Editori Mihaela Aluaş Simion Simon

Metode experimentale avansate pentru studiul şi analiza bio-nano-sistemelor

1

2

Editori Mihaela Aluaş Simion Simon

METODE EXPERIMENTALE AVANSATE
PENTRU STUDIUL ŞI ANALIZA BIO-NANO-SISTEMELOR

Casa Cărţii de Ştiinţă Cluj-Napoca, 2012 3

Coperta: Patricia Puşcaş

Editură acreditată CNCSIS (24)

© Universitatea „Babeş-Bolyai”, 2012

Material editat în cadrul proiectului „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, ID 36154

Descrierea CIP a Bibliotecii Naţionale a României Metode experimentale avansate pentru studiul şi analiza bio-nanosistemelor / ed.: Mihaela Aluaş, Simion Simon. - Cluj-Napoca : Casa Cărţii de Ştiinţă, 2012 Bibliogr. ISBN 978-606-17-0115-5 I. Aluaş, Mihaela (ed.) II. Simon, Simion (ed.) 53

4

Prefaţă
În calitate de director al proiectului cu titlul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract” POSDRU/21/1.5/G/36154, doresc să mulţumesc tuturor colaboratorilor care au contribuit prin expertiza şi profesionalismul lor la realizarea acestui volum şi, implicit, la dezvoltarea programului doctoral. Mulţumirile mele se îndreaptă de asemenea către echipa de management a proiectului, în următoarea componenţă: Prof. dr. Simion Simon, coordonator ştiinţific program doctoral Prof. dr. Octavian Popescu, coordonator ştiinţific relaţii internaţionale Cristina Dominic, asistent manager Andra Ghira, responsabil logistic şi asistent manager Jr. Alexandru Braşoveanu, consilier juridic Ec. Gelu Silviu Moldovan, responsabil financiar Ing. Carmen Ciplea, expert IT Ec. István Püsök, expert contabil Am convingerea că informaţia cuprinsă în această lucrare va sprijini generaţiile prezente şi viitoare de conducători de doctorat în activitatea lor de cercetare. De asemenea, va facilita orientarea doctoranzilor în lumea minunată a ştiinţei contribuind la determinarea acestora de a face din meseria de cercetător o vocaţie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract POSDRU/21/1.5/G/36154, a fost cofinanţat din Fondul Social European prin Programul Operaţional Sectorial Dezvoltarea Resurselor Umane 2007-2013. C.S.III. dr. Mihaela ALUAŞ 5

6

Cuvânt înainte
Institutul de Cercetări Interdisciplinare a fost înfiinţat prin Hotărârea Senatului Universităţii Babeş-Bolyai din data de 30.05.2001, ca unitate de cercetare şi transfer tehnologic, având ca obiectiv de activitate atât realizarea de studii şi cercetări interdisciplinare în domeniile biologie moleculară, biomateriale şi sisteme biologice, materiale avansate şi mediu ambiant, sisteme nanostructurate natural şi artificial, cât şi transferul rezultatelor obţinute către beneficiari locali, naţionali sau internaţionali. Institutul beneficiază de o clădire proprie, cu o suprafaţă desfăşurată de peste 3000 mp, modernizată la nivelul standardelor internaţionale din punct de vedere al dotărilor conexe şi având laboratoare de cercetare structurate în acord cu nevoile cercetărilor interdisciplinare menţionate. Între timp institutul, prin efortul conjugat al celor care au decis să-şi dedice energia şi cunoştinţele cercetărilor la interfaţa Bio-NanoSistemelor, a devenit Institutul de Cercetări Interdisciplinare în Bio-NanoŞtiinţe (ICI-BNS). În cadrul acestuia îşi desfăşoară activitatea în prezent 12 profesori universitari (dintre care 10 conducători de doctorat), 25 alte cadre didactice şi cercetători şi peste 40 de doctoranzi cu frecvenţă. Aceştia aparţin domeniilor Fizică, Chimie, Biologie, Informatică, Ştiinţa mediului şi Psihologie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară” a oferit posibilitatea de a mobiliza un set de cercetători valoroşi, cu experienţă deosebită în tehnicile experimentale frecvent utilizate în cercetările interdisciplinare din domeniul Bio-Nano-Ştiinţelor. Marea majoritate a experţilor a beneficiat de stagii doctorale sau postdoctorale în prestigioase laboratoare din lume unde au dobândit o bogată experienţă în utilizarea echipamentelor de înaltă performanţă de care dispune Institutul nostru. Studenţii doctoranzi, dar şi specialişti din domenii ca: fizică, chimie, biologie, geologie sau ştiinţa mediului interesaţi în studii experimentale interdisciplinare vor găsi în materialele incluse în prezentul volum date teoretice dar mai ales practice, despre tehnici experimentale avansate prezentate într-o formă accesibilă, cu exemple semnificative, menite a facilita înţelegerea fenomenelor studiate şi a contribui la creşterea aportului fiecărui cercetător la dezvoltarea domeniului în care îşi va desfăşura activitatea ştiinţifică. Prof. Dr. Simion SIMON Director ICI-BNS

7

8

CUPRINS
I. ANALIZE GENETICE ................................................................................................. 13 Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine.......................................................................................................................... 13 Asist. univ. dr. Iulia Lupan Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare ........... 36 Asist. univ. dr. Iulia Lupan II. CULTURI CELULARE ............................................................................................... 64 Culturi celulare ........................................................................................................... 64 Lect. dr. Mircea Teodor Chiriac Culturi celulare – partea a II-a .................................................................................... 82 Lect. dr. Mircea Teodor Chiriac III. MICROSCOPUL CONFOCAL RAMAN............................................................ 101 Microspectroscopia Raman....................................................................................... 101 Conf. dr. Monica Maria Baia Microspectroscopia Raman – partea a II-a................................................................ 121 Conf. dr. Monica Maria Baia IV. SPECTROMETRUL IR........................................................................................... 134 Spectroscopia de absorbţie în infraroşu .................................................................. 134 Lect. dr. Nicolae Leopold Tendinţe moderne în spectroscopia de absorbţie IR ............................................. 147 Lect. dr. Nicolae Leopold V. SPECTROFLUORIMETRUL .................................................................................. 160 Spectrofluorimetria .................................................................................................... 160 Conf. dr. Dana Maniu Spectrofluorimetria - aplicaţii ................................................................................... 172 Conf. dr. Dana Maniu VI. SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ ......... 191 Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) .................. 191 C.S.I. dr. Claudiu Filip, C.S.III. dr. Mihaela Aluaş Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă .......................................................................................................... 216 C.S.I. dr. Claudiu FILIP, C.S.III. dr. Mihaela Aluaş

9

Rezonanţa magnetică nucleară pe sisteme lichide ................................................ 246 Lect. dr. Mihai Vasilescu VII. MĂSURĂTORI TERMICE .................................................................................. 266 Analiză termică diferenţială. Analiză calorimetrică diferenţială......................... 266 Conf. dr. Raluca Ciceo-Lucăcel Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială. Ghid de interpretare a măsurătorilor DTA/TG şi DSC........................................................................................................................... 275 Conf. dr. Raluca Ciceo-Lucăcel VIII. DIFRACTOMETRUL DE RAZE X ................................................................... 286 Difracţie de raze X pe pulberi ................................................................................... 286 C.S.I. dr. Gheorghe Borodi Determinarea structurii cristaline prin difracţie de raze X................................... 305 C.S.I. dr. Gheorghe Borodi IX. MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE ........... 327 Microscopia electronică ............................................................................................. 327 şef lucrări dr. Lucian Barbu-Tudoran Microscopia electronică - partea a II-a .................................................................... 347 şef lucrări dr. Lucian Barbu-Tudoran X. MICROSCOPUL DE FORŢĂ ATOMICĂ ............................................................ 365 Microscopia de forţă atomică ................................................................................... 365 Conf. dr. Ioan Burda Microscopia de forţă atomică – partea a II-a ........................................................... 378 Conf. dr. Ioan Burda XI. SPECTROMETRUL DE FOTOELECTRONI DE RAZE X ŞI ULTRAVIOLETE .......................................................................................................... 394 Spectroscopia fotoelectronică ................................................................................... 394 C.S.III. dr. Maria Teodora Radu Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale ................................................................................... 424 C.S.III. dr. Teodora Maria Radu, C.S.dr. Emilia Sabina Varga XII. SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN .......... 437 Spectroscopia de rezonanţă electronică de spin ................................................... 437 C.S. dr. Milica Todea Spectroscopia de rezonanţă electronică de spin – partea a II- a ............................ 452 C.S. dr. Milica Todea

10

.... Réka Barabás     11 ......................XIII........... 467 Conf.... 467 Elaborarea.............. Graziella Liana Turdean XIV............................... 490 Conf.. dr... Studiu de caz ................. 509 Lect.............................. ing........... ing. METODE ELECTROCHIMICE ...... dr... dr....... ing. SISTEME DE ANALIZĂ A SUPRAFEŢEI SPECIFICE ŞI A DIMENSIUNII PARTICULELOR ... 509 Sisteme de analiză a suprafeţei specifice şi a dimensiunii particulelor ... testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice ........................ Graziella Liana Turdean Electrochimia unei substanţe cu potenţial biologic activ.............

  12 .

... ARNm rezultat serveşte ca matriţă în procesul de traducere a ADN (sinteza proteinelor) care are loc în ribozomi................... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot ADN în sine are doar 2 funcţii importante şi anume păstrarea informaţiei genetice şi furnizarea acesteia pentru sinteza de proteine....................... Dogma centrală a biologiei presupune transmiterea unidirecţională a informaţiei de la ADN la proteine prin intermediul ARN (Figura 1)......... Practic ARN este cărăuşul informaţiei din nucleu în citoplasmă unde are loc sinteza proteinelor............................ 33 4................... care este sintetizat în procesul de transcriere a ADN de către o enzimă numită ARN polimerază. Informaţia genetică nu poate fi transmisă invers........................ A doua funcţie este legată de descifrarea informaţiei pentru sinteza de proteine................. 13 ....... 34 1...... Informaţia genetică poate fi transmisă de la ARN la ADN în cazul retrovirusurilor la care materialul genetic este ARN...... 13 2................... Păstrarea include transmiterea materialului genetic nemodificat de la o generaţie la alta......I............... univ...... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot .. 31 3.. de la proteine la ADN.......... dr............ Mesagerul informaţiei între ADN şi proteine este ARN............................................................... Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare ....... Infrastructura existentă în cadrul Centrului de Biologie Moleculară ..... Iulia Lupan Cuprins 1. Acest fapt este realizat prin replicarea ADN şi împărţirea egală a celor două copii în timpul diviziunii celulare.................. Nu există cazuri de transmitere a informaţiei de la ADN direct la proteine. ANALIZE GENETICE Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine Asist................................. Bibliografie ...

care necesită apoi o izolare din amestecul de fragmente generate. ci un fragment de ADN care nu poate fi separat dintr-un amestec heterogen de molecule apropiate ca mărime. • verificarea moleculelor recombinate Amplificarea genei de interes. Moleculele de ARN rezultate în urma transcrierii pot fi împărţite în 2 categorii: • ARN funcţional • ARN informaţional ARN funcţional este ARN care nu se traduce. O genă este considerat orice fragment de ADN care se transcrie într-o moleculă de ARN. procesul clonării constă din următoarele etape: • amplificarea genei de interes • introducerea genei de interes într-un vector de clonare • introducerea moleculelor recombinate în celule gazdă • selecţia celulelor transformate (purtătoare ale moleculei recombinate) Figura 1. Din această cauză în continuare se va utiliza doar termenul fragment ADN de interes pentru a evita confuziile. Prin multiplicarea celulelor cu genele clonate se pot obţine milioane de copii ale unei singure gene. îndeplineşte anumite funcţii în celulă (în cea mai mare parte participă la procesul de traducere) şi ocupă cea mai mare parte din ARN total din celulă: ARN ribosomal (ARNr) şi ARN de transport (ARNt). Există 2 modalităţi de a obţine fragmentul dorit. Deoarece fragmentul ADN de interes sau ţintă se află într-un genom este necesară extragerea acestuia.Clonarea genelor constă în izolarea unei gene dintr-un genom şi introducerea ei în alte celule gazdă pentru multiplicare şi în unele cazuri pentru exprimare. De cele mai multe ori genele de interes care sunt scopul clonării codifică un polipeptid. A doua opţiune de copiere a fragmentului din genom este cea mai des 14 . fie prin tăierea acestuia din genom. Dogma centrală a biologiei. Tăierea fragmentului din genom este mai dificilă deoarece necesită prezenţa unor situsuri (secvenţe specifice) la capetele fragmentului. fie prin copierea acestuia. Sumar. iar numărul moleculelor deci şi cantitatea de ADN este mică. ARN informaţional este ARN mesager (ARNm) care codifică un polipeptid şi serveşte ca matriţă în procesul de traducere (sinteză a proteinelor). În alte cazuri scopul clonării nu este obligatoriu o genă.

Temperatura de aliniere se stabileşte la câteva grade (2-5ºC) mai puţin decât temperatura de topire (Tm) a amorsei. Temperatura de topire se calculează în dependenţă de lungimea amorsei şi de compoziţia ei. Dacă în celule pentru replicare se foloseşte o întreagă serie de proteine. Denaturarea ADN este necesară pentru separarea celor 2 catene. fiecare ciclu fiind alcătuit din 3 etape: • denaturarea ADN • alinierea amorselor • sinteza catenei complementare de către ADN polimerază După fiecare ciclu practic cantitatea de ADN se dublează. iar după 35-40 de cicluri se obţin milioane de copii ale fragmentului ţintă pornind de la o singură copie. aici rolul unora dintre ele este preluat de unii factori fizici. catenele complementare formând molecula dublu catenară după înlăturarea agentului de denaturare. Reacţia de amplificare este una ciclică. doar de 30-45 sec. Dacă secvenţa este necunoscută. este rapidă şi sensibilă deoarece necesită cantităţi foarte mici de ADN matriţă. În acest scop se utilizează tehnica PCR (Polymerase Chain Reaction).utilizată. temperatura este coborâtă la 40-60ºC timp de câteva zeci de secunde. Denaturarea ADN presupune separarea celor două catene. sunt secvenţe scurte de ADN monocatenar. cum ar fi spre exemplu denaturarea ADN. Pentru alinierea amorselor la secvenţele complementare. Principiul tehnicii PCR este o imitaţie a procesului de replicare a ADN care are loc în celule. Etapele de denaturare după primul ciclu sunt mai scurte. O condiţie obligatorie pentru o amplificare reuşită este cunoaşterea secvenţei ţintă. atunci se vor analiza cel puţin secvenţe ADN omoloage de la alte specii sau secvenţa de aminoacizi a proteinei dacă este vorba despre o genă. cea mai simplă formulă de calcul pentru o amorsă de până în 25 de nucleotide este: Tm = 4 (G + C) + 2(A + T) 15 . care sunt foarte mari. Această tehnică poate fi considerată un adevărat copiator de gene. denumite şi oligonucleotide. e nevoie de mai mult timp. Amorsele (termenul englezesc este primer). Tehnica este pe larg utilizată. Procesul este reversibil. Ca agent denaturant se utilizează temperaturi înalte de 94-98ºC. în special la capetele acesteia. Această etapă este numită de aliniere sau hibridizare. Denaturarea din primul ciclu durează câteva minute (2-6) deoarece pentru denaturarea moleculelor de ADN genomic. Există mai multe formule de calcul. Aceste amorse sunt complementare cu extremităţile secvenţei ţintă şi formează cu acestea porţiuni scurte dublu catenare.

Astfel amplificarea fragmentelor de ADN era una foarte costisitoare. Taq polimeraza are activitatea optimă la 72°C şi nu se denaturează la temperaturi ridicate de peste 90°C foarte repede. Numărul de G şi C se înmulţeşte dublu faţă de A şi T deoarece între acestea există 3 legături de hidrogen. dar şi ca punct start pentru ADN polimerază. În acest fel tuburile de reacţie trebuiau schimbate de la o temperatură la alta şi după fiecare ciclu era nevoie de un surplus de ADN polimerază. De la aceste porţiuni dublu catenare formate între catena matriţă şi amorsa ADN. Salvarea acestei metode a venit după descoperirea şi descrierea ADN polimerazelor de la bacteriile termofile. care nu poate porni sinteza de la zero şi are nevoie de un capăt liber 3'. astfel după câteva ore la 95°C pierderea de activitate este nesemnificativă. în consecinţă moleculele bogate în G şi C au o temperatură mai mare de topire. Enzima revoluţionară în acest sens. ADN polimeraza catalizează sinteza catenei complementare în direcţia 5'→3' (Figura 2). iar ca rezultat se vor amplifica porţiunile scurte rămase monocatenare.Unde G. Cel mai mare dezavantaj al utilizării acestei enzime era inactivarea termică în timpul denaturării ADN. Iniţial la originea tehnicii PCR se folosea ADN polimeraza izolată de la bacteria Escherichia coli. în caz contrar amorsa poate forma secvenţe interne dublu catenare care au aspect de stem sau buclă • cele două amorse sens (forward) şi antisens (reverse) nu trebuie sa fie complementare între ele. polimeraza poate iniţia sinteza catenei complementare. A şi T sunt numărul de nucleotide ce conţin aceste baze azotate. C. Amorsele servesc în primul rând la delimitarea fragmentului amplificat. care are activitatea optimă de sinteză la 37°C. Viteza de polimerizare a Taq polimerazei este de 16 . altfel se vor forma porţiuni dublu catenare sau dimeri de amorse. Există câteva reguli pentru construirea amorselor şi anume: • numărul de nucleotide este de 15-35 • temperatura de topire a amorselor trebuie să fie între 40 şi 70ºC • conţinutul de G şi C nu trebuie să depăşească 50-55% • la capătul 3' al amorsei este de dorit să fie o G sau C. izolată de la o bacterie termofilă Thermococcus aquaticus (de unde şi denumirea ei). care sintetizează polimerizarea nucleotidelor trifosfat într-un lanţ polinucleotidic în direcţia 5′→3′. pe larg utilizată şi astăzi este Taq polimeraza. deoarece oferă o stabilitate mai mare • amorsele nu trebuie să prezinte complementaritate internă. Această enzimă este o ADN polimerază.

iar pentru un fragment de 2000 de nucleotide – 2minute.aproximativ 1000 de nucleotide per minut. Etapa iniţială de denaturare 5' 3' ADN genomic cu fragmentul ţintă 3' 5' 5' 3' 3 5' Alinierea amorselor la capetele fragmentului ţintă 3' 5' 3 ' 5' Ciclu I 5' 3' Etapa de elongare sau sinteză a catenei complementare de către ADN polimerază 3' 5' 5' 3' Sfârşitul primului ciclu 3' 5' 5' 3' 3' 5' 5' 3' 3' 5' 5' 3' 5' 3' 3' 3' 5' Ciclu II 5' 3' 5' 3' 3' 3' 5' 17 . Durata elongării necesare sintezei va fi în dependenţă de mărimea fragmentului ţintă. Pentru un fragment de 500 de nucleotide vor fi suficiente 30 sec.

Ele pot fi numite cu alte cuvinte adevărate foarfece de ADN. Acest tip este asemănător PCR obişnuit.5' 3' 5' 3' 3' 5' 3' 5' 5' 3' 3' 5' 3' 3' Ciclu III 5' 3' 3' 5' 3' 5' 3' 5' 5' 3' 3' 5' 5' 3' 3' Taq polimeraza amorsă amorsă ce indică direcţia de sinteză Figura 2. În ambele cazuri se porneşte de la ARNm (ARN informaţional care codifică proteine). Reprezentarea schematică a primelor cicluri de PCR. doar că foloseşte o matriţă de ARN pentru a sintetiza ADN. Enzima responsabilă de această sinteză este transcriptaza inversă. Enzime de restricţie Enzimele de restricţie sau restrictazele sunt enzime care taie molecule monocatenare sau dublu catenare de ADN la anumite situsuri specifice. Restrictazele recunosc doar anumite secvenţe scurte numite situsuri specifice de recunoaştere. Transcriptaza inversă a fost izolată de la virusurile care au material genetic ARN şi în momentul intrării în celulă necesită sinteza unei copii a materialului său genetic. Aceste enzime au fost descoperite la bacterii şi se presupune că funcţia lor este de apărare contra bacteriofagilor (virusuri ale bacteriilor). se fixează de acestea şi taie legăturile fosfoesterice între nucleotide. care este de fapt o ADN polimerază ARN-dependentă. Taq polimeraza este o ADN polimerază deoarece sintetizează ADN şi este ADN dependentă deoarece utilizează o matriţă ADN pentru sinteză. RT-PCR se utilizează pentru obţinerea copiilor de gene eucariote care nu conţin introni şi analiza exprimării de gene. În mo18 . Un tip special de PCR este RT-PCR sau PCR de transcriere inversă.

în general. enzimele de restricţie. care au secvenţa de recunoaştere un palindrom şi utilizează ioni de Mg2+ ca şi cofactor. Toate aceste enzime se împart în 3 clase: I. Capetele libere după tăierea de către enzimele de restricţie pot fi de 2 feluri: coezive sau drepte. iar enzimele SmaI şi EcoRV generează capete drepte sau netede (Figura 3). Astfel. ADN bacterian propriu este protejat contra enzimelor de restricţie prin metilarea unor baze azotate. Această clasificare este în dependenţă de cofactorul utilizat şi de secvenţa de recunoaştere. 19 . II şi III. Secvenţele de recunoaştere pentru enzimele EcoRI (A) şi SmaI (B) şi capetele libere după tăiere. Cu ajutorul unor programe speciale se pot alcătui hărţi de restricţie care reprezintă situsurile de recunoaştere pentru diferite restrictaze într-o secvenţă (Figura 4). Secvenţa palindrom este alcătuită din 4-6 nucleotide şi citită pe ambele catene în direcţia 5′→3′ este identică. Nomenclatura enzimelor de restricţie porneşte de la denumirea bacteriei de la care a fost izolată. nu taie ADN metilat. Enzima BamHI şi EcoRI generează capete coezive după tăiere. Până acum au fost descrise 4000 de enzime de restricţie de la câteva sute de specii bacteriene. HindIII este izolată de Heamophilus influenzae tulpina Rd. A EcoRI B SmaI 5′ GAATTC CTTAAG 3′ 3′ 5′ 5′ GGGCCC CCCGGG 3′ 3′ 5′ 5′ G CTTAA 3′ AATTC G 3′ 5′ 5′ GGG CCC 3′ CCC GGG 3′ 5′ Figura 3. iar EcoRI de la Escherichia coli tulpina RY13. Locurile de tăiere sunt indicate cu săgeţi. enzimele de restricţie digeră aceste molecule.mentul intrării ADN fagic în bacterii. Enzimele cele mai utilizate în tehnicile moleculare sunt cele de tip II.

bacteriofagi. Vectorii sunt de mai multe tipuri: cosmide. care este circulară. închisă şi capabilă de replicare autonomă în celule 20 . Figura 5. Cea mai des utilizată este ADN ligaza T4 izolată de la bacteriofagul T4. recombinării şi după repararea ADN. Un plasmid este o moleculă dublu catenară de ADN. acestea nu pot fi legate prin creare de noduri sau nu există nici un lipici special. Funcţia ligazei în celule vii este legarea fragmentelor în timpul replicării. plasmide şi vectori artificiali. Cu cifre în paranteze sunt indicate situsurile enzimelor de restricţie. Cele mai pe larg utilizate sunt plasmidele. Reprezentarea schematică de legare de către ADN ligază a două fragmente ADN care au capete netede. Aceşti vectori sunt utilizaţi în dependenţă de scopul clonării. Vectori de clonare Prin vectori de clonare subînţelegem molecule de ADN transportatoare ale fragmentului de ADN străin în celulele gazdă. Ligarea fragmentelor de ADN Deşi moleculele de ADN pot fi asemănate cu nişte fire. ADN ligaza T4 utilizează ATP ca şi cofactor.B am H I (533) H inf I (7 5) E co RV (5 8) H inf I (32) H inf I (461) E co RI (605) H inf I (616) E co RI (633) B am H I (7 7 3) NcoI (7 7 7 ) H inf I (942 Y LR3 7 7 C 1047 bp Figura 4. Harta de restricţie a unei gene de la drojdia Saccharomyces cerevisiae. Această enzimă reface legăturile fosfoesterice între gruparea hidroxil a unui nucleotid (capătul 3′) şi gruparea fosfat de la nucleotidul altui fragment (capătul 5′) (Figura 5). Pentru legarea fragmentelor de ADN se utilizează o enzimă numită ADN ligază.

În această regiune se introduce fragmentul ţintă de ADN cu ajutorul enzimelor de restricţie şi a ligazei. Un alt fel de selecţie este selecţia celulelor transformate cu plasmid recombinat adică cu insert de cele cu plasmid fără insert. se însămânţează pe un mediu cu ampicilină. mai corect spus produsul genei conferă rezistenţă. Atât vectorul cât şi fragmentul ADN sunt tăiate cu aceleaşi enzime de restricţie şi legate împreună cu ajutorul ligazei. Dacă β-galactozidaza este activă atunci va metaboliza acest substrat. Plasmidele care conţin gena pentru această enzimă vor proteja celulele bacteriene de efectul antibioticului. cât şi fără plasmid. În acest scop situsul multiplu de clonare se află într-o genă ce codifică o enzimă. Spre exemplu. Spre exemplu dacă SMC se află în gena lacZ′ care codifică subunitatea α a enzimei β-galactozidază. O altă componentă foarte importantă a plasmidelor sunt markerii de selecţie care sunt de obicei nişte gene. Dacă în SMC nu a fost introdus niciun fragment ADN atunci gena este intactă.gazdă. selecţiei şi uneori exprimării genelor. În acest fel coloniile re21 . Plasmidele au nişte secvenţe specifice necesare replicării. Plasmidele comerciale utilizate pe larg sunt plasmide naturale izolate de la bacterii care au fost modificate. Pentru replicarea autonomă în celule gazdă plasmidele conţin secvenţa ori. atunci produsul acestei gene împreună cu subunităţile codificate din genomul celulei gazdă bacteriene vor forma o enzimă activă capabilă să metabolizeze un derivat al galactozei numit X-Gal (bromo-cloro-indolil galactopiranozid) care este adăugat în mediu şi este incolor. produsul ei este o proteină activă. O regiune foarte importantă într-un vector de clonare este Situsul Multiplu de Clonare (termenul englezesc este Multiple Cloning Site). Dacă în SMC a fost introdus un fragment ADN atunci gena este modificată şi produsul ei este inactiv. Insert se referă la fragmentul de ADN ţintă clonat. Originea de replicare este o regiune a moleculei de ADN de unde poate începe replicarea şi care este recunoscută de anumite proteine care iniţiază replicarea. vor supravieţui doar celulele care conţin plasmidul. Nicio moleculă de ADN nu poate fi replicată fără o origine de replicare. Cei mai frecvenţi markeri utilizaţi sunt genele ce conferă rezistenţă la antibiotice. clonării. iar produsul format în urma reacţiei va avea o culoare albastră. SMC conţine secvenţele de recunoaştere pentru mai multe enzime de restricţie care nu se conţin în altă regiune a vectorului. care este originea de replicare. β-lactamaza conferă rezistenţă la ampicilină. Astfel dacă un amestec de celule transformate cu plasmide care vor conţine atât celule cu. a căror produs (enzimă) fac posibilă selectarea celulelor cu plasmid de cele fără plasmid care sunt mai numeroase.

doar de câteva mii de pb şi în care pot fi inserate fragmente de ADN de la 100 pb până la 2000-3000 pb (Figura 6: A. În unele cazuri acesta este prezent după regiuni care codifică anumite aşa-zise etichete. iar cele ce conţin vector recombinat vor fi albe. Glutation S-transferaza (GST) şi proteina de legare a maltozei (Maltose Binding Protein. în caz contrar acesta se poate introduce în fragmentul ţintă cu ajutorul amorselor. Vectorii de clonare au de obicei mărime mică.zultate după transformare care conţin vectorul fără insert vor fi albastre. Plasmidele de exprimare trebuie să mai conţină câteva elemente în plus faţă de vectorii de clonare. Numai în prezenţa promotorului exprimarea va fi foarte scăzută. în consecinţă şi pentru a obţine o cantitate mai mare de ADN este necesară o cantitate mai mare de cultură. Vectorii de clonare mai mici au de obicei un număr mai mare de copii per celulă. Celulele bacteriene care au plasmidul cu insert vor avea gena nefuncţională şi vor supraveţui. Aceste etichete vor fi parte integrantă a proteinelor la 22 . deoarece ele nu produc enzimă activă capabilă de metabolizarea substratului X-Gal. Astfel. O caracteristică importantă pentru plasmide este numărul de copii per celulă. Codonul STOP este inclus şi el de obicei în situsul de clonare. de aceea situsul de legare al ribozomilor (termenul englezesc este Ribosome Binding Site) este o secvenţă care se transcrie dar care nu se traduce şi care este recunoscută de ribosomi. celulele cu plasmid fără insert au gena funcţională care va provoca moartea celulelor. Ribosomii se leagă la acest situs şi se deplasează de-a lungul ARNm până întâlnesc primul codon START de unde începe traducerea. Pentru vectorii mai mari numărul copiilor per celulă este mai mic. B). Acest fapt permite obţinerea unei cantităţi mari de ADN plasmidic dintr-o cultură mică de bacterii (din 3-5 ml de cultură se pot obţine câteva μg de ADN plasmidic). Acest codon este de obicei inclus în situsul multiplu de clonare. Cele mai des utilizate sunt eticheta de 6 histidine (His-tag). Etichetele facilitează purificarea proteinelor recombinate prin cromatografie de afinitate. MBP este termenul în engleză). Vectorii de exprimare sunt de asemenea vectori de clonare dar care oferă în plus posibilitatea exprimării genei clonate (Figura 6 C). codonii START şi STOP care delimitează cadrul deschis de citire (termenul englezesc este Open Reading Frame). care se fixează la nivelul promotorului şi iniţiază transcrierea. Promotorul este o secvenţă care se află în amonte de genă şi este recunoscut de factorii de transcriere. Codonul START la procariote este în cele mai dese cazuri ATG. Un alt tip de selecţie utilizează o enzimă toxică pentru celulele bacteriene. Aceste elemente sunt cele care se găsesc şi în genom şi fac parte dintr-o genă: promotorul. situsul de legare al ribosomilor.

Hărţile unor vectori plasmidici. situsul multiplu de clonare care conţine un codon START şi un codon STOP după eticheta de 6 histidine. C – harta vector de exprimare pET21a de la Novagen care include gena bla care conferă rezistenţă la ampicilină.capătul ei C-terminal sau N-terminal dacă secvenţa ce codifică eticheta este prezentă după sau înainte de situsul de clonare respectiv. promotorul de la fagul T7 care este inductibil cu IPTG. Etichetele vor conferi proteinelor recombinate afinitate faţă de anumite răşini cromatografice. A – harta plasmidului pBR322 include 2 gene de rezistenţă la antibiotice: Apr conferă rezistenţă la ampicilină. A Eco RI (4360) Sca I (3847) Pvu I (3737) Cla I (25) HindIII (30) Eco RV (188) Bam HI (376) Sph I (567) Sal I (652) B LacZ Eco RI Sac I (6 AP r Pst I (3612) bla(AmR) Kpn I (6 TC r pTZ57R 2886 bp Xba I (6 Bam HI pBR322 4361 bp MCS Apa I (6 Sal I (6 Pst I (6 Hin dI ORI Bst Z17I (2247) T7 p T7 terminator C f1 origin His tag XhoI (159) Not I (167) HindIII (174) Sal I (180) Sac I (191) Ori M CS Eco RI (193) bla (Ap) Bam HI (199 Nde I (239 pET-21a 5443 bp T7 prom Bgl II (34 lacI ColE1 pBR322 origin Figura 6. în dependenţă de gena selectată pentru inserare. rezistenţa la antibioticul respectiv se va pierde . situsul multiplu de clonare îl poate constitui oricare dintre cele două gene de rezistenţă. Plasmidul are rezistenţă la ampicilină. B – harta plasmidului de clonare pTZ57R comercializat de firma Fermentas. 23 . iar situsul multiplu de clonare se află în gena lacZ' care oferă selecţia alb-albastră a clonelor pozitive. iar TCr rezistenţă la tetraciclină.

o valoare foarte mare ţinând cont de faptul că avem nevoie de o singură colonie 24 . Eficienţa de transformare a celulelor se poate măsura efectuând o transformare cu o cantitate de 1 ng de ADN plasmidic şi apoi numărând coloniile rezultate. ceea ce înseamnă ca la transformarea unui μg de plasmid s-ar obţine 1 milion de colonii. Există două tipuri de transformare a celulelor bacteriene pe larg utilizate în laboratoarele de biologie moleculară: • transformarea chimică • transformare sub influenţa câmpului electric. Aceste spălări repetate vor asigura eliminarea ionilor care pot afecta transformarea. Celulele sunt şocate termic foarte scurt. Acest timp este suficient pentru intrarea moleculelor recombinate în celulele bacteriene. adică fără plasmid. Amestecul de celule competente şi plasmide recombinate vor fi depuse într-o cuvă specială de electroporare. Numărul obţinut de la transformarea a 1 ng de ADN plasmidic se raportează la 1 μg de ADN (înmulţind valoarea la 1000). deoarece E. Transformarea în câmp electric este mai eficientă decât transformarea chimică. timp de maxim 2 minute.Introducerea moleculelor recombinate în celule gazdă Introducerea plasmidelor recombinate în celule gazdă se numeşte transformare dacă sunt utilizate celule bacteriene sau transfecţie dacă sunt celule eucariote. la 42°C. Pentru acest tip de transformare este necesar un aparat numit electroporator. După transformare celulele şocate sunt preluate în mediu de cultură şi apoi însămânţate pe mediu selectiv cu antibiotice. Transformarea are loc la o tensiune de 1800 sau 2500 V timp de câteva msec (Figura 7 B). Doar unele celule bacteriene sunt transformate.8) şi înlăturarea prin spălări repetate a mediului de cultură.6-0. Această competenţă în cazul transformării chimice este indusă cu CaCl2. care va crea câmpul electric între doi electrozi. ai cărei pereţi laterali sunt electrozii. coli şi prin tratarea celulelor cu clorură de calciu la rece se poate induce transformarea celulelor bacteriene (Figura 7 A). În acest scop se realizează o cultură de E. Prepararea celulelor competente presupune doar creşterea lor până în faza logaritmică (D=600nm = 0. acestea având cea mai mare aplicabilitate şi simplitate în scopul obţinerii clonelor şi proteinelor recombinate. În continuare se va detalia doar transformarea celulelor procariote. Numărul de colonii va corespunde numărului de celulele transformate deoarece fiecare colonie ia naştere dintr-o singură celulă. cea mai mare parte dintre ele fiind netransformate. O eficienţă bună de transformare este 106. Ambele tipuri de transformare necesită inducerea unei competenţe de transformare. coli nu are proprietăţi de transformare naturală.

Primul loc în utilizarea vizualizării acizilor nucleici aparţine electroforezei în gel de agaroză. Moleculele de acizi nucleici sunt încărcate negativ datorită grupărilor fosfat. Transformarea chimică este mai puţin eficientă decât electroporarea. dar mai ieftină deoarece nu necesită aparatură şi cuve costisitoare. Fiecare dintre cele două metode de transformare prezintă avantaje şi dezavantaje legate de eficienţa de transformare şi de costuri. Electroforeza acizilor nucleici Electroforeza este procesul de migrare a moleculelor cu sarcină într-un câmp electric. A – transformarea chimică cu CaCl2. A CaCl2 2 min 42ºC B Celule de E. Metoda este aplicată pentru analiza proteinelor şi a acizilor nucleici. mai ales în cazul fragmentelor mici. B – electroporarea celulelor bacteriene.coli Celule transformate de E. Transformarea celulelor bacteriene cu ADN plasmidic.coli Însămânţarea celulelor transformate pe mediu selectiv Spălarea celulelor bacteriene 1800 V 5 msec Figura 7. Această matrice este folosită mai rar în laboratoarele de analize genetice. Deşi metoda oferă o rezoluţie inferioară celei din poliacrilamidă. Desigur în amestecul de ligare numărul de molecule recombinate este mic şi din această cauză este recomandată o eficienţă cât mai mare a celulelor competente. deoarece este mai laborioasă.sau de câteva când avem un amestec eterogen de molecule ţintă. Pentru proteine se aplică cel mai des electroforeza proteinelor în condiţii denaturante în gel de poliacrilamidă (termenul englezesc SDS-PAGE). Poliacrilamida se poate utiliza ca matrice şi pentru electroforeza acizilor nucleici care oferă o rezoluţie foarte bună a separării fragmentelor de ADN. Migrarea moleculelor se realizează printr-o matrice specifică. Această sarcină face posibilă migrarea moleculelor de ADN şi ARN 25 . ea este utilizată cu succes deoarece este mai simplă.

B – fotografia aceluiaşi gel. Gelurile de agaroză sunt plasate între cei doi electrozi în cuve speciale care conţin tampon de migrare. Moleculele mici se vor deplasa mai repede prin porii matricei. dar în godeu separat se va migra un amestec de molecule cu mase moleculare diferite dar cunoscute. care fixată de ADN în lumină ultravioletă devine fluorescentă şi are o culoare portocalie (Figura 8). A – imaginea gelului la expunerea în UV. iar concentraţii mari pentru fragmente mici. Astfel separarea moleculelor va fi în dependenţă de masa lor moleculară. Separarea unor fragmente de ADN cu ajutorul electroforezei în gel de agaroză. Vizualizarea ne oferă informaţii despre integritatea ADN 26 . Cele mai folosite tampoane sunt TAE (Tris/Acetat/EDTA) şi TBE (Tris/Borat/EDTA). Amestecul de molecule nu se va deplasa în câmp electric cu aceeaşi viteză. Gelurile de agaroză de 1% sunt cel mai des utilizate. porii vor fi mai mari şi migrarea moleculelor mai rapidă. oferind separarea moleculelor între 0. Concentraţia agarozei în gel poate fi între 1 şi 3% în dependenţă de scopul urmărit. Acest amestec de molecule se numeşte marker molecular ADN. În concluzie concentraţii mai mici se folosesc pentru fragmente mari (câteva mii de pb).1 şi 10 kpb. Deoarece ADN nu poate fi vizualizat cu ochiul liber este necesară utilizarea unui colorant. Cu cât concentraţia agarozei este mai mare. A B Figura 8. Bromura de etidiu se intercalează între bazele azotate din molecula dublu catenară de ADN. Acest tampon este acelaşi folosit şi pentru realizarea gelului.într-un câmp electric de la catod la anod. Agaroza este un poliglucid extras din alge marine roşii. Lungimea de undă a luminii ultraviolete la care este expus gelul trebuie să fie cuprinsă între 260 şi 300 nm. iar cele mai mari vor avansa mai lent. Electroforeza în gel de agaroză este utilizată pentru vizualizarea şi purificarea ADN. Cel mai des folosită în acest scop este bromura de etidiu. Pentru estimarea aproximativă a mărimii fragmentelor în acelaşi gel. Gelurile de agaroză se realizează prin încălzirea agarozei într-un tampon specific. cu atât mărimea porilor va fi mai mică. La concentraţii mai mici de agaroză.

Pfu polimeraza. Verificarea moleculelor recombinate Rezultatul ligării şi transformării se poate vedea doar după 12-18 ore de la transformare când apar coloniile de E. Acest principiu presupune utilizarea unei variante de PCR pentru secvenţiere.(ADN genomic. Astfel de ADN polimeraze sunt Vent polimeraza. Această verificare este necesară deoarece ADN polimeraza utilizată pentru amplificarea insertului prin PCR poate introduce erori de sinteză. coli pe mediu selectiv. ADN plasmidic urmează a fi analizat iniţial prin digestie enzimatică şi apoi prin secvenţializare. Digestia ADN plasmidic se va realiza cu enzimele de restricţie cu care acesta a fost introdus în vector sau care se află la extremele situsului multiplu de clonare. Această digestie va confirma prezenţa insertului în plasmid şi aproximativ mărimea acestuia. Analizor Genetic CEQ™ 8800 Genetic Analysis System (laser cu detecţie pentru 4 fluorocromi). dar nu va furniza nicio informaţie despre secvenţa fragmentului clonat. Matriţa ADN ce urmează a fi secvenţiată este denaturată. Cultura se va incuba peste noapte cu agitare la 37°C. Apariţia coloniilor nu indică neapărat şi o reuşită deplină a clonării. dar asigură de obicei randamente de sinteză mai mari. Ambele aparate utilizează principiul Sanger de secvenţiere. a. ADN poate fi purificat din gel de agaroză după migrare prin excizarea fragmentului ţintă şi purificarea din gel cu kituri special predestinate acestui tip de purificări. Chiar dacă se foloseşte un sistem alb-albastru de selecţie a coloniilor pozitive. ADN plasmidic etc). Applied Biosystems. acestea necesită totuşi o dovadă în plus a prezenţei plasmidului recombinat. Secvenţializarea fragmentului ţintă este verificarea definitivă a clonării. Pentru a evita erorile în produşii PCR se poate utiliza o ADN polimerază care are proprietatea de a corecta erorile introduse. Tli polimeraza ş. apoi la unul din capetele sale are loc ataşarea 27 . estimarea cantităţii de ADN obţinută în reacţiile PCR sau de extracţie. rezultatul digestiilor enzimatice. SUA (laser cu detecţie pentru 5 fluorocromi). În cadrul Centrului de Biologie Moleculară există 2 secvenţiatoare: Analizorul Genetic ABI Prism 310. În unele cazuri se utilizează un amestec de 2 polimeraze (3 părţi de Taq polimerază şi o parte Pfu polimerază) pentru a combina un randament mai mare cu o fidelitate crescută. În acest scop se va efectua o cultură lichidă de 3-5 ml de mediu cu antibiotic care se va însămânţa cu o singură colonie. deoarece acestea pot conţine un amestec de colonii pozitive şi colonii cu plasmid fără insert. Ziua următoare din bacteriile rezultate se va purifica ADN plasmidic cu ajutorul unor metode clasice sau cu ajutorul unor kituri speciale. Taq polimeraza nu are activitate de corectare a erorilor.

Exprimarea genelor în sistem procariot Clonarea genelor vizează în principal două obiective posibile: multiplicarea unui fragment ADN sau exprimarea genei clonate. Rezultatul acestui PCR vor fi fragmente monocatenare (deoarece se foloseşte o singură amorsă) de diferite mărimi. Migrarea fragmentelor în gel este în dependenţă de mărimea lor. Pentru fragmente mai mari sau pentru matriţe dificile (cu secvenţe repetitive) este necesară utilzarea unor kituri speciale. deoarece ADN polimeraza nu poate adăuga următorul nucleotid.unei amorse de la care ADN polimeraza va porni sinteza catenei complementare. Lipsa acestei grupări va face imposibilă continuarea sintezei ADN. Amestecul de fragmente rezultate sunt separate cu ajutorul electroforezei capilare. iar fluorescenţa emisă va fi captată şi prezentată sub forma unei electroforegrame (Figura 9). Electroforegrama unei secvenţe obţinută cu ajutorul analizorului ABI Prism 310. iar clonele pozitive sunt apoi secvenţializate. Figura 9. Mărimea fragmentelor de ADN care pot fi secvenţializate variază între 600 şi 800 pb. care presupune utilizarea unui capilar cu un diametru de ordinul micrometrilor. O cantitate de câţiva microlitri vor fi separaţi în gelul din capilar. ceea ce permite sinteza tuturor fragmentelor care se opresc în toate punctele matriţei de ADN. 28 . Pentru detecţia fragmentelor. fiecare ddNTP este marcat cu un fluorocrom. iar la final cele mai mari. În ultima parte a capilarului există o fereastră transparentă prin care un fascicol laser va excita fluorocromii. În acest scop amestecul de fragmente se clonează într-un vector de clonare. Numărul de cicluri este de 40. Amestecul PCR conţine dezoxiribonucleozide trifosfat (dNTP) dar şi di-dezoxiribonucleozide trifosfat (ddNTP) care nu conţin gruparea OH în poziţia 3' a dezoxiribozei. Electroforegramele sunt apoi analizate şi comparate cu secvenţa existentă în bazele de date. Clonarea în scopul multiplicării fragmentului este utilizată atunci când ADN supus analizei este de fapt un amestec de fragmente care nu pot fi separate cu ajutorul electroforezei şi la care se urmăreşte cunoaşterea secvenţei. cele mai mici vor fi primele.

Promotorii din aceste tipuri de plasmide sunt de tip inductibil. Promotorul T7 nu este recunoscut de către ARN polimeraza de la E. situsul de recunoaştere a ribosomilor. Vectorii pET necesită tulpini de E. atunci în genă se va păstra codonul STOP şi traducerea se va opri înainte de etichetă. coli care conţin gena pentru ARN polimerază de la fagul T7. Dacă se optează pentru prezenţa unei etichete 6×His la capătul C-terminal a proteinei pentru facilitarea purificării. atunci din genă se va înlătura codonul STOP. coli sunt utilizate pe larg în obţinerea de proteine recombinate. Cel mai des utilizat inductor este IPTG (isopropil-tio-galactozid). coli în lipsa inductorului. Spre exemplu. un situs de legare a ribosomilor (rbs). Plasmidele de exprimare conţin neapărat un promotor recunoscut de ARN polimeraza celulei gazdă. 29 . Ele pot fi numite adevărate fabrici de proteine la comandă. Inhibiţia exprimării genei pentru ARN polimeraza de la fagul T7 şi a genei ţintă în celulele gazdă de E. codonul START în situsul multiplu de clonare şi codonul STOP după o etichetă de 6 histidine. care este un analog al galactozei. Figura 10. coli şi simpla prezenţă a plasmidului în celulele bacteriene nu va sigura o exprimare a genei. Dacă această etichetă nu este necesară. care însă câteodată „refuză” să sintetizeze proteinele comandate şi de ce cele mai dese ori străine celulei bacteriene. Această genă se află sub controlul promotorului lac UV5 şi a operatorului lac (Figura 10). un codon START şi unul STOP la capetele situsului multiplu de clonare. Gena codificatoare poate fi clonată direct în vectorul de exprimare. Foarte important în acest caz este păstrarea cadrului deschis de citire. adică împărţirea exactă pe codoni a genei de la primul codon tradus până la ultimul. Plasmidul pET21 conţine promotorul de la fagul T7. vectorii de tip pET de la Novagen asigură de obicei o supraexprimare a genelor clonate.Celulele de E. Clonarea în scopul exprimării genei şi obţinerii de proteină recombinată include câteva aspecte care sunt importante pentru exprimare.

În absenţa T7 ARN polimerazei nu va exista nici transcrierea genei ţintă din plasmid. astfel promotorul lac devine accesibil pentru ARN polimeraza de E. 30 .Operatorul lac este o secvenţă recunoscută de către o proteină numită represorul lac. atunci se poate recurge la înlăturarea acesteia prin digestie cu peptidaze. Reprezentarea schematică a purificării de proteine recombinate prin cromatografie de afinitate. Purificarea proteinelor recombinate Proteinele recombinate pot fi purificate prin metode cromatografice. care în acest caz este gena pentru T7 ARN polimerază. ceea ce reduce timpul necesar şi asigură randamente de purificare mai mari (Figura 11). Agentul care induce exprimarea este un analog al galactozei IPTG. Aceasta din urmă va recunoaşte promotorul T7 din plamsid şi va transcrie gena ţintă. A B C Figura 11. Moleculele de IPTG se fixează de represorul lac şi cauzează disocierea acestuia de la operatorul lac. Pentru o purificare cât mai bună din amestecul total de proteine este necesară purificarea în cel puţin 2 etape prin metode cromatografice diferite. C – eluarea proteinei ţintă de pe coloană. Represorul lac este codificat de gena lacI care se află atât în genomul bacteriei gazdă cât şi în plasmidul de exprimare. cum este spre exemplu situsul pentru trombină în cazul plasmidului pET28. coli care va transcrie gena pentru T7 ARN polimerază. Ataşarea unor etichete la proteinele recombinate asigură purificarea proteinelor într-o singură etapă. B – spălarea coloanei cu tampon şi fixarea proteinei ţintă de răşină. În acest scop pentru clonare şi exprimare se va alege un plasmid care conţine situsul pentru peptidază. A – încărcarea amestecului total de proteine pe coloana cu răşină. Atunci când în mediu nu există lactoză (sau analogi ai lactozei) represorul lac se fixează la operatorul lac şi împiedică transcrierea genei pe care o reglează. Dacă eticheta deranjează în analiza ulterioară a proteinei. Acest sistem de exprimare este unul foarte puternic şi care poate asigura o producţie de proteină care va alcătui până la 50% din proteinele totale bacteriene.

• fuzionării. În cele mai multe cazuri purificarea unei proteine din celulele în care aceasta se exprimă în mod firesc natural prezintă mai multe dificultăţi: • cantitatea de proteine în ţesuturi este foarte mică. iar rezultatul purificărilor în câteva etape pot fi sub 100 mg de proteină. • proteinele recombinate pot fi marcate. spre exemplu pentru purificarea unei proteine din bacterii este necesară o cantitate de zeci de litri de cultură bacteriană. Una dintre aplicaţiile acestei tehnici. spre exemplu cum este cazul unor bacterii pe care nu putem să le cultivăm în condiţii de laborator. • obţinerea materialului pentru purificare implică probleme etice. • obţinerea unei cantităţi mari de ţesut pentru purificare este aproape imposibil. Un mare avantaj al acestei metode este posibilitatea introducerii de mutaţii care pot dezvălui rolul unor domenii sau aminoacizi particulari în activitatea proteinei. importante nu numai pentru biologie. se pot fuziona proteine între ele sau regiuni ale unei proteine cu regiuni ale altei proteine. consumabile şi are randamente mai mici. Prin intermediul tehnicilor de mutageneză pot fi introduse mai multe tipuri de mutaţii: • mutaţii missens care schimbă un aminoacid cu altul. spre exemplu regiunea N-terminală a unei proteine de la o specie se poate fuziona cu capătul C-terminal al aceleiaşi proteine de la o specie înrudită. • purificarea se face în mai multe etape care necesită timp. dar şi pentru studii interdisciplinare este utilizarea ei în scopul obţinerii de proteine recombinate.2. • inserţii care constau în introducerea de fragmente noi în gena codificatoare şi respectiv în proteina recombinată. Aceste dezavantaje ale purificării direct din material biologic sunt eliminate în cazul exprimării genelor în celule gazdă. obţinerea de proteine din celule umane ar fi imposibilă. cum ar fi spre exemplu cazul unor proteine umane. • deleţii în care porţiuni întregi din lanţul polipeptidic pot fi înlăturate. Clonarea genelor şi exprimarea lor în celule gazdă reprezintă o sursă foarte preţioasă de proteine. Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare Clonarea genelor în ultimii ani a devenit o tehnică indispensabilă în laboratoarele de biologie moleculară. Proteinele pot fi marcate 31 .

32 . a. Există cazuri când acumularea proteinei sub forma corpilor de incluziune este un avantaj. Exprimarea proteinelor sub forma corpilor de incluziune nu poate fi prezisă pe baza apartenenţei genei sau pe baza analizei structurii primare. în mod specific sau randomic. în alte cazuri este nevoie de condiţii speciale şi alte proteine care contribuie la adoptarea conformaţiei proteinei active. Clonarea genelor şi exprimarea lor în sistem procariot este tehnica la care se apelează cel mai des. Un alt exemplu este marcarea proteinelor prin fuziunea lor cu proteine fluorescente. Unele proteine atât de la eucariote cât şi de la procariote sintetizate în celule gazdă de E. Exprimarea genelor şi sinteza proteinelor în celulele procariote asigură doar structura primară exactă a polipeptidului sintetizat. astfel o proteină are structură: primară. terţiară şi cuaternară. Lipsa modificărilor post-traducere este un avantaj atunci când este cunoscută funcţia proteinei active şi se doreşte să se cunoască rolul grupărilor care sunt adăugate după sinteză. Un exemplu în acest sens este marcarea proteinelor cu izotopi stabili sau radioactivi. glicozilări ş. coli nu reuşesc să adopte o structură secundară corectă. Majoritatea proteinelor de la eucariote necesită nu numai adaptări conformaţionale dar şi modificări post-traducere cum ar fi fosforilări. Corpii de incluziune oferă posibilitatea unei purificări printr-o singură etapă în condiţii denaturante.cu anumite molecule care sunt introduse în proteine în procesul lor de sinteză sau pot fi fuziuni. În acest fel proteina recombinată nu va fi modificată şi se va putea deduce rolul acestor grupări în activitatea proteinei. secundară. Dacă prezenţa acestor modificări este absolut necesară. Cel mai important aspect pentru imunizare este secvenţa de aminoacizi a proteinei şi nu structura ei secundară sau terţiară. deoarece este mai rapidă şi mai puţin costisitoare. Proteinele denaturate purificate în acest mod pot fi utilizate pentru imunizarea de animale în scopul producerii de anticorpi. Proteinele sunt structuri cu mai multe nivele de organizare. O altă problemă care poate apărea este neexprimarea genei. atunci se va recurge la clonarea genei în sistem procariot şi exprimarea ei în celule gazdă eucariote. Un alt dezavantaj (deşi în unele cazuri este un avantaj) este lipsa modificărilor post-traducere a polipeptidelor sintetizate în celule bacteriene. iar ca rezultat polipeptidele acumulate în citoplasmă formează corpi de incluziune. Cauzele neexprimării pot fi toxicitatea proteinei asupra celulelor gazdă. care apoi facilitează detecţia lor. În unele cazuri proteinele adoptă structura secundară independent după sinteză.

rezoluţie 1 nm.3. autocalibrare. 48 probe Masurarea pH-ului. Japonia Patru instalaţii electroforeză proteine. Consort. Germania “Thermocycler”. gradient de temperatură în tub Pentru amplificarea ADN-ului prin PCR în tuburi de 0. Olanda Două balanţe analitice. cu termostatare. Germania Spectrofotometru UV-Vis monofascicul M301. 198-1000 nm. Consort. Australia Electroporator Eppendorf.2 MΩ/cm (apa MilliQ) Centrifugarea probelor. Snijders Scientific. Corbett Research. Belgia Şase instalaţii electroforeza acizi nucleici. răcire de la temperatura camerei la 0°C. Germania Centrifugă de masă Sigma 1-13. 32 probe Electroforeza orizontală în gel de agaroză.1mg la 160g. Japonia Congelator temperaturi foarte scăzute. Belgia Congelator temperaturi foarte scăzute. (3%) 33 . 13000xg) Pentru amplificarea ADN-ului prin PCR în tuburi de 0. Germania Caracteristici Achiziţia şi interpretarea imaginilor de pe geluri de poliacrilamidă sau geluri de agaroză Purificarea apei până la o rezistivitate de 18. rotor 8x50ml şi rotor 4x250ml Fără răcire cu rotor Eppendorf (12 tuburi.2ml şi plăci ELISA cu 96 de godeuri. Jasco. de la 0. Scaltec. pentru cinetică enzimatică Electroforeză verticală în gel de poliacrilamidă. Eppendorf. 100 litri. Marea Britanie Instalaţie de apă ultrapură. maximum 28000xg. Memmert. Sigma. 198-1000 nm. interfaţă pentru calculator şi imprimantă Incubarea culturilor bacteriene şi a probelor moleculare de la temperatura camerei la 70ºC Incubarea probelor biologice pana la 100ºC.2ml la 1 litru.2ml. Sigma. Belgia pH-metru P901 (două bucăţi). Germania Doua bai de apa cu agitare. rezoluţie 1 nm Interval de fotometrare. 70 litri.5ml şi placi ELISA cu 96 de godeuri. Memmert. Germania Două incubatoare bacteriologice. Sanyo. 0. max. electrod combinat prevăzut cu senzor de temperatură Congelare probe biologice la -82ºC Congelare probe biologice la -82ºC Domeniul de măsurare de la 0. rotor Eppendorf (24 tuburi). Elga-Lab Water. max. gradient de temperatură Transformarea celulelor electrocompetente – bacterii şi drojdii Interval de fotometrare. Infrastructura existentă în cadrul Centrului de Biologie Moleculară Denumire echipament Instalaţie de preluare şi prelucrare a imaginilor Ced Limited. Marea Britanie Spectrofotometru Jasco V-530 dublu-fascicul cu termostatare. Germania “Thermocycler”. Marea Britanie Centrifugă cu răcire Sigma 3K18 (4 rotoare). Consort. rotor 6x30ml. CamSpec.

97%).. 4th edition. (2002).. ţesuturilor animale şi Sonics & Materials vegetale în volume de la 1ml până la 1 litru Hota PCR cu flux laminar Flux laminar vertical. Pasternak J. 5th edition.. Spania re. New York: W... New York: Garland Science.L. (2009). Japolă. Miller J. DNA Cloning: A Practical Approach: Expression Systems (The Practical Approach Series). and Lewontin R...M. Roberts K.. Raff M. Freeman Company. mateAutoclav AE-75-DRY Raypa. 6. Molecular Cell Biology.3 Hota flux laminar biohazard µm 99.C. SUA laser cu detecţie pentru 5 fluorocromi Analizor Genetic CEQ™ 8800 Genetic Analysis System laser cu detecţie pentru 4 fluorocromi Instalaţie Real Time PCR.... 7th edition. Lewontin R. Coreea de Sud reglabil în 9 trepte (0. Alberts B. Spania Sterilizarea umedă sau uscată a mediilor de cultură. Biochemistry. and Walter P.5 m/s). 5. Glick B.T. 4. Applied Biosystems.. Selecta. 8. Hames B. (2002). Jasco. Matsudaira P. Johnson A. H.L. Zipursky L. contrast de fază şi fluorescenţă nia Autoclav 80l. Modern Genetic Analysis.. Lodish H.. Gelbart W. Molecular Biology of the Cell. New York: W. rialelor şi instrumentelor Spania Ultrasonicator cu patru sonde.97%).. Oxford University Press.J. H. Amplificarea ADN-ului în timp real. Brown T. iluminasteril. H. 5th edition New York: W. Freeman Company.. Baltimore D.. Glover D.M. electroforeza capilară la 15kV.. detecţia simultană a 4 fluorocromi Separarea probelor prin cromatografie de înaltă perforInstalaţie HPLC.A... 9. ASM Press. (2000). (1999). 3. soft-uri speciale pentru secvenţiere şi genotipare. 4. Nikon.. An Introduction to Genetic Analysis. 2. (2006). Freeman Company. Corbett Research. Telstar. New York: W. Lewis J.M.3 um 99.Analizor Genetic ABI Prism 310. 7. Miller J. Patten C.. flux de aer 100. prefiltru reciclabil (3-30 µm). gradient binar de înaltă presiune şi gradient cuaternar de joasă presiune Microscop inversat NIKON Studiul preparatelor celulare şi tisulare în lumina normaEclipse TE2000S. Manipulation and Expression of Recombinant DNA. Berg J.. Griffiths A.. Darnell J. filtru bacteriologic HEPA. 2nd Edition. preparare probe PCR (4% Filtru exahustare HEPA (0. and Robertson D. 4th edition. 34 . Japonia manţă.. 4th edition.C. Academic Press. Gene Cloning and DNA Analysis: An Introduction. identificare umană şi determinarea polimorfismelor genetice. Freeman Company.. (2000).M. filtru HEPA (0. H. Berk A. and Stryer L. Dezintegrarea celulelor bacteriene. Griffiths A.D. (2005).35-0. Australia Secvenţierea fragmentelor de ADN... Wiley-Blackwell Publishing. Suzuki D...Bibliografie 1...R. 2d edition. Carson S. and Gelbart W. Molecular Biotechnology: Principles and Applications of Recombinant DNA. Tymoczko J. (1995).

J. 1 edition. 35 .. and. Working with DNA (THE BASICS (Garland Science)). Freeman Company. H.. (2000).. Taylor & Francis. Caudy A. W. Witkowski J.A.. 13. McPherson M.M. Electroforeza proteinelor în geluri de poliacrilamidă. 1990. 11. 1st edition.. 3rd Edition. Springer-Verlag Telos.10.. Mǿller S.A Short Course. (2007).. Basics: from Background to Bench.G. Bucureşti. Myers R. Popescu O. Metzenberg S. PCR. Watson J.A. (2006). 12. Editura Tehnică.D. Recombinant DNA: Genes and Genomes ..

piruvat şi săruri de amoniu........... care nu se găsesc în natură............ • cantităţile produse şi concentraţiile sunt mai mari............ folosite în exces.... 36 2...... La început... Metoda enzimatică de sinteză a acizilor aminaţi Un număr mare de aminoacizi se pot obţine prin sinteză enzimatică.. Iulia Lupan Cuprins 1..... Această metodă capătă o amploare mai mare pe an ce trece datorită cererii mari de aminoacizi... Pentru a reduce costul sintezelor............... O sursă de triptofanază 36 .... se foloseau enzime nerecombinate produse de microorganisme..... Tendinţe actuale în aplicarea bionanotehnologiilor ........... Totuşi metoda enzimatică prezintă unele avantaje faţă de alte metode.......... care nu se pot obţine prin fermentare directă sau prin extracţie.. pornind de la indol..... presiune..... 57 3...... şi de derivaţi ai acizilor aminaţi.... dr............ enzimele nu se purificau şi se folosea lizatul celular ce conţinea enzime specifice...... Imobilizarea enzimelor în sintezele enzimatice prezintă două avantaje importante şi anume reutilizarea multiplă a enzimelor costisitoare şi recuperarea substratelor rămase. pH.... univ........... care nu se aplică la scară industrială la fel ca în fermentarea directă. Sinteza enzimatică continuă prin imobilizarea enzimelor a fost aplicată în producerea L-tirozinei cu β-tirozinază şi a triptofanului cu triptofanază. deoarece: • izomerii optici ai aminoacizilor se pot obţine direct din substratele corespunzătoare.... Bibliografie ...... • necesită condiţii blânde de temperatură............. Metoda enzimatică de sinteză a acizilor aminaţi.... din cauza costurilor prea mari a substratelor..Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare Asist. • se pot obţine derivaţi ai aminoacizilor sau aminoacizi rari..................... fiind stimulată sinteza lor prin diverse metode.... • se pot sintetiza D-izomeri. 60 1.. • sintezele sunt uşor de manipulat....................... pentru producerea acizilor aminaţi pe cale enzimatică.

. În strategia de sinteză s-au utilizat enzime provenite de la un singur microorganism şi anume Bacillus megaterium.poate fi lizatul brut de E . [1990] au sintetizat L-alanina şi L-valina folosind sistemul cuplat de alanin dehidrogenază. 1976]. Sistemul multienzimatic a fost utilizat şi în sinteza L-leucinei din α-cetoisocaproat. Acest impediment a cauzat folosirea sistemelor enzimatice cuplate. Producerea continuă de L-valină folosind valin dehidrogenaza şi glucozo dehidrogenaza pentru regenerarea NADH a fost studiată detailat [Monot şi colab. Celule imobilizate de E. 1985] şi formiat dehidrogenaza de la Candida boidinii. 37 . 1976].. 1990]. Imobilizarea asigură sinteza continuă a aminoacizilor şi reciclarea amoniului şi piruvatului neutilizate. NADPH).. 3-fluoroalanina s-a obţinut din 3-fluoropiruvat. 1973]. 1974]. Honorat-Pascal şi colab. 1988. Sinteza continuă a fost realizată prin încorporarea enzimelor în gel de poliacrilamidă.. Honorat şi col. nu permite extinderea sintezelor la scară industrială. Fukui şi colab.. Aceeaşi metodă de imobilizare a fost folosită şi în sinteza alaninei cu celule de Pseudomonas dacunhae care prezentau o activitate mare a L-aspartat β-carboxilazei [Fusee şi Weber. Mediul de sinteză mai conţine formiat de amoniu. S-a testat eficienţa sintezelor în cazul folosirii lizatelor şi a enzimelor purificate.. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab. respectiv valin dehidrogenază. 1981. Astfel.coli. iar ionul formiat pentru reacţia de regenerare a NADH [Oshima şi colab. 1988]. în cazul folosirii fracţiunilor purificate. folosite în exces [Deconttignies-Le Maréchal şi colab. costisitori în sintezele enzimatice. Producerea acidului aspartic la scară industrială s-a realizat enzimatic pornind de la fumarat şi săruri de amoniu şi utilizând aspartaza ca şi catalizator [Chibata şi colab. Utilizarea enzimelor de la microorganismele termofile prezintă avantajul că au o stabilitate mai mare. în care se utilizează enzime pentru regenerarea cofactorilor.. în cazul folosirii lizatului brut până la 92%... cu glucozo dehidrogenază pentru regenerarea NADH. Tosa şi colab. la care s-a indus sinteza acestei enzime. ionul de amoniu fiind necesar în reacţia de sinteză a aminoacidului. reacţie catalizată de alanin dehidrogenază într-un sistem cuplat cu formiat dehidrogenaza pentru regenerarea NADH. 1984]. Numai în cazul sintezei alaninei s-a evidenţiat o creştere a randamentului sintezei de la 80%. 1979. pentru regenerarea NADH [Schütte şi colab. Utilizarea de cofactori (NADH.. utilizând leucin dehidrogenază de la Bacillus stearothermophilus [Oshima şi colab.

această caracteristică fiind foarte importantă pentru industria farmaceutică.X) sunt enzime care fac parte din familia oxidoreductazelor. caracteristic în unele patologii. leucin dehidrogenaza (LeuDH). dar există şi câteva enzime care reacţionează şi cu aminoacizii β. Aceste enzime catalizează eliminarea grupării amino din L-aminoacizi cu formare de cetoacizi corespunzători. în prezenţă de NAD(P)+.Aminoacid dehidrogenaze Aminoacid dehidrogenazele (EC 1. care este comun pentru toate aceste enzime. Aminoacid + NAD+ + H2O ↔ α-cetoacid + NADH + H+ + NH3 Majoritatea aminoacid dehidrogenazelor sunt specifice pentru α-aminoacizi.1. Enzima are un rol important în furnizarea energiei necesare germinării sporilor. L-alanina + NAD+ + H2O ↔ piruvat + NADH + H+ + NH3 Alanin dehidrogenaza a fost descrisă de către Wiame şi Piérard în 1955 [Norbert şi colab. Deoarece ele acţionează stereospecific.1) catalizează reversibil reacţia de dezaminare a L-alaninei cu formare de piruvat. cu excepţia domeniului de legare a cofactorului. care pot să monitorizeze nivelul ridicat de aminoacizi din plasma sanguină.. 1994]. Alanin dehidrogenaza (L-alanin oxidoreductază NAD+ dependentă. enzimele produc L-izomeri ai aminoacizilor naturali puri. 38 . Alanin dehidrogenaza Aminarea reductivă a cetoacizilor la L-aminoacizi în procese NAD(P)H-dependente este catalizată de o suprafamilie de enzime omoloage de aminoacid dehidrogenaze. 1. alanin dehidrogenazele şi suprafamilia de aminoacid dehidrogenaze au evoluat separat [Baker şi colab.4. valin.4.. Cele mai bine studiate aminoacid dehidrogenaze sunt cele care au importanţă industrială (fenilalanin-. care include fenilalanin dehidrogenaza (PheDH). Deşi realizează unul şi acelaşi proces biologic. valin dehidrogenaza (ValDH) şi glutamat dehidrogenaza (GluDH). alanin-. Aceste enzime au întrebuinţare şi în sinteza industrială de aminoacizi. Aminoacid dehidrogenazele au fost intens studiate în vederea utilizării lor în diverse ramuri industriale. Ele au fost folosite la construirea biosenzorilor. S-a demonstrat că în lipsa enzimei sporularea avea loc cu mari dificultăţi [Siranosian şi colab.1..şi glutamat dehidrogenaza). 1998]. leucin-. Nu există asemănări semnificative între secvenţele alanin dehidrogenazelor (AlaDH) şi membrii acestei familii de aminoacid dehidrogenaze. Această enzimă a fost purificată şi studiată în principal la mai multe specii din genul Bacillus.

