. M. I-F. J. A. G. Anal.. 8. Wu. 484. SPIE Proceeding. A.1200708.-C. Chang. And Tech. R. P. P. Temperini. Janik-Czachor. 22. Thiele. E. Schmautz. A. Zhao. 2000. H. H. M. Weinberg. Raman Spectrosc. 57. J. 2009. R. Reproducible Substrates for Surface Enhanced Raman Spectroscopy. 37. 21. X. M. H. H. A. 12. Roguska. Wu. A.Wuttig. Hofer. pp. Surface-enhanced Raman spectroscopic detection of a bacteria biomarker using gold nanoparticle immobilized substrates.-Q.-W. Lin. N. Hanahan. Vo-Dinh. De Beer. Raman Spectroscopy Cell-based Biosensors. 23. 2008. A. 40. 2007. G. Single-molecule and single-nanoparticle SERS: from fundamental mechanisms to biomedical applications. H. Surface-enhanced Raman scattering spectroscopy via gold nanostars. S. L. în Biomedical Photonics Handbook. J. 6. R11. 14. The use of Raman spectroscopy în the detection of counterfeit 131 . S. Raman investigations of TiO2 nanotube substrates covered with thin Ag or Cu deposits. T. 034104. 2009. Ellis. M. Kudelski. Schuele. Popp. 11. Ronneberger. M. 7. 24. Ed. Shanker. 40. P. Lui. 572. 183. Nie. M.. 18. Pharm. pp.0856. Sant’Ana. Esenturk. D. Biomicrofluidics 4. Domenico Campolo. Popp. 1992. 2009. FORMATEX 2010. Méndez-Vilas and J. Dolata. Technology. Cheng. Washington DC.-L. M. 2003. M. D.Weinheim.).

11717. Nanopart. Gabudean. Tuschel. D. 32. Yang. Astilean. Simon. 33. Graupner. Astilean. J. Farcau. Schaman. Raman Spectrosc. Farcau . Phys. and Processed Foods Using Surface Enhanced Raman Spectroscopy and HPLC. R. Ojha. V. Mustapha. Nanotechnology 21. S. Canpean. D. 73. 1444. G. J. 35. 2009. Localized surface plasmon resonance (LSPR) and surface-enhanced Raman scattering (SERS) studies of 4-aminothiophenol adsorption on gold nanorods. Multilayer Structures of Self-Assembled Gold Nanoparticles as a Unique SERS and SEIRA Substrate. H. 2011. S. Astilean. Awika. Y. S. Heise. Res. Raman Spectrosc. P. C. Gabudean. Appl. A. Kuckuk. C. S. D. A. Lin. C. 39. 406. fluorescence. Y. 21. S. J. 12. Sect. M. The study of Raman enhancement efficiency as function of nanoparticle size and shape. S. Nucl. 34. Griffiths. Solution-phase. C. Toderas. Appl. R. Chem. W. K. F. Detection of Melamine în Gluten.and multi-walled nanotubes. Silver half-shell arrays with controlled plasmonic response for fluorescence enhancement optimization. single. graphitised porous carbon and graphite. 2049. Mater. A. B 267. 2007. 30. S. Astilean. 193110. 41. Astilean. Evidence of a surface plasmon-mediated mechanism în the generation of the SERS background. Raman scattering from nanomaterials encapsulated into single wall carbon nanotubes. Public-health risks of melamine în milk products. M. M. Methods Phys. M. Chan. 38. Zenone. Mol. Lancet. Boca. N. 29. He. 704. 2008. Potential of Raman spectroscopy and imaging methods for rapid and routine screening of the presence of melamine în animal feed and foods. 2843. Wiley: New York. H. 28.. 95. Hasi.. Mapping the SERS Efficiency and Hot-Spots Localization on Gold Film over Nanospheres Substrates. Lab Chip 9. Detoxification of gold nanorods by conjugation with thiolated poly(ethylene glycol) and their assessment as SERS-active carriers of Raman tags. T129. Focsan (Iosin). Astilean. L. 2009. L. Raman Spectrosc. Struct. 477. Chao. G. Camerlingo. A. D. 993. Commun. P. H. Gabudean. Farcau. V. L. Characterisation of carbonaceous materials using Raman spectroscopy: a comparison of carbon nanotube filters. M. O. 40. Multivariate Calibration. Tagmatarchis. J. 31. ChemPhysChem 10. Srivastava. C. Chen. F. K. J. Plank. Delfino. Liu. Res. Boca. Formation 132 . Li. S. Sensors. Maniu. 2009. Maniu. Astilean. 2010. Baia. Olkhovyk. I. 26. Pfeiffer. R. 38. 673. Chem C 114. C. 43. Pagona. S. J. S. 2010. R. J. Multifunctional plasmonic sensors on low-cost subwavelength metallic nanoholes arrays. 42. S. Chem. Astilean. 2009. Mita. January/February 2005. Lepore. 2010. Farcau. M. Study of tryptophan assisted synthesis of gold nanoparticles by combining UV–Vis. Investigation on Clarified fruit juice composition by using visible light micro-Raman spectroscopy. Ledoux. J Food Sci. B. D. F. 2007. 3861. H. Astilean. S. 235601. Iosin. M. W. Phys. Diano. M. 47. Kim. Spectrosc. dual LSPR-SERS plasmonic sensors of high sensitivity and stability based on chitosan coated anisotropic silver nanoparticles. A. Canpean. Asthana. 36. 1106. 3574. G. Ch. 2009. V. N. 1993. 37. M.. Y. American Pharmaceutical Review. 7. 2008. S. Rotas.25. 2007. 40. 344. Astilean. S. A. 38. T. Baia. Biro. 2011. 3625. Kuzmany. M. Astilean. Chicken Feed. 2011. J. E. Instrum. Srivastava. 420. and SERS spectroscopyJ. 63. 372. Potara. Noes. F. 27. S. Baldeck. Martens. and adulterated pharmaceutical products. Lett. R. Raman spectroscopy of covalently functionalized single-wall carbon nanotubes. D. Priore. 2009.

P. Fang. Ricci. 2007. 46. J. Hark.133-173. L. Shi. Nabet. C. S. D. 48. B. 1341. . 2011. T. Mat. Edwards. 38. Morris. M. Damert. Elsevier 2009. Raman Spectrosc. A. N. A. Salis. Astilean.-J. 38. E. Raman spectroscopy study of atherosclerosis în human carotid artery. în situ investigation of the chemical composition of ceroid în human atherosclerosis by Raman spectroscopy. L. A. Astilean. 133 . J. M. M.. Smukler. 40. Identifying chemical changes în subchondral bone taken from murine knee joints using Raman spectroscopy. Popescu. Anedda. X. Inverse Spatially Offset Raman Spectroscopy for Deep Noninvasive Probing of Turbid Media. A. Nanotechnology 22. A. Rugina. pp. J. 060502. of size and shape tunable gold nanoparticles în solution by bio-assisted synthesis with bovine serum albumin în native and denaturated state. He. A. K. Chem. 2007. Morris. V. Potara. Q. 2011. Biomed. 939. R. Jelicks. T. 51. Biomed. 57. 055702. Jr. 33.-M. Pasqualucci. 10. G. Ravindran. characterization and their application as SERS-active tags inside living cells. Spectrosc. 7 5321A-11 (p. T. 49. A. Rousseau. Appl. T. Pintea. M. A. Raman Spectroscopy. C.-Y. 60. J..G. K. G. Nogueira. 45. 1911. 56. C. Dooley. B. S. P. 2031. A. H. E. Y. C. J. Yeh. 604.. Raman Spectrosc. “Raman Spectroscopy în Art and Archaeology: A New Light on Historical Mysteries” în Frontiers of Molecular Spectroscopy. L.M. J. H. Rajalakshmi. J. Elucidation of the atherosclerostic disease process în apo E and wild type mice by vibrational spectroscopy. J. Naudin. 55.. C. Xie. B.. Valenzuela. 2005. Y. Boca. 60. A. Pigment identification and decoration analysis of a 5th century Chinese lacquer painting screen: a micro-Raman and FTIR study. Zângaro. Silveira. Spanier. Applied Spectroscopy. 697. Burgio. 40. Raman spectroscopy of optical phonon confinement în nanostructuredmaterials. M.1 of 9). Nanotechnology 22. M. Transcutaneous fiber optic Raman spectroscopy of bone using annular illumination and a circular array of collection fibers. 544. Spectroscopic investigation of modern pigments on purportedly medieval miniatures by the "Spanish Forger". R. M. Clark. Li. Schulmerich. 2006.-S. Vanasse. Dehring. J. 129. W. M. A. T. Raman Spectrosc. An analytical form for the Raman shift dependence on size of nanocrystals. Flower-shaped gold nanoparticles: synthesis. 58. Laane Ed. Opt. S. K A. 64. Matousek. Canpean. Puppels. G. Chavantes. J. J. Roessler.-L. R. Arora. J. Sivasubramanian. J. D.. O. Crane. 2002. 135101. E. 52. J. V. 2011. Martin. J. Phys. Irmer. 2006.SPIE 2004. Raman Spectrosc. 031117. L. van de Poll. Jakab. 50. 38.44. Yang. T. D. R. A. D. 47. 2009. V. Optics. 2007.. Wang. Pacheco. Barbu-Tudoran. Adar. J. 1134. van der Laarse. On the Raman scattering from semiconductor nanowires. V. 634. 54. L. 2006. R. P. Raman Spectrosc. 2009. C. 2009. Raman Spectrosc.-F. 53. 11. Raman scattering of nanoporous semiconductors. Laim. D. Bakker Schut. Cao. Synergistic Antibacterial Activity of Chitosan–Silver Nanocomposites on Staphylococcus Aureus. S. F. S. Goldstein. M.. V. S. 40. McHugh. L. R.

........... Introducere Materia este formată din electroni.................... 146 1............................................ 134 2.... ci sunt sarcini pozitive şi negative ce formează dipoli şi multipoli electrici.................................... Aceste sarcini nu sunt doar sarcini izolate (monopoli)...... Oscilatorul armonic ........... nuclee... Nicolae Leopold Cuprins 1................................. 135 3......... Instrumentaţia şi metodologia obţinerii spectrelor IR ...... Reguli de selecţie pentru spectroscopia IR ..... Legea Lambert-Beer .......... o moleculă................................... cum ar fi un atom. În unda de lumină............... Bibliografie .. 139 6........... În interacţiunea luminii cu materia. 137 4...... Fiecare subdiviziune a materiei...................................... dr. 138 5.... câmpul electric (şi într-o măsură mai mică şi cel magnetic) al undei electromagnetice poate să modifice distribuţia de sarcină şi în acest fel să inducă un moment de dipol................................................ Introducere ......................................................................................................................... ceea ce înseamnă că modificarea distribuţiei de sarcină va avea loc 134 ....... sau un solid prezintă o distribuţie de sarcină specifică................ SPECTROMETRUL IR Spectroscopia de absorbţie în infraroşu Lect...............IV..... câmpul electric oscilează cu o frecvenţă de aproximativ 1015 Hz.................................................. ioni pozitivi şi negativi....... Moduri de vibraţie .............................. 141 7............

la rându-i. O regulă simplă de simetrie este aşa numita “regula excuziunii mutuale”. Numărul modurilor de vibraţie posibile al unei molecule poate fi determinat din numărul atomilor N din moleculă şi geometria moleculară. Benzile vibraţional-rotaţionale sunt observate doar când proba se află în stare de gaz. Gradele de libertate rămase corespund numărului modurilor de vibraţie: 3N-5 pentru molecule liniare. Astfel. Molecula are aşadar 3N grade de libertate. De vreme ce distribuţia de sarcină este specifică pentru un anumit tip de materie. urmate de tranziţia în stări de energie mai mari. Aceste procese. acele vibraţii care duc la o modificare a polarizabilităţii moleculare vor fi active Raman. sunt în tratarea clasică procesele de bază ale fiecărei metode spectroscopice. sau generarea unui foton când sistemul trece de la o stare energetică ridicată la una joasă. precum un dipol oscilator poate genera. precum şi spectroscopia Raman oferă informaţii despre modurile vibraţionale şi vibraţional-rotaţionale ale moleculelor. şi 3N-6 pentru moleculele neliniare. În teoria cuantică. trei dintre aceste grade fiind folosite pentru specificarea mişcării de translaţie a moleculei în spaţiu. activitatea unui mod vibraţional depinde de simetria lui şi de simetria moleculei. 135 . Conform acesteia. unde moleculele se pot roti liber. oferind informaţii unice despre materie. în cazul moleculelor cu centru de simetrie. ca fotonii să interacţioneze cu materia este descrisă de aşa numita “secţiune eficace “ a efectului spectroscopic. pot fi observate doar frecvenţele de vibraţie ale probei. În fazele condensate (lichidă sau solidă). modificări (oscilaţii) ale distribuţiei de sarcină. Moduri de vibraţie Spectroscopia de absorbţie în infraroşu. procesele sunt descrise de anihilarea unui foton. Pe de altă parte. IR şi Raman. molecula unei anumite substanţe de exemplu. un câmp electric. În funcţie de simetria moleculei. O vibraţie va fi activă IR dacă are loc o variaţie a momentului de dipol în timpul vibraţiei. schimbul de energie între unda electromagnetică şi materie este de asemenea specifică. Probabilitatea specifică. şi invers. ce apar la interacţiunea luminii cu materia. pe scurt spectroscopia IR. În schimb. vibraţiile active Raman nu sunt active IR.cu aceeaşi frecvenţă în materie. şi alte două (molecule liniare) sau trei (molecule neliniare) grade sunt necesare pentru a specifica mişcarea de rotaţie. cele două tehnici. 2. pot fi privite ca fiind complementare. Geometria moleculară este specificată de coordonatele carteziene ale fiecărui atom.

De exemplu, vibraţiile fundamentale ale moleculei de apă, H2O, sunt prezentate în Figura 1. Apa, fiind o moleculă neliniară prezintă trei vibraţii fundamentale:

întindere simetrică

întindere asimetrică

deformare (forfecare)

Figura 1. Moduri de vibraţie de întindere şi deformare ale H2O.

Dioxidul de carbon, CO2, este o moleculă liniară, astfel că va prezenta patru vibraţii fundamentale (Figura 2). Vibraţia de întindere asimetrică a CO2 generează o bandă intensă în spectrul IR la 2350 cm-1. De menţionat este că această bandă se observă de regulă în spectrul IR al background-ului, datorită prezenţei CO2 în atmosferă.

întindere asimetrică

deformare (forfecare) perpendiculară pe planului foii

întindere simetrică

deformare (forfecare) în planul foii

Figura 2. Moduri de vibraţie de întindere şi deformare ale CO2.

Cele două vibraţii de deformare (forfecare) sunt echivalente, vibraţia acestora având loc la aceeaşi frecvenţă, fiind astfel numite degenerate, şi apar în spectrul IR la 666 cm-1. Vibraţia de întindere simetrică a CO2 este inactivă IR deoarece această vibraţie nu produce modificare în momentul de dipol al moleculei.

136

3. Oscilatorul armonic
Cel mai simplu model pentru vibraţia unei molecule diatomice este oscilatorul armonic. În acest model se consideră cei doi atomi de mase m1 şi m2 ai moleculei legaţi printr-un resort elastic. Descrierea matematică a mişcării de vibraţie a acestor două corpuri cu masele m1 şi m2 poate fi simplificată prin considerarea unui singur corp cu masa redusă µ=m1*m2/(m1+m2), ce oscilează în jurul centrului de masă al moleculei biatomice, într-un câmp potenţial de tipul kx2/2.

Figura 3. Modelul oscilatorului armonic pentru molecula diatomică. Variaţia energiei potenţiale cu distanţa internucleară.

Din punct de vedere fizic, aşa cum se poate deduce din Figura 3, o energie mai mare a oscilatorului armonic corespunde unei amplitudini mai mari a oscilaţiei, frecvenţa fiind aceeaşi pentru toate nivelele de energie. Energiile vibraţionale cuantificate se obţin în urma rezolvării ecuaţiei Schrödinger pentru oscilatorul armonic: Ev=hν(v+

1 ) , v=0,1,2…. 2

(1.1)

unde v este numărul cuantic de vibraţie, ν este frecvenţa de vibraţie şi h este constanta lui Planck. Frecvenţa de vibraţie a oscilatorului armonic depinde de puterea legăturii (constanta de forţă a legăturii k) şi masa redusă µ: ν=

1 2π

k

μ

(1.2)

137

Nivelele de energie vibraţionale sunt la distanţe egale (echidistante) în modelul oscilatorului armonic, diferenţa între două nivelele de energie adiacente E fiind: ΔE=hν=ћ k μ (1.3)

4. Reguli de selecţie pentru spectroscopia IR
O moleculă diatomică va absoarbe radiaţie IR numai dacă momentul ei de dipol se modifică în urma variaţiei distanţei internucleare. Probabilitatea de tranziţie depinde de diferenţa de populaţie ΔN dintre două stări cuantice şi pătratul momentului de dipol al tranziţiei, M: probabilitatea de tranziţie ~ ΔN M
2

(1.4)

unde, pentru o moleculă aflată într-o stare electronică dată, momentul de dipol al tranziţiei pentru o tranziţie vibraţională este dat de:
* (e) M= Ψν " μ 0 Ψν ' d τ

(1.5)

Funcţiile de undă ψ ν " şi ψ ν ' reprezintă stările vibraţionale finală şi respec(e) tiv iniţială, iar μ 0 este momentul de dipol electric permanent în această stare electronică. Pentru vibraţia unei molecule diatomice, momentul de dipol electric permanent poate fi extins într-o serie Taylor după distanţa internucleară de echilibru re :

∂μ ⎞ (e) =µe+ ⎛ μ0 ⎜ ⎟ q+ ⎝ ∂r ⎠ re

1 2

⎛ ∂ 2 μ ⎞ q2+ … ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

(1.6)

Aici q=r-re, iar r este distanţa internucleară la un moment dat, şi µe este momentul de dipol când legatura se află în poziţia de echilibru. Probabilitatea apariţiei unei tranziţii vibraţionale într-o moleculă diatomică poate fi obţinută substituind forma extinsă a momentului de dipol electric permanent în ecuaţia momentului de dipol pentru tranziţia vibraţională:

∫ Ψν

*
'

(e) μ0 Ψν d τ =
'

* µe Ψν " Ψν ' d τ + ⎜

⎛ ∂μ ⎞ 1 * ⎟ ∫ Ψν ' q Ψν d τ + 2 ⎝ ∂r ⎠ re
'

⎛ ∂2μ ⎞ ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

∫ Ψν

*
"

q2 Ψν ' d τ + … (1.7)

138

Primul termen din această ecuaţie este egal cu zero de vreme ce funcţiile de undă vibraţionale ψ ν " şi ψ ν ' sunt ortogonale. Al doilea termen este diferit de zero doar dacă momentul de dipol depinde de distanţa internucleară r

⎛ ∂μ ⎞ ⎜ ⎟ ≠0 ⎝ ∂r ⎠

(1.8)

De aceea, moleculele biatomice prezintă absorbţie vibraţională în spectrul IR doar atunci când există o modificare a momentului de dipol în cadrul mişcării de vibraţie. Moleculele diatomice homonucleare au momentele de dipol zero pentru toate lungimile legăturilor, astfel nu prezintă spectru de absorbţie vibraţional. Astfel, teoria mecanicii cuantice specifică faptul că absorbţia luminii infraroşii va apărea doar dacă un mod vibraţional implică o modificare a momentului de dipol şi că nivelele de energie vibraţionale în moleculă sunt cuantificate. Teoria ne spune de asemenea şi faptul că tranziţiile pot avea loc doar între nivele de energie adiacente, deoarece integrala din cel de-al doilea termen pentru polinoamele Hermite care descrie funcţia de undă a oscilatorului armonic, este diferită de zero doar dacă Δv= ± 1.

5. Legea Lambert-Beer
Domeniul spectral IR al radiaţiei electromagnetice este poziţionat între domeniul vizibil şi cel al microundelor. Prin convenţie, domeniul spectral IR este subdivizat în domeniul IR apropiat (Near Infrared Region - NIR), IR mijlociu (Mid Infrared Region - MIR) şi IR îndepărtat (Far Infrared Region FIR) (Figura 4). Spectrele IR discutate în această lucrare sunt toate din domeniul spectral MIR.

Figura 4. Domeniile spectrului electromagnetic şi subdiviziunile domeniului IR.

139

Spectrul IR se obţine prin înregistrarea intensităţii radiaţiei în lipsa probei de analiză (spectrul background) şi a intensităţii radiaţiei IR după ce aceasta trece prin probă. În urma trecerii prin probă, intensitatea fasciculului se va atenua datorită absorbţiei de radiaţie de către analit, precum şi a împrăştierii radiaţiei la interfaţa şi în interiorul probei (Figura 5a). Astfel, spectrul IR reprezentat va fi dat de mărimea: T= Is/IR unde, T este transmitanţa, Is intensitatea radiaţiei IR după, iar IR înainte de a traversa radiaţia proba. Valorile transmitanţei sunt între 0 şi 1, sau 0–100% pentru transmitanţa exprimată în procente. Între transmitanţă şi concentraţia unui compus relaţia este logaritmică. De aceea, pentru o reprezentare mai convenientă, în majoritatea cazurilor, în locul transmitanţei se foloseşte o altă mărime, absorbanţa A:

A = lg

1 = − lg T T

Relaţia dintre transmitanţă şi absorbanţă în funcţie de concentraţie este reprezentată în Figura 5b

Figura 5. (a) Atenuarea unui fascicul de radiaţie la refelexia interfeţei probei, împrăştierea de către particule şi absorbţia analitului. (b) Relaţia dintre transmitanţă, T, şi absorbanţă, A, în funcţie de concentraţia unui compus ipotetic.

În mod independent, Bouguer în 1729 şi Lambert în 1760, au stabilit că la concentraţie constantă, absorbanţa este direct proporţională cu grosimea probei, iar Beer în 1852 a observat că dacă grosimea probei este constantă, absorbanţa este proporţională cu concentraţia. Combinarea acestor observaţii a dus la legea Lambert-Beer, ce exprimă absorbanţa: 140

(I.2) unde a este absorbtivitatea – o constantă de proporţionalitate a moleculei la o lungime de undă specifică, d este lungimea drumului optic prin probă, iar c reprezintă cocentraţia substanţei analizate. Concluzionând, spectroscopia IR oferă atât informaţii moleculare calitative, prin modurile de vibraţie specifice fiecărei molecule, cât şi informaţii cantitative, aşa cum rezultă din legea Lambert-Beer.

A = a⋅d ⋅c

6. Instrumentaţia şi metodologia obţinerii spectrelor IR
Odată cu introducerea spectroscopiei transformată Fourier (FTIR) principalele dezavantaje ale spectroscopiei ”clasice” dispersive IR au putut fi înlăturate. Pe scurt, spectroscopia FTIR nu mai înregistrează intensitatea la fiecare lungime de undă, în mod secvenţial, la o lungime de undă după alta, şi de asemenea, spre deosebire de spectrometrele dispersive nu necesită prismă sau reţea de difracţie monocromatoare, unde apar pierderi majore în energia emisă de sursa IR la trecerea prin diferite fante de intrare şi ieşire. În spectroscopia FTIR, se aplică modularea interferometrică a radiaţiei (Figura 6). Pentru aceasta, un divizor de undă, de regulă din KBr acoperit cu un film de germaniu, împarte radiaţia în două fascicule, un fascicul fiind direcţionat către o oglindă fixă, iar celălalt fascicul către o oglindă mobilă (Figura 6). Aceste două fascicule sunt reflectate înapoi pe divizorul de undă, după care se recombină, intensitatea fasciculului variind în timp, datorită alternării interferenţei constructive şi destructive în funcţie de diferenţa de drum optic dintre cele două oglinzi, la fiecare moment de timp. Astfel, fiecare parcurs al oglinzii mobile este caracterizat de o interferogramă în funcţie de timp. Diferenţa de drum δ este proporţională cu timpul t, deoarece oglinda mobilă se deplasează cu viteză constantă v, astfel că δ = 2vt. Prin folosirea unui algoritm de transformată Fourier rapidă (Fast Fourier Transform - FFT algorithm), interferograma în funcţie de timp, I(δ), este convertită într-o interferogramă în funcţie de frecvenţă, I( v ), folosind următoarea relaţie:

I (δ ) = 0.5 H (v ) I (v ) cos 2πvδ I (δ )
unde H( v ) este un factor de corecţie dependent de numărul de undă şi de caracteristicile spectrometrului. Interferograma convertită în domeniul frecvenţelor se numeşte spectru de tip single-beam.

141

IR-light source

Figura 6. Spectrometrul FTIR. (a) Schema bloc a componentelor de bază ale unui spectrometru IR. (b) Principiul de funcţionare a unui interferometru Michelson format din sursă de lumină, divizor de undă, oglindă fixă, oglindă mobilă, detector şi probă (panel sus). Oglinda mobilă a interferometrului (panel sus) produce un semnal sinusoidal la detector pentru fiecare frecvenţă modulată (panel central). Pentru sursa IR, cu domeniu spectral de frecvenţe larg, semnalele modulate se suprapun şi formează o interferogramă complexă (panel jos).

Spectrometrele FTIR prezintă mai multe avantaje faţă de instrumentele convenţionale IR dispersive, incluzând o îmbunătăţire dramatică a raportului semnal-zgomot (S/N), obţinută prin multiplexare (detectarea simultană a tuturor frecvenţelor), reducerea timpului de scanare, precum şi un câştig mai mare în energia radiativă. Un alt avantaj important este reproductibilitatea excelentă în lungimea de undă a spectrometrelor FTIR, datorită utilizării unui laser de referinţă intern (de regulă HeNe, 632.8 nm ), ceea ce permite manipularea datelor spectrale, cum ar fi scăderea, adunarea sau scalarea spectrelor cu un grad foarte ridicat de acurateţe. De asemenea, progresul spectroscopiei FTIR a fost facilitat şi de dezvoltarea calculatoarelor personale, ce permit utilizarea de programe soft complexe, pentru aplicaţii calitative şi cantitative. Pentru partea practică a acestei lucrări, spectrele au fost înregistrate cu un spectrometru Jasco FTIR-6200 cuplat cu un microscop IR Jasco IRT-5000 (Figura 7). 142

Figura 7. Aparatura IR Jasco: spectrometrul FTIR-6200 şi microscopul IRT-5000.

Principalele părţi componente ale spectrometrului FTIR sunt sursa de emisie, interferometrul şi detectorul. Sursa de emisie IR este componenta cea mai simplă a instrumentului, constând într-un filament incadescent (10000C). Interferometrul este de tip Michelson, iar parcursul maxim al oglinzii mobile determină rezoluţia spectrală a spectrometrului. Alegerea detectorului este legată de aplicaţiile abordate. Astfel dacă se urmăreşte de exemplu cinetica unei reacţii chimice, este absolut necesară folosirea unui detector de tip MCT (Mercury Cadmium Telluride). Acestea sunt de două tipuri: MCT A, detector de foarte înaltă sensibilitate în domeniul spectral 650-7800 cm-1 ce permite înregistrarea rapidă a spectrelor (până la ns), şi MCT B, detector de înaltă sensibilitate în domeniul spectral 400-7800 cm-1, de asemena pentru înregistrări rapide. De menţionat că detectoarele MCT necesită răcirea cu azot lichid. Detectoarele de tip DTGS (Deuterated L-Alanine doped Triglycene Sulphate) lucrează la temperatura camerei într-un domeniu spectral larg 10-7800 cm-1, însă sensibilitatea acestora este de până la două ordine de mărime mai mică faţă de detectoarele MCT. De menţionat însă că domeniul spectral de detecţie al spectrometrului este limitat de fereastra din faţa detectorului (de regulă KBr) precum şi de divizorul de undă (beamsplitter, de regulă din KBr acoperit cu un strat de Ge), astfel că spectrometrele IR uzuale nu permit înregistrarea spectrelor sub 400 cm-1. Spectrometrul FTIR-6200 permite înregistrarea spectrelor IR în modul transmisie, pentru acest mod fiind necesară prepararea în prealabil a probe143

lor sub formă de dispersie în pastile KBr. Tot pentru măsurători IR în transmisie se poate presa proba între două discuri/ferestre dintr-un material ce nu absoarbe (este transparent) în domeniul IR mijlociu, de exemplu ZnSe, Si, Ge, KBr etc. Microscopul IRT-5000 este dotat cu un obiectiv tip Cassegrain şi unul de tip ATR (Attenuated Total Reflectance). Obiectivul de tip Cassegrain se pretează doar pentru probe plane (filme, suprafeţe lucioase etc.). În prealabil, la folosirea obiectivului Cassegrain, se înregistrează spectrul background prin focalizarea pe oglinda de aur, un accesoriu din dotare. Modul de analiză ATR (Attenuated Total Reflection) este utilizat pentru investigarea probelor lichide şi solide. De asemenea, modul ATR se pretează pentru caracterizarea materialelor care sunt fie prea groase sau prea puternic absorbante pentru a fi analizate prin spectroscopie în transmisie. În modul de analiză ATR, radiaţia IR trece printr-un cristal transparent în infraroşu, cu un indice de refracţie ridicat, astfel că fasciculul IR va efectua reflexii interne succesive în cristalul ATR, aşa cum este prezentat schematic în Figura 8.

Figura 8. Prezentare schematică a tehnicii de analiză ATR-IR.

În vederea analizei, suprafaţa probei este presată astfel încât să fie în contact optic cu suprafaţa superioară a cristalului ATR. La reflexia internă a fasciculului, aşa numita undă evanescentă IR pătrunde în afara cristalului ATR, astfel că o mică parte din radiaţie penetrează proba. În modul de analiză ATR nu este necesară o preparare în prealabil a probei în vederea analizei. Dezavantajul constă în limitarea spectrală datorită cristalului ATR, de exemplu pentru un cristal ATR din ZnSe spectrele se pot înregistra începând de la 650 cm-1. De regulă, în prealabil, la folosirea modului ATR, se înregistrează spectrul background al atmosferei, cristalul ATR fiind în aer. Folosind microscopul IRT-5000 în modul de analiză ATR, au fost înregistrate spectrele FTIR/ATR a următoarelor substanţe de interes farmaco144

logic: aspirina, paracetamol şi deferoxamina. Structurile moleculare ale acestora sunt prezentate mai jos.

Aspirina

Paracetamol

Deferoxamina Tabloul spectral din Figura 9 prezintă spectrele de absorbţie în IR ale celor trei substanţe analizate.

Figura 9 Spectrele FTIR/ATR ale substanţelor de interes farmacologic: aspirina, paracetamol şi deferoxamina.

145

Cluj-Napoca. Bibliografie 1. 146 . Napoca Star. 1992. Leopold. Surface-Enhanced Raman Spectroscopy. Cozar. 2001. Weinheim. Spectroscopia IR şi Raman. Chichester. 2002. Wiley. Engelke. D. 4. 2004. 5. T. 10. Cluj-Napoca. Teubner. Cozar. Casa Cărţii de Ştiinţă. Cluj-Napoca. T. UK. Teoria Grupurilor în Fizica Atomului şi Moleculei. Dent. Napoca Star. 7. Iliescu. Casa Cărţii de Ştiinţă. S. 7. 8. 2007. Atribuirea benzilor de vibraţie se poate face pe baza literaturii de specialitate comparând spectrele cu cele ale compuşilor asemănători sau prin calcularea teoretică a spectrelor IR folosind programe dedicate de chimie cuantică. Grecu. J. Smith and G. W. Aştilean. Chiş. pentru fiecare substanţă putându-se identifica o amprentă spectrală caracteristică. UK. 9. Stuttgart. Selected Applications. Probleme de Fizica Moleculei. B. Chiş. Casa Cărţii de Ştiinţă. Cîntă-Pînzaru. VCH. Simon. Germany. O. Litografia Universitatii Babes-Bolyai. Iliescu.Methods and Applications.M. 1986. V. F. R. 11. Litografia Universităţii Babeş-Bolyai. Germany. 2009. Cluj-Napoca.Spectrele din Figura 9 sunt caracteristice structurilor moleculare corespunzătoare. S. Cluj-Napoca. Spectroscopie Optică Moleculară. Ed. Maniu. Modern Raman Spectroscopy – A Practical Approach. Wiley. Chichester. 2000. 2002. Aufbau der Moleküle. 2.E. Simetrie Moleculară. S. Leopold. David. I. 1998. 3. Cluj-Napoca. O. L. Cluj-Napoca. Aştilean. 6. Aplicaţii ale spectroscopiei vibraţionale. 2005. N. Infrared and Raman Spectroscopy . Hollas. Vol. Metode şi tehnici moderne de spectroscopie optică. N. Schrader. Modern Spectroscopy.

............ 151 4.......................................................................... 157 1........................ 147 2......Tendinţe moderne în spectroscopia de absorbţie IR Lect.. 154 5.................................................................. Îmbunăţiri tehnice recente în cuplajul LC-IR.... Nicolae Leopold Cuprins 1..... Cuplajul on-line cromatografia de lichide (lc)-IR ....................... 147 ...............2........ Bibliografie ................................... 149 2................................. Introducere Spectroscopia de absorbţie în infraroşu (IR) reprezintă o metodă analitică de investigaţie moleculară utilizată într-un număr vast de domenii......... 150 3.......... Aplicaţii analitice ale spectroscopieie IR ..1................. Cuplajul on-line electroforeza capilară (CE)-IR ................. 155 6.................................................... 150 2................ 148 2............................... dr... Aplicaţii ale spectroscopiei IR în geoştiinţe...... Introducere ..................... Aplicaţii biomedicale ale spectroscopiei IR .................................... Spectroscopia IR în calitatea şi siguranţa alimentelor ........... Publicaţiile din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR pot fi clasificate pe domenii ştiinţifice după cum este prezentat în Figura 1...........1...1......................

com) Este evident din numărul mare al publicaţiilor în domeniile chimiei şi a fizicii că spectroscopia de absorbţie IR este în continuare o metodă experimentală de bază în cercetarea fundamentală. De aceea s-a ales în mod reprezentativ cuplarea on-line a detecţiei IR în metodele de separare cromatografie de lichide (LC) şi electroforeza capilară (CE). 2.scopus.Figura 1. astfel că pot fi foarte greu cuprinse într-o prezentare unitară. 148 . Clasificarea pe domenii a numărului de publicaţii din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR (www. Aplicaţii analitice ale spectroscopieie IR Aplicaţiile analitice ale spectroscopiei IR sunt extrem de diversificate.

1. şi ii) senzitivitatea redusă datorată utilizării unui drum optic redus al celulor pentru a evita saturarea semnalului ce intervine datorită absorbţiei eluentului. sau laboratoare pentru studii farmacologice. Desigur. Cele două subiecte sunt strâns corelate. 149 . laboratoare medicale. 2. Detecţia on-line LC-FTIR a fost limitată în trecut de un anumit număr de restricţii privind aplicabilitatea în problemele analitice de tip real-life. precum şi posibilitatea de a utiliza soluţii tampon nevolatile [3-4]. aspecte ce pot interveni la înlăturarea solvenţilor. abordarea on-line este de preferat datorită unor avantaje majore. detecţia substanţelor interzise. Utilitatea spectroscopiei de absorbţie IR. fie on-line folosind celule de curgere (flow-through cells) transparente pentru radiaţia infraroşie. Totuşi. Cuplarea on-line permite totodată înregistrarea de spectre IR pentru analiţi fără o anumită orientare. Cuplajul on-line cromatografia de lichide (lc)-IR Cromatografia de lichide este cea mai uzuală metodă instrumentală folosită în laboratoarele analitice pentru separarea amestecurilor fizice. în mod special a celei cu transformată Fourier (FTIR) ca şi mijloc de detecţie on-line în urma separării cromatografice a fost demonstrată în mod repetat în ultimii ani [1-3]. aceste metode prezintă avantaje şi dezavantaje în funcţie de analizele efectuate. furnizarea de informaţii în timp real. cristalizare sau degradare oxidativă. De regulă. Două dintre cele mai citate dezavantaje ale cuplajului LC-FTIR sunt următoarele: i) dificultatea de a corecta absorbţia de fond a solvenţilor şi a aditivilor folosiţi pentru prepararea fazei mobile. fiind pusă la îndoială în mod frecvent viabilitatea acestui cuplaj. În dectecţia off-line folosirea interfeţelor de înlăturare a solventului duce la îmbunătăţirea senzitivităţii. Cert este faptul că în ultimii ani sunt depuse eforturi pentru a cupla cu spectrometria de masă şi alte metode de detecţie cum ar fi spectroscopia Raman sau spectroscopia de absorbţie IR.Metodele de separare cromatografice şi electroforetice sunt tehnici standard în laboratoare analitice privind siguranţa şi autenticitatea alimentelor. incluzând o rezoluţie cromatografică îmbunătăţită. Cuplarea cromatografiei de lichide cu un sistem de detecţie IR se poate realiza fie în modul off-line după înlăturarea solventului. aceste metode de separare sunt cuplate cu metode de detecţie ca. identificare şi cuantificare. iar atunci când sunt ambele luate în considerare este uşor de înţeles numărul limitat de referinţe cu privire la cuplarea on-line a spectroscopiei de absorţie IR cu cromatografia de lichide. absorbţia UV-VIS sau spectrometria de masă.

Cuplajul on-line electroforeza capilară (CE)-IR Electroforeza capilară (CE) a devenit o tehnică de separare importantă. [12] au folosit două lasere QCL pentru detecţia on-line în cromatografia de lichide de înaltă performanţă. Au fost puşi în mişcare gradienţi liniari în limitele 50:50-35:65 [apă(0. duce la o nouă abordare a detecţiei IR on-line [7-10] folosind noi dispozitive [11]. Separarea apare în urma aplicării unei tensiuni înalte. facilitând o serie de noi aplicaţii.05% TFA-acid trifluoroacetic):acetonitril] timp de 15 min pentru separarea soluţiilor standard de nitrofenoli. care a fost plasat pe un condensor al fasciculului optic ataşat spectrometrului. obţinându-se astfel on-line. mai ales în analizele bio-chimice din cauza eficienţei mari a separării cât şi consumului redus de substanţă [13-15].5 nL. pe coloană. cu un volum intern al celulei de 7. Un alt factor de limitare pentru detecţia IR cuplată cu cromatografia de lichide este legată de absorbţia puternică a apei în domeniul spectral MIR. 150 . Acest lucru a fost evidenţiat de coeficienţii de corelare cuprinşi între 89-96% (în regiunea spectrală 1700-1050 cm-1) şi utilizaţi pentru compararea spectrelor de referinţă cu cele obţinute în urma injectării în sistemul cromatografic a unei cantităţi între 230-270 ng din analiţi. Avantajul surselor IR de tip QCL constă în posibilitatea reglării lungimii de undă a laserului prin reglarea temperaturii de funcţionare [12]. Folosind tehnica gradienţilor s-au putut obţine spectre de înaltă calitate ale analiţilor în urma aplicării unei corecţii ale fondului (semnal background) la datele înregistrate.2.2. Sistemul a fost utilizat pentru separarea a opt constituenţi ai vinului şi ai sucului de struguri. fapt care duce la o curgere electro-osmotică în capilar. Kuligowski et al. Prin reducerea dimensiunii şi a costurilor aparaturii se conturează o direcţie clară în ceea ce priveşte detecţia on-line IR dedicată cromatografiei de lichide. QCL .quantum-cascade laser. 2. Urmând studii anterioare [7].1. [5] folosind o micro-celulă de curgere [6] cu ferestre transparente în IR mijlociu din CaF2. limite de detecţie între 35-94 ng.1. Dezvoltarea din ultimii ani a unei noi tehnologii laser pentru surse IR. Un set-up optic bazat pe trei oglinzi de aur şi un separator de fascicule din ZnSe a fost folosit pentru a direcţiona lumina emisă de laser printr-o celulă fluidică cu un drum optic de 52 µm către un detector MCT (mercury-cadmium-telluride). Îmbunăţiri tehnice recente în cuplajul LC-IR Pentru a creşte senzitivitatea cuplajului LC-FTIR şi pentru a obţine astfel o limită de detecţie mai bună s-a realizat interfaţarea unui sistem de cromatografie capilară pentru lichide cu spectrometrul FTIR.

bucal [50]. prostată [54-55]. Utilitatea detecţiei FTIR on-line a fost demonstrată prin separarea şi cuantificarea adenosinei.De obicei. os [61] sau ţesut tumoral [62]. colon [56-59]. Interacţiunea moleculelor analit cu selectorul chiral a produs diastereomeri cu un spectru IR clar. distinct. fibroblast [60]. În măsurători de transmisie folosind celule transparente manufacturate special pentru IR o parte din spectru este blocat din cauza absorbţiei puternice a fazei lichide. Un alt studiu prezintă separarea şi detecţia IR a 5 analiţi. gastrointestinal [43-46]. aşa cum s-a arătat la discriminarea on-line de enantiomeri în timpul separării chirale într-un mediu neapos. Acest ultim aspect este cel care face spectroscopia FTIR o metodă de analiză biomoleculară foarte atrăgătoare [20]. limfoid [51]. detecţia în CE este dificilă. col uterin [26-34]. tot mai multe studii arată că detecţia on-line FTIR este utilizată cu succes. [26] au evidenţiat potenţialul spectroscopiei FTIR ca instrument de biodiagnostic în cancerul de col uterin. limfocite [52]. 3. Recent însă. Acest articol raportează prima separare a unor proteine în electroforeza capilară cu detecţia FTIR on-line. Maturitatea cuplajului CE-FTIR on-line este considerată prin separarea şi cuantificarea cu succes a glucidelor din băuturi răcoritoare [18]. Un alt domeniu în care spectrometria IR poate furniza informaţii importante este analiza proteinelor. sân [38-42]. Wood et al. limfon non-Hodgkin’s [53]. Detecţia on-line bazată pe tehnica reflexiei totale atenuate ocoleşte această problemă prin reducerea eficientă a drumului optic. Spectrele înregistrate 151 . din cauza concentraţiei mici de substanţă disponibilă pentru detecţie. medicamente anti-cancer [66]. permiţând discriminarea moleculelo analit [19]. guaninei şi a adenosinei-5’ monofosfat în domeniul ng folosind electroforeza capilară convenţională [16]. Aplicaţiile principale în acest domeniu sunt cele privind dinamica proteinelor şi elucidarea structurii secundare. plămân [35-37]. creier [47-49]. Informaţia moleculară specifică livrată de spectrul IR poate fi interpretată în mod avantajos. sau pentru monitorizarea glucozei [67]. Alte studii relevante au fost efectuate pe bacterii [63-64] ADN [65]. Aplicaţii biomedicale ale spectroscopiei IR Analiza FTIR este folosită într-o serie largă de studii biologice cuprinzând măsurători pe diverse ţesuturi ca: piele [21-25]. rezultatele fiind foarte bune din punct de vedere calitativ şi cantitativ [17]. Pentru detecţia prin spectroscopia infraroşie mijlocie s-au raportat măsurători atât off-line cât şi on-line. iar în cazul detecţiei UV-Vis sensitivitatea este limitată de diametrul mic al capilarului.

Scopul acestui studiu a fost determinarea eficienţei spectroscopiei IR în diagnosticare şi în acest sens s-a descoperit că leucocitele. Privind aceeaşi afecţiune. Spectrele înregistrate au fost analizate privind posibilele modificări în ceea ce priveşte nivelul biomoleculelor: ADN. a culturilor celulare şi a xenogrefelor de acest tip. Diferenţa considerabilă este reprezentată de raportul benzilor de la 1030 şi 1080 cm-1. Acestea reprezintă un factor discriminant privind ţesutul de plămân canceros şi cel normal. [36] se bazează pe posibilitatea de achiziţie directă de pe ţesut de plămân canceros sau normal prin microscopia FTIR. Yano et al. ARN. atribuită glicogenului şi grupării fosfat din acizii nucleici. probele păreau să fie 152 . şi totodată o pronunţată bandă atribuită întinderii simetrice a grupării fosfat la 1078 cm-1. La nivel macroscopic. respectiv limfocitele au o caracteristică spectrală în zona legăturii fosfodiester (1300-900 cm-1). Wood et al.pe celule epiteliale normale prezintă benzi intense ale glicogenului la 1022 cm-1 şi 1150 cm-1. fosfaţi şi carbohidraţi. Pentru evaluarea cantitativă a malignităţii s-au ales intensităţile benzilor de la 1045 şi 1465 cm-1. încercând astfel diferenţierea ţesutului canceros de cel normal. [28] au investigat cu microspectroscopia FTIR tipurile de celule şi potenţialele variabile care ar duce la confuzii în diagnosticarea malignităţii acestui ţesut. Acest studiu a demonstrat potenţialul de aplicabilitate a tehnologiei automatizate FTIR în monitorizarea cancerului de col uterin în mediul clinic. Zona de interes a studiilor comparative de spectroscopie IR pentru Fabian et al. Rezultatele lor demonstrează că sunt diferenţe semnificative între celulele normale din plămân şi cele tumorale. atribuite glicogenului şi colesterolului. sugerând prin aceasta modificări spre malignitate. Studiul iniţiat de Mordechai et al. [30] pe melanom fixat cu formalină şi pe celule canceroase de col uterin bazat pe microspectroscopia FTIR a urmărit detecţia unor biomarkeri comuni care apar în cele două afecţiuni. în vederea implementării acesteia ca şi tehnică medicală în acest domeniu. Nivelul acestora din urmă s-a dovedit a fi un bun indicator în diagnosticarea şi detecţia cancerului de col uterin. Wang et al. Caracteristicile spectrale care sugerează transformări de malignitate sunt în principal modurile de vibraţie simetrice şi antisimetrice ale grupării fosfat precum şi reducerea în intensitate a benzii atribuite glicogenului. [35] s-au concentrat asupra studiilor microscopice FTIR ale celulelor canceroase din fluidul pleural. Un avantaj major al acestei metode îl reprezintă posibilitatea de a obţine rezultate determinante foarte rapid. [38] a fost reprezentată de cancerul la sân. Într-un alt studiu.

[44] au studiat tumori de stomac. Weng et al. cancer de stomac şi gastrită cronică prin comparare cu ţesut normal şi a obţinut o acurateţe în diagnostic de 90%. s-a reuşit determinarea cantitativă a apei în fiecare caz. Dovbeshko et al. Fujioka et al. respectiv să diferenţieze materia albă de cea cenuşie cu acurateţe de 90%. Utilizând spectroscopia FTIR s-a realizat această discriminare cu o acurateţe de 88. 74%. Prin utilizarea mai multor metode multivariate au arătat că este posibil să se clasifice datele spectroscopice non-subiectiv. rect. [23] a utilizat spectroscopia ATR-FTIR (spectroscopia IR cu tranformată Fourier în reflexie totală atenuată) pentru a măsura gradul de hidratare al corneei. Li et al. urmărind absorbţia atribuită colagenului. Choo et al. urmărind vibraţia de deformare a apei în combinaţie cu cea de întindere a legăturii OH în cazul unei suprafeţe normal hidratată de cornee şi a uneia nehidratate suficient din cauza unor ocluzii. Astfel. urmărindu-se raportul benzilor de la 1460 şi 1400 cm-1. S-a concluzionat că un studiu de spectroscopie IR poate deveni foarte util în interpretarea corectă şi înţelegerea pe deplin a patologiei acestui ţesut. Fukuyama et al. ficat şi a altor părţi ale sistemului digestiv cu ajutorul fibrei optice FTIR şi a spectroscopiei FT-Raman. Se presupune că pentru această apreciere este necesară obţinerea de informaţii fundamentale privind pătrunderea şi pierderea lichidului apos de la nivelul corneei. însă foarte rar în cele de ţesut tumoral. Ulterior s-au detectat modificări în conţinutul de colagen şi a depozitării celulelor lipidice. Prin comparare cu spectre ale cheratinei pure şi ale colagenului s-au obţinut rezultate care să susţină introducerea acestor investigaţii în clinici. colon. [50] au folosit spectroscopia FTIR pentru a studia diferenţele între celule canceroase gingivale şi celulele epiteliale gingivale normale. achiziţia de informaţii având loc la contactul cu o sondă ATR. [46] au realizat o investigare a biopsiilor cu spectroscopia ATR-FTIR privind afecţiuni ca şi: gastrită superficială. respectiv 90%. dar acest stu153 . 66%.6%. Lucassen et al. Andrus şi Strickland [51] au monitorizat gradual tumori limfoide cu ajutorul spectroscopiei FTIR. Rezultatele au indicat faptul că banda atribuită întinderii C=O a adipozei poate fi identificată în spectrele probelor de ţesut normal. [43] au raportat diferenţierea spectroscopică între ţesutul gastric normal şi cel tumoral. [47] au aplicat spectroscopia IR în diagnosticarea afecţiunii Alzheimer investigând spectre achiziţionate pe ţesut uman de sistem nervos central. intestin subţire.omogene din punct de vedere al ţesutului conjunctiv care a fost ales ca şi amprentă spectrală. [62] au ales un studiu de reflexie FTIR prin absorpţie amplificată la suprafaţă a acizilor nucleici din celulele tumorale.

atribuită în principal întinderii C=O [68]. până la părţi pe milliard (ppb).Spectroscopia IR în calitatea şi siguranţa alimentelor Spectroscopia FTIR este o tehnologie promiţătoare pentru industria agroalimentară deoarece permite măsurători simple. Spectre înregistrate după extracţia fazei solide din sucuri a îmbunătăţit puterea de modelare pentru compararea cu sucul pur şi a recunoaşterii prin folosirea unui tipar (soft independent analysis of class analogy (SIMCA)) şi a permis diferenţierea sucurilor de origini diferite. Extracţia fazei solide a minimizat interferenţa zahărului cu spectrele şi a izolat componentele fenolice care au oferit o amprentă unică în autentificarea sucurilor. struguri Concord. respectiv apariţia prin interpretarea spectrelor a unor configuraţii “ciudate” de baze şi zaharuri. He et al. spectroscopia de absorbţie IR reprezintă o metodă senzitivă în ceea ce priveşte analiza malignităţii ţesuturilor cu potenţial real pentru aplicaţii clinice în detecţia şi diagnosticarea a diverse afecţiuni. Datorită utilizării tehnicii FTIR în aplicaţii de control a calităţii şi a procesării. În concluzie. Regresia de tip parţial least-squares (PLS) ce corelează conţinutul de fructe şi spectrele FTIR centrate pe o bandă la 1729 cm-1 a asigurat o bună calibrare statistică la analizarea gemului de căpşuni [69]. Spectre MIR au fost folosite pentru a diferenţia sucurile concentrate pure din rodii de cele contrafăcute cu suc de struguri concentrat (2%-14% v/v) folosind analiza de componente principale (PCA) în regiunea IR 1780-1685 cm-1. [70] au analizat afine. spectroscopia MIR a fost de mare succes în diferenţierea varietăţilor de fructe şi a originilor geografice.diu a ridicat anumite probleme. Progresul în instrumentaţia FTIR combinat cu dezvoltarea unor metode statistice multivariate de analiză a datelor fac această tehnologie ideală pentru monitorizare rapidă cât şi caracterizarea compuşilor din alimente la nivel de urme. Spectroscopia MIR a fost folosită în autentificarea sucurilor cu ingrediente de înaltă calitate contrafăcute din surse inferioare. nectar de prune şi sucuri de mere de la diferiţi producători. În mod similar. 4. Rodiile sunt foarte apreciate pentru activitatea lor antioxidantă cât şi pentru potenţialele efecte chemopreventive împotriva cancerului de prostată [68]. Autorii au 154 . industria agroalimentară este deja familiarizată cu această tehnologie şi cu potenţialul ei de implementare în monitorizarea alimentelor. Un parametru important în monitorizarea autenticităţii piureurilor. iar pentru fiecare produs s-au stabilit limite inferioare ale acestuia. preparatelor şi a gemurilor de fructe este procentul care desemnează conţinutul de fructe. rapide şi nedistructive ale compuşilor chimici. merişor.

estimată la circa 5µm [72]. Rezultatele au fost comparabile cu cele obţinute prin metoda convenţională bazată pe micro-FTIR. Până în 2009 nu a fost o metodă standardizată în industria viticolă care să permită determinarea eficientă a compoziţiei şi autenticităţii vinurilor organice [71]. iar LDA a reuşit să clasifice 75%. care ar contribui la discriminarea vinurilor. iar pentru obsidian 0. În general. dar a existat o uşoară suprapunere [71]. Aplicaţii ale spectroscopiei IR în geoştiinţe Concentraţia şi distribuţia apei în rocile vulcanice din Sumisu Caldera şi Vulcanul Torishima din arcul Izu-Bonin (Japonia) au fost studiate de Wysoczanski şi Tani [72].2-1.atras atenţia asupra limitărilor acestei metode. rezultând o precizie similară şi o rezoluţie spaţială chiar mai bună. Consumatorii sunt tot mai interesaţi de produse organice şi sunt dispuşi să plătească un preţ mai mare pentru aceste produse. 5. niciuna dintre ele fiind foarte practică pentru că sunt costisitoare din punct de vedere al timpului necesar efectuării lor şi al setărilor pentru controlul de calitate. valori corespunzătoare cu saturarea apei la presiunile de erupţie. Cozzolino et al. 155 . Explorarea rezultatelor analizei PLS nu a desemnat un parametru chimic individual care să fi explicat diferenţierea vinurilor. ci mai degrabă mai mulţi compuşi chimici. [71] au fost primii care au folosit tehnologia IR pentru a clasifica vinuri comerciale provenite de la sisteme de producţie organică şi anorganică. incluzând compuşi fenolici volatili şi nevolatili. folosesc solvenţi dăunători şi monitorizează doar un parametru la un moment dat. Masa brută a dacitelor din Sumisu Caldera conţine între 1. dar au subliniat că această metodă este o îmbunătăţire reală comparativ cu încercărilor anterioare [70].4 % (wt) H2O. şi analiza discriminantă liniară (LDA). regresia PLS discriminantă (DPLS). Aproape 200 de soiuri de vinuri roşii şi albe din 13 regiuni din Australia au fost analizate folosind spectroscopia MIR combinată cu PCA. inclusiv în procesul de extracţie şi asupra nevoii unui spectru larg de probe pentru a îmbunătăţi repetabilitatea acestui model. Autorii aduc la cunoştinţă că spectroscopia MIR combinată cu tehnici chemometrice au permis o discriminare bună între probele produse în sisteme de producţie organică şi anorganică. Metodele tradiţionale pentru autentificarea sucurilor de fructe includ cromatografia sau analiza raportului izotopilor de carbon.2 % (wt) H2O. rezultatul analizei PCA a separat vinurile organice de cele anorganice. DPLS a clasificat corect 85% din vinurile organice. Industria de vinuri a recunoscut acest trend şi astfel în multe podgorii se pune accentul pe vinuri organice.

aceste studii fiind folositoare în determinarea genezei şi a evoluţiei sistemelor magmatice [78]. Mulţumiri pentru suportul acordat de Drd. Pe lângă caracterizarea cristalo-chimică. Nicoleta E. Concluzia lui Della Ventura et al. conţinutul de CO2 din lazurite a fost propus ca şi indicator al sursei naturale ultramarine de pigmenţi. [76] au studiat un set de cristale leucite transparente atent selecţionate provenind din vulcanul Alban Hills (Roma. colecţia de imagini obţinute prin scanare a arătat. de aceea aceste materiale merită ca toată atenţia. Krisztian Herman la redactarea acestui material. precum era de aşteptat. Aplicând fluorescenţa de raze X. Mircescu şi Mast. Italia). analiza spectroscopică a CO2 fiind comună în studiul rocilor. fugacitatea oxigenului şi compoziţia fluidelor în sistemele minerale. În acest context. Della Ventura et al. a fost că imagistica FTIR a distribuţiei apei în leucite reprezintă un instrument valoros în monitorizarea evoluţiei sistemelor magmatice. Astfel se susţine ideea că o analiză amănunţită a speciilor volatile din minerale poate oferi informaţii cantitative şi calitative privind activitatea apei şi a CO2. în special privind studiile arheologice şi problemele de conservare. Numeroase studii recente au arătat că specii volatile ca şi CO2 şi specii hidride ca şi OH şi H2O pot fi de asemenea încorporate în circumstanţe speciale în majoritatea mineralelor din crustă [75-77]. 156 . faptul că acel conţinut de CO2 depinde puternic de faza mineralului [82]. O microanaliză preliminară a acestor probe a dezvăluit o absorpţie în regiunea 3000-4000 cm-1 datorată vibraţiilor de întindere a apei. fiind 3 peak-uri bine definite la 3604 cm-1. Aceste incluziuni determină totodată şi dezvoltarea modelelor restrictive în geneza depozitării minereurilor şi oferă informaţii pentru exploatarea geotermală şi petrolieră în producţia la nivel industrial. De fapt.Este bine cunoscut faptul că mineralele anhidride nominale formate în condiţii de înaltă presiune conţin urme de specii hidride [73-74]. Analiza apei în minerale [79] şi roci [80] cu ajutorul spectroscopiei FTIR este aproape o tehnică de rutină. procesele de deformare cât şi a unui “geotermometru” privind rocile din crusta terestră [83]. dar teste efectuate pe incluziunile de fluide din minerale sunt rare [81]. studiul speciilor volatile în minerale are aplicaţii şi în alte domenii. Studiile care tratează incluziunile de fluide sunt foarte utile în definirea rolului fluidelor în geneza. mineralele au o largă răspândire în istoria rocilor ornamentale sau a pigmenţilor utilizaţi în operele de artă. la 3500 cm-1 şi la 3245 cm-1.

M. Pilavdzic and A. Frank. Quarterly Reviews of Biophysics 35 (2002) 369-430. Karlberg. I. D. Electrophoresis 24 (2003) 687-692. Zakim and M. A. 29. P. 15. Gooijer and U. Pivik and B. A. J. N. 27. Bibliografie 1. Lendl and B. Issaravanich. S. Ruzicka. Somsen. Barry. M. Jackson. Lendl. J. Lendl. Ashdown. A. M. K. E. H. Lendl. Frank. Zarou. Udomprasertgul. Lewis. Nilsson. C. M. Journal of Raman Spectroscopy 23 (1992) 641-645. M. T. Hinsmann. P. B. Kuligowski. J. Journal of Biomedical Optics 3 (1998) 267-280. V. G. Godwin. Applied Spectroscopy 58 (2004) 667-670. M. H. L. Kolhed. Schaden. M. Lendl. B. B. P. Wood. W. Talanta 64 (2004) 1127-1146. 22. 12. 19. F. M. Goldstein. Mantsch. 21. 16. M. C. M. Barnett and S. Crowson. Kolhed. M. Kolhed and B. D. S. 157 . M. Kuligowski and B. Srisookho. S. http://www. Journal of Investigative Dermatology 112 (1999) 951-956. Gornik and G. 14. D. F. Austria http://daylightsolutions. 20. Wong. Frank. Rigas. Journal of Chromatography A 1080 (2005) 132-139. Lucassen. Analyst 128 (2003) 2-6. G. J. N. N. Boonbundarlchai and N. Lendl and B. M. 2. A. B. Journal of Chromatography A 1068 (2005) 3-30. Journal of Chromatography A 1079 (2005) 24-40. G. Wood. Kantarovich. T. Grekin. A.quantared. Lendl. J. Surowiec. McNaughton.6. Faist. Journal of Chromatography A 856 (1999) 213-242. McIntosh. Barth and C. P. Kolhed. Journal of Microscopy-Oxford 215 (2004) 86-91. Applied Spectroscopy 58 (2004) 662-666. 8. Goldstein and S. Svasek. Mark. Yee. R. C. 23. M. Quintas and B. Svasek. R. Jansen. J. R. Vigorita. B. H. 5. H. D. Strasser. B. 25. Analytical Chemistry 81 (2009) 3746-3753. G. B. Quintas. R. R. Svasek. B. W. Edelmann. R. Hislop. Lammerhofer. A. Sukuta and R. M. Lendl. S. 3. Karlberg. Argov. Applied Physics B-Lasers and Optics 99 (2010) 833-840. W. 13. 9. B. V. Muller. Burden and D. Lendl. M. P. Journal of Chromatography A 934 (2001) 123-128.com J. Gynecologic Oncology 90 (2003) 10-14. 17. Brunetto. Zscherp. Z. Analytical Chemistry 74 (2002) 3843-3848. T. R. Biospectroscopy 2 (1996) 143-153. Warakamin. Bruch. A. P. E. Hinsmann. L. Svasek. Edwards and A. T. Karlberg. Sahu. 4. J. W. Hinsmann. C. Dusitsin. Haberkorn. 7. 28. 18. 24. R. G. A. M. Karlberg and B. L. Baena and B. Xie. Trojanowicz and B. Stranc. Williams. H. Sensors and Actuators a-Physical 115 (2004) 591-599. P. 30. Sindhuphak. S. Lasers în Surgery and Medicine 24 (1999) 382-388. Cancer Research 53 (1993) 762-765. Vellekoop. Lammerhofer and B. Hammody. Diem. T. Guterman. S. Frank. Talanta 67 (2005) 269-279. Gallignani and M. A. Sindhuphak. Quinn. Schindler. Veen and J. Quinn. Brinkman. McNaughton. M. J. V. Frank. Biospectroscopy 4 (1998) 47-53. S. Chiriboga. Righetti. Podshyvalov. K. N. Laurell. J. Mordechai. W. Romeo and D. G. Lendl and M. 11. Arce. Lendl. Analytical Chemistry 72 (2000) 1645-1648. Beck and J. Schrenk. Anastos. 6. P. 26. Tait. B. Analyst 130 (2005) 772-778. T.com Vienna. R. P. Biospectroscopy 4 (1998) 75-91. G. 10. S. J. P. R. W. C. Baena. M.

35. Fung. Eckel. McCreery and D. A. Gazi. C. Moser and J. K. Zakim and M. X. X. Chiriboga. 34. Z. 48. 54. Weng. Vibrational Spectroscopy 27 (2001) 165-173. K. N. T. 41. Katayama. C. Morimoto. Sakai. Crowe. 47. G. J. Journal of Raman Spectroscopy 33 (2002) 552-563. J. L. L. Fukuyama. Biospectroscopy 4 (1998) 55-59. Mahadevan-Jansen. R. K. Argov. J. 46. Chaims and Z. Choo. G. Andrus. M. S. A. Myles. U. S. N. J. F. Miyazaki. Shohat. Mordechai. Journal of Raman Spectroscopy 28 (1997) 119-&. H. Analytical Biochemistry 287 (2000) 218-225. S. C. Che and W. J. 38. Salman. P. Xu. Manfait and A. K. 53. Paluszkiewicz and W. B.31. Treado. A. Arai and M. Journal of Pathology 201 (2003) 99-108. K. Y. Sun. I. Y. L. M. D. H. Takeshita. Wang and Y. I. Kruglova and O. H. Hammody. American Clinical Laboratory 19 (2000) 20. M. 42. N. N. J. T. R. Yang. M. Journal of Molecular Structure 565 (2001) 329-334. F. 52. E. Redd. 40. Y. Zhang. B. J. J. A. P. Kapelushnik C. Ghanbari-Siahkali. Biospectroscopy 1 (1995) 37-45. S. Yang. Erukhimovitch. Heintzelman. Weng. Shafer-Peltier. G. C. Zarou. Mordechai. S. K. Levi. 49. 44. L. Application of FTIR microspectroscopy for the follow-up of childhood leukemia chemotherapy 4491 (2001) 243-250. R. Argov. Talanta 53 (2000) 233-246. Fichtner and H. Cancer Detection and Prevention 28 (2004) 32-36. Biospectroscopy 1 (1995) 357-364. I. Huleihel. S. Ohoshima. Wu. Lacelle. H. Shi and J. Strickland. Kobayashi. 37. Zhou and J. Watson. Mansfield. Brown. Frank. P. El Haj. J. P. 55. P. G. Cohen. Y. Technology în Cancer Research & Treatment 5 (2006) 157-167. A. Vigorita. Biopolymers 75 (2004) 384-392. Fabian. Feld. Wang. H. R. P. Dwyer. Salman. Senterman and N. Y. Q. J. Dasari and M. X. F. Yang. Proceedings of the SPIE 3918 (2000) 66-77. D. S. P. Li. Biospectroscopy 1 (1995) 141-148. Zelig and S. D. Fujioka. F. Jackson. X. Xie. L. Lockyer. 56. J. M. 33. Kegelaer. Pizzi. T. W. Kwiatek. X. Xu. T. Jackson. Fitzmaurice. M. J. Biospectroscopy 4 (1998) 37-46. C. Yano. L. P. Wong. Mantsch. A. S. G. T. 51. R. V. Shanks. E. T. G. Sockalingum. D. F. H. M. P. C. Yoshida. Yuasa. W. V. Yoshida. C. Huang. Okuyama. L. 158 . N. J. Utzinger. S. 43. S. H. Kikuchi. Shimizu. A. V. Sule-Suso. Gridina. Malpica. S. M. Richards-Kortum. M. Vickerman. Wade. 45. X. Y. Biospectroscopy 5 (1999) 117-126. Senterman. 50. Ramesh. Bernshtain. Z. Gardner. Science of the Total Environment 204 (1997) 283-287. S. Huang. Zhang. M. A. M. J. Y. Kline and P. W. Song. S. Pashchuk. H. L. Fung. Clinical Chemistry 51 (2005) 346-350. Hart and M. Murphy. Kumaido. Applied Spectroscopy 55 (2001) 955-959. Biopolymers 78 (2005) 311-317. W. Hu. S. Follen and R. P. Y. Halliday and H. M. Watanabe and H. W. J. Ling. B. O. Mantsch. L. Sahu. N. Goldstein. D. A. F. Somorjai. J. Nguyen. E. P. 36. N. Miyan. Andrus and R. Clarke. Yanagisawa and M. U. Huo. H. B. G. Mikhael. Moriguchi and H. M. D. Z. H. Biospectroscopy 3 (1997) 281-290. Li. 32. K. S. Gotou. Analytical Chemistry 67 (1995) 777-783. Mikhael. R. Biospectroscopy 2 (1996) 155-165. Lacelle and P. Dovbeshko. Wong. Sun. A. J. T. Y. E. J. Diem. C. S. Erukhimovitch. K. M. S. Sato. R. Z. 39. J. O. Wu. Haka. Mordehai. Y. Scott. Mordechai. Guan.

Journal of Volcanology and Geothermal Research 156 (2006) 302-314. Andersen. 63. H. Solyanik. Morgello. T. A. Joe. F. 69. Carle and A. Niehaus. T. M. 75. K. F. 61. Journal of Raman Spectroscopy 35 (2004) 939-946. I. Mineral. M. Mossoba. D. Claussen. 71. Murakami. A. Erukhimovich. R. R. Holdstock. E. J. Jalkanen. P. Fry. Dambergs. Y. Libowitzky and G. Cavallo and M. I. A. H. M. R. Food Chemistry 108 (2008) 742-748. Canadian Mineralogist 42 (2004) 1275-1282. Lithos 55 (2001) IX-XI. Tamura. Hervig and P. Jung. T. Wong. M. Rigas. Food Chemistry 116 (2009) 761-765. Beran and E. Repnytska. Rodriguez-Saona and M. McMillan. 76. T. Journal of Biochemical and Biophysical Methods 50 (2002) 111-121. L. Della Ventura. Skogby. Water în Nominally Anhydrous Minerals 62 (2006) 117-154. Nieminen. H. Smith and I. A. J. S. 70. Abraham. Nardi. Johnson. 83. Schieber. V. Frezzotti and E. M. H. Jurgensen. Mauer. Tani. R. S. 77. T. Bergmann. K. N. D. Burke. A. Degtyarenko. P. H. 74. 72. Water în natural mantle minerals II: Olivine. Huleihel. 65. R. A. Rossman. V. T. M. Smith. Rehman. I. H. Shirshov. 81. K. 64. Rahim. 59. 67. A. 78. G. Infrared and NIR raman spectroscopy în medical microbiology 3257 (1998) 245-257. 82. Vibrational Spectroscopy 38 (2005) 229-235. Proceedings of the National Academy of Sciences of the United States of America 87 (1990) 8140-8144. Frimand and S. J. M. Rendiconti Lincei-Scienze Fisiche E Naturali 19 (2008) 141-159. A. R. American Mineralogist 93 (2008) 1538-1544. J. garnet and accessory minerals 62 (2006) 169-191. R. R. Wong. Bellatreccia and M. L. 80. E. J. G. 58. Giusti. G. J. Yamada. B. F. M. Piccinini. M. R. A. Physics and Chemistry of Minerals 23 (1996) 319-327. A. V. Salman. Cancer Research 52 (1992) 84-88. L. Johannsen. Ozen and L. He. Vibrational Spectroscopy 28 (2002) 103-110. Brilli. 73 (2009) 399-413. Gridina. 62. Sedman and A. G. B. I. Herrmann. Piccinini. B. Rigas and P. I. Sterner. Knapp-Mohammady. Todor and C. H. Keppler. Della Ventura. Dovbeshko. Biopolymers 67 (2002) 470-486. Steiner. P. Wade. Z. Linnen. Keppler and S. Mantsch. W. J.57. Ramesh. H. Physics în Medicine and Biology 48 (2003) 2373-2390. M. Water în Nominally Anhydrous Minerals 62 (2006) 155-167. R. S. Tay. Al-Khaldi. Nielsen. G. Arimoto and Y. J. T. Bellatreccia. Jensen. De Vivo. Richter. G. A. Lima and J. R. W. C. V. Salzer. M. 60. Mag. J. D. F. Mordechai. M. 159 . Cynkar and P. Ihinger. L. M. Ismail. J. Tryndiak. Suhai. Cozzolino. S. F. P. Hammody and S. Della Ventura. M. M. R. Naumann H. F. D. Binoy. B. 73. F. Volatiles în Magmas 30 (1994) 67-121. Journal of Materials Science-Materials în Medicine 5 (1994) 775-778. M. Trends în Food Science & Technology 16 (2005) 433-441. R. Wysoczanski and K. S. F. E. Kirkwood. M. T. 79. A. 68. Journal of Agricultural and Food Chemistry 55 (2007) 4443-4452. I. R. G. Vardin. M. C. F. Webster. G. Pettit and O. International Journal of Quantum Chemistry 106 (2006) 1160-1198. Tarumi. Elements 1 (2005) 19-24. I. Shimada. Piccinini. U. M. Bellatreccia and M. V. Goldman and P. Jayakumar. Abu-Id. S. Fugel. Libowitzky H. Rodig and B. Chegel. 66. O. Y. A.

......... deci nu emit radiaţie de fluorescenţă... Consideraţii teoretice Fluorescenţa este un fenomen de fotoluminiscenţă (procesul prin care substanţele absorb lumină şi după aceea reemit lumină cu o lungime de undă diferită).......................... Dana Maniu Cuprins 1......................................... procesul se numeşte fluorescenţă..... Consideraţii teoretice....................... Aplicaţii ale spectrofluorimetriei ...... Atunci când radiaţia luminoasă ajunge pe o moleculă fluorescentă.. Prin absorbţie de radiaţie luminoasă moleculele pot fi excitate prin trecerea unui electron de pe nivelul fundamental pe un nivel excitat......................................... Energia stării excitate nu poate fi menţinută decât o perioadă foarte scurtă............... Există o mulţime de nivele vibraţionale ale stării electronice excitate pe care se poate afla o moleculă fluorescentă........ În starea electronică fundamentală moleculele fluorescente se află într-o configuraţie stabilă. Moleculele care au această proprietate................ Dacă molecula se dezexcită (electronul trece din starea excitată în starea fundamentală) prin emisie de lumină..... Energia acestor nivele depinde de energia (lungimea de undă) radiaţiei luminoase care produce excitarea................. molecula dezexcitându-se............. De aceea ele 160 .............. 160 2............. 171 1........... Moleculele fluorescente sunt instabile atunci când se află pe un nivel vibraţional al stării electronice excitate... se numesc molecule fluorescente sau fluorofori..................... SPECTROFLUORIMETRUL Spectrofluorimetria Conf.................... Din aceeaşi clasă fac parte şi fosforescenţa şi fosforescenţa întârziată. aceasta poate trece într-o stare electronică excitată (cu energie mai mare) în urma absorbţiei de energie de la radiaţia luminoasă.............................. Bibliografie .. 169 6................ Avantajele spectrofluorimetriei .. dr............. Aparatura disponibilă ................................. 164 3...................... 166 4....V.............................................................. Tehnica experimentală ................................ 166 5.........................

sunt posibile următoarele procese (ilustrate în figura 1): . Timpul de viaţă a unei stări excitate de triplet poate ajunge până la 10 s. care este semi-stabilă. Acest fapt este deosebit de util. ceea ce face posibilă degradarea ei. După acest interval.conversia internă (IC) .fosforescenţa . deci procesul descris mai sus poate fi repetat. deoarece înseamnă că o moleculă poate emite radiaţie de fluorescenţă de mai multe ori.moleculele aflate pe diferite nivele vibraţionale se relaxează pe nivelul fundamental al stării electronice respective. excesul de energie dintre cele două stări regăsindu-se în energia radiaţiei luminoase emise în procesul de dezexcitare. Molecula fluorescentă poate absorbi energie luminoasă din nou. De obicei fosforescenţa apare doar la temperaturi scăzute sau în medii cu vâscozitate mare (dezexcitatea nivelului T1 se poate face şi prin conversie internă sau alte procese neradiative). I) sau la metale. care să excite molecula. astfel încât aceasta să nu mai emită radiaţie de fluorescenţă. Radiaţia luminoasă de fluorescenţă are energie mai mică decât radiaţia luminoasă absorbită de moleculă. Acest proces se poate observa la atomii grei (Br. moleculele fluorescente sunt instabile structural în intervalul de timp cât se află în stare de excitaţie (timpul de viaţă). Deci lungimea de undă a radiaţiei emise este totdeauna mai mare decât lungimea de undă a radiaţiei absorbite datorită energiei pierdute de moleculă în timpul trecerii pe cea mai joasă stare electronică excitată.trec în cea mai joasă stare electronică excitată.intersystem crossing (ISC) . 161 . deci emisia de fosforescenţă poate continua şi după încetarea iradierii iniţiale.unele molecule aflate în prima stare electronică excitată.10-11 s). pierderea de energie este neradiativă. procesul de fluorescenţă este ciclic şi are loc atâta timp cât există o radiaţie luminoasă. De fapt. În urma absorbţiei unui foton de către o moleculă. moleculele fluorescente trec din stare electronică excitată în stare electronică fundamentală. . În realitate. pot trece în prima stare de triplet (T1). O radiaţie luminoasă de mare intensitate poate provoca modificarea structurii moleculei fluorescente. făcându-se prin ciocnirea cu alte molecule. relaxarea vibraţională se face prin pierderea de energie în urma ciocnirilor dintre molecule (10-14 . Intervalul de timp în care o moleculă fluorescentă se află în stare excitată se numeşte “timp de viaţă“ şi are o valoare foarte mică (între 10-15 şi 10-9 s). . O tranziţie triplet-singlet este mult mai puţin probabilă decât o tranziţie singlet-singlet. Acest proces este numit “photobleaching“. stare de singlet (S1). Această proprietate face ca fluorescenţa să fie o tehnică foarte senzitivă (chiar şi o mică cantitate de substanţă poate fi detectată).moleculele aflate în starea de triplet pot să se dezexcite prin emisia unui foton.

De aceea.fluorescenţa. Fluorescenţa se poate măsura cu ajutorul eficienţei cuantice Q (randament cuantic): Q = (numărul de fotoni emişi) / (numărul de fotoni absorbiţi) Q are o valoare fixă pentru fiecare moleculă (pentru aceleaşi condiţii). valoarea maximă fiind 1. . Diagrama Perrin-Jablonski.Figura 1. 162 . În acest caz relaxarea vibraţională este mai rapidă decât relaxarea prin fluorescenţă. Fluorescenţa poate să apară doar în timpul absorbţiei (timpul de viaţă a unei stări excitate de singlet este între 10-9 şi 10-15 s). Fluorescenţa observată cu ajutorul spectrofluorimetrelor este cunoscută ca Fluorescenţa de tip Stokes. moleculele fluorescente au spectre de absorbţie şi de fluorescenţă caracteristice. Lumina emisă are totdeauna lungime de undă mai mare decât lumina absorbită (figura 2). Majoritatea moleculelor nu sunt fluorescente deoarece starea excitată S1 se suprapune cu nivelele vibraţionale ale stării fundamentale S0. este proprietatea moleculelor de a emite radiaţie electromagnetică la trecerea de pe prima stare excitată de singlet S1 pe un nivel vibraţional al stării electronice fundamentale S0. Fluorescenţa de tip Stokes reprezintă emisia de fotoni cu lungime de undă mai mare (frecvenţă mai mică) de către o moleculă ce a absorbit fotoni cu o lungime de undă mai mică (frecvenţă mai mare). Atât absorbţia cât şi emisia de fluorescenţă sunt unice pentru fiecare moleculă.

Figura 2.10-εbc) Figura 3. Spectru de fluorescenţă (emisie) şi de absorbţie (excitaţie) caracteristic. Curba de calibrare 163 . iar K' este o constantă ce depinde de condiţiile experimentale şi de eficienţa cuantică a fluorescenţei. Intensitatea radiaţiei fluorescente este proporţională cu intensitatea radiaţiei absorbită de o moleculă fluorescentă: F = K'(I0-I) unde I0 este intensitatea radiaţiei incidente pe probă. atunci printr-o simplă înlocuire se obţine legea fluorescenţei: F = K' I0 (1 . unde A = bcε este absorbanţa. Dacă ţinem cont de legea Beer: I/I0 = 10-εbc . I este intenstitatea radiaţiei după ce a traversat un strat de substanţă de lungime b.

unul pentru lumina excitatoare şi unul pentru radiaţia de fluorescenţă emisă. monocromator al radiaţiei emise. Avantajul spectrofluorimetrelor este faptul că permit variaţia controlată a lungimii de undă a radiaţiei excitatoare. Bineînţeles.05) termenii de ordin superior pot fi consideraţi nuli. Pentru o concentraţie mai mare decât c1 curba de calibrare nu mai este liniară. proprietăţile fluorescente ale probei pot fi scanate pentru un domeniu larg de lungimi de undă ale radiaţiei excitatoare (200-1000 nm). Semnalul detectat poate fi reprezentat în funcţie de cele două lungimi de undă sau numai în funcţie de una din cele două lungimi de undă.3 ⋅ ε ⋅ b ⋅ c − ⎥ 2! 2! ⎣ ⎦ Dacă εbc are o valoare suficient de mică (< 0. Dacă folosim o descompunere în serie Taylor.3 ⋅ ε ⋅ b ⋅ c)3 − . se înregistrează şi se prelucrează datele.3 ⋅ ε ⋅ b ⋅ c)2 + (2. Spectrofluorimetrele folosesc două monocromatoare. orice spectrofluorimetru modern este interfaţat cu un computer cu ajutorul căruia se setează parametrii de măsurare.⎤ F = K ' I 0 ⎢2. avem: ⎡ (2. detector (figura 4).. Radiaţia emisă este colectată la un 164 . monocromator a radiaţiei excitatoare.. Astfel. 2. iar celalalt analizează lungimea de undă a radiaţiei de fluorescenţă (emise). Fluorimetrele se folosesc pentru măsurători cantitative pentru compuşi specifici (măsurători de rutină). Tehnica experimentală Pentru a măsura fluorescenţa există două tipuri de instrumente: fluorimetre şi spectrofluorimetre. intensitatea radiaţiei de fluorescenţă nu depinde liniar de concentraţie. Primul monocromator analizează lungimea de undă a radiaţiei excitatoare.3·K'·ε·b·c·I0 Relaţia de mai sus ne arată ca pentru concentraţii suficient de mici intensitatea de fluorescentă este proporţională cu concentraţia şi cu intensitatea radiaţiei excitatoare la frecvenţa de absorbţie. camera probei. deci putem scrie: F = 2. Un fluorimetru măsoară abilitatea unei probe de a absorbi lumină la o anumită lungime de undă şi de a emite lumină la o lungime de undă mai mare..Spre deosebire de legea Beer. Părţile principale ale unui spectrofluorimetru sunt: sursa.

pentru a permite instalarea diferitelor accesorii pentru probe solide. Lumina emisă de sursă este focalizată pe fanta de intrare a primului monocromator cu ajutorul unei oglinzi sferice sau eliptice. Deoarece radiaţia de fluorescenţă are totdeauna lungime de undă mai mare decât radiaţia excitatoare. Atât intensitatea luminoasă a radiaţiei incidente. sursă monocromator detector probă monocromator Figura 4. lichide şi gazoase. Detectorul este poziţionat la ieşirea din cel de-al doilea monocromator. sau pentru controlarea temperaturii probei. Schema bloc pentru un spectrofluorimetru Sursa unui spectrofluorimetru emite în domeniul UV şi vizibil (de obicei se folosesc lămpi cu Xenon). Camera probei este de obicei destul de spaţioasă. Fanta de intrare este ajustabilă continuu (cu ajutorul soft-ului) pentru a se asigura maximul de rezoluţie şi reproductibilitate. Prin fanta de ieşire a monocromatorului radiaţiei excitatoare iese lumină cu lungimea de undă dorită.unghi de 90° faţă de radiaţia excitatoare pentru a preveni orice interferenţă între radiaţia excitatoare şi cea emisă. Acesta descompune radiaţia de fluorescenţă emisă de probă în culorile componente. Lumina emisă de probă este focalizată pe fanta de intrare al celui de-al doilea monocromator. elementul dispersiv al celui de-al doilea monocromator este astfel conceput încât să aibă maximul de eficienţă în domeniul vizibil. Primul monocromator descompune radiaţia excitatoare în culorile componente. cât şi lungimea de undă a acesteia este monitorizată şi controlată cu ajutorul unui fotodetector suplimentar situat între monocromator şi camera probei. Astfel radiaţia luminoasă incidentă pe probă poate să aibă lungime de undă fixă pentru tot timpul măsurătorii. 165 . sau poate să se modifice continuu pe tot domeniul de emisie al sursei.

Spectrofluorimetrele au limite de detecţie mult mai bune decât spectrofotometrele. Avantajele spectrofluorimetriei Senzitivitatea: Limitele de detecţie depind în mare măsură de proprietăţile probei de măsurat.Toate spectrofluorimetrele moderne sunt controlate de computer. Fluorimetria poate fi folosită pe un domeniu mare de concentraţii fără a fi nevoie de diluţia eşantioanelor sau de modificarea celulei în care se pune eşantionul. sau chiar dacă au fluorescentă este puţin probabil ca două substanţe să absoarbă şi să emită radiaţie de fluorescenţă în acelaşi domeniu. De asemenea. vi166 . Viteză şi simplitate: spectrofluorimetria este o tehnică analitică relativ simplă.) folosind probe foarte mici. Fluorescenţa oferă informaţii asupra dinamicii. Spectrofluorometrele au o specificiate ridicată şi apar mult mai puţine probleme de interferenţă deoarece substanţele fluorescente pot fi incluse în solvenţi sau matrici care nu sunt fluorescente. 3. Domeniu de concentraţie: Intensitatea semnalului de fluorescenţă este direct proporţional cu concentraţia substanţei fuorescente pe un domeniu larg. Pentru multe substanţe fluorescente este obişnuită o limită de detecţie de părţi/miliard sau chiar părţi/triliard. hidrocarburi aromatice. Senzitivitatea şi specificitatea mare a acestei tehnici reduce sau chiar elimină procedurile de preparare a probelor. Această extraordinară senzitivitate permite detecţia sigură a substanţelor fluorescente (clorofilă. Specificitatea: Spectrofotometrele măsoară doar lumina absorbită. ceea ce face dificil izolarea semnalului de la materialul de analizat din matricea în care se află. Aplicaţii ale spectrofluorimetriei Medicină şi farmacologie Sensitivitatea deosebită a spectroscopiei de fluorescenţă. etc. prin intermediul computerului se pot seta toţi parametri necesari derulării diferitelor tipuri de măsurători. studiile pot fi efectuate în soluţii apoase fără a fi nevoie ca probele să fie tratate. Tehnicile spectrofotometrice au probleme de interferenţă deoarece multe materiale absorb lumina. rigidităţii şi structurii proteinelor. face ca această tehnică să fie folosită atât pentru cercetări avansate cât şi pentru analize de rutină sau controlul calităţii în domeniile farmaciei şi medicinii. 4. Astfel. Datele obţinute în urma măsurătorilor efectuate se pot prelucra cu ajutorul programelor speciale.

efectul general de solvent . emisie. Mediul înconjurător Cu ajutorul fluorescenţei se poate monitoriza calitatea aerului. producătorii trebuie să identifice contaminanţi.timpul de viaţă şi randamentul cuantic .efectul temperaturii . Cu ajutorul fluorescenţei se poate identifica prezenţa unui număr foarte mare de analiţi chiar dacă aceştia sunt în cantităţi foarte mici (sub picomolar).momentul de dipol al stării excitate . Chimia analitică În chimia analitică se studiază spectrele de luminescenţă precum şi eficienţa cuantică a speciilor flourescente în funcţie de matriţa în care sunt puse. După ce sunt determinate caracteristicile de bază (excitaţie.reacţia la diferite suprafeţe Industria alimentară şi agricultura În industria alimentară este importantă îmbunătăţirea calităţii nutriţionale a alimentelor. mucegaiuri. microorganisme. Fluores167 . toxine. De asemenea măsurătorile de fluorescenţă 3D sunt folosite pentru determinarea surselor geologice a diferitelor eşantioane de petrol. Culturile de bacterii ce pot să apară pe alimente sunt distructive şi periculoase datorită potenţialului de contaminare şi îmbolnăvire pe care îl au. Pentru a asigura calitatea produselor alimentare. creşterea termenului de garanţie precum şi a calităţii ambalajelor.efectul prezenţei atomilor grei . randament cuantic) ale unei substanţe fluorescente. Deoarece probele preluate din mediul înconjurător sunt deosebit de complexe.ruşilor. Prin determinări de fluorescenţă pot fi determinate: . Spectrele de fluorescenţă 3D pot fi folosite ca o amprentă unică care duce la identificarea calitativă a compuşilor. mutageni sau substanţe canceroase. pentru detectarea diferitelor substanţe sunt necesare tehnici de mare senzitivitate şi selectivitate care să evite multiplele surse de interferenţă. etc. pot fi elaborate metode şi teste de rutină pentru analizele de laboratoar. Calitatea ambalajelor este de asemenea importantă atât ca membrană protectoare împotriva oxidării alimentelor cât şi datorită faptului că sunt o posibilă sursă de contaminare cu urme de plastic sau de polimeri. fapt ce are deosebite aplicaţii în imunologie. şi chiar pesticide utilizate în mod normal pentru a preveni răspândirea unor boli. AND-ului. a apei şi a solului prin detectarea urmelor de substanţe organice sau inorganice.

identificarea şi controlul tumorilor. hormonilor. fluorescenţa este folosită ca instrument de cercetare în domeniul biotehnologiilor. Fabricanţii de instrumentar medical şi clinic studiază sistemele invazive pe bază de fibre optice (ce pot fi introduse în interiorul arterelor sau a altor orificii).capturează energie luminoasă şi o foloseşte pentru a transfera protoni în exteriorul celulei). carotenoide. Biologie celulară În studiul proceselor biologice sunt implicaţi o largă varietate de markeri fluorescenţi. şi a altor substanţe biologice.mecanismul molecular de transfer prin membrana de proteină a bacteriorhodopsinei (o membrană integrală de proteină care acţionează ca o pompă de protoni . Una din tehnicile cele mai folosite în acest domeniu este determinarea raportului dintre intensităţile semnalului de fluorescenţă emis de markerul folosit la diferite lungimi de undă. .caracterizarea substanţelor fotoreceptoare (flavine. etc).cenţa poate fi folosită şi în determinarea randamentului şi calităţii anumitor culturi în urma aplicării fertilizatorilor. înălbitorilor optici şi suprafeţelor fosforescente. Aceştia pot fi caracterizaţi cu ajutorul spectrelor de fluorescenţă de excitaţie şi de emisie. .conversia biologică de energie în fotosinteza plantelor verzi. proteinelor. De asemenea. pentru analiza medicamentelor. emolientele pe bază de lipide şi cremele anti-rid.o tehnică pentru localizarea. a polimerilor. Aplicaţiile fotochimice ale fluorescenţei includ: . .folosirea "quantum dots"-urilor ca probe biologice în diagnosticarea cancerului şi studierea ţesuturilor. Industrie Producătorii folosesc fluorescenţa pentru a monitoriza calitatea vopselelor. 168 .terapia fotodinamică . a plascticelor. tehnică mai avantajoasă decât cea clasică în care se măsoară intensitatea absolută de fluorescenţă la o singură lungime de undă. . vitaminelor. Companiile de cosmetice şi produse pentru îngrijirea sănătăţii evaluează eficacitatea unor noi produse cum ar fi loţiunile pentru protecţie solară. Fotochimie Mecanismul absorbţiei luminii precum şi proprietăţile fotofizice ale unei substanţe determină rolul său în procesele biologice şi chimice.

Aparatura disponibilă Spectrofluorimetru Jasco FP 6500 Spectrofluorimetrul Jasco 6500 are următoarele caracteristici: Sursa este o lampă cu xenon de 150 W dotată cu un fotomultiplicator ce monitorizează şi compensează orice variaţie în intensitate asigurându-se astfel maximul de stabilitate. .determinarea stabilităţii intensităţii de fluorescenţă în timp.determinarea concentraţiei de substanţă fluorescentă (analiză cantitativă). Fantele monocromatoarelor au dimensiuni reglabile.raportul semnal .determinarea spectrului de fluorescenţă a unei probe. . Calibrarea spectrofluorimetrului se face cu ajutorul kit-ului inclus ce utilizează ca probă standard Rodamina B. atât ca lăţime cât şi ca înălţime.000 nm/ min pentru ambele monocromatoare.rezoluţia monocromatoarelor este de 1 nm. .măsurători 3D de fluorescenţă. . 169 .5. Alte caracteristici ale spectrofluorimetrului Jasco FP 6500 sunt: . . .viteza de scanare este între 20 şi 10.determinarea timpului de viaţă în cazul probelor fosforescente. ceea ce asigură maxim de senzitivitate pe întregul domeniu de lungimi de undă (200-850 nm). Cele două monocromatoare sunt echipate cu reţele de difracţie holografice concave (1500 trăsături/mm) cu unghi de "blaze" optimizat. lichide şi gazoase). . .determinarea spectrului de fosforescenţă a unei probe.măsurători de cinetică. Cu ajutorul spectrofluorimetrului Jasco 6500 pot fi efectuate următoarele tipuri de măsurători: .acurateţea lungimii de undă este ±2 nm pentru ambele monocromatoare.zgomot este 200:1 sau mai mare. . precum şi cu suporturi pentru diferite tipuri de probe (solide. .măsurători la lungimi de undă fixă. Spectrofluorimetrul este echipat cu accesorii pentru modificarea controlată a temperaturi probei şi pentru polarizarea luminii incidente.