1988].. B. cereus. mediu acid sau alcalin. stabile şi la alţi factori care afectează proteinele. 1989].9) (LeuDH) este o oxidoreductază NAD+-dependentă. deoarece sunt mai stabile.. stearothermophilus. în general.3. Leucin dehidrogenazele studiate provin în mare parte de la genul Bacillus precum şi de la Thermoactinomyces [Ohshima şi colab. Leucina + NAD+ + H2O ↔ α-cetoisocaproat + NADH + NH4+ + H+ Echilbrul reacţiei este deplasat spre formarea aminoacidului. cât şi 3-hidroxipiruvatul.. coli.1993]. [Delforge şi colab. Una din aceste enzime este cea de la B. Natronobacterium magadii MS-3 [Katoh şi colab. Ca şi majoritatea aminoacid dehidrogenazelor. solvenţi organici. Aminoacizii din vecinătatea acestei lizine prezintă o regiune conservată. 1989]. care catalizează reversibil dezaminarea L-leucinei şi a unor L-aminoacizi alifatici la cetoacizii corespunzători. Majoritatea enzimelor studiate sunt hexameri.1) catalizează reversibil transformarea acidului L-aspartic la fumarat şi NH4+. AlaDH poate utiliza ca substrate în reacţia de aminare atât piruvatul. detergenţi. O mare atenţie s-a acordat leucin dehidrogenazelor provenite de la microorganisme mezotermofile. Această enzimă poate fi foarte utilă în sinteza de L-serină din 3-hidroxipiruvat [Nagata şi colab. fiind. a cărei genă codificatoare a fost clonată. cum ar fi enzime proteolitice.. B. sphaericus. Mycobacterium. subtilis. Aspartat amoniu-liaza L-aspartat amoniu-liaza (AAL) sau aspartaza (EC 4. Lizina din poziţia 74 din secvenţa de aminoacizi a AlaDH de la B. dar care nu este specifică altor aminoacid dehidrogenaze. Mecanismele cinetice ale AlaDH au fost studiate la mai multe specii. iar proteina exprimată în celule de E.1. Alanin dehidrogenaza este o enzimă NAD+ dependentă. prin denaturare termică.1.4. Leucin dehidrogenaza Leucin dehidrogenaza (EC 1.. Diferenţele de termostabilitate ale proteinelor totale de E. 1994]. coli şi proteina recombinată de LeuDH permit purificarea acesteia într-o singură etapă.. Alanin dehidrogenaza este o enzimă oligomerică. cu ultimul reacţia fiind mult mai lentă. stearothermophilus. Enzima nu-şi pierde activitatea după incubare timp de 30 min la 70ºC [Oka şi colab. Enzimele termostabile nu prezintă numai avantajul termostabilităţii. Anabaena. iar NADH în reacţia de aminare. cum ar fi cele de la B. 2003]. NAD+ se leagă înaintea piruvatului în reacţia de dezaminare oxidativă. Această 39 . 1997]. Un caz unic printre alanin dehidrogenazele bacteriene este cea de la Bacillus sp DSPM730 care reacţionează în egală măsură cu ambele substrate. LeuDH intervine în catabolismul unor aminoacizi. B. subtilis este esenţială în cataliză şi este conservată şi la alte alanin dehidrogenaze. Thermus. [Nagata şi colab.

Amorsele utilizate pentru amplificarea prin PCR a genelor.enzimă joacă un rol important în metabolsimul azotului la bacterii. Acest vector oferă posibilitatea exprimării genelor la inducere cu IPTG. Vectorii de exprimare au fost digeraţi cu aceleaşi enzime de restricţie. alanin dehidrogenaza şi aspartaza s-a utilizat vectorul de exprimare pET21b (Novagen). Produşii de digestie (produşii PCR şi vectorii) au fost separaţi cu ajutorul electroforezei în gel de agaroză. Produşii PCR au fost purificaţi din gel şi digeraţi cu enzimele de restricţie corespunzătoare (Tabel 1). alanin dehidrogenaza de la Bacillus subtilis. Pentru clonarea genelor ce codifică leucin dehidrogenaza. Majoritatea aspartazelor studiate au masa moleculară în jur de 200 kDa şi sunt alcătuite din patru monomeri identici. la pH mai mic ea nu necesită ioni de metal [Karsten şi Viola. Enzima AlaDH Q08352 LeuDH P13154 ALL (P0AC38) Amorsele utilizate 5΄-GAGGGATCCGATGATCATAGGGGTTCCTAAAG-3΄ 5΄-GGTCTCGAGTATAGCACCCGCCACAGATGATT-3΄ 5΄-GGTGGATCCGATGGAATTGTTCAAATATATGG-3’ 5΄-TATTCTCGAGTATTGCCGAAGCACCTGC-3΄ 5' –GGTAGGATCCGATGTCAAACAACATTCGTATCG– 3' 5' –GCTACTCGAGTTACTGTTCGCTTTCATCAGTA– 3' Escherichia coli Bacillus subtilis Bacillus stearothermophilus Organism sursă Enzime de restricţie BamHI XhoI BamHI XhoI NdeI BamHI NdeI BamHI NdeI BamHI Vector utilizat pET21b pET21b pET21b 5'-GGAATTCCATATGCTGAACGAAACTCCCGCAC-3' GalM Escherichia coli (P0A9C3) 5'-CGCGGATCCTCACTCAGCAATAAACTGATATTCCG-3' GlucDH P12310 5΄-GGAATTCCATATGTATCCGGATTTAAAAGGAAAAG-3΄ 5΄-CGCGGATCCTCAACCGCGGCCTGCCTGG-3΄ Bacillus subtilis pET24a pET24a Fragmentele ADN au fost purificate din gelul de agaroză. 1991]. Enzima este activată în prezenţă de ioni de Mg2+ la un pH alcalin. Tabelul 1. de circa 50 kDa. Metode Clonarea genelor pentru aminoacid dehidrogenaze Genele ce codifică leucin dehidrogenaza de la Bacillus sterothermophilus. care are proprietatea de a 40 . Pentru inserarea genelor în vectori s-a utilizat ADN ligaza. glucoz dehidrogenaza de la Bacillus subtilis şi aspartaza de la Escherichia coli au fost amplificate prin metoda PCR utilizând amorse specifice. În secvenţa amorselor au fost incluse situsurile pentru enzime de restricţie necesare inserării genei în vectorul de exprimare.

AlaDH 1 2 3 94 67 43 LeuDH 1 2 3 AAL 1 94→ 67→ 43→ ←54 2 ← ← 42→ ← ← ← ← 94 67 43 → → → → → ← 42 30 20. Celulele bacteriene au fost preluate în tampon Tris HCl pH=8. preum şi masele moleculare ale proteinelor recombinate. O purificare a proteinelor recombinate ar implica costuri şi timp suplimentar.4 30→ 20. După sonicare extractul bacterian a fost centrifugat (20 min la 21 000 ×g la 4°C).4→ 30 20. coli. coli a fost urmărită cu ajutorul electroforezei în gel de poliacrilamidă în condiţii denaturante în prezenţă de SDS (Figura 1). s-a indus exprimarea genelor cu izopropil-β D-tiogalactopiranozid (IPTG) 1 mM. Secvenţele genelor clonate au fost verificate prin secvenţializare cu un aparat ABI Prism 310 Genetic Analyzer utilizând kitul de secvenţializare BigDye Terminator v3.reface legăturile fosfoesterice. După ce densitatea optică (DO) la 600 nm a atins valorile de ~1. Producerea de proteine recombinate Pentru exprimarea genelor. Pereţii celulelor bacteriene au fost distruse prin sonicare. Pentru obţinerea de proteine recombinate s-au realizat culturi mai mari (0. Analiza exprimării genelor şi sintezei de proteine recombinate în celulele de E. Sinteza de proteine recombinate în celulele gazdă de E. După câteva ore de la inducere (3-5 ore) bacteriile au fost centrifugate şi păstrate la -80°C până la utilizare. Se poate observa cantitatea mare de proteine recombinate raportată la cantitatea de proteine totale din celulele bacteriene. Sintezele enzimatice au fost realizate cu extracte celulare bacteriene. Cu cifre sunt indicate masele moleculare ale proteinelor din markerul molecular. iar orice proces biotehnologic este cu atât mai valoros cu cât implică mai puţine costuri.1 (Applied Biosystems).0 50 mM.5-1L). 41 . moleculele corect recombinate au fost introduse prin transformare în tulpina de Escherichia coli BL21(DE3). Moleculele recombinate rezultate după ligare (vector + gena) au fost introduse prin transformare în tulpina de Escherchia coli DH5α.1 Figura 1.1→ 14.1 14. iar supernatantul cu proteinele solubile a fost utilizat pentru măsurarea activităţii enzimatice.

NH4Cl 1 M. S-a ales porţiunea dreptei cu activitatea cea mai mare. care are un coeficient molar de extincţie la aceasă lungime de undă egal cu 2. L-leucină 10 mM. glicocol 50 mM pH 10.0 d) GalM (galacto mutarotaza): glucoză 10 mM.0 în reacţia de aminare. NADH 0. L-alanină 10 mM. NAD 2 mM.3. NH4Cl 1 M.15 mM. MgCl2 6 mM Pentru măsurarea activităţii enzimatice a aspartzei s-a urmărit formarea acidului fumaric la 240 nm. Tris HCl 50 mM pH 8. Tris HCl 50 mM pH 8. glicocol 50 mM pH 10. Tris HCl 50 mM pH 8. NAD 2 mM.05 şi 0. Sinteza de aminoacizi marcaţi cu 15N Mediul de reacţie pentru sintezele de aminoacizi marcaţi cu 15N a conţinut: 42 . astfel încât valorile DO/min să fie cuprinse între 0. NADH 0.0 f) AAL (aspartat amoniuliaza): acid L-aspartic 100 mM.54 ·103 ·M-1 ·cm-1.0 în reacţia de aminare. Pentru măsurarea activităţii enzimatice s-au folosit câţiva µl de enzimă purificată sau extract brut bacterian.5 în reacţia de dezaminare b) AlaDH (alanin dehidrogenaza): piruvat 10 mM.15 mM. GDH 1 U e) LDH (lactat dehidrogenaza): piruvat 1 mM. Tris HCl 50 mM pH8. Activitatea enzimatică s-a calculat după formula: A=[(DO/min)/6.5 în reacţia de dezaminare c) GDH (glucozo dehidrogenaza): glucoză 10 mM.5. NAD 2 mM.15 mM. NAD 2 mM. La această lungime de undă NADH prezintă maximul de absorbanţă şi are un coeficient molar de extincţie de 6.22 ·103 ·M-1 ·cm-1. NADH 0. Mediile de reacţie pentru enzime au fost următoarele: a) LeuDH (leucin dehidrogenaza): cetoacid 10 mM.0. Tris HCl 50 mM pH 8.22]*(Vr/Vp) *FD *103 U/l DO/min – variaţia densităţii optice pe minut la 340 nm Vr – volumul reacţiei Vp – volumul probei FD – factorul de diluţie O unitate enzimatică (1U) corespunde formării unui µmol de produs într-un minut.Măsurarea activităţii enzimatice a enzimelor Măsurătorile de activitate enzimatică a dehidrogenazelor s-au efectuat la 30ºC cu un spectrofotometru Jasco V-530 urmărindu-se scăderea absorbanţei NADH (reacţia de aminare a cetoacizilor) sau formarea acestuia (reacţia de dezaminare a aminoacizilor) la 340nm. Tris HCl 50 mM pH 8.

Activarea umpluturii s-a făcut prin tratare cu HCl 2N. 200 µl de fenolnitroprusiat.8 0. 200 µl de hipoclorit de sodiu şi 590 µl apă. Amestecul de sinteză filtrat s-a încărcat pe coloană şi apoi s-a spălat cu apă (10 volume). Pe baza curbelor etalon s-a calculat cantitatea de ion de amoniu rămas în mediul de sinteză. Aminoacidul s-a eluat cu NH4OH 1M. Reacţia s-a declanşat prin adăugarea enzimelor. Controlul eluării s-a făcut cu ninhidrină pentru aminoacizi. după care s-a spălat până la un pH neutru.• cetoacid 100 mM • 15NH4Cl 100 mM • NADH 1 mM • glucoză 670 mM Amestecul de sinteză a fost ajustat la pH 8. Probele s-au preparat după următoarea procedură: 10 µl de probă diluată de 20 ori. S-a măsurat absorbanţa la 623 nm. y = 0. Pe parcursul sintezei s-a urmărit consumul de NH4Cl prin metoda Berthelot. Developarea culorii s-a făcut prin incubarea probelor timp de 2-3 min la 100ºC.013334x R= 0. Sintezele de aminoacizi marcaţi au fost efectuate la 30ºC cu urmărirea pH-lui şi agitare. Fracţiunea cu aminoacid s-a concentrat pe 43 . Purificarea aminoacizilor sintetizaţi Aminoacizii sintetizaţi au fost purificaţi pe o coloană cu răşină schimbătoare de ioni Dowex 50W x 8. Ca martor a servit amestecul de sinteză fără clorură de amoniu (din care cauză se adăuga la sfârşit). Această metodă constă în formarea unui compus de culoare.6 0. În Figura 2 este prezentată curba etalon de la sinteza de [15N]-L-metionină.4 0. Sintezele au fost oprite prin denaturarea termică a enzimelor. Curba etalon de la sinteza [15N] L-Metionină. timp de 15 min la 85ºC. Înainte de declanşarea sintezelor s-a preluat o probă care a servit la alcătuirea unei curbe etalon. în forma H+.2 1 0.2 0 0 20 40 60 80 100 120 DO 623nm NH Cl (% ) 4 Figura 2.068852 + 0. a fenolnitroprusiatului şi a cloraminei.4 1.99935 1. la interacţiunea ionului de amoniu.0 cu NaOH.

datorită substituentului terţ-butil voluminos. Precipitarea s-a lăsat peste noapte. în calitate de catalizator. În primele etape de marcare a acizilor aminaţi cu izotopi stabili s-au folosit metode de sinteză chimică. iar spectrele s-au înregistrat cu un spectrometru de masă cuadrupolar HP 5985. la carboxil şi amină. aminoacizii sub formă de TBDMS-derivaţi se produc în cea mai mare parte sub formă de ioni prin fragmentarea moleculelor. după care s-a precipitat cu etanol absolut. Separarea gaz-cromatografică a produşilor de sinteză sub formă de TBDMS-derivaţi s-a făcut pe o coloană capilară cu fază staţionară DB5 de 30 m lungime. M-57 şi M-85. iar precipitatul obţinut s-a filtrat şi uscat. la amină se introduce o singură grupare silil. randamente scăzute datorită mai multor etape de sinteză. Prin ruperea în diferite poziţii din gruparea tert-butildimetilsilil se formează ioni cu masele M-43. cu 150 µl de acetonitril ca solvent şi 50 µl reactiv MTBSTFA. Derivatizarea s-a făcut pe cantitaţi de probă de ordinul 0. Aceste metode prezintă un şir întreg de dezavantaje. Sinteza de aminoacizi marcaţi cu 15N Marcarea aminoacizilor cu izotopi stabili se poate realiza prin sinteze chimice şi enzimatice. obţinerea racemicului. la 120ºC timp de 20 minute. La ionizarea cu impact de electroni. 44 . Pentru analize s-a utilizat un cromatograf de gaze Hewlett Packard 5840 A. cum ar fi consumul unei cantităţi mari de amoniac.baia de apă. Acest tip de derivatizare are avantajul că. ia naştere un fragment cu masa M-159. cu hidrogen ca şi gaz purtător şi cu temperatură programată între 55 şi 250ºC. utilizând metoda Das Neves şi Vasconcelos. reactivul având şi un conţinut de 1% terţ-butil-dimetil-clorsilan. Analiza aminoacizilor sintetizaţi prin spectrometrie de masă Pentru analiza calitativă prin metoda spectrometriei de masă a aminoacizilor este necesară o derivatizare a produsului de reacţie. adiacent. şi nu una sau două în mod statistic. Derivatizarea. care introduce la fiecare funcţiune polară din moleculă câte o grupare terţ-butil-dimetilsilil (TBDMS). iar prin ruperea legăturii dintre carboxil şi atomul de carbon alfa. cum se întâmplă în cazul derivatizării cu grupări trimetilsilil. s-a facut prin sililare.5-1 mg de probă. În continuare. Masele ionilor fragment fiind caracteristice fiecărui aminoacid. care trebuie facută la ambele funcţiuni polare ale moleculei de aminoacid. aminoacizii astfel obţinuţi au fost supuşi determinării structurii. Derivatizarea s-a făcut utilizând ca reactiv N-metil-N-(terţ-butil-dimetilsilil) triflouroacetamida (MTBSTFA) în calitate de donor al grupării silil. purităţii şi concentraţiei izotopice.

1989). cu utilizare de celule în creştere. Această metodă prezintă dezavantajul manipulării laborioase a celulelor şi caracterul enantioselectiv scăzut al reacţiei. care constă în oxidarea unui mediator şi transferul electronului la NAD(P)+. Schema de sinteză a aminocizilor marcaţi cu 15N utilizată în prezenta lucrare este reprezentată în Figura 3. Pentru a evita acest fenomen există câteva căi de regenerare continuă a coenzimelor pe parcursul sintezelor: • regenerarea în vivo. Piridin nucleotid transhidrogenaza de la Pseudomonas fluorescens a fost utilizată în regenerarea atât a NAD cât şi a NADP pentru producerea de hidromorfonă [Boonstra şi colab.. Din cauza preţului mare a acestora utilizarea lor în cantităţi stoichiometrice nu este eficientă. marea majoritate provenind de la bacterii. Majoritatea enzimelor utilizate în sinteza diverşilor compuşi necesită coenzime (NADH sau NADP). Sursele enzimelor utilizate în regenerarea coenzimelor sunt destul de variate. 15NH4Cl Cetoacid NADH AADH Acid gluconic GDH GalM β-glucoză -glucoză L-(15N)aminoacid NAD+ Figura 3. Reacţiile de sinteză sunt cuplate cu reacţii de regenerare a cofactorilor costisitori. 2000]. • regenerarea enzimatică în vitro. • regenerarea electrochimică.Folosirea enzimelor în sinteze de aminoacizi marcaţi cu izotopi stabili prezintă mai multe avantaje faţă de metodele chimice. AADH – aminoacid dehidrogenză Aminoacid dehidrogenazele catalizează reacţia de formare a aminoacizilor pornind de la 15NH4Cl şi cetoacizii corespunzători. Un dezavantaj al metodei îl prezintă specificitatea şi viteza de regenerare reduse. datorită faptului că decurg stereoselectiv şi au randamente superioare. cele mai utilizate enzime pentru regenerarea coenzimelor în sinteze fiind alcool dehidrogenaza şi formiat dehidrogenaza (Hummel şi Kula. O metodă relativ simplă şi mai utilizată pentru obţinerea de aminoacizi marcaţi cu 15N este sinteza enzimatică pornind de la cetoacizi şi săruri de amoniu (15N). Sinteza de aminoa45 . Modalitatea cea mai eficientă pentru regenerarea coenzimelor rămâne metoda enzimatică. Schema de sinteză a acizilor aminaţi cu 15N.

exprimate în celule de E. utilizând ca substrat glucoza cu formare de acid gluconic. GlucDH a servit la regenerarea NADH. constanta de inhibiţie calculată de noi Ki=4. Pe tot parcursul sintezei alaninei s-a urmărit consumarea clorurii de amoniu prin metoda Berthelot (Figura 4 A) care este o metodă colorimetrică foarte sensibilă de dozare a amoniacului. subtilis. Purificarea acestora este o etapă suplimentară care. Mediul de reacţie utilizat a conţinut: piruvat de Na 150 mM. Enzimele recombinate. Honorat şi colab. Reacţia s-a declanşat la adăugarea enzimelor (115 U de leucin dehidrogenază şi 60 U de glucozo-dehidrogenază). Enzimele utilizate în sintezele de aminoacizi marcaţi nu au fost purificate. Astfel.cizi a fost cuplată cu reacţia catalizată de glucozo-dehidrogenaza (GlucDH) de la B. M = 318.25 mM. Figura 4. la concentraţii mari de substrat activitatea enzimei este redusă. [1990] au testat sinteza de L-alanină şi L-valină cu enzime (alanin dehidrogenază şi valin dehidrogenază) purificate şi în lizat bacterian. În unele sinteze s-a folosit galactozo-mutarotaza pentru transformarea α-glucozei în β-glucoză. Activitatea alanin dehidrogenazei din B. Sinteza de [15N] L-Ala Amestecul de sinteză a fost ajustat la pH 8. (B) Spectrul de masă al [15N]-Alaninei. cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. (A) Consumul. Sinteza de L-alanină marcată cu 15N s-a realizat pentru o cantitate de 8 mmol. în general. subtilis este inhibată de piruvat. coli. reprezintă aproximativ 50% din proteinele totale existente în lizatul bacterian. NADH 1 mM. nu conduce la mărirea randamentului reacţiei. înainte de adăugarea enzimelor. 15NH4Cl pe parcursul sintezei de [15N]-alanină. 15NH4Cl 130 mM. Sinteza de [15N]-alanină. Acest fapt nu a influenţat randamentul sintezelor. glucoză 670 mM. DMTBS derivat. O soluţie în acest 46 . După purificarea aminoacidului randamentul sintezei a fost de 60%.0.

Masele caracteristice ale ionilor fragment ale leucinei cu conţinut izotopic natural au valorile m/z 316. pH 8.7 (2. Enzima are cea mai mare specificitate de substrat pentru acidul α-cetoisovaleric. O altă soluţie poate fi adăugarea piruvatului în mai multe etape. 302. şi respectiv 200. Masa moleculară a alaninei fără marcare izotopică este 317.6) 4. 274.caz ar fi declanşarea reacţiei de sinteză cu cantităţi mai mari de enzimă. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele menţionate mai sus.8) Activitatea enzimatică a fost determinată la 30°C în tampon Tris-HCl 50 mM. Tabelul 2. stearothermophilus sunt prezentate în Tabelul 2. Sinteza de [15N]-L-Leu Leucin dehidrogenazele au specificitate pentru un număr mai mare de cetoacizi. Specificităţile de substrat ale leucin dehidrogenazei native din B. ceea ce demonstrează marcarea alaninei nu 15N (Figura 4 B). α-cetoacid 10 mM. masa moleculară exactă pentru leucină fără marcare izotopică la azot este M=359. În sintezele de aminoacizi la care enzima are o specificitate mai mică pentru precursorul acestora.8 (22) 17.0. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 5 A). Activitatea specifică (U/mg de proteină) a LeuDH din B. În ambele cazuri este necesară o urmărire minuţioasă a consumului clorurii de amoniu. În cazul leucinei derivatizate cu două grupări silil. stearothermophilus în prezenţa diferiţilor α-cetoacizi α-cetoacid Acid α-cetoisovaleric Acid α ceto-β-metilvaleric Acid α-cetoizocaproic Acid α-cetocaproic Acid α-ceto-γ-metiltiobutiric Acid α-cetobutiric LeuDH429 168 (100) 46. 232 şi 158. NH4Cl 1M şi NADH 0.4 (10) 7. a fost necesară o cantitate mai mare de enzimă. De aceste valori ale activităţii enzimatice s-a ţinut cont în sintezele de aminoacizi marcaţi cu izotopul stabil al 15N.15 mM. Între paranteze este exprimată activitatea procentuală considerând rezultatul obţinut cu acid α-cetoisovaleric ca 100%.5 (28) 36. Mediul de reacţie pentru sinteza de [15N]-leucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. 260.8 (4. În cazul aminoacizilor mar47 . Masele fragmentelor ion ale alaninei cu conţinut izotopic natural sunt m/z 274.

Raportul molar al reactanţilor (acid α-ceto isovaleric:15NH4Cl )a fost de 1:1. înainte de adăugarea enzimelor. DMTBS derivat. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 6 A). Din fiecare reactant s-a utilizat o cantitate de 8. (B) Spectrul de masă al [15N]-Leucinei. Figura 5. Sinteza s-a declanşat cu 205 U de leucin dehidrogenază şi 110 U de glucozo dehidrogenază. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă (Figura 5 B). Sinteza de [15N]-leucină (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-leucină. raportul reactan48 . cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. înainte de adăugarea enzimelor. cca 97 atom % 15N. Sinteza de [15N]-L-Val Mediul de reacţie pentru sinteza de [15N]-valină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-valină.2 mmol. Sinteza de [15N]-valină. S-au realizat câteva sinteze. Din fiecare reactant s-a utilizat o cantitate de 8. DMTBS derivat. M = 346.caţi cu 15N. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo-dehidrogenază. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. M = 360.0 mmol. (B) Spectrul de masă al [15N]-valinei. Figura 6.

masa moleculară exactă pentru valina fără marcare izotopică la azot este M=345 .ţilor şi randamentele sintezelor sunt prezentate în Tabelul 3. Scăderea vitezei de reacţie se poate explica prin scăderea concentraţiei substratelor. Masele caracteristice ale ionilor fragment ale metioninei fără marcare izotopică au valorile m/z 320. 288. 292. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-γ-metiltiobutiric este aproximativ 8 U/mg proteină. În cazul metioninei marcate cu 15N. Cel mai mare randament s-a constatat în cazul sintezei de 12 mmol. Viteza reacţiei a scăzut foarte mult după primele 10 min când s-au consumat 50% din substrate (Figura 7 A). Din această cauză a fost nevoie de o cantitate mai mare de proteină.0 12.0 8. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice. iar în cazul valinei marcate cu 15N. Sinteza de [15N]-L-Met Mediul de reacţie pentru sinteza de 15N-metionină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. În continuare viteza reacţiei a scăzut.0 Randamentul sintezei (%) 79 86 92 Viteza de reacţie este. viteza reacţiei fiind direct proporţională cu concentraţia de substrat până la anumite valori. După purificarea aminoacidului s-a constatat un randament al sintezei de 94%.0 15NH 4Cl 3. acumularea de produşi de sinteză care pot inhiba activitatea enzimelor. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 7 A). În cazul valinei derivatizate cu două grupări silil. Masa moleculară a metioninei derivatizată cu două grupări silil este de 377. şi deci şi consumul de clorură de amoniu este foarte mare în primele minute de sinteză.0 8. Pentru consumarea celorlalte 20% NH4Cl au fost necesare 100 min.0 12. Sinteze de [15N]-L-valină Reactanţi (mmol) Acid cetoisovaleric 3. Viteza a scăzut mult după încă 10 min (în primele 20 min ale sintezei s-au consumat 80% clorură de amoniu). atât masa moleculară cât şi 49 . după 10 min s-a consumat 50% clorură de amoniu. Astfel. Masele caracteristice ale ionilor fragment a valinei cu conţinut izotopic natural au valorile m/z 302. şi 218. 260 şi respective 186. Spectrul de masă al valinei marcate isotopic este prezentat în Figura 6 B. Tabelul 3. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă.

DMTBS derivat. (B) Spectrul de masă al [15N]-norleucinei. Figura 7. cca 97 atom % 15N 50 . Spectrul de masă al metioninei marcate isotopic este prezentat în Figura 7 B. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. M = 360. M = 378. Sinteza s-a declanşat cu 106 U de leucin dehidrogenază şi 86 U de glucozo dehidrogenază şi 39 U de galacto mutarotază. Sinteza de [15N]-norleucină. Raportul molar al reactanţilor (acid α-ceto-γ-metiltiobutiric:15NH4Cl )a fost de 1:1. înainte de adăugarea enzimelor. Din fiecare reactant s-a utilizat o cantitate de 5. Din fiecare reactant s-a utilizat o cantitate de 4. 100 A 100 90 80 70 60 73 201 B 80 NH Cl (%) 60 I. Sinteza de [15N]-metionină. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo dehidrogenază. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norleucină. (B) Spectrul de masă al [15N]-metioninei.masele ionilor fragment cresc cu o unitate de masă. DMTBS derivat. Raportul molar al reactanţilor (acid α-ceto caproic:15NH4Cl )a fost de 1:1. cca 97 atom % 15N Sinteza de [15N]-L-NorLeu Mediul de reacţie pentru sinteza de [15N]-norleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa metioninei marcate cu 15N în produsul sintezei enzimatice.8 mmol.7 mmol. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-metionină. % 50 40 30 20 10 0 4 40 57 75 147 133 275 303 15 20 346 0 50 100 150 200 m/z 250 300 350 400 0 0 5 10 20 min 30 70 90 120 Figura 8. înainte de adăugarea enzimelor.

Masele fragmentelor ion ale norleucinei cu conţinut izotopic natural sunt sunt m/z 316. ceea ce demonstrează marcarea norleucinei nu 15N (Figura 8 B).0 4. Sinteze de [15N]-L-norleucină Reactanţi (mmol) Acid cetocaproic 2. % 60 50 40 261 147 57 133 303 331 0 50 100 150 200 250 300 350 289 15 40 30 20 20 10 0 0 0 5 15 30 m in 60 90 120 m/z Figura 9. cca 97 atom % 15N 51 .7 U/mg proteină.4 U/mg proteină). M = 346.7 Masa moleculară a norleucinei fără marcare izotopică este 359.Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetocaproic este relativ mică (17.03 mmol.7 15NH 4Cl Randamentul sintezei (%) 78 78 2. DMTBS derivat.0 4. Raportul reactanţilor şi randamentele sintezelor sunt prezentate în Tabelul 4. 274 şi 200. Tabelul 4. 100 A 100 90 80 187 73 B 80 NH4Cl (%) 70 60 I. ceea ce constituie 2. Sinteza de [15N]-norvalină. Din fiecare reactant s-a utilizat o cantitate de 8. Raportul molar al reactanţilor (acid α-ceto butiric:15NH4Cl)a fost de 1:1. Sinteza s-a declanşat cu 310 U de leucin dehidrogenază şi 204 U de glucozo dehidrogenază. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 9 A). Sinteza de [15N]-L-Norval Mediul de reacţie pentru sinteza de [15N]-norvalină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. înainte de adăugarea enzimelor.8% din activitatea pentru acidul cetoisovaleric). (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norvalină. (B) Spectrul de masă al [15N]-norvalinei. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele mai menţionate mai sus. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. 302. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 8 A). Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetobutiric este cea mai mică dintre substratele analizate (4.

este M=345. şi respectiv 200. Din fiecare reactant s-a utilizat o cantitate de 5. ceea ce demonstrează marcarea izoleucinei cu 15N (Figura 10 B). 274. Masele caracteristice ale ionilor fragment ale valinei cu conţinut izotopic natural au valorile m/z 302. % 60 4 50 40 15 303 57 75 147 133 275 40 30 20 20 10 0 0 0 5 10 20 40 min 60 90 120 345 50 100 150 200 250 300 350 400 0 m/z Figura 10. Masele caracteristice ale ionilor fragment ale izoleucinei cu conţinut izotopic natural au valorile m/z 316. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice.5 U/mg proteină) este mai mare decât pentru acidul cetoisocaproic (36. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. 302. cca 97 atom % 15N În cazul izoleucinei derivatizate cu două grupări silil. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-β-metilvaleric (46. înainte de adăugarea enzimelor.În cazul norvalinei derivatizate cu două grupări silil.27 mmol. DMTBS derivat. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. iar în cazul norvalinei marcate cu 15N . Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 10). A 100 80 NH Cl (%) 100 90 80 70 60 201 73 B I.8 U/mg proteină). (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-isoleucină. masa moleculară exactă pentru norvalină fără marcare izotopică la azot. 52 . Spectrul de masă al norvalinei marcate isotopic este prezentat în Figura 9 B. (B) Spectrul de masă al [15N]-izoleucinei. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. 288. Sinteza de [15N]-L-Ile Mediul de reacţie pentru sinteza de [15N]-izoleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. Sinteza de [15N]-isoleucină. masa moleculară exactă pentru izoleucină fără marcare izotopică la azot este M=359. Masele fragmentelor ion obţinute prin spectrometrie de masă sunt mai mari cu o unitate. În cazul aminoacizilor marcaţi cu 15N. Sinteza s-a declanşat cu 290 U de leucin dehidrogenază şi 221 U de glucozo dehidrogenază. 260 şi 186. M = 360.

Rezultatele şi condiţiile acestor determinări sunt prezentate în Tabelul 5.70 Mediul de reacţie conţine la un volum de 1 ml următorii reactivi: tampon Tris-HCl 50 mM (pH 8.Asp NH4Cl Fumarat L.251 0. Determinarea constantei de echilibru (Keq = [NH3] [acid fumaric] / [acid aspartic]) a reacţiei catalizate de aspartaza din E. 1981.5).0 0 0. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab. MgCl2 6mM. Pentru a determina concentraţiile reactanţilor la care se stabileşte echilibrul reacţiei am făcut mai multe determinări ale constantei de echilibru. 53 . Reacţia de sinteză s-a oprit prin denaturarea termică a enzimei. Dozarea activităţii enzimatice a aspartazei s-a făcut de asemenea la temperatura camerei. La echilibru nu se mai observă nici o variaţie de extincţie.434 0. Tabelul 5.0 40. care este deplasat spre formarea de acid aspartic. Concentraţiile la echilibru de L-Asp şi NH4Cl se calculează din concentraţiile lor iniţiale şi concentraţia la echilibru de acid fumaric.53). Reacţia de formare a acidului aspartic din fumarat este reversibilă.352 4.0 0 1. diverse concentraţii de acid aspartic şi NH4Cl. Tosa şi colab.Media celor 4 măsurători au indicat o valoare a Keq = 3. 1973].352 0.. metoda fiind foarte eficientă şi simplă.566 30. Celule imobilizate de E.69 x 10 –3 M).749 10.648 20.523 10. Acid L-aspartic ↔ Acid fumaric + NH4+ După o anumită perioadă de timp.28 2.432 3. Se adaugă apoi 1 U de aspartază recombinată. 1976].43 2..0 0 1.Asp NH4Cl Fumarat (mM) 1. indicate în partea stângă a tabelului.35 4.0 0 3.69 mM (sau 3. iar la diferite intervale de timp se citeşte extincţia la 240 nm.. În cazul reacţiilor reversibile nu se consumă tot substratul şi ca rezultat randamentul sintezelor scade. între cei doi reactanţi (fumarat şi acid aspartic) se stabileşte un echilibru.0 10.477 0.251 3. Pe tot parcursul sintezei s-a urmărit consumul de acid fumaric prin citirea absorbanţei la 240 nm (Figura 11 A).477 3.0 20. iar acidul aspartic având o cerere mare pe piaţa de aminoacizi.0 10. Sinteza de acid aspartic s-a realizat la temperatura camerei. care este proporţională cu concentraţia de acid fumaric format (εmM = 2. coli Concentraţia iniţială (mM) Concentraţia de echilibru (mM) Keq L.Sinteza de acid L-aspartic Aspartaza este folosită cu succes în sinteza de acid aspartic din acid fumaric şi clorură de amoniu. Producerea acidului aspartic la scară industrială s-a realizat enzimatic din fumarat şi săruri de amoniu utilizând aspartaza ca şi catalizator [Chibata şi colab.

Sinteza de acid aspartic. iar echilibrul este deplasat spre formarea de aminoacid. coli. Masele caracteristice ale ionilor fragment ale acidului aspartic fără marcare izotopică au valorile m/z 432. pH s-a ajustat la valoarea de 8. DMTBS derivat. catalizată de aspartaza recombinată din E. Sinteza de acid α-cetoisocaproic Sinteza chimică a cetoacizilor este dificil de realizat. Leucin dehidrogenaza de la B. (A) Consumul de acid fumaric şi formarea de acid aspartic în cursul reacţiei de sinteză a acidului aspartic. stearothermophilus cu 9 aminoacizi lipsă la capătul C-terminal are o activitate specifică în reacţia de dezaminare a L-leucinei. coli. (B) Spectrul de masă al acidului aspartic.Fumarat mM Aspartat mM 1000 100 90 80 73 Fumarat/Aspartat (mM) 800 70 60 600 I. M = 457. % 50 40 400 30 20 75 200 10 0 0 50 100 147 202 244 150 200 250 302 316 300 350 418 390 400 450 460 500 0 0 50 100 150 200 min 250 300 350 m/z Figura 11. Aspartaza a servit la înlăturarea ionului de amoniu format în urma reacţiei 54 . Componenţa mediului de sinteză a fost: acid fumaric 1 M. NH4Cl 0. fapt care explică şi costurile mari a acestora. Până acum nu a fost descrisă o metodă enzimatică eficientă de producere a cetoacizilor.8 M. După purificare s-a constat un randament de 70%. 418. Masa moleculară a acidului aspartic derivatizat cu trei grupări silil este de 457. aproape de două ori mai mare decât enzima nativă. Acest fapt ne-a determinat să testăm o sinteză de acid cetoisocaproic (Figura 12). fără marcare cu 15N. Spectrul de masă al acidului aspartic fără marcare izotopică este prezentat în Figura 11 B. Reacţia s-a declanşat cu aspartază 2 U/ml. 390 şi 316. Reacţiile sunt reversibile.5 cu NaOH. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa acidului aspartic în produsul sintezei enzimatice. Acesta reprezintă cel mai mare impediment în utilizarea AADH în sinteza enzimatică a cetoacizilor. Aminoacid dehidrogenazele (AADH) catalizează dezaminarea L-aminoacizilor cu formare de cetoacizi corespunzători. Pentru sinteză am utilizat şi aspartază recombinată de la E.

L-leucină

NAD+ LeuDH358 NADH LDH

Lactat

Acid αcetoisocaproic NH4+

Piruvat

+
Fumarat AAL Acid aspartic

Figura 12. Schema de sinteză a acidului cetoisocaproic.

de dezaminare a L-leucinei. Reacţia catalizată de aspartază este şi ea reversibilă, dar în acest caz echilibrul reacţiei este deplasat spre formarea de acid aspartic, deci spre consumarea de NH4+. Pentru regenerarea coenzimei am utilizat lactat dehidrogenaza din muşchi de bovine. Un impediment care poate apărea pe parcursul sintezelor de acest gen (cu mai multe enzime) este reacţionarea enzimelor secundare cu produsul sintezei. Este cunoscută specificitatea strictă a aspartazei pentru acid aspartic, de aceea am testat numai activitatea LDH cu diferiţi cetoacizi (Tabelul 6). Surprinzător este faptul că, totuşi, unii cetoacizi sunt substrate pentru LDH. Pentru sinteza cetoacizilor ce servesc ca substrate şi pentru LDH trebuie căutate alte enzime pentru regenerarea coenzimei.
Tabelul 6. Activitatea LDH din muşchi de bovine (Boehringer) în prezenţa diferiţilor α-cetoacizi în raport cu substratul fiziologic (acid piruvic) α cetoacid Acid piruvic Acid hidroxipiruvic Acid fluoropiruvic Acid α cetobutiric Acid α cetocaproic Acid α cetovaleric Acid α ceto γ metiltiobutiric Acid α cetoizocaproic Acid α ceto β metilvaleric Activitate U/mg proteină 140 69 38 10 0,38 0,13, 0,02 0,00 0,00 % 100 49 27 7,1 0,27 0,093 0,014 0,00 0,00

Mediul de reacţie conţine în volumul final de 1 ml: tampon Tris–HCl 50 mM (pH 8,5), MgCl2 6 mM, NADH 0,15 mM, α-cetoacid 1 mM.

55

Sinteza de acid isocaproic s-a realizat pentru o cantitate de 5 mmol. Temperatura la care a fost efectuată sinteza a fost de 35ºC. Reacţiile au fost oprite prin denaturarea termică a enzimelor (15 min la 85ºC). Formarea acidului cetosiocaproic s-a urmărit prin consumarea piruvatului (Figura 13).
Piruvat mM cetoisocaproat mM 120

100 Piruvat/cetoisocaproat (mM)

80

60

40

20

0 0 50 100 min 150 200 250

Figura 13. Consumul de acid piruvic şi formarea de acid α-cetoisocaproic în cursul reacţiei de sinteză a acidului α-cetoisocaproic în sistemul cuplat LeuDH/AAL/LDH. Componenţa mediului de sinteză a fost: acid fumaric 150 mM, acid piruvic 120 mM, L-leucină 100 mM, NAD 1 mM, pH-ul s-a ajustat la valoarea de 8,5 cu NaOH. Reacţia s-a declanşat cu 2 U/ml aspartază, lactat dehidrogenază şi leucin dehidrogenază (LeuDH358).

Din amestecul de sinteză s-a purificat leucina rămasă după sinteză. Cantitatea de leucină recuperată a servit la calcularea randamentului sintezei, care a fost de 30%. Deşi randamentul este mic, sinteza este rentabilă din punctul de vedere al preţului reactanţilor, cei folosiţi sunt mai ieftini decât produsul final. În concluzie, tehnicile care utilizează ADN recombinat au aplicaţiile cele mai diverse în biotehnologie. Aplicarea lor cere însă expertize variate cum sunt: - calcularea randamentelor de reacţie pe baza echilibrelor termodinamice şi a parametrilor cinetici a enzimelor implicate, - utilizarea unor procedee rapide de purificare prin cristalizare sau cromatografie, dar nu în ultimul rând şi cunoaşterea pieţei internaţionale privind cererea şi oferta produselor. Piaţa moleculelor marcate cu 15N este redusă dar interesantă, considerând valoarea ridicată a acestor compuşi. Pentru comparaţie, 1 kg 56

de acid L-glutamic valorează în prezent ~1 €, în timp ce 1 g acid [15N]-L-glutamic valorează ~150 €

2. Tendinţe actuale în aplicarea bionanotehnologiilor
Bionanotehnologiile moderne se inspiră din organizarea celulară a lumii vii. Astfel, structurile nano la fel ca şi structurile vii, sunt alcătuite din componente de natură organică şi anorganică. Aceste structuri sunt speranţa pentru tratarea a numeroase cancere, existând în prezent deja aplicaţii ale nanoparticulelor în tratamentul unor cancere. Nanoparticulele sunt o speranţă nu numai pentru tratamentul numeroaselor boli, dar şi pentru stabilirea unor diagnostice. Utilizarea nanoparticulelor în medicină este axa prioritară în aplicarea bionanotehnologiilor. Limitările bionanotehnologiilor sunt: incapacitatea de a sintetiza particule de aceleaşi dimensiuni cu aceeaşi suprafaţă, controlul organizării lor. Ţesuturile tari, cum ar fi ţesutul osos, cochiliile la moluşte, conţin una sau mai multe componente organice de natură proteică care controlează organizarea structurală . Aplicaţii ale bionanotehnologiilor Nanoparticulele de aur (NP-Au) sunt o adevărată speranţă în diagnosticul şi tratamentul cancerelor. Au a fost utilzat timp de câteva decenii în diverse aplicaţii în medicină (implanturi dentare) datorită caractersticilor sale neutre. Nanoparticulele de Au au început să fie din ce în ce mai des utilizate în depistarea şi chiar tratamentul unor celule canceroase datorită faptului că acestea sunt inerte, non-toxice, au stabilitate mare, dimensiuni mici şi capacitate de legare mare. NP-Au sunt capabile de a acţiona asupra unor anumite tipuri de celule chiar în absenţa oricăror grupe funcţionalizate. NP-Au induc moartea celulară liniei de celule de carcinom pulmonar A549 de la om, dar nu au nici un efect asupra altor linii de celule HepG2 (carcinom hepatic hepatocelular uman) şi BHK21 (celule juvenile din rinichi de hamster) (Patra şi col., 2007). Diagnostic Diagnosticul nanomolecular al cancerului poate asigura depistarea celulelor canceroase în faze incipiente ale bolii. Nanoparticule de aur derivatizate cu nucleotide tiolate au fost utilizate pentru depistarea celulelor canceroase (Conde şi col., 2010). NP-Au la care s-au ataşat oligonucleotide de ADN au fost utilizate pentru diagnosticul timpuriu al leucemiilor mieloide acute. Oligonucleotidele ADN utilizate în acest scop 57

reprezentau un fragment din joncţiunea care rezultă în urma translocaţiiei t(9;22)(q34;q11). Un fragment dintr-un cromozom este translocat la un alt cromozom, în acest caz fragmentul de la cromozomul 9 este transferat pe cromozomul 22, cromozomul find cunoscut sub denumirea de cromozom Philadelphia. Această translocaţie este cauza leucemiilor mieloide cronice şi care sunt cauzate de fuziunea a 2 gene BCR(22)-Abl(9) (Figura 14).

Figura 14. Formarea cromozomului Philadelphia – translocaţia reciprocă între cromozomul 9 şi 22.

Produsul acestei gene este o proteină himeră cu activitate tirozin-kinazică. Metoda de detecţie cu ajutorul nanoparticulelor se bazează pe formarea de porţiuni hibride ADN:ARN (ADN sonda: ARNm din celulele canceroase) dublu catenare, care vor împiedica agregarea nanoparticulelor de Au odată cu creşterea concentraţiei de săruri. Metoda nanosondelor pentru diagnosticul acestui tip particular de cancer oferă avantaje faţă de metodele utilizate actual în diagnostic (FISH, transcrierea inversă a ARNm şi amplificarea prin PCR) prin faptul că este mai ieftină şi mai rapidă (~30 min) şi necesită cantităţi mici de ARNm (10 ng/μl). Diagnosticul timpuriu în asemenea cazuri este foarte important, în fazele ulterioare celulele canceroase devenind rezistente la chemoterapice. Nanoparticulele de argint (NP-Ag) au devenit atractive în domeniul bionanotehnologic după descoperirea efectului lor antibactericid (Sondi şi Salopek-Sondi, 2004). Acest efect este unul de importanţă majoră datorită faptului că bacteriile capătă din ce în ce mai multă rezistenţă la antibiotice. Nanoparticulele de argint par a avea o influenţă nu numai asupra bacteriilor, dar şi asupra virusurilor. Astfel NP-Ag la concentraţii non-toxice pentru celule inhibă replicarea virală (sinteza materialului genetic ai virusului) 58

atunci când nanoparticulele sunt administrate înainte de infectare sau imediat după (2-4 ore) aceasta (Speshock şi col., 2010). Unele substanţe chimice s-au dovedit a avea un efect inhibitor asupra proliferării celulare, angiogenezei şi rol antiinflamator. Un astfel de exemplu este colorantul DCPIP (2,6-diclorofenol-indofenol) care induce apoptoza (moartea celulară) în celule umane de melanom A375 şi G361 (Cabello şi col., 2009). DCPIP s-a dovedit a avea acţiune antiangiogeneză şi antiinflamatoare asupra celulelor canceroase umane de colon HCT116. Efectul acestuia este mai intens dacă este încapsulat în particule de poliacizi (lactic şi glicolic). Concentraţiile de ≥6 μg/ml de colorant (DCPIP) induc moartea celulară prin apoptoză (Mondalek şi col., 2010). Nanobiotehnologiile urmăresc nu numai crearea de nano-vehicule pentru transportarea diferitor substanţe, dar şi crearea şi manipularea unor adevărate nano-motoare, utile în nanomanipulare celulară. F1-ATP-aza este un veritabil nano-motor rotativ, a cărei mişcări pot fi controlate cu ajutorul unor stimuli optici şi chimici (Ristic şi col., 2009). Sisteme particulare capabile de transport ţintit şi eficient a diferitor substanţe, cu puţine efecte adverse, se datorează probabil endocitozei transportorilor. Nanoparticule cationice formate din lipide cationice şi polielectroliţi s-au dovedit a fi cărăuşi excelenţi pentru transportul amfotericinei B – un antifungicid pentru Candida albicans (Vieira şi Carmona-Ribeiro, 2008). Nanodiscurile de HDL (High Density Lipoprotein) sunt un strat bifosfolipidic cu aspect de disc (ND-HDL). Este cunoscut faptul că HDL este numit “colesterolul bun” deoarece este implicat în transportul moleculelor hidrofobe (colesterol) în fluxul sangvin care este un mediu hidrofil. Structura HDL (liporoteine cu densitate mare) este una simplă, fiind alcătuit din fosfolipide şi apolipoproteină (apo). Cea mai abundentă formă de lipoproteină din plasma sanguină umană este apoA-I, care este alcătuită din 243 de aminoacizi, este bine caracterizată şi la incubarea cu vezicule de fosfolipide în vitro formează HDL revers, capabil de transportul moleculelor hidrofobe (Ryan, 2010). Fosfolipidele cele mai frecvent utilizate pentru asamblarea veziculelor sunt DMPC (dimirisstoil-fosfatidil colina) şi DMPG (dimirisstoil-fosfatidil glicerol). Incubarea acestor vezicule cu apoA-I se autoasamblează ND-HDL. Aceste nano-discuri se pot autoasambla chiar dacă nu este utilizată enzima integrală, ci numai fragmente de apolipoproteine (Weers şi col., 2001). ND-HDL reprezintă astfel un mediu favorabil pentru studierea proteinelor transmembranare, transportul unor substanţe hidrofobe. 59

Stratul bilipidic este un mediu natural pentru proteinele transmembranare care îşi păstrează proprietăţile sale conformaţionale şi activitatea. Suprafaţa unui nanodisc cu diametrul de 20nm este de ~300 nm2, o suprafaţă suficientă pentru integrarea câtorva molecule proteice. Avantajul utilizării acestor structuri comparativ cu miceliile de detergenţi, este că asigură un mediu natural apropiat, fără prezenţa detergenţilor care pot schimba conformaţiile proteinelor. ND-HDL au fost utilizate în studierea a numeroase proteine transmembranare cum ar fi bacteriorodopsina (Bayburt ţi col., 2006; Blanchette şi col., 2008), citoromul p450 3A4 (Baas şi col., 2004), toxina antraxului (Katayama şi col., 2010), hidrogenaze enzime de membrană produse de Pyrococcus furiosus care pot sintetiza H2 (Baker şi col., 2009). ND-HDL au fost testate în utilizarea lor pentru transportul diferitor substanţe hidrofobe, care sunt insolubile în mediu sangvin hidrofil. Un exemplu în acest sens este transportul de către ND-HDL a amfotericinei B un potenţial antifungicid care inhibă creşterea Saccharomyces cerevisiae şi a altor fungi patogene, care administrat sub această formă nu mai este toxic la anumite concentraţii (Oda şi col., 2006). ND-HDL ce conţineau cucurmină (un polifenol hidrofob natural obţinut din Curcuma longa) au inhibat creşterea liniei celulare hepatice HepG2 comparativ cu administrarea curcuminei libere (Ghosh şi col., 2010). O altă aplicaţie a nanodiscurilor de HDL a fost încorporarea de lipide cu ioni bivalenţi de Ni2+, care au capacitatea de a fixa proteinele cu etichetă de 6-His (histidine). Proteina din învelişul virusului West Nile (Fischer şi col., 2010)

3. Bibliografie
1. Baas B. J., Denisov I. G., Sligar S. G., (2004). Homotropic cooperativity of monomeric cytochrome P450 3A4 în a nanoscale native bilayer environment, Archives of Biochemistry and Biophysics, 430(2), 218-28. Baker S. E., Hopkins R. C., Blanchette C. D., Walsworth V. L., Sumbad R., Fischer N. O., Kuhn E. A., Coleman M., Chromy B. A., Letant S. E., Hoeprich P. D., Adams M. W., Henderson P. T., (2009). Hydrogen production by a hyperthermophilic membrane-bound hydrogenase în water-soluble nanolipoprotein particles, Journal of the American Chemical Society, 131(22), 7508-7509. Baker P., Sawa Y., Shibata H., Sedelnikova S., Rice D., (1998). Analysis of the structure and substrate binding of Phormidium lapideum alanine dehydrogenase. Nature Structural Biology, 5, 561-67. Bayburt T. H., Grinkova Y. V., Sligar S. G., (2006). Assembly of single bacteriorhodopsin trimers în bilayer nanodiscs, Archives of Biochemistry and Biophysics, 450(2), 215-22. Blanchette C. D., Cappuccio J. A., Kuhn E. A., Segelke B. W., Benner W. H., Chromy B. A., Coleman M. A., Bench G., Hoeprich P. D., Sulchek T. A., (2008). Atomic force microscopy differentiates discrete size distributions between membrane protein

2.

3.

4.

5.

60

6.

7.

8. 9. 10.

11.

12. 13. 14.

15. 16.

17.

18.

19.

20. 21.

containing and empty nanolipoprotein particles, Biochimica et Biophysica Acta, 1788(3), 724-31. Boonstra B., Rathborne D. A., French C. E., Walker E. H., Bruce N. C., (2000). Cofactor regeneration by a soluble pyridine nucleotide transhydrogenase for biological production of hydromorphone. Applied Enviromental Microbiology, 66, 5161-66. Cabello C. M., Warner B. Bair W. B., Bause A. S., Wondrak G. T., (2009). Antimelanoma activity of the redox dye DCPIP (2,6-Dichlorophenolindophenol) is antagonized by NQO1, Biochemical Pharmacology, 78(4), 344-54. Chibata I., Tosa T., Sato T., (1976). Production of L-aspartic acid by microbial cells entrapped în polyacrylamide gels. Methods în Enzymology, 44, 739-746. Conde J., de la Fuente J. M., Baptista P. V., (2010). RNA quantification using gold nanoprobes - application to cancer diagnostics, Journal of Nanobiotechnology, 8:5. Deconttignies-Le Maréchal P., Calderon-Seguin R., Vandecasteele J.,P., Azerad R., (1979). Synthesis of L-tryptophan by immobilized Escherichia coli cells. European Jornal of Applied Microbiology and Biotechnology, 7, 33-44. Delforge D., Devreese B., Dieu M., Delaivre E., Beeumen J., Remacle J., (1997). Identification of lysine 74 în pyruvate bineding of alanine dehydrogenase from Bacillus subtilis. Journal of Biological Chemistry, 272, 2276-84. Ghosh M., Singh A. T., Xu W., Sulchek T., Gordon L. I., Ryan R. O., (2010). Curcumin nanodisks: formulation and characterization, Nanomedicine: Nanotechnology, Biology and Medicine, Honorat A., Monot F., Ballerini D., (1990). Synthesis of L-alanine and L-valine by enzyme system from Bacillus megaterium. Enzyme and Microbial Technology, 12, 515-20. Honorat-Pascal A., Monot F., Ballerini D., (1990). Coparative stady of the enzymatic synthesis of L-valine by purified enzymes, crude extract or permeabilized cells from Bacillus megaterium. Applied Microbiology and Biotechnology, 34, 236-41. Hummel W., Kula M-R., (1989). Dehydrogenases for the synthesis of chiral compounds. European Journal of Biochemistry, 184, 1-13. Fischer N.O., Infante E., Ishikawa T., Blanchette C.D., Bourne N., Hoeprich P.D., Mason P.W., (2010). Conjugation to nickel-chelating nanolipoprotein particles increases the potency and efficacy of subunit vaccines to prevent West Nile encephalitis, Bioconjugate Chemistry, 21(6), 1018-22. Fukui S., Ikeda S., Fujimura M., Yamada H., Kumagai H., (1974). Production of L-tryptophan, L-tyrosine and their analogues by immobilized tryptophanase and immobilized β-tyrosinase. European Journal of Applied Microbiology, 1, 25-39. Fusee M., Swann W., Calton G., (1981). Immobilization of Escherichia coli cells containing aspartase activity with polyurethane and its application for L-aspartic acid production. Applied Enviromental Microbiology, 42, 672-76. Fusee M., Weber J., (1984). Immobilization by polyurethane of Pseudomonas dacunhae cells containing L-aspartat β-decarboxylase activity and application to L-alanine production. Applied Enviromental Microbiology, 48, 694-98. Karsten W.E., Viola R.E., (1991). Kinetic studies of L-aspartase from Escherichia coli: pH-dependent activity changes. Archives of Biochemistry and Biophysics, 287, 60-67. Katayama H., Wang J., Tama F., Chollet L., Gogol E. P., Collier R. J., Fisher M. T., (2010). Three-dimensional structure of the anthrax toxin pore inserted into lipid nanodiscs and lipid vesicles, Proceedings of the National Academy of Sciences of the USA, 107(8), 3453-57.

61

22. Katoh R., Nagata S., Ozawa A., Ohshima T., Kamekura M., Misono H., (2003). Purification and characterization of leucine dehydrogenase from an alkaliphilic halophile, Natronobacterium magadii MS-3. Journal of Molecular Catalysis, 23, 231-38. 23. Mondalek F. G., Ponnurangam S., Govind J., Houchen C., Anant S., Pantazis P., Rama P Ramanujam R. P., (2010). Inhibition of angiogenesis- and inflammation-inducing factors în human colon cancer cells în vitro and în ovo by free and nanoparticle-encapsulated redox dye, DCPIP, Journal of Nanobiotechnology, 8:17, 1-9. 24. Monot F., Benoit Y., Lemal J., Honorat A., Ballerini D., (1988). Simultaneous production of amino acid dehydrogenase and glucose dehydrogenase by Bacillus megaterium and their utilization for L-valine synthesis with NADH regeneration. Biocatalysis, 2, 161-74. 25. Nagata S., Misono H., Nagasaki S., Esaki N., Tanaka H., Soda K., (1989). Thermostable alanine dehydrogenase of Bacillus sp.DSM730: gene cloning, purification, and characterization. Biochemistry, 71, 559-63. 26. Nagata S., Tanizawa K., Esaki N., Sakamoto Y., Ohshima T., Tanaka H., Soda K., (1988). Gene cloning and sequence determination of leucine dehydrogenase from Bacillus stearothermophilus and structural comparison with other NAD(P)+-dependent dehydrogenases. Biochemistry, 27, 9056-62. 27. Norbert M., Brunhuber W., Blanchard J.S., (1994). The biochemistry and enzymology of amino acids dehydrogenases. Critical Reviews în Biochemistry and Molecular Biology, 29, 415-67. 28. Oda M. N., Hargreaves P. L., Beckstead J. A., Redmond K. A., van Antwerpen R., Ryan R. O., (2006). Reconstituted high density lipoprotein enriched with the polyene antibiotic amphotericin B, Journal of Lipid Research, 47(2), 260-67. 29. Ohshima T., Nishida N., Bakthavatsalam S., Kataoka K., Takada H., Yoshimura T., Esaki N., Soda K., (1994). The purification, characterization, cloning and sequencing of the gene for a halostable and thermostable leucine dehydrogenase from Thermoactinomyces intermedius. European Journal of Biochemistry, 222, 305-12. 30. Ohshima T., Wandrey C., Conrad D., (1988). Continous production of 3-fluoro-L-alanine with alanine dehydrogenase. Biotechnology and Bioengineering, 34, 394-97. 31. Ohshima T., Wandrey C., Kula M-R., Soda K., (1985). Impovement for L-leucine production în a continously operated enzyme membrane reactor. Biotechnology and Bioengineering, 26, 1616-18. 32. Oka M., Yang Y.S., Nagata S., Esaki N., Tanaka H., Soda K., (1989). Overproduction of thermostable leucine dehydrogenase of Bacillus stearothermophilus and its one-step purification from recombinant cells of Escherichia coli. Biotchnology and Applied Biochemestry, 11, 307-11. 33. Patra H.K., Banerjee S., Chaudhuri U., Lahiri P., Dasgupta A., (2007). Cell selective response to gold nanoparticles, Nanomedicine: Nanotechnology, Biology, and Medicine, 3, 111–19 34. Ristic Z., Vitali M., Duci A., Goetze C., Kemnitz K., Zuschratter W., LillH., Bald D., (2009). Two-stimuli manipulation of a biological motor, Journal of Nanobiotechnology, 7:3. 35. Ryan R. O., (2010). Nanobiotechnology applications of reconstituted high density lipoprotein, Journal of Nanobiotechnology, 8:28. 36. Schütte H., Flossdorf J., Sahm H., Kul, M. R., (1976). Purification and properties of formaldehyde dehydrogenase and fromate dehydrogenase from Candida boidinii. European Journal of Biochemistry, 62, 151.

62

37. Siranosian J.K., Ireton, K., Grossamn D.A., (1993). Alanine dehydrogenase (ald) is required for normal sporulation în Bacillus subtilis. Journal of Bacteriology. 175, 6789-96. 38. Sondi I., and Salopek-Sondi B., (2004). Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria, Journal of Colloid and Interface Science, 275, 177–82. 39. Speshock J. L., Murdock R. C., Braydich-Stolle L. K., Schrand A. M., Hussain S. M., (2010). Interaction of silver nanoparticles with Tacaribe virus, Journal of Nanobiotechnology, 8:19. 40. Tosa T., Sato T., Mori T., Chibata I., (1974). Basic studies for continous production of L-aspartic acid by immobilized Escherichia coli Cells. Applied Microbiology, 27, 886-89. 41. Vieira D. B., and Carmona-Ribeiro A. M., (2008) Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity în vitro, Journal of Nanobiotechnology, 6:6. 42. Weers P. M., Narayanaswami V., Ryan R. O., (2001). Modulation of the lipid binding properties of the N-terminal domain of human apolipoprotein E3, European Journal of Biochemistry, 268, 3728-35.

63

II. CULTURI CELULARE Culturi celulare
Lect. dr. Mircea Teodor Chiriac Cuprins
1. Prezentarea principiului tehnicii experimentale .................................................... 64 2. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu ............. 67 3. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente .................................................. 71 3.1. Echiparea laboratorului de culturi celulare ..................................................... 71 3.2. Strategii de lucru ............................................................................................ 74 3.3. Instruirea personalului ................................................................................... 75 3.4. Cultivarea celulelor ......................................................................................... 78 3.5. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora .......................................................................................... 78 3.6. Îngheţarea şi dezgheţarea celuluor .................................................................. 79 3.7. Subclonarea; tripsinizarea............................................................................... 81 4. Bibliografie ............................................................................................................. 81

1. Prezentarea principiului tehnicii experimentale
Multe dintre tehnicile introduse la un moment dat în diferite ştiinţe au revoluţionat felul în care acea ştiinţă a fost percepută ulterior. Culturile celulare sunt un asemenea exemplu în biologie. Introducerea acestei tehnici în urmă cu aproximativ 100 de ani a permis practic importul naturii în laborator, ceea ce a dus la standardizarea tehnicilor şi generalizarea strategiilor de studiu între cercetătorii din diverse instituţii, urmată de o explozie informaţională în lumea biologică. Avansarea cunoaşterii bio-medicale din ultimele decenii nu ar fi fost posibilă fără dezvoltarea printre altele a metodelor de lucru cu celulele. Cercetarea bio-medicală actuală foloseşte tehnicile de lucru cu celulele pentru investigarea unor probleme din domenii ca: biofizica, biochimie, biologie celulară şi moleculară, genetica, biologia dezvoltării organismelor, evolutionism, medicina moleculară, farmacologia, bio-nano-tehnologia, inteligent drug design etc. 64

există trei tipuri de celule animale care sunt cultivate în laborator: primare. eritropoietina).presupune prelevarea unor ţesuturi şi digestia lor pentru obţinerea unei suspensii unicelulare care este apoi cultivată mai departe. . hormoni. secundare şi imortalizate (tabel 1).cultura de organe . 65 . .presupune prelevarea şi cultivarea unui organ în totalitate. studii de genomică. cancere şi altele.cultura de ţesuturi . metabolism. Aplicaţii curente sunt legate de: folosirea culturilor celulare pentru elaborarea vaccinurilor. Caracteristicile celulelor primare. celulele cresc în vasul de cultură până când stabilesc contact cu vecinele lor.Este practic de neimaginat desfăşurarea activităţii într-un centru de cercetare bio-medical lipsit de laboratorul de culturi celulare. Avansarea cercetării din domeniul celulelor stem şi lucrul cu celulele embrionare face posibilă. celulele pot fi folosite ca şi model pentru studiul răspunsurilor fiziologice la diferiţi factori de stres din mediu. interferoni.cultura de celule .presupune prelevarea unor fragmente de ţesuturi şi cultivarea lor. cultivarea organelor şi ţesuturilor cu aplicaţii în bolile cronice degenerative. deocamdată teoretic. Celulele canceroase pierd această caracteristică fenotipică şi după ce ajung să fie confluente încep să crească una peste cealaltă formând ghemuri de celule uşor de distins la microscopul optic. secundare şi imortale/canceroase Proprietăţi Inhibiţia de contact1 Fenotipul faţă de situaţia in vivo Genotipul faţă de situaţia in vivo Necesarul factorilor de creştere Diferenţiate Număr de diviziuni Timp necesar cultivării Reproductibilitatea rezultatelor 1 primare da identic identic crescut da 2-3 crescut scăzută secundare da asemănător identic crescut da <100 scăzut crescută imortale/canceroase unele/nu asemănător/rotunde asemănător/diferit crescut/limitat da/nediferenţiate nelimitat scăzut crescută în mod normal. Din punct de vedere al tipului de cultură se poate vorbi despre: . apoptoză. Într-un sens mai larg. Tabel 1. anticorpi monoclonali folosiţi în cercetare şi clinica medicală. moment în care îşi opresc creşterea. cultura celulară poate cuprinde cultura ţesuturilor şi organelor. Pe de altă parte. Aceasta include şi cultivarea unor embrioni întregi. producţia glico-proteinelor recombinante (cytokine. testarea agenţilor anticanceroşi. Dacă ne referim la cultura de celule.

fizici (radiaţii) sau biologici (virusurile oncogene). Pe de altă parte. fibroblaste) se face prin biopsierea ţesutului şi formarea unei suspensii unicelulare. cu alte cuvinte transplantarea lor la animalele de laborator este urmată de apariţia tumorilor la acestea. 66 . Pentru a le separa de acesta şi pentru separarea celulelor unele de altele se folosesc de obicei enzime proteolitice (tripsina). Unele dintre aceste celule imortale (transformate) pot avea caracter oncogenic. Celulele dintr-o cultură secundară pot parcurge până la 100 de diviziuni înainte de a-şi pierde potenţialul proliferativ. După cum se poate observa din tabelul 1. cultivarea celulelor prelevate din sângele periferic se face într-o manieră care nu necesită ancorarea acestora de pereţii vasului de cultură. Deşi nu prezintă alterări ale setului de cromozomi (karyotipului). Cultivarea celulelor provenite din piele (keratinocite. subcultura are ca scop menţinerea celulelor în faza logaritmică de creştere. celulele canceroase au unele proprietăţi care le diferenţiază de celelalte celule imortale necancreoase: nu mai prezintă inhibiţia de contact.Culturi primare Majoritatea celulelor din culturile primare necesită ancoraj. Pe lângă derivarea culturilor secundare. îndepărtarea celulelor moarte şi a produşilor de metabolism celular şi adăugarea substanţelor nutritive. Culturi secundare Prin subcultivarea celulelor dintr-o cultură primară se pot obţine aşa-numitele culturi secundare. Este posibil ca celulele să formeze aderenţe între ele dar de obicei acestea sunt de o mică intensitate. Diferite substanţe (factori de creştere ai diferitelor populaţii leucocitare şi/sau mitogeni – substanţe care stimulează mitoza) pot fi utilizate pentru diferenţierea şi înmulţirea celulelor în cultură. evitarea confluenţei care poate avea ca rezultat inhibarea creşterii. pot creşte cu mai puţini nutrienţi etc. aceste celule acumulează anumite caracteristici fenotipice care le fac să devină o linie celulară distinctă. Aceste celule pot apărea ca urmare a unor modificări (transformări) la nivelul cromozomului prin factori chimici. Aceste celule vor creşte aderente de suprafaţa vasului de cultură. Culturi de celule imortalizate Este posibil ca unele celule din culturile secundare să sufere anumite transformări care le conferă caracterul de imortalitate adică posibilitatea de a se divide la nesfârşit.

prin folosirea tehnologiei AND-ului recombinat este posibilă crearea celulelor transgene care constituie per se un model de studiu pentru investigarea metabolismului energetic. Aceste celule sunt fuzionate apoi în prezenţa poli-etilen-glicolului (PEG) cu o linie celulară canceroasă de mielom (cancer al plasmocitelor). dezvoltarea în ultimii ani a cunoştinţelor şi tehnologiei de lucru cu celulele stem constituie una dintre temele cele mai actuale în domeniul biomedical. eritropoietina). celulele animale sunt deosebit de utile în testarea citotoxicităţii diferitelor substanţe incluzând noile terapii anticanceroase. anticorpilor monoclonali şi altor substanţe imunomodulatoare (interferoni. anticorpii monoclonali şi-au găsit foarte rapid aplicaţii în domenii variate cum ar fi: diagnosticul şi trata67 . Prin diferite metode de screening se pot găsi aceste celule care sunt ulterior subclonate dând naştere astfel unor linii celulare pure şi stabile are produc anticorpii monoclonali. interleukine). Pe scurt tehnica presupune imunizarea unui animal de experienţă cu un antigen şi recoltarea celulelor B (cele care produc anticorpii) la un anumit interval de timp după imunizare (figura 1). În plus. Nu în ultimul rând. antiparotidita epidemică. Datorită specificităţii deosebit de mari (se consideră că un anticorp poate distinge antigenul pereche între 108 molecule). traficului de membrană.2. factorilor de coagulare. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Aplicaţiile culturilor celulare îşi găsesc utilitatea în producerea: vaccinurilor (antirubeolic. îmbătrânirii şi apoptozei. În 1975 cei doi cercetători au publicat rezultatele prin care pot fi obtinuţi anticorpii monoclonali. Anticorpii monoclonali Una dintre aplicaţtiile culturilor celulare cu cel mai mare impact pentru societate la ora actuală este reprezentată de tehnologia de obţinere a anticorpilor monoclonali prin folosirea hibridoamelor. diferenţierii. hormonilor şi factorilor de creştere (insulina. Este de aşteptat ca acest domeniu să revoluţioneze tratamentul diferitelor afecţiuni. Mai mult. În urma acestei fuziuni. se formează celule hibrid (de unde şi numele de hibridoame) dintre care unele produc anticorpii cu specificitatea dorită (caracter dobândit de la celula B a animalului imunizat) într-o manieră continuă (dobândind caracterul imortal de la celulele de mielom). ciclului celular. Această tehnologie a fost pusă la punct de către Milstein şi Koehler în urma cu aproape patru decenii. agenţilor anticanceroşi etc. enzimelor. antivaricela. antirabic).

Folosirea terapeutică a anticorpilor monoclonali în diferite afecţiuni umane urmează două direcţii: markeri diagnostici care pot identifica diferite tipuri de antigene din populaţii celulare in vivo şi terapia ţintită a diferitelor afecţiuni în care anticorpului monoclonal îi sunt ataşate substanţe chimice toxice sau radioactive. antigen PEG HAT Screening Subclonare Linie celulară producatoare de anticorp monoclonal Figura 1 Producerea anticorpilor monoclonali Splina este izolată la câteva saptămâni (timp necesar pentru îmbogăţirea repertoriului de celule B specifice) după imunizarea animalului cu antigenul faţă de care se doreşte producerea anticorpilor monoclonali. cercetare fundamentală şi aplicată (metode de izolare a diferitelor substanţe recunoscute). catalizatori ai reacţiilor chimice (abzymes). Screeningul face posibilă identificarea coloniilor care produc anticorpi faţă de antigenul dorit.mentul clinic. Urmează apoi subclonarea realizată prin diluarea celulelor din coloniile producătoare în aşa fel încât fiecare 68 . Celulele B sunt izolate şi combinate cu mieloamele (partea stângă) în prezenţa PEG care mediază fuziunea celulelor. Celulele hibrid sunt singurele care vor supravieţui în mediul suplimentat cu Hypoxanthine Aminopterin Thymidine (HAT).

celule stem pot fi clasificate în: totipotente. Există la ora actuală şi peste 30 de anticorpi monoclonali folosiţi ca şi agenti terapeutici în diferite afecţiuni umane. Celule stem Următorul pas în revoluţia din domeniul biomedical a fost reprezentat de posibilitatea cultivării celulelor stem în laborator. Interesul major pentru biologia celulelor stem este explicat de potenţialul de diferenţiere al acestora în orice tip de ţesuturi şi organele dintr-un organism. Această abordare a permis medicilor oncologi să obţină rezultate spectaculoase în diferite forme de cancere. Prin definiţie celulele stem sunt acele celule care prin diviziune dau naştere unei celule fiică identică şi unei alte celule care poate fi diferită.recipient să conţină teoretic o singură celulă. După cum implică numele. Se poate vorbi la ora actuală de cancere tratate cu anticorpi monoclonali în care pacienţii supravieţuiesc fără recidivă la 30 de ani de la administrarea terapiei. După sursa de provenienţă există două tipuri de celule stem: celule stem embrionare şi celule stem adulte. numărul celor aflaţi în diferite stadii de testare depăşeşte 100. Ajunşi în organism aceşti anticorpi ca orice altă substanţă străină iniţiază un răspuns imun din partea gazdei care se poate manifesta prin secreţia de anticorpi umani anti-anticorpi monoclonali de şoarece. Tehnologia ADN-ului recombinat a făcut posibilă ataşarea părţii specifice (cea care recunoaşte antigenul) derivată de la şoarece cu un braţ constant (care consituie cea mai mare parte) de la om. anticorpii monoclonali produşi în şoarece prezintă neajunsul de a fi străini organismului uman. pluripotente. în ultimii ani. Din acest motiv. Deşi nu sunt toxici. Deşi cercetarea în acest domeniu este relativ la început. Se obţin în acest fel colonii în care toate celule provin dintr-o singură celulă mamă şi deci vor produce acelaşi anticorp ca şi aceasta. oligopotente. După numărul de precursori ai liniilor diferenţiate pe care le poate produce. celulele totipotente sunt capabile să formeze un organism în totalitate. O schiţă a diferenţierii celulare se găseşte în figura 2. multipotente. Aceste celule sunt reprezentate de către ovulul fertilizat şi celulele obţinute din primele diviziuni ale acestuia. cercetătorii au reuşit să izoleze şi cultive cu succes 69 . anticorpii de şoarece au fost umanizaţi. Cele mai bine studiate celule stem sunt cele derivate din măduva osoasă şi care constituie precursorii tuturor celulelor din sânge. Cu timpul anticorpii umani pot neutraliza şi distruge anticorpii monoclonali injectaţi anulându-le efectele terapeutice.

celulele stem prezintă şi aplicaţii diagnostice. Folosirea acestor celule face posibilă şi obţinerea animalelor modificate genetic prin introducerea unor gene în embrionul tânăr.anumite celule stem din diferite surse unele dintre ele fiind apoi diferenţiate în numeroase celule finale. tehnologia cultivării celulelor stem embrionare este puternic îngrădită de normele actuale ale eticii cercetării. Este posibil ca una dintre cele opt celule ale embrionului rezultat în urma fertilizării in vitro a unui ovul să fie îndepărtată şi analizată din punct de vedere genetic (celula este dispensabilă deoarece restul celulelor rămase refac embrionul). Pe lângă potenţialul terapeutic enorm. Deşi deosebit de atractivă. Dacă aceste organe sunt chiar gonadele. postmitotică Figura 2 Celulele stem pot da nastere unui numar mare de celule diferentiate final 70 . Celula stem Pluripotentă Celula stem Multipotentă Celula stem cu potenţial limitat Celula diferenţiată Parţial Celula diferenţiată final. Se pot produce astfel animale „chimera” care exprimă genele implantate în diferite organe. atunci urmaşii unei împerecheri dintre doi astfel de şoareci chimera pot produce un knock-out/knock-in pentru acea genă. În urma analizelor care pot să depisteze diferite defecte genetice se poate decide neimplantarea embrionului în uterul viitoarei mame.

Această nouă descoperire pune sub semnul întrebării principiile actuale care stau la baza tratamentului cancerului. • tipul de hotă folosită pe scară largă în cultura celulelor animale este hota cu flux de aer vertical care oferă o protecţie bună atât pentru celule cât şi pentru operator. b. Succesul în lucrul cu celule depinde de factori variaţi cum ar fi: utilarea laboratorului. Incubator cu sursa de CO2 • creşterea celulelor. în funcţie de tipul de celulp. Experimental s-a dovedit că un număr de doar 200 de celule considerate ca fiind celule stem canceroase este suficient pentru a transfera cancerul de la un animal la un altul în timp ce un număr de câteva sute de ori mai mare de celule canceroase care nu prezintă caracteristicile celulelor stem sunt incapabile să transfere boala. Echiparea laboratorului de culturi celulare Organizarea generală a laboratorului de culturi celulare include următoarele echipamente de bază (figura 3): a. Recent au fost descrise şi celule stem canceroase. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente 3. tehnica asepteică (prezentate în cele ce urmează) şi experienţa personală a operatorului care contribuie decisiv la primele trei. Existenţa acestor celule canceroase stem poate explica apariţia recidivelor prin participarea unui număr redus de celule care nu pot fi distinse/distruse prin tehnicile actuale. 3. concentraţia de CO2 este în general ajustată între 5% şi 7% pentru a obţine un sistem tampon optimal în combinaţie cu substanţele din mediul de cultură. Hota cu flux laminar • Serveşte lucrului efectiv cu celulele. calitatea celulelor şi a reactivilor.Disputele asupra aspectelor etice ale lucrului cu celule stem embrionare au încurajat dezvoltarea tehnicilor de lucru cu celulele stem adulte.1. Rămâne de văzut dacă potenţialul unor astfel de celule stem adulte este la fel de nelimitat ca şi al celor embrionare. • este prevazută în mod obligatoriu cu o lampă de UV care va fi pornită 5-10 minute înainte de începerea lucrului şi repornită pentru 5-10 minute după încheierea lucrului. aranjarea spaţiului de lucru este descrisă în figura 4. 71 .

high efficiency particulate air). • Autoclav şi sterilzor cu aer uscat o Folosite pentru sterilizarea diferitelor soluţii şi recipiente folosite. DMSO) se poate folosi şi ca sistem de aspirare a mediilor folosite. halat). de obicei se găseşte într-o incintă anexată. c. • deoarece în cultura de celule animale. umede şi cu temperatura constantă.) (medii cultură. • 72 . Alte componente • Baie de apă o păstrarea mediilor şi altor reactivi la temperatura de 37 grade Celsius. Frigider/congelator • stocarea reactivilor L-glutamina etc. • o precauţie deosebită trebuie acordată faptului că recipientul este extrem de rece (-196 grade Celsisus) şi azotul poate produce arsuri în urma contactului cu pielea sau mucoasele. o o alternativă este înlocuirea apei cu perle metalice care prezintă următoarele avantaje: reducerea contaminării reactivilor cu care vin în contact. e. Pompa de vid şi sisteme de sterilfiltrare o pentru lichidele instabile la autoclavare (de ex. manuşi. Recipient cu azot lichid • stocarea celulelor pe termen lung. Microscop optic inversat cu contrast de fază (opţional aparat foto) • serveşte la observarea celulelor. igienizare uşoară. stocuri de antibiotice. • contrastul de fază îmbunătăţeşte vizualizarea specimenelor transparente (celulelor).• responsabil pentru menţinerea unei atmosfere sterile (filtre HEPA. de aceea este necesară utilizarea echipamentului de protecţie (ochelari/mască facială. celulele sunt în general situate pe suprafaţa bazei recipientului se foloseşte microscopul inversat. Centrifuga de masă cu răcire • centrifugarea suspensiilor de celule în diverse scopuri. d. f. economisirea consumului de energie. stabilitate în timp.

73 . • vase de cultură . Organizarea laboratorului de culturi celulare Consumabile • pipete serologice. • medii de cultură (multe celule pot fi cultivate în DMEM/RPMI+10%FBS la care se adaugă diferite concentraţii de L-glutamina şi antibiotice).Figura 3.codate în funcţie de aria utilă de cultivare şi de volumul maxim de mediu care poate fi conţinut. pot fi din plastic (de unică folosinţă) sau din sticlă (refolosibile după sterilizare).

un indicator al pH-ului care trebuie să rămână între 7 şi 7. Compoziţia mediilor de cultură este complexă incluzând: aminoacizi.2. • spre deosebire de celulele vegetale şi bacterii. Cele mai multe medii conţin şi phenol red. carbohidraţi. 3. factori de creştere şi alte componente. glucoză şi altele în funcţie de particularităţile experimentului.Conologic se poate vorbi de existenţa a două categorii de medii. cu unele excepţii serul este considerat un component de bază. vitamine.4. • suplimente pentru mediile de cultură: antibiotice – uzual se foloseşte un ameste de penicilină/streptomicină. • acele încăperi care sunt dedicate lucrului cu celule prezintă risc infecţios pentru cei implicaţi. de aceea încăperile vor fi semnalizate corespunzător. există câteva principii de bază ale lucrului cu celulele: • culturile celulare vor fi făcute într-o cameră dedicată acestui scop. L-glutamină. Dacă acesta virează spre galben indicând un mediu acid este cazul ca mediul să fie schimbat. serul provine de la animale mari. • personalul care urmează să lucreze cu celulele va fi instruit corespunzător (vezi mai jos). săruri. acizi graşi. hormoni. celulele animale sunt pretenţioase în ceea ce priveşte condiţiile în care pot sa crească. de aceea se va permite doar accesul celor care sunt direct implicaţi în procesul de lucru cu celulule. în general de la vacă . • toate mediile şi suplimentele care urmează a fi folosite în cultura celulară trebuie să fie certificate pentru lucrul pe culturi de celule (indicaţia cell culture certified/approved trebuie să apară pe ambalaj/descrierea produsului). cele naturale care includ serul sanguin şi alte secreţii de origine animală şi medii sintetice în care componentele de bază sunt produse separat şi apoi amestecate de obicei de către firme specializate. Chiar dacă este vorba de un mediu sintetic. există riscul contaminării cu diferite microorganisme care datorită ratei 74 . Mediile de cultură sunt soluţii saline tamponate.Strategii de lucru Din punct de vedere tehnic. Tot din acest motiv.de unde şi numele de fetal bovine serum (FBS). accesul personalului în această cameră va fi restricţionat pe cât posibil. microelemente. Este de dorit ca această încapere să fie oarecum izolată faţă de restul laboratoarelor pentru a limita riscul de contaminare. toate acestea trebuie adaptate liniilor celulare cu care urmează a se lucra în laborator. La ora actuală. bicarbonat. Na-pyruvat.

creşterii densităţii peste un nivel critic. osmolaritatea (290-310mOsm). substanţele pot fi preîncălzite fie la 22. o faza de creştere exponenţială care durează în jur de 7-10 zile. tripsina). oricine poate învaţa să menţină culturile de celule după doar câteva zile petrecute în laborator dacă respectă protocoalele şi are la dispoziţie echipamentul necesar. se poate porni un cronometru pentru a evita „uitarea” mediilor pentru un timp îndelungat şi degradarea lor (L-glutamina.• • • • de creştere mult superioară celulelor animale vor deveni majoritare în scurt timp. o imediat după adăugarea suplimentelor în mediile de cultură se notează acest fapt pe recipientul respectiv. Odată aparută. lucrul bine organizat şi desfăşurat fără grabă este esenţial pentru o eficienţă maximă: o mişcările vor fi măsurate şi sigure. celulele animale se vor opri din creştere după un număr de generaţii care depinde de sursa primară a celulelor. Cu alte cuvinte. Singurul lucru care este şi mai uşor şi nici măcar nu necesită învatare este să contaminezi celulele. în plus factori ca spre exemplu temperatura (37 de grade Celsius pentru celule mamifere). o faza de inhibare a creşterii datorită inhibiţiei de contact. 3. Chiar şi în condiţii optime. şi o concentraţie a CO2 între 5 şi 7% condiţionează clutura celulelor animale (sistemul de tampon cel mai frecvent utilizat este cel cu bicarbonat de sodiu sau potasiu din mediul de cultură + CO2 din incubatorul folosit). celulele animale sunt limitate în ceea ce priveşte numărul de generaţii pe care le produc. Instruirea personalului Cultivarea celulelor este un lucru care se poate învaţa repede. scăderii potenţialului de metabolizare a mediului. contaminarea se poate propaga din aproape în aproape şi duce în final la compromiterea nu doar a celulelor la care contaminarea a fost iniţial sem75 .3.. fie la 37 grade Celsius (10-20 min e suficient. De aceea desfăşurarea activităţii în linişte este esenţială în laboratorul de culturi celulare. creşterea celulelor animale urmează o curbă cu trei faze: o faza de echilibrare (primele 24h) în care celulele se acomodează cu noul mediu în care sunt introduse. o nimic din ceea ce vine în contact direct cu celulele nu se deschide în afara hotei sterile. pH-ul. înainte de scoaterea din hotă se verifică etanşeitatea închiderii.

recipient etc.pentru evitarea contaminării celulelor şi operatorului: o halat cu mâneci lungi o pantofi închişi o mănuşi de unică folosinţă • Spălatul pe mâini înainte şi după lucrul cu celulele. ei vor începe prin a observa manoperele de lucru şi a le discuta cu un coleg familiarizat deja cu tehnicile. • Orice lichid care ajunge în contact cu suprafaţa de lucru sterilă va fi îndepărtat imediat cu ajutorul unui prosop de hârtie îmbibat în ethanol 70%. • Orice mediu sau obiect contaminat din greşeală va fi aruncat3.nalată ci a întregului stoc de celule. mai întâi sub supravegherea directă a celor familiarizaţi şi mai apoi în mod independent. • Orice pipetă trebuie folosită o singură dată2.) care urmează să fie introdus în hota pentru lucrul steril trebuie dezinfectat înainte sau imediat după introducere. cel proaspăt iniţiat va fi supravegheat din umbră de către un coleg cu experienţă care ar putea observa anumite manopere executate neconform cu normele curente. Asigurarea asepsiei şi antisepsiei Există anumite măsuri care asigură igiena în lucrul cu celulele: • Utilizarea echipamentului de protecţie . • Instrumentele de lucru trebuie igienizate la intervale regulate. 2 Excepţie fac pipetele de sticlă care pot fi spălate şi sterilizate. Toţi cei care urmează să lucreze cu celule vor fi în prealabil instruiţi teoretic înainte de a pătrunde pentru prima dată în laborator. 76 . 1 În categoria substanţelor cu efect antimicrobian sunt incluse alături de antisepticele aplicate pe ţesuturi vii. Practic. Orice obiect (pipeta. contaminarea recipientelor cu conţinut original (celule produse în laborator şi care nu pot fi achiziţionate de la companiile specializate sau transferate de la alţi investigatori) reprezintă cel mai neplăcut aspect care poate afecta un laborator de culturi celulare. antibioticele care acţionează în interiorul organismului şi de asemenea dezinfectantele care distrug microorganismele aflate pe suprafeţele neaparţinând fiinţelor vii. 3 Este vorba despre acele medii/suplimente/alte substanţe care nu mai pot fi sterilizate (fie prin sterilfiltrare fie prin autoclavare) şi respectiv obiecte care nu mai pot fi sterilizate. nu este permisă păstrarea pipetei în mediu sau folosirea unei pipete pentru a transfera mediu de la un recipient la altul. Doar după această perioadă este permis lucrul direct. Chiar şi după câştigarea independenţei în lucru. • O soluţie antimicrobiană1 de ethanol 70% trebuie să fie în permaneţă la îndemână. Pe lângă considerentele financiare.

Figura nu este la scală. Linia din faţă: Dreapta – pipeta/pompa aspirare medii prevazută la capăt cu pipetă de unică folosinţă Centru – recipientul cu celule În plan posterior: Stânga – vasele cu resturi lichide şi respeciv solide etichetate corespunzător 77 . Se pot lua probe care sunt analizate pentru stabilirea prin diferite tehnici a gradului de puritate/contaminare. Pentru organizarea eficientă a „mesei” de lucru se poate consulta figura 4. Figura corespunde pentru persoanele care folosesc cu precădere mâna dreaptă. Se pot de asemenea observa contaminări cu alte celule sau microorganisme. Se pot astfel observa caracteristicile normale sau abateri de la acestea.• Este necesară investigarea stării de sănătate a celulelor în fiecare zi. Trebuie evitată supraîncărcarea spaţiului de lucru care poate duce pe de o parte la blocarea fluxului de aer şi pe de altă parte la accidente nedorite care pot produce contaminarea celulelor sau reactivilor. Organizarea spaţiului de lucru steril Figura prezintă organizarea de bază a spaţiului. aşa cum este ea întalnită în mod frecvent în majoritatea laboratoarelor. WASTE Figura 4 . Organizarea spaţiului pentru lucrul steril Pentru reducerea la maxim a pericolului de contaminare este esenţială aranjarea locului de muncă sub hotă într-un mod care să evite încrucişarea mâinilor deasupra vaselor de cultură/mediilor.

în anumite situaţii este nevoie de utilizarea unor soluţii de tripsina/EDTA pentru crearea suspensiilor unicelulare (vezi Tripsinizarea). celulele care cresc aderent trebuie să apară distribuite pe suprafaţa de contact cu vasul în care cresc şi de cele mai multe ori capătă o formă poligonală. evaluarea celulelor se face în mod normal în fiecare zi prin vizualizarea lor sub microscopul optic. această procedură care se aplică în faza logaritmică de creştere a celulelor permite obţinerea unor cantităţi crescute de celule prin împărţirea/transferul acestora dintr-un recipient de cultură în mai multe recipiente fiecare reprezentând o nouă sursă de celule.4. de asemenea se pot planifica în acest fel anumite experimente pentru anumite date. subcultivarea celulelor: deoarece aglomerarea celulară poate influenţa negativ vitalitatea celulelor (a se vedea mai sus). starea de sănătate a celulelor este confirmată şi de creşterea numărului de la o zi la alta. o culoare care virează spre galben indică necesitatea schimbării mediului.suport pentru tuburi În afara hotei la îndemană . se recomandă ca celulele să fie subcultivate. există anumite formule de calcul care permit aflarea cu precizie a combinaţiilor optime.Dreapta – mediile de cultură Centru. Cultivarea celulelor • după felul în care cresc în flacoanele de cultură. 3. Modul de lucru este asemănător pentru toate celulele dar există anumite particularităţi de care trebuie ţinut cont în cazul fiecărei grupe. o evaluare de primă instanţă a celulelor se realizează prin vizualizarea macroscopică a culorii mediului din sticlele de cultură.pipete serologice de diferite mărimi.5. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora Pentru a subcultiva celulele/folosi celulele într-un anumit protocol este nevoie de stabilirea numărului de celule pe unitatea de volum. Mediul de 78 . flacon cu ethanol 70%. • • • 3. celulele eucariote pot fi împarţite în două mari categorii: cele care cresc aderent pe vasul de cultură şi cele care cresc în suspensie. iar celulele care cresc în suspensie rămân rotunde şi uneori (în funcţie de linia cultivată) pot forma aglomerări de celule (asemănător cu o ciorchină de struguri). culoarea standard a mediilor este roşu-orange.

Figura 5 . cryoconservarea este o metodă practică din punct de vedere economic: este mult mai simplu să păstrezi un tub cu celule îngheţate care nu au nevoie decât de o completare periodică a rezervei de azot decât să cultivi în mod repetat celulele în laborator. Sub microscopul optic. Îngheţarea şi dezgheţarea celuluor Doi paşi critici ai lucrului cu celulele sunt constituiţi de către îngheţarea şi dezgheţarea celulelor. Pentru o separare bună este nevoie de 10 minute la 200-250g/min (într-o centrifugă de masă cu rotor standard 1000rpm). De aceea cea mai sigură metodă de prezervare a liniilor celulare este cryoprezervarea care opreşte procesele metabolice nelăsând astfel loc modificărilor genotipului. există formule de calcul după care putem să aflăm numărul total de celule.cultură conţinând celulele este transferat unor tuburi în care se centrifughează (centrifuga trebuie echilibrată în prealabil . În funcţie de tipul camerei de numărăt.dacă avem un singur tub cu celule va trebui să folosim un al doilea tub cu aceeaşi greutate care poate să conţină apă distilată sau orice alt lichid cu densitate asemănătoare). O viabilitate de peste 90-95% este în general acceptată pentru toate manipulările ulterioare. leucocitele apar ca şi celule gălbui/transparente cu o membrană brună. Celulele vor sedimenta ca şi în figura 5.6.5% şi pipetate în camera de numărat. de aseme79 . Îngheţarea este indispensabilă din următoarele considerente: • Celulele sunt supuse în permanenţă variaţiilor în compoziţia cromozomilor. • În plus. După centrifugare celulele se resuspendă în mediu proaspăt şi apoi 10 microlitri sunt combinaţi cu 10 microlitri de soluţie Trypan blue 0. Soluţia de trypan blue va pătrunde în celulele moarte care apar albastre. Aspectul celulelor în tub după centrifugare 3.

• Nu în ultimul rând. De aceea trebuie limitat contactul acestuia cu celulele. după care se poate adăuga mai rapid mediu până la 10ml. 4 5 80 . Urmează apoi transferul peste noapte la -80 de grade Celsius şi apoi stocarea de lungă durată în azot lichid. direct în baia de apă la 37 de grade Celsius. Prin mişcări fine se distribuie celulele. metoda face posibilă revenirea la celule cu un număr mai mic de pasaje. Se resuspendă în 10 ml de mediu şi se transfera în sticlele de culturp etichetate. Odată ce dezgheţarea permite pipetarea suspensiei (>75% dezgheţată) aceasta se transferă într-un tub de 15ml peste care se adaugă picătură cu picătură8 o cantitate de mediu preîncălzit echivalentă cu de două-trei ori cantitatea suspensiei. numărul de celule. Îngheţarea4 va fi lentă şi constantă pentru a minimaliza efectele adverse asupra viabilităţii celulelor.nea transportul între laboratoare este mai uşor dacă celulele sunt îngheţate. Mediul va fi schimbat pentru a înlătura celulele moarte şi resturile de cryoprotector (DMSO – sterilfiltrat sau glycelor .autoclavat). 7 DMOS este toxic pentru celuele la temperatura camerei. După câteva ore (cel târziu a doua zi dimineaţa) se verifică starea celulelor prin vizualizarea la microscop. celulele vor fi resuspendate direct în mediul de îngheţare răcit în prealabil la 4 grade la o concentraţie de 1x106-1x107/ml6 şi transferate imediat7 la -20 de grade C pentru 1-2 ore. Mediul de îngheţare5 cel mai frecvent folosit conţine mediul de cultură recomandat pentru linia celulară + 20% FCS + 5-10% cryoprotector -Dimethyl sulfoxid (DMSO) sau 10-15% glycerol care are rolul de a scădea temperatura de îngheţ permiţând apei să iasă din celulă şi împiedicând astfel formarea cristalelor de gheaţă care ar putea distruge membrana. Există dispozitive speciale care permit coborarea temperaturii cu un grad pe minut. Se centrifughează în general la 200rpm timp de 2-5 min pentru a elimina urmele mediului de îngheţare. După centrifugarea şi verificarea vitalităţii (se recomandă folosirea celulelor vitale în proporţie de >90-95% la colorarea cu trypan blue). pe gheaţa uscată. este important să avem o suspensie omogenă unicelulară. la îngheţare apa iese din celule unde presiunea osmotică va creşte. 6 Numărul de celule/aliquot variază În funcţie de tipul de celule. numărul de pasaj şi data la care a fost creat stocul. Există linii celulare la care se preferă folosirea altor substanţe în locul DMSO. 8 Pentru a preveni socul osmotic. Dezgheţarea celulelor trebuie făcută extrem de rapid (ideal în mai puţin de un minut) prin transferul acestora din recipientul cu azot. Este esenţial ca înainte de începerea procedurii respective să notăm următoarele detalii pe fiecare tub: tipul de celulă.

Garland Science.com 9 Acesti ioni pot scadea eficienţa tripsinei/EDTA 81 . John Wiley & Sons 5th Edition 2005 Molecular Biology of the Cell – 4th ed. Harford JB.7.3. 2002 Short Protocols în Cell Biology – 1st ed. acţiunea trispinei este antagonizată prin adăugarea de ser urmată de transferul într-un tub adecvat şi centrifugarea. Celulele nu trebuie lăsate neacoperite timp îndelungat. 6. La celulele neaderente nu se face tripsinizarea. Lippincott-Schwartz J. Walter P . Lewis J. John Wiley & Sons 2004 Zell. Yamada KM. Roberts K. spălarea cu o soluţie salină tampon fără9 calciu şi magneziu şi adăugarea unei cantităţi de trispină/EDTA care să acopere stratul de celule. Auflage. 5. Bonifacino JS. Celulele devin rotunde odată ce pierd aderenţele.. Culture of Animal Cells: A Manual of Basic Technique. unele celule care cresc în suspensie). 4. La fiecare 2-4 săptămâni se centrifughează şi resuspendă celulele neaderente în mediu proaspăt. A doua zi se recomandă schimbarea mediului care permite înlăturarea celulelor moarte şi a resturilor de tripsină/EDTA. Johnson A.invitrogen. Dasso M. celulele sunt apoi transferate vaselor noi de cultură şi incubate până a doua zi. 2. Subclonarea. Lindl T. Dacă este vorba de celule aderente protocolul de lucru presupune îndepărtarea mediului. Urmărind sub microscop separarea celulelor (durează câteva minute) se poate evita efectul nociv al unei incubări prea îndelungate.protocol-online. 3.Bibliografie 1. celule pot fi direct numărate iar densitatea lor este ajustată prin adăugarea mediului proaspăt. Raff M. După centrifugare celulele sunt resuspendate în mediu pentru a obţine o suspensie unicelulară şi apoi numărate/investigate la microscop prin colorarea cu trypan blue (proporţia celulelor moarte). Freshney RI.. 4. se urmează paşii din protocolul respectiv. Alberts B. Pentru a ajuta separarea este posibilă uşoara bătaie a sticlei de podul palmei. Spektrum Akademischer Verlag 2000 www.org www. Dacă manopera s-a făcut în alt scop. tripsinizarea Celulele formează aderenţe între ele şi suprafaţa vasului de cultură (celule aderente) şi/sau între ele (celulele aderente.und Gewebekultur – 4. Dacă tripsinizarea s-a făcut în cadrul protocolului de subcultivare. Pentru cele mai multe protocoale/manopere este necesară obţinerea unei suspensii unicelulare. Imediat. Cea mai frecventă combinaţie folosită în acest scop este tripsina/EDTA.

.... evoluţionism.... Anticorpii monoclonali bio-nano-functionalizaţi .. Producerea proteinelor recombinate în celule mamifere....... genetică..................... biologia dezvoltării organismelor........ Mircea Teodor Chiriac Cuprins 1........ inteligent drug design etc.......... biologie celulară şi moleculară..................... Adaptarea/importul acestora la tematicile de cercetare ale platformei ....... dr.................. biochimie........... Acesta este reprezentat de către totalitatea celulelor............. ţesuturilor şi proceselor biochimice care au funcţia de a ne proteja faţă de efectele nedorite ale agenţilor patogeni din mediu şi/sau acţiunii dăunătoare a structurilor proprii 82 ........... În acest context.. bio-nano-tehnologia... vom discuta în cele ce urmează folosirea celulelor ca şi entităţi de producţie a proteinelor recombinate cu aplicaţii în autoimunitate şi producerea şi caracterizarea anticorpilor monoclonali bio-nano-funcţionalizaţi cu aplicaţii în cancere şi boli autoimune......... farmacologia..... 88  2.... medicina moleculară..... 88  1.............Culturi celulare – partea a II-a Lect............. culturile celulare sunt folosite fie ca mini-bioreactoare pentru producerea diverselor produse biotehnologice fie ca şi model organismic pentru testarea efectelor/toxicităţii noilor medicamente. 94  4.. De asemenea dezvoltarea industriei farmaceutice a profitat din plin de avansarea tehnicilor de lucru cu celulele............. 99  1.... Bibliografie . Studiul de literatură privind cercetări exploratorii recente ..... Dintre aplicaţiile moderne ale culturilor celulare............... 82  1... 93  3.... Imunologia este ştiinţa care se ocupă cu studiul sistemului imun. Studiul de literatură privind cercetări exploratorii recente Culturile celulare reprezintă una dintre cele mai puternice tehnologii/metodologii utilizate de către comunitatea ştiinţifică internaţională din domenii ca: biofizică.. Recomandări pentru abordarea de noi tipuri de experimente şi metodologii ...2...............1...........

fenomen caracteristic bolilor autoimune. răspunsul imun poate cuprinde două variante: • răspunsul înnăscut care reprezintă o primă barieră întâmpinată de către agenţii patogeni veniţi din afară (acest tip de răspuns apare pe scara evolutivă încă de la bacterii şi plante şi este păstrat şi la mamiferele superioare inclusiv la om). celulele natural killer etc. După cum menţionam anterior. Răspunsurile adaptative apar pentru prima dată pe scara evolutivă la peştii cartilaginoşi ca o completare a sistemului imun înnăscut. Deoarece sistemul imun adapatativ nu apare în urma unui salt brusc de la sistemul imun înnăscut. Ele pot fi clasificate în boli specifice pentru anumite organe aşa cum este spre exemplul pemfigusul vulgar care interesează pielea 83 . funcţia sistemului imun este să ne protejeze faţă de patogenii din mediu şi faţă de structurile proprii modificate. există din ce în ce mai multe date care au permis elaborarea unor teorii şi modele experimentale care s-au dovedit utile în caracterizarea acestor boli. celulele B1. NKT sunt considerate a fi cele care prin diverşi receptori şi căi de semnalizare celulară fac posibilă comunicarea între sistemul adaptativ şi cel înnăscut. În ciuda specificităţii remarcabile a răspunsurilor imune. Există aşa-numitele celule. celulele dendritice. Din punct de vedere didactic. Acest fapt permite apariţia unor erori care au ca şi rezultat declanşarea unor reacţii împotriva propriilor structuri.) într-o formă finită. există diferite structuri care asigură trecerea lină de la un sistem la altul asigurând astfel o continuitate între cele două sisteme.alterate (cum ar fi celulele tumorale). sudoare etc. Se poate vorbi în acest context despre o împărţire judicioasă a sarcinilor în sistemul imun al mamiferelor. Se consideră că bolile autoimune constituie un grup heterogen de afecţiuni care apar la aproximativ 5% din populaţie. • răspunsul adaptativ numit şi specific care este iniţiat atunci când răspunsurile înnăscute nu reuşesc să producă efectul dorit. există diverse mecanisme care au evoulat cu timpul pentru a satisface cu eficienţă maximă rezolvarea fiecărei situaţii ivite. Celulele ca şi macrofagele. cum ar fi granulocitele. recunoaşterea structurilor străine se face într-un mod indirect. de sine stătătoare şi cel cu componente celulare în care celulele sunt cele care îndeplinesc funcţia majoră de apărare (Figura 1. Se vorbeşte despre un sistem imun cu componente umorale adică cel în care produşii celulelor imune circulă prin sânge sau secreţii (lacrimi. care aparţin sistemului imun înnăscut şi alte celule cum sunt limfocitele care aparţin sistemului adaptativ. Tabel 1). Datorită diversităţii extraordinare pe care mediul o oferă. Deşi mecanismul apariţiei acestor boli nu este pe deplin înţeles.

Peptide antimicrobiene Anticorpii (imunoglobulinele) celulele dendritice şi monocitele/macrofagele aparţin didactic imunităţii înnăscute dar se găsesc din punct de vedere funcţional la graniţa dintre acesta şi sistemul adaptativ în sensul că fac legătura dintre antigen şi centrul de comandă reprezentat de limfocite. diabetul zaharat de tip I care afectează celule beta ale pancreasului sau tiroidita Hashimoto care apare la glanda tiroida. celule natural killer. Exista totodata schimburi directe intre sistemul innascut şi cel adaptativ care au loc cel mai adesea prin intermediul citokinelor. Tabel 1 Componente ale sistemului imun al mamiferelor Linia de apărare Primară = imunitatea înnăscută Secundară = imunitatea dobândită (adaptativă sau specifică) 1 Imunitate celulară Granulocite.Th Imunitate înnăscută Imunitate adaptativă Granulocyte. Acest centru de control şi decizie este reprezentat de către celula (limfocitul) T helper (Th). produsi de secretie ai celulelor imune care mijlocesc schimbul de informatii intre acestea (sageata cu doua sensuri). sistemul imun este organizat ierarhic în sensul ca există o unitate de control care integreaza informatiile primite de la toate celelalte componente şi pe baza lor stabileşte care este cea mai bună soluţie de urmat. şi mucoasele. La mamifere. şi boli autoimnune generalizate care interesează mai multe organe sau ţesuturi aşa cum este spre exemplu lupusul sistemic eritematos în care unul dintre au84 . 1 Limfocitele B şi limfocitele T Imunitate umorală Sistemul complement. Acesta primeşte informaţii de la sistemul imun înnăscut. sistem complement Tc B (Ig) Figura 1 Organizarea ierarhică a sistemului imun al mamiferelor. NK. macrofage. coordoneaza activarea sistemului imun adaptativ şi controleaza mecanismele efectoare ale sistemului innascut inchizand astfel circuitul.

autoanticorpii prezintă reactivitate cu forme recombinate ale autoantigenelor ţintă atât în ELISA cât şi în imunoblot. La ora actuală. O grupă de boli autoimune care se manifestă la nivelul pielii şi mucoaselor este caracterizată de prezenţa autoanticorpilor şi celulelor T autoreactive îndreptate faţă de autoantigenele de la nivelul pielii şi mucoaselor. Necesitatea înţelegerii mecanismelor patogenetice la nivel molecular este esenţială nu doar din punctul de vedere al tratamentului dar şi din perspectiva unei depistări precoce sau chiar a posibilelor mijloace de prevenţie a unor asemenea afecţiuni. adică răspunsul autoimun este întreţinut în permanenţă de existenţa unui anumit nivel rezidual al autoantigenului. Aceste celule odată activate produc şi eliberează specii reactive de oxigen care activează enzime 85 . Paraclinic. serurile majorităţii pacienţilor recunosc fomele native ale autantigenelor ţintă atât în imunoblot cât şi pe secţiuni de piele îngheţată. Dezavantajul major al acestui tip de tratament se manifestă prin apariţtia multiplelor „atacuri” din partea microorganismelor patogene din mediu care găsesc un teren propice pentru dezvoltare într-un organism în care sistemul imun este deprimat. Fie că este vorba despre boli specifice de organ fie că este vorba despre cele generalizate. Din punct de vedere clinic aceste boli se caracterizează prin prezenţa bulelor la nivelul pielii şi mucoaselor. printre care se numară epidermoliza buloasă dobândită şi pemfigoidul bulos/pemfigoidul cicatricial sunt caracterizate de prezenţa anticorpilor circulanţi şi a anticorpilor legaţi la nivelul joncţiunii dermo-epidermale care fixează complementul in situ. majoritatea pacienţilor sunt tratati cu ajutorul cortizonului şi derivaţilor acestuia. bolile din grupa celor generalizate au tendinţa de a se croniciza. lipsa unei înţelegeri depline a mecanismelor care iniţiază şi mai apoi întreţin distrucţia ţesuturilor proprii se repercută nefavorabil asupra prognosticului şi totodată calităţii vieţii celor afectaţi. De asemenea. substanţe care produc deprimarea sistemului imun ca mijloc de aparare împotriva celulelor hiperreactive care întreţin distrucţia tisulară.toantigenele ţintă este reprezentat de cromatina [1]. Scenariul fazei efectoare propune o succesiune de evenimente care debutează cu legarea autoanticorpilor la nivelul autoantigenelor ţintă urmată de fixarea componentelor sistemului complement. bule care se sparg lasând în urmă eroziuni acoperite parţial de cruste. Bolile din această grupă. Cercetările din ultimii ani au reuşit să precizeze o parte dintre mecanismele efectoare responsabile de patologia observată. Deoarece cromatina se găseşte practic în toate celulele nucleate. Anticorpii recrutează şi activează fie direct fie prin intermediul complementului granulocitele in situ.

8. Folosirea unui amestec de granulocite cu (b) superoxid dismutază sau (c) catalază. (a) Secţiunile incubate cu granulocite în lipsa altor substanţe rezultă în apariţia bulei experimentale. două enzime care sunt responsabile pentru conversia superoxidului în peroxid de hidrogen şi respectiv a celui din urmă în apă şi oxigen nu rezultă în inhibarea producerii separării dermo-epidermale. criosecţiuni de piele umană sunt incubate cu anticorpi de la (a-c) pacienţi cu boli autoimune subepidermale şi apoi cu granulocite amestecate sau nu cu diferite substanţe capabile să influenţeze nivelul producţiei de specii reactive de oxigen în granulocite.5.11.7. Într-un model experimental ex vivo. în care am folosit un ser de la un donator sănătos în loc de ser de la bolnavi. caracterizarea exclusivă a fazei efectuare a răspunsului autoimun nu generează nici o indicaţie asu86 .12] (Figura 2).9.10.6. mărire 200x (după [13]). Odată eliberate aceste enzime digeră structurile proteice responsabile de asigurarea joncţiunii derm-epiderm [2.4. (d) Controlul nostru negativ. Reprezentare schematică a implicării speciilor reactive de oxigen în patogeneza bolilor subepidermale. prin degradarea inhibitorilor acestor enzime.3. Deşi deosebit de utilă în precizarea posibilelor ţinte terapeutice specifice lipsite de efectele adverse ale terapiilor actuale. e Figura 2. arată lipsa separării dintre derm şi epiderm. (e) Diagrama prezintă lanţul de reacţii care produce speciile reactive de oxigen cu enzimele implicate (fundal roz şi albastru) şi respectiv inhibitori ai acestora (pe fundal verde) a-d.proteolitice prezente în veziculele granulocitare fie direct fie indirect.

proteinele sunt produse prin tehnologia ADN-ului recombinat şi exprimate apoi în celulele mamifere care oferă un sistem de expresie superpozabil cu cel întâlnit in vivo. Pentru aceste modele active de boală. receptorii pentru porţiunea Fc de pe fagocite. situate spre interior în această figură) şi două lanţuri uşoare (situate înspre exterior în partea de sus).pra cauzelor care declanşează reacţia autoimună. De asemenea tehnologia producerii. De aceea eforturile din ultima perioadă urmăresc reproducerea bolii prin imunizarea activă a animalelor cu proteine recombinate. Lanţurile grele sunt identice între ele la fel cum lanţurile uşoare sunt identice între ele. interacţiunea cu diverse componente ale sistemului imun (cum ar fi complementul. imunoglobulina (numită şi anticorp când se gaseşte sub formă circulantă în sânge/secreţii) are două porţiuni: zona superioară (N-terminală) Fab are rolul de a recunoaşte specific antigenul iar zona inferioară (C-terminală) Fc are rolul de a îndeplini funcţiile efectoare. Prezentare schematică a unei imunoglobuline. Imunoglobulinele sunt glicoproteine heterogene alcătuite din două lanţuri grele (cu masa moleculară mai mare. Din punct de vedere funcţional. În cele ce urmează vor fi descrise anumite caracteristici şi metode utile pentru înţelegerea acestor tehnologii. sau cu receptorii de pe celulele placentei – permit trecerea anticorpilor de la 87 . -COOH Fab Fc -NH2 Figura 3. caracterizării şi utilizării anticorpilor (Figura 3) monoclonali ca mijloace moderne de combatere a diverselor afecţiuni mergând de la cancer la boli autoimune sau boli degenerative va fi descrisă în cele ce urmează.

15]. se găsesc reziduuri de glucide care au rol în modularea interacţiunii dintre Fc şi receptorii sistemului imun (vezi text). fragmentele de interes sunt amplificate prin tehnica PCR. Producerea proteinelor recombinate în celule mamifere Tehnica de bază pentru producerea acestor proteine implică mai multe etape care sunt menţionate în tabelul 3. 1. Pe scurt. prevenţia/terapia cu ajutorul anticorpilor este o procedură folosită de câteva mii de ani. este semnalată folosirea serurilor pentru protejarea persoanelor în Turcia şi apoi odată cu experimentele doctorului Edward Jenner de la sfârşitul secolului al XVIII şi în Anglia. În urmă cu câteva secole. Ataşat de aceste cozi Fc. Cu ajutorul amorselor specifice. 1. După întocmirea strategiei de lucru. folosind acest ADN complementar pot fi amplificate secvenţele de interes prin reacţia de PCR.15]. Anticorpii monoclonali bio-nano-functionalizaţi Terapia biologică cu ajutorul anticorpilor este considerată la ora actuală ca fiind cea mai activă branşă a industriei farmaceutice[16].1. urmează exprimarea proteinelor codate şi purificarea acestora [14. 88 . ţesutul care conţine antigenul ţintă este prelevat de la sursa de interes după care ARN-ul mesager obţinut în urma extracţiei este folosit ca şi matriţă pentru sinteza ADN-ului complementar [14.mamă la făt). • anumite aspecte adverse (apriţia unui răspuns imun faţă de însuşi anticorpii) datorită utilizării anticorpilor de la alte specii. acestea vor fi utilizate fie la imunizarea pentru modelul activ de boală fie pentru cel pasiv. În ciuda efectelor terapeutice extraordinare.2. folosirea anticorpilor a fost însă limitată de anumite aspecte dintre care cele mai neconvenabile au fost: • lipsa unei surse constante de anticorpi omogeni. Apoi în funcţie de aplicaţia dorită. Totusi folosirea pe scară mai largă a anticorpilor în scop terapeutic a început să fie practicată începând cu secolul XX. După clonarea acestor fragmente în celule. Din punct de vedere istoric. • dificultăţilor tehnice în izolarea/producerea lor şi • necunoaşterea posibilelor ţinte terapeutice esenţiale pentru diferite afecţiuni. Chinezii şi indienii sunt cei cărora li se atribuie folosirea terapeutică a serurilor (fracţiunea sângelui în care se găsesc anticorpii alături de alte proteine) încă înaintea erei noastre.

89 . Într-o lucrare de referinţă pentru literatura biomedicală. de asemenea. entuziaştii au continuat însă lucrul la producerea anticorpilor monoclonali ducând la aprobarea utilizării primului anticorp produs în acest fel nu însă mai repede de un deceniu de la publicarea metodologiei de către Koehler şi Milstein [16]. lumea bio-medicală şi industria farmaceutică a fost în prima instanţă rezervată la posibila utilizare a acestora pe scară largă. Totuşi în anii care au urmat. Chiar dacă uşor exagerată şi poate nu cea mai potrivită din punct de vedere bio-medical. Această temere a fost dublată şi de avansarea tehnicilor industriale de producere a moleculelor cu masă moleculară mică care păreau să fi rezolvat în sfârşit problema inexistenţei unor medicamente perfecte. a dus la înlăturarea primului din cele două mari dezavantaje ale folosirii anticorpilor policlonali. doi cercetători anunţă în revista Nature [17] o metodă prin care se pot obţine cantităţi teoretic nelimitate de anticorpi cu specificitatea dorită.Descoperirea antibioticelor în anii 30-40 ai secolului trecut alături de celelalte inconveniente amintite au dus la intrarea anticorpilor într-un con de umbră. cu diferenţa dintre două persoane. Începând cu 1975 situaţia avea însă să se schimbe. prima purtând haine de diferite mărimi. cu timpul. potenţialul imens al noii tehnologii a incitat atât curiozitatea comunităţii ştiinţifice (interesată în definirea noilor aplicaţii pentru care anticorpii monoclonali reprezentau unealta mult-căutată. noua tehnologie a premis obţinerea lor prin tehnici relativ simple şi cu costuri substanţial diminuate înlăturând astfel cel de-al treilea dintre dezavantajele amintite anterior. forme şi culori şi a doua purtând haine personalizate de către un croitor profesionist. începând de la lenjerie şi până la ultimul nasture al paltonului. Cel mai probabil din acest motiv. Diferenţa între anticorpii policlonali (cei care erau la acea oră în uz medical) şi noii anticorpi (numiţi monoclonali) poate fi comparată. chiar şi numai pentru a face lucrurile mai uşor de înţeles. Anticorpii monoclonali produşi iniţial au păstrat neajunsul de a fi produşi în alte specii ducând la declanşarea unui răspuns imun masiv din partea primitorului (cel de-al doilea neajuns). folosirea acesteia are un substrat uşor de înţeles şi anume în literatura de specialitate de limba engleză termenii „tailor made antibodies” sunt folosiţi pentru a descrie producerea de anticorpi monoclonali specifici pentru diferite situaţii [18]. şi anume lipsa unei surse constante de anticorpi cu caracteristici omogene. Dezvoltarea acestei noi tehnici. În ciuda acestor piedici. cel de-al patrulea neajuns amintit mai sus) cât şi de către pragmatismul industriei farmaceutice (care găsea o nouă mină de aur în comercializarea noilor „gloanţe magice” aşa cum le numea Paul Ehrlich.

Aceste date au menirea de a sublinia interesul major al comunităţii bio-medicale şi al guvernelor statelor industrializate (din moment ce majoritatea studiilor sunt finanţate din bani publici) pentru găsirea unor strategii terapeutice specifice pentru tratarea acestei maladii. Dacă în anul 2000. urmaţi de cei conjugaţi cu material radioactiv şi o mică proporţie sunt reprezentaţi de cei conjugaţi cu toxine. După unii. După cum aminteam anterior la 11 ani de la publicarea lucrării lui Koehler şi Milstein. Datorită eşecului relativ al utilizării acestui medicament şi datorită timpului îndelungat necesar dezvoltării unui nou medicament. majoritatea sunt destinaţi tratării cancerelor. cu mai bine de un secol în urmă) [19].părintele hematologiei şi chemoterapiei (acesta din urmă fiind un termen pe care l-a introdus chiar el). cu o singură excepţie. se estimează că cinci din cele zece substanţe vor fi reprezentate de anticorpi în 2014 [16]. Majoritatea sunt folosiţi ca atare (neconjugati). în topul primelor zece produse folosite în tratamentul diverselor afecţiuni existau. În 1997. anticorpii sunt în aproape toate situaţiile luaţi în calcul la stabilirea strategiei terapeutice alternative sau câteodată constituie chiar terapia de primă alegere. timpul scurs până la aprobarea celui de-al doilea anticorp monoclonal a fost de încă opt ani de la aprobarea OKT3. La ora actuală. Desigur această turnură a fost posibilă prin îmbunătăţirea permanentă a protocoalelor de lucru şi obţinerea unor anticorpi modificaţi prin tehnologia ADN recombinat. administrarea acestui anticorp a dus la apariţia sindromului eliberării sistemice de cytokine [21] datorită interacţiunii OKT3 cu receptorii pentru porţiunea Fc a IgG. diagnostică şi preventivă a îmbolnăvirilor umane [16]. De asemenea dintr-un total de 1500 de studii clinice în care sunt testaţi noi anticorpi monoclonali peste75% sunt axate pe folosirea acestora în tratarea cancerelor. Dintre cei peste 25 de anticorpi monoclonali aflaţi la ora actuală pe lista medicamentelor aprobate pentru tratamentul afecţiunilor umane. rituxan (rituximab). un anticorp monoclonal împotriva CD20 de pe celulele 90 . tehnici care au cunoscut o dezvoltare extraordinară în ultimele două – trei decenii. doar substanţe cu greutate moleculară mică. în 1986 este aprobată utilizarea primului anticorp monoclonal pentru prevenirea rejetului de transplant. Mai mult. dezvoltarea tehnologiei producerii anticorpilor monoclonali reprezintă inovaţia secolului trecut în ceea ce priveste importanţa terapeutică. Folosirea pe scară largă a Orthoclone OKT3 (muronomab CD3) a fost însă limitată de faptul că acest anticorp de origine murină (produs în celule de şoarece care diferă suficient de celulele umane) induce un răspuns imun amplu în organismul uman [20].

Acest anticorp chimer (combinaţie între uman şi murin) are multiple mecanisme de acţiune dintre care merită amintite: inducerea toxicităţii celulare indusă de anticorpi (ADCC) şi citotoxicitatea mediată de complement (CDC). anemia hemolitică autoimună. o multispecificitatea. o 91 . Mai mult. Dintre acestea amintim: o modificarea porţiunii Fc a anticorpilor pentru: . Fab) fie prin fuzionarea lor pe domenii de Ig.B devine cel de-al treilea medicament admis pe piaţa din SUA pentru tumori ale celulelor B. prelungirea duratei de injumătăţire cu efecte favorabile datorate reducerii dozajului fie prin PEG-ylarea fragmentelor (scFv. vasculita autoimună etc. anticorpii sunt substanţe care interacţionează cu structuri extracelulare sau de pe suprafaţa celulelor. În plus dacă anticorpii iniţiali aparţineau clasei IgG1. diabetul zaharat de tip I.îmbunătăţirea proprietăţilor efectoare prin optimizarea interacţiunii cu sistemul complement. alături de un mecanism de inducere a apoptozei celulelor care exprimă CD20 pe suprafaţă. anticorpul păstrează specificitatea pentru care a fost creat pe unul dintre fragmentele Fab cu care se va lega de ţinta dorită urmând ca pe celalalt fragment Fab să lege un receptor de pe o celulă efectoare (spre exemplu CD3 de pe celula T) care are proprietatea de a distruge celula recunoscută specific. Pe scurt. pemfigoidul). Mare parte dintre eforturile actuale au menirea de a creşte penetranţa acestor glicoproteine pentru ţinte din interiorul celulelor. există câteva direcţii prin care se urmăreşte creşterea posibilelor interacţiuni terapeutice. investigaţii actuale sunt concentrate asupra diversificării activităţii prin schimbarea clasei şi deci a paletei de efecte posibile. Utilitatea acestei modificări poate fi exemplificată ca şi în figura 4. adică adăugarea unei alte specificităţi în zona de recunoaştere a Fab. bolile buloase (pemfigusul. În general. Între timp acest medicament este folosit şi în tratamentul unor boli autoimune cum ar fi artrita reumatoidă.îmbunătăţirea interacţiunii cu receptorii Fc sau Fc de tip neonatal (FcRn) de pe celulele efectoare. .

Existenţa a două fragmante Fab duce la legarea unui anticorp de două antigene invecinate. anticorpul monoclonal recunoaşte antigenul specific. Celula imună figurată cu linie punctată ramasă la distanţă nu este capabilă să distrugaă celula tumorală. (C) Alternativ porţiunea Fc poate fi modificată (funcţionalizată) prin ataşarea unei nanosfere care poate avea ca atare un efect toxic asupra celulei tumorale. (B) Modificarea unuia dintre fragmentele Fab poate fi făcută în aşa fel încât acesta să nu mai recunoască ţinta iniţială ci un receptor de pe o celulă imună efectoare aducând-o în imediata vecinătate a celulei tumorale. o toxină.A Celula tumorala B Celula tumorala Celula imun Celula imun C Celula tumorală D Celula tumorală Celula Celula imun imun nano nano + Figura 4. 92 . în acest caz de pe celula tumorală. fie. în cazul cytokinei prin recrutarea altor celule imune în zona respectivă. Puntea creată are ca efect reducerea dramatică a spaţiului dintre cele două celule permiţând celulei imune să distrugă celula canceroasă în condiţii optime. (D) Este de asemenea posibil ca nanosfera să conţină un material radioactiv. o enzimă sau chiar o cytokină care să crească puterea distructivă a anticorpului fie direct. de care se leagă. Modul de acţiune al anticorpilor bispecifici. (A) Clasic.

implementarea metodologiei şi tehnicilor moderne este un deziderat al activităţii prezente şi viitoare a grupului de cercetare. celule cu rol cheie în patogeneza autoimună a acestor boli. în paralel este de dorit abordarea acestei problematici din punct de vedere terapeutic. De asemenea instruirea personalului şi co-interesarea şi implicarea cercetătorilor externi în tematicile de cercetare ale platformei este esenţială pentru întărirea resursei umane cu expertiză în domeniu. De asemenea protocoale specifice a căror necesitate poate să apară pe parcursul desfăşurării experimentelor pot fi obtinute de la colaboratorii din afara Institutului. În acest context. un diagnostic precoce şi un tratament specific al acestor afecţiuni. În vederea atingerii acestui obiectiv. Potenţialul acestor anticorpi va fi studiat fie în preparaţii care conţin doar anticorpul pur fie în alte instanţe cu anticorpul funcţionalizat (Tabelul 2). la ora actuală. Tehnicile de lucru cu celulele mamifere sunt puse la punct în laborator. De aceea. Odată produse aceste fragmente vor fi caracterizate din punct de vedere bio-chimic şi folosite apoi fie separat fie în diferite combinaţii pentru producerea de anticorpi şi/sau pentru reproducerea bolii umane în animalele de experienţă.2. De altfel. Este de aşteptat ca o caracterizare precisă a mecanismelor patogenetice să necesite o perioadă relativ lungă de timp. Într-o primă fază. un deziderat este reprezentat de funcţionalizarea anticorpilor îndreptaţi faţă de molecule de pe celulele B. 93 . Adaptarea/importul acestora la tematicile de cercetare ale platformei Este de dorit ca în viitor. grupul de cercetare include în preocupările sale problematica legată de caracterizarea răspunsului autoimun în diferite modele de boală. vor fi luaţi în calcul anticorpi consacraţi cum ar fi anti-human CD20 alături de alţi anticorpi a căror ţintă se află tot pe celulele B dar a căror eficienţă în distrugerea acestor celule este încă necunoscută. utilizând tehnicile şi aparatura specifică culturilor celulare vor fi produse diverse fragmente recombinate ale unor proteine cu rol cheie în asigurarea adeziunii dintre derm şi epiderm. caracterizarea precisă a mecanismelor patogenetice implicate în distrucţia tisulară din bolile autoimune sa permită o prevenţie. Desigur importul premanent de know-how relevant pe plan internaţional este esenţial pentru consolidarea cercetării locale şi recunoaşterea validităţii datelor obţinute de către comunitatea ştiinţifică internaţională. Într-un set de experimente menite să caracterizeze potenţialul anticorpilor specifici faţă de diferiţi receptori de pe suprafaţa celulelor B de a determina distrugerea acestora.

producerea unui model de boală şi modularea acestuia în scop preventiv/terapeutic implică mai multe etape (Tabelul 3). De aceea. Ca şi metodologie de lucru. Recomandări pentru abordarea de noi tipuri de experimente şi metodologii Una dintre direcţiile de cercetare care vor fi abordate în viitor se va concentra pe producerea de fragmente recombinate ale diferitelor proteine autoantigen cu ajutorul culturilor celulare eucariote. Strategiile de lucru abordate pentru atingerea celor două obiective majore. Obiective Stablilirea dozei 50%1 Model de studiu Culturi celulare ex vivo Strategie Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Stabilirea potenţialului preventiv/curativ al anticorpilor funcţionalizaţi 1 Model animal în vivo Este vorba despre doza care provoacă moartea a 50% dintre celule. Nu este deocamdată clar în ce fel şi în ce masură autoanticorpii faţă de aceste molecule sunt implicaţi în patogeneza autoimună. contribuind astfel într-un mod inovativ la definirea naturii autoimune a diferitelor entităţi clinice. Atenţia va fi concentrată pe producerea acelor autoantigene a cpror patogenitate este încă incomplet elucidată. Integrinele sunt o clasă heterogenă de proteine implicate în diverse procese de la asigurarea contactelor dintre celule şi mediul înconjurător. odată produse aceste fragmente ar putea fi folosite în diferite combinaţii pentru a reproduce caracteristicile bolii umane în animalele de experienţă.Tabel 2. 94 . 3. Defecte ale acestor integrine sunt considerate a fi implicate în patogeneza bolilor autoimune. Un exemplu în acest sens îl constituie clonarea fragmentelor de integrine. la funcţii de recrutare şi transducerea semnalului. Un interes primar pentru preocupările noastre îl constituie producerea fragmentelor recombinate ale proteinelor care asigură adeziunea keratinocitelor de stratul dermal.

) .folosirea diverselor căi de administrare. Etape recomandate pentru modelare în scop preventiv/terapeutic a unei boli autoimune în animalele de experienţă Denumire etapă Obţinerea fragmentelor recombinate ale autoantigenului Activităţi Stabilirea planului de clonare Designul şi producerea de amorse specifice Izolarea ARN-ului mesager RT-PCR Clonarea produşilor obtinuţi prin PCR Exprimarea proteinelor recombinate Imunizarea animalelor de experienţă cu diferite combinaţii de proteine recombinate Evaluarea clinică şi paraclinică a inducerii bolii Dezvoltarea unor strategii de prevenţie.folosirea anticorpilor monoclonali cruzi sau funcţionalizaţi cu nanosfere . cantităţi variabile de autoanitgen. adjuvanţi.modificarea anticorpilor prin tehnica ADN-ului recombinat (se urmăreşte în acest fel modularea interacţiunii cu diferite mecanisme efectoare prin modificarea spre exemplu a porţiunii Fc a anticorpului) Producerea modelului activ de boală Producerea modelului pasiv de boală 95 . granulocite prin FcR etc. folosirea autoantigilor modificaţi .folosirea nanosferelor direcţionate specific împotriva celulelor imune autoreactive Imunizarea unor animale intermediare cu diferite combinaţii de proteine recombinate şi izolarea anticorpilor specifici produşi Transferul pasiv al acestor anticorpi în şoarecii de laborator Dezvoltarea strategiilor de prevenţie. diagnostic şi tratament a bolii induse: .Tabel 3.izolarea claselor şi subclaselor din sursa de anticorpi policlonali şi investigarea mecanismelor efectoare prin care aceştia produc boala . diagnostic şi tratament: .folosirea anticorpilor din diferite surse şi evaluarea mecanismelor patogenetice specifice fiecăruia (sistem complement.

S-a dovedit astfel existenţa unei concordanţe între aceste secvenţe şi capacitatea lanţurilor codate de a activa anumite mecanisme efectoare. Este vorba despre adăugarea diferitelor lanţuri glucidice care fac anticorpii entităţi glicoproteice. Cercetări recente au arătat că există diferenţe esenţiale între acţiunea diverşilor anticorpi care la prima vedere sunt identici. anticorpii multispecifici posedă şi alte specificităţi care să le crească capacitatea funcţională benefică. Se vorbeşte în acest sens despre anticorpi trispecifici/multispecifici în care pe lângă specificitatea porţiunii Fab pentru ţinta dorită. Spre exemplu. De altfel interesul tot mai mare în explicarea la nivel molecular a susceptibilităţii la anumite afecţiuni a dus din ce în ce mai frecvent la obţinerea secvenţelor de nucleotide care codează pentru anticorpi. De asemenea structura primară a lanţului polipeptidic care formează porţiunea Fc a anticorpilor este implicată în reactivităţile diferite observate la folosirea diverselor preparaţii de anticorpi. S-a dovedit recent că o scădere a syalilarii lanţului glucidic din această porţiune duce la creşterea activării celulelor efectoare cu receptror Fcgamma. semnificaţia funcţională a acestui detaliu structural a rămas un mister până de curând. iar o a treia. Explicaţia propusă a fost că diferenţa este datorată unor modificări postranslaţionale apărute în porţiunea Fc a anticorpilor. Deşi acest lucru era cunoscut de mai multă vreme. prin modificarea 96 . cea de-a doua porţiune Fab poartă specificitatea agentului terapeutic (nanosfera radioactivă sau toxina.În ultimii ani. Ideea de bază este că un sistem imun „acordat” perfect reuşeşte să distrugă celulele nedorite prin implicarea la timpul şi momentul potrivit a potenţialului uriaş pe care celulele imunităţii il posedă. Tendinţa actuală este de a grupa aceste polimorfisme de la nivelul ADN în funcţie de capacitatea anticorpilor de a activa/inhiba o anumită clasă de celule efectoare cu implicare în terapia afecţiunilor autoimune şi cancerelor. Astfel. Pe lângă specificitatea pentru celula tumorală ţintă şi cea pentru nanoparticule. sistemul complement). specificitate este adusă de către modificarea/modificările din porţiunea Fc astfel încât acestea să poată activa cu succes diverse mecanisme imune (Figura 5). patra etc. un accent deosebit a fost pus pe studierea interacţiunilor dintre porţiunea Fc a anticorpilor şi alte proteine efectoare din sistemul imun (receptorii pentru Fc de la nivelul celulelor imunităţi înnăscute. specificitate pentru un alt receptor de pe o celulă citotoxică spre exemplu). interesul extraordinar în găsirea combinaţiilor optime de anticorpi care să identifice celulele tumorale ţintă şi în acelaşi timp să angajeze un răspuns prin modificare celui de-al doilea fragment Fab a început să fie balansată de interesul pentru modificarea porţiunii Fc în vederea creşterii efectivităţii.

porţiunii Fc pe partea stângă a figurii.6…). folosirea unei duble specificităţi a porţiunii variabile a fragmentului Fab face posibilă recrutarea în vecinătatea tumorii a celulelor T citotoxice (4). Mecanisme de acţiune ale anticorpilor multispecifici. prin „personalizarea” interacţiunii fragmentului Fc cu celulele care poartă receptori pentru acesta (partea dreapta jos) sunt transduse semnale puternice care pot avea ca rezultat o activare crescută a acestor celule cu producerea speciilor reactive de oxigen şi eliberarea proteazelor efectoare (5.timpul de înjumătăţire crescut faţă de moleculele cu greutate moleculară mică ceea ce face posibilă scăderea dozei utilizate . anticorpul capătă proprietăţi sporite de activare a sistemului complement care fie direct (2) fie indirect (3) duce la distrugerea celulei canceroase/autoimune. De asemenea. proteaze CDC Figura 5. Numeroşi membri ai acestuia se află în prezent în diverse laboratoare partenere unde deprind metode şi tehnici noi pe care dorim să le implementăm odată cu reintegrarea acestora în laboratorul de origine.6… Celula imună 3 2 1 nano-r x/tox ROS. În prezent se urmăreşte lărgirea paletei de experimente şi metodologii care pot fi oferite la nivelul laboratorului.specificitatea şi afinitatea mare 97 .Celula imună Celula tumorală/ autoimună 4 5. În plus. Dintre avantajele folosirii anticorpilor ca şi agenţi biologici în tratamentul cancerului amintim: .