) Analiza acestor spectre permite determinarea poziţiei maximului de excitaţie şi de emisie. se pot face spectre pe tot domeniul sau pe un domeniu selectat de utilizator. Modul "3D Fluorescence measurements" permite măsurarea în acelaşi timp a (i) spectrului de fluorescenţă a unei probe în timp ce se modifică lungimea de undă a radiaţiei excitatoare şi (ii) măsurarea spectrului de excitaţie în timp ce se modifică lungimea de undă de emisie. Modul "Fixed wavelength measurement" permite efectuarea măsurării fluorescenţei probelor la maxim 4 lungimi de undă simultan. Se obţin spectre tridimensionale (pe o axă este reprezentată intensitatea semnalului de fluorescenţă şi pe celelalte două axe avem lungimea de undă de excitaţie. fie pe emisie. 170 . selectabile fie pe excitaţie. Astfel.Controlul acestor măsurători se face folosind programul "Spectra manager" Modul "Quantitative analysis": pentru a efectua o analiză cantitativă trebuie trasată o curbă de calibrare. Modul "Spectrum measurement" permite măsurarea fluorescenţei probelor prin scanare de spectru. la viteze diferite de scanare. Această acţiune presupune măsurarea soluţiilor etalon. fapt deosebit de util pentru probe necunoscute. Se pot face spectre de excitaţie sau de emisie. Modul "Time course measurement" permite verificarea stabilităţii în timp a intensităţii fluorescenţei soluţiilor. respectiv de emisie. Rezultatele măsurătorilor probelor de concentraţie necunoscută vor fi date în unitatea de măsură de concentraţie în care a fost construită curba de calibrare. Se face citirea la o lungime de undă selectabilă într-un interval de timp selectabil. construirea şi stocarea curbei de calibrare.

spectrum measurement" permite măsurarea spectrului de fosforescenţă al probelor. Molecular Fluorescence: Principles and Applications.jascoinc. Bibliografie 1. 3. Principles of Fluorescence Spectroscopy. Wiley-VCH. Springer. Bernard Valeur.com/Products/Spectroscopy/FP-6000-Series-Spectrophotom eters. 2006 http://www. Ed. 2002 Joseph Lakowicz. 6. Ed. 2.Modul "Phospho.aspx 171 .

...............2........... Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur.. 184 3............ pentru a obţine informaţii chimice mai amănunţite trebuie determinată variaţia în timp a fluorescenţei..........................2...........1............................. Fiecare moleculă individuală emite aleatoriu după excitaţie................... Deoarece timpul de viaţă de fluorescenţă a unei molecule este foarte sensibil la vecinătatea sa moleculară......... 187 4.................................... 180 3...... Bibliografie ........... Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) .............. Exemple de aplicaţii ale spectrofluorimetriei ........ 178 3............... 176 2............ 175 2............3..1..................................... determinarea acestui timp de viaţă este deosebit de util în determinarea stării fluoroforului............... cum ar fi difuzia rotaţională....... transferul rezonant de energie şi stingerea dinamică........................ Fluorescenţa în timp real ......................... Astfel........... 172 2...... apar pe aceeaşi scară temporală cu emisia de fluorescenţă......................aplicaţii Conf.......................................................................... Unele molecule excitate vor emite radiaţie de fluorescenţă înainte de durata 172 ..... Microscopia confocală de fluorescenţă ....................... 190 1...... Fluorescenţa în timp real Deşi măsurătorile normale de fluorescenţă pot fi folosite ca o sondă non-invazivă extrem de selectivă şi sensibilă.................................. dr..Spectrofluorimetria ............................................ 174 2........................ Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) ................................................................3.................. Este important să ne amintim că timpul de viaţă de fluorescenţă este timpul mediu pentru ca o moleculă să rămână în stare excitată înainte de a emite un foton.................. Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului .......... în urma modificărilor de temperatură şi pH................. Determinarea interacţiunii dintre albumina bovină şi nanoparticule de aur . ..... Microscopia de fluorescenţă avansată .. Multe evenimente macromoleculare............. 180 3.... spectroscopia de fluorescenţă în timp real poate fi utilizată pentru a investiga aceste procese şi a obţine informaţii despre vecinătatea chimică a fluoroforului.. Fluorescenţa în timp real furnizează mai multe informaţii despre moleculele ce se află în imediata vecinătate a fluoroforului........ Dana Maniu Cuprins 1.............

în general. Cristalele din borat de bariu au avantajul transparenţei în UV şi eficienţei cuantice mai mare (cu un factor de 4-6). 173 . Această mixare ("fluorescence up-conversion") generează lumină cu frecvenţa ωsum = ω1 + ωfl . de ordinul 1-10 ns. Timpii de viaţă de fluorescenţă sunt. Emisia de fluorescenţă incoerentă emisă de probă este colectată şi mixată cu pulsul de frecvenţă ω1 într-un cristal neliniar. Cu cât este mai mare decalajul temporar dintre pulsul ω1 şi emisia de fluorescenţă ωfl. cristalele neliniare sunt confecţionate din potasiu-dihidrogen-fosfat (KDP) sau borat de bariu (BBO). iar alte molecule excitate vor emite radiaţie de fluorescenţă mult timp după durata medie de viaţă. Deci dacă interesează întreg domeniu de fluorescenţă. O sursă laser emite un puls ultra scurt (de ordinul femtosecundelor) cu lungimea de undă λ1 corespunzătoare frecvenţei ω1. Din această cauză este foarte important ca aparatura experimentală folosită pentru acest tip de masurători să aibă rezoluţie temporală foarte bună. iar pulsul de frecvenţă ω2 este focalizat pe probă (flow cell). Armonica a doua a acestui puls (frecvenţa ω2) este generat într-un cristal neliniar. deşi în unele cazuri pot avea ordinul sutelor de nanosecunde sau să fie mai mici decat 1 ns (sute de femtosecunde). Pentru o poziţie dată a cristalului. cristalul trebuie rotit la diferite unghiuri.medie de viaţă. cu atât intensitatea de fluorescenţă este mai mică. ceea ce ne demonstrează că există o coincidenţă temporală şi spaţială între ω1 şi ωfl. Intensitatea Isum a pulsului cu frecvenţa ωsum pentru un anumit decalaj temporar între pulsul de frecvenţă ω1 şi emisia de fluorescenţă de frecvenţă ωfl este proporţională cu funcţia de corelaţie dintre intensitatea de fluorescenţă Ifl şi intensitatea I1 a pulsului de frecvenţă ω1: I sum (τ ) ≈ ∫ I fl (t ) I1 (t − τ )dt −∞ ∞ În acest fel se poate determina dependenţa intensităţii de fluorescenţă de timp prin modificarea timpului de întârziere (prin intermediul dispozitivului "optical delay line"). De obicei. În figura 1 este prezentat un montaj experimental folosit pentru determinări de fluorescenţă în timp real. numai pentru un domeniu îngust din spectrul de fluorescenţă apare coincidenţa temporală şi spaţială cu pulsul de frecvenţă. Pulsul de frecvenţă ω1 trece printr-un dispozitiv optic ce produce o întârziere de fază (optical delay line). fiind separat de fundamentală cu ajutorul unui divizor de undă dicroic.

2. M . fluorescenţa în timp real a fost folosită cu succes în studii ale proceselor biologice care au loc în prezenţa luminii (proteina galbenă fotoactivă. lockin .placă semi-undă. GG420 . Observarea emisiei de fluorescenţă poate fi efectuată cu ajutorul ochiului observatorului. în principal. (DM . 2001). Set-up experimental pentru fluorescenţă în timp real (Mialocq and Gustavsson. CCD .) şi a proceselor intermoleculare (elctron transfer etc. pentru a investiga celulele şi ţesuturile vii.). 174 . Lungimea de undă de excitaţie este selectată cu ajutorul unui filtru de interferenţă sau a unui monocromator. dar este de asemenea folosită pentru a studia diferite sisteme chimice cum ar fi coloizi. cristale lichide. proton transfer etc. proteina albastră fluorescentă.fotomultiplicator.cameră video. De asemenea. iar rezoluţia maximă este aproximativ egală cu jumatatea lungimii de undă a radiaţiei folosite la excitare.Figura 1. fotodegradarea polimerilor naturali. PM . Microscopia de fluorescenţă avansată Microscopia de fluorescenţă convenţională este folosită. colorarea fibrelor etc. Un microscop de fluorescenţă convenţional diferă de un microscop standard prin faptul că este folosită o sursă de lumină (lampă cu mercur sau oxigen) ce emite şi în domeniu UV. BBO -cristal neliniar. HW .coupled device).numărător) Măsurătorile de fluorescenţă în timp real sunt foarte potrivite pentru investigarea proceselor intramoleculare fotoinduse (charge transfer. Profunzimea de câmp a unui microscop convenţional cu fluorescenţă este 2-3 µm. a unui film fotografic sau a unei camere cu detector CCD (charge.filtru. proteina verde fotoactivă etc. mixturi polimerice.oglindă dicroică.monochromator.).

5 µm. 2.1.În cazul în care proba este mai subţire decît valoarea profunzimii de câmp. prin folosirea microscopiei optice în câmp apropiat (near-field scanning optical microscopy (NSOM)) se poate lucra dincolo de limita de difracţie optică. dar. Emisia de fluorescentă produsă de proba situată în afara planului de focalizare nu va trece prin fanta multiplicatorului deoarece se va lovi de tubul ocularului (figura 2). fasciculul de lumină este focalizat pe probă. folosind o lentilă cu apertură numerică mare. Figura 2. deci prin deplasarea probei pe verticală se obţine imaginea tridimensională a acesteia. imaginea este neclară datorită defocalizării. Astfel. este de preferat folosirea altor tehnici. Deoarece în microscopia confocală de fluorescenţă se colectează numai 175 . de obicei. grosimea secţiunilor confocale poate atinge limita teoretică de aproximativ 0. De asemenea. Principiul microscopiei confocale (stânga) comparativ cu microscopia convenţională (dreapta). Microscopia confocală de fluorescenţă În cazul unui microscop confocal. Emisia de fluorescenţă este separată de lumina excitatoare cu ajutorul unei oglinzi dicroice şi este focalizată cu ajutorul lentilelor obiectivului pe fanta unui fotomultiplicator. cum ar fi microscopia confocală (confocal microscopy) sau microscopia prin excitaţia cu doi fotoni (two-photon excitation microscopy). În acest caz imaginea se poate îmbunătăţi cu ajutorul computerului. Una din caracteristicile microscopiei confocale de fluorescenţă este faptul că se pot obţine imaginile unor straturi cu o grosime bine definită.

În consecinţă. imagistica Ca2+.o parte din fasciculul de fluorescenţă emis. a cristalelor lichide şi a amestecurilor de polimeri. Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) În spectroscopia de fluorescenţă convenţională. Dacă se folosesc două lasere. De exemplu. de asemenea. posibilă prin absorbţia simultană a doi fotoni de energie mai mică (lungime de undă mai mare) prin intermediul unei stări virtuale cu timp de viaţă foarte scurt (Figura 3). Excitaţia fluoroforului este.2. Creşterea energiei fasciculului de excitare duce la descompunere fotochimică a fluoroforului. absorbţia depinde de pătratul intensităţii luminii folosite la excitaţie. Secţiunea eficace a procesului de absorbţie a doi fotoni este foarte mică (10-50 cm4·s/foton·moleculă pentu rodamina B). Microscopia confocală de fluorescenţă poate fi combinată cu tehnicile domeniu-timp şi frecvenţă-timp (time-domain. atunci fotonii sunt diferiţi (1/λe = 1/λ1 + 1/λ2). Probabilitatea absorbţiei a doi fotoni depinde de coincidenţa temporală şi spaţială a fotonilor incidenţi (diferenţa dintre timpul în care cei doi fotoni ajung la fluorofor trebuie să fie sub 10-18 s). fluoroforul este excitat prin absorbţia unui foton a cărui energie corespunde cu diferenţa de energie dintre starea electronică fundamentală şi starea electronică excitată. 2. microscopia confocală de fluorescenţă a fost folosită în studii din domeniul coloizilor. pentru a putea folosi unui fascicul excitator cu putere mai mică. energia de excitare necesară trebuie să fie mai mare decât în microscopia de fluorescenţă convenţională. imagistica pH. Reducerea efectelor nedorite datorate fenomenului de photobleaching se face prin utilizarea de fluorofori stabili şi prin folosirea unui microscop confocal echipat cu detector cu sensibilitate mare şi obiectiv cu apertură numerică mare. cei doi fotoni absorbiţi sunt identici. Excitaţia cu doi fotoni este un proces neliniar. fenomen numit photobleaching. frequency-domain) pentru a se obţine imagini din perioada numită timp de viaţă al fluoroforului (lifetime imaging). iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy). etc. iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu două culori (two-color excitation fluorescence microscopy). Microscopia confocală de fluorescenţă este o tehnică utilizată pe scară largă în biologia celulară (vizualizarea celulelor. determinarea distribuţiei potenţialului electric.). vor fi excitaţi numai fluoroforii situaţi într-o 176 . absorbţia a doi fotoni din domeniul roşu poate excita o moleculă care absoarbe în domeniul UV. Dacă este folosit un singur laser. De asemenea.

deci trebuie folosiţi laseri cu putere mare şi funcţionare în impulsuri. cum ar fi laserul cu Ti-safir. fenomenul de difuzie duce la scăderea intensităţii fasciculului de fluorescenţă emis din focar. acesta reprezintă o reducere a volumului de excitare de 1010 ori. Folosind un obiectiv cu o apertură numerică de 1.) Deoarece intensitatea fasciculului de excitare variază cu pătratul distanţei de la planul focal. Deşi efectul secţionării 3-D este comparabil cu cel din microscopia confocală. peste 80% din intensitatea totală de fluorescenţă va fi emisă dintr-o zonă situată la 1 mm în jurul focarului. Excitarea cu două culori se foloseşte atunci când se doreşte observarea unor obiecte microscopice situate în medii puternic difuzante. Deci. Excitarea cu doi fotoni permite obţinerea unei rezoluţii tridimensională deosebită în microscopia de fluorescenţă. Figura 3. (Linia punctată reprezintă starea virtuală care mediază absorbţia a doi fotoni. Deşi. în cazul excitarii cu două culori nu apare decât o creştere minimală a background-ului de fluorescenţă. nedorit. probabilitatea de absorbţie a doi fotoni în afara regiunii focale scade cu puterea a patra a distanţei.25 şi un fascicul de excitare având 780 nm. Comparativ cu fluorometrele convenţionale. excitarea cu doi fotoni a fluoroforului poate avea loc doar în focar. Comparaţie între excitaţia cu doi fotoni şi excitaţia cu un foton. 177 . în ambele tipuri de excitari (cu doi fotoni sau cu două culori). ceea ce duce la obţinerea unui contrast mai bun pentru obiecte de mici dimensiuni.1-1 femptolitri. în cazul excitării cu doi fotoni avem următoarele avantaje: (i) deoarece fasciculul de excitare este concentrat atât în timp cât şi în spaţiu nu apare fenomenul de photobleaching în afara focarului şi (ii) fasciculul excitator nu este atenuat de abosorbţia din afara focarului. ceea ce duce la creşterea adâncimii de penetrare a fasciculului excitator.regiune unde fluxul de fotoni este foarte mare. Volumul de excitaţie este de ordinul a 0.

Această limită poate fi depăşită prin utilizarea unei surse de lumină cu lungime de undă mai mică şi prin plasarea probei foarte aproape de această sursă (în câmp apropiat). Figura 4. Fasciculul laser trece printr-o fibră optică uni-modală la ataşată de un vârf special pentru determinările în câmp apropiat (vârf NSOM).2. Majoritatea instrumentelor NSOM sunt construite în jurul unui microscop cu fluorescenţă inversat. de tip NSOM (Figura 5). iar emisia de fluorescenţă este colectată de obiectivul cu apertură numerică mare. Synge (figura 4). Radiaţia luminoasă incidentă trece printr-o fantă cu dimensiuni sub-lungime de undă.axa Oz). Limita de rezoluţie este de aproximativ λ/2. Proba se află pe un suport piezo. Suprafaţa probei este poziţionată în imediata apropiere a fantei.3. H. care permite deplasarea ei în planul xy. Vârful este montat într-un cap piezo. care oferă avantajul de a furniza imagini normale şi permite ca regiunea de studiat să fie localizată cu rezoluţie mare. Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) Rezoluţia unui microcop convenţional este limitată datorită fenomenelor de interferenţă şi difracţie. care permite deplasarea pe verticală . Principiul scanării în câmp apropiat (conform ideii lui Synge) Ideea de optică în "câmp apropiat" este atribuită cercetătorului E. Fanta acţionează ca o sondă luminoasă de dimensiune sub-lungime de undă care poate fi folosită pentru a lumina suprafaţa probei înainte ca lumina să fie difractată. Lumina din vârful NSOM ataşat fibrei optice excită proba. unde λ este lungimea de undă a sursei de luminii. montat sub suportul pe care se află proba şi detec178 . Această tehnică are o rezoluţie spaţială foarte mare (de ordinal sub-micrometrilor) şi o sensibilitate foarte bună. astfel încât fasciculul emergent este forţat să interacţioneze cu proba.

a capacităţii de cartografiere a topografiei suprafeţei şi datorită faptului că fenomenul de photobleaching este redus. Acest lucru poate fi realizat cu ajutorul feedback-ului bazat în general pe metoda de forţă-forfecare: vârful este intercalat lateral la una dintre frecvenţele sale de rezonanţă cu o amplitudine de aproximativ 2-5 nm. Figura 5. proba este iluminată de la un câmp îndepărtat şi emisia de fluorescenţă este colectată de către un vârf NSOM.tată printr-un filtru (pentru a elimina lumina reziduală de la laserul folosit pentru excitare) şi un detector. în modul colectare. 179 .). Tehnica NSOM este remarcabilă pentru analiza filmelor subtiri. Această amplitudine poate fi monitorizată şi folosită pentru a genera un semnal de feedback cu ajutorul căruia se controlează distanţa dintre probă şi vârf în timpul scanării. localizarea proteinelor. Microscopia de fluorescenţă prin scanare optică în câmp apropiat poate oferi noi perspective în studiul sistemelor biologice complexe din cauza rezoluţiei mai mari decât în microscopia confocală. Sistemele care scanează piezo şi înregistrează imaginile sunt similare cu cele utilizate în microscopia de forţă atomică. Cu ajutorul tehnicii NSOM au fost investigate cu succes sisteme fotosintetice. forţele de forfecare atenueză amplitudinea vibraţiilor acestuia. cartografierea cromozomilor şi microstructura membranelor. Alternativ. Acest mod este numit modul iluminare. Pentru a obţine imagini de înaltă rezoluţie este necesară poziţionarea precisă a vârfului NSOM (de ordinul nm) faţă de suprafaţa probei. cristale lichide. etc.mod iluminare. Instrument NSOM construit în jurul unui microscop de fluorescenta inversat . (polimeri electroluminiscenţi. Când vârful NSOM interacţionează cu câmpul de forţe Van der Waals a probei.

Nanoparticulele de aur (GNP) sunt sonde ideale pentru investigarea proceselor biologice datorită biocompatibilităţii lor. II şi III). Albumina bovina (Bovine Serum Albumin) este o proteină globulară. Semnalul de fluorescenţă al albuminei (BSA) a fost obţinut la 337 nm prin excitarea reziduului de triptofan cu o radiaţie având lungimea de undă 280 nm. structura terţiară cuprinde trei domenii omoloage (I. Cunoaşterea efectelor biologice ale nanoparticulelor de aur necesită determinarea legăturilor ce apar între nanoparticule şi proteinele cu care interacţionează. ce le permite conjugarea uşoară cu diferite biomolecule. stabilizate de o reţea internă de 17 legături disulfide. Iosin şi colaboratorii [4] au înregistrat spectrele de fluorescenţă ale bioconjugatelor BSA-nanoparticule de aur cu ajutorul unui Spectrofluorimetru Jasco LP-6500 cuplat cu un dispozitiv pentru controlarea temperaturii (ADP-303T). Pe de altă parte conjugarea dintre proteină şi nanoparticulele de aur nu are ca efect doar stabilizarea sistemului proteină-nanoparticulă. 180 . Exemple de aplicaţii ale spectrofluorimetriei 3.1.3. În unele cazuri interacţiunea dintre proteină şi suprafaţa nanoparticulelor de aur poate determina modificări de structură ce duc la alterarea proprietăţilor proteinei. Albumina bovină (BSA) este utilizată ca proteină model în studiile biologice deoarece are o structură bine cunoscută şi posedă proprietăţi de fluorescenţă specifice. Soluţia de bioconjugate (nanoparticule de aur şi BSA) a fost pusă într-o cuvă de cuarţ având dimensiunea de 10 mm. folosită des în aplicaţii din domeniul bio-nanotehnologiilor. şi joacă un rol important în procesele fiziologice. datorită prezenţei celor două reziduuri de triptofan din structura ei. Structura nativă a albuminei bovine (BSA) este caracterizată de un singur lanţ polipeptidic compus din 583 reziduri de aminoacizi. este foarte importantă determinarea modificărilor conformaţionale pe care le suferă proteina în urma adsorbţiei la suprafaţa nanoparticulei. fiecare domeniu fiind format din şase elice. cu formă aproximativ elipsoidală (4nm×4nm×14nm). Deoarece interacţiunea dintre proteine şi nanoparticulele de aur este foarte sensibilă la starea conformaţională a proteinei şi la chimia suprafeţei nanoparticulelor. Determinarea interacţiunii nanoparticule de aur dintre albumina bovină şi Iosin şi colaboratorii [4] au demonstrat interacţiunea directă dintre nanoparticulele de aur şi albumina bovină. Albumina bovină (BSA) se găseşte în cantităţi mari în plasmă. cu ajutorul căruia temperatura poate fi modificată controlat de la −10 °C la +110 °C. ci determină biocompatibilizarea (funcţionalizarea) acestor nanoparticule pentru alte interacţiuni sau cuplaje cu mediul biologic.

1×10-11 M. iar nanoparticulele de aur nu prezintă emisie de fluorescenţă. tirosina şi fenilalanina a căror emisie de fluorescenţă poate fi stinsă. Soluţia apoasă de BSA are o bandă puternică de fluorescenţă cu maximul situat la 336 nm.Din spectrele de fluorescenţă se pot obţine informaţii importante (constanta de legătură şi numărul ”siturilor” de legătură) referitoare la modul de legare a proteinelor de suprafaţa nanoparticulelor de aur. (b) 0. regiune ce coincide cu banda de emisie a triptofanului. de aceea studiul emisiei de fluorescenţă a acestuia este deosebit de utilă în determinarea modificărilor conformaţionale ale proteinei şi adsorbţia la nanoparticule. Spectrele de fluorescenţă ale unor soluţii având diferite concentraţii de nanoparticule de aur şi albumină bovină (BSA) au fost monitorizare în domeniul 290-450 nm. Triptofanul este deosebit de senzitiv la modificarea vecinătăţii locale. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanosfere de aur. Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii ale nanosferelor de aur: (a) 0. Albumina bovină (BSA) conţine trei cromofori: triptofan. au monitorizat stingerea semnalului de fluorescenţă prin creşterea concentraţiei nanoparticulelor de aur de formă sferică. bandă ce este datorată emisiei reziduurilor de triptofan. Pe langă efectul evident Figura 6. După cum se poate observa în figura 6. În realitate. (e) 2. Iosin şi colaboratorii [4]. lungime de undă ce este departe de banda plasmonică de rezonanţă a nanoparticulelor de aur. fluorescenţa intrinsecă a BSA-ului este dată în principal de reziduurile de triptofan. 181 .65×10-11 M. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. F – concentraţii intermediare. iar fluorescenţa tirosinei este aproape stinsă dacă este ionizată sau dacă este aproape de un grup amino. (d) 1. (c) 1. Măsurătorile de fluorescenţă au fost efectuate cu o radiaţie excitatoare de 280 nm. carboxyl sau triptofan.2×10-11 M. deoarece fenilalanina are un randament cuantic foarte mic.55×10-11 M.

(c) 2. [6]: (F0 – Fsat)/(F – Fsat) = ([M]/Kdiss)n unde F0. adaugarea în continuare a nanoparticulelor nu duce la apariţia de noi legături BSA-nanoparticule). (b) 1. deplasare ce indică o modificare a polarităţii din jurul reziduului de triptofan. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanobastonaşe de aur. intensitatea emisiei de fluorescenţă rămâne constantă după atingerea unui nivel de concentratie a nanoparticulelor de aur.12×10-14 M.06×10-14 M. Din spectrele de fluorescenţă de mai sus autorii au determinat constanta de legătură (Kb) precum şi numărul siturilor de legătură dintre nanoparticulele de aur şi BSA.de stingere a fluorescenţei. în ambele cazuri.18×10-14 M. În figura 7 sunt prezentate spectrele de fluorescenţă ale complexului BSA-nanobastonaşe de aur. F – concentraţii intermediare. Fsat şi F sunt intensităţile de fluorescenţă datorate reziduurilor de triptofan din BSA: 182 . F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. (d) 3. Se observă că intensitatea benzii de fluorescenţă descreşte odată cu creşterea concentraţiei de nanobastonaşe de aur. autorii au observant şi o deplasare spre roşu a maximului benzii de fluorescenţă cu 4 nm (de la 336 nm la 340 nm). Această comportare se datorează unui efect de saturaţie (când toate moleculele de BSA sunt legate de nanoparticulele de aur.24×10-14 M. folosind metoda descrisă de Tedesco et al. În cazul complexului BSA-nanobastonaşe nu se observă nici o deplasare a maximului benzii de fluorescenţă odată cu modificarea concentraţiei. pentru diferite concentraţii. Figura 7. (e) 4. Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii de nanobastonaşe de aur: (a) 0.

Fsat)] în funcţie de log([M]). Din panta graficului au calculat numărul siturilor de legătură ‘‘n”. F este F intensitatea de fluorescenţă a soluţiilor de BSA având concentraţii intermediare. nanosfere de aur nanobastonaşe de aur Kb 2.5 × 105 n 1.37 0. Fsat este intensitatea de fluorescenţă a soluţiei de BSA saturată cu nanoparticule de aur.F)/(F .F0 este intensitatea de fluorescenţă a soluţiei apoase de BSA pur. [M] reprezintă concentraţia nanoparticulelor de aur. În concluzie. e reprezintă coeficientul de extincţie molară Pentru a calcula parametrii ‘‘n” şi ‘‘Kb” autorii au reprezentat grafic log[(F0 . Constanta de legătură (Kb) şi numărul siturilor de legatură (n) pentru complexul BSA-nanoparticule de aur. Concentraţia nanoparticulelor de aur a fost estimată cu ajutorul relaţiei A = [M]dε unde: A este absorbanţa soluţiei. iar nanosferele au sarcină electrică negativă. indus de suprafaţa metalică a nanoparticulei comjugată. iar din valoarea lui log[M] pentru care log[(F0 .Fsat)] = 0 au obţinut constanta de disociere (Kdiss).F)/ (F .34 × 1011 0. În plus nanobastonaşele sunt stabilizate cu citrat de sodiu pe când nanosferele sunt stabilizate cu CTAB. d este grosimea cuvei folosită pentru înregistrarea spectrelor. [M] este concentraţia particulelor (în moli). Tabelul 1. Valorile astfel calculate se găsesc în tabelul 1. interacţiunea locală dintre nanoparticulele de aur şi albumina bovină a fost investigată cu ajutorul spectroscopiei de fluorescenţă. n reprezintă numărul ”siturilor” de legătură dintre nanoparticulele de aur şi BSA Kdiss este valoarea reciprocă a constantei de legătură Kb. folosind efectul de stingere a emisiei de fluorescenţă a triptofanului din BSA. 183 .38 Valoarea mai mare a constantei de legatură în cazul nanosferelor este datorată faptului că cele două tipuri de nanoparticule au sarcinii electrice şi o chimie a suprafeţei diferite: nanobastonaşele au sarcină electrică pozitivă.

punctul izoelectric este 4. neutră pentru pH= pI şi negativă pentru pH> pI. după cum am mai amintit. Nanoparticulele de aur folosite sunt încărcate negativ la suprafaţă datorită faptului că sunt acoperite cu citrat pentru a prevenii agregarea lor. După cum se observă în figura 8. spectrul c) are maximul benzii de emisie la 337 nm. Iosin şi colaboratorii [5] au monitorizat mecanismul de interactiune între albumina bovină (BSA) şi nanoparticulele de aur cu ajutorul spectroscopiei de fluorescenţă. în consecinţă. fiecare stare conformaţională având formă şi dimensiune proprie. în soluţie. Modificări conformaţionale ale proteinelor pot fi induse de variaţii ale temperaturii şi ale pH-ului. unde pI reprezintă punctul izoelectric [6]. grupare aflată într-o poziţie hidrofobică). Spectrele înregistrate sugerează faptul că nanoparticulele de aur inhibă emisia de fluorescenţă a reziduurilor de triptofan din BSA. iar spectrele de fluorescenţă ale soluţiilor de BSA cu valori ale pH-ului 2 (spectrul a).7 [7]. grupărilor de triptofan ce sunt localizate pe suprafaţa proteinei (în domeniul I: Trp-134. în urma modificărilor de temperatură şi pH. fiind pozitivă pentru pH< pI. atracţia sau respingerea nanoparticulelor de aur. Sarcina netă a albuminei bovine este puternic dependentă de pH-ul soluţiei. spectrul de fluorescenţă al soluţiei pure de BSA (pH = 6. M. datorită senzitivităţii mari.2. în principal printr-un mecanism static (constanta de legatură Kb este dependentă de valoarea pH-ului). având o influenţă majoră asupra interfeţei dintre nanoparticule şi substanţele biologice. 336 nm respectiv 339 nm. În cazul albuminei bovine. Spectroscopia de fluorescenţă. a diabetului şi a afecţiunilor cardiovasculare. Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur. 5 (spectrul b) şi 9 (spectrul d) au maximul benzii de emisie la 324 nm. Structura albuminei bovine este puternic dependentă de pH şi temperatură. poate fi folosită pentru a obţine informaţii legate de modificările coinformaţionale ale proteinelor induse de interacţiunea cu nanoparticulele de aur la diferite valori ale pH-ului şi la diferite temperaturi. Proprietăţile fluorescente ale albuminei bovine (BSA) sunt datorate. Valoarea pH-ului afectează atât structura albuminei bovine cât şi sarcina grupării funcţionale a proteinei. Deplasarea maximul benzii de emisie indică faptul că modificarea pH-ului soluţiei duce la obţinerea de stări con184 . grupare expusă mai puternic influenţei vecinătăţii hidrofilice) şi în interiorul proteinei (în domeniul II: Trp-213. Aceste modificări ale structurii proteinelor pot duce la apariţia cancerului.3. determinând.

Pentru a obţine informaţii legate de emisia de fluorescenţă a triptofanului din albumina bovină la diferite valori ale pH-ului în prezenţa nanoparticulelor de aur. pH 6 (c) şi pH 9 (d). Astfel.75×10−11 M).55×10−11 M la 2. pH 5 (b). Deplasarea maximului benzii de emisie spre lungimi de undă mai mici indică faptul că triptofanul din albumina bovină are o vecinătate mai hidrofobică (se modifică structura terţiară). Emisia de fluorescenţă a albuminei bovine de tipul ‘E-form’ are maximul deplasat spre albastru. în timp ce la pH = 2 şi pH = 9 albumina bovină are formă extinsă (‘E-form’) respectiv bazică (‘B. Iosin şi colaboratorii [5] au folosit o concentraţie fixă de BSA titrată în cantităţi diferite de soluţie de nanoparticule de aur. iar deplasarea maximului benzii de emisie spre lungimi de undă mari ne indică faptul că triptofanul este mai expus solventului.formaţionale diferite ale albuminei. autorii au calculat constanta de stingere a fluorescenţei (KSV) folosind ecuaţia Stern–Volmer: F0/F = 1 + Kqτ0[GNPs] = 1 + KSV[GNPs] unde: F0 şi F sunt intensităţile relative de flkuorescenţă ale triptofanului în absenţa şi în prezenţa nanoparticulelor de aur. în comparaţie cu emisia albuminei bovine de tipul ‘N-form’. Figura 8. la pH neutru albumina bovină are o formă nativă (‘N-form’). Din spectrele de fluorescenţă.form’). datorită creşterii separaţiei inter-domeniu şi schimbării configuraţiei proteinei astfel încât gruparea triptofan are o vecinătate mai hidrofobică. Spectre de fluorescenţă ale albuminei bovine la pH 2 (a). 185 . Spectrele de fluorescenţă înregistrate (figura 9) demonstrează scăderea drastică a emisiei de fluorescenţă (quenching) a triptofanului din albumina bovină la pH = 2 odată cu creşterea concentraţiei nanoparticulelor de aur (de la 0.

KSV este constanta de stingere Stern–Volmer.0×1010 M−1 s−1) în cazul stingerii emisiei de fluorescenţă a macromoleculelor biologice datorită mecanismului de ciocnire. precum şi numărul siturilor de legătură (n) dintre nanoparticule şi BSA conform relaţiilor din pargraful anterior.1×10−11 M. ce indică senzitivitatea fluoroforului la molecula ce determină stingerea fluorescenţei (quencher).65×10−11 M. Figura 9. în cazul bioconjugatelor BSA–GNPs stingerea emisiei de fluorescenţă nu este iniţiată de ciocniri dinamice ci de formarea unui complex nefluorescent în urma unui mecanism de stingere static.7×109 M−1 pentru pH = 6 şi KSV = 1. (b) 0. [GNPs] reprezintă concentraţia nanoparticulelor de aur.55×10−11 M.77 la pH 2. (c) 1.11×109 M−1.6×109 M−1 pentru pH = 9. Prin fitare liniară s-a obţinut KSV = 1. obţinându-se valorile: Kq = 0. Graficul inserat reprezintă curba Stern–Volmer. 1. (e) 2.32×1018 M−1 s−1 la pH = 9. Valoarea obţinută pentru constanta de stingere bimoleculară Kq este mai mare decât valoarea obţinută (2.2×10−11 M şi (f) 2. În urma calculelor s-au obţinut următoarele valori pentru numărul siturilor de legătură (n): 1. Deci. Astfel.97 la 186 .22×1018 M−1 s−1 pentru bioconjugatele BSA– GNPs la pH = 2. Spectre de fluorescenţă ale grupării triptofan din BSA la pH = 2 pentru diferite concentraţii ale nanoparticulelor de aur: (a) 0. (d) 1.34×1018 M−1 s−1 la pH = 6.Kq este constanta de stingere bimoleculară. τ0 = 5×10−9 s este timpul de viaţă mediu al albuminei bovine în absenţa nanoparticulelor de aur. constanta de stingere bimoleculară Kq a fost calculată.75×10−11 M. În mod similar au fost calculate constantele de stingere Stern–Volmer pentru pH = 6 şi pH = 9. Iosin şi colaboratorii [5] au determinat constanta de legătură la echilibru Kb (indică echilibrul dintre speciile adsorbante şi cele resorbante). obţinându-se valorile KSV = 1. respectiv Kq = 0. Kq = 0.

pH 6 şi 1. autorii au studiat formarea bioconjugatelor la pH = 5. analizând emisia de fluorescenţă a triptofanuluui din BSA. În acest scop. 1. deci creşterea temperaturii duce la apariţia de modificări structurale ale proteinei.82×109 M−1. Odată cu creşterea temperaturii.74×109 M−1 şi Kq = 0. Graficul inserat (denaturation curve) indică o relaţie neliniară între deplasarea maximului benzii de absorbţie şi temperatură.3.03×109 M−1 la pH 9. iar cealaltă la 65 ºC. Iosin şi colaboratorii [5] au studiat modificările structurale ce apar în cazul denaturării termice a albuminei bovine. înainte şi după absorbţia la suprafaţa nanoparticulelor de aur. respectiv pentru constanta de legătură Kb: 2. curba de denaturare a albuminei bovine pure sugerează existenţa a două temperaturi de tranziţie: una la 43 ºC. 3. La aceste temperaturi apare o modificare a vecinătăţii triptofanului din albumină. au fost monitorizate modificările emisiei de fluorescenţă a triptofanului din BSA pentru temperaturi cuprinse între 22 ºC şi 85 ºC (domeniu în care apare o modificare importantă a structurii terţiare a albuminei).6×109 M−1 la pH 2. soluţia apoasă pură de BSA are o emisie de fluorescenţă puternică. Pentru a mima o vecinătate biologică reală. La temperatura camerei. maximul benzii de fluorescenţă datorată triptofanului se deplasează spre numere de undă mai mici. deci determinarea condiţiilor în care are loc acest proces este foarte importantă pentru înţelegerea stabilităţii proteinelor. prin creşterea temperaturii forma nativă a proteinei devine mai flexibilă. prima temperatură de tranziţie apărând în 187 .85 şi Kb = 2. sau regiunile hidrofobice devin predispuse la interacţiuni intermoleculare noi.81×109 M−1 la pH 6 şi 2. ajungând până la 330 nm (figura 10). După cum observă şi autorii. Constanta de stingere Stern–Volmer şi constanta de stingere bimoleculară obţinute pentru această valoare a pH-ului sunt: KSV = 1. valori ce indică faptul că adsorbţia maximă a moleculelor de albumină la suprafaţa nanoparticulelor de aur apare pentru o valoare a pH-ului apropiată de punctul izoelectric (pI) al BSA-ului. De menţionat că valorile mai mari ale constantei de legătură indică o atracţie mai puternică între cele două specii. Numărul siturilor de legătură şi constanta de legătură pentru pH = 5 este: n = 1. grupările –SH libere. Ca urmare a acestui fapt. cerntrată la 337 nm. De fapt.76 la pH 9. Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului Denaturarea termică a proteinelor este un proces intrinsec.348×1018 M−1 s−1. Platoul curbei de denaturare indică faptul că albumina îşi menţine starea nativă pînă la aproximativ 42 ºC.

pe lângă denaturarea proteinei. Între 43 ºC şi 65 ºC se observă o deplasare spre albastru a maximului emisiei de fluorescenţă a albuminei bovine.la creşterea şi descreşterea temperaturii). Astfel. la pH 6. Autorii au studiat efectul combinat al pH-ului şi al temperaturii înainte şi după conjugarea albuminei bovine cu nanoparticulele de aur. Dependenţa de temperatură a emisiei de fluorescenţă a grupărilor de triptofan din albumina bovină. Inserat: curba de denaturare termică (variaţia maximului benzii de fluorescenţă în funcţie de temperatură . Figura 10. în mediu alcalin (pH mare) temperatura de tranziţie este mult mai scăzută (32 °C) decât în mediu neutru (pH = 6) ceea ce indică o denaturare termică mult mai rapidă în mediu bazic. creşterea temperaturii de la 22 ºC la 85 ºC determină descreşterea cu 72% a emisiei de fluorescenţă. Astfel. prin compararea denaturării termice (între 22 ºC şi 85 ºC) a proteinei în soluţie pentru diferite valori ale pH-ului (2 . în mediu acid (pH mic) proteina este mai stabilă termic.9). deplasare ce sugerează tranziţia albuminei de la starea nativă (compactă) la o stare cu o structură mai deschisă.jurul pragului maxim admis al febrei ce apare în condiţii de boală (42 ºC). valoare la care apare un al doilea platou în curba de denaturare. Prin măsurarea emisiei de fluorescenţă a triptofanului din albumină în procesul de răcire. Denaturarea completă a proteinei se face după 65 ºC. s-a determinat faptul că procesul de denaturare termică a albuminei bovine este ireversibil. O dată cu creşterea temperaturii. În urma măsurătorilor efectuate s-a observat o dependenţă accentuată de valoarea pH-ului a temperaturii de tranziţie la care proteina îşi modifică conformaţia. În mod contrar. apare şi scăderea în intensitate a emisiei de fluorescenţă a triptofanului. datorită expunerii triptofanului la moleculele de solvent. După cum se observă în figu188 . temperatura de tranziţie la care începe denaturarea termică este mai mare (46 °C) decât în mediu neutru.

prezenţa nanoparticulelor de aur îmbunătăţeşte stabilitatea termică a proteinei. Deci. pentru pH = 6 temperatura de tranziţie creşte de la 42 °C la 47 °C. Inserat: dependenţa constantei de stingere Stern–Volmer de temperatură. 189 . Figura 11. în funcţie de temperatură pentru diferite valori ale pH-ului. bioconjugarea albuminei bovine cu nanoparticule de aur. modifică forma curbei de denaturare. După cum se observă şi din figura 11. prezenţa nanoparticulelor induce o deplasare. deci modifică comportarea termică a proteinei. Curbele Stern–Volmer pentru stin gerea fluorescenţei BSA-ului de către nanoparticule de aur (pH = 6).ra 11. Variaţia maximului emisiei de fluorescenţă a triptofanului din BSA. a emisiei de fluorescenţă. Figura 12. respectiv din bioconjugatul BSA-nanoparticule. Pentru a investiga efectul temperaturii asupra fenomenului de stingere a fluorescenţei albuminei bovine de către nanoparticulele de aur a fost calculată constanta de stingere KSV pentru diferite temperaturi. spre numere de undă mari. De exemplu. rezultând creşterea temperaturii de tranziţie indiferent de valoarea pH-ului.

“Principles of Fluorescence Spectroscopy”. (2011). Ed.35 -54.0601 0. Gunner.R. “Molecular Fluorescence: Principles and Applications”.70 -64. Mol. Curry. Toderas. Joseph Lakowicz. Constanta de stingere KSV şi parametrii termodinamici pentru complexul BSA-nanoparticule de aur.60x109 1. Springer Verlag.-C. 395-401. S.79 132. 83 (2002) 1731–1748. Crystal structural analysis of human serum albumin complexed with hemin and fatty acid.A. Valeur. Alexov. Tabelul 2.-C.9982 0. Journal of Photochemistry and Photobiology A: Chemistry. F.9983 0.E. Wiley-VCH. Gustavsson.Graficul Stern-Volmer ce caracterizează stingerea emisie de fluorescenţă a triptofanului din albumina bovină de către nanoparticulele de aur. Canpean. Bibliografie 1. J.0683 0. Spectroscopic studies on pH. BMC Struct.70x109 1.11x109 6. Investigation of femtosecond chemical reactivity by means of fluorescence up-conversion. 190 . Astilean. M.88x109 5. Iosin. Komatsu. Brochon.41x109 9. Berlin (2001).11 10. Iosin.9975 ΔH(kJ/mol) ΔS(J/mol K) ΔG(kJ/mol) -48. (2006). P. Fluorescence Spectroscopy: New Trends în Fluorescence Spectroscopy. 7. Zunszain. Bernard Valeur. Springer. 6. Eds B. (2002). P.0700 R 0. 338. E. 318.deviaţia standard pentru valorile coeficientului KSV. J. Tsuchida. 3. Biophys. (SD .0721 0. 924–926 (2009) 196–200.9980 0. Ed.96 81. S. 5. J. R.and thermally induced conformational changes of Bovine Serum Albumin adsorbed onto gold nanoparticles. S.05x109 SD 0. 3 (2003) 1–9. Astilean. confirmă faptul că mecanismul de stingere a fluorescenţei triptofanului din albumina bovină de către nanoparticulele de aur este iniţiat de formarea unui complex ne-fluorescent prin adiţia moleculelor de albumină bovină la nanoparticulele de aur. Study of protein-gold nanoparticle conjugates by fluorescence and surface-enhanced Raman scattering. E. V. Georgescu.0651 0.87 53. R . 4. la pH 6 pentru diferite temperaturi (295. 2.0782 0. Ghuman.G. Biol. 358 K) ne indică faptul că constanta de stingere KSV scade odată cu creşterea temperaturii (figura 12). T.coeficientul de corelaţie) pH 6 T (K) 295 318 338 295 318 338 KSV (L/mol) 1.32 51.9988 0. J. 217.59 55. M. Combining conformational flexibility and continuum electrostatics for calculating pKas în proteins. Baldeck.22 2 Proporţionalitatea inversă dintre constanta de stingere KSV şi temperatură (tabelul 2). Struct. Mialocq and T. 4.9994 0.29 -28. M. J.

...................... în jurul direcţiei câmpului magnetic static (direcţia z).............. Principalele proprietăţi ale câtorva nuclee active RMN.....γiB0....... Principiul metodei..... astfel încât după o perioadă de ordinul aşa numitului timp de relaxare longitudinal.... distribuite izotrop în momentul aplicării lui B0....... unde S este numărul cuantic de spin.......... asociate speciei nucleare i..... SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) C. Bibliografie . 196 3................... are două efecte majore: (i) axa polarizării de spin efectuează o mişcare de precesie cu frecventa Larmor........ Principiul metodei Generarea semnalului RMN Spectroscopia RMN se bazează pe fenomenul de rezonanţă magnetică aplicat asupra momentelor magnetice nucleare μi = γiS...................S..S.i = . T1. 215 1.... iar γ i reprezintă factorul giromagnetic.............. Claudiu Filip C. sunt prezentate în tabelul de mai jos: 191 .VI................................................... dr...... dr..... 191 2... şi (ii) polarizările spinilor.....III.... Plasarea probei care conţine momente magnetice nucleare într-un camp magnetic extern intens................. cu relevanţă în special pentru sisteme moleculare organice...... Mihaela Aluaş Cuprins 1.. B0 ~ 7-23 T (generat cu ajutorul unei bobine supraconductoare)......... 202 4...... se vor reorienta sub acţiunea câmpurilor magnetice locale fluctuante uşor datorită mişcării termice....I............... ω0..... Infrastructura existentă la UBB Cluj pentru exprimente RMN-S ....... proba va fi caracterizată de o magnetizare macroscopică orientată de-a lungul direcţiei câmpului magnetic extern......... Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice .....

După încetarea acţiunii pulsului rf magnetizarea Figura 1 192 .1 99.5 125 35.98 0.9 90 Deoarece magnetizarea longitudinală nu poate genera un semnal RMN.7 Abundenţa naturală [%] 99.i tp = π/2) necesită aplicarea câmpului rf pe durata tp de ordinul câtorva µs. Pentru valori tipice ale lui B1 utilizate în spectroscopia RMN-S.i. i 1H 2H 13C 14N 15N γ iγ S 1/2 1 1/2 1 1/2 [ 107 rad s-1T-1] 26. Deşi în practică B1 << B0. ωrf = ω0. rf) va determina o mişcare de precesie cu frecvenţa ω1.i [MHz] B0 = 11.i = ω1.6 0. Acest lucru se realizează prin aplicarea unui câmp magnetic oscilant cu frecvenţa ωrf.5 50 B0 = 21 T 900 137.Specia nucleară.i = γiB1 a polarizării spinilor i în jurul direcţiei lui B1 dacă ωrf satisface condiţia de rezonanţă.8 4.02 1.7 225 63.37 ν0. frecvenţa de nutatie ν1. câmpul oscilant (numit şi câmp de radiofrecvenţă.i /2π este de ordinul zecilor de kHz. este necesară mai întâi rotirea polarizării de spin în planul transversal. astfel încât rotirea magnetizării în plan transversal (ω1.7 T 500 76. sau este apropiată de aceasta: în literatura RMN această precesie este deseori denumită nutaţie.7 1. perpendicular pe câmpul magnetic extern: el este generat de curentul aplicat asupra unei bobine de transmisie în interiorul căreia este plasată proba.9 -2.1 6. adică sub forma unui puls. şi amplitudinea B1. xy.

şi constituie astfel baza multiplelor aplicaţii ale spectroscopiei RMN în (bio)chimie. ω0. adică spectrul RMN. conţin o parte reală şi una imaginară. B0.i). Frecvenţele asociate interacţiunilor de spin interne sunt mult mai mici decât frecvenţele Larmor. adică înregistrarea de spectre RMN distincte pentru fiecare specie nucleară în parte. FID-ul este înregistrat în intervalul de timp t2. 1 se obţine un spectru RMN 1D (unidimensional) ale cărui proprietăţi (poziţii. forme şi intensităţi de linie) depind în mod esenţial de interacţiunile la care sunt supuşi spinii nucleari pe durata t2. Cu ajutorul experimentului din Fig. 1.i. În realitate. etc. şi este ilustrat schematic în Fig. 2 în cazul nucleelor 13C: 193 . în jurul lui ω0. numit timp de achiziţie. pe durata căruia se produce defazarea polarizării transversale. În acest context. Descrierea de mai sus se referă la aşa-numitul experiment RMN de “un puls”. spectrul asociat speciei nucleare i ar conţine o singură linie la poziţia frecvenţei Larmor asociate. ceea ce face ca pentru fiecare specie nucleară i.i.transversală va precesa liber în jurul lui B0. astfel încât amplitudinea lui se apropie de zero. Atât semnalul în domeniul temporal. de exemplu deplasările (faţă de ω0. şi deci implicit la apariţia mai multor linii în spectrul RMN 1D. să existe o fereastră spectrală de lărgime limitată. ştiinţa materialelor. iar conţinutul lui de informaţii ar fi extrem de sărac. Această mişcare induce un curent electric oscilant pe bobina de detecţie (aceeaşi cu bobina de transmisie) ce poartă numele de semnal RMN.i care conţine întregul spectru RMN-1D al speciei nucleare respective. prezenţa aşa-numitor interacţiuni de spin interne conduce la valori ale câmpului magnetic local la poziţiile diferitor spini i uşor diferite de B0. soluţia practică utilizată în spectroscopia RMN modernă corespunde aşa-numitului mod de lucru pe canale rf distincte. Detecţia semnalului RMN Aplicând transformata Fourier asupra FID-ului se obţine reprezentarea acestuia în domeniul de frecvenţă. despicările şi/sau lărgirile liniilor individuale sunt în directă conexiune cu elemente de structură chimică/spaţială bine determinate. sau FID (free-induction decay). precum este cel ilustrat în Fig. După o perioadă de aproximativ t0 ~ 5T1 polarizarea de spin se reconstruieşte de-a lungul direcţiei z şi experimentul poate fi repetat. ΔΩi << ω0. corespunzător modului de detecţie în cuadratură. Parametrii spectrali. Considerând doar interacţiunea cu câmpul static extern. cât şi cel în domeniul de frecvenţă.

aşa-numitele deplasări chimice. poziţiile liniilor în spectrul 13C din Fig. sunt interacţiunea dipolară (homo. 2 sunt utile pentru determinarea structurii chimice. şi interacţiunea scalară (cuplajul J).C ca urmare a diferenţelor în intensitatea câmpului magnetic local indus de distribuţia electronică din vecinătate. În acest mod.Figura 2 Interacţiunile de spin cu relevanţă în aplicaţiile spectroscopiei RMN-S pe probe organice. au fost dezvoltate o serie de tehnici speciale numite de decuplare: ele acţionează în sensul atenuării efectului produs de anizotropia interacţiunilor de spin şi conduc la spectre RMN-S de înaltă rezoluţie. Deplasările chimice reflectă deplasările frecvenţei de precesie la diferite poziţii ale nucleelor 13C în sistemul molecular investigat faţă de valoarea ω0. şi sunt prin urmare reprezentative pentru gruparea chimică din care nuceele respective fac parte. spectre RMN 1D precum cel ilustrat în Fig. 2 sunt determinate de valorile izotrope ale ecranării chimice. prin identificarea grupărilor chimice distincte din moleculă în funcţie de regiunea spectrală specifică în care se plasează liniile RMN. 194 . interacţiunea de ecranare chimică. Ele produc în general spectre cu linii foarte largi caracterizate prin suprapuneri severe ce fac imposibilă extragerea de informaţii utile. cu linii suficient de înguste încât să permită identificarea componentelor izotrope ale acestora. De exemplu.şi heteronucleara). În consecinţă. Primele două sunt dominante în cazul nucleelor cu spin ½ (având constante de cuplaj de la câţiva kHz până la aproximativ 100 kHz) şi au un caracter anizotrop.

1).Noţiunile introductive vor fi completate în final cu câteva precizări utile. în timp ce pentru un spectru 1H de calitate este suficientă înregistrarea unui singur scan. câmpul magnetic static.7 T va fi denumit spectrometru de 500 MHz) • Pentru a obţine un spectru RMN de calitate (cu raport semnal/zgomot cât mai mic) este în general nevoie de înregistrarea unui număr N de FID-uri. în cazul în care ωrf nu este exact în rezonanţă cu frecvenţa de precesie Larmor a speciei nucleare i. Cel de-al doilea mod este de obicei preferat pentru că poziţiile liniilor într-un compus dat vor fi aceleaşi indiferent de valoarea câmpului magnetic . factorul giromagnetic. abundenţa izotopică şi numărul de poziţii chimice distincte în sistemul studiat. care reprezintă unghiul φ pe care îl face B1 faţă de axa Ox. privind implementarea lor concretă în practica curentă: • Un spectrometru RMN este caracterizat în mod tradiţional prin valoarea frecvenţei Larmor a spinilor 1H în câmpul magnetic al acestuia (de exemplu un spectrometru cu un criomagnet care produce un câmp B0 = 11. cu un timp de repetiţie determinat de valoarea lui t0 (conform Fig. etc. • Poziţiile liniilor într-un spectru RMN sunt date fie în unităţi absolute de frecvenţă (Hz).).ω0. π. fie în unităţi relative numite părţi pe milion (ppm) care reprezintă raportul dintre această deplasare faţă de frecvenţa de referinţă şi frecvenţa Larmor a speciei respective. menite să asigure legătura între baza conceptual-teoretică prezentată mai sus şi elementele concrete cu caracter aplicativ. • Un puls rf se caracterizează prin trei parametri distincţi: (i) unghiul α de rotire a magnetizării faţă de direcţia z – aşa-numitul unghi de tilt (de exemplu α = π/2.i. Pentru exemplificare. Aceasta din urmă este dată în principal de cantitatea de probă. ca şi deplasare faţă de o linie de referinţă caracteristică fiecărei specii nucleare. (ii) faza pulsului. spectrul RMN-S 13C a unui compus în faza policristalină cu izotopul 13C în abundenţă naturală şi cu un număr de până la 10 poziţii chimice distincte a carbonilor din moleculă necesită acumularea unui număr de ordinul miilor de scanuri pentru a obţine un raport semnal/zgomot acceptabil (> 30). Valoarea optimă a lui N (denumit număr de scanuri în terminologia de specialitate) depinde pentru fiecare specie nucleară de sensibilitatea asociată. şi (iii) frecvenţa de offset. care vor fi adunate pentru a genera semnalul RMN final. Δωi = ωrf . • Fiecare specie nucleară distinctă este caracterizată de o aşa-numită fereastră spectrală de lărgime limitată în interiorul căreia se plasează toate liniile RMN posibile: de exemplu lărgimile tipice ale acestei 195 .

simultan pe mai multe canale rf. achiziţionate în anii 2002 şi 2009. pot fi găsite în literatura de specialitate. De-a lungul timpului a fost dezvoltată o diversitate foarte mare de tehnici RMN complexe care presupun aplicarea de secvenţe multi-puls extrem de sofisticate. această tehnologie fiind introdusă chiar de firma Bruker în 1996. 2. În consecinţă. 1) se realizează în mod discret (digital) cu un timp de eşantionare numit dwell time. 300 ppm (pentru 13C). Infrastructura existentă la UBB Cluj pentru experimente RMN-S Descrierea componentelor hardware Laboratoarele Centrului Naţional de Rezonanţă Magnetică (CNRM) sunt dotate cu două spectrometre Bruker. şi 500 ppm (pentru 15N). 1 prezintă cel mai simplu experiment posibil în spectroscopia RMN.1 Tesla cu frecvenţa de rezonanţă pentru nucleii de hidrogen de 400 MHz şi 600MHz. şi permit extragerea selectivă a informaţiilor dorite. Magnetul acestora este autoecranat.4 Tesla. transformarea Fourier se va aplica asupra acestui semnal digitizat. respectiv 14. iar câmpul generat de acesta este de 9. Referinţe detaliate cu privire la fundamentarea teoretică a acestor tehnici moderne. Exemplul prezentat în Fig. Spectrometrul Bruker DRX 400 din dotarea CNRM 196 .• • ferestre spectrale sunt de aproximativ 20 ppm (pentru 1H). şi se realizează utilizând aşa-numitul algoritm FFT (fast Fourier transform). precum şi la implementarea lor experimentală. Achiziţionarea directă a semnalului RMN (pe durata lui t2 în Fig.

57Fe.Spectrometrele Bruker DRX 400 şi Bruker DRX 600 sunt complet digitale iar controlul acestora se face în totalitate prin intermediul unui calculator de tip PC. Pentru studiul probelor solide există în dotare mai multe capete de sondă care permit efectuarea experimentelor la temperaturi între -80 °C şi 200 °C. iar rotirea mecanică a probei se poate face la o frecvenţă de rotatie de până la 35 kHz. 15N. Magnetul spectrometrului Bruker DRX 600 din dotarea CNRM Unitatea MAS folosită pentru controlul automat sau manual al rotirii probelor solide la unghiul magic 197 . Pot fi efectuate măsurători spectroscopice de rezonanţă magnetică nucleară pe o gamă foarte largă de nuclee: 1H. Ambele sisteme pot analiza atât probe în stare condensată cât şi probe în stare lichidă. 13C. 27Al. 69Ga etc.

necesară introducerii şi tasării substanţei de măsurat precum şi scoaterii acesteia din rotor. începând cu generaţia de spectrometre Avance III. soft-ul de comandă se numeşte XWin NMR (până la generaţia Avance II). Se mai poate observa şi conexiunea cablului care serveşte la detectarea. Se pot observa conectările acestui cap de probă la surse de aer necesar atât pentru rotirea probei la unghiul magic cât şi pentru controlul temperatuii probei. În cazul spectrometrelor Bruker. Descrierea componentelor software Pentru comanda modulelor electronice ale unui spectrometru RMN există pachete software specializate prin intermediul cărora elementele distincte ale unui experiment RMN sunt transpuse în comenzi specifice.Capul de probă folosit pentru măsurătorile pe probe solide introdus în câmpul magnetic static. iar programul TopSpin comandă spectrometrul Bruker DRX 600. şi respectiv TopSpin. Cele două versiuni ale soft-ului de comandă Bruker diferă prin interfaţa grafică şi prin numărul 198 . Corespunzător echipamentelor existente la UBB Cluj. a vitezei de rotaţie a probei. primul este instalat pe spectrometrul Bruker DRX 400. În imaginea de mai sus se poate observa rotorul şi instrumentaţia specifică. prin intermediul fibrei optice.

necesar în experimentul considerat. respectiv: pulsuri rf. Pentru o privire completă a modului de lucru cu fazele. după care se ajustează puterea la ieşire a transmiţătorului astfel încât curentul transmis pe bobină să producă o intensitate B1 a câmpului rf care să corespundă unui puls de 900 (în cazul exemplificat. 31 – indicele asociat). durata fiecăruia dintre acestea şi. De aceea. comune ambelor programe: • Comanda unui experiment RMN se realizează prin intermediul aşa numitului program de pulsuri (pulse program) care specifică acţiunile aplicate în cadrul experimentului. • Sensibilitatea spectrală maximă se obţine pentru o valoare α = 900 a unghiului de tilt pentru pulsul p1 (asa-numitul puls de 900). Ele au asociate următoarele comenzi specifice în programul de pulsuri: pn (p – puls.. dn (d – delay. 1. p1. calibrarea acestui puls se realizează prin fixarea duratei lui p1. 90. În practică. precum şi faptul caă este aplicat pe canalul f1. şi go=n (go – este un script care transmite comenzi specifice receptorului pentru achiziţionarea digitală a semnalului RMN. o serie de proprietăţi specifice • Primul tip de acţiuni corespunde elementelor standard ale unui experiment RMN (precum cel ilustrat în Fig. ν1 trebuie să fie 100 kHz. de exemplu la 2. reprezintă fazele 0. iar n este eticheta liniei de comandă care va fi efectuată după încheierea achiziţiei) • În programul de pulsuri prezentat mai jos (care implementează experimentul RMN de un puls în Fig. -x şi –y). iar în reprezentarea modelului vectorial. Ea specifică durata acestuia. conform relaţiei 2πν1tp = π/2).5 μs. 199 . în continuare vom face o foarte scurtă prezentare axată pe evidenţierea principiior fundamentale.. în funcţie de tipul acţiunii. 1). 2 şi 3. Faza ph1 este în schimb explicitată la sfârşitul programului de pulsuri (valorile corespund convenţiei Bruker în care 0. y.sporit de scripturi pentru calibrarea parametrilor experimentali existente în TopSpin dar. α. În mod similar se procedează şi în cazul în care se calibrează un puls cu orice altă valoare a unghiului de tilt. 1). cu faza ph1. se recomandă consultarea manualului de utilizare Bruker.. perioade de evoluţie liberă şi perioada de achiziţie directă. comanda referitoare la aplicarea pulsului rf este p1:f1 ph1. în rest. Valorile lui p1 şi f1 sunt introduse explicit de către utilizator în aşa numita tabela de achiziţie (acquisition table). 31 – indicele asociat). incluzând cazul general în care acestea nu sunt multipli de 900.. n = 0 . x. 180 şi respectiv 2700. prin intermediul unor variabile care poartă acelaşi nume. ele sunt echivalente la nivel conceptual. n = 0 .

iar valoarea lui este introdusă explicit în tabela de achiziţie. iar în exemplul nostru concret d1 corespunde unei valori rezervate. care vor fi specificate prin comenzi de tipul dn. Ele corespund în general unor comenzi care se aplică asupra modulelor electronice. de exemplu între pulsuri rf consecutive. unde ph31 este faza receptorului). Linia de comandă 2 d1 din programul de pulsuri de mai jos reprezintă o perioadă de durată d1 (a cărei valoare este introdusă explicit în tabela de achiziţie) în care intensitatea câmpului rf transmis/receptat este zero. valorile pln sunt date în decibeli (dB). aceste tipuri de acţiuni sunt reprezentate de comenzile: 1 ze (efectuează resetarea tuturor modulelor electronice la valorile lor iniţiale). În convenţia Bruker. În experimente multi-puls mai complexe. în afară de recycle delay vor exista mai multe perioade de evoluţie liberă a sistemului.• • • Nivelul de putere al unui puls rf este cel specificat în programul de pulsuri anterior comenzii de aplicare a pulsului respectiv. go=2 ph31. şi exit (comanda de încheiere a experimentului). 200 . şi corespund atenuării care trebuie aplicată la ieşirea transmiţătorului pentru a obţine valoarea dorită a câmpului rf pe bobina. linia de comandă are în faţă indicele 2. cu scopul comutării lor între diferite regimuri de funcţionare. a fazelor. Din acest motiv. scrierea datelor achiziţionate etc. în exemplul nostru. adică timpul necesar reconstruirii magnetizării longitudinale după detecţia sa. a nivelurilor de putere la ieşirea transmiţătorului. ce reprezintă punctul de unde experimentul RMN se repetă. adică semnalul RMN digitizat). wr #0 (scrie în memorie datele achiziţionate. În exemplul de mai jos. pentru a achiziţiona un nou scan: acest fapt este explicitat în linia de comandă asociată achiziţiei semnalului RMN. 2us pl1:f1 (pe durata unui delay fixat la 2 μs se setează atenuatorii la ieşirea transmiterului la valoarea specificată prin parametrul de achiziţie pl1. respectiv recycle delay. astfel încât orice comandă pn care apare după aceasta linie va aplica un puls rf de durata pn şi cu un nivel de putere pl1). pl1. Al doilea tip de acţiuni specificate într-un program de pulsuri nu au echivalent în schema standard a unui experiment RMN.) şi au asociat un timp (ideal cât mai scurt) pe durata căruia comutarea se poate realiza din punct de vedere fizic. Ea reprezintă aşa numitul delay. şi sunt necesare pentru implementarea practică a elementelor componente în experimentul RMN dat (de exemplu comutarea frecvenţelor de offset.

se recomandă consultarea manualelor Bruker. etc. Parametri specifici acestui proces sunt incluşi în aşa numita tabelă de procesare. care oferă informaţii cu privire la: tipul de experiment (1D. qseq – în cuadratură. tabela de achiziţie va mai conţine în mod obligatoriu şi alţi parametri caracteristici experimentelor RMN. dewll time (dw) – durata de eşantionare a semnaluilui RMN digitizat. numărul de scanuri (ns) – numărul de semnale RMN achiziţionate direct şi adunate între ele în scopul reducerii nivelului de zgomot la un nivel acceptabil. iar tipul şi numărul acestor parametri depinde de complexitatea experimentului avut în vedere. numele programului de pulsuri utilizat în experimentul considerat (pulprog). exprimate de obicei în multiplii de 16. pe canalul f1.).• • • Liniile care încep cu . Pentru o descriere detaliată. reprezintă linii de comentarii: ele sunt necesare (în special în cazul experimentelor multi-puls mai complexe) pentru a explicita semnificaţia parametrilor incluşi în programul de pulsuri asociat.). 2D. f2. : pentru fiecare nucleu aceasta este fixată în momentul configurării spectrometrului). de asemenea. acesta trebuie supus transformării Fourier pentru a genera spectrul RMN. frecvenţele de offset pe canalele pe care se lucrează (o1. 201 . După cum s-a precizat mai sus. Pentru detalii.) – se exprimă în Hz sau ppm. valorile numerice ale parametrilor incluşi în programul de pulsuri sunt specificate în tabela de achiziţie. În afară de aceştia. sf2. însă reprezintă doar o mică parte din numărul total de parametri posibili (câţi anume dintre aceştia sunt utilizaţi efectiv într-un experiment dat depinde de complexitatea lui). şi reprezintă devierea (cu + sau -) faţă de frecvenţa de bază pe canalul respectiv (sf1. dar colectând altenativ puncte în partea reală şi imaginară a semnalului RMN. tipul nucleului asociat cu canalele rf utilizate în experimentul dat ( f1. domeniul temporal (td) – numărul de puncte achiziţionate. etc. pe canalul f2. etc. tipul de achiziţie directă (qsim – în cuadratură. colectând simultan puncte în partea reală şi imaginară a semnalului RMN. adică durata între două puncte consecutive. După achiziţionarea semnalului RMN. Aceştia sunt parametri cei mai importanţi în cadrul unui experiment RMN tipic. o2. etc. etc.). se recomandă consultarea manualelor Bruker.

În stare solidă mişcarea rapidă de reorientare moleculară este absentă. Anizotropia interacţiunilor prezintă pe de o parte dezavantajul de a conduce la pierderea rezoluţiei prin suprapunerea liniilor RMN: în Fig. Spectrele compuşilor în soluţie sunt caracterizate de o rezoluţie foarte bună.incl" 1 . efectul componentelor anizotrope ale interacţiunilor de spin prezente în sistem este mediat la zero. implicit. respectiv lichidă sau solidă.d1 : relaxation delay. în 202 .power level for pulse (default) . datorată mişcării moleculare rapide: prin aceasta. 3 este ilustrată comparaţia dintre un spectru 1H RMN tipic al unui compus organic în soluţie. caracterizat de rezoluţie înaltă. adică un spectru cu linii de rezonanţă înguste şi bine separate în funcţie de deplasările chimice izotrope. păstrându-se doar partea lor izotropă. Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice Tehnici specifice de înaltă rezoluţie în solide: rotirea în jurul unghiului magic (MAS – Magic Angle Spinning). şi spectrul aceluiaşi compus aflat în stare solidă. 1 diferă fundamental în funcţie de starea de agregare a probei. fapt care duce la menţinerea caracterului anizotrop al interacţiunilor de spin şi.1D sequence # 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/Avance.pl1 : f1 channel .high power pulse .p1 : f1 channel .incl 1 ze 2us pl1:f1 2 d1 p1:f1 ph1 go=2 ph31 wr #0 exit ph1=0 2 2 0 1 3 3 1 ph31=0 2 2 0 1 3 3 1 . şi decuplarea heteronucleară Aspectul liniilor de rezonanţă dintr-un spectru RMN 1D. obţinut spre exemplu cu ajutorul experimentului de un puls ilustrat în Fig. 1-5 * T1 3.# 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/zg" . la lărgirea liniilor de rezonanţă. decuplarea homonucleară.Avance2.

adică la rezoluţie spectrală înaltă şi (ii) reintroducerea selectivă pe durata celorlate perioade ale exeprimentului a unor componente anizotrope ale interacţiunilor de spin (care să afecteze mărimi spectrale altele decât lărgimile de linie). rezultă necesitatea dezvoltării de metode specifice ale spectroscopiei RMN-S care să conducă în cadrul aceluiaşi experiment la două efecte distincte: (i) pe durata anumitor perioade ale experimentului să se obţină medierea componentelor anizotrope ale interacţiunilor de spin. care să conducă la separarea liniilor RMN-S în funcţie de deplasările chimice izotrope ale diferitelor grupări chimice din sistemul molecular investigat. În mod explicit. deoarece componentele anizotrope conţin informaţii importante cu privire la structura şi dinamica din sistem. manifestarea caracterului anizotrop al interacţiunilor de spin în probe solide prezintă şi avantaje de ordin practic. anizotropia ecranării chimice furnizează informaţii despre structura electronică (prin tipul orbitalilor moleculari) şi legăturile dintre atomi. Pentru a diminua efectul negativ al anizotropiei interacţiunilor de spin în spectroscopia RMN-S. Având în vedere toate aceste considerente. iar anizotropia cuplajului dipolar conţine informaţii despre distanţele internucleare.care se observă cu usurinţă pierderea completă a rezoluţiei prin suprapunerea severă a liniilor RMN. la mijlocul anilor ’50 a fost introdusă tehnica MAS 203 . Figura 3 Comparaţie între spectrul 1H RMN static al unui compus organic tipic în stare solidă (a) şi în stare lichidă (b) Pe de altă parte. pentru a codifica în spectrul obţinut şi informaţii specifice cu privire la structura şi/sau dinamica moleculară din sistem – în acest scop sunt aplicate aşa numitele metode de recuplare. care vor fi introduse în raportul următor.

care devine zero când axa de rotaţie este înclinată la unghiul magic în raport cu direcţia câmpului magnetic static. Conform descrierii teoretice de mai sus. şi implicit asupra lărgirii liniilor RMN. în funcţie de forma explicită a hamiltonienilor asociaţi acestor interacţiuni. După cum se va prezenta în continuare. numit “unghiul magic”. Din acest punct de vedere. t2 şi (ii) interacţiuni omogene (interacţiunea dipola204 . H (t2 )] = 0. ∀ t1 . efectul termenilor modulaţi devine din ce în ce mai mic cu creşterea frecvenţtei de rotaţie a probei: în perioada scursă de la introducerea metodei MAS şi până în prezent tehnologia în domeniu a avansat extrem de mult. trebuie menţionat că. 4. se pot evidenţia două cazuri distincte: (i) interacţiuni neomogene (deplasarea chimică şi interacţiunea dipolară heteronucleară pentru care [ H (t1 ). ilustrată schematic în Fig. permiţând rotaţii de până la 70 kHz ale probei în jurul unghiului magic. mecanismul de îngustare prin MAS a liniilor RMN în solide se bazează pe manipularea părţii spaţiale a hamiltonianului de interacţiune: termenii anizotropi ai acestuia în proba rotită se descompun într-o componentă statică. în raport cu direcţia câmpului magnetic static. şi respectiv 2υR. Figura 4 Majoritatea metodelor RMN-S moderne de înaltă rezoluţie sunt aplicate în condiţii de rotaţie a probei în jurul unghiului magic.(Magic Angle Spinnining) în cadrul căreia proba este rotită în jurul unei axe înclinate la un unghi. De asemenea. mediază efectul anizotropiei interacţiunilor de spin prin faptul că rotaţia mecanică a probei determină oscilaţia în timp a termenilor anizotropi şi prin aceasta micşorează efectul lor de lărgire asupra liniilor RMN. Această metodă. efectul lor asupra dinamicii de spin. şi două componente dependente de timp ce corespund unei modulări periodice cu frecvenţele υR. va fi diferit.

care apar la multiplii întregi ai frecvenţei de rotaţie. în Fig. încep să se contureze atât linia centrală de rezonanţă. Astfel. precum şi benzile de rotaţie laterale. Figura 5 Spectele 1H RMN-MAS ale adamantanului (a). în cazul static se obţine doar un spectru foarte larg. respectiv adamantanul şi policarbonatul. în care datorită numărului mare de protoni inter205 . forma spectrelor se apropie de cea întalnită în cazul în care predomină interacţiunile neomogene. 5 sunt prezentate spectrele 1H RMN pentru diferite frecvenţe de rotaţie υR în cazul a doi compuşi organici. respectiv ale policarbonatului (b). exemplifică modalitatea prin care frecvenţa de rotaţie acţionează asupra caracterului omogen al interacţiunilor de spin din sistem. datoraţi interacţiunii dipolare homonucleare în sisteme multi-spin. ∀ t1 . În aceste două cazuri. Evoluţia lărgimii liniilor RMN. pornind de la cazul static până la domeniul de frecvenţe înalte (35 kHz). H (t2 )] ≠ 0.ră homonucleară în [ H (t1 ). caracterizaţi prin dinamica moleculară complet diferită. sisteme multi-spin) pentru care Pentru a ilustra efectul interacţiunilor omogene asupra formei şi lărgimii liniilor de rezonanţă. pentru frecvenţe de rotatie în intervalul 0 – 35 kHz Un pas foarte important în îmbunătăţirea rezoluţiei spectrale pentru sisteme de tip multi-spin. t2 . iar pentru υR ~ 3 kHz. Mergând spre limita superioară a frecvenţei de rotaţie. fără rezoluţie. se consideră acţiunea Hamiltonienilor de tip omogen.

În cazul sistemelor de spini cu factor giromagnetic mic (de exemplu 13C sau 15N) în abundenţă naturală (adică separaţi prin distanţe mari) cuplajele dipolare devin neglijabile. pe lângă mai sus amintita metodă DUMBO. În Fig. PMLG. la 0. respectiv anizotropa). se numeşte DUMBO. mai pot fi enumerate şi FSLG.32 ppm în cazul (b). 206 .acţiunea dipolară homonucleară. una dintre secvenţele intens utilizate în prezent. este predominantă.MAS şi decuplare homonucleră cu ajutorul secvenţei DUMBO (b). De exemplu. Comparând spectrele obţinute se observă o creştere apreciabilă a rezoluţiei spectrale în cazul decuplării homonucleare. ultimele două metode fiind aplicate în timpul perioadei de evoluţie indirectă a experimentelor de tip bidimensional. iar apoi prin aplicarea celor două tehnici . de tip omogen. deoarece este aplicabilă în cazul rotirii probei cu frecvenţe înalte de ordinul a 65 – 70 kHz. precum şi RNnυ şi SAM (Smooth Amplitude Modulation). astfel încât interacţiunea dominantă din sistem rămâne ecranarea chimică (cu componentele ei izotropa. astfel încât lărgimea liniei grupării metil scade de la 1. constă în combinarea tehnicii MAS cu metode de decuplare homonucleară.1 ppm în cazul (a). Figura 6 În clasa metodelor de decuplare homonucleră. 6 este prezentat spectrul 1H al dipeptidei β-L-Asp-L-Ala obţinut rotind proba cu υR= 65 kHz (a). Acestea presupun aplicarea pe canalul 1H (care este şi canalul de detecţie) a unor secvenţe de pulsuri adecvate care să conducă la medierea efectului produs de interacţiunile dipolare homonucleare.

5 pentru CH2. este de aşteptat în principiu ca odată cu creşterea frecvenţei de rotaţie a probei să se obţină spectre cu rezoluţie şi sensibilitatea spectrală din ce în ce mai înalte. Din punct de vedere teoretic. situate la multiplii întregi ai frecvenţei de rotaţie. astfel încât efectul spectrul RMN 13C al L-alaninei. 0. Spectrul static al L-Alaninei prezintă caracteristicile tipice întâlnite în cazul unui sistem de spini izolaţi. Chiar şi în cazul frecvenţelor de rotaţie mari se vor obţine linii de rezonanţă ale 13C (15N) cu lărgimi reziduale mari dacă se foloseşte doar tehnica MAS.În acest caz. Situaţia prezentată în Fig. nucleele 13C (15N) sunt Figura 7 Evoluţia cu frecvenţa de înconjurate în compuşii organici de un rotaţie a liniilor de rezonanţă din număr mare de protoni. intensităţile benzilor rotaţionale se reduc semnificativ astfel încât un spectru MAS de înaltă rezoluţie va conţine cu o bună aproximaţie doar linii poziţionate la valori ale deplasărilor chimice izotrope corespunzătoare grupărilor chimice din probă. respectiv 0. υR= 1 kHz. adică η =1 în cazul grupării COO-.3 pentru CH3. Pentru a creşte rezoluţia spectrală în aceste cazuri este nevoie de combinarea teh207 . Odată cu creşterea lui υR până la valori mari. liniile celor trei grupări se descompun într-o serie de benzi de rotaţie laterale. 7 corespunde unui model teoretic idealizat. Forma liniilor este dată de valoarea parametrului de asimetrie. care ilustrează comportarea în condiţii de MAS a unor interacţiuni de spin de tip pur neomogen: în realitate. în interacţiunilor suplimentare datorate acesprezenţa ecranării chimice tora nu poate fi neglijat în practică. La o frecvenţă de rotaţie mică. 7. evoluţia cu frecvenţa de rotaţie a liniilor într-un spectru RMN 1D într-un sistem de trei spini 13C care nu interacţionează dipolar dar sunt supuşi ecranării chimice este prezentată în Fig. în care se consideră doar efectul ecranării chimice. liniile de rezonaţă fiind largi. centrate la valori ale deplasării chimice izotrope asociate fiecărei grupări chimice.

procedura constă în următoarele: • Se utilizează adamantanul drept probă standard pentru calibrarea nivelurilor de putere pe canalul protonilor deoarece spectrul 208 . bine separate.nicii MAS cu o tehnică suplimentară numită decuplare heteronucleară în scopul de a se limita efectul de lărgire produs de protonii din vecinătate. 7). Lărgimile liniilor pentru toate cele trei grupări sunt în intervalul 20 – 50 Hz. al cărui program de pulsuri este listat la finalul Secţiunii 2. această tehnică constă în aplicarea pe canalul 1H a unui câmp rf intens. Figura 8 După cum se observă în Fig. utilizarea decuplării heteronucleare în condiţii de MAS conduce la linii de rezonanţă înguste. în timpul achiziţionării semnalului RMN pe canalul 13C (15N). 8 pentru cazul spectrului RMN pe 13C al L-alaninei măsurat la o frecvenţă de rotaţie de 10 kHz. cu o diferenţă de un ordin de mărime faţă de valorile întâlnite în mod uzual în cazul compuşilor în stare lichidă. Calibrarea parametrilor pe canalul 1H cu ajutorul experimentului de un puls Pentru calibrarea nivelului de putere (sau echivalent. poziţionate la valori ale deplasării chimice izotrope caracteristice fiecărei grupări structurale. Din punct de vedere practic. sub formă continuă sau de pulsuri cu modulaţie în fază. În esenţă. 1. valoarea B1 a câmpului rf exprimat în kHz) generat de transmiter pe canalul 1H în funcţie de valoarea atenuării (in dB) se utilizează experimentul simplu de un puls din Fig. asemănătoare celor simulate pentru cazul idealizat al interacţiunilor pur neomogene (Fig.

şi se determină în final valoarea exactă a pl1 pentru care intensitatea liniei se anulază complet: această valoare va corespunde deci pulsului de 1800 pentru câmpul rf considerat. Aceste proprietăţi favorabile conduc la o sensitivitate şi o rezoluţie foarte bună care permit calibrarea rapidă şi precisă a pulsului de 1800 (după cum se va descrie mai jos). Se repetă apoi în mod identic procedura de baleiere a nivelurilor de putere pl1 descrisă mai sus pentru toate valorile câmpului rf (implicit. Modificarea acestor parametri se poate face înscriind valorile dorite în tabela de achiziţie. se procedează la operaţiunile preliminare standard de acordare a frecvenţei de rezonanţă şi a impedanţelor (aşa numitele tuning şi matching). în cadrul căruia se modifică durata pulsului (p1) şi nivelul de putere asocial (pl1) şi se înregistrează spectrul RMN-S 1H al adamantanului. 6. 75 şi 50 kHz). şi se datorează faptului că molecula de adamantan nu este rigidă în reţeaua cristalină ci efectuează mişcări rapide de rotaţie simultan în jurul a trei axe de simetrie. şi respectiv pl1 <valoare> (in dB) Mai întâi se fixează durata pulsului p1 astfel încât aceasta să corespundă unui puls de 1800 pentru un set de valori dorite ale câmpului rf pe canalul 1H (de exemplu.5 dB) până se constată anularea (sau inversarea) liniei RMN-S. sau direct prin comenzile p1 <valoare> (in us).1 dB) în jurul valorii pentru care acesta s-a obţinut. şi se utilizează comanda zg). p1 = 5. Pentru fiecare dintre aceste valori fixe se baleiează parametrul pl1 până când intensitatea liniei din spectrul RMN-S înregistrat devine zero. şi stabilizarea rotaţiei la frecvenţa aleasă. pentru câmpuri de 100.67. În funcţie de capul de probă folosit. se recomandă utilizarea unor frecvenţe de rotaţie cuprinse între 10 şi 30 kHz Se începe apoi procedura de calibrare a puterilor pe canalul protonilor prin rularea repetată a experimentului de un puls (programul de pulsuri redat mai sus. cu lărgime mai mică decât a altor compuşi organici în fază solidă (sub 1 kHz pentru frecvenţe de rotaţie a probei mai mari decât 10 kHz).• • • • RMN-S 1H al acestui compus constă dintr-o singură linie. În cazul inversării. Trebuie avut însă în vedere că scăzând câmpul 209 . se scanează pl1 cu paşi mai mici (0. p1) considerate. şi 10 us. Se recomandă calibrarea în ordinea descrescătoare a câmpului rf . caz în care se va putea începe cu o valoare de strat pl1 = 2-0 dB care va fi scăzută în paşi mai mari la început (de exemplu 0. ceea ce reduce foarte mult tăria cuplajelor dipolare 1H-1H După plasarea probei în magnet.

• rf valoarea de start a parametrului pl1 creşte în mod corespunzător. Calibrarea parametrilor pe canalul 13C cu ajutorul experimentului CP-MAS Secvenţa de pulsuri asociată experimentului de Cross-Polarizare în condiţii MAS (CP-MAS) este ilustrată în Fig. deoarece monitorizarea rezultatului prin intermediul unui semnal care se anulează este mai sensibilă decât dacă s-ar urmări valoarea maximă a acestuia. dn. phn.0) . 9 utilizând reprezentarea schematică convenţională din RMN. pentru a se evita de exemplu să se pornească cu o valoare care deja corespunde unui puls > 1800. În practică se preferă calibrarea prin intermediul pulsului de 1800 şi nu 900. Figura 9 # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-const" . 9. descrisă în Fig.basic cp experiment 1 ze 2 d1 do:f2 210 . pn. şi delay-uri. incluşi în programul de pulsuri cp-const asociat acestei secvenţe. şi listat mai jos. pln. Pentru a face mai uşoară o comparaţie directă între aceasta reprezentare schematică. în figură sunt menţionaţi explicit parametrii de timp (pulsuri. şi respectiv de fază.cp (TopSpin 2. de putere. şi implementarea ei pe spectrometrul Bruker. sau <valoare> us).

pl12 is used here with cw . Procesul de transfer prezintă maxime de eficienţă dacă amplitudinile celor două câmpuri rf de contact satisfac aşa-numita condiţie Hartmann-Hahn de matching. precum 13C sau 15N. 1m exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 . este necesară calibrarea unui câmp rf pe canalul carbonului de 35 sau 65 kHz pentru a asigura un transfer maxim de 211 . În general se lucrează cu valori ale câmpului în jur de 50 kHz pe canalul protonilor. ν1H = ν13C +(-) nνR. unde n=1. and p30 the pulse CP-MAS este un experiment de dublă rezonanţă.2. se va considera în detaliu doar primul aspect. În cadrul prezentului raport.go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. la condiţia de matching n =1: aceasta înseamnă că valoarea câmpului pe canalul 13C(15N) va fi astfel calibrată încât să fie mai mare (sau mai mică) cu valoarea frecvenţei de rotaţie a probei.1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u pl12:f2 . 9). De exemplu. deoarece presupune aplicarea de câmpuri rf (pulsuri) simultan pe două canale distincte (f1: 13C şi f2: 1H în cazul particular ilustrat mai sus). şi vom începe prin a explica de ce se preferă în practică experimentul CP-MAS pentru a înregistra spectre RMN-S 1D ale 13C(15N) în locul experimentului mult mai simplu de un puls.pl12 is used here with tppm. Procesul de transfer de polarizare 1H <-> 13C(15N) prin aşa-numitul mecanism de polarizare încrucişată (cross-polarization. cât şi ca parte componentă în experimente multi-dimensionale mai complexe. pentru o rotaţie cu νR = 15 kHz (o valoare uzuală pentru înregistrarea spectrelor 13C) a probei în jurul unghiului magic. CP) este un proces coerent generat de interacţiunile dipolare heteronucleare 1H. El este un experiment standard în spectroscopia RMN-S care se utilizează atât pentru înregistrarea spectrelor 1D convenţionale ale nucleelor cu factor giromagnetic mic.13C(15N) şi se desfăşoară în condiţiile iradierii simultane cu câmpuri rf pe canalele asociate (aşa numitele pulsuri de contact: Fig.

9.polarizare 1H -> 13C. Avantajele principale ale unui experiment CP-MAS rezultă din faptul că polarizarea iniţială care conduce la formarea semnalului RMN-S este cea transferată de la spinii 1H. şi respectiv de zece ori în cazul spinilor 15N. Deoarece la echilibru termic raportul dintre aceste polarizări este proporţional cu raportul factorilor giromagnetici corespunzători. rezultă o amplificare de aproximativ patru ori în intensitatea semnalului RMN-S 13C. valorile optime pentru durata pulsului de contact (p15) în cazul nucleelor de 13C este cuprinsă între câteva sute de μs. cuplajul dipolar 1H. în Fig. Utilizarea polarizării transferate de la protoni mai are încă un avantaj important care este determinat de valorile mult mai mici ale timpului de relaxare longitudinal T1 în cazul nucleelor 1H în comparaţie cu cei asociaţi 13C(15N): deoarece aceşti timpi practic guvernează valoarea duratei de repetiţie a experimentului (aşa-numita recycle delay. prin aplicarea pulsului p3 de 900 cu faza y pe canalul f2 asociat protonilor).15N la aceeaşi distanţă internucleară. Simultan se aplică pulsul de contact de aceeaşi durată p15 şi pe canalul carbonului cu un nivel de putere corespunzător unui transfer maxim de polarizare 1H->13C (adică să satisfacă una dintre condiţiile de matching Hartmann-Hahn descrise mai sus). De asemenea. d1. Plecând de la secvenţa de pulsuri ilustrată schematic în Fig. În realitate aceşti factori teoretici sunt rareori obţinuţi în practică datorită proceselor de relaxare care se desfăşoară pe durata pulsului de contact. însă şi în aceste condiţii câştigul în intensitate al semnalului RMN este semnificativ.5 ori mai mare decât cuplajul 1H. rezultă că într-un anumit interval dat se pot acumula mult mai multe scanuri cu ajutorul CP/MAS decât ar fi posibile în cazul utilizării experimentului simplu de un puls. Deoarece. şi respectiv programul de pulsuri asociat. Polarizarea transferată pe 212 . un experiment CP/MAS standard (sau convenţional) se derulează în modul următor: mai întâi se aduce polarizarea longitudinală a spinilor nucleari 1H în planul transversal (de exemplu de-a lungul direcţiei x. 9). şi valoarea optimă a pulsului de contact va creşte corespunzător (în acest caz se obţine un transfer maxim de polarizare la valori ale p15 cuprinse între 3-7 ms).13C este de aproximativ 2. Ambele mecanisme conduc la creşterea substanţială a sensibilităţii spectrale în cazul utilizării metodei CP/MAS. Această polarizare este apoi „blocată” – aşa-numitul „spin locking” – cu ajutorul pulsului de contact p15 aplicat pe canalul f2 cu faza x (deoarece direcţia câmpului rf asociat şi direcţia polarizării trebuie să coincidă). şi nu polarizarea asociată nucleelor 13C(15N). comparativ cu intensitatea care s-ar obţine printr-un experiment de un puls. până la 1-2 ms: această durată depinde direct de tăria medie a cuplajelor dipolare dintre fiecare spin 13C din probă şi protonii cei mai apropiaţi.

adică prin utlizarea unor tehnici speciale care au drept scop minimalizarea efectelor produse de interacţiuniile dipolare 1H-13C şi 1H-1H (în special efectul de lărgire a liniilor spectrale) pe durata achiziţionării semnalului RMN 13C. deoarece acesta necesită în general 213 . În principiu. a fazei receptorului în sincronie cu faza ph1 a pulsului de contact pe canalul f1 (aşa-numitul Cyclops phase cycling) pentru a elimina eventualele imperfecţiuni ale circuitelor de detecţie în cuadratură. cu Δφ având valori cuprinse în general între 15 şi 300. φ = φ + Δφ. adamantanul prezintă avantajul că se obţin linii 13C RMN-S relativ înguste (2-3 Hz).durata lui p15 se construieşte de-a lungul direcţiei câmpului de contact aplicat pe canalul f1: aceasta reprezintă în fapt o polarizare transversală a spinilor 13C astfel că. Ca şi în cazul calibrării puterilor pe canalul 1H. numite Continuous Wave – CW. Pentru a obţine spectre RMN-S 13C de calitate ale compusului studiat. câmpul se aplică în mod continuu cu faza arbitrară. respectiv 0. de ordinul zecilor de secunde. TPPM este tehnica de decuplare heteronucleară cel mai des utilizată pentru înregistrarea de spectre 13C RMN-S pe compuşi organici cristalini. în momentul încetării acţiunii pulsului de contact. Compuşii standard cel mai des utilizaţi în acest scop sunt adamantanul (calibrarea nivelelor de putere pe canalul carbonului) şi glicina (ajustarea valorii unghiului magic). pentru a elimina contribuţia polarizării iniţiale a spinilor 13C la semnalul detectat. de exemplu în scopul calibrării experimentului CP/MAS. parametrii caracteristici ai experimentului CP/MAS trebuie mai întâi calibraţi cu ajutorul unor compuşi de referinţă (standard). sau la înregistrarea de spectre 15N RMN-S. cu performanţe îmbunătăţite. 90. care conţine două subcicluri suprapuse: (i) alternarea cu 1800 a fazei pulsului p3. numita TPPM (Two Pulse Phase Modulation) câmpul se aplică sub formă de trenuri de două pulsuri cu faze alternante. însă şi metoda CW este preferată uneori. adamantanul este considerat un compus ideal pentru procesul de calibrare a experimentului CP/MAS. câmp ce trebuie să satisfacă anumite cerinţe în funcţie de condiţiile experimentale concrete: în cadrul celei mai simple metode. pentru un experiment CP/MAS: în acest fel. respectiv ph3 = 90 şi 2700. 180 şi 2700. adică în cazurile în care nu este necesar aplicarea unor câmpuri rf de decuplare foarte intense. iar în cadrul unei metode mai recente. În mod uzual un experiment CP/MAS se efectuează cu un phase cycling de 8 paşi. În final trebuie menţionat că detecţia FID-ului se face în condiţii de decuplare heteronucleară. ea evoluează liber şi poate fi achiziţionată ca şi semnal RMN (FID). toate tehnicile de decuplare heteronucleară constau în aplicarea unui câmp rf pe canalul protonilor de-a lungul întregii durate de achiziţie a semnalului RMN. şi (ii) alternarea în paşi de 900. respectiv la un timp de acumulare scurt. ceea ce conduce la o sensibilitate spectrală foarte bună.