- - multiple mecanisme de acţiune care pot fi combinate (vezi anticorpi multispecifici pentru ADCC şi CDC) posibilitatea folosirii acestora ca şi terapie complementară/alternativă oricărei forme de terapie anti-canceroasă tradiţională utilizarea lor ca şi vehicul specific pentru transportul diverselor substanţe anticanceroase spre diverse destinaţii (vezi anticorpi bispecifici) utilizarea lor ca şi markeri de diagnostic/prognostic pentru diferite afecţiuni în anumite cazuri anticorpii pot per se să controleze creşterea tumorii prin interferarea cu căile de semnalizare celulară. enzime sau cytokine 1 Reprezentant Anti-CD20 Anti-CD20 Anti-CD20 Anti-EGFR Anti-EGFR Anti-Her2/neu Anti-EGFR Anti-VEGF-A AntiDiverşi Referinţa bibliografică [23. Cercetări recente au arătat că ADCC este mai eficientă la acei indivizi care prezintă anumite polimorfisme în porţiunea Fc (respondenţi cu grad înalt) [23. 98 . legarea concomitentă a Fv (partea a Fab) de antigenul ţintă şi a Fc de o celulă cum ar fi macrofagul sau celula NK care posedă receptori pentru această porţiune duce la activarea celulei imune urmată de distrugerea celulei ţintită specific. Diferite mecanisme de acţiune ale anticorpilor monoclonali Mecanism de acţiune propus ADCC1 CDC Inducerea apoptozei Blocarea interacţiunii factorilor de creştere cu receptorii specifici Blocarea fizică a dimerizării receptorilor pentru factorii de creştere Inhibarea neoformării vaselor sangvine Blocarea factorilor de creştere în forma solubilă Funcţionalizarea/conjugarea cu radioizotopi. toxine. fie prin inducerea apoptozei fie prin antagonizarea efectelor factorilor de creştere [22].24]. Tabel 4.29] [22] Majoritatea anticorpilor monoclonali utilizaţi acţionează asupra ţintelor specifice prin acest mecanism.24] [22] [25] [26] [26] [27] [28.

Haußer I. Sitaru C. J Cell Mol Med 11: 462-481. Murphy KM. J Clin Invest 115: 870-878. (1995) The OKT3 4. Cluj-Napoca: Babes-Bolyai University. 120 p. Sui W. 17. Chowdhury PS. J Immunol 183: 4088-4093. Chiriac MT. J Autoimmun. New Jersey: Wiley. Mihai S. 10. Sawamura D. Kohler G. et al. Sawamura D. J Autoimmun 31: 331-338. Takahashi K. 2. Chiriac MT. 5. Chiriac MT (2007) Inflammatory Mechanisms of Tissue Damage Induced by Antibodies. Li N. Sawamura D. Ito K. In: Zhiqiang A. Exp Dermatol 14: 861-875. Methods 36: 11-24. et al. Shimizu H (2010) What's new în bullous pemphigoid. et al. Roesler J. (2005) Induction of dermal-epidermal separation în mice by passive transfer of antibodies to type VII collagen. Recke A. 16. J Cell Mol Med 11: 1117-1128. et al. Lisi P. Natsuga K. Goto M. Evensen M. Wang G. Goodall M. Zillikens D. 3. Shield CF. Walport M (2007) Janeway's Immunobiology. J Immunol 184: 2166-2174. (2010) A novel active mouse model for bullous pemphigoid targeting humanized pathogenic antigen. 18. Vidarsson G. Sindrilaru A. 7. Schroeder TJ. Mihai S. 20. Sesarman A. (2009) Pathogenicity of IgG subclass autoantibodies to type VII collagen: Induction of dermal-epidermal separation. Mihai S. Liu Z. et al. Wu H (2005) Tailor-made antibody therapeutics. Ujiie H. Travers P. Sitaru C. 14. Herrero-Gonzalez JE. Chiriac MT. N Engl J Med 350: 1079-1080. (2007) Humanization of autoantigen. Milstein C (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. et al. Chiriac MT. Chiriac MT. Otto C.4. Shibaki A. Norman DJ. 11. Nishie W. Scharffetter-Kochanek K. 13. 99 . (2009) A novel humanized neonatal autoimmune blistering skin disease model induced by maternally transferred antibodies. (2007) The alternative pathway of complement activation is critical for blister induction în experimental epidermolysis bullosa acquisita. Jefferis R. 19. Goto M. et al. Sitaru C (2007) Immunopathology and molecular diagnosis of autoimmune bullous diseases. 8. editor. 6.Bibliografie 1. Oswald E. et al. 9. Shibaki A. Feldrihan V. (2007) IgG4 autoantibodies induce dermal-epidermal separation. Thurman JM. Zhao M. 15. 12. Cell Mol Life Sci 67: 1343-1351. Mihai S. Ujiie H. (2007) NADPH oxidase is required for neutrophil-dependent autoantibody-induced tissue damage. J Pathol 212: 56-65. et al. Nat Med 13: 378-383. Nishie W. Li Z. Zhiqiang A (2009) Therapeutic Monoclonal Antibodies: From Bench to Clinic. (2008) Subepidermal blistering induced by human autoantibodies to BP180 requires innate immune players în a humanized bullous pemphigoid mouse model. Shibaki A. Nishie W. et al. Shinkuma S. et al. J Dermatol 37: 194-204. Nishie W. 1st ed. Fritsch A. Zillikens D (2005) Mechanisms of blister induction by autoantibodies. J Immunol 178: 6514-6521. Nature 256: 495-497. (2010) Cross-reactivity of autoantibodies from patients with epidermolysis bullosa acquisita with murine collagen VII. Holers VM. Kimball JA. Schwartz RS (2004) Paul Ehrlich's magic bullets. Csorba K. New York and London: Garland. Sitaru C.

et al. Novotny W (2004) Discovery and development of bevacizumab. Cartron G. Ledbetter JA. Oncogene 26: 3714-3733. (2002) Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism în IgG Fc receptor FcgammaRIIIa gene. Solal-Celigny P. Ferguson KM (2004) Active and inactive conformations of the epidermal growth factor receptor. Legendre C. et al. Nat Rev Drug Discov 3: 391-400. Weng WK. 28. Blood 99: 754-758. Biochem Soc Trans 32: 742-745. 29. 23. Gillett N. Merite S. Zafir-Lavie I. Kim KJ. Reiter Y (2007) Novel antibodies as anticancer agents. Gascon P (2003) Mechanism of action of anti-HER2 monoclonal antibodies: scientific update on trastuzumab and 2C4. an anti-VEGF antibody for treating cancer. Michaeli Y. 25. Levy R (2003) Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab în patients with follicular lymphoma. Chatenoud L. Li B. Salles G.21. Ferran C. Codony J. Ferrara N. 26. Systemic cytokine release and modulation by corticosteroids. Bardos P. Armanini M. Transpl Immunol 3: 212-221. Shan D. et al. J Clin Oncol 21: 3940-3947. 22. Rovira A. Hillan KJ. Gerber HP. Adv Exp Med Biol 532: 253-268. Antibody Response Study: a multicentre study of human anti-mouse antibody (HAMA) production following OKT3 use în solid organ transplantation. 24. Albanell J. (1990) în vivo cell activation following OKT3 administration. Press OW (2000) Signaling events involved în anti-CD20-induced apoptosis of malignant human B cells. (1993) Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth în vivo. Mellado B. Transplantation 49: 697-702. Thouard I. 100 . Winer J. Cancer Immunol Immunother 48: 673-683. Nature 362: 841-844. 27. Dacheux L.

...... Aspecte generale ale spectroscopiei Raman ......... dr. 111 2................ Microspectroscopia Raman confocală ....... Celula Linkam ................................................................... Efectul Raman .................... 103 1.....................................3............3...... 109 2........................................... Aplicaţii în stiinta mediului...... 117 3...........................2..1......................2..... 110 2............... 115 3..... Analiza medicamentelor anticanceroase ..................2.........1............2..................... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii ......................2.................... Cipuri ADN ........................ 107 2............ 108 2................................. 107 2.................... 119 4... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 .. Analiza domeniilor amorfe .......... Modul de microscopie de forţă atomică model alpha 300 ............2.............. Monica Maria Baia Cuprins 1.... Imagistica Raman confocală...3... 119 101 .....2. Înregistrarea spectrelor Raman confocale ............................3............................4...................... Aplicaţii ale microspectroscopiei Raman........1...... 113 3............. Aplicaţii în ştiinţa materialelor ................... Identificarea fazelor cristaline şi a tranziţiilor de fază......2... 109 2...............1...................2.............................................. Accesorii .................................................... 107 2......................................................... Localizarea şi identificarea unor bacterii ....................................................................................... Bibliografie ..................................1........................................ 112 3.....3.........................1.... 112 3.................................................................3....... 104 1.............. Studii structurale ale componentelor solului: Acidul humic ..3.................................2......... MICROSCOPUL CONFOCAL RAMAN Microspectroscopia Raman Conf................1........................................ 108 2...... 102 1..................... Structuri alotrope de carbon ..............2................3...........1......................... 113 3....... Efectul Raman rezonant.................1.......................... 109 2.... Spectroscopia Raman amplificată de suprafaţă ............... Detecţia poluanţilor din apă.............2.................................................. Aplicaţii bio-medicale .......................................1.... 102 1..........III...... 111 2..... 105 2.......................1..2.................................................................. 117 3..............3..................... Parametrii optimi de funcţionare .................. 111 3............................

aşa încât. Liniile Raman denumite Stokes şi anti-Stokes se găsesc simetric. are o probabilitate de apariţie mult mai mare decât cel în urma căruia se eliberează o cuantă de energie hν 0 + hν s (linii anti-Stokes).1. şi care poartă numele de împrăştiere Rayleigh. în conformitate cu legea de distribuţie a lui Boltzmann. 102 . etc. în urma căruia este eliberată o cuantă de energie hν 0 − hν s (linii Stokes). Dacă o cuantă de lumină hν 0 nu este absorbită de o moleculă ea poate să sufere fie un proces de împrăştiere elastică.h ν s hν0 h ν0 hν0 hν0 + hνs v=1 v=0 Imprastiere Rayleigh Imprastiere Raman (Stokes) Imprastiere Rayleigh Imprastiere Raman (anti-Stokes) Figura 1. 1). 2]. De aceea. pe nivelele vibraţionale ale stării fundamentale cu energii mai mari se va găsi un număr mult mai mic de electroni. în urma căruia rezultă o cuantă a cărei energie rămâne neschimbată. fie un proces de împrăştiere inelastică care este cunoscut sub denumirea de împrăştiere Raman şi în urma căruia sunt emise cuante de energie hν 0 ∓ hν s (Fig. un micro-organism. 2].) interacţionează cu atomii sau moleculele constituiente şi poate fi absorbită sau împrăştiată [1. Diagrama tranziţiilor care au loc între diferite nivele energetice vibraţionale şi care corespund proceselor de împrăştiere Rayleigh şi Raman La temperatura mediului ambiant cea mai mare parte a electronilor se află pe nivelele vibraţionale ale stării electronice fundamentale cu energiile cele mai mici. hν 0 . de o parte şi de cealaltă a liniei Rayleigh [1. procesul Raman.1. Nivel electronic excitat Energie hν0 hν0 hν0 h ν0 . Efectul Raman O rază de lumină incidentă pe o probă (de exemplu o celulă biologică. Aspecte generale ale spectroscopiei Raman 1. un material.

Diagrama tranziţiilor care au loc între diferite nivele energetice în cazul (a) efectului Raman convenţional. 3]. care la rândul său reprezintă aproximativ 10-4 .10-3 din intensitatea radiaţiei incidente excitatoare. h ν0 h ν0 h ν0 . 1.h ν s h ν0 . Totuşi există substanţe care au capacitatea de a împrăştia radiaţia laser cu o intensitate de până la 106 ori mai mare decât cea a semnalului Raman normal. ceea ce limitează detecţia unor molecule aflate în concentraţie mică. cu cât energia de excitare este mai apropiată de energia necesară tranziţiei electronice cu atât este mai mare intensitatea 103 . Efectul Raman rezonant În spectroscopia Raman se folosesc în mod curent ca surse de excitare lasere cu lungimi de undă situate în domeniul vizibil (verde şi rosu) şi infraroşu-apropiat care nu au energie suficientă pentru a produce prima tranziţie electronică a majorităţii moleculelor. (b) efectului Raman pre-rezonant. 2). evitându-se astfel excitarea fluorescenţei [1.2.Intensitatea benzilor Raman este în general de 3 ÷ 5 ordine de mărime mai mică decât intensitatea liniei Rayleigh. În cele mai multe cazuri. (c) efectului Raman rezonant. dacă energia laserului este apropiată de valoarea energiei necesare unei tranziţii electronice (efect Raman rezonant). În unele cazuri observarea efectului Raman este impiedicată de apariţia fluorescenţei.10-8 din fotonii incidenţi sunt transformaţi în fotoni Raman.hνs (a) (b) (c) Figura. Aceste neajunsuri pot fi înlăturate prin utilizarea unei surse de excitare (laser) cu lungimea de undă situată în domeniul infraroşu-apropiat (NIR) sau prin utilizarea unor tehnici speciale cum ar fi cea bazată pe efectul Raman rezonant sau spectroscopia Raman amplificată de suprafaţă (surface-enhanced Raman spectroscopy SERS) [1-4]. Se face distincţie între două tipuri de efecte Raman rezonant: efectul pre-rezonant şi efectul rezonant (vezi Fig. care este mai intensă cu câteva ordine de mărime decât semnalul Raman şi care apare mai ales la investigarea biomoleculelor şi a sistemelor biologice. deci doar 10-6.h ν s h ν0 hν0 . 2.

O contribuţie majoră la amplificarea electromagnetică este datorată plasmonilor de suprafaţă. care de obicei nu se observă într-un spectru Raman convenţional. cum sunt cele biologice. 1. Modificarea regulilor de selecţie precum şi amplificarea tranziţiilor vibraţionale specifice de până la 106 ori permit utilizarea spectroscopiei Raman pre-rezonantă cât şi rezonanţa la un număr mare de aplicaţii din fizicp. Câmpurile locale rezultate amplifică intensitatea radiaţiei Raman emise. Tranziţiile de ordin superior. 5]: electromagnetic (amplificare a semnalului Raman de 104÷106 ori) şi chimic (amplificare a semnalului Raman de 10÷102 ori). la aşa numiţii cromofori. sunt deseori observabile într-un spectru Raman rezonant.3. Amplificarea semnalului Raman (de 106-108 ori) este explicată cu ajutorul a două mecanisme principale de amplificare [1. Pentru folosirea efectului Raman rezonant nu este necesar un echipament special. chimie. Efectul chimic al amplificării este asociat suprapunerii funcţiilor de undă ale metalului şi adsorbatului. Spectroscopia Raman rezonantă se foloseşte mai ales la investigarea moleculelor poliatomice mari. În plus. care este proporţională cu pătratul amplitudinii câmpului electric incident pe moleculă. săi în 1974 [5]. biochimie şi biologie. unde absorbţia este localizată într-o anumită zonă a moleculei. se folosesc doar lasere cu lungime de undă variabilă care să permită ajustarea energiei de excitare la valoarea necesară unei absorbţii electronice. Spectroscopia Raman amplificată de suprafaţă Efectul amplificării semnificative a semnalului Raman al moleculelor adsorbite pe suprafaţa rugoasă a unui electrod de argint a fost descoperit de Fleischman şi colab. O amplificare suplimentară apare datorită excitării plasmonilor de suprafaţă de către radiaţia Raman emisă de molecule.benzilor observate. care duce la procese de transfer de sarcină între nivelele fundamentale şi cele excitate ale moleculelor adsorbite [6]. apar benzi noi din analiza cărora se pot obţine informaţii structurale suplimentare. în lipsa unor semnale spectrale datorate mediului înconjurător (ex. Amplificarea semnalului Raman rezultă din excitarea acestor plasmoni de suprafaţă de către radiaţia incidentă. care sunt asociaţi oscilaţiilor colective ale electronilor de conducţie de pe suprafaţa particulelor metalice. Amplificarea Raman rezonantă permite izolarea benzilor Raman datorate acestor cromofori şi a unităţilor structurale situate în vecinătatea lor facilitând astfel analizarea zonei cromoforice care este de obicei zona activă. se modifică regulile de selecţie şi vor fi amplificate doar anumite tranziţii vibraţionale Raman. Astfel. proteine). 4. Ionul negativ obţinut are configuraţii geometrice de echilibru diferite faţă de cele 104 .

Pentru a optimiza amplificarea electromagnetică frecvenţa laserului trebuie să coincidă cu frecvenţa de rezonanţă plasmonică. antrax [12]. Acest lucru combinat cu faptul că intensitatea câmpului electromagnetic scade cu creşterea distanţei faţă de suprafaţă permite determinarea orientării speciilor adsorbite în raport cu suprafaţa.Microspectroscopia Raman confocală În urmă cu aproximativ două decenii au fost efectuate primele măsurători Raman cu ajutorul unui microscop. În particular. SERS a fost utilizată ca un mecanism de transpunere a semnalului în senzori chimici. Cu. Astfel de exemple sunt analiza unor cantităţi reduse de pesticide [11]. biomedical. SERS poate fi exploatată la identificarea selectivă a unor specii moleculare precum şi la detecţia unei singure molecule [10].ale moleculei neutre neadsorbite. 8].4. transferul de sarcină duce la apariţia unei molecule neutre excitată vibraţional şi la emisia unui foton Raman. Recent. Regulile de selecţie ale spectroscopiei Raman amplificată de suprafaţă (SERS surface-enhanced Raman spectroscopy) sunt în principiu aceleaşi ca şi în cazul spectroscopiei Raman convenţionale [7. de mediu. deoarece intensitatea câmpului electromagnetic local este maximă pe direcţia perpendiculară la suprafaţă. modurile de vibraţie care rezultă dintr-o modificare a polarizabilităţii perpendicular pe suprafaţă vor fi amplificate. suspensiile coloidale de Au şi Ag. Pentru a întelege mai bine raţiunile care au stat la baza evoluţiei spectroscopiei micro-Raman este foarte importantă cunoaşterea tuturor factorilor care contribuie la modificarea intensităţii semnalului ( S ) „livrat” de detectorul unui spectrometru în cazul unei linii Raman înregistrată la o lungime de undă λ . Cele mai des folosite sunt electrozii de Au. sunt utilizate mai multe tipuri de substrate active SERS. etc. 105 . şi de securitate globală şi naţională [9]. 1. De aceea. Pentru realizarea unui experiment SERS se foloseşte în principiu acelaşi echipament ca şi în cazul realizării unui experiment Raman convenţional. Îmbunătăţirea majoră era dată de folosirea unui obiectiv de microscop prin intermediul căruia se realiza atât iluminarea probei cât şi colectarea luminii împrăştiate. Deoarece amplificarea depinde de proprietăţile substratului. Datorită sensibilităţii de detecţie remarcabile şi a flexibilităţii sale de aplicare tehnică SERS este utilizată în mod frecvent pentru a soluţiona o mare varietate de probleme cu caracter analitic. filmele metalice de Au şi Ag. Astfel. glucoza [14] şi a unor reziduuri nucleare [15]. Ag. a unor antigene specifice prostatei [13].

unde I L este intensitatea radiaţiei laser incidentă pe probă (W⋅cm-2). Eficienţa de colectare a luminii este aproape în totalitate influenţată de apertura numerică NA a obiectivului de microscop care este definită de relaţia NA = n sin θ max în care n este indicele de refracţie al mediului dintre obiectiv şi probă iar θ max este unghiul maxim de colectare al obiectivului. şi rezoluţie spaţială paralelă la axa optică sau rezoluţie axială). Important în astfel de situaţii ramâne faptul ca mediul în care se face imersarea să nu influenţeze structura şi proprietăţile probei investigate. N m reprezintă numărul de molecule din volumul de probă investigat V P . Aceştia sunt intensitatea radiaţiei laser incidentă pe proba I L şi unghiul solid Ω din care se face colectarea luminii împrăştiate Raman. iar Tλ and s λ reprezintă capacitatea de înregistrare a instrumentului şi respectiv sensibilitatea detectorului la lungimea de undă λ . Se poate observa că atunci cand se doreşte examinarea unui volum V P foarte mic dintr-o probă. doar câţiva parametrii pot fi modificaţi astfel încât să se compenseze reducerea numărului de molecule N m . Ω este unghiul solid din care se face colectarea luminii împrăştiate Raman. care focalizează radiaţia laser şi culege lumina împrăştiată sub un unghi solid mare. specificate foarte exact de către producător. σ λ este secţiunea specifică de împrăştiere Raman (cm2⋅sterad-1⋅molecula-1).) impune utilizarea unor obiective speciale care posedă caracteristici diferite pentru fiecare mediu. utilizarea unei linii laser. şi a unui obiectiv de microscop. Astfel. etc. În numeroase studii micro-Raman apare un neajuns deoarece informaţia spectrală obţinută nu este culeasă dintr-un volum suficient de mic (referirea se face în termeni de rezoluţie spaţială perpendiculară la axa optică sau rezoluţie laterală. duce atât la obţinerea unui spectru Raman mai bun din punct de vedere calitativ cât şi la localizarea unei anumite zone de interes comparativ cu cazul în care acesta este înregistrat fără obiectiv de microscop [16].S ∝ I L ⋅ σ λ ⋅ N m ⋅ Ω ⋅ Tλ ⋅ s λ . a cărei putere poate fi reglată într-un domeniu relativ larg. Utilizarea unui astfel de mediu (apă. În microscopul convenţional întregul câmp vizual este uniform 106 . Se poate observa că în cazul unor măsurători efectuate cu un obiectiv de microscop imersat într-un mediu al cărui indice de refracţie este apropiat de cel al probei investigate (nu există o modificare a drumului razelor de lumină la trecerea într-un mediu cu indice de refracţie diferit) apare o îmbunătăţire a eficienţei de colectare şi a rezoluţiei spaţiale. ulei.

la detector ajungând doar radiaţia din volumul în care a fost focalizat laserul [17]. Aplicaţii ale microspectroscopiei Raman Spectroscopia Raman este o tehnică care pe lângă faptul că permite obţinerea de informaţii extrem de rapide despre structura.1. 107 .1.95) şi poate conduce la obţinerea de informaţie spectrală dintr-un tub focal cu un diametru de 1.iluminat şi observat. 2. nedistructivă şi extrem de puţin sensibilă la prezenţa apei. Analiza medicamentelor anticanceroase Producerea unor structuri moleculare capabile să se ataşeze de diferite secvenţe ale unui lanţ de ADN reprezintă un domeniu de cercetare intens datorită importanţei pe care o are acest subiect în obţinerea unor compuşi noi cu potenţial terapeutic. Spre deosebire de acesta. În paragrafele următoare sunt prezentate succint principalele informaţii care se pot obţine în urma aplicării microspectroscopiei Raman pe diferite sisteme de studiu. ca fiind neinvazivă. prin prezenţa pinholului se realizează o filtrare spaţială a radiaţiei. 2. În plus. Spectroscopia Raman poate fi utilizată pentru a examina interacţiunile dintre molecule mici şi ADN. în cele mai multe cazuri aplicarea ei nu necesită prepararea prealabilă a probei. Aplicaţii bio-medicale 2. microscopul confocal utilizează o diafragmă (pinhol) care izolează radiaţia luminoasă care provine din zona marginală a volumului în care a fost focalizat fascicolul laser (zona din afara focarului). Utilizarea primei metode de obţinere a confocalităţii necesită în general folosirea unor obiective de microscop cu apertură numerică mare (NA = 0. Astfel. spectroscopia Raman poate fi singura metodă care să permită detecţia lor în interiorul celulelor în absenţa unor marcări fluorescenţi. modificările structurale şi morfologice care apar în diferite tipuri de probe poate oferi şi unele avantaje unice în comparaţie cu alte tehnici. în funcţie de tipul aplicaţiei. Experimentele iniţiale constă în înregistrarea spectrelor medicamentelor în soluţie în vederea realizării unei caracterizări Raman fundamentale. Confocalitatea poate fi de asemenea obţinută şi prin restrângerea ariei de pe detector unde intensitatea radiaţiei Raman este mare (realizarea unei ”aperturi electronice”). această tehnică spectroscopică poate fi considerată.22λ/NA şi o adâncime de 4λ/NA2 [17].1. Astfel.9 – 0. Astfel. în cazul unor medicamente anticanceroase care nu prezintă fluorescenţă.

2. pentru a detecta cantităţi extrem de reduse ale unui anumit lanţ de ADN existent într-o probă se foloseşte tehnica SERS [18].Următorul pas constă în efectuarea de studii Raman ale medicamentelor ataşate de anumite secvenţe ale unor oligonucleotide pentru a obţine informaţii de bază care vor fi mai apoi utilizate când se studiază in vitro aceste procese [18]. Tehnica SERS poate fi utilizată în semnalarea unirii unui lanţ de ADN cu lanţul complementar şi formarea structurii dublu elicoidale. nucleu sau citoplasmă). microscopia Raman se poate utiliza pentru a studia medicamentele în interiorul celulelor şi a furniza informaţii despre: (a) interacţiunea dintre compus şi mediul celular.1. ca de ex. Astfel. (c) forma chimică a compusului în interiorul celulei (de ex. (b) localizarea sa într-o anumită regiune sub-celulară (de ex. Localizarea şi identificarea unor bacterii Cercetările din medicină şi biologie se confruntă cu necesitatea identificării precise a unor micro-organisme.2. Metoda standard de detecţie a procesului de hibridizare foloseşte marcări fluorescenţi. Acest fenomen este cunoscut sub denumirea de hibridizare şi stă la baza tehnologiei de obţinere a cipurilor ADN. dacă există o secvenţă cunoscută de ADN fixată într-o anumită zonă a suprafeţei cipului şi dacă apare procesul de hibridizare al unui lanţ de ADN în acea poziţie.1. se poate determina secvenţa de ADN din acel lanţ [18].3. dacă în spectrul SERS se observă benzile moleculei folosite ca marker înseamnă că s-a produs hibridizarea ADN-ului. Prin înregistrarea spectrului Raman este posibilă diferenţierea marcărilor fluorescenţi care dau benzi Raman specifice. În plus. Astfel. În cele din urmă. în care diagnosticarea pe baza hibridizării este utilizată în mod eficient pentru a obţine informaţii despre secvenţele de ADN. fapt care face posibilă testarea diferitelor secvenţe care există într-o zonă a cipului. suprafaţa cipului se foloseşte atât ca imobilizator al lanţului de ADN cât şi ca substrat activ SERS pentru lanţul de ADN marcat care va fi adus în vecinătate datorită procesului de hibridizare cu lanţul imobilizat. bacterii sau viruşi. Majorita108 . Cipuri ADN Biocipurile revoluţionează diagnosticarea clinică modernă şi tehnicile farmaceutice datorită rapidităţii de testare a probelor şi de livrare a rezultatelor. 2. dacă sunt posibile formele protonate sau neprotonate) [18]. În aceste experimente.

contribuţiile celorlalte componente nefiind prezente în spectru [3]. obţinuţi prin depunere din faza gazoasă. poate fi de asemenea evidenţiată prin spectroscopia Raman. Trebuie menţionat faptul că prin folosirea laserului care excită rezonant cromoforii se obţin doar benzile acestora. S-a arătat faptul că structura cristalină a clusterilor nanometrici de TiO2. Un alt studiu a dovedit că temperatura la care are loc tranziţia de fază ortorombic-tetragonal a structurii ceramice de BaTiO3 depinde de mărimea grăunţilor [21]. Aplicaţii în ştiinţa materialelor 2. 2. Atât studiile cristalografice cât şi 109 . s-a reuşit identificarea celor două bacterii.tea metodelor de identificare folosesc o evaluare morfologică combinată cu teste specifice în care se urmăreşte dezvoltarea micro-organismelor în diferite medii şi care durează până la 72 de ore. ceea ce facilitează identificarea directă a fazelor cristaline [19]. În plus.1. Spectroscopia Raman confocală oferă posibilitatea identificării unor bacterii individuale. care uneori este în strânsă corelare cu tranziţiile de fază. observarea unor moduri vibraţionale interzise în spectrele Raman reprezintă o dovadă a distorşilor care apar la nivelul reţelei cristaline [19]. care este prezentă în Rhodotorula rubra şi a benzilor date de sarcinaxantin. De exemplu.2. existent în Micrococcus luteus. 2. suferă o tranziţie de la faza de rutil la anatas atunci când dimensiunile lor depăşesc 5 nm [20]. apoi au fost amestecate şi o mostră de analiză a fost investigată cu ajutorul unui echipament Raman confocal.2. Analiza domeniilor amorfe Informaţiile obţinute prin aplicarea spectroscopiei micro-Raman sunt uneori mult mai utile decât cele determinate din analiza de raze X. Cunoaşterea spectrelor Raman ale diferitelor faze cristaline permite caracterizarea tranziţiilor de fază care apar la modificarea temperaturii sau a presiunii prin analiza comparativă a modificărilor care apar în cazul modurilor de vibraţie. Existenţa unei diferenţe în energia de suprafaţă ca urmare a modificării dimensiunii nanoparticulelor. Este cazul structurilor preponderent amorfe. s-a reuşit identificarea unor bacterii care conţin un cromofor (β-carotina. sarcinaxantin) în citoplasma membranei. Identificarea fazelor cristaline şi a tranziţiilor de fază Spectrul Raman a diverse nanostructuri este asemănător spectrului unui monocristal. Pentru aceasta au fost cultivate mai multe bacterii Rhodotorula rubra şi Micrococcus luteus. După înregistrarea spectrelor Raman şi analizarea benzilor date de β-carotina.2.2.

Atribuirea benzilor în aceste cazuri se face pe baza comparaţiei cu spectrele experimentale obţinute pe faze cristaline similare compoziţional structurii sticlelor sau vitroceramicilor investigate. Cel mai rapid mod de a obţine componenta amorfă şi cea cristalină este de a deconvoluţiona modurile Raman situate la numere de undă mici în vecinătatea liniei Rayleigh care conţin cele două componente [23]. mai exact atunci când apar modificări structurale în ordinea la mică distanţă.5 nm) şi respectiv în cea de a doua (0. nanotuburi. în cazul spectroscopiei Raman doar modurile de vibraţie ale reţelei şi cele de libraţie (care se găsesc la numere mici de undă) sunt afectate de dezordinea la mare distanţă. care sunt reprezentate de anumiţi atomi ai altor subreţele sau de defecte care apar ca urmare a substituţiei de atomi sau a prezenţei vacanţelor.3. În timp ce în cazul difracţiei de raze X apariţia lărgimii benzii este asociată cu abaterile de la periodicitate a reţelei cristaline pentru un număr însemnat de atomi. fulerene. 2. Lărgimea celorlalte benzi Raman este în principal afectată atunci când au loc modificări ale câmpului cristalin local. Aplicarea spectroscopiei micro-Raman la studiul materialelor şi în special al polimerilor poate face uneori distincţie între domeniile conformaţionale submicrometrice cristaline şi amorfe. Este una dintre puţinele tehnici sensibile la modificările structurale care apar în aceste tipuri de materiale. Raportul ariilor celor două benzi oferă o bună estimare a gradului de cristalinitate al probei. de la structuri cu grad de cristalinitate extrem de ridicat la structuri amorfe.cele de spectroscopie Raman se bazează pe a interpreta măsura dezordinii în termeni de lărgime a benzii. dar nu poate fi facută o separare spaţială a acestora [22]. modurile Raman de deformare sunt influenţate de dezordinea geometriei locale. grafit. în spectrele Raman ale acestor structuri 110 .1-0.2.). 26]. Separarea fazelor poate fi de asemenea studiată în cazul sticlelor unde valoarea numărului de undă la care apare semnalul Raman este strâns legată de conectivitatea unităţilor structurale poliedrice constitutive [24]. Structuri alotrope de carbon Microspectroscopia Raman a fost des utilizată la studiul structurilor alotrope ale carbonului (diamant. Dacă se ţine seama de descrierea moleculară a vibraţiilor. cu precădere în cazul structurilor dominate de legături covalente puternice. Din datele obţinute în urma analizei de difracţie de raze X se poate evidenţia faptul că există domenii cu structura periodică şi dezordonată. sau cu cele obţinute prin simulări teoretice [25. Astfel.5-5 nm) [19]. în prima sferă de coordinare (0. în timp ce modurile de intindere sunt afectate de dezordinea vecinătăţilor. etc.

Acidul humic apare în sol şi în apele subterane şi este implicat în numeroase procese chimice şi biologice care au loc în mediul terestru şi acvatic. Compuşi chimici precum hidrocarburile aromatice.2.3. Pentru a detecta aceste concentraţii mici este necesară folosirea unor tehnici instrumentale extrem de sensibile. 111 . fenolii sau derivaţii naftalinei sunt prezenţi în mediile acvatice datorită utilizării lor ca pesticide sau în procesele industriale. Extrem de important este faptul că în cazul nanotuburilor de carbon apar. benzile datorate modurilor de respiraţie radială (Radial Breathing Mode) cu ajutorul cărora se poate determina diametrul nanotubului (relaţie de inversă proporţionalitate cu valoarea frecvenţei Raman) [19]. Studii structurale ale componentelor solului: Acidul humic Caracterizarea structurală a acidului humic precum şi determinarea comportamentului lui de complexare sunt extrem de importante în ştiinţa mediului. 2.3. Tehnica SERS datorită sensibilităţii sale este capabilă să detecteze concentraţii extrem de scăzute ale acestor substanţe. Studiile SERS ale acidului humic au condus la obţinerea unor informaţii legate de mecanismele de legare şi/sau configuraţiile de complexare ale acidului humic. Cunoaşterea proprietăţilor chimice este esenţială pentru dezvoltarea unor modele ecologice folosite pentru remedierea şi detoxificarea de compuşi antropogenici sau chiar de reziduuri nucleare [3]. Persistenţa precum şi efectele toxicologice ale acestor compuşi şi ale produşilor lor intermediari sunt semnale de alarmă pentru agenţiile de resort din lume. Aplicaţii în ştiinţa mediului 2. derivaţii toxici de azot. 2.3. Determinarea substratului SERS cel mai potrivit pentru fiecare tip de poluant reprezintă un prim pas în dezvoltarea unui senzor bazat pe metoda SERS. Cu ajutorul acestei tehnici este posibilă determinarea orientării şi a modului de adsorbţie al acestor molecule pe suprafaţa substratului activ SERS [27]. Detecţia poluanţilor din apă Prezenţa poluanţilor organici în apă a devenit o problemă de actualitate pentru comunitatea internaţională.1. în regiunea numerelor mici de undă (< 200 cm-1).apar clar definite benzi datorate vibraţiilor date de structuri grafitice (notate G) şi de structuri dezordonate (notate D şi D’). Acestea au stabilit o concentraţie maximă permisă a acestor compuşi în apa potabilă de < 1 μg/l.

achiziţie de spectru/pixel (scanare) . 50X şi respectiv 100X (uscat şi în ulei de imersie). Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii 3. posibilitate de poziţionare a probei în planul x-y într-o regiune de 20 mm x 20 mm cu o rezoluţie mai mică de 1 μm.imagistica spectrală Raman la lungimi de undă fixe. cuplaj cu fibră optică standard SMA.achiziţie de spectre din arii selectate (confocal micro-Raman) . x-z şi y-z (pănă la 1024 x 1024 pixeli) . 112 . 20X.microscopie de câmp întunecat cu obiectiv EC Epiplan-Neofluar 100X/0.25 şi mărire 10X. 0.microscopie confocală în reflexie . fibre optice multimod (100.imagistica de fluorescenţă confocală (prin montare de filtre adecvate) Sistemul dispune în prezent de 2 lasere. 0. 50 şi 25 μm). 3) [28].45. Sistemul de microscopie Raman confocală lucrează în următoarele moduri de operare: . două reţele de difracţie cu 600 şi respectiv 1800 linii/mm. detecţie Raman între 150-3500 cm-1. Rezoluţia optică laterală la linia laserului de 532 nm este de 250 nm. un YAG 532 nm şi un He-Ne 633 nm. Echipamentul mai conţine un sistem de focalizare motorizat cu posibilitate de deplasare pe o distanţă de 30 mm şi o rezoluţie de 50 nm (un pas) şi o platformă de scanare prin acţionare piezo-electrică cu următoarele caracteristici: suprafaţa de scanare de 200 μm x 200 μm x 20 μm. Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este dotat cu un microscop optic care este echipat cu 4 obiective plan acromatizate de apertura numerică (NA) 0. pe direcţiile x-y.3. domeniul lungimilor de undă de excitaţie 442-785 nm.3. detector CCD cu răcire Peltier (1340 x 100 pixeli) şi iluminare prin spate tip Marconi. reflector de câmp intunecat . spectrometru UHTS 300.1. incluzând de asemenenea un obiectiv (cu cantilever ataşat) pentru analiza AFM în lichide şi o cameră video color.9 HDDIC. acurateţe de poziţionare pe direcţiile x şi y sub 4 nm iar pe direcţia z sub 1 nm.8 şi 1. Drumul razelor în interiorul echipamentului CRM 200 este prezentat în schema de mai jos (Fig. Dimensiunea maximă a probelor care pot fi măsurate este de 120 mm în diametru şi 20 mm înălţime. conectori.

Echipamentul CRM 200 are în dotarea standard trei fibre multimod cu diametre de 100. platforma de scanare 05. sistem de focalizare motorizat pe axa z 09. 3. Fibra este montată în planul imagine al microscopului şi poate fi ajustataă astfel încât să se obţină eficienţa maximă de colectare.5.2. fibra optică standard 03. Înregistrarea spectrelor Raman confocale În echipamentul CRM 200 radiaţia laser ajunge în microscop printr-o fibră optică standard iar radiaţia Raman împrăştiată. obiectivul 04. NA apertura numerică a obiectivului de microscop. pentru a obţine cea mai mare rezoluţie laterală vPmax ≤ 0.1. colectată cu ajutorul obiectivului de microscop.01. camera video Figura. Parametrii optimi de funcţionare 3. unde M este mărirea obiectivului. λ lungimea de undă. este transmisă spectrometrului echipat cu o cameră CCD prin intermediul unei fibre optice multimod. spectrometru UHTS 300 07. Partea stângă a ecuaţiei este legată doar de parametrii obiectivului de microscop. lampa cu lumină albă pentru iluminare 08. fibra optică multimod 06. 50 şi 25 μm. iar vPmax este un parametru variabil a cărui valoare trebuie stabilită în funcţie de tipul de informaţie spectrală care se doreşte a fi obţinută (ex. Drumul razelor în microscopul Raman WITec CRM 200.2. laserul 02. d0 diametrul ≥ NA v P max λ pinholului. Relaţia care trebuie îndeplinită în cazul măsurătorilor Raman confocal este πd 0 M . 3. Diametrul acestei fibre joacă rolul pinholului cu ajutorul căruia se realizează confocalitatea [29]. iar pentru vPmax ≤ 4 nu se modifică semnificativ rezoluţia axială). 113 .

apare riscul de a obţine semnal de la contaminanţi sau se poate degrada molecula. Puterea laserului trebuie aleasă astfel încât să nu inducă transformări probei (fotodegradare. în timp ce cea mai mare rezoluţie laterală s-ar obţine pentru un diametru optim al pinholului de 10 μm. etc.se lucrează cu fibra de 100 şi cu obiectivul de 20X sau 50X.Tabelul 1.4 50 40 / 0. iar spectrele obţinute să aibă un raport semnal/zgomot multumitor.pentru a stabili puterea laserului.4 71 Tabelul 2.5λ pentru diferite lungimi de undă şi diametre ale pinholului.25 53 20 / 0. cea mai mare rezoluţie axială s-ar obţine pentru un diametru optim al pinholului de 50 μm. De exemplu. se parcurg următoarele etape: .). În caz contrar.9. Astfel. Dacă proba de interes nu este predispusă la transformări din cauza laserului. fiind indicat să fie chiar mai mică de 200 ccd cts. . în cazul în care nu se obţine semnal Raman se creşte puterea laserului). un obiectiv de microscop cu mărire de 100 şi o apertură numerică de 0.9 111 100 / 1. în vederea stabilirii parametrilor optimi. Raportul πd0/2. Obiectiv microscop M/NA 10 / 0. se pot utiliza puteri mai mari (≤ 3 mW). se schimbă obiectivul de 100X.6 67 60 / 0. Raportul M/NA pentru diferite tipuri de obiective de microscop. Lungime de undă [nm] d0 = 10 μm d0 = 25 μm d0 = 50 μm d0 = 100 μm d0 = 200 μm 440 29 71 142 286 571 488 26 64 129 258 515 532 24 59 118 236 472 633 20 50 99 199 397 785 16 40 80 160 320 Cu ajutorul celor două tabele poate fi determinată mărimea corectă a pinholului în măsurătorile Raman confocal efectuate cu echipamentul CRM 200. în experimente SERS pe molecule biologice se foloseşte o putere a laserului sub 1 mW.25 80 100 / 1. În anumite situaţii se poate schimba şi fibra (vezi detaliile despre confocalitate prezentate mai sus) .stabilirea timpului de înregistrare se face în funcţie de intensitatea semnalului Raman obţinut (se poate alege de ordinul milisecundelor sau de ordinul minutelor) 114 . se foloseşte intensitatea liniei Rayleigh (ar fi bine să nu depăşească 400 ccd cts. Dacă semnalul Raman obţinut este bun. pentru măsurători în care este utilizat un laser cu lungimea de undă de 532 nm. Înaintea efectuării măsurătorilor propriu-zise.8 75 100 / 0.

Harta spectrală a intensităţii benzii Raman de la 737 cm-1 din spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenina pe o sticlă de microscop.2. 115 .1 s şi 1 s). Imagistica Raman confocală Pentru imagistică este indicată utilizarea obiectivului de 100X (în aer sau cu imersie în ulei).8 nm • puterea laserului 640 μW • timp de integrare/măsurare 60 s 3. iar stabilirea lui depinde de tipul probei. Exemplu.Exemplu: Spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenină pe o sticlă de microscop. 35000 30000 25000 Intensity [ccd cts] 20000 15000 10000 5000 0 400 600 800 1000 1200 -1 1400 1600 1800 Raman shift [cm ] Parametrii folosiţi: • fibra multimode de 100 μm • obiectivul 100X aer • linia laser 632. Referitor la timpul de integrare. În ceea ce priveşte stabilirea numărului de linii şi de puncte pentru suprafaţa pe care dorim s-o scanpm. ideal este să fie cât mai mic cu puţinţă (între 0. de puterea laserului şi de aria scanată. Înaintea efectuării unei scanări se stabilesc parametrii optimi de înregistrare (puterea laserului şi timpul de integrare) prin măsurarea spectrelor individuale şi time series. în general pentru o arie de 10 μm x 10 μm se utilizeazp minim 75 linii şi 75 de puncte pentru fiecare linie (la un număr prea mic de linii şi de puncte imaginea este de proastă calitate).2.

500

737

400

Intensity [ccd cts]

300

200

100

0 500 1000 1500
-1

Raman shift [cm ]

În spectrul selectat din imaginea scanată se poate observa semnalul “curat” de la adenină. Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 632.8 nm • puterea laserului: 640 μW • suprafaţa scanată: 10 μm x 10 μm • 75 linii; 75 puncte/linie • timp de integrare 0.5 s/punct (softul calculează timpul de integrare pentru o linie – în acest caz 37,5 s (trace) şi 0.075 s (retrace) Exemplu. Imagistica Raman pe o secţiune dintr-un dinte, la interfaţa dintre dinte şi plombă

116

Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 532 nm • putere laser 3 mW. • suprafaţa scanată 10 μm x 10 μm • nr. de linii 150, puncte 150/linie • timp de integrare 0.2 s/punct

3.3. Accesorii
3.3.1. Modul de microscopie de forţă atomică model alpha 300 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300.

01. camera video 02. unitatea de deflexie a razelor 03. lampa cu lumină albă pentru iluminare 04. obiectivul AFM cu cantilever 05. platforma de scanare 06. masa antivibraţie

Figura 4. Drumul razelor în microscopul de forţă atomică alpha300.

Microscopul AFM alpha 300 lucrează în următoarele moduri: contact mod, forţă laterală, acustic (tapping) mod, contact mod intermitent cu imagistica în fază şi amplitudine cu o rezoluţie de 16 bit, digitizare 5 MHz, şi frecvenţa 10-500 KHz. Sistemul dispune de un laser de deflexie 980 nm, o unitate de detecţie a deflexiei, masa antivibraţie 0.7 – 1000 Hz, > 1000 Hz pasivă. Aria de scanare este de 100 μm x 100 μm x 20 μm. Drumul razelor în interiorul microscopului de forţă atomică alpha 300 este prezentat în schema de mai sus (Fig. 4) [30]. 117

Parametrii optimi de funcţionare 1. Modul acustic (AFM AC-Mode) • Este modul de operare uzual, utilizat mai ales în cazul probelor moi (probe biologice). • Se folosesc tip-uri de Si3N4 fixate pe cantilever-uri cu frecvenţa de rezonanţă mare (200 – 300 kHz). • În vederea realizării alinierii se efectuează următorii paşi: • Se determină frecvenţa liberă de oscilaţie a cantileverului aplicând o tensiune de 0.05 –0.1 V • Se ajustează amplitudinea oscilaţiilor libere ale cantilever-ului până la o tensiune de 2 V • Se setează un setpoint de 1.5 V • Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. • Valorile tipice ale parametrilor pentru scanare sunt: • Număr puncte pe linie: 256 • Număr linii pe imagine: 256 • Timpul scanare pe linie: 0.5 – 2 s • În timpul scanării se ajustează P-gain şi I-gain astfel încât drumul înainte şi drumul înapoi să coincidă. • Apropierea tip-ului de substrat se face automat.

Imagine topografică AFM

Imagine fază AFM

2. Modul contact (AFM contact mode) - Permite înregistrarea de imagini, scanarea de-a lungul unei singure linii sau înregistrarea curbelor de forţă. - în vederea realizării alinierii se efectuează următorii paşi: - Se utilizează tip-ul de AFM dorit. 118

Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. - Apropierea tip-ului de substrat se face automat. - Valori tipice ale parametrilor pentru scanare: - Număr puncte pe linie: 256 - Număr linii pe imagine: 256 - Timpul scanare pe linie: 0.5 – 2 s peraturi.
• • • • •

3.3.2. Celula Linkam pentru efectuarea unor măsurători la diferite temDomeniul de temperatură: -196 - 600 °C. Stabilitate < 0.1 °C. Rata de încălzire: max 150 °C/min. Senzor din platină 100 Ω. Sistem de răcire a corpului celulei cu apă pentru temperaturi > 300 °C.

4.Bibliografie
I. R. Lewis, H. G.M. Edwards (Eds.), Handbook of Raman Spectroscopy, Marcel Dekker Inc. New York, 2001. 2. S. Astilean, Metode şi tehnici moderne de spectroscopie optica, Spectroscopia IR şi Raman, Editura Casa Cartii de Stiinta, Cluj-Napoca, 2002. 3. R. Petry, M. Schmitt, J. Popp, Raman Spectroscopy–A Prospective Tool în the Life Sciences, ChemPhysChem, 4, 14, 2003. 4. S. Schluecker, (Ed.), Surface Enhanced Raman Spectroscopy: Analytical, Biophysical and Life Science Applications, Wiley VCH, 2010. 5. M. Fleischmann, P. J. Hendra, A. J. McQuillan, Raman spectra of pyridine adsorbed at a silver electrode, Chem. Phys. Lett., 26, 163, 1974. 6. T. Vo-Dinh, SERS chemical sensors and biosensors: new tools for environmental and biological analysis, Sensors and Actuators B, 29, 183, 1995. 7. J. A. Creighton în Spectroscopy of Surfaces, Vol. 21 (Eds.: R. J. H. Clark, R. E. Hester), John Wiley & Sons, New York, 1988. 8. D. A. Weitz, M. Moskovits, J. A. Creighton în Surface-Enhanced Raman Spectroscopy with Emphasis on Liquid - Solid Interfaces, Vol. 2 (Eds.: R. B. Hall, A. B. Ellis),VCH, Deer field Beach, FL, pp. 197- 243, 1986. 9. G. A. Baker, D. S. Moore, Progress în plasmonic engineering of surface-enhanced Raman-scattering substrates toward ultra-trace analysis, Anal. Bioanal. Chem. 382, 1751, 2005. 10. K. Kneipp, H. Kneipp, P. Corio, S. D. M. Brown, K. Shafer, J. Motz, L. T. Perelman, E. B. Hanlon, A. Marucci, G. Dresselhaus, M. S. Dresselhaus, Surface-Enhanced and Normal Stokes and Anti-Stokes Raman Spectroscopy of Single-Walled Carbon Nanotubes, Phys. Rev. Let. 84, 3470, 2000. 11. N. Weissenbacher, B. Lendl, J. Frank, H. D. Wanzenboeck, B. Mizaikoff, R. Kellner, Continuous Surface Enhanced Raman Spectroscopy for the Detection of Trace Organic Pollutants în Aqueous Systems, J. Mol. Struct. 539, 410, 1997. 1.

119

12. X. Zhang, M. A. Young, O. Lyandres, R. P. Van Duyne, Rapid Detection of an Anthrax Biomarker by Surface-Enhanced Raman Spectroscopy, J. Am. Chem. Soc. 127, 4484, 2005 13. D. S. Grubisha, R. J. Lipert, H. Y. Park, J. Driskell, M. D. Porter, Femtomolar detection of prostate-specific antigen: an immunoassay based on surface-enhanced Raman scattering and immunogold labels, Anal. Chem., 75, 5936, 2003. 14. K. E. Shafer-Peltier, C. L. Haynes, M. R. Glucksberg, R. P. Van Duyne, Toward a Glucose Biosensor Based on Surface-Enhanced Raman Scattering, J. Am. Chem. Soc., 125, 588, 2003; C. R. Yonzon, C. L. Haynes, X. Zhang, J. T. Jr. Walsh, R. P. Van. Duyne, A glucose biosensor based on surface-enhanced Raman scattering: improved partition layer, temporal stability, reversibility, and resistance to serum protein interference, Anal. Chem. 76, 78, 2004. 15. L. Bao, S. M. Mahurin, R. G. Haire, S. Dai, Silver-doped sol-gel film as a surface-enhanced Raman scattering substrate for detection of uranyl and neptunyl ions, Anal. Chem. 75, 6614, 2003. 16. J. M. Chalmers and P. R. Griffiths, (Eds.), Handbook of Vibrational Spectroscopy, John Wiley and Sons, Chichester, pp. 1419-1428, 2002. 17. N. J., Everall, Depth Profiling with Confocal Raman Microscopy, Part II, Spectroscopy 19, 16, 2004. 18. C. G. Coates, J. J. McGarvey, On the Pulse: Andor tehchnology, 1(8), 2001. 19. G. Gouadec, P. Colomban, Raman Spectroscopy of nanomaterials: How spectra relate to disorder, particle size and mechanical properties, Progress în Crystal Growth and Characterization of Materials 53, 1, 2007. 20. E. Barborini, I. N. Kholmanov, P. Piseri, C. Ducati, C.E. Bottani, P. Milani, Engineering the nanocrystalline structure of TiO2 films by aerodynamically filtered cluster deposition, Appl. Phys. Lett. 81, 3052, 2002. 21. M. H. Frey, D. A. Payne, Grain-size effect on structure and phase transformations for barium titanate, Phys. Rev. B, 54, 3158, 1996. 22. A. Guinier, Théorie et Technique de la Radiocristallographie, Dunod, Paris, 1956. 23. M. F. Cerqueira, L. Rebouta, M. Andritschky, J.A. Ferreira, M. F. Da-Silva, Microcrystalline silicon thin films prepared by RF reactive magnetron sputter deposition, Vacuum 46, 1385, 1995. 24. D. G. Georgiev, M. Mitkova, P. Boolchand, G. Brunklaus, H. Eckert, M. Micoulaut, Molecular structure, glass transition temperature variation, agglomeration theory, and network connectivity of binary P-Se glasses, Phys. Rev. B, 64, 134204, 2001. 25. D. G. Georgiev, P. Boolchand, K.A. Jackson, Intrinsic nanoscale phase separation of bulk As2S3 glass, Phil. Mag., 83, 2941, 2003. 26. Y. Wang, J. Wells, D. G. Georgiev, P. Boolchand, K. Jackson, M. Micoulaut, Sharp Rigid to Floppy Transition Induced by Dangling Ends în a Network Glass, Phys. Rev. Lett., 87, 185503, 2001. 27. E. A. Carrasco, M. Campos-Vallette, P. Leyton, G. Diaz, R. E. Clavijo, J. V. Garcıa-Ramos, N. Inostroza, C. Domingo, S. Sanchez-Cortes, R. Koch, Study of the Interaction of Pollutant Nitro Polycyclic Aromatic Hydrocarbons with Different Metallic Surfaces by Surface-Enhanced Vibrational Spectroscopy (SERS and SEIR), J. Phys. Chem. A, 107, 9611, 2003. 28. http://www.witec.de/en/company/witecnews/19/crm200flyer.pdf 29. Manual WITec CRM200. 30. www.witec.de/en/download/AFM/alpha300Aflyer.pdf

120

Microspectroscopia Raman – partea a II-a
Conf. dr. Monica Maria Baia Cuprins
1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman................... 121 1.1. Substrate SERS ............................................................................................. 122 1.2. Identificarea unor bacterii ............................................................................. 122 1.3. Caracterizarea celulelor ................................................................................. 123 1.4. Diagnosticarea unor boli ............................................................................... 124 1.5. Aplicaţii în domeniul farmaceutic................................................................. 125 1.6. Aplicaţii în domeniul alimentar .................................................................... 125 1.7. Nanotuburi de carbon ................................................................................... 126 2. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS................................................................................... 126 3. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS .......................................... 128 4. Bibliografie ........................................................................................................... 130

1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman
În ultima perioadă, odată cu dezvoltarea tehnologică a aparaturii aferente care permite înregistrarea rapidă a spectrelor Raman folosind diferite linii de excitare laser precum şi vizualizarea zonelor cu ajutorul microscopiei de forţă atomică sau a celei electronice de baleiaj, microspectroscopia Raman este din ce în ce mai mult aplicată în diverse domenii cum ar fi: medicină, biologie, studiul materialelor, geologie şi mineralogie, arta, ştiinţa mediului, controlul calităţii alimentelor, etc. [1]. Datele bibliometrice furnizate de Thomson Reuters ISI Web of Science confirmă faptul că în perioada 2001-2009 numărul publicaţiilor referitoare la spectroscopia Raman şi aplicaţiile ei s-a dublat de la 1931 înregistrate în 2001 la 4078 apărute în 2009 [1]. Această creştere a numărului de publicaţii este datorată, în principiu, următoarelor motive: (a) dezvoltării continue a metodei SERS; (2) progresului extraordinar înregistrat în domeniul fabricării controlate a nanomaterialelor şi a nanostructurilor; (3) creşterii eficienţei în imagistica biomedicală şi de diagnosticare a bolilor; (4) numărului tot 121

mai mare de aplicaţii în afara laboratorului (artă, arheologie, criminalistică, farmaceutice), (5) designului tot mai sofisticat şi controlat al pulsurilor laser ultrarapide utilizate în aplicaţii care exploatează efectele Raman neliniare. Din domeniul vast de aplicabilitate al spectroscopiei Raman se remarcă cu precădere aplicaţiile biomedicale, axate pe diagnosticarea unor boli, de identificare a unor bacterii, de investigare a unor celule vii, cele din domeniul nanoparticulelor şi nanomaterialelor, precum şi cele din domeniul artei şi arheologiei, farmaceutic şi alimentar. Astfel, în continuare vom face o trecere în revistă a principalelor domenii de aplicabilitate, făcând o referire concretă la cele mai recente cercetări.

1.1. Substrate SERS
În ultimii ani, metoda SERS s-a dezvoltat considerabil datorită obţinerii unor substrate SERS capabile să producă o amplificare importantă a semnalului Raman al speciilor adsorbite, reproductibilă şi stabilă în timp. Uniformitatea răspunsului SERS al substratelor depinde de morfologia lor. Astfel, s-a dovedit că gradul de amplificare poate fi controlat prin utilizarea unor metode de nanofabricare a structurii suprafeţei în termeni de mărime, formă şi distanţa dintre formaţiunile de pe suprafaţă, pe care adsorb speciile moleculare. Astfel, în ultima perioadă pe lângă substratele SERS obţinute prin litografie cu fascicul de electroni, litografie cu nanosfere de polistiren [2-4] au fost preparate şi substrate constând din nanoparticule anizotrope de forme diferite [5, 6]. De asemenea, au fost realizate noi substrate constând din nanotuburi de TiO2 pe care a fost depus Ag, sau nanofire de ZnO pe care a fost depus Au [7, 8] toate manifestând o activitate SERS remarcabilă.

1.2. Identificarea unor bacterii
Identificarea rapidă şi precisă a micro-organismelor a devenit o cerinţă importantă nu numai pentru analizele clinice, sau cele ale unor materiale frauduloase, ci şi în diferite aplicaţii cum ar fi producţia de medicamente sau tehnologia de procesare a mâncării. În toate aceste aplicaţii este de dorit ca timpul de cultivare a micro-organismelor să fie minimizat pentru a prescrie pacienţilor în timp util tratamentul corespunzător sau pentru a reduce timpul în care unităţile de producţie sunt închise din cauza unor disfuncţionalităţi. Majoritatea metodelor convenţionale de identificare a bacteriilor se bazează pe efectuarea unor teste chimice după cultivarea microorganismelor în diferite medii şi necesită timp îndelungat. Dintre tehnicile 122

care permit identificarea rapidă a micro-organismelor spectrosopia Raman a devenit una dintre cele mai promiţătoare metode [9] . Procedura de caracterizare a unei celule bacteriene cu ajutorul spectroscopiei Raman constă în patru etape: colectarea micro-organismelor, localizarea moleculelor biologice cu ajutorul unor markeri fluorescenţi, înregistrarea spectrelor Raman şi compararea lor cu alte spectre existente în baze de date în scopul identificării bacteriilor. Combinând rezultatele Raman cu o metodă de clasificare bazată pe chemometrie s-a reuşit identificarea subspeciei unor bacterii cu o probabilitate de 98% [10]. O altă modalitate de identificare a bacteriilor şi/sau a sporilor este cu ajutorul metodei SERS. În acest caz, se detectează prezenţa unui compus chimic, cunoscut ca biomarker al sporilor sau al bacteriei [11]. Relativ recent, a fost dezvoltată o metodă de identificare a unor bacterii pe un cip microfluidic [12]. Prin aplicarea unui câmp electric pe un electrod de aur s-a reuşit sortarea bacteriilor, concentrarea lor şi apoi, prin înregistrarea specrelor SERS în cip, cercetătorii au fost capabili să identifice fiecare bacterie pe baza semnăturii sale spectrale. Testele au fost efectuate pentru două tipuri de bacterii Gram positive (Staphylococcus aureus) şi Gram negative (Pseudomonas aeruginosa). Cu ajutorul acestei metode se îmbunătăţeste semnificativ timpul şi efortul necesar identificării diferitelor bacterii din mâncare sau altă materie organică.

1.3. Caracterizarea celulelor
Spectroscopia Raman este o metodă sensibilă pentru studiul biochimic al celulei fiind capabilă să pună în evidenţă modificări care apar în urma interacţiunii cu diferiţi agenţi [13]. Pe de altă parte, microscopia de forţă atomică oferă informaţii despre topografia suprafeţei, adeziunea şi elasticitatea celulară a unei celule. Prin utilizarea combinată a celor două metode pot fi investigate proprietăţile biomecanice şi biochimice ale celulelor vii în diferite condiţii fiziologice [14]. Spectrele Raman ale celulelor vii constă din benzi corespunzătoare biopolimerilor existenţi în celule (lipide, proteine, ADN, ARN). Cu ajutorul spectrelor Raman este posibilă discriminarea celulelor vii de cele moarte. Acest lucru este extrem de important în realizarea unui biosenzor. De asemenea, cu ajutorul spectroscopiei Raman este posibilă monitorizarea în timp a interacţiunii dintre celule şi diverse medicamente, precum şi diferite elemente toxice folosite în bioterorism, în vederea stabilirii efectelor acestei interacţiuni.

123

1.4. Diagnosticarea unor boli
După introducerea spectroscopiei Raman în studiul pielii de către Williams et all în 1992 [15] utilizarea ei în acest domeniu a devenit tot mai frecventă. În prezent, spectrele Raman înregistrate pe piele sunt bine analizate şi pe baza diferenţelor s-a pus în evidenţă existenta unor boli [16, 17]. Deoarece intensitatea semnalului Raman este scăzută, timpii de achiziţie sunt extrem de lungi şi din această cauză aplicaţiile clinice sunt reduse. Relativ recent, s-a reuşit implemetarea spectroscopiei Raman în aplicaţii clinice prin intermediul unui sistem capabil să înregistreze şi să analizeze în timp real spectre Raman in vivo [18]. Cu ajutorul acestui sistem s-a reuşit efectuarea unei evaluări a pielii unor voluntari precum şi diagnosticarea unor boli ale pielii. S-a constatat că există regiuni spectrale care prezintă benzi specifice pentru piele provenită din diferite regiuni ale corpului. De asemenea, s-a constatat că semnăturile spectrale specifice ale pielii diferă de la un individ la altul. Astfel, prin evaluarea raportului dintre conţinutul de lipide şi proteine se poate face o evaluare a pielii precum şi o diagnosticare cu ajutorul spectroscopiei Raman [19]. De asemenea spectroscopia Raman permite identificarea şi monitorizarea melaninei, un pigment natural care acţionează ca un scut împotriva radiaţiei solare, înlătură speciile chimice active şi produce radicali activi care afectează ADN-ul. Cancerul este o boală complexă indusă de o instabilitate genetică şi o acumulare a unor alternări moleculare multiple [20]. Deoarece diagnosticarea timpurie implică o rată de supravieţuire ridicată, un interes deosebit l-a avut dezvoltarea unor metode de detecţie moleculară care să permită vizualizarea unor biomarkeri sau a unor evenimente celulare şi să indice starea de fapt a cancerului. Spectroscopia Raman este o metodă utilă în diagnosticarea cancerului datorită sensibilităţii sale de a detecta modificări moleculare extrem de mici care sunt asociate cu cancerul, cum ar fi o creştere a raportului dintre nucleu şi citoplasmă, existenţa cromatinei dezordonate, o activitate metabolică crescută şi modificări ale cantităţilor de lipide şi proteine [21]. În principal spectroscopia Raman a fost aplicată la diagnosticarea cancerului de piele, de sân, de tract gastrointestinal şi cervical sau de col uterin [21]. Senzorii optici bazaţi pe metoda SERS au fost în ultima perioadă destul de des folosiţi pentru diagnosticarea in vitro şi in vivo a cancerului [22]. Ei sunt capabili să ofere informaţii moleculare specifice despre moleculele ţintă de interes, fără o marcare prealabilă a acestora.

124

1.5. Aplicaţii în domeniul farmaceutic
Spectroscopia Raman a devenit o metodă rapidă, directă şi nedistructivă în analizele farmaceutice, odată cu dezvoltarea aparatelor şi a metodelor chemometrice de analiză. Majoritatea studiilor se bazează pe investigarea ingredientului farmaceutic activ şi în consecinţă, bazele de date existente conţin informaţii referitoare la aceste ingrediente. Reletiv recent [23] a fost publicată o bază de date cu spectre Raman ale mediului excipient în care este înglobat ingredientul farmaceutic activ, astfel încât se pot realiza analize complete ale produselor farmaceutice. În ultima perioadă, creşterea cantităţii de medicamente contrafăcute pe piaţă pune în pericol sănătatea cetăţenilor şi ridică un semnal de alarmă. Aceste produse pot fi dăunătoare sănătăţii deoarece conţin impurităţi inodore, pot fi inactive şi/sau să aibă o absorbabilitate scăzută sau chiar inexistentă. De asemenea, aceste medicamente pot conţine alte ingrediente decât cele dorite, cantităţi incorecte ale agenţilor farmaceutici activi sau ambalaje necorespunzătoare. Cu ajutorul spectroscopiei Raman se pot obţine informaţii specifice legate de identificarea ingredientului farmaceutic activ, a mediului excipient, precum şi informaţii utile legate de identificarea elementelor necunoscute [24].

1.6. Aplicaţii în domeniul alimentar
Melamina este un ingredient folosit la obţinerea plasticului, dar este frecvent adăugat în mod abuziv şi în mâncare, pentru a crea impresia falsă a unui conţinut ridicat de proteine, deoarece această moleculă conţine un număr mare de atomi de azot. În anul 2007, aproximativ 1700 de câini şi pisici din SUA au murit ca urmare a consumului de mâncare contaminată cu melamină [25]. În ţesuturile şi urina animalelor moarte au fost detectate, pe lângă melamină, şi cantităţi reduse de acid cianuric, amelina şi amelida, care au rezultat cel mai probabil din descompunerea unor derivaţi ai melaminei [26]. În anul 2008, 54000 de copii au fost intoxicaţi iar 5 au murit ca urmare a consumului de lapte contaminat, produs în China. Mai târziu s-a aflat că melamina a fost introdusă intenţionat în multe alte produse lactate produse în China şi destinate exportului [25]. Spectroscopia Raman a fost utilizată în analizarea melaminei din gluten, hrana pentru pui, prăjituri şi tăiţei [27]. A fost de asemenea identificată melamina din făina contaminată, gluten din porumb, hrana pe bază de soia, lapte praf şi a fost stabilit un algoritm de analiză calitativă şi cantitativă a melaminei din amestecuri [26]. În plus, spectroscopia Raman împreună cu 125

imagistica Raman au fost utilizate pentru o testare rapidă a hranei în vederea detecţiei melaminei pentru a creşte siguranţa şi securitatea publică. Nanotuburi de carbon Spectroscopia Raman este o metodă consacrată pentru caracterizarea nanotuburilor de carbon. În toate aceste studii s-a urmărit banda caracteristică a melaminei de la 676 cm-1. în general şi a celor funcţionalizate. Spectroscopia micro-Raman confocală a fost utilizată şi la stabilirea compoziţiei unor sucuri de fructe [28]. nanotuburi de carbon cu un perete sau cu mai mulţi pereţi. Spectroscopia Raman a fost de asemenea aplicată la investigarea nanomaterialelor încapsulate în nanotuburi de carbon pentru a determina procesul de umplere a nanotuburilor cu C60. carbon poros grafitizat şi grafit. în special [30]. Acest fapt ar permite utilizarea acestei metode pentru monitorizarea on-line a conţinutului acestor substanţe în sucurile aflate în diferite stagii de producţie. etc. în cadrul grupului care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300. precum şi a unor 126 . 2. S-a demonstrat modul în care deschiderea sau închiderea reversibilă a nanotuburilor poate fi utilizată pentru a monitoriza cu succes procesul de umplere [32].7. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS În prezent. Astfel. Heise şi colaboratorii săi [31] au caracterizat materiale pe bază de carbon utilizând spectroscopia Raman prin compararea spectrelor înregistrate pe filtre cu nanotuburi de carbon. C59N şi antracena. fructoza şi β-carotenul. 1. S-a determinat existenţa a trei componente importante ale sucurilor de fructe şi anume pectina. microspectroscopia Raman poate fi o metodă de analiză complementară sau alternativă măsurătorilor de turbiditate care sunt de obicei utilizate în industria alimentară în producţia berii. Limita de detecţie a melaminei a fost de 1%. monitorizarea apei. printre tematicile de cercetare ale platformei se regăsesc multe dintre cele prezentate anterior. se desfăşoară cercetări interdisciplinare axate pe fabricarea şi biofuncţionalizarea unor nanoparticule de metal nobil. Prin utilizarea combinată a spectroscopiei Raman cu alte tehnici de analiză se pot obtine informaţii cantitative referitoare la particulele nedorite prezente în sucurile de fructe [29]. Astfel. această metodă ar putea oferi informaţii şi despre caracteristicile lor biochimice. În plus. pe lângă faptul că ar detecta particule nedorite.

ordonate şi dezordonate. folosind metode de auto-asamblare. s-a reuşit corelarea activităţii SERS cu topologia substratului cu ajutorul imagisticii Raman [35]. chimice 127 .). 44]. Câteva dintre nanoparticulele obţinute au fost utilizate în aplicaţii biomedicale cu impact în nanomedicină bazate pe proprietăţile optice. S-a studiat interacţiunea diferitelor biomolecule (triptofan. s-a dovedit a avea proprietăţi multifuncţionale atât ca senzor SERS cât şi ca senzor LSPR [33. O parte a substratelor SERS obţinute.) cu nanoparticule metalice de forme şi dimensiuni diferite [39-41. 43. În figura de mai jos (Fig. Selecţie de imagini a substratelor SERS ordonate (a) şi a nanoparticulelor de metal nobil sintetizate (b). 1. în cazul substratelor ordonate s-au folosit nanosfere de polistiren peste care au fost depuse filme metalice [33-36].nanostructuri hibride. albumină. etc. 42]. mai ales cele constând din nanoparticule de metal nobil. cu scopul de a permite dezvoltarea unor noi aplicaţii spectroscopice şi plasmonice. (a) (b) Figura. proteine şi biopolimeri relevanţi (PEG. Toate aceste studii contribuie la înţelegerea mecanismelor care stau la baza amplificării SERS. 1b). 41. Astfel. 1a) şi a nanoparticulelor sintetizate şi testate din punct de vedere a capacităţii lor de amplificare a semnalului Raman al unor specii moleculare adsorbite pe suprafaţa lor (Fig. În cadrul unui studiu. chitosan. iar în cazul celor dezordonate au fost obţinute diferite tipuri de nanoparticule metalice care au fost asamblate pe substrate solide funcţionalizate/nefuncţionalizate anterior [37-45]. Prin combinarea imagisticii AFM cu imaginile SERS înregistrate prin microspectroscopie Raman confocală s-a reusit evidenţierea implicării mecanismului plasmonic de amplificare la semnalul de bază SERS [36]. O mare parte a activităţii de cercetare este concentrată pe obţinerea de noi substrate SERS. glutation etc. 1) este prezentată o selecţie a tipurilor de substrate SERS ordonate obţinute (Fig.

de obicei învelite într-un strat polimeric biocompatibil. 47]. Astfel. Au fost de asemenea efectuate studii de detecţie SERS intracelulare utilizând nanoparticule de aur PEGylate şi marcate cu coloranţi [44] Rezultatele obţinute demonstrează faptul că nanoparticulele prezintă stabilitate. 3. s-a demonstrat că o serie de nanobastonaşe de aur sau alte nanoparticule de metal nobil anizotrope. În majoritatea studiilor spectroscopia Raman a fost acompaniată de imagistica Raman sau AFM. fiind capabile să distrugă Staphylococcus aureus [45]. în grupul de cercetare care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu modulul de microscopie de forţă atomică (AFM) model alpha 300. cercetătorii au considerat spectroscopia vibraţională ca o metodă capabilă să furnizeze informaţii legate de diagnosticarea bolilor care apar la nivelul ţesuturilor muscularo-scheletale [46. şi osteogeneza imperfectă. s-ar putea aborda noi tipuri de experimente bio-medicale de diagnosticare a unor boli cum ar fi cele ale sistemului osos sau arteroscleroza. Au fost efectuate numeroase investigaţii cu scopul înţelegerii spectrelor. la animale şi în câteva cazuri şi la oameni. care constă dintr-o serie de defecte genetice care afectează scheletul. realizându-se şi studii complementare de absorbţie în IR. Doar în ultimii ani. conservându-şi identitatea Raman in vitro. caracteristici care conferă acestui tip de markeri SERS aplicabilitate ca şi agenţi imagistici în interiorul organismelor vii [44]. şi corelării caracteristicilor spectrale cu modificările care apar datorită vârstei sau a diverselor boli. pot fi utilizate în terapia fototermică a cancerului [40]. Există numeroase studii în literatură referitoare la utilizarea metodelor spectroscopice complementare Raman şi de absorbţie în IR în analizarea osului şi a cartilajelor. În cadrul unui alt studiu s-a dovedit că o serie de nanoparticule de argint de formă triunghiulară invelite în chitosan posedă activitate bactericidală. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS Având în vedere stadiul actual al cercetărilor exploratorii prin spectroscopie Raman precum şi dotările existente în cadrul platformei. o boală metabolică. Se ştie că 128 . Au fost investigate două dintre cele mai importante boli ale oaselor şi anume osteoporoza.şi termice ale nanoparticulelor de aur în detecţia şi tratamentul la nivel celular al cancerului (hipertermie locală indusă laser) sau în evaluarea profilului de toxicitate a nanopartirculelor în medii celulare.

Această boala apare ca urmare a mutaţiilor de la nivelul genelor care codifică producerea de colagen tip I. spectroscopia Raman s-a dovedit a fi o metodă fezabilă în studiul materialelor nanostructurate. Se pot monitoriza benzile caracteristice proteinelor (colagen.) şi lipidelor. deoarece absenţa periodicităţii la dimesiuni sub cele ale particulei relaxează regulile de selecţie ale fononilor optici în regiunea centrală a zonei Brillouin şi prin urmare. Metodele spectroscopice complementare Raman şi de absorbţie în IR sunt capabile să coreleze informaţiile histopatalogice ale unei aorte afectate de arteroscleroză cu compoziţia chimică a unei aorte sănătoase [49-51].). Studii efectuate pe nanostructuri poroase 129 . prin depunerea de calciu se formează plăcile ateromatoase. 47]. Metodele spectroscopice vibraţionale sunt capabile să identifice ţesuturile anormale afectate de această boală [48]. etc. Aceste plăci se formează datorită colesterolului şi grăsimilor prezente în cantităţi excesive în sânge (datorită greşelilor de alimentaţie) care se "infiltrează" în pereţii arterelor. De asemenea au fost investigate prin spectroscopie Raman efectele de confinare a fononilor optici în materialele nanostructurate [53]. şi se pot localiza plăcile ateromatoase prin prezenţa benzilor caracteristice carbonatului de calciu [49-51].un os afectat de osteoporoză are un grad de cristalinitate crescut şi un domeniu mai îngust de cristalinitate decât osul sănătos. arteriopatie obliterantă etc. accident vascular cerebral. actina. infarct miocardic. Această confinare duce la modificări ale spectrului de vibraţie al materialelor nanostructurate în comparaţie cu cel al materialului bulk. elastina. maladia se tratează medical cu aminobisfosfonaţi iar spectroscopia poate juca un rol important în urmărirea progresului tratamentului. Aceste modificări ale structurii sunt reflectate în spectrele Raman şi IR ale probelor [46. Arteroscleroza stă la baza apariţiei majorităţii bolilor cardiovasculare (angina pectorală. manifestată în special prin fracturi la nivelul oaselor lungi. În cadrul unui studiu a fost analizată dependenţa deplasării benzilor Raman în funcţie de dimensiunea unor nanocristale [52]. Ele stânjenesc din ce în ce mai mult circulaţia liberă a sângelui prin artera afectată: din laminară şi fluentă. În ultima perioadă. cardiopatie ischemică. S-a constatat că în principiu metodele spectroscopice vibraţionale pot fi atât un instrument de diagnosticare cât şi o metodă care să monitorizeze progresul tratamentului asupra bolii. În timp. în spectrul Raman. ea devine turbulentă şi inegală. Osteogeneza imperfectă este o maladie genetică al cărei principal semn clinic este fragilitatea osoasă crescută. vor exista contribuţii ale fotonilor din afara acestei zone. În prezent. Ea se datorează prezenţei aşa-numitelor plăci ateromatoase pe pereţii arterelor.

853. T. Studii Raman ale nanofirelor sau nanoconurilor de GaP au dovedit faptul că există o dependenţă între intensitatea spectrală şi caracterul spaţial al radiaţiei Raman împrăştiate şi dimensiunea. 2010. monumente de piatră [56]. presupuse a fi lucrări medievale autentice. Baia. 130 . ceramici. s-au dovedit a fi pictate la sfârşitul secolului al 19-lea sau începutul secolului 20. J. 1566. Recent advances în linear and nonlinear Raman spectroscopy. pot fi diferenţiate operele de artă veritabile de cele contrafăcute sau falsificate. picturi. L. McFarland. A. Pe de altă parte. sticle. sculpturi. Cu ajutorul acestei metode se obţin informaţii despre compuşii moleculari aflaţi în probele supuse analizei. Gold Films Deposited over Regular Arrays of Polystyrene Nanospheres as Highly Effective SERS Substrates from Visible to NIR. a devenit o metodă de investigare extrem de utilă în domeniul patrimoniului cultural. M. Metoda este prezentă în departamentele de conservare şi restaurare a celor mai recunoscute muzee şi librării din lume şi este utilizată pentru identificarea unor materiale. acompaniată în ultimii ani de microscopie şi de tehnica SERS. textile. Chem. Astilean. 23982. A. utilizate în artifacte ca de exemple manuscrise.Bibliografie 1. Sackmann. Haynes. Part IV. Bom. 2. Balster. Acest lucru a fost confirmat cu ajutorul microspectroscopiei Raman [57]. 2006. B 106. D. Nafie. Li şi colaboratorii săi [58] au realizat analiza decoraţiunilor şi au identificat pigmenţii folosiţi la decorarea unui covor chinezesc din secolul al 5-lea cu ajutorul tehnicilor complementare micro-Raman şi FT-IR. Astfel. forma şi compoziţia nanofirelor [55]. J. În acest mod. L. Phys. un număr de cinci picturi în miniatură achiziţionate de Muzeul Victoria şi Albert în 2008. 41. L. C. printre tematicile de cercetare care ar putea fi abordate în viitor s-ar putea regăsi atât studiul unor materiale nanostructurate de tipul nanofirelor şi a filmelor nanostructurate cât şi al unor obiecte din patrimoniul cultural. efectele de confinare pot fi utilizate pentru a determina dimensiunea acestora [54]. Chem. Raman Spectrosc. B 110. de la pigmenţi anorganici la biomateriale. M.semiconductoare au dovedit faptul că în cazul unor unităţi structurale de câţiva nanometri. Materny. Popp. S. A. aşa cum au fost observate în cazul şi sau Ge poros. Dick. Nanostructured Gold Surfaces as 3. R. Baia. având în vedere aceste considerente şi ţinând seama de echipamentele existente în cadrul platformei. P Van Duyne. A. Metal Film over Nanosphere (MFON) Electrodes for Surface-Enhanced Raman Spectroscopy (SERS): Improvements în Surface Nanostructure Stability and Suppression of Irreversible Loss. 2002. J. S. 4. L. 4. De exemplu. J. spectroscopia Raman. Phys.

Janik-Czachor. SPIE Proceeding.-D. 2008. Raman investigations of TiO2 nanotube substrates covered with thin Ag or Cu deposits. McLean. Anal. Moens.-C. Wu. J. Burkhardt. 22. 23. Raman Spectrosc. Applications and Education A. Single-molecule and single-nanoparticle SERS: from fundamental mechanisms to biomedical applications. 572. T. M. Yu. Domenico Campolo. Caspers. 2003. 14. Zhao. Díaz (Eds. Chang. 2010. 2000. Popp. Khan. N. R. 2008. 484. P. McLean. 912. C. Chem Soc Rev. Online monitoring and identification of bioaerosols (OMIB). J. pp. M. Méndez-Vilas and J. Vandenabeele. L. 40. Schuele. 85. I. Raman Spectrosc. The use of Raman spectroscopy în the detection of counterfeit 131 . Zeng. P. Peschke. Cell 100. R. H. H. 9902. Microscopy: Science. And Tech. Huan.-L. H. P.-C. M. 1652. 2008. Petry. J. 10. Combined AFM/Raman microspectroscopy for characterization of living cells în near physiological conditions. P. Barry. Lasers în Surgery and Medicine. A. 2007. Sant’Ana. M. R. 15. 11. 40. 034104. Raman Spectrosc. Krause. D. M. 1539. Shanker. C. A. J. Hanahan. Int. H. Ellis. Raman Spectrosc.1200708. pp.. Surface-enhanced Raman spectroscopic detection of a bacteria biomarker using gold nanoparticle immobilized substrates. 277. 2009. 40. Lewandowska. Skin Res. 18. Lui. Technology. McEwen. A dielectrophoretic chip with a roughened metal surface for on-chip surface-enhanced Raman scattering analysis of bacteria. 19. Pisarek. 455-474. InTech. Wiley-VCH. în vivo nonmelanoma skin cancer diagnosis using Raman microspectroscopy.-Y.Weinheim.5. Raman Spectrosc. pp. Riesenberg. J.. 7. Qian. S.. Ed. 2007.-L. H. Billheimder. Lin. 7. Size-dependent SERS enhancement of colloidal silver nanoplates: the case of 2-amino-5-nitropyridine. Williams. Sensors. D. B. A. 86. Z. 81. A.Wuttig. P. T. 30:1–30:27. Chem. Nie. 6. R. Washington DC. 2010. Rocha. 2009. 37. G. A. H. Biomicrofluidics 4.1117/2. Ed. H. 2009. Cheng. Integrated real time Raman system for clinical în vivo skin analysis. J. H. G. M. J. L. Mahadevan-Jansen.-Q. pp. Lankers. G.-Y. Y. O. Zeng. 2009. M. Fourier transform Raman spectroscopy a novel application for examining human stratum corneum. Temperini. X. G. Witkowski. Wu. 10.. 24. Zanchet.. I. R11. 40. Lui. 20. Ronneberger. Identification of micro-organisms by Raman spectroscopy. A. D. Harz. H.. 40. Surface-enhanced Raman scattering spectroscopy via gold nanostars. Dolata. Esenturk. Hofer. Gold-coated zinc oxide nanowire-based substrate for surface-enhanced Raman spectroscopy. Reference database of Raman spectra of pharmaceutical excipients. 21. A. 8. Lin. R. Zhou. 57. E. I. J. Notingher. 13. Lucassen. Hogan. S. 461. Roguska. D. 40. R. Edwards. A. M.-W. H. G. Biophys. D. T.. H. Santos. R. 2006. Thiele. Majumder. Remon. 89–165. A. 9. Kudelski.0856. Zhao. Weinberg. M. Reproducible Substrates for Surface Enhanced Raman Spectroscopy. Mahadevan-Jansen. J. S. S. T. Puppels. Combined în Vivo Confocal Raman Spectroscopy and Confocal Microscopy of Human Skin. J. D. Biophotonics: Vision for a better Health Care.-W. 1343. 2003). Raman Spectrosc. Vo-Dinh. Pharm. Raman Spectroscopy Cell-based Biosensors. D. Cheng. 12. P. Shen. 16. C. I-F. 81. The Hallmarks of Cancer. S. 515-522. M.A. C. M. A. M. Motzkus. New Developments în Biomedical Engineering. K. de Veij. B. J. 1992. Schmautz. 38. M. H. Popp. J. D. 2009. 183. A. ch. HightWalker. în Biomedical Photonics Handbook. (CRC Press.). De Beer. J. FORMATEX 2010. 17. A. 14. Lieber. Roesch. 2009. 297.

372. Graupner. Astilean. Srivastava. 2007. Heise. dual LSPR-SERS plasmonic sensors of high sensitivity and stability based on chitosan coated anisotropic silver nanoparticles. S. Gabudean. 2010. 29. Lancet. 406. Detection of Melamine în Gluten. 39. Tuschel. M. Gabudean. Localized surface plasmon resonance (LSPR) and surface-enhanced Raman scattering (SERS) studies of 4-aminothiophenol adsorption on gold nanorods. 73. Phys. Multifunctional plasmonic sensors on low-cost subwavelength metallic nanoholes arrays. Appl. Astilean. Kim. Nucl. Biro. Characterisation of carbonaceous materials using Raman spectroscopy: a comparison of carbon nanotube filters. N. and SERS spectroscopyJ. S. 993. A. Silver half-shell arrays with controlled plasmonic response for fluorescence enhancement optimization. S. C. Study of tryptophan assisted synthesis of gold nanoparticles by combining UV–Vis. 2007. Pagona. D. Astilean. Kuzmany. 1993. 34. 344. G. Multilayer Structures of Self-Assembled Gold Nanoparticles as a Unique SERS and SEIRA Substrate. Astilean. 1444. January/February 2005. 420. Res. Li. single. Sensors. Detoxification of gold nanorods by conjugation with thiolated poly(ethylene glycol) and their assessment as SERS-active carriers of Raman tags. A. S. and adulterated pharmaceutical products. Toderas.. T. Boca. Baldeck. 235601. J. S. Astilean. J. Potential of Raman spectroscopy and imaging methods for rapid and routine screening of the presence of melamine în animal feed and foods. Lepore. Chao. K. 21. Ledoux. 2007. S.and multi-walled nanotubes. 32. Farcau. 477. Iosin. L. Schaman. Hasi. fluorescence. Canpean. J. Y.25. 35. S. Astilean. G. R. M. 41. S. G. 2009. 704. Phys. A. T129. M. Yang. 36. Chicken Feed. Maniu. Evidence of a surface plasmon-mediated mechanism în the generation of the SERS background. L. 27. 26. W. 38. C. H. Methods Phys. F. 42. Potara. M. Canpean. Farcau. P. Delfino. 2011. Mol. 2008. 43. 193110. Commun. 2011. Chem. M. 2010. Raman Spectrosc. 28. Griffiths. D. A. 3625. Nanopart. Ojha. S. M. S. S. Astilean. 3861. 38. M. P. N. A. Astilean. R. M. 2011. Lin. Baia. C. He. 2049. Diano. Lab Chip 9. S. 2009. Baia. F. V. Chen. S.. J. Chem C 114. R. 2009. H. C. K. Martens. American Pharmaceutical Review. D. Spectrosc. The study of Raman enhancement efficiency as function of nanoparticle size and shape. Formation 132 . Y. D. Boca. Mita. S. C. Priore. D. A. S. 33. 47. and Processed Foods Using Surface Enhanced Raman Spectroscopy and HPLC. Maniu. graphitised porous carbon and graphite. Mustapha. Chan. Res. Liu. B. F. 2843. 38. 1106. W. 30. Solution-phase. 37. Kuckuk. M. J. Astilean. Nanotechnology 21. Zenone.. Instrum. Appl. F. 2009. V. Gabudean. 2009. 11717. 95. H. H. 3574. Raman Spectrosc. B 267. Struct. 2009. Raman Spectrosc. 12. Farcau . R. Tagmatarchis. M. Sect. 673. Camerlingo. Simon. 31. C. Rotas. Mapping the SERS Efficiency and Hot-Spots Localization on Gold Film over Nanospheres Substrates. Chem. J Food Sci. Astilean. Astilean. Farcau. J. Plank. 2008. R. Lett. J. ChemPhysChem 10. Asthana. Olkhovyk. Pfeiffer. Multivariate Calibration. 63. I. V. Focsan (Iosin). Noes. Awika. L. Mater. O. 40. Investigation on Clarified fruit juice composition by using visible light micro-Raman spectroscopy. D. Wiley: New York. Raman spectroscopy of covalently functionalized single-wall carbon nanotubes. Public-health risks of melamine în milk products. 40. Srivastava. Y. Raman scattering from nanomaterials encapsulated into single wall carbon nanotubes. Ch. 2010. 7. J. E.

A. A. Pigment identification and decoration analysis of a 5th century Chinese lacquer painting screen: a micro-Raman and FTIR study. Inverse Spatially Offset Raman Spectroscopy for Deep Noninvasive Probing of Turbid Media. în situ investigation of the chemical composition of ceroid în human atherosclerosis by Raman spectroscopy. K A. characterization and their application as SERS-active tags inside living cells. Valenzuela. A. Applied Spectroscopy. 51. 060502. Spanier. B. 2006. Appl. 50. Optics.-S. V. 2031. Spectrosc. Clark. 57. Phys. 055702. S. Smukler. Synergistic Antibacterial Activity of Chitosan–Silver Nanocomposites on Staphylococcus Aureus. 48. 38. Popescu. Irmer. D. 58. Martin. Raman Spectrosc. 38. T.133-173. Rousseau. T. 2009. Salis. Hark. Ravindran. M. C.. F. Potara. E. M. X. Pacheco. of size and shape tunable gold nanoparticles în solution by bio-assisted synthesis with bovine serum albumin în native and denaturated state.-Y.-M. M. B. D. K. An analytical form for the Raman shift dependence on size of nanocrystals. Raman Spectrosc. S. J. 1341. J. Goldstein. 031117. S. Astilean. Rajalakshmi. Laane Ed. Crane.. Raman Spectroscopy. On the Raman scattering from semiconductor nanowires.. Rugina. Yeh.44. Q. A... Pasqualucci. M.-F. 2011. Identifying chemical changes în subchondral bone taken from murine knee joints using Raman spectroscopy. Xie. Biomed. L. Morris. Li. L. Shi. 52. 135101. M. 55. 53. 1134. Elucidation of the atherosclerostic disease process în apo E and wild type mice by vibrational spectroscopy. T. Matousek.SPIE 2004. 604. 33. J. C. Canpean. Raman Spectrosc. 2006. Flower-shaped gold nanoparticles: synthesis. “Raman Spectroscopy în Art and Archaeology: A New Light on Historical Mysteries” în Frontiers of Molecular Spectroscopy. 46. C. Bakker Schut. W. C. Ricci. L. Puppels. J. J. Damert.. Arora. C. R. Y. R. Roessler. Raman spectroscopy study of atherosclerosis în human carotid artery. R. Zângaro. Elsevier 2009. van de Poll. Chavantes. 60. 47.. R. Yang. Mat. A. 40. Adar. O. A. N. P. A. J. 2005. L. 2011. G. Laim. 40. 10. Transcutaneous fiber optic Raman spectroscopy of bone using annular illumination and a circular array of collection fibers. J. Chem. Cao. L. J. M. 2007. Morris. Raman Spectrosc. Naudin. A. T. 64. J. D. He. Opt. G. J. Astilean. 129. Biomed. 2007. 54. . Raman spectroscopy of optical phonon confinement în nanostructuredmaterials. A. Jakab. McHugh. H. 697. R. 133 . 49. P. Y. D. 38. Nanotechnology 22. S. 2009. Raman Spectrosc. S. L. B. Spectroscopic investigation of modern pigments on purportedly medieval miniatures by the "Spanish Forger". Dooley.. 56. G. 2006. V. Boca. Edwards. Dehring. E. van der Laarse. C. 40. A. Barbu-Tudoran. J. Raman scattering of nanoporous semiconductors. Sivasubramanian.G. P. 939. M. V. 60. R. Pintea. J. T. S. Silveira. pp. Jelicks. 2009. Anedda. Nogueira. 634. K. Nanotechnology 22. 7 5321A-11 (p. M. 11. V.-L. M. J. 2002. J. J. 2007. Schulmerich. Burgio. A.-J. 544. V. A. Fang. 1911.1 of 9). Vanasse. T. 2011. D. Wang. 45. H. J. Raman Spectrosc. Jr. Nabet.M. E.

.............. Introducere Materia este formată din electroni................ Introducere ................... Moduri de vibraţie .............................................. Nicolae Leopold Cuprins 1.............................. Legea Lambert-Beer . 141 7..... 134 2................ ceea ce înseamnă că modificarea distribuţiei de sarcină va avea loc 134 .. Reguli de selecţie pentru spectroscopia IR ...................IV.................... cum ar fi un atom.................... 146 1............. 135 3.............. dr.... În interacţiunea luminii cu materia....................... Aceste sarcini nu sunt doar sarcini izolate (monopoli)...... Fiecare subdiviziune a materiei...................................................................... câmpul electric (şi într-o măsură mai mică şi cel magnetic) al undei electromagnetice poate să modifice distribuţia de sarcină şi în acest fel să inducă un moment de dipol....... 139 6............ SPECTROMETRUL IR Spectroscopia de absorbţie în infraroşu Lect................. o moleculă..................................................... sau un solid prezintă o distribuţie de sarcină specifică.............................. Oscilatorul armonic .......................... 138 5... Instrumentaţia şi metodologia obţinerii spectrelor IR ..... ioni pozitivi şi negativi.................. nuclee.......... ci sunt sarcini pozitive şi negative ce formează dipoli şi multipoli electrici.... 137 4.................................................... În unda de lumină........... câmpul electric oscilează cu o frecvenţă de aproximativ 1015 Hz............. Bibliografie ........................

Moduri de vibraţie Spectroscopia de absorbţie în infraroşu. modificări (oscilaţii) ale distribuţiei de sarcină. O regulă simplă de simetrie este aşa numita “regula excuziunii mutuale”. unde moleculele se pot roti liber. urmate de tranziţia în stări de energie mai mari. Pe de altă parte. Aceste procese. Numărul modurilor de vibraţie posibile al unei molecule poate fi determinat din numărul atomilor N din moleculă şi geometria moleculară. Probabilitatea specifică. Benzile vibraţional-rotaţionale sunt observate doar când proba se află în stare de gaz. activitatea unui mod vibraţional depinde de simetria lui şi de simetria moleculei. pe scurt spectroscopia IR. pot fi observate doar frecvenţele de vibraţie ale probei. oferind informaţii unice despre materie. pot fi privite ca fiind complementare. Geometria moleculară este specificată de coordonatele carteziene ale fiecărui atom. 135 . De vreme ce distribuţia de sarcină este specifică pentru un anumit tip de materie. ce apar la interacţiunea luminii cu materia. În fazele condensate (lichidă sau solidă). IR şi Raman. vibraţiile active Raman nu sunt active IR. un câmp electric. schimbul de energie între unda electromagnetică şi materie este de asemenea specifică. ca fotonii să interacţioneze cu materia este descrisă de aşa numita “secţiune eficace “ a efectului spectroscopic. la rându-i. trei dintre aceste grade fiind folosite pentru specificarea mişcării de translaţie a moleculei în spaţiu. Astfel. Molecula are aşadar 3N grade de libertate. sau generarea unui foton când sistemul trece de la o stare energetică ridicată la una joasă. Gradele de libertate rămase corespund numărului modurilor de vibraţie: 3N-5 pentru molecule liniare. şi 3N-6 pentru moleculele neliniare. şi alte două (molecule liniare) sau trei (molecule neliniare) grade sunt necesare pentru a specifica mişcarea de rotaţie. şi invers. în cazul moleculelor cu centru de simetrie. procesele sunt descrise de anihilarea unui foton. cele două tehnici. acele vibraţii care duc la o modificare a polarizabilităţii moleculare vor fi active Raman.cu aceeaşi frecvenţă în materie. molecula unei anumite substanţe de exemplu. precum şi spectroscopia Raman oferă informaţii despre modurile vibraţionale şi vibraţional-rotaţionale ale moleculelor. O vibraţie va fi activă IR dacă are loc o variaţie a momentului de dipol în timpul vibraţiei. Conform acesteia. În teoria cuantică. precum un dipol oscilator poate genera. sunt în tratarea clasică procesele de bază ale fiecărei metode spectroscopice. În schimb. În funcţie de simetria moleculei. 2.

De exemplu, vibraţiile fundamentale ale moleculei de apă, H2O, sunt prezentate în Figura 1. Apa, fiind o moleculă neliniară prezintă trei vibraţii fundamentale:

întindere simetrică

întindere asimetrică

deformare (forfecare)

Figura 1. Moduri de vibraţie de întindere şi deformare ale H2O.

Dioxidul de carbon, CO2, este o moleculă liniară, astfel că va prezenta patru vibraţii fundamentale (Figura 2). Vibraţia de întindere asimetrică a CO2 generează o bandă intensă în spectrul IR la 2350 cm-1. De menţionat este că această bandă se observă de regulă în spectrul IR al background-ului, datorită prezenţei CO2 în atmosferă.

întindere asimetrică

deformare (forfecare) perpendiculară pe planului foii

întindere simetrică

deformare (forfecare) în planul foii

Figura 2. Moduri de vibraţie de întindere şi deformare ale CO2.

Cele două vibraţii de deformare (forfecare) sunt echivalente, vibraţia acestora având loc la aceeaşi frecvenţă, fiind astfel numite degenerate, şi apar în spectrul IR la 666 cm-1. Vibraţia de întindere simetrică a CO2 este inactivă IR deoarece această vibraţie nu produce modificare în momentul de dipol al moleculei.

136

3. Oscilatorul armonic
Cel mai simplu model pentru vibraţia unei molecule diatomice este oscilatorul armonic. În acest model se consideră cei doi atomi de mase m1 şi m2 ai moleculei legaţi printr-un resort elastic. Descrierea matematică a mişcării de vibraţie a acestor două corpuri cu masele m1 şi m2 poate fi simplificată prin considerarea unui singur corp cu masa redusă µ=m1*m2/(m1+m2), ce oscilează în jurul centrului de masă al moleculei biatomice, într-un câmp potenţial de tipul kx2/2.

Figura 3. Modelul oscilatorului armonic pentru molecula diatomică. Variaţia energiei potenţiale cu distanţa internucleară.

Din punct de vedere fizic, aşa cum se poate deduce din Figura 3, o energie mai mare a oscilatorului armonic corespunde unei amplitudini mai mari a oscilaţiei, frecvenţa fiind aceeaşi pentru toate nivelele de energie. Energiile vibraţionale cuantificate se obţin în urma rezolvării ecuaţiei Schrödinger pentru oscilatorul armonic: Ev=hν(v+

1 ) , v=0,1,2…. 2

(1.1)

unde v este numărul cuantic de vibraţie, ν este frecvenţa de vibraţie şi h este constanta lui Planck. Frecvenţa de vibraţie a oscilatorului armonic depinde de puterea legăturii (constanta de forţă a legăturii k) şi masa redusă µ: ν=

1 2π

k

μ

(1.2)

137

Nivelele de energie vibraţionale sunt la distanţe egale (echidistante) în modelul oscilatorului armonic, diferenţa între două nivelele de energie adiacente E fiind: ΔE=hν=ћ k μ (1.3)

4. Reguli de selecţie pentru spectroscopia IR
O moleculă diatomică va absoarbe radiaţie IR numai dacă momentul ei de dipol se modifică în urma variaţiei distanţei internucleare. Probabilitatea de tranziţie depinde de diferenţa de populaţie ΔN dintre două stări cuantice şi pătratul momentului de dipol al tranziţiei, M: probabilitatea de tranziţie ~ ΔN M
2

(1.4)

unde, pentru o moleculă aflată într-o stare electronică dată, momentul de dipol al tranziţiei pentru o tranziţie vibraţională este dat de:
* (e) M= Ψν " μ 0 Ψν ' d τ

(1.5)

Funcţiile de undă ψ ν " şi ψ ν ' reprezintă stările vibraţionale finală şi respec(e) tiv iniţială, iar μ 0 este momentul de dipol electric permanent în această stare electronică. Pentru vibraţia unei molecule diatomice, momentul de dipol electric permanent poate fi extins într-o serie Taylor după distanţa internucleară de echilibru re :

∂μ ⎞ (e) =µe+ ⎛ μ0 ⎜ ⎟ q+ ⎝ ∂r ⎠ re

1 2

⎛ ∂ 2 μ ⎞ q2+ … ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

(1.6)

Aici q=r-re, iar r este distanţa internucleară la un moment dat, şi µe este momentul de dipol când legatura se află în poziţia de echilibru. Probabilitatea apariţiei unei tranziţii vibraţionale într-o moleculă diatomică poate fi obţinută substituind forma extinsă a momentului de dipol electric permanent în ecuaţia momentului de dipol pentru tranziţia vibraţională:

∫ Ψν

*
'

(e) μ0 Ψν d τ =
'

* µe Ψν " Ψν ' d τ + ⎜

⎛ ∂μ ⎞ 1 * ⎟ ∫ Ψν ' q Ψν d τ + 2 ⎝ ∂r ⎠ re
'

⎛ ∂2μ ⎞ ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

∫ Ψν

*
"

q2 Ψν ' d τ + … (1.7)

138

Primul termen din această ecuaţie este egal cu zero de vreme ce funcţiile de undă vibraţionale ψ ν " şi ψ ν ' sunt ortogonale. Al doilea termen este diferit de zero doar dacă momentul de dipol depinde de distanţa internucleară r

⎛ ∂μ ⎞ ⎜ ⎟ ≠0 ⎝ ∂r ⎠

(1.8)

De aceea, moleculele biatomice prezintă absorbţie vibraţională în spectrul IR doar atunci când există o modificare a momentului de dipol în cadrul mişcării de vibraţie. Moleculele diatomice homonucleare au momentele de dipol zero pentru toate lungimile legăturilor, astfel nu prezintă spectru de absorbţie vibraţional. Astfel, teoria mecanicii cuantice specifică faptul că absorbţia luminii infraroşii va apărea doar dacă un mod vibraţional implică o modificare a momentului de dipol şi că nivelele de energie vibraţionale în moleculă sunt cuantificate. Teoria ne spune de asemenea şi faptul că tranziţiile pot avea loc doar între nivele de energie adiacente, deoarece integrala din cel de-al doilea termen pentru polinoamele Hermite care descrie funcţia de undă a oscilatorului armonic, este diferită de zero doar dacă Δv= ± 1.

5. Legea Lambert-Beer
Domeniul spectral IR al radiaţiei electromagnetice este poziţionat între domeniul vizibil şi cel al microundelor. Prin convenţie, domeniul spectral IR este subdivizat în domeniul IR apropiat (Near Infrared Region - NIR), IR mijlociu (Mid Infrared Region - MIR) şi IR îndepărtat (Far Infrared Region FIR) (Figura 4). Spectrele IR discutate în această lucrare sunt toate din domeniul spectral MIR.

Figura 4. Domeniile spectrului electromagnetic şi subdiviziunile domeniului IR.

139

Spectrul IR se obţine prin înregistrarea intensităţii radiaţiei în lipsa probei de analiză (spectrul background) şi a intensităţii radiaţiei IR după ce aceasta trece prin probă. În urma trecerii prin probă, intensitatea fasciculului se va atenua datorită absorbţiei de radiaţie de către analit, precum şi a împrăştierii radiaţiei la interfaţa şi în interiorul probei (Figura 5a). Astfel, spectrul IR reprezentat va fi dat de mărimea: T= Is/IR unde, T este transmitanţa, Is intensitatea radiaţiei IR după, iar IR înainte de a traversa radiaţia proba. Valorile transmitanţei sunt între 0 şi 1, sau 0–100% pentru transmitanţa exprimată în procente. Între transmitanţă şi concentraţia unui compus relaţia este logaritmică. De aceea, pentru o reprezentare mai convenientă, în majoritatea cazurilor, în locul transmitanţei se foloseşte o altă mărime, absorbanţa A:

A = lg

1 = − lg T T

Relaţia dintre transmitanţă şi absorbanţă în funcţie de concentraţie este reprezentată în Figura 5b

Figura 5. (a) Atenuarea unui fascicul de radiaţie la refelexia interfeţei probei, împrăştierea de către particule şi absorbţia analitului. (b) Relaţia dintre transmitanţă, T, şi absorbanţă, A, în funcţie de concentraţia unui compus ipotetic.

În mod independent, Bouguer în 1729 şi Lambert în 1760, au stabilit că la concentraţie constantă, absorbanţa este direct proporţională cu grosimea probei, iar Beer în 1852 a observat că dacă grosimea probei este constantă, absorbanţa este proporţională cu concentraţia. Combinarea acestor observaţii a dus la legea Lambert-Beer, ce exprimă absorbanţa: 140

(I.2) unde a este absorbtivitatea – o constantă de proporţionalitate a moleculei la o lungime de undă specifică, d este lungimea drumului optic prin probă, iar c reprezintă cocentraţia substanţei analizate. Concluzionând, spectroscopia IR oferă atât informaţii moleculare calitative, prin modurile de vibraţie specifice fiecărei molecule, cât şi informaţii cantitative, aşa cum rezultă din legea Lambert-Beer.

A = a⋅d ⋅c

6. Instrumentaţia şi metodologia obţinerii spectrelor IR
Odată cu introducerea spectroscopiei transformată Fourier (FTIR) principalele dezavantaje ale spectroscopiei ”clasice” dispersive IR au putut fi înlăturate. Pe scurt, spectroscopia FTIR nu mai înregistrează intensitatea la fiecare lungime de undă, în mod secvenţial, la o lungime de undă după alta, şi de asemenea, spre deosebire de spectrometrele dispersive nu necesită prismă sau reţea de difracţie monocromatoare, unde apar pierderi majore în energia emisă de sursa IR la trecerea prin diferite fante de intrare şi ieşire. În spectroscopia FTIR, se aplică modularea interferometrică a radiaţiei (Figura 6). Pentru aceasta, un divizor de undă, de regulă din KBr acoperit cu un film de germaniu, împarte radiaţia în două fascicule, un fascicul fiind direcţionat către o oglindă fixă, iar celălalt fascicul către o oglindă mobilă (Figura 6). Aceste două fascicule sunt reflectate înapoi pe divizorul de undă, după care se recombină, intensitatea fasciculului variind în timp, datorită alternării interferenţei constructive şi destructive în funcţie de diferenţa de drum optic dintre cele două oglinzi, la fiecare moment de timp. Astfel, fiecare parcurs al oglinzii mobile este caracterizat de o interferogramă în funcţie de timp. Diferenţa de drum δ este proporţională cu timpul t, deoarece oglinda mobilă se deplasează cu viteză constantă v, astfel că δ = 2vt. Prin folosirea unui algoritm de transformată Fourier rapidă (Fast Fourier Transform - FFT algorithm), interferograma în funcţie de timp, I(δ), este convertită într-o interferogramă în funcţie de frecvenţă, I( v ), folosind următoarea relaţie:

I (δ ) = 0.5 H (v ) I (v ) cos 2πvδ I (δ )
unde H( v ) este un factor de corecţie dependent de numărul de undă şi de caracteristicile spectrometrului. Interferograma convertită în domeniul frecvenţelor se numeşte spectru de tip single-beam.

141

IR-light source

Figura 6. Spectrometrul FTIR. (a) Schema bloc a componentelor de bază ale unui spectrometru IR. (b) Principiul de funcţionare a unui interferometru Michelson format din sursă de lumină, divizor de undă, oglindă fixă, oglindă mobilă, detector şi probă (panel sus). Oglinda mobilă a interferometrului (panel sus) produce un semnal sinusoidal la detector pentru fiecare frecvenţă modulată (panel central). Pentru sursa IR, cu domeniu spectral de frecvenţe larg, semnalele modulate se suprapun şi formează o interferogramă complexă (panel jos).

Spectrometrele FTIR prezintă mai multe avantaje faţă de instrumentele convenţionale IR dispersive, incluzând o îmbunătăţire dramatică a raportului semnal-zgomot (S/N), obţinută prin multiplexare (detectarea simultană a tuturor frecvenţelor), reducerea timpului de scanare, precum şi un câştig mai mare în energia radiativă. Un alt avantaj important este reproductibilitatea excelentă în lungimea de undă a spectrometrelor FTIR, datorită utilizării unui laser de referinţă intern (de regulă HeNe, 632.8 nm ), ceea ce permite manipularea datelor spectrale, cum ar fi scăderea, adunarea sau scalarea spectrelor cu un grad foarte ridicat de acurateţe. De asemenea, progresul spectroscopiei FTIR a fost facilitat şi de dezvoltarea calculatoarelor personale, ce permit utilizarea de programe soft complexe, pentru aplicaţii calitative şi cantitative. Pentru partea practică a acestei lucrări, spectrele au fost înregistrate cu un spectrometru Jasco FTIR-6200 cuplat cu un microscop IR Jasco IRT-5000 (Figura 7). 142

Figura 7. Aparatura IR Jasco: spectrometrul FTIR-6200 şi microscopul IRT-5000.

Principalele părţi componente ale spectrometrului FTIR sunt sursa de emisie, interferometrul şi detectorul. Sursa de emisie IR este componenta cea mai simplă a instrumentului, constând într-un filament incadescent (10000C). Interferometrul este de tip Michelson, iar parcursul maxim al oglinzii mobile determină rezoluţia spectrală a spectrometrului. Alegerea detectorului este legată de aplicaţiile abordate. Astfel dacă se urmăreşte de exemplu cinetica unei reacţii chimice, este absolut necesară folosirea unui detector de tip MCT (Mercury Cadmium Telluride). Acestea sunt de două tipuri: MCT A, detector de foarte înaltă sensibilitate în domeniul spectral 650-7800 cm-1 ce permite înregistrarea rapidă a spectrelor (până la ns), şi MCT B, detector de înaltă sensibilitate în domeniul spectral 400-7800 cm-1, de asemena pentru înregistrări rapide. De menţionat că detectoarele MCT necesită răcirea cu azot lichid. Detectoarele de tip DTGS (Deuterated L-Alanine doped Triglycene Sulphate) lucrează la temperatura camerei într-un domeniu spectral larg 10-7800 cm-1, însă sensibilitatea acestora este de până la două ordine de mărime mai mică faţă de detectoarele MCT. De menţionat însă că domeniul spectral de detecţie al spectrometrului este limitat de fereastra din faţa detectorului (de regulă KBr) precum şi de divizorul de undă (beamsplitter, de regulă din KBr acoperit cu un strat de Ge), astfel că spectrometrele IR uzuale nu permit înregistrarea spectrelor sub 400 cm-1. Spectrometrul FTIR-6200 permite înregistrarea spectrelor IR în modul transmisie, pentru acest mod fiind necesară prepararea în prealabil a probe143

lor sub formă de dispersie în pastile KBr. Tot pentru măsurători IR în transmisie se poate presa proba între două discuri/ferestre dintr-un material ce nu absoarbe (este transparent) în domeniul IR mijlociu, de exemplu ZnSe, Si, Ge, KBr etc. Microscopul IRT-5000 este dotat cu un obiectiv tip Cassegrain şi unul de tip ATR (Attenuated Total Reflectance). Obiectivul de tip Cassegrain se pretează doar pentru probe plane (filme, suprafeţe lucioase etc.). În prealabil, la folosirea obiectivului Cassegrain, se înregistrează spectrul background prin focalizarea pe oglinda de aur, un accesoriu din dotare. Modul de analiză ATR (Attenuated Total Reflection) este utilizat pentru investigarea probelor lichide şi solide. De asemenea, modul ATR se pretează pentru caracterizarea materialelor care sunt fie prea groase sau prea puternic absorbante pentru a fi analizate prin spectroscopie în transmisie. În modul de analiză ATR, radiaţia IR trece printr-un cristal transparent în infraroşu, cu un indice de refracţie ridicat, astfel că fasciculul IR va efectua reflexii interne succesive în cristalul ATR, aşa cum este prezentat schematic în Figura 8.

Figura 8. Prezentare schematică a tehnicii de analiză ATR-IR.

În vederea analizei, suprafaţa probei este presată astfel încât să fie în contact optic cu suprafaţa superioară a cristalului ATR. La reflexia internă a fasciculului, aşa numita undă evanescentă IR pătrunde în afara cristalului ATR, astfel că o mică parte din radiaţie penetrează proba. În modul de analiză ATR nu este necesară o preparare în prealabil a probei în vederea analizei. Dezavantajul constă în limitarea spectrală datorită cristalului ATR, de exemplu pentru un cristal ATR din ZnSe spectrele se pot înregistra începând de la 650 cm-1. De regulă, în prealabil, la folosirea modului ATR, se înregistrează spectrul background al atmosferei, cristalul ATR fiind în aer. Folosind microscopul IRT-5000 în modul de analiză ATR, au fost înregistrate spectrele FTIR/ATR a următoarelor substanţe de interes farmaco144

logic: aspirina, paracetamol şi deferoxamina. Structurile moleculare ale acestora sunt prezentate mai jos.

Aspirina

Paracetamol

Deferoxamina Tabloul spectral din Figura 9 prezintă spectrele de absorbţie în IR ale celor trei substanţe analizate.

Figura 9 Spectrele FTIR/ATR ale substanţelor de interes farmacologic: aspirina, paracetamol şi deferoxamina.

145

3. Ed.E. Napoca Star. UK. Surface-Enhanced Raman Spectroscopy. L. 11. Probleme de Fizica Moleculei. Cluj-Napoca. I. Cluj-Napoca. Hollas. Grecu.Methods and Applications. 1998. Germany. Wiley. 2002. UK. VCH. 10. Spectroscopie Optică Moleculară. Iliescu. Aştilean. Spectroscopia IR şi Raman. V. 9. Maniu. 1986. Aufbau der Moleküle. Chiş. 2009. Chichester. Cozar. Atribuirea benzilor de vibraţie se poate face pe baza literaturii de specialitate comparând spectrele cu cele ale compuşilor asemănători sau prin calcularea teoretică a spectrelor IR folosind programe dedicate de chimie cuantică. Chiş. 7. Casa Cărţii de Ştiinţă. 2002. Casa Cărţii de Ştiinţă. D. Smith and G. S. Weinheim. F. Germany. Wiley. Modern Spectroscopy. 2. Cozar. 4. B. Cluj-Napoca. T. 8. Litografia Universitatii Babes-Bolyai. 2005. Leopold. Selected Applications. Simon. Aştilean. Cîntă-Pînzaru. 2001. Schrader. Cluj-Napoca. Leopold. 2000. 2007. 5. 146 . Chichester. R. 6. W. Stuttgart. Cluj-Napoca. pentru fiecare substanţă putându-se identifica o amprentă spectrală caracteristică.M. N. 7. Metode şi tehnici moderne de spectroscopie optică. Simetrie Moleculară. Iliescu. Bibliografie 1. Aplicaţii ale spectroscopiei vibraţionale. Infrared and Raman Spectroscopy . Casa Cărţii de Ştiinţă. Cluj-Napoca. Engelke. Cluj-Napoca. N. 2004. Teubner. O.Spectrele din Figura 9 sunt caracteristice structurilor moleculare corespunzătoare. Vol. Litografia Universităţii Babeş-Bolyai. David. O. S. Modern Raman Spectroscopy – A Practical Approach. 1992. Napoca Star. T. J. S. Dent. Teoria Grupurilor în Fizica Atomului şi Moleculei.

.......................... Introducere ............1............... 148 2...................................... 147 .................... 149 2............................ Îmbunăţiri tehnice recente în cuplajul LC-IR................ Aplicaţii analitice ale spectroscopieie IR ................................................................................................... dr.......... 154 5...................... 151 4................................ Nicolae Leopold Cuprins 1............. Cuplajul on-line electroforeza capilară (CE)-IR .....................................Tendinţe moderne în spectroscopia de absorbţie IR Lect... Bibliografie ........ 147 2..................... Introducere Spectroscopia de absorbţie în infraroşu (IR) reprezintă o metodă analitică de investigaţie moleculară utilizată într-un număr vast de domenii........................ 150 2.. Aplicaţii biomedicale ale spectroscopiei IR ........... Publicaţiile din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR pot fi clasificate pe domenii ştiinţifice după cum este prezentat în Figura 1.........................2................. 150 3... Cuplajul on-line cromatografia de lichide (lc)-IR ... 157 1.... 155 6....... Aplicaţii ale spectroscopiei IR în geoştiinţe.................1..... Spectroscopia IR în calitatea şi siguranţa alimentelor ............................1............................

astfel că pot fi foarte greu cuprinse într-o prezentare unitară. De aceea s-a ales în mod reprezentativ cuplarea on-line a detecţiei IR în metodele de separare cromatografie de lichide (LC) şi electroforeza capilară (CE). 148 .Figura 1.com) Este evident din numărul mare al publicaţiilor în domeniile chimiei şi a fizicii că spectroscopia de absorbţie IR este în continuare o metodă experimentală de bază în cercetarea fundamentală.scopus. Clasificarea pe domenii a numărului de publicaţii din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR (www. 2. Aplicaţii analitice ale spectroscopieie IR Aplicaţiile analitice ale spectroscopiei IR sunt extrem de diversificate.

Utilitatea spectroscopiei de absorbţie IR.1. cristalizare sau degradare oxidativă. 2.Metodele de separare cromatografice şi electroforetice sunt tehnici standard în laboratoare analitice privind siguranţa şi autenticitatea alimentelor. Desigur. fie on-line folosind celule de curgere (flow-through cells) transparente pentru radiaţia infraroşie. Cele două subiecte sunt strâns corelate. 149 . furnizarea de informaţii în timp real. laboratoare medicale. Cuplarea on-line permite totodată înregistrarea de spectre IR pentru analiţi fără o anumită orientare. precum şi posibilitatea de a utiliza soluţii tampon nevolatile [3-4]. Cuplajul on-line cromatografia de lichide (lc)-IR Cromatografia de lichide este cea mai uzuală metodă instrumentală folosită în laboratoarele analitice pentru separarea amestecurilor fizice. aspecte ce pot interveni la înlăturarea solvenţilor. Cert este faptul că în ultimii ani sunt depuse eforturi pentru a cupla cu spectrometria de masă şi alte metode de detecţie cum ar fi spectroscopia Raman sau spectroscopia de absorbţie IR. Două dintre cele mai citate dezavantaje ale cuplajului LC-FTIR sunt următoarele: i) dificultatea de a corecta absorbţia de fond a solvenţilor şi a aditivilor folosiţi pentru prepararea fazei mobile. absorbţia UV-VIS sau spectrometria de masă. Cuplarea cromatografiei de lichide cu un sistem de detecţie IR se poate realiza fie în modul off-line după înlăturarea solventului. Totuşi. incluzând o rezoluţie cromatografică îmbunătăţită. şi ii) senzitivitatea redusă datorată utilizării unui drum optic redus al celulor pentru a evita saturarea semnalului ce intervine datorită absorbţiei eluentului. fiind pusă la îndoială în mod frecvent viabilitatea acestui cuplaj. identificare şi cuantificare. aceste metode de separare sunt cuplate cu metode de detecţie ca. Detecţia on-line LC-FTIR a fost limitată în trecut de un anumit număr de restricţii privind aplicabilitatea în problemele analitice de tip real-life. iar atunci când sunt ambele luate în considerare este uşor de înţeles numărul limitat de referinţe cu privire la cuplarea on-line a spectroscopiei de absorţie IR cu cromatografia de lichide. în mod special a celei cu transformată Fourier (FTIR) ca şi mijloc de detecţie on-line în urma separării cromatografice a fost demonstrată în mod repetat în ultimii ani [1-3]. abordarea on-line este de preferat datorită unor avantaje majore. În dectecţia off-line folosirea interfeţelor de înlăturare a solventului duce la îmbunătăţirea senzitivităţii. aceste metode prezintă avantaje şi dezavantaje în funcţie de analizele efectuate. De regulă. sau laboratoare pentru studii farmacologice. detecţia substanţelor interzise.

mai ales în analizele bio-chimice din cauza eficienţei mari a separării cât şi consumului redus de substanţă [13-15].quantum-cascade laser. 150 . Cuplajul on-line electroforeza capilară (CE)-IR Electroforeza capilară (CE) a devenit o tehnică de separare importantă. Dezvoltarea din ultimii ani a unei noi tehnologii laser pentru surse IR.2. Sistemul a fost utilizat pentru separarea a opt constituenţi ai vinului şi ai sucului de struguri. Acest lucru a fost evidenţiat de coeficienţii de corelare cuprinşi între 89-96% (în regiunea spectrală 1700-1050 cm-1) şi utilizaţi pentru compararea spectrelor de referinţă cu cele obţinute în urma injectării în sistemul cromatografic a unei cantităţi între 230-270 ng din analiţi.1. Avantajul surselor IR de tip QCL constă în posibilitatea reglării lungimii de undă a laserului prin reglarea temperaturii de funcţionare [12]. Un alt factor de limitare pentru detecţia IR cuplată cu cromatografia de lichide este legată de absorbţia puternică a apei în domeniul spectral MIR.1. Au fost puşi în mişcare gradienţi liniari în limitele 50:50-35:65 [apă(0. pe coloană. Îmbunăţiri tehnice recente în cuplajul LC-IR Pentru a creşte senzitivitatea cuplajului LC-FTIR şi pentru a obţine astfel o limită de detecţie mai bună s-a realizat interfaţarea unui sistem de cromatografie capilară pentru lichide cu spectrometrul FTIR.2. obţinându-se astfel on-line. duce la o nouă abordare a detecţiei IR on-line [7-10] folosind noi dispozitive [11]. Kuligowski et al. facilitând o serie de noi aplicaţii. [5] folosind o micro-celulă de curgere [6] cu ferestre transparente în IR mijlociu din CaF2. cu un volum intern al celulei de 7. Urmând studii anterioare [7]. fapt care duce la o curgere electro-osmotică în capilar.05% TFA-acid trifluoroacetic):acetonitril] timp de 15 min pentru separarea soluţiilor standard de nitrofenoli. Un set-up optic bazat pe trei oglinzi de aur şi un separator de fascicule din ZnSe a fost folosit pentru a direcţiona lumina emisă de laser printr-o celulă fluidică cu un drum optic de 52 µm către un detector MCT (mercury-cadmium-telluride). QCL . limite de detecţie între 35-94 ng. [12] au folosit două lasere QCL pentru detecţia on-line în cromatografia de lichide de înaltă performanţă. Separarea apare în urma aplicării unei tensiuni înalte.5 nL. 2. care a fost plasat pe un condensor al fasciculului optic ataşat spectrometrului. Folosind tehnica gradienţilor s-au putut obţine spectre de înaltă calitate ale analiţilor în urma aplicării unei corecţii ale fondului (semnal background) la datele înregistrate. Prin reducerea dimensiunii şi a costurilor aparaturii se conturează o direcţie clară în ceea ce priveşte detecţia on-line IR dedicată cromatografiei de lichide.

os [61] sau ţesut tumoral [62]. bucal [50]. Interacţiunea moleculelor analit cu selectorul chiral a produs diastereomeri cu un spectru IR clar. tot mai multe studii arată că detecţia on-line FTIR este utilizată cu succes. prostată [54-55]. Aplicaţii biomedicale ale spectroscopiei IR Analiza FTIR este folosită într-o serie largă de studii biologice cuprinzând măsurători pe diverse ţesuturi ca: piele [21-25]. col uterin [26-34]. sân [38-42]. permiţând discriminarea moleculelo analit [19]. Pentru detecţia prin spectroscopia infraroşie mijlocie s-au raportat măsurători atât off-line cât şi on-line. Utilitatea detecţiei FTIR on-line a fost demonstrată prin separarea şi cuantificarea adenosinei. limfoid [51]. Recent însă. fibroblast [60]. sau pentru monitorizarea glucozei [67]. Acest ultim aspect este cel care face spectroscopia FTIR o metodă de analiză biomoleculară foarte atrăgătoare [20]. Un alt studiu prezintă separarea şi detecţia IR a 5 analiţi. creier [47-49]. Maturitatea cuplajului CE-FTIR on-line este considerată prin separarea şi cuantificarea cu succes a glucidelor din băuturi răcoritoare [18]. aşa cum s-a arătat la discriminarea on-line de enantiomeri în timpul separării chirale într-un mediu neapos. 3. Alte studii relevante au fost efectuate pe bacterii [63-64] ADN [65]. gastrointestinal [43-46].De obicei. Un alt domeniu în care spectrometria IR poate furniza informaţii importante este analiza proteinelor. medicamente anti-cancer [66]. Aplicaţiile principale în acest domeniu sunt cele privind dinamica proteinelor şi elucidarea structurii secundare. limfocite [52]. distinct. rezultatele fiind foarte bune din punct de vedere calitativ şi cantitativ [17]. Wood et al. Detecţia on-line bazată pe tehnica reflexiei totale atenuate ocoleşte această problemă prin reducerea eficientă a drumului optic. limfon non-Hodgkin’s [53]. Acest articol raportează prima separare a unor proteine în electroforeza capilară cu detecţia FTIR on-line. detecţia în CE este dificilă. guaninei şi a adenosinei-5’ monofosfat în domeniul ng folosind electroforeza capilară convenţională [16]. din cauza concentraţiei mici de substanţă disponibilă pentru detecţie. Spectrele înregistrate 151 . colon [56-59]. Informaţia moleculară specifică livrată de spectrul IR poate fi interpretată în mod avantajos. iar în cazul detecţiei UV-Vis sensitivitatea este limitată de diametrul mic al capilarului. În măsurători de transmisie folosind celule transparente manufacturate special pentru IR o parte din spectru este blocat din cauza absorbţiei puternice a fazei lichide. plămân [35-37]. [26] au evidenţiat potenţialul spectroscopiei FTIR ca instrument de biodiagnostic în cancerul de col uterin.

[30] pe melanom fixat cu formalină şi pe celule canceroase de col uterin bazat pe microspectroscopia FTIR a urmărit detecţia unor biomarkeri comuni care apar în cele două afecţiuni. ARN. [36] se bazează pe posibilitatea de achiziţie directă de pe ţesut de plămân canceros sau normal prin microscopia FTIR. atribuită glicogenului şi grupării fosfat din acizii nucleici. Într-un alt studiu. Rezultatele lor demonstrează că sunt diferenţe semnificative între celulele normale din plămân şi cele tumorale. Nivelul acestora din urmă s-a dovedit a fi un bun indicator în diagnosticarea şi detecţia cancerului de col uterin. Wang et al. sugerând prin aceasta modificări spre malignitate. [38] a fost reprezentată de cancerul la sân. Spectrele înregistrate au fost analizate privind posibilele modificări în ceea ce priveşte nivelul biomoleculelor: ADN. Pentru evaluarea cantitativă a malignităţii s-au ales intensităţile benzilor de la 1045 şi 1465 cm-1. Diferenţa considerabilă este reprezentată de raportul benzilor de la 1030 şi 1080 cm-1. Scopul acestui studiu a fost determinarea eficienţei spectroscopiei IR în diagnosticare şi în acest sens s-a descoperit că leucocitele. Un avantaj major al acestei metode îl reprezintă posibilitatea de a obţine rezultate determinante foarte rapid. încercând astfel diferenţierea ţesutului canceros de cel normal. fosfaţi şi carbohidraţi. Yano et al. Zona de interes a studiilor comparative de spectroscopie IR pentru Fabian et al. probele păreau să fie 152 . La nivel macroscopic. şi totodată o pronunţată bandă atribuită întinderii simetrice a grupării fosfat la 1078 cm-1. Studiul iniţiat de Mordechai et al.pe celule epiteliale normale prezintă benzi intense ale glicogenului la 1022 cm-1 şi 1150 cm-1. Wood et al. respectiv limfocitele au o caracteristică spectrală în zona legăturii fosfodiester (1300-900 cm-1). Privind aceeaşi afecţiune. Acest studiu a demonstrat potenţialul de aplicabilitate a tehnologiei automatizate FTIR în monitorizarea cancerului de col uterin în mediul clinic. Acestea reprezintă un factor discriminant privind ţesutul de plămân canceros şi cel normal. Caracteristicile spectrale care sugerează transformări de malignitate sunt în principal modurile de vibraţie simetrice şi antisimetrice ale grupării fosfat precum şi reducerea în intensitate a benzii atribuite glicogenului. în vederea implementării acesteia ca şi tehnică medicală în acest domeniu. a culturilor celulare şi a xenogrefelor de acest tip. [28] au investigat cu microspectroscopia FTIR tipurile de celule şi potenţialele variabile care ar duce la confuzii în diagnosticarea malignităţii acestui ţesut. [35] s-au concentrat asupra studiilor microscopice FTIR ale celulelor canceroase din fluidul pleural. atribuite glicogenului şi colesterolului.

Utilizând spectroscopia FTIR s-a realizat această discriminare cu o acurateţe de 88. s-a reuşit determinarea cantitativă a apei în fiecare caz.omogene din punct de vedere al ţesutului conjunctiv care a fost ales ca şi amprentă spectrală. Li et al. [23] a utilizat spectroscopia ATR-FTIR (spectroscopia IR cu tranformată Fourier în reflexie totală atenuată) pentru a măsura gradul de hidratare al corneei. [46] au realizat o investigare a biopsiilor cu spectroscopia ATR-FTIR privind afecţiuni ca şi: gastrită superficială. [62] au ales un studiu de reflexie FTIR prin absorpţie amplificată la suprafaţă a acizilor nucleici din celulele tumorale. [44] au studiat tumori de stomac. respectiv 90%. urmărind vibraţia de deformare a apei în combinaţie cu cea de întindere a legăturii OH în cazul unei suprafeţe normal hidratată de cornee şi a uneia nehidratate suficient din cauza unor ocluzii. urmărindu-se raportul benzilor de la 1460 şi 1400 cm-1. Se presupune că pentru această apreciere este necesară obţinerea de informaţii fundamentale privind pătrunderea şi pierderea lichidului apos de la nivelul corneei.6%. achiziţia de informaţii având loc la contactul cu o sondă ATR. rect. Fujioka et al. Andrus şi Strickland [51] au monitorizat gradual tumori limfoide cu ajutorul spectroscopiei FTIR. Rezultatele au indicat faptul că banda atribuită întinderii C=O a adipozei poate fi identificată în spectrele probelor de ţesut normal. Prin utilizarea mai multor metode multivariate au arătat că este posibil să se clasifice datele spectroscopice non-subiectiv. intestin subţire. respectiv să diferenţieze materia albă de cea cenuşie cu acurateţe de 90%. însă foarte rar în cele de ţesut tumoral. 74%. Prin comparare cu spectre ale cheratinei pure şi ale colagenului s-au obţinut rezultate care să susţină introducerea acestor investigaţii în clinici. cancer de stomac şi gastrită cronică prin comparare cu ţesut normal şi a obţinut o acurateţe în diagnostic de 90%. Dovbeshko et al. Astfel. ficat şi a altor părţi ale sistemului digestiv cu ajutorul fibrei optice FTIR şi a spectroscopiei FT-Raman. Lucassen et al. S-a concluzionat că un studiu de spectroscopie IR poate deveni foarte util în interpretarea corectă şi înţelegerea pe deplin a patologiei acestui ţesut. urmărind absorbţia atribuită colagenului. [50] au folosit spectroscopia FTIR pentru a studia diferenţele între celule canceroase gingivale şi celulele epiteliale gingivale normale. 66%. colon. Choo et al. [47] au aplicat spectroscopia IR în diagnosticarea afecţiunii Alzheimer investigând spectre achiziţionate pe ţesut uman de sistem nervos central. Fukuyama et al. Ulterior s-au detectat modificări în conţinutul de colagen şi a depozitării celulelor lipidice. Weng et al. [43] au raportat diferenţierea spectroscopică între ţesutul gastric normal şi cel tumoral. dar acest stu153 .

Spectre MIR au fost folosite pentru a diferenţia sucurile concentrate pure din rodii de cele contrafăcute cu suc de struguri concentrat (2%-14% v/v) folosind analiza de componente principale (PCA) în regiunea IR 1780-1685 cm-1. rapide şi nedistructive ale compuşilor chimici. spectroscopia de absorbţie IR reprezintă o metodă senzitivă în ceea ce priveşte analiza malignităţii ţesuturilor cu potenţial real pentru aplicaţii clinice în detecţia şi diagnosticarea a diverse afecţiuni. Progresul în instrumentaţia FTIR combinat cu dezvoltarea unor metode statistice multivariate de analiză a datelor fac această tehnologie ideală pentru monitorizare rapidă cât şi caracterizarea compuşilor din alimente la nivel de urme. struguri Concord. Extracţia fazei solide a minimizat interferenţa zahărului cu spectrele şi a izolat componentele fenolice care au oferit o amprentă unică în autentificarea sucurilor.Spectroscopia IR în calitatea şi siguranţa alimentelor Spectroscopia FTIR este o tehnologie promiţătoare pentru industria agroalimentară deoarece permite măsurători simple. până la părţi pe milliard (ppb).diu a ridicat anumite probleme. Rodiile sunt foarte apreciate pentru activitatea lor antioxidantă cât şi pentru potenţialele efecte chemopreventive împotriva cancerului de prostată [68]. Spectroscopia MIR a fost folosită în autentificarea sucurilor cu ingrediente de înaltă calitate contrafăcute din surse inferioare. Autorii au 154 . nectar de prune şi sucuri de mere de la diferiţi producători. iar pentru fiecare produs s-au stabilit limite inferioare ale acestuia. Regresia de tip parţial least-squares (PLS) ce corelează conţinutul de fructe şi spectrele FTIR centrate pe o bandă la 1729 cm-1 a asigurat o bună calibrare statistică la analizarea gemului de căpşuni [69]. atribuită în principal întinderii C=O [68]. [70] au analizat afine. În mod similar. He et al. merişor. Spectre înregistrate după extracţia fazei solide din sucuri a îmbunătăţit puterea de modelare pentru compararea cu sucul pur şi a recunoaşterii prin folosirea unui tipar (soft independent analysis of class analogy (SIMCA)) şi a permis diferenţierea sucurilor de origini diferite. spectroscopia MIR a fost de mare succes în diferenţierea varietăţilor de fructe şi a originilor geografice. industria agroalimentară este deja familiarizată cu această tehnologie şi cu potenţialul ei de implementare în monitorizarea alimentelor. 4. Datorită utilizării tehnicii FTIR în aplicaţii de control a calităţii şi a procesării. preparatelor şi a gemurilor de fructe este procentul care desemnează conţinutul de fructe. În concluzie. respectiv apariţia prin interpretarea spectrelor a unor configuraţii “ciudate” de baze şi zaharuri. Un parametru important în monitorizarea autenticităţii piureurilor.

155 .4 % (wt) H2O. Până în 2009 nu a fost o metodă standardizată în industria viticolă care să permită determinarea eficientă a compoziţiei şi autenticităţii vinurilor organice [71].2 % (wt) H2O. estimată la circa 5µm [72]. [71] au fost primii care au folosit tehnologia IR pentru a clasifica vinuri comerciale provenite de la sisteme de producţie organică şi anorganică. Explorarea rezultatelor analizei PLS nu a desemnat un parametru chimic individual care să fi explicat diferenţierea vinurilor. Consumatorii sunt tot mai interesaţi de produse organice şi sunt dispuşi să plătească un preţ mai mare pentru aceste produse. şi analiza discriminantă liniară (LDA). În general. Masa brută a dacitelor din Sumisu Caldera conţine între 1. dar au subliniat că această metodă este o îmbunătăţire reală comparativ cu încercărilor anterioare [70]. inclusiv în procesul de extracţie şi asupra nevoii unui spectru larg de probe pentru a îmbunătăţi repetabilitatea acestui model. ci mai degrabă mai mulţi compuşi chimici. Industria de vinuri a recunoscut acest trend şi astfel în multe podgorii se pune accentul pe vinuri organice. care ar contribui la discriminarea vinurilor. 5. Cozzolino et al. dar a existat o uşoară suprapunere [71].2-1. Rezultatele au fost comparabile cu cele obţinute prin metoda convenţională bazată pe micro-FTIR. Aplicaţii ale spectroscopiei IR în geoştiinţe Concentraţia şi distribuţia apei în rocile vulcanice din Sumisu Caldera şi Vulcanul Torishima din arcul Izu-Bonin (Japonia) au fost studiate de Wysoczanski şi Tani [72]. Metodele tradiţionale pentru autentificarea sucurilor de fructe includ cromatografia sau analiza raportului izotopilor de carbon. niciuna dintre ele fiind foarte practică pentru că sunt costisitoare din punct de vedere al timpului necesar efectuării lor şi al setărilor pentru controlul de calitate. incluzând compuşi fenolici volatili şi nevolatili. regresia PLS discriminantă (DPLS). DPLS a clasificat corect 85% din vinurile organice. Aproape 200 de soiuri de vinuri roşii şi albe din 13 regiuni din Australia au fost analizate folosind spectroscopia MIR combinată cu PCA. iar pentru obsidian 0. rezultatul analizei PCA a separat vinurile organice de cele anorganice. iar LDA a reuşit să clasifice 75%. valori corespunzătoare cu saturarea apei la presiunile de erupţie. rezultând o precizie similară şi o rezoluţie spaţială chiar mai bună. Autorii aduc la cunoştinţă că spectroscopia MIR combinată cu tehnici chemometrice au permis o discriminare bună între probele produse în sisteme de producţie organică şi anorganică.atras atenţia asupra limitărilor acestei metode. folosesc solvenţi dăunători şi monitorizează doar un parametru la un moment dat.