5 dB) şi se scanează acest parametru în paşi de 0.5 ppm. (ii) nivelurile de putere ale pulsurilor de contact p15 pe cele două canale sunt astfel ajustate încât să îndeplinească condiţia Hartmann-Hahn de matching descrisă mai sus. iar metoda de decuplare utilizată pentru adamantan este CW). Valorile particulare ale parametrului pl1 pentru care se obţin aceste maxime se transformă în valori ale câmpului rf asociat utilizând relaţia ν13C = 50 kHz +(-) nνR.5 şi 38. 2. Pentru a evita posibile efecte de offset. şi (iii) tehnica de decuplare utilizată să conducă la îngustarea maximă posibilă pentru compusul dat. frecvenţa de iradiere pe canalul f2 va fi cea corespunzătoare frecvenţei de rezonanţă a liniei adamantanului din spectrul 1H RMN-S. respectiv a eficienţei procesului de transfer de polarizare prin CP. intensitatea spectrală obţinută este maximă dacă sunt îndeplinite simultan următoarele trei condiţii: (i) pulsul p3 pe canalul protonilor este un puls 900. Curba de matching Hartmann-Hahn prezintă cinci maxime corespunzătoare celor cinci condiţii menţionate anterior. Conform schemei experimentale din Fig. astfel încât acestea să corespundă unei valori a câmpului rf de 50 kHz: şi în acest caz se utilizează rezultatele anterioare ale calibrării puterilor pe canalul 1H. • Se ajustează valoarea puterii pl1 a câmpului de contact pe canalul carbonului până când se obţine o intensitate maximă a liniilor RMN în spectrul CP/MAS achiziţionat. procedura de calibrare a experimentului CP/MAS poate fi descrisă pe scurt în felul următor: • Pentru valorarea fixată a lui p3 se setează puterea pl3 (determinată anterior în procesul de calibrare a puteriolor pe canalul protonului) astfel încât aceasta să corespundă unui puls de 900. Corespunzător acestor elemente. pentru pulsul de contact pe canalul protonului. Plecând de la aceste considerente. pl2 şi pl12 (în condiţiile în care se consideră fixate valorile pulsurilor p3 şi p15. trebuie deci calibrate puterile pl3. şi respectiv câmpul de decuplare prin CW. pl1. determinate de grupările CH şi CH2 din moleculă). În particular. • Se setează valorile pl2 şi pl12. respectiv dependenţa puterii pe canalul 13C a intensităţii spectrale.1 dB mergând înspre valori mici. Aceasta este etapa cea mai laborioasă din cadrul procedurii. cu n = 0.achiziţionarea unui număr mare de spectre până când sunt determinate valorile optime ale tuturor parametrilor de interes. 214 . 9. În cazul fiecărui parametru optimizarea se face prin maximizarea intensităţii liniilor RMN în spectrul achiziţionat (în cazul particular al adamantanului avem două linii poziţionale la 29. 1. se porneşte de la valori mari ale lui pl1 (de exemplu. Setul de spectre obţinut astfel furnizează aşa-numită curba de matching Hartmann-Hahn.

Pentru valoarea setată a lui pl12. Oxford University Press. Keeler. După acest pas este trecut se procedează în continuare la ajustarea pulsului p31 în secvenţa de decuplare heteronucleară prin TPPM pentru a se obţine în final îngustarea maximă posibilă a liniilor spectrale.R. Wokaun. 6. Ernst. Understanding NMR Spectroscopy.H. Wiley 2001 Bruker Biospin Group. Guenther. 2008 215 . durata optimă a pulsului p15 se apropie în general de cea a unui puls de 1800. Principles of Nuclear Magnetic Resonance în One and Two Dimensions. Wiley 2010 T. TOPSPIN User Manual. Introduction to High-Resolution Solid-State NMR. nu mai poate produce o rezoluţie spectrală satisfăcătoare. 4. A. se modificăa uşor înclinarea axei rotorului până ce se obţine un spectru 13C RMN-S a glicinei în care linia carbonilului (de la 176. astfel încât calibrarea lui p31 se face pornind de la această valoare de referinţă. În practică.Bibliografie 1. Oxford 1987 M. 3. Această etapă este necesară deoarece valorile câmpului rf pe canalul 1H în general sunt determinate cu un grad de eroare mai mare prin experimentul de un puls decât cu ajutorul experimentului CP/MAS. amplitudine maximă). 4. Levitt. 2. 5. Elsevier Science 2007 H. şi se reţine acea valoare pentru care intensitatea spectrală atinge un maxim absolut.• În final. Spin Dynamics: Basics of Nuclear Magnetic Resonance. Wiley 2008 J. Gullion. de ordinul a 50 kHz. R. Datorită faptului că glicina este o moleculă relativ rigidă în reţeaua cristalină (aşa cum sunt majoritatea compuşilor organici) decuplarea prin CW la câmpuri mici. Alegerea acestui compus standard este motivată de faptul că el are un spectru RMN-S simplu care conţine doar două linii (deci sensibilitate spectrală mare) dintre care una corespunde grupării carbonil a cărei lărgime este foarte sensibilă la deplasări mici ale înclinării axei de rotaţie a probei faţă de valoarea unghiului magic: acest efect se datorează anizotropiei mari a deplasării chimice. Experimentul CP/MAS cu parametri calibraţi pe adamantan din punct de vedere al nivelurilor de putere. G. pentru o ajustare mai fină a pulsului iniţial de 900 pe canalul protonului se revine la primul pas. NMR Spectroscopy. astfel încât se preferă metoda TPPM la câmpuri intense (ideal pl12 ar trebui să corespundă unor câmpuri de cel puţin 100 kHz). prin modificarea uşoară a puterii pl3 în jurul valorii fixate iniţial.5 ppm) are lărgime minimă (implicit. se utilizează în continuare pe glicină pentru ajustarea valoarii unghiului magic şi pentru optimizarea pulsurilor p31 asociate decuplării prin metoda TPPM. Bodenhousen.

..... şi vom ajunge în final la prezentarea de metode care 216 .............. Introducere În acest raport se vor prezenta în mod detaliat o serie de experimente RMN-S avansate........................................... Accentul va fi pus pe experimente RMN-S de dublă rezonanţă pe 13C.245 1...... dr............. Metode RMN-S 2D de corelare 13C-13C ............................ Mihaela Aluaş Cuprins 1..............S...... Bibliografie .................. Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C .....III........ chiar dacă nu pot fi utilizate în practică la UBB Cluj....... nu vor putea fi prezentate o serie de metode RMN-S intensiv utilizate în domeniu... care să permită rotaţii ale probei până la 70 kHz.............. sau metode de înaltă rezoluţie pe 1H............ de exemplu cele care implică lucrul simultan pe trei canale rf [1] (metode de triplă rezonanţă)............. Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) ........................... care necesită o electronică adaptată secvenţelor de decuplare homonucleară [2] şi/sau capuri de probă de tip „ultra-fast MAS”............. recomandăm studenţilor aprofundarea lor cel puţin la nivel teoretic (consultând bibliografia indicată mai sus)..237 5...........Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă C............... în ordinea creşterii complexităţii lor: se vor descriere mai întâi experimente care necesită înregistrarea de seturi de date bidimensionale (2D)..... Deoarece acestea sunt considerate ca făcând parte din „arsenalul de bază” al metodologiei moderne RMN-S pe sisteme moleculare organice........216 2........S. dr. Vor fi ilustrate de asemenea tehnici bazate pe detecţia 1H............................... Claudiu Filip C................................................I... însă doar în cazul acelor compuşi unde se obţine o rezoluţie spectrală satisfăcătoare în condiţiile tehnice date............................. dar care nu necesită transformarea lor în spectre 2D..... cu aplicaţii în investigarea structurii sistemelor moleculare organice cristaline............ metode ce au fost până în prezent implementate şi testate experimental pe infrastructura existentă la UBB Cluj......... Introducere ............ Drept urmare................219 3..226 4........... Introducerea metodelor se va face progresiv.

3Δt1…nΔt1. Această succesiune de perioade poartă denumirea de secvenţă de pulsuri 2D. pe durata lui t2.) care va evolua pe durata t1. este de menţionat că. Schema generală pentru un experiment RMN bidimensional este redată în Fig. t1 şi t2. coerente de mai multe cuante. unde n este de obicei cuprins între câteva zeci şi câteva sute). 217 . Secvenţa de mixing are rolul cel mai important într-un experiment 2D.furnizează informaţii structurale pe bază de spectre RMN-S 2D de corelaţie. se înregistrează şi se stochează FID-ul corespunzător acestei valori. Apoi se repetă aceeaşi procedură pentru t1 egal cu multiplii întregi ai perioadei de sampling Δt1 (adica Δt1. se presupune că mai întâi au fost parcurşi paşii prezentaţi în raportul anterior. au fost calibrate corespunzător. respectiv că toţi parametri experimentali relevanţi. şi în special nivelurile de putere pe fiecare canal rf. în acest caz transformata Fourier trebuie aplicată de două ori. unde spectrul RMN se obţine prin transformarea Fourier a FID-ului. 1. iar informaţia care se regăseşte în spectrul RMN depinde concret de tipul interacţiunii care a fost selectată în perioadele de preparare şi de mixing. în urma cărora se generează o mărime fizică asociată sistemului de spini (de ex. t1 (corespunzător dimensiunii indirecte F1) şi t2 (corespunzător dimensiunii directe F2). se aplică unul sau mai multe pulsuri rf. polarizare transversală. în afară de aspecte pur practice se va face şi o scurtă prezentare a fundamentelor teoretice pe care aceasta se bazează. constă în aplicarea celui de-al doilea puls (sau pulsuri) de radiofrecvenţă. În fiecare caz. 2Δt1. Pentru a se obţine spectrul în frecvenţă. prin intermediul semnalul RMN. Figura 1: Schema de principiu a unui experiment RMN bidimensiuonal (2D) În prima perioadă. În consecinţă. cea de preparare. şi va depinde explicit de ambele variabile temporale. De asemenea. semnalul RMN este descris de o funcţie care depinde de două variabile de timp. Spre deosebire de varianta unidimensională. Următoarea perioadă – perioada de mixing. în spectroscopia RMN bidimensională (2D). semnalul RMN bidimensional constă dintr-un set de n FID-uri. deoarece ea defineşte corelaţiile care se stabilesc între mărimile care evoluează în t1 şi polarizarea transversală asociată fiecărui spin care se detectează în mod direct. etc. pentru fiecare tehnică RMN-S avută în vedere. Un spectru RMN 2D se obţine în următorul mod: se aplică secvenţa de pulsuri pentru t1 = 0.

În cazul spectrelor bidimensionale de separare. şi respectiv de corelare [3]. În funcţie de tipul de experiment RMN de corelare utilizat. se pot obţine două tipuri distincte de spectre RMN 2D: de separare. şi perioada de mixing coincid. numite peak-uri diagonale. 2(c). Un alt tip de peak-uri care se pot obţine într-un spectru RMN 2D. de exemplu Fig. în dimensiunea F2 se obţine spectrul izotrop al compusului studiat. Multe dintre tehnicile RMN 2D utilizate în mod curent. F1. respectiv cross-peakurile Modul de apariţie a peak-urilor în spectre RMN bidimensionale şi interpretarea acestora vor fi descrise pe scurt în cele ce urmează. t1. vor exista diferenţe în ceea ce priveşte (i) mărimea fizică asociată sistemului de spini (de exemplu coerente de una sau mai multe cuante). separat. pentru fiecare linie izotropă. o secvenţă de pulsuri specifică spectroscopiei RMN 2D de separare corespunde cazului particular în care domeniul temporal indirect. se obţine spectrul anizotrop al interacţiunii recuplate. Astfel. generează spectre care conţin ambele tipuri de peak-uri. atunci pe durata perioadei de preparare s-a format un semnal care a evoluat cu frecvenţa ωA de-a lungul lui t1. şi (ii) interacţiunea de spin recuplată pe durata perioadei de mixing. iar în dimensiunea indirectă. ilustrată în Fig. dacă într-un spectru 2D va apărea un peak poziţionat la ωA în dimensiunea F1 şi la ωB în dimensiunea F2 (aşa numitele cross-peakuri). corespund cazului în care frecvenţa de rezonanţă a unui semnal generat în timpul perioadei de preparare va rămâne neafectată de pulsul (sau pulsurile) care alcătuieşte perioada de mixing.Figura 2: Exemple de spectre RMN 2D şi modalitatea în care apar peakurile diagonale. în cazul spectrelor de corelare ambele dimensiuni codifică deplasările chimice izotrope. iar interacţiunea recuplată va genera peakuri de corelatie (cross-peakuri) între nucleele diferitelor grupări chimice dintr-un anumit compus. În practică. iar pe durata perioadei de mixing acelaşi semnal a fost transformat cu ajutorul unei anumite secvenţe de pulsuri într-un alt semnal care evoluează cu frecvenţa ωB pe durata t2. Conform schemei generale a unui experiment 2D. De 218 . 1. Spre deosebire de spectrele RMN 2D de separare. în funcţie de succesiunea de pulsuri aleasă. care va evolua în dimensiunea indirectă F1.

Figura 3: Reprezentarea schematică a experimentului RMN 2D de investigare a transferului de polarizare 1H-13C prin intermediul secvenţei CP-MAS clasice 219 . se foloseşte aceeaşi convenţie ca şi în raportul anterior. şi listat mai jos. Toate celelalte elemente (comenzi.) sunt reprezentate cu negru. Secvenţa de pulsuri asociată acestui experiment este redată mai jos în Fig. şi delay-uri. cu eficienţe care depind de distanţele dintre spinii nucleari implicaţi. Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C Metoda RMN-S 2D bazată pe secvenţa CP-MAS clasică Exemplul cel mai ilustrativ al unei metode RMN-S 2D de separare este reprezentat de experimentul de recuplare a interacţiunii dipolare heteronucleare C – H cu ajutorul secvenţei clasice CP-MAS ce are drept efect un transfer de polarizare între protoni şi nucleele 13C din vecinătate. dn. Referitor la notaţiile atât în reprezentarea schematică. incluşi în programul de pulsuri cp-var asociat acestei secvenţe. etc. parametri adimensionali. în figură sunt mentionaţi explicit parametrii de timp (pulsuri. pln. niveluri de putere ale pulsurilor rf. experimentele bidimensionale pot fi clasificate şi în funcţie de tipul de nuclee implicate. 3. şi implementarea ei pe un spectrometru Bruker. 2. şi respectiv de fază. roşu şi verde reprezintă durate.asemenea. şi anume experimente de corelare homonucleare sau heteronucleare. Pentru a face mai uşoară o comparaţie directă între această reprezentare schematică. phn. şi anume. sau <valoare> us). cât şi în programul de pulsuri. şi respectiv faze asociate acestor pulsuri. descrisă în raportul anterior. variabilele notate cu albastru. pn. de putere. utilizând reprezentarea schematică convenţională din RMN.

pl12 is used here with tppm.cp (TopSpin 2. şi se obţine astfel 220 .pl12 is used here with cw . secvenţele CP-MAS efectiv utilizate diferă între ele prin durata pulsului de contact. După achiziţionarea celor N semnale RMN distincte. and p30 the pulse În esenţă. care constă dintr-un număr N de semnale RMN 13C distincte. ivp (increment variable pulse – trece la următoarea valoare a pulsului de contact specificată în lista de pulsuri).basic cp experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (vp ph1):f1 (vp ph2):f2 1u pl12:f2 . În programul de pulsuri. experimentul descris în Fig. de un număr de ori specificat prin parametrul de achiziţie td1) – repetă experimentul de N ori (N = td1) pentru a acumula toate datele prevăzute în experimentul 2D. modul de achiziţie 2D este specificat prin comenzile de incrementare şi de repetiţie (loop) specifice: if (increment file – trece la un nou fişier unde va fi stocat următorul FID din cadrul setului de date 2D). achiziţionate prin intermediul secvenţei CP-MAS clasice: la fiecare dintre cele N repetiţii ale experimentului. se aplică transformata Fourier de-a lungul dimensiunii directe (F2) prin intermediul comenzii xf2. 3 presupune înregistrarea unui set de date 2D. Valorile acestor pulsuri sunt stocate într-o aşa-numită listă de pulsuri (variable pulse list) care este apelată în cadrul programului de pulsuri prin comanda vp (variable pulse).go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu.0) . 1m 1m if 1m ivp lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 . urmează procesarea datelor: concret. Lista este cuprinsă în fişierul care este specificat în tabela parametrilor de achiziţie. lo to 2 times td1 (loop la linia 2.# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-var" .

pentru durate ale pulsului de contact p15 cuprinse în intervalul 0 – 200 μs e preferabilă utilizarea unei eşantionări în paşi egali (de exemplul. Peste această valoare a lui p15 se pot utiliza creşteri cu paşi din ce în ce mai mari. CH3. dinamica procesului de transfer de polarizare de la protonii învecinaţi (în principiu. contribuţii însemnate vor avea cei situaţi până la o distanţă de 2. Astfel. Procedura descrisă mai sus face parte dintr-o clasă mai largă de metode RMN-S numite 221 . cu cât rata de creştere a unei astfel de curbe CP este mai mare şi oscilaţiile dipolare mai pronunţate (vezi curba CP corespunzătoare grupării CH comparativ cu cele pentru CH3. în locul curbelor CP se vor obţine aşa-numitele spectre dipolare: cele două modalităţi de a extrage informaţii despre parametrii interacţiunii dipolare sunt însă echivalente. Transformata Fourier s-a aplicat doar în dimensiunea directă. În Fig. astfel încât numărul de N de repetiţii ale experimentului. cu atât cuplajul dipolar heteronuclear asociat este mai puternic. obţinându-se în final aşa-numitele curbe CP-MAS. deoarece în interiorul acestui domeniu temporal caracterul coerent al procesului de transfer este dominant. care coincide cu numărul de puncte ce definesc curbele CP-MAS înregistrate. Dacă transformata Fourier se aplică şi de-a lungul lui t1. Considerând variaţia intensităţilor de linie cu poziţia spectrului CP-MAS din setul de date 2D. în dimensiunea indirectă se obţin curbele de transfer de polarizare (CP) corespunzătoare fiecărei grupări chimice: forma specifică a fiecărei dintre aceste curbe reflectă tăria cuplajelor dipolare heteronucleare recuplate. Acesta este format din N spectre 13C CP-MAS. şi se manifestă prin apariţia aşa-numitelor oscilaţii dipolare în curbele CP-MAS corespunzătoare. se recomandă de asemenea înregistrarea curbei până la valori ale pulsului de contact de 3 – 5 ms. 30-50. să fie menţinut la o valoare rezonabilă. 5 – 10 μs). În practică. proprietăţile caracteristice ale unei asemenea curbe descriu. Pentru a putea caracteriza şi parametrii relaxării spin-reţea în sistemul rotitor. ţinând cont de caracteristicile procesului de transfer de polarizare 1H -> 13C. se reprezintă grafic evoluţia intensităţii de linie în funcţie de durata lui p15. obţinându-se spectrul izotrop al compusului. respectiv COOH). cu cele trei linii de rezonanţă caracteristice grupărilor CH.setul de date 2D. Pentru fiecare dintre liniile RMN din spectru. pentru fiecare poziţie chimică distinctă a atomilor de carbon din sistemul molecular investigat. 4 este prezentat un set de date bidimensional înregistrat utilizând tehnica descrisă mai sus în cazul particular al L-Alaninei. aşezate în ordinea crescătoare a duratei pulsurilor de contact p15 utilizate. care afectează dinamica procesului de transfer de polarizare 1H -> 13C la durate de ordinul milisecundelor. respectiv COOH.5-3 Å).

5]. această secvenţă numită CPPI (Cross-Polarization Polarization-Inversion) are drept scop generarea unei 222 . însă extinde domeniul acesteia de aplicabilitate prin încorporarea unei noi secvenţe în perioada de preparare. şi de prezenţa sau nu a ordonării în probele investigate. Aceste curbe au fost înregistrate după ce în prealabil puterile pe cele două canale rf au fost calibrate la condiţia n = -1 de matching Hartmann-Hahn. În dimensiunea directă se aplică transformata Fourier şi se obţin liniile de rezonanţă ale grupărilor chimice din compus. Metoda Remote Protons CP-MAS O nouă metodă RMN-S 2D de separare este bazată pe experimentul anterior. cum ar fi metodele LG (Lee-Goldburg) sau FSLG (Frequency-Switched Lee-Goldburg). se obţine o recuplare eficientă a interacţiunii dipolare heteronucleare. iar în dimensiunea indirectă sunt ilustrate curbele CP corespunzătoare acestor grupări.de tip SLF (Separated Local Field Spectroscopy): în cadrul acestora. Figura 4: Set de date 2D obţinut în cazul compusului L-alanina. care să ţină cont de detaliile structurale dorite. în condiţii de rotire a probei la unghi magic. În general. prin combinarea tehnicii de recuplare heteronucleară CP cu metode de decuplare homonucleară a protonilor. tehnica CP-MAS de recuplare a interacţiunii dipolare heteronucleare este în general înlocuită cu tehnici mai sofisticate [4.

1m 1m if 1m ivp .go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. p15 şi p16. iar faza celui de-al doilea bloc este inversată în raport cu faza primului.cp (TopSpin 2. care poate fi creată cu ajutorul configuraţiei experimentale formată din cele două blocuri CP ale secvenţei CPPI de durate bine determinate.0) . Figura 5: Reprezentarea schematică a experimentului RMN 2D „Remote Protons CP-MAS” de investigare a transferului de polarizare 1H-13C de la protonii nelegaţi chimic de catonii din probă # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/rem_prot_cp" . and p30 the pulse 223 .stări iniţiale diferită de polarizarea uniformă 1H.pl12 is used here with tppm.pl12 is used here with cw . cum este cazul experimentului CP-MAS clasic.remote protons CP-MAS experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 (p16 ph1):f1 (p16 ph6):f2 (vp ph1):f1 (vp ph8):f2 1u pl12:f2 . Noua stare iniţială constă într-o distribuie neuniformă a polarizării protonilor.

lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph4= 2 ph31= 0 2 2 0 1 3 3 1

Alternând fazele celor două pulsuri CP care formează secvenţa CPPI se creează o stare iniţială de polarizare egală cu zero atât pentru nucleul 13C, cât şi pentru protonii direct legaţi chimic de acesta. Ca o condiţie necesară pentru ca în curbele de transfer de polarizare să fie cuantificat doar procesul de transfer de la protonii îndepărtaţi, secvenţa CPPI trebuie să aducă simultan la zero polarizarea spinului central 13C şi a protonilor direct ataşaţi, în timp ce polarizarea protonilor îndepărtaţi este menţinută la o valoare cât mai mare. Pentru a verifica în ce măsură această condiţie este îndeplinită, am efectuat simulări numerice utilizând programul Spinevolution. În acest scop, sistemul de spini ales este format dintr-un nucleu 13C înconjurat de 7 protoni, care aparţin moleculei de L-Alanina. Pentru cazul grupării CH rezultatele analizei sunt prezentate în Fig. 6: în aceste grafice este ilustrată evoluţia polarizării pentru fiecare spin din sistem în funcţie de creşterea timpului de inversie, p17, şi pentru trei valori diferite ale frecvenţei de rotaţie, νR = 5; 8, respectiv 15 kHz. Pentru sistemul de spini utilizat, primul bloc CP are o durata fixă, p16 = 70 μs, corespunzătoare transferului maxim de polarizare de la protonul legat chimic de spinul central 13C. Dependenţa curbelor de polarizare

Figura 6: Simulări ale dependenţei polarizării de spin de timpul de inversie τ2 din secvenţa de pulsuri CPPI pentru υR = 5; 8 respectiv 15 kHz, în cazul grupării CH din L-Alanina. Prin linie continuă sunt reprezentate curbele de inversie ale polarizării pentru spinul 13C (cu negru), respectiv a protonului legat chimic de acesta (cu roşu). Cu linie punctată este reprezentată polarizarea remanentă pe protonii îndepărtaţi, care aparţin grupării CH3 (albastru), respectiv NH3 (verde) din sistemul de spini considerat.

224

din Fig. 6 arată că polarizările din cadrul grupării CH (adică nucleului 13C şi a protonul sau direct ataşat) pot fi aduse simultan la zero pentru frecvenţe de rotaţie a probei mai mari decât 5 kHz, iar valoarea efectivă a duratei pulsului p17 pentru care această condiţie este îndeplinită depinde în mod explicit de valoarea frecvenţei de rotaţie: de exemplu pentru νR = 8 kHz se obţine un puls de contact p17 cu o durată de 42 μs. În măsura în care starea iniţială dorită poate fi generată cu ajutorul secvenţei CPPI, curbele de transfer de polarizare înregistrate experimental prin incrementarea duratei celui de-al treilea bloc CP din Fig. 5 se consideră ca reflectă doar contribuţia protonilor îndepărtaţi. Pentru a verifica acest lucru, predicţiile teoretice referitoare la procesul de transfer de polarizare de la protonii îndepărtaţi realizat prin noua metodă Remote Protons CP-MAS, au fost testate experimental [6]. În acest scop, am extins configuraţia utilizată în simulări numerice la un sistem de 10 spini (9 protoni şi un nucleu 13C) din L-Alanina, iar curbele CP simulate au fost comparate cu cele experimentale. Molecula de L-Alanina a fost alesă deoarece poziţiile protonilor, şi implicit distanţele H-H şi C-H, sunt determinate precis, prin difracţie de neutroni (cu precizie de ±0.003 Å). Simulările numerice au fost efectuate considerând două cazuri distincte şi anume: în primul caz se consideră gruparea NH3 ca fiind rigidă, iar în cel de-al doilea caz aceeaşi grupare se consideră în regim de rotaţie rapidă în jurul axei sale. În ambele situaţii gruparea CH3 este considerată a efectua o mişcare de rotaţie rapidă. Prin compararea curbelor CP-MAS simulate cu cele experimentale (Fig. 7)

Figura 7: Comparaţia între curbele CP/MAS teoretice şi experimentale corespunzătoare nucleului 13C din gruparea CH din L-Alanina, obţinute prin utilizarea secvenţei CP clasice (curbele roşii), respectiv a secvenţei de transfer de la protonii nelegaţi (curbele cu albastru). Curbele experimentale sunt reprezentate prin cercuri, iar cele simulate prin linie punctată (pe un sistem format din 8 spini), respectiv linie continuă (sistem format din 10 spini). Gruparea CH3 se consideră a efectua o mişcare de rotaţie rapidă în ambele cazuri, iar gruparea NH3 se consideră în aproximaţie rigidă în (a), respectiv în regim de rotaţie rapidă în (b).

225

se observă o foarte bună concordanţă în cazul în care gruparea NH3 este considerată quasi-rigidă. Totuşi, există unele mici diferenţe între curba calculată şi cea măsurată, diferenţe care cel mai probabil se datorează faptului că gruparea NH3 efectuează în realitate o mişcare de rotaţie lentă (la scală de timp a procesului de transfer de polarizare, de ordinul µs). Cea mai importantă concluzie care rezultă în urma comparării efectuate este sensibilitatea crescută a curbei Remote CP-MAS la dinamica moleculară prezentă în sistemul molecular studiat, în timp ce curba CP clasică nu este atât de sensibilă la detalii ale mişcării moleculare caracteristice grupării NH3.

3. Metode RMN-S 2D de corelare 13C-13C
Metoda Proton Driven Spin-Diffusion Metoda RMN-S 2D numită Proton Driven Spin Diffusion (PDSD) este o metodă de corelare: după cum se observă din schema experimentală asociată acestui experiment (Fig. 8), pe durata ambelor perioade de evoluţie indirectă şi directă, t1 şi t2, magnetizarea transversală 13C evoluează în condiţii de decuplare heteronucleară prin TPPM aplicată pe canalul protonilor şi rotaţie a probei în jurul unghiului magic, astfel încât ambele dimensiuni spectrale în spectrul RMN 2D vor codifica preponderent informaţii cu privire la deplasările chimice izotrope ale carbonilor din sistemul molecular investigat (cu o lărgire reziduală determinată de imperfecţiunea metodei de decuplare). Pe durata perioadei de mixing, se generează o stare de polarizare longitudinală

Figura 8: Reprezentarea schematică a experimentului RMN 2D „Proton Driven Spin-Diffusion” (PDSD) de investigare a transferului de polarizare 13C-13C mediat de interacţiunea dipolară cu protonii

226

diferenţială, care va fi transferată între spinii 13C între care există cuplaje dipolare suficient de puternice. Din această cauză, în afară de peakurile diagonale, în spectrul RMN 2D obţinut prin metoda PDSD apar şi cross-peakuri de corelaţie între oricare două poziţii chimice distincte între care se stabileşte transfer de polarizare (spin diffusion), cu intensităţi care depind de distanţa la care se află nucleele 13C corespunzătoare.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/sp-diff" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 pl4:f1 1u do:f2 (p1 ph4):f1 d5 (p1 ph5):f1 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0 lo to 2 times td1 exit

; tau mix ;pl12 is used here with tppm, and p30 the pulse

ph3= 1 3 ph1= (4) 0 0 2 2 ph2= 0 ph4= 0 0 0 0 0 0 0 0 2 2 2 2 2 2 2 2 ph5= 1 1 1 1 3 3 3 3 ph31= 0 2 2 0 1 3 3 1

Transferul de polarizare 13C-13C în experimentul PDSD este iniţiat de interacţiunile dipolare homonucleare între spinii nucleari corespunzători, însă el se produce prin intermediul protonilor situaţi între aceşti carboni. Deoarece aceste cuplaje dipolare C-C sunt în general slabe, durata perioadei de mixing, d5 – în secvenţa de pulsuri ilustrată mai sus, trebuie să fie 227

relativ mare, între câteva sute de µs până la 10-100 ms, pentru a avea un transfer eficient în domeniul de distante 2-5 Å. Din această cauză, metoda este preponderent utilizată pe probe marcate uniform cu 13C: cu toate acestea, există şi câteva cazuri în care PDSD a fost demonstrat şi pe probe cu 13C în abundenţă naturală, însă în aceste cazuri este nevoie de durate de mixing de ordinul secundelor pentru a identifica cross-peakuri cu intensităţi măsurabile. Cu privire la implementarea practică a unui experiment RMN 2D, introduse prin acest exemplu, trebuie menţionate următoarele aspecte: (i) sintaxa ph1= (4) 0 0 2 2 utilizată în programul de pulsuri asociat secvenţei PDSD pentru faza pulsului de contact p15 pe canalul 13C specifică procedura numită TPPI (Time Proportional Phase Incrementation) aplicată pentru înregistarea semnalului în cuadratură pe dimensiunea indirectă – în practică înseamnă că la fiecare experiment nou în dimensiunea indirectă fazele vor fi incrementate cu 3600/4 = 900 faţă de experimentul anterior (adică dacă pentru primul FID din setul de date 2D se utilizează fazele 0 0 2 2 pentru pulsul p15, al doilea FID va avea fazele 1 1 3 3, şi aşa mai departe; (ii) pasul temporal în dimensiunea indirecta este denumit in0 (increment delay 0), iar durata totală de achiziţie indirectă este notată cu aq1, şi se calculează înmulţind incrementul in0 cu numărul de puncte al semnalului înregistrat în dimensiunea indirectă, respectiv td1.

Figura 9: Spectru 13C CP-MAS pe L-Tirozina HCl, şi o reprezentare schematica a atribuirii liniilor pentru cele 7 poziţii chimice distincte ale carbonilor din molecula

228

În final vom ilustra utilizarea metodei PDSD cu rezultatele experimentale obţinute în cazul particular al compusului L-Tirozina HCl, marcată uniform cu 13C. Mai întâi prezentăm în Fig. 9 spectrul 13C RMN-S 1D obţinut prin CP-MAS la o frecvenţă de rotaţie a probei de 10 kHz. Atribuirea liniilor spectrale corespunde indexării poziţiilor de carbon din reprezentarea schematică a moleculei de L-Tirozina inclusă în aceeaşi figură. Am ales acest caz particular pentru că ne permite comportaţii în cadrul unor domenii de distanţe internucleare 13C-13C scurte (1.5 Å – între carboni direct legaţi chimic), medii (3-4 Å, de exemplu între carbonii alifatici şi cei de pe inelul benzenic), şi respectiv lungi (4-5.5 Å, între C1 şi C7 sau C8). Posibilitatea de a estima astfel de distante C-C din spectre PDSD de corelaţie 13C-13C este ilustrată în continuare prin exemplele prezentate în Fig. 10. Primul corespunde unei durate de mixing scurte, de 300 µs, şi evidenţiază faptul că la această scală de timp transferul de polarizare este eficient doar pe distanţe scurte, între carbonii direct legaţi chimic. Utilitatea practică a unui asemenea spectru este evidentă, respectiv identificarea conectivităţilor chimice în cazul unui compus nou, şi pe această cale este un instrument extrem de util în procesul de atribuire spectrală.

Figura 10: Spectre RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina aplicând metoda PDSD; ele ilustrează dinamica procesului de transfer de polarizare la durate de mixing scurte (300 μs), şi respectiv lungi (5 ms)

Cel de-al doilea spectru PDSD ilustrat în Fig. 10 corespunde unei perioade de mixing mult mai mari, de 5 ms, şi este reprezentativ pentru situaţia în care transferul de polarizare se reduce pe distanţe mult mai mari, până la 5 Å, după cum se poate observa din prezenţa peakului de corelaţie C1-C7. Astfel de spectre sunt utile pentru a extrage constrângeri structurale utile pentru investigarea conformaţiei moleculare în sistemul investigat. 229

Metoda CHHC Metoda CHHC pe care o vom discuta în continuare permite determinarea distanţelor 1H-1H, cu rezoluţie înaltă datorită implementării în cadrul spectroscopiei RMN-S 2D de corelaţie 13C-13C. Metoda este demonstrată efectiv pe L-Tirozina·HCl sintetizată sub formă poli-cristalină şi marcată uniform cu 13C. L-Tirozina·HCl a fost aleasă drept sistem model deoarece spectrul 13C RMN-S 1D prezintă o rezoluţie suficient de bună pentru a putea separa liniile corespunzătoare tuturor grupărilor chimice din molecula (Fig. 9), iar structura sa cristalină este bine caracterizată. În Fig. 11 este ilustrată secvenţa de pulsuri asociată metodei CHHC. Experimentul începe cu prepararea unei stări iniţiale prin transfer de polarizare prin CP de la 1H la 13C. Polarizarea transversală astfel creată evoluează sub influenţa deplasărilor chimice izotrope al carbonilor pe durata perioadei de evoluţie indirectă, t1, în condiţii de decuplare heteronucleară prin TPPM pe canalul 1H. Polarizarea 13C care a evoluat cu deplasările chimice izotrope corespunzătoare fiecărei poziţii distincte din moleculă este apoi transferată prin intermediul unei perioade scurte (65 μs) de cross-polarizare (CP) a protonilor direct conectaţi chimic. Polarizarea transversală astfel obţinută este apoi adusă de-a lungul direcţiei z (este transformată în polarizare longitudinală) prin aplicarea unui puls π/2 asupra spinilor 1H. Deoarece polarizările 1H astfel obţinute nu au aceeaşi valoare la toţi protonii, pe durata perioadei de mixing, tmix, se va realiza o redistribuire a acestora prin intermediul aşa-numitului proces de schimb de magnetizare, şi se generează astfel cross-peakuri a căror intensitate este proporţională cu cantitatea de

Figura 11: Reprezentarea schematică a experimentului RMN 2D CHHC de investigare a transferului de polarizare 1H-1H codificat în spectre de corelaţie 2D 13C-13C

230

polarizare schimbată de protonii corelaţi. Deoarece schimbul de magnetizare se datorează interacţiunilor dipolare 1H-1H, intensitatea fiecărui cross-peak obţinut codifică informaţii cu privire la tăria cuplajului dipolar dintre protonii implicaţi si, implicit, cu privire la distanţele internucleare dintre aceştia. După parcurgerea etapei de mixing urmează transformarea polarizării longitudinale în polarizare 1H transversală (prin aplicarea a incă unui puls π/2 pe canalul 1H), iar aceasta apoi transferată către nucleele 13C direct conectaţi chimic (prin intermediul unei perioade scurte de CP, similară celei prin care s-a realizat transferul 13C->1H iniţial). În final, polarizarea transversală 13C este detectată sub formă de semnal RMN pe durata perioadei de evoluţie directă, t2. Detecţia semnalului se face de asemenea în condiţii de înaltă rezoluţie, adică se urmăreşte evoluţia polarizării transversale 13C sub acţiunea deplasărilor chimice izotrope asociate carbonilor din probă, în condiţii de decuplare heteronucleară prin TPPM.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chhc" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f2 1u pl3:f2 p3:f2 ph8 d5 p3:f2 ph9 1u pl2:f2 (p16 ph7):f1 (p16 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0

; tau mix

;pl12 is used here with tppm, and p30 the pulse

231

lo to 2 times td1 exit ph3= 0 0 2 2 1 1 3 3 ph1= (4) 1 ph2= 3 3 3 3 0 0 0 0 ph4= 3 1 ph5= 1 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph8= 0 ph9= 2 ph31= 3 1 3 1 0 2 0 2

Un spectru CHHC tipic este ilustrat în Fig. 12, unde este considerat cazul particular al spectrului 2D de corelaţie 13C-13C înregistrat la o valoare tmix de 50 μs, utilizând o fereastră spectrală care se limitează la carbonii protonaţi (indexaţi conform schemei din Fig. 9). Corelaţiile care se stabilesc între protonii asociaţi diferitelor poziţii de carbon din moleculă sunt identificate în spectrul CHHC prin apariţia cross-peakurilor care conectează poziţiile chimice corespunzătoare. Deoarece mecanismul de stabilire a corelaţiilor în spectre CHHC se bazează pe schimbul de magnetizare longitudinală 1H-1H determinat de interacţiunea dipolară, amplitudinea fiecărui cross-peak va fi o măsură a tăriei acestui cuplaj şi, implicit, a distanţei internucleare dintre protonii asociaţi poziţiilor de carbon corelate. Acest mecanism este exemplificat în Fig. 12 cu corelaţii ale carbonului A (a se vedea liniile punctate). În particular, se observă apariţia unui cross-peak intens între A şi carbonul C, însă este de remarcat de asemenea lipsa uni peak de corelaţie similar cu carbonul din poziţia B. Din punct de vedere calitativ, acest rezultat este în perfectă concordanţă cu distanţele intra-moleculare dintre protonii conectaţi chimic de aceştia, şi anume: 3.2 Å între protonii cei mai apropiaţi de carbonii A şi C, şi respectiv de 4.8 Å pentru ceilalţi doi protoni prezentaţi în exemplul din Fig. 12. O analiză cu caracter cantitativ relevantă pentru determinarea de distanţe 1H-1H cu ajutorul metodei CHHC trebuie însă să ia în considerare şi alte efecte care influenţează intensităţile cross-peakurilor din spectru: pentru aceasta am elaborat un model teoretic al dinamicii de spin în condiţii specifice experimentului CHHC [7]. Rezultatele modelării ne-au permis îmbunătăţirea procesului de analiză a datelor experimentale, prin introducerea de corecţii adecvate pentru o serie de procese perturbative, şi anume: (i) caracterul neselectiv al transferului de polarizare 1H<->13C pe durata blocurilor CP care “flanchează” perioada de transfer de magnetizate (tmix în Fig. 11), (ii) efectul protonilor care nu contribuie direct la semnalul RMN-S detectat (protonii care nu sunt legaţi chimic de carbon, şi respectiv protonii din molecule nemarcate izotopic cu 13C), şi 232

Figura 12: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcată uniform cu 13C aplicând metoda CHHC; spectrul a fost obţinut pentru o durată de mixing de 50 µs şi ilustrează modul în care dinamica procesului de transfer de polarizare 1H-1H (si implicit distanţa dintre protonii implicaţi) este codificată prin intensitatea cross-peakurilor corespunzătoare din spectrul de corelaţie 2D.

Figura 13: Curbe CHHC reprezentative pentru protoni cu contacte intermoleculare scurte (de exemplu protonul legat de C5 de pe inelul aromatic), şi respectiv lungi (protonii ataşaţi lui C2) în urma împachetării moleculelor de L-Tirozina în reţeaua cristalină (figura din dreapta)

233

efectul multiplicităţii protonice pentru diferite grupări chimice din sistem (CH.cp (TopSpin 2. CH3). numit CHCC: acesta prezintă avantajul de a cuantifica pe ambele dimensiuni spectrale deplasări chimice ale nucleelor 13C. Metoda CHCC Având în vedere rezoluţia spectrală limitată a protonilor în experimente RMN-S 2D de tip HETCOR.0) 234 .(iii). În mod similar cu metoda CHHC. 13). CH2. şi respectiv C5 din molecula de L-Tirozină. unde transferul de polarizare este utilizat pentru a codifica cuplajele dipolare 1H-1H. iar procesul care stă la baza experimentului CHCC este şi în acest caz transferul de polarizare proton-carbon. am proiectat şi implementat practic un nou tip de experiment de corelare 13C-13C. adică spectre de înaltă rezoluţie. Corecţiile introduse conduc la creşterea semnificativă a gradul de precizie cu care sunt estimate distanţele proton-proton din spectre RMN-S de tip CHHC. în particular prin intermediul aşa-numitelor curbe CHHC extrase dintr-un set de astfel de spectre înregistrate pentru diferite valori ale timpului de mixing (Fig. care sunt utilizate în mod tradiţional pentru investigaţii structurale bazate pe determinarea de distante C-H. metoda CHCC se aplică în cazul compuşilor uniform marcaţi cu 13C. Informaţia codificată în acest tip de spectre se referă tot la cuplajele dipolare 1H-13C. În această figură ilustrăm comportamentul observat pentru transferul de polarizare în care sunt implicaţi protonii ataşaţi poziţiilor de carbon C2. Figura 14: Reprezentarea schematică a experimentului RMN 2D CHCC de investigare a transferului de polarizare 1H-13C codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chcc" .

pl12 is used here with tppm.. Pe durata celui de-al doilea bloc CP din secvenţa de mixing transferul de polarizare 1H-13C se realizează în mod clasic. and p30 the pulse Secvenţa de pulsuri corespunzătoare metodei CHCC (Fig. Pentru a obţine rezoluţie înaltă. astfel încât liniile de rezonanţă specifice fiecărei grupări chimice să fie separate. Primul bloc CP din perioada de mixing este unul de durată scurtă. astfel încât polarizarea fiecărui 13C este transferată în mod selectiv doar către protonul (protonii) direct legaţi. polarizarea de spin va evolua în condiţii de decuplare heteronucleară prin TPPM. atât în dimensiunea directă. Informaţii cu privire la eficienţa procesului de transfer de polarizare de la nuclee individuale 1H la toate nucleele 13C aflate în vecinătate sunt codificate în perioada de mixing. 235 . cât şi în cea indirectă.13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f1 (p17 ph7):f1 (p17 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 3 1 3 1 3 1 3 ph1= (4) 0 ph2= 0 ph4= 1 ph5= 0 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 . 14) constă în trei blocuri CP distincte. dintre care ultimele două formează perioada de mixing a experimentului.

informaţiile extrase în urma aplicării schemei experimentale CHCC sunt codificate în spectre 2D de corelaţie 13C-13C. Sz. aleasă astfel încât polarizarea de spin să fie transferată de la nucleele de 13C doar la protonii direct legaţi. (iii) incrementând durata ultimului puls CP (tmix) polarizarea 1H Figura 15: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcata uniform cu 13C aplicând metoda CHCC pentru valori ale ultimului puls de contact (p17) de 0. 15. 236 . urmat de evoluţia pe durata t1 a polarizării 13C sub acţiunea interacţiunii de ecranare chimică şi în condiţii de decuplare heteronucleră prin TPPM. în funcţie de distanţele carbon-proton individuale.către toate nucleele de carbon aflate în vecinătate. (ii) aplicarea unui bloc CP de durată scurtă. şi de polarizarea rămasă pe canalul carbonilor după pulsul CP scurt (din cauza că această polarizare nu se transferă în întregime protonilor direct legaţi) se impune ca asupra secvenţei CHCC să se aplice procedeul de ”phase cycling”.5 ms (a). spectrele 1D de mai jos reprezintă felii de-a lungul dimensiunii directe ce corespund poziţiilor de carbon C2 şi C8. iar prin asterisk este marcat în fiecare caz evoluţia cross-peakului specificat. Cross-peakurile CHCC sunt generate conform următoarei scheme: (i) primul pas este format dintr-un bloc CP standard. conform programului de pulsuri asociat schemei experimentale din Figura 14. Deoarece selectivitatea metodei CHCC poate fi afectată de influenţa polarizării iniţiale a carbonului. şi respectiv 1 ms (b). Ca şi în cazul celorlalte două metode de corelare prezentate mai sus. Fig.

aceasta este transformată în polarizare longitudinală care apoi este utilizată pe durata aplicării secvenţei INADEQUATE (Fig.6 b). rata de transfer fiind proporţională cu 1/r3.5. 5. şi C2-C7 (4. respectiv 1 ms) spectrele codifică informaţii structurale despre contactele intramoleculare scurte. ω1+ω2.20 Å. iar la jumătatea acestei perioade se aplică un puls de 1800. utilizând cuplajul J dintre diferite poziţii chimice în molecula investigată.13 Å (H7-C8).7 Å). de la 2. tmix. C3-C5.6(a). Discuţia rezultatelor experimentale se va concentra doar pe distanţe intermoleculare proton-carbon mai mici de 6 Å. respectiv (b).se transferă atât nucleelor 13C direct legate de protonii polarizaţi. Totuşi. se mai aplică o dată secvenţa INADEQUATE care va reconverti coerenţele DQ care au evoluat pe durata lui t1 în coerenţe 237 . La o analiză atentă a spectrelor CHCC se poate observa că cross-peakurile cele mai intense (C7-C8. cross-peakurile datorate corelaţiilor între spini aflaţi la distanţe mai mari sunt şi ele bine conturate. Acest lucru arată că pentru timpii de mixing aleşi (tmix = 0. spre exemplu C7-C5(C4) (pentru distanţa C7-H5(H4) de 2. În prealabil.68 Å). C2-C4) corespund celor mai mici distanţe internucleare 1H-13C.5 ms. la 5. 16. Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) Metoda INADEQUATE Metoda numită INADEQUATE (Incredible Natural Abundance Double Quantum Transfer Experiment) este o metodă RMN-S 2D de corelatie 13C-13C în cadrul căreia în perioada de preparare se generează coerente de două cuante (DQ – Double Quantum).15 – 2. iar în dimensiunea directă ele dau naştere semnalelor izotrope corespunzătoare ambilor spini. Spectrele bidimensionale CHCC ale L-Tyrozinei·HCl uniform marcate 13 cu C pentru timpi de mixing de 0.13Cj. Experimentul generează polarizare transversală a spinilor 13C prin secvenţa CP-MAS: cu ajutorul pulsului de 900 aplicat după pulsul de contact pe canalul carbonului. În dimensiunea indirectă. Distanţele intra-moleculare 1H-13C acoperă un interval larg de valori. cât şi celor aflate în vecinătate. fiind în bună concordanţă cu datele teoretice (Figura 5. Eficienţa transferului de polarizare către nuclee 13C individuale este reflectată în intensitatea cross-peakurilor obţinute. adică ω1 şi ω2. 16b) pentru a genera coerenţele DQ. aceste coerenţe evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor corelaţi. pentru a refocaliza evoluţia cu deplasarea chimică 13C la sfârşitul procesului de generare a coerenţelor DQ.65 Å (H3-C8). situate în intervalul 2. C3-C4 (3. 4. Secvenţa INADEQUATE constă în două pulsuri de 900 separate de o evoluţie liberă pe durata perioadei de mixing. unde r este disţanta 1Hi . Secvenţa de pulsuri asociată experimentului INADEQUATE este redată în Fig.9 Å). respectiv 1 ms sunt prezentate în Fig.

13C-13C INADEQUATE experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u (pl12:f2) (pl4:f1) (p1 ph4):f1 1u cpd2:f2 (p1 ph5):f1 d5 (2p1 ph6):f1 d5 (p1 ph7):f1 238 . În cazul nucleelor 13C.0) .de tip Single Quantum (SQ). 17 nu va apărea cross-peakul corespunzător coerentei ω1+ω3.cp (TopSpin 2. codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/inadequate" . adică între nucleele C1 şi C3. Figura 16: Reprezentarea schematică a experimentului RMN 2D INADEQUATE utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 13C-13. în exemplul de spectru INADEQUATE prezentat în Fig. cuplajul J are valori semnificative pentru a produce coerente DQ în general între poziţii direct conectate prin legături chimice: din aceasta cauză.

ωi şi ωj. corespund formării unei coerenţe DQ care evoluează în dimensiunea indirectă cu frecvenţa ωi + ωj şi indică conectivitatea chimică directă între carbonii corespunzători 239 . 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 1 1 1 3 3 3 3 ph1= 0 ph2= 0 ph4= 3 3 3 3 1 1 1 1 ph5= (8) 0 2 4 6 ph6= (8) 0 2 4 6 ph7= (8) 4 6 0 2 ph8= 1 ph9= 1 ph10= 3 ph31= 0 2 0 2 2 0 2 0 Figura 17: Exemplu ilustrativ de spectru RMN 2D INADEQUATE: peakurile de corelaţie între două poziţii chimice.d0 (p1 ph8):f1 d5 (2p1 ph9):f1 d5 (p1 ph10):f1 1m do:f2 wr #0 HaltAcqu.

Un exemplu relevant pentru acest tip de aplicaţii practice ilustrat în Fig. majoritatea situate în regiunea spectrală 10 – 60 ppm. această moleculă prezintă o structură cristalină puternic ordonată. Datorită acestui fapt. spectrul 13C unidimensional conţine 58 de linii RMN (fiecărei poziţii individuale a unui nucleu 13C ii va aparţine o linie de rezonanţă dublată). În urma analizei spectrului 2D INADEQUATE s-au determinat toate corelaţiile posibile între nucleele de carbon din moleculă.Datorită particularităţilor sale. care conţine două molecule în unitatea asimetrică. Figura 18: Spectrul RMN 2D de corelare corespunzător acetatului de colesteril în abundenţă naturală (2 molecule pe unitatea asimetrică) obţinut cu ajutorul secvenţei de pulsuri INADEQUATE 240 . metoda INADEQUATE este intens utilizată în investigaţiile structurale din chimia organică. 18 corespunde spectrului 13C INADEQUATE înregistrat pe acetatul de colesteril (C29H48O2). în abundenţă naturală [8]. în scopul stabilirii conectivităţilor chimice dintre diferitele grupări prezente în molecula investigată. concluzionându-se asupra acurateţei metodei INADEQUATE în caracterizarea conectivităţilor chimice în sisteme moleculare complexe. în abundenţă naturală. În stare solidă.

pentru excitarea coerenţelor ilizează secvenţa numita BABA2 241 . schema generală a experimentului 1H-1H DQ-MAS (Fig. În prezentul raport vom considera aşa-numita secvenţă BABA (Back to Back) [9].Metoda 1H-1H DQ-MAS Metodele bazate pe excitarea coerentelor DQ se pot aplica şi în cazul protonilor. au fost dezvoltate numeroase metode de excitare DQ pentru protoni. unde rezoluţia spectrală este asigurată prin rotaţia rapidă în jurul unghiului magic. iar altele aplicarea de pulsuri rf intense: toate au însă în comun sincronizarea duratei secvenţei de excitare DQ cu perioada de rotaţie a probei în jurul unghiului magic. care conţine două cicluri BABA cu fazele relative astfel proiectate încât să minimizeze efectul evoluţiei sub acţiunea deplasărilor chimice 1H pe Figura 19: Reprezentarea schematică a experimentului RMN 2D 1H-1H DQ-MAS utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 1H-1H . şi respectiv o versiune perfecţionată a ei. BABA2. în cazul metodelor 1H-1H DQ-MAS coerenţele de două cuante se generează interacţiunile dipolare homonucleare 1H-1H recuplate pe durata perioadei de excitare şi reconversie cu ajutorul unor secvenţe de pulsuri specifice. În practică. 19) este aceeaşi ca şi în cazul INADEQUATE. Drept urmare. Spre deosebire de experimentul INADEQUATE prezentat anterior. singura deosebire fiind secvenţa de pulsuri aplicată pentru a genera coerenţe DQ. unele implicând acţiunea continuă a câmpurilor rf. condiţie necesară pentru a realiza o recuplare eficientă a interacţiunilor dipolare 1H-1H. codificat în spectre de corelaţie 2D 1H-1H. detectabile direct. şi respectiv de a le reconverti la coerenţe SQ.

astfel încât duratele implicate în Fig.0) . având o separare între ele egală cu o jumătate de perioadă de rotaţie.1H-1H DQ-MAS experiment 1 ze 2 d1 1u pl1:f1 (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph2):f1 d1 (p1 ph3):f1 1u (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph3):f1 d1 (p1 ph2):f1 d0 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph5):f1 d1 (p1 ph6):f1 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph6):f1 d1 242 .cp (TopSpin 2. 19 sunt tmix = 2tBABA = 2τR # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/dq-baba" .durata perioadei de excitare/reconversie. Fiecare ciclu BABA conţine două perechi de pulsuri de 900 alipite între ele.

evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor. datorită multiplicităţii protonilor dintr-o anumită grupare chimică. (CH3. NH3). 1m 1m if 1m in0 lo to 2 times td1 exit ph1= (4) 0 2 4 6 ph2= (4) 2 4 6 0 ph3= (4) 4 6 0 2 ph4= 0 ph5= 1 ph6= 3 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 Aplicaţiile practice ale metodei 1H-1H DQ-MAS vor fi ilustrate în continuare. 20). dar şi deosebiri. NH3).ω3) corespunzătoare coerenţelor DQ care se generează între protoni aparţinând grupărilor (CH3. şi respectiv (CH. considerând cazul relativ simplu al spectrului de corelaţie 1H-1H înregistrat pe L-alanina (Fig. unde am utilizat secvenţa BABA2. dar şi din cauza tăriei mari a cuplajelor dipolare 1H-1H care permit evidenţierea corelaţiilor dintre protonii CH (ω2) aparţinând la două molecule vecine (corelaţii intermoleculare): în cazul peakurilor diagonale ωj. cum este cazul grupărilor CH3 (ω1) şi NH3 (ω3) în spectrul din Fig.ω2). 243 . În spectrul DQ-MAS al L-alaninei acesta este cazul pakurilor de corelaţie (ω1. în dimensiunea indirectă (DQ). la o frecvenţă de rotaţie a probei în jurul unghiului magic de νR = 30 kHz.(p1 ph5):f1 go=2 ph31 wr #0 HaltAcqu. Eficienţa maximă s-a obţinut pentru o singură secvenţă BABA2. Concret. (ω1. Deosebirile sunt legate de faptul că în spectre 1H-1H DQ-MAS pot apărea şi peakuri diagonale. CH). ωi+ωj. frecvenţa de evoluţie în dimensiunea DQ va fi de 2ωj. asemănările sunt legate de faptul că liniile de rezonanţă corespunzătoare spinilor 1H corelaţi.ω3) şi (ω2. Analizând spectrul se constată şi similarităţi cu un spectru tipic INADEQUATE. 20. de exemplu ωi şi ωj în dimensiunea directă.

a.3 Å.5 u.a. De exemplu. între protonii grupării CH3. şi anume 19 u.a. de ~1. intensitatea de ~ 4 u. ω2). ω1) a cărui intensitate în unităţi arbitrare este de 20 u.Figura 20: Spectrul RMN 2D de corelare 1H-1H DQ-MAS achiziţionat utilizând secvenţa BABA2 pe L-Alanina. În consecinţă. o analiză riguroasă a intensităţilor relative ale peakurilor din spectrul 2D 1H-1H DQ-MAS ne poate conduce la 244 .a în cazul grupărilor CH-NH3 cu distanţa intramoleculara de ~2. reflectă o distanţă semnificativ mai mare de ~2. Informaţii mai cantitative cu privire la distanţele internucleare dintre protonii din probă se pot obţine din analiza spectrelor 1H-1H DQ-MAS comparând intensităţile relative ale peakurilor de corelaţie. peakului diagonal (2ω1. intensităţile sunt comparabile. Prin comparaţie.. obţinută pentru peakul diagonal (ω2. care formează o reţea compactă de spini. Pentru cross-peakurile (ω1+ ω2. În primul caz.3 Å între protonii grupării CH aparţinând la două molecule vecine din reţeaua cristalină a L-Alaninei. care implică o distanţă intramoleculară de ~2.6 Å.7 Å. pentru coerenţele de două cuante generate între grupările CH-CH3. corespunde unor distanţe intranucleare mici. ω2) şi (ω3+ ω2. ω2). şi respectiv de 18.

S. A. X. Opella. Wokaun. De Paepe. Filip. C. Reson A 109 (1994) 270-272. Principles of Nuclear Magnetic Resonance în One and Two Dimensions. D. Tripon. Feike. SolidSate Nuclear Magnetic Resonance 35 (2009) 2-11 R.M.. ChemPhysChem 5 (2004) 869-875. S. Filip. Graf. Steuernagel.W. L.cuantificarea tuturor proximităţilor proton-proton din proba investigată. Aluas.R. Chem. M.H. X. Ramamoothy. Hafner.K. T. G. Tripon. 5. Magn. Aluas. Bibliografie 1. T. Ernst. C. S.E. Demco. Reson. A 122 (1996) 214. 2. Brown. 5. C. J. 9. 7.G. 6. Oxford University Press. Narasimhaswami. A. S. J.. Reson. Lesage. Spiess. Emsley. Filip. D. rezultând caracterul aplicativ al acestei metode în caracterizarea structurală a compuşilor moleculari în fază solidă. P. Oxford 1987 C. 199 (2009) 173. Introduction to High-Resolution Solid-State NMR. M. Reson. Ladizhansky. A. Wu. Griffin. 245 . K. R. 3. J. A. 408 (2005) 118-122.J. G. 183 (2006) 68. 8. Griffin. 4. Magn. Lee. Gullion. Lett. J. Elsevier Science 2007 P. J. Madhu. R. M. Filip. C. Magn. Magn. H. Bodenhousen. Phys. V.. Ramamoorthy.

4 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide ................... precum şi înţelegerea modului în care acestea funcţionează şi a rolului fiecărei părţi......... Bibliografie ..........265 În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca se află două spectrometre de rezonanţă magnetică nucleară (RMN) performante şi anume: ................264 4............... Prezentarea principiului tehnicii experimentale Rezonanţa magnetică nucleară este un fenomen ce apare atunci când nucleele de un anumit tip se găsesc într-un câmp magnetic static şi sunt expuse la un al doilea câmp magnetic................... oscilant..... Spectroscopia de rezonanţă magnetică nucleară are loc în regiunea undelor radio şi este asociată cu tranziţiile energetice ale spinilor nucleari..... O particularitate importantă asociată cu tehnica RMN este sensibilitatea sa la mediul chimic.....Rezonanţa magnetică nucleară pe sisteme lichide Lect.......253 3........... Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente .......... dr................................. Mihai Vasilescu Cuprins 1.......................246 2...... prezentăm mai jos protocolul de lucru pentru aceste echipamente................. doar acele spectroscopii care au scala lungimilor apropiată frecvenţelor de rezonanţă caracteristice.. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu .. Deoarece legăturile chimice sunt asociate cu valenţa ionilor şi structura moleculară...... În scopul facilitării activităţilor de practică experimentală pentru utilizarea acestor echipamente de ultimă generaţie................ Prezentarea principiului tehnicii experimentale .spectrometrul Bruker Avance 600 cu câmp central de 14 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide Utilizarea acestor spectrometre de către studenţii Facultăţii de Fizică presupune o stăpânire temeinică a noţiunilor şi principiilor de bază din RMN........................... 246 ..... 1............spectrometrul Bruker Avance 400 cu câmp central de 9..................... cunoaşterea părţilor componente ale unui spectrometru.............. vor răspunde acestor efecte...

395 T: Izotop 1H 2H 13C 14N 15N 17O 31P 35Cl 37Cl 43Ca Frecvenţa RMN (MHz) 400 61 100 29 40 54 161 39 32 27 Abundenţa naturală (%) 99. în experimentele de RMN. Aceste diferenţe mari ale frecvenţelor de rezonanţă (unele exemple sunt date în Tabelul 1) fac posibilă observarea nucleelor diferitelor elemente relativ independent unele de altele.Spectroscopia RMN dă date despre toate nucleele rezonante din sistem. Proprietăţi RMN ale unor nuclee într-un câmp de 9. Pentru 247 . câmpul efectiv din zona nucleului este influenţat şi de câmpurile locale interne. în diverse medii chimice. precum şi despre procesele dinamice. presupune reprezentarea grafică a unui bilanţ energetic.108 99. care conţin informaţii specifice structurii locale.015 1. Spectroscopia RMN este o metodă foarte utilă pentru studiul structurii locale şi a dinamicii constituenţilor compuşilor. Tabel 1. ele vor fi multe de acest fel. Pe lângă câmpul magnetic static. De obicei. alte posibile nuclee rezonante fiind excluse prin reglarea spectrometrului pe domeniul de frecvenţe de interes.145 Rezonanţa magnetică nucleară. despre atomii învecinaţi (din prima şi a doua sferă de coordinare). ca orice metodă spectroscopică. Într-un spectru RMN pot fi înregistrate semnale de la un singur tip de nuclee.47 0. Astfel se pot obţine date despre unghiurile dintre legături şi lungimea legăturilor. câmpul magnetic este în domeniul 2.98 0.3-14 T.037 100 75. Domeniul corespunzător pentru C13 este 25-150MHz. Valorile frecvenţelor cu care se lucrează în RMN fac însă folosirea lor foarte anevoioasă. tipic. Cele mai importante interacţii sunt interacţia de deplasare chimică pentru toate nucleele şi interacţia cuadrupolară pentru nucleele cu I>1/2.63 0.37 0. Toate nucleele cu moment magnetic sunt capabile să ofere informaţii detaliate despre ordinea locală.53 24. Pentru proton aceasta corespunde unor frecvenţe de rezonanţă între 100-600MHz. simetria locală şi numerele de coordinare.

dar a devenit rară în spectroscopia RMN. de ordinul zecilor sau sutelor de ppm. aceasta nu se face prin parcurgerea domeniului de frecvenţe. de obicei. De obicei. Prima este similară ca şi concepţie cu alte forme dispersive de spectroscopii şi implică o analiză (“sweep”) spectrală în care fiecare condiţie de rezonanţă posibilă (echivalentă absorbţiei) este căutată secvenţial. Această abordare este mai uşoară din punct de vedere tehnic şi are la bază ecuaţia: ω0 = -γB0 echivalentă cu parcurgerea frecvenţelor. de frecvenţă fixată. ea fiind rezultatul energiei foarte joase implicate în experimentele RMN. acesta va fi un sistem de bobine acordate. Acesta este cunoscut ca sistemul rotativ (“the rotating frame”). Îngustimea extraordinară a liniilor RMN este cea care face ca efectele deplasărilor chimice mici să fie măsurabile şi utile. Îngustimea liniilor în cazul lichidelor se datorează mişcării moleculare rapide [1]. Baza experimentului de rezonanţă magnetică este plasarea probei într-un câmp magnetic uniform intens şi asigurarea iradierii ei cu un câmp electromagnetic printr-un sistem potrivit de emisie şi recepţie a frecvenţelor radio sau de microunde. şi modificând câmpul magnetic principal. Această abordare este adesea utilizată în RES. o scală a deplasărilor chimice date de formula: δ = ν −ν 0 ν0 Unitatea de măsură pentru deplasările chimice este "partea per milion" sau "ppm". Ulterior s-a recurs la un artificiu. pentru rezonanţa magnetică nucleară. a căror frecvenţă de rezonanţă să fie considerată nivelul zero al scalei energetice. Pentru a urmări experimentul este necesar să folosim un sistem de coordonate care se roteşte cu frecvenţa Larmor ω0.simplificare s-a ales ca primă soluţie folosirea unor etaloane. În aceste 248 . De obicei. ci prin iradierea cu un câmp electromagnetic slab. substanţe de referinţă. A doua abordare demonstrează chiar mai clar distincţia dintre rezonanţa magnetică nucleară şi alte spectroscopii şi exemplifică folosirea descrierii clasice a câmpului de radiaţie. Pentru a observa semnalele pot fi urmate două strategii. acum reprezentându-se în loc de scală energetică propriu-zisă. Deplasările chimice întâlnite în RMN sunt.

(b) Magnetizarea după un puls de 1800. Dacă radiaţia electromagnetică este de aceeaşi frecvenţă cu frecvenţa Larmor. Dacă. în loc să aplicăm un puls de 180. (c) Magnetizarea după un puls de 900. În sistemul rotativ. B1. Figura 1(b) ilustrează acest proces pentru un unghi de 1800.γ B1 Unghiul la care se mişcă magnetizarea este θ.γ B1 t aşa că magnetizarea poate fi înclinată la orice unghi doar prin simpla aplicare a unui puls electromagnetic de putere şi durată cunoscute. în mod clar. T1. cunoscut ca timp de relaxare spin-reţea sau timp de relaxare longitudinală.condiţii magnetizarea nucleară poate fi descrisă de un vector paralel cu direcţia z. dat de: θ = ω1 t = . (a) Magnetizarea (M0) în sistemul rotativ în prezenta câmpului de radiofrecvenţa (B1). atunci va părea statică în sistemul de coordonate astfel ales. Când aplicăm B1 magnetizarea răspunde precesând în jurul lui B1 cu o frecvenţă ω1 dată de: ω1 = . În această situaţie fiecare vector nuclear individual (vectori care sunt însumaţi pentru a da magnetizarea macroscopică) 249 . După un “puls de 180” sensul magnetizării se inversează complet. B0 poate fi ignorat şi este necesar doar să considerăm efectele câmpului de radiaţie. o situaţie de non-echilibru. Aceasta corespunde unei inversii a populaţiei nivelelor energetice şi este. care este direcţia câmpului magnetic principal. Situaţia este ilustrată în figura 1(a) [2]. cunoscut ca plan transversal (fig 1c). atunci magnetizarea se roteşte cu 90 de grade în planul x’y’. Figura 1. Radiaţia electromagnetică este descrisă de componenta sa magnetică ca un vector la un anumit unghi faţă de direcţia câmpului. Revenirea la echilibru este caracterizată de un timp. aplicăm un puls cu durata jumătate.

Figura 2. numit relaxare spin-spin sau transversală. oscilează cu o frecvenţa egală cu diferenţa dintre frecvenţa de referinţă şi frecvenţa de rezonanţă a semnalelor deplasate. atunci setul de spini nucleari. T2 este legat de lărgimea liniei la jumătatea înălţimii peak-ului. În lichide. Acolo unde avem un număr de rezonanţe deplasate se obţine un semnal oscilator complicat al relaxării. Acest proces este ilustrat în figura 3. (c) şi (d) arată evoluţia în timp după un puls de 900. vor produce variaţii aleatoare ale frecvenţei Larmor. Relaxarea transversală – fiecare săgeată reprezintă un vector magnetizare nucleară. Semnalul obţinut prin relaxare se referă de obicei la relaxarea liberă a magnetizării (free induction decay. (b). dependente de timp. această relaxare poate fi adesea caracterizată ca un proces exponenţial cu constanta de timp T2. Acest proces. Există o relaţie importantă între relaxarea transversală şi lărgimea liniei. care vor face ca vectorii nucleari individuali să se mişte cu viteze diferite faţă de viteza sistemului rotativ. Pe măsura trecerii timpului suma vectorilor se va reduce la zero. corespunzând liniilor deplasate. sistemul începe să se relaxeze. FID) şi poate fi transformat într-un spectru printr-un proces matematic cunoscut sub numele de transformare Fourier. Cum aceste câmpuri sunt aleatoare. prin: 250 . numit timp de relaxare spin-spin sau timp de relaxare transversală. Efectele de câmp aleatoare. Imediat după ce aplicarea pulsului încetează. vom avea tot atâtea nuclee ce se mişcă mai rapid ca şi numărul celor ce se mişcă mai lent. Când apar deplasarea chimică (“chemical shift”) sau rezonanţele cuplate scalar. este ilustrat în figura 2.este forţat de câmpul de radiaţie să se rotească coerent cu frecvenţa Larmor ω0. ν½ . Pentru o descreştere exponenţiala spre echilibru. (a).

Principiul unei astfel de metode este ca. toate frecvenţele sunt excitate în mod 251 . intensitate (a) timp (b) frecventa Figura 3.ν½ = 1/(πT2) de aceea. este un exemplu de metodă multiplex. care este acum metoda aleasă în cele mai multe experimente RMN. În multe cazuri. respectând condiţia ca pulsul excitaţiei să acopere o lărgime de bandă potrivită. cu cât relaxarea se produce mai rapid. Transformarea Fourier a unui FID (a) într-un spectru (b) Tehnica transformării Fourier. cu atât linia observată este mai largă. din cauza lărgimii liniei deplasarea chimică sau informaţiile privind cuplajul sunt obscure sau chiar pierdute.

iar partea iniţială a semnalului este distorsionată de revenirea sistemului de recepţie după pulsul de radiaţie. aceasta limitează metoda transformatei Fourier la doar un grup restrâns de sisteme. Dimpotrivă. În aceste condiţii s-ar putea să fie avantajoasă folosirea metodei CW cuplată cu tehnici de scanare rapidă. Deoarece N este de obicei mii sau zeci de mii. atunci liniile spectrale sunt foarte largi şi digitizarea devine o problemă. Metoda transformatei Fourier nu este însă lipsită de probleme. vor avea doar o mică contribuţie la FID. atunci contribuţia semnalelor mici poate fi pierdută cu totul. Figura 4. Prima este durata FID-ului. Ca o consecinţă. În cazuri ideale. CW) frecvenţele sunt excitate secvenţial. Ca rezultat al acestei metode. atunci când se fac analize pe alimente. A doua problemă este direct legată de avantajul multiplexului. cu linii foarte înguste. CW tinde să fie mult mai lentă decât metoda transformatei Fourier. de interes. Vedere generala asupra spectrometrului 252 . acest avantaj este foarte consistent. un semnal foarte intens în anumite părţi ale spectrului va creşte intensitatea tuturor punctelor din FID. Cum toate frecvenţele contribuie la fiecare punct. În cazul RES. în metoda undelor continue (continous wave. de exemplu. Aceasta poate fi o problemă importantă în spectrele RMN pentru protoni. Dacă nu avem o rezoluţie suficientă în convertorul analog – digital. avantajul semnal/zgomot al metodei transformatei Fourier asupra metodei CW pentru acelaşi timp de achiziţie este N unde N este numărul de frecvenţe. unde apa este adesea componentul majoritar şi poate domina spectrul.egal şi toate contribuie la toate punctele din FID. pot apărea probleme cu digitizarea semnalului. Dacă aceasta este foarte scurtă. deoarece semnalele mici. În RMN pot apare dificultăţi cu semnalele solidelor.

4 K) • straturi termoizolante şi ecranante • orificiu central vertical (îngust sau larg) Figura 5.Magnetul • cea mai scumpă parte a spectrometrului • electromagnet din fire supraconductoare • câţiva km de fir • solenoid. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Cel mai adesea analizele probelor lichide se concentrează pe studiul spectrului RMN corespunzător nucleelor de hidrogen sau carbon. Secţiune schematică printr-un magnet RMN 2.2 K) • straturi termoizolante şi ecranante • azot lichid (T = 77. Dizolvarea probelor se face în solvenţi deuteraţi. Analizele se fac utilizând recipienţi speciali pentru analize RMN. Interpretarea acestor spectre ne permite identificarea structurii probelor analizate. bobine helmholtz • heliu lichid (T = 4. 253 . anume a izotopilor 1H şi 13C. eprubete de quartz de 5 mm diametru. spectrometrul realizând fixarea câmpului cu ajutorul nucleelor de deuteriu. bobina.

• TMS (tetrametilsilandeuterat) are frecvenţa de rezonanţă de 0 ppm pentru 1H. • C3D6O (acetona deuterata) are frecvenţa de rezonanţă de 2. respectiv 0 ppm pentru 13C şi 0 ppm pentru 29Si. respectiv 39.01 ppm pentru 13C. respectiv triplet la 77. Astfel: • CDCl3 (cloroform deuterat) are frecvenţa de rezonanţă de 7. Proba: benzen (C6H6). • DMSO (dimetilsulfoxid deuterat) are frecvenţa de rezonanţă de 2. Redăm mai jos şi câteva exemple de analize 1H NMR pe probe relativ simple [3]: Figura 6.156 ppm pentru 1H.În acelaşi timp.47 ppm pentru 13C.16 ppm pentru 1H. Solvent: CDCl3 Figura 7. solvenţii au şi rol de referinţă.78 ppm pentru 1H.26 ppm pentru 1H. respectiv 30 ppm şi 206 ppm pentru 13C.512 ppm pentru 1H. Solvent: CDCl3 254 .032 ppm pentru 13C. • D2O (apa deuterată) are frecvenţa de rezonanţă de 4. Proba: ciclohexan (C6H12) . • C6D6 (benzen deuterat) are frecvenţa de rezonanţă de 7. respectiv 128.

Solvent: CDCl3 Figura 10. Solvent: CDCl3 255 . Proba: toluen (C6H5CH3).Figura 8. Proba: etil benzen (C6H5CH2CH3). Proba: acetona (CH3(C=O)CH3) . Solvent: CDCl3 Figura 9.

Solvent: D2O Figura 13. Proba: etanol (CH3CH2OH) . Solvent: CDCl3 256 . Proba: metil etil cetona (CH3(C=O)CH2CH3). Solvent: CDCl3 Figura 12. Proba: apa (H2O) .Figura 11.

Proba: 2-propanol ((CH3 )2CHOH). Solvent: CDCl3 Figura 16. Proba: etanol (CH3CH2OH).Figura 14. Solvent: D2O Figura 15. Solvent: CDCl3 257 . Proba: 1-propanol (CH3CH2CH2OH).

Solvent: CDCl3 Figura 18. Solvent: CDCl3 Figura 19. Solvent: CDCl3 258 .Figura 17. Proba: piridina (C5H5N). Proba: t-butanol ((CH3 )3COH). Proba: 2-butanol (CH3CH2CH(OH)CH3 ).

identificarea corespondenţei celor trei semnale de rezonanţă este completă. Solvent: CDCl3 Raportul relativ al celor trei integrale este 2:3:3. Analizele de tip 13C NMR vor utiliza diferite metode ce conduc la îmbunătăţirea semnalului RMN. diferenţa de populaţie poate fi crescută prin scăderea temperaturii probei. Informaţii suplimentare se obţin dacă calculăm integralele liniilor de rezonanţă. Cum semnalul RMN creşte odată cu creşterea diferenţei de populaţie dintre nivelele energetice. acestea reprezentând de fapt intensitatea relativă a semnalelor şi fiind. Pentru a identifica semnalele celor doua grupări CH3 vom ţine cont de faptul că protonii grupării legate de C=O dau semnal simplu (singlet). în timp ce protonii grupării legate de CH2 dau semnal despicat (n+1). senzitivitatea este îmbunătăţită de creşterea câmpului magnetic utilizat [5]. Senzitivitatea spectrometrului RMN este o măsură a numărului minim de spini detectabili.Pentru aceste exemple identificarea corespondenţei între semnalele de rezonanţă şi poziţia protonilor în moleculă se face relativ simplu. aşa cum se vede în figura 20: Figura 20. De asemenea. în general. proporţionale cu numărul de nuclee care produc semnalele respective. deci triplet. corespunzător numărului de protoni legaţi de fiecare dintre nucleele de carbon. Integrarea semnalelor pentru proba: metil etil cetona (CH3(C=O)CH2CH3). Redăm mai jos şi câteva exemple de analize 13C NMR pe probe relativ simple: 259 . Astfel.

Solvent: CDCl3 Figura 22. Solvent: CDCl3 Figura 23. Proba: ciclohexan (C6H12) .Figura 21. Proba: benzen (C6H6). Solvent: CDCl3 260 . Proba: toluen (C6H5CH3).

Figura 24. Proba: etil benzen (C6H5CH2CH3). Solvent: CDCl3 Figura 25. Proba: acetona (CH3(C=O)CH3) . Solvent: CDCl3 261 . Solvent: CDCl3 Fiurag 26. Proba: metil etil cetona (CH3(C=O)CH2CH3).

Figura 27. Solvent: CDCl3 262 . Proba: etanol (CH3CH2OH) . Proba: 1-propanol (CH3CH2CH2OH). Solvent: CDCl3 Figura 28. Solvent: D2O Figura 29. Proba: etanol (CH3CH2OH).

Proba: t-butanol ((CH3 )3COH). Proba: 2-propanol ((CH3 )2CHOH). Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Solvent: CDCl3 Figura 31. Solvent: CDCl3 Figura 32. Solvent: CDCl3 263 .Figura 30.

4 grame proba). specială pentru analize RMN. semnal foarte util şi pentru a calibra spectrul în funcţie de referinţă. Proba: piridina (C5H5N). 3. Solvent: CDCl3 În toate spectrele de mai sus.01 ppm. acolo unde s-a utilizat ca solvent CDCl3. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca. la nevoie se încălzeşte uşor eprubeta pentru a facilita dizolvarea. utilizabil pentru analiza probelor lichide.1-0. până când coloana de lichid are aproximativ 4 cm înălţime (circa 0. se observă şi semnalul corespunzător solventului la 77. • se agită pentru dizolvarea probei. se află spectrometrul de rezonanţă magnetică nucleară (RMN) Bruker Avance 400 cu câmp central de 9.Figura 33. 264 . peste probă.4Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide. • se pune eprubeta în suportul special: • se aşează eprubeta cu suportul în dispozitivul special de reglaj al distanţei şi se aşează eprubeta astfel încât ulterior proba să fie în centrul câmpului magnetic.5 ml solvent). Etapele înregistrării spectrului RMN pe probe lichide la spectrometrul Bruker Avance 400 din dotarea laboratorului: • se ia o eprubeta de 5 mm diametru. • se dă comanda „lift on” de la BSMS pentru a crea perna de aer pentru eprubeta. curată • se pune proba în eprubetă (circa 0. • se pune solventul în eprubetă.

se dă comanda „lock” şi se alege solventul potrivit. 3. Grimmer and B. Anterior înregistrării unui spectru este posibil ca parametrii de achiziţie să necesite o optimizare. Belton. funcţie de structura moleculară. 31. • se setează parametrii de achiziţie. • se realizează reglajele de „shimm” făcând corecţiile necesare de la BSMS.D. • se realizează măsurătoarea efectivă alegând un număr de achiziţii potrivit pentru obţinerea unui raport semnal/zgomot suficient de bun. măsurând integrala lor şi atribuind în final semnalele nucleelor. R.rit. • se calibrează spectrul în funcţie de referinţa aleasă. • se fazează corespunzător. Vol. spectrometrul va intra în modul „lock”. făcându-se automat corecţiile variaţiilor externe. X sau Y. marcând peak-urile de rezonanţă. Annual Reports on NMR Spectroscopy. Bibliografie 1. • se analizează spectrul. • se alege programul de pulsuri dorit şi nucleul pe care se doreşte realizarea analizei RMN. Vol. Blumich. 2007 Carrington. (1994). A.edu/htbooks/nmr/ Mihai Vasilescu. se dă comanda „lift off” şi proba coboară în magnet. • • • • 4. 1-18. Introduction to Magnetic Resonance. 1-60. Academic Press. • se dă comanda „wobb” şi din şuruburile speciale ale capului de sondă se reglează frecvenţa de rezonanţă pentru nucleul studiat. McLachlan.se aşează eprubeta pe perna de aer. Hornak. 30. se centrează semnalul de „lock” în fereastra de control a BSMS-ului. 2. NMR Basic Principles and Progress. Z4. (1995). 5. • se dă comanda „efp” pentru a trece din semnal timp (FID) în semnal frecvenţa (spectru). deci câmpul va fi fixat şi stabilizat. modificând în principal câmpurile Z1 şi Z2. la nevoie se modifică şi Z3. Chapman and Hall. P.S. Joseph P.cis. Aceasta se realizează cu comanda „popt” şi se referă în general la setarea duratei pulsului de excitare (p1) şi respectiv a timpului de relaxare dintre două achiziţii consecutive (d1). p. p. Teza de doctorat. 4. http://www. London (1967) 265 .

VII. Analiză calorimetrică diferenţială Conf. răcire.Robert Austin în anul 1899. Raluca Ciceo-Lucăcel Analiza termică a materialelor acoperă o categorie largă de metode prin care sunt determinate proprietăţile fizice şi chimice ale acestora. • tranziţii vitroase ale solidelor ne-cristaline.. sublimare. Metodele de analiză termică diferenţială reprezintă varianta modernă a metodelor clasice de investigare a efectelor termice induse de variaţia temperaturii unui corp fiind pentru prima dată folosite de către W. tratamente izoterme. • temperaturile caracteristice ale transformărilor de fază. cristalizare. Fenomenele fizice şi chimice.. MĂSURĂTORI TERMICE Analiză termică diferenţială. • oxidarea.. în funcţie de temperatură sau timp pe baza efectelor termice care însoţesc transformările din probă în timpul supunerii acesteia la procese de încălzire. • puritatea şi compatibilitatea materialelor. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. • căldurile de topire. reducerea. fierbere. de-vitrificare etc. cristalizare. dr. hidratarea – dehidratarea etc. descompunerea. • capacităţi calorice. • cinetica reacţiilor şi a formării fazelor. călduri specifice. • re-cristalizarea sticlelor metalice etc. de reacţie etc. etc. Termenul de “metoda diferenţială” provine de la fap266 .C. • coroziunea metalelor în diferite atmosfere.

2. DTA poate fi folosită si pentru a studia proprietăţile termice şi transformările de faze care nu se produc cu modificarea entalpiei materialului. iar panta curbei în orice punct va depinde de microstructura probei la temperatura respectivă. 1.[2] Figura. Cuptorul. metoda constă în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic. Programatorul de temperatură. De aceea. 267 . 1) sunt: 1. Linia de bază a unei înregistrări DTA prezintă astfel discontinuităţi la temperaturile de tranziţie. [1] Concret. Analiza termică diferenţială (DTA) este suficient de sensibilă pentru a determina variaţii foarte mici de temperatură şi este capabilă să sesizeze transformările lente ce se produc în intervale largi de temperatură. Principalele componente ale unui sistem termic diferenţial Principalele componente ale unui sistem termic diferenţial (Fig. 3. Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme.tul că aceste tehnici permit determinarea diferenţelor dintre variaţiile unor mărimi fizice ale probei în raport cu cele ale unui etalon. Suportul pentru probe conţinând termocuplurile şi containerele pentru probe plasate într-un bloc ceramic sau metalic. concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă. Suprafaţa de sub aria curbei este proporţională cu modificarea entalpiei şi nu depinde de capacitatea calorică a probei.

2). Sistemul de furnizare a gazelor. Figura. amplificat şi 268 .conform IUPAC (International Union of Pure and Applied Chemistry).4. Efectul termic care se produce în cazul unei tranziţii termice sau a unui proces fizico-chimic este înregistrat ca diferenţă de flux caloric între probă şi referinţă şi la rândul lui este tradus în semnal electronic. nu de temperatură. Termenul calorimetrie se referă exclusiv la măsurarea căldurii. în scopul menţinerii unei atmosfere inerte în cuptor (pentru inhibarea oxidării probei. eliminarea volatilelor şi asigurarea unui transfer termic cât mai bun). Sistemul de înregistrare. Calorimetrele cu baleiaj diferenţial sunt tehnici îmbunătăţite ale DTA (analiza termică diferenţială) în sensul că ele au fost calibrate pentru măsurători de energie calorică. Căldura poate fi o cantitate de energie schimbată sub forma unui flux de căldură între două corpuri într-un interval de timp. 2 Schema idealizată a unei curbe DTA Calorimetria dinamică diferenţială (DSC) este o tehnică în care diferenţa de energie dintre o substanţă (şi/sau produşii de reacţie) şi un material de referinţă este măsurată ca funcţie de temperatură (sau timp) în timp ce substanţa şi materialul de referinţă sunt supuse unui program de temperatură controlat . pe care este reprezentată diferenţa de temperatură (semnalul DTA) (Fig. 5. Orice proces endoterm sau exoterm (cum ar fi topirea sau cristalizarea) care are loc în probă la încălzire este înregistrat ca un peak în direcţia negativă. respectiv pozitivă a axei X.

Sistemul „heat flux” DSC înregistrează diferenţa de temperatură între probă şi referinţă care apare în cursul unei transformări fizico-chimice. fluxul diferenţial de căldură de la cuptor spre probă şi referinţă este măsurat pe căi complet diferite. atunci semnalul DSC va arăta ca o linie dreaptă. Schematic este prezentată o termogramă DSC în care linia de bază prezintă multiple modificări datorate proceselor şi tranziţiilor termice din probă (fig. Faţă de această linie se vor măsura intensitatea şi temperatura la care se manifestă procesele termice din probă.apoi prelucrat de componenta software a instrumentului. drept pentru care linia serveşte ca şi referinţă şi este numită linie de bază. 3 Tipuri de procese care pot apărea într-o înregistrare DSC Există două tipuri de tehnici DSC utilizate în analizele termice: • calorimetre DSC cu flux de căldură („heat flux” DSC). Înregistrarea se redă sub forma unei curbe numită termogramă DSC care reprezintă o dependenţă a fluxului caloric măsurat funcţie de temperatură (analiză în regim dinamic) sau timp (analiză în regim izotermal). • calorimetre DSC cu compensarea puterii calorice („power compensated” DSC). În continuare vom prezenta pe scurt câteva detalii pentru fiecare tehnică in parte. Semnalul măsurat redat în termograma DSC este direct proporţional cu capacitatea calorică a probei. 269 . astfel că orice diferenţă ce apare în capacitatea calorică a probei conduce la modificarea termogramei DSC. Deşi în ambele tipuri semnalul măsurat reprezintă diferenţa de temperatură generată de senzori. Figura. 3). Dacă proba de analizat nu suferă o transformare fizico-chimică sau o tranziţie termică. iar „power compensated” DSC transformă această diferenţă de temperatură în puterea calorică necesară restabilirii echilibrului termic dintre probă şi referinţă.

în funcţie de tipul procesului. care este convertită în flux de căldură printr-o construcţie specială (Fig. se modifică gradientul de temperatură al probei faţă de etalon. iar graficul înregistrează aşa-numita linie de bază în funcţie de timp sau temperatură. prin diferenţa de putere electrică introdusă în rezistenţele de încălzire aşezate în imediata vecinătate a probei şi etalonului. 5) – măsoară diferenţa de flux termic proba-etalon indirect. 4). este controlată în timp ce se înregistrează diferenţa de temperatură dintre cele două. care este şi parte integrantă a sistemului de înregistrare a temperaturii. pentru a menţine diferenţa de temperatură zero. Semnalul măsurat este folosit ulterior la măsurarea diferenţei de flux de căldură. 4. Dacă în probă au loc transformări de fază sau alte procese care se produc la o anumită temperatură.Heat flux DSC – măsoară diferenţa de temperatură dintre probă şi etalon. 270 . diferenţa de temperatură este zero. Figura. Dacă în cuptor fluxul de căldură este echilibrat. Proba şi referinţa sunt menţinute la aceeaşi temperatură printr-un sistem electric format din două rezistenţe de încălzire. Schema de principiu a metodei heat flux DSC Power compensated DSC (Fig. iar în grafic apare o deviere de la linia de bază sub forma unor peak uri endoterme sau exoterme. Căldura transportată la probă şi referinţă printr-un platan din argint sau constantan.

dar peak-urile înregistrate sunt mai largi. metalele nobile şi seminobile. însă pot apărea suprapuneri de peak-uri. 5. Metalele cele mai frecvente utilizate le temperaturi înalte sunt nichelul. cu peak-uri mai înguste. Semnalul electric dat de diferenţa de putere dintre cele 2 rezistenţe este proporţional cu diferenţa de flux termic şi este înregistrat sub forma curbei de analiză termică. La o viteză mai mică efectele termice au loc la temperatură mai joasă. Rolul formei şi al materialului din care este format locaşul pentru probe Materialele folosite la construcţia locaşelor sunt de două categorii: metalice sau ceramice.sau endoterm). La viteze de încălzire mai mari efectele termice sunt evidenţiate mai bine. există o serie de factori care influenţează în mod direct efectele termice analizate şi implicit forma termogramelor. pentru ca temperatura probei să nu difere de cea a referinţei se cuplează sau decuplează rezistenţa de încălzire a acesteia până la egalizarea temperaturilor. 2. Materialele ceramice utilizate la confecţionarea locaşurilor sunt 271 .Figura. Din punct de vedere experimental. Principalii astfel de factori de influenţă sunt [3]: 1. Influenţa vitezei de încălzire asupra curbelor se explică prin aceea că odată cu creşterea ei creşte şi cantitatea de produşi sub formă de gaz care generează o diferenţă de temperatură mai mare între probă şi cuptor. Viteza de creştere sau descreştere a temperaturii în cuptor: viteza de încălzire afectează înălţimea şi lăţimea efectelor termice înregistrate de curbele DTA şi DTG. oţelul inoxidabil la temperaturi înalte. Schema de principiu a metodei power compensated DSC Dacă în probă are loc un proces (exo.