O microanaliză preliminară a acestor probe a dezvăluit o absorpţie în regiunea 3000-4000 cm-1 datorată vibraţiilor de întindere a apei. [76] au studiat un set de cristale leucite transparente atent selecţionate provenind din vulcanul Alban Hills (Roma. de aceea aceste materiale merită ca toată atenţia. faptul că acel conţinut de CO2 depinde puternic de faza mineralului [82]. Krisztian Herman la redactarea acestui material. Nicoleta E. fugacitatea oxigenului şi compoziţia fluidelor în sistemele minerale. În acest context. Analiza apei în minerale [79] şi roci [80] cu ajutorul spectroscopiei FTIR este aproape o tehnică de rutină. în special privind studiile arheologice şi problemele de conservare. mineralele au o largă răspândire în istoria rocilor ornamentale sau a pigmenţilor utilizaţi în operele de artă. analiza spectroscopică a CO2 fiind comună în studiul rocilor. Aceste incluziuni determină totodată şi dezvoltarea modelelor restrictive în geneza depozitării minereurilor şi oferă informaţii pentru exploatarea geotermală şi petrolieră în producţia la nivel industrial. conţinutul de CO2 din lazurite a fost propus ca şi indicator al sursei naturale ultramarine de pigmenţi. la 3500 cm-1 şi la 3245 cm-1. Italia).Este bine cunoscut faptul că mineralele anhidride nominale formate în condiţii de înaltă presiune conţin urme de specii hidride [73-74]. Studiile care tratează incluziunile de fluide sunt foarte utile în definirea rolului fluidelor în geneza. fiind 3 peak-uri bine definite la 3604 cm-1. Pe lângă caracterizarea cristalo-chimică. studiul speciilor volatile în minerale are aplicaţii şi în alte domenii. Astfel se susţine ideea că o analiză amănunţită a speciilor volatile din minerale poate oferi informaţii cantitative şi calitative privind activitatea apei şi a CO2. 156 . a fost că imagistica FTIR a distribuţiei apei în leucite reprezintă un instrument valoros în monitorizarea evoluţiei sistemelor magmatice. colecţia de imagini obţinute prin scanare a arătat. Mulţumiri pentru suportul acordat de Drd. procesele de deformare cât şi a unui “geotermometru” privind rocile din crusta terestră [83]. De fapt. Mircescu şi Mast. dar teste efectuate pe incluziunile de fluide din minerale sunt rare [81]. precum era de aşteptat. Concluzia lui Della Ventura et al. Numeroase studii recente au arătat că specii volatile ca şi CO2 şi specii hidride ca şi OH şi H2O pot fi de asemenea încorporate în circumstanţe speciale în majoritatea mineralelor din crustă [75-77]. Aplicând fluorescenţa de raze X. Della Ventura et al. aceste studii fiind folositoare în determinarea genezei şi a evoluţiei sistemelor magmatice [78].

K. I. S. Goldstein. M. A. Karlberg and B. T. N. Pivik and B. Barry. Sindhuphak. D. Goldstein and S. P. Talanta 67 (2005) 269-279. Lendl. M. J. Analytical Chemistry 72 (2000) 1645-1648. Brunetto. M. Barth and C. 4. R. F. Kuligowski and B. S. M. Quintas. B. Journal of Raman Spectroscopy 23 (1992) 641-645. Hammody. Journal of Chromatography A 934 (2001) 123-128. A. H. J. Journal of Chromatography A 1068 (2005) 3-30. R. McNaughton. Edwards and A. 9. G. B. Diem. 26. 7. Pilavdzic and A. Schaden. Edelmann. Frank. Z. P. J. R. Xie. Kolhed and B. 28. M. Anastos. Gornik and G. Hislop. R. Ashdown. 11. 23. Cancer Research 53 (1993) 762-765. Applied Physics B-Lasers and Optics 99 (2010) 833-840. Frank. A. Udomprasertgul. Gooijer and U. C. Barnett and S. Karlberg. S. J. Srisookho.6. P. G. Baena and B. A. M. Hinsmann. Lendl. Hinsmann. Beck and J. W. Quarterly Reviews of Biophysics 35 (2002) 369-430. P. M. Sukuta and R. M. Lewis. Bruch. 10. N. G. M. G. R. J. Godwin. W. Svasek. T. Grekin. Stranc. P. Schindler. R. Schrenk. Wood. Vigorita. L. Sensors and Actuators a-Physical 115 (2004) 591-599. Gynecologic Oncology 90 (2003) 10-14. A. Bibliografie 1. Lammerhofer. R. Surowiec. Journal of Chromatography A 856 (1999) 213-242. 157 . M. L. 20. http://www. Journal of Biomedical Optics 3 (1998) 267-280. Zakim and M. Electrophoresis 24 (2003) 687-692. Lendl and B. Lendl. 3. M. Brinkman. Karlberg. A. Laurell. Karlberg. 24. D. V. 22. M. Rigas. Lucassen. D. Sindhuphak. H. 16. Talanta 64 (2004) 1127-1146. W. Journal of Investigative Dermatology 112 (1999) 951-956. J. Kantarovich. K. Yee. M. G. Jackson. B. W. Ruzicka. Lendl. B. Zarou. Quinn. 18. B. E. Analyst 130 (2005) 772-778. 13. Arce. Austria http://daylightsolutions. Quinn. D. W. Tait. Biospectroscopy 2 (1996) 143-153.com Vienna. T. Svasek. Williams. Chiriboga. H. N. 6. Veen and J. Strasser. Applied Spectroscopy 58 (2004) 662-666. M. Quintas and B. A. P. Svasek. C. Muller. Kolhed. S. C. Frank. Sahu. S. Lendl and M. Lendl. Vellekoop. 29. G.com J. Podshyvalov. Baena. H. 21. A. 8. P. Biospectroscopy 4 (1998) 75-91. 5. C. Issaravanich. R. M. Journal of Chromatography A 1079 (2005) 24-40. B. Burden and D. T. M. V. R. N. Applied Spectroscopy 58 (2004) 667-670. M. 19. Lammerhofer and B. Analytical Chemistry 74 (2002) 3843-3848. Dusitsin. 25. P. Crowson. B. Argov. Zscherp. 12. P. S. M. McIntosh. M. Warakamin. V. Lendl. 17. Wood. J. R. Somsen. Mantsch. F. C. Hinsmann. Biospectroscopy 4 (1998) 47-53. H. Frank. Trojanowicz and B. Mordechai. L. 2. Mark. Romeo and D. Lendl and B. Boonbundarlchai and N. 30. P. Wong. A. Analytical Chemistry 81 (2009) 3746-3753. T. S. B. Guterman. Jansen. W. Analyst 128 (2003) 2-6. J. Haberkorn. Gallignani and M. Kuligowski. Journal of Chromatography A 1080 (2005) 132-139. Kolhed. B. Lendl. 14. McNaughton. Journal of Microscopy-Oxford 215 (2004) 86-91. 15. 27. Nilsson. Svasek. Righetti. E. Kolhed.quantared. B. G. Faist. S. J. Lasers în Surgery and Medicine 24 (1999) 382-388. J. T. Lendl. Frank.

J. C. Fabian. Fung. C. Talanta 53 (2000) 233-246. Vigorita. 43. L. T. Kruglova and O. H. X. Fitzmaurice. K. A. D. 41. P. B. Eckel. M. Kapelushnik C. S. Weng. Journal of Molecular Structure 565 (2001) 329-334. A. H. Watanabe and H. J. U. J. Sockalingum. S. S. R. Fichtner and H. Y. J. K. Yuasa. L. Manfait and A. Z. American Clinical Laboratory 19 (2000) 20. G. R. W. N. Salman. A. J. S. Andrus. M. N. M.31. J. D. 55. H. Clarke. Y. R. K. F. Okuyama. P. C. W. Kwiatek. M. Lockyer. L. 46. Goldstein. P. P. Miyan. Mikhael. Haka. Technology în Cancer Research & Treatment 5 (2006) 157-167. Kline and P. Shafer-Peltier. A. W. 49. 39. Gotou. Shimizu. S. Biospectroscopy 4 (1998) 55-59. T. J. Arai and M. Biospectroscopy 1 (1995) 357-364. Huang. Mikhael. W. E. M. Guan. M. D. D. Scott. I. Lacelle and P. J. Yoshida. Sun. X. P. J. Li. S. K. Andrus and R. B. S. Proceedings of the SPIE 3918 (2000) 66-77. Science of the Total Environment 204 (1997) 283-287. Biospectroscopy 1 (1995) 141-148. Halliday and H. Kegelaer. O. S. Cohen. L. Moriguchi and H. Y. Fukuyama. F. Diem. M. R. K. H. G. H. Biopolymers 78 (2005) 311-317. G. Wade. Hu. A. V. K. Gardner. Brown. L. Gridina. H. M. Levi. Fujioka. Mantsch. C. M. Yang. S. L. V. Salman. Zhang. C. Lacelle. H. Takeshita. Argov. A. Fung. Kobayashi. Sun. Senterman and N. Kumaido. Yang. Pizzi. P. S. 42. Miyazaki. Clinical Chemistry 51 (2005) 346-350. Yano. S. Watson. Frank. Shi and J. 52. X. Z. Jackson. N. 158 . T. Huo. F. Dwyer. 51. X. Ghanbari-Siahkali. Y. F. Journal of Raman Spectroscopy 33 (2002) 552-563. S. Murphy. Weng. G. Ramesh. Y. P. Somorjai. T. Huleihel. Ohoshima. 40. 47. 45. Applied Spectroscopy 55 (2001) 955-959. Biospectroscopy 5 (1999) 117-126. R. Huang. J. Heintzelman. R. J. W. Wong. D. Utzinger. Zarou. Biospectroscopy 2 (1996) 155-165. Chiriboga. H. Follen and R. Argov. Xie. Shohat. Biospectroscopy 4 (1998) 37-46. N. V. Journal of Pathology 201 (2003) 99-108. Strickland. Che and W. L. N. I. J. S. Mansfield. Journal of Raman Spectroscopy 28 (1997) 119-&. C. Pashchuk. Sato. Q. Malpica. Mordechai. Kikuchi. Paluszkiewicz and W. Moser and J. O. Analytical Biochemistry 287 (2000) 218-225. Y. A. H. S. Vibrational Spectroscopy 27 (2001) 165-173. S. Yoshida. P. M. J. X. P. Zakim and M. Sakai. 54. Y. Cancer Detection and Prevention 28 (2004) 32-36. C. P. Xu. T. 53. Song. T. 38. Mordechai. I. F. S. Dasari and M. R. E. Feld. Yanagisawa and M. Wang. J. Sahu. A. Y. M. Zhang. J. Crowe. 50. C. Katayama. B. Zhou and J. Mantsch. Li. M. Xu. Ling. J. 48. Choo. Chaims and Z. 34. Hammody. Mordechai. A. N. El Haj. 33. Y. Wu. Wang and Y. Erukhimovitch. X. E. Jackson. M. Biospectroscopy 1 (1995) 37-45. S. G. L. G. Treado. Z. Zelig and S. G. Mahadevan-Jansen. Mordehai. J. N. 36. 56. Morimoto. Shanks. L. Y. H. Sule-Suso. Wu. McCreery and D. 44. Dovbeshko. Erukhimovitch. Yang. Z. 32. Biospectroscopy 3 (1997) 281-290. Nguyen. Application of FTIR microspectroscopy for the follow-up of childhood leukemia chemotherapy 4491 (2001) 243-250. M. Hart and M. J. E. 35. U. J. F. K. T. D. Wong. Vickerman. A. 37. Myles. Richards-Kortum. Analytical Chemistry 67 (1995) 777-783. Gazi. B. K. Senterman. P. Biopolymers 75 (2004) 384-392. Redd. Bernshtain.

Wong. Vibrational Spectroscopy 28 (2002) 103-110. Journal of Raman Spectroscopy 35 (2004) 939-946. Bellatreccia and M. Al-Khaldi. Cavallo and M. Trends în Food Science & Technology 16 (2005) 433-441. J. Johannsen. F. T. Della Ventura. U. Mineral. M. Journal of Materials Science-Materials în Medicine 5 (1994) 775-778. L. T. K. T. S. Dambergs. Tani. F. H. Lima and J. Keppler. Ramesh. Hammody and S. A. D. 77. 68. R. R. A. Schieber. R. Z. 67. Shimada. Piccinini. H. Mordechai. 58. A. Morgello. Della Ventura. Naumann H. F. Lithos 55 (2001) IX-XI. Jurgensen. Canadian Mineralogist 42 (2004) 1275-1282. Fugel. R. F. Wade. L. R. Steiner. Food Chemistry 116 (2009) 761-765. I. Mag. 80. 61. T. V. M. 78. G. Proceedings of the National Academy of Sciences of the United States of America 87 (1990) 8140-8144. Degtyarenko. H. P. H. Beran and E. J. J. R. S. Rodriguez-Saona and M. V. Y. Libowitzky H. R. M. Wong. Smith and I. Nardi. M. 62. T. J. Cozzolino. Ismail. 63. Burke. American Mineralogist 93 (2008) 1538-1544.57. Richter. L. H. Ozen and L. Tryndiak. G. Rodig and B. Journal of Volcanology and Geothermal Research 156 (2006) 302-314. J. Mossoba. A. 75. E. M. V. B. A. Water în natural mantle minerals II: Olivine. Linnen. 71. Physics în Medicine and Biology 48 (2003) 2373-2390. R. M. Claussen. Jayakumar. 73. K. A. I. Andersen. Frezzotti and E. J. Murakami. D. Bergmann. A. G. Webster. Tamura. M. M. Knapp-Mohammady. Skogby. H. 72. I. Piccinini. 65. Mantsch. Shirshov. Della Ventura. C. G. Infrared and NIR raman spectroscopy în medical microbiology 3257 (1998) 245-257. Jung. Ihinger. garnet and accessory minerals 62 (2006) 169-191. M. S. S. A. Piccinini. M. 74. Holdstock. 79. O. P. M. K. S. M. P. G. S. Mauer. Niehaus. Rendiconti Lincei-Scienze Fisiche E Naturali 19 (2008) 141-159. H. 69. V. J. T. Suhai. Brilli. A. Libowitzky and G. 60. M. 64. Tarumi. Giusti. M. N. International Journal of Quantum Chemistry 106 (2006) 1160-1198. Huleihel. A. F. B. Chegel. D. Vibrational Spectroscopy 38 (2005) 229-235. Todor and C. Y. C. E. Sedman and A. 70. Biopolymers 67 (2002) 470-486. Rigas and P. 83. Gridina. I. 81. W. J. B. I. J. Solyanik. 59. 76. Fry. E. Rigas. M. Hervig and P. Dovbeshko. Elements 1 (2005) 19-24. M. Jensen. 73 (2009) 399-413. Water în Nominally Anhydrous Minerals 62 (2006) 155-167. Abraham. G. 82. P. Wysoczanski and K. Bellatreccia. Carle and A. Sterner. M. I. Johnson. R. Joe. Cancer Research 52 (1992) 84-88. Nielsen. H. T. Physics and Chemistry of Minerals 23 (1996) 319-327. McMillan. Volatiles în Magmas 30 (1994) 67-121. Bellatreccia and M. F. A. A. Erukhimovich. Keppler and S. Water în Nominally Anhydrous Minerals 62 (2006) 117-154. Abu-Id. Journal of Agricultural and Food Chemistry 55 (2007) 4443-4452. Binoy. Smith. Goldman and P. M. G. Rossman. B. Journal of Biochemical and Biophysical Methods 50 (2002) 111-121. T. F. G. Herrmann. R. Rahim. Pettit and O. R. I. He. Arimoto and Y. W. R. L. F. Jalkanen. A. 159 . V. R. Yamada. Frimand and S. Kirkwood. M. 66. Vardin. R. D. Food Chemistry 108 (2008) 742-748. Cynkar and P. De Vivo. Salzer. Rehman. Repnytska. J. F. Tay. Salman. Nieminen.

...... Tehnica experimentală ............................ Din aceeaşi clasă fac parte şi fosforescenţa şi fosforescenţa întârziată............. Aplicaţii ale spectrofluorimetriei ................. În starea electronică fundamentală moleculele fluorescente se află într-o configuraţie stabilă....... 169 6............... Dana Maniu Cuprins 1...................................................... 160 2.................. aceasta poate trece într-o stare electronică excitată (cu energie mai mare) în urma absorbţiei de energie de la radiaţia luminoasă........................................ SPECTROFLUORIMETRUL Spectrofluorimetria Conf........... molecula dezexcitându-se.......... Avantajele spectrofluorimetriei ........ deci nu emit radiaţie de fluorescenţă................................ Aparatura disponibilă ....... De aceea ele 160 .... 171 1... 166 5..... Dacă molecula se dezexcită (electronul trece din starea excitată în starea fundamentală) prin emisie de lumină................ Atunci când radiaţia luminoasă ajunge pe o moleculă fluorescentă.. Prin absorbţie de radiaţie luminoasă moleculele pot fi excitate prin trecerea unui electron de pe nivelul fundamental pe un nivel excitat.. Moleculele fluorescente sunt instabile atunci când se află pe un nivel vibraţional al stării electronice excitate.........................................................V.... se numesc molecule fluorescente sau fluorofori.............................. Moleculele care au această proprietate.... 166 4................................................. Energia acestor nivele depinde de energia (lungimea de undă) radiaţiei luminoase care produce excitarea....... Consideraţii teoretice... 164 3. Bibliografie ...... Energia stării excitate nu poate fi menţinută decât o perioadă foarte scurtă.................... dr................................. Consideraţii teoretice Fluorescenţa este un fenomen de fotoluminiscenţă (procesul prin care substanţele absorb lumină şi după aceea reemit lumină cu o lungime de undă diferită)................................. procesul se numeşte fluorescenţă...... Există o mulţime de nivele vibraţionale ale stării electronice excitate pe care se poate afla o moleculă fluorescentă....

Deci lungimea de undă a radiaţiei emise este totdeauna mai mare decât lungimea de undă a radiaţiei absorbite datorită energiei pierdute de moleculă în timpul trecerii pe cea mai joasă stare electronică excitată.moleculele aflate în starea de triplet pot să se dezexcite prin emisia unui foton. moleculele fluorescente sunt instabile structural în intervalul de timp cât se află în stare de excitaţie (timpul de viaţă). Acest fapt este deosebit de util. deoarece înseamnă că o moleculă poate emite radiaţie de fluorescenţă de mai multe ori.fosforescenţa . O tranziţie triplet-singlet este mult mai puţin probabilă decât o tranziţie singlet-singlet. deci procesul descris mai sus poate fi repetat.unele molecule aflate în prima stare electronică excitată. . În urma absorbţiei unui foton de către o moleculă. Molecula fluorescentă poate absorbi energie luminoasă din nou. Această proprietate face ca fluorescenţa să fie o tehnică foarte senzitivă (chiar şi o mică cantitate de substanţă poate fi detectată). După acest interval. Timpul de viaţă a unei stări excitate de triplet poate ajunge până la 10 s.intersystem crossing (ISC) . relaxarea vibraţională se face prin pierderea de energie în urma ciocnirilor dintre molecule (10-14 . De fapt.conversia internă (IC) . stare de singlet (S1).moleculele aflate pe diferite nivele vibraţionale se relaxează pe nivelul fundamental al stării electronice respective. ceea ce face posibilă degradarea ei. I) sau la metale. procesul de fluorescenţă este ciclic şi are loc atâta timp cât există o radiaţie luminoasă. care să excite molecula. Radiaţia luminoasă de fluorescenţă are energie mai mică decât radiaţia luminoasă absorbită de moleculă.10-11 s). sunt posibile următoarele procese (ilustrate în figura 1): . moleculele fluorescente trec din stare electronică excitată în stare electronică fundamentală. În realitate. De obicei fosforescenţa apare doar la temperaturi scăzute sau în medii cu vâscozitate mare (dezexcitatea nivelului T1 se poate face şi prin conversie internă sau alte procese neradiative). deci emisia de fosforescenţă poate continua şi după încetarea iradierii iniţiale. Intervalul de timp în care o moleculă fluorescentă se află în stare excitată se numeşte “timp de viaţă“ şi are o valoare foarte mică (între 10-15 şi 10-9 s).trec în cea mai joasă stare electronică excitată. pierderea de energie este neradiativă. făcându-se prin ciocnirea cu alte molecule. pot trece în prima stare de triplet (T1). Acest proces este numit “photobleaching“. 161 . excesul de energie dintre cele două stări regăsindu-se în energia radiaţiei luminoase emise în procesul de dezexcitare. . O radiaţie luminoasă de mare intensitate poate provoca modificarea structurii moleculei fluorescente. care este semi-stabilă. astfel încât aceasta să nu mai emită radiaţie de fluorescenţă. Acest proces se poate observa la atomii grei (Br.

Majoritatea moleculelor nu sunt fluorescente deoarece starea excitată S1 se suprapune cu nivelele vibraţionale ale stării fundamentale S0.Figura 1. 162 . Atât absorbţia cât şi emisia de fluorescenţă sunt unice pentru fiecare moleculă. În acest caz relaxarea vibraţională este mai rapidă decât relaxarea prin fluorescenţă. . Lumina emisă are totdeauna lungime de undă mai mare decât lumina absorbită (figura 2).fluorescenţa. valoarea maximă fiind 1. Fluorescenţa poate să apară doar în timpul absorbţiei (timpul de viaţă a unei stări excitate de singlet este între 10-9 şi 10-15 s). De aceea. este proprietatea moleculelor de a emite radiaţie electromagnetică la trecerea de pe prima stare excitată de singlet S1 pe un nivel vibraţional al stării electronice fundamentale S0. Diagrama Perrin-Jablonski. Fluorescenţa se poate măsura cu ajutorul eficienţei cuantice Q (randament cuantic): Q = (numărul de fotoni emişi) / (numărul de fotoni absorbiţi) Q are o valoare fixă pentru fiecare moleculă (pentru aceleaşi condiţii). Fluorescenţa de tip Stokes reprezintă emisia de fotoni cu lungime de undă mai mare (frecvenţă mai mică) de către o moleculă ce a absorbit fotoni cu o lungime de undă mai mică (frecvenţă mai mare). Fluorescenţa observată cu ajutorul spectrofluorimetrelor este cunoscută ca Fluorescenţa de tip Stokes. moleculele fluorescente au spectre de absorbţie şi de fluorescenţă caracteristice.

Figura 2.10-εbc) Figura 3. iar K' este o constantă ce depinde de condiţiile experimentale şi de eficienţa cuantică a fluorescenţei. Dacă ţinem cont de legea Beer: I/I0 = 10-εbc . Curba de calibrare 163 . unde A = bcε este absorbanţa. Intensitatea radiaţiei fluorescente este proporţională cu intensitatea radiaţiei absorbită de o moleculă fluorescentă: F = K'(I0-I) unde I0 este intensitatea radiaţiei incidente pe probă. atunci printr-o simplă înlocuire se obţine legea fluorescenţei: F = K' I0 (1 . Spectru de fluorescenţă (emisie) şi de absorbţie (excitaţie) caracteristic. I este intenstitatea radiaţiei după ce a traversat un strat de substanţă de lungime b.

Dacă folosim o descompunere în serie Taylor.⎤ F = K ' I 0 ⎢2. Bineînţeles. detector (figura 4). Radiaţia emisă este colectată la un 164 . monocromator a radiaţiei excitatoare. Spectrofluorimetrele folosesc două monocromatoare. Primul monocromator analizează lungimea de undă a radiaţiei excitatoare.. orice spectrofluorimetru modern este interfaţat cu un computer cu ajutorul căruia se setează parametrii de măsurare.3 ⋅ ε ⋅ b ⋅ c)2 + (2. Fluorimetrele se folosesc pentru măsurători cantitative pentru compuşi specifici (măsurători de rutină). avem: ⎡ (2. intensitatea radiaţiei de fluorescenţă nu depinde liniar de concentraţie.Spre deosebire de legea Beer. Semnalul detectat poate fi reprezentat în funcţie de cele două lungimi de undă sau numai în funcţie de una din cele două lungimi de undă.. se înregistrează şi se prelucrează datele.3 ⋅ ε ⋅ b ⋅ c − ⎥ 2! 2! ⎣ ⎦ Dacă εbc are o valoare suficient de mică (< 0. iar celalalt analizează lungimea de undă a radiaţiei de fluorescenţă (emise). Tehnica experimentală Pentru a măsura fluorescenţa există două tipuri de instrumente: fluorimetre şi spectrofluorimetre. unul pentru lumina excitatoare şi unul pentru radiaţia de fluorescenţă emisă.3·K'·ε·b·c·I0 Relaţia de mai sus ne arată ca pentru concentraţii suficient de mici intensitatea de fluorescentă este proporţională cu concentraţia şi cu intensitatea radiaţiei excitatoare la frecvenţa de absorbţie.05) termenii de ordin superior pot fi consideraţi nuli. proprietăţile fluorescente ale probei pot fi scanate pentru un domeniu larg de lungimi de undă ale radiaţiei excitatoare (200-1000 nm). Astfel. Pentru o concentraţie mai mare decât c1 curba de calibrare nu mai este liniară.. camera probei. deci putem scrie: F = 2. Un fluorimetru măsoară abilitatea unei probe de a absorbi lumină la o anumită lungime de undă şi de a emite lumină la o lungime de undă mai mare. 2. Părţile principale ale unui spectrofluorimetru sunt: sursa.3 ⋅ ε ⋅ b ⋅ c)3 − . Avantajul spectrofluorimetrelor este faptul că permit variaţia controlată a lungimii de undă a radiaţiei excitatoare. monocromator al radiaţiei emise.

sursă monocromator detector probă monocromator Figura 4. elementul dispersiv al celui de-al doilea monocromator este astfel conceput încât să aibă maximul de eficienţă în domeniul vizibil. Detectorul este poziţionat la ieşirea din cel de-al doilea monocromator. Lumina emisă de sursă este focalizată pe fanta de intrare a primului monocromator cu ajutorul unei oglinzi sferice sau eliptice. lichide şi gazoase. Camera probei este de obicei destul de spaţioasă. sau poate să se modifice continuu pe tot domeniul de emisie al sursei.unghi de 90° faţă de radiaţia excitatoare pentru a preveni orice interferenţă între radiaţia excitatoare şi cea emisă. Lumina emisă de probă este focalizată pe fanta de intrare al celui de-al doilea monocromator. pentru a permite instalarea diferitelor accesorii pentru probe solide. Astfel radiaţia luminoasă incidentă pe probă poate să aibă lungime de undă fixă pentru tot timpul măsurătorii. cât şi lungimea de undă a acesteia este monitorizată şi controlată cu ajutorul unui fotodetector suplimentar situat între monocromator şi camera probei. Deoarece radiaţia de fluorescenţă are totdeauna lungime de undă mai mare decât radiaţia excitatoare. sau pentru controlarea temperaturii probei. Fanta de intrare este ajustabilă continuu (cu ajutorul soft-ului) pentru a se asigura maximul de rezoluţie şi reproductibilitate. Primul monocromator descompune radiaţia excitatoare în culorile componente. Schema bloc pentru un spectrofluorimetru Sursa unui spectrofluorimetru emite în domeniul UV şi vizibil (de obicei se folosesc lămpi cu Xenon). Prin fanta de ieşire a monocromatorului radiaţiei excitatoare iese lumină cu lungimea de undă dorită. Atât intensitatea luminoasă a radiaţiei incidente. 165 . Acesta descompune radiaţia de fluorescenţă emisă de probă în culorile componente.

etc. Această extraordinară senzitivitate permite detecţia sigură a substanţelor fluorescente (clorofilă. De asemenea. face ca această tehnică să fie folosită atât pentru cercetări avansate cât şi pentru analize de rutină sau controlul calităţii în domeniile farmaciei şi medicinii.Toate spectrofluorimetrele moderne sunt controlate de computer. Senzitivitatea şi specificitatea mare a acestei tehnici reduce sau chiar elimină procedurile de preparare a probelor. 4. Aplicaţii ale spectrofluorimetriei Medicină şi farmacologie Sensitivitatea deosebită a spectroscopiei de fluorescenţă. Datele obţinute în urma măsurătorilor efectuate se pot prelucra cu ajutorul programelor speciale. ceea ce face dificil izolarea semnalului de la materialul de analizat din matricea în care se află. rigidităţii şi structurii proteinelor. vi166 . 3. prin intermediul computerului se pot seta toţi parametri necesari derulării diferitelor tipuri de măsurători. sau chiar dacă au fluorescentă este puţin probabil ca două substanţe să absoarbă şi să emită radiaţie de fluorescenţă în acelaşi domeniu. Fluorescenţa oferă informaţii asupra dinamicii. Spectrofluorometrele au o specificiate ridicată şi apar mult mai puţine probleme de interferenţă deoarece substanţele fluorescente pot fi incluse în solvenţi sau matrici care nu sunt fluorescente. Fluorimetria poate fi folosită pe un domeniu mare de concentraţii fără a fi nevoie de diluţia eşantioanelor sau de modificarea celulei în care se pune eşantionul. Tehnicile spectrofotometrice au probleme de interferenţă deoarece multe materiale absorb lumina. Spectrofluorimetrele au limite de detecţie mult mai bune decât spectrofotometrele. Viteză şi simplitate: spectrofluorimetria este o tehnică analitică relativ simplă. Avantajele spectrofluorimetriei Senzitivitatea: Limitele de detecţie depind în mare măsură de proprietăţile probei de măsurat. Specificitatea: Spectrofotometrele măsoară doar lumina absorbită. Astfel. Pentru multe substanţe fluorescente este obişnuită o limită de detecţie de părţi/miliard sau chiar părţi/triliard. Domeniu de concentraţie: Intensitatea semnalului de fluorescenţă este direct proporţional cu concentraţia substanţei fuorescente pe un domeniu larg.) folosind probe foarte mici. studiile pot fi efectuate în soluţii apoase fără a fi nevoie ca probele să fie tratate. hidrocarburi aromatice.

a apei şi a solului prin detectarea urmelor de substanţe organice sau inorganice. După ce sunt determinate caracteristicile de bază (excitaţie. Fluores167 . Prin determinări de fluorescenţă pot fi determinate: .reacţia la diferite suprafeţe Industria alimentară şi agricultura În industria alimentară este importantă îmbunătăţirea calităţii nutriţionale a alimentelor. producătorii trebuie să identifice contaminanţi.ruşilor. Spectrele de fluorescenţă 3D pot fi folosite ca o amprentă unică care duce la identificarea calitativă a compuşilor. fapt ce are deosebite aplicaţii în imunologie. Pentru a asigura calitatea produselor alimentare. creşterea termenului de garanţie precum şi a calităţii ambalajelor. microorganisme. etc. şi chiar pesticide utilizate în mod normal pentru a preveni răspândirea unor boli. AND-ului. Chimia analitică În chimia analitică se studiază spectrele de luminescenţă precum şi eficienţa cuantică a speciilor flourescente în funcţie de matriţa în care sunt puse.timpul de viaţă şi randamentul cuantic . pot fi elaborate metode şi teste de rutină pentru analizele de laboratoar. Deoarece probele preluate din mediul înconjurător sunt deosebit de complexe. Calitatea ambalajelor este de asemenea importantă atât ca membrană protectoare împotriva oxidării alimentelor cât şi datorită faptului că sunt o posibilă sursă de contaminare cu urme de plastic sau de polimeri. Mediul înconjurător Cu ajutorul fluorescenţei se poate monitoriza calitatea aerului.efectul prezenţei atomilor grei . randament cuantic) ale unei substanţe fluorescente. mutageni sau substanţe canceroase.efectul general de solvent . Cu ajutorul fluorescenţei se poate identifica prezenţa unui număr foarte mare de analiţi chiar dacă aceştia sunt în cantităţi foarte mici (sub picomolar). Culturile de bacterii ce pot să apară pe alimente sunt distructive şi periculoase datorită potenţialului de contaminare şi îmbolnăvire pe care îl au. mucegaiuri.efectul temperaturii . De asemenea măsurătorile de fluorescenţă 3D sunt folosite pentru determinarea surselor geologice a diferitelor eşantioane de petrol. pentru detectarea diferitelor substanţe sunt necesare tehnici de mare senzitivitate şi selectivitate care să evite multiplele surse de interferenţă.momentul de dipol al stării excitate . toxine. emisie.

fluorescenţa este folosită ca instrument de cercetare în domeniul biotehnologiilor. Fotochimie Mecanismul absorbţiei luminii precum şi proprietăţile fotofizice ale unei substanţe determină rolul său în procesele biologice şi chimice. carotenoide.o tehnică pentru localizarea. De asemenea.folosirea "quantum dots"-urilor ca probe biologice în diagnosticarea cancerului şi studierea ţesuturilor. a plascticelor. . Companiile de cosmetice şi produse pentru îngrijirea sănătăţii evaluează eficacitatea unor noi produse cum ar fi loţiunile pentru protecţie solară. pentru analiza medicamentelor. vitaminelor. înălbitorilor optici şi suprafeţelor fosforescente. etc). a polimerilor. Fabricanţii de instrumentar medical şi clinic studiază sistemele invazive pe bază de fibre optice (ce pot fi introduse în interiorul arterelor sau a altor orificii).caracterizarea substanţelor fotoreceptoare (flavine.mecanismul molecular de transfer prin membrana de proteină a bacteriorhodopsinei (o membrană integrală de proteină care acţionează ca o pompă de protoni . şi a altor substanţe biologice. tehnică mai avantajoasă decât cea clasică în care se măsoară intensitatea absolută de fluorescenţă la o singură lungime de undă. proteinelor. Aceştia pot fi caracterizaţi cu ajutorul spectrelor de fluorescenţă de excitaţie şi de emisie. . 168 .cenţa poate fi folosită şi în determinarea randamentului şi calităţii anumitor culturi în urma aplicării fertilizatorilor. hormonilor. emolientele pe bază de lipide şi cremele anti-rid. . Aplicaţiile fotochimice ale fluorescenţei includ: .capturează energie luminoasă şi o foloseşte pentru a transfera protoni în exteriorul celulei).conversia biologică de energie în fotosinteza plantelor verzi. Una din tehnicile cele mai folosite în acest domeniu este determinarea raportului dintre intensităţile semnalului de fluorescenţă emis de markerul folosit la diferite lungimi de undă. identificarea şi controlul tumorilor. Biologie celulară În studiul proceselor biologice sunt implicaţi o largă varietate de markeri fluorescenţi. . Industrie Producătorii folosesc fluorescenţa pentru a monitoriza calitatea vopselelor.terapia fotodinamică .

Aparatura disponibilă Spectrofluorimetru Jasco FP 6500 Spectrofluorimetrul Jasco 6500 are următoarele caracteristici: Sursa este o lampă cu xenon de 150 W dotată cu un fotomultiplicator ce monitorizează şi compensează orice variaţie în intensitate asigurându-se astfel maximul de stabilitate.000 nm/ min pentru ambele monocromatoare. precum şi cu suporturi pentru diferite tipuri de probe (solide. Cele două monocromatoare sunt echipate cu reţele de difracţie holografice concave (1500 trăsături/mm) cu unghi de "blaze" optimizat. . . . .zgomot este 200:1 sau mai mare. Fantele monocromatoarelor au dimensiuni reglabile. . Alte caracteristici ale spectrofluorimetrului Jasco FP 6500 sunt: .determinarea concentraţiei de substanţă fluorescentă (analiză cantitativă).determinarea spectrului de fluorescenţă a unei probe.măsurători de cinetică. . Cu ajutorul spectrofluorimetrului Jasco 6500 pot fi efectuate următoarele tipuri de măsurători: . . lichide şi gazoase).măsurători 3D de fluorescenţă. . atât ca lăţime cât şi ca înălţime.5.determinarea timpului de viaţă în cazul probelor fosforescente. Spectrofluorimetrul este echipat cu accesorii pentru modificarea controlată a temperaturi probei şi pentru polarizarea luminii incidente. ceea ce asigură maxim de senzitivitate pe întregul domeniu de lungimi de undă (200-850 nm). .acurateţea lungimii de undă este ±2 nm pentru ambele monocromatoare. .determinarea spectrului de fosforescenţă a unei probe. Calibrarea spectrofluorimetrului se face cu ajutorul kit-ului inclus ce utilizează ca probă standard Rodamina B.viteza de scanare este între 20 şi 10.rezoluţia monocromatoarelor este de 1 nm.raportul semnal . 169 .determinarea stabilităţii intensităţii de fluorescenţă în timp.măsurători la lungimi de undă fixă.

Modul "Spectrum measurement" permite măsurarea fluorescenţei probelor prin scanare de spectru. Această acţiune presupune măsurarea soluţiilor etalon. Se pot face spectre de excitaţie sau de emisie. Modul "Time course measurement" permite verificarea stabilităţii în timp a intensităţii fluorescenţei soluţiilor. Rezultatele măsurătorilor probelor de concentraţie necunoscută vor fi date în unitatea de măsură de concentraţie în care a fost construită curba de calibrare. la viteze diferite de scanare. fapt deosebit de util pentru probe necunoscute. respectiv de emisie. se pot face spectre pe tot domeniul sau pe un domeniu selectat de utilizator.) Analiza acestor spectre permite determinarea poziţiei maximului de excitaţie şi de emisie. Se obţin spectre tridimensionale (pe o axă este reprezentată intensitatea semnalului de fluorescenţă şi pe celelalte două axe avem lungimea de undă de excitaţie. 170 . construirea şi stocarea curbei de calibrare. fie pe emisie. Astfel. selectabile fie pe excitaţie. Modul "3D Fluorescence measurements" permite măsurarea în acelaşi timp a (i) spectrului de fluorescenţă a unei probe în timp ce se modifică lungimea de undă a radiaţiei excitatoare şi (ii) măsurarea spectrului de excitaţie în timp ce se modifică lungimea de undă de emisie. Modul "Fixed wavelength measurement" permite efectuarea măsurării fluorescenţei probelor la maxim 4 lungimi de undă simultan. Se face citirea la o lungime de undă selectabilă într-un interval de timp selectabil.Controlul acestor măsurători se face folosind programul "Spectra manager" Modul "Quantitative analysis": pentru a efectua o analiză cantitativă trebuie trasată o curbă de calibrare.

6.Modul "Phospho. Bernard Valeur. 2. 2002 Joseph Lakowicz. Ed. 3. spectrum measurement" permite măsurarea spectrului de fosforescenţă al probelor.aspx 171 . Wiley-VCH. Bibliografie 1.jascoinc. Molecular Fluorescence: Principles and Applications. Springer.com/Products/Spectroscopy/FP-6000-Series-Spectrophotom eters. Ed. Principles of Fluorescence Spectroscopy. 2006 http://www.

................................................................................Spectrofluorimetria .......... 176 2.... dr.. determinarea acestui timp de viaţă este deosebit de util în determinarea stării fluoroforului................ Fluorescenţa în timp real ... 180 3.............................................. Unele molecule excitate vor emite radiaţie de fluorescenţă înainte de durata 172 ........ .............. 180 3................... apar pe aceeaşi scară temporală cu emisia de fluorescenţă.......... cum ar fi difuzia rotaţională................................................. în urma modificărilor de temperatură şi pH.... Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului .......... Fluorescenţa în timp real furnizează mai multe informaţii despre moleculele ce se află în imediata vecinătate a fluoroforului................. Bibliografie ....aplicaţii Conf........................... Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) ......... Fluorescenţa în timp real Deşi măsurătorile normale de fluorescenţă pot fi folosite ca o sondă non-invazivă extrem de selectivă şi sensibilă.. pentru a obţine informaţii chimice mai amănunţite trebuie determinată variaţia în timp a fluorescenţei........ Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur................... 184 3.......... 190 1.............2................................................................................ Determinarea interacţiunii dintre albumina bovină şi nanoparticule de aur ..... Microscopia confocală de fluorescenţă ............. transferul rezonant de energie şi stingerea dinamică...................... 187 4...... 172 2......................2...............1................................................. Fiecare moleculă individuală emite aleatoriu după excitaţie....... Este important să ne amintim că timpul de viaţă de fluorescenţă este timpul mediu pentru ca o moleculă să rămână în stare excitată înainte de a emite un foton.......................................................... Multe evenimente macromoleculare.........3....... Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) ....................1.. Dana Maniu Cuprins 1........ spectroscopia de fluorescenţă în timp real poate fi utilizată pentru a investiga aceste procese şi a obţine informaţii despre vecinătatea chimică a fluoroforului...... 178 3......... Deoarece timpul de viaţă de fluorescenţă a unei molecule este foarte sensibil la vecinătatea sa moleculară....................... 174 2..... Microscopia de fluorescenţă avansată .......3........... 175 2......... Astfel...... Exemple de aplicaţii ale spectrofluorimetriei .

Emisia de fluorescenţă incoerentă emisă de probă este colectată şi mixată cu pulsul de frecvenţă ω1 într-un cristal neliniar. iar alte molecule excitate vor emite radiaţie de fluorescenţă mult timp după durata medie de viaţă. de ordinul 1-10 ns. iar pulsul de frecvenţă ω2 este focalizat pe probă (flow cell). fiind separat de fundamentală cu ajutorul unui divizor de undă dicroic. deşi în unele cazuri pot avea ordinul sutelor de nanosecunde sau să fie mai mici decat 1 ns (sute de femtosecunde). O sursă laser emite un puls ultra scurt (de ordinul femtosecundelor) cu lungimea de undă λ1 corespunzătoare frecvenţei ω1. Intensitatea Isum a pulsului cu frecvenţa ωsum pentru un anumit decalaj temporar între pulsul de frecvenţă ω1 şi emisia de fluorescenţă de frecvenţă ωfl este proporţională cu funcţia de corelaţie dintre intensitatea de fluorescenţă Ifl şi intensitatea I1 a pulsului de frecvenţă ω1: I sum (τ ) ≈ ∫ I fl (t ) I1 (t − τ )dt −∞ ∞ În acest fel se poate determina dependenţa intensităţii de fluorescenţă de timp prin modificarea timpului de întârziere (prin intermediul dispozitivului "optical delay line"). numai pentru un domeniu îngust din spectrul de fluorescenţă apare coincidenţa temporală şi spaţială cu pulsul de frecvenţă. ceea ce ne demonstrează că există o coincidenţă temporală şi spaţială între ω1 şi ωfl. Cu cât este mai mare decalajul temporar dintre pulsul ω1 şi emisia de fluorescenţă ωfl. De obicei. Cristalele din borat de bariu au avantajul transparenţei în UV şi eficienţei cuantice mai mare (cu un factor de 4-6). Timpii de viaţă de fluorescenţă sunt. în general. 173 . cu atât intensitatea de fluorescenţă este mai mică. Pentru o poziţie dată a cristalului. Armonica a doua a acestui puls (frecvenţa ω2) este generat într-un cristal neliniar. În figura 1 este prezentat un montaj experimental folosit pentru determinări de fluorescenţă în timp real. Această mixare ("fluorescence up-conversion") generează lumină cu frecvenţa ωsum = ω1 + ωfl . Din această cauză este foarte important ca aparatura experimentală folosită pentru acest tip de masurători să aibă rezoluţie temporală foarte bună.medie de viaţă. Deci dacă interesează întreg domeniu de fluorescenţă. Pulsul de frecvenţă ω1 trece printr-un dispozitiv optic ce produce o întârziere de fază (optical delay line). cristalele neliniare sunt confecţionate din potasiu-dihidrogen-fosfat (KDP) sau borat de bariu (BBO). cristalul trebuie rotit la diferite unghiuri.

proteina albastră fluorescentă. proton transfer etc. 2001). iar rezoluţia maximă este aproximativ egală cu jumatatea lungimii de undă a radiaţiei folosite la excitare. Lungimea de undă de excitaţie este selectată cu ajutorul unui filtru de interferenţă sau a unui monocromator. (DM .cameră video.). proteina verde fotoactivă etc.Figura 1.fotomultiplicator. BBO -cristal neliniar. CCD . a unui film fotografic sau a unei camere cu detector CCD (charge.monochromator. Observarea emisiei de fluorescenţă poate fi efectuată cu ajutorul ochiului observatorului. fotodegradarea polimerilor naturali. dar este de asemenea folosită pentru a studia diferite sisteme chimice cum ar fi coloizi. pentru a investiga celulele şi ţesuturile vii. lockin .placă semi-undă.oglindă dicroică.coupled device). Microscopia de fluorescenţă avansată Microscopia de fluorescenţă convenţională este folosită.numărător) Măsurătorile de fluorescenţă în timp real sunt foarte potrivite pentru investigarea proceselor intramoleculare fotoinduse (charge transfer. HW . PM . 174 . Un microscop de fluorescenţă convenţional diferă de un microscop standard prin faptul că este folosită o sursă de lumină (lampă cu mercur sau oxigen) ce emite şi în domeniu UV. cristale lichide. M . Set-up experimental pentru fluorescenţă în timp real (Mialocq and Gustavsson. în principal. De asemenea.) şi a proceselor intermoleculare (elctron transfer etc.). Profunzimea de câmp a unui microscop convenţional cu fluorescenţă este 2-3 µm. 2. mixturi polimerice. colorarea fibrelor etc. GG420 . fluorescenţa în timp real a fost folosită cu succes în studii ale proceselor biologice care au loc în prezenţa luminii (proteina galbenă fotoactivă.filtru.

Emisia de fluorescenţă este separată de lumina excitatoare cu ajutorul unei oglinzi dicroice şi este focalizată cu ajutorul lentilelor obiectivului pe fanta unui fotomultiplicator. Principiul microscopiei confocale (stânga) comparativ cu microscopia convenţională (dreapta). Figura 2. imaginea este neclară datorită defocalizării. este de preferat folosirea altor tehnici. fasciculul de lumină este focalizat pe probă. cum ar fi microscopia confocală (confocal microscopy) sau microscopia prin excitaţia cu doi fotoni (two-photon excitation microscopy). De asemenea. Emisia de fluorescentă produsă de proba situată în afara planului de focalizare nu va trece prin fanta multiplicatorului deoarece se va lovi de tubul ocularului (figura 2). În acest caz imaginea se poate îmbunătăţi cu ajutorul computerului. de obicei. deci prin deplasarea probei pe verticală se obţine imaginea tridimensională a acesteia.5 µm.În cazul în care proba este mai subţire decît valoarea profunzimii de câmp. prin folosirea microscopiei optice în câmp apropiat (near-field scanning optical microscopy (NSOM)) se poate lucra dincolo de limita de difracţie optică. folosind o lentilă cu apertură numerică mare.1. dar. Astfel. Deoarece în microscopia confocală de fluorescenţă se colectează numai 175 . Una din caracteristicile microscopiei confocale de fluorescenţă este faptul că se pot obţine imaginile unor straturi cu o grosime bine definită. grosimea secţiunilor confocale poate atinge limita teoretică de aproximativ 0. Microscopia confocală de fluorescenţă În cazul unui microscop confocal. 2.

Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) În spectroscopia de fluorescenţă convenţională. determinarea distribuţiei potenţialului electric. fluoroforul este excitat prin absorbţia unui foton a cărui energie corespunde cu diferenţa de energie dintre starea electronică fundamentală şi starea electronică excitată.o parte din fasciculul de fluorescenţă emis. În consecinţă. imagistica pH. imagistica Ca2+. etc. fenomen numit photobleaching. vor fi excitaţi numai fluoroforii situaţi într-o 176 . de asemenea. Dacă este folosit un singur laser. Secţiunea eficace a procesului de absorbţie a doi fotoni este foarte mică (10-50 cm4·s/foton·moleculă pentu rodamina B). cei doi fotoni absorbiţi sunt identici. 2. De asemenea. microscopia confocală de fluorescenţă a fost folosită în studii din domeniul coloizilor. iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy). Microscopia confocală de fluorescenţă poate fi combinată cu tehnicile domeniu-timp şi frecvenţă-timp (time-domain. Reducerea efectelor nedorite datorate fenomenului de photobleaching se face prin utilizarea de fluorofori stabili şi prin folosirea unui microscop confocal echipat cu detector cu sensibilitate mare şi obiectiv cu apertură numerică mare. posibilă prin absorbţia simultană a doi fotoni de energie mai mică (lungime de undă mai mare) prin intermediul unei stări virtuale cu timp de viaţă foarte scurt (Figura 3). Excitaţia fluoroforului este.2. absorbţia a doi fotoni din domeniul roşu poate excita o moleculă care absoarbe în domeniul UV. pentru a putea folosi unui fascicul excitator cu putere mai mică. iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu două culori (two-color excitation fluorescence microscopy). Dacă se folosesc două lasere. frequency-domain) pentru a se obţine imagini din perioada numită timp de viaţă al fluoroforului (lifetime imaging). atunci fotonii sunt diferiţi (1/λe = 1/λ1 + 1/λ2). Creşterea energiei fasciculului de excitare duce la descompunere fotochimică a fluoroforului. energia de excitare necesară trebuie să fie mai mare decât în microscopia de fluorescenţă convenţională. a cristalelor lichide şi a amestecurilor de polimeri.). absorbţia depinde de pătratul intensităţii luminii folosite la excitaţie. Excitaţia cu doi fotoni este un proces neliniar. Probabilitatea absorbţiei a doi fotoni depinde de coincidenţa temporală şi spaţială a fotonilor incidenţi (diferenţa dintre timpul în care cei doi fotoni ajung la fluorofor trebuie să fie sub 10-18 s). Microscopia confocală de fluorescenţă este o tehnică utilizată pe scară largă în biologia celulară (vizualizarea celulelor. De exemplu.

în cazul excitării cu doi fotoni avem următoarele avantaje: (i) deoarece fasciculul de excitare este concentrat atât în timp cât şi în spaţiu nu apare fenomenul de photobleaching în afara focarului şi (ii) fasciculul excitator nu este atenuat de abosorbţia din afara focarului. Excitarea cu doi fotoni permite obţinerea unei rezoluţii tridimensională deosebită în microscopia de fluorescenţă. Figura 3.) Deoarece intensitatea fasciculului de excitare variază cu pătratul distanţei de la planul focal. deci trebuie folosiţi laseri cu putere mare şi funcţionare în impulsuri.25 şi un fascicul de excitare având 780 nm. Deşi efectul secţionării 3-D este comparabil cu cel din microscopia confocală. nedorit. Comparaţie între excitaţia cu doi fotoni şi excitaţia cu un foton. ceea ce duce la creşterea adâncimii de penetrare a fasciculului excitator. în cazul excitarii cu două culori nu apare decât o creştere minimală a background-ului de fluorescenţă.regiune unde fluxul de fotoni este foarte mare. (Linia punctată reprezintă starea virtuală care mediază absorbţia a doi fotoni. acesta reprezintă o reducere a volumului de excitare de 1010 ori. 177 . Folosind un obiectiv cu o apertură numerică de 1. Deşi. peste 80% din intensitatea totală de fluorescenţă va fi emisă dintr-o zonă situată la 1 mm în jurul focarului.1-1 femptolitri. Deci. în ambele tipuri de excitari (cu doi fotoni sau cu două culori). fenomenul de difuzie duce la scăderea intensităţii fasciculului de fluorescenţă emis din focar. ceea ce duce la obţinerea unui contrast mai bun pentru obiecte de mici dimensiuni. Excitarea cu două culori se foloseşte atunci când se doreşte observarea unor obiecte microscopice situate în medii puternic difuzante. cum ar fi laserul cu Ti-safir. probabilitatea de absorbţie a doi fotoni în afara regiunii focale scade cu puterea a patra a distanţei. Volumul de excitaţie este de ordinul a 0. excitarea cu doi fotoni a fluoroforului poate avea loc doar în focar. Comparativ cu fluorometrele convenţionale.

Vârful este montat într-un cap piezo. Această tehnică are o rezoluţie spaţială foarte mare (de ordinal sub-micrometrilor) şi o sensibilitate foarte bună. Limita de rezoluţie este de aproximativ λ/2. Proba se află pe un suport piezo. unde λ este lungimea de undă a sursei de luminii. Această limită poate fi depăşită prin utilizarea unei surse de lumină cu lungime de undă mai mică şi prin plasarea probei foarte aproape de această sursă (în câmp apropiat). Radiaţia luminoasă incidentă trece printr-o fantă cu dimensiuni sub-lungime de undă.2. Majoritatea instrumentelor NSOM sunt construite în jurul unui microscop cu fluorescenţă inversat. Lumina din vârful NSOM ataşat fibrei optice excită proba. de tip NSOM (Figura 5). Figura 4.3. Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) Rezoluţia unui microcop convenţional este limitată datorită fenomenelor de interferenţă şi difracţie. Fasciculul laser trece printr-o fibră optică uni-modală la ataşată de un vârf special pentru determinările în câmp apropiat (vârf NSOM). care permite deplasarea pe verticală . Suprafaţa probei este poziţionată în imediata apropiere a fantei. montat sub suportul pe care se află proba şi detec178 . astfel încât fasciculul emergent este forţat să interacţioneze cu proba.axa Oz). H. Principiul scanării în câmp apropiat (conform ideii lui Synge) Ideea de optică în "câmp apropiat" este atribuită cercetătorului E. Synge (figura 4). care permite deplasarea ei în planul xy. care oferă avantajul de a furniza imagini normale şi permite ca regiunea de studiat să fie localizată cu rezoluţie mare. Fanta acţionează ca o sondă luminoasă de dimensiune sub-lungime de undă care poate fi folosită pentru a lumina suprafaţa probei înainte ca lumina să fie difractată. iar emisia de fluorescenţă este colectată de obiectivul cu apertură numerică mare.

etc. localizarea proteinelor.).tată printr-un filtru (pentru a elimina lumina reziduală de la laserul folosit pentru excitare) şi un detector. Instrument NSOM construit în jurul unui microscop de fluorescenta inversat .mod iluminare. forţele de forfecare atenueză amplitudinea vibraţiilor acestuia. cristale lichide. Sistemele care scanează piezo şi înregistrează imaginile sunt similare cu cele utilizate în microscopia de forţă atomică. proba este iluminată de la un câmp îndepărtat şi emisia de fluorescenţă este colectată de către un vârf NSOM. Această amplitudine poate fi monitorizată şi folosită pentru a genera un semnal de feedback cu ajutorul căruia se controlează distanţa dintre probă şi vârf în timpul scanării. Alternativ. 179 . Cu ajutorul tehnicii NSOM au fost investigate cu succes sisteme fotosintetice. cartografierea cromozomilor şi microstructura membranelor. Tehnica NSOM este remarcabilă pentru analiza filmelor subtiri. Microscopia de fluorescenţă prin scanare optică în câmp apropiat poate oferi noi perspective în studiul sistemelor biologice complexe din cauza rezoluţiei mai mari decât în microscopia confocală. în modul colectare. Acest mod este numit modul iluminare. Pentru a obţine imagini de înaltă rezoluţie este necesară poziţionarea precisă a vârfului NSOM (de ordinul nm) faţă de suprafaţa probei. (polimeri electroluminiscenţi. Figura 5. Acest lucru poate fi realizat cu ajutorul feedback-ului bazat în general pe metoda de forţă-forfecare: vârful este intercalat lateral la una dintre frecvenţele sale de rezonanţă cu o amplitudine de aproximativ 2-5 nm. Când vârful NSOM interacţionează cu câmpul de forţe Van der Waals a probei. a capacităţii de cartografiere a topografiei suprafeţei şi datorită faptului că fenomenul de photobleaching este redus.

este foarte importantă determinarea modificărilor conformaţionale pe care le suferă proteina în urma adsorbţiei la suprafaţa nanoparticulei. Albumina bovină (BSA) este utilizată ca proteină model în studiile biologice deoarece are o structură bine cunoscută şi posedă proprietăţi de fluorescenţă specifice. Albumina bovină (BSA) se găseşte în cantităţi mari în plasmă. 180 . datorită prezenţei celor două reziduuri de triptofan din structura ei. Cunoaşterea efectelor biologice ale nanoparticulelor de aur necesită determinarea legăturilor ce apar între nanoparticule şi proteinele cu care interacţionează. În unele cazuri interacţiunea dintre proteină şi suprafaţa nanoparticulelor de aur poate determina modificări de structură ce duc la alterarea proprietăţilor proteinei. folosită des în aplicaţii din domeniul bio-nanotehnologiilor. Soluţia de bioconjugate (nanoparticule de aur şi BSA) a fost pusă într-o cuvă de cuarţ având dimensiunea de 10 mm. ci determină biocompatibilizarea (funcţionalizarea) acestor nanoparticule pentru alte interacţiuni sau cuplaje cu mediul biologic. şi joacă un rol important în procesele fiziologice.3. cu formă aproximativ elipsoidală (4nm×4nm×14nm). Determinarea interacţiunii nanoparticule de aur dintre albumina bovină şi Iosin şi colaboratorii [4] au demonstrat interacţiunea directă dintre nanoparticulele de aur şi albumina bovină. ce le permite conjugarea uşoară cu diferite biomolecule. II şi III). Albumina bovina (Bovine Serum Albumin) este o proteină globulară.1. fiecare domeniu fiind format din şase elice. stabilizate de o reţea internă de 17 legături disulfide. Exemple de aplicaţii ale spectrofluorimetriei 3. Deoarece interacţiunea dintre proteine şi nanoparticulele de aur este foarte sensibilă la starea conformaţională a proteinei şi la chimia suprafeţei nanoparticulelor. Iosin şi colaboratorii [4] au înregistrat spectrele de fluorescenţă ale bioconjugatelor BSA-nanoparticule de aur cu ajutorul unui Spectrofluorimetru Jasco LP-6500 cuplat cu un dispozitiv pentru controlarea temperaturii (ADP-303T). cu ajutorul căruia temperatura poate fi modificată controlat de la −10 °C la +110 °C. Pe de altă parte conjugarea dintre proteină şi nanoparticulele de aur nu are ca efect doar stabilizarea sistemului proteină-nanoparticulă. Semnalul de fluorescenţă al albuminei (BSA) a fost obţinut la 337 nm prin excitarea reziduului de triptofan cu o radiaţie având lungimea de undă 280 nm. structura terţiară cuprinde trei domenii omoloage (I. Structura nativă a albuminei bovine (BSA) este caracterizată de un singur lanţ polipeptidic compus din 583 reziduri de aminoacizi. Nanoparticulele de aur (GNP) sunt sonde ideale pentru investigarea proceselor biologice datorită biocompatibilităţii lor.

Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii ale nanosferelor de aur: (a) 0. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. (d) 1. În realitate. Spectrele de fluorescenţă ale unor soluţii având diferite concentraţii de nanoparticule de aur şi albumină bovină (BSA) au fost monitorizare în domeniul 290-450 nm. carboxyl sau triptofan. Iosin şi colaboratorii [4]. Soluţia apoasă de BSA are o bandă puternică de fluorescenţă cu maximul situat la 336 nm. au monitorizat stingerea semnalului de fluorescenţă prin creşterea concentraţiei nanoparticulelor de aur de formă sferică. iar fluorescenţa tirosinei este aproape stinsă dacă este ionizată sau dacă este aproape de un grup amino. Măsurătorile de fluorescenţă au fost efectuate cu o radiaţie excitatoare de 280 nm. (e) 2.1×10-11 M. (c) 1. fluorescenţa intrinsecă a BSA-ului este dată în principal de reziduurile de triptofan. F – concentraţii intermediare. bandă ce este datorată emisiei reziduurilor de triptofan. lungime de undă ce este departe de banda plasmonică de rezonanţă a nanoparticulelor de aur. regiune ce coincide cu banda de emisie a triptofanului.55×10-11 M. de aceea studiul emisiei de fluorescenţă a acestuia este deosebit de utilă în determinarea modificărilor conformaţionale ale proteinei şi adsorbţia la nanoparticule.Din spectrele de fluorescenţă se pot obţine informaţii importante (constanta de legătură şi numărul ”siturilor” de legătură) referitoare la modul de legare a proteinelor de suprafaţa nanoparticulelor de aur. tirosina şi fenilalanina a căror emisie de fluorescenţă poate fi stinsă. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanosfere de aur. 181 . (b) 0. Triptofanul este deosebit de senzitiv la modificarea vecinătăţii locale. deoarece fenilalanina are un randament cuantic foarte mic. iar nanoparticulele de aur nu prezintă emisie de fluorescenţă. După cum se poate observa în figura 6.65×10-11 M. Pe langă efectul evident Figura 6.2×10-11 M. Albumina bovină (BSA) conţine trei cromofori: triptofan.

(b) 1. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. folosind metoda descrisă de Tedesco et al.12×10-14 M. Această comportare se datorează unui efect de saturaţie (când toate moleculele de BSA sunt legate de nanoparticulele de aur. (c) 2. pentru diferite concentraţii. în ambele cazuri. intensitatea emisiei de fluorescenţă rămâne constantă după atingerea unui nivel de concentratie a nanoparticulelor de aur. În figura 7 sunt prezentate spectrele de fluorescenţă ale complexului BSA-nanobastonaşe de aur. deplasare ce indică o modificare a polarităţii din jurul reziduului de triptofan. Din spectrele de fluorescenţă de mai sus autorii au determinat constanta de legătură (Kb) precum şi numărul siturilor de legătură dintre nanoparticulele de aur şi BSA. F – concentraţii intermediare.de stingere a fluorescenţei. Se observă că intensitatea benzii de fluorescenţă descreşte odată cu creşterea concentraţiei de nanobastonaşe de aur.06×10-14 M. (e) 4. În cazul complexului BSA-nanobastonaşe nu se observă nici o deplasare a maximului benzii de fluorescenţă odată cu modificarea concentraţiei. [6]: (F0 – Fsat)/(F – Fsat) = ([M]/Kdiss)n unde F0. (d) 3. adaugarea în continuare a nanoparticulelor nu duce la apariţia de noi legături BSA-nanoparticule).24×10-14 M. autorii au observant şi o deplasare spre roşu a maximului benzii de fluorescenţă cu 4 nm (de la 336 nm la 340 nm). Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii de nanobastonaşe de aur: (a) 0. Figura 7. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanobastonaşe de aur.18×10-14 M. Fsat şi F sunt intensităţile de fluorescenţă datorate reziduurilor de triptofan din BSA: 182 .

[M] este concentraţia particulelor (în moli).5 × 105 n 1. iar nanosferele au sarcină electrică negativă. În concluzie.Fsat)] în funcţie de log([M]).34 × 1011 0. 183 .F)/ (F . Fsat este intensitatea de fluorescenţă a soluţiei de BSA saturată cu nanoparticule de aur. Din panta graficului au calculat numărul siturilor de legătură ‘‘n”. Valorile astfel calculate se găsesc în tabelul 1. n reprezintă numărul ”siturilor” de legătură dintre nanoparticulele de aur şi BSA Kdiss este valoarea reciprocă a constantei de legătură Kb.F)/(F . iar din valoarea lui log[M] pentru care log[(F0 . Tabelul 1. folosind efectul de stingere a emisiei de fluorescenţă a triptofanului din BSA.F0 este intensitatea de fluorescenţă a soluţiei apoase de BSA pur. e reprezintă coeficientul de extincţie molară Pentru a calcula parametrii ‘‘n” şi ‘‘Kb” autorii au reprezentat grafic log[(F0 . F este F intensitatea de fluorescenţă a soluţiilor de BSA având concentraţii intermediare. Constanta de legătură (Kb) şi numărul siturilor de legatură (n) pentru complexul BSA-nanoparticule de aur. indus de suprafaţa metalică a nanoparticulei comjugată. nanosfere de aur nanobastonaşe de aur Kb 2. În plus nanobastonaşele sunt stabilizate cu citrat de sodiu pe când nanosferele sunt stabilizate cu CTAB. Concentraţia nanoparticulelor de aur a fost estimată cu ajutorul relaţiei A = [M]dε unde: A este absorbanţa soluţiei.Fsat)] = 0 au obţinut constanta de disociere (Kdiss).38 Valoarea mai mare a constantei de legatură în cazul nanosferelor este datorată faptului că cele două tipuri de nanoparticule au sarcinii electrice şi o chimie a suprafeţei diferite: nanobastonaşele au sarcină electrică pozitivă. d este grosimea cuvei folosită pentru înregistrarea spectrelor.37 0. interacţiunea locală dintre nanoparticulele de aur şi albumina bovină a fost investigată cu ajutorul spectroscopiei de fluorescenţă. [M] reprezintă concentraţia nanoparticulelor de aur.

poate fi folosită pentru a obţine informaţii legate de modificările coinformaţionale ale proteinelor induse de interacţiunea cu nanoparticulele de aur la diferite valori ale pH-ului şi la diferite temperaturi. Nanoparticulele de aur folosite sunt încărcate negativ la suprafaţă datorită faptului că sunt acoperite cu citrat pentru a prevenii agregarea lor. după cum am mai amintit. Iosin şi colaboratorii [5] au monitorizat mecanismul de interactiune între albumina bovină (BSA) şi nanoparticulele de aur cu ajutorul spectroscopiei de fluorescenţă. Structura albuminei bovine este puternic dependentă de pH şi temperatură.2. grupărilor de triptofan ce sunt localizate pe suprafaţa proteinei (în domeniul I: Trp-134. unde pI reprezintă punctul izoelectric [6]. fiecare stare conformaţională având formă şi dimensiune proprie. fiind pozitivă pentru pH< pI. în soluţie. a diabetului şi a afecţiunilor cardiovasculare. neutră pentru pH= pI şi negativă pentru pH> pI. în principal printr-un mecanism static (constanta de legatură Kb este dependentă de valoarea pH-ului). Aceste modificări ale structurii proteinelor pot duce la apariţia cancerului.3. atracţia sau respingerea nanoparticulelor de aur.7 [7]. datorită senzitivităţii mari. spectrul de fluorescenţă al soluţiei pure de BSA (pH = 6. iar spectrele de fluorescenţă ale soluţiilor de BSA cu valori ale pH-ului 2 (spectrul a). Modificări conformaţionale ale proteinelor pot fi induse de variaţii ale temperaturii şi ale pH-ului. Valoarea pH-ului afectează atât structura albuminei bovine cât şi sarcina grupării funcţionale a proteinei. Spectrele înregistrate sugerează faptul că nanoparticulele de aur inhibă emisia de fluorescenţă a reziduurilor de triptofan din BSA. Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur. 336 nm respectiv 339 nm. După cum se observă în figura 8. grupare expusă mai puternic influenţei vecinătăţii hidrofilice) şi în interiorul proteinei (în domeniul II: Trp-213. grupare aflată într-o poziţie hidrofobică). determinând. Deplasarea maximul benzii de emisie indică faptul că modificarea pH-ului soluţiei duce la obţinerea de stări con184 . Proprietăţile fluorescente ale albuminei bovine (BSA) sunt datorate. M. Sarcina netă a albuminei bovine este puternic dependentă de pH-ul soluţiei. În cazul albuminei bovine. în consecinţă. punctul izoelectric este 4. Spectroscopia de fluorescenţă. spectrul c) are maximul benzii de emisie la 337 nm. în urma modificărilor de temperatură şi pH. având o influenţă majoră asupra interfeţei dintre nanoparticule şi substanţele biologice. 5 (spectrul b) şi 9 (spectrul d) au maximul benzii de emisie la 324 nm.