Rolul acoperirii sau descoperirii probei Acoperirea probei poate să ajute. 6. s-au impus două tendinţe: utilizarea locaşurilor în formă de blocuri şi utilizarea locaşurilor în formă de creuzet. de multe ori. În ceea se priveşte forma locaşelor pentru probe. ele pot influenţa forma efectelor termice sau să se impurifice. deci ale liniei de bază a curbei DTA. pe cât posibil. în cazul când în probă se află un compus care se topeşte. 4. Densitatea sau gradul de tasare a probei în locaş: diferenţele în densitatea sau gradul de tasare a probei în locaş sunt cauzele cele mai obişnuite ale devierilor de la linia de bază a curbei DTA. fără ca această variaţie să aibă prea mare influenţă asupra rezultatelor. dau efecte termice cu intensităţi mari. Cantitatea de probă luată în lucru: greutatea probei luată în lucru poate să varieze între 0. 5. Locaşurile metalice.alumină cu adaus de silice. 3. nu sunt poroase şi dau mici deviaţii ale fluxului de căldură.2 şi 1g. pe de altă parte. Dar dezavantajul lor este că intensitatea efectelor termice tinde să fie mică. în timpul procesului termic. Un alt dezavantaj este acela că datorită structurilor poroase. aşezarea lor în cuptor este dificilă din cauza faptului că au o slabă conductibilitate termică iar atunci trebuie foarte bine centrate. cu probele descoperite. la obţinerea unei linii de bază a curbei DTA sub forma unei linii drepte sau prin acoperirea probei se protejează unele reacţii violente ca de exemplu: fierberile sau descompunerile în urma cărora ar ieşi o cantitate de probă afară din locaş. Cantitatea de probă ce trebuie luată în lucru este de 272 . Cum ar fi. Dar au şi acestea dezavantajele lor . iar suprafeţele efectelor termice sunt mai mici (cu excepţia oxidărilor). Această precauţie de a se lucra cu proba descoperită se ia pentru a nu influenţa admisia şi emisia gazelor şi a vaporilor de apă care însoţesc reacţiile termice şi care dacă ar fi într-un sistem închis ar duce la suprimarea unor reacţii. în decursul timpului. argilă arse. sticle rezistente la temperatură şi. fapt ce denaturează foarte mult forma curbelor termice. Locaşurile ceramice. în anumite cazuri. din cauză că transferul de căldură are loc încet prin pereţii lor. din cauză că transferul de căldură care are loc se face rapid prin pereţii lor şi între aceşti pereţi şi masa probei. Cu toate acestea este bine să se lucreze. grafitul. care sunt mai frecvent utilizate. Influenţa gradului de mojarare a probei: cu cât granulaţia probei este mai mică cu atât temperaturile de descompunere sunt mai joase. pentru aceeaşi cantitate de material reactant ca şi în cazul celor metalice. au avantajul că pot fi mult mai uşor de confecţionat.

Materialul de referinţă şi probele de analizat sunt puse în celule standard din alumină (având dimensiunile Ø: 5. Natura şi proprietăţile termocuplelor: un termocuplu este format din doi conductori de compoziţie diferită. Măsurătorile de analiză termică diferenţială se realizează cu un derivatograf termic Shimadzu tip DTG-60/60H. între 100-800˚C se pot folosi termocuple confecţionate din aliaje speciale de Ni şi Cr. 9. dar.8 mm x h: 2. Materialul de referinţă şi probele de analizat sunt puse în celule standard din 273 . cu o rată de încălzire a cuptorului de 5-10ºC/min (uzual) în domeniul maxim de temperatură de la 23 ºC (sau temperatura camerei) până la 1600 ºC. Institutului de Cercetări Experimentale Interdisciplinare în Bio-Nano-Ştiinţe deţine două aparate performante destinate analizelor termice. care sunt rezistente la atacul termic şi au o durată de utilizare lungă în comparaţie cu cele confecţionate din metale inferioare. presiunea trebuie menţinută constantă pe tot parcursul determinărilor. Termocuplele ideale sunt cele constituite din metale nobile.5 mm). comparativ cu această substanţă termică inertă. Substanţa termică inertă. Măsurătorile de analiză calorimetrică se realizează pe un calorimetru diferenţial Shimadzu tip DSC-60. Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min.obicei determinată de sensibilitatea aparaturii şi de intensitatea proceselor termice care au loc în substanţa cercetată. el trebuie să aibă aceeaşi mărime granulară şi să se ia aceeaşi cantitate în lucru ca şi proba de cercetat. În analiza termică se foloseşte o substanţă termică inertă în vederea determinărilor fenomenelor care au loc la încălzirea unui produs solid. Cele mai bune materiale inerte sunt acelea care au aceeaşi conductivitate termică ca şi materialul de cercetat. Pentru temperaturi cuprinse între 100-2200˚C se folosesc termocuple confecţionate dintr-un fir de Pt şi celălalt dintr-un aliaj de Pt cu rodiu. 7. sudaţi la un capăt între ei şi care au proprietatea ca prin încălzire la locul sudurii să dea naştere unui curent electric proporţional cu cantitatea de căldură aplicată. Alegerea substanţei termice inerte este foarte importantă. oricare ar fi materialul folosit. fiecare. Acţiunea atmosferei din cuptor asupra desfăşurării reacţiilor: oricare ar fi procedeul experimental de reglare a presiunii din cuptor. 8.

Clujeană. Fizica Materialelor. N. Analiza termică a mineralelor. Introduction to thermal analysis: techniques and applications. Michael E. Bucureşti. I. Presa Univ. Second edition. teze de doctorat si lucrări ştiinţifice cotate ISI (anexa I). Cluj Napoca.8 mm x h: 1. 2001. cadrelor didactice. masteranzilor. în domeniul maxim de temperatură 23ºC (sau temp.. cercetătorilor din UBB sau din Universităţi. 1972. V. camerei) până la 600ºC. Bibliografie 1.N. Brown. obţinute prin măsurători efectuate la ICIBNS se regăsesc în o serie de lucrări de licenţă. O baie de azot lichid permite determinări la temperaturi scăzute (de la -150ºC). Accesul la aceste aparate este deschis tuturor studenţilor. 274 .aluminiu Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min fiecare (având dimensiunile Ø: 5. 2. doctoranzilor. Jumate. Ed. Ed. Todor D. Kluwer Academic Publishers. dizertaţie . Rata de încălzire a cuptorului este de 5-10ºC/min (uzual). 2001.Metode Experimentale.5 mm). 3. Tehnică. Chicinaş.Pop. Centre de Cercetare partenere. Informaţii importante privind proprietăţile termice ale unor materiale.

.Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială......................... care prezintă pe abscisă timpul sau temperatura iar pe ordonată diferenţa de temperatura probă-referinţă (la DTA) sau diferenţa de flux termic (la DSC).. Raluca Ciceo-Lucăcel Cuprins 1............. 285 1.... În cele ce urmează sunt prezentaţi paşii necesari efectuării măsurătorilor DTA/TG şi DSC....... 279 3. camerei – 1500ºC • Acurateţea balanţei: ± 1% • Detectorii: termocuplu de Pt plus 10% Pt/Rh 275 .......................... dr...................... concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă.......................... Cluj Napoca.. Ghid de interpretare a măsurătorilor DTA/TG si DSC Conf.......... 275 2........... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială................. raportat la cele două aparate de măsura existente în cadrul Institutului de Cercetări Interdisciplinare în Bio-Nano-Ştiinţe......... Analiza termică diferenţială simultan (DTA/TG) – aparat Shimadzu tip DTG-60/60H cu termogravimetria Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp...... în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic......... Ghid de interpretare a măsurătorilor DTA/TG şi DSC . ca principiu....... Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme...... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială Metodele termice diferenţiale constau............................... Bibliografie ............

Se deschide cuptorul apăsând pe tasta [OPEN/CLOSE] de pe afişajul digital al aparatului. 4. 3. • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min. 7. Se aşteaptă un timp pentru stabilizarea semnalului.8 mm x h 2. Se apasă o dată pe tasta [DISPLAY] când ecranul digital al aparatului afişajează valoarea masei.0ºC/min pe un domeniu de temperatură de la temperatura camerei (minim) până la 1500 ºC (maxim). 5. Se pregătesc două creuzete curate: unul pentru proba de referinţă (α-alumina) altul pentru proba de analizat. 6.5 mm). Se deschid recipientele de gaze pentru a asigura atmosfera în cuptor. • Rata de încălzire a cuptorului: 0. apoi se apasă tasta [ZERO] pentru aducerea la valoarea zero a balanţei. 8. 1 g Paşi în efectuarea unei măsurători DTA: 1. Se deschide cuptorul apăsând tasta [OPEN/CLOSE]. Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor.1÷50. • Cantitatea de probă folosită: max. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. Se apasă tasta [OPEN/CLOSE] de pe afişajul digital al aparatului pentru a închide cuptorul. iar creuzetul gol pe suportul din partea dreaptă.• • • Interval măsurabil semnal DTA: ± 1 la ± 1000 µV Nivel de zgomot: < 1µV Materialul de referinţă (α-alumina) şi proba de analizat se pun în cellule standard din alumină (având dimensiunile Ø 5. se ia creuzetul 276 . 2.

Se deschide programul de analiză al aparatului. dar şi la un sistem de gaz care asigură evacuarea elementelor volatile. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP]. ca şi greutatea probei. apoi se pune din nou creuzetul pe suportul de probă. Analiza datelor (pierderi de masă. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters].gol de pe suport şi se pune în el o cantitate optimă de probă. Pornirea măsurătorii se face cu butonul [Start]. existând posibilitatea salvării datelor înregistrate până în acel moment. Valoarea afişată după stabilizarea semnalului TG reprezintă masa de probă. fişierul de analiză fiind salvat automat în directorul specificat. Se închide cuptorul. 9. care se aduce la zero prin apăsarea tastei [ZERO]. Oprirea măsurătorii se face în condiţii normale. Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp. identificare temperaturi evenimente termice etc. • Interval măsurabil semnal DSC: ± 40 mW • Nivel de zgomot flux de căldură: < 1µW 277 . unde se poate alege numele fişierului şi directorul unde va fi salvat. 10. Aparatul este conectat la un sistem de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare. Se apasă de două ori pe tasta [DISPLAY]. 13. ecranul digital al aparatului afişează valoarea semnalului DTA. 11. 12. asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). Analiza calorimetrică (DSC) – calorimetru diferenţial Shimadzu tip DSC-60.) se poate face din programul de analiză TA60 care permite asemenea prelucrări ale termogramelor ca şi convertirea şi salvarea datelor în format text pentru prelucrări ulterioare în alte tipuri de programe de prelucrare date. camerei – 500ºC sau minus 150ºC – 500ºC când se foloseşte baia de azot lichid.

Se apasă tasta [ZERO] pentru aducerea la valoarea zero a semnalului. şi la sistemul de gaz care asigură evacuarea elementelor volatile. 278 . 5. iar creuzetul gol pe suportul din partea dreaptă. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor. Paşi în efectuarea unei măsurători DSC: 1. cântărită în prealabil pe o balanţă digitală. 6.5 mm). Într-un creuzet se pune o cantitate de referinţă (α-alumina). Se deschid recipientele de gaze pentru a asigura formarea atmosferei în cuptor. asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). • Rata de încălzire a cuptorului: 1 ÷ 50 ºC/min. Se apasă o dată pe tasta [DISPLAY]. 4. iar în celălalt creuzet se pune proba. 2. Se pregătesc două creuzete curate.8 mm x h 1. Se deschide programul de analiză al aparatului. ecranul digital al aparatului afişează valoarea semnalului DSC. • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min.• Materialul de referinţă (α-alumina) şi proba de analizat se pun în celule standard din aluminiu (având dimensiunile Ø 5. • Proba: substanţe în formă solidă sau lichidă la temperatura camerei. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. 3. Şi acest aparat este conectat la sistemul de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare.

În mod identic cu datele obţinute de la analiza DTATG. rearanjarea atomic este un proces exotermic. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. unde se poate alege numele fişierului şi directorul unde va fi salvat. • căldurile de topire. • cinetica reacţiilor şi a formării fazelor. datele salvate într-o măsurătoare DSC pot fi analizate cu programul TA60. călduri specifice. Pornirea măsurătorii se face cu butonul [Start]. fişierul de analiză fiind salvat automat în directorul specificat. • capacităţi calorice. existând posibilitatea salvării datelor înregistrate până în acel moment. hidratarea-dehidratarea etc. • temperaturile caracteristice ale transformărilor de fază. mai jos fiind prezentate câteva exemple semnificative cu scopul de a oferi o imagine cât mai exactă a modului de intepretare a datelor furnizate de metodele termice diferenţiale: 279 . • oxidarea. de-vitrificare etc. fierbere. 8. fenomenele fizice şi chimice.. sublimare. • coroziunea metalelor în diferite atmosfere. • puritatea şi compatibilitatea materialelor. cristalizare. reducerea. • tranziţii vitroase ale solidelor ne-cristaline. iar proba eliberează mai multă căldură decât în referinţa. Modificări subtile ale semnalului DTA pot indica prezenţa unui peak exotermic asociat cu o separare de faze. de reacţie etc. Ghid de interpretare a măsurătorilor DTA/TG şi DSC La modul general... 2.7. Când probele cristalizează. descompunerea. În cadrul laboratorului de analize termice de la Institutul de Cercetare Interdisciplinară în Bio-Nano-Ştiinţe au fost abordate o parte din aceste tipuri de măsurători. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP]. Oprirea măsurătorii se face în condiţii normale. ca şi greutatea probei. cristalizare. • cristalizarea sticlelor metalice etc.

00 260 100 200 Temp [C] 300 Semnalul DTA prezintă patru peak-uri endoterme: • Tendo = 58ºC.7ºC.37 C 10.38% Weight Loss -52% -52. pierdere de masă de ~ 52%→ suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3.094 % 20.00 6.5 TGA mg 12. identificate prin analiza XRD după un tratament termic la 500ºC.8 169. 280 .00 274. fără pierdere de masă → transformare structurală a NH4NO3 format în probă din precursorii azotaţi şi hidroxidul de amoniu introdus pentru cataliza bazică a hidrolizei din procesul sol-gel • Tendo = 169.382% -1.00 274.00 DTA uV -1. fără pierdere de masă → topirea NH4NO3 • Tendo = 260ºC. fără pierdere de masă → începutul procesului de cristalizare a fazelor magnetit şi hematit.00 132 57. • Tendo = 132ºC.1.4 10.7 -10.00 -20.00 0. Analiza DTA/TG a unui sistem aluminosilicatic cu Fe60SiO2·20Al2O3·20Fe2O3 preparată prin metoda sol-gel la pH 8. • Texo = 274. eliminarea altor reziduuri volatile din probă.4ºC.38% → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei. pierdere de masă în TG ~ 1.00 8.

indicând faptul că prezenţa în matrice a unei cantităţi mai mari de Fe influenţează schimburile energetice şi cauzează întârzierea producerii anumitor evenimente termice în probă.2. 15. Analiza DSC a unor sisteme aluminosilicatice cu Fe(80-x)[SiO2]· 20Al2O3· x[Fe2O3].4ºC → eliminarea apei rezultate din reacţia hidroxidului de amoniu (introdus în soluţie pentru obţinerea unui pH de 8.6 0 100 200 300 Temp [C] 400 500 Semnalele DSC ale probelor prezintă cinci peak-uri endoterme: • Tendo = 54ºC şi 56ºC → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei. Linia semnalului DSC pentru cele 2 probe ce conţin Fe este aceeaşi.4 56 129 171 221 241. 281 .7ºC şi 171ºC → topirea NH4NO3 • Tendo = 221ºC şi 241ºC → suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3. HNO3. prin metoda sol-gel. eliminarea altor reziduuri volatile din probă. DSC mW x=0 129 230 93 128.5. 20.5) cu acidul azotic. diferind doar temperaturile la care au loc evenimentele (în special cele două evenimente care indică descompunerea. la pH 8.6 169. • Tendo = 93. cele pentru 20% Fe fiind deplasate mai sus cu câteva grade.7 x=15 55 x=20 93. x = 0. rezultat din precursorul folosit pentru Al [Al(NO3)3·9H2O]: • NH4OH + HNO3 → NH4NO3 + H2O • Tendo = 128ºC şi 129ºC → transformare structurală a NH4NO3 • Tendo = 169. respectiv topirea NH4NO3).

care corespunde unui proces tipic de dehidratare prin dehidroxilarea caolinitului cu producerea fazei dezordonate metakaolinit. corespunzător unei tranziţii structurale de stare solidă. Analiza DTA/TG a unei argile minerale cu structură majoritară de caolinit TGA mg 8.3% în intervalul de temperatură 30-109ºC corespunde dehidratării probei prin pierderea apei adsorbite la suprafaţa probei. semnalul DTA etalează un peak exoterm (cu maximul la 993.00 7.4ºC).765% 993.50 0 500 Temp [C] 1000 • Pierderea iniţială de masă de ~0. Si3Al4O12.00 6.5 ºC (unde apare peak-ul exoterm îngust) într-o fază aluminiu-siliciu spinel. fără pierdere de masă în TG. • În intervalul de temperatură 354–660ºC se observă un peak endoterm foarte larg.3.353% -14. Faza dezordonată de metakaolin. Dar pierderi continue de hidroxil sunt observate până la 900°C (~0. • În intervalul 977 ºC – 1007 ºC.50 1046 0.4 10. o conversie structurală a metakaolinitului în altă stare polimorfă aluminosilicatică.00 DTA uV -0.5%) şi pot fi atribuite deprotonării graduale prin oxolare a metakaolinitului.542% -20. care este considerată o structură tip γ-alumină [1]: 2 Al2Si2O7 –> Si3Al4O12 + SiO2 282 . având un maxim la 505ºC şi însoţit de o pierdere de masă de ~14 % din totalul masei probei. Al2Si2O7.00 7. Al2Si2O7.00 505 -0. se transformă la temperatura la 995.00 -10.

00 Temp [C] 600.00 1000.90C -13.00 -12.00 Temp [C] 600.18C HA+50%Fe .00 0.00 85 84.00 4.5 491 491.00 10.00 Semnalul DTA prezintă două peak-uri endotermice clare: • la 83.838% 50.00 800.530% 8.00 400.32C -6.026% 15.00 0.00 DTA uV 20.554% 507 507.00 5.00 6.00 -10.00 10.00 445.00 -8.68C -30.94C 445 7.00 -13.00 DTA uV 371 371.00 400. cu pierdere de masă – descompunerea termică propriu-zisă în TCP (fosfat tricalcic) şi TTCP ( fosfat tetracalcic): Ca 10 ( PO 4 ) 6 ( OH ) 2 → 2 Ca 3 ( PO 4 ) 2 + Ca 4 P2 O 9 + H 2 O gas 5. Analiza DTA/TG a două probe de hidroxiapatită (cu 30%Fe şi 50%Fe) – tratate termic la 450º C TGA mg -12.00 -22.786% 20.00 83.00 283 .907% -20.t HA+30%Fe-t 0. Analiza DTA/TG a unei probe de corn de cerb deproteinată TGA mg 9.ºC şi 100ºC.00 100 200.4. cu pierderi de masă în TG – dehidroxilare • la 491 ºC şi la 507 ºC.00 200.00 -50.417% 5.

• un eveniment exoterm de intensitate mare în intervalul de temperatură 350–500ºC. eveniment dependent şi de gradul de hidratare al materialului.Procedeul de deproteinare a probei a constat în degresare în acetonă timp de 48 h şi cu eter etilic timp de 30 min. Aceste evenimente pot corespunde degradării şi respectiv arderii matricii organice a osului însoţită de volatilizarea compuşilor gazoşi rezultaţi din acest proces.3.4] 6. eveniment care ar corespunde denaturării structurii triplu helix a colagenului din matricea osoasă. Analiza DTA/TG a unor materiale compozite polimer-sticle[5] Semnalele TG prezintă patru trepte de pierdere de masă: • I – intervalul de temperatură 20-400°C – volatilizarea apei de pe suprafaţa probelor 284 .[2. însoţite de pierderi de masă considerabile. dar şi eliminării apei libere ataşate în matricea de hidroxiapatită. format din două peak-uri cu maximele la 371ºC şi la 446ºC. apoi uscare în cuptor la 40ºC până la îndepărtarea completă a solventului. Semnalul DTA etalează trei evenimente termice: • un peak endoterm având maximul la 85ºC. asociat cu o scădere a masei probei în curba TG (pe intervalul 50ºC–150ºC).

Bibliografie 1. Gualtieri.. A. Radu. 2 (2009). V. No. Lozano. Journal of Materials Science 38 (2003) 4777-4782 M. Chem. M. Part I: kaolinite dehydroxylation. Bellotto. I. Phys. 958-960.. V. Ma.. A. and Clark. Coman. Javadpour.F. Artioli. 4 (2008). Prejmerean. Minerals 22. J. intensitatea acestor peak-uri poate fi legată de efectul interacţiunii mutuale dintre produşii de hidratare cu polimerul utilizat în sinteză. Journal of Optoelectronics and Advanced Materials. Velazquez. A. III – intervalul de temperatură 500-800°C curba DTA prezintă la T ~ 740 °C un peak endotermic pronunţat care poate fi atribuit unui proces de disociere fără pierdere de masă IV – la aproximativ 810-830 °C apare un peak exotermic mic. A. 4. Thermoanalytical characterisation of new dental ionomer biocomposites. Heredia. Javidi. Bucio. 1995. S. L. Ocotlan-Flores. vol. Simon. cel mai probabil datorat formării unei faze cristaline în structura compozitelor.E. Gomez-Cortes. Colceriu. 207-214 . T. L. S. Acesta este. no. Tămăşan. Băciuţ. Vol. 10. J. 5. L. 11. S. acompaniat de o pierdere de masă. Pena-Rico. 4 (2009). 3. V. No. Pe de altă parte. Bahrololoom. Simon. Characterisation of natural hydroxyapatite extracted from bovine cortical bone ash. 10. C. 129-138. Thermal kinetics analysis of bone tissue organic phase. Simon. M. R. 479-483. M. M.. C. 285 . 2. Tamas. Silaghi-Dumitrescu. Vol. Kinetic study of the kaolinite-mullite reaction sequence.• • • II – intervalul de temperatură 400-500°C – însoţită în DTA de un peak exoterm cu maximul la ~T = 450ºC – o reacţie de dehidroxilare aferentă restructurării reţelei polimerice a compozitelor. M. Menţionăm că toate aceste măsurători au fost publicate şi/sau prezentate în cadrul unor conferinţe naţionale/internaţionale de specialitate. Belio. Journal of Ceramic Processing Research. Journal of Optoelectronics and Advanced Materials.A. G.A. Thermal Analysis study of human bone.M. 3.

....3..................................297 2...........299 2.............................. Metode bazate pe analiza Rietveld ..........4........... Analiza cantitativă de faze ......292 2...........................300 3.................................. Metoda Warren-Averbach........ DIFRACTOMETRUL DE RAZE X Difracţie de raze X pe pulberi C. Metode bazate pe utilizarea de standarde ..........................................294 2....................2...289 2.........VIII...........................................3............ Aplicarea unor procedee de calcul pe monocristale la pulberi .................... Această tensiune se aplică între catodul şi anodul tubului de raze X.....................1..................................... Bibliografie .... Metoda bazată pe analiza Rietveld .....................4..........289 2.....................................................................1......... Metoda de căutare în spaţiul direct............................... Rafinarea Pawley sau Le Bail ...................3.....1...292 2...................3.......2.4.....303 1............................................................. dr............2..................... Metoda Scherrer ........................4.........4.........3............ Gheorghe Borodi Cuprins 1...........293 2................S................................................... Analiza microstructurală..................... Rafinarea structurilor cristaline prin metoda Rietveld .294 2.................. Principiul de funcţionare a unui difractometru de raze X este următorul: Cu ajutorul unui generator de înaltă tensiune se obţine tensiune de ordinul zecilor de kV................ Principiul metodei ..........3..2.............292 2..2........... Principiul metodei Difracţia de raze X este una dintre metodele cele mai utilizate pentru investigarea compuşilor în faza solidă cristalină.1.........4....... Analiza calitativă de faze cristaline ................................................302 4........296 2................................................ Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente ...............4................................3..............295 2.......................286 2................................................290 2............I.....2............... Indexarea Difractogramelor ................................................................. 286 ......................................... Informaţiile care se obţin din difracţia de raze X pe pulberi .................1......................... Determinarea structurii cristaline din pulberi ...............................2...........................290 2.....

Catodul tubului de raze X este alcătuit dintr-un filament care este de asemenea alimentat la o sursă de joasă tensiune şi care face ca filamentul să emită electroni. l) dacă cel mai apropiat plan cristalografic faţă de origine intersectează axele cristalografice la distanţele: a/h. Astfel. Cu are lungimea de undă intermediară şi este cel mai utilizat. iar liniile caracteristice pentru Cr si Co au lungimi de undă mari. Co. În celula elementară se pot construi diverse seturi de plane cristalografice fiecare set fiind caracterizat prin indicii Miller corespunzători. Fe. Cea mai uzuală interpretare este difracţia Bragg pe planele cristalografice. Spectrul continuu nu depinde de natura anodului în schimb spectru caracteristic depinde de anodul folosit. Proba este aşezată pe un suport plan. Cr. b/k. Liniile caracteristice pentru elementele grele cum sunt Mo şi Ag au lungimi de undă mică. Ag etc. Electronii respectivi sunt acceleraţi între catodul şi anodul tubului. Electronii care lovesc anodul fac să se emită radiaţii X sub forma unui spectru continuu şi a unui spectru caracteristic. Dintre lungimile de undă emise de un tub de raze X cea mai intensă este radiaţia K α . dar există şi alte tipuri de montaje experimentale. c/l. detectorul se roteşte cu un unghi dublu în aşa fel încât tot timpul unghiul de incidenţă este egal cu unghiul de reflexie. Radiaţia X emisă de tubul de raze X intră într-un goniometru. Difracţia razelor X se poate explica în mai multe feluri. trece printr-un sistem de fante care sunt montate pe goniometru după care radiaţiile X ajung la detector unde este înregistrată. Pentru aplicaţiile practice de difracţie pe pulberi este necesar să folosim o radiaţie cât mai monocromatică. k. Monocromatizarea radiaţiei X se face cu ajutorul filtrelor de raze X sau cu ajutorul monocromatoarelor de raze X. un anumit grup spaţial şi un mod de aranjare a atomilor în celula elementară. unghiul dintre radiaţia incidentă şi probă este egal cu unghiul dintre radiaţia difractată şi planul probei. În timp ce proba se roteşte cu un anumit unghi. Acest lucru se realizează în cazul montajului θ . Orice compus cristalin cristalizează într-un anumit sistem cristalografic cu parametrii de reţea bine precizaţi. Anozii tuburilor de raze sunt din următoarele materiale: Cu. un set de plane cristalografice echidistante are indicii Miller (h. Mo. 2 θ . Se poate considera difracţia pe astfel de plane cristalografice după cum este arătat în figura următoare: 287 .

de parametrii celulei elementare şi de indicii Miller. iar în cazul acesta. De aici rezultă că poziţiile maximelor de difracţie depind exclusiv de tipul reţelei cristaline şi de parametrii celulei elementare. Dar orice sarcină care oscilează produce la rândul ei unde electromagnetice. Vibraţiile vectorului câmpului electric produc oscilaţii ale electronilor atomilor. Dacă radiaţia X cade pe probă. pentru sistemul ortorombic avem 1/d2 = h2/a2 + k2/b2 + l2/c2. Să vedem în continuare de cine depind intensităţile de difracţie. Radiaţia X constă din unde electromagnetice în care componenta vectorului câmp electric şi magnetic oscilează perpendicular pe direcţia de propagare a undei. Expresia factorului de structură este dată de relaţia: Fhkl= ∑ fj exp π 2 i(hxj+kj+lzj) (2) Intensităţile de difracţie sunt proporţionale cu pătratul factorilor de structură. θ unghiul de difracţie. Intensitatea radiaţiei X împrăştiate de către un singur atom este caracterizată prin factorul de împrăştiere atomic. iar rezultanta este dată de factorul de structură. De aici se observă că fiecare set de plane cristalografice corespunde unui anumit unghi de difracţie.Condiţia de difracţie este dată de relaţia: 2dsin θ = λ (1) unde d este distanţa interplanară. intensităţile de difracţie vor depinde de natura şi 288 . Aceste unde electromagnetice produse de atomii din celula elementară se suprapun şi se compun. De exemplu. Dependenţa intensităţii factorilor de împrăştiere de sin θ / λ este dată în tabelele internaţionale sub forma unor relaţii empirice. Factorii de împrăştiere atomici scad cu unghiul de împrăştiere. radiaţii X. iar λ lungimea de undă. Distanţa interplanară este determinată de sistemul cristalografic. atunci fiecare atom din celula elementară împrăştie radiaţiile incidente. Prin urmare. Factorii de împrăştiere atomici depind de numărul de electroni din componenta atomului dat. Pentru alte sisteme cristalografice avem alte formule de calcul a distanţelor interplanare.

1. Acesta rezultă din aceea că pot să existe mai multe plane cristalografice care să producă difracţie la acelaşi unghi θ . iar Fhkl este factorul de structură. numărul de cristalite care participă la difracţie este foarte mic. 2. Probele se pun de obicei pe suporturi plane. De aceea.poziţia atomilor în celula elementară. În felul acesta intensitatea de difracţie corespunzătoare unui set de plane cristalografice este dată de relaţia: Ihkl=K·m·Lp·A·T·I·Fhkl·I2 (4) În această relaţie s-a introdus şi m care este factorul de multiplicitate. Vcr. dar acestea necesită o abordare mai laborioasă şi timp mai mult. Analiza calitativă de faze cristaline Analiza cantitativă de compuşi chimici în faza solidă se poate face prin metode chimice. iar intensităţile de difracţie de poziţiile atomilor în celula elementară.(e2/mc2)2·Vcr·I0·Lp·A·T·I·FhklI2 unde (3) λ este lungimea de undă ω viteza unghiulară cu care se roteşte monocristalul V volumul celulei elementare I0 intensitatea fasciculului incident Lp este factorul Lorentz-polarizare A factorul de absorbţie T factorul de temperatură. I0 sunt constante pentru un experiment de difracţie. 289 . Deoarece în general λ . V. iar (e2/mc2) sunt constante universale. Vom obţine difracţie numai de la planele cristalografice care sunt paralele cu suprafaţa suportului de probă. Informaţiile care se obţin din difracţia de raze X pe pulberi 2. m masa acestuia. ω . poziţiile maximelor de difracţie depind de celula elementară. În concluzie. Intensităţile de difracţie depind şi de alţi factori. e fiind sarcina electronului. iar c viteza luminii. toate acestea se pot grupa împreună sub forma unei constante notată cu K. Pulberile constau din foarte multe cristalite mici de ordinul zecilor până la ordinul miilor de Å orientate haotic unele în raport cu altele. Astfel se demonstrează că intensitatea radiaţiei difractate de către un mic monocristal care se roteşte cu viteza unghiulară ω este dată de relaţia [1] : Ihkl = ( λ 3/ ω V2).

Metode bazate pe utilizarea de standarde Între intensităţile de difracţie şi fracţia în greutate Wα. iar atomii compusului se plasează în anumite poziţii în celula elementară. 2. Difracţia de raze X pe pulberi deosebeşte cu uşurinţă diferite forme polimorfice ale unui anumit compus. are parametrii de reţea bine determinaţi sau care variază într-un interval relativ mic. Analiza de faze cristaline se bazează pe compararea difractogramei de raze X experimentală cu difractogramele care se găsesc în bazele de date. Se ştie că acelaşi compus chimic poate să se prezinte în diferite forme polimorfice sau. Identificarea fazelor cristaline se bazează pe următoarele considerente: fiecare fază cristalină aparţine unui anumit sistem cristalografic. Analiza cantitativă de faze În foarte multe cazuri. analiza calitativă de produşi chimici cristalini se face în cea mai mare măsură prin difracţie de raze X pe pulberi. 2. aparţine unui anumit grup spaţial. Obţinerea componentei procentuale a fazelor dintr-un amestec se poate face atât prin metode chimice. ne interesează compoziţia procentuală a fiecărei faze din amestec. Compararea difractogramei experimentale cu cele din catalog se face utilizând bazele de date. atunci putem să simulăm difractograma acelui compus şi să o comparăm cu difractograma experimentală. în diferite faze cristaline. Aceasta face ca fiecare fază cristalină să aibă intensităţile de difracţie şi unghiurile la care apar aceste intensităţi bine determinate. difractograma rezultată va fi o suprapunere a difractogramelor individuale. Deci. cu luarea în considerare a coeficienţilor de absorbţie a fazelor componente.2. Dacă avem la dispoziţie baza de date CSD sau o altă bază de date.2. Analiza cantitativă de faze se bazează pe faptul că fiecare fază cristalină produce propria difractogramă. cum se mai spune.1. deoarece proprietăţile fizico-chimice depind de compoziţia procentuală. cât şi prin difracţie de raze X. când avem un amestec de faze cristaline. din analiza de faze putem să identificăm o anumită fază numai dacă aceasta a fost catalogată în prealabil. iar dacă avem mai multe faze. în special PDF-2. În anumite cazuri difracţia de raze X pe pulberi cristaline poate să fie o metodă rapidă şi eficientă. PDF-4.În prezent. care ne dă datele cristalografice complete pentru compuşii care ne interesează. pentru o anumită fază α există relaţia: 290 .

I jsWd Fracţia Wα pentru faza necunoscută se determină în funcţie de fracţia Ws pentru proba standard. O altă metodă este aceea a raportului intensităţii de referinţă (RIR) (Reference Intensity Ratio). şi de raportul dintre intensitatea liniei i a probei de analizat şi intensitatea liniei j a probei standard după relaţia: Wα = I iα W s I js RIRαs (8) 291 . Se defineşte RIRαs = I isWs . Ca standard extern se alege în general corundum.I iα = C i α Wα x ρα μ m (5) unde Ciα este o constantă pentru reflexie (sau un grup de reflexii) i a fazei α. măsurarea lui Iiα şi estimarea lui μ m O altă metodă este aceea a standardului intern care presupune includerea unui standard intern în proba de compoziţie procentuală cunoscută Ws. iar μ m este coeficientul de absorbţie masic pentru întreaga probă [2]. standard (ii). Intensitatea de reflexie Ijs este dată de relaţia: I js = C js Ws x ρsμm (6) Împărţind cele două relaţii rezultă: is Wα = K α sWs I iα I js (7) ij unde K α s = C js ρα Ciα ρ s ij poate fi determinat făcând un amestec cunoscut de fază standard şi Kα s fază de analizat. Pentru aplicarea acestei relaţii este necesară (i) determinarea constantei Ciα prin prepararea de standarde cu compoziţie procentuală a fazei α bine x a probelor determinată şi estimarea coeficientului de absorbţie masic μ m x pentru probe necunoscute. x ρα este densitatea fazei α.

Erorile sunt cu atât mai mici cu cât dimensiunea particulelor este mai mică şi cu cât coeficienţii de absorbţie vor fi mai mici. Se filtrează toţi parametrii de care depinde intensitatea de difracţie. β este lărgimea liniilor de difracţie 292 . Metoda Scherrer Scherrer a arătat pentru prima dată că dimensiunile cristalitelor sunt legate de lărgimea de difracţie prin relaţia [2]: D= Kλ β cos θ (9) D este dimensiunea microcristalitelor. Analiza microstructurală Analiza microstructurală include determinarea dimensiunilor microcristalitelor şi eventual distribuţia acestora după dimensiune. Într-o particulă pot să existe mai multe cristalite (monocristale) orientate diferit între ele. numite cristalite. microabsorbţia. Dacă reţeaua este mai deformată sau dacă avem mai multe defecte. inclusiv procentul de fază necunoscută.2. Reducerea coeficienţilor de absorbţie se poate face prin utilizarea tuburilor de raze X cu lungime de undă mai mică. Intensităţile de reflexie pentru probele cu coeficient mai mare de absorbţie vor fi mai intense. Dar la lărgimea liniilor de difracţie contribuie şi deformările reţelei cristaline şi probabilităţile de defecte.2. liniile de difracţie de asemenea se lărgesc.1. Dacă dimensiunile cristalitelor sunt sub 20 Å. a deformării reţelei cristaline şi a probabilităţilor de defecte. 2. Cu cât dimensiunile cristalitelor sunt mai mici cu atât liniile de difracţie sunt mai largi. se consideră că compusul respectiv este sub formă amorfă. orientarea preferenţială a cristalitelor. Metoda bazată pe analiza Rietveld Analiza cantitativă de faze se poate face şi cu analiza Rietveld [3]. Factorii care limitează precizia analizei de fază sunt: dimensiunea diferită pentru particulele aparţinând la diferite faze de analizat. distribuite haotic unele în raport cu altele.3. 2.3. Se ştie că pulberile cristaline sunt formate din mici monocristale. din analiza Rietveld rezultă fracţia de faze din probă. Dimensiunile acestor cristalite sunt de ordinul zecilor până la ordinul miilor de Å. Astfel. Trebuie menţionat că dimensiunile particulelor sunt diferite de dimensiunile cristalitelor.2.

293 . Precizia legată de determinarea dimensiunilor cristalitelor scade odată cu creşterea acestora.9λ + 4ε sinθ D (10) în cazul în care profilul liniei de difracţie este de tip Lorentz.3. Lărgimea instrumentală se obţine din lărgimea de difracţie experimentală astfel: β = B-b. Lărgimea liniilor de difracţie creşte cu unghiul. unde ε este un parametru care reflectă deformaţia reţelei cristaline şi reprezintă deplasarea medie a atomilor faţă de poziţia de echilibru. Ca măsură a lărgimii liniilor de difracţie se consideră lărgimea la semiînălţime.89. În această relaţie B este lărgimea de difracţie măsurată. dacă profilul de difracţie este o funcţie de tip Lorentz şi β2 = B2 –b2. iar b este lărgimea de difracţie instrumentală. care se defineşte ca fiind aria maximului de difracţie împărţită la intensitatea maximă pentru maximul respectiv. deoarece cu cât dimensiunile sunt mai mari lărgimea liniilor de difracţie se apropie de lărgimea instrumentală şi depinde foarte mult cât de corect am ales lărgimea instrumentală. precum şi de alţi factori. Dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată dimensiunilor cristalitelor este diferită de dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată deformării reţelei cristaline.corectată de lărgimea instrumentală. dacă profilul de difracţie este o funcţie de tip Gauss. iar θ este unghiul de difracţie.2. Pentru a obţine b. până la 1000Ǻ. K este o constantă care depinde de modul cum se defineşte dimensiunea D. dacă aceasta se defineşte ca fiind dimensiunea liniară sau rădăcina de ordinul 3 din volum. se foloseşte o probă foarte bine cristalizată şi se măsoară lărgimea maximelor de difracţie pentru unghiurile de difracţie apropiate cu cele ale probei de măsurat. Metoda Warren-Averbach Am amintit că lărgimea liniilor de difracţie scade atât cu scăderea cristalitelor cât şi cu creşterea deformaţiilor reţelei cristaline. Domeniul pe care precizia determinării dimensiunilor cristalitelor se consideră acceptabilă este de la aproximativ 20Å. Astfel avem relaţia: β cosθ = 0. Cea mai utilizată valoare a lui K = 0. 2. Unii autori iau ca lărgime a liniilor de difracţie lărgimea integrală.

Numărul intensităţilor de difracţie care se pot obţine din pulberi cristaline este de ordinul zecilor. 2. U.4.3. rezultă dimensiunile cristalitelor şi deformările reţelei. dar poate ajunge şi până la 200. unde ΓL este lărgimea la semiînălţime. Determinarea structurii cristaline din pulberi Determinarea structurii cristaline se face în general din datele de difracţie obţinute din monocristale. V. 2. atunci avem relaţia: β 2 cos 2 θ = λ2 D2 + 16ε 2 sin 2 θ (11) Din reprezentarea grafică a lui β2cos2θ. dacă considerăm diferite linii de difracţie. În continuare dimensiunile cristalitelor şi deformaţiile reţelei se calculează în funcţie de aceşti parametrii. De aici putem să determinăm ε şi D.Reprezentând grafic βcosθ în funcţie de sinθ.9λ . Metode bazate pe analiza Rietveld O altă modalitate de determinare a dimensiunilor cristalitelor şi a deformării reţelei cristaline se poate face prin analiza [4] Rietveld. Pentru un profil de tip Gauss avem: ΓG = Utg 2θ + Vtgθ + W + P cosθ (13) Din fitarea Rietveld rezulta X. iar panta D dreptei reprezintă 4ε.3. Se obţin mai puţine intensităţi de difracţie deoarece liniile de difracţie pot să se suprapună şi de ase294 . Conform formulei lui Caglioti. ar trebui să obţinem o dreaptă. lărgimea la semiînălţime depinde de unghiul θ. Numărul intensităţilor de difracţie care se pot obţine din difracţia pe monocristale este de ordinul zecilor de mii. Dimensiunile cristalitelor se mai pot determina şi din analiza Fourier a liniilor de difracţie. Y. Dacă profilul liniilor de difracţie este de tip Gauss. iar X si Y parametrii de fit. Ordonată la origine pentru această dreaptă reprezintă 0. astfel: ΓL = X + Y tgθ cosθ (12) pentru un profil de tip Lorentz. în funcţie de sin2θ. W si P.

c şi unghiurile dintre ele α. De asemenea. unele maxime de difracţie se suprapun în cazul pulberilor. Din reflexiile interzise se pot atribui grupurile spaţiale cele mai probabile. În funcţie de a. Deoarece numărul de intensităţi de difracţie care se pot colecta din difractograma pe pulberi este mult mai mic decât pentru monocristale. Se ştie că difracţia razelor X pe atomi poate fi privită ca difracţie pe planele cristalografice. c. k. β. Numărul de maxime de difracţie în cazul pulberilor care se observă este foarte mic comparativ cu numărul de maxime de difracţie observate pentru monocristal.4. α.1 Indexarea Difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic în care cristalizează compusul. Parametrii care caracterizează celula elementară se numesc parametrii celulei elementare. a determina parametrii celulei elementare şi a atribui fiecărui maxim de difracţie indicii Miller corespunzători. b. difracţia razelor X poate fi privită ca difracţia de pe planele cristalografice. l este un plan care intersectează axele cristalografice la distanţele a/h. determinarea structurii cristaline este mult mai dificilă pentru pulberi decât pentru monocristale. β. Concordanţa dintre poziţiile maximelor de difracţie calculate şi obser295 . γ. b/c si c/l de origine. b. avem şapte sisteme cristalografice. Dar există situaţii când anumiţi compuşi nu se pot cristaliza şi totuşi ne interesează structura lor cristalină. Determinarea structurii cristaline pentru un anumit compus înseamnă determinarea sistemului cristalografic.menea unele intensităţi de difracţie sunt foarte slabe şi nu se pot observa. După cum se ştie. a parametrilor celulei elementare. În acest caz se apelează la determinarea structurii cristaline din pulberi. Etapele principale pentru determinarea structurii cristaline din pulberi sunt: 2. Numărul mai mic de maxime de difracţie observat în cazul pulberilor precum şi suprapunerea unor maxime provenite de la plane cristalografice diferite este motivul pentru care este mult mai dificil de determinat structura cristalină din pulberi faţă de monocristale. Orice compus este caracterizat de o anumită celulă elementară care este un paralelipiped cu muchiile a. Se obţin maxime de difracţie dacă este îndeplinită condiţia lui Bragg: Maximele de difracţie au intensităţi mai mari sau mai mici în funcţie de modul de distribuţie a atomilor în celula elementară. γ. Pentru o anumită celulă elementară putem să definim planele cristalografice. Un plan cristalografic de indicii Miller h. a grupului spaţial şi a poziţiilor atomilor în celula elementară.

Există mai multe metode de indexare dintre care cele mai importante sunt: Metoda Ito[7]. Dacă avem M20 > 10. Rafinarea Pawley sau Le Bail Rafinarea Pawley sau Le Bail este utilizată pentru extragerea intensităţilor de difracţie. rafinarea celulei elementare şi atribuirea grupului spaţial cel mai probabil.4. care este valoarea în θ pentru limita superioară selectată. Există mai multe moduri de definire ale figurilor de merit sau gradului de încredere în indexarea respectivă. N20 este numărul de linii diferite calculate până la linia corespunzătoare lui Q20. Suprapunerea accidentală are loc atât pentru sisteme cu simetrie ridicată. 2. < Δ 2 θ > este abaterea medie dintre liniile de difracţie calculate şi observate. indexarea este probabil corectă. Un alt factor de încredere datorat lui Smith si Snyder [6] se defineşte astfel: FN= N < Δ 2θ > . Suprapunerea reflexiilor este cu atât mai probabilă cu cât celula elementară are volumul mai mare. Cea mai utilizată figură de merit este M20. de Woolf [5]: M 20 = Q 20 2 < Q > N 20 (14) Q20 este valoarea lui Q pentru a 20-a linie de difracţie. Au fost dezvoltate două metode de extragere a intensităţilor de difracţie din pulberi. şi anume: Metoda Le Bail şi metoda propusă de Pawley.N (θg ) (15) unde N( θg ) este numărul de linii de difracţie calculate până la θ g.vate se caracterizează şi prin aşa numite figuri de merit. reflexiile 333 şi 511 pentru sistemul cubic sau 43l şi 50l pentru sistemul tetragonal. Există o suprapunere sistematică a intensităţilor de difracţie şi o suprapunere accidentală.2. iar <Q> este abaterea medie dintre liniile de difracţie calculate şi observate. Una dintre figurile de merit se datorează lui P. De exemplu. dar mai ales pentru sisteme cristalografice cu simetrie joasă şi se datoreşte creşterii numărului de reflexii independente. Suprapunerea exactă a intensităţilor de difracţie are loc mai ales pentru sistemele cristalografice de înaltă simetrie. Metoda Le Bail [11] de extragere a intensi296 . metoda Dicvol [8] X-Cel [9] si metoda Treor [10].M.

Pawley [12] a elaborat o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X fără a avea un model structural. Unii autori [13. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative. Aceasta este o metodă de analiză prin cele mai mici pătrate. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie.3. există şi cazuri când prezintă instabilităţi. Deşi procesul de rafinare este în general stabil. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. mai ales atunci când fondul de difracţie este supraestimat. fragmente din molecule. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială. În timp ce metoda Le Bail este o metodă iterativă. Această metodă nu cere extragerea factorilor de structură din difractogramă. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. 2. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului.4. grupe de atomi aranjaţi într-o anumită configuraţie. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală.4. Deşi metoda este în general robustă. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare.tăţilor de difracţie este inspirată din metoda Rietveld.14] au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură în schimbul intensităţilor de difracţie. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale.5 dintr-un pas de înregistrare a difractogramei.3. Putem să avem atomi.1. Ca intensităţi de pornire se pot considera valorile calculate ale intensităţilor de difracţie. 297 . Obţinerea unui model structural 2. molecule. ca de exemplu. în care mărimile care trebuie determinate sunt intensităţile de difracţie. octaedrii etc. tetraedrii.

în faza iniţială a procesului de căutare a configuraţiei optime se poate uşor trece de la un minim local la un alt minim în scopul determinării minimului absolut. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. când T este foarte mic. atunci se reţine noua configuraţie cu probabilitatea exp(. se consideră funcţia de cost CF. T fiind temperatura distribuţiei. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. În schimbul utilizării unui singur lanţ de configuraţii. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. un alt algoritm a fost dezvoltat. atunci se reţine noua configuraţie. Totuşi. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. Astfel pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. definit în felul următor: Σ i wi ( y Rwp=[ obd i − i y calc i )2 ]1/2 (16) Σ i wi ( y ) 2 obs Dacă funcţia de cost CF este mai mică decât cea precedentă. dintre care amintim: Răcire simulată (simulated annealing). În timpul procesului de căutare temperatura se scade treptat. Fox [16.17]. probabilitatea de a găsi un alt minim este de asemenea mică. şi anume Parallel Tempering (PT) [18]. Funcţia de cost CF se poate alege în diverse moduri.Δ CF/T).Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. Una dintre posibilităţi este să se aleagă ca fiind rezidiul R. dintre care amintim Powder Solve [15]. cu descreşterea temperaturii se aleg de la 298 . se testează potrivirea dintre difractograma calculată şi cea experimentală. eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. o variantă a acesteia numită Parallel tempering şi Tehnica algoritmilor genetici. Pentru moleculele organice. În cazul metodei de răcire simulată se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2 = exp[(CF2-CF1)/T]. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. Dacă CF este mai mare decât cea precedentă. dar în faza finală. Astfel. pentru a evita să cădem într-un minim local.

Determinarea factorului de scală şi a factorului global de temperatură.3. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi.4.început mai multe configuraţii (un număr mic de configuraţii).2. Dacă se fac corecţiile intensităţilor de difracţie. Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley. intervine un factor de scală K care trebuie determinat. În felul acesta. factorul de absorbţie. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat. se obţine modulul factorilor de structură. Deoarece intensităţile de difracţie se măsoară în unităţi arbitrare. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. Cu toate acestea. se determină factorul de scală şi de temperatură. Paşii care trebuie urmaţi sunt: corectarea intensităţilor de difracţie de diverşi factori. factorul de extincţie. Sinteza Fourier şi sinteza Patterson. Dar factorii de structură sunt numere complexe. Cunoscând factorii de struc299 . intensităţile acestora se reduc cu un factor de temperatură. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. până la 3 sau 4 sute.20]. Datorită faptului că atomi oscilează în jurul poziţiilor de echilibru. deci în acest caz factorii de structură sunt numere reale pozitive sau negative. dintre care amintim: Factorul Lorentz. Determinarea fazei factorilor de structură [19. factorul de polarizare. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice aplicate invarianţilor şi semiinvarianţilor. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul zecilor. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. 2. în unele cazuri s-au obţinut rezultate bune. posibilitatea de a se obţine minime locale este mai mică.

Dintre programele de calcul cel mai utilizat este GSAS [22].w)= 1 V h .Rafinarea modelului structural prin metoda celor mai mici pătrate. atunci putem face sinteza Patterson. k . 300 . 2. putem să determinăm densitatea electronică de sarcină în celula elementară cu ajutorul următoarei relaţii: ρ ( x. deoarece nu sunt necesare variaţii mari ale acestor parametrii. Funcţia ce trebuie minimizată este: S y = ∑ wi ( y i − y ci ) 2 i (19) unde: wi . În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim.4. y . există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. z ) = 1 V ∑F hkl hkl exp( −2πi ( hx + ky + lz )) (17) Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât.v. Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară dacă aceştia există. Pe baza densităţii electronice se poate construi un model structural aproximativ.4. k . de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate. unde densitatea electronică este mai mare.l cos( 2π ( hx + ky + lz )) (18) Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi mai ales distanţele dintre atomii grei. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [21].tură.l ∑F 2 h . . În cazul obţinerii modelului structural s-a făcut o căutare globală potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată. după relaţia: P(u. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora.factorul de pondere şi este wi=1/yi. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate.

factorul de temperatură şi coeficienţii polinomului care descriu fondul. Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective.intensitatea observată la pasul i. exprimată prin funcţia lui Caglioti [23]: H 2 = U tan 2 θ + V tanθ + W (20) unde. La început se rafinează factorul de scală. factorii care descriu asimetria liniilor de difracţie etc. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. În ultimele etape. Calitatea rafinării se apreciază pe baza unor indici de rezidiu. În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. deformaţiile de reţea. V. W sunt parametri care se pot rafina. factorul care descrie absorbţia razelor X. Din literatură şi din experienţă proprie am constatat că este necesar să se adopte următoarea strategie. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară.yi . yci . Pentru o difractogramă oricât de perfectă maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale.intensitatea calculată la pasul i. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. şi factorul de polarizare. În general. Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma[24]. fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. mai ales dacă avem un număr mare 301 . Urmează rafinarea deplasării punctului de zero pentru difractogramă. se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. H este lărgimea la semiînălţime şi U. în general trebuie impuse constrângeri. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RP = ∑| y − y ∑y i i ci | (21) 1/ 2 RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ (22) unde wi=1/yi şi se numesc factori de pondere.

Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi. 3. permiţând translaţia şi rotaţia acestora. Totuşi. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu [27]. timpul de înregistrare este suficient să fie 0 2 /minut. Aceasta ar trebui făcută săptămânal. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. Pentru analiza calitativă. Suporţii de probă aduşi de firmă nu au permis analiza unor cantităţi mici de probă. de exemplu C–C. Unităţile glicozidice au fost legate între ele prin constrângeri slabe. în procesul de rafinare a complecşilor de incluziune. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare.de atomi pe celula elementară. de aceea. este necesar ridicarea unei difractograme pentru un etalon de siliciu. C–O pentru legături simple sau duble. aceste distanţe pot să varieze între anumite limite. Modul de aliniere şi calibrarea lunară se găsesc în documentaţia de folosire a difractometrului. Este recomandat ca difractometrul să fie aliniat în fiecare dimineaţă înainte de a începe experimentele. au fost adaptaţi alţi suporţi de probă care să permită difracţie pentru cantităţi foarte mici de probă. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. Pentru o mai mare siguranţă referitoare la punctul de zero al difractometrului. mai este necesară o calibrare mai complectă la fiecare lună. În cazul în care se fac măsurători pentru compuşi anorganici cu 302 . Timpul de înregistrare pentru difractograme şi fantele folosite depind de tipul de măsurători efectuate. Difractometru este prevăzut cu o bază de date pentru efectuarea de analize calitative şi cu software pentru determinarea raportului cristalin-amorf. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei împreună cu atomii de oxigen secundari au fost considerate ca “rigid body”. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain” [25] şi “rigid body“ [26]. De exemplu. dar forma ansamblului să nu se schimbe. De exemplu. Pe lângă aceasta. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente Aparatura de difracţie disponibilă este un difractometru Shimadzu XRD–600 prevăzut cu un monocromator pentru fasciculul difractat.

Cryst. G.L. 3. fantele trebuie să fie cât mai înguste. este indicat să se controleze filtrele pentru apă odată la 3 luni şi. 9. Oxford University Press 2002. Cryst. de Woolff. Appl. 252-255 (1977). Appl. când dorim să vedem efectele structurale de suprafaţă sau când avem probă puţină. R.J. Willey& Sons. Cryst. eventual să se lase aparatul să funcţioneze şi peste noapte. Ed.P. 356-365 (2003). 2. Appl. care poate fi chiar proba cântărită din etalonul de Si. Din punct de vedere tehnic.S. Ed. 108-113 (1968). dacă este cazul. Powder Diffraction Reviews in Mineralogy Vol 20 1989. J. este avantajos utilizarea tubului de Cr. P. Pentru analiza microstructurală nu este necesară înregistrarea difractogramei pe întreg domeniul. să fie curăţate.Bish and J. Cryst. 6.E.W. A. Fundamentals of crystallography. 4. adică timpul de înregistrare să fie în jur de 20 ore. Neumann J.E. 987-993 (1991). Nu este indicată achiziţionarea de tuburi de raze X care să nu se utilizeze deoarece tuburile de raze X se deteriorează în timp. Appl. 2. 5. măsurătorile trebuie să se facă aproximativ între 10 si 800. C. Klug and L. Inc 1974. Boultif. Dinnebier and S. 303 . Dacă se lucrează cu probe care conţin Fe sau Mn este de dorit să se folosească tub de Cr care există în dotarea laboratorului. Pentru analiza cantitativă de faze este indicat să se lucreze cu metoda standardului intern. Post.Louer J. Pentru indexarea compuşilor şi determinarea parametrilor de reţea este indicat să se folosească şi standard intern deoarece în acest caz se poate evalua mai precis punctul de zero al difractometrului şi se pot determina mai exact poziţiile liniilor de difracţie. Snyder J. ci doar înregistrarea maximelor de difracţie care trebuie să se facă cât mai precis.E. chiar dacă acestea nu funcţionează.L. Appl. Eds D. Smith and R. R.S. În cazul în care se încearcă determinarea structurii pentru un nou compus. M. Bibliografie 1. Visser J. D. Powder diffraction. 24. Alexander X-Ray Diffraction Procedures J. Tubul de Cu dă fluorescenţă pentru probele care conţin Fe sau Mn. Cryst. de aceea. De asemenea. timpul de înregistrare trebuie să fie mare. 4.L. H. 10. 7. iar pentru compuşi organici care au celula elementară mai mare între 3 si 450. Billinge. adâncimea de pătrundere a razelor X este mult mai mică în cazul utilizării tubului de Cr.celula elementară mică. 89 (1969). J.M. Giacovazzo. 36. În acest caz. 1.C Publishing 2008. 8.

O. Le Bas.C. 1754-1766 (1999). 110. H. 219. 13. Nowell.E. D. Cerny J. G. G. Crystallogr. 23.A. 84-92 (1999). Direct phasing in crystallography. 20. Coelho J. 367-370 (1985). 24.M. L. Wike. A.S.E. Cryst. Pawley J. Le Bail. V. 33. O. Werner. 65-71 (1969). G.M.Wilke. V. Cryst. 32. 746-757 (1991).Eriksson. 19. Cerny Z.Scardi J. R. 899-908 (2000). J.P. 15. 17.M Rietveld J. D. 12. Appl. Cryst.10. 1169 (1999). Tsoucaris Acta. 35. 87545. Bull. Giacovazzo. 25. M. Fundamentals of crystallography. Ed. F. Appl. Appl. 14. USA. Von Dreele. Von Dreele General Structure Analysis System (GSAS). R. Oxford Science Publications 1999. Leuse.E. Larson & R. 835-840 (2002). 357-361 (1981). J. 23. C. 36-50 (1999). Appl. A. D. Kristallogr. NM.W.D. S. Cole Acta Cryst. K. Mentzafos. Los Alamos National Laboratory.Engel. 32.C. M. Deem J. Favre-Nicolin and R. 16. McCusker. Crystallogr.B. G. Appl. Appl. 18. 847-856 (2004). Crystallogr. 734-743 (2002). Fourquet Mater. Westdahl J. Cryst. F. R.L. P. Engel. Appl. 27.B. Leusen J. Dinnebier Powder Diffraction 14. Falcioni. K. Giacovazzo. 447-452 (1988).B. Favre-Nicolin and R. Res. Appl. Ed. H. 1169-1179 (1999). Louer and P.Harris. Harris. Duroy. The Rietveld Method. Koning. M. 11. Konig. 21.E. B47.E. Mavridis. Cox. 18. Oxford University Press 2002. B B58.J. 14. C. I. J. Cryst. 26. Cryst. Young Oxford University Press (1993). 32. 22. Report LAUR 86-748. G. S. Chem. H. Attfield and J.D. Phys. 304 . 2. L.

........ 307 1.............. 325 Determinarea structurii cristaline este foarte importantă.................. 322 5.......S.................. Câteva metode uzuale de idexare .. Bibliografie .. Metoda de căutare în spaţiul direct ..................... Pentru orice compus nou preparat într-un anumit fel este de dorit să se determine structura cristalină...... 314 3....................................... A determina structura cristalină pentru un anumit compus înseamnă determinarea sistemului cristalografic în care acesta cristalizează.. Algoritmi de indexare . a grupului spaţial şi a poziţiilor atomilor în celula elementară. foarte multe intensităţi de difracţie se suprapun... Obţinerea modelului structural .................................1.................................................. se obţin doar câteva zeci...... 311 2.1... Totuşi.................1.3.. ............. 316 4............ 305 .. iar extragerea acestora este dificilă şi afectată de erori. Indexarea difractogramelor .. În general.................................2.......1.......................................... 311 2............. 319 4..........4]-tiadiazol-2-il0-toluensulfonamida. Determinarea structurii cristaline din pulberi este mai dificilă deoarece................ deoarece proprietăţile materialelor în stare solidă depind de structura cristalină şi moleculară a acestora.............................. 309 2............................................Determinarea structurii cristaline prin difracţie de raze X C.... Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect ..... cât şi în industrie şi tehnologie.......... dr.3..I...... În cazul în care nu se pot obţine monocristale se încearcă determinarea structurii cristaline din pulberi............ 319 4.................................... Rafinarea structurilor cristaline prin metoda Rietveld .......... 311 2.. Aplicarea unor procedee de calcul pe monocristale la pulberi ........ Exemple privind determinarea structurii cristaline din pulberi .......................................................................... Metodele pentru monocristale aplicate la pulberi .................... a parametrilor celulei elementare.............2. Determinarea structurii cristaline se face în principal prin difracţie de raze X......................... Extragerea intensităţilor de difracţie................. în cazul pulberilor................ 306 1...................... Structura cristalină pentru N-(5-etil-[1........... 312 2.................................. atât în diferitele ramuri ale ştiinţei.................. dar de foarte mare ajutor sunt metodele spectroscopice şi de modelare moleculară care pot să furnizeze informaţii structurale deosebit de utile.................1. 307 1..........2.............................2................................................................. Pe lângă aceasta.....................1......................... Gheorghe Borodi Cuprins 1....................... Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina.. structura cristalină se determină din monocristale......... în timp ce la monocristale se pot colecta mii de intensităţi de difracţie........................................

la difracţia pe pulberi se obţin doar câteva zeci de unghiuri de difracţie din care se determină modulul vectorilor corespunzători din reţeaua reciprocă. cât şi direcţia pentru un număr foarte mare de vectori din reţeaua reciprocă. trebuie menţionat că indexarea este cu atât mai dificilă cu cât simetria este mai scăzută. unde se determină atât modulul. dar se alege acea celulă care are volumul cât mai mic şi simetria cât mai mare. Dificultatea indexării provine din faptul că. o celulă elementară se poate defini în mai multe moduri. Deoarece în cadrul ICE există difractometru pentru pulberi ne vom ocupa doar de determinarea structurii cristaline din pulberi cristaline. indexarea ar fi imediată. În general. Vom descrie aceste etape. compuşii care cristalizează în sistemul triclinic. din difractogramele pe pulberi se determină unghiurile de difracţie din care rezultă modulul unui număr limitat de vectori din reţeaua reciprocă din care se doreşte să se reconstituie întreaga reţea reciprocă. Celula elementară este un paralelipiped în interiorul căruia se găsesc atomii sau moleculele şi dacă acesta se translatează după cele 3 direcţii. Astfel. nu se poate determina structura cristalină. Indexarea difractogramelor este primul pas în determinarea structurii cristaline. Etapele principale pentru determinarea structurii cristaline din pulberi sunt: indexarea difractogramelor. atunci se obţin poziţiile tuturor atomilor din celula elementară. cel mai uşor se indexează compuşii care cristalizează în sistemul cubic şi. Dificultăţile în indexarea difractogramelor provin din erorile legate de determinarea poziţiilor maximelor de difracţie. dacă poziţiile maximelor de difracţie ar fi determinate exact. foarte multe structuri cristaline au fost determinate din pulberi. cel mai dificil. obţinerea modelului structural şi rafinarea Rietveld a modelului obţinut. iar la final se vor da câteva exemple de determinare a structurii cristaline din pulberi. dacă aceasta nu este făcută corect. Astfel. în cazul pulberilor. în timp ce în cazul difracţiei pe monocristale se obţin mii de vectori din reţeaua reciprocă. dintre care unele se suprapun 306 . cu cât sistemul cristalografic are simetrie mai joasă. datele experimentale sunt proiecţia unidimensională a reţelei reciproce care este tridimensională. Aceasta deoarece. 1.în ultimul timp. Indexarea difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic. parametrii celulei elementare şi atribuirea fiecărei linii de difracţie a indicilor Miller corespunzători. datorită creşterii puterii de calcul şi rezoluţiei difractometrelor. Aceasta este total diferită faţă de cazul determinării structurii cristaline din monocristale. Astfel. cu atât are mai multe linii de difracţie. De asemenea.

atunci la indexare s-ar putea să avem o celulă cu o constantă de reţea dublă faţă de cea reală. Dacă. Erorile sistematice pot să fie minimizate prin alinierea difractometrului. Cea mai precisă corecţie se face prin utilizarea de standard intern. În cazul căutării în spaţiul direct. definirea celulei elementare pentru sistemul cubic depinde de un singur parametru. 1. În general. În programele de calcul elaborate în ultimul timp se poate face indexarea chiar când există un număr mic de reflexii care aparţin impurităţilor şi acestea sunt excluse dacă celelalte linii de difracţie se potrivesc cu celula elementară găsită.2 Algoritmi de indexare Există două abordări pentru algoritmii de indexare şi anume căutarea în spaţiul direct şi în spaţiul reciproc.parţial. d) Să nu existe impurităţi în proba de analizat. pentru sistemul ortorombic depinde de trei parametrii. Acest lucru este foarte important deoarece nu se poate distinge între liniile de difracţie ale compusului şi liniile de difracţie ale impurităţii. iar pentru sistemul triclinic depinde de şase parametrii. Astfel. Indexarea difractogramelor se face în mod automat folosind diferiţi algoritmi de calcul[1]. Cele mai importante erori sistematice sunt poziţia de zero a difractometrului şi deplasarea probei. Indexarea este cu atât mai dificilă cu cât simetria reţelei cristaline este mai joasă. de exemplu. Erorile sistematice sunt mai nefavorabile pentru indexare decât erorile întâmplătoare. dacă avem impurităţi. 1. ceea ce face ca să nu se poată determina precis poziţiile maximelor de difracţie. c) Să avem o precizie mare pentru determinarea poziţiilor de difracţie.1 Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect sunt: a) Să existe linii de difracţie observabile la unghiuri cât mai mici. se variază parametrii celulei elementare într-un anumit mod şi se aleg acele 307 . b) Numărul de extincţii pentru maximele de difracţie la unghiuri mici să nu fie foarte mare. Aceasta presupune introducerea în proba de analizat a unui compus pentru care se ştiu exact poziţiile maximelor de difracţie. Aceasta deoarece la unghiuri mici peak-urile de difracţie sunt mai rare şi şansele de a se suprapune sunt mai mici. Pentru corectarea erorilor sistematice se poate folosi atât standard extern. unul dintre indicii Miller este tot timpul par din cauza reflexiilor interzise. obţinem o celulă elementară incorectă. cât şi standard intern.

β . γ cu 0. Valoarea indicilor Miller variază între 0 308 . Timpul de calcul. Vectorii reţelei reciproce sunt legaţi de unghiurile de difracţie prin relaţia (2sin θ )/ λ =1/d. dacă se lucrează în spaţiul direct. Astfel. este o metodă iterativă şi Monte Carlo ce utilizează poziţiile liniilor de difracţie pe baza descompunerii difractogramei şi extragere a intensităţilor de difracţie LSI (Least Square Indexing) and LP-Search [5]. în special pentru sistemul triclinic şi monoclinic.01 Å şi unghiurile α.b. mai ales în cazul compuşilor cu simetrie scăzută. La căutarea în spaţiul reciproc se caută să se găsească vectorii elementari ai celulei reciproce folosind unghiurile de difracţie.10 şi se caută cea mai bună potrivire dintre poziţiile calculate şi observate ale unghiurilor de difracţie. Deci se cunosc un număr limitat de vectori ai reţelei reciproce şi se urmăreşte să se găsească vectorii elementari ai reţelei reciproce care să genereze întreaga reţea reciprocă. pentru sistemul cubic numărul unghiurilor din setul de bază este 1 pentru sistemul tetragonal. Din vectorii elementari ai reţelei reciproce rezultă imediat vectorii elementari ai reţelei directe.valori pentru care poziţiile maximelor de difracţie calculate se potrivesc cât mai bine cu cele observate. Prima este mai eficientă pentru sisteme cu simetrie ridicată de la cubic la ortorombic. Numărul unghiurilor de difracţie din setul de bază este egal cu numărul parametrilor ce caracterizează celula elementară. Căutarea în spaţiul reciproc poate fi implementat în două variante. utilizând spaţiul direct. Această metodă este metoda directă de căutare în spaţiul direct.c cu aproximativ 0. În cazul indexării. Metodele de indexare care utilizează spaţiul reciproc sunt mai eficiente decât cele de căutare în spaţiul direct. merită menţionate următoarele: Autox [2]. Metoda de încercare şi eroare se bazează pe atribuirea de indici Miller la un număr minim de peak-uri de difracţie. Există şi posibilitatea utilizării algoritmilor genetici pentru indexarea difractogramelor. este 2 şi aşa mai departe. Aceasta este tot o variantă a metodei Monte Carlo. se variază parametrii celulei elementare a. O altă tehnică de indexare foarte puternică şi care este implementată în programul de calcul de către firma Bruker Topas. şi anume: metoda de încercare şi eroare şi metoda de căutare pe zone. pentru sistemul triclinic fiind 6. Dintre programele de calcul care utilizează căutarea în spaţiul direct. iar a doua variantă este mai eficientă pentru sisteme cu simetrie joasă. este mult mai mare decât în spaţiul reciproc. McMaille [3] şi SVDIndex [4] care se bazează pe metode de căutare de tip Monte Carlo. care se numeşte setul de bază şi care sunt liniile de difracţie cu cele mai mici unghiuri. O altă posibilitate de căutare este utilizarea metodei Monte Carlo.

atunci această metodă nu poate să facă corect indexarea deoarece nu are posibilitatea să dis309 .3 Câteva metode uzuale de idexare Metoda Treor. se generează unghiurile de difracţie şi se verifică dacă unghiurile calculate se potrivesc cu cele experimentale.k.0.k. Metoda căutării pe zone începe prin căutarea zonelor unidimensionale. lm. Această metodă este o metodă de căutare în spaţiul reciproc şi se bazează pe atribuirea unor indici Miller la primele linii de difracţie. adică de tipul h. Când o zonă tridimensională (reţeaua) a fost construită.l. 1. Operaţia se repetă atribuind alţi indici Miller primelor maxime de difracţie şi se ordonează soluţiile în ordinea descrescătoare a factorilor de încredere.h. dacă în intervalul respectiv se găseşte soluţia elementară. Se reţin acei parametrii de reţea pentru care unghiurile calculate se potrivesc cel mai bine cu unghiurile experimentale şi care indexează toate sau aproape toate unghiurile experimentale. h. 0.0.l şi construirea zonelor tridimensionale utilizând liniile comune din zonele bidimensionale. Dacă difractograma experimentală are şi impurităţi.şi valori maxime preselectate pentru h.0. l notate cu hm. 0. Cu acest program se poate indexa orice sistem cristalografic. 0. Având parametrii celulei elementare. după care se calculează factorul de încredere. Pentru fiecare permutare a indicilor se determină parametrii celulei elementare. Metoda Dicvol. adică de tipul h. dar cele mai bune rezultate se obţin pentru sistemele cu simetrie ridicată.l şi bidimensionale. km.0.k.0. după care se calculează parametrii celulei elementare [6]. Metoda Dicvol [7] este o metodă de căutare în spaţiul direct şi se bazează pe metoda dihotomiei care constă în variaţia lungimilor celulei elementare şi a unghiurilor dintre axe între anumite limite şi reducerea intervalelor respective. se încearcă atribuirea indicilor Miller pentru toate reflexiile Bragg observate. Aceste valori sunt între 2 şi 4. Se testează toate sistemele cristalografice începând de la sistemul cubic până la sistemul triclinic. care este de simetria cea mai ridicată şi termină cu sistemul triclinic. Se reţin acele valori ale parametrilor de reţea care se potrivesc cel mai bine cu valorile experimentale şi se calculează pentru acestea factorul de încredere.0. Programele de calcul care fac indexarea prin metoda Dicvol încep de la sistemul cubic. se generează toate poziţiile posibile ale maximelor de difracţie şi se verifică dacă poziţiile unghiulare ale maximelor de difracţie observate sunt incluse în cele calculate în limita unor erori de măsură.

Metoda Ito. acestea să aparţină unor impurităţi. cu condiţia ca liniile de difracţie neindexate să fie de mică intensitate şi. Programul cere cel puţin 20 de reflexii Bragg şi nu funcţionează cu mai puţine linii de difracţie. în acest caz. c) Reducerea celulei găsite şi transformarea acesteia în una din cele 14 reţele Bravais. O primă observaţie este că dacă nu au fost indexate toate liniile de difracţie. dar care nu este foarte sensibilă la impurităţi se numeşte X-cel [8]. Maximelor de difracţie experimentale li se pun în corespondenţă cele mai apropiate maxime de difracţie calculate. dar aceasta trebuie confirmată. în special triclinic şi monoclinic. Un număr de 30-35 de reflexii Bragg este recomandat. În general. După indexare cunoaştem volu310 . Ca o remarcă generală: cu cât poziţiile liniilor de difracţie sunt determinate mai precis şi cu cât proba de analizat este mai pură. realizează o căutare a zonelor în spaţiul reciproc şi transformare a axelor celulei pentru a găsi o celulă cât mai potrivită [9]. Se ordonează soluţiile în ordinea descrescătoare a erorii medii. d) Atribuirea indicilor Miller pentru toate maximele observate şi calcularea figurilor de merit. Cu această metodă de indexare se obţine şi grupul spaţial la care aparţine compusul. Programul Ito este folosit în special pentru indexarea sistemelor cu simetria joasă. se calculează eroarea medie dintre poziţiile maximelor calculate şi cele experimentale şi se trece la pasul următor. Programul mai ţine cont de densitatea aproximativă a compusului şi de numărul posibil de molecule pe celula elementară. s-ar putea ca soluţia să fie corectă. Pentru fiecare combinaţie de parametrii ai celulei elementare se generează poziţiile maximelor de difracţie. Pe lângă aceste programe de calcul am mai elaborat şi noi un program [10] care se bazează pe căutarea în spaţiul direct pentru parametrii reţelei cuprinşi într-un anumit interval şi cu un anumit pas. împreună cu programul aferent. cu atât şansa de a obţine mai repede soluţia corectă la indexare este mai mare. O metodă asemănătoare cu Dicvol şi care se bazează tot pe procedeul dihotomiei. Pentru a se indexa cu această metodă se parcurg următorii paşi: a) Găsirea potenţialelor zone utilizând primele 20 unghiuri Bragg. Această metodă de calcul. b) Construirea reţelelor tridimensionale prin găsirea de zone bidimensionale care au o zonă unidimensională comună. Cele mai comune versiuni sunt ITO13 şi ITO15.tingă între liniile de difracţie ale compusului şi ale impurităţilor. O altă observaţie în alegerea soluţiei corecte se referă la densitatea calculată. din programele de indexare rezultă mai multe soluţii foarte diverse între ele. rămânând una sau două linii de difracţie neindexate.

Densitatea calculată trebuie să aibă o valoare rezonabilă în funcţie de elementele care se găsesc în compus. Un alt criteriu foarte important este valoarea figurii de merit. Le Bail a extins această metodă pentru estimarea valorilor absolute a factorilor de structură. în caz contrar. Ca intensităţi de pornire. 2.1 Metodele pentru monocristale aplicate la pulberi În acest caz. figura de merit trebuie să fie neapărat mai mare ca 4. Obţinerea modelului structural Pentru obţinerea modelului structural există două posibilităţi. metoda Le Bail şi metoda Pawley. atunci putem să mergem mai departe pentru a obţine modelul structural şi să-l rafinăm. când nu există un model structural. există şi cazuri când prezintă instabilităţi. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie. şi anume.1. se pot considera valorile calculate ale intensităţilor de difracţie. Le Bail a propus o metodă iterativă de determinare a intensităţilor de difracţie observate. 2. Deşi metoda este în general robustă. Există două tehnici de extragere a intensităţilor de difracţie. Treor sau Ito. atunci o putem compara cu densitatea calculată şi să confirmăm dacă indexarea poate fi corectă cu soluţia aleasă. mai ales atunci când fondul de difracţie este supraestimat. 2. şi anume: metode utilizate în cazul monocristalelor şi metode de căutare în spaţiul direct. Dacă indexarea este corectă. mai întâi se extrag intensităţile de difracţie deoarece se ştie că în cazul difracţiei pe pulberi foarte multe intensităţi de difracţie se suprapun.1 Extragerea intensităţilor de difracţie Metoda Le Bail de extragere a intensităţilor de difracţie este inspirată din metoda Rietveld. Intensităţile de difracţie pentru iteraţia (r+1) se exprimă în funcţie de intensităţile de difracţie pentru iteraţia r. modelul structural obţinut nu va putea fi rafinat.mul celulei elementare şi dacă presupunem un anumit grup spaţial putem determina numărul de molecule pe celula elementară şi de aici densitatea. Dacă indexarea se face cu Dicvol. Vom descrie pe scurt cele două tipuri de metode. Vom descrie pe scurt cele două metode. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei 311 . Dacă s-a determinat densitatea experimentală.

în schimbul intensităţilor de difracţie. se determină factorul de scală şi de temperatură şi se obţine modulul factorilor de structură. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. În timp ce metoda Le Bail este o metodă iterativă. care nu necesită un model structural. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. după ce au fost obţinute intensităţile de difracţie.Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi. (iii) Determinarea fazei factorilor de structură. factorul de absorbţie şi factorul de extincţie. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative. intensităţile acestora se reduc cu un factor de temperatură. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. (ii) Determinarea factorului de scală şi a factorului global de temperatură. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. Dar factorii de 312 . este corectarea acestora de factori fizici sau geometrici care afectează intensităţile de difracţie.5 dintr-un pas de înregistrare a difractogramei. Cu toate acestea. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. Metoda Pawley este o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X. Paşii care trebuie urmaţi sunt: (i) Corectarea intensităţilor de difracţie. Aceştia sunt: Factorul Lorentz. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială.2 Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley. 2. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. Datorită faptului că atomii oscilează în jurul poziţiilor de echilibru. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul a zecilor până la 3 sau 4 sute. factorul de polarizare. Primul pas. Deşi procesul de rafinare este în general stabil.1. Unii autori au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură. Dacă se fac corecţiile intensităţilor de difracţie. în unele cazuri s-au obţinut rezultate bune.

structură sunt numere complexe. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. cu ajutorul relaţiei: 1 ∑ Fhkl exp( −2πi(hx + ky + lz )) V hkl Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât. există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. putem să determinăm densitatea electronică de sarcină în celula elementară. Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară. ρ ( x.l unde u. mai ales. z ) = 313 . distanţele dintre atomii grei. atunci putem face sinteza Patterson.l cos( 2π ( hx + ky + lz )) V h . Pentru a îmbunătăţi şi completa modelul se apelează la tehnici de rafinare Fourier. k . Modelele structurale obţinute prin metodele directe sau metoda Patterson sunt adesea incomplete chiar şi pentru monocristale. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. Pe baza densităţii electronice se poate construi un model structural aproximativ.w) = ∑ Fh . w reprezintă respectiv Δ x. (v) Rafinare Fourier. k . Cele mai importante tehnici de rafinare Fourier sunt: Sinteze Fourier succesive şi Sinteza Diferenţă. după relaţia: 2 1 P(u. Δ y. v. y . iar pentru pulberi cu atât mai mult pentru că numărul de intensităţi experimentale este mult mai mic. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice şi probabilităţi condiţionate. dacă aceştia există. Δ z. Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi. Cunoscând factorii de structură. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. (iv) Sinteza Fourier şi sinteza Patterson. dacă densitatea electronică este mai mare.v. deci în acest caz factorii de structură sunt numere reale pozitive sau negative.

rezultă că numărul total de configuraţii care trebuie să fie testat este de 10x10=1010. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală. se testează potrivirea dintre difractograma calculată şi cea expe314 .2. În acest caz. de exemplu. Astfel. Să presupunem că la cele 6 grade de libertate (translaţii şi rotaţii) se adaugă doar 4 grade de libertate interne şi să avem în total 10 grade de libertate. Putem să avem atomi. o variantă a acesteia numită parallel tempering şi tehnica algoritmilor genetici. În cazul metodei de răcire simulată. octaedrii etc. Să presupunem că avem doar o moleculă pe celula elementară. La aceasta se adaugă gradele de libertate interne legate de modificarea configuraţiei moleculare prin modificarea unghiurilor de torsiune. eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. mai rar. 3 grade de libertate de rotaţie. ceea ce cere un timp foarte mare de calcul.2. molecule. Această metodă nu cere extragerea factorilor de structură din difractogramă. Pentru moleculele organice. avem în mod obligatoriu 3 grade de libertate de translaţie. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. unghiurilor de legătură dintre atomi şi. grupe de atomi aranjaţi într-o anumită configuraţie. ca de exemplu. distanţe. Dacă. metoda Monte Carlo inversă [11]. ca de exemplu. presupunem că pentru fiecare grad de libertate corespunde doar 10 zece paşi de căutare. dintre care amintim: Răcire simulată (simulated annealing). tetraedrii. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. fragmente din molecule. se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. Aceasta înseamnă că nu se pot testa toate configuraţiile şi de aceea se apelează la metode probabilistice. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală.

315 . când T este foarte mic. atunci se reţine noua configuraţie. temperatura se scade treptat. dintre care amintim. În timpul procesului de căutare. Difractogramele pot fi modelate ca o sumă de două funcţii. funcţia care descrie fondul (background) şi o funcţie care sumează liniile de difracţie. posibilitatea de a se obţine minime locale este mai mică. În procesul de căutare a minimului global ca şi Cost Function. poate să se introducă ca şi criteriu pentru modelul obţinut. T fiind temperatura distribuţiei.Δ CF/T). Funcţia de cost CF se poate alege în diverse moduri. în faza iniţială a procesului de căutare a configuraţiei optime. se poate uşor trece de la un minim local la un alt minim. şi anume. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. se poate introduce un factor numit ‘anti-bump’. În felul acesta. minimizarea energiei potenţiale de interacţiune inter . Pentru ca unităţile structurale să nu se apropie foarte mult unele de altele. Fox [13. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat.şi intramoleculară. Powder Solve [12]. Astfel.14]. atunci se reţine noua configuraţie.rimentală. Totuşi. În schimbul utilizării unui singur lanţ de configuraţii cu descreşterea temperaturii. şi anume. Profilul liniilor de difracţie se descrie de obicei prin funcţii standard de tipul Gaussiana. un alt algoritm a fost dezvoltat. se aleg de la început mai multe configuraţii (un număr mic de configuraţii). se consideră funcţia de cost CF. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2=exp[(CF2-CF1)/T]. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. definit în felul următor: Rwp=[ Σ i wi ( y obd i − i y calc i )2 Σ i wi ( y ) obs 2 ]1/2 Dacă funcţia de cost CF este mai mică decât cea precedentă. fiecare linie de difracţie fiind centrată corespunzător. Lorentziana sau pseudos-Voigt. probabilitatea de a găsi un alt minim este de asemenea mică. Dacă CF este mai mare decât cea precedentă. dar în faza finală. Orientarea preferenţială poate fi descrisă prin funcţii de tip March-Dollase. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. pentru a evita probabilitatea să cădem într-un minim local. în afară de potrivirea dintre difractograma calculată şi cea observată. în scopul determinării minimului absolut. cu probabilitatea exp(. Parallel Tempering (PT) [15]. Una dintre posibilităţi este să se aleagă ca fiind reziduul R.

Profilul liniei de difracţie. Dintre acestea. cel mai utilizat este GSAS [17]. ϕ.coordonatele atomului j. Funcţia ce trebuie minimizată este: (1) S y = wi ( y i − y ci ) 2 ∑ i unde yi si yci sunt intensităţile observate şi calculate la pasul i. B . dându-se intensitatea de difracţie la fiecare pas. factorul de absorbţie.3. de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate. fj . pV. iar wi=1/yi este factorul de ponderare. deoarece nu sunt necesare variaţii mari ale acestor parametrii.factorul de structură pentru atomul j. factorul de scală. yci este difractograma care se calculează la pasul i pentru că difractograma se calculează în paşi. şi anume: de factorii de structură şi indicii Miller corespunzători factorilor de structură respectivi. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural. Dintre programele de calcul. este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [16]. se poate aproxima prin diverse funcţii: de tip Gauss. În cazul obţinerii modelului structural. fondul de difracţie în punctul respectiv etc. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate. etc. zj . cea mai utilizată este funcţia pseudo Voigt. care este descrisă ca fiind o combinaţie a funcţiei Gauss şi Lorentz: 316 .factorul de temperatură (care se datoreşte vibraţiilor termice). yj. În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim. funcţia de profil pentru liniile de difracţie. pseudo-Voigt.factorul de ocupare. xj. s-a făcut o căutare globală. yci depind de o serie de factori. factorul Lorentz–polarizare. Lorentz. Expresia factorilor de structură este dată de relaţia: Fhkl ⎛ B sin 2 θ ⎞ = ∑ N j f j exp[2Π(hx j + ky j + lz j )]exp⎜ ⎟ ⎜ − λ2 ⎟ j ⎠ ⎝ (2) unde: Nj . potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată. Forma liniilor de difracţie este o convoluţie datorată probei şi efectelor instrumentale. Cu alte cuvinte.

funcţia pseudo-Voigt . V. Calitatea rafinării se apreciază pe baza unor indici de rezidiu.unghiul ascuţit dintre vectorul de împrăştiere pentru reflexia K şi direcţia preferenţială de orientare a planului cristalitelor faţă de planul probei. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară. Orientarea preferenţială are loc când cristalitele din probă tind să se orienteze preferenţial după anumite direcţii. PK este funcţia care descrie orientarea preferenţială. ca de exemplu. Orientarea preferenţială poate fi modelată matematic cu ajutorul unor funcţii. G . unde 0 se referă la 100% orientare preferenţială a cristalitelor în probă şi 1 se referă la orientare complet întâmplătoare a cristalitelor. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RB = RP = ∑| I K ( obs ) ∑| y − y ∑y i i ∑I − I K ( calc) | (5) (6) K ( obs ) ci | 317 . G funcţia Gaus iar η parametru de amestecare a celor două funcţii. αK . L fiind funcţia Lorentz. Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective. Aceasta face ca unele maxime de difracţie să fie mai intense. W sunt parametri care se pot rafina. iar altele mai puţin intense faţă de cazul când nu ar exista orientare preferenţială.coeficientul March care variază între 0 şi 1. Icor .intensitatea măsurată.intensitatea corectată pentru orientare preferenţială. exprimată prin funcţia lui Caglioti[18]: H 2 = U tan 2 θ + V tanθ + W (3) unde. Iobs . March-Dollase [19]: I cor = I obs (G 2 cos2 α K + 1 2 sin α K ) −3 / 2 G (4) unde.pV = ηL + (1-η)G unde: pV . H este lărgimea la semiînălţime şi U.

Urmează rafinarea deplasării punctului de zero pentru difractogramă. factorul care descrie absorbţia razelor X şi factorul de polarizare. în general trebuie impuse constrângeri. Dacă rafinarea se face ţinând cont de constrângerile slabe. maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma [20]. deformaţiile de reţea. aceste distanţe pot să varieze între anumite limite. mai trebuie să adăugăm şi termenii care iau în considerare constrângerile slabe. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. Din literatură şi din experienţa proprie. wi=1/ σ 2 (yoi) . σ 318 este . În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. La început se rafinează factorul de scală. de exemplu C-C. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. Totuşi. De exemplu. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. C-O. am constatat că este necesar să se adopte următoarea strategie. funcţia ce trebuie minimizată este: SyR= ∑ w (y i i oi-yci) 2+C w ∑ w (R -R j oj cj(x)) 2 . În acest caz. Pentru o difractogramă oricât de perfectă. factorul de temperatură şi coeficienţii polinomului care descriu fondul. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain”[21] şi “rigid body“[22]. pentru legături simple sau duble. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu. care trebuie minimizată. wj=1/ σ 2 (Roj) (8) (yoi) j unde yoi şi yci sunt intensităţile observate şi calculate la pasul i. În ultimele etape se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. mai ales dacă avem un număr mare de atomi pe celula elementară. atunci la funcţia din formulă (5). În general fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. factorii care descriu asimetria liniilor de difracţie etc.RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ 1/ 2 (7) Cei mai utilizaţi indici sunt RP si RWP.

constrângerile puternice “rigid bodies” sunt incompatibile cu constrângerile slabe. Complecşii de incluziune cu β -ciclodextrina se folosesc pentru a îmbunătăţi biodisponibilitatea. de ordinul miilor.y. În cazul programului de rafinare GSAS [17]. Exemple privind determinarea structurii cristaline din pulberi 4. permiţând translaţia şi rotaţia acestora. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei. se porneşte cu un cw mare.deviaţia standard a intensităţii lor măsurate. solubilitatea şi stabilitatea diferitelor medicamente în soluţii apoase. Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi dar forma ansamblului să nu se schimbe. β -ciclodextrina este compusă din 7 unităţi glicosidice. pentru ciclu benzenic. În cazul în care există şi grupări plane. cu atât constrângerile sunt mai puternice. 319 . unghiuri etc (aşa numita pseudo observabilă). cw este un factor de ponderare care permite să se varieze contribuţia constrângerilor în procesul de rafinare.1 Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina. împreună cu atomii de oxigen secundari. atunci este necesară aplicarea constrângerilor de planeitate [23]. Aceasta are o formă toroidală în care se pot încapsula diferiţi compuşi bioactivi şi se poate realiza eliberarea treptată a acestora. în procesul de rafinare a complecşilor de incluziune. δ (Roj) este deviaţia standard a pseudo-observabilei. Roj este valoarea aşteptată pentru mărimea stereochimică respectivă care poate fi lungime de legătură. şi se tot reduce în procesul de rafinare. iar Rcj(x) este valoarea calculată din poziţiile atomilor (x.z). În general. au fost considerate ca “rigid body”. ca de exemplu. când în afară de constrângerile slabe se aplică şi constrângeri ca molecula să fie planară. 4. Cu cât cw este mai mare. una dintre aceste unităţi este prezentată în figura 1. Unităţile glicozidice au fost legate între ele prin constrângeri slabe. aceasta înseamnă că atomilor care aparţin unui corp rigid nu le pot fi aplicate constrângerile slabe în acelaşi timp. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. De exemplu.

celula elementară şi configuraţia moleculară. Figura 2 Formula structurală pentru Atenolol După determinarea poziţiilor maximelor de difracţie. Configuraţia moleculară pentru β ciclodextrină a fost luată din baza de date Cambridge Structural Database [29]. celula elementară şi modul în care interacţionează şi se cuplează cele două molecule pentru a forma complexul de incluziune.0 [20]. indexarea s-a făcut cu ajutorul programului de calcul Ito [9]. Formula structurală pentru Atenolol este prezentată în figura 2. Dar la interacţiunea cu atenololul structura cristalină se modifică total în sensul că se schimbă grupul spaţial. configuraţia moleculară pentru atenolol a fost calculată cu ajutorul programului de modelare moleculară Cerius 2. adică să determinăm sistemul cristalografic. În urma indexării s-a stabilit că. Structura cristalină pentru β Ciclodextrină se cunoştea. complexul de incluziune cristalizează în sistemul monoclinic având grupul spaţial C2 cu 4 molecule de 320 . Structura cristalină pentru atenolol nu a fost cunoscută la acel moment.Figura 1 Unitate glicozidică din componenta β Ciclodextrina Noi am urmărit să determinăm structura cristalină pentru Atenolol cu β -Ciclodextrina. De aceea. grupul spaţial.