Din spectrele de fluorescenţă. Figura 8.75×10−11 M). Spectrele de fluorescenţă înregistrate (figura 9) demonstrează scăderea drastică a emisiei de fluorescenţă (quenching) a triptofanului din albumina bovină la pH = 2 odată cu creşterea concentraţiei nanoparticulelor de aur (de la 0. Pentru a obţine informaţii legate de emisia de fluorescenţă a triptofanului din albumina bovină la diferite valori ale pH-ului în prezenţa nanoparticulelor de aur. Spectre de fluorescenţă ale albuminei bovine la pH 2 (a). 185 . în comparaţie cu emisia albuminei bovine de tipul ‘N-form’. iar deplasarea maximului benzii de emisie spre lungimi de undă mari ne indică faptul că triptofanul este mai expus solventului. Astfel.formaţionale diferite ale albuminei. în timp ce la pH = 2 şi pH = 9 albumina bovină are formă extinsă (‘E-form’) respectiv bazică (‘B. pH 6 (c) şi pH 9 (d).55×10−11 M la 2. Deplasarea maximului benzii de emisie spre lungimi de undă mai mici indică faptul că triptofanul din albumina bovină are o vecinătate mai hidrofobică (se modifică structura terţiară). pH 5 (b). autorii au calculat constanta de stingere a fluorescenţei (KSV) folosind ecuaţia Stern–Volmer: F0/F = 1 + Kqτ0[GNPs] = 1 + KSV[GNPs] unde: F0 şi F sunt intensităţile relative de flkuorescenţă ale triptofanului în absenţa şi în prezenţa nanoparticulelor de aur. Emisia de fluorescenţă a albuminei bovine de tipul ‘E-form’ are maximul deplasat spre albastru. Iosin şi colaboratorii [5] au folosit o concentraţie fixă de BSA titrată în cantităţi diferite de soluţie de nanoparticule de aur.form’). la pH neutru albumina bovină are o formă nativă (‘N-form’). datorită creşterii separaţiei inter-domeniu şi schimbării configuraţiei proteinei astfel încât gruparea triptofan are o vecinătate mai hidrofobică.

22×1018 M−1 s−1 pentru bioconjugatele BSA– GNPs la pH = 2. Astfel. respectiv Kq = 0. Figura 9. Deci. constanta de stingere bimoleculară Kq a fost calculată. (c) 1. [GNPs] reprezintă concentraţia nanoparticulelor de aur. În urma calculelor s-au obţinut următoarele valori pentru numărul siturilor de legătură (n): 1. Prin fitare liniară s-a obţinut KSV = 1.32×1018 M−1 s−1 la pH = 9. Kq = 0.77 la pH 2.1×10−11 M. τ0 = 5×10−9 s este timpul de viaţă mediu al albuminei bovine în absenţa nanoparticulelor de aur. (b) 0. precum şi numărul siturilor de legătură (n) dintre nanoparticule şi BSA conform relaţiilor din pargraful anterior. (d) 1.97 la 186 . KSV este constanta de stingere Stern–Volmer. Iosin şi colaboratorii [5] au determinat constanta de legătură la echilibru Kb (indică echilibrul dintre speciile adsorbante şi cele resorbante).34×1018 M−1 s−1 la pH = 6.2×10−11 M şi (f) 2.65×10−11 M.11×109 M−1. 1. obţinându-se valorile KSV = 1. ce indică senzitivitatea fluoroforului la molecula ce determină stingerea fluorescenţei (quencher).55×10−11 M. În mod similar au fost calculate constantele de stingere Stern–Volmer pentru pH = 6 şi pH = 9. Valoarea obţinută pentru constanta de stingere bimoleculară Kq este mai mare decât valoarea obţinută (2. (e) 2. Spectre de fluorescenţă ale grupării triptofan din BSA la pH = 2 pentru diferite concentraţii ale nanoparticulelor de aur: (a) 0. obţinându-se valorile: Kq = 0.75×10−11 M.Kq este constanta de stingere bimoleculară.6×109 M−1 pentru pH = 9. în cazul bioconjugatelor BSA–GNPs stingerea emisiei de fluorescenţă nu este iniţiată de ciocniri dinamice ci de formarea unui complex nefluorescent în urma unui mecanism de stingere static. Graficul inserat reprezintă curba Stern–Volmer.7×109 M−1 pentru pH = 6 şi KSV = 1.0×1010 M−1 s−1) în cazul stingerii emisiei de fluorescenţă a macromoleculelor biologice datorită mecanismului de ciocnire.

Ca urmare a acestui fapt. au fost monitorizate modificările emisiei de fluorescenţă a triptofanului din BSA pentru temperaturi cuprinse între 22 ºC şi 85 ºC (domeniu în care apare o modificare importantă a structurii terţiare a albuminei).82×109 M−1. ajungând până la 330 nm (figura 10). Odată cu creşterea temperaturii. În acest scop. deci determinarea condiţiilor în care are loc acest proces este foarte importantă pentru înţelegerea stabilităţii proteinelor. autorii au studiat formarea bioconjugatelor la pH = 5. De menţionat că valorile mai mari ale constantei de legătură indică o atracţie mai puternică între cele două specii.85 şi Kb = 2. maximul benzii de fluorescenţă datorată triptofanului se deplasează spre numere de undă mai mici. Numărul siturilor de legătură şi constanta de legătură pentru pH = 5 este: n = 1.76 la pH 9. deci creşterea temperaturii duce la apariţia de modificări structurale ale proteinei. respectiv pentru constanta de legătură Kb: 2. soluţia apoasă pură de BSA are o emisie de fluorescenţă puternică.3. iar cealaltă la 65 ºC. De fapt. Pentru a mima o vecinătate biologică reală.6×109 M−1 la pH 2. La temperatura camerei.03×109 M−1 la pH 9. prima temperatură de tranziţie apărând în 187 . După cum observă şi autorii.pH 6 şi 1. Iosin şi colaboratorii [5] au studiat modificările structurale ce apar în cazul denaturării termice a albuminei bovine. valori ce indică faptul că adsorbţia maximă a moleculelor de albumină la suprafaţa nanoparticulelor de aur apare pentru o valoare a pH-ului apropiată de punctul izoelectric (pI) al BSA-ului. înainte şi după absorbţia la suprafaţa nanoparticulelor de aur. analizând emisia de fluorescenţă a triptofanuluui din BSA.81×109 M−1 la pH 6 şi 2. prin creşterea temperaturii forma nativă a proteinei devine mai flexibilă.74×109 M−1 şi Kq = 0. Constanta de stingere Stern–Volmer şi constanta de stingere bimoleculară obţinute pentru această valoare a pH-ului sunt: KSV = 1. 1. sau regiunile hidrofobice devin predispuse la interacţiuni intermoleculare noi. cerntrată la 337 nm. Platoul curbei de denaturare indică faptul că albumina îşi menţine starea nativă pînă la aproximativ 42 ºC. curba de denaturare a albuminei bovine pure sugerează existenţa a două temperaturi de tranziţie: una la 43 ºC. 3. Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului Denaturarea termică a proteinelor este un proces intrinsec. La aceste temperaturi apare o modificare a vecinătăţii triptofanului din albumină.348×1018 M−1 s−1. Graficul inserat (denaturation curve) indică o relaţie neliniară între deplasarea maximului benzii de absorbţie şi temperatură. grupările –SH libere.

în mediu acid (pH mic) proteina este mai stabilă termic. la pH 6. s-a determinat faptul că procesul de denaturare termică a albuminei bovine este ireversibil. temperatura de tranziţie la care începe denaturarea termică este mai mare (46 °C) decât în mediu neutru. Prin măsurarea emisiei de fluorescenţă a triptofanului din albumină în procesul de răcire. Autorii au studiat efectul combinat al pH-ului şi al temperaturii înainte şi după conjugarea albuminei bovine cu nanoparticulele de aur. O dată cu creşterea temperaturii. pe lângă denaturarea proteinei. apare şi scăderea în intensitate a emisiei de fluorescenţă a triptofanului. în mediu alcalin (pH mare) temperatura de tranziţie este mult mai scăzută (32 °C) decât în mediu neutru (pH = 6) ceea ce indică o denaturare termică mult mai rapidă în mediu bazic. După cum se observă în figu188 . În mod contrar.jurul pragului maxim admis al febrei ce apare în condiţii de boală (42 ºC). Astfel. deplasare ce sugerează tranziţia albuminei de la starea nativă (compactă) la o stare cu o structură mai deschisă. valoare la care apare un al doilea platou în curba de denaturare.la creşterea şi descreşterea temperaturii). Inserat: curba de denaturare termică (variaţia maximului benzii de fluorescenţă în funcţie de temperatură . Denaturarea completă a proteinei se face după 65 ºC. În urma măsurătorilor efectuate s-a observat o dependenţă accentuată de valoarea pH-ului a temperaturii de tranziţie la care proteina îşi modifică conformaţia. creşterea temperaturii de la 22 ºC la 85 ºC determină descreşterea cu 72% a emisiei de fluorescenţă.9). Între 43 ºC şi 65 ºC se observă o deplasare spre albastru a maximului emisiei de fluorescenţă a albuminei bovine. Dependenţa de temperatură a emisiei de fluorescenţă a grupărilor de triptofan din albumina bovină. Figura 10. datorită expunerii triptofanului la moleculele de solvent. prin compararea denaturării termice (între 22 ºC şi 85 ºC) a proteinei în soluţie pentru diferite valori ale pH-ului (2 . Astfel.

ra 11. spre numere de undă mari. prezenţa nanoparticulelor de aur îmbunătăţeşte stabilitatea termică a proteinei. modifică forma curbei de denaturare. prezenţa nanoparticulelor induce o deplasare. 189 . rezultând creşterea temperaturii de tranziţie indiferent de valoarea pH-ului. Deci. De exemplu. După cum se observă şi din figura 11. bioconjugarea albuminei bovine cu nanoparticule de aur. Pentru a investiga efectul temperaturii asupra fenomenului de stingere a fluorescenţei albuminei bovine de către nanoparticulele de aur a fost calculată constanta de stingere KSV pentru diferite temperaturi. în funcţie de temperatură pentru diferite valori ale pH-ului. Figura 11. a emisiei de fluorescenţă. pentru pH = 6 temperatura de tranziţie creşte de la 42 °C la 47 °C. respectiv din bioconjugatul BSA-nanoparticule. deci modifică comportarea termică a proteinei. Figura 12. Variaţia maximului emisiei de fluorescenţă a triptofanului din BSA. Curbele Stern–Volmer pentru stin gerea fluorescenţei BSA-ului de către nanoparticule de aur (pH = 6). Inserat: dependenţa constantei de stingere Stern–Volmer de temperatură.

Tabelul 2. Struct.coeficientul de corelaţie) pH 6 T (K) 295 318 338 295 318 338 KSV (L/mol) 1.59 55. Astilean. “Molecular Fluorescence: Principles and Applications”. 395-401. Ed. J. E.-C. Baldeck. E.R. Fluorescence Spectroscopy: New Trends în Fluorescence Spectroscopy.32 51. 4. Alexov. J.70x109 1. J.11x109 6. F. confirmă faptul că mecanismul de stingere a fluorescenţei triptofanului din albumina bovină de către nanoparticulele de aur este iniţiat de formarea unui complex ne-fluorescent prin adiţia moleculelor de albumină bovină la nanoparticulele de aur. 5. 190 .11 10. M.9975 ΔH(kJ/mol) ΔS(J/mol K) ΔG(kJ/mol) -48. 338.0700 R 0.0651 0. (2006). Toderas.87 53.A. Tsuchida.9988 0.70 -64. Springer. Astilean. Mialocq and T.G.35 -54. V. 3 (2003) 1–9.96 81. Study of protein-gold nanoparticle conjugates by fluorescence and surface-enhanced Raman scattering. J. Constanta de stingere KSV şi parametrii termodinamici pentru complexul BSA-nanoparticule de aur. S. 217. R . Canpean. 83 (2002) 1731–1748.88x109 5.41x109 9. Valeur.0683 0. Bernard Valeur. 358 K) ne indică faptul că constanta de stingere KSV scade odată cu creşterea temperaturii (figura 12). M. Spectroscopic studies on pH. Mol.22 2 Proporţionalitatea inversă dintre constanta de stingere KSV şi temperatură (tabelul 2). M. Iosin.60x109 1. T.9982 0. Komatsu.0601 0. Biophys. la pH 6 pentru diferite temperaturi (295. Gustavsson. “Principles of Fluorescence Spectroscopy”. Berlin (2001).05x109 SD 0.9983 0. P. (2011).0782 0. Zunszain. (2002). Journal of Photochemistry and Photobiology A: Chemistry. Ed. 3. P. Springer Verlag. 6.79 132. Joseph Lakowicz. Eds B.29 -28. R. 7. Combining conformational flexibility and continuum electrostatics for calculating pKas în proteins.E. Investigation of femtosecond chemical reactivity by means of fluorescence up-conversion. 924–926 (2009) 196–200. Gunner. Crystal structural analysis of human serum albumin complexed with hemin and fatty acid. Curry. Wiley-VCH.-C. Georgescu. S.deviaţia standard pentru valorile coeficientului KSV.and thermally induced conformational changes of Bovine Serum Albumin adsorbed onto gold nanoparticles.9980 0.0721 0. Iosin. S. Brochon. Ghuman.Graficul Stern-Volmer ce caracterizează stingerea emisie de fluorescenţă a triptofanului din albumina bovină de către nanoparticulele de aur. (SD . 2. Bibliografie 1. 4. J. 318.9994 0. Biol. BMC Struct.

..........VI.. asociate speciei nucleare i...... SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) C............. Principalele proprietăţi ale câtorva nuclee active RMN..........I. şi (ii) polarizările spinilor................................ are două efecte majore: (i) axa polarizării de spin efectuează o mişcare de precesie cu frecventa Larmor.γiB0.... Bibliografie ............. Mihaela Aluaş Cuprins 1.... dr......... sunt prezentate în tabelul de mai jos: 191 .. ω0........... 191 2... se vor reorienta sub acţiunea câmpurilor magnetice locale fluctuante uşor datorită mişcării termice... Claudiu Filip C..........S............ cu relevanţă în special pentru sisteme moleculare organice...........S................ în jurul direcţiei câmpului magnetic static (direcţia z).....i = .. 196 3........... unde S este numărul cuantic de spin......... proba va fi caracterizată de o magnetizare macroscopică orientată de-a lungul direcţiei câmpului magnetic extern........ Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice .. distribuite izotrop în momentul aplicării lui B0.......III.... Plasarea probei care conţine momente magnetice nucleare într-un camp magnetic extern intens........ T1. dr.... Infrastructura existentă la UBB Cluj pentru exprimente RMN-S ........ astfel încât după o perioadă de ordinul aşa numitului timp de relaxare longitudinal............. B0 ~ 7-23 T (generat cu ajutorul unei bobine supraconductoare)....... iar γ i reprezintă factorul giromagnetic............ 202 4......... Principiul metodei.... 215 1........... Principiul metodei Generarea semnalului RMN Spectroscopia RMN se bazează pe fenomenul de rezonanţă magnetică aplicat asupra momentelor magnetice nucleare μi = γiS.............

astfel încât rotirea magnetizării în plan transversal (ω1.6 0. Acest lucru se realizează prin aplicarea unui câmp magnetic oscilant cu frecvenţa ωrf. Deşi în practică B1 << B0.8 4. Pentru valori tipice ale lui B1 utilizate în spectroscopia RMN-S.9 90 Deoarece magnetizarea longitudinală nu poate genera un semnal RMN. rf) va determina o mişcare de precesie cu frecvenţa ω1.7 T 500 76. sau este apropiată de aceasta: în literatura RMN această precesie este deseori denumită nutaţie. xy.7 1. şi amplitudinea B1.02 1.5 125 35. ωrf = ω0.98 0. perpendicular pe câmpul magnetic extern: el este generat de curentul aplicat asupra unei bobine de transmisie în interiorul căreia este plasată proba.i [MHz] B0 = 11. frecvenţa de nutatie ν1. câmpul oscilant (numit şi câmp de radiofrecvenţă.i = γiB1 a polarizării spinilor i în jurul direcţiei lui B1 dacă ωrf satisface condiţia de rezonanţă.i.37 ν0.7 Abundenţa naturală [%] 99.i tp = π/2) necesită aplicarea câmpului rf pe durata tp de ordinul câtorva µs. adică sub forma unui puls.i /2π este de ordinul zecilor de kHz.1 99. i 1H 2H 13C 14N 15N γ iγ S 1/2 1 1/2 1 1/2 [ 107 rad s-1T-1] 26.7 225 63. După încetarea acţiunii pulsului rf magnetizarea Figura 1 192 .Specia nucleară.i = ω1. este necesară mai întâi rotirea polarizării de spin în planul transversal.1 6.5 50 B0 = 21 T 900 137.9 -2.

ΔΩi << ω0. 1. 2 în cazul nucleelor 13C: 193 . adică înregistrarea de spectre RMN distincte pentru fiecare specie nucleară în parte. corespunzător modului de detecţie în cuadratură. 1 se obţine un spectru RMN 1D (unidimensional) ale cărui proprietăţi (poziţii. ştiinţa materialelor. Descrierea de mai sus se referă la aşa-numitul experiment RMN de “un puls”. să existe o fereastră spectrală de lărgime limitată. Detecţia semnalului RMN Aplicând transformata Fourier asupra FID-ului se obţine reprezentarea acestuia în domeniul de frecvenţă.i). pe durata căruia se produce defazarea polarizării transversale.i. în jurul lui ω0. etc. şi constituie astfel baza multiplelor aplicaţii ale spectroscopiei RMN în (bio)chimie. şi deci implicit la apariţia mai multor linii în spectrul RMN 1D. de exemplu deplasările (faţă de ω0. sau FID (free-induction decay).i. cât şi cel în domeniul de frecvenţă. Parametrii spectrali. Frecvenţele asociate interacţiunilor de spin interne sunt mult mai mici decât frecvenţele Larmor. precum este cel ilustrat în Fig. ω0. numit timp de achiziţie. Atât semnalul în domeniul temporal. şi este ilustrat schematic în Fig. După o perioadă de aproximativ t0 ~ 5T1 polarizarea de spin se reconstruieşte de-a lungul direcţiei z şi experimentul poate fi repetat. B0. adică spectrul RMN. În realitate. astfel încât amplitudinea lui se apropie de zero. Cu ajutorul experimentului din Fig. prezenţa aşa-numitor interacţiuni de spin interne conduce la valori ale câmpului magnetic local la poziţiile diferitor spini i uşor diferite de B0. conţin o parte reală şi una imaginară. iar conţinutul lui de informaţii ar fi extrem de sărac. FID-ul este înregistrat în intervalul de timp t2. spectrul asociat speciei nucleare i ar conţine o singură linie la poziţia frecvenţei Larmor asociate.i care conţine întregul spectru RMN-1D al speciei nucleare respective. Considerând doar interacţiunea cu câmpul static extern. forme şi intensităţi de linie) depind în mod esenţial de interacţiunile la care sunt supuşi spinii nucleari pe durata t2. Această mişcare induce un curent electric oscilant pe bobina de detecţie (aceeaşi cu bobina de transmisie) ce poartă numele de semnal RMN. ceea ce face ca pentru fiecare specie nucleară i. soluţia practică utilizată în spectroscopia RMN modernă corespunde aşa-numitului mod de lucru pe canale rf distincte.transversală va precesa liber în jurul lui B0. despicările şi/sau lărgirile liniilor individuale sunt în directă conexiune cu elemente de structură chimică/spaţială bine determinate. În acest context.

şi heteronucleara). 194 . au fost dezvoltate o serie de tehnici speciale numite de decuplare: ele acţionează în sensul atenuării efectului produs de anizotropia interacţiunilor de spin şi conduc la spectre RMN-S de înaltă rezoluţie. 2 sunt determinate de valorile izotrope ale ecranării chimice. Deplasările chimice reflectă deplasările frecvenţei de precesie la diferite poziţii ale nucleelor 13C în sistemul molecular investigat faţă de valoarea ω0. şi interacţiunea scalară (cuplajul J). prin identificarea grupărilor chimice distincte din moleculă în funcţie de regiunea spectrală specifică în care se plasează liniile RMN. În consecinţă. interacţiunea de ecranare chimică. De exemplu. sunt interacţiunea dipolară (homo.C ca urmare a diferenţelor în intensitatea câmpului magnetic local indus de distribuţia electronică din vecinătate. poziţiile liniilor în spectrul 13C din Fig. În acest mod. Ele produc în general spectre cu linii foarte largi caracterizate prin suprapuneri severe ce fac imposibilă extragerea de informaţii utile. şi sunt prin urmare reprezentative pentru gruparea chimică din care nuceele respective fac parte. cu linii suficient de înguste încât să permită identificarea componentelor izotrope ale acestora. spectre RMN 1D precum cel ilustrat în Fig. Primele două sunt dominante în cazul nucleelor cu spin ½ (având constante de cuplaj de la câţiva kHz până la aproximativ 100 kHz) şi au un caracter anizotrop. aşa-numitele deplasări chimice.Figura 2 Interacţiunile de spin cu relevanţă în aplicaţiile spectroscopiei RMN-S pe probe organice. 2 sunt utile pentru determinarea structurii chimice.

• Fiecare specie nucleară distinctă este caracterizată de o aşa-numită fereastră spectrală de lărgime limitată în interiorul căreia se plasează toate liniile RMN posibile: de exemplu lărgimile tipice ale acestei 195 .i. Cel de-al doilea mod este de obicei preferat pentru că poziţiile liniilor într-un compus dat vor fi aceleaşi indiferent de valoarea câmpului magnetic . • Poziţiile liniilor într-un spectru RMN sunt date fie în unităţi absolute de frecvenţă (Hz). Aceasta din urmă este dată în principal de cantitatea de probă. Δωi = ωrf . menite să asigure legătura între baza conceptual-teoretică prezentată mai sus şi elementele concrete cu caracter aplicativ. abundenţa izotopică şi numărul de poziţii chimice distincte în sistemul studiat. care reprezintă unghiul φ pe care îl face B1 faţă de axa Ox. ca şi deplasare faţă de o linie de referinţă caracteristică fiecărei specii nucleare. (ii) faza pulsului. câmpul magnetic static. Valoarea optimă a lui N (denumit număr de scanuri în terminologia de specialitate) depinde pentru fiecare specie nucleară de sensibilitatea asociată. π. factorul giromagnetic. şi (iii) frecvenţa de offset.Noţiunile introductive vor fi completate în final cu câteva precizări utile. cu un timp de repetiţie determinat de valoarea lui t0 (conform Fig. privind implementarea lor concretă în practica curentă: • Un spectrometru RMN este caracterizat în mod tradiţional prin valoarea frecvenţei Larmor a spinilor 1H în câmpul magnetic al acestuia (de exemplu un spectrometru cu un criomagnet care produce un câmp B0 = 11. în timp ce pentru un spectru 1H de calitate este suficientă înregistrarea unui singur scan. în cazul în care ωrf nu este exact în rezonanţă cu frecvenţa de precesie Larmor a speciei nucleare i. • Un puls rf se caracterizează prin trei parametri distincţi: (i) unghiul α de rotire a magnetizării faţă de direcţia z – aşa-numitul unghi de tilt (de exemplu α = π/2. care vor fi adunate pentru a genera semnalul RMN final. spectrul RMN-S 13C a unui compus în faza policristalină cu izotopul 13C în abundenţă naturală şi cu un număr de până la 10 poziţii chimice distincte a carbonilor din moleculă necesită acumularea unui număr de ordinul miilor de scanuri pentru a obţine un raport semnal/zgomot acceptabil (> 30). etc.). fie în unităţi relative numite părţi pe milion (ppm) care reprezintă raportul dintre această deplasare faţă de frecvenţa de referinţă şi frecvenţa Larmor a speciei respective.7 T va fi denumit spectrometru de 500 MHz) • Pentru a obţine un spectru RMN de calitate (cu raport semnal/zgomot cât mai mic) este în general nevoie de înregistrarea unui număr N de FID-uri. Pentru exemplificare.ω0. 1).

2. Exemplul prezentat în Fig. De-a lungul timpului a fost dezvoltată o diversitate foarte mare de tehnici RMN complexe care presupun aplicarea de secvenţe multi-puls extrem de sofisticate. Magnetul acestora este autoecranat.• • ferestre spectrale sunt de aproximativ 20 ppm (pentru 1H). achiziţionate în anii 2002 şi 2009. 1) se realizează în mod discret (digital) cu un timp de eşantionare numit dwell time.1 Tesla cu frecvenţa de rezonanţă pentru nucleii de hidrogen de 400 MHz şi 600MHz. În consecinţă. şi 500 ppm (pentru 15N). precum şi la implementarea lor experimentală. Spectrometrul Bruker DRX 400 din dotarea CNRM 196 . 1 prezintă cel mai simplu experiment posibil în spectroscopia RMN.4 Tesla. 300 ppm (pentru 13C). această tehnologie fiind introdusă chiar de firma Bruker în 1996. respectiv 14. Achiziţionarea directă a semnalului RMN (pe durata lui t2 în Fig. iar câmpul generat de acesta este de 9. Referinţe detaliate cu privire la fundamentarea teoretică a acestor tehnici moderne. Infrastructura existentă la UBB Cluj pentru experimente RMN-S Descrierea componentelor hardware Laboratoarele Centrului Naţional de Rezonanţă Magnetică (CNRM) sunt dotate cu două spectrometre Bruker. transformarea Fourier se va aplica asupra acestui semnal digitizat. şi permit extragerea selectivă a informaţiilor dorite. pot fi găsite în literatura de specialitate. şi se realizează utilizând aşa-numitul algoritm FFT (fast Fourier transform). simultan pe mai multe canale rf.

69Ga etc. Ambele sisteme pot analiza atât probe în stare condensată cât şi probe în stare lichidă. iar rotirea mecanică a probei se poate face la o frecvenţă de rotatie de până la 35 kHz. 27Al. Magnetul spectrometrului Bruker DRX 600 din dotarea CNRM Unitatea MAS folosită pentru controlul automat sau manual al rotirii probelor solide la unghiul magic 197 . Pot fi efectuate măsurători spectroscopice de rezonanţă magnetică nucleară pe o gamă foarte largă de nuclee: 1H. 15N. 13C. 57Fe. Pentru studiul probelor solide există în dotare mai multe capete de sondă care permit efectuarea experimentelor la temperaturi între -80 °C şi 200 °C.Spectrometrele Bruker DRX 400 şi Bruker DRX 600 sunt complet digitale iar controlul acestora se face în totalitate prin intermediul unui calculator de tip PC.

şi respectiv TopSpin. Se mai poate observa şi conexiunea cablului care serveşte la detectarea. iar programul TopSpin comandă spectrometrul Bruker DRX 600. În cazul spectrometrelor Bruker. primul este instalat pe spectrometrul Bruker DRX 400. Corespunzător echipamentelor existente la UBB Cluj. Descrierea componentelor software Pentru comanda modulelor electronice ale unui spectrometru RMN există pachete software specializate prin intermediul cărora elementele distincte ale unui experiment RMN sunt transpuse în comenzi specifice. În imaginea de mai sus se poate observa rotorul şi instrumentaţia specifică. începând cu generaţia de spectrometre Avance III. Se pot observa conectările acestui cap de probă la surse de aer necesar atât pentru rotirea probei la unghiul magic cât şi pentru controlul temperatuii probei. soft-ul de comandă se numeşte XWin NMR (până la generaţia Avance II). Cele două versiuni ale soft-ului de comandă Bruker diferă prin interfaţa grafică şi prin numărul 198 . necesară introducerii şi tasării substanţei de măsurat precum şi scoaterii acesteia din rotor. prin intermediul fibrei optice. a vitezei de rotaţie a probei.Capul de probă folosit pentru măsurătorile pe probe solide introdus în câmpul magnetic static.

iar în reprezentarea modelului vectorial. comune ambelor programe: • Comanda unui experiment RMN se realizează prin intermediul aşa numitului program de pulsuri (pulse program) care specifică acţiunile aplicate în cadrul experimentului. 2 şi 3. n = 0 . În mod similar se procedează şi în cazul în care se calibrează un puls cu orice altă valoare a unghiului de tilt. după care se ajustează puterea la ieşire a transmiţătorului astfel încât curentul transmis pe bobină să producă o intensitate B1 a câmpului rf care să corespundă unui puls de 900 (în cazul exemplificat. incluzând cazul general în care acestea nu sunt multipli de 900. respectiv: pulsuri rf. ν1 trebuie să fie 100 kHz. x. 90. durata fiecăruia dintre acestea şi. α.sporit de scripturi pentru calibrarea parametrilor experimentali existente în TopSpin dar. cu faza ph1. de exemplu la 2. Ea specifică durata acestuia. De aceea. ele sunt echivalente la nivel conceptual. precum şi faptul caă este aplicat pe canalul f1. 1).. 31 – indicele asociat). necesar în experimentul considerat. o serie de proprietăţi specifice • Primul tip de acţiuni corespunde elementelor standard ale unui experiment RMN (precum cel ilustrat în Fig.. prin intermediul unor variabile care poartă acelaşi nume. în funcţie de tipul acţiunii.. 31 – indicele asociat). Pentru o privire completă a modului de lucru cu fazele. y. • Sensibilitatea spectrală maximă se obţine pentru o valoare α = 900 a unghiului de tilt pentru pulsul p1 (asa-numitul puls de 900). 199 .. reprezintă fazele 0. în continuare vom face o foarte scurtă prezentare axată pe evidenţierea principiior fundamentale. n = 0 . Faza ph1 este în schimb explicitată la sfârşitul programului de pulsuri (valorile corespund convenţiei Bruker în care 0. perioade de evoluţie liberă şi perioada de achiziţie directă. Ele au asociate următoarele comenzi specifice în programul de pulsuri: pn (p – puls. conform relaţiei 2πν1tp = π/2). calibrarea acestui puls se realizează prin fixarea duratei lui p1. -x şi –y). 1). Valorile lui p1 şi f1 sunt introduse explicit de către utilizator în aşa numita tabela de achiziţie (acquisition table). iar n este eticheta liniei de comandă care va fi efectuată după încheierea achiziţiei) • În programul de pulsuri prezentat mai jos (care implementează experimentul RMN de un puls în Fig. şi go=n (go – este un script care transmite comenzi specifice receptorului pentru achiziţionarea digitală a semnalului RMN. dn (d – delay. se recomandă consultarea manualului de utilizare Bruker. În practică. comanda referitoare la aplicarea pulsului rf este p1:f1 ph1. 180 şi respectiv 2700. 1. p1. în rest.5 μs.

linia de comandă are în faţă indicele 2. În exemplul de mai jos. aceste tipuri de acţiuni sunt reprezentate de comenzile: 1 ze (efectuează resetarea tuturor modulelor electronice la valorile lor iniţiale). Ele corespund în general unor comenzi care se aplică asupra modulelor electronice. go=2 ph31. Linia de comandă 2 d1 din programul de pulsuri de mai jos reprezintă o perioadă de durată d1 (a cărei valoare este introdusă explicit în tabela de achiziţie) în care intensitatea câmpului rf transmis/receptat este zero. adică semnalul RMN digitizat). care vor fi specificate prin comenzi de tipul dn. Din acest motiv.) şi au asociat un timp (ideal cât mai scurt) pe durata căruia comutarea se poate realiza din punct de vedere fizic. cu scopul comutării lor între diferite regimuri de funcţionare. 2us pl1:f1 (pe durata unui delay fixat la 2 μs se setează atenuatorii la ieşirea transmiterului la valoarea specificată prin parametrul de achiziţie pl1. Al doilea tip de acţiuni specificate într-un program de pulsuri nu au echivalent în schema standard a unui experiment RMN. şi sunt necesare pentru implementarea practică a elementelor componente în experimentul RMN dat (de exemplu comutarea frecvenţelor de offset. a fazelor. iar valoarea lui este introdusă explicit în tabela de achiziţie. în exemplul nostru. în afară de recycle delay vor exista mai multe perioade de evoluţie liberă a sistemului. respectiv recycle delay. de exemplu între pulsuri rf consecutive. şi exit (comanda de încheiere a experimentului). scrierea datelor achiziţionate etc. astfel încât orice comandă pn care apare după aceasta linie va aplica un puls rf de durata pn şi cu un nivel de putere pl1).• • • Nivelul de putere al unui puls rf este cel specificat în programul de pulsuri anterior comenzii de aplicare a pulsului respectiv. pentru a achiziţiona un nou scan: acest fapt este explicitat în linia de comandă asociată achiziţiei semnalului RMN. unde ph31 este faza receptorului). Ea reprezintă aşa numitul delay. În experimente multi-puls mai complexe. pl1. valorile pln sunt date în decibeli (dB). a nivelurilor de putere la ieşirea transmiţătorului. În convenţia Bruker. şi corespund atenuării care trebuie aplicată la ieşirea transmiţătorului pentru a obţine valoarea dorită a câmpului rf pe bobina. wr #0 (scrie în memorie datele achiziţionate. iar în exemplul nostru concret d1 corespunde unei valori rezervate. adică timpul necesar reconstruirii magnetizării longitudinale după detecţia sa. 200 . ce reprezintă punctul de unde experimentul RMN se repetă.

). numele programului de pulsuri utilizat în experimentul considerat (pulprog). Aceştia sunt parametri cei mai importanţi în cadrul unui experiment RMN tipic. 2D.). : pentru fiecare nucleu aceasta este fixată în momentul configurării spectrometrului). însă reprezintă doar o mică parte din numărul total de parametri posibili (câţi anume dintre aceştia sunt utilizaţi efectiv într-un experiment dat depinde de complexitatea lui). frecvenţele de offset pe canalele pe care se lucrează (o1. iar tipul şi numărul acestor parametri depinde de complexitatea experimentului avut în vedere. adică durata între două puncte consecutive. etc. se recomandă consultarea manualelor Bruker. o2. acesta trebuie supus transformării Fourier pentru a genera spectrul RMN. qseq – în cuadratură. domeniul temporal (td) – numărul de puncte achiziţionate. pe canalul f2. f2. etc. etc. tipul de achiziţie directă (qsim – în cuadratură.) – se exprimă în Hz sau ppm.• • • Liniile care încep cu . După achiziţionarea semnalului RMN. se recomandă consultarea manualelor Bruker. Pentru detalii. reprezintă linii de comentarii: ele sunt necesare (în special în cazul experimentelor multi-puls mai complexe) pentru a explicita semnificaţia parametrilor incluşi în programul de pulsuri asociat. tabela de achiziţie va mai conţine în mod obligatoriu şi alţi parametri caracteristici experimentelor RMN. dar colectând altenativ puncte în partea reală şi imaginară a semnalului RMN. Parametri specifici acestui proces sunt incluşi în aşa numita tabelă de procesare. sf2. de asemenea. etc. valorile numerice ale parametrilor incluşi în programul de pulsuri sunt specificate în tabela de achiziţie. După cum s-a precizat mai sus. dewll time (dw) – durata de eşantionare a semnaluilui RMN digitizat. pe canalul f1. exprimate de obicei în multiplii de 16. tipul nucleului asociat cu canalele rf utilizate în experimentul dat ( f1.). etc. Pentru o descriere detaliată. numărul de scanuri (ns) – numărul de semnale RMN achiziţionate direct şi adunate între ele în scopul reducerii nivelului de zgomot la un nivel acceptabil. care oferă informaţii cu privire la: tipul de experiment (1D. colectând simultan puncte în partea reală şi imaginară a semnalului RMN. În afară de aceştia. şi reprezintă devierea (cu + sau -) faţă de frecvenţa de bază pe canalul respectiv (sf1. 201 .

Spectrele compuşilor în soluţie sunt caracterizate de o rezoluţie foarte bună. datorată mişcării moleculare rapide: prin aceasta.high power pulse . la lărgirea liniilor de rezonanţă. şi spectrul aceluiaşi compus aflat în stare solidă. caracterizat de rezoluţie înaltă. decuplarea homonucleară. 3 este ilustrată comparaţia dintre un spectru 1H RMN tipic al unui compus organic în soluţie. respectiv lichidă sau solidă. obţinut spre exemplu cu ajutorul experimentului de un puls ilustrat în Fig.pl1 : f1 channel . şi decuplarea heteronucleară Aspectul liniilor de rezonanţă dintr-un spectru RMN 1D. adică un spectru cu linii de rezonanţă înguste şi bine separate în funcţie de deplasările chimice izotrope.d1 : relaxation delay. fapt care duce la menţinerea caracterului anizotrop al interacţiunilor de spin şi. păstrându-se doar partea lor izotropă.p1 : f1 channel .Avance2. implicit.# 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/zg" .1D sequence # 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/Avance. Anizotropia interacţiunilor prezintă pe de o parte dezavantajul de a conduce la pierderea rezoluţiei prin suprapunerea liniilor RMN: în Fig.power level for pulse (default) . efectul componentelor anizotrope ale interacţiunilor de spin prezente în sistem este mediat la zero.incl" 1 . în 202 . 1 diferă fundamental în funcţie de starea de agregare a probei. 1-5 * T1 3.incl 1 ze 2us pl1:f1 2 d1 p1:f1 ph1 go=2 ph31 wr #0 exit ph1=0 2 2 0 1 3 3 1 ph31=0 2 2 0 1 3 3 1 . Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice Tehnici specifice de înaltă rezoluţie în solide: rotirea în jurul unghiului magic (MAS – Magic Angle Spinning). În stare solidă mişcarea rapidă de reorientare moleculară este absentă.

Pentru a diminua efectul negativ al anizotropiei interacţiunilor de spin în spectroscopia RMN-S. care să conducă la separarea liniilor RMN-S în funcţie de deplasările chimice izotrope ale diferitelor grupări chimice din sistemul molecular investigat. care vor fi introduse în raportul următor. rezultă necesitatea dezvoltării de metode specifice ale spectroscopiei RMN-S care să conducă în cadrul aceluiaşi experiment la două efecte distincte: (i) pe durata anumitor perioade ale experimentului să se obţină medierea componentelor anizotrope ale interacţiunilor de spin. Figura 3 Comparaţie între spectrul 1H RMN static al unui compus organic tipic în stare solidă (a) şi în stare lichidă (b) Pe de altă parte. manifestarea caracterului anizotrop al interacţiunilor de spin în probe solide prezintă şi avantaje de ordin practic.care se observă cu usurinţă pierderea completă a rezoluţiei prin suprapunerea severă a liniilor RMN. În mod explicit. la mijlocul anilor ’50 a fost introdusă tehnica MAS 203 . adică la rezoluţie spectrală înaltă şi (ii) reintroducerea selectivă pe durata celorlate perioade ale exeprimentului a unor componente anizotrope ale interacţiunilor de spin (care să afecteze mărimi spectrale altele decât lărgimile de linie). iar anizotropia cuplajului dipolar conţine informaţii despre distanţele internucleare. deoarece componentele anizotrope conţin informaţii importante cu privire la structura şi dinamica din sistem. Având în vedere toate aceste considerente. pentru a codifica în spectrul obţinut şi informaţii specifice cu privire la structura şi/sau dinamica moleculară din sistem – în acest scop sunt aplicate aşa numitele metode de recuplare. anizotropia ecranării chimice furnizează informaţii despre structura electronică (prin tipul orbitalilor moleculari) şi legăturile dintre atomi.

(Magic Angle Spinnining) în cadrul căreia proba este rotită în jurul unei axe înclinate la un unghi. Această metodă. Figura 4 Majoritatea metodelor RMN-S moderne de înaltă rezoluţie sunt aplicate în condiţii de rotaţie a probei în jurul unghiului magic. De asemenea. şi respectiv 2υR. După cum se va prezenta în continuare. va fi diferit. permiţând rotaţii de până la 70 kHz ale probei în jurul unghiului magic. în raport cu direcţia câmpului magnetic static. şi două componente dependente de timp ce corespund unei modulări periodice cu frecvenţele υR. şi implicit asupra lărgirii liniilor RMN. în funcţie de forma explicită a hamiltonienilor asociaţi acestor interacţiuni. numit “unghiul magic”. trebuie menţionat că. ∀ t1 . mediază efectul anizotropiei interacţiunilor de spin prin faptul că rotaţia mecanică a probei determină oscilaţia în timp a termenilor anizotropi şi prin aceasta micşorează efectul lor de lărgire asupra liniilor RMN. Conform descrierii teoretice de mai sus. H (t2 )] = 0. efectul termenilor modulaţi devine din ce în ce mai mic cu creşterea frecvenţtei de rotaţie a probei: în perioada scursă de la introducerea metodei MAS şi până în prezent tehnologia în domeniu a avansat extrem de mult. se pot evidenţia două cazuri distincte: (i) interacţiuni neomogene (deplasarea chimică şi interacţiunea dipolară heteronucleară pentru care [ H (t1 ). ilustrată schematic în Fig. mecanismul de îngustare prin MAS a liniilor RMN în solide se bazează pe manipularea părţii spaţiale a hamiltonianului de interacţiune: termenii anizotropi ai acestuia în proba rotită se descompun într-o componentă statică. Din acest punct de vedere. t2 şi (ii) interacţiuni omogene (interacţiunea dipola204 . efectul lor asupra dinamicii de spin. 4. care devine zero când axa de rotaţie este înclinată la unghiul magic în raport cu direcţia câmpului magnetic static.

pornind de la cazul static până la domeniul de frecvenţe înalte (35 kHz). în Fig. în care datorită numărului mare de protoni inter205 . sisteme multi-spin) pentru care Pentru a ilustra efectul interacţiunilor omogene asupra formei şi lărgimii liniilor de rezonanţă. pentru frecvenţe de rotatie în intervalul 0 – 35 kHz Un pas foarte important în îmbunătăţirea rezoluţiei spectrale pentru sisteme de tip multi-spin. caracterizaţi prin dinamica moleculară complet diferită. care apar la multiplii întregi ai frecvenţei de rotaţie. în cazul static se obţine doar un spectru foarte larg. Mergând spre limita superioară a frecvenţei de rotaţie. fără rezoluţie. încep să se contureze atât linia centrală de rezonanţă. se consideră acţiunea Hamiltonienilor de tip omogen. t2 . Figura 5 Spectele 1H RMN-MAS ale adamantanului (a). H (t2 )] ≠ 0. 5 sunt prezentate spectrele 1H RMN pentru diferite frecvenţe de rotaţie υR în cazul a doi compuşi organici. În aceste două cazuri. datoraţi interacţiunii dipolare homonucleare în sisteme multi-spin. respectiv ale policarbonatului (b). Evoluţia lărgimii liniilor RMN. ∀ t1 . Astfel.ră homonucleară în [ H (t1 ). forma spectrelor se apropie de cea întalnită în cazul în care predomină interacţiunile neomogene. respectiv adamantanul şi policarbonatul. precum şi benzile de rotaţie laterale. iar pentru υR ~ 3 kHz. exemplifică modalitatea prin care frecvenţa de rotaţie acţionează asupra caracterului omogen al interacţiunilor de spin din sistem.

mai pot fi enumerate şi FSLG. constă în combinarea tehnicii MAS cu metode de decuplare homonucleară. precum şi RNnυ şi SAM (Smooth Amplitude Modulation). astfel încât lărgimea liniei grupării metil scade de la 1. Acestea presupun aplicarea pe canalul 1H (care este şi canalul de detecţie) a unor secvenţe de pulsuri adecvate care să conducă la medierea efectului produs de interacţiunile dipolare homonucleare. respectiv anizotropa). iar apoi prin aplicarea celor două tehnici . deoarece este aplicabilă în cazul rotirii probei cu frecvenţe înalte de ordinul a 65 – 70 kHz. astfel încât interacţiunea dominantă din sistem rămâne ecranarea chimică (cu componentele ei izotropa. Figura 6 În clasa metodelor de decuplare homonucleră. 6 este prezentat spectrul 1H al dipeptidei β-L-Asp-L-Ala obţinut rotind proba cu υR= 65 kHz (a). pe lângă mai sus amintita metodă DUMBO. În cazul sistemelor de spini cu factor giromagnetic mic (de exemplu 13C sau 15N) în abundenţă naturală (adică separaţi prin distanţe mari) cuplajele dipolare devin neglijabile.1 ppm în cazul (a). Comparând spectrele obţinute se observă o creştere apreciabilă a rezoluţiei spectrale în cazul decuplării homonucleare. În Fig. la 0. se numeşte DUMBO. ultimele două metode fiind aplicate în timpul perioadei de evoluţie indirectă a experimentelor de tip bidimensional. PMLG.MAS şi decuplare homonucleră cu ajutorul secvenţei DUMBO (b).acţiunea dipolară homonucleară. De exemplu. una dintre secvenţele intens utilizate în prezent. de tip omogen. 206 .32 ppm în cazul (b). este predominantă.

Chiar şi în cazul frecvenţelor de rotaţie mari se vor obţine linii de rezonanţă ale 13C (15N) cu lărgimi reziduale mari dacă se foloseşte doar tehnica MAS.3 pentru CH3. Odată cu creşterea lui υR până la valori mari. astfel încât efectul spectrul RMN 13C al L-alaninei.5 pentru CH2. liniile de rezonaţă fiind largi. nucleele 13C (15N) sunt Figura 7 Evoluţia cu frecvenţa de înconjurate în compuşii organici de un rotaţie a liniilor de rezonanţă din număr mare de protoni. Din punct de vedere teoretic. Situaţia prezentată în Fig. liniile celor trei grupări se descompun într-o serie de benzi de rotaţie laterale.În acest caz. situate la multiplii întregi ai frecvenţei de rotaţie. υR= 1 kHz. 0. în interacţiunilor suplimentare datorate acesprezenţa ecranării chimice tora nu poate fi neglijat în practică. evoluţia cu frecvenţa de rotaţie a liniilor într-un spectru RMN 1D într-un sistem de trei spini 13C care nu interacţionează dipolar dar sunt supuşi ecranării chimice este prezentată în Fig. 7 corespunde unui model teoretic idealizat. care ilustrează comportarea în condiţii de MAS a unor interacţiuni de spin de tip pur neomogen: în realitate. Forma liniilor este dată de valoarea parametrului de asimetrie. este de aşteptat în principiu ca odată cu creşterea frecvenţei de rotaţie a probei să se obţină spectre cu rezoluţie şi sensibilitatea spectrală din ce în ce mai înalte. adică η =1 în cazul grupării COO-. Spectrul static al L-Alaninei prezintă caracteristicile tipice întâlnite în cazul unui sistem de spini izolaţi. La o frecvenţă de rotaţie mică. respectiv 0. centrate la valori ale deplasării chimice izotrope asociate fiecărei grupări chimice. în care se consideră doar efectul ecranării chimice. intensităţile benzilor rotaţionale se reduc semnificativ astfel încât un spectru MAS de înaltă rezoluţie va conţine cu o bună aproximaţie doar linii poziţionate la valori ale deplasărilor chimice izotrope corespunzătoare grupărilor chimice din probă. 7. Pentru a creşte rezoluţia spectrală în aceste cazuri este nevoie de combinarea teh207 .

7). 8 pentru cazul spectrului RMN pe 13C al L-alaninei măsurat la o frecvenţă de rotaţie de 10 kHz. poziţionate la valori ale deplasării chimice izotrope caracteristice fiecărei grupări structurale. Lărgimile liniilor pentru toate cele trei grupări sunt în intervalul 20 – 50 Hz. sub formă continuă sau de pulsuri cu modulaţie în fază. Calibrarea parametrilor pe canalul 1H cu ajutorul experimentului de un puls Pentru calibrarea nivelului de putere (sau echivalent. bine separate. 1. utilizarea decuplării heteronucleare în condiţii de MAS conduce la linii de rezonanţă înguste. În esenţă. valoarea B1 a câmpului rf exprimat în kHz) generat de transmiter pe canalul 1H în funcţie de valoarea atenuării (in dB) se utilizează experimentul simplu de un puls din Fig. asemănătoare celor simulate pentru cazul idealizat al interacţiunilor pur neomogene (Fig.nicii MAS cu o tehnică suplimentară numită decuplare heteronucleară în scopul de a se limita efectul de lărgire produs de protonii din vecinătate. Figura 8 După cum se observă în Fig. al cărui program de pulsuri este listat la finalul Secţiunii 2. Din punct de vedere practic. cu o diferenţă de un ordin de mărime faţă de valorile întâlnite în mod uzual în cazul compuşilor în stare lichidă. în timpul achiziţionării semnalului RMN pe canalul 13C (15N). procedura constă în următoarele: • Se utilizează adamantanul drept probă standard pentru calibrarea nivelurilor de putere pe canalul protonilor deoarece spectrul 208 . această tehnică constă în aplicarea pe canalul 1H a unui câmp rf intens.

şi 10 us. p1) considerate.• • • • RMN-S 1H al acestui compus constă dintr-o singură linie. ceea ce reduce foarte mult tăria cuplajelor dipolare 1H-1H După plasarea probei în magnet. În funcţie de capul de probă folosit. se scanează pl1 cu paşi mai mici (0. se procedează la operaţiunile preliminare standard de acordare a frecvenţei de rezonanţă şi a impedanţelor (aşa numitele tuning şi matching).1 dB) în jurul valorii pentru care acesta s-a obţinut. se recomandă utilizarea unor frecvenţe de rotaţie cuprinse între 10 şi 30 kHz Se începe apoi procedura de calibrare a puterilor pe canalul protonilor prin rularea repetată a experimentului de un puls (programul de pulsuri redat mai sus. Se repetă apoi în mod identic procedura de baleiere a nivelurilor de putere pl1 descrisă mai sus pentru toate valorile câmpului rf (implicit. şi se determină în final valoarea exactă a pl1 pentru care intensitatea liniei se anulază complet: această valoare va corespunde deci pulsului de 1800 pentru câmpul rf considerat.5 dB) până se constată anularea (sau inversarea) liniei RMN-S. p1 = 5. în cadrul căruia se modifică durata pulsului (p1) şi nivelul de putere asocial (pl1) şi se înregistrează spectrul RMN-S 1H al adamantanului. Modificarea acestor parametri se poate face înscriind valorile dorite în tabela de achiziţie. sau direct prin comenzile p1 <valoare> (in us). Se recomandă calibrarea în ordinea descrescătoare a câmpului rf . Aceste proprietăţi favorabile conduc la o sensitivitate şi o rezoluţie foarte bună care permit calibrarea rapidă şi precisă a pulsului de 1800 (după cum se va descrie mai jos). În cazul inversării. 6. cu lărgime mai mică decât a altor compuşi organici în fază solidă (sub 1 kHz pentru frecvenţe de rotaţie a probei mai mari decât 10 kHz). Trebuie avut însă în vedere că scăzând câmpul 209 . şi respectiv pl1 <valoare> (in dB) Mai întâi se fixează durata pulsului p1 astfel încât aceasta să corespundă unui puls de 1800 pentru un set de valori dorite ale câmpului rf pe canalul 1H (de exemplu. caz în care se va putea începe cu o valoare de strat pl1 = 2-0 dB care va fi scăzută în paşi mai mari la început (de exemplu 0. pentru câmpuri de 100. 75 şi 50 kHz). Pentru fiecare dintre aceste valori fixe se baleiează parametrul pl1 până când intensitatea liniei din spectrul RMN-S înregistrat devine zero.67. şi se datorează faptului că molecula de adamantan nu este rigidă în reţeaua cristalină ci efectuează mişcări rapide de rotaţie simultan în jurul a trei axe de simetrie. şi stabilizarea rotaţiei la frecvenţa aleasă. şi se utilizează comanda zg).

basic cp experiment 1 ze 2 d1 do:f2 210 . în figură sunt menţionaţi explicit parametrii de timp (pulsuri. În practică se preferă calibrarea prin intermediul pulsului de 1800 şi nu 900. incluşi în programul de pulsuri cp-const asociat acestei secvenţe. deoarece monitorizarea rezultatului prin intermediul unui semnal care se anulează este mai sensibilă decât dacă s-ar urmări valoarea maximă a acestuia.0) . şi listat mai jos. phn. 9 utilizând reprezentarea schematică convenţională din RMN. 9.cp (TopSpin 2. şi implementarea ei pe spectrometrul Bruker. şi delay-uri. pn. sau <valoare> us). Calibrarea parametrilor pe canalul 13C cu ajutorul experimentului CP-MAS Secvenţa de pulsuri asociată experimentului de Cross-Polarizare în condiţii MAS (CP-MAS) este ilustrată în Fig. pln. dn. de putere.• rf valoarea de start a parametrului pl1 creşte în mod corespunzător. descrisă în Fig. pentru a se evita de exemplu să se pornească cu o valoare care deja corespunde unui puls > 1800. şi respectiv de fază. Pentru a face mai uşoară o comparaţie directă între aceasta reprezentare schematică. Figura 9 # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-const" .

unde n=1. pentru o rotaţie cu νR = 15 kHz (o valoare uzuală pentru înregistrarea spectrelor 13C) a probei în jurul unghiului magic. şi vom începe prin a explica de ce se preferă în practică experimentul CP-MAS pentru a înregistra spectre RMN-S 1D ale 13C(15N) în locul experimentului mult mai simplu de un puls. and p30 the pulse CP-MAS este un experiment de dublă rezonanţă.pl12 is used here with cw . 9).13C(15N) şi se desfăşoară în condiţiile iradierii simultane cu câmpuri rf pe canalele asociate (aşa numitele pulsuri de contact: Fig.pl12 is used here with tppm. precum 13C sau 15N. El este un experiment standard în spectroscopia RMN-S care se utilizează atât pentru înregistrarea spectrelor 1D convenţionale ale nucleelor cu factor giromagnetic mic. deoarece presupune aplicarea de câmpuri rf (pulsuri) simultan pe două canale distincte (f1: 13C şi f2: 1H în cazul particular ilustrat mai sus). ν1H = ν13C +(-) nνR. Procesul de transfer de polarizare 1H <-> 13C(15N) prin aşa-numitul mecanism de polarizare încrucişată (cross-polarization.2.1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u pl12:f2 . De exemplu.go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. se va considera în detaliu doar primul aspect. cât şi ca parte componentă în experimente multi-dimensionale mai complexe. CP) este un proces coerent generat de interacţiunile dipolare heteronucleare 1H. Procesul de transfer prezintă maxime de eficienţă dacă amplitudinile celor două câmpuri rf de contact satisfac aşa-numita condiţie Hartmann-Hahn de matching. În cadrul prezentului raport. la condiţia de matching n =1: aceasta înseamnă că valoarea câmpului pe canalul 13C(15N) va fi astfel calibrată încât să fie mai mare (sau mai mică) cu valoarea frecvenţei de rotaţie a probei. este necesară calibrarea unui câmp rf pe canalul carbonului de 35 sau 65 kHz pentru a asigura un transfer maxim de 211 . În general se lucrează cu valori ale câmpului în jur de 50 kHz pe canalul protonilor. 1m exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 .

Deoarece la echilibru termic raportul dintre aceste polarizări este proporţional cu raportul factorilor giromagnetici corespunzători. în Fig.5 ori mai mare decât cuplajul 1H. Simultan se aplică pulsul de contact de aceeaşi durată p15 şi pe canalul carbonului cu un nivel de putere corespunzător unui transfer maxim de polarizare 1H->13C (adică să satisfacă una dintre condiţiile de matching Hartmann-Hahn descrise mai sus). d1. Polarizarea transferată pe 212 . un experiment CP/MAS standard (sau convenţional) se derulează în modul următor: mai întâi se aduce polarizarea longitudinală a spinilor nucleari 1H în planul transversal (de exemplu de-a lungul direcţiei x. şi respectiv de zece ori în cazul spinilor 15N. În realitate aceşti factori teoretici sunt rareori obţinuţi în practică datorită proceselor de relaxare care se desfăşoară pe durata pulsului de contact. rezultă că într-un anumit interval dat se pot acumula mult mai multe scanuri cu ajutorul CP/MAS decât ar fi posibile în cazul utilizării experimentului simplu de un puls.13C este de aproximativ 2. De asemenea. şi nu polarizarea asociată nucleelor 13C(15N). rezultă o amplificare de aproximativ patru ori în intensitatea semnalului RMN-S 13C. Deoarece. Această polarizare este apoi „blocată” – aşa-numitul „spin locking” – cu ajutorul pulsului de contact p15 aplicat pe canalul f2 cu faza x (deoarece direcţia câmpului rf asociat şi direcţia polarizării trebuie să coincidă). 9. Plecând de la secvenţa de pulsuri ilustrată schematic în Fig.polarizare 1H -> 13C. prin aplicarea pulsului p3 de 900 cu faza y pe canalul f2 asociat protonilor). 9). Utilizarea polarizării transferate de la protoni mai are încă un avantaj important care este determinat de valorile mult mai mici ale timpului de relaxare longitudinal T1 în cazul nucleelor 1H în comparaţie cu cei asociaţi 13C(15N): deoarece aceşti timpi practic guvernează valoarea duratei de repetiţie a experimentului (aşa-numita recycle delay. valorile optime pentru durata pulsului de contact (p15) în cazul nucleelor de 13C este cuprinsă între câteva sute de μs. Avantajele principale ale unui experiment CP-MAS rezultă din faptul că polarizarea iniţială care conduce la formarea semnalului RMN-S este cea transferată de la spinii 1H. Ambele mecanisme conduc la creşterea substanţială a sensibilităţii spectrale în cazul utilizării metodei CP/MAS. şi valoarea optimă a pulsului de contact va creşte corespunzător (în acest caz se obţine un transfer maxim de polarizare la valori ale p15 cuprinse între 3-7 ms). şi respectiv programul de pulsuri asociat. însă şi în aceste condiţii câştigul în intensitate al semnalului RMN este semnificativ.15N la aceeaşi distanţă internucleară. cuplajul dipolar 1H. comparativ cu intensitatea care s-ar obţine printr-un experiment de un puls. până la 1-2 ms: această durată depinde direct de tăria medie a cuplajelor dipolare dintre fiecare spin 13C din probă şi protonii cei mai apropiaţi.

numita TPPM (Two Pulse Phase Modulation) câmpul se aplică sub formă de trenuri de două pulsuri cu faze alternante. respectiv la un timp de acumulare scurt. În final trebuie menţionat că detecţia FID-ului se face în condiţii de decuplare heteronucleară. 180 şi 2700. Ca şi în cazul calibrării puterilor pe canalul 1H. TPPM este tehnica de decuplare heteronucleară cel mai des utilizată pentru înregistrarea de spectre 13C RMN-S pe compuşi organici cristalini. şi (ii) alternarea în paşi de 900. de ordinul zecilor de secunde. În mod uzual un experiment CP/MAS se efectuează cu un phase cycling de 8 paşi. adică prin utlizarea unor tehnici speciale care au drept scop minimalizarea efectelor produse de interacţiuniile dipolare 1H-13C şi 1H-1H (în special efectul de lărgire a liniilor spectrale) pe durata achiziţionării semnalului RMN 13C. cu Δφ având valori cuprinse în general între 15 şi 300. toate tehnicile de decuplare heteronucleară constau în aplicarea unui câmp rf pe canalul protonilor de-a lungul întregii durate de achiziţie a semnalului RMN. adică în cazurile în care nu este necesar aplicarea unor câmpuri rf de decuplare foarte intense. Pentru a obţine spectre RMN-S 13C de calitate ale compusului studiat. însă şi metoda CW este preferată uneori. respectiv 0. ea evoluează liber şi poate fi achiziţionată ca şi semnal RMN (FID). adamantanul prezintă avantajul că se obţin linii 13C RMN-S relativ înguste (2-3 Hz). ceea ce conduce la o sensibilitate spectrală foarte bună. În principiu. a fazei receptorului în sincronie cu faza ph1 a pulsului de contact pe canalul f1 (aşa-numitul Cyclops phase cycling) pentru a elimina eventualele imperfecţiuni ale circuitelor de detecţie în cuadratură. câmp ce trebuie să satisfacă anumite cerinţe în funcţie de condiţiile experimentale concrete: în cadrul celei mai simple metode. cu performanţe îmbunătăţite. φ = φ + Δφ. în momentul încetării acţiunii pulsului de contact. iar în cadrul unei metode mai recente. Compuşii standard cel mai des utilizaţi în acest scop sunt adamantanul (calibrarea nivelelor de putere pe canalul carbonului) şi glicina (ajustarea valorii unghiului magic). adamantanul este considerat un compus ideal pentru procesul de calibrare a experimentului CP/MAS. numite Continuous Wave – CW. pentru a elimina contribuţia polarizării iniţiale a spinilor 13C la semnalul detectat. respectiv ph3 = 90 şi 2700. de exemplu în scopul calibrării experimentului CP/MAS. câmpul se aplică în mod continuu cu faza arbitrară. pentru un experiment CP/MAS: în acest fel. deoarece acesta necesită în general 213 . care conţine două subcicluri suprapuse: (i) alternarea cu 1800 a fazei pulsului p3. 90. sau la înregistrarea de spectre 15N RMN-S.durata lui p15 se construieşte de-a lungul direcţiei câmpului de contact aplicat pe canalul f1: aceasta reprezintă în fapt o polarizare transversală a spinilor 13C astfel că. parametrii caracteristici ai experimentului CP/MAS trebuie mai întâi calibraţi cu ajutorul unor compuşi de referinţă (standard).

Valorile particulare ale parametrului pl1 pentru care se obţin aceste maxime se transformă în valori ale câmpului rf asociat utilizând relaţia ν13C = 50 kHz +(-) nνR. pl1.1 dB mergând înspre valori mici. Setul de spectre obţinut astfel furnizează aşa-numită curba de matching Hartmann-Hahn. frecvenţa de iradiere pe canalul f2 va fi cea corespunzătoare frecvenţei de rezonanţă a liniei adamantanului din spectrul 1H RMN-S. procedura de calibrare a experimentului CP/MAS poate fi descrisă pe scurt în felul următor: • Pentru valorarea fixată a lui p3 se setează puterea pl3 (determinată anterior în procesul de calibrare a puteriolor pe canalul protonului) astfel încât aceasta să corespundă unui puls de 900. • Se setează valorile pl2 şi pl12. pl2 şi pl12 (în condiţiile în care se consideră fixate valorile pulsurilor p3 şi p15. 2. pentru pulsul de contact pe canalul protonului. Curba de matching Hartmann-Hahn prezintă cinci maxime corespunzătoare celor cinci condiţii menţionate anterior. iar metoda de decuplare utilizată pentru adamantan este CW). şi (iii) tehnica de decuplare utilizată să conducă la îngustarea maximă posibilă pentru compusul dat. În particular.5 ppm. Plecând de la aceste considerente. Pentru a evita posibile efecte de offset. se porneşte de la valori mari ale lui pl1 (de exemplu. cu n = 0. 1. astfel încât acestea să corespundă unei valori a câmpului rf de 50 kHz: şi în acest caz se utilizează rezultatele anterioare ale calibrării puterilor pe canalul 1H.achiziţionarea unui număr mare de spectre până când sunt determinate valorile optime ale tuturor parametrilor de interes. respectiv a eficienţei procesului de transfer de polarizare prin CP. şi respectiv câmpul de decuplare prin CW. respectiv dependenţa puterii pe canalul 13C a intensităţii spectrale. Corespunzător acestor elemente. trebuie deci calibrate puterile pl3. 5 dB) şi se scanează acest parametru în paşi de 0. În cazul fiecărui parametru optimizarea se face prin maximizarea intensităţii liniilor RMN în spectrul achiziţionat (în cazul particular al adamantanului avem două linii poziţionale la 29. 214 . determinate de grupările CH şi CH2 din moleculă). Aceasta este etapa cea mai laborioasă din cadrul procedurii. intensitatea spectrală obţinută este maximă dacă sunt îndeplinite simultan următoarele trei condiţii: (i) pulsul p3 pe canalul protonilor este un puls 900. (ii) nivelurile de putere ale pulsurilor de contact p15 pe cele două canale sunt astfel ajustate încât să îndeplinească condiţia Hartmann-Hahn de matching descrisă mai sus. 9. Conform schemei experimentale din Fig.5 şi 38. • Se ajustează valoarea puterii pl1 a câmpului de contact pe canalul carbonului până când se obţine o intensitate maximă a liniilor RMN în spectrul CP/MAS achiziţionat.

Introduction to High-Resolution Solid-State NMR. Experimentul CP/MAS cu parametri calibraţi pe adamantan din punct de vedere al nivelurilor de putere. şi se reţine acea valoare pentru care intensitatea spectrală atinge un maxim absolut. În practică. Gullion. amplitudine maximă).Bibliografie 1. Bodenhousen. Elsevier Science 2007 H. 4. Această etapă este necesară deoarece valorile câmpului rf pe canalul 1H în general sunt determinate cu un grad de eroare mai mare prin experimentul de un puls decât cu ajutorul experimentului CP/MAS. Wiley 2010 T. 4.H. Wiley 2008 J. După acest pas este trecut se procedează în continuare la ajustarea pulsului p31 în secvenţa de decuplare heteronucleară prin TPPM pentru a se obţine în final îngustarea maximă posibilă a liniilor spectrale.• În final. Oxford University Press. Datorită faptului că glicina este o moleculă relativ rigidă în reţeaua cristalină (aşa cum sunt majoritatea compuşilor organici) decuplarea prin CW la câmpuri mici. prin modificarea uşoară a puterii pl3 în jurul valorii fixate iniţial.R. Guenther. Levitt. 2. Wiley 2001 Bruker Biospin Group. Spin Dynamics: Basics of Nuclear Magnetic Resonance. 2008 215 . se utilizează în continuare pe glicină pentru ajustarea valoarii unghiului magic şi pentru optimizarea pulsurilor p31 asociate decuplării prin metoda TPPM. durata optimă a pulsului p15 se apropie în general de cea a unui puls de 1800. astfel încât se preferă metoda TPPM la câmpuri intense (ideal pl12 ar trebui să corespundă unor câmpuri de cel puţin 100 kHz). Principles of Nuclear Magnetic Resonance în One and Two Dimensions. Oxford 1987 M. Wokaun. NMR Spectroscopy. Understanding NMR Spectroscopy. 3. 6. 5. de ordinul a 50 kHz. se modificăa uşor înclinarea axei rotorului până ce se obţine un spectru 13C RMN-S a glicinei în care linia carbonilului (de la 176. nu mai poate produce o rezoluţie spectrală satisfăcătoare.5 ppm) are lărgime minimă (implicit. Ernst. Alegerea acestui compus standard este motivată de faptul că el are un spectru RMN-S simplu care conţine doar două linii (deci sensibilitate spectrală mare) dintre care una corespunde grupării carbonil a cărei lărgime este foarte sensibilă la deplasări mici ale înclinării axei de rotaţie a probei faţă de valoarea unghiului magic: acest efect se datorează anizotropiei mari a deplasării chimice. TOPSPIN User Manual. G. Pentru valoarea setată a lui pl12. R. Keeler. pentru o ajustare mai fină a pulsului iniţial de 900 pe canalul protonului se revine la primul pas. astfel încât calibrarea lui p31 se face pornind de la această valoare de referinţă. A.