Profilul de difracţie a fost aproximat prin funcţii de tip pseudo-Void. O. s-a permis rotaţia şi translaţia. restrângerile slabe referitoare la planeitatea atomilor (O4)n a fost în cazul ciclodextrinei de 0. unghiurile de torsiune dintre unităţile glicizidice şi unghiurile dintre unităţile glicozidice. iar oxigenii de la capătul grupărilor glicozidice au fost legaţi între ei prin restrângeri slabe (soft restrains). Au fost rafinaţi de asemenea parametrii termici. utilizând tehnica ”simulated anealling” şi ”paralel tempering”. c=15. rigidizarea este cu atât mai mare cu cât factorii de pondere pentru restrângerile slabe sunt mai mari..375g/cm3. Obţinerea modelului structural s-a făcut cu ajutorul programului de calcul. a fost considerată ca “rigid bodies”. cu ajutorul restrângerilor de planeitate. Pentru funcţiile de profil s-au folosit 12 parametrii.640. Fiecare unitate glicozidică. Volumul celulei elementare este V=6772.649Å . γ =900. α =900. au fost aplicate restrângeri slabe pentru toate distanţele dintre atomi şi unghiurile de legătura dintre aceştia. Iniţial. împreună cu atomii de oxigen O4. β =110. pentru restrângerile slabe este permisă mişcarea atomilor. Restrângerile slabe nu se pot aplica pentru atomii din cadrul unui grup aparţinand la “rigid body”. Reamintim că în cadrul unui grup de atomi care au fost definiţi ca “rigid bodies” nu se permite nici o mişcare a atomilor din cadrul grupului. s-a pus condiţia ca toţi cei 7 atomi de oxigen O4 să fie aproximativ în acelaşi plan. dar între anumite limite. adică fondul de difracţie care a fost aproximat cu un polinom.ciclodextrină şi 4 molecule de atenolol pe celula elementară şi următorii parametrii de reţea: a= 18. punctul de zero pentru 321 . o valoare plauzibilă pentru compuşii organici care conţin C. b=24. În urma modelării s-a constatat că molecula de atenolol intră în cavitatea β -ciclodextrinei. Pentru aceasta s-a utilizat programul de calcul GSAS. fd fiind factorul de pondere pentru restrângerile de distanţe. De asemenea. Au fost aplicate restrângeri de planeitate pentru gruparea fenil din cadrul atenololului. s-a procedat la rafinarea modelului structural prin metoda Rietveld. unele în raport cu altele. Ca grade de libertate au fost translaţiile şi rotaţiile pentru molecula de ciclodextrină şi molecula de atenolol. background-ul.914Å.450Å. factorii de pondere pentru restrângerile slabe au fost: fd=fa=fp=5000. fa pentru restrângerile de unghiuri. Pentru unităţile glicozidice. H. parametrii de reţea. unghiurile de torsiune pentru molecula de atenolol. N. Pentru obţinerea unui model structural realist s-a procedat la aplicarea unor serii de restrângeri şi constrângeri.55Å3. În continuare. Astfel. Densitatea calculată este ρ =1. De asemenea. iar fp pentru restrângerile de planeitate.05 Å. În schimb.

vedere după axa b şi c. formând un fel de dimeri.difractogramă şi. bineînţeles.2. În final. În mod asemănător s-a determinat structura cristalină pentru complexul de incluziune Acid Mefenamic.β -Ciclodextrina.β CD.8% şi Rwp=11. Structura cristalină pentru N-(5-etil-[1. 4.3. parametrii de poziţie.58%. Se observă ca moleculele de ciclodextrină şi cele de atenolol se grupează între ele prin legături de hidrogen.4]-tiadiazol-2-il0-toluensulfonamida Structura cristalină pentru acest compus a fost determinată prin combinarea difracţiei de raze X pe pulberi cu informaţii obţinute din RMN pen322 . Configuraţia moleculară pentru complexul de incluziune văzut după axa b şi după axa c este prezentată în figura 3. care au fost în număr de 288. Figura 3 Configuraţia moleculară pentru complexul de incluziune atenolol. s-a obţinut un rezidiu Rp=7.

37g/cm3.tru 13C şi din modelare moleculară. s-a calculat densitatea ca fiind ρ =1. unghiuri fa şi planeitate fp au fost reduşi treptat în cursul ciclurilor de rafinare de la 500 la 100. În continuare s-a făcut fitarea Le Bail a difractogramei experimentale pentru confirmarea grupului spaţial selectat. Prin examinarea difractogramei cu ajutorul programului de calcul Checkcell [28]. Difractograma de raze X pe pulberi a fost obţinută cu difractometrul de raze X. unghiuri şi planeitate a grupării fenil.5364Å. ceea ce confirmă grupul spaţial ales din reflexiile interzise. b=15.914 Å3. Cea mai bună soluţie corespunde sistemului ortorombic cu următorii parametrii de reţea: a=8. dintre care 6 corespund pentru poziţia moleculei şi orientarea acesteia.3846 Å şi volumul celulei elementare fiind V=2740. pentru un anumit grup de reflexii interzise corespund mai multe grupuri spaţiale. iar 4 la unghiurile de torsiune pentru moleculă. s-a utilizat radiaţia Cu K α 1 9 λ =1.54056Å. S-a obţinut un fit cu Rp=0. utilizând programul de calcul GSAS [17] combinat cu interfaţa grafică EXPGUI [31] . D8 Advance.072. se obţin informaţii structurale foarte importante. în cele mai multe cazuri. folosind programul de calcul Dash [30]. Considerând 8 molecule pe celula elementară. prin urmare.5-500 au fost modelate cu funcţii de profil de 323 . La acest grup spaţial corespund un număr de 8 poziţii generale. Factorii de pondere corespunzători restrângerilor pentru distanţe fd. Determinarea structurii cristaline s-a făcut prin metoda căutării în spaţiul direct. S-a lucrat varianta geometria Bragg-Brentano θ -2 θ prin reflexie. rezultă că numărul de molecule pe celula elementară este 8. Indexarea compusului s-a făcut utilizând programul de calcul Dicvol [9].0148 Å si c=21. Pentru a avea un model structural realist în timpul rafinării. cel mai probabil grup spaţial a fost găsit ca fiind Pbca. Menţionăm că. Modelul obţinut în acest mod a fost în continuare rafinat prin metoda Rietveld. Deoarece nu există nici un motiv ca moleculele să se plaseze în poziţii speciale. Profilul maximelor de difracţie de pe întregul interval 2 θ = 3. Un factor de temperatură global a fost rafinat pentru toţi atomii.05 şi Rwp=0. prin ajustarea a 10 grade de libertate. Deoarece deplasarea chimică obţinută din RMN pe solide este sensibilă chiar şi la mici modificări de împachetare moleculară şi modificare conformaţională din spectrul RMN. s-au aplicat o serie de restrângeri slabe pentru distanţe. care reprezintă o valoare rezonabilă. Modelul structural de pornire a fost obţinut cu ajutorul programului de calcul Molden. Noi vom descrie în special aportul difracţiei de raze X la determinarea structurii cristaline pentru acest compus. echipat cu un monocromator de Ge (111) pentru fasciculul incident pentru înlăturarea radiaţiei K α 2 şi.

În continuare. Rexp= 0. Se observă o potrivire foarte bună între cele două difractograme.71.079. s-au obţinut următorii factori care caracterizează figura de merit a modelului structural: Rp=0. χ 2=6. Fondul de difracţie a fost modelat cu un polinom Chebyshev de ordinul întâi. Rwp=0. În figura 5 este prezentată difractograma experimentală. modelul a fost îmbunătăţit utilizând tehnici de modelare moleculară combinată cu informaţii obţinute din măsurători de deplasare chimică din spectul RMN. În final. Figura 4 Împachetarea în celula elementară şi aranjarea supramoleculară Un alt compus pentru care s-a determinat structura cristalină prin combinarea difracţiei pe pulberi cu spectroscopie RMN şi modelare moleculară a fost Etoxiazolamida [27]. 324 .tipul pseudo-Voight cu 18 termeni. deci modelul structural este corect.113. difractograma calculată şi diferenţa dintre difractograma calculată şi cea experimentală. În figura 4 este prezentată împachetarea în celula elementară pentru compusul studiat şi aranjarea supramoleculară sub formă de două şuviţe formate din molecule puse cap la cap.053.

Cryst.Falcioni.B. 1. 19. Guagliardi. Appl. 36. 219. A.J. 33. Borodi.Figura. 69 (1992).Harris . 25. A.Cerny J.G. 35. Gavira Roumanian Reports in Physics.Leusen. 1180 (2000).Pusztai . Appl.A. P. (2004) M. 32. The Third Pharmaceutical Powder X-ray Symposium (PXRD-3).Deem J. (1969) 2.Phys. Oxford University Press. K.. 249 (2004) J. 1754 (1999) H.G. 356 (2003). Cryst. Mihailescu. (2004). and Ch. McCusker. Eds. Visser. 36. Coelho. in: Structure determination from powder diffraction data. M.Koning. 14. 12. 6.W. Le Bail. Lou¨er. Cryst. L. 8.-E.McGreevy.Engel. 110 . 847-856. New York (2002) J. K. 2. Crystallogr.M Rietveld . Monte Carlo indexing with McMaille. J. W. Rizzi. 734. R. I. Giacovazzo.Werner. 10. J.Cryst. J. C. 11.Appl. 1169. 13. 5. Powder Diffraction.D. Appl.Appl. 16. 4. Appl. J.Favre-Nicolin and R. Kern.Simul.W. Cryst.Wilke . Oxford.(1999) V. 51(7-10) 983 (1999) R. J.Mol. 89 (1969) Gh. L. F. A. IUCr monographs on crystallography .L. Cryst. O. Shankland. P. Appl. 15.Cerny Z. 2.Appl. 86 (2003). 325 .M. (2002) V. Werner J. Baerlocher. S.E.Chem. Boultif and D. Appl.Favre-Nicolin and R.Kristallogr. Gh. 7. 724 (2004) J.359 (1988) G. Moliterni. 37. A.A. Cryst. I. 9. F. 65. Autoindexing. 3. Altomare. A. Cryst. David. A. Bibliografie 1.-E. Bratu. 5 Comparaţie dintre difractograma observată şi cea calculată 5.

Report LAUR 86-748.Appl.P.(2002 22. 746 (1991) 24. Filip. Von Dreele General Structure Analysis System (GSAS).Nowell. (2010) 27. 1041.1039/c1cp21878f. B. Hangan. Koeller J.Pop. G. 1036. B47.70. 18. J. 84. 28.Scardi J. (1986) 20. Filip.B. le Bas. J. Van de Streek. Laboratoire des Materaux et du Genie Physique de l’Ecole Superieur de Physique de Grenoble. USA. B. Cox. H. 267.C. 87545. F. NM. Toby. 19. (2008) 25. X.. 116. E. L.B B58 835. C. Peschar. M.17. Borodi and C. D. Spectrochimica Acta A. Motherwell. Chem. R. J.Laugier.A. Steiner and G. Borodi. C. T. Mentzafos. W. Appl. Phys.B.. Acta Cryst. 910. McCusker.Am. G.(1994) 30.E.Bochu CHECKCELL. Dinnebier Powder Diffraction 14. Shenk Acta Cryst. Dollase. David. Peschar. G.. 26. Young Oxford University Press (1993) 19. Acta Cryst. Dragan.Pidcock. 21. Cryst. 615. 10. W.Mavridis. X. J.Chem. D. A. Cryst.F.I.D. R. Acta. J.Shankland.210.Cryst.C. D. (1001) 326 . Borodi.Cole.E. J. Goubitz. M.and B. (1999) 23. Tsoucaris. Bratu. A. R. B58.Cole.S. The Rietveld Method edited by R. K. Von Dreele. I. Los Alamos National Laboratory. France. R. J. Filip. Helmbholdt. 34. Hernanz. Chem. B66.5122. Oprean and C. De Ridder.H. K.B. Soc. I.Appl. Cryst.J.A. W. L. Colaborative Computational Project Number 14 (CCP14). Phys.Larson & R.M. Tripon. (2002). Morari. 29. Appl. 36. DOI. 32.39.Louer and P. H. 31. (2006). G. Cryst. D.A. Attfield and J. A. Borodi. R. Filip.C. G. Bogdan. G.

. Generalităţi ..... Ruska a creat primul microscop a cărui rezoluţie era superioară unui microscop optic... Compania Siemens a patentat invenţia celor doi germani........ obiect ce utilizează lentila pentru a focaliza lumina reflectată de un obiect într-o imagine mai mare. Limitările microscopiei optice constă în rezoluţia obţinută prin această tehnică (aprox....... Rezoluţia este limitată de lungimea de undă a fotonilor utilizaţi ca sursă de iluminare a specimenului... ceea ce înseamnă că două caracteristici aflate la o distanţă mai mică de 250 nm nu vor putea fi diferenţiate. Generalităţi Microscoapele sunt instrumente utilizate pentru a facilita observarea unor obiecte la o mărire mai mare decât cea a obiectului observat.. Accelerarea electronilor permite reducerea lungimii de undă a unui fascicul de electroni ceea ce face posibila vizualizarea detaliilor cele mai fine... 327 ......................................... 328 3...IX.................... Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) . 250 nm).... Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) ........... MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE Microscopia electronică şef lucrări dr. iar în 1939 primul microscop electronic de transmisie a fost produs în scopuri comerciale... Printre alte surse se numără razele X şi neutronii..... Lucian Barbu-Tudoran Cuprins 1..... În 1931... 338 1.. 327 2........... Pentru observarea detaliilor mai mici a fost necesar crearea unui microscop care să utilizeze o sursă de iluminare caracterizată printr-o lungime de undă mult mai mică. Cel mai comun microscop este lupa........ fizicianul Ernst Ruska şi inginerul Max Knoll au construit un microscop electronic prototip............... Doi ani mai târziu..... Microscoapele optice (figura 1) sunt instrumente mai complexe care conţin un set de lentile care măresc imaginea.....

interacţionează cu aceasta în grosimea ei. Microscopul optic 2.1 – ocular 2 – revolver 3 – obiective 4 – viza macrometrică 5 – viza micrometrică 6 – platina 7 – sursă de lumină 8 . Probele analizate trebuie să fie foarte subţiri deoarece ar absorbi o mare parte a fasciculului de electroni. aceştia putând fi deviaţi sau nu. Astfel obiectele având structură internă diferită pot fi diferenţiate deoarece proiecţiile acestora vor fi diferite. incluzând suprafaţa şi structurile interne. Electronii pătrund prin probă. Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) Prin intermediul TEM imaginea observată este proiecţia probei în grosimea ei. informaţiile aparţinând axei z se vor pierde. Organizarea unui microscop electronic 328 . Ca limitare se aminteşte natura bidimensională a proiecţiei rezultate.diafragma şi lentila condensor Figura 1.

Tunul de electroni Electronii sunt emişi de un filament supraîncălzit de un curent electric până când suficientă energie va fi produsă (aprox. care este încărcat mult mai negativ decât filamentul în sine. astfel circuitul fiind complet. Electronii emişi au o distribuţie Boltzman a energiei şi trebuie să fie concentraţi pentru ca fasciculul rezultat să străbată coloana. lentile şi aperturi. electronii pot fi pompaţi de către filament spre placa anodică şi coloana microscopului. Cele mai comune microscoape sunt cele de emisie termionică si FEG (Field Emission Guns). Prin construirea unui cilindru Wehnelt. 329 . Pentru a modifica mărirea şi punctul focal al unei imagini se pot utiliza diferite lentile. Aperturile de pe traseul fasciculul de electroni au rolul de a schimba contrastul şi rezoluţia imaginii. un vârf Wehnelt şi un anod de extracţie.Principiile funcţionării unui croscop electronic de transmite nu diferă cu mult faţă de cele ale unui microscop optic. circuitul de interferenţă (biasing circuit). prin probă. Prin conectarea filamentului de partea negativă a generatorului de energie. Aceşti electroni vor penetra proba şi vor trece printr-o serie de lentile magnetice. se asigură convergenţa optimă a electronilor încă din momentul emisiei. de obicei tungsten sau hexaborid de lantaniu. 2500K) pentru a învinge ’’the work function’’ a metalului. iar în final vor fi focalizaţi pe ecranul situat la capătul coloanei.Secţiune prin coloana unui TEM lele de aer. Tunul de electroni are mai multe componente: filamentul. În interiorul coloanei se va stabili un vid înalt pentru a minimaliza interacţiunile dintre electroni şi molecuFigura 2 . În vârful coloanei există un emiţător de electroni cu voltaj înalt care va genera fasciculul de electroni care va traversa coloana.

Schema unui tun de electroni Tipuri de tunuri de electroni Tungsten: filamentul este fabricat din tungsten. Mărimea şi gradul de apropiere a câmpului electric cauzează desprinderea electronilor de pe filament. Hexaborid de lantaniu: este tot un filament de emisie termionică. Tipuri de tunuri de electroni: filament de tungsten şi cristal de hexaborid de lantaniu 330 . FEG: filamentul nu este unul termic. Emisia de electroni este asigurată de aplicarea unui puternic câmp electric imediat în vecinătatea vârfului filamentului. iar principiul de funcţionare se aseamănă cu cel al funcţionării unui bec.Figura 3. de aceea este mai eficient. Figura 4. dar are ”the work function” mai mică. pe măsură ce filamentul se încălzeşte electronii vor fi emişi.

Deoarece lentilele sunt reglate pentru o anumită lungime de undă acestea vor concentra electronii cu alte lungimi de undă mai puţin uniforme. Deoarece electronii emişi sunt supraîncălziţi. Când acest fenomen are loc imaginea se va roti pe măsură ce vor fi introduse în coloană alte lentile. Lentila intermediară controlează. mărirea imaginii sau pattern-ul de difracţie. este localizată în vecinătatea tunului de electroni şi este utilizată pentru concentrarea electronilor şi menţinerea coerenţei fasciculului. adică distribuţia energiei să fie o mică fracţiune din energia medie a electronilor. Aperturile Aperturile sunt găuri de-a lungul coloanei microscopului care pot limita mărimea fasciculul de electroni. vor interfera distructiv. Dacă electronii emişi sunt paraleli atunci fasciculul va fi coerent o mai multă perioadă. Cuplată cu apertura obiectiv va genera contrastul de amplitudine. este localizată sub probă imediat după lentila obiectiv. Prima apertură. apertura obiectiv. iar fasciculul va pierde din intensitate. Dacă electronii sunt în fază ei vor interfera constructiv. lumina fiind descompusă în radiaţii cu lungimi de undă diferite. Coerenţa temporală. Faza electronilor afectează coerenţa fasciculul. Lentila obiectiv are rolul de a realiza primul pas de mărire şi focalizare a unei imagini. Această aberaţie cromatică se aseamănă cu scindarea luminii când o rază traversează o prismă. ideal toţi electronii emişi ar trebui să fie în fază.Fasciculul de electroni se caracterizează prin coerenţă. A doua apertură. distribuţia energiei nu este sub forma unui singur peak. prin poziţia şi puterea ei. Această apertură controlează contrastul unei imagini. Lentilele Lentilele utilizate în microscopia electronică sunt bobine magnetice care au scopul de a focaliza şi direcţiona fasciculul de electroni. Se referă la intensitatea fasciculului. Ultima lentilă – lentila proiector . Prin urmare în urma trecerii fasciculului printr-o lentilă acesta va suferi o scindare. Dacă electronii sunt defazaţi. Funcţia unei aperturi este determinată de poziţia acesteia în coloana microscopului. În cazul prismei lumina este refractată sub diferite unghiuri.focalizează şi proiectează imaginea finală pe suprafaţa folosită pentru vizualizare. În cazul unui microscop performant se doreşte ca raportul ∆E/E să fie cât mai mic. Pentru formarea imaginii se folosesc 3 tipuri de lentile. în schimb distribuţia este de tip Boltzman şi diferă în funcţie de natura filamentului. Coerenţa spaţială. 331 . În cazul lentilelor electro-magnetice acestea pot roti fasciculul de electroni dacă sunt ajustate corespunzător. apertura condensator.

În cazul microscopiei electronice de transmisie proba analizată este depusă pe o grilă de metal. Dacă electronul intră în contact cu atomi din probă poate suferi o ciocnire elastică. luminozitatea fasciculului. Pe consolă se mai află butoane care controlează poziţia specimenului în interiorul coloanei. curentul. nu va pierde din energie. Acest electron va conferi o rezoluţie înaltă imaginii. va asigura introducerea probei în vidul din coloana microscopului cu o scădere minimă a presiunii din interiorul coloanei. prin intermediul goniometrului. Principii ale formării imaginii În momentul în care fasciculul trece prin grosimea unui specimen au loc mai multe fenomene. Acest holder de metal. Microscoapele electronice de nouă generaţie au interfeţe cu computerele ceea ce conferă utilizatorului o mai mare flexibilitate şi control. astfel când electronul va ajunge la nivelul ecranului va avea energia diminuată şi un unghi de incidenţă necunoscut. iar legea conservării momentului va determina unghiul la care acesta a fost deviat de la traiectorie.5). valoarea defocalizării. alinierea. Figura 5 . Acest electron va cauza apariţia zgomotului în imagine. Dacă electronul nu loveşte un atom din probă acesta va avea o traiectorie nedeviată până la ecranul care va colecta imaginea.Holder utilizat în microscopia electronică de transmisie Dacă se doreşte vizualizarea unei probe sub diferite unghiuri sau realizarea unei tomograme. goniometrul se poate roti pentru a schimba unghiul probei. focalizarea şi mărirea. voltajul curentului etc. În cazul unei ciocniri inelastice electronul va ceda o cantitate variabilă de energie specimenului.Exteriorul microscopului Consola utilizatorului constă dintr-un ecran pe care se vor afişa parametrii sub care funcţionează microscopul precum: mărirea. iar aceasta într-un holder de metal (fig. 332 .

Electronii care vor fi deviaţi de la traiectoria iniţială în urma interacţiunii cu atomii specimenului vor interfera constructiv sau distructiv cu fasciculul principal de electroni. Pattern-ul de difracţie se formează ” in the back focal plane” al lentilei obiectiv. Dacă se utilizează o apertură obiectiv mică electronii care sunt deviaţi sub un unghi mare nu vor contribui la formarea imaginii. astfel de electroni nu sunt folosiţi în microscopia electronică. Electronii cu deflecţie mare conţin informaţii importante legate de rezoluţie. iar contrastul este îmbunătăţit. Spre exemplu. aceste informaţii fiind pierdute.Electronii pot fi deviaţi la unghiuri mai mari de 90°. Diferenţa dintre proiecţiile unei sfere solide şi a unei sfere goale în momentul vizualizării la TEM Microscoapele electronice pot fi utilizate pentru vizualizarea pattern-urilor de difracţie a probelor. Un pattern de difracţie poate fi colectat din probe care conţin un motiv care se repetă. În cazul sferei goale gradientul va fi în direcţia opusă. Aceste proiecţii diferă deoarece gradul de întunecare a unei imagini este direct proporţional cu capacitatea materialului de a absorbi electronii. Într-un microscop electronic de transmisie electronii trec prin probă înainte de a impresiona ecranul şi conţin informaţii cu privire la structura internă a acestei probe. Observarea directă a imaginii de către utilizator are loc la nivelul unui ecran de fosfor. Figura 6. de exemplu din cristale bidimensionale. Sfera solidă va genera un disc întunecat la interior. dacă privim o sferă goală pe dinăuntru sau una plină. Contrastul dintr-o imagine ia naştere în urma interferenţei electronilor ce au unghiuri diferite. marginea fiind cea mai închisă. proiecţiile acestora vor diferi (figura 6). Pentru a înregistra imaginea se utilizează negative care sunt impresionate de fasciculul de electroni sau camere CCD (Charge Coupled Device) care traduc în format digital interacţiunile electronilor cu senzorul camerei. 333 . Colectarea imaginilor se poate face în diverse moduri. intensitatea diminuându-se spre marginile discului. Lentila intermediară determină vizualizarea imaginii sau a pattern-ului de difracţie pe ecran.

Figura 7. Deasupra platoului pe care sunt aşezate cele două foiţe de mică se află un fragment de sfoară de carbon conectată la un circuit de mare voltaj. După stabilirea vidului un 334 . Pentru a obţine un film continuu de Formvar o lamă de sticlă pentru microscopia optică este curăţată şi scufundată uniform în soluţia de Formvar. fiind des folosit în microscopia electronică. Există două metode pentru depozitarea filmului pe grile: una implică aşezarea grilelor pe suprafaţa filmului flotat pe apă. Principiul evaporării carbonului este unul foarte simplu. Pe această grilă se va depozita un film care va conferi suport specimenului. vedere superioară şi secţiune Filme de suport Filmul Formvar este un film de natură polimerică (formal de polivinil). Grilă de microscopie electronică. hexagon). iar a doua depunerea pe grile a filmului flotat. iar noile plăci sunt introduse cu partea proaspăt clivată în interiorul unei camere în care se va stabili un vid înalt.Tehnici de preparare a probelor Grile În cazul microscopiei electronice de transmisie specimenele sunt depozitate pe grile. aur. Filmele de carbon sunt foarte stabile.05 mm care prezintă o reţea. Ochiurile reţelei pot avea diferite dimensiuni şi forme (pătrat. Grilele sunt discuri de metal (cupru. Filmele de carbon Probele trebuie depuse pe un film care este foarte stabil sub acţiunea fasciculului de electroni. platină) având un diametru de 3. nichel. cei mai utilizaţi fiind cloroformul şi dioxanul. Feţele proaspăt clivate ale micăi sunt perfect plate din punct de vedere atomic ceea ce îmbunătăţeşte proprietăţile filmului de carbon. O foaie de mică este proaspăt clivată. Substanţa se găseşte sub formă solidă şi este solubilă în solvenţi organici.

Pentru ca o coloraţie să aibă efect trebuie să se lege de preferenţial anumite părţi ale probei. iar când voltajul este aplicat între anod şi catod potenţialul electronic ionizează aerul din încăpere. După coloraţie. Ionii negativi se vor depozita pe suprafaţa filmului de carbon. azot şi hidrogen. această nouă rază va interfera cu fasciculul iniţial şi contrastul se creează. Pentru a face filmele mai accesibile substanţelor aflate în soluţie apoasă carbonul trebuie hidrofilizat. oxigen. în acest moment carbonul se va evapora şi depozita pe mică formând un film continuu. proba se va usca şi va putea fi examinată la microscop. Depozitarea filmului de carbon are loc prin evacuarea vasului de apă. Plăcile de mică sunt imersate treptat în apă ceea ce permite filmului hidrofob să se desprindă. Coloranţii se bazează fie pe vopsele sau pe materiale foarte absorbante. În cazul glow discharching grilele sunt introduse într-o cameră parţial evacuată. contrastul specimenului este prea slab pentru ca ochiul uman să diferenţieze marginile şi detaliile probei observate. Grilele sunt aşezate pe o sită de metal într-un vas plin cu apă. Carbonul este o substanţă hidrofobă. Aceasta se poate realiza fie prin tratarea cu UV a grilelor sau prin glow discarching. În funcţie de cantitatea de energie absorbită intensitatea fasciculului care va impresiona ecranul diferă şi se va forma o imagine. pentru o vizualizare mai bună. În cazul probelor biologice care sunt formate din atomi precum carbon. iar dacă o picătură de apă este depusă pe suprafaţa unui astfel de film aceasta va avea tendinţa de a-şi micşora suprafaţa care întră în contact cu carbonul. Microscopia electronică de transmisie utilizează un fascicul de electroni de înaltă energie pentru a bombarda specimenul. cantitatea de energie absorbită este foarte mică comparativ cu energia fasciculului. în cazul acestei tehnici lumina care penetrează proba suferă o schimbare a fazei. Coloraţia negativă În cazul microscopiei. Alte metode se bazează pe colorarea probelor pentru evidenţierea unor caracteristici. probele sunt impregnate cu săruri de metale grele.curent se aplică sforii de carbon până când aceasta devine incandescentă. În cazul microscopiei optice se aplica contrastul de fază. datorită descoperirii graphene-ului şi a remarcabilelor sale proprietăţi se investighează aplicaţia acestui film în microscopia electronică. acestea nefiind foarte dense. Ionii de 335 . De aceea. uraniu sau tungsten. Coloraţia în cazul microscopiei electronice de transmisie se bazează pe săruri de metale grele derivate din molibden. În ultimii ani. Pentru a îmbunătăţi contrastul se folosesc diferite tehnici.

Coloraţia cu aceşti atomi grei se numeşte coloraţie negativă deoarece în microscop se va observa o zona neacoperită de colorant înconjurată de coloraţia negativă. Colorantul absoarbe electronii mult mai bine decât mediul înconjurător. iar apertura obiectiv îi va elimina pe cei care vor fi deviaţi la un unghi prea mare. Contrastul optim se obţine când coloraţia înconjoară complet specimenul si zonele adiacente. Alterarea datorită radiaţiei este irelevantă deoarece sărurile metalice nu sunt la fel de susceptibile la efectele electronilor precum molecule organice. În timpul uscării specimenul îşi pierde învelişul hidratant. 4 minute). electronii ce vor interacţiona cu atomii de metale grele vor fi puternic deviaţi. 336 Contra În timpul colorării particulele pot fi distorsionate. Pregătirea probei nu necesită aparatură şi nu ia mult timp (aprox. Excesul va fi îndepărtat cu ajutorul unei hârtii de filtru. Figura 8. Zona este neacoperită deoarece proba (proteina de exemplu) împiedică depunerea sării pe filmul de carbon. Contrastul apare în urma interacţiunii electronilor cu specimenul. Rezoluţia este limitată la 20 Å în condiţii optime. Aceasta corespunde cu mărimea granulei sării folosite pentru coloraţia negativă. ceea ce va determina contrastul şi rezoluţia imaginii. de aceea diferite regiuni ale probei pot avea diferite densităţi de electroni şi pot fi diferenţiate în proiecţiile obţinute. În figura 8 se observă o proteină colorată negativ. În cazul proteinelor menţinerea unei stări hidratate este importantă pentru păstrarea configuraţiei. Tehnica este una simplă: proba este depusă pe grilă şi lăsată câteva zeci de secunde urmată fiind de ‘’spălarea’’ grilei cu 3 picături de colorant.metale grele vor interacţiona cu electronii. Ca urmare a distribuţiei inegale a coloraţiei pot să apară artefacte. . Interacţiunea dintre un specimen (coloraţie negativă) şi fasciculul de electroni Avantaje şi dezavantaje ale coloraţiei negative Pro Contrast foarte mare. iar după uscare grila poate fi examinată.

dar capacitatea calorică este foarte mică. prin urmare forma observată este cea reală în stare nativă. Avantaje şi dezavantaje ale cryo-electronmicroscopiei faţă de coloraţia negativă Avantaje Specimenul este tot timpul în soluţie şi nu intră în contact cu suprafeţe. Procesul este laborios deoarece plonjarea grilei în recipientul de etan lichid trebuie să fie suficient de rapidă pentru a împiedica formarea gheţii cubice. Înregistrarea imaginilor pentru tomografie e dificilă deoarece prin rotire stratul de gheaţă expus este prea gros. apa din jurul probei va îngheţa. cristaline care va estompa detaliile specimenului. De aceea se preferă utilizarea etanului lichid. iar proba va fi protejată. Îngheţarea se face prin dropping a unei grile pe care proba este deja depozitată.Îngheţarea probei – metoda cryo Microscopia cryo este o tehnică prin care proba este îngheţată într-un refrigerent pentru o mai bună păstrare şi protecţie în timpul observaţiei. -195˚). Schemă a instalaţiei utilizate pt. Nu există colorant care să distorsioneze preparatul. sită o doză minimă de electroni penîngheţarea probei tru a evita alterarea probei datorită radiaţiei. Proba poate să aibă o orientare preferenţială pe grilă în cazul Dezavantaje Raportul semnal/zgomot este foarte mic deoarece absorbţia electronilor e scăzută. Doza recomandată e de 6-10 electroni/Å2. în momentul introducerii unei grile aflate la temperatura camerei fierbe ceea ce favorizează formarea gheţii cristaline. Azotul lichid are o temperatură ideală (aprox. Pentru a vizualiza proba în cryo-electronmicroscopie trebuie foloFigura 9. Pregătirea probelor necesită mult 337 .

338 . Imaginile SEM sunt utilizate într-o mare varietate media. ceea se asigură prezervarea probei. iar obţinerea gheţii vitroase în cazul cryo. Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) În cazul SEM. Imaginea se formează pe un ecran datorită electronilor care sunt reflectaţi de învelişul metalic. Deşi principala lui utilizare este de a obţine imagini topografice la o mărire cuprinsă între de 10-10000 de ori. de la jurnale ştiinţifice la reviste de popularizare şi filme. specimenele sunt acoperite cu un strat subţire de metal pentru ca electronii să fie reflectaţi. poate fi problematică. astfel se evită încărcarea electrică a probei. Prin intermediul microscopiei electronice de baleiaj se pot observa detalii de pe suprafaţa unui specimen. Acest înveliş metalic asigură o suprafaţă conductoare. 3. Fasciculul de electroni este concentrat şi utilizat pentru a scana suprafaţa obiectului observat. Microscopul electronic scanning (SEM) permite observarea şi caracterizarea materialelor organice şi anorganice heterogene la o scară cuprinsă între nanometri (nm) şi micrometri (µm). SEM-ul are o adaptabilitate mare. Se foloseşte doza minimă de electroni.coloraţiei negative. ceea ce se evită timp. Popularitatea SEM-ului e datorată capacităţii sale de a obţine imagini aparent tridimensionale ale suprafeţelor unei game largi de materiale. iar informaţiile privitoare la structura internă lipsesc.

pentru că aceştia variază în primul rând datorită diferenţelor topografice. sau care poate fi static pentru a obţine analiza unei singure poziţii. Aceste semnale se obţin din emisii de volum specifice probei şi pot fi folosite pentru a examina multe caracteristici ale probei (topografia. rezoluţii instrumentale cu ordin de 1-5 nm (10-50 Å) se folosesc azi ca rutină la instrumente comerciale. La SEM. această calitate a SEM-ului fiind cea mai apreciată de către un utilizator. Cele mai multe micrografii SEM se efectuează la măriri sub 8000 de ori. Evoluţia SEM-ului şi capacităţile specifice ale instrumentelor comerciale moderne se vor discuta în cele ce urmează. Analiza acestor raze emise de către probă poate scoate în evidenţă atât caracteristici calitative cât şi informaţii cantitative de element. precum şi efectului de umbră dat de contrastul electronilor secundari şi reflectaţi. Emisia de electroni secundari. suprafaţa de examinat sau microvolumul de analizat este iradiată cu un fascicol îngust de electroni. ca şi rezultat al bombardamentului de electroni. O altă caracteristică importantă a SEM-ului este adâncimea câmpului. Semnalele de imagine de cel mai mare interes sunt electronii secundari şi reflectaţi.).La SEM. Cu cât e mai mare această adâncime a câmpului cu atât se furnizează mai multe informaţii despre specimen. se emit şi raze X caracteristice. care poate fi trecut în raster (linie cu linie) deasupra suprafeţei specimenului pentru a forma mai multe imagini. permite formarea de imagini la o rezoluţie apropiată de cea a mărimii fascicolului de electroni. electroni reflectaţi. Un motiv puternic pentru utilitatea SEM-ului este rezoluţia mare ce poate fi obţinută când sunt examinate obiecte voluminoase. compoziţia etc. unde aparatul ope339 . aleasă la diferite valori ale energiei razei de electroni. regăsiţi într-un volum foarte mic în apropierea zonei de impact a fascicolului. Capacităţi de imagistică Microscopul electronic scanning este unul dintre cele mai versatile instrumente disponibile pentru examinarea şi analizarea caracteristicilor microstructurale ale obiectelor solide. din regiuni ale unui specimen având mărimea de 1µm în diametru şi 1µm în adâncime (în condiţii normale de operare). Tipurile de semnale rezultate din interacţiunea fascicolului cu probă includ electroni secundari. care e cea responsabilă în parte pentru aparenţa tridimensională a imaginii specimenului. cristalografia. raze X caracteristice şi alţi fotoni cu energii variate. Aparenţa tridimensională a imaginii se datorează unei adâncimi mari a câmpului microscopului electronic.

Mullan a fost urmat de Smith (1956) care a observat că procesarea semnalului ar putea îmbunătăţi micrografiile. Dar. această metodă a fost considerată neincitantă şi dezvoltarea pe această ramură a stagnat. Astfel. proprietate foarte utilă în studii de criminalistică şi nu numai.Mullan au construit primul lor SEM care până în 1952 a atins rezoluţia de 50 nm. Colectorul a fost înclinat pozitiv aproximativ cu 50 V înspre specimen şi al doilea curent acumulat în el a produs o cădere de tensiune de-a lungul unui rezistor. W. Alte utilizări ale SEM-ului au fost dezvoltate în această perioadă. În plus. Principalele componente ale SEM-ului sunt sistemele de lentile. Spre exemplu. Atât aspectele teoretice cât şi cele practice ale STEM-ului au fost explicate în detaliu de către von Ardenne. De asemenea a îmbunătăţit sistemul de scanare prin introducerea de scanare prin dublă deflecţie. prin comparaţie cu performanţele obţinute atunci cu TEM-ul în continuă perfecţionare. şi a introdus amplificarea neliniară a semnalului. Schimbarea multiplicatorului de electroni cu mult mai eficientul fotomultiplicator a crescut cantitatea semnalului colectat şi a rezultat un mai bun raport semnal-zgomot. Ei au adăugat un scintilator pentru a converti electronii în lumină. C. Mc. mai târziu Wells (1959) a făcut primele studii ale efectelor penetrării fascicolului cu scopul formării imaginii la SEM. Autorii au realizat că emisia de electroni secundari este cea responsabilă pentru contrastul topografic. de către Everhart şi Thornley (1960). astfel s-a obţinut o rezoluţie de aproximativ 50 nm. Primul SEM utilizat să examineze specimene dense a fost descris de Zwokyn şi col. şi părţile electronice asociate. pentru că imaginea SEM vine cu informaţii adiţionale imaginii obţinute la microscopul optic. tunul. şi primul care a utilizat perechi 340 . Oatley şi Everhart au putut observa pentru prima dată contrastul de voltaj. Mc. mecanisme de contrast mai slab ar putea fi mai bine studiate. (Smith. care a fost apoi transmisă printr-o ţeavă de lumină direct pe suprafaţa fotomultiplicatorului. colectorul de electroni. şi a fost primul care a inclus un stigmator în SEM. iar aparatul său includea multe instrumente care de atunci au devenit standard. SEM-ul are capacitatea de a analiza la măriri foarte mici. 1956) Următorul pas înainte a fost refacerea detectorului secundar de electroni.rează bine în limitele propriilor capacităţi de rezoluţie. Oatley şi studentul său D. A urmat apoi von Ardenne (1938) care a construit microscopul electronic scanning de transmisie (STEM) prin adăugarea unei lentile de baleiere la microscopul electronic de transmisie (TEM). tubii catodici fotocolectori de raze. (1942). Prima lucrare recunoscută ca descriind conceptul de microscop electronic scanning este cea a lui Knoll (1935). În următorii câţiva ani.

În anii ce au urmat mai mult de 50 000 de unităţi SEM au fost vândute de către producători din S. aceste microscoape şi-au găsit utilitatea în numeroase domenii de cercetare şi tehnologie în care rezoluţia înaltă şi energia mică a sursei sunt importante.A. Odată stocată în format digital imaginea poate fi procesată în multe moduri. Sursele de electroni au nevoie totuşi de vid de ordinul a cel puţin 10-8 Pa pentru a opera într-un mod de încredere. cu trei lentile magnetice. Germania şi Franţa.. De la primul aparat comercial din 1965 s-au făcut numeroase îmbunătăţiri. 1972). care conţinea şi sistemul detector Everhart-Thornley. 341 .Stereoscan” (Cambridge Scientific Instruments Mark I). Acest aparat a devenit primul prototip comercial numit . şi astfel de nevoi cer o atenţie specială tehnologiei de vidare. A. Marea Britanie. printate sau reţinute pe un CD sau alte unităţi de memorie. obţinându-se astfel o rezoluţie mai bună. una din ele fiind dezvoltarea surselor de lumină puternică precum catodul de hexaborid de lantan (LaB6).stereografice pentru a produce imagini tridimensionale la SEM. Japonia. Olanda. Cu toate că au crescut costurile şi complexitatea SEM-urilor cu emisie de curent. oferă microscopistului o mare flexibilitate şi uşurinţă în utilizarea SEM-ului. Disponibilitatea unor computere puternice şi ieftine dotate cu capacitate de stocare mare şi pachete de soft capabile de o varietate mare de procesări şi funcţii pentru imagini digitale. Imaginile pot fi observate pe un ecran. 1960) Pease a construit un sistem cunoscut ca SEM V. s-a dezvoltat în aşa măsură încât poate fi acum folosită pentru imagini de cea mai înaltă rezoluţie. D. Această lumină puternică permite pătrunderea a de 1000 de ori mai mulţi electroni pe cele mai mici dintre probe. Cu această sursă o mai mare cantitate de electroni au putut fi concentraţi pe o suprafaţă mai mică. precum prin amplificare non-lineară. G. (Wells. Majoritatea SEM-urilor sunt dotate cu capacitatea de a stoca imagini digitale. utilizată pentru prima dată la SEM în 1942. la nivel de rutină. Avantajul tunului de emisie este dimensiunea sa mică astfel încât poate fi obţinută o imagine a unei probe de 1 nm. deşi în aparatele mai vechi imaginile încă se mai fac prin fotografierea tubului catodic de raze. decât filamentele convenţionale de tungsten. Sursa de emisie de electroni. Alte avansări în utilizarea SEM-ului includ mecanismele de contrast precum contrastul prin canalizarea electronilor produs prin variaţii în orientarea cristalografică şi contrast magnetic produs din domenii magnetice din materiale uniaxiale şi cubice. Stewart şi coechipierii de la compania Cambridge Scientific Instrument au finalizat design-ul comercial şi împachetarea produsului (Oatley..U. diferenţiere etc.

1991. Totuşi. care au fost suficient de puternice pentru a rezista procesului de vidare fără să se deformeze (Smith şi Oatley. dezvoltările în domeniul biologic au depins de avansarea în prepararea specimenului. şi acoperirii lor cu un strat subţire de material conductor. Una dintre cele mai importante descoperiri recente este microscopul electronic scanning cu presiune variabilă (VPSEM). aşadar. 1993). În formatul său modern. Un sistem diferenţial de pompare a vidului este folosit pentru a menţine tunul de electroni la vid înalt în timp ce specimenul este sub o presiune mai mare. Această capacitate se foloseşte de difracţia electronilor reflectaţi de pe suprafaţa specimenului (Schwartz şi col. se pot efectua experimente în aparat în care suprafaţa specimenului poate interacţiona cu atmosfera gazoasă. termolabile. În plus. Imaginile tridimensionale permit interpretarea corectă a caracteristicilor morfologice şi măsurarea lor. Probele biologice sunt ideale pentru studiul la acest aparat. Dimensiunea mare a adâncimii câmpului întâlnită la SEM face posibilă observarea tridimensională a obiectelor utilizând stereoscopia. suprafaţa specime342 .2. Au apărut echipamente care permit evaluarea cantitativă a suprafeţei şi urmărirea în timp real şi de înaltă rezoluţie a specimenului prin intermediul SEM-ului. Dezvoltarea procesărilor la temperaturi scăzute a ajutat la reducerea pierderii de masă şi a distrugerilor termice la specimenele sensibile (Echlin. pentru că mediul înconjurător specimenului nu mai este nevoie să fie la vid înalt (Danilatos. uscat sau umed. de contrast mic şi emisivitate de electroni slabă şi sunt. S-a dat multă atenţie la stabilizarea materialelor organice delicate.20 torri). şi este cunoscută sub numele de difracţie electrono-reflectată (EBSD). Pentru a colecta maximum de intensitate în modelul de difracţie. Mediul poate fi alcătuit din vapori de apă sau alte gaze în intervalul de 25-2500 Pa (0. îndepărtării sau imobilizării fluidelor celulare. Acest tip de aparat permite examinarea suprafeţelor a aproape oricărui tip de specimen. 2000). Majoritatea materialelor biologice sunt umede. sensibile la radiaţii. VPSEM-ul poate detecta electroni secundari şi retroîmprăştiaţi la fel de bine precum razele X. 1992).. Mai târziu Thornley a prezentat imagini SEM ale materialelor uscate prin îngheţare şi analizate la 1 keV pentru a evita încărcarea electrostatică. slabi conductori. Analiza structurală Una din cele mai promiţătoare dezvoltări din domeniul SEM-ului este abilitatea de a determina structura cristalină şi orientarea lor pe suprafaţa specimenelor preparate. 1955).Printre primele micrografii scanate au fost câteva materiale biologice precum carcasa unor insecte sau fibre lemnoase.

cei doi oameni de ştiinţă treceau fascicolul brusc pe suprafaţa probei. Recunoaşterea complexităţii transformării intensităţii razelor X în compoziţie chimică a dus la perfecţionarea analizei cantitative de către numeroşi investigatori pe parcursul ultimilor 50 de ani. Castaing sub îndrumarea lui A.1. Intensitatea modelului reflectat Kikuchi este relativ mică. Castaing nu numai că a demonstrat că o analiză chimică localizată poate fi desfăşurată pe suprafaţa specimenului.microsondă electronica”(Castaing. 1947).. Dezvoltarea unui instrument de analiza chimică localizată a probelor solide (EPMA) s-a produs deodată cu apariţia SEM-ului. Analiza elementală SEM-ul poate fi utilizat pentru a obţine informaţii legate de compoziţie folosind razele X caracteristice. de aceea e nevoie de camere ultrasensibile şi senzori fini de captare a contrastului.A. iar primul aparat comercial a fost introdus de CAMECA în Franţa în 1956.. Optica electronică era formată dintr-un tun electronic urmat de lentile convergente ce formau o sondă electronică cu un diametru de 0. Cosslett şi Duncumb (1956) au construit primul microanalizor electronic scanning de probe la Laboratoarele Cavendish în Cambridge. adăugarea 343 .1 µm pe specimen. Conceptul unui microanalizator electronic de probe a apărut în anii 1940 (Hillier. aşa cum se face azi în SEM-rile actuale.U. Dacă până atunci microprobele electronice operau cu fascicole statice de electroni. În timpul anilor 1950 câteva aparate EPMA au fost dezvoltate în laboratoare din Europa şi S. precum şi contrastul semnalului. În teza sa de doctorat.Guinier au descris şi construit un instrument numit . Cea mai recentă descoperire în aplicaţia modelului Kikuchi la volume de analizat este dezvoltarea sistemului de înregistrare a modelului folosind o cameră video de înaltă sensibilitate sau mai recent o cameră video tensio-cuplată (CCD). şi de abia în 1949 R. 1951). dar a şi subliniat modul în care această informaţie poate fi cuantificată. Aceste pattern-uri sunt mai apoi analizate printr-o metodă de indexare asistată de computer. Indexarea automată a modelelor şi cartarea orientării straturilor de cristale asistată electronic permite identificarea fazelor de cristalizare şi arată orientarea greşită printre limitele cristalelor. De asemenea mai făcea parte din aparat şi un microscop optic pentru găsirea corectă a punctului de analiză şi una sau mai multe spectrometre WDS pentru analizarea intensităţii radiaţiei X emise în funcţie de energie. Deşi conceptul de analiză locală cu raze X este în sine un stimulent pentru folosirea microanalizatorului.nului este dintr-o dată răsucită la un unghi de 70º faţă de orizontală.

pe lângă analiza calitativă rapidă. pe când WDS-ul este utilizat pentru detecta razele X ale elementelor minore (<10 wt%) sau chiar pentru a le recunoaşte în probă. detectorii din derivaţi de silicon.1968). Detectorii de raze X se bazau pe o formă solidă de silicon derivat de litiu [Si (Li)]. Proba este analizată fără a fi afectată şi analiza cantitativă poate fi obţinută la o rezoluţie spaţială de 1 µm pe probă. având şi lentile optice şi una şi mai multe unităţi WDS. un microscop optic pentru observarea suprafeţei specimenului şi un fascicol de curent de electroni care se stabilizează prin analiza de raze X. printr-o analiză normală cu fascicolul de electroni se obţine o acurateţe de 1-2% (5-10% la probele biologice) din cantitatea respectivului element prezent. s-au făcut numeroase îmbunătăţiri. În plus. printre care o descoperire a fost de mare importanţă: difracţia cristalelor din moleculele organice cu spaţieri mari interplanare 344 . Adăugarea unui spectrometru EDS la microanalizorul electronic pentru a măsura razele X a atras atenţia asupra nevoii utilizării lui şi în cadrul SEM-ului (Fitzgerald şi col. Atracţia acestei forme de acumulare a informaţiei este detaliul microcompoziţional ce poate fi corelat cu metalografia optică şi electronică. două sau mai multe spectrometre de lungime de undă (WDS). Un EPMA modern are în mod normal capacităţile unui SEM. Pentru probe plate şlefuite. Într-un SEM tipic echipat cu detectori EDS şi WDS. toate găsind o tot mai mare utilizare în cadrul SEM-ului. Câteva dintre acestea cuprind microcalorimetria în raze X. câteva descoperiri recente au dat noi tendinţe în conceptele de detectori şi design. În anii ce au urmat de la prima apariţie a EPMA-ului. O altă însuşire importantă a SEM-ului cu EDS şi WDS este capacitatea de cartare compoziţională folosind raze X caracteristice. EDS-ul e utilizat pentru a analiza razele X caracteristice elementelor majore (>10 wt%).conceptului de scanare a fost o contribuţie foarte semnificativă. Sistemul EDS oferă o modalitate rapidă de analiză a elementelor constituente în probă.. prin spectrometrie EDS de raze X se mai poate realiza şi o analiză cantitativă foarte fină. După ce pentru mulţi ani principalele linii de concentrare au fost în direcţia dezvoltării tehnologiilor existente. Spectrometrele dispersive de energie moderne sunt capabile de detectarea razelor X caracteristice ale tuturor elementelor cu număr atomic mai mare decât 4. Marea majoritate a SEM-urilor vândute azi sunt echipate cu capacităţi EDS. la curenţi tipici utilizaţi la imagistica electronică secundară a SEM-ului. dar azi EPMA-ul este considerat a fi un echipament aparţinând SEM-ului. SEM-ul şi EPMA-ul au fost considerate aparate separate pentru încă un deceniu. şi utilizarea de spectrometre de cristale plate împreună cu optică capilară X-ray.

în care efectele absorbţiei şi de fluorescenţă sunt neglijabile.(Henke. produsă din interacţiunea electronilor cu specimenul a fost asociată cu prezenţa unor impurităţi în material (Long şi Agrell. Măsurarea catoluminiscenţei a devenit azi o parte importantă a SEM-ului mai ales în industria microelectronicelor. De exemplu. 1966). C. După ce s-a observat capacitatea de măsurare a razelor X care poate fi extinsă şi la specimene nonmetalice. O) ce pot fi măsurate de spectrometre dispersive de lungime de undă. în plus preparatorul trebuie să fie foarte atent ca elementele pentru măsurat să rămână în cadrul punctului de analiză şi să nu se îndepărteze sau să dispară pe parcursul preparării. Efectele de suprafaţă pot fi mai uşor de măsurat. În plus. 1965). fac aproximările succe345 . deşi intervine problema contaminării cu carbon din cauza vacumizării slabe a SEM-ului. a apărut ipoteza folosirii şi altor tipuri de fenomene de excitaţie. Avantajul energiei mici a fascicolului de electroni este că apare posibilitatea minimizării dimensiunii sursei de raze X şi a minimizării efectului de absorbţie în procedura cantitativă. culoarea luminii vizibile (catodluminiscenţa). În ultima vreme. S-au creat programe care pot să convertească raportul intensităţii razelor X în compoziţii chimice. în primul rând datorită faptului că unii parametri de corecţie sunt funcţie de concentraţie şi. 1965). Totuşi materialele biologice sunt mult prea uşor afectate de fascicolul de electroni şi astfel că în deceniile trecute s-a depus mult efort în instrumentare precum şi în procedurile preparative şi analitice cum sunt analiza la temperatură scăzută. Aceste cristale eliberează raze X cu lungime mare de undă din elementele cu număr atomic mic (B. se mai poate studia şi emisia de fotoni vizibili din recombinarea excesului de perechi de goluri de electroni dintr-un semiconductor (Kyser şi Wittry. Microanaliza în raze X a materialelor biologice şi polimerice întâlneşte aceiaşi problemă în examinarea probelor la SEM. aparatele au fost construite să permită posibilitatea unei analize de încredere cu fascicol de electroni si raze X de energie mică. Utilizarea tot mai intensă a computerului împreună cu SEM-ul a crescut calitatea şi cantitatea de informaţii adunate prin intermediul aparatului. Ele se bazează pe analiza unor secţiuni subţiri. Capacitatea de a detecta elemente cu număr atomic mic le dă utilizatorilor de EPMA posibilitatea de a investiga numeroase noi probleme ale aparatului. Recent au fost dezvoltaţi difractori mari de spaţii interplanare ce utilizează depunerea fizică alternativă de straturi de vapori de elemente grele şi uşoare. metodele cantitative sunt în principiu simple. N. prin urmare. Deşi prepararea specimenului biologic este mult mai exactă decât procedura pentru alte ştiinţe.

Dezvoltarea cartării compoziţiei cantitative este un alt punct forte în legătura dintre imagistică. Aceste programe derulează calcularea compoziţiei în câteva secunde şi astfel operatorul se bucură de mai multă flexibilitate în obţinerea rezultatelor. la cartarea cantitativă de compoziţie. Automatizarea e de mare ajutor în operaţiunile repetitive. 346 . pentru fiecare rază discretă din suprafaţa scanată. şi spectrometrele. capacitatea de analiză cantitativă a elementelor şi utilizarea automatizată computaţională a SEM-ului. şi îi permite operatorului să se concentreze pe evaluarea analizelor. Imaginile rezultate sunt hărţi compoziţionale şi au la fiecare element constitutiv (pixel) valoare numerică completă a concentraţiei. Valorile concentraţiilor corespunzătoare poziţiei razelor pe specimen sunt asamblate într-o imagine digitală cu un procesor de imagini prin codificarea axelor concentraţiei cu nuanţa de gri corespunzătoare. În acest fel analistul poate să revadă analizele corespunzătoare fiecărui pixel sau şir de pixeli. iar hărţile pot fi corelate cu imagini SEM preparate prin oricare alt fel de semnal.sive necesare. Se face câte o analiză completă executată de calculator. creşte numărul analizelor efectuate. În plus programele pot acum să controleze fascicolul de electroni. mişcarea specimenului.

..... Microscopia electronică de transmisie. luarea în calcul a tratamentelor la care este supusă proba până la ajungerea în faza de examinare....... în general. iar marcarea antigenilor de suprafaţă se poate realiza cu uşu347 ....... problemele preparării probelor biologice au rămas mult în urma îmbunătăţirilor aduse performanţelor microscoapelor electronice..................... absolut necesare pentru obţinerea unor imagini utilizabile.. fiind una din cele mai uşoare şi mai rapide proceduri pentru detectarea virusurilor....5 nm pentru specimenele biologice s-ar putea realiza prin utilizarea acestui STEM........0 nm.............. răspunzătoare de acurateţea interpretării imaginilor.... 359 Din păcate. Atâta vreme cât artefactele inevitabile sunt interpretabile.... eliminându-se astfel nevoia contrastării. virusurilor...... performanţă uşor de atins acum pentru materiale anorganice.......... 349 2.......... Depăşirea barierei de 1..... acestea sunt acceptate..2 nm) a permis vizualizarea unui singur atom de metal greu.Microscopia electronică ........ nu sunt mai bune de 1...... iar înţelegerea acestora este esenţială pentru extrapolarea detaliilor oferite de microscop la situaţia existentă in vivo....... Pe lângă metodele clasice de contrastare a probelor biologice.... O imagine electronomicroscopică este diferită de situaţia reală din organismul viu....... Plaja efectelor induse de diferitele tratamente premergătoare analizei electronomicroscopice este foarte largă.. virusuri cu ultrastructuri similare pot fi diferenţiaţi cu sensibilitate mare.. coloraţia negativă este cea mai utilizată metodă pentru vizualizarea topografiei şi structurii bacteriilor.. Când microscopia imunoelectronică este folosită în conjuncţie cu coloraţia negativă............. Microscopia electronică de baleiaj . în timp ce detaliile probelor biologice.. gradul alterării probei depinzând foarte mult de tehnica de pregătire a materialului biologic... ce oferă un contrast superior şi mai multe tipuri de informaţii simultan sau prin utilizarea câmpului întunecat într-un TEM convenţional.... fiind necesară.... Lucian Barbu-Tudoran Cuprins 1. organitelor celulare izolate (inclusiv membrane) şi macromoleculelor..partea a II-a şef lucrări dr. deci.......5 – 2......... Dezvoltarea unui microscop electronic de baleiaj şi transmisie (STEM) de înaltă rezoluţie (0......

microscopia probelor colorate negativ este o metodă importantă pentru investigarea structurii tridimensionale a proteinelor cristalizate. scopul acestora fiind de a stabiliza ultrastructura celulei aşa cum există in vivo. deşi. chiar la 370C. Dintre avantajele fixării cu căldura microundelor menţionăm: capilarele pulmonare interstiţiale nu colapsează cum se întâmplă în cazul fixării cu formaldehidă. iar ca dezavantaje: deteriorarea eritrocitelor din ţesuturile nefixate. în timp ce cele din zona profundă vor fi subfixate. artefactele dependente de timp. cu o frecvenţă de 2. precum şi în cazul nivelelor scăzute de virusuri. în special. În plus. Microundele sunt unde electromagnetice generate. dar suficientă pentru a interacţiona cu cele necovalente cum sunt legăturile sterice (legături de H şi interacţiuni van der Waals). pentru detecţia virusurilor foarte mici. De asemenea. antigenilor virali şi a anticorpilor. pe lângă beneficiile crioprotecţiei. oscilaţia dielectrică a moleculelor de apă şi o energie a fotonului de 10-5 eV.rinţă prin colorarea imunonegativă. şi aici există pericolul producerii de artefacte în intervalul de temperatură dintre cea fiziologică şi cea de imobilizare. Unele din acestea pot fi evitate prin fixarea cu aldehide într-un cuptor cu microunde. esenţiale funcţiilor biologice. Undele electromagnetice sunt radiaţii neionizante ce produc deplasări moleculare prin migrarea ionilor şi rotirea moleculelor dipolare.4 cm. Cea mai bună soluţie rămâne combinarea celor două metode. cromatina este mult mai distinctă în ţesuturile tumorale. crioelectron . ce includ răcirea ultrarapidă a celulelor şi ţesuturilor. vitrificarea nefiind uşor de realizat. astfel. Fixarea pieselor de dimensiuni mari prin metode convenţionale prezintă un gradient de calitate a fixării. respectiv. straturile superficiale pot fi suprafixate. sunt o alternativă la fixarea chimică. Coloraţia negativă a probelor deshidratate prin îngheţare ar putea evidenţia ultrastructura virusurilor şi a membranelor fără colapsul specimenului. picornavirus şi parvovirus. obişnuit. cum ar fi contractarea sau umflarea probelor şi extracţia componentelor celulare datorate difuziei lente a fixatorilor. apar destul de des. energie prea mică pentru a afecta legăturile covalente. 348 . Marcarea imunogold în combinaţie cu coloraţia negativă au un potenţial considerabil în detectarea virusurilor. Un marker de aur coloidal este util. dilatarea excesivă a secţiunilor anumitor ţesuturi (limfoid). fixarea cu glutaraldehidă într-un cuptor cu microunde. O altă abordare este utilizarea coloraţiei negative în combinaţie cu vitrificarea pentru realizarea unui contrast crescut.45 GHz (1 GHz = 109 cicluri / sec) şi prezentând o lungime de undă de 12. Criotehnicile.

Microscopia electronică de transmisie Principalele etape de a căror acurateţe depinde foarte mult obţinerea unor informaţii cât mai apropiate de situaţia reală din celula vie. cu latura de maxim 1 mm. acţionate în sens contrar pentru a se evita lezarea mecanică (zdrobirea/sfâşierea) ţesutului.7-3% (primul agent fixator). principalul agent de fixare utilizat în microscopia electronică de transmisie. până la secţionare. Pentru menţinerea neschimbată a ultrastructurii – deci păstrarea ei identică cu cea din momentul sacrificării animalului. examinarea şi developarea suporturilor fotografice. Începând cu această etapă. se vor desfăşura sub nişă. fixarea. Din fragmentele aflate pe glutaraldehidă se taie foarte repede cuburi mici. Se prelevează fragmente suficiente pentru prepararea a câte 3 blocuri/probă (adică cel puţin 6 cuburi). sunt următoarele: recoltarea. datorită toxicităţii mari a reactivilor cu care se lucrează. contrastarea. Pentru decuparea cuburilor se recomandă folosirea a două lame de ras noi. Dimensiuni mai mari nu ar permite penetrarea pieselor de către tetraoxidul de osmiu. deshidratarea. includerea. Acesta nu fixează corespunzător la o profunzime mai mare de 0.1 M. Prefixarea Prefixarea se efectuează cu o soluţie de glutaraldehidă 2-6% (2. secţionarea. FIXAREA Procesul de fixare asigură stabilizarea structurii biologice cât mai aproape de starea nativă. modelarea.5 mm. se trec rapid pe glutaraldehidă 2. Rezultate foarte bune se obţin dacă. RECOLTAREA Recoltarea fragmentelor de ţesut trebuie efectuată foarte rapid (1-2 min) după sacrificarea animalelor pentru a se împiedica instalarea unor alterări morfo-funcţionale la nivelul ţesutului. nepermiţându-se deteriorarea arhitectonicii ultrastructurale. încapsularea. toate celelalte operaţii. înainte de prelevarea acestuia din organismul animal.1.7%) în Tampon fosfat 0. cu ajutorul unor agenţi capabili să creeze legături încrucişate între moleculele constitutive ale materialului prelucrat. Se realizează o fixare chimică a pieselor. A. înainte de recoltare. fragmentele recoltate la rece (pe gheaţă). se pipetează soluţia de glutaraldehidă pe suprafaţa organului de inte349 . cu doi agenţi fixatori la 4ºC. Este indicată pipetarea soluţiei de glutaraldehidă peste organul ce urmează a fi recoltat.

apă distilată 350 1. pătrunde mai uşor şi acţionează rapid asupra ultrastructurii preparatului.1 M se prepară după reţeta: .154 g (18.res. posibilitatea perfuziei ţesuturilor cu fixator. formând punţi încrucişate şi punţi intermoleculare. respectiv introducerea fixatorului în circulaţie. la 280 nm.036 g) Până la 500 ml 2 ml 10 ml 4.NaH2PO4 · H2O (NaH2PO4 · 2H2O) . După 15-30 minute se schimbă glutaraldehida şi se continuă fixarea timp de încă 1-2-3 ore în funcţie de consistenţa ţesutului. de asemenea. în soluţie apar polimeri ai glutaraldehidei. Există.Tampon fosfat 0. Deci glutaraldehida 25% (sau 50%) stoc se va păstra numai la frigider.5 ml glutaraldehidă. Dacă este ţinută la temperatura camerei. Glutaraldehida este primul fixator utilizat curent. Glutaraldehida [O=CH-(CH2)3-CH=O] are proprietatea de a lega grupările active de hidrogen.4 .Glutaraldehidă (25%) pentru microscopie electronică . Ele se acoperă cu dop (de cauciuc rezistent) – care nu se va fărâmiţa sub acţiunea substanţelor ce se vor folosi. acestea sunt trecute în tuburi de sticlă şi păstrate timp de 15-30 minute în 1-1. permite o mai uşoară manipulare a preparatului. urmate de spălare abundentă cu apă distilată). Tuburile de sticlă cu care se lucrează vor fi foarte curate (bine spălate cu detergent şi amestec sulfocromic. După obţinerea cuburilor de ţesut.Na2HPO4 anhidru (Na2HPO4 · 12H2O) .37 g (1.1 M pH 7. deoarece este mai puţin toxic. prepararea soluţiei 2. conferind astfel o mare stabilitate structurilor celulare cu care vine în contact. iar fixarea se va face la 4ºC. Glutaraldehida pură prezintă un singur vârf de absorbţie în UV. asigurându-se astfel o răspândire rapidă a acestuia la nivelul ţesuturilor. în special de la alcooli şi grupările amino. Glutaraldehida se utilizează în soluţie apoasă 2.56 g) 7. care vor avea un nou vârf de absorbţie la 235 nm.7% preparată extemporaneu după reţeta: .Apă distilată Tamponul fosfat 0.7% se va face extemporaneu. Prin urmare va prezerva foarte bine ultrastructura celulară şi activitatea enzimatică a celulelor.2 ml .(din moleculele proteice) şi imino-.

351 . Culoarea unei soluţii proaspete de OsO4 este galben pal. se adaugă o soluţie proaspătă de OsO4 în care piesele vor mai sta timp de 85 minute. pe care o colorează prin depunerea osmiului.15 M se prepară după reţeta: . Se închide sticla şi se agită puternic până la spargerea fiolei.1 M.15 M. Rolul acidului osmic este de a stabiliza atât proteinele cât şi bistraturile lipidice.4 în 4 băi succesive a câte o oră (în a patra baie piesele se pot ţine peste noapte). pH 7. După înlăturarea tamponului fosfat. Există cazuri când fixarea a fost prelungită peste noapte pentru fiecare fixator.4. pH 7. prezervarea structurii fine a celulelor şi stabilizarea acestora pentru a face posibile etapele ulterioare de preparare în scopul vizualizării în microscopul electronic de transmisie. dar şi de a mări contrastul la nivelul ultrastructurii ţesutului. pentru 15 minute.139 g) .NaH2PO4 · H2O (NaH2PO4 · 2H2O) 2. în tuburile cu piesele prefixate şi spălate se adaugă cel de-al doilea agent fixator. Dacă prefixarea s-a făcut la frigider. Se înlătură această soluţie. poate rezulta un precipitat electron-dens care dăunează calităţii preparatului. Postfixarea Postfixarea se realizează cu tetraoxid de osmiu (OsO4) 1-4% în funcţie de consistenţa ţesutului de studiat. şi anume. este foarte important a se înlătura prin spălare orice urmă de glutaraldehidă. după care se lasă 24 ore la 4ºC pentru dizolvarea completă. C. conţinând 50 ml tampon fosfat 0. iar trecerea soluţiei în alte flacoane se va face numai prin răsturnare. la post-fixare lipidele din membrane nu se vor fixa bine cu OsO4.15 M pH 7. Prin procedura de fixare menţionată se urmăreşte stoparea proceselor metabolice din ţesturi. cu dop rodat. şi spălarea se va face în aceleaşi condiţii. În plus. Se va evita contactul soluţiei cu obiecte metalice. Tamponul fosfat 0. o soluţie 1% (sau 2%) de OsO4 în Tampon Fosfat 0.4. După îndepărtarea glutaraldehidei se adaugă peste piese (care nu vor rămâne niciodată neacoperite) tampon fosfat 0.765 g (27.064 g (2. ale cărei reziduuri vor împiedica legarea osmiului.Na2HPO4 anhidru (Na2HPO4 · 12H2O) 10. Prin reacţia posibilă între cele două substanţe fixatoare aplicate succesiv. dacă urmele de aldehide nu sunt eliminate din ţesut.apă distilată Până la 500 ml OsO4 2% se prepară astfel: 1 g OsO4 se trece într-o sticlă foarte curată.B.366 g) . Spălarea După prefixare.

În cazul fixărilor succesive duble. 80% timp de 30 minute. DESHIDRATAREA În vederea includerii pieselor (pentru a se putea efectua secţiunile ultrafine) se utilizează răşini epoxidice: Vestopal W sau Epon 812 care sunt substanţe organice hidrofobe. este necesar ca toată apa introdusă în timpul spălării în piese să fie extrasă fără a produce modificări în structura moleculară a celulelor. 100% (anhidră) timp de 15 minute. 100% (anhidră) timp de 15 minute.4. La includerea în Epon 812 pot urma două băi de oxid de propilen de câte 15 minute fiecare. Dacă fixarea s-a făcut la frigider. Prezenţa urmelor de fixator în ţesut facilitează reacţii între acesta şi soluţiile de solvenţi organici folosite la deshidratare. dioxan sau toluol în etapele finale. După îndepărtarea tetraoxidului de osmiu se adaugă peste piese (care nu vor rămâne niciodată neacoperite) Tampon Fosfat 0. deoarece alcoolul sau acetona se evaporă uşor şi piesele pot suferi procese 352 . Când se ajunge la etapele finale. 90% timp de 30 minute. înlocuirea solventului trebuie făcută foarte rapid. spălarea trebuie efectuată după fiecare fixator folosit. pentru o cât mai bună includere. Până la concentraţia de 70% se lucrează la temperatura de 4ºC după care tuburile vor putea fi păstrate la temperatura camerei. şi spălarea se va face în aceleaşi condiţii. Cantitatea de soluţie folosită pentru fiecare etapă de deshidratare trebuie să fie de 2-5 ml în funcţie de numărul pieselor din fiecare flacon. în 4 băi succesive de câte o oră (în a patra baie piesele se pot ţine peste noapte). Deci.D. Pentru deshidratare se utilizează acetona (pentru epon se poate folosi şi alcoolul etilic) şi în unele cazuri oxidul de propilen. 70% timp de 30 minute. Extragerea apei se face treptat şi în timpi scurţi pentru ca procesul să nu fie însoţit de alterări structurale (eventuale extracţii de proteine din ţesut). Spălarea După terminarea procesului de fixare pe cale chimică trebuie să urmeze imediat spălarea pentru înlăturarea totală a excesului de fixator din ţesut. pH 7.15 M. 50% timp de 15 minute. în soluţii apoase de concentraţii crescătoare: 30% timp de 15 minute. cu urmări asupra polimerizării blocurilor la includere. 100% (anhidră) timp de 15 minute.

În cazul cercetărilor de localizare enzimatică. etc. 3:1 şi în Vestopal (Epon) pur. fiind foarte fluid şi miscibil cu aceste răşini. În cazul includerii cu răşini epoxidice. 2:1. care înlocuieşte substanţa în care se efectuează deshidratarea. fiind mai volatil. 1:1. răşini poliesterice şi unele răşini epoxidice. A. Există şi medii de includere hidrofile. din aceeaşi clasă mai fac parte lacul poliesteric ME 6611. Între soluţiile de deshidratare şi cele de includere este bine să se intercaleze câteva băi cu solvenţi de tranziţie. Dintre răşinile poliesterice. prin grosimea lor redusă să permită transmisia electronilor şi deci obţinerea imaginilor în TEM este condiţionată de includerea pieselor într-un mediu suficient de dur care să faciliteze secţionarea pieselor. Tot ca intermediar este recomandat xilolul sau toluolul. care nu necesită deshidratarea pieselor după fixare şi spălare. Pentru includera în Vestopal sau Epon piesele sunt ţinute câte 1 oră în soluţii de Vestopal (Epon)/acetonă (anhidră) în concentraţii crescătoare: 1:2. urmate de modificări nedorite. dar care. DER 332 – DER 732. asigură o foarte bună infiltrare a ţesuturilor.de strângere. cel mai bun intermediar este oxidul de propilen care acţionează ca deshidratant şi fixator şi. rigolacul. Dintre răşinile epoxidice se pot enumera: Araldita. Din această categorie pot fi amintite: durcupanul. Din categoria mediilor de includere hidrofobe fac parte cele pe bază de metacrilat. Specimenele sunt infiltrate în toată masa lor cu materialul de includere. Epon 812 –Araldită. INCLUDEREA Obţinerea secţiunilor ultrafine care. prin infiltrarea în ţesut. Maraglas 655 – DER 732. În paralel cu deshidratarea se prepară soluţie de Vestopal sau Epon pentru includere. respectiv acetona (sau dacă este cazul – alcoolul etilic). acest solvent trebuie evitat deoarece inhibă unele enzime. fără dop. prepolimerizaţi împreună până la starea unui 353 . Vestopal W Vestopalul W este o răşină poliesterică – un copolimer format dintr-un poliester nesaturat şi stiren. peste noapte. Este recomandabil ca alcoolul sau acetona folosite în ultimele băi să fie anhidre. Toate operaţiile de includere şi încapsulare se desfăşoară în nişă. cel mai frecvent utilizat este Vestopalul W. glicol-metacrilatul sau aquonul. ceea ce se poate realiza introducând în vase o cantitate oarecare de sulfat de sodiu anhidru. să nu altereze structurile. selectronul etc. Eponul 812.

4 ml) Peroxidul de benzoil se activează în prealabil prin recristalizarea din cloroform. Secţiunile sunt rezistente la fasciculul de electroni. chiar la rece. pătrunde repede în ţesuturi. ţesuturile au un contrast ridicat şi sunt excelent prezervate. se pot monta pe grile fără pelicule suport şi permit obţinerea unei înalte rezoluţii. De aceea. care îşi schimbă culoarea. se secţionează uşor cu cuţitul de sticlă. iniţiatorul şi activatorul. altfel blocurile vor fi moi şi de slabă calitate. uşor gălbui. şi pentru deshidratare trebuie să se folosească acetona. Cel care expiră mai repede este activatorul. În timpul lucrului se va avea grijă să nu se amestece direct iniţiatorul cu activatorul. Vestopalul W nu este miscibil cu alcoolul. duritatea blocurilor poate fi modificată după dorinţă. În timp ce răşina poate fi păstrată câteva luni la rece. stirenul. îşi pierd activitatea în decurs de o lună. obţinută prin condensarea epiclorohidrinei cu glicerol. Pentru includere şi încapsulare.Peroxid de benzoil . iar secţiunile sunt foarte rezistente la fascicolul de electroni. aceştia din urmă trebuie reînnoiţi în fiecare lună.Vestopal W . nu produce procese de strângere a ţesuturilor.sirop consistent. se adaugă Vestopal în cantitate de 1 g/bloc. cristale care se răzuiesc şi se mărunţesc. 354 . Ca amestec de includere. după care se pun în tuburi. Blocurile se pot secţiona uşor cu cuţitul de sticlă. deoarece amestecul este exploziv. Substanţa activată se depune sub formă de cristale incolore pe pereţii vasului respectiv. Epon 812 Eponul 812 este o răşină epoxi-alifatică pe bază de glicerol. se prepară vestopalul astfel: se adaugă în puţin Vestopal peroxidul de benzoil (iniţiator al polimerizării Vestopalului) pentru predizolvare şi se amestecă foarte bine cu o baghetă de sticlă. Pentru 3 probe (15 blocuri) reţeta de preparare a Vestopalului este următoarea: . Atât răşinile cât şi iniţiatorul şi activatorul se pot păstra la rece. Fiind parţial polimerizat. se omogenizează din nou foarte bine şi se adaugă 8 picături de activator (la 3 probe) (octoat de cobalt) cu o pipetă la care 1 ml corespunde pentru 20 de picături. B. dioxanul sau chiar glicometacrilatul.Octoat de cobalt preparat astfel: 1 ml α-metil stiren + 7 picături de octoat de cobalt 15 g 150 mg 8 picături (0.

ÎNCAPSULAREA Încapsularea specimenelor se face în capsule de gelatină foarte bine uscate (ţinute câteva ore la etuvă la 60°C) – în fiecare capsulă se pune o picătură de mediu de includere şi apoi câte două cuburi dintr-o probă pentru fiecare bloc.Reţeta de preparare a Eponului este următoarea: Soluţia A Epon 812 (Epitoke 212) DDSA (anhidrida dodecenil-succinică) ml 66 100 Soluţia B (dă duritatea) Epon 812 NMA (anhidrida metil-nadică) ml 100 84 Soluţiile A şi B pot fi păstrate timp de peste 6 luni la 4ºC în sticle bine închise şi ferite de umezeală.4. Temperatura mai ridicată poate duce la polimerizarea neomogenă. spre a intra aproape în întregime în suportul ultramicrotomului. 355 . Pentru două probe (6 blocuri). După încapsulare se induce polimerizarea mediului de includere prin introducerea capsulelor la etuvă la o temperatură de 60ºC timp de 24-48 de ore. Înainte de amestecarea celor două soluţii. pentru ca blocul să fie relativ scurt. cu preponderenţă la periferia blocurilor. ele trebuie scoase de la frigider şi ţinute la temperatura camerei timp de câteva ore pentru a evita condensarea vaporilor de apă pe ele. iar dacă predomină soluţia B (3:7). În urma polimerizării se obţin blocuri dure. blocurile vor fi mai dure. transparente. Se completează cu Vestopal (Epon) circa 3/4 din volumul capsulelor. conţinând în interior piesele – de culoare neagră. sau chiar la spargerea acestora. Ulterior se face etichetarea capsulelor (pe etichete se scrie cu creionul chimic pentru Vestopal şi cu creion obişnuit pentru Epon – pentru a se evita ştergerea simbolurilor la contactul cu mediul de includere) şi completarea concomitentă a tuturor capsulelor de gelatină. ceea ce ar afecta polimerizarea. În vârful blocurilor. Se amestecă foarte bine cu o baghetă de sticlă şi apoi se centrifughează pentru eliminarea bulelor de aer. Raportul 5:5 duce la obţinerea unor blocuri potrivit de dure. MODELAREA BLOCURILOR Blocurile de răşină se fasonează cu ajutorul unei lame de ras nouă. raportul de combinare A:B = 5:5 la care se adaugă 150 μl DMP 30 (2. deci includerea corectă. sub o lupă binoculară cu posibilităţi de mărire de 70-100×.6-dimetil-aminometil fenol) – acceleratorul polimerizării. blocurile vor fi mai moi. dacă predomină soluţia A (7:3).

la o mărire de 50-100×. Pentru realizarea cuţitelor se poate utiliza aparatul special conceput pentru aceasta (knife maker). Înainte de confecţionarea cuţitelor.2 mm. Cuţitele selecţionate pentru secţionare se păstrează ferite de praf. Din barele de sticlă se vor tăia în prima fază pătrate. sub formă de bare. aşa-zisa linie Wallner. La marginea 356 . S-a demonstrat că dacă nu există sticlă specială pentru cuţite. cu atât tensiunea de accelerare a electronilor va trebui să fie mai mare pentru a se putea obţine imaginea pe ecranul fluorescent al microscopului. Pentru tăierea sticlei nu se folosesc cuţite de diamant.1-0. Se modelează câte două blocuri pentru fiecare probă. SECŢIONAREA Această operaţie este necesară pentru obţinerea secţiunilor ultrafine. apare ca o linie albă. Folosirea knife-maker-ului are ca rezultat obţinerea de cuţite cu tăiş drept. în cazul tăierii manuale. late de 25 mm şi groase de 5. Apăsarea pe foaia de sticlă trebuie să fie uşoară. lungi de 400 mm. mult mai accesibile. Cele mai potrivite sunt rondelele de metal din comerţ. Tăierea se va face pe o folie de cauciuc. rezultând câte două cuţite de formă triunghiulară. de aceeaşi intensitate pe toată linia de tăiere. Înainte de folosire este necesară pregătirea suplimentară a cuţitelor. şi la fracturare sticlei se produc tensiuni care afectează calitatea cuţitului. strălucitoare. deoarece acestea pătrund prea adânc. câte un bloc fiind păstrat ca rezervă. barele de sticlă se curăţă uşor cu un tampon de vată cu acetonă anhidră după care se şterg cu o bucată de tifon curat. cu ajutorul căreia se poate detecta zona utilă a cuţitului. Se poate întinde înainte de tăiere o urmă de petrol cu ajutorul unui tampon de vată. poate fi folosită orice sticlă albă plană. prismatică. sticla pentru cuţite. asigurându-se astfel o tăiere uşoară şi o rupere a benzilor de sticlă fără tensiuni. cu o grosime care să permită străbaterea lor de către fasciculul de electroni acceleraţi la tensiuni de 50-100 kW în TEM. Aceasta începe în punctul unde linia Wallner se curbează: zona cea mai ascuţită examinată la microscopul stereoscopic al ultramicrotomului. Pentru secţionare se pot folosi cuţite de diamant sau cele de sticlă.5 mm. pentru care se foloseşte ca materie primă.la nivelul probei se execută un trunchi de piramidă care să poarte în vârf o suprafaţă trapezoidală cu laturile de aproximativ 0. în timp ce zonele învecinate prezintă dinţi de fierăstrău. Din cauza tensiunii de fracturare. imediat sub tăişul cuţitului se formează o linie curbă. cuţitele pot avea muchia de tăiere oblică. Operaţiunea de modelare a blocurilor este necesară pentru ca în momentul secţionării să se obţină secţiuni trapezoidale care vor forma benzi rectilinii. cu grosimea de 5-8 mm. pe diagonala cărora se va face o nouă tăietură. Cu cât secţiunile sunt mai groase.

apoi se face oglinda. oglinda de apă trebuie să fie orizontală. În cazul ultramicrotomului LKB avansul este controlat prin dilatarea termică a unei tije metalice (aliaj de nichel). bara înaintează cu o distanţă reglabilă. şi apoi micrometrică a ultramicrotomului. egală cu grosimea secţiunii (500-1000 Å). reflexia luminii să se realizeze cât mai uniform la suprafaţa băii. piramida realizată la nivelul probei trebuie să se afle la nivelul gurii cuţitului (în plan vertical). prin reglarea poziţiei lămpii fluorescente.prismei unde se află suprafaţa de secţionare se construieşte un bazin prin lipirea unei benzi adezive în poziţie perfect orizontală. Pentru secţionare blocurile se montează pe rând în dispozitivul barei de înaintare al ultramicrotomului LKB. în zona cea mai ascuţită a acestuia. să nu prezinte menisc. grosimea acestora fiind apreciată după culoarea lor: Cenuşie Cenuşiu-argintie Argintie Argintiu-gălbuie Galben pai 100-200 Å 300-400 Å 500 Å 600 Å 650-700 Å Galben intens-maroniu Maro Maro – albăstrui Albăstrui Verde 700-800 Å 800-850 Å 900-1000 Å 1000-1100 Å 1300-1500 Å 357 . bara de înaintare în sus şi în jos prin acţionarea manuală a acesteia – de la viza de pe panoul de comandă. pe o suprafaţă cât mai mare posibilă (ideal este completă) a acesteia. ceea ce ar putea determina udarea blocului şi compromiterea secţionării. Cuţitul se instalează în ultramicrotom raportat la limitatorul din stânga locaşului cuţitului şi la un unghi de 3º. în paralel. La nivelul bazinului se va ajusta cantitatea de alcool 10% astfel încât. Se spală de cel puţin 3 ori cu alcool (10% sau acetonă 10%) sau cu apă distilată. temperatura camerei trebuie să fie cât mai scăzută posibil. Pentru realizarea acestui lucru se reglează angrenajele intermediare care ajută la fixarea suportului care poartă blocul de bară de înaintare a ultramicrotomului. În poziţia blocată a barei de înaintare. Pentru aceasta. Blocurile se montează astfel ca baza mare a trapezului din vârful piramidei să fie perfect paralelă cu lama cuţitului. După fiecare mişcare de tăiere. De asemenea. astfel încât suprafaţa de secţionare a blocului cade pe faţa de tăiere a cuţitului de sticlă sau de diamant. Se apropie cât mai mult posibil cuţitul de bloc prin manevrarea voxelor macrometrică. mişcând uşor. Secţiunile obţinute vor pluti la suprafaţa apei distilate din baia cuţitului (care formează oglinda). Bara de înaintare va efectua mişcări succesive în plan vertical.

au putere mică de împrăştiere a electronilor. în mijlocul unui cristalizor cu apă bidistilată se pipetează o picătură de parlodion. contrastul acestora este foarte scăzut. grilele fiind ferite de praf. Grosimea secţiunilor se va alege şi ţinând cont de caracteristicile microscopului în care se va face examinarea. şi ca urmare.Pentru cercetări de rutină. pentru a le evidenţia sunt contrastate cu săruri ale metalelor grele. Contrastarea cu acetat de uranil. Pentru obţinerea peliculei de parlodion.Alcool etilic 50% în apă distilată 358 2. În cazul de faţă contrastarea se face în două etape. O. Grilele se păstrează în cutii Petri cu capac pentru a fi ferite de praf (pe hârtie de filtru pe care se trec simbolurile corespunzătoare specimenelor). însă în mod curent sunt folosite grile cu 100-200 de ochiuri. se trece la acoperirea cu carbon (un strat de circa 100 Å) a grilelor într-un evaporator cu vid (metalizor). Stratul de carbon are rolul de a proteja pelicula de parlodion de acţiunea distrugătoare a fasciculului de electroni. Grilele electrolitice sunt reţele de cupru cu cadrul de 3 mm. CONTRASTAREA Ţesuturile biologice incluse în mase plastice. Soluţia de acetat de uranil se prepară după reţeta: . H). cu doi contrastanţi diferiţi: A.6 g 20 ml . Secţiunile sunt preluate pe grile electrolitice de cupru (200 mesh) acoperite în prealabil cu o peliculă fină de parlodion. Se evaporă diluantul rămânând o peliculă de 100 Å grosime. N. Numărul de ochiuri pe care le poate avea o grilă variază între 50 şi 1000. Din fiecare bloc se vor culege secţiuni pe cel puţin câte 2 grile. cu atât dispersia electronilor şi implicit contrastul imaginii sunt mai mari.Acetat de uranil . Contrastul imaginii obţinute în microscopul electronic depinde de numărul atomic al elementelor din care este alcătuit specimenul: cu cât acest număr este mai mare. secţiunile de culoare argintie sunt foarte convenabile. Deoarece moleculele din structurile biologice sunt constituite din atomi cu număr atomic mic (C. Uscarea grilelor se face cu hârtie de filtru prin tamponarea laterală a grilelor. Grilele sunt apoi scoase cu ajutorul unor rondele de hârtie. Pe această peliculă se aşează grilele. După uscarea peliculei la temperatura camerei. Contrastarea urmăreşte creşterea capacităţii de împrăştiere diferenţiată a electronilor de către materialul biologic secţionat. obţinute prin electroliză. datorită fineţei lor şi a compoziţiei chimice. cu faţa în jos.

În microscopul electronic de transmisie clasic imaginea se formează în întregime.Se pipetează acetatul de uranil în godeurile unei plăci de parafină (ceară). Soluţia de citrat de plumb se prepară după reţeta: Citrat de plumb (GM 1053.5–30 kV) sunt concentraţi.85) NaOH 1N Se agită timp de 5 minute Apă distilată Se aduce pH-ul la valoarea 12 Se completează până la 50 ml 1. după care se lasă grilele cu secţiunile în jos pe picăturile de contrastant. într-un sistem cu mai multe lentile. iar colorarea să se facă în apropierea câtorva granule de NaOH care să absoarbă CO2. care se compune din numărul total al liniilor. imaginea se formează punct cu punct în forma rasterului. filtrată. interacţionează cu materialul. Imaginea finală. după care s-au lăsat grilele cu secţiunile în jos pe picăturile de contrastant. Electronii emişi de tunul de electroni al microscopului şi acceleraţi de o tensiune înaltă (0. simultan. într-un fascicul îngust al cărui diametru în locul de încrucişare are. Microscopia electronică de baleiaj Microscopul electronic de baleiaj sau scanning (SEM) diferă fundamental de microscopul electronic de transmisie în privinţa modului de formare a imaginii. se va evita contactul contrastantului cu aerul atmosferic. Contrastarea cu citrat de plumb. Se pipetează citratul de plumb în godeurile plăcii de parafină (ceară). Se ţin grilele pe acetat de uranil 15-20 minute după care se spală la jet de pisetă cu apă distilată-alcool şi se iau pe hârtie de filtru spre a nu adera la vârful pensei fine cu care se lucrează. Cel mai bine este să se folosească o soluţie proaspătă preparată. Pentru evitarea apariţiei precipitatelor (reprezentate de carbonatul de plumb ce apare la contactul citratului de plumb cu CO2 atmosferic).410 g 8 ml Se dizolvă în 30 ml apă distilată şi se agită puternic timp de 5-10 minute 2. după care se spală la jet de apă distilată. se numeşte raster. Raza primară (incidentă) a electronilor acceleraţi şi concentraţi ce cade pe suprafaţa probei. B. pe suprafaţa probei cercetate. interacţiune în urma căreia apar următoarele semnale: 359 . Se ţin grilele pe citratul de plumb maxim 9 minute (timp după care apar precipitate). în timp ce la cel de baleiaj. sub 10 nm.

Deşi rezoluţia acestui microscop nu permite observarea unor detalii de ordinul celor din TEM. în condiţii de vacuum înalt. Timpii de lucru ai acestor etape vor fi adaptaţi tipului de ţesut organic şi. . capabil de a genera electroni secundari sub impactul fasciculului incident provenit din filamentul microscopului. dar pentru probele biologice este necesară acoperirea acestora cu un strat foarte subţire de metal (prin evaporare în vid).15M. în special. 360 .7% în tampon fosfat 0. îndepărtându-se orice urmă de solvent sau a vreunei substanţe volatile din materialul biologic. generatoare de vapori (ce pot diminua nivelul vidului din microscop) dintr-o probă biologică în vederea examinării acesteia la microscopul electronic cu baleiaj. DESHIDRATAREA LA PUNCT CRITIC Deshidratarea la punct critic reprezintă o metodă de eliminare a oricărei substanţe volatile.prefixarea cu glutaraldehidă 2.postfixarea cu acid osmic (Os O4) 1% în tampon fosfat 0.4 timp de 75-90 minute.4 .15M. dimensiunilor probei. pH 7.trei băi consecutive a câte 60 minute fiecare. Ca şi în cazul TEM. . de asemenea. o deshidratare naturală a materialului biologic produce alterări ale suprafeţei probelor datorate tensiunii superficiale. Pentru fixarea probelor biologice cu conţinut ridicat de apă se foloseşte aceeaşi combinaţie de fixatori ca şi pentru microscopia electronică de transmisie: . Neavând de a face cu electroni transmişi prin probă.1M. limitarea fiind dată doar de mărimea incintei probei. şi aici probele trebuiesc deshidratate. a patra peste noapte.îndepărtarea fixatorului în exces prin trecerea probei în tampon fosfat 0. de asemenea la 4 0C.4 pentru 60 – 90 minute la 4 0C. examinarea desfăşurându-se.• Electroni secundari (SE) • Electroni reflectaţi (BE) • Electroni Auger • Electroni absorbiţi de probă (AE) • Electroni transmişi prin probă (TE) • Fotoni • Radiaţii X. toate la 4 0C. pH 7. pH 7. suficient de profunde pentru a nu mai înregistra un aspect normal al acestora. pentru SEM dimensiunile preparatelor pot depăşi 3 cm grosime.

spre deosebire de acetonă. Tensiunea superficială poate fi redusă prin substituirea cu un lichid ce are o tensiune superficială mult mai mică decât a apei. cauza primară a acestora fiind efectele tensiunii superficiale. În acest sens. Deshidratarea normală prin evaporare la temperatura camerei induce deformări ale majorităţii specimenelor. Totuşi. suprafaţa lichidului devine foarte instabilă şi. care prezintă o tensiune superficială la aer foarte mare. Prin creşterea temperaturii gazului lichefiat. Anderson a dezvoltat această metodă folosind CO2 lichid. în final. evitând astfel posibilitatea apariţiei deformărilor datorate tensiunii superficiale. Dacă proba biologică a fost în lichid. 361 . aşteptându-se deformări minore ale suprafeţei probei în timpul deshidratării. Cel mai comun mediu al probelor biologice este apa. unde aceasta este de câteva ori mai mică. cu păstrarea nealterată a detaliilor de suprafaţă.În 1952. studierea morfologiei suprafeţelor probelor biologice implică prezervarea detaliilor de suprafaţă. trece în faza de gaz. va parcurge această tranziţie spre un mediu gazos “uscat” fără a fi în contact cu suprafaţa. metodă superioară sublimării apei în vid. meniscul devine plat. intervenţia aşa-numitei continuităţi de fază sugerează o metodă de deshidratare pentru care tensiunea superficială poate fi redusă la zero. Dacă tensiunea superficială scade foarte mult. proba fiind supusă forţelor prezente la limita fazei lichid – vapori. indicând o reducere a tensiunii superficiale. dar se pot folosi şi alte gaze lichefiate ca şi fluid de tranziţie. Când este atins punctul critic este posibilă trecerea de la faza de lichid la faza de gaz fără modificări dramatice.

CONSTANTE CRITICE Substanţa Temperatura critică (oC) HIDROGEN -234. Acest fapt este realizat pe izoterma de 31.1 APĂ +374 Presiunea critică (atm) 20 50 33 73 36 219 Deci. la atingerea punctului critic (caracterizat de valori ale presiunii şi temperaturii foarte precise). proprietăţile stării de lichid şi ale stării de gaz (vapori) ale aceleiaşi substanţe. unde poate fi lichefiată. procedura glutaraldehidă – osmium. tipic pentru microscopia electronică. Nefiind miscibil cu apa. de regulă. în cazul probelor biologice la unele dintre acestea ar interveni modificări termice suplimentare. o substanţă poate fi clasificată drept gaz doar deasupra temperaturii critice. stadiul intermediar implică deshidratarea probei biologice cu ajutorul lichidului intermediar: (proba umedă) H2O > Acetonă > CO2 > DPC (proba uscată) 362 .1 oC pentru CO2. Acest fluid intermediar. astfel. Înaintea acestor etape se realizează fixarea probei. o continuitate de stare. Aşa cum s-a menţionat. valori la care are loc tranziţia. este mult mai precis termenul de vapori. devin similare şi. deşi se pot utiliza şi variante cu două fluide intermediare. Dacă lichidul a fost încălzit într-o incintă închisă. cel mai utilizat fiind.1 MONOXID DE CARBON -141. aşa încât presiunea critică să poată fi atinsă la temperatura critică. dioxidul de carbon. orice menisc vizibil va dispărea. aceasta fiind temperatura critică căreia i se asociază o presiune critică.5 OXIGEN -118 AZOT -146 DIOXID DE CARBON +31. schimbă apa din ţesut şi este miscibil cu CO2. apa din proba biologică trebuie înlocuită cu un alt fluid miscibil cu CO2. Deasupra acestei temperaturi gazul nu poate fi lichefiat prin aplicarea presiunii. sub această valoare. tensiunea superficială fiind zero având. în final. în consecinţă. coincid. Chiar dacă valorile critice ale diferitelor substanţe pot fi atinse practic. CO2 rămâne cel mai utilizat mediu pentru deshidratarea la punct critic şi este numit fluid de tranziţie.Graficul indică faptul că. deci.

4.7% şi OsO4 1% în tampon fosfat. 363 . fiind mai puţin susceptibil deformărilor datorate evaporării fluidului de tranziţie ce-l va înlocui. având drept rezultat pierderi semnificative de material din probă. 5. fixarea probei cu glutaraldehidă 2.Specimenul este trecut prin diferite concentraţii crescătoare ale fluidului intermediar. substituirea acetonei cu CO2 lichid sub presiune – operaţie repetată în funcţie de dimensiunile probelor. specimenele nonconductive examinate la parametri optimi prezintă invariabil fenomenul încărcării electrice ce conduce la distorsionarea imaginii şi la distrucţii termice. 6. Această acoperire este necesară pentru eliminarea sau reducerea încărcării electrice ce se instalează rapid la suprafaţa unei probe neconductive la baleierea acesteia de către un flux de electroni de energie înaltă. _______________acetonă________________________ H2O > 30% > 50% > 60% > 70% > 80% > 90% > 100% > CO2 ¤ ------------------. proba acţionând în acest caz ca oglindă pentru electroni. imersia probei în acetonă în incinta aparatului.trei schimbări FLUIDE INTERMEDIARE / DESHIDRATANTE Substanţa ETANOL ACETONĂ FREON (113) APĂ Tensiunea superficială (dyne/cm) 23 24 19 73 Principalele etape ale deshidratării la punct critic: 1. Materialul uzual pentru acoperirea probelor este aurul. În situaţii extreme. culminând cu înlocuirea completă a apei din ţesut cu acest fluid. deshidratarea cu acetonă. 2. În absenţa stratului de acoperire. 3. eliberarea vaporilor de CO2.câte 10 minute fiecare ---------------------¤ . deoarece prezintă o tensiune superficială foarte scăzută. specimenul poate acumula o încărcătură suficient de mare pentru a decelera fluxul primar. ACOPERIREA CU METALE Toate probele neconductive necesită acoperirea cu un film subţire de material conductiv. încălzirea incintei până la atingerea punctului critic.

probe de tipul microfosilelor (foraminifere) sau segmente de aparate bucale. putându-se realiza chiar hărţi cu distribuţia fiecărui element chimic în zona luată în studiu. Detectorul special al EDX identifică. Astfel. imaginile fiind preluate în format digital sau clasic pe film. în timp ce. O anexă importantă a SEM este sistemul de microanaliza elementală cu raze X (EDX). aşa încât zona de interes să fie expusă direct fasciculului de electroni ce balează proba. antene. de câteva sute de nanometri. Pulberile. ţinând cont de posibilitatea limitată de înclinare a probei în microscop. aurul este cel mai utilizat element pentru acoperirea probelor. pot fi aranjate în ordine pe un singur suport. vor fi presărate pe suportul adeziv. surplusul fiind îndepărtat în momentul introducerii în vid pentru metalizare. Acoperirea se realizează prin evaporarea metalului în vid. la celelalte probe este obligatorie uscarea la punct critic pentru prevenirea deformărilor datorate unei deshidratări brutale în aer. palpi (insecte). sporii sau alte probe ce nu pot fi manipulate cu pensa. compoziţia chimică a probei analizate atât calitativ cât şi cantitativ. EXAMINAREA DIFERITELOR PROBE IN SEM Probele pentru examinarea în SEM sunt montate pe suporturi conductive din cupru cu ajutorul unor discuri de carbon adezive pe ambele feţe. Orientarea probei pe suport în aceasta fază este foarte importantă. la capete aplicându-se o tensiune continuă de 1 – 3 kV. Probele astfel pregătite se introduc în microscop si se examinează la diferite măriri. ce presupune legarea metalului la polul pozitiv şi a probei la cel negativ. Probe biologice de tipul insectelor chitinoase.Când scopul analizei nu este achiziţia unui spectru de raze X. dispozitiv instalat într-o incintă ce menţine un nivel de vacuum (10-2 Pa) suficient pentru a asigura o depunere a atomilor de aur într-un strat uniform şi foarte subţire. montarea probelor se va realiza sub lupa binocular unde. pe baza radiaţiei X (specifică fiecărei specii chimice) generate din probă. precum şi cele cu un conţinut nesemnificativ de apă (frunze uscate) pot fi montate pe suport şi metalizate fără deshidratare. 364 . abia apoi realizându-se acoperirea cu metale a acestora.

.... Nanomanipularea cu ajutorul Microscopului de Forţă Atomică ........................................... Microscopia de Forţă Atomică . 369 3.......... În cazul celor mai performante echipamente SPM disponibile în prezent.................... se poate vizualiza dintr-un eşantion maxim 150 X 150 um dacă rugozitatea în zona scanată este 365 Figura 1................. 374 7........... Ch............................. Weibel in 1981 was marked as the invention of STM.............. Binnig. 375 8.................... Microscopia de Scanare a Probei ..................................... Spectroscopia de Forţă Atomică .... Microscopia de Scanare a Probei Microscopia cu scanarea probei (Scanning Probe Microscopy ..... 365 2.... Aplicaţii ale Microscopiei de Forţă Atomică ........................ H.........................................................................SPM) este o microscopie mecanică ce acoperă câteva tehnici de vizualizare a suprafeţei unui eşantion (morfologia suprafeţei) cu o rezoluţie la nivelul moleculelor sau a grupurilor de atomi..... Bibliografie .... ...... 1..................................................................................................................... dr............................... 371 4........... Gerber and E............. 371 5...... Imagine SEM x1000 pentru un cantiliver – tip...... Rohrer..................... MICROSCOPUL DE FORŢĂ ATOMICĂ Microscopia de forţă atomică Conf................ An observation of this dependence between a W-tip and Pt surface by G............... Avantajele şi Limitele Microscopiei de Forţă Atomică ......................X......... Nanolitografie cu Microscopul de Forţă Atomică ........... Ioan Burda Cuprins 1.. 373 6................................ 376 Quantum mechanics predicts an exponential dependence of tunneling current with a separate distance between the two electrodes.....

Scanner piezoelectric de forma prin sensibilitatea lor (raportul dintre tubulara. deplasarea pe o direcţie şi tensiunea aplicată pe acea direcţie) adică. atât cât se extinde sau contractă un material piezoelectric per volt.mai mică de 10 um. Pentru a calcula forţa de interacţie utilizăm legea lui Hook (F = kz). se definesc tehnicile SPM. tip) şi eşantionul scanat. scanner-ul este construit sub forma unui tub (Figura 3) cu electrozi pentru deplasarea pe X. Scanner-ele sunt caracterizate Figura 3. Cunoaşterea acestor forţe este unui fascicul laser şi a unui fotodetector. se poate spune că este singurul element puternic limitativ în evoluţia viitoare a microscopiei mecanice. Y şi Z iar cu ajutorul lui se poate poziţiona proba (tip-ul) cu extremă precizie în 3D (3 Dimensiuni). cele mai multe sisteme SPM utilizează un fascicol laser pentru a determina deflexia cantilever-ului. iar z este distanţa pe care cantilever-ul a suferit o Figura 2. deplasarea nu este 366 . În prezent. De performanţele mecan. Pentru valori mari ale tensiunii. Acest tip este ataşat de o grindă (cantilever) flexibilă. Tehnologia SPM are la bază un concept simplu: scanarea unei suprafeţe cu ajutorul unui vârf (tip) foarte ascuţit (sharp. Acest fascicul laser se reflectă de partea opusă tip-ului (fabricat din Si sau Si3N4) pe un fotodetector sensibil la poziţie (Figura 2). Mai mult. importantă pentru interpretarea imaginilor SPM sau pentru a determina proprietăţi mecanice locale ale eşantionului. vârf cu raza de curbură de circa 3-50 nm. Figura 1). astfel încât să poată fi urmărit profilul suprafeţei scanate.electrice ale scanner-ului piezoelectric depind în ceea mai mare măsura performanţele întregului SPM. respectiv cu polaritatea acesteia. De regulă. unde k este constanta de elasticitate a cantilever-ului. Detecţia deflexiei cu ajutorul deflexie. În funcţie de mecanismul de interacţiune dintre probă (vârf. Cu ajutorul unui astfel de sistem de detecţie este posibilă măsurarea indirectă a forţei dintre tip şi suprafaţa eşantionului studiat. Scanner-ul SPM este realizat din material piezoelectric (PZT) care se expandează şi contractă proporţional cu tensiunea aplicată. Un alt element de bază al unui SPM este scanner-ul piezoelectric.

Această situaţie experimentală este posibilă în cazul unor suprafeţe conductoare curate (practic fără rugozitate) precum şi în lipsa vibraţiilor ambientale. Pentru a limita efectele date de procesul de îmbătrânire. Desigur că acest efect poate fi limitat prin aplicarea unei tensiuni neliniare pentru scanare (identificată în procesul de calibrare a scanner-ului). Proba (un tip de fibră optică plus o apertură) trebuie să fie foarte aproape de suprafaţa eşantionului. Din această cauză. o recalibrare frecventă a scanner-ului se impune mai ales în primul an de utilizare.liniară cu tensiunea aplicată şi această dependenţă diferă de la scanner la scanner. toate eşantioanele de material de orice tip (inclusiv de natură biologică) pot fi investigate/măsurate cu AFM. Poate cel mai neplăcut lucru legat de scanner este procesul exponenţial de îmbătrânire ce determină o scădere a sensibilităţii în timp. Această diversitate este bazată pe principiul de funcţionare care implică existenţa unui tip (probă) în contact sau foarte apropiat de suprafaţa eşantionului. magnetice si mecanice. Cu toate acestea. fabricantul utilizează cel putin 48 de ore scanner-ul înainte de a fi livrat pentru o aplicaţie. această tehnică a cunoscut o dezvoltare rapidă (în comparaţie cu STM). Pe lângă morfologia suprafeţei. Prin utilizarea unei surse cvasi-punctiforme. poate fi obţinută o rezoluţie dincolo de limita de difracţie. Efectul final al acestei situaţii este identificat prin rezultate diferite funcţie de direcţia de scanare. • Atomic Force Microscopy (Microscopia de Forţă Atomică) a apărut ca o extensie în utilizarea microscopiei mecanice (1986) pentru eşantioanele nu foarte conductoare. Principiul STM-ului este dat de efectul de tunelare al electronilor între doi electrozi în prezenţa unui câmp electric. 367 . fiind extrem de utilă în multe domenii de cercetare. aşa că. AFM-ul a fost dezvoltat în ultimele decenii pentru a măsura o mare varietate de proprietăţi pe suprafaţa eşantionului cum ar fi proprietăţile electrice. • Near-Field Scanning Optical Microscopy (NSOM) utilizează o sursă de lumină de foarte mici dimensiuni ca mecanism de formare a imaginii. Pentru a putea măsura efectul de tunelare distanţă dintre cei doi electrozi trebuie să fie de aproximativ 1 nm. cu un diametru mai mic decât lungimea de undă. Cele mai comune tehnici SPM sunt: • Scanning Tunneling Microscopy (STM) este tehnica SPM de bază care a generat întreg domeniul acoperit azi de microscopia mecanică. orice interacţiune dintre tip şi suprafaţa eşantionului este măsurabilă. Practic.

Dimensiunea punctului de lumină determină rezoluţia maximă ce poate fi obţinută. O prima metodă este echivalentă cu cea din cazul AFM. Pentru a vizualiza imaginile. cât şi de colectarea luminii reflectate. Tipic. De regulă. sunt utilizate câteva mecanisme de contrast: polarizare. prin intermediul unei fibre optice. • Reflexie: lumina care vine prin apertura probei se reflectă pe suprafaţa eşantionului. sunt necesare eşantioane transparente. 368 . feedback-ul necesar în sistem. indice de refracţie. iar proba colectează lumina reflectată. cum ar fi indicele de refracţie. lumina laserului. În funcţie de modul de obţinere a imaginii. structura chimică si stress-ul local. avem mai multe moduri de operare: • Transmisie: lumina care vine prin apertura probei este transmisă prin eşantion. topografie. Un al doilea mod este un mod rezonant (tuning fork) şi este monitorizată amplitudinea oscilaţiei când tip-ul se mişcă deasupra suprafeţei eşantionului. birefringenta. Detecţia semnalului se realizează prin: spectrometru. Această regiune limitată de proba şi eşantion este numită “Near-Field” de unde şi numele acestei microscopii. Rezoluţia imaginii este limitată de dimensiunea aperturii detectorului şi nu de lungimea de undă a luminii incidente. tub fotomultiplicator sau CCD (Charge Coupled Devices). În cazul NSOM. APD (Avalanche Photo Diode). dar intensitatea lumini este scăzuta si dependentă de forma probei. şi în acest caz. • Iluminare/Colectare: Proba este responsabilă atât de iluminare. pentru a menţine o distanţă de lucru dintre probă şi suprafaţa eşantionului. fluorescenţă. în cazul unui NSOM avem o rezoluţie laterală de circa 20 nm şi o rezoluţie verticală de 2-5 nm. Mutarea laterală a tip-ului este denumită “shear-force” feedback. eşantionul poate fi opac.mai aproape decât lungimea de undă. La fel ca în orice microscopie optică. mecanismele de contrast pot fi uşor adaptate pentru studierea diferitelor proprietăţi. adică prin intermediul unui cantilever şi a unui sistem de detecţie al deflexiei cu fascicul laser. parcurge o apertură realizată prin acoperirea ei cu metal (cum ar fi Al) şi microfabricată la fel ca o probă AFM. dependenţa de lungimea de undă şi reflectivitate. • Colectare: eşantionul este iluminat dintr-o sursă externă cu arie mare de iluminare. În acest caz. se realizează prin două metode.

2. ceramici. Marele avantaj al AFM-ului este capacitatea acestuia de a investiga practic orice tip de suprafaţă inclusiv polimeri. Aceste forţe sunt măsurate indirect prin deflecţia laterală (twist) a cantilever-ului. 1986) a fost dezvoltată ca o soluţie tehnică pentru STM. Microscopia de Forţă Atomică Microscopia de Forţă Atomică (AFM. pentru suprafeţe ale eşantionului cu rugozitate scăzuta să se opereze în modul distanţă constantă. Capabilitatea de a urmării suprafaţa eşantionului în acest mod este limitată doar de circuitul de feedback. Modul de operare LFM este 369 . iar cantilever-ul este mutat în sus sau în jos pe timpul scanării. de a măsura prin microscopie mecanică eşantioanele neconductoare. Acesta a fost de altfel primul mod de operare AFM implementat ca o adaptare la STM. în medii chimice corozive sau medii biologice termostatate. precum şi pentru a pune în evidenţă muchiile de pe suprafaţa eşantionului. În acest scop. Versatilitatea AFM-ului a dus în timp la o diversitate de moduri de operare şi adaptări. atracţie) al forţei Van der Waals ca o funcţie de distanţă. Se poate.LFM) măsoară forţele de frecare dintre tip şi suprafaţa eşantionului. dacă eşantionul este special preparat. care sunt determinate de neomogenităţile materialului. tocmai de aceea. Tip-ul este în contact puternic cu suprafaţa eşantionului şi în modul distanţă constantă este posibilă rezoluţia atomică. tip-ul este menţinut (de obicei) la o forţă constantă puternic de respingere. LFM este util în vizualizarea forţelor de frecare pe suprafaţa eşantionului. Potenţialul Lennard-Jones (Figura 4) este un model aproximativ pentru cazul izotropic (repulsie şi Figura 4. Potentialul Lennard-Jones versus modurile de operare AFM. materiale compozite. de asemenea. cantilever-ul este optimizat pentru sensibilitate mare la forţele de frecare laterală. Relativ la natura forţelor implicate şi interacţiunea dintre tip şi suprafaţa eşantionului definim cele mai importante moduri AFM de operare (clasice): • Contact Mode (modul contact). cantilever-ul este foarte subţire. sticle şi materiale biologice. modificări la situaţii specifice: măsurători in lichide. • Microscopia de Forţă Laterală (Lateral Force Microscopy .

Tabelul 1 este departe de a fi complet (doar modurile esenţiale) şi mai mult. Phase Imaging este un mod în care sunt culese informaţii despre shift-ul de fază a cantilever-ului aflat în oscilaţie în raport cu semnalul de excitaţie. Aceste date pot fi culese simultan cu topografia suprafeţei eşantionului. Avantajul acestui mod de operare este legat de rezoluţia laterală mai ridicată fără apariţia unor forţe de dragare. cantilever-ul este oscilat în apropierea suprafeţei eşantionului. 370 . iar mai recent este denumit DFM (Dynamic Force Mode). Modurile de operare din Microscopia de Forţă Atomică sunt rezumate în Tabelul 1 cu referire la forţa de interacţiune pentru fiecare mod. dar părţi ale oscilaţiei sunt extinse în regimul de respingere. cantilever-ul este oscilat îin regim de atracţie. iar slop-ul. Detecţia se bazează pe măsurarea diferenţelor de cuplaj cu suprafaţa eşantionului care determină schimbarea frecvenţei de rezonanţă a cantilever-ului şi/sau a amplitudinii de oscilaţie. ceea ce înseamnă că tip-ul este apropiat de suprafaţa eşantionului. NonContact Mode este un concept ce descrie familia modurilor AC (moduri de curent alternativ). vîscoelastice). În acest caz. în acest caz. dar nu este în contact cu aceasta. forţa-distanţă este măsurată determinând astfel elasticitatea eşantionului. de ordinul pN. Tip-ul este oscilat şi pus în regim de respingere. tipul este în contact constant cu suprafaţa eşantionului. în aşa fel încât. Tapping Mode) este denumirea clasică. Acest mod de operare este un mod măsurat simultan cu modurile AC enumerate mai sus. tip-ul intră intermitent în contact cu suprafaţa eşantionului. Prin acest mod de operare AFM se pot determina şi compara simultan morfologia şi proprietăţile locale. Contact Intermitent (Dynamic Force. Desigur că forţele de interacţiune dintre tip şi suprafaţa eşantionului sunt foarte mici. în fiecare an se adăuga noi moduri de operare sau noi versiuni ale acestora. Acest shift de fază se corelează cu proprietăţi specifice suprafeţei eşantionului (frecare. adeziune. Force Modulation este un mod AFM de operare ce se referă la utilizarea proprietăţilor materialului probei pentru a controla interacţiunea cu suprafaţa eşantionului. Şi în acest mod.• • • • un mod derivat din modul de operare Contact Mode.

În această metodă. tip-ul este împins în faţă şi apoi retras de la suprafaţa eşantionului. Aceasta tehnică inovativă este combinată cu probe specializate şi este corelată cu intensitatea spectrală (Raman) în timp real pentru a vizualiza legăturile chimice. megapascali) care produce un shift în semnalul Raman corelat cu stresul aplicat. Force Spectroscopy) şi se referă la măsurarea directă a interacţiunii dintre tip şi suprafaţa eşantionului în funcţie de distanţa de separare. situaţie în care cantilever-ul este vibrat (metoda AC). O altă metodă modernă de investigare mediată de AFM este nanoidentarea (nanoidentation). Spectroscopia de Forţă Atomică O altă aplicaţie majoră AFM este Spectroscopia de Forţă Atomică (FS.Tabelul 1. Mod de Operare contact mode non-contact mode intermittent contact mode lateral force mode magnetic force thermal scanning Forţa de Interacţie puternic de respingere – forţa constantă sau distanţa constantă slabă de atracţie . Aplicaţii ale Microscopiei de Forţă Atomică Datorită faptului că AFM-ul poate investiga practic orice tip de material fără o preparare specială a eşantionului. 3. forţe Van der Waals. această tehnică experimentală a devenit în timp cea mai utilizată tehnică în studierea macromoleculelor sau 371 . iar distanţa pe axa Z este mai bună de 0.1 nm.vibrarea probei forţele de frecare exercită o torsiune a cantileverului folosit în scanare câmpul magnetic de la suprafaţa eşantionului poate fi vizualizat distribuţia conductivităţii termice pe suprafaţa eşantionului este vizualizată. Această metodă este utilă în măsurarea contactului la dimensiune nano (legături atomice.vibrarea probei puternică de respingere . forţe Casimir) cum ar fi forţa de rupere a moleculelor de suprafaţa eşantionului. iar deflexia cantilever-ului este monitorizată în funcţie de deplasarea scanner-ului. Limita de măsurare este în domeniul pN. 4. AFM-ul poate aplica un stres mecanic controlat pe suprafaţa eşantionului (raza de curbură a tip-ului este de câţiva nm aşa că P = F/A determină presiuni ridicate. Spectroscopia de Forţă Atomică poate fi implementată ca şi deflexie statică sau mai recent în mod dinamic.

Modul de lucru AFM trebuie ales în funcţie de caracteristicile ce prezintă interes în investigare. În aceste situaţii. ADN. precum şi în studierea unor nanostructuri (suprafaţa polimerilor. liniaritatea scanner-ului şi vibraţiile ambientale. în final. dar va deforma mai puţin sau deloc eşantioanele moi. Modurile AC (cu vibrarea probei) sau intermitente au fost imaginate pentru a investiga suprafaţa unor eşantioane biologice. De asemenea. încât multe din articolele ştiinţifice de ieri au devenit azi automatizare. Vizualizarea cu AFM a suprafeţelor pentru eşantioane cu relief înalt implică utilizarea unui 372 . deoarece poate produce o contaminare a tip-ului sau poate îndepărta material de pe suprafaţa eşantionului.eşantioanelor biologice (proteine. bacterii). răşini naturale). Acest lucru nu este posibil în cazul AFM şi este limitat atât fizic (Van der Waals). ¾ Restaurarea Imaginii (Deconvoluţia Probei). imaginea obţinută este practic convoluţia dintre forma tip-ului şi morfologia locală. este frecvent utilizată în studierea suprafeţelor în industria electronică (Silicon wafers. circuite integrate). ¾ Distorsiuni ale imaginii induse de probă. medii de stocare a datelor. Marii producători de echipamente de microscopie mecanicp au reuşit în ultimul timp să elimine o mare parte din limitările anterioare prin îmbunătăţirea componentelor mecanice şi electronice. ceramici. de exemplu. Murdăria şi efectele de capilaritate induse de apa de pe suprafaţa eşantionului vor avea un rol dominat si. este importantă cunoaşterea formei tip-ului (geometria acestuia) pentru o interpretare corectă a imaginilor obţinute. cât şi tehnologic prin limita de ascuţire a tip-ului. Calibrarea automată tridimensională a uşurat mult munca operatorului. Reţinem din aceste timpuri istorice câteva distorsiuni induse de forma tip-ului care merită înţelese. precum şi de natura suprafeţei eşantionului. Performanţele unui AFM sunt limitate de un număr de factori dintre care amintim: capacitatea elementelor mecanice de a muta tip-ul cu precizie şi de a măsura poziţia acestuia. cromozomi. dar nu este o alegere potrivită pentru suprafeţele moi. în general. reţele de difracţie. Modul contact este o bună alegere pentru suprafeţele dure. La rezoluţii ridicate. ceea ce vedem într-o imagine AFM este mai degrabă o imagine mediată a morfologiei suprafeţei eşantionului. Aşa că. vor degrada calitatea imaginii obţinute. calitatea tip-ului. Pentru a vizualiza atomi sau molecule este necesar ca interacţiunea să fie numai între tip şi atomul/molecula cea mai apropiată (acest lucru se poate realiza pentru rezoluţia atomică numai în tehnologia STM). Dacă alegem un contact apropiat atunci AFM-ul va deveni foarte sensibil la zgomote (vibraţii) externe.

5. Nanolitografia nu se rezumă la utilizarea AFM. În figura 5. litografie AFM (5 um). Figura 5.tip foarte ascuţit. În aceste situaţii. Nanolitografie vectorială de la procedeu (a) la rezultat (b). În prezent. Trebuie menţionat că pe lângă nanolitografia de scanare a mai fost dezvoltată în ultimul timp şi litografia vectorială. ceea ce vedem poate fi imaginea tip-ului reflectată de suprafaţă. aşa că. Nanolitografie cu Microscopul de Forţă Atomică Nanolitografia se referă la fabricarea de structuri nanometrice mai mici de 100 nm. • Atomic Force Microscopic Nanolithography (AFMN) este o metodă de pattering pe o suprafaţă chimică-mecanică pentru AFM. se pot vedea câteva exemple clasice de nanolitografie. această tehnică de utilizare a unui AFM este utilizată (nu foarte frecvent) în realizarea de circuite integrate (nanocircuite) sau de sisteme nanoelectromecanice (NEMS). atomi individuali pot fi manipulaţi prin utilizarea tip-ului unui STM. Patter-ul poate fi creat manual sau automat. 373 . trebuie să apelam la metode matematice pentru a restaura imaginea (deconvoluţie). o descriere sumară a principalelor tehnici este utilă: • Scanning Probe Lithography (SPL) este o unealtă/tehnologie promiţătoare pentru realizarea de pattering la scală nano. În caz contrar. Metoda efectivă de deconvoluţie depinde de caracteristicile suprafeţei eşantionului şi de geometria tip-ului (un subiect frecvent prezent în literatura ştiinţifică). Dip-Pen Nanolithography (DPN) a fost prima metodă SPL disponibilă comercial pentru AFM. De exemplu.

Nanomanipularea unor particule de latex cu diametrul de 100 nm. Figura 6. Nanomanipularea cu ajutorul Microscopului de Forţă Atomică Diverse structuri nanometrice. pot fi manipulate pentru a realiza circuite electrice sau pentru a măsura proprietăţile lor mecanice. pattern-ul poate fi realizat manual sau automat. cum ar fi nanotuburi şi nanofire care sunt pe suprafaţa unui eşantion. Un exemplu de nanomanipulare a unor particule de aur (nano cuburi) cu diametrul de 100 nm pe o suprafaţă de sticlă se poate vedea în figura 6. 374 . Trebuie menţionat că AFM-ul poate fi utilizat ca un robot 3D (manipulator 3D) care are spaţiul de lucru la scală nano. Nanomanipularea unor nano cuburi de aur pe o suprafaţă de sticlă. sau mai recent. prin utilizarea unei interfeţe haptic şi a unei aplicaţii de realitate îmbunătăţită. După cum am menţionat. Figura 7.6. implicate în manipularea lor. Prin utilizarea AFM-ului ca sistem nanorobotic. nanomanipularea poate deveni o operaţie relativ uşor de realizat. Un alt exemplu de nanomaipulare este prezentat în figura 7 a unor particule de latex cu diametrul de 100 nm într-o structură complicată.

un exemplu este prezentat în figura 8. Elucidarea acestor situaţii nu se poate face decât prin experienţe de nanomanipulare a ADN-ului. Aceste molecule cunoscute de mai mult de o jumătate de secol au atras atenţia. în ultimul timp. unele rezultate sugerează că avem un bun conductor (chiar supraconductor la temperaturi joase). Cunoaşterea acestor limite. cum ar fi realizarea unor circuite electronice (motivată de studierea proprietăţilor electrice). iar altele ca un izolator. în special nanomanipularea moleculelor ADN. eşantionul nu necesită un tratament special (acoperirea cu metal sau carbon) care poate compro375 . După aproximativ 15 ani de controverse relativ la mecanismul de conducţie (transfer de sarcină) este acum bine demonstrată dependenţa de distanţă (tunelarea într-un singur pas sau hopping termic mai mulţi paşi). alte rezultate îl prezintă ca fiind un semiconductor. în literatura de specialitate ADN-ul rămâne pentru moment un subiect neelucidat. Mai mult. În acelaşi timp. Ambele mecanisme (tunelarea sarcinii. respectiv a avantajelor. este importantă în luarea unei decizii corecte înainte de a apela la acest echipament pentru investigarea unui eşantion.4 nm şi este în esenţă o structură scurtă (3. Nanomanipularea ADN-ului pe o placă de polycarbonat (aria de scanare este de 5 um). Microscopul de Forţă Atomică are în aceeaşi măsură avantaje şi limite.AFM-ul ca nano robot este extrem de util în nanomaipularea unor celule sau molecule. Avantajele şi Limitele Microscopiei de Forţă Atomică La fel ca orice alt echipament. în cazul AFM avem un profil 3D. 7.6 nm) care se repetă. Microscopia concurenta SPM (AFM) este SEM (Scanning Electron Microscopy) dar spre deosebire de SEM unde avem o proiecţie 2D sau mai exact o imagine 2D pentru eşantion. Figura 8. Molecula de AND are un diametru de circa 2. hopping termal) au fost studiate şi verificate indirect experimental. pentru aplicaţii în nanotehnologie.

făcând lipsită de precizie măsurarea unor structuri. Q (1993). în unele situaţii. această post-filtrare poate elimina unele caracteristici ale eşantionului. "Advances în atomic force microscopy". Journal of the American Chemical Society 127 (45): 15688–9 Zhong. Un alt avantaj este posibilitatea de a investiga eşantionul în condiţii ambientale. Giessibl. Peter (2001). (2003). Minko.Y. 376 . M. bine cunoscută limitarea puternică indusă de existent pe eşantion a unor pereţi drepţi sau şanţuri foarte adânci şi înguste a căror morfologie nu poate fi pusă în evidenţă decât prin utilizarea unor tip-uri speciale şi extrem de scumpe. Aceste limitări sunt un subiect fierbinte în cercetarea instrumentală din acest domeniu şi câteva succese au fost obţinute prin utilizarea în paralel a mai multor cantilevere sau.mite. drift-ul termic poate induce distorsiuni pe imagine. de asemenea. Datorită faptului că timpul de scanare în cazul AFM-ului este mare. toate acestea la o viteză mult mai mare. Roiter. mai recent. La fel ca şi în orice altă tehnică bazată pe realizarea de imagini este posibilă apariţia de artefacte care pot fi induse de tip-ul instabil sau mediul ambiental impropriu sau chiar de eşantionul studiat. AFM cu rata de scanare video. "Fractured polymer/silica fiber surface studied by tapping mode atomic force microscopy". Reviews of Modern Physics 75: 949. 2. Aceste limitări au fost eliminate în cazul microscoapelor AFM moderne prin scannere în bucla închisă sau scanner-e ortogonale.Z care necesită refacerea în software a imaginii. eşantionul. Ralph A. cu posibilitatea de scanare simultană a unor arii diferite. Proceedings of the Royal Society a Mathematical Physical and Engineering Sciences 457: 1161. Y. Este. asigurând în principiu o rezoluţie mai bună decât SEM. distorsionate de efectul de hysteresis al materialului piezoelectric. Din păcate. "Direct measurement of interatomic force gradients using an ultra-low-amplitude atomic force microscope". Ahmet Oral. de asemenea. Hoffmann. 8. comparabilă cu rezoluţia unui TEM (Transmission Electron Microscopy). Imaginile obţinute cu AFM pot fi. 3. Bibliografie 1. lucru foarte important pentru eşantioanele biologice. Franz J. Surface Science Letters 290: L688. care în cazul SEM este de ordinul milimetrilor. G. precum şi de efectele de mixare între axele X. "AFM single molecule experiments at the solid-liquid interface: în situ conformation of adsorbed flexible polyelectrolyte chains". S (Nov 2005). 4. Marele dezavantaj al AFM faţă de SEM se referă la aria scanată.

Saglik and D. Li. 2000. Ning Xi “Micro/Nano Motion Control for Biological Specimen Handling”. J.5. Xi. B. 377 . Phys.M. (2003). Ayres. Yu. October. N. Fung. Phys. J C Wolfe and B P Craver. V. 6. Proceedings of International Symposium on Smart Structures and Microsystems. K. Lett. Taiwan. K. Lapshin (1998). 3-D nanomanipulation using atomic force microscopy. Goolsby. N. "Automatic lateral calibration of tunneling microscope scanners". Review of Scientific Instruments (USA: AIP) 69 (9): 3268–3276. F. F. M. C. M. D: Appl. May. 41 (2008) 024007 (12pp) 7. G. W. R. "Chemomechanical surface patterning and functionalization of silicon surfaces using an atomic force microscope". Proceedings of the 2001 1st IEEE Conference on Nanotechnology 10. 9. Xi. “SPM-Based Investigation of Site Specific Biological Interactions”.Y. Hong Kong. V. Ayres. "Neutral particle lithography: a simple solution to charge-related artefacts în ion beam proximity printing". Phys. Proceeding of the 2003 IEEE International Conference on Robotics and Automation. Davis et al. 82 (5): 808–810. Wang. 8. Salam. 2003. V. H.Gilgenbach. Appl. Hummert. R. Salam. H.

.................. Ioan Burda Cuprins 1... scattering etc) or fluorescence 200nm – 1mm 500nm – 10 mm 1nm-10 mm 1Å-100μm What is studied Complicated sample preparation optical slice optional 10 nm-1 mm limited by ultratome (10 nm-1 μm) surface real thin slice necessary necessary surface optional 378 .....................5Å-20 μm Mechanism of contrast formation Range in XY Range in Z Light absorption (diffraction... polarization................393 1.. dr....... Bibliografie ......378 2............. Bibliografie .....385 3............................................... în microscopia modernă prelevate odată cu informaţia topografică.............................................. O evaluare obiectivă a tehnicilor microscopice (Tabelul 1) pune în evidenţă elemente de performanţă favorabile pentru SPM (Scanning Probe Microscopy)............. Tehnici Experimentale ....................... de regulă................... Implementarea Noilor Tehnologii....... Tabel 1..... Tehnici Experimentale ...........................Microscopia de forţă atomică – partea a II-a Conf......................................... Optical microscope Scanning electron microscope Electron scattering Transmission electron microscope Electron absorption Atomic force microscope Forces of probe-sample interaction 1Å-200 μm 0.......Scanning Probe Microscopy .........................................386 4............. Dintre acestea............... în primul rând merită remarcată informaţia 3D reală a topologiei suprafeţei dublată de măsurarea unor mărimi fizice pe suprafaţă........Scanning Probe Microscopy Introducere..

Consecinţa acestei situaţii se reflectă în performanţa finală a experimentelor în care apelăm la un SPM şi putem spune că în mare măsură performanţa este dependentă de iscusinţa experimentatorului. respectiv apelarea la instrumente SPM complexe (izolare la vibraţii avansată. să reţinem că acest detector mecanic este capabil să pună în evidenţă atomii. nu ne putem aştepta să vedem diferite domenii în moleculele de proteină. Performanţa sistemului de control şi achiziţie este esenţială în performanţa finală a SPM-ului. temperatură scăzută.Dacă ne referim la modul de preparare a probelor pentru SPM. Merită să reţinem că detectorul este mecanic şi de asemenea. Aşa că. SPM-urile moderne pot pune în evidenţă un singur atom. În condiţii experimentale adecvate. ne obligă să apelăm la o preparare complexă a eşantioanelor. atmosferă controlată. Sistemul optic nu are alt rol decât de a măsura deflexia cantileverului. nu de puţine ori. Mărimea specifică de interes într-o situaţie particulară este detectată (Figura 1.1. nici limitădetectia inneractiuni sonda (tip) si esantion. La o extremă. …). Tehnica experimentală la nivel de detecţie a interacţiunii dintre un tip (sondă) şi eşantion se bazează pe un cantilever. un fir de păr) este suficient de potrivit dacă nu are o rugozitate comparabilă cu capacitatea de deplasare a scanner-ului pe direcţia Z (perpendicular pe eşantion). respectiv amplitudinea de oscilaţie sau fază. Fasciculul este poziţionat în centrul unui foto-detector cu patru cadrane (fotodiodă). dar nu poate elimina limitările mecanice Figura 1. orice material (de exemplu. 379 . atunci cuvântul „optional” nu sugerează întotdeauna ceva facil. mari schimbări de conformaţie (myosin) sau forme spiralate ale moleculelor DNA. Obţinerea unor imagini unice în conţinut si performanţă. acest lucru nu este posibil datorită lipsei de rigiditate a acestora. Viteza de scanare depinde de caracteristicile mecanice ale scanner-ului şi tot de calităţile mecanice ale acestuia depinde şi aria maximă ce poate fi scanată. dar în cazul unor eşantioane biologice (molecule). Digital Anolog Converter DAC) cantilever şi sondă (tip). Rezoluţia sistemului este asigurată de sistemul de control (electronic. subsistem pentru (din construcţie). Scaning Probe Microscope.1) de un sistem opto-electronic bazat pe reflexia unui fascicul laser pe cantilever.

380 . Această situaţie este produsul unei lungi evoluţii a tehnologiilor de laborator şi asigură maximul de informaţie posibil în acest moment. Tocmai de aceea. cu o mai Figura 1. SPM poate include în platforma sa tehnici optice în special în cazul AFM. moleculare. reconstrucţia 3D şi nanomanipularea. imaginea celulelor. o imagine mai bună este echivalentă cu mai multă informaţie. Proteine (Seleno Protein. nu pot fi considerate complementare cu alte tehnici experimentale.3. după cum rezultă din Tabelul 1. Treponema Pallidum (Tp) antigens).2. performanţa unei tehnici experimentale sau a unui echipament modern este complet definită de imaginea obţinută pentru un eşantion dat. Bacterii (Anabaena Variabils. Latice HPOG (stanga) grafia moleculară. DNA (sus). în general. sau imagine şi spectroscopie Raman. Virus Ebola. respectiv imagine 3D. Tehnologia experimentală actuală se bazează masiv pe conceptul de imagine. cum ar fi: AFM plus microscopie laser confocală. Informaţiile care se pot obţine pe diferite sisteme de studiu cu ajutorul unui SPM. interacţiunile respective latice MoTe2. acestea fiind parte din limitele fizice ale unui SPM.rile induse de proprietăţile materialelor folosite la construcţia SPM-ului. Specific şi unic în cazul SPM este capacitatea acestuia de a pune în evidenţă topoFigura 1. Helicobacter Pilory). imagini SNOM.

De asemenea. exemple cu ceea ce poate „vedea” un SPM (Figura 1. Lărgirea platformei cu elemente specifice microscopiei optice. adesiune intre sonda si suprafta esantionului. cu un mai bun raport semnal zgomot. sunt prezentate în continuare.4.4. În acest sens. baza funcţionării SPM-ului. este uşor de pus în evidenţă curba forţă– distanţă atunci când o legătură specifică apare. SNOM şi spectroscopiei Raman întregeşte această tehnică modernă. dat fiind interesul crescut pentru biologie şi biotehnologii. SPM are un rol bine definit prin capacitatea sa unică de a putea asigura o rezoluţie ridicată pentru eşantioane superficial pregătite (Figura 1. Într-o măsurătoare locală.y). capacitatea de nanomanipulare simultană a acestor eşantioane asigură premisele unui nano laborator într-un singur echipament. De mare interes sunt imaginile ce pot fi obţinute pe eşantioane biologice. SPM-ul a fost primul echipament (STM) care a pus în evidenţă atomii şi acest lucru este posibil fără echipamente complexe pe eşantioane cu rugozitate scăzută (monostrat atomic). Nu exista adesiune (jos). două situaţii distincte pot fi observate în interacţiunea dintre sondă (tip) şi eşantionul studiat: a) nu există o adeziune la suprafaţa eşantionului. În acest sens.bună calitate. este exploatată şi în spectroscopia locală de distanţă. respectiv HOPG. eşantionului.2 se poate vedea la rezoluţie atomică o latice de MoTe2.3).3). este pusă în evidenţă o adeziune. într-o poziţie dată (x. prin imagini. După cum se poate vedea în Figura 1. În Figura 1. adică toate mărimile fizice istorice se regăsesc în final în calitatea imaginii. cu o mai bună liniaritate în sistemul de măsură. b) între sondă şi suprafaţa Figura 1. Interacţiunea dintre sondă (tip) şi eşantion. 381 .

Platforma Integrată pentru Nanotehnologii combină toate tehnologiile cunoscute în Scanning Probe Microscopy (SPM) într-un singur produs.5. Toate aceste rezultate au fost obţinute prin observarea unor probe corespunzător preparate pe suprafeţe substrat şi nu în condiţii fiziologice. glicani. fiecare experiment în care este implicat SPM – ul. proteoglicani. din Figura 1. are multe elemente particulare care. acizi nucleici) a unui vârf AFM a deschis o cale promiţătoare pentru recunoaşterea unor molecule particulare. S-a dovedit că receptori independenţi pot fi recunoscuţi de un vârf AFM funcţionalizat cu anticorpi. se poate imagina un sistem de recunoaştere moleculară. este cel mai recent echipament şi singurul 382 . generând astfel un nou şi performant echipament în acest domeniu. b) acest lucru este dificil şi în cazul unei topologii moleculare. Tehnica sondă-ligant şi analiza unei situaţii particulare prin intermediul curbelor locale forţă – distanţă sunt de mare folos în diferite experimente de recunoaştere a proteinelor. Sunt încă dificil de recunoscut proteine specifice.5 este reprezentat schematic un astfel de experiment care printr-o tehnică specifică permite discriminarea unor receptori pe suprafaţa unei celule. cum sunt receptorii. Discriminarea unor receptori pe suprafaţa unei perspectiva utilizării acescelule. cum ar fi: a) celula este un sistem prea labil pentru a putea observa o singură proteină pe suprafaţa ei. sonda funcţionalizată (molecula ligant) interacţionează cu un eşantion biologic special preparat. printr-o tehnică de cartare a forţei. În Figura 1. avem câteva reguli generale. Cu toate acestea. Sistemul NTegra produs de NT-MDT Inc. tuia. numai pe baza acestor informaţii topografice. depind în mod esenţial de experienţa utilizatorului.Bazat pe observaţia anterioară. plecând de la tăria adeziunii pentru o situaţie dată. tehnica funcţionalizării cu anumite biomolecule (proteine. În general. Deoarece interacţiunea dintre liganzi şi receptori este foarte specifică. Progresele recente privind rezoluţia spaţială a tehnologiei AFM au făcut din obţinerea unor imagini topografice a unei singure proteine o operaţiune de rutină. în final.

current). măsurarea caracteristicilor probei şi generarea automată de rapoarte.6) a fost special proiectat pentru a permite înglobarea unor tehnici de analiză ştiinţifică (spectroscopie si/sau prepararea probelor) pe lângă cele specifice SPM. inclusiv procesarea de imagine 3D. cu posibilitatea schimbării acestuia pe durata măsurătorilor).pe plan mondial care poate fi încadrat în conceptul de NanoLaborator. Programul NOVA (NT-MDT) controlează întreaga platformă. un sistem SPM şi un controler de temperatură pentru măsurarea probelor biologice în aer sau lichid (inclusiv în mediul de cultură. de la achiziţia de imagine la arhivarea acesteia.Vita. Sistemul NTegra se prezintă utilizatorului ca fiind o soluţie completă pentru cercetare. Toate sistemele integrate în platforma NTegra utilizează acelaşi suport electronic şi acelaşi program.click). industrie şi nanotehnologie. trebuie menţionate metodele avansate de litografie disponibiFigura 1. în producerea de echipamente şi programe pentru nanotehnologii. chiar dacă sistemul este foarte complex. îmbiFigura 1. doar prin program (mouse . Programul de aplicaţie înglobează lunga experienţă NT-MDT Inc. Laboratorul de Nanotehnologii Fizice are în dotare un sistem NTegra Vita care integrează două microscoape optice performante.7). În acest moment. Ntegra. Nu în ultimul rând. 383 . acesta este uşor de înţeles şi utilizat. Acest concept este sugerat şi prin numele echipamentului format din grupul de litere cheie NT care sunt prescurtarea de la NanoTechnology şi un al doilea grup de litere cheie care sunt prescurtarea de la intEGRA. in microscopul optic. Subsitem scanner integrat le (scratching. astfel încât. pentru litografie. Aproape toate setările sistemului sunt controlate de programul NOVA. Sistemul NTegra (Figura 1. Sitemul nând simplitatea utilizării cu facilităţile oferite. Rezultatul acestui concept permite reconfigurarea sistemului pentru orice aplicaţie particulară (Figura 1. care înseamnă perfect.6.7.

diverse tipuri de încălzitoare pentru lichid şi măsurarea probelor biologice cu schimbarea lichidului cu flux controlat pe parcursul experimentului.programul NOVA are aplicaţii. Ntegra Vita are facilitaţi de excepţie pentru investigarea de probe biologice cum ar fi: incinte închise/deschise stabile chimic care pot opera cu discuri Petri. non-contact). prin Vbscript. În acest fel. 15 mm in height by probe by sample up to 14x14x2. realizarea unor extensii sau automatizarea unor secvenţe de genul măsurare. procesare imagine şi generare de rapoarte.0. STM by sample Φ 40 mm. Metodele de bază SPM. Scanning Capacitance Microscopy. semi-contact.5 mm and by probe up to 15x15x3 mm 100x100x10 μm up to 200x200x20 μm in DualScan mode from RT to 60˚ C +/.005˚ C (typically). Phase Imaging. Electrostatic Force Microscopy. În proiectele noastre. Kelvin Probe Microscopy. 15 mm in height and Φ 100mm .01 ˚ C in air only Sample size in air in liquid Scan Range Temperature control (for operation in fluid environment ) Range Stability O pagină help bine documentată cu descrierea funcţiilor de bază şi câteva exemple de utilizare asigură accesul utilizatorului la semnale de bază din sistem. utilizăm intensiv facilitatea open software a programului NOVA care permite. Forces-Distance Curves STM/MFM (Magnetic Force Microscopy). AFM Lithography (scratching). Lithography: AFM (current). <= +/. LFM (Lateral Force Microscopy).0. Tabel 2 SPM methods in air and liquid AFM(contact. controlul temperaturii pentru lichide. programul poate fi extins pentru orice aplicaţie utilizator fără a fi nevoie de cunoştinţe de programare avansată. 384 . Force Modulation. Spreading Resistance Imaging. pot fi preluate imagini „gray level” şi transpuse pe suprafaţa de investigat. facilităţi de generare automată de imagini sau mai mult. AFI(Adhesion Force Imaging). cât şi unele performanţe ale sistemului NTegra Vita sunt enumerate in Tabelul 2. sau între experimente.

van der Lelie D. Liedl T. Wiley-Liss. Li MQ. Song Y. Dammer U.two key technologies in nanoscience and templating. 17. Adv Eng Mater. 19. Hoboken. Golden handshake. Stephens BJ. 17. Winfree E. Hinterdorfer P. A combined atomic force/fluorescence microscopy technique to select apatamers in a single cycle from a small pool of random oligonucleotides. 2004. 9. 11. 1998. 3. Anselmetti D. Liu F. Seeman NC. Wagner P. Surf Interface Anal. Simultaneous AFM manipulation and fluorescence imaging of single DNA strands. 2007. Popescu O. 1995. 5. Yan SH. Crocker JC. 451. Heckl WM. Guntherodt HJ. Wenzler LA. Hartmann U. 2004. Chem Phys Chem. Nanodissection. 127-138. Maye MM. 1173-1175. Hench LL. 456. Microsc Res Tech. Tang R. Kufer SK. Nature. J Am Chem Soc. 10. 13. 13. 2007. Nykypanchuk D. Liu Y. 6. Dufrene YF. Nature. Li MQ. Brauchle C. 534-540. Wang L. Single-molecule cut-and-paste surface assembly. Zhang Y. 8. 70. 528-529. 2008. 372-381.Eur J Physiol. 2. Nature. Seitz M. Binding strength between cell adhesion proteoglycans measured by atomic force microscopy. Hards A. An H. Cubicciotti R. 267. 2002. Li Z. 998-1004. 15. Microsc Res Tech. and lithography using modified tapping mode atomic force microscope. 36. 2004. Science. 2006. Guthold M. Ferreira A. Surf Interface Anal. Science. Zumbusch A. Zhou C. 2006. Zhang Y. Lu J. 12. IEEE Robot Autom Mag. Molecular self-assembly and nanomanipulation . Lu JH. and future. Li M. 2005. Hu J. Goodsell DS. Polak JM. Polak JM. Gao HB. 2006. Nanomanipulation of single DNA molecules and its applications. 295. 4690-4698. Wang Y. Nat Methods. Ann NY Acad Sci. 1994. 451. 124-126. Tao J. 237-245. isolation.2. Science. 549-552. Gang O. 18. 2008. Inc. Li H. Molecular nanomachines: physical principles and implementation strategies. 7. 20. 4. 2. 1068. 594-596. Hu J. Cai Y. 1014-1017. Misevic GN. 2008. present. 23. 394. Drexler KE. Li B. Li B. Tan Z. Design and self-assembly of two-dimensional DNA crystals. Li X. Strick TR. Pan H. and PCR amplification of single DNA molecules. 7. 6. Adv Eng Mater. Hu J. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Puchner EM. Third-generation biomedical materials. 193-196. 2005. 69. New Jersey. 385 . 2006. 38. Rubio-Sierra FJ. Xu X. 377-405. Virtual reality and haptics for nanorobotics. and differentiation of bone marrow mesenchymal stem cells. Mavroidis C. Effect of crystallinity of calcium phosphate nanoparticles on adhesion.. Hu Q. Zhang Y. Bionanotechnology: lessons from nature. 1010-1013. Bishop AE. Gaub HE. Zhang M. DNA-guided crystallization of colloidal nanoparticles. Liu Z. Ye M. Stem cells and tissue engineering: past. Revyakin A. Peng L. Ann Rev Biophys Biomol Struct. 16. 78-92. Recent progress in AFM molecular recognition studies. Stark RW. 14. Gumpp H. 129. 319. 21. 2005. Sun L. 539-544. Heckl WM. Bibliografie 1. Positioning scission of single DNA molecules with nonspecific endonuclease based on nanomanipulation. Nanomanipulation by atomic force microscopy. Ebright RH. 6668-6669. 6. Wei G. Manipulation. J Mater Chem. 843-847. 2008. Bonin K. 2007. dissection. Pflugers Arch . proliferation. 352–366.

Aceste dispozitive bazate pe interfaţa haptica prezintă o mare oportunitate în dezvoltarea unor aplicaţii generic asistative care să permită manipularea nano-obiectelor precum şi imersia totală în realitatea virtuală a utilizatorului. Studiul abilitaţilor tactile umane este o încercare recentă şi multe din sistemele disponibile astăzi nu incorporează cunoştinţe din domeniile psihofizicii. biomecanicii şi elemente neurologice ale percepţiei haptice. unde prin haptic înţelegem ştiinţa pipăitului. urmată de încorporarea acestor cunoştinţe în ingineria interfeţelor haptice. simţim lucruri interesante cu ajutorul mâinilor. Deoarece cercetările iniţiale au fost promiţătoare. Această metodă va asigura cercetătorului posibilitatea de a se concentra pe investigarea suprafeţei şi proprietarilor asociate şi nu asupra programării unei interfeţe. acestea au generat o adevărata competiţie în încercarea de a dezvolta o interfaţă haptică naturală. În viitorul apropiat. O problemă majoră legată de sistemul tactil uman constă în faptul că nu este foarte bine cunoscut. cercetătorul percepe că poate interacţiona direct cu suprafaţa de investigat.3. Aceste maşini sunt denumite interfeţe haptice. spre deosebire de alte modalităţi de interacţiune: percepţia vizuală. intuitive şi a unui feedback senzorial multi-modal a determinat proiectarea unor maşini care asigură utilizatorului generarea unor comenzi prin mişcarea mâinilor. privim către lucruri din diverse unghiuri. privim în jurul nostru. Motivare. Nevoia unei interacţiuni om-maşină naturale. utilizatorul primeşte informaţii despre forţe sau coliziuni ale mâinilor sale. Sistemul de control va translata mişcarea uneltei în mişcarea sondei SPM-ului şi va translata parametrii măsuraţi ai suprafeţei sub forma unei forţe aplicate uneltei simultan cu informaţii vizuale şi/sau audio despre parametrii suprafeţei. Mişcarea naturală a capului sau mâinilor poate fi utilizată pentru a investiga şi modifica suprafaţa care este afişata la scala cercetătorului. În acelaşi timp. pentru a crea acestuia o percepţie naturală. vorbirea sau sistemul motor. Când noi suntem prezenţi undeva. putem lua lucrurile pentru a le rearanja şi putem interacţiona cu acestea pentru a vedea răspunsul lor. privim comportamentul lucrurilor care se mişcă sau se schimbă. noi vom avea mult de învăţat despre lumea la scală 386 . Implementarea Noilor Tehnologii Introducere. Când este utilizat un astfel de sistem. Dezvoltarea unor interfeţe şi dispozitive haptice moderne necesită studii extensive pentru a înţelege legătura dintre fenomenele perceptuale şi măsurătorile biologice. Interfaţa ideală dintre om şi SPM trebuie să prezinte utilizatorului suprafaţa investigată ca o reprezentare 3D mărită pe care să o poată pipăi şi care să poată fi modificată cu ajutorul unor unelte controlate de mână.

Prin combinarea unui SPM cu o interfaţă de realitate virtuală asigurăm o afişare intuitivă a datelor produse de instrument. oferind cercetătorului posibilitatea de a fi virtual în dimensiune nano. un dispozitiv SPIDAR (Space Interface Devices for Artificial Reality.1) cu feedback de forţă împreună cu controller-ul şi o reţea de calculatoare PC cu facilităţi grafice avansate. Scopul unei interfeţe SPIDAR este de a asigura cercetătorului imersia virtuală în lumea la scală nano. Sistemul de Nanomanipulare. Figura 3. inclusiv despre modul cum proprietăţile mecanice. precum şi legat de interfaţa cu obiectele la scală nano.nano. Beneficiile unei asemenea tehnologii sunt: 387 . oferindu-ne posibilitatea de a investiga individual nano-obiecte cu facilitaţi de excepţie obţinute prin combinarea caracteristicilor unor proprietăţi fizice cu informaţiile structurale. Figura 3. transportul de sarcină şi dinamica acestor proprietăţi sunt afectate de structura la scală atomică a nano-obiectelor. Nanomanipularea dă o semnificaţie aparte acestor probleme. Nanomanipulatorul este obţinut prin integrarea unui microscop de scanare a probei împreună cu controller-ul. Acest cluster local format din cel puţin trei calculatoare comunică printr-o reţea IP. Interfaţa SPIDAR. precum şi un control natural al funcţiilor acestuia.1. Semnificaţia interfeţei de realitate virtuală a SPM-ului este aceea de a simula prezenţa cercetătorului pe suprafaţa de investigat. Interfaţa utilizator avansată va juca un rol crucial prin modul transparent de a experimenta la scală nano.

urmat de un feedback al parametrilor pe durata modificărilor şi utilizând pseudo-culori sau imagini ale liniilor. forţe laterale şi de adeziune (AFM). b) explorarea efectivă a suprafeţei de investigat.1. Figura 3. 388 . Acestea includ măsurători de conductanţă şi măsurarea de curbe curent/distanţă (STM). dar această afişare nu permite cercetătorului să vadă corelarea dintre aceste informaţii şi topografia suprafeţei. dar într-o manieră utilă. c) abilitatea de a observa procese dinamice aproape în timp real d) şi posibilitatea de a modifica interactiv suprafaţa. utilitatea unei tehnici este mult mai importantă decât realismul. Pentru vizualizarea ştiinţifică. pe măsura ce se colectează datele. într-un mod nerealist. Microscopul de scanare a probei (SPM) este un instrument extrem de rafinat pentru explorarea şi manipularea la scală nanometrică. este util să afişăm aceşti parametri într-un spaţiu virtual.a) îmbunătăţirea percepţiei structurilor 3D. Câţiva dintre aceşti parametri sunt reprezentaţi natural pe canalele vizuale ca informaţie de culoare sau înălţime. Interfaţa SPIDAR. În acest caz. SPM-ul poate colecta multe alte date despre parametrii fizici specifici eşantionului. Multe experimente au fost realizate prin controlul preprogramat sau în buclă deschisă a probei SPM-ului. transmisia laser a diverse lungimi de undă şi polarizări (NFOM – near field optical microscopy). proprietăţi magnetice (MFM – magnetic force microscopy). Pe lângă datele despre topografia suprafeţei. temperatură sau alţi parametri fizici.

prin interfaţa haptică. Utilizând procesarea de imagine 3D. acest concept este foarte elegant în simplitatea sa şi foarte util pentru o unitate de nanomanipulare. Se poate asigura interacţiunea în timp real cu parametrii de vizualizare cum ar fi direcţia iluminării. setul de date pentru o abordare prin interfaţa SPIDAR este de fapt topografia suprafeţei (Figura 3. O procesare de imagine 3D utilizează un mixaj de imagini într-un head-mounted display (HMD). tehnologie bine cunoscută în câteva aplicaţii de avionică. efectiv o vedere cu raze X utilizatorului. a feedback-ului de forţă. În această etapă tehnologică. Figura 3. pe timpul unor situaţii complexe. prin combinarea unui rendering grafic computerizat cu elementele ascunse. O afişare naturală a unui set de date 3D este posibilă prin iluminarea direcţionată a suprafeţei. ca un exemplu a consideraţiilor implicate.Sistemul Multimodal. Acest concept generează noi aplicaţii în nanomanipulare şi asigură. 389 .2. A fost revăzută problema relativ simplă a rendering-ului 3D pentru o suprafaţă. Au fost studiate şi dezvoltate câteva moduri de vizualizare a unor seturi de date. Implementarea unei componente de vedere cu raze X la programul nanomanipulatorului SPM. introduce conceptul de realitate îmbunătăţită. este acum posibil să creăm un rendering în timp real al suprafeţei.2). unghiul de vizualizare şi scalarea. pe măsură ce datele sunt achiziţionate de SPM. Interfaţa SPIDAR in timpul unei operaţii de nano-manipulare. Într-un caz simplu.

micile caracteristici de pe suprafaţă conţinute în alte mari variaţii sunt mai bine puse în evidenţă prin utilizarea unei hărţi de culoare şi iluminarea puternică a suprafeţei 3D (acestea ar fi imperceptibile într-o reprezentare 2D). utilizând numai o lumină ambientală cu intensitatea funcţie de înălţime. pe perioada modificărilor suprafeţei. Această tehnologie poate lucra bine pentru imagini lipsite de zgomot. Abilitatea cercetătorului de a recunoaşte structuri moleculare specifice în prezenţa zgomotului este îmbunătăţită prin vedere stereoscopică. De asemenea. De asemenea. dar să şi acţioneze asupra lor şi să le atingă. grafica 3D bazată pe umbre cu hărţi de culoare iluminate puternic. Asigurând afişarea stereoscopică şi nu cea monoscopică. Pentru imaginile SPM. Folosirea umbrelor este echivalentă cu desenarea suprafeţei. Conceptual. Poziţia o-ring-ului în spaţiu poate controla diferite caracteristici afişate. uneori reuşind. Este neaşteptat să ne imaginăm că putem acum oferi posibilitatea cercetătorului nu numai de a vedea nano suprafeţe cu ajutorul SPM. netezite micile fluctuaţii cauzate de zgomotul conţinut în imaginea suprafeţei. dar imaginile din lumea reală conţin întotdeauna zgomot. de asemenea. Acest lucru este adevărat din două considerente: pseudo-colorarea dedică întreg domeniul de intensitate adâncimii şi sunt. din caracteristicile imaginii. Pentru caracteristicile care sunt semnificative numai prin diferenţa mare de înălţime faţă de suprafaţa imaginii.Vizualizarea 3D nu este întotdeauna cea mai bună soluţie pentru suprafeţe cu mici denivelări. pentru cercetător este mai uşor să perceapă adâncimea obiectelor virtuale apropiate. Percepţia spaţială 3D a datelor SPM cu acurateţe face posibilă pentru cercetător utilizarea cunoştinţelor sale ştiinţifice la recunoaşterea unor structuri şi caracteristici de interes. imaginile pseudo-colorate au dedicat întreg domeniul de intensităţi pentru a evidenţia aceste diferenţe. cum ar fi controlul unghiului de vizualizare a suprafeţei. Acest zgomot va determina o fluctuaţie a iluminării caracteristicilor cu aceeaşi magnitudine. din păcate. acest sistem este echivalent cu un sistem tele-robotic care operează între două scale foarte diferite. de regulă o vedere prin pseudo-culoare este superioară unei vizualizări 3D prin umbre. Noi utilizăm o interfaţă haptică cu feedback de forţă care sesizează poziţia 3D a o-ring-ului SPIDAR (cu capabilităţi adiţionale pentru a sesiza 3DOF – grade de libertate) şi aplică forţele de la nivel nano adecvat scalate în mâna utilizatorului. Această abilitate 390 . spre deosebire de sistemele tele-robot utilizate în chirurgie. să le facă neobservabile. o suprafaţă plată are un mare conţinut de zgomot şi acesta este exprimat ca o fracţie. un feedback de forţă asigură un control intuitiv al probei şi permite sesizarea contururilor de pe suprafaţă.

persoanele nevăzătoare construiesc modele intercorelate între canalul auditiv şi cel haptic. Cu toate acestea. 391 . Abilitatea de a sesiza şi percepe obiecte dincolo de zona accesibilă (Figura 3. Un sistem automat cu abilitatea de a face o predicţie despre cum simţim obiectele de tipul celor reprezentate prin valori ale pixelilor are multiple aplicaţii în generarea automată a datelor haptice. fedback-ul de forţă asigură utilizatorului posibilitatea de a localiza obiecte şi caracteristici ale suprafeţei. O abilitate deosebită a oamenilor este aceea de a dezvolta capabilităţi de coordonare intermodală şi de procesare a modelelor. Mai mult. auz şi senzaţiile tactile determină redundanta în reprezentarea spaţială care asigură fiecăruia dintre noi utilizarea transferului intermodal şi coordonarea mecanică pentru activităţile spaţiale. Vederea asigură fiecăruia abilitatea de a plănui şi executa activităţi spaţiale (zonă cunoscută ca fiind kinesferă). Studiile efectuate pe persoane nevăzătoare arată că au abilitaţi eficiente în câteva activităţi spaţiale. Utilizatorului ii este extrem de util să revadă experimentul pentru a vedea ce decizii a luat pe parcursul desfăşurării acestuia (analiza post-expriment). De exemplu. recunoaşterea obiectelor şi descrierea acestora. Acest fişier poate fi redat mai târziu pentru a revedea întregul experiment. inclusiv corelarea cu proprietăţile măsurate cu o up-datare a imaginilor structurii.asigură controlul precis al suprafeţei şi deschide calea unor noi experimente. sistemul de nanomanipulare înregistrează toate datele. noi putem face o predicţie despre caracteristicile lui tactile cu o acurateţe rezonabilă. corelarea dintre văz . aşa cum avem în cazul văzului. incluzând topografia suprafeţei şi canalele externe. Percepţia Multimodală şi Intermodală. găsirea traseului pentru modificare şi asigurarea unei atingeri fine care să permită începerea unui ciclu experimental în secvenţa scanare-modificare-scanare. simţind când proba SPM se apropie de punctul de la care sunt posibile modificările. numai dacă privim un obiect. o limitare majoră a percepţiei tactile este dată de dimensiunea kinesferei. iar cercetările psihologice au arătat că aceste modele nu sunt adaptate pentru percepţia de stimuli la distanţă. navigaţia şi aşa mai departe. discriminarea formelor. cum ar fi conductanţa cu secvenţa de timp pe care o numim fişier stream. descrierea formelor. De asemenea. În al doilea rând. Feedback-ul de forţă este esenţial în găsirea structurilor ce urmează a fi modificate. în descrierea acestora. Un astfel de sistem poate fi de exemplu unul care construieşte nano-blocuri şi un dispozitiv care asistă cercetătorul şi asigură generarea de date haptice despre nano-mediul apropiat. în special în discriminarea texturilor.3) este extrem de importantă în activităţile zilnice cum ar fi conducerea maşinilor. În final.

Aceste structuri de date care stochează atât caracteristicile vizuale cât şi pe cele haptice ale obiectului sunt baza dezvoltării unor cartografieri automate dintre diferite caracteristici vizuale şi haptice. Modelele computaţionale sunt dezvoltate la nivelul tehnologic actual ca şi prototipuri vizual-haptice. Feedback-ul de forţă capturează procese din SPM şi acest lucru este denumit în literatura „explorare haptică a nano-obiectelor”.Figura 3. Odată ce un obiect a fost capturat vizual. greutatea. Captura vizuală SPM poate fi ajutată prin stocarea profilului haptic sau de atingere al unui obiect sub forma miscărilor mâinii. Nevoia de noi experimente şi dezvoltarea de algoritmi care pot îmbunătăţi percepţia în lumea de scală nano prin stimulare în timp real vizual. Gesturile utilizate de cercetător pentru a percepe caracteristicile unui nano-obiect au o structură logică şi asigură înţelegerea caracteristicilor unui nano-obiect.3. utilizată de cercetător pentru a percepe un nano-obiect. audio şi haptic este un domeniu fascinant de cercetare. dimensiunea. în faza de antrenament. Aceste prototipuri stocate într-o bază de obiecte haptice împreună cu strategiile de explorare haptic 392 . Interfata SPIDAR in timpul unei operatii de recunoastere haptica a unei structuri create anterior prin nano-manipulare. Explorarea haptică a nano-obiectelor se referă în esenţă la mişcarea mâinii. utilizatorul urmează să categorisească perceptual forma. Aceste modele computaţionale sunt dezvoltate pe baza modelelor neuropsihologice şi cognitiv psihologice ale analizei caracteristicilor vizual-haptice. textura şi materialul nano-obiectului haptic.

R. 4. Science 266 (December 23). Clary. and Guntherodt. 127 .138 (01 Feb 2005). Meyer. G. Jean-Louis Viovy.. S. 699 . Science 18 April 2003 300: 472-474.. Ullrich Pietsch. Academic Press. 1979 . 1998. 6... Guangyu Zhang. Sled-Type Motion on the Nanometer Scale: Determination of Dissipation and Cohesive Energies of C60. Gaudeline Wagner. 393 . 8... Microsc.. Luthi. P. 1998. 444 . Nature Methods 2.. 2. F. Advanced Interfaces to Scanning Probe Microscopes. Dieter Neher. M. Building and manipulating three-dimensional and linked two. Microanal. M.. Taylorr II.. 9. A. B. Nature Structural & Molecular Biology 13. Ariel Prunell.1981. Requicha.703 (01 Sep 2005). Falvo. Bugacov. R.. Richard H Ebright. Peter Karageorgiev.. 7. Science 17 November 2006 314: 1097-1098.. 1999.. BIOCHEMISTRY: RNA Polymerase. 504-512. Julien Mozziconacci. Terence R Strick. Vincent Croquette. R. Resch. 66136616...asigură baza de date pentru nano-spaţiu. J.. Michael Giersig.dimensional structures of nanoparticles using scanning force microscopy.. fiind suportul oferit de tehnologia actuală pentru viitoare aplicaţii în nano-robotică. Brooks Jr. Jean-François Allemand. Aurélien Bancaud. New York. Nanomanipulation experiments exploring frictional and mechanical properties of carbon nanotubes. Gutmannsbauer. R. 4. H. Structural plasticity of single chromatin fibers revealed by torsional manipulation. H. A. Jean-Marc Victor. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Roberts. and Enge Wang.. G. R. 5. 4. L. Chi. and Superfine. and Superfine. Burkhard Stiller. Bibliografie 1..450 (01 May 2006). 271-308. Langmuir 14 (23). Nalwa. Howald.. in Handbook of Nanostructured Materials and Nanotechnology. Ludwig Brehmer. E.. A. a Scrunching Machine. E. Natalia Conde e Silva. pp. S. Koel. Haefke. Helser. Baur. Andrey Revyakin. A. Jeffrey W. R. H. Maria Barbi. Taylor II. Washburn. Madhukar. W. 1994. From anisotropic photo-fluidity towards nanomanipulation in the optical near-field. Xin Jiang. V.. Tubular Graphite Cones.. M. Burkhard Schulz. Nature Materials 4. Paulson. and Will. S. P. 3. S. C. Christophe Lavelle. A.

.......... Generarea fotonilor de raze X .................................................1.5....................................... 395 1....................................... Maria Teodora Radu Cuprins I......................................5......... Detector Multicanal MCD .. Mecanismul de tăiere a orbitei .... Modul de focalizare.........................2..........................2....... dr.............................................. 415 1................................. Sursa de raze X pentru FOCUS 500 (XR50 M) ..........................................................Concepte de bază ................ 401 1..1......................2................................. 416 2...... 402 1.. 417 2................................. Componente ... 421 2................... Principiile Detecţiei ........ Analizorul Emisferic (HSA) ............................ Informaţii generale în legătură cu sursa XR 50 M ........................ Analiza de suprafaţă .................. Izolarea Magnetică ...1................ Descrierea Analizorului ............................................... 422 3...............................................................................2.................2............................2.............2................................................. 417 2........3............5... Caracteristici generale .....1........ Flood-Gun 15/40 ...........................2................. Spectroscopia fotoelectronică de raze X .4. Bibliografie ..............3..............1... Descrierea sursei ..............S........................2..1.................. Principiu de funcţionare..................................................2.....................................................3................ 412 1.................... 398 3... Răcirea cu apă ................. 422 3.. 421 2............................3............................................................................ 422 3.....1.........2..................................... 414 1....1.......... Design-ul şi principiul de funcţionare al spectrometrului de electroni ................ 396 2....... Coerenţa între şi pas ... 402 1..1.........2.....................2........................................ SPECTROMETRUL DE FOTOELECTRONI DE RAZE X (XPS) ŞI ULTRAVIOLETE (UPS) Spectroscopia fotoelectronică C.................2..... 412 1........3.......III........... Spectrele UPS şi energia de rezoluţie ............. Informaţii generale .............. 417 2..................................................... Sistemul de lentile ...................................2.................................... 395 2...2. Monocromatorul ................ 414 1....................................................... 402 1......... Spectroscopia fotoelectronică cu radiaţie UV (UPS) ....................................... 400 II...............................2............................... Analizorul de energie emisferic de tip PHOIBOS .............. 410 1.........2............................XI........ Caracteristici generale ............................2................................ 416 2...1.........2............................. Multiplicarea Electronică .. 415 2..........5........................................................................ 397 2............ 423 394 .......................................... 422 4........................................ 405 1....

la energii de legătură mai mari. Concepte de bază 1. folosirea unui monocromator suplimentar poate fi un avantaj atât pentru energia de rezoluţie cât mai ales pentru suprimarea background-ului şi a intensităţilor sateliţilor care pot să apară în spectru. Distribuţia fotoelectronilor I(Ekin) poate fi măsurată de analizor şi reprezintă în prima aproximaţie o imagine a densităţii stărilor electronice ocupate N(EB) în proba analizată.2: 1486.2:1253. cu gaze rare ca heliu (He I: 21. Analiza de suprafaţă Spectroscopia fotoelectronică a fost stabilită ca una din cele mai importante metode de studiu a structurii electronice a moleculelor.82 eV) şi liniile ceraracteristice ale unei surse de raze X care utilizează de obicei ca materiale pentru anod aluminiul (Al . şi a contribuit semnificativ la înţelegerea principiilor fundamentale din fizica corpului solid [1-5]. 1 eV pentru anozii sursei de raze X. Electronii cu energia de legătura EB pot fi excitaţi deasupra nivelului E de către fotoni cu energia hν > EB + Φ0. solidelor şi suprafeţelor [1-2].Kα1.V.23 eV si He II: 40.6 eV) sau magneziul (Mg Kα1. Această separare se bazează în principal pe cele două tipuri diferite de sursă de excitare cvazi-monocromatică disponibile în laboratoarele de cercetare şi anume: spectrul liniei UV a lampei de descărcare pentru energii în domeniul de aproximativ 10-50 e. pentru că proprietăţile fotoelectronilor emişi reflectă în principal stările electronice proprii ale sistemului investigat.6 eV). suprapunerea dintre rezultatele experimentele de spectroscopie de fotoemisie şi teorie este necesară pentru investigarea a numeroase proprietăţi a stării solide.I. are pe scară largă implicaţii practice în diferite domenii ca de exemplu fizica şi chimia suprafeţelor sau ştiinţa materialelor.1 Această figură simplificată arată atractivitatea spectroscopiei de fotoemisie. câţiva meV pentru lampa de descărcare şi aprox. de ex. Mai mult. În general. inclusiv dispersia benzii de valenţă magnetismul 395 . Deşi lărgimea liniei este de obicei suficient de mică pentru multe aplicaţii. În principiu se poate face distincţie între fotoemisia cu radiaţie în ultraviolet (UPS) utilizată în principal pentru investigaţii ale stărilor din benzile de valentă şi spectroscopia de fotoemisie cu raze X (XPS) care permite identificarea atomilor la suprafaţa solidelor şi determinarea deplasărilor în energiile de legătură ale core-level-urilor care sunt legate de diferite moduri de legături chimice. Principiul fundamental al procesului de fotoemisie este prezentat schematic în fig.

d. trebuie menţionate câteva exemple pentru caracteristici “many-body” ce pot fi puse în evidenţă pe scala meV în spectrele de fotoemisie UPS a sistemelor solide: (111) stări de suprafaţă de tip Shockley pentru Cu(1 1 1) [7-8]. În prezent. De asemenea. furnizând informaţii despre dispersia fononilor în solide. tehnic în domeniul spectrometrelor de înaltă rezoluţie. gap-ul supraconductor al unui supraconductor conven396 . Spectroscopia fotoelectronică cu radiaţie UV (UPS) Această tehnică este folosită pentru a studia nivelele de energie din banda de valenţă şi legăturile chimice corespunzătoare.Figura 1. 2. UPS joacă un rol important în obţinerea structurii benzii de valenţă a unui număr mare de solide şi suprafeţe. Mai mult. În acest context. Investigarea experimentală a acestor proprietăţi necesită o energie de rezoluţie de ordinul meV. în cazul chemosorbţiei metoda ne permite studierea nivelelor electronice de energie derivate din orbitali moleculari ai sistemului substrat absorbit. Turner pentru studierea moleculelor în faza gazoasă[6] şi ulterior dezvoltată până la nivelul actual. aproape la fel ca difracţia de neutroni.p. în ultimii ani s-au efectuat îmbunătăţiri remarcabile d. Prezentare schematică a procesului de fotoemisie în modelul uni-particulă.v. Metoda a fost dezvoltată iniţial în 1962 de David W. şi suprafaţa Fermi.

diametrul capilarului (1.distanţa de la capilar la probă (aprox 40 mm).randamentul total de electroni 397 .1. 2. d .raza ariei excitate din proba.fluxul fotonilor (sec-1).ţional (V3Si). Caracteristici generale Fluxul fotonilor emişi de sursa de-a lungul axei optice poate fi determinat utilizând formula Φ = I ph * Ω . (CeCu2Si2) [10-11].unghiul solid (sr-1). dc .curentul fotonic pe probă. Ω. Schema pentru aproximaţia unghiului solid Fluxul de fotoni poate fi calculat folosind formula: Φ= 1 e*r .3 mm). Aceste exemple sunt reprezentative pentru înţelegerea unor probleme mult mai complexe în fizica stării solide cum ar fi supraconductivitatea de temperatură înaltă (HTSC) şi compuşii cu fermioni grei. Iph . [9] şi rezonanţă Kondo în sistemele cu fermioni grei. unde (4) I. În prima aproximaţie unghiul solid rezultă din zona iluminată a probei şi distanţa dintre capilar şi probă: Ω= π + r2 d2 (2 ) (3 ) R= d (1 − 2d*cr ) R .densitatea fotonilor (sec-1sr-1). unde (1) Φ. Figura 2. η .

2. Dacă energia fotonilor este 40 eV structurile d-like sunt generate cu o probabilitate de excitare mare. în plus faţă de XPS. densitatea fotonilor este calculată ca fiind: Iph= 8.3 * 1015 fotoni sr-1sec-1 2. şi folosite pentru determinarea unor informaţii specifice suplimentare în analiza de suprafaţă. Φ. Descărcarea VUV acoperă un interval de energie al fotonilor de la 10 la 50 eV. Datorită caracterului cvasimonocromatic al liniilor de excitare se poate obţine energie de rezoluţie înaltă (aprox. Determinarea funcţiei de lucru. De aceea. 0. Figura 3.01 eV) ceea ce permite rezolvarea structurilor vibraţionale moleculare. cu UPS 398 . sau< 12 eV energie a fotonilor) spectrele fotoelectronilor UV excitaţi. În intervalul VUV de energii joase (<20 ev. depind puternic de energia fotonilor excitanţi.2. Lăţimea liniei de excitare. forma şi structura lor.40 eV structurile electronilor de valenţă s-like sunt suprimate în comparaţie cu orbitalii p-like.22 mm diametru şi un curent pe proba de 55 nA. este în general de câţiva meV de aceea monocromatizarea suplimentară nu este necesară în cele mai multe cazuri.Din (1) si (4) rezultă: ⎛ d ⎞ 2 ⎟ I ph = I * ⎜ ⎜ 1 − dc ⎟ / e *π * r *η ⎝ 2*r ⎠ 2 (5) Pentru o arie iluminată a probei de aprox. Spectrele UPS şi energia de rezoluţie Sursa UV de tipul UVS 10/35 este în principal utilizată pentru studiul densităţii de stări a electronilor de valentă. spectrele UV ale fotoelectronilor exciţi pot fi comparate cu rezultatele teoretice obţinute din calculul structurilor de benzi. Pentru energiile fotonilor VUV în intervalul 20 .

adică lăţimea spectrului cu ΔE= constant în figura 4. funcţia de lucru poate fi calculată folosind formula: Φ= h * ν – (Emax . Determinarea funcţiei de lucru.Φ) (7 ) unde. pentru energia de legătură şi energia cinetică avem: EB= 0 Emax= h * ν – Φ. pentru un electron emis de la un nivel de energie EB < EF: Ekin= h * ν – (EB .nivelul de energie al vidului. Φ.nivelul Fermi. unde Emax este cea mai mare energie cinetică. Φ.Potrivit figurii 3.EF. prin măsurători UPS Diferenţa dintre energiile cinetice ale electronilor la poziţiile A şi B este Emax . este exprimată astfel: Φ= Evac .Emin= h * ν – Φ (10) Această diferenţă este egală cu distanţa de la A la B. Prin urmare. Un electron emis de la un nivel de energie Ex < Ef (figura 3C) are o energie cinetică minimă (Emin= 0). (8 ) (9 ) Figura 4. EF. hν este energia fotonului.Emin) (11) 399 . unde (6 ) Evac.Emin adică: Emax . funcţia de lucru. În general. Pentru un electron emis de la nivelul Fermi (figura 3B). Acest electron ar apărea în poziţia A în figura 4.

deoarece toţi electronii cu o energie de legătură mai mică decât energia fotonilor vor fi cuprinşi în spectru. adică de emiterea unui electron de la un nivel de bază datorită acţiunii unui foton de raze X de energie hv. Figura 5. Cantităţile din dreapta relaţiei sunt cunoscute sau măsurabile. acest lucru va fi efectuat de către sistemul de control sau de sistemul de date asociat cu spectrometrul. unde. Acest lucru poate fi realizat prin emisia unui foton de raze X. sau pot suferi pierderi de energie şi să contribuie la fundal. Aceşti electroni care sunt excitaţi şi scapă fără a pierde energie. Energia cinetică a electronilor (EK) este experimental măsurată cantitativ de spectrometru.W. spectrul este suprapus pe o structură electronică schematică a plumbului pentru a studia modul în care fiecare orbital dă naştere la linii fotoelectronice. Operatorul doar selectează o scală de energie cinetică sau de legătură. În practică. în general suntem preocupaţi de o formă specială de fotoemisie. Spectru fotoelectronic al plumbului care arată modul în care electronii scapă din solid. care este considerată mai adecvată. cei care sunt supuşi unei împrăştieri inelastice şi suferă pierderi de energie. contribuie la vârfurile caracteristice în spectru. Energia fotoelectronului emis este apoi analizată de un spectrometru de electroni şi datele sunt prezentate ca un grafic de intensitate funcţie de energia fotoelectronilor emişi. atomul ionizat trebuie să se relaxeze. cunoscut sub 400 . Relaţia dintre parametrii implicaţi în XPS este: EB = hv .EK .Spectroscopia fotoelectronică de raze X În XPS. Energia de legătură a electronilor (EB) este parametrul care identifică specificul electronilor. unde hv este energia fotonilor. Odată ce fotoelectronul a fost emis.3. EK este energia cinetică a electronilor şi W (cst) este funcţia de lucru a spectrometrului. spectrul XPS al plumbului este suprapus pe o reprezentare a orbitalilor electronici. Spectrul de fotoelectroni va reproduce structura electronică a unui element destul de precis. Acest lucru este ilustrat în figura următoare. contribuie la fondul spectrului. dar acest lucru depinde de energia fotonilor razelor X implicate şi de aceea nu este o proprietate a materialelor intrinseci. contribuind la vârfuri discrete.

cu toate că nu se practică la scară largă. spectrometrul de electroni conţine următoarele componente: • Analizor de energie a electronilor de tip PHOIBOS 150 • Sursa de raze X. O altă posibilitate o constituie ejecţia unui electron Auger. II. sistem de tăiere a probelor. 401 . care funcţionează în regim de vid ultra-înalt (UHV). Sursa de radiaţii primare pentru spectroscopia fotoelectronilor de raze X face uz de razele X. X-AES. electronii Auger sunt produşi ca urmare a procesului XPS. sistem de curăţare cu ioni de Ar etc.). în general cu catodul de aluminilu (Al Kα) sau catodul de magneziu (Mg Kα). Design-ul şi principiul de funcţionare al spectrometrului de electroni Figura 6. poate conduce la informaţii chimice valoroase despre un atom. Astfel. XR50 • Sursa de raze X cu monocromator FOCUS 500 • Sursa UV UVS 10/35 • Sursa sputter IQE 11/35 cu ioni de Ar • Neutralizator de tip Flood Gun FG 15/40 Acestea sunt cuprinse într-o cameră de vid.numele de fluorescenţă de raze X. Sistemul de analiză a suprafeţelor SPECS În cel mai simplu mod. Camera de vid si de preparare poate fi dotată cu diferite instalaţii pentru prepararea probelor şi facilitaţi analitice auxiliare (neutralizator de sarcină. Un sistem computerizat este folosit pentru achiziţia datelor şi de procesarea ulterioară. adesea denumit X-AES (X-ray induced Auger electron spectroscopy).

Lentilele de intrare sunt proiectate pentru a se potrivi cu o gamă largă de aplicaţii. Descrierea Analizorului Analizorul PHOIBOS este format dintr-un sistem de vidare şi patru componente majore interne care sunt arătate în figurile de mai jos. Un mecanism de tăiere a orbitei şi o lentilă multi-mod fac selectabile zona de pe proba de analizat şi unghiul de recepţie. Toate modurile lentilei pot fi setate electronic.2. un preamplificator. nefiind necesară intervenţia celui care o foloseşte. De aceea. Analizorul PHOIBOS 150.Intervalul 3500 V.1. Un ansamblu de lentile de transfer în doi paşi poate fi folosit în diferite moduri pentru rezolvarea spaţială şi unghiulară. Analizorul de energie emisferic de tip PHOIBOS 1. Voltajul emisferelor (între . . cercetarea unor suprafeţe largi asociate diferitelor unghiuri de recepţie ale lentilelor. de asemenea. Toate părţile sunt integrate într-o singură cutie compactă din aluminiu protejată RF. Toate componentele sunt controlate de un program SPECS. Partea electronică de detecţie este alimentată împreună cu unitatea analizoare de control.Intervalul 1500 V. Unitatea poate fi folosită şi pentru aplicaţii la nivele mai mari de energie folosind un mod de operare corespunzător. Voltajul emisferelor (între -400 şi 400 V) şi voltajul de întârziere (între -400 şi 400 V) sunt schimbate independent. Voltajul emisferelor (intre -40 si 40 V) ţi voltajul de întârziere (între -40 şi 40 V) sunt schimbate independent.400 şi 400 V) variază cu voltajul de întârziere (între -3500 şi 3500 V). un numerator şi o interfaţă bus. 1.Intervalul 40 V.5 keV.1. analizorul permite măsurători rezolvate spaţial cu un diametru minim de 100 µm şi. Analizorul de acest tip poate detecta energii ale electronilor şi ionilor în intervalul 0-3500 eV cu o lărgime minimă a pasului de 7 meV. Voltajul emisferelor (între -400 şi 400 V) variază cu voltajul de întârziere (între -1500 şi 1500 V). . .Intervalul 400 V. Generatorul HSA3500 pentru analizatorul PHOIBOS este controlat în totalitate cu ajutorul computerului. Toate aceste 402 . Partea electronică pentru detecţie include un discriminator. Caracteristici generale Analizorul SPECS de energie emisferic electrostatic de tip PHOIBOS permite înregistrarea spectrelor de energie pentru particulele negative (electroni) şi particulele pozitive (ioni) în intervalul energiilor cinetice de la 0 eV la 3. Acesta are patru moduri de operare pentru diferite intervale de voltaj: . este echipat cu 9 canale detectoare.

componente sunt introduse într-un mediu de vid ultra-înalt (UHV). pentru a evita ciocnirea particulelor emise de pe suprafaţa probei cu moleculele de gaz. Figura 7. 403 . Uchannel HV/ Base – potenţialul pe anod/catod pentru canale. U0 = –Ekin(kinetic energy) + Ep(pass energy) + WF(work function). Schema de conectare a componentelor PHOIBOS Figura 8: Principalele componente ale analizorului şi principiul voltajului U0 – voltajul principal de întârziere.

5 sau 9 canale). C1…C9 . S1 – intrarea de tăiere a capacitorului emisferic. ioni. Pentru analiza cu un spot mic este disponibilă o rezoluţie colaterală de până la 100 µm. • Analizorul emisferic de 180° (HSA) cu un diametru de 150 mm pentru măsurători spectroscopice de energie. Sistemul de lentile electronic şi părţile tăiate (intrarea şi ieşirea) au efecte importante asupra împrăştierii energiei detectate de analizor. În plus. Înainte ca particulele să treacă prin analizorul semisferic. folosind modul de amplificare puternică si o apertură iris corespunzătoare. În modurile de amplificare rezolvarea unghiulară este realizată cu o apertură iris în planul de difracţie al sistemului de lentile. Particulele care trec prin lentile sunt focalizate în poarta de tăiere S1. sau electroni. trec mai întâi printr-un sistem de lentile electronic care taie fasciculul de particule. IH. Sursa excitatoare depinde de tehnica folosită. Sistemul de lentile de intrare include zece segmente de lentile. UChannelBase-U0 – voltajul de conversie. • Ansamblul detector pentru particule individuale. • Mecanism de tăiere a orbitei cu o interconexiune rotaţională exterioară. sistemul de lentile nu conţine sau nu are interfranje. Succesiunea de lentile defineşte suprafaţa de analiză şi acceptanţa unghiulară prin imagistica particulelor emise la intrarea în analizor. OH – emisfera interioară/exterioară. unde sunt întârziate în lentile pentru o analiză energetică ulterioară. S2 – planul de ieşire al capacitorului emisferic. r0 – raza nominală a capacitorului (100 sau 150 mm). T1…T10 – electrozi ai lentilei de transfer multi-mod.UHV–UBase – voltajul detectorului. Toate modurile lentilei pot fi setate electronic.detectori mono/multi-canal de colecţie discretă (1. 404 . • Apertură iris cu interconexiune rotaţională exterioară. panourile de lentile definesc acceptanţa unghiulară şi suprafaţa pentru o anumită mărime a tăierii de intrare. LA…LE – potenţialele pe lentile. Pentru obţinerea unei imagini nedegenerate. Sistemul de lentile poate fi operat în diferite moduri pentru situaţii de rezolvare spaţială şi unghiulară pentru a adapta analizorul la diferite cerinţe. pentru recepţionarea particulelor încărcate. Componentele interne sunt: • Sistemul lentilelor de intrare. dar de obicei se folosesc razele X sau alte tipuri de fotoni.

• a defini zona probei analizată şi unghiul solid de recepţie de pe probă. • a accelera/decelera particulele la energia de trecere. montat în afara vidului. Modurile de transmisie sunt optimizate pentru transmisii înalte la mărimi diferite ale spotului. rezoluţia unghiulară poate fi ajustată continuu menţinând suprafaţa de recepţie a probei constantă. Particulele de pe traiectoria centrală au energia de trecere optimă. iar particulele cu o energie cinetică mai mică. fiecare canal este conectat la un preamplificator separat.Folosind irisul. În modurile unghiulare dispersive. informaţia dată de unghiurile de emisie este obţinută uşor.1. cu înregistrarea simultană a unei benzi de energie în jurul valorii de trecere optime a energiei.2. Acesta poate fi folosit în diferite moduri care pot fi setate electronic. Ele sunt focalizate pe poziţia centrală radială a ieşirii plane S2. Rezoluţia colaterală este înrăutăţită şi suprafaţa de recepţie nu este definită în mod normal de lentile. Poziţia radială a imaginii tăiate în planul S2 depinde de energia cinetică a particulelor în capacitor. 1. Particulele cu o energie cinetică mai mare sunt focalizate mai departe spre exterior. pentru rezolvarea spaţială şi unghiulară. Toată rezoluţia colaterală este pierdută. Cu detectorul multi-canal. dar. Un sistem de lentile cu un mecanism variabil de tăiere a orbitei este necesar pentru: • a vizualiza planul probei pe intrarea plană HSA. suprafeţelor Fermi sau experimente similare. sunt focalizate mai în interiorul planului S2. Preamplificatorii sunt citiţi de către detectorii multi-canal (MCD). Aceste moduri sunt concepute pentru schiţarea benzilor UPS. Distanţa standard de lucru de 40 mm şi partea frontală de formă conică la un unghi de 44° al lentilei furnizează accesul optim la probă pentru toate tipurile de surse excitatoare. Particulele care trec prin planul de ieşire al capacitorului S2 sunt accelerate în sistemul de detectori C. particulele care intră în S1 sunt focalizate în planul de ieşire al capacitorului S2. În capacitorul semisferic. Sistemul de lentile Ansamblul de lentile de transfer în doi paşi a fost conceput pentru a oferi randament de transmisie foarte bun şi proprietăţi optice bine definite. cu interfaţa pentru programul de achiziţie de date SPECS. distribuţia emisiei după unghiuri este vizualizată în locul imaginii reale. Aceasta permite posibilitatea folosirii detectorilor multi-canal. La nivelul lentilei particulele ce ies de pe pro405 .

La nivelul S1 particulele sunt întârziate de diferenţa de energie dintre particulele cu energia cinetică preponderentă Ekin şi energia preponderentă de trecere Epas.ba S sunt vizualizate în intrarea de tăiere S1. particulele trec printr-o imagine intermediară înainte să fie focalizate în intrarea de tăiere S1 a capacitorului emisferic (figura 4). conectând la electrozii lentilelor voltajul optim. În interiorul primei lentile. Gradul de difuzie creşte. cu unghiul de recepţie al intrării lentilei.Epas + funcţie de lucru. Aceasta înseamnă că zona observată în planurile focale ale intrării sistemului de lentile este tot mai împrăştiată cu creşterea unghiului. (figura 9). Planul imaginii probei este în coincidenţă cu planul intrării analizorului. atunci. proba fiind în planul focal al sistemului de lentile. ţinând aberaţia sferică la o valoare cunoscută şi acceptabilă. voltajul aplicat pe emisfere este dat de ecuaţia: Epas = (-q)kΔV În modul FRR. de exemplu. Amplificarea este schimbată electric. Amplificarea înaltă. suprafaţa vizualizată a probei va avea dimensiunea DS egală cu: DS = D1 / M (1) Puterea de amplificare a planului de lentile poate fi selectată. este în mod special potrivită pentru studii de rezolvare spaţială. conform teoriei. Utilizatorul poate defini zona de recepţie a analizorului cu ajutorul intrării de tăiere deoarece traiectoriile electronilor emişi 406 . rezultând astfel dimensiuni mai mari ale probei decât cele date de ecuaţia (1). Din această cauză unghiul de recepţie al lentilei este selectabil prin modurile de amplificare. Dacă S1 are diametrul D1. energia de trecere are valoarea: Epas = Ekin / R. 40 mm în faţa primului electrod al lentilei T1. R fiind rata de întârziere. În modul FAT. Cu toate acestea. pentru o amplificare dată. Valorile voltajului sunt dependente de voltajul spectrometrului U0 care este preponderant egal cu Ekin . datorită aberaţiei sferice a intrării lentilei. Sistemul PHOIBOS poate funcţiona într-un nivel stabilit de întârziere (fixed retarding ratio – FRR) sau în transmisie stabilită de analiză (fixed analyzer transmission – FAT). Mărimea reală a suprafeţei probei de analizat DS este în principiu dată de ecuaţia (1). imaginea în planul de intrare este difuză. Ekin este negativă pentru electroni şi pozitivă pentru ioni.

rezoluţia unghiulară poate fi încontinuu ajustată între ± 10 şi ± 90 . Mai mult. Modurile de amplificare au fost optimizate pentru a permite unghiuri foarte mari de recepţie pentru surse punctiforme cu transmisie puternică (moduri de transmisie punctiformă). o rezoluţie laterală de până la 100 µm este disponibilă. În aceste moduri. pot să găsească un drum spre intrarea analizorului. Folosind irisul. utilizând modul de amplificare înaltă şi apertură iris. Pentru analiza cu spoturi mici.T1 având un potenţial fix care este setat ca fond la schimbarea sursei de alimentare. rezoluţia unghiulară este realizată cu ajutorul aperturii iris în planul de difracţie al sistemului de lentile. razele care intră în lentilă depărtate faţă de axa ei la unghiuri mari. aceste raze rele pot fi eliminate.Figura 9. Mod de arie medie de către probă sunt influenţate de către câmpurile electrice din jurul probei. Datorită aberaţiilor lentilei. menţinând zona de recepţie a probei constantă. Razele apropiate de axa 407 . apertura iris poate fi utilizată pentru ajustarea unghiului de recepţie a analizorului. Cu o apertură iris. Mod de transmisie înaltă Figura 10.

Figura 11.5 mm 7 mm 10 mm 13 mm 15. Modul de amplificare înaltă Tabelul 1: Unghiul de recepţie versus diametrul irisului pentru o sursă punctiformă Unghiul de recepţie ± 1º ± 2º ± 3º ± 4º ± 5º ± 6º Diametrul irisului 3. Asta face ca modurile de transmisie punctuale să fie cele mai potrivite pentru AES.5 mm În noul mod de suprafaţă medie cu unghiuri rezolvate. electronii care părăsesc proba la o anumită distanţă unghiulară sunt focalizaţi pe aceeaşi 408 . Focalizări mici sub lentilă. dar rezoluţia spaţială este înrăutăţită. Razele care intră în lentilă la unghiuri mai mari. De aceea este realizat un unghi mare de recepţie. în planul imaginii. ISS şi studii de sincroton.lentilei (raze paraxiale) sunt focalizate în focarul Gaussian. Discul cu cea mai mică dezordine se află unde tubul de raze emergente are cel mai mic diametru. converg mai puternic.5 mm 17. implică deplasarea discului de cea mai mică dezordine.

Funcţia intensitate-poziţie a analizorului este o Gaussiană. Figura 12.050 cu mecanismul de tăiere a orbitei. fără restricţionarea unghiului de recepţie. acest mod este alegerea ideală pentru studii de dependenţă unghiulară. Setarea optimă a aperturii iris depinde de mărimea tăierii şi de calitatea dorită a suprafeţei de analizat. Suprafaţa de analizat a fost definită pentru a include între 90-99% din totalitatea semnalului fotoelectric. Pentru o analiză cu spoturi mici. Folosind apertura iris. a analizorului. apertura iris poate fi folosită pentru micşorarea suprafeţei de analizat. Folosind apertura iris. amplificarea şi apertura unghiulară sunt selectabile. 409 .zonă a intrării analizorului indiferent de poziţia lor din probă. La PHOIBOS. Există mai multe combinaţii diferite disponibile. Profilul tipic intensitate-poziţie cu apertură iris Cozile de intensitate mică formează un disc. aceste intensităţi pot fi suprimate. Modurile unghiulare permit utilizatorului să optimizeze rezoluţia unghiulară până la ± 0. Cu un sistem de detecţie 2-D se pot obţine unghiuri de rezoluţie mare pe direcţia dispersiei. Setările lentilelor pot fi combinate cu diferite combinaţii ale tăierii. dar cu intensităţi mai mari în regiunile de margine. rezultând astfel un număr de combinaţii egal cu produsul dintre modurile de setare a lentilei şi numărul de tăieri. Intensitatea sa integrată poate atinge acelaşi ordin de magnitudine ca intensitatea peak-ului. aceste intensităţi pot fi suprimate.

sunt deviate pe traiectorii eliptice de câmpul electric radial între emisfera internă Rin şi emisfera externă Rout. Dacă HSA acceptă jumătatea unghiului α pe direcţia dispersiei.75 R0. Particulele încărcate care intră în HSA prin intrarea de tăiere S1. Pentru liniile de fotoemisie cele mai importante contribuţii adiţionale sunt: a) Lărgimea proprie a liniei pentru nivelul atomic ΔElevel (de exemplu O 1s.9375 2R0 (Rout − R in ) (3) (4) Aceste particule ajung pe S2. numai particulele cu energie cinetică cuprinsă într-un anumit interval. Particulele cu energie cinetică mai mare se vor apropia de emisfera exterioară în timp ce particulele cu energie cinetică mai mică sunt deviate spre emisfera interioară. ΔV – diferenţa de potenţial aplicată pe emisfere (Vout . q – sarcina electrică a particulei. rezoluţia HSA sau FWHM (full width at half maximum).2. C 1s). Intrarea de tăiere S1 şi planul de ieşire S2 sunt centrate în jurul razei R0: R0 = R in + R out = 150 mm 2 (2) Pentru un gradient fix al câmpului electric. Analizorul Emisferic (HSA) Analizorul emisferic PHOIBOS (HSA) cu o rază R0 (100mm/150mm) măsoară energia particulelor încărcate. pot să treacă integral prin devierea unghiulară de la intrarea de tăiere S1 la planul de ieşire S2. Acele particule care intră în HSA perpendicular pe S1 şi se mişcă prin emisfere pe o traiectorie circular centrală.2. au energia de trecere preponderentă Epass: Epass = (-q) kΔV.25 R0 şi 0. b) Lărgimea naturală a liniei pentru radiaţia caracteristică folosită la excitare ΔEphoto (de exemplu Mg Kα. FWHMtotal observat este dat de convoluţia FWHM . k – constanta de calibrare. k= R in R out = 0. de exemplu. Această valoare (S) este o constantă a analizorului. Există contribuţii în plus la lărgimea liniei observate în spectru. Al Kα).urilor individuale. Razele emisferelor PHOIBOS sunt 1.Vin). parcurgând un arc de cerc de rază R0.1. a liniei transmise ΔEan este dată de : ΔEan S α2 = + Epas 2R0 4 (5) unde S = (S1 + S2)/2. pentru lărgimea Gaussiană a liniilor: (6) FWHMtotal =(ΔEan 2 +ΔElevel2 +ΔEphoto2 )1/2 =ΔE 410 .

Ecuaţia rezultă din teorema lui Liouville. de exemplu radiaţie Al Kα monocromatică în mare parte. Ele sunt constante ale unde analizatorului. datorită îngustării lărgimii liniei proprii a nivelului Si 2p. energia de trecere este proporţională cu energia cinetică. gradul de întârziere R este definit ca: R= Ekin Epas (10) În acest mod toate particulele sunt decelerate cu acelaşi factor constant. Pentru radiaţie Al Kα monocromatică şi pentru nivelul Ag 3d5/2 rezoluţia extremă este: (8) FWHMextreme = 0.65 eV este de obicei suficientă pentru studii de înaltă rezoluţie cu o excitare monocromatică a Al Kα. Pentru o rezoluţie mai mare a instrumentului.44 eV Pentru a atinge rezoluţia extremă de 0. Intensitatea semnalului integral I al particulelor măsurate (suprafaţa cuprinsă în interiorul peak-ului până la nivelul fondului) este proporţională cu produsul dintre unghiul solid de recepţie ΩS. cu costul unei mari pierderi în intensitate. o rezoluţie de 0. ΔEan : I:ΔEan ΩSAS =ΔEan Ω0A0 Epass Epass 2 . Pentru radiaţia monocromatică. FWHM-ul razelor X trebuie să fie foarte mic. : Ekin Ekin (9) sunt valorile de recepţie pentru HSA. FWHMtotal este uneori determinat înregistrând nivelul Si 2p3/2 în loc la Ag 3d5/2. În practică.8 eV (7) În practică. de unde rezultă valori mai mici pentru FWHMextreme. după extracţia liniară a fondului. Pentru excitarea Mg Kα.FWHMtotal este de obicei stabilit folosind o probă de argint curăţată prin împrăştiere ionică şi înregistrarea nivelului Ag 3d5/2. suprafaţa de recepţie a probei AS şi rezoluţia HSA. (11) 411 . o rezoluţie de 0. De aceea. Intensitatea creşte cu creşterea energiei cinetice: I ∼ Ekin . în timp ce rezoluţia energetică scade.44 eV. folosind doar o mică parte din suprafaţa spotului monocromatic de radiaţii X (datorită dispersiei energiei pe suprafaţa spotului). rezoluţia HSA la nivelele joase ale energiei de trecere pentru Ag 3d5/2 este : HMMgKa= 0. Analizorul poate fi operat în două moduri diferite: a) Gradul de întârziere fix (Fixed retarding ratio (FRR)). este posibilă folosirea radiaţiei X monocromatice de excitare.9 eV este de obicei suficientă pentru măsurători la rezoluţie mare.

2. Factorul de izolare pentru regiunea analizatorului este de aproximativ 35. unde este necesară o informaţie detaliată şi rezoluţia nu trebuie să depindă de energie. indiferent de energia lor cinetică. rezultă că: I ∼ Epass 2 1. Mecanismul poziţionează o deschidere de intrare şi ieşire de o mărime adecvată în planul de intrare şi ieşire al analizorului. din materiale non-magnetice într-o carcasa de µ-metal. acestea sunt construite. în întregime.2. Analizatorul. Aceasta face posibilă cea mai mare rată de numărare permisă pentru aceşti parametrii şi de aceea rezultă un timp scurt de măsurare şi un raport bun semnal-zgomot. ISS şi este preferabil pentru măsurători ale survey-ului. Inelul de intrare poate fi poziţionat direct prin rotirea cadranului (vezi fi412 . Pentru o rezoluţie energetică dată.4. Modul FRR este folosit cel mai mult în AIS. Izolarea Magnetică (13) Particulele încărcate sunt influenţate de câmpul magnetic rezidual. (inclusiv câmpul magnetic al pământului) de aceea este esenţial să eliminăm aceste câmpuri în volumul închis al analizatorului. Pentru o performanţă maximă a analizatorului şi sistemului de lentile. în care Epass şi ΔEan din ecuaţia (5) sunt constante ajustabile. Dacă Ekin este constantă şi acelaşi peak este măsurat pentru diferite energii de trecere.b) Transmisie fixă a analizorului (fixed analyzer transmission(FAT)).5 mm grosime µ-metal pentru a ecrana câmpurile magnetice la un nivel minim. Raza de intrare este definită de două secţiuni care sunt la circa 6 mm depărtare. Modul FAT este folosit preponderent în XPS şi UPS. sistemul de lentile şi detectorul sunt înconjurate de un strat de 1. Există unele aplicaţii în care unul dintre ele este de obicei preferabil. tăierea maximă posibilă poate fi selectată. Tăierea posterioară se află în planul intrării şi defineşte energia de rezoluţie a analizorului (vezi ecuatia (5)).3. Semnalele date de toate particulele. Mecanismul de tăiere a orbitei Mecanismul de tăiere a orbitei este folosit pentru a schimba manual deschiderea intrării şi ieşirii analizorului. o zonă de analiză tolerată şi un unghi de recepţie. sunt măsurate cu aceeaşi scădere a rezoluţiei şi intensităţii cu energia cinetică: I∼ 1 Ekin (12) Cele două moduri sunt disponibile pentru toate tipurile de măsurători. în timp ce tăierea anterioară serveşte la compararea împrăştierii unghiulare pentru analizor. 1.

Prin acest aranjament se pot alege puterile de intrare şi ieşire independent. sau A. Când deschiderea intrării şi ieşirii este schimbată. Pe de altă parte.gura 10). Figura 13. Selecţia fantei de ieşire 413 . poziţiile trebuie introduse în zona de editare a datelor. Poziţiile tăierii de intrare sunt indicate cu numere (1-8) pe cadranul rotaţional exterior.B sau C). folosind acelaşi sistem rotaţional. au 8 tăieri de intrare şi 2 de ieşire în configuraţia standard. Aranjamentul propriu-zis în analizor apare în secţiunea de tăiere a programului de control livrat împreună cu analizorul. Aceşti indicatori corespund celor care apar în setările programului de control al analizatorului SpecsLab2. Analizorii PHOIBOS. Poziţiile tăierilor de ieşire sunt indicate cu litere (A-B. inelul de ieşire este poziţionat indirect prin intermediul inelului de intrare (vezi figura 11). începând cu ieşirea 5.

situată în vid • Preamplificatori MCD. Principiile Detecţiei Datorită simetriei sferice a HSA. Energia cinetică En a particulelor ce ajung la colectorul Cn.5. traiectoria electronului este mutată între fiecare analizor pas cu pas. Valoarea teoretică a lui D este: D = 2R0 (16) (17) Valoarea experimentală determinată pentru dispersie poate fi puţin diferită. sunt cercuri concentrice. în planul ieşirii pentru electroni monocromatici cu energia preponderentă de trecere Epass. 1. Într-o primă aproximaţie raza de poziţie R a electronilor cu energia cinetică Ek. Distanţa radială între ieşiri de tăiere vecine ΔR.1. 414 . baleând spectrul odat peste suprafaţa detectorului. este selectată pentru a corespunde cerinţelor unei diferenţe de energie cinetică constantă între canalele vecine ΔEk. cu o compensare fixă a energiei între canalele vecine. poate fi adăugat. fiind ştiută din ecuaţia (16).1. şi în acest fel fiecare colector înregistrează un spectru corect. având diferite energii în HSA. Detecţia multicanal se realizează aranjând corespunzător 9 CEMs (multiplicator de electroni cu canale) ca şi colectori. În principiu.2.2. Detector Multicanal MCD Detectorul este format din următoarele părţi: • Un aranjament de multiplicatori de electroni MCD • O punte ceramică multi-pin. este dată de: R − R0 Ek − Epass D = × R0 E pass R0 unde D este dispersia la HSA. rezultând numărul total de particule pentru fiecare energie cinetică. Schimbând tensiunea spectrometrului U0. cu 9 ieşiri de tăiere în cercuri concentrice în planul de ieşire. există o imagine 1:1 a intrării circulare de tăiere cu o rază de curbură R0. 5 sau 9 spectre paralele sunt înregistrate simultan. aparţinând aceleiaşi energii cinetice. numărul particulelor din fiecare canal. de voltaj înalt. în principal datorită câmpurilor de refringenţă existente pe marginea analizorului. Imaginile electronilor.5. iar aceste numere sunt stocate şi procesate într-o unitate de achiziţie a datelor. Numărul particulelor Nn care sosesc la fiecare colector Cneste numărat separat.

3. Datorită procesului de interpolare. Aceşti electroni sunt acceleraţi de către voltajul înalt. se numeşte câştigul G. Pentru asta. 1. un “nor electronic” se formează la ieşirea din CEM. Algoritmul este uniechivoc. un calcul al energiei detectate a particulelor este necesar. CEM este format dintr-un tub mic şi curbat de sticlă. diferenţa de energie Δ între canalele vecine. deoarece nu există niciodată mai mult decât o energie nominală între două poziţii ale energiei măsurate. prin interpolarea între numerele măsurate în canalul Cn la energiile măsurate cel mai apropiat dedesubt şi deasupra energiei nominale.2. Pentru detectarea unei singure particule. Numărul mediu de electroni care pleacă din ansamblul CEM pe particula incidentă. conectat la CEM. câştigul trebuie selectat destul de înalt pentru a folosi CEMs în modul 415 . În special în modul FRR. un program calculează numărul de particule Nn în canalul Cn. etc) limitează lărgimea şi distanţa posibilă a paşilor.5. până când. la energia cinetică nominală. sau radiaţia. este: ΔEk = ΔR D D ΔR Epass (18) sau: Epass = ΔEk (19) unde D este dispersia pe analizor. Multiplicarea Electronică Un multiplicator de electroni cu canale (CEM) este un dispozitiv de achiziţie înaltă pentru detectarea particulelor energetice. Acest efect este repetat succesiv.1. şi eliberează noi electroni secundari prin impactul în continuare de-a lungul peretelui CEM.2. Performanţa acumulatorului (DAC steps. Materialul rezistiv devine o dinodă (o serie de electrozi incorporaţi într-un fotomultiplicator) continuă când un potenţial este aplicat la capetele acestui tub. Peretele interior este căptuşit cu un material de rezistenţă înaltă.5. nu există o restricţie a pasului energiei datorată performanţei analizorului. Impactul particulelor încărcate formează electroni secundari care sunt eliberaţi din peretele CEM.2. cum ar fi electronii şi ionii. Coerenţa între Epass şi pas Din ecuaţia de dispersie energetică pentru analizor. în final. unde energia de trecere se schimbă în spectru (şi diferenţa de energie dintre canalele învecinate). la distanţa ΔR unul de celălalt. Programul validează valorile la cele mai apropiate valori.

Particulele ce trec de ieşirea aperturii. Selecţia între anodul 1 şi anodul 2 accesează fie radiaţia Al Kα la 1486. ca o componentă de multiplicare electronică pentru analizorii PHOIBOS. În modul de non-focalizare. fie radiaţia Ag Lα la 2984. în detectarea unei singure particule. Dacă modul de focalizare este activat de către acumulatorul XRC 1000 M. 416 . Datorită mărimii mici a sursei.1. această sursă este o sursă cu doi anozi. 2. Fiecare anod poate fi operat în modul de focalizare sau non-focalizare. câştigul minim pentru operaţia de saturare este de aproximativ 107. La fel ca şi XR 50.5 x 0.25 eV poate fi atinsă pentru Al Kα. modul focalizare/non-focalizare este utilizabil pe amândoi anozii. de exemplu. şi pulsul sarcinii purtate de norul electronic este detectat ca provenind de la una din particulele incidente şi numărate în canalul preamplificatorului. Norul electronic emis. Puterea maximă este restricţionată la 150 W în modul de focalizare. De obicei.74 eV. având ca materiale constituente Al şi Ag. monocromatorul este folosit în reflexia Bragg de ordinal 2.saturat. a cărui sarcină este independentă de micile schimbări în voltajul multiplicator. un nor electronic format din mai mult de 107 electroni părăseşte CEM. fiecare particulă incidentă eliberează un nor electronic la ieşirea aranjamentului CEM.3 eV.5 x 1 mm2 pe probă) şi sursa de raze X poate fi operată la puterea maximă de 400 W ( 600 W pentru Ag Lα) la lărgimea liniei de 0. Operaţia de saturare este necesară pentru o reflexie a zgomotului suficientă.4 eV pentru Al Kα. Principiu de funcţionare Monocromatorul FOCUS 500 de raze X este echipat cu o versiune specială a sursei de raze X XR-50. numită XR 50 M.5 x 4 mm2 (corespunde la 3. iar XR 50 M trebuie să fie mutat cu 16 mm.5 mm2 (corespunde la 3. Toate CEMs sunt montate într-o unitate paralelă pe o flanşă cu rol de punte.5 x 0. sunt accelerate la o energie cinetică corespunzătoare în interiorul CEM. spotul sursei de raze X pe anod este de 3. este accelerat în electrodul conectorului CEM. Dacă anodul de argint este activat. de exemplu. Sursa de raze X pentru FOCUS 500 (XR50 M) 2. Cum este menţionat mai sus.2 mm2 pe probă). Unul sau un grup de CEM este folosit într-un aranjament special. mărimea spotului de raze X pe anod este de 3. rezoluţia maximă a monocromatorului de 0.

Generarea fotonilor de raze X Dacă un material în stare solidă este bombardat cu electroni de înaltă energie. care nu există în XR-50 standard. Dacă aceste locuri vacante sunt umplute cu electroni cu o caracteristică energetică mai înaltă. amplasată în capul sursei.Efectul de focalizare este obţinut cu ajutorul unei lentile electronice adiţionale. arătând voltajul şi curenţii pe sursă. are loc un proces de ionizare al nivelelor electronice. Aceasta este reflectată după legea lui Bragg pe oglinda elipsoidală din cuarţ în monocromatorul FOCUS 500 şi focalizată pe probă. Descrierea sursei 2.2. permiţând o operaţie UHV. 2. de către electronii întârziaţi. Conectorii de filtrare rapidă permit îndepărtarea rapidă a liniilor de răcire cu apă şi HV (de înaltă tensiune). va fi produsă şi o radiaţie cu o frecvenţă continuă a spectrului. Voltajul de focalizare este generat de către un amplificator XRC 1000 M şi este transferat la sursa de raze X printr-un cablu de filament prin cele 4 punţi. Diagrama bloc a sursei de raze X este prezentată mai jos. vor fi generate raze X sau electroni Auger. Figura 14.1. 417 . Diagrama bloc a principiului de funcţionare a sursei 2.2.2. În afară de aceste două procese.2. Monocromatorul Radiaţia caracteristică este generată pe anodul XR-50 M şi pleacă de la sursă sub un unghi de 15°. Modulul XR-50 M (cu alimentarea de apă şi protecţia HV scoase) poate fi încălzit până la 250°C.

Sursa este alimentată de către un acumulator XRC 1000 M şi de către o unitate de răcire CCX60. Manipulatorul oglinzii poate genera trei moduri de mişcare: translaţie (focalizare) şi două direcţii de înclinare. • Un background mai mic. Sursa de raze X XR 50 M este montată pe un manipulator după cele trei axe.A) Descrierea generală a monocromatorului: Ansamblul cristalului este compus dintr-o oglindă din cristal de cuarţ şi un manipulator al oglinzii. care simplifică analiza spectrală. Monocromatorul aduce următoarele avantaje sursei de raze X: • Distribuţia energetică a razei X cu benzi energetice înguste îmbunătăţeşte selectivitatea chimică.3 eV). cu plane de cristal monoatomice orientate precis. Este folosit pentru poziţionarea oglinzii în vederea obţinerii unui fascicul de raze X monocromatic. • Eliminarea Bremsstrahlung şi a radiaţiei termale de la sursa de raze X. Prezentarea schematica a monocromatorului FOCUS 500 În anodul dual sunt produse raze X Al Kα (1486. • Un spot de raze X focalizat pe probă creşte sensibilitatea în XPS pe probe mici. • Eliminarea razelor X nedorite de la sateliţi şi impurităţile anodului. care reduce semnificativ uzajul indus asupra sursei. Oglinda este făcută dintr-un suport monolitic de încălzire.74 eV) sau Ag Lα (2984. Figura 15. îngustând peak-urile spectrului. 418 .

Situaţia este explicată de ecuaţia lui Bragg: 2d cosθ = n λ În termenii energiei avem: 2dE cosθ = n 1239.096°. trebuie să fie constante.8419 nm eV Din cele două ecuaţii rezultă. trebuie să fie la fel ca şi cele din planul de reflexie. Toate punctele de pe suprafaţa cristalului.851243 nm. are loc o interferenţă constructivă după împrăştiere numai dacă drumurile parţiale ale undelor pe plane diferă printr-un număr întreg de lungimi de undă. O sursă de raze X divergentă. Când razele X. Există două cerinţe pentru ca difracţia de raze X să aibă loc în concordanţă cu legea lui Bragg: 1.149° şi pentru Ag Lα. de lungime de undă λ cad pe cristal sub unghiul de incidenţă θ. unghiurile de incidenţă θ1 şi unghiurile de reflexie θ2. pentru Al Kα unghiul de difracţie 2θ = 23. se află pe un cerc. Configuraţia monocromatorului cristalin elipsoidal Cristalele de cuarţ individuale sunt folosite în procesul de monocromatizare.B) Monocromatizarea prin difracţia pe cristal Figura 16. Toate punctele de pe suprafaţă şi unghiul de reflexie 2θ al razei. focarul şi suprafaţa oglinzii. 419 . 2. va fi focalizată dacă sursa. Cercul Rowland este o condiţie geometrică pentru reflexie. luând 2d = 0. 2θ = 25.

Legea lui Bragg presupune ca unghiul de reflexie să fie independent de punctul reflexiei. Există numeroase ajustări date pentru montajul optic. rezoluţia energetică intrinsecă a FWHM este 167 meV. iar planele reflectoare ale cristalului să fie concave. Aliniatorul sursei de raze X îi dă voie utilizatorului să poziţioneze anodul pe cercul Rowland. poate fi operată în modul non-focalizare. XR M 50 este echipată cu o lentilă electrostatică care focalizează electronii pe anod. Sursa de raze X.7 eV Pentru Al Kα. Poate fi operată în două moduri diferite. cu raza egală cu diametrul cercului Rowland şi să fie tangenţiale la cercul Rowland în punctul c (figura 15). Pentru fluxuri înalte. Profilul Gaussian al peak-ului de difracţie al unei raze monocromatice (Al Kα) Curba intensitate-unghi de difracţie pentru un anumit tip de cristal este cunoscută sub numele de “rocking curve”.Condiţia de reflexie necesită ca sursa şi proba să se afle pe cercul Rowland. lărgirea datorată sursei este neglijabilă. În modul de focalizare. Ambele condiţii sunt îndeplinite doar pentru reflexia simetrică din punctul c. Ansamblul cristalului poate fi înclinat în două direcţii şi mutat pe direcţia y pentru a duce suprafaţa cristalului pe cercul Rowland. unde se produce o lărgire datorată diametrelor finite ale spotului sursei de raze X. Pentru monocromatorul elipsoidal FOCUS 500 sunt folosite doar cristale cu Δθ = ±10" . iar pentru Ag Lα este de 344 meV. 420 . Diferenţa din ecuaţia Bragg duce la expresia pentru rezoluţia intrinsecă a oglinzii: Rezoluţia energetică intrinsecă la o anumită aliniere a planurilor cristalelor este ΔE=n Δθ (cosθ)2 1456. Figura 17.

3.25 eV poate fi atinsă pentru Al Kα. Datorită mărimii mici a sursei. 421 .2. Fiecare anod poate opera în modul de focalizare sau non-focalizare. Lărgimea spotului de raze X în functie de Puterea maximă şi tensiunea corespunzătoare UL pentru anozii de Al şi Ag. sursa XR-50 M este echipată cu o lentilă electronică în capul sursei. Dacă modul de focalizare este activat. Al non-focalizat (anod 2N). Pentru condiţiile optime de focalizare.5 mm2. Ag non-focalizat (anod 1N). 2. mărimea spotului de raze X pe anod este 3. UL: Figura 18.2. În modul non-focalizare.3. Această lentilă poate focaliza electronii care se fixează pe anod şi astfel este obţinut un spot de raze X de mărime variabilă. spotul sursei de raze X pe anod este de 3. pot fi setate în interiorul sursei XRC 1000 M. 3. Această relaţie este setată automatic de către sursa XRC 1000 M. UL trebuie să varieze liniar cu tensiunea pe anod. Ag focalizat (anod 1F).5 x 0. Informaţii generale în legătură cu sursa XR 50 M 2. 4.2.1. rezoluţia maximă a monocromatorului de 0.5 x 4 mm2 şi sursa de raze X poate fi folosită la putere maximă. Aceasta dă un total de patru moduri de operare pe anod: 1. Al focalizat (anod 2F). Modul de focalizare În contrast cu sursa standard XR-50. Figura următoare arată lărgimea spotului pe probă în funcţie de tensiunea de focalizare.

Tensiunea şi curenţii necesari pentru operaţia FG-ului sunt asigurate cu PS FG 20. Componente: 1.3. 3.2.2. Filament. sau semiconductorilor.1. Diagrama operaţională • 422 Energia este controlată manual. Temperaturi mai mici decât temperatura camerei vor duce la condensarea apei şi fenomene de descărcare în interiorul conductei de apă sau al învelişului de protecţie. şi este folosit special pentru aplicaţii XPS. poate fi obţinută doar dacă presiunea de răcire a apei este mai mare decât 3. . Temperaturile înalte au ca şi consecinţă suprasolicitarea. Flood-Gun 15/40 3. 3. Lentile extractoare. fisurarea anodului şi eliberarea apei în camera de vid. Fasciculul de energie poate varia între 0 şi 500 eV. Disiparea maximă de putere pe anod a sursei de raze X.5 l/m.1. a izolatorilor încărcaţi pozitiv. Anod.5-3.1. 2. de exemplu evaporarea materialului anodului sau în cel mai rău caz. Diagrama operaţională şi conexiunile electrice ale Flood-Gun-ului sunt arătate în figura următoare: Figura 19. Informaţii generale Flood-Gun–ul FG 15/40 a fost conceput pentru neutralizarea generală a sarcinilor probelor.2.5 bar (de obicei 5-6 bar) şi dacă debitul este de aproximativ 2. 3. Curentul de emisie poate varia de la 0 la 5 mA. Răcirea cu apă Ca agent de răcire pentru XR-50 M se foloseşte apa.

Jobory. W. Schmidt S and Hüfner S 2004 The electron-phonon selfenergy of metallic systems determined by angular resolved high resolution photoemission Physica B 351 229-34 10. PA: Saunders College) 11. I. The Journal of Chemical Physics 37:3007 7. Forster F.Principles and Applications 3rd edn (Berlin: Springer) 3.• • Voltajul de extracţie nu este selectabil de către utilizator.) 6. Matzdorf R. Al (1962). Rev. Curentul de emisie este independent de energie şi este controlat manual 4. Schattke W and Van Hove M A (ed) 2003 Solid-State Photoemission and Related Methods: Theory and Experiment (Weinheim: Wiley-VCH Dec. Meister G and Goldmann A 1993 Temperature-dependent photoemission spectra from Cu(1 0 0) and Cu(1 1 1) surfaces Surf. Davison S G and Steslicka M 1992 Basic Theory of Surface States (Oxford: Oxford University Press) 9. Eltner B. Feuerbacher B. Ashcroft N W and Mermin N D 1988 Solid State Physics (Philadelphia. Hüfner S 2003 Photoelectron Spectroscopy. Reinert F. Shockley W 1939 On the surface states associated with a periodic potential Phys. D. 286 56-65 1. 423 .. Bibliografie Cardona M and Ley L (ed) 1978 Photoemission în Solids I (Topics în Applied Physics vol 26) (Berlin: Springer) 2. M. Sci.Theory and Current Applications (Studies în Surface Science and Catalysis) 74) (Amsterdam: Elsevier) 5. Fitton B and Willis R F 1978 Photoemission and the Electronic Properties of Surfaces (Chichester: Wiley) 4. "Determination of Ionization Potentials by Photoelectron Energy Measurement". Turner. 56 317-23 8. Nicolay G. Kevan S D (ed) 1992 Angle Resolved Photoemission .

..................436 1.. Toţi electronii fotoemişi de la adâncimi mai mari în urma penetrării materialului de către radiaţia X (aprox......... măsurătorile XPS trebuie efectuate în condiţii de vid ultra-înalt (UHV) din cauza distanţei la care se află instrumentele de detecţie în instalaţiile XPS........424 2............. Pentru a detecta numărul de electroni la fiecare valoare a energiei de legătură (energie cinetica) cu eroare minimă....... Instrumentul de bază pentru măsurarea numărului de 424 ....................... Emilia Sabina Varga Cuprins 1....... Introducere .....Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale C....... Teodora Maria Radu............ Această metodă permite determinarea elementelor care contaminează o suprafaţă şi uniformitatea compoziţiei elementale la suprafaţă sau în adâncime (depth profiling)................... mai exact cei care pleacă din material de la o adâncime de aproximativ 10-12 nm.................. 1-5 µm) sunt recapturaţi sau blocaţi în diferite stări de excitare în interiorul materialului......... Înregistrarea energiei cinetice şi a numărului de electroni emişi de la suprafaţa materialului datorită acţiunii razei X de energie hν duc la obţinerea spectrului XPS... Este important de reţinut că XPS detectează numai acei electroni care ajung în vidul din incinta echipamentului..III... Pentru majoritatea aplicaţiilor este de fapt o metodă nedistructivă prin care se determină chimia suprafeţei oricărui material........dr. C.................S.. faţă de suprafaţa iradiată cu raze X........S...... La baza cuantificării unui spectru XPS obţinut stă presupunerea că numărul electronilor înregistraţi este proporţional cu numărul de atomi într-o stare dată... Introducere Spectroscopia XPS este o tehnică de analiză foarte utilă în domeniul cercetării avansate în ştiinţa şi tehnologia materialelor............. Fiecare element determină un număr caracteristic de vârfuri XPS la valori caracteristice ale energiei de legătură care ne permit identificarea directă a elementelor care există pe suprafaţa investigată.... De asemenea se poate folosi în analiza modificărilor care apar în chimia suprafeţei unui material după ce acesta a fost supus unor tratamente fizico-chimice.................................... Bibliografie .... dr...

Cu ajutorul acestor spectre (“high resolution” spectra) se identifică stările chimice ale elementelor detectate (deplasările chimice) din poziţia şi forma liniilor spectrale. etc. din spectrele XPS se pot obţine concentraţiile relative ale elementelor pe suprafaţă ca de exemplu: x%Si.. Obiectivele principale ale regiunii de cuantificare sunt: definirea domeniului de energie în care semnalul poate fi atribuit tranziţiei de interes şi specificarea tipului de aproximaţie adecvat pentru eliminarea semnalului de fond care nu aparţine vârfului de interes. prin aceasta micşorând transmisia analizorului şi. Trebuie menţionat că acest tip de analiză se realizează maximizând semnalul obţinut (sensibilitatea) cu preţul degradării rezoluţiei. calibrarea cu exactitate a scalei energetice şi a scalei de intensitate este crucială. crescând rezoluţia energetică. Spectrele de înaltă rezoluţie se înregistrează pe domenii energetice restrânse (10-15 eV) micşorând fereastra energetică. y%Si3+. proba se va încărca relativ la suportul de probă având ca efect apariţia unui câmp electric de întârziere la suprafaţa probei care determină deplasarea spectrului spre energii cinetice 425 . Y%C. t%Si1+) sau concentraţiile relative ale stărilor chimice prezente pe suprafaţă (x%Si4+. În marea majoritate a cazurilor primul pas în analiza probei este acela de a înregistra spectrul pe scala energetică maximă disponibilă a spectrometrului pentru a determina elementele prezente pe suprafaţă (survey analysis). Resursele software ajută la o analiză cantitativă (concentraţia relativă a tuturor elementelor prezente pe suprafaţă ) cu o precizie acceptabilă după 2-3 baleiaje a scalei energetice. Pentru a realiza măsurători de încredere şi pentru a putea face intercompararea rezultatelor cu alte laboratoare. În acest caz numărul de “scan”-uri pe această plajă energetică îngustă va fi mai mare (10–20 baleiaje) pentru că sensibilitatea scade cu creşterea rezoluţiei. În figura 1 este ilustrat un spectru survey analizat folosind un tabel de cuantificare din baza de date a software-ului de prelucrare a datelor (Casa XPS) pentru regiunile selectate.electroni înregistraţi pentru o stare atomică este regiunea de cuantificare. capacitatea de calibrare a scalei de energie este dependentă de capacitatea de compensare a sarcinii pozitive acumulate la suprafaţa probei în timpul măsurătorii şi de disponibilitatea unei linii spectrale la o energie de legătură cunoscută care să poată constitui un etalon pentru deplasarea scalei de energie. În aceste spectre de înaltă rezoluţie apar structurările secundare care ne permit studiul complex al elementelor în înconjurarea lor chimică şi structurală. Y%Si3+. Z%O. concentraţiile relative ale stărilor de oxidare ale unui singur element ( x% Si4+. în consecinţă. Cu excepţia cazului când electronii emişi sunt înlocuiţi. t% C-C). z%O. z%Si2+. Aşadar. Mai mult.

Pentru ilustrarea acestui efect. energia masurată pentru o linie fotoelectrică poate varia în funcţie de energia cinetică a electronilor.Figura 1 Exemplificare spectru XPS cuantificat pe o probă cu conţinut de C. Ca.un tun de electroni de energie joasă (flood gun) pentru a restabili o stare de echilibru d. forma liniilor spectrale sa fie cea mai bună concomitent cu asigurarea că distanţa dintre vârfuri între tranziţii este inde426 . figura 2 prezintă spectrul unei probe înregistrat înainte şi după compensarea de sarcină [1]. Este important de menţionat că. În absenţa compensării efective de sarcină .d.p. î. B. electric. compensarea de sarcină nu înseamnă neapărat neutralizarea suprafeţei probei ci mai mult stabilizarea suprafeţei probei a. C1s. Si şi Mg. Pentru probe conductoare conectate electric la suport echilibrul de sarcină este restabilit uşor. este deplasată cu 120 eV între cele doua situaţii (cu compensare de sarcina şi fără). pentru materialele izolatoare electronii emişi trebuie înlocuiţi de la o sursă externă . O. mai mici (energii de legătură mai mari). Linia spectrală a carbonului.v.

însă forma vârfurilor este bună şi poziţiile relative ale vârfurilor sunt stabile. pe o proba cu conţinut de C.pendentă de energia la care sunt măsuraţi electronii. Măsurătorile au fost realizate cu ajutorul unui echipament de tip SPECS PHOIBOS 150 MCD echipat cu o sursă AlKα monocromatică (hν=1486. cu scopul de a pune în evidenţă performanţele tehnice ale echipamentului folosit. metalul Al oxidează chiar şi în vid iar stratul subţire de oxid se comportă ca un izolator. Avantajele utilizării monocromatorului sunt: reduce semni427 . vârfurile au forma foarte îngustă Măsurătorile XPS prezentate mai jos reprezintă sinteza unor studii complexe pe diferite tipuri de materiale.6 eV). Mai mult. concretizate deja în lucrări ştiinţifice importante. Casa XPS. Straturile de oxid pe materialele metalice pot transforma un material conductor într-o suprafaţă izolatoare care astfel necesita tratarea lor ca un material izolator. Si şi O: a) În absenta neutralizării (flood gun off). De exemplu. Figura 2 Efectul compensării de sarcină în spectrul XPS. [1]. Obţinerea unei energii de legătură corecte pentru o tranziţie cunoscută nu e neapărat un indicator al unei bune neutralizări de sarcină. aceste măsurători furnizează informaţii relevante despre limitele şi posibilităţile de îmbunătăţire ale acestei tehnici de analiză. Un experiment în care compensarea de sarcină este făcută corespunzător necesită de obicei deplasarea în energia de legătură folosind pagina “ Calibration property” din programul de cuantificare al spectrelor. spectrul este deplasat cu 120eV şi distorsionat b) În prezenţa neutralizatorului de sarcina dar cu parametrii de lucru selectaţi incorect. vârfurile sunt largi. acumularea de sarcina este compensată insuficient c) Suprafaţa probei neutralizată corect.

875 Intensitate ( u.375 O3 O2 x=0. î. indicată în fig. Se observă că. cu cele obţinute şi publicate recent [2] în literatura de specialitate cu un echipament similar. 3a este prezentată descompunerea spectrului O1s urmărind scenariul propus în literatură. ) x=0.375 (a) O1 (b) 540 535 530 525 520 Energie de legatura (eV) 540 535 530 525 520 Energie de legatura (eV) Figura 3 Deconvoluţia spectrului O1s de înaltă rezoluţie: (a) aşa cum a fost sugerată in literatură. pe acelaşi tip de probe. Presiunea în camera de analiză este în intervalul 10-9. a.2 eV. temperatură de topire joasă.6 x=0. (b) propusă în studiul nostru 428 . Măsurătorile se realizează utilizând o sursă de raze X de putere 250 W. Prin măsurarea probei B2O3 autorii au determinat poziţia vârfului O1s la o valoare a energiei de legătură de 533. a.10-10 mbar. Proba care urmează a fi analizată este fixată pe un suport de molibden cu ajutorul unei benzi dublu adezive de carbon. În acest studiu sunt comparate rezultatele XPS obţinute pentru sistemul (1-x) B2O3·xBi2O3 cu x = 25 – 65 cu echipamentul descris mai sus. Materialele oxidice cu structură vitroasă pe bază de Bi2O3 prezintă interes foarte mare atât din punct de vedere ştiinţific cât şi tehnologic deoarece prezintă proprietăţi fizice mai bune decât alte sticle: coeficienţi de expansiune termică mari. În Fig.ficativ fondul de radiaţie. elimină sateliţii din spectru (vârfuri secundare care însoţesc tranziţiile de interes) . Autorii au propus descompunerea spectrelor O1s obţinute pentru acest sistem în două componente : O1 – asociată legăturilor de tip B-O-B şi O2 atribuită legăturilor B-O-Bi şi Bi-O-Bi. prezenţa O1s as prep x=0. transmisie în ultraviolet (UV) şi caracteristici optice.875 O1s as prep x=0. asigură o rezoluţie energetică şi spaţială foarte bună. spectrul O1s se deplasează spre energii de legătură mai mici. cu creşterea lui x.6 x=0.3a prin linia punctată.

5 eV şi cel corespunzător oxigenului în reţeaua SiO2 (Si-O-Si) observat la 532. Începând cu proba tratată termic la 700°C. Se observă că. iar spectrul de înaltă rezoluţie corespunzător Ti 2p pentru substratul de Ti:Si 1:2 (Fig. Acest tip materiale a atras o atenţie deosebită în ultimii ani [4. Rezultatele XPS obţinute pentru sistemul cu raport Ti:Si 1:2.875. Analiza fotopicului Si 2p (102 eV) identifică formarea SiO2 (Fig. vârful corespunzător oxigenului din reţeaua TiO2 (Ti-O-Ti) prezent în jurul valorii de 530. 4C). asimetrică datorită suprapunerii mai multor componente specifice oxigenului din structura sistemului investigat (Fig.monocromata) în laboratorul nostru. spre deosebire de [3]. această componentă nu mai poate fi pusă în evidenţă. O2 şi O3 atribuite legăturilor de tipul B-O-B. î. indicând o segregare a celor doua faze. pentru proba cu x = 0. împreună cu Ti. Bi-O-B şi Bi-O-Bi. O categorie de probe pe care au fost efectuate măsurători XPS în scopul evaluării modificărilor structurale induse la suprafaţa acestor sisteme prin aplicarea tratamentelor termice o reprezintă nanocompozitele pe bază de Si şi Ti preparate prin combinarea metodei sol-gel cu metoda uscării prin pulverizare. 4D). indică prezenţa oxigenului şi a carbonului de contaminare.83 eV pentru cea tratată la 1400 eV. nu mai poate fi clar evidenţiată. şi de valorile energiilor de legătură ale oxigenului în B2O3 şi Bi2O3 raportate în literatură [3]. indică prezenţa TiO2 evidenţiat 429 . 4B).84 eV pentru proba netratată termic. Si şi Gd. deoarece prezintă o fotoactivitate mult crescută faţă de oxidul de titan pur. în timp ce componenta atribuită legăturilor de tip B-O-B scade continuu a. s-a reuşit o analiză mult mai detaliată a tipurilor de legături şi a modificărilor care apar la nivelul acestora în probe cu creşterea conţinutului de Bi. Astfel. după cum se poate observa din spectrul survey prezentat în Fig. acest studiu confirmă faptul că rezoluţia spectrelor înregistrate are un rol foarte important în analiza şi modul de interpretare a datelor. Fotopicul O1s prezintă o formă complexă. concentraţia legăturilor de tip Bi-O-Bi creşte.8 eV sunt bine separate (Fig. Bi2O3 devine aşadar formator de reţea vitroasă ceea ce determina creşterea stabilităţii chimice a probelor. În Fig. cu preponderenţa fazei de siliciu la suprafaţă. cu creşterea conţinutului de Bi. 5] în special pentru aplicaţii de fotocataliză. 4A. 3b este prezentată deconvoluţia spectrului O1s cu trei componente: O1. la 532.componentei B-O-B în spectru. Ţinând cont de echipamentul de înaltă rezoluţie utilizat în achiziţionarea acestor spectre (sursa -AlKα. Prin creşterea temperaturilor de tratament termic acesta se deplasează de la 530. 4B). Spectrul O1s pentru această probă constă din două componente atribuite legăturilor de tipul Bi-O-B şi Bi-O-Bi.

(c) 700°C.5 eV (Ti 2p1/2). Cantitatea de oxigen la suprafaţa probelor descreşte odată cu creşterea temperaturii de tratament. După cum se poate observa din Tabelul 1. (d) 900°C.05 %. 430 . (e) 1100°C şi (f) 1400°C. (D) Ti 2p.Spectrele XPS de înaltă rezoluţie corespunzătoare (B) O 1s.Ti LMM C KLL Gd 3d O KLL O 1s Gd 4d (A ) Si 2p C 1s (B) (f) (e) (d) (c) (b) (a) 545 540 535 530 525 Intensitate (u.0 eV (Ti 2p3/2) şi 464. în timp ce cantitatea de Si 2p creşte de la 16. la 2. (d) 900°C.89 % pentru proba tratată termic la 1100°C.) (f) (e) (d) (c) (b) (a) 110 105 100 95 90 470 465 460 455 450 Energie de legatura (eV) Energie de legatura (eV) Figura 4A: Spectrele XPS survey pentru sistemul Ti:Si 1:2 (a) netratat termic. pentru (a) proba netratată termic precum şi pentru probele tratate termic la (b) 350°C. (C) Si 2p. Formarea celor doi oxizi (SiO2 şi TiO2) este confirmată şi de forma vârfului O 1s (Fig.a. respectiv tratat termic la (b) 350°C. fapt datorat îndepărtării oxigenului specific compuşilor organici sau grupărilor OH. cum sunt atomii de Si în reţeaua SiO2.28 % pentru proba netratată termic. dar mai ales separării celor două faze.) Ti 2p (f) (e ) (d ) (c ) (b ) (a ) 1200 900 600 300 0 E n e r g ie d e le g a t u r a ( e V ) Energie de legatura (eV) (C) (D) (f) (e) (d) (c) (b) (a) Intensitate (u. prin peak-ul de la 459. (e) 1100°C şi (f) 1400°C . (c) 700°C. Acest fapt poate fi explicat printr-o migrare a titanului de la suprafaţă spre interior şi a siliciului din interior spre suprafaţă. reflectându-se astfel o substituţie a atomilor de Ti de către atomi cu o electronegativitate mai mare şi polarizabilitate mai mică. 4B). cantitatea de Ti 2p la suprafaţă descreşte de la 12.a.87 % la 38.

Concentraţia relativă a principalelor componente. Pentru măsurători ulterioare pe probe funcţionalizate cu diverse tipuri de proteine este reco431 . Fe 2p. Biocompatibilitatea este dictată de modul în care proteinele se adsorb la suprafaţa materialului odată ce acesta intră în contact cu mediul biologic.653 38. Experimentele de adsorbţie a proteinelor s-au realizat prin imersarea compusului aluminosilicatic în lichid biologic simulat (SBF) îmbogăţit cu BSA.498 Si 2p 16.164 27. BSA şi Fg reprezintă principalele componente plasmatice şi proteinele relevante care se adsorb la suprafaţa biomaterialelor care intră în contact cu sângele.22 0.428 62.829 59.37 Spectrele de înaltă rezoluţie corespunzătoare Si 2p (Fig. dar şi datorită benzii dublu adezive de carbon pe care a fost imobilizată proba pentru măsurare. După procedura de imersie.43 eV pentru proba netratată termic la 102.) O 1s 70.18 0.15 0. Temperatura de tratament termic (ºC) Netratat termic 350 700 900 1100 1400 Compoziţia elementală (% at. înainte şi după tratamentul termic. Prezenţa carbonului se explică prin expunerea probei la atmosferă. de la 101. Ceramicele vitroase aluminosilicatice sunt foarte stabile în organism iar prin adăugarea oxidului de fier şi ytriu ele pot fi optimizate pentru aplicaţii simultane de hipertermie şi radioterapie [6]. precum şi în soluţie tampon fosfatică (PBS) îmbogăţită cu Fg. Motivul acestei deplasări este corelat cu deplasarea spectrelor O1s şi cu migrarea atomilor de Si spre suprafaţă odată cu creşterea temperaturii de tratament termic.procente molare). 4B) sunt de asemenea deplasate spre energii de legătură mai mari.76 29. excepţie făcând fotopicul de C 1s (Fig. 5 (A.9 eV pentru proba tratată termic la 1400°C.281 11.640 58.684 62.331 Ti 2p 12.260 9. probele spălate şi uscate au fost analizate cu ajutorul spectroscopiei XPS.798 Gd 3d 0. Pentru exemplificare sunt prezentate caracteristicile de adsorbţie a albuminei serice bovice (BSA) şi a fibrinogenului (Fg) la suprafaţa unui compus aluminosilicatic cu conţinut de Fe şi Y preparat prin metoda sol-gel (60%SiO220%Al2O310%Fe2O310%Y2O3 . B)).057 34.367 7.875 24.Tabel 1.894 5.148 0. pentru sistemul Ti:Si 1:2. Si 2p şi Al 2p) pentru toate probele investigate.549 2. XPS ne permite de asemenea studiul biocompatibilităţii diferitelor tipuri de materiale. Spectrul XPS survey înregistrat înainte de imersie prezintă doar fotopicuri corespunzătoare elementelor care intră în compoziţia sistemului (Y 3p.156 0.688 64.

47 25. Fotopicul N 1s înregistrat la aproximativ 400 eV este tipic pentru azotul din compuşii organici [8]. centrate la 398. înainte şi după imersia în soluţiile de SBF/BSA. concentraţia de azot a fost practic zero înainte de imersie în soluţiile cu proteină (Tabel 2. 3).93 33.) O Al Si 53. 6) de înaltă rezoluţie scoate în evidenţă două componente. 2 ore (c) şi 24 ore (d) de imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). În acelaşi timp. 2).77 25.21 35. caracteristice grupărilor C-NH2.21 N 5. azotul poate fi utilizat ca un indicator sigur al ataşării proteinelor. Rapoartele N:C de 0.5.19 1.68 6. datorită azotului prezent în fiecare aminoacid component al proteinelor. Fe 2p.mandată utilizarea benzii de In în locul celei de C.54 36.92 28.a. detecţia elementelor Y 3p.) (d) (c) (b) (a) Si 2s Si 2p Al 2p O 2s (d) (c) (b) (a) 1200 800 400 0 1200 1000 800 600 400 200 0 Energie de legatura (eV) Energie de legatura (eV) Figura 5 Spectrele XPS survey înainte de imersie (a) şi după 5 minute (b). Concentraţia relativă a principalelor componente. Deconvoluţia spectrelor de N 1s (Fig. Măsurătorile XPS de concentraţie de azot pot fi utilizate şi ca metodă indirectă de determinare a cantităţii de proteină adsorbită la suprafaţă [7].75 0.42 432 .18 0.2 şi 400 eV.71 1.2 respectiv 0. Si 2p şi Al 2p a fost mai puţin evidentă datorită stratului de proteină format (Tabel 1.67 Compoziţia elementală (% at.3 2.46 6. Este de remarcat faptul că pentru suprafeţele funcţionalizate cu proteine. analiza spectrelor survey indică fotopicuri corespunzătoare N 1s.49 0.08 37. înregistrate deja după un timp de imersie de 5 minute. Tabel 2. Deoarece.43 28. O 1s O KLL C KLL N 1s Y 3p C 1s Si 2s Si 2p Al 2p (A) O KLL C KLL Fe 2p O 1s C 1s (B) N 1s Intensitate (u.03 Y 0. Rezultate similare au fost obţinute pentru ambele proteine (BSA/Fg) utilizate pentru funcţionalizare.7 37.16 2.46 0. denotă o ataşare rapidă a proteinei la suprafaţa compusului.2 23 Fe 0. Timpul de imersie 0 5 min 2 ore 24 ore C 6.04 0.a.) Fe 2p Y 3p Intensitate (u.

81 48.1 Si 36. şi 24 ore (c) imersie în soluţiile de SBF/BSA (coloana stângă) şi PBS/Fg (coloana dreapta). aşa cum este de aşteptat.26 23.69 11.a.01 Y 0.25 27.52 O 53. (Fg).8 0.16 - Analizele XPS confirmă creşterea conţinutului de azot după diferite perioade de imersie.) 405 400 395 Energie de legatura (eV) 390 (a) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) Figura 6 Deconvoluţia spectrelor XPS de înaltă rezoluţie ale N 1s pentru BSA/Fg liofilizat (a) după 5 minute (b).) 410 405 400 395 390 410 Energie de legatura (eV) (a) Intensitate (u.83 Al 2. În plus.02 Fe 0.02 0. 433 .53 N 10. înainte şi după imersia în soluţiile de PBS/Fg.) C 6.5 13.75 0.92 43. produce un semnal de azot mai intens decât proteina mai mică.a. Intensitate (u.11 51.a.18 0.08 29. proteina mai mare.3 0.) (c) (c) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) (b) (b) Intensitate (u.02 10. Timpul de imersie 0 5 min 2 ore 24 ore Compoziţia elementală (% at.41 0. Concentraţia relativă a principalelor componente.96 13. (BSA).77 15.Tabel 3.

434 .a. semnalând formarea unor noi tipuri de legături specifice carbonului în proteine [8]. (A) Intensitate (u. datorită ataşării la suprafaţă a BSA/Fg-ului cu un conţinut scăzut în oxigen faţă de compusul oxidic utilizat (Fig.8). ale C 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c).) (e) (d) (c) (b) Intensitate (u. este un indicativ al formării unui monostrat complet de proteină [9]. pe baza componentei BSA-ului de la 530. După imersia în soluţiile cu proteine. ale O 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c). semnalele de înaltă rezoluţie ale C 1s (Fig. 3) corespunde în mare parte oxigenului peptidic constituent al proteinelor.Potrivit rezultatelor publicate anterior privind adsorbţia proteinelor. fotopicul O 1s este evident lărgit şi se deplasează spre energii de legătură mai mici. respectiv Fg-ului la 531.a. (A) (B) Intensitate (u. După imersia în soluţiile cu proteină.8B) Astfel spectroscopia XPS a fost utilizată cu succes în acest studiu. conţinutul semnificativ diminuat al O 1s (Tabel 2.) (B) (e) (d) (c) (b) (a) 545 540 535 530 525 545 540 535 530 (a) 525 Energie de legatura (eV) Energie de legatura (eV) Figura 8 Spectrele XPS de înaltă rezoluţie ale O1s înainte de imersie (a).3 eV. În cazul probelor imersate în soluţiile cu proteină. o cantitate de 14% N.2 eV (Fig. 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B).) (e) (d) (c) (b) (a) Intensitate (u. în cazul Fg-ului (Tabel 3). 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B).a.a. 7) sunt mai largi şi prezintă o formă asimetrică. evidenţiind ataşarea proteinelor la suprafaţa materialului şi totodată biocompatibilitatea materialului investigat [10-12].) (e) (d) (c) (b) (a) 292 288 284 280 276 272 Energie de legatura (eV) 292 288 284 280 276 272 Energie de legatura (eV) Figura 7 Spectrele XPS de înaltă rezoluţie ale C 1s înainte de imersie (a).

0 16 (b) 110 (a) 92 90 88 86 84 82 110 80 12 8 4 0 Energie de legatura (eV) Energie de legatura ( eV ) Figura 9(a) Spectrul XPS obţinut pentru Au 4f pe proba 0. Au0 şi Auδ+. Au0 şi Auδ.7P2O5] tratată termic la 110. având despicarea. Aceste rezultate furnizează dovezi experimentale complete pentru corelaţia dintre dimensiunea şi structura electronică a nanoparticulelor de Au care a fost prezisă teoretic.67 eV. Au4f δ0 ΔE 0. atribuiţi la trei specii de Au diferite: Auδ-.3 0.3Au2O3·99.0 0.3 0. Au 4f7/2 şi Au 4f5/2. ) 300 300 0. Mai jos sunt prezentate rezultatele XPS cu privire la nucleaţie şi procesul de creştere a nanoparticulelor de Au în sticla bioactivă CaO-SiO2-P2O5 tratată termic la diferite temperaturi. 435 . 83. Linia gri reprezintă spectrul obţinut pentru fiecare din cele trei probe fără nanoparticule de Au. [14]. ce deschid noi oportunităţi în medicină. 300 şi 500°C.95 eV.72 şi 85. Ag) prezintă un interes crescut datorită caracteristicilor remarcabile ale acestora.în fiecare proba.7[61. Deconvoluţia spectrului Au4f înregistrat pentru probele tratate termic la 300 şi respectiv 500 °C prezintă trei dubleţi la energiile de legătură: 82. Acest tip de materiale furnizează avantaje valoroase şi în diagnosticarea cancerului sau imagistica biomedicală. are importanţă ştiinţifică mare datorită faptului că demonstrează foarte clar legătura care există între dimensiunea nanoclasterilor care se formează în matrice şi modificările observate în spectrul Au4f şi cel al benzii de valenţă cu creşterea temperaturii de tratament a probei.8CaO·7.3 0.6 T (°C) Au 5d T(°C) 500 δ+ 500 0. Identificarea speciilor de Au prezente în probe este foarte importantă deoarece studii recente au demonstrat faptul că toxicitatea nanoparticulelor de Au în tratamentul cancerului depinde de sarcina acestora [13].6 0. a. Spectrul Au4f este caracterizat de două componente spin-orbită.0 0. ΔE = 3. (b) Spectrul XPS al benzii de valenţa (Au 5d) obţinut pe aceleaşi probe.6 Intensitate (u.Biomaterialele dopate cu particule nano ( Au. Acest studiu publicat recent.5SiO2·30. Deconvoluţia liniilor spectrale indica prezenţa speciilor de Au Auδ+.

P.. Hulshof MCCH. A. J. 16. C. 163. S. Ciceo-Lucacel. Solid State Ionics. Neumann. M. Kennedy. R. Stenport. Sul. E.P. O. Pasche S. B. 13.2. West. Chem. Simon. Langmuir 2005. vol. R. Lewinski. 5. 100-112 (2002). 257(2011) 2346-2352 L. of Solid State Chem. Coughlin. 12. Radu. Adv. R. Saramago. A. Dahl O. M. Mat.32-40. Colaco. Mella O. O. S1. XPS study of protein adsorption onto nanocrystalline aluminosilicate microparticles. Simon. H. Benea.C. G. J Biomed Mater Res. E. P. Hu. Structural characterization of some silicate xerogels and microspheres. E. 2011 T. 9. E. Applied Surface Science. 6. V. Textor. 43. Prinz. Y. M. 2006. S. J.3681307 14. 2009. No. 8. 2009. R. N.78A:581-589. Glasses. L. 180. Bickford. Drezek.T. Gonzalez Gonzalez D. 9. S. A. M.1063/1. 21:12327–12332. M. December 2010 Overgaard J. 2008. A. Small 7. Gispert. Cavalu. S. PhD Thesis. M. Phys. Ponta and S. 764–76. V. Brogueira. Currie. Simon. Appl. European Cells & Materials. D. 20:1869-1879.. D. Day. Honma et al. Ponta. S. (2008) 2325 Oana Ponta. doi:10. M.L. V. Dimitrov et al. Prinz. Cavalu. V. 55. Simon. Arvidsson. S. V. Simon. Neumann. P. F. 2. 2002. Mocuta. Y. Vanea. 25:323-334. Simon. Simon. Arcangeli G. Phys. L. 11. Bibliografie 1. 169-183. 436 . A New Era for Cancer Treatment: Gold-Nanoparticle-Mediated Thermal Therapies. S. Int J Hyperther 2009. “Dual-Beam” Charge Neutralisation for monoXPS T. V. Kjellin. Neumann. Vanea. 4. Simon. J. J Mater Sci: Mater Med. Michel. Martins. Vanea.. Opt. 7. M.. et al. R. J. 10. A. Serro. Castner. J. 10. 3.

...................2................................................... SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN Spectroscopia de rezonanţă electronică de spin C. 447 3............................................... Consideraţii teoretice Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor energetice ale centrilor paramagnetici.. Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1................ 441 2.........................3.........................................................................................................S.................... 438 1.......... dr...... RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale..................XII...................... Spectrometrul portabil RES ADANI PS8400 ................................................... 447 3.... Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 .................. Consideraţii teoretice .................... 437 1............................................................1................. Bibliografie ..................................................................................... Principiul de funcţionare al unui spectrometrul RES........................2........................ Metoda constă 437 . 447 3................... 449 4. Interacţiunea Zeeman .............. Caracterizarea instalaţiei experimentale RES ................ 443 3............ Obţinerea şi analiza spectrelor RES ................................1.................. 451 1....................................... Hamiltonianul de Spin ............

procesele electrochimice. cataliza şi reacţiile de polimerizare au fost toate studiate cu mare succes. geologie.în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. structura cristalină. spectroscopia RES a fost cu succes aplicată în diverse domenii ca biologie. astfel încât interacţiunea lor să fie slabă). Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. 5. Interacţiunea Zeeman Metoda RES constă în studiul tranziţiilor induse între două subnivele Zeeman vecine. 1. De exemplu. Radicalii liberi în stare solidă. cel mai cunoscut din această clasă este centrul F. procesele de cinetică.). antropologie. Sisteme cu trei sau mai mulţi electroni neîmperecheaţi. 2. Sisteme cu stare fundamentală de triplet (cu doi electroni neîmperecheaţi care interacţionează puternic). în domeniul microundelor. 4. Sistemele tipice care pot fi studiate prin RES sunt: 1. Ioni ai metalelor tranziţionale şi ai pământurilor rare [1. Frecvenţa de ordinul gigahertzilor (GHz). 3. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. ştiinţa materialelor. lichidele şi gazele sunt deopotrivă accesibile spectroscopiei RES. suficient de depărtaţi unul de altul. chimie. etc. 7. Biradicalii (molecule ce conţin doi electroni neîmperecheaţi. Prin utilizarea unor tehnici specializate variate (cum ar fi metoda capcanelor de spin şi a radicalilor nitroxidici. ştiinţele medicale. În cazul experimentelor de Rezonanţă Magnetică Nucleară (RMN). ESEEM şi ENDOR) în conjuncţie cu RES este posibil să se obţină informaţii detaliate privind unele teme de interes ştiinţific. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi (de exemplu. fizică. atomii interstiţiali dintr-un cristal sau matricea unei sticle. De-a lungul anilor. etc. Sisteme cu electroni de conducţie (metale şi semiconductori). Astfel. 2]. Defecte punctuale (imperfecţiuni localizate în cristale) în solide. frecvenţele utilizate sunt de ordinul megahertzilor (MHz) din domeniul vizibil la cel ultraviolet. lichidă sau gazoasă. un electron prins într-o vacanţă ionică negativă. schimbul electronic.1.2]. sub acţiunea unui câmp de microunde cu o anumită frec438 . Solidele. este folosită în cazul experimentelor RES. 6.

iar MS este numărul cuantic mag= ± 1 2 . Din această cauză dacă Δ M S = + 1 când un foton este absorbit M I (numărul cuantic magnetic nuclear) trebuie să rămână neschimbat pentru ca momentul unghiular total să se conserve. ⎛ 1⎞ E↓ = −⎜ ⎟⋅ β ⋅ g ⋅ B ⎝ 2⎠ (3) Regula de selecţie pentru tranziţia unui spin electronic este Δ M S = ± 1 . depinde de intensitatea câmpului magnetic aplicat. paralelǎ sau antiparalelǎ cu câmpul magnetic.venţă numită frecvenţă de rezonanţă [1]. se cunoaşte faptul că electronul posedă o proprietate cuantică numită “spin”.0023. ecuaţia (2) poate avea doar două forme pentru o orientare dată a câmpului magnetic B: ⎛ 1⎞ E↑ = +⎜ ⎟ ⋅ β ⋅ g ⋅ B ⎝ 2⎠ . Asemenea tranziţii corespund la o schimbare în momentul unghiular de spin de ( ± ). în energie. care este privită clasic ca o rotaţie în jurul propriei axe. orientarea spinului trecând din cea paralelă cu câmpul în poziţia antiparalelă cu acesta. Diferenţa dintre cele două direcţii ale spinului. netic de spin care poate lua valoarea M S → → (2) β = γ ⋅ . Energia interacţiunii Zeeman a unui electron într-un câmp magnetic aplicat B este dată de relaţia: E Zeeman = − μ s ⋅ B = g ⋅ β ⋅ B⋅ M S unde β este magnetonul Bohr.este momentul cinetic de spin. 439 . În urma absorbţiei de energie electronii trec de pe nivelul de energie inferior pe unul superior. Astfel. Un foton are momentul unghiular intrinsec egal cu . Astfel. efect denumit efect Zeeman. Introdus într-un câmp magnetic static B. spinul electronului poate avea două orientări. Ca urmare a acestei rotaţii electronul posedă un moment cinetic de spin S căruia i se asociază un moment magnetic μ S : → → μ S = −g ⋅γ ⋅ S → → (1) unde g este factorul Landé care pentru electronul liber are valoarea 2. Astfel regulile de selecţie impuse sunt Δ M S = ± 1 şi Δ M I = 0 . iar γ este raportul giromagnetic electronic. Diferenţa de energie în spectroscopia RES este predominant datorată interacţiunii electronilor neîmperecheaţi din probe cu câmpul magnetic produs de un magnet. S .

Cu alte cuvinte. Parametrul g determină poziţia liniei de absorbţie. Această energie. 1) sunt reprezentate schematic energiile Zeeman funcţie de magnetizarea câmpului aplicat B. de obicei se obţine de la o sursă de energie electromagnetică. Figura 1. figura ilustrează tranziţia între nivelul de energie inferior « spin jos » şi nivelul de energie superior « spin sus » indusă prin introducerea probei în câmpul de microunde de frecvenţă ν. Nivelele energetice şi absorbţia de rezonanţă RES pentru interacţia Zeeman a unui electron (S = 1/2) În (Fig. în cazul unui electron neîmperecheat (S=1/2). într-un câmp magnetic exterior. De asemenea. având o frecvenţă fixă de oscilaţie ν şi deci energia (h·ν). De obicei linia de absorbţie nu este singulară apărând uneori un spectru de multipleţi datorită existenţei nucleelor magnetice în specia paramagnetică. Rezultă de aici condiţia de rezonanţă: h ⋅ν = g ⋅ β ⋅ B (4) unde h este constanta lui Planck. spectrul RES măsoară energia necesară tranziţiei electronului (ΔE) între cele două nivele energetice. 440 . ν frecvenţa de rezonanţă. iar B câmpul magnetic aplicat. Spectrul de absorbţie măsurat la condiţia de rezonanţă este schematic reprezentat în partea de jos a figurii.

iar ultimii doi sunt termenii ce dau structura fină. termenul E fiind 0. HSS – reprezintă interacţiunea de structură fină în aproximaţia de ordin II (sau termenul de despicare în câmp nul). În esenţă hamiltonianul de spin este un operator echivalent care acţionează numai asupra coordonatelor de spin conducând la aceleaşi rezultate ca şi hamiltonianul total al sistemului. ƒ HN – reprezintă termenul interacţiunii hiperfine. ƒ HZ – reprezintă interacţiunea electronului cu câmpul magnetic exterior (termenul Zeeman).2. deci depind de forma funcţiei de undă şi de câmpul cristalin. Starea unui ion paramagnetic având spinul nuclear nenul. introdus într-o reţea cristalină şi aşezat într-un câmp magnetic static. ƒ HD – descrie proprietăţile diamagnetice. Hamiltonianul de spin conţine o serie de coeficienţi care sunt mărimi tensoriale. H0 . HLS – este interacţiunea spin – orbită. Hamiltonianul de Spin Fenomenul RES poate fi tratat teoretic prin două metode: tratarea clasică cu ajutorul teoriei lui Bloch şi tratarea cuantică. respectiv rombică. este descrisă printr-un hamiltonian compus din mai mulţi termeni [1]. şi anume: H=H0+HLS+HSS+HZ+HN+HQ+HD+HC unde. Dacă simetria este axială. Toţi coeficienţii tensoriali din expresia hamiltonianului de spin se exprimă prin matrici care pot fi diagonalizate.1. Folosind teoria perturbaţiilor se ajunge la forma bine cunoscută a hamiltonianului de spin: 1 ⎤ 2 2 2 Hs = β ⋅ ( g xx S x Bx + g yy S y By + g zz S z Bz ) + D ⋅ ⎡ ⎢S z − 3 S (S + 1)⎥ + E ⋅ (S x − S y ) (6) ⎣ ⎦ Primul termen din acest hamiltonian este aşa numita interacţiune Zeeman. D şi E reprezintă constantele de despicare în câmp nul. rămân în hamiltonian numai termenul Zeeman şi termenul în D. ƒ HC – termenul câmpului cristalin şi reprezintă influenţa câmpului electrostatic cristalin. ƒ HQ – interacţiunea electrostatică cu momentul de cuadrupol q al nucleului. Cel mai simplu formalism pentru interpretarea spectrelor RES este cel al hamiltonianului de spin.reprezintă energia ionului liber care nu depinde de spin. 441 (5) ƒ ƒ ƒ . axială.

Tocmai această interacţiune produce structura hiperfină a nivelelor energetice de spin. Hamiltonianul de spin care descrie starea energetică a unui centru paramagnetic electronic în interacţiune cu n nuclee cu spinul nuclear diferit de zero va fi: H = → → ~⋅ S + S ⋅ A ⋅ I i β ⋅ B⋅ g ∑ i i =1 → → n → ~ → (10) unde. De exemplu. BX este componenta câmpului magnetic de-a lungul direcţiei perpendiculare (x). cât şi Ai sunt mărimi tensoriale. 442 . şi are următoarea formă: H = g ⋅ β ⋅ B ⋅ SZ (7) unde direcţia câmpului magnetic este aleasă ca fiind axa z. Ordinul de mărime al energiei hiperfine este de 0 ÷ 10-2 cm-1. SZ este operatorul de spin corespunzător proiecţiei acestuia după axa z. în cazul unor simetrii nesferice atât g. Hamiltonianul de structură hiperfină produce o despicare simetrică a nivelelor energetice şi are următoarea formă: HN → ~ → = S⋅ A ⋅ I (9) unde A este tensorul interacţiunii hiperfine. pentru o simetrie axială hamiltonianul de spin are următoarea formă: H = g // ⋅ β ⋅ B Z ⋅ S Z + g ⊥ ⋅ β ⋅ B X ⋅ S X (8) unde BZ este componenta câmpului magnetic de-a lungul axei z (paralel). Dacă câmpul magnetic este direcţionat paralel cu direcţia axelor moleculare atunci situaţia este identică cu relaţia (7). Termenul HN (ecuaţia 5) reprezintă termenul interacţiunii hiperfine. fără interacţiuni hiperfine corespunzător ecuaţiei (4). Acest termen reprezintă interacţiunea momentului cinetic de spin I cu momentul de spin electronic S . Interacţiunea dintre momentul magnetic de spin şi un moment magnetic nuclear se numeşte interacţiune hiperfină. descrisă de hamiltonianul de mai sus.Cea mai simplă formă a hamiltonianului de spin este pentru un singur electron cu g izotrop. Pentru un singur electron cu g anizotrop hamiltonianul de spin este mai complicat din cauza diferiţilor operatori ai proiecţiei spinului.

există limitări tehnice legate de utilizarea benzilor de frecvenţă ridicate: folosirea de probe de dimensiuni mici. Aceşti tensori dau cele mai importante informaţii cu privire la structura centrului paramagnetic studiat.2. momentul de spin şi cel orbital se pot combina. provocat de mişcarea orbitală. Pentru radicalii liberi. rezultă că se obţine o rezoluţie spectrală mult mai bună o dată cu creşterea frecvenţei de microunde. În sistemele chimice. se datorează unui slab câmp perturbator indus. Deoarece sensibilitatea instrumentului creşte proporţional cu pătratul frecvenţei. electronii neîmperecheaţi ocupă un orbital care poate fi localizat pe un singur atom sau poate fi delocalizat pe o întreagă moleculă sau pe un radical. În felul acesta în sisteme cu un electron neîmperecheat şi legătură π. Acest câmp perturbator se poate adăuga sau scădea la câmpul exterior. În expresia factorului g. Spectrul RES al unui centru paramagnetic cu spinul ½ este bine definit dacă se cunosc tensorii g (factorul de despicare spectroscopică) şi A (constanta de despicare hiperfină). creşterea absorbţiei o dată cu creşterea frecvenţei. având în vedere posibilităţile de absorbţie şi de a da semnal RES al sticlei obişnuite.5 GHz) şi Q (∼ 35 GHz). obţinând o valoare a lui Δg pozitivă sau negativă. pulberi şi monocristale. în afara unei mărimi constante intervine o mărime care dă abaterea factorului g de la valoarea corespunzătoare electronului liber. Unul din factori este datorat faptului că electronul posedă în plus un moment unghiular orbital căruia i se asociază un moment magnetic. Probele se introduc de obicei în tuburi şi. Astfel. valoarea factorului g este ge = 2. ceea ce duce la scăderea sensibilităţii. abaterea factorului g de la valoarea 2. Valoarea lui g definită prin 443 . Factorul g este o mărime tensorială caracterizată prin trei valori principale. dificultăţi de obţinere a omogenităţii câmpului (δH/H) la frecvenţe mari.0023. trebuie luate în considerare contribuţiile la momentul magnetic ale mişcării orbitale a electronului. notată Δg. pentru probe sub formă de soluţii. Măsurătorile RES se pot efectua pe probe gazoase. soluţii îngheţate. Pentru un electron liber. Tuburile au diametre de câţiva milimetri şi lungimi de ordinul centimetrilor.0023. În celelalte cazuri. Cu toate acestea în probele care conţin centri paramagnetici intervin o serie de factori care abat valoarea factorului g de la valoarea amintită mai sus. Obţinerea şi analiza spectrelor RES În experimentele RES cele mai utilizate benzi de frecvenţe de microunde sunt benzile X (∼ 9. este indicat a se folosi cuarţul. Totuşi. g rămâne apropiat de valoarea electronului liber.

în particular prin alterarea timpului de relaxare spin-reţea.0. iar această ecuaţie reprezintă formula lui Lande.00 . mai rar scade mult sub această valoare. Cel mai uzual radical utilizat ca etalon pentru marcarea câmpului magnetic este DPPH (difenilpicrilhidrazil). Liniile de rezonanţă ale probelor solide sunt considerabil distorsionate de anizotropia factorului g sau de cuplajul dintre spinii electronici şi nucleari. În acest caz valoarea factorului g depinde de numerele cuantice J. de exemplu ENDOR (Electron Nuclear DOuble Resonance) şi ELDOR (Electron Electron DOuble Resonance). În experimentele RES uzuale efectuate în undă continuă se fixează frecvenţa şi se variază inducţia câmpului magnetic aplicat. Astfel. poate fi β ⋅B diferită de 2. Prezenţa anumitor tipuri de interacţiuni are ca efect lărgirea sau îngustarea liniei de rezonanţă. Acestea sunt exemple de tehnici neliniare. dar poate ajunge la 9. valoarea lui g pentru un sistem paramagnetic oarecare se calculează utilizând următoarea relaţie: g = g etalon ⋅ B etalon B proba (12) Există posibilitatea de a combina metode în care pot fi îndeplinite mai multe condiţii de rezonanţă pe lângă cele referitoare la spinul electronic. Valoarea lui g depinde de orientarea câmpului magnetic extern în raport cu cel electric cristalin şi este o mărime tensorială. În ceea ce priveşte forma şi lărgimea semnalului RES. deoarece ambele depind de saturaţie [3]. cunoscută şi sub denumirea de g efectiv (gef ). Impurităţile paramagnetice pot de asemenea distorsiona semnalul RES. factorul g este calculat din condiţia de rezonanţă. L – numărul cuantic orbital. S – numărul cuantic de spin. cât şi de condiţiile experimentale. pentru care g = 2. fiind necesar un câmp magnetic de ∼ 3300 G. pentru semnale cu g ~ 2. se poate introduce în cavitatea de rezonanţă pe lângă proba de studiat şi un etalon. acestea sunt influenţate atât de caracteristicile fizico-chimice ale substanţei paramagnetice. utilizând valorile măsurate ale frecvenţei şi câmpului la rezonanţă.0036. Astfel.00 sau mai mult. De obicei se lucrează în banda X. 444 . Pentru a determina valoarea factorului g mai uşor.relaţia g = h ⋅ν . L şi S astfel: g =1+ J ⋅ ( J + 1) + S ⋅ ( S + 1) − L ⋅ ( L + 1) 2 J ⋅ ( J + 1) (11) unde J – numărul cuantic total.

Pentru sistemele reale. sunt simetrice şi au o formă aproximativ Lorentziană (Fig. Cauzele care determină lărgirea neomogenă sunt : interacţiunea dipolară între spinii de acelaşi tip. Această linie este îngustă în zona centrală şi are o descreştere lentă spre extreme. apărute în urma unor fluctuaţii dinamice în sistemul de spini (variabile în timp). neomogenităţilor câmpului magnetic static. interacţiunea dintre spinul electronic şi câmpul de microunde. Lărgirea liniei RES poate fi omogenă sau neomogenă. linia de rezonanţă are în general o formă intermediară între cele două cazuri limită. Figura. relaxarea spin – reţea. anizotropiei tensorilor g şi de structura fină. Liniile lărgite neomogen sunt înfăşurătoarele liniilor lărgite omogen corespunzătoare diferitelor pachete de spini. saturarea sistemului de spini cu o putere excesivă. Liniile lărgite omogen. Cauzele lărgirii neomogene sunt fluctuaţii spaţiale de câmp magnetic şi sunt datorate prezenţei unor interacţiuni hiperfine. neliniaritatea amplificatorului sau a detectorului. absorbind cuantele la o valoare bine determinată a câmpului magnetic. diversele scheme de modulaţie utilizate pentru a creşte detecţia.2). În cazul lărgirii omogene toţi spinii din probă răspund ca o unitate acţiunii cuantelor de microunde. difuzia de spin. avem: neomogenitatea câmpului magnetic static B0. atunci când lărgirea nu este provocată de interacţiunile anizotrope.2 Forma Lorentzianǎ şi gaussianǎ a liniilor RES Dacă numai anumite grupuri de spini sau pachete de spini din probă pot absorbi direct cuantele de o frecvenţă particulară. Liniile lărgite neomogen.Dintre factorii instrumentali care pot influenţa forma semnalului RES. dipolare dintre spini cu frecvenţe Larmour diferite. 445 . fluctuaţiile datorate mişcării spinilor în câmpul magnetic local. linii care au maxime de absorbţie uşor diferite între ele datorită distribuţiei de câmp magnetic local în probă. se apropie de o formă Gaussiană. atunci linia este lărgită neomogen.

Prezenţa unei structuri hiperfine caracteristice. intensitatea lor şi valoarea despicării hiperfine depind de numărul nucleelor cuprinse în orbita electronului paramagnetic. I. căci apar (2I1+1)(2I2+1)…. care permite în multe cazuri identificarea radicalilor liberi. Factorul de despicare spectroscopică g are valoarea foarte apropiată de cea corespunzătoare electronului liber (g = 2. o serie de particularităţi [1]: I. II. spectrul va avea (2nI+1) linii de structură hiperfină. în majoritatea cazurilor. III. arată că la radicalii liberi există o interacţiune spin-orbită foarte slabă şi electronii cu spinii neîmperecheaţi au un grad mare de localizare. descifrarea structurii hiperfine a spectrelor este destul de complicată.În cazul radicalilor liberi generaţi prin iradiere γ în sisteme biofarmaceutice şi de interes biomedical. structura fină lipseşte pentru că spinul este egal cu ½ . structura hiperfină permite. Factorul g nu permite identificarea radicalilor liberi. deoarece majoritatea radicalilor detectaţi sunt radicali centraţi pe carbon sau azot. II. foarte precise. structura hiperfină a spectrelor RES (când este bine rezolvată) furnizează informaţii mai importante despre radicali decât valoarea factorului g. de faptul dacă aceste nuclee sunt identice sau nu. identificarea radicalului liber studiat. Studiile efectuate au pus în evidenţă la spectrele de rezonanţă ale radicalilor liberi. Lărgimea liniei este de obicei mică. caracterizate printr-un număr cuantic I. Numărul liniilor de structură hiperfină.. totuşi unele măsurători RES. determinată de numărul de nuclee cuprinse în orbita electronului şi de gradul de localizare al electronului la fiecare dintre aceste nuclee. Prezenţa structurii hiperfine la radicalii liberi se datorează interacţiunii magnetice a electronului cu spin neîmperecheat cu momentul magnetic al nucleelor cuprinse în orbita acestui electron. au reuşit să pună în evidenţă dependenţa factorului g de structură într-o serie de substanţe organice [2]. Fiecare radical liber are o structură hiperfină caracteristică. Când orbita electronului cuprinde cu egală probabilitate un număr n de nuclee identice. Prin aceasta. iar poziţia spectrelor este aproximativ aceeaşi în câmpul magnetic [4]. şi de densitatea de electroni cu spini neîmperecheaţi la fiecare dintre aceste nuclee.0023). dar situate la intervale neegale. Valoarea factorului de despicare spectroscopică g apropiată de cea a electronului liber.(2In+1) linii de egală intensitate. 446 . aşezate la intervale egale şi cu intensităţi care sunt mai mari în centrul spectrului şi descresc spre margini. În cazul când electronii paramagnetici înconjoară mai multe nuclee cu spini nucleari diferiţi.

Spectrele RES se înregistrează la temperatura camerei cu ajutorul spectrometrului “ADANI Portable EPR Spectrometer PS8400”. Interacţiunea hiperfină izotropă este partea principală a interacţiunii hiperfine în radicali liberi. Spectrometrul portabil RES ADANI PS8400 În cazul tuturor experimentelor. spectrometrul RES se compune dintr-un electromagnet capabil să creeze un câmp magnetic static B. măsurătorile se efectuează folosind capilare speciale de sticlă. deoarece în multe cazuri interacţiunea hiperfină anizotropă nu se rezolvă şi are ca efect doar o lărgire a liniilor de rezonanţă sau o anizotropie a formei şi lărgimii liniei. Interacţiunea hiperfină anizotropă este interacţiunea de tip dipol magnetic între electronul cu spin neîmperecheat şi nucleul cu moment magnetic diferit de zero. De asemenea lărgimea mică a liniilor facilitează studiul structurii hiperfine. Astfel. III. are loc între nucleul cu moment magnetic nenul şi electronii cu spini neîmperecheaţi. Principiul de funcţionare al unui spectrometru RES Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static al polarizării induse de o probă electromagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale particulelor paramagnetice. o cavitate de microunde şi un sistem computerizat pentru înregistrarea şi observarea fenomenului de rezonanţă. Structura hiperfină a spectrelor apare în special în cazurile când electronii cu spin neîmperecheat sunt electroni s sau σ.1. Caracterizarea instalaţiei experimentale RES 3. un detector. a căror densitate la locul nucleului este diferită de zero.Există două tipuri de interacţiuni hiperfine: interacţiunea hiperfină anizotropă şi interacţiunea hiperfină izotropă. un generator de microunde.2. cu lungimea de 20 cm şi diametrul interior de 1mm. 3. în care se introduce proba. Interacţiunea hiperfină izotropă sau interacţiunea hiperfină de contact (interacţiunea de contact Fermi). care operează în banda X (9.6 GHz) şi 447 . Lărgimea liniei fiind mică permite determinări foarte precise de concentraţie a radicalilor liberi şi separarea efectelor diferiţilor radicali prezenţi în acelaşi timp în proba studiată. Structura fină lipseşte în cazul radicalilor liberi cu un singur electron neîmperecheat. Toate aceste elemente se găsesc cuplate prin intermediul probei de studiat care se află sub acţiunea câmpului magnetic static şi al câmpului de microunde. în general despicarea hiperfină fiind mai mare decât lărgimea componentelor hiperfine.1 GHz ÷ 9. 3.

Schema bloc a spectrometrului portabil “ADANI PS8400” este redată în (Fig. Factorul de calitate este dat de relaţia Q = ν res . Factorul de calitate Q indică cât de eficient stochează cavitatea energia de microundă. iar Δν lărgimea la semiînălţime a rezonanţei. (630 mmHg . O baleiere a câmpului este divizată în 4096 de paşi discreţi. unde νres este frecvenţa Δν de rezonanţă. Modulaţia se realizează cu un semnal de frecvenţă ν = 100 kHz. Valorile de “offset” ale câmpului magnetic şi timpul de baleiere sunt controlate de către sistemul de achiziţionare computerizat. Spectrometrul poate opera în următoarele condiţii : temperatura mediului cuprinsă între (+18°C) şi (+28°C) . “ADANI PS8400” Figura. computerizat.800mmHg) (Fig. 448 .care este echipat cu un sistem de achiziţie al datelor. Sensibilitatea spectrometrului RES tip “ADANI PS8400” este 5×106 spin /Gauss. Puntea de microunde este o cutie de metal care ajută la amplificarea semnalelor slabe provenite de la probe. iar rezoluţia este de 0. Canalul de semnal cuprinde partea electronică necesară detectării senzitive în fază. Sursa de microunde este reprezentată de un oscilator “GUNN”. sensibilitatea spectrometrelor creşte. umiditatea relativă între 20% şi 80%. Parametrii spectrometrului utilizaţi la achiziţionarea spectrelor RES sunt diferiţi. în funcţie de probele care urmează a fi studiate. 3 ADANI Portable EPR Spectrometer PS8400 Cavitatea de microunde este de formă rectangulară. lucrează în modul TE102 şi are un factor de calitate Q = 5000.07 Gauss /cm. 4).3). Sursa de radiaţie electromagnetică şi detectorul de află într-o cavitate numită “punte de microunde”. şi presiunea atmosferică (840 GPa – 1066 GPa). Cu creşterea factorului de calitate Q.

o tensiune de referinţă corespunzătoare valorii de “offset” a câmpului magnetic este trimisă către acea parte a controlerului care reglează bobinele de baleiere.3. 3. Rata de baleiere este controlată prin varierea timpului de aşteptare între paşii individuali. Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 a) spectrele RES ale unor probe de hidroxiapatită cu fier 449 . Toate aceste componente lucrează împreună pentru achiziţionarea unui spectru de rezonanţă electronică de spin (RES).Figura.4 Schema bloc a spectrometrului “Portable ADANI PS8400” La fiecare pas.

0 30 20 10 Camp magnetic (G) 1000 2000 3000 4000 5000 Camp magnetic (G) c) spectrele RES ale unor medicamente: spectrul experimental spectrul experimental spectrul simulat spectrul simulat 3250 3300 3350 B(G) 3400 3450 3250 3300 3350 B(G) 3400 3450 d) spectrele RES ale unor radicali liberi [6]: T im p (zile) 7 E (92 z) 5 1 E (ini) 0 3320 3340 3360 B (G ) 3380 3400 3250 3300 3350 B (G) 3400 3450 450 .) Intensitate (u.a.3 x (mol %) 70 60 Intensitate (u.b) spectrele RES ale unor probe vitroase şi vitroceramice care conţin fier [5]: g = 4.) 50 40 30 20 10 1000 2000 3000 4000 5000 50 40 g = 2.3 x (mol %) 70 60 g = 4.a.

S. Simon. Cozar. J.4. (2001) A-S. M.Ursu. Academiei R. 2. 12: 1356 -1359. Rezonanţa electronică de spin. submis la Radiation Physics and Chemistry. I. 3. 4. Rezonanţa electronică de spin. 6. Cluj-Napoca. Study of radicalizing mechanisms of irradiated drugs (Radiosterilization of pharmaceuticals: radicals). Presa Universitară Clujeană. Dina Petrişor. S. V. Chimie Nouvelle. David. G. Crucq. Spectroscopic study on iron doped silica-bismuthate glasses and glass ceramics. (2006) 2947. O. 2007 451 . Chiş. Editura Didactică şi Pedagogică. (1965) Al. Solids. 5. 352. Ed. C. Rezonanţa magnetică. Gamma-irradiated ExtraVit M nutritive supplement studied by EPR spectroscopy . Todea. Bucureşti. Crăciun. Simon. Non-Cryst. Bibliografie 1. (1994) S.România. Nicula. 28-29. 61-64 (1980) L. Damian.

... monocristalelor.... folosită pentru caracterizarea ordinii locale şi a interacţiunilor magnetice în materiale organice si anorganice..... Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1........S.. Spectrele RES înregistrate de asemenea în cazul: sistemelor necristaline........................ Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) ......... mineralogiei si geologiei................... Bibliografie: .... chimiei....................... Centrii paramagnetici...... Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor 452 . fizicii....454 4...........................................................Spectroscopia de rezonanţă electronică de spin – partea a II...................................... dr............ Introducere ..... soluţiilor congelate sau în cazul soluţiilor lichide aduc contribuţii importante cercetărilor din domeniul materialelor.. Exemple de aplicaţii ale rezonanţei electronice de spin ......................465 1....................... non-distructive si non-invazive.. Introducere Spectroscopia de rezonanţă electronică de spin (RES) este una dintre cele mai eficiente metode..... care pot fi investigaţi prin RPE sunt ionii metalelor de tranziţie şi elemente ale pământurilor rare sau centrii asociaţi cu sarcinile electrice sau cu defectele neutre... biologiei....a C...............................452 2............... pulberilor policristaline......................453 3...

În domeniul fizicii • concentraţii de spin • ioni paramagnetici ai metalelor de tranziţie. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi. aplicaţiile industriale etc. deformări locale • electroni de conducţie în conductori şi semiconductori • interacţii magnetice şi cristaline • procese de recombinare la temperaturi scăzute b. centrii de culoare. biologie. medicinii şi mediului • markeri de spin • antioxidanţi şi agenţi de contrast • oximetrie • radicali liberi în ţesuturi. Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. nanoştiinţelor. pământurilor rare şi actinidelor • defecte paramagnetice. Cu ajutorul rezonanţei paramagnetice electronice (RES) pot fi studiate: a. radicali ai oxigenului. În domeniul chimiei • radicali liberi • cataliza • procese de oxidare si reducere • stări de triplet a moleculelor • compuşi organo-metalici şi zeoliţi • cinetica de reacţie şi reacţii de polimerizare c. RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. NO în sisteme biologice • fotosinteza 453 . studiul materialelor. 2.2]. În domeniul biologiei. chimie. nanomateriale.energetice ale centrilor paramagnetici. Metoda constă în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. Astfel. mediu. Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) Spectroscopia RES are aplicaţii în cadrul cercetărilor din diferite domenii cum sunt: fizică. medicină. geologie.

În domeniul caracterizării materialelor • proprietăţi ale polimerilor • defecte în fibre optice • materiale laser • conductori organici şi anorganici cu dimensionalitate redusă • influenţa impurităţilor şi defectelor în semiconductori • proprietăţi ale noilor materiale magnetice • proprietăţi ale materialelor utilizate în spintronică.6 GHz) şi este 454 . Exemple de aplicaţii ale rezonanţei electronice de spin Spectrele RES au fost înregistrate pe pulberi la temperatura camerei cu ajutorul unui spectrometru portabil RES “ADANI Portable EPR Spectrometer PS8400”. metabolism şi toxicitate • factori poluanţi d.strat superficial ale nanoparticulelor magnetice • proprietăţi ale nanoparticulelor şi nanofirelor magnetice • interacţii magnetice dipolare şi de schimb: efectele dimensiunii • nanometrologie: dimensiune medie a nanoparticulelor metalice şi magnetice • caracterizare nanotuburi de carbon. geologie • detecţia radicalilor în polimeri iradiaţi şi procese de coroziune • prospeţimea uleiurilor vegetale • controlul calităţii sticlelor optice speciale • procese oxidative în vopsele utilizate în industria auto e. fullerene şi compuşi derivaţi • proprietăţi ale conducţiei electrice şi transportului polaronic 3. nanocompozite • efecte miez interior . În domeniul aplicaţiilor industriale • controlul calităţii produselor alimentare iradiate • dozimetrie pentru procesele de iradiere • vârste şi datări de materiale cu aplicaţii în arheologie. În domeniul nanomaterialelor şi nanoştiinţelor • efecte ale reducerii dimensionalităţii • dinamica de spin în nanomateriale.1 GHz – 9. care operează în banda X (9.• detecţie de droguri. optoelectronică • manganiţi cu magnetorezistenţa colosală • supraconductori oxidici cu temperatură de tranziţie ridicată • semiconductori f.

pentru probele vitroase din sistemul 0. 12].0. Liniile de la gef=2.echipat cu un sistem de achiziţie a datelor.a.3 şi o linie foarte slab rezolvată la gef ≅ 2. Exemplul1. Îngustarea liniei de 455 .0 sunt atribuite ionilor paramagnetici izolaţi în poziţii caracterizate de câmpuri cristaline relativ slabe. acesta fiind în stare S şi frecvent utilizat în investigaţiile RES ale sticlelor.) 50 40 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura. computerizat. Observăm că linia de rezonanţă de la gef=4. în timp ce liniile cu gef>2. Dependenţa lărgimii acestor linii de la gef ≅ 4. g = 4. Spectrul conţine o linie principală de rezonanţă relativ largă cu gef ≅ 4. 1) arătând că vecinătatea ionilor Fe3+ nu depinde foarte mult de compoziţia matricilor vitroase. Fe3+ Spectrele RES înregistrate. Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static a polarizării induse de o probă paramagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale centrilor paramagnetici. 2).99[xSiO2·(100-x)Bi2O3].0 sunt atribuite ionilor paramagnetici aflaţi în poziţii caracterizate de câmp cristalin relativ puternic unde termenii de câmp cristalin sunt comparabili sau mai mari decât termenii Zeeman [9.01Fe2O3·0. 2. sunt reprezentate în figura 1.3 se îngustează pe măsură ce înlocuim Bi2O3 cu SiO2 (Fig. Sticlele şi vitroceramicile studiate conţin ionul paramagnetic Fe3+ (3d5 6S5/2). Linia de la gef ≅ 4. pentru care termenul Zeeman este dominant .3 de compoziţia probelor este ilustrată în Fig. 1 Spectrele RES înregistrate pentru probele netratate termic Caracteristicile spectrului RES pentru diferite rapoarte Bi2O3/SiO2 sunt complet similare pentru toate probele netratate termic (Fig.3 este specifică tuturor sticlelor ce conţin ioni Fe3+ ca impuritate sau ca dopant în concentraţii mici [5-8].3 x (mol %) 70 60 Intensitate (u.

atât cea de la gef ≅ 2. scade cu x aşa cum se observă în Fig.0 este slab evidenţiat iar linia dominantă fiind cea de la gef ≅ 4.rezonanţa pentru x>20 indică o vecinătate a ionilor Fe3+ mai uniformă în sticlele bogate în siliciu.4. Acest rezultat indică faptul că ordinea la scurtă distantă.0 cât şi cea de la gef ≅ 4. 230 220 210 200 ΔB (G) 190 180 170 160 10 20 30 40 50 60 70 x (mol%) Figura. înregistrată pentru probele cu un conţinut scăzut de SiO2. În probele tratate termic. Semnalul de la gef = 4. 2 Dependenţa lărgimii liniilor de rezonanţă de la gef ≅ 4. 456 .5O9.0.6Si0. Pentru un conţinut scăzut de SiO2 (x ≤ 30) linia dominantă se găseşte la gef ≅ 2. este caracterizată de un câmp cristalin relativ puternic şi poate fi asociat cu poziţiile fierului în reţeaua necristalină bogată în siliciu.3. 3) arată schimbările apărute în ordinea locală în jurul ionilor de fier. Lărgimea liniei de la gef ≅ 2. semnalul de la gef ≅ 2.3 este înregistrat pentru toate probele şi lărgimea liniei este de aproximativ 200 G pentru toate compoziţiile. Forma liniilor RES descrie şi dezordinea din jurul ionilor de fier rezonanţi şi caracteristicile structurale ale matricilor vitroase în care sunt încorporaţi aceşti ioni de fier. din jurul ionilor Fe3+ responsabili pentru acest semnal. 3.3.3. 4. Caracteristicile spectrelor RES pentru ionii Fe3+ în probele tratate termic sunt evident modificate aşa cum se poate vedea în Fig. spectrele RES ale Fe3+ (Fig.3 de compoziţia probelor Pentru probele cu un conţinut mai ridicat de SiO2 (40 ≤ x ≤ 50) şi în cazul cărora a fost identificată prin difracţia de raze X faza cristalină Bi5. În cazul probelor cu conţinut ridicat de siliciu (60 ≤ x ≤ 70) sunt prezente ambele linii.0 în timp ce linia mai puţin intensă se situează la gef ≅ 4.

până la x = 30 şi este atribuit ionilor Fe3+ situaţi în poziţii cu câmp cristalin slab cu simetrie octaedrală.) 50 40 g = 2.0 de compoziţia probelor 457 . 160 150 140 ΔB (G) 130 120 110 100 90 10 20 30 x (mol %) Figura.g = 4. Remarcăm de asemenea că linia se îngustează cu creşterea conţinutului de SiO2 (Fig.0 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura. 3 Spectrele RES pentru probele vitroceramice Linia cu gef = 2.a.3 x (mol %) 70 60 Intensitate (u.0 este linie rezolvată numai pentru conţinut scăzut de SiO2 . 4) ceea ce denotă tendinţa de ordonare structurală în jurul ionilor Fe3+ rezonanţi dispuşi în aceste poziţii. Luând în considerare razele ionice pentru ionii Bi3+ şi Fe3+ şi starea lor identică de valentă. este de aşteptat ca ionii Fe3+ să ocupe poziţiile Bi3+ din faza cristalină Bi12SiO20. 4 Dependenţa lărgimii liniei de la g ≅ 2.

6).9 2. 4.6Si0. În probele în care se dezvoltă faza cristalină de tipul Bi2SiO5 ( x = 60.4 (Fig. 11].14 x = 0.3 x = 0.5 4. vacante de oxigen Spectrele RES înregistrate în cazul microsferelor netratate termic sunt dominate de o linie largă centrată la g ≈ 2. cât şi o linie largă la g ≅ 2.0 5.8.0 x=0 x=0 x = 0. Exemplul 2: Gd3+ a) Analizele de rezonanţă paramagnetică electronică au pus în evidenţă compoziţii diferite ale ionilor de gadoliniu în probe cu conţinut mai mare de bismut (Fig.0 care reflectă o vecinătate relaxată în matricea amorfă. Ti3+. Acestea indică faptul că există poziţii în matricea amorfă unde ionii de Gd3+ se află în 458 . 14]. dar se observă şi linii mici la ≈ 5.9 2.5 1000 2000 3000 4000 5000 B(G) 1000 2000 3000 4000 5000 B(G) Figura 5 Spectrele RES ale probelor preparate prin metoda sol-gel Figura 6 Spectrele RES ale probelor tratate termic 30 minute la 400oC b) Gd3+.9 şi2. 2.5O9. dacă în probele cu x = 0 şi x = 0.14 spectrele RES ale ionilor de Gd3+ sunt similare şi reflectă o vecinătate relaxată a acestora în matricea amorfă.33 x = 0. odată cu creşterea conţinutului de bismut.0 specifică ionilor din poziţii în câmp cristalin slab dar în vecinătate distorsionată sau între care se manifestă interacţiuni dipolare [15].33 x = 0. vecinătatea lor fiind puternic distorsionată [3. gadoliniul ocupă poziţii in regiuni cvasicristaline în acord cu modificarea difractogramelor acestor probe. Probabil că majoritatea ionilor Fe3+ să fie dispuşi în faza rămasă necristalină bogată în Si [13.3 specifică ionilor de Fe3+ în poziţii cu câmp cristalin intens din matrici necristaline. 70) spectrele RES prezintă atât linia cu g ≅ 4.5O9.4). 5). După tratamentul termic la 400oC ionii de gadoliniu ocupă poziţii în interiorul fazei cristaline de tip Bi5.14 x = 0. 10. Astfel.8 2. pe lângă asemenea poziţii.6Si 0.Linia de rezonanţă slab rezolvată atribuită ionilor de fier dispuşi în câmp cristalin slab pentru probele vitroceramice cu 40 ≤ x ≤ 50 mol % arată că doar o mică parte dintre ionii de Fe3+ sunt situaţi în poziţiile Bi3+ ale fazei δ (Bi5.8 5.

Linia largă de la g ≈ 2. Modificările structurale induse în probele titano-silicatice amorfe prin tratamentele termice sunt bine puse în evidenţă în spectrele RES ale probelor parţial şi total cristaline (Fig.câmp intermediar. 459 . iar celălalt atom de Ti se relaxează într-o configuraţie planar trigonală. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g. Prin aplicarea tratamentului termic. suprapus peste componenta spectrală.0 din spectrele probelor tratate termic la 350. la g ∼ 2. se modifică în intervalul de temperatură investigat. 700 şi 900°C ne indică că ionii de Gd3+ sunt preponderent dispuşi în faza reziduală necristalină. Se observă şi spectrul în ‘‘U’’ cu linii la g ≈ 5.0.3 este atribuită fierului (III) şi apare datorită tuburilor de sticlă în care se pune proba pentru a efectua măsurătoarea RES. Lărgimea liniei spectrelor RES. unde se formează ionii de Ti3+. Spectrele RES prezintă o uşoara asimetrie a liniei de rezonanţă (se abat de la o funcţie pur Lorentziană) care poate fi explicată prin prezenţa unei anizotropii uşoare şi/sau a unui fundal de rezonanţă relativ larg de o foarte joasă amplitudine. Spectrele RES pentru microsferele tratate termic în intervalul 350 – 1400°C sunt caracterizate printr-un semnal îngust. g ≈ 2. În conformitate cu Kolodiazhnyi şi Petric am atribuit aceste linii vacanţelor de oxigen la titan (VTi) cu spin electronic neîmperecheat. g ≈ 2. în câmp cristalin slab.0 din spectrele RES. se modifică în intervalul de temperatură investigat [16]. Unul dintre aceşti atomi de Ti captează un electron şi rămâne în configuraţia tetraedrală. care creşte în intensitate odată cu creşterea temperaturii de tratament.8. Lărgimea liniei de la g ≈ 2. oxigenul difuzează din interior spre suprafaţă şi se formează în regiunea de sub-suprafaţă vacante de oxigen. legaţi anterior de atomul de oxigen. Linia de la g ≈ 4. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g.9. 7-14). în timp ce titaniul difuzează de la suprafaţă spre interior. rezultat în urma relaxării structurale dar încă cu un grad mare de dezordine în jurul lor. specific matricelor policristaline dezordonate care conţin ioni de Gd3+ destul de omogen distribuiţi. În timp ce atomul de O difuzează el generează doi atomi de titan cu configuraţie incomplete.

2. 30 minute. Figura 10 Spectrele RES ale microsferelor tratate termic la 900°C. 30 minute.004 1. 30 minute.3 Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 7 Spectrele RES ale microsferelor preparate prin metoda sol gel. Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 9 Spectrele RES ale microsferelor tratate termic la 700°C. (a) (b) 2.9 4.98 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 11 Spectrele RES ale microsferelor tratate termic la 1100°C.98 Ti:Si 1:2 Ti:Si 1:2 2. Figura 8 Spectrele RES ale microsferelor tratate termic la 350°C. utilizând un baleiaj de (a) 4000 G. 30 minute. 460 .8 2.004 1.0 5. (b) 600 G.

utilizand un baleaj de (a) 4000 G si respectiv (b) 600 G. neexistând vacanţe de O din cauza atmosferei reducătoare. (b) 2. 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 14 Spectrele RES ale sistemului Ti:Si 1:1 preparate prin metoda sol gel şi supuse diferitelor tratamente termice. Spectrele RES ale probelor tratate termic la 1400°C sunt caracterizate doar prin semnalul din jurul valorii g∼1. utilizand un balaj de (a) 4000 G. 30 minutes. (a) o 1400 C o 1100 C o 900 C o 700 C o 350 C (b) 2.004 1. Centrii de Ti3+ sunt de obicei detectaţi la temperaturi sub 120K [17.004 1. dar au mai fost detectaţi în literatura de specialitate [19] la temperatura camerei. (b) 600 G. atribuit ionilor de Ti3+. (a) o 1400 C 1100oC o 900 C 700oC o 350 C as-prep.(a) (b) Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 12 Spectrele RES ale microsferelor tratate termic la 1400°C. 461 .98 1400oC 1100oC 900oC 700oC 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 13 Spectrele RES ale sistemului Ti:Si 1:2 preparate prin metoda sol gel si supuse diferitelor tratamente termice.98.18].98 o 1400 C o 1100 C o 900 C o 700 C as-prep. utilizând un baleiaj de (a) 4000 G şi respectiv (b) 600 G.

Figura 16 Spectrele RES ale microsferelor tatate termic la 350°C. [26] în probe de TiO2 dopat cu N.0055 în spectrele RES în probe de titan dopat cu C. În cazul microsferelor preparate prin metoda sol gel. cât şi de către Feng şi col. 462 .004 detectat pe plasma de TiO2 tratată termic provine de la un electron captat la o vacanţă de oxigen. În cazul microsferelor tratate termic la 350. 700. Ga2O3 Ga2O3 20% 10% 5% 1% 0% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 1000 2000 3000 4000 5000 B(G) B(G) Figura 15 Spectrele RES ale microsferelor preparate prin metoda sol gel. Pentru microsferele tratate termic la 1100°C si 1400°C se observă efectul galiului în sensul prevenţiei formării vacanţelor de oxigen.005 unui electron captat la o vacanţă de oxigen.003 – 2. Semnale similare au fost observate şi în TiO2 – anatase dopate cu C [22-24]. deoarece sistemul Ti:Si 1:1 nu prezintă modificări esenţiale. În Figurile 13 si 14 sunt evidenţiate evoluţiile vacanţelor de oxigen (pentru g∼2. cât si în TiO2 dopat cu B [25]. în bună concordanţă cu literatura de specialitate şi rezultatele obţinute prin spectroscopie Raman unde a fost obţinut un semnal de fluorescenţă în cazul probelor tratate termic până la temperatura de 900°C. semnalul RES provine numai de la ionii de Gd3+. Spectrele RES evidenţiază integrarea ionilor de Ti3+ în această fază. ambele sisteme având o dependenţă oarecum similară în raport cu tratamentul termic. peak-ul de la g∼2. în urma tratamentelor termice.004) şi Ti3+ (g∼1. Nakamura şi col.003 pe TiO2 redus în vid şi l-a atribuit unui defect. după ce au fost folosite în teste fotocatalitice.98).004 poate fi atribuit vacanţelor de oxigen. [22] la g∼2.13. În cazul microsferelor cu conţinut de galiu se dezvoltă după tratamentul termic la 1400°C o nouă faza. Ga2TiO5. iar Serpone [27] a atribuit semnalele din intervalul g = 2.Din spectrele RES prezentate în Fig. 900 si 1100°C. în concordanţă cu difracţiile de raze X. Au mai fost raportate astfel de semnale RES de către Li şi col. Serwicka [21] a observat un astfel de semnal la g∼2. Acest studiu este focusat în special pe efectul adiţiei oxidului de galiu în sisteme. deoarece evoluţia defectelor: vacanţe de oxigen (g∼2. Vor fi prezentate doar spectrele RES ale sistemului Ti:Si 1:2.004) si Ti3+ (pentru g∼1.98) este similară cu cea discutată anterior. [20] au raportat faptul că semnalul RES la g∼2. 14 se observă faptul că tratamentul termic joacă un rol important în formarea de centrii paramagnetici adiţionali. cel mai probabil un electron captat la o vacanţă de oxigen.

Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 5% 10% 5% 1% 0% 1% 0% 3000 3200 3400 3600 3800 1000 2000 3000 4000 5000 B(G) B(G) Figura 17 Spectrele RES ale microsferelor tatate termic la 700°C. (b) 600 G. utilizand un baleaj de (a) 4000 G. utilizand un baleaj de (a) 4000 G. (b) 600 G. 463 . (b) 600 G. Ga2O3 (a) Ga2O3 (b) 20% 10% 5% 1% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 0% 3000 3200 3400 3600 3800 B(G) B(G) Figura 19 Spectrele RES ale microsferelor tatate termic la 1100°C. utilizand un baleaj de (a) 4000 G. Ga2O3 (a) 20% (b) 20% 10% 10% 5% 5% 1% 0% 1000 2000 3000 4000 5000 1% 0% Ga2O3 3000 3200 3400 3600 3800 B(G) B(G) Figura 18 Spectrele RES ale microsferelor tatate termic la 900°C.

5% mol Gd2O3). Această lărgire a liniei de rezonanţă este în mod normal atribuită interacţiunii dipol-dipol dintre ionii de Gd3+. (b) 600 G. în funcţie de compoziţia probelor. distanţa medie dintre ionii de gadoliniu este mai mică decât în cazul distribuţiei uniforme în întregul volum şi se confruntă cu interacţiuni magnetice puternice. dar şi dezordinii locale [29-32]. Prezenţa în probe a ionilor de Gd3+ ne dă informaţii cu privire la modificările structurale care au loc în vecinătatea lor. utilizand un baleaj de (a) 4000 G. fiind mult mai grupată pentru probele cu raportul Si/Ge 1:2 şi 1:3.0 fapt ce denotă că vecinătatea ionilor de Gd3+ se confruntă cu câmpuri cristaline slabe. Spectrele constau din linii relativ largi cu g = 2. 464 . Diferenţele observate în forma liniilor. în funcţie de compoziţia matricii şi este utilă în caracterizarea locurilor în care s-ar putea distribuii alte pământuri rare neparamagnetice. arată că această distribuţie pe suprafaţa nanoparticulelor nu este uniformă. considerând că gadoliniu ar fi distribuit omogen în întregul volum de probă. c) Gd3+ Prin rezonanţa paramagnetică electronică a fost investigată ordinea structurală din jurul ionilor de Gd3+ si interacţiunea magnetică dintre ei. ceea ce înseamnă că aceştia nu sunt incluşi în reţeaua silicatică sau germanată unde au avut o vecinătate mult mai distorsionată [28]. În acest caz. introduse în aceeaşi matrice. Spectrele RES ale probelor investigate sunt prezentate în figura 21. unde efectul interacţiunii de schimb este clar evidenţiat [33]. Liniile largi preconizate pentru o concentraţie atât de scăzută (0. sprijină ipoteza distribuţiei sale pe suprafaţa nanoparticulelor.Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 10% 5% 5% 1% 1% 0% 0% 1000 2000 3000 4000 5000 3000 3200 3400 3600 3800 B(G) B(G) Figura 20 Spectrele RES ale microsferelor tatate termic la 1400°C.

Soc. Todea. 7. 13. Japan. 9. M. DiCicco. Journal of Materials Science Letters. Forbess. 20. Kubokawa. W. Karkas. Adv. Pop. Sugihara. Rev. Negishi. M. C. G. K. Simon. Sci. 404 (2005) 25–29. N. 3 (2000) 1503 I. Ghosh. Nanba. Witkowska. Bissey. Seraji. Miura. Hwang. M. V.Konstantiniva. No. 6. S. K. (1965) Al. Simon. Proceedings of XX Int. Sept. 10-13 September 2001 T. Catal. N. J. 10 (2001) 5296 Pan. 97. Non-Cryst. F. Kokorin. Mol. Appl. 465 . Vol. Solids. 67 (1994) 156 S. J. C. M. E. Tokyo. J. Non-Cryst. Zinsou. Rezonanţa magnetică. A. Rev. Nicula. Wu. S. Rybicki. E. A. 18. Ioncu. Stößer. T. 161 (2000) 205–212. 10. Berger. O. V. Y. Castner. M.J. P-10-011 R. Zolnierkiewicz. Simon. S. Y. S.. 12. K.005Gd2O3·0. Tabuchi. Y. 621-624. Chem. Lett. Phys. I. Volume 20.J. Chem. Non-Cryst. D. Sands. 352 (2006) 2947. Simon. S.S. Yahiaoui. S. Todea. Chou. 9 (2007). Phys. Glastechn. Simon. Typek.Ursu. Ihara. G. E. J. Notz. N. H. 4. E. 3336 – 3340. J. I. Phys. Sakthivel. Bucureşti. K.K. Schlichter. P. 23 (2010) 189-195. J. 90. 112. V. Kliava. Chem. Thurnauer. Solids 180 (1995) 151 T. Cao. Congress.. 6-thInternational Conference on Intermolecular Interactions în Matter.P. 3. Anagnostakis. Rezonanţa electronică de spin. Number 10. M. S. Anpo. I. Holton. 14. 21. Japan 59 (1986) 259. (1993). Trifunac. Academiei R. 16. 8. S. J. Figiel. Solids. J. Biedunkiewicz. 2004. V. Bibliografie: 1. A.C. 99 (1955) 1222 R. Mater. 13 (1985) 287–293. J.S. 32 (1960) 668d Y. Nguyen.. Cromack. T. Phys. Beziade. 947-949(3). Optoelectronics and Advanced Materials. Optoelectronics and Advanced Materials. P. A. Newell. A. 22. J. C. D. Guskos. Coldea. Glass Sci. Ed.995[(1−x)SiO2·xGeO2] 4. Phys. 2001. Spectrele RES ale probelor aparţinând sistemului 0. Colloids Surf. Lee. Glass. 1. Li.H.. A . Ber. 12 (2008).România. R. P. Chem. 2. S. 61-64 (1980) A. Bull. C. Lips. Gdańsk – Poland. 17.M. 5. 21. S. J. Micic. Ardelean. 27Oct.J. Zhang.Figura. Limmer. H. Editura Didactică şi Pedagogică. Simon. Yabuta. Kisch. M. Kim. A. M. Nakamura. J. Kodama. 331 (2003) 1 R.-C. M. Y. J. Takeuchi. Serwicka.P. M. Todea. Ciorcas. Chimia 12 (2007) 61. J. I. A. A: Chem. Chem. Simon. Phys. 7277.S.H. 19. Guskos. R. 15. 11. Peteanu. Kutsuna. Technol. 10. A.

A. Kliava. Simon. E. Phys. Z. Petrakovskaja. 27. S. 33. Filip. M. Wu. R. Turcu. Bruckental. 26. Malakhovskii. Montini. Zarubina. M. 32. K. D. 116 (2000) 83–86. R.A. Materials Science and Engineering B 172 (2010) 68–71 466 . V. G. Matter 15 (2003) 6671–6681. Graziani. G. Jin. T.23. Wang. Fittipaldi. Y. Zhang. Petrakovskaja. Potseluyko. Gasparotto. R. Simon. Raftery. 25. Zhang. 272–276 (2004) 1647–1649. C. I. I. A. Y. 30. J. E. Y. P. Potseluyko. A. Potseluyko. 8 (2006) 99–101. Mater. Mater.M. L. Gombac. Tondello. D. J. Y. Z. Phys. P. Chem. S. Chim. Ardelean. V. Solid State Nucl. T.V. S. Adv. 28. 35 (2009) 74–81. Zhang. B 71 (2005) 104406. Edelman. N. J. Fornasiero. 29. Sun. Simon. I.V. Bruckental. I. T. E. R. Optoelectr. Y. Gil.: Condens. New J. Feng. Yeshurun. G. S. Gombac. A. T. A. J. Kuznetsov. Solid State Commun. Fornasiero. J. Chem. Edelman. M. Berger. D. 32 (2008) 1038–1046.S. Magn. Y. Petrovskii. J. A. Z. Zarubina. Yeshurun. Bruckental. Serpone. Phys. N. T. Barreca. R. J. Zarubina. V. 24. S. Petrakovskaja. A. Rev. Vicario. Malakhovskii. S. Mag. Rogatis. I. J. Phys. Berger. Melnikova. Diana-Louisa Trandafir. Garcia. 31. Reson.V. E. R. Inorg. A.F. Cosma. Acta 361 (2008) 3980–3987. Bratu. Yeshurun. Kliava. I. Kliava. 339 (2007) 111–123. E. Montini. Edelman. Malakhovskii. Magn. Chem. C 113 (2009) 15110–15123. I. Balducci. Graziani. I.

....... Una dintre aceste metode este voltametria..................XIII..... în care curnetul este măsurat ca o funcţie de potenţialul aplicat şi este utilizată la studiul cineticii reacţiei de transfer de electroni şi proprietăţile de transport ale reacţiilor... * voltametrie ciclică (CV)......... Voltametria ciclică cu un cuplu redox activ... Bibliografie ... de obicei............... 488 1........... METODE ELECTROCHIMICE Elaborarea.......... Introducere Metodele electrochimice moderne oferă chimistului electroanalist o varietate de tehnici pentru a rezolva problemele analitice.. Voltametria ciclică fără cuplu redox activ.... 471 4............................. există două tipuri de metode voltametrice: * voltametrie cu baleiaj liniar de potenţial (LSV)....................................................................................... 2.......... ing.................. În principal.................................................................. Graziella Liana Turdean Cuprins 1.............................. Voltametrie cu baleiaj liniar de potenţial (LSV) ............................ Introducere ..................... 467 3......................Voltametrie cu baleiaj liniar de potenţial (LSV) În voltametria cu baleiaj liniar de potenţial (LSV)..... aşa cum se arată in figura 1........... 474 5............................... dr.................................. testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice Conf.......... 467 .. 474 6...................................... de la o limită inferioară la o limită superioară a potenţialului... Voltametria ciclică (sau CV) ...... potenţialul este baleiat într-un domeniu fix de potenţial cu o viteză constantă.................... 467 2...............

ecuaţia lui Nernst este cea care prezice relaţia dintre concentraţie şi potenţial (diferenţă de potenţial). Dacă avem în vedere reducerea electrochimica a Fe3+ la Fe2+. poate atinge şi un maxim înainte să scadă. * viteza de baleiaj a potenţialului. trebuie să se ia în considerare influenţa potenţialului asupra echilibrului stabilit la suprafaţa electrodului. Pentru sistemul Fe3+/Fe2+. Prin urmare. Viteza de scanare (v) se calculează din panta dreptei din figura 1. În echilibrul electrochimic. unda aparută se datorează reacţiei 1. unde iniţial nu este curent. începe să apară un curent care. Forma semnalului de excitare în voltametria cu baleiaj liniar de potenţial. Caracteristicile voltamogramei înregistrate (figura 2) depind de o serie de factori. (1) Presupunem că scanarea începe din partea stângă a graficului curent/potenţial. În mod clar prin schimbarea timpului necesar pentru a baleia domeniul de potenţial se modifică viteza de baleiaj (scanare). viteza reacţiei de transfer de electroni este mai rapidă în comparaţie cu viteza de baleiaj a potenţialului. Voltamograma cu baleiaj liniar de potenţial. unde E este diferenţa de potenţial aplicat şi Eo este potenţial standard de electrod. * reactivitatea chimică a speciilor electroactive. Când potenţialul este baleiat spre dreapta (spre valori de reducere). conform ecuaţiei 2: 468 . Exemplu: Rezultatul măsurătorilor de LSV este rRESezentarea grafică a curentului obţinut versus potenţialul baleiat cu o viteză constantă. eventual. cum ar fi: * viteza reacţiei de transfer de electroni. Figura 2. la suprafaţa electrodului se stabileşte un echilibru identic cu cel prezis de termodinamică.Figura 1. Pentru a înţelege acest comportament.

scăderea curentului urmează acelaşi comportament ca şi cel estimat prin ecuaţia Cottrell. datorită dimensiunilor stratului de difuzie şi a 469 . Fiecare curbă are aceeaşi formă. maximul) apare deoarece la un moment dat stratul de difuzie a crescut suficient încât fluxul de reactant la electrod nu este suficient de rapid pentru a satisface cerinţele impuse de ecuaţia lui Nernst.(2) Deci. dar este evident că curentul creşte cu creşterea vitezei de baleiaj. Influenţa vitezei de baleiaj asupra voltamogramelor cu baleiaj liniar de potenţial. conform ecuaţiilor 3: (3) Aşa cum curentul creşte cu potentialul. În cazul în care se modifică viteza de baleiaj. când potenţialul este baleiat de la valoarea V1 la V2. apare un curent. De fapt. alura voltamogramei se modifică şi ea (Figura 3). ca urmare. Peak-ul (vârful. poziţia de echilibru se modifică de la nici o conversie (la V1) la conversia completă (la V2) a reactantului la suprafaţa electrodului. Figura 3. Când potenţialul este baleiat de la valoarea iniţiala V1. poziţia de echilibru se deplasează continuu în sensul conversiei reactantului. Forma exactă a voltamogramei poate fi înţeleasă prin luarea în considerare şi a efectelor potenţialului şi transportului în masă. În această situaţie curentul începe să scadă. echilibrul la suprafaţa electrodului începe să se modifice şi.

potenţialul aplicat nu va duce la generarea concentraţiilor la suprafaţa electrodului conform estimărilor din ecuaţia Nernst. stratul de difuzie va creşte mai mult în comparaţie cu cazul în care viteza de scanare este mare. Cum mărimea curentului este proporţională cu fluxul spre electrod. Figura 4. În mod clar. timpul necesar pentru a înregistra o voltamogramă) influenţează puternic comportamentele observate. valoarea curentului va fi mai mică la valori mici ale vitezei de baleiaj. Aceste procese rapide sunt adesea menţionate ca reacţii reversibile de transfer de electroni. fluxul de la suprafaţa electrodului este considerabil mai mic la viteze de baleiaj mici. În consecinţă. viteza de balaiaj a potenţialului (şi. Pentru aceste cazuri. cu cât viteza de baleiaj este mai mică. care au o cinetică rapidă de transfer de electroni. La o viteză de baleiaj mică. Conditii experimentale: viteza de baleiaj identica. În aceast caz.timpului necesar pentru a înregistra voltamograma. Prin urmare. voltamograma se va obţine mai încet. Acest lucru evidenţiază un punct important atunci când se examinează LSV (şi CV): deşi nu există o axă a timpului pe grafic. În consecinţă. Figura 4 arată o serie de voltamograme înregistrate la o singură viteză de baleiaj pentru diferite valori ale constantei vitezei reacţiei de reducere (kred). grosimea stratului de difuzie de la suprafaţa electrodului va fi diferită în funcţie de viteza de baleiaj folosită. Voltamograma cu baleiaj liniar de potential. faţă de cele de la viteze de baleiaj mari. pentru diferite constante ale vitezei reactiei de reducere. reacţiile sunt menţionate ca reacţii cvasi-reversibile sau ireversibile de transfer de electroni. prin urmare. se poate formula întrebarea referitoare la ce s-ar întâmpla în cazul în care procesele de transfer de electroni au fost "lente" (în raport cu viteza de baleiaj a potenţialului). deoarece 470 . O altă observaţie este poziţia curentului de peak: este clar că peak-ul apare la aceeaşi valoare de potenţial (figura 3) şi aceasta este o caracteristică a reacţiilor de electrod.

echilibrele nu sunt stabilite rapid (în comparaţie cu viteza de baleiaj). de viteza de baleiaj a potenţialului). de asemenea. dar apoi va scădea deoarece concentraţia analitului se va epuiza în vecinătatea suprafeţei electrodului. când potenţialul atinge V2 sensul de baleiaj este inversat. Această inversare se poate produce de mai multe ori în timpul unui singur experiment. panta dreptei fiind cunoscută ca viteza de baleiaj (v [V/s]). Dacă transferul de electroni la suprafaţă este rapid şi curentul este limitat de difuzia speciilor spre suprafaţa electrodului.cinetica de reacţie este "lentă" şi. pentru a studia proprietăţile electrochimice ale unui analit într-o soluţie. iar curentul este măsurat între electrodul de lucru şi electrodul auxiliar. deşi potenţialul este baleiat tot între două valori (V1 şi V2). Acesta are loc deoarece curentul apare mai încet decât în cazurile reversibile. Curentul va creşte pe măsură ce potenţialul atinge potenţialul de oxidare a analitului. În cazul în care cuplul redox este reversibil. poziţia curentului de peak/maxim se schimbă în funcţie de constanta vitezei de reducere (şi. în general. potenţialul electrodului de lucru este baleiat liniar în funcţie de timp. din astfel de experimente se obţin informaţii despre potenţialul redox şi despre vitezele reacţiilor electrochimice. Spre deosebire de voltametria cu baleiaj linear. În voltametrie ciclică. în cazul CV. se va ajunge la potenţialul la care se va reduce produsul format în prima reacţie de oxidare şi se va produce un curent de polaritate inversă faţă de scanarea directă. ca şi în cazul voltametriei liniare. Într-un experiment de voltametrie ciclică. forma generală a voltamogramei înregistrate este similară cu cea de mai sus. care se încheie atunci când se ajunge la un potenţial stabilit (V2). iar potenţialul este baleiat înapoi la V1. Potenţialul este măsurat între electrodul de referinţă şi electrodul de lucru. peak-ul de reducere va avea o formă similară cu peak-ul de oxidare. dar spre deosebire de reacţia reversibilă. De obicei. 3. După cum se observă în voltamograma din figura 6. atunci când potenţialul aplicat este invers. în scanarea în sens direct se obţine un curent de peak pentru orice specie care poate fi oxidată în domeniul de potenţial baleiat. astfel. În această situaţie. Voltametria ciclică este folosită. Ca urmare. Voltamograma ciclică obţinută este rRESezentarea grafică a curentul obţinut la electrodul de lucru (i) faţă de potenţialul aplicat (E). atunci curentul de peak 471 . potenţialul de electrod este baleiat liniar faţă de timp (figura 5).Voltametria ciclică (sau CV) Este metoda electrochimică potenţiodinamică foarte similară cu LSV.

În cazul reducerii. Curentul apare din nou datorită speciilor din soluţie care difuzează spre electrod şi are sens invers decât procesul din prima etapă. Voltamograma ciclică pentru un rectant participând la o reacţie monoelectronică de transfer de electroni. În soluţie. convertind produsul (Fe2+) înapoi la reactant (Fe3+). Curentul de la suprafaţă este generat prin transferul de electroni de la electrod la speciile redox. Reacţia de electrod şi capacitatea electrodului Figura 7 descrie procesul care are loc în reacţii de electrod simple. primeşte un electron şi difuzează de la suprafaţă. iar pentru descrierea sistemelor electrochimice se preferă acest model 472 . ci se comportă mai degrabă ca şi cum ar fi. O interfaţă electrod-soluţie. poziţia echilibrului se modifică în sens invers. în absenţa unui cuplu redox nu este un condensator cu plăci paralele pur. ionii se mişcă spre suprafaţa electrodului pentru a forma un strat dublu electric. înregistrată pentru o reacţie reversibilă monoelectronică. curentul este transportat prin migraţia ionilor.(vârf) va fi proporţional cu rădăcina pătrată a vitezei de scanare. Figura 5. Răspunsul la baleiajul în sens direct este identic cu cel de la LSV. Se pune întrebarea dacă un curent poate apărea dacă nu există nici o specie în soluţia care poate transfera electroni la suprafaţă electrodului. este prezentată în figura 6. Când sensul de baleiaj este inversat. Figura 6. Când potenţialul electrodului este variat. Semnalul de excitare în cazul voltametriei ciclice. la potenţialul de interes? Răspunsul este că un curent tranzitoriu poate circula deoarece interfaţa electrod-soluţie se va comporta ca un condensator. O voltamogramă ciclică tipică. Această relaţie este descrisă de ecuaţia Cottrell. aşa cum se arată în figura 8. specia (Ox) capabilă de a primi un electron de la electrod difuzează spre suprafaţă.

Destul de logic (şi fără imaginaţie). pentru un condensator cu plăci paralele. Astfel. se diferenţiază ecuaţia (1) în raport cu t şi presupune că capacitatea este o mărime constantă: dQ dE =C dt dt (6) 473 . ℓ este distanţa de separare între plăcile paralele.care permite să se înţeleagă comportamentul electrozilor în absenţa unui cuplu redox. Schema stratului dublu electric. Pentru a calcula mărimea acestui curent. Cea mai simplă descriere a capacităţii electrochimice este dată de modelul Helmholtz: C εε 0 = A (5) unde: ε este constantă dielectrică a materialului de separare a plăcilor. Figura 7. Figura 8. iar A este aria de electrod. εo este permitivitatea spaţiului liber. cât şi de electrolitul suport. Acest model nu descrie în mod adecvat toate interfeţele electrochimice dacă capacitatea depinde atât de potenţial. sarcina condensatorului (Q) este proporţională cu căderea de tensiune în condensator (E): Q=CE (4) Constanta de proporţionalitate C este capacitatea mediului. numim această mărime curent de încărcare. Capacitatea este un factor esenţial în experimentele electrochimice pentru că dă naştere la un curent în timpul de încărcare al condensatorului. Sistem electrochimic care include transferul de electroni şi circuitul echivalent corespunzător.

prin măsurarea curentului de încărcare la o anumită viteză de scanare. Curentul faradaic depinde de doi factori: cinetica transferului de electroni şi viteza la care specia redox difuzează spre suprafaţa electrodului. Dacă nu există nici o posibilitate de transfer de electroni între soluţie şi electrod (nu există un cuplu redox). care se menţine atât cât se menţine variaţia de potenţial. atunci acest curent este singurul care va fi observat. se obţine o expresie pentru curentul de încărcare în stare staţionară. Curentul atinge o stare de echilibru. 474 . şi se aplică semnalul de excitare a potenţialului având forma din figura 9a. puterea reală a acestei tehnici constă în capacitatea sa de a investiga mecanismul reacţiei de electrod. curentul revine la zero. atunci când se aplică o treaptă de potenţial. voltamograma obţinută are forma din figura 9b. se poate determina capacitatea sistemului. în care nu este prezent nici un cuplu redox activ (experimentul prezentat în figura 9). iar când se opreşte scanarea. se vor folosi condiţii în care curentul capacitiv este mic în comparaţie cu curentul de transfer de electroni (denumit curent faradaic). se obţine: I = C*v (7) Prin această derivare simplă. Figura 9. La inversarea vitezei de scanare. Astfel. Rezultatul excitării sistemului este o creştere bruscă a curentului din cauza schimbării bruşte a vitezei de scanare (ν). Voltametria ciclică fără cuplu redox activ Dacă se consideră cazul foarte simplu al voltametriei ciclice. 4. curentul îşi schimbă semnul. Voltametria ciclică cu un cuplu redox activ Deşi curenţii capacitivi în voltametrie ciclică sunt o realitate.Identificând dQ/dt ca o expresie a curentului şi dE/dt cu viteza de baleiaj a potenţialului (v). De obicei. 5. în absenţa speciei redox active. Experiment de voltametrie ciclică.

cu atât este mai mare fluxul J şi. concentraţiile de Fe(CN)63.. Chem. Dacă presupunem că concentraţiile de la suprafaţa electrodului sunt reglementate prin ecuaţia lui Nernst.trebuie să scadă la suprafaţa electrodului. cu atât este mai mare curentul catodic. x este distanţa de la suprafaţa electrodului. Chiar şi în cazul asumării comportamentului nernstian. 1965. ENH (8) (9) E = E o' − 0. prin reacţia de reducere la Fe(CN)64-. 36. 1351). prin urmare. conform ecuaţiei 10. Se poate observa că. concentraţia de Fe(CN)63. Interpretări calitative.356 V vs. concentraţia de specii oxidate la suprafaţă va scădea odată cu negativarea potenţialului. rRESoducerea fidelă a voltamogramei cuplului Fe(CN)63-/4(figura 6) necesită o soluţie analitică la două ecuaţii diferenţiale. 475 . 706 şi Anal.şi Fe(CN)64.respectă ecuaţia lui Nernst 9: Fe (CN)6 3.0592 log 4− [Fe(CN)6 ] − [Fe(CN)3 6 ] unde: E este potenţialul aplicat şi E0’ este potenţialul formal de electrod. care participă la reacţia 8 a cărei cinetică de transfer de electroni este destul de rapidă. C* este concentraţia de specie oxidată în volumul soluţiei. 1964.. εo’ = 0. Presupunând că viteza de transfer de electroni este foarte rapidă. cu cât este mai mare gradientul de concentraţie. şi Cx=0 este concentraţia sa la suprafaţa electrodului. (Detalii cu privire la simulări în voltametria ciclică pot fi găsite în Anal.+ 1 e. deoarece potenţialul aplicat devine mai negativ.→ Fe(CN)6 4. conform ecuaţiei 10: i=nFAJ Fluxul este guvernat de legea lui Fick: (10) (C * −C x = 0 ) ⎛ dC ⎞ ≅D J = −D ⎜ ⎟ Δx ⎝ dx ⎠ x = 0 (11) unde: D este coeficientul de difuzie a speciilor. După cum se observă din ecuaţia 11. (dC/dx)x=0 este gradientul de concentraţie la suprafaţa electrodului. curentul i care este măsurat când potenţialul scade va fi direct proporţional cu fluxul speciilor oxidate care difuzează spre suprafaţa electrodului. Chem.Pentru cuplul redox Fe(CN)63-/4-. aşa că se presupune că la suprafeţele electrodului. 37.

Parametrii electrochimici caracteristici. Profilul de concentraţie la diferite momente de timp. În momentul în care se aplică un potenţial. prin urmare. Se va obţine un curent de peak negativ şi apoi curentul va scădea în amplitudine. Toate acestea vor duce la obţinerea unei curbe curent-potenţial care are forma din figura 11. iar soluţia are concentraţia uniformă din faza de volum C*. curentul catodic vor fi mai mari. Alura voltamogramei ciclice pentru o reacţie electrochimică nernstiană. În cele din urmă. dar concentraţia de suprafaţă începând să crească. fluxul spre suprafaţă şi. Figura 11. Figura 10. curentul va scădea în continuare. faza de volum a soluţiei care este epuizată în specia oxidată va creşte şi gradientul de concentraţie va începe să scadă. astfel încât în conformitate cu legea de difuzie a lui Fick (ec. 11). În acelaşi timp. Apoi sistemul va trece prin intermediul profilelor de concentraţie similare pentru speciile reduse. 476 . Dacă se va continua negativarea potenţialului. concentraţia speciilor oxidate la suprafaţa electrodului va tinde spre zero. cu atât va scădea fluxul spre suprafaţa electrodului şi curentul va începe să scadă. Cu cât scade gradientul de concentraţie. Dacă se inversează potenţialul de scanare (nu este arătat în figura 10). încă mai există un strat epuizat de specie oxidată. cu cât epuizarea stratului de specie redusă va creşte. nu există nici un gradient de concentraţie. concentraţia speciei oxidate se epuizează la suprafaţă. vom ajunge la o regiune unde curentul anodic începe să domine (figura 11). Înainte ca un potenţial să fie aplicat la electrod (t = 0). în cadrul experimentului de CV (numai baleiaj negativ). Această concentraţie mai mică la suprafaţă dă un gradient de concentraţie mai mare (cel puţin iniţial).Schimbarea gradientului de concentraţie pentru regiunea catodică din voltamograma ciclică este prezentată în figura 10.

Chiar şi cuplurile reversibile conţin suprapotenţiale de polarizare şi astfel prezintă o histereză între potenţialul absolut de reducere (Epc) şi de oxidare (Epa). care se cuantifică conform figurii 11. Analitul trebuie să fie o specie redox în domeniul de potenţial experimentat. În 1964. Un peak reversibil se obţine atunci când un analit este redus sau este oxidat pe un sens al baleiajului de potenţial şi apoi este reoxidat sau redus pe sensul invers al baleiajului. Următorii parametrii sunt folosiţi pentru a caracteriza voltamograma ciclică a unui proces reversibil: a. D este coeficientul de difuzie (în cm2 s-1). la 25 oC.Epa) = 59/n [mV].687 *105) n3/2 A D1/2 v1/2 C* (13) unde: ip este curentul de peak (în A). Nicholson şi Shain au efectuat simulări cantitative ale voltametriei care au dus la schimbări majore în domeniul electrochimiei. Este foarte dificil pentru a atinge o sepa477 .Caracterizarea Aceasta a fost o descriere foarte calitativă a voltametriei ciclice. Curentul de peak într-o voltamogramă ciclică care conţine o singură specie este descrisă de ecuaţia Randles-Sevcik (ec. A este aria electrodului (în cm2). 13). la 25 °C: ip = (2. Acest suprapotenţial reiese dintr-o combinaţie a vitezelor de difuzie a analitului şi bariera intrinsecă de activare a transferului de electroni de la electrod la analit. Separarea potenţialului de peak ΔEp (= Epc . De asemenea. O descriere teoretică a suprapotenţialului de polarizare este inclusă în ecuaţia Butler-Volmer şi ecuaţia Cottrell. la toate vitezele de scanare. n este numărul de electroni transferaţi. este foarte de dorit ca analitul să prezinte peak-uri reversibile. Dacă un sistem redox rămâne în echilibru pe întreg domneiul de potenţial scanat. Simulările cantitative arată mai multe aspecte pentru un sistem nernstian. Parametrii importanţi pentru o voltamogramă ciclică sunt potenţialele de vârf (Ep ) şi curenţii de vârf (ip). Proces redox reversibil Utilitatea voltametriei ciclice este foarte dependentă de analitul studiat. conform reacţiei 12: Ox + e- → Red (12) Toate voltamogramele reversibile arată la fel şi au forma tipică indicată în figura 11. v este viteza de baleiaj (în V/s) şi C* este concentraţia în faza de volum a speciei (în mol/cm3). procesul redox este numit reversibil (echilibru impune ca concentraţiile de suprafaţă de Ox şi Red să fie menţinute la valorile prezise prin ecuaţia Nernst).

Curenţii de peak (ip) sunt proporţionali cu rădăcina pătrată a vitezei de scanare (v). b. ca funcţie de grosimea stratului de difuzie. cât şi de transportul de masă. curentul este controlat atât de transferul de încărcare. g. poate fi explicată ca şi în cazul LSV. valoarea Eo’ poate fi estimată ca media aritmetică a valorilor potenţialelor de peak anodic şi catodic (Eo’ = (Epa + Epc )/2). în experimentele de stripare sau în prezenţa unui fenomen de nucleaţie. Raportul curenţilor de peak este unitar (ipa/ipc = 1) la toate vitezele de scanare. d. Atunci când se obţin peak-uri reversibile. Influenţa vitezei de baleiaj asupra voltamogramelor ciclice ale unui cuplu redox monoelectronic reversibil. ilustrat în figura 12. Acest raport poate fi perturbat pentru cuplurile reversibile în prezenţa unei reacţii chimice. În cazul în care valorile constantelor de difuzie pentru speciile oxidate şi reduse sunt similare. precum şi de viteză de scanare).rare a peak-urilor în valoare de 59/n [mV]. este de 56. e. funcţia ip/v1/2 este independentă de v. Aceasta este o funcţie de pregătire a electrozilor. Procese redox cvasi-reversibile Pentru sistemele cvasi-reversibile (cu 10-1> k °> 10-5 cm/s). f. Figura 12. c. Poziţia potenţialului de peak nu se modifică cu viteza de scanare.5/n [mV] la 25 °C. Diferenţa între potentialul de peak (Ep) şi potentialul la care curentul este jumătate decât la Ep. Voltamograma pentru o reacţie cvasi-reversibilă pentru diferite valori ale constantelor vitezelor de reducere şi de oxidare. 478 . (Se consideră o valoare mulţumitoare aceea de 70 mV. unde: n este numărul de electroni transferaţi. (Ep/2). Influenţa vitezei de scanare asupra curentului pentru un transfer de electroni reversibil. cum ar fi: potenţialul de semi-undă (E01/2). iar conform ecuaţiei 13. Figura 13. se pot determina informaţii termodinamice. pe majoritatea electrozilor solizi.

sistemul va prezenta un comportament ireversibil. este posibil ca în scopul de a schimba un proces cvasi-reversibil într-unul reversibil să se micşoreze viteza de baleiaj v (ceea ce permite ca într-un timp mai îndelungat concentraţiile superficiale să se ajusteze la noile valori ce479 . viteza de transfer de electroni are o şansă mai mare de a fi mai rapidă. Sistemele nernstiane de transfer de electroni la electrod complete sunt greu de găsit în practică şi moleculele redox-active sunt adesea destul de lente. În general. atunci procesul se spune că este cvasi-reversibil. dacă electrozii nu sunt curăţati (sau sunt acoperiţi cu monostraturi). se poate demonstra rolul esenţial pe care îl joacă curăţenia electrodului prin compararea voltamogramelor obţinute cu electrodul curat şi modificat. Pe măsură ce acest raport creşte. care scade când cuplurile redox nu sunt în măsură să ajungă la suprafaţa electrodului. la valorile cerute de ecuaţia lui Nernst. Cu cât curentul este mai mic. comparativ cu difuzia. Cu toate acestea. 1) Cinetica transferului de electroni lent Aşa cum s-a menţionat anterior. Comportamentul unui electrod se poate apropia de cel al un sistem nernstian prin încetinirea vitezei de scanare. Prin urmare. v). procesul se apropie de cazul reversibil. voltamogramele unui sistem cvasi-reversibil sunt mai extinse şi prezintă o separare mai mare. pentru valori mici ale acestuia. Există două cazuri de comportament ireversibil descrise mai jos. De asemenea. reversibilitatea depinde de valorile relative ale constantelor de viteză a transferului de electroni eterogen (ks) şi viteza de schimbare a potenţialului (viteza de scanare. potenţial de peak în comparaţie cu un sistem reversibil. Dacă raportul ks/v este suficient de mic încât concentraţiile nernstiene nu pot fi menţinute. Un proces cvasi-reversibil se caracterizează prin: A) Separarea potenţialelor de peak are o valoare care depaşeşte 58/n mV şi care creşte cu creşterea v (ΔEp > 58/n mV). Când se efectuează o voltamogramă ciclică pe un electrod modificat cu un monostrat auto-asamblat. reversibilitatea impune ca cinetica de transfer de electroni să fie suficient de rapidă pentru a menţine concentraţiile de suprafaţă ale Ox şi Red.Forma voltamogramei ciclice este funcţie de raportului k°/(πνnFD/RT)1/2. Atâta timp cât reversibilitatea depinde de valoarea raportului ks/v. Deviaţiile de la comportamentul reversibil sunt identificate prin variaţii de la parametrii expuşi anterior (a-g). sistemele devin mai lente şi sunt apte să prezinte control cinetic. În aceste cazuri se observă că separarea de peak este o funcţie de viteză constantă a transferului de electroni.

creşterea ΔEp cu creşterea v poate fi. viteza de reducere creşte şi potenţialul de peak (Epc) se deplasează spre o valoare mai pozitivă. dacă ambele specii Ox şi Red sunt stabile în timpul experimentului.rute de schimbările de potenţial). Efectul Ru poate fi minimizat printr-un design experimental atent. C) Atunci când peak-urile sunt semi-reversibile. B) Din păcate. de asemenea. Prin analizarea variaţiei potenţialului de peak. cu toate acestea. atât de oxidare. în timp ce valoarea ks este independentă de concentraţia de analit). acest lucru poate fi înţeles în termeni de echilibru la suprafaţă care nu este stabilit atât de rapid. ks poate fi calculată din variaţiile Ep cu v. cât şi de reducere sunt încă rapide. afectată de reacţii chimice care urmează după transferul de electroni. separarea potenţialelor de peak nu mai este fixă. 2) Reacţiile chimice ale Ox şi Red Valorile de echilibrul pentru Ox şi Red pot fi menţinute în timpul unui experiment de voltametrie ciclică. în special despre procesul cinetic care urmează după cel electrochimic. Dacă această valoare este mare. prin compensare electronică cu feedback pozitiv şi prin manipularea ulterioară a datelor. adică raportul ipa/ipc este diferit (mai mare sau mai mic) de 1. În aceste cazuri. În plus. Cele două efecte pot fi distinse prin varierea concentraţiei de analit (scăderea potenţialului datorită rezistenţei necompensate a soluţiei şi astfel. dar variază în funcţie de viteza de scanare. 480 . În figura 13. în funcţie de viteza de scanare este posibil să se obţină o estimare pentru constantele vitezelor de transfer de electroni. cauzată de rezistenţa necompensată a soluţiei (Ru). când constantele de viteză sunt reduse. este posibil să se determine mai multe informaţii. de asemenea. valoarea ΔEp rezultată creşte cu creşterea curentului. raportul ipa/ipc este mai mic decât unitatea (din moment ce doar o parte din moleculele care au fost reduse prin baleiajul direct sunt disponibile pentru reoxidation prin baleiajul invers). atunci mai mult Red trebuie generat pentru a compensa pierderea de Red. potenţialele de peak se deplasează spre valori mai pozitive/negative. ΔEp depinde de valoarea ks/v şi. Efectul unei reacţii chimice depinde de valoarea raportului k/v (unde k este constanta de viteză a reacţiei chimice). prima curbă prezintă cazul în care constantele de viteză ale proceselor. Din nou. Prin urmare. curentul de peak variază în funcţie de rădăcina pătrată a ratei de scanare. prin urmare. în cazul în care reducerea de la Red la Ox este urmată de conversia lui Red la P. De exemplu. Valoarea curentului poate fi. În mod similar cu cazul de reversibilitate. În plus.

în ambele stări de oxidare. datorită unui suprapotenţial. atunci constantele de viteză pentru aceste procese nu pot fi calculate folosind metode de simulare. prin cresterea v. Valoarea lui k poate fi calculată fie prin studii de simulare. cu toate acestea el necesită adesea existenţa de cantităţi egale de analit. atunci viteze mari de scanare pot arăta peak-uri reversibile. Într-adevăr. exprimat prin vCdl (unde: Cdl este capacitatea la interfaţa electrodului de lucru). Când peak-urile sunt ne-reversibile este imposibil să se determine parametrul E01/2. voltameteria ciclică nu poate determina dacă peak-ul este la potenţialul său termodinamic sau s-a deplasat la un potenţial mai extrem. b. Dacă este acesta cazul. este posibil ca peak-ul să fie ireversibil din cauza unui proces fizic. Acest fapt restrânge limita de detecţie la aproximativ 10-5 M. plasând o limită superioară a lui v decât poate fi utilizată. cel mai frec481 . un exemplu comun pentru metale tranziţionale este o schimbare în geometria sferei de coordonare.atunci reacţia chimică are un efect semnificativ. Procese redox ireversibile (control de transfer de sarcină) În cazul transferului de electroni ne-reversibil. Cuplul redox ar putea fi ireversibil din cauza unui proces chimic care urmează. În ciuda acestor limitări. Dacă ambele efecte sunt prezente. raportul dintre curentul de peak faradaic şi curentul de încărcare scade cu creşterea v (în timp ip este proporţional cu v1/2). în unele domenii de cercetare. voltametria ciclică este una din tehnicile standard utilizate pentru caracterizare. Deşi voltametria ciclică este foarte utilizată pe scară largă pentru caracterizarea speciilor redox (de exemplu: potenţiale redox şi stabilitatea diferitelor stări de oxidare) şi de investigare calitativă a reacţiilor chimice care însoţesc transferul de electroni. este posibil să se elimine efectul reacţiei chimice (deci să se restabilească reversibilitatea). există o serie de dezavantaje inerente în cadrul acestui procedeu: a. Când un peak este ne-reversibil. În plus. voltametria ciclică este foarte potrivită pentru o gamă largă de aplicaţii. Prin urmare. Acesta poate fi însă determinat. De asemenea. există diferenţe considerabile în ceea ce priveşte parametrii voltamogramei. Efectele transferului eterogen de electroni lent şi reacţiile chimice nu pot fi separate. fie prin investigarea efectului vitezei de baleiaj asupra raportului ipa/ipc. în timp ce un efect mai redus apare în cazul în care acest raport este mai mic. Există un curent rezidual de încărcare în timpul experimentului.

Unele speculaţii pot fi făcute în ceea ce priveşte peak-urile ireversibile. Solubilitatea unui analit se poate schimba drastic dacă se schimbă sarcina totală a acestuia. sarcina analitului. de obicei. Celula electrochimică pentru experimentul de voltametrie liniară sau ciclică. Condiţii experimentale Metoda utilizează o combinaţie de trei electrozi: electrodul de lucru. cel puţin. Agitarea soluţiei între trasarea voltamogramelor este importantă pentru ca să furnizeze suprafaţei electrodului analit proaspăt în fiecare nou experiment. Această metodă cu soluţie staţionară are ca şi consecinţă apariţia caracteristicilor de peak controlate de difuzie. Combinaţia dintre solvent. În timpul voltametriei ciclice. poate modifica 482 . Această stratificare a analitului poate izola suprafaţa electrodului. electrolitul este adăugat la soluţia de testat pentru a asigura o conductivitate suficientă. Deoarece voltametria ciclică modifică.vent. cu toate acestea. acolo unde poate afişa în continuare activitate redox. o formă de precipitare. electrolit şi electrodul de lucru specific determină intervalul de potenţial baleiat. Această metodă permite. un electrod de referinţă şi un contraelectrod (figura 14). De obicei. este uzual pentru analitul redus sau oxidat să precipite pe electrod. de asemenea. ca o parte din analit să rămână. ele sunt în general în afara domeniului de aplicare al voltametriei ciclice. Figura 14. electrozii sunt statici şi aşezaţi în soluţii negitate. după reducere sau oxidare. evidenţiind propria activitate redox în scanările ulterioare sau.

pot fi folosiţi ultramicroelectrozi. Aceşti electrozi sunt. pompare a soluţiei sau rotaţia electrodului. care au ca rezultat creşterea rezistenţei. Pentru a executa experimente de voltametrie ciclică la viteze de scanare mari este insuficient un electrod de lucru obişnuit. de asemenea. uneori separaţi de soluţia testată prin capilare Luggin care să împiedice infestarea electrolitului cu KCl. care apar oricum indiferent dacă baleiajul se face dinspre valori pozitive sau negative.5 mM K3Fe(CN)6 prin dizolvarea cantităţii corespunzătoare de sare în 100 ml de KCl 1 M. platina şi aurul. Din acestea sau alte motive. Electrozii de referinţă uzuali sunt cei de calomel sau de Ag/AgCl saturaţi cu KCl. ΔEp. Pentru interpretarea rezultatelor de voltametrie ciclică este important ca electrodul să posede o arie a suprafaţei controlată cu o formă definită. Aceste tehnici ţintesc condiţiile de stare de echilibru. ceea ce duce la denaturarea formei voltamogramei. se vor oxida sau reduce adesea electrolitul sau solventul. Pentru a menţine curentul observat la contraelectrod. cum este în cazul electrozilor disc-rotitor şi disc-inel-rotitor. adesea este necesară curăţarea electrozilor între scanări. contraelectrodul de platină şi electrodul de referinţă Ag/AgCl/KClsat. precum şi D. ceea ce le limitează la voltametria cu baleiaj liniar de potenţial. Exemplu Se realizează o soluţie de hexacianoferat de potasiu 0. 483 . Contraelectrodul cunoscut. Reacţiile care apar la suprafaţa contraelectrodului sunt lipsite de importanţă. Utilizând voltametria ciclică să sa investigheze comportamentul cuplului redox Fe(CN)63-/4. ipa/ipc. poate fi orice material care conduce cu uşurinţă şi nu va reacţiona cu volumul soluţiei. Celula electrochimică conţine 10 ml soluţie de analit şi este echipată cu 3 electrozi: electrod de lucru din grafit. Un electrod de lucru obişnuit are o rază de un ordin de mărime de câţiva mm. fluxul spre suprafaţa electrodului este realizat prin agitare. Într-o tehnică hidrodinamică. Pentru a minimiza curentul şi rezistenţa. Vitezele mari de scanare creează peak-uri având intensităţi mari de curent. având doar un disc expus la unul dintre capete. sub numele de electrod auxiliar. în general. Materialele uzuale pentru electrozii de lucru sunt: cărbunele sticlos. Remarci Voltametrie ciclică nu este o tehnică hidrodinamică. încastraţi într-un material izolator inert. atâta timp cât este asigurată o conducţie bună a curentului.şi să se determine parametrii electrochimici: Eo’.suprafaţa electrodului.

potenţialul de întoarcere.Procesele de electrod sunt: reducere: oxidare: [FeII(CN)6]3.→ [FeIII(CN)6]4[FeII(CN)6]4. Eventual. 484 . după ce s-a dat comanda “Start”. La rularea softului GPES se deschid 3 ferestre (figura 16). numărul de cicluri şi viteza de baleiaj. În fereastra «Edit Procedure» se fixează parametrii experimentului: potenţialul de start. Softul GPES pentru pilotarea potenţiostatului.+ e(13) (14) Aparatura folosită este un potenţiostat Autolab PGStat 10 (EcoChimie. În fereastra «Data presentation» va apărea voltamograma on-line. se fixează şi parametrii pretratamentului (depinde de sistemul studiat). Figura 15. Olanda) pilotat de computer (figura 15).→ [FeIII(CN)6]3.+ e. În fereastra «Manual Control» se bifează toată gama de curenţi pentru ca rRESezentarea grafică on-line să se autoscaleze. Potenţiostat Autolab PGStat 10. Figura 16.

8.00075 20 mV/s 50 mV/s 70 mV/s 100 mV/s 200 mV/s 0.1 M. Dependenţa log I vs.00025 -0.303 0. la diferite viteze de baleiaj. Log v pentru electrodul CV/NP (0.6 10 E/ V vs. se observă ca mărimile ΔEp şi ipa/ipc au valori care plasează sistemul studiat în cazul sistemelor monoelectronice. 0.00050 anodic catodic 1E-3 0. pH = 6.050 ipa/ipc 0. tampon fosfat 0.1 V/ Ag/AgCl. se obţin voltamogramele din figura 17. potenţial de start. -0.023e-4 2. v (mV/s) 50 100 Epa (V) 0. reversibile (conform Anexei 1). 2 cicluri.254e-4 Ipc (A) -1. pH = 6. care scade exponenţial cu timpul. KClsat log v Figura 17. Figura 18.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl.753e-4 Eo’ (V) 0.00000 0.818 Din datele prezentate în tabelul 1.278 ΔEp (V) 0. Ca şi toate tehnicile cu puls de potenţial.4 0.815 0.278 0. 485 .1 V/ Ag/AgCl. Parametrii electrochimici ai sistemului studiat în figura 17.255e-4 -2.050 0. Curentul obţinut (figura 19) are două componente: un curent datorat încărcării stratului dublu (figura 20) şi altul datorat transferului de electroni. Cronoamperometrie Cronoamperometria este o tehnică electrochimică în care potenţialul electrodului de lucru este variat după un semnal tip treaptă. Ag/AgCl.253 0. tampon fosfat 0. 2 cicluri. Voltamograma ciclică pe CV/NP (0.303 Epc (V) 0. KClsat.00025 -0. Din panta rRESezentării log I vs log v (figura 18) se stabileşte puterea lui v şi astfel se verifică posibilitatea de a utiliza ecuaţia Randles-Sencik pentru calculul coeficientului de difuzie.8. potenţial de start.253 Ipa (A) 1.00075 log I 1E-4 I/A 0.0 0. Condiţii experimentale: electrolit.Pentru sistemul studiat.00050 -0.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl. KClsat. -0. Condiţii experimentale: electrolit.1 M. Tabelul 1. ca orice circuit RC.2 0. cronoamperometria generează un curent mare. curentul faradic rezultat la electrod este monitorizat ca funcţie de timp.

pe măsură ce trece timpul. Cronoamperograma Figura 20. Un gradient similar. concentraţia de Ox din vecinătatea electrodului este redusă la zero faţă de concentraţia iniţială. acelaşi lucru se va observa şi în cazul curentului. Profilul curentului stratului dublu electric Considerând o situaţie în care un electrod solid este cufundat într-o soluţie care conţine forma oxidată (Ox) a unui cuplu redox la concentraţie iniţială cunoscută (C0). Ca urmare a transformării. electrodul este fixat la un potenţial (Ei) mult mai pozitiv decat ale E0’ a cuplului Red/Ox. Iniţial. prin care Ox din cea mai mare parte a soluţiei trebuie să difuze la suprafaţa electrodului. unde este imediat redusă la Red.: 1 mM. se extinde. Cu cât electrodul rămâne mai mult la acest potenţial de reducere. Aşa cum s-a discutat anterior. în faza de volum de 1 mM. curentul faradaic în condiţii controlate de difuzie este direct legat cu gradientul de concentraţie. dar în sens opus există pentru Red.Figura 19. Soluţia conţine. cu atât stratul de difuzie sărăcit în Ox. 486 . La un moment t0. asigurându-ne că doar Ox este prezent în soluţie. care după formarea sa este liber să difuzeze departe de suprafaţa electrodului. Astfel. şi se lucrează în acele condiţii experimentale care să asigure că fluxul spre electrod să fie strict controlat de difuzie. potenţialul este modificat după un semnal de tip treaptă până la o valoare semnificativ mai negativă decât E0’ pentru cuplu redox (Es). Această situaţie este prezentată în Figura 21. în faza de volum. cum panta profilului de concentrare pentru Ox scade cu timpul în urma excitării sub formă de treaptă de potenţial. evaluate la x = 0. iar forma Ox din vecinătatea electrodului este imediat transformată (după o cinetică reversibilă) la forma Red. ∂Ci/∂x. un exces de electrolit inert. de asemenea. de ex. Aceasta duce la formarea unui gradient de concentraţie pentru Ox.

la potenţialul Es.chem. care descrie curentul observat (electrodul planar) în orice moment. si D0 = constanta de difuzie pentru specia electroactiv (cm /s). i = n F A Co Do1/2 π-1/2 t-1/2 [A] 2 (15) unde n = numărul de electroni implicaţi în reactie. F = constanta Faraday (96. C0 = concentraţia speciei electroactiv (mol/cm ). cu raportul 100:1 ajungând la o valoare de 118 mV mai negativă decât E0’. Curentul datorat încărcării stratului dublu. A = aria electrodului (cm ). De obicei. ic. scade ca funcţie de 1/t si are valori semnificative numai în perioada iniţială (de câteva ms) imediat după aplicarea semnalului treaptă. există şi cele cu treaptă dublă de potenţial. în care numai curentul rezultat este înregistrat. această influenţă poate fi evitată numai luând în considerare datele i-t în ultimele 90% din timp. Prin natura lui acest curent capacitiv. adică cel cu o singură treaptă de potenţial. Pe lângă cel mai frecvent experiment de cronoamperometrie.485 C/echivalent). concentraţia de Ox la suprafaţă a atins imediat valoarea zero pentru o treaptă de potenţial mult mai negativă decât E0’ a cuplului redox. În general. contribuie la curentul total observat după aplicarea unei treapte de potenţial.Figura 21. 487 2 3 . raportul [Red] la [Ox] la suprafaţa electodului este dat de ecuaţia lui Nernst la orice potenţial. Informaţii suplimentare cu privire la formarea de gradienţilor de concentrare. pot fi găsite la (http://www. În exemplul de mai sus. Acesta poate fi uşor înregistrat prin efectuarea experimentului într-o celulă care conţine doar electrolit. pentru un sistem reversibil (de reducere). Semnalul de excitare in cronoamperometrie si evolutia profilului de concentratie la suprafata electodului. în urma unui trepte de potenţial într-o reacţie redox reversibilă (sau la suprapotenţial mare) în funcţie de t-1/2. Ecuaţia cea mai utilă în cronoamperometria este ecuaţia Cottrell.uoa.html). în care potenţialul revine la o valoare finală (Ef) după ce este menţinut o perioadă de timp τ.gr/applets/AppletDiffus/Appl_Diffus2.

New York. 1993.Prezenţa unei reacţii chimice după etapa de transfer de electroni va duce la un raport diferit de această valoare teoretică. Un sistem simplu. fie de D0 pentru o specie electroactivă. curentul observat pentru prima treaptă scade cu t-1/2. Cum era de aşteptat din ecuaţia Cottrell. Oxford University Press. Electrochemistry: Principles. după fiecare treaptă (notat ir şi if în figura 22) pentru un astfel de sistem ar duce la o valoare egală cu 0. Methods and Applications. 6. În acest exemplu. M. În general. Figura 22.Bibliografie 1. Semnalul de excitare şi răspunsul în cronoamperometria cu treaptă dublă . cât şi electrochimic. A.Cronoamperometria cu pas dublu de potenţial este ilustrată în figura 22. . Faulkner L. 488 . Cu o suprafaţă de electrod cunoscută. USA. Bard A. Electrochemical Methods: Fundamentals and Applications. Brett Oliveira A.293 pentru raportul dintre [-ir (2τ)/if (τ). pentru ca apoi să revină la Ef = Ei. curentul din perioada de întoarcere este înregistrat tot pentru un inte rval de timp τ... Brett C. Curentul apărut la treapta de întoarcere este conceptual mai dificil de explicat decât cel de la prima treaptă. J. fie de n. Co si Do cunoscute]. transferul de electroni este reversibil atât chimic.. după fiecare treaptă de potenţial. De exemplu. Pentru cei interesaţi detaliile se află în Bard şi Faulkner. sunt uşor de realizat măsurători. 2. Cronoamperometria se pretează bine la măsurarea exactă a ariei electrodului (A) prin utilizarea unui cuplu redox bine-definit (cu n. R. 2001. unde este menţinut un timp τ. M. John Wiley and Sons Publishers. Metoda dublei trepte de potenţial este deseori aplicată în măsuratori de constante de viteză pentru reacţii chimice (inclusiv produşi de adsorbţie) care apar în urma primei trepte de potenţial. reversibil poate fi identificat prin compararea valorile curentului direct şi invers măsurat în acelaşi interval de timp. În partea stângă a figurii este arătat felul cum se aplică treapta de potenţial de la Ei la Es. valorile curentului măsurat la un moment egal cu τ/2.

N. 1965. edt) Springer-Verlag. S. 36. Chem. 2007.. Nicholson R.. 1965. Banks C. E. S. John Wiley & Sons. Š.. Chem.7 [mV]. 7. se calculeaza αna αn a [Pentru identificarea notaţiilor şi detalii vezi: Nicholson.. Lovrić: Square-Wave Voltammetry. se calculeaza k ⎜ 0.3.pdf) Anexa 1.09⎜ ⎟ = E1 / 2 + n ⎝ nF ⎠ ΔEp (= Epc .S. se calculeaza D na = număr de 1/2 o ⎞ ⎛ 1/2 ⎞ RT ⎛ αn F ⎞ 1/2 . Nicholson R.. V. 37.. Komorsky-Lovrić. ISBN 978-3-540-73739-1. 37(11).5 [mV] ⎛ ⎞ E p/2 = E1/2 + 1. 706.1. 1351] E p . ip = (2. Anal. 2007. 8. M.Epa) = 59/n ipa/ipc = 1 Sisteme cvasi-reversibile ⎛ nF ⎞ i p = nFAC* D1/2 Ψ(E) v1/2 Ox ⎜ RT ⎟ ⎝ ⎠ ⎛ RT ⎞ Ep/2 . 9. 37.E1/2 = . World Scientific. S. 1965. In: Monographs in Electrochemistry (F. Chem. G. (Editor) Bioelectrochemistry: Fundamentals. Anal. S. 37.. Nicholson R .co. 190. Theory and Application.E p/2 = 489 . Nicholson R.ogt. ISBN 981-270-625-9 5. Compton R. 1965. Anal... Ltd.687 *105) n3/2 AD1/2 v1/2C* [A]. 178. Chem.. Chem..99 *105) n(αna)1/2 A D1/2 v1/2 C* [A]. Berlin.78 + ln ⎜ D Ox ⎟ + ln ⎛ electroni transferaţi în E p = E o' ⎜ a ⎟ + lnv ⎟ o ⎜ ⎟ ⎜ ⎟ αn a F ⎝ RT ⎠ ⎝ k ⎠ etapa determinată de ⎝ ⎠ viteză 47. se calculează D Sisteme reversibile 28. Understanding voltammetry. 1351 (https://twiki. Chem. Nicholson R. α )⎜ ⎟ ⎝ nF ⎠ ⎛ ⎜ ⎜ ko Λ=⎜ nF ⎜ ⎡D1−α Dα ⎜ ⎢ Ox Red RT ⎝⎣ ⎞ ⎟ ⎟ 1/2 ⎟ ⎤ v⎥ ⎟ ⎟ ⎦ ⎠ 1/2 ⎛ ⎛ D ⎞α/2 ⎞ ⎜ ⎜ ox ⎟ k ⎟ .... Mirčeski.uk/twiki/pub/People/ElectrochemistryPapers/TheoryandApplicationofC yclicVoltammetryforMeasurementofElectrodeReactionKinetics. se calculează ks s ⎟ ⎟ ⎜ ⎜D ⎟v −1 / 2 Ψ = ⎜ ⎝ Re d ⎠ 1/2 ⎜ ⎡ nF ⎤ ⎟ D π ⎜ ox ⎥ ⎟ ⎜⎢ RT ⎦ ⎟ ⎠ ⎝⎣ Sisteme ireversibile. 10. Anal. Singapore. Anal... 371 + XII p. Anal. 1965.Ep = (Λ . Experimental Techniques and Applications.5 [mV] ⎛ RT ⎞ E p . 2008. 667. Scholz. 37. Bartlett P. 6. Shain I.(ISBN 978-0470843642) 4. Shain I. Criterii de identificare pentru voltametria ciclică cu specia redox în soluţie ip = (2.109⎜ ⎟=− n ⎝ nF ⎠ RT 28. Shain I. 1964.

...........................3............................. dr.................................... Estimarea stabilităţii sistemului G/SWCNT–Fe(III)P-Nafion la funcţionare continuă ....................... Concluzii ..... Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie........ a................. ing.......155 mA si Ipc = 0...........498 3....................490 2.............................. Graziella Liana Turdean Cuprins 1....493 2... Ipa = 0. Calculul constantei eterogene de transfer de electroni pentru sistemul G/SWCNT–Fe(III)P-Nafion ................ pentru o viteză de baleiaj de 50 mV/s.....506 6......................................... ........ Se trasează voltamogramele ciclice la diferite viteze de baleiaj pe electrodul de platină în soluţia de 5 mM K3[Fe(CN)6] care conţine 0........ Anexă ................................... Studiul integrităţii filmului de Fe(III)P pentru sistemul G/SWCNT–Fe(III)P-Nafion prin calculul ariei suprafeţei active .502 3..... Comportamentul redox al acestei substanţe considerată standard este descris de ecuaţia 1: Fe(CN)6 + e -3 - → Fe(CN)6 -4 (1) şi se manifestă prin apariţia unei perechi de picuri bine conturate (poziţionate la Ea = 0......................109 V........................507 1. Studiu de caz Conf..................1........................1...................................... Bibliografie .......... Influenţa pH-ului asupra comportării sistemului adsorbit (G/SWCNT– Fe(III)P-Nafion) pe electrod de grafit ...... Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie................................................................................. Influenţa vitezei de baleiaj asupra comportării heminei in soluţie (G//Fe(III)P) pe electrod de grafit.............2.......................................354 V............504 4.................. prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj...... Influenţa pHului asupra comportării sistemului G//Fe(III)P pe electrod de grafit ......1 M KCl ca şi fond electrolitic pentru îmbunătăţirea conducţiei (Figura 1A)....................................................................499 3.....................494 2. Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) imobilizată în polimeri ...............157 mA) având parametrii electrochimici (ΔE = 0.. 490 ..................987...........................245 V........ Eo’ = 0..........2...........501 3................................................497 3..........4.....Electrochimia unei substanţe cu potenţial biologic activ................300 V si Ipa/Ipc = 0. Influenţa vitezei de baleiaj asupra comportării heminei adsorbită (G/SWCNT–Fe(III) P-Nafion) pe electrod de grafit ... Ec = 0............505 5....495 3...Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie ............ prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj............5.........

conform ecuaţiei Randles Sevcik) sau transfer de sarcină eterogen (specia adsorbită. Astfel. respec491 .4 0 . 500 / μA anodic 400 300 200 100 I / μA I 0 -1 0 0 -2 0 0 -3 0 0 -4 0 0 0 . C0* = concentraţia soluţiei în fază de volum (mol/cm3). A = aria electrodului (cm2). v1/2. Panta acestor regresii ne dă indicii despre tipul de transfer de sarcină difuziv (specia în soluţie.2 V vs. cu ajutorul curenţilor de peak anodic şi catodic (Ipa. (C) Influenta vitezei de baleiaj asupra curentului de peak I pentru voltamogramele din fig 1A.6 E / V vs. iar intensitatea curentului.8 1/2 catodic 1 .2 0 .0 v 1 /2 / (V /s ) b. (A) Voltamograma ciclica a 5 mM K3[Fe(CN)6]+ 0. ESC (C) Figura 1. ESC. se trasează dependenta log I vs. Analiza datelor prezentate în tabelul 1 indică că specia redox studiată.6 0 . Ipc).4 0 .(A) 800 600 400 200 0 -2 0 0 -4 0 0 -6 0 0 -0 .0 0 . 1980]: Ip = 2. dependenţa I vs. log v (figura 1B). –0. Condiţii experimentale: potenţial iniţial.2 (B) 5 m V /s 1 0 m V /s 2 5 m V /s 5 0 m V /s 7 5 m V /s 1 0 0 m V /s 2 5 0 m V /s 5 0 0 m V /s 7 5 0 m V /s 9 0 0 m V /s anodic catodic I / μA I/A 1E-4 10 100 1000 -1 v / (mV *s ) 0 .1 M KCl pe electrod de platina.69*105 n3/2 A D01/2 v1/2 Co* (2) unde: Ip = curentul de peak (A).2 0 .0 0 . v = viteza de baleiaj (V/s) . (B) Dependenta log I vs. J. D0 = coeficientul de difuzie (cm2/s).. panta în jur de 0. n = numărul de electroni. Ecuaţiile regresiei liniare sunt prezentate în tabelul 1. K3[Fe(CN)6]. I. Intensitatea curentului de peak (Ip) depinde de viteza de baleiaj (v) în conformitate cu ecuaţia Randles-Sevcic (ecuatia 2) pentru un sistem reversibil sub control difuziv [Bard A.5. se află în soluţie. panta în jur de 1). log v pentru voltamogramele din fig 1A.

în rRESezentarea I vs. Se înlocuiesc în ecuaţia Randles Sevcik (ecuaţia 2) parametrii cunoscuţi. unde a este panta. 2003] si D = 5.817e-4 ± 2. n=6 R = 0.00517 102)2 = 1. adică 5 mM = 5 10-6 mol/cm3.131e-4 ± 1.7)2]/4 D01/2 5 10-6 = 0. n=6 R = 0.00517 102)2 = 1.a = (5.438 ± 0.648e-5 ± 3. C0* = concentraţia soluţiei de K3[Fe(CN)6] în fază de volum (mol/cm3). Tabelul 1.69*105 (1)3/2 [π (0.817 10-4)2/(0. anodic log Ia = (-4.011) + (0. Având stabilită dependenţă log I vs.9982 n = 6 catodic c. Valorile parametrilor regresiei liniare I vs. 492 . Prin urmare panta regresiei liniare este: a = 2. D. I vs.s log v şi respectiv.7)2]/4 D01/2 5 10-6 v1/2 analoaga unei ecuaţii liniare y = a x.007) log v Ia /A= (2.008e-5)v1/2 /V/s log Ic = (-4.00517 102 D01/2 de unde: D0 = a2/(0. v1/2 (figura 1C) şi estima panta regresiei liniare. adică d = 0.69*105 (1)3/2 [π (0.009) log v Ic /A= (-1. n = 6 R =0.552 ± 0. Datele obţinute sunt în concordanţă cu cele din literatură care variază între: D = 6.-S.33 10-6 cm2/s.c = (6. iar Dmediu = 1. A = aria electrodului (cm2) este (πd2)/4. d.9976.131 10-4)2/(0. v1/2.518 ± 0. ecuaţia 2 devine: Ip = 2. pentru a putea utiliza ecuaţia Randles Sevcik la calculul coeficientului de difuzie.265 10-6 cm2/s si Do.tă dependenţa Randles-Sevcik faţă de v1/2.220e-6) + (5. Astfel.7 cm.415 ± 0.858e-5) v1/2 /V/s R = 0. log v se poate trasa dependenţa I vs.90e-6) – (6. Astfel: n = numărul de electroni este 1 în conformitate cu reacţia 1..132 e-5 ± 4.013) + (0. pentru a putea utiliza corect rezultatele.5 10-6 cm2/s obţinut cu o soluţie 20 mM K3[Fe(CN)6] [Hrapovic S. Atentie. Regresii liniare pentru dependenţele log I v. valorile curentului trebuie să fie în amperi (A) şi ale vitezei de baleiaj (v) în (V/s). v. unde d= diametrul electrodului..9 10-5 cm2/s obţinut cu o soluţie 5 mM K3[Fe(CN)6] [Ye J.41 10-6 cm2/s.9994.9992.00517 102)2 Adică: Do. 2004]. v1/2 sunt prezentate în tabelul 1.

Structura heminei. Este non-motil.500 V vs. în special în porfiria intermitentă acută11. termenii sunt uneori echivalenţi. contraceptivele orale. Academia Română. mici (1 . este protoporfirina IX care conţine un ion de fier feric (Heme b) şi un ligand clorură. 13 Haemophilus influenzae sunt cocobacili Gram negativi.) pigment care provine din sânge şi conţine fier. 12 Hematină. 1998]. care Porfiria este o boală ereditară cauzată de o tulburare a sintezei hemului (fracţiunea neproteică a hemoglobinei) şi caracterizată prin acumularea în ţesuturi a unor substanţe intermediare ale acestei sinteze. în funcţie de pHul soluţiei. Se distinge de hematină12 care are o grupare hidroxid în loc de clorură.350 to . sulfamidele si fenitoina. Institutul de Lingvistică „Iorgu Iordan”. nu formează spori.→ Fe(II)P Din 10 (3) conţine parametrii electrochimici ai tabelul 2. printr-o slăbiciune musculară şi prin tulburări psihice. hématine [Dicţionarul explicativ al limbii române. Voltamogramele ciclice ale Fe(III)P în soluţie obţinute la diferite viteze de baleiaj pe electrod de grafit arată o pereche de peak-uri bine definite plasate la un potenţial formal standard (εo’)14 care se plasează între – 0. Porfiriile sunt boli foarte rare. Numeroase medicamente. Editura Univers Enciclopedic. KClsat. se află la originea acestor crize. pleomorfic. Hematina este considerată "factorul X" necesar pentru creşterea Haemophilus Figura 2. Este folosit în gestionarea atacurilor de porfirie10. 14 Potenţialul formal standard se calculează ca media aritmetică a potenţialelor de peak anodic şi catodic. 17 – tetrametil .2. influenzae13. Mai exact. cu capete rotunjite. uneori prin crampe. 493 . 13 – divinilporfirin . Peak-urile au fost atribuite unui comportament reversibil monoelectronic al cuplului redox Fe(III)/Fe(II) coordinat în inelul porfirinic (Figura 3A). 12. cu bacili scurţi.0.1.2. porfirinele. Urinele devin roşii atunci când sunt lăsate să aştepte. facultativ anaerobe.8.Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie Hemina (denumirea IUPAC: cloro[3.5/0. – din fr. ca barbituricele. 7. hematine.f. drepţi. 18 –dipropanoato (2−)]fier(III). în conformitate cu reacţia 3: Fe(III)P + e. Ag/AgCl. (s. 11 Porfiria intermitentă acută se manifestă de cele mai multe ori la vârsta adultă prin dureri abdominale acute. Cu toate acestea. denumirea comercială: Panhematina) este o porfirină cu conţinut de fier (figura 2).3 μm).

200 / μA I /μA I cat an 100 0 -1 0 0 -2 0 0 -3 0 0 0 500 1000 1500 v / m V *s -1 494 . Ca urmare dependenţa liniară I-v (figura 3C) confirmă un transfer de electroni heterogen. pentru specia considerată standard. 2. K3[Fe(CN)6]. KC lsat -500 -250 0 10 100 1000 log v (C ) Figura 3. Ag/AgC l. separarea peak-urilor (ΔEp) devine superioară valorii de 59/n mV. Influenţa vitezei de baleiaj asupra comportării heminei in soluţie (G//Fe(III)P) pe electrod de grafit Trasarea dependenţei log I vs. indicând transformarea procesului reversibil. potenţial initial.voltamogramelor din figura 4A se observă că la viteze de baleiaj care depăşesc 300 mV*s-1. nu este posibil calculul coeficientului de difuzie D al speciei studiate din ecuaţia Randles-Sevcik (aşa cum s-a descris în capitolul 1. într-unul cvasi-reversibil. Condiţii experimentale: electrolit. (B) Dependenta log I vs. Ag/AgCl. TRIS 0. log v pentru voltamogramele din fig 3A. (A) 300 200 100 v v v v v v v = = = = = = = 10 m V*s -1 20 m V*s -1 100 m V*s -1 300 m V*s -1 500 m V*s -1 1000 m V*s -1 1500 m V*s -1 (B) anodic catodic