........... dar care nu necesită transformarea lor în spectre 2D. Claudiu Filip C.......................S......... Drept urmare.. metode ce au fost până în prezent implementate şi testate experimental pe infrastructura existentă la UBB Cluj..I..........Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă C............... Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) ...................................... chiar dacă nu pot fi utilizate în practică la UBB Cluj.. dr............... Vor fi ilustrate de asemenea tehnici bazate pe detecţia 1H.. dr.... Bibliografie .. de exemplu cele care implică lucrul simultan pe trei canale rf [1] (metode de triplă rezonanţă)......... Introducere În acest raport se vor prezenta în mod detaliat o serie de experimente RMN-S avansate................. sau metode de înaltă rezoluţie pe 1H...................................................... Introducerea metodelor se va face progresiv................. şi vom ajunge în final la prezentarea de metode care 216 ...... Metode RMN-S 2D de corelare 13C-13C .....245 1...................................216 2..... cu aplicaţii în investigarea structurii sistemelor moleculare organice cristaline....................... Deoarece acestea sunt considerate ca făcând parte din „arsenalul de bază” al metodologiei moderne RMN-S pe sisteme moleculare organice....... Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C ..... Accentul va fi pus pe experimente RMN-S de dublă rezonanţă pe 13C.................III. care necesită o electronică adaptată secvenţelor de decuplare homonucleară [2] şi/sau capuri de probă de tip „ultra-fast MAS”.....................226 4........ care să permită rotaţii ale probei până la 70 kHz...... însă doar în cazul acelor compuşi unde se obţine o rezoluţie spectrală satisfăcătoare în condiţiile tehnice date.............................S............ în ordinea creşterii complexităţii lor: se vor descriere mai întâi experimente care necesită înregistrarea de seturi de date bidimensionale (2D).................. Mihaela Aluaş Cuprins 1. Introducere ..... recomandăm studenţilor aprofundarea lor cel puţin la nivel teoretic (consultând bibliografia indicată mai sus).........237 5..219 3.... nu vor putea fi prezentate o serie de metode RMN-S intensiv utilizate în domeniu............................

etc. De asemenea. Un spectru RMN 2D se obţine în următorul mod: se aplică secvenţa de pulsuri pentru t1 = 0. în acest caz transformata Fourier trebuie aplicată de două ori. coerente de mai multe cuante. şi va depinde explicit de ambele variabile temporale. Următoarea perioadă – perioada de mixing. unde spectrul RMN se obţine prin transformarea Fourier a FID-ului. polarizare transversală. În fiecare caz. constă în aplicarea celui de-al doilea puls (sau pulsuri) de radiofrecvenţă.furnizează informaţii structurale pe bază de spectre RMN-S 2D de corelaţie. 3Δt1…nΔt1. Schema generală pentru un experiment RMN bidimensional este redată în Fig. pentru fiecare tehnică RMN-S avută în vedere. Apoi se repetă aceeaşi procedură pentru t1 egal cu multiplii întregi ai perioadei de sampling Δt1 (adica Δt1. în urma cărora se generează o mărime fizică asociată sistemului de spini (de ex. t1 (corespunzător dimensiunii indirecte F1) şi t2 (corespunzător dimensiunii directe F2). Figura 1: Schema de principiu a unui experiment RMN bidimensiuonal (2D) În prima perioadă. şi în special nivelurile de putere pe fiecare canal rf. au fost calibrate corespunzător. 217 . pe durata lui t2. iar informaţia care se regăseşte în spectrul RMN depinde concret de tipul interacţiunii care a fost selectată în perioadele de preparare şi de mixing. respectiv că toţi parametri experimentali relevanţi. Secvenţa de mixing are rolul cel mai important într-un experiment 2D.) care va evolua pe durata t1. semnalul RMN este descris de o funcţie care depinde de două variabile de timp. deoarece ea defineşte corelaţiile care se stabilesc între mărimile care evoluează în t1 şi polarizarea transversală asociată fiecărui spin care se detectează în mod direct. Această succesiune de perioade poartă denumirea de secvenţă de pulsuri 2D. se aplică unul sau mai multe pulsuri rf. se presupune că mai întâi au fost parcurşi paşii prezentaţi în raportul anterior. prin intermediul semnalul RMN. în spectroscopia RMN bidimensională (2D). 2Δt1. cea de preparare. se înregistrează şi se stochează FID-ul corespunzător acestei valori. este de menţionat că. t1 şi t2. Spre deosebire de varianta unidimensională. Pentru a se obţine spectrul în frecvenţă. unde n este de obicei cuprins între câteva zeci şi câteva sute). În consecinţă. semnalul RMN bidimensional constă dintr-un set de n FID-uri. 1. în afară de aspecte pur practice se va face şi o scurtă prezentare a fundamentelor teoretice pe care aceasta se bazează.

generează spectre care conţin ambele tipuri de peak-uri. de exemplu Fig. pentru fiecare linie izotropă. şi perioada de mixing coincid. vor exista diferenţe în ceea ce priveşte (i) mărimea fizică asociată sistemului de spini (de exemplu coerente de una sau mai multe cuante). De 218 . 2(c). Conform schemei generale a unui experiment 2D. separat. În cazul spectrelor bidimensionale de separare. şi (ii) interacţiunea de spin recuplată pe durata perioadei de mixing. care va evolua în dimensiunea indirectă F1. corespund cazului în care frecvenţa de rezonanţă a unui semnal generat în timpul perioadei de preparare va rămâne neafectată de pulsul (sau pulsurile) care alcătuieşte perioada de mixing. t1.Figura 2: Exemple de spectre RMN 2D şi modalitatea în care apar peakurile diagonale. Multe dintre tehnicile RMN 2D utilizate în mod curent. numite peak-uri diagonale. ilustrată în Fig. Astfel. 1. iar în dimensiunea indirectă. iar interacţiunea recuplată va genera peakuri de corelatie (cross-peakuri) între nucleele diferitelor grupări chimice dintr-un anumit compus. atunci pe durata perioadei de preparare s-a format un semnal care a evoluat cu frecvenţa ωA de-a lungul lui t1. se obţine spectrul anizotrop al interacţiunii recuplate. şi respectiv de corelare [3]. în funcţie de succesiunea de pulsuri aleasă. F1. în dimensiunea F2 se obţine spectrul izotrop al compusului studiat. În funcţie de tipul de experiment RMN de corelare utilizat. Un alt tip de peak-uri care se pot obţine într-un spectru RMN 2D. iar pe durata perioadei de mixing acelaşi semnal a fost transformat cu ajutorul unei anumite secvenţe de pulsuri într-un alt semnal care evoluează cu frecvenţa ωB pe durata t2. în cazul spectrelor de corelare ambele dimensiuni codifică deplasările chimice izotrope. se pot obţine două tipuri distincte de spectre RMN 2D: de separare. respectiv cross-peakurile Modul de apariţie a peak-urilor în spectre RMN bidimensionale şi interpretarea acestora vor fi descrise pe scurt în cele ce urmează. dacă într-un spectru 2D va apărea un peak poziţionat la ωA în dimensiunea F1 şi la ωB în dimensiunea F2 (aşa numitele cross-peakuri). o secvenţă de pulsuri specifică spectroscopiei RMN 2D de separare corespunde cazului particular în care domeniul temporal indirect. În practică. Spre deosebire de spectrele RMN 2D de separare.

de putere. Toate celelalte elemente (comenzi. Referitor la notaţiile atât în reprezentarea schematică. pn. şi implementarea ei pe un spectrometru Bruker. şi respectiv de fază. etc. cu eficienţe care depind de distanţele dintre spinii nucleari implicaţi. descrisă în raportul anterior. Figura 3: Reprezentarea schematică a experimentului RMN 2D de investigare a transferului de polarizare 1H-13C prin intermediul secvenţei CP-MAS clasice 219 . şi respectiv faze asociate acestor pulsuri. şi anume. parametri adimensionali. în figură sunt mentionaţi explicit parametrii de timp (pulsuri. pln. experimentele bidimensionale pot fi clasificate şi în funcţie de tipul de nuclee implicate. şi anume experimente de corelare homonucleare sau heteronucleare. phn. dn. sau <valoare> us). cât şi în programul de pulsuri. 3.) sunt reprezentate cu negru. niveluri de putere ale pulsurilor rf. Secvenţa de pulsuri asociată acestui experiment este redată mai jos în Fig. roşu şi verde reprezintă durate. şi listat mai jos. şi delay-uri. 2. se foloseşte aceeaşi convenţie ca şi în raportul anterior. Pentru a face mai uşoară o comparaţie directă între această reprezentare schematică. incluşi în programul de pulsuri cp-var asociat acestei secvenţe. Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C Metoda RMN-S 2D bazată pe secvenţa CP-MAS clasică Exemplul cel mai ilustrativ al unei metode RMN-S 2D de separare este reprezentat de experimentul de recuplare a interacţiunii dipolare heteronucleare C – H cu ajutorul secvenţei clasice CP-MAS ce are drept efect un transfer de polarizare între protoni şi nucleele 13C din vecinătate.asemenea. variabilele notate cu albastru. utilizând reprezentarea schematică convenţională din RMN.

Valorile acestor pulsuri sunt stocate într-o aşa-numită listă de pulsuri (variable pulse list) care este apelată în cadrul programului de pulsuri prin comanda vp (variable pulse). şi se obţine astfel 220 .pl12 is used here with tppm. experimentul descris în Fig. ivp (increment variable pulse – trece la următoarea valoare a pulsului de contact specificată în lista de pulsuri).# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-var" .0) . secvenţele CP-MAS efectiv utilizate diferă între ele prin durata pulsului de contact. and p30 the pulse În esenţă. achiziţionate prin intermediul secvenţei CP-MAS clasice: la fiecare dintre cele N repetiţii ale experimentului. 3 presupune înregistrarea unui set de date 2D. lo to 2 times td1 (loop la linia 2. de un număr de ori specificat prin parametrul de achiziţie td1) – repetă experimentul de N ori (N = td1) pentru a acumula toate datele prevăzute în experimentul 2D. În programul de pulsuri.go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu.basic cp experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (vp ph1):f1 (vp ph2):f2 1u pl12:f2 . Lista este cuprinsă în fişierul care este specificat în tabela parametrilor de achiziţie. modul de achiziţie 2D este specificat prin comenzile de incrementare şi de repetiţie (loop) specifice: if (increment file – trece la un nou fişier unde va fi stocat următorul FID din cadrul setului de date 2D). 1m 1m if 1m ivp lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 . se aplică transformata Fourier de-a lungul dimensiunii directe (F2) prin intermediul comenzii xf2.pl12 is used here with cw . urmează procesarea datelor: concret. După achiziţionarea celor N semnale RMN distincte. care constă dintr-un număr N de semnale RMN 13C distincte.cp (TopSpin 2.

dinamica procesului de transfer de polarizare de la protonii învecinaţi (în principiu. în dimensiunea indirectă se obţin curbele de transfer de polarizare (CP) corespunzătoare fiecărei grupări chimice: forma specifică a fiecărei dintre aceste curbe reflectă tăria cuplajelor dipolare heteronucleare recuplate. 4 este prezentat un set de date bidimensional înregistrat utilizând tehnica descrisă mai sus în cazul particular al L-Alaninei. Acesta este format din N spectre 13C CP-MAS. Astfel. pentru fiecare poziţie chimică distinctă a atomilor de carbon din sistemul molecular investigat. cu cele trei linii de rezonanţă caracteristice grupărilor CH. În Fig. Transformata Fourier s-a aplicat doar în dimensiunea directă. care afectează dinamica procesului de transfer de polarizare 1H -> 13C la durate de ordinul milisecundelor. Dacă transformata Fourier se aplică şi de-a lungul lui t1. proprietăţile caracteristice ale unei asemenea curbe descriu. contribuţii însemnate vor avea cei situaţi până la o distanţă de 2. obţinându-se spectrul izotrop al compusului. deoarece în interiorul acestui domeniu temporal caracterul coerent al procesului de transfer este dominant. şi se manifestă prin apariţia aşa-numitelor oscilaţii dipolare în curbele CP-MAS corespunzătoare. Considerând variaţia intensităţilor de linie cu poziţia spectrului CP-MAS din setul de date 2D. Peste această valoare a lui p15 se pot utiliza creşteri cu paşi din ce în ce mai mari. CH3. 30-50. respectiv COOH). să fie menţinut la o valoare rezonabilă. astfel încât numărul de N de repetiţii ale experimentului. Pentru a putea caracteriza şi parametrii relaxării spin-reţea în sistemul rotitor. se reprezintă grafic evoluţia intensităţii de linie în funcţie de durata lui p15. în locul curbelor CP se vor obţine aşa-numitele spectre dipolare: cele două modalităţi de a extrage informaţii despre parametrii interacţiunii dipolare sunt însă echivalente.setul de date 2D. respectiv COOH. cu atât cuplajul dipolar heteronuclear asociat este mai puternic.5-3 Å). cu cât rata de creştere a unei astfel de curbe CP este mai mare şi oscilaţiile dipolare mai pronunţate (vezi curba CP corespunzătoare grupării CH comparativ cu cele pentru CH3. Pentru fiecare dintre liniile RMN din spectru. se recomandă de asemenea înregistrarea curbei până la valori ale pulsului de contact de 3 – 5 ms. obţinându-se în final aşa-numitele curbe CP-MAS. ţinând cont de caracteristicile procesului de transfer de polarizare 1H -> 13C. care coincide cu numărul de puncte ce definesc curbele CP-MAS înregistrate. Procedura descrisă mai sus face parte dintr-o clasă mai largă de metode RMN-S numite 221 . aşezate în ordinea crescătoare a duratei pulsurilor de contact p15 utilizate. În practică. pentru durate ale pulsului de contact p15 cuprinse în intervalul 0 – 200 μs e preferabilă utilizarea unei eşantionări în paşi egali (de exemplul. 5 – 10 μs).

prin combinarea tehnicii de recuplare heteronucleară CP cu metode de decuplare homonucleară a protonilor. În general. În dimensiunea directă se aplică transformata Fourier şi se obţin liniile de rezonanţă ale grupărilor chimice din compus. tehnica CP-MAS de recuplare a interacţiunii dipolare heteronucleare este în general înlocuită cu tehnici mai sofisticate [4. şi de prezenţa sau nu a ordonării în probele investigate. această secvenţă numită CPPI (Cross-Polarization Polarization-Inversion) are drept scop generarea unei 222 . care să ţină cont de detaliile structurale dorite. Figura 4: Set de date 2D obţinut în cazul compusului L-alanina.de tip SLF (Separated Local Field Spectroscopy): în cadrul acestora. 5]. iar în dimensiunea indirectă sunt ilustrate curbele CP corespunzătoare acestor grupări. se obţine o recuplare eficientă a interacţiunii dipolare heteronucleare. Aceste curbe au fost înregistrate după ce în prealabil puterile pe cele două canale rf au fost calibrate la condiţia n = -1 de matching Hartmann-Hahn. în condiţii de rotire a probei la unghi magic. cum ar fi metodele LG (Lee-Goldburg) sau FSLG (Frequency-Switched Lee-Goldburg). Metoda Remote Protons CP-MAS O nouă metodă RMN-S 2D de separare este bazată pe experimentul anterior. însă extinde domeniul acesteia de aplicabilitate prin încorporarea unei noi secvenţe în perioada de preparare.

stări iniţiale diferită de polarizarea uniformă 1H. 1m 1m if 1m ivp . Noua stare iniţială constă într-o distribuie neuniformă a polarizării protonilor. care poate fi creată cu ajutorul configuraţiei experimentale formată din cele două blocuri CP ale secvenţei CPPI de durate bine determinate.0) .remote protons CP-MAS experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 (p16 ph1):f1 (p16 ph6):f2 (vp ph1):f1 (vp ph8):f2 1u pl12:f2 . p15 şi p16. iar faza celui de-al doilea bloc este inversată în raport cu faza primului.cp (TopSpin 2. Figura 5: Reprezentarea schematică a experimentului RMN 2D „Remote Protons CP-MAS” de investigare a transferului de polarizare 1H-13C de la protonii nelegaţi chimic de catonii din probă # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/rem_prot_cp" .pl12 is used here with cw .pl12 is used here with tppm. and p30 the pulse 223 . cum este cazul experimentului CP-MAS clasic.go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu.

lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph4= 2 ph31= 0 2 2 0 1 3 3 1

Alternând fazele celor două pulsuri CP care formează secvenţa CPPI se creează o stare iniţială de polarizare egală cu zero atât pentru nucleul 13C, cât şi pentru protonii direct legaţi chimic de acesta. Ca o condiţie necesară pentru ca în curbele de transfer de polarizare să fie cuantificat doar procesul de transfer de la protonii îndepărtaţi, secvenţa CPPI trebuie să aducă simultan la zero polarizarea spinului central 13C şi a protonilor direct ataşaţi, în timp ce polarizarea protonilor îndepărtaţi este menţinută la o valoare cât mai mare. Pentru a verifica în ce măsură această condiţie este îndeplinită, am efectuat simulări numerice utilizând programul Spinevolution. În acest scop, sistemul de spini ales este format dintr-un nucleu 13C înconjurat de 7 protoni, care aparţin moleculei de L-Alanina. Pentru cazul grupării CH rezultatele analizei sunt prezentate în Fig. 6: în aceste grafice este ilustrată evoluţia polarizării pentru fiecare spin din sistem în funcţie de creşterea timpului de inversie, p17, şi pentru trei valori diferite ale frecvenţei de rotaţie, νR = 5; 8, respectiv 15 kHz. Pentru sistemul de spini utilizat, primul bloc CP are o durata fixă, p16 = 70 μs, corespunzătoare transferului maxim de polarizare de la protonul legat chimic de spinul central 13C. Dependenţa curbelor de polarizare

Figura 6: Simulări ale dependenţei polarizării de spin de timpul de inversie τ2 din secvenţa de pulsuri CPPI pentru υR = 5; 8 respectiv 15 kHz, în cazul grupării CH din L-Alanina. Prin linie continuă sunt reprezentate curbele de inversie ale polarizării pentru spinul 13C (cu negru), respectiv a protonului legat chimic de acesta (cu roşu). Cu linie punctată este reprezentată polarizarea remanentă pe protonii îndepărtaţi, care aparţin grupării CH3 (albastru), respectiv NH3 (verde) din sistemul de spini considerat.

224

din Fig. 6 arată că polarizările din cadrul grupării CH (adică nucleului 13C şi a protonul sau direct ataşat) pot fi aduse simultan la zero pentru frecvenţe de rotaţie a probei mai mari decât 5 kHz, iar valoarea efectivă a duratei pulsului p17 pentru care această condiţie este îndeplinită depinde în mod explicit de valoarea frecvenţei de rotaţie: de exemplu pentru νR = 8 kHz se obţine un puls de contact p17 cu o durată de 42 μs. În măsura în care starea iniţială dorită poate fi generată cu ajutorul secvenţei CPPI, curbele de transfer de polarizare înregistrate experimental prin incrementarea duratei celui de-al treilea bloc CP din Fig. 5 se consideră ca reflectă doar contribuţia protonilor îndepărtaţi. Pentru a verifica acest lucru, predicţiile teoretice referitoare la procesul de transfer de polarizare de la protonii îndepărtaţi realizat prin noua metodă Remote Protons CP-MAS, au fost testate experimental [6]. În acest scop, am extins configuraţia utilizată în simulări numerice la un sistem de 10 spini (9 protoni şi un nucleu 13C) din L-Alanina, iar curbele CP simulate au fost comparate cu cele experimentale. Molecula de L-Alanina a fost alesă deoarece poziţiile protonilor, şi implicit distanţele H-H şi C-H, sunt determinate precis, prin difracţie de neutroni (cu precizie de ±0.003 Å). Simulările numerice au fost efectuate considerând două cazuri distincte şi anume: în primul caz se consideră gruparea NH3 ca fiind rigidă, iar în cel de-al doilea caz aceeaşi grupare se consideră în regim de rotaţie rapidă în jurul axei sale. În ambele situaţii gruparea CH3 este considerată a efectua o mişcare de rotaţie rapidă. Prin compararea curbelor CP-MAS simulate cu cele experimentale (Fig. 7)

Figura 7: Comparaţia între curbele CP/MAS teoretice şi experimentale corespunzătoare nucleului 13C din gruparea CH din L-Alanina, obţinute prin utilizarea secvenţei CP clasice (curbele roşii), respectiv a secvenţei de transfer de la protonii nelegaţi (curbele cu albastru). Curbele experimentale sunt reprezentate prin cercuri, iar cele simulate prin linie punctată (pe un sistem format din 8 spini), respectiv linie continuă (sistem format din 10 spini). Gruparea CH3 se consideră a efectua o mişcare de rotaţie rapidă în ambele cazuri, iar gruparea NH3 se consideră în aproximaţie rigidă în (a), respectiv în regim de rotaţie rapidă în (b).

225

se observă o foarte bună concordanţă în cazul în care gruparea NH3 este considerată quasi-rigidă. Totuşi, există unele mici diferenţe între curba calculată şi cea măsurată, diferenţe care cel mai probabil se datorează faptului că gruparea NH3 efectuează în realitate o mişcare de rotaţie lentă (la scală de timp a procesului de transfer de polarizare, de ordinul µs). Cea mai importantă concluzie care rezultă în urma comparării efectuate este sensibilitatea crescută a curbei Remote CP-MAS la dinamica moleculară prezentă în sistemul molecular studiat, în timp ce curba CP clasică nu este atât de sensibilă la detalii ale mişcării moleculare caracteristice grupării NH3.

3. Metode RMN-S 2D de corelare 13C-13C
Metoda Proton Driven Spin-Diffusion Metoda RMN-S 2D numită Proton Driven Spin Diffusion (PDSD) este o metodă de corelare: după cum se observă din schema experimentală asociată acestui experiment (Fig. 8), pe durata ambelor perioade de evoluţie indirectă şi directă, t1 şi t2, magnetizarea transversală 13C evoluează în condiţii de decuplare heteronucleară prin TPPM aplicată pe canalul protonilor şi rotaţie a probei în jurul unghiului magic, astfel încât ambele dimensiuni spectrale în spectrul RMN 2D vor codifica preponderent informaţii cu privire la deplasările chimice izotrope ale carbonilor din sistemul molecular investigat (cu o lărgire reziduală determinată de imperfecţiunea metodei de decuplare). Pe durata perioadei de mixing, se generează o stare de polarizare longitudinală

Figura 8: Reprezentarea schematică a experimentului RMN 2D „Proton Driven Spin-Diffusion” (PDSD) de investigare a transferului de polarizare 13C-13C mediat de interacţiunea dipolară cu protonii

226

diferenţială, care va fi transferată între spinii 13C între care există cuplaje dipolare suficient de puternice. Din această cauză, în afară de peakurile diagonale, în spectrul RMN 2D obţinut prin metoda PDSD apar şi cross-peakuri de corelaţie între oricare două poziţii chimice distincte între care se stabileşte transfer de polarizare (spin diffusion), cu intensităţi care depind de distanţa la care se află nucleele 13C corespunzătoare.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/sp-diff" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 pl4:f1 1u do:f2 (p1 ph4):f1 d5 (p1 ph5):f1 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0 lo to 2 times td1 exit

; tau mix ;pl12 is used here with tppm, and p30 the pulse

ph3= 1 3 ph1= (4) 0 0 2 2 ph2= 0 ph4= 0 0 0 0 0 0 0 0 2 2 2 2 2 2 2 2 ph5= 1 1 1 1 3 3 3 3 ph31= 0 2 2 0 1 3 3 1

Transferul de polarizare 13C-13C în experimentul PDSD este iniţiat de interacţiunile dipolare homonucleare între spinii nucleari corespunzători, însă el se produce prin intermediul protonilor situaţi între aceşti carboni. Deoarece aceste cuplaje dipolare C-C sunt în general slabe, durata perioadei de mixing, d5 – în secvenţa de pulsuri ilustrată mai sus, trebuie să fie 227

relativ mare, între câteva sute de µs până la 10-100 ms, pentru a avea un transfer eficient în domeniul de distante 2-5 Å. Din această cauză, metoda este preponderent utilizată pe probe marcate uniform cu 13C: cu toate acestea, există şi câteva cazuri în care PDSD a fost demonstrat şi pe probe cu 13C în abundenţă naturală, însă în aceste cazuri este nevoie de durate de mixing de ordinul secundelor pentru a identifica cross-peakuri cu intensităţi măsurabile. Cu privire la implementarea practică a unui experiment RMN 2D, introduse prin acest exemplu, trebuie menţionate următoarele aspecte: (i) sintaxa ph1= (4) 0 0 2 2 utilizată în programul de pulsuri asociat secvenţei PDSD pentru faza pulsului de contact p15 pe canalul 13C specifică procedura numită TPPI (Time Proportional Phase Incrementation) aplicată pentru înregistarea semnalului în cuadratură pe dimensiunea indirectă – în practică înseamnă că la fiecare experiment nou în dimensiunea indirectă fazele vor fi incrementate cu 3600/4 = 900 faţă de experimentul anterior (adică dacă pentru primul FID din setul de date 2D se utilizează fazele 0 0 2 2 pentru pulsul p15, al doilea FID va avea fazele 1 1 3 3, şi aşa mai departe; (ii) pasul temporal în dimensiunea indirecta este denumit in0 (increment delay 0), iar durata totală de achiziţie indirectă este notată cu aq1, şi se calculează înmulţind incrementul in0 cu numărul de puncte al semnalului înregistrat în dimensiunea indirectă, respectiv td1.

Figura 9: Spectru 13C CP-MAS pe L-Tirozina HCl, şi o reprezentare schematica a atribuirii liniilor pentru cele 7 poziţii chimice distincte ale carbonilor din molecula

228

În final vom ilustra utilizarea metodei PDSD cu rezultatele experimentale obţinute în cazul particular al compusului L-Tirozina HCl, marcată uniform cu 13C. Mai întâi prezentăm în Fig. 9 spectrul 13C RMN-S 1D obţinut prin CP-MAS la o frecvenţă de rotaţie a probei de 10 kHz. Atribuirea liniilor spectrale corespunde indexării poziţiilor de carbon din reprezentarea schematică a moleculei de L-Tirozina inclusă în aceeaşi figură. Am ales acest caz particular pentru că ne permite comportaţii în cadrul unor domenii de distanţe internucleare 13C-13C scurte (1.5 Å – între carboni direct legaţi chimic), medii (3-4 Å, de exemplu între carbonii alifatici şi cei de pe inelul benzenic), şi respectiv lungi (4-5.5 Å, între C1 şi C7 sau C8). Posibilitatea de a estima astfel de distante C-C din spectre PDSD de corelaţie 13C-13C este ilustrată în continuare prin exemplele prezentate în Fig. 10. Primul corespunde unei durate de mixing scurte, de 300 µs, şi evidenţiază faptul că la această scală de timp transferul de polarizare este eficient doar pe distanţe scurte, între carbonii direct legaţi chimic. Utilitatea practică a unui asemenea spectru este evidentă, respectiv identificarea conectivităţilor chimice în cazul unui compus nou, şi pe această cale este un instrument extrem de util în procesul de atribuire spectrală.

Figura 10: Spectre RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina aplicând metoda PDSD; ele ilustrează dinamica procesului de transfer de polarizare la durate de mixing scurte (300 μs), şi respectiv lungi (5 ms)

Cel de-al doilea spectru PDSD ilustrat în Fig. 10 corespunde unei perioade de mixing mult mai mari, de 5 ms, şi este reprezentativ pentru situaţia în care transferul de polarizare se reduce pe distanţe mult mai mari, până la 5 Å, după cum se poate observa din prezenţa peakului de corelaţie C1-C7. Astfel de spectre sunt utile pentru a extrage constrângeri structurale utile pentru investigarea conformaţiei moleculare în sistemul investigat. 229

Metoda CHHC Metoda CHHC pe care o vom discuta în continuare permite determinarea distanţelor 1H-1H, cu rezoluţie înaltă datorită implementării în cadrul spectroscopiei RMN-S 2D de corelaţie 13C-13C. Metoda este demonstrată efectiv pe L-Tirozina·HCl sintetizată sub formă poli-cristalină şi marcată uniform cu 13C. L-Tirozina·HCl a fost aleasă drept sistem model deoarece spectrul 13C RMN-S 1D prezintă o rezoluţie suficient de bună pentru a putea separa liniile corespunzătoare tuturor grupărilor chimice din molecula (Fig. 9), iar structura sa cristalină este bine caracterizată. În Fig. 11 este ilustrată secvenţa de pulsuri asociată metodei CHHC. Experimentul începe cu prepararea unei stări iniţiale prin transfer de polarizare prin CP de la 1H la 13C. Polarizarea transversală astfel creată evoluează sub influenţa deplasărilor chimice izotrope al carbonilor pe durata perioadei de evoluţie indirectă, t1, în condiţii de decuplare heteronucleară prin TPPM pe canalul 1H. Polarizarea 13C care a evoluat cu deplasările chimice izotrope corespunzătoare fiecărei poziţii distincte din moleculă este apoi transferată prin intermediul unei perioade scurte (65 μs) de cross-polarizare (CP) a protonilor direct conectaţi chimic. Polarizarea transversală astfel obţinută este apoi adusă de-a lungul direcţiei z (este transformată în polarizare longitudinală) prin aplicarea unui puls π/2 asupra spinilor 1H. Deoarece polarizările 1H astfel obţinute nu au aceeaşi valoare la toţi protonii, pe durata perioadei de mixing, tmix, se va realiza o redistribuire a acestora prin intermediul aşa-numitului proces de schimb de magnetizare, şi se generează astfel cross-peakuri a căror intensitate este proporţională cu cantitatea de

Figura 11: Reprezentarea schematică a experimentului RMN 2D CHHC de investigare a transferului de polarizare 1H-1H codificat în spectre de corelaţie 2D 13C-13C

230

polarizare schimbată de protonii corelaţi. Deoarece schimbul de magnetizare se datorează interacţiunilor dipolare 1H-1H, intensitatea fiecărui cross-peak obţinut codifică informaţii cu privire la tăria cuplajului dipolar dintre protonii implicaţi si, implicit, cu privire la distanţele internucleare dintre aceştia. După parcurgerea etapei de mixing urmează transformarea polarizării longitudinale în polarizare 1H transversală (prin aplicarea a incă unui puls π/2 pe canalul 1H), iar aceasta apoi transferată către nucleele 13C direct conectaţi chimic (prin intermediul unei perioade scurte de CP, similară celei prin care s-a realizat transferul 13C->1H iniţial). În final, polarizarea transversală 13C este detectată sub formă de semnal RMN pe durata perioadei de evoluţie directă, t2. Detecţia semnalului se face de asemenea în condiţii de înaltă rezoluţie, adică se urmăreşte evoluţia polarizării transversale 13C sub acţiunea deplasărilor chimice izotrope asociate carbonilor din probă, în condiţii de decuplare heteronucleară prin TPPM.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chhc" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f2 1u pl3:f2 p3:f2 ph8 d5 p3:f2 ph9 1u pl2:f2 (p16 ph7):f1 (p16 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0

; tau mix

;pl12 is used here with tppm, and p30 the pulse

231

lo to 2 times td1 exit ph3= 0 0 2 2 1 1 3 3 ph1= (4) 1 ph2= 3 3 3 3 0 0 0 0 ph4= 3 1 ph5= 1 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph8= 0 ph9= 2 ph31= 3 1 3 1 0 2 0 2

Un spectru CHHC tipic este ilustrat în Fig. 12, unde este considerat cazul particular al spectrului 2D de corelaţie 13C-13C înregistrat la o valoare tmix de 50 μs, utilizând o fereastră spectrală care se limitează la carbonii protonaţi (indexaţi conform schemei din Fig. 9). Corelaţiile care se stabilesc între protonii asociaţi diferitelor poziţii de carbon din moleculă sunt identificate în spectrul CHHC prin apariţia cross-peakurilor care conectează poziţiile chimice corespunzătoare. Deoarece mecanismul de stabilire a corelaţiilor în spectre CHHC se bazează pe schimbul de magnetizare longitudinală 1H-1H determinat de interacţiunea dipolară, amplitudinea fiecărui cross-peak va fi o măsură a tăriei acestui cuplaj şi, implicit, a distanţei internucleare dintre protonii asociaţi poziţiilor de carbon corelate. Acest mecanism este exemplificat în Fig. 12 cu corelaţii ale carbonului A (a se vedea liniile punctate). În particular, se observă apariţia unui cross-peak intens între A şi carbonul C, însă este de remarcat de asemenea lipsa uni peak de corelaţie similar cu carbonul din poziţia B. Din punct de vedere calitativ, acest rezultat este în perfectă concordanţă cu distanţele intra-moleculare dintre protonii conectaţi chimic de aceştia, şi anume: 3.2 Å între protonii cei mai apropiaţi de carbonii A şi C, şi respectiv de 4.8 Å pentru ceilalţi doi protoni prezentaţi în exemplul din Fig. 12. O analiză cu caracter cantitativ relevantă pentru determinarea de distanţe 1H-1H cu ajutorul metodei CHHC trebuie însă să ia în considerare şi alte efecte care influenţează intensităţile cross-peakurilor din spectru: pentru aceasta am elaborat un model teoretic al dinamicii de spin în condiţii specifice experimentului CHHC [7]. Rezultatele modelării ne-au permis îmbunătăţirea procesului de analiză a datelor experimentale, prin introducerea de corecţii adecvate pentru o serie de procese perturbative, şi anume: (i) caracterul neselectiv al transferului de polarizare 1H<->13C pe durata blocurilor CP care “flanchează” perioada de transfer de magnetizate (tmix în Fig. 11), (ii) efectul protonilor care nu contribuie direct la semnalul RMN-S detectat (protonii care nu sunt legaţi chimic de carbon, şi respectiv protonii din molecule nemarcate izotopic cu 13C), şi 232

Figura 12: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcată uniform cu 13C aplicând metoda CHHC; spectrul a fost obţinut pentru o durată de mixing de 50 µs şi ilustrează modul în care dinamica procesului de transfer de polarizare 1H-1H (si implicit distanţa dintre protonii implicaţi) este codificată prin intensitatea cross-peakurilor corespunzătoare din spectrul de corelaţie 2D.

Figura 13: Curbe CHHC reprezentative pentru protoni cu contacte intermoleculare scurte (de exemplu protonul legat de C5 de pe inelul aromatic), şi respectiv lungi (protonii ataşaţi lui C2) în urma împachetării moleculelor de L-Tirozina în reţeaua cristalină (figura din dreapta)

233

În această figură ilustrăm comportamentul observat pentru transferul de polarizare în care sunt implicaţi protonii ataşaţi poziţiilor de carbon C2. Informaţia codificată în acest tip de spectre se referă tot la cuplajele dipolare 1H-13C. În mod similar cu metoda CHHC. efectul multiplicităţii protonice pentru diferite grupări chimice din sistem (CH. unde transferul de polarizare este utilizat pentru a codifica cuplajele dipolare 1H-1H. metoda CHCC se aplică în cazul compuşilor uniform marcaţi cu 13C. Figura 14: Reprezentarea schematică a experimentului RMN 2D CHCC de investigare a transferului de polarizare 1H-13C codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chcc" . Corecţiile introduse conduc la creşterea semnificativă a gradul de precizie cu care sunt estimate distanţele proton-proton din spectre RMN-S de tip CHHC. CH3). în particular prin intermediul aşa-numitelor curbe CHHC extrase dintr-un set de astfel de spectre înregistrate pentru diferite valori ale timpului de mixing (Fig. 13). adică spectre de înaltă rezoluţie.cp (TopSpin 2. CH2.0) 234 . am proiectat şi implementat practic un nou tip de experiment de corelare 13C-13C. iar procesul care stă la baza experimentului CHCC este şi în acest caz transferul de polarizare proton-carbon.(iii). şi respectiv C5 din molecula de L-Tirozină. care sunt utilizate în mod tradiţional pentru investigaţii structurale bazate pe determinarea de distante C-H. Metoda CHCC Având în vedere rezoluţia spectrală limitată a protonilor în experimente RMN-S 2D de tip HETCOR. numit CHCC: acesta prezintă avantajul de a cuantifica pe ambele dimensiuni spectrale deplasări chimice ale nucleelor 13C.

14) constă în trei blocuri CP distincte. Pentru a obţine rezoluţie înaltă. astfel încât polarizarea fiecărui 13C este transferată în mod selectiv doar către protonul (protonii) direct legaţi. dintre care ultimele două formează perioada de mixing a experimentului.13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f1 (p17 ph7):f1 (p17 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu.. polarizarea de spin va evolua în condiţii de decuplare heteronucleară prin TPPM. Pe durata celui de-al doilea bloc CP din secvenţa de mixing transferul de polarizare 1H-13C se realizează în mod clasic. cât şi în cea indirectă. atât în dimensiunea directă. Primul bloc CP din perioada de mixing este unul de durată scurtă.pl12 is used here with tppm. 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 3 1 3 1 3 1 3 ph1= (4) 0 ph2= 0 ph4= 1 ph5= 0 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 . 235 . and p30 the pulse Secvenţa de pulsuri corespunzătoare metodei CHCC (Fig. astfel încât liniile de rezonanţă specifice fiecărei grupări chimice să fie separate. Informaţii cu privire la eficienţa procesului de transfer de polarizare de la nuclee individuale 1H la toate nucleele 13C aflate în vecinătate sunt codificate în perioada de mixing.

236 .către toate nucleele de carbon aflate în vecinătate. şi respectiv 1 ms (b). informaţiile extrase în urma aplicării schemei experimentale CHCC sunt codificate în spectre 2D de corelaţie 13C-13C. spectrele 1D de mai jos reprezintă felii de-a lungul dimensiunii directe ce corespund poziţiilor de carbon C2 şi C8. aleasă astfel încât polarizarea de spin să fie transferată de la nucleele de 13C doar la protonii direct legaţi. în funcţie de distanţele carbon-proton individuale. (ii) aplicarea unui bloc CP de durată scurtă. conform programului de pulsuri asociat schemei experimentale din Figura 14. iar prin asterisk este marcat în fiecare caz evoluţia cross-peakului specificat. Fig.5 ms (a). Cross-peakurile CHCC sunt generate conform următoarei scheme: (i) primul pas este format dintr-un bloc CP standard. Ca şi în cazul celorlalte două metode de corelare prezentate mai sus. urmat de evoluţia pe durata t1 a polarizării 13C sub acţiunea interacţiunii de ecranare chimică şi în condiţii de decuplare heteronucleră prin TPPM. 15. Sz. şi de polarizarea rămasă pe canalul carbonilor după pulsul CP scurt (din cauza că această polarizare nu se transferă în întregime protonilor direct legaţi) se impune ca asupra secvenţei CHCC să se aplice procedeul de ”phase cycling”. Deoarece selectivitatea metodei CHCC poate fi afectată de influenţa polarizării iniţiale a carbonului. (iii) incrementând durata ultimului puls CP (tmix) polarizarea 1H Figura 15: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcata uniform cu 13C aplicând metoda CHCC pentru valori ale ultimului puls de contact (p17) de 0.

6(a).13 Å (H7-C8). Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) Metoda INADEQUATE Metoda numită INADEQUATE (Incredible Natural Abundance Double Quantum Transfer Experiment) este o metodă RMN-S 2D de corelatie 13C-13C în cadrul căreia în perioada de preparare se generează coerente de două cuante (DQ – Double Quantum). şi C2-C7 (4. 4. respectiv 1 ms) spectrele codifică informaţii structurale despre contactele intramoleculare scurte. 5. la 5. se mai aplică o dată secvenţa INADEQUATE care va reconverti coerenţele DQ care au evoluat pe durata lui t1 în coerenţe 237 . adică ω1 şi ω2. C3-C5. pentru a refocaliza evoluţia cu deplasarea chimică 13C la sfârşitul procesului de generare a coerenţelor DQ.20 Å.13Cj. În prealabil. rata de transfer fiind proporţională cu 1/r3. Secvenţa de pulsuri asociată experimentului INADEQUATE este redată în Fig.68 Å). 16. Totuşi. Eficienţa transferului de polarizare către nuclee 13C individuale este reflectată în intensitatea cross-peakurilor obţinute. situate în intervalul 2. respectiv 1 ms sunt prezentate în Fig. respectiv (b).5.6 b). Distanţele intra-moleculare 1H-13C acoperă un interval larg de valori. iar în dimensiunea directă ele dau naştere semnalelor izotrope corespunzătoare ambilor spini. cross-peakurile datorate corelaţiilor între spini aflaţi la distanţe mai mari sunt şi ele bine conturate.se transferă atât nucleelor 13C direct legate de protonii polarizaţi. aceasta este transformată în polarizare longitudinală care apoi este utilizată pe durata aplicării secvenţei INADEQUATE (Fig. Acest lucru arată că pentru timpii de mixing aleşi (tmix = 0.65 Å (H3-C8). utilizând cuplajul J dintre diferite poziţii chimice în molecula investigată. C3-C4 (3. Secvenţa INADEQUATE constă în două pulsuri de 900 separate de o evoluţie liberă pe durata perioadei de mixing. 16b) pentru a genera coerenţele DQ. iar la jumătatea acestei perioade se aplică un puls de 1800. cât şi celor aflate în vecinătate.9 Å). La o analiză atentă a spectrelor CHCC se poate observa că cross-peakurile cele mai intense (C7-C8.7 Å). ω1+ω2.5 ms. Experimentul generează polarizare transversală a spinilor 13C prin secvenţa CP-MAS: cu ajutorul pulsului de 900 aplicat după pulsul de contact pe canalul carbonului. de la 2. aceste coerenţe evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor corelaţi. Discuţia rezultatelor experimentale se va concentra doar pe distanţe intermoleculare proton-carbon mai mici de 6 Å. fiind în bună concordanţă cu datele teoretice (Figura 5. Spectrele bidimensionale CHCC ale L-Tyrozinei·HCl uniform marcate 13 cu C pentru timpi de mixing de 0. unde r este disţanta 1Hi . spre exemplu C7-C5(C4) (pentru distanţa C7-H5(H4) de 2. În dimensiunea indirectă.15 – 2. tmix. C2-C4) corespund celor mai mici distanţe internucleare 1H-13C.

13C-13C INADEQUATE experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u (pl12:f2) (pl4:f1) (p1 ph4):f1 1u cpd2:f2 (p1 ph5):f1 d5 (2p1 ph6):f1 d5 (p1 ph7):f1 238 .de tip Single Quantum (SQ).0) . 17 nu va apărea cross-peakul corespunzător coerentei ω1+ω3. cuplajul J are valori semnificative pentru a produce coerente DQ în general între poziţii direct conectate prin legături chimice: din aceasta cauză.cp (TopSpin 2. În cazul nucleelor 13C. codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/inadequate" . în exemplul de spectru INADEQUATE prezentat în Fig. Figura 16: Reprezentarea schematică a experimentului RMN 2D INADEQUATE utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 13C-13. adică între nucleele C1 şi C3.

ωi şi ωj. corespund formării unei coerenţe DQ care evoluează în dimensiunea indirectă cu frecvenţa ωi + ωj şi indică conectivitatea chimică directă între carbonii corespunzători 239 . 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 1 1 1 3 3 3 3 ph1= 0 ph2= 0 ph4= 3 3 3 3 1 1 1 1 ph5= (8) 0 2 4 6 ph6= (8) 0 2 4 6 ph7= (8) 4 6 0 2 ph8= 1 ph9= 1 ph10= 3 ph31= 0 2 0 2 2 0 2 0 Figura 17: Exemplu ilustrativ de spectru RMN 2D INADEQUATE: peakurile de corelaţie între două poziţii chimice.d0 (p1 ph8):f1 d5 (2p1 ph9):f1 d5 (p1 ph10):f1 1m do:f2 wr #0 HaltAcqu.

18 corespunde spectrului 13C INADEQUATE înregistrat pe acetatul de colesteril (C29H48O2). spectrul 13C unidimensional conţine 58 de linii RMN (fiecărei poziţii individuale a unui nucleu 13C ii va aparţine o linie de rezonanţă dublată). Un exemplu relevant pentru acest tip de aplicaţii practice ilustrat în Fig. în abundenţă naturală.Datorită particularităţilor sale. care conţine două molecule în unitatea asimetrică. Figura 18: Spectrul RMN 2D de corelare corespunzător acetatului de colesteril în abundenţă naturală (2 molecule pe unitatea asimetrică) obţinut cu ajutorul secvenţei de pulsuri INADEQUATE 240 . În stare solidă. metoda INADEQUATE este intens utilizată în investigaţiile structurale din chimia organică. această moleculă prezintă o structură cristalină puternic ordonată. În urma analizei spectrului 2D INADEQUATE s-au determinat toate corelaţiile posibile între nucleele de carbon din moleculă. Datorită acestui fapt. în scopul stabilirii conectivităţilor chimice dintre diferitele grupări prezente în molecula investigată. majoritatea situate în regiunea spectrală 10 – 60 ppm. concluzionându-se asupra acurateţei metodei INADEQUATE în caracterizarea conectivităţilor chimice în sisteme moleculare complexe. în abundenţă naturală [8].

Spre deosebire de experimentul INADEQUATE prezentat anterior. BABA2. Drept urmare. schema generală a experimentului 1H-1H DQ-MAS (Fig. în cazul metodelor 1H-1H DQ-MAS coerenţele de două cuante se generează interacţiunile dipolare homonucleare 1H-1H recuplate pe durata perioadei de excitare şi reconversie cu ajutorul unor secvenţe de pulsuri specifice. iar altele aplicarea de pulsuri rf intense: toate au însă în comun sincronizarea duratei secvenţei de excitare DQ cu perioada de rotaţie a probei în jurul unghiului magic. 19) este aceeaşi ca şi în cazul INADEQUATE. codificat în spectre de corelaţie 2D 1H-1H. unele implicând acţiunea continuă a câmpurilor rf. În prezentul raport vom considera aşa-numita secvenţă BABA (Back to Back) [9]. şi respectiv de a le reconverti la coerenţe SQ.Metoda 1H-1H DQ-MAS Metodele bazate pe excitarea coerentelor DQ se pot aplica şi în cazul protonilor. care conţine două cicluri BABA cu fazele relative astfel proiectate încât să minimizeze efectul evoluţiei sub acţiunea deplasărilor chimice 1H pe Figura 19: Reprezentarea schematică a experimentului RMN 2D 1H-1H DQ-MAS utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 1H-1H . unde rezoluţia spectrală este asigurată prin rotaţia rapidă în jurul unghiului magic. singura deosebire fiind secvenţa de pulsuri aplicată pentru a genera coerenţe DQ. În practică. detectabile direct. condiţie necesară pentru a realiza o recuplare eficientă a interacţiunilor dipolare 1H-1H. pentru excitarea coerenţelor ilizează secvenţa numita BABA2 241 . şi respectiv o versiune perfecţionată a ei. au fost dezvoltate numeroase metode de excitare DQ pentru protoni.

19 sunt tmix = 2tBABA = 2τR # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/dq-baba" .durata perioadei de excitare/reconversie.cp (TopSpin 2.0) . astfel încât duratele implicate în Fig. având o separare între ele egală cu o jumătate de perioadă de rotaţie.1H-1H DQ-MAS experiment 1 ze 2 d1 1u pl1:f1 (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph2):f1 d1 (p1 ph3):f1 1u (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph3):f1 d1 (p1 ph2):f1 d0 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph5):f1 d1 (p1 ph6):f1 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph6):f1 d1 242 . Fiecare ciclu BABA conţine două perechi de pulsuri de 900 alipite între ele.

NH3). ωi+ωj. unde am utilizat secvenţa BABA2. la o frecvenţă de rotaţie a probei în jurul unghiului magic de νR = 30 kHz.ω3) corespunzătoare coerenţelor DQ care se generează între protoni aparţinând grupărilor (CH3. NH3). CH). de exemplu ωi şi ωj în dimensiunea directă. în dimensiunea indirectă (DQ). 243 . datorită multiplicităţii protonilor dintr-o anumită grupare chimică. 1m 1m if 1m in0 lo to 2 times td1 exit ph1= (4) 0 2 4 6 ph2= (4) 2 4 6 0 ph3= (4) 4 6 0 2 ph4= 0 ph5= 1 ph6= 3 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 Aplicaţiile practice ale metodei 1H-1H DQ-MAS vor fi ilustrate în continuare.ω2).(p1 ph5):f1 go=2 ph31 wr #0 HaltAcqu. (ω1. Eficienţa maximă s-a obţinut pentru o singură secvenţă BABA2.ω3) şi (ω2. În spectrul DQ-MAS al L-alaninei acesta este cazul pakurilor de corelaţie (ω1. (CH3. 20). Analizând spectrul se constată şi similarităţi cu un spectru tipic INADEQUATE. considerând cazul relativ simplu al spectrului de corelaţie 1H-1H înregistrat pe L-alanina (Fig. Deosebirile sunt legate de faptul că în spectre 1H-1H DQ-MAS pot apărea şi peakuri diagonale. dar şi din cauza tăriei mari a cuplajelor dipolare 1H-1H care permit evidenţierea corelaţiilor dintre protonii CH (ω2) aparţinând la două molecule vecine (corelaţii intermoleculare): în cazul peakurilor diagonale ωj. dar şi deosebiri. cum este cazul grupărilor CH3 (ω1) şi NH3 (ω3) în spectrul din Fig. 20. asemănările sunt legate de faptul că liniile de rezonanţă corespunzătoare spinilor 1H corelaţi. Concret. evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor. frecvenţa de evoluţie în dimensiunea DQ va fi de 2ωj. şi respectiv (CH.

pentru coerenţele de două cuante generate între grupările CH-CH3.a. De exemplu.5 u. care implică o distanţă intramoleculară de ~2.a. Pentru cross-peakurile (ω1+ ω2. şi respectiv de 18. Prin comparaţie. între protonii grupării CH3. de ~1. Informaţii mai cantitative cu privire la distanţele internucleare dintre protonii din probă se pot obţine din analiza spectrelor 1H-1H DQ-MAS comparând intensităţile relative ale peakurilor de corelaţie. intensitatea de ~ 4 u. obţinută pentru peakul diagonal (ω2. care formează o reţea compactă de spini. şi anume 19 u.6 Å.Figura 20: Spectrul RMN 2D de corelare 1H-1H DQ-MAS achiziţionat utilizând secvenţa BABA2 pe L-Alanina.3 Å între protonii grupării CH aparţinând la două molecule vecine din reţeaua cristalină a L-Alaninei.3 Å.a în cazul grupărilor CH-NH3 cu distanţa intramoleculara de ~2. reflectă o distanţă semnificativ mai mare de ~2. ω2). ω2) şi (ω3+ ω2. În consecinţă. peakului diagonal (2ω1. o analiză riguroasă a intensităţilor relative ale peakurilor din spectrul 2D 1H-1H DQ-MAS ne poate conduce la 244 . ω2)..a. intensităţile sunt comparabile. corespunde unor distanţe intranucleare mici. ω1) a cărui intensitate în unităţi arbitrare este de 20 u.7 Å. În primul caz.

Wokaun. Madhu. D. A. Graf. J. Tripon. SolidSate Nuclear Magnetic Resonance 35 (2009) 2-11 R. 5. T. Magn. R. Ladizhansky. Bodenhousen. 2. Ramamoorthy. Elsevier Science 2007 P. 199 (2009) 173. M. Narasimhaswami. A. G. rezultând caracterul aplicativ al acestei metode în caracterizarea structurală a compuşilor moleculari în fază solidă.K.W. Lett. Magn. Emsley. 6. A. Oxford 1987 C. Oxford University Press. X. Hafner.M. Wu. Filip. J. C. G. J. 5. J. Reson. Filip. K. C. H..H. Principles of Nuclear Magnetic Resonance în One and Two Dimensions. J. Steuernagel. Griffin. Gullion. R. Magn. S. Filip. Aluas. Lesage. Brown. 8. Demco. A. Aluas.G. Filip. 9. Reson A 109 (1994) 270-272. De Paepe..cuantificarea tuturor proximităţilor proton-proton din proba investigată. Opella. Chem. C.J. C. X. Lee. S. V. A 122 (1996) 214. Reson. 4. Introduction to High-Resolution Solid-State NMR. M.. S. M. Feike. Phys. ChemPhysChem 5 (2004) 869-875. S. Magn. Tripon.E. D. 3. Bibliografie 1. Reson. 408 (2005) 118-122.R. T. P. Ernst. L. Spiess. Ramamoothy. Griffin. 183 (2006) 68. 7. 245 .

...265 În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca se află două spectrometre de rezonanţă magnetică nucleară (RMN) performante şi anume: .......... doar acele spectroscopii care au scala lungimilor apropiată frecvenţelor de rezonanţă caracteristice.......... Prezentarea principiului tehnicii experimentale Rezonanţa magnetică nucleară este un fenomen ce apare atunci când nucleele de un anumit tip se găsesc într-un câmp magnetic static şi sunt expuse la un al doilea câmp magnetic. Spectroscopia de rezonanţă magnetică nucleară are loc în regiunea undelor radio şi este asociată cu tranziţiile energetice ale spinilor nucleari..........4 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide ........................... Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu . O particularitate importantă asociată cu tehnica RMN este sensibilitatea sa la mediul chimic............. oscilant......................spectrometrul Bruker Avance 400 cu câmp central de 9........264 4...... Prezentarea principiului tehnicii experimentale ....spectrometrul Bruker Avance 600 cu câmp central de 14 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide Utilizarea acestor spectrometre de către studenţii Facultăţii de Fizică presupune o stăpânire temeinică a noţiunilor şi principiilor de bază din RMN........246 2.................................................. cunoaşterea părţilor componente ale unui spectrometru... Mihai Vasilescu Cuprins 1..................... prezentăm mai jos protocolul de lucru pentru aceste echipamente....... Bibliografie .............................253 3........... 246 ...........Rezonanţa magnetică nucleară pe sisteme lichide Lect............... vor răspunde acestor efecte. Deoarece legăturile chimice sunt asociate cu valenţa ionilor şi structura moleculară............... dr........ precum şi înţelegerea modului în care acestea funcţionează şi a rolului fiecărei părţi..... 1.. În scopul facilitării activităţilor de practică experimentală pentru utilizarea acestor echipamente de ultimă generaţie.......... Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente ........

Domeniul corespunzător pentru C13 este 25-150MHz. Valorile frecvenţelor cu care se lucrează în RMN fac însă folosirea lor foarte anevoioasă.015 1.53 24. Cele mai importante interacţii sunt interacţia de deplasare chimică pentru toate nucleele şi interacţia cuadrupolară pentru nucleele cu I>1/2. simetria locală şi numerele de coordinare.63 0. în experimentele de RMN.47 0. Proprietăţi RMN ale unor nuclee într-un câmp de 9. Pentru 247 . Astfel se pot obţine date despre unghiurile dintre legături şi lungimea legăturilor.108 99. De obicei. Aceste diferenţe mari ale frecvenţelor de rezonanţă (unele exemple sunt date în Tabelul 1) fac posibilă observarea nucleelor diferitelor elemente relativ independent unele de altele. tipic. Tabel 1. Toate nucleele cu moment magnetic sunt capabile să ofere informaţii detaliate despre ordinea locală.Spectroscopia RMN dă date despre toate nucleele rezonante din sistem.37 0. Pe lângă câmpul magnetic static.3-14 T. alte posibile nuclee rezonante fiind excluse prin reglarea spectrometrului pe domeniul de frecvenţe de interes.395 T: Izotop 1H 2H 13C 14N 15N 17O 31P 35Cl 37Cl 43Ca Frecvenţa RMN (MHz) 400 61 100 29 40 54 161 39 32 27 Abundenţa naturală (%) 99. câmpul efectiv din zona nucleului este influenţat şi de câmpurile locale interne. câmpul magnetic este în domeniul 2. în diverse medii chimice. precum şi despre procesele dinamice.037 100 75.98 0. ele vor fi multe de acest fel. despre atomii învecinaţi (din prima şi a doua sferă de coordinare). presupune reprezentarea grafică a unui bilanţ energetic.145 Rezonanţa magnetică nucleară. care conţin informaţii specifice structurii locale. Spectroscopia RMN este o metodă foarte utilă pentru studiul structurii locale şi a dinamicii constituenţilor compuşilor. ca orice metodă spectroscopică. Într-un spectru RMN pot fi înregistrate semnale de la un singur tip de nuclee. Pentru proton aceasta corespunde unor frecvenţe de rezonanţă între 100-600MHz.

Această abordare este mai uşoară din punct de vedere tehnic şi are la bază ecuaţia: ω0 = -γB0 echivalentă cu parcurgerea frecvenţelor. pentru rezonanţa magnetică nucleară. acesta va fi un sistem de bobine acordate.simplificare s-a ales ca primă soluţie folosirea unor etaloane. Îngustimea liniilor în cazul lichidelor se datorează mişcării moleculare rapide [1]. de obicei. ci prin iradierea cu un câmp electromagnetic slab. Îngustimea extraordinară a liniilor RMN este cea care face ca efectele deplasărilor chimice mici să fie măsurabile şi utile. ea fiind rezultatul energiei foarte joase implicate în experimentele RMN. De obicei. Această abordare este adesea utilizată în RES. În aceste 248 . de frecvenţă fixată. Pentru a observa semnalele pot fi urmate două strategii. acum reprezentându-se în loc de scală energetică propriu-zisă. de ordinul zecilor sau sutelor de ppm. Pentru a urmări experimentul este necesar să folosim un sistem de coordonate care se roteşte cu frecvenţa Larmor ω0. substanţe de referinţă. Acesta este cunoscut ca sistemul rotativ (“the rotating frame”). aceasta nu se face prin parcurgerea domeniului de frecvenţe. şi modificând câmpul magnetic principal. Prima este similară ca şi concepţie cu alte forme dispersive de spectroscopii şi implică o analiză (“sweep”) spectrală în care fiecare condiţie de rezonanţă posibilă (echivalentă absorbţiei) este căutată secvenţial. A doua abordare demonstrează chiar mai clar distincţia dintre rezonanţa magnetică nucleară şi alte spectroscopii şi exemplifică folosirea descrierii clasice a câmpului de radiaţie. Baza experimentului de rezonanţă magnetică este plasarea probei într-un câmp magnetic uniform intens şi asigurarea iradierii ei cu un câmp electromagnetic printr-un sistem potrivit de emisie şi recepţie a frecvenţelor radio sau de microunde. a căror frecvenţă de rezonanţă să fie considerată nivelul zero al scalei energetice. De obicei. o scală a deplasărilor chimice date de formula: δ = ν −ν 0 ν0 Unitatea de măsură pentru deplasările chimice este "partea per milion" sau "ppm". dar a devenit rară în spectroscopia RMN. Deplasările chimice întâlnite în RMN sunt. Ulterior s-a recurs la un artificiu.

În sistemul rotativ. După un “puls de 180” sensul magnetizării se inversează complet. Aceasta corespunde unei inversii a populaţiei nivelelor energetice şi este. o situaţie de non-echilibru. Revenirea la echilibru este caracterizată de un timp. B1. Figura 1. care este direcţia câmpului magnetic principal. Radiaţia electromagnetică este descrisă de componenta sa magnetică ca un vector la un anumit unghi faţă de direcţia câmpului. dat de: θ = ω1 t = . aplicăm un puls cu durata jumătate. Dacă. Figura 1(b) ilustrează acest proces pentru un unghi de 1800. în loc să aplicăm un puls de 180. În această situaţie fiecare vector nuclear individual (vectori care sunt însumaţi pentru a da magnetizarea macroscopică) 249 . T1. cunoscut ca plan transversal (fig 1c). (a) Magnetizarea (M0) în sistemul rotativ în prezenta câmpului de radiofrecvenţa (B1). B0 poate fi ignorat şi este necesar doar să considerăm efectele câmpului de radiaţie. (c) Magnetizarea după un puls de 900. Situaţia este ilustrată în figura 1(a) [2]. cunoscut ca timp de relaxare spin-reţea sau timp de relaxare longitudinală.γ B1 t aşa că magnetizarea poate fi înclinată la orice unghi doar prin simpla aplicare a unui puls electromagnetic de putere şi durată cunoscute. (b) Magnetizarea după un puls de 1800. în mod clar.condiţii magnetizarea nucleară poate fi descrisă de un vector paralel cu direcţia z. Când aplicăm B1 magnetizarea răspunde precesând în jurul lui B1 cu o frecvenţă ω1 dată de: ω1 = . atunci magnetizarea se roteşte cu 90 de grade în planul x’y’. atunci va părea statică în sistemul de coordonate astfel ales. Dacă radiaţia electromagnetică este de aceeaşi frecvenţă cu frecvenţa Larmor.γ B1 Unghiul la care se mişcă magnetizarea este θ.

FID) şi poate fi transformat într-un spectru printr-un proces matematic cunoscut sub numele de transformare Fourier. Acest proces. ν½ . (c) şi (d) arată evoluţia în timp după un puls de 900. această relaxare poate fi adesea caracterizată ca un proces exponenţial cu constanta de timp T2. Relaxarea transversală – fiecare săgeată reprezintă un vector magnetizare nucleară. Acolo unde avem un număr de rezonanţe deplasate se obţine un semnal oscilator complicat al relaxării. Acest proces este ilustrat în figura 3. Pentru o descreştere exponenţiala spre echilibru. (a). atunci setul de spini nucleari. T2 este legat de lărgimea liniei la jumătatea înălţimii peak-ului. numit timp de relaxare spin-spin sau timp de relaxare transversală. În lichide. Semnalul obţinut prin relaxare se referă de obicei la relaxarea liberă a magnetizării (free induction decay. prin: 250 . vor produce variaţii aleatoare ale frecvenţei Larmor. sistemul începe să se relaxeze. Când apar deplasarea chimică (“chemical shift”) sau rezonanţele cuplate scalar. corespunzând liniilor deplasate. Efectele de câmp aleatoare. este ilustrat în figura 2. numit relaxare spin-spin sau transversală.este forţat de câmpul de radiaţie să se rotească coerent cu frecvenţa Larmor ω0. care vor face ca vectorii nucleari individuali să se mişte cu viteze diferite faţă de viteza sistemului rotativ. Pe măsura trecerii timpului suma vectorilor se va reduce la zero. Figura 2. Există o relaţie importantă între relaxarea transversală şi lărgimea liniei. oscilează cu o frecvenţa egală cu diferenţa dintre frecvenţa de referinţă şi frecvenţa de rezonanţă a semnalelor deplasate. dependente de timp. Imediat după ce aplicarea pulsului încetează. Cum aceste câmpuri sunt aleatoare. vom avea tot atâtea nuclee ce se mişcă mai rapid ca şi numărul celor ce se mişcă mai lent. (b).

care este acum metoda aleasă în cele mai multe experimente RMN. intensitate (a) timp (b) frecventa Figura 3. cu atât linia observată este mai largă. În multe cazuri. cu cât relaxarea se produce mai rapid. din cauza lărgimii liniei deplasarea chimică sau informaţiile privind cuplajul sunt obscure sau chiar pierdute. Transformarea Fourier a unui FID (a) într-un spectru (b) Tehnica transformării Fourier. respectând condiţia ca pulsul excitaţiei să acopere o lărgime de bandă potrivită. toate frecvenţele sunt excitate în mod 251 .ν½ = 1/(πT2) de aceea. Principiul unei astfel de metode este ca. este un exemplu de metodă multiplex.

atunci contribuţia semnalelor mici poate fi pierdută cu totul. vor avea doar o mică contribuţie la FID. În cazul RES. Dacă nu avem o rezoluţie suficientă în convertorul analog – digital. Dacă aceasta este foarte scurtă. de interes. acest avantaj este foarte consistent. avantajul semnal/zgomot al metodei transformatei Fourier asupra metodei CW pentru acelaşi timp de achiziţie este N unde N este numărul de frecvenţe. atunci liniile spectrale sunt foarte largi şi digitizarea devine o problemă. În aceste condiţii s-ar putea să fie avantajoasă folosirea metodei CW cuplată cu tehnici de scanare rapidă. Ca o consecinţă. de exemplu. în metoda undelor continue (continous wave. aceasta limitează metoda transformatei Fourier la doar un grup restrâns de sisteme. Metoda transformatei Fourier nu este însă lipsită de probleme. A doua problemă este direct legată de avantajul multiplexului. În RMN pot apare dificultăţi cu semnalele solidelor. Aceasta poate fi o problemă importantă în spectrele RMN pentru protoni. Cum toate frecvenţele contribuie la fiecare punct. deoarece semnalele mici. un semnal foarte intens în anumite părţi ale spectrului va creşte intensitatea tuturor punctelor din FID. Vedere generala asupra spectrometrului 252 . pot apărea probleme cu digitizarea semnalului. Figura 4. cu linii foarte înguste. În cazuri ideale. CW tinde să fie mult mai lentă decât metoda transformatei Fourier. iar partea iniţială a semnalului este distorsionată de revenirea sistemului de recepţie după pulsul de radiaţie. Deoarece N este de obicei mii sau zeci de mii. Ca rezultat al acestei metode.egal şi toate contribuie la toate punctele din FID. atunci când se fac analize pe alimente. CW) frecvenţele sunt excitate secvenţial. Dimpotrivă. unde apa este adesea componentul majoritar şi poate domina spectrul. Prima este durata FID-ului.

Interpretarea acestor spectre ne permite identificarea structurii probelor analizate. Secţiune schematică printr-un magnet RMN 2. anume a izotopilor 1H şi 13C.2 K) • straturi termoizolante şi ecranante • azot lichid (T = 77. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Cel mai adesea analizele probelor lichide se concentrează pe studiul spectrului RMN corespunzător nucleelor de hidrogen sau carbon. Analizele se fac utilizând recipienţi speciali pentru analize RMN. bobina.4 K) • straturi termoizolante şi ecranante • orificiu central vertical (îngust sau larg) Figura 5. eprubete de quartz de 5 mm diametru. Dizolvarea probelor se face în solvenţi deuteraţi. spectrometrul realizând fixarea câmpului cu ajutorul nucleelor de deuteriu.Magnetul • cea mai scumpă parte a spectrometrului • electromagnet din fire supraconductoare • câţiva km de fir • solenoid. 253 . bobine helmholtz • heliu lichid (T = 4.

În acelaşi timp. Proba: ciclohexan (C6H12) . • C6D6 (benzen deuterat) are frecvenţa de rezonanţă de 7. respectiv triplet la 77.16 ppm pentru 1H. respectiv 128.156 ppm pentru 1H. respectiv 0 ppm pentru 13C şi 0 ppm pentru 29Si.26 ppm pentru 1H. respectiv 39.47 ppm pentru 13C. respectiv 30 ppm şi 206 ppm pentru 13C.512 ppm pentru 1H.78 ppm pentru 1H. • D2O (apa deuterată) are frecvenţa de rezonanţă de 4. Astfel: • CDCl3 (cloroform deuterat) are frecvenţa de rezonanţă de 7.032 ppm pentru 13C. • TMS (tetrametilsilandeuterat) are frecvenţa de rezonanţă de 0 ppm pentru 1H. • C3D6O (acetona deuterata) are frecvenţa de rezonanţă de 2. solvenţii au şi rol de referinţă. Solvent: CDCl3 Figura 7. Redăm mai jos şi câteva exemple de analize 1H NMR pe probe relativ simple [3]: Figura 6. • DMSO (dimetilsulfoxid deuterat) are frecvenţa de rezonanţă de 2. Proba: benzen (C6H6).01 ppm pentru 13C. Solvent: CDCl3 254 .

Proba: toluen (C6H5CH3). Solvent: CDCl3 Figura 10.Figura 8. Solvent: CDCl3 255 . Solvent: CDCl3 Figura 9. Proba: acetona (CH3(C=O)CH3) . Proba: etil benzen (C6H5CH2CH3).

Solvent: CDCl3 Figura 12. Solvent: CDCl3 256 .Figura 11. Proba: apa (H2O) . Proba: etanol (CH3CH2OH) . Solvent: D2O Figura 13. Proba: metil etil cetona (CH3(C=O)CH2CH3).

Solvent: D2O Figura 15. Proba: etanol (CH3CH2OH). Proba: 1-propanol (CH3CH2CH2OH). Proba: 2-propanol ((CH3 )2CHOH).Figura 14. Solvent: CDCl3 Figura 16. Solvent: CDCl3 257 .

Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Solvent: CDCl3 Figura 18. Proba: piridina (C5H5N). Solvent: CDCl3 258 . Solvent: CDCl3 Figura 19. Proba: t-butanol ((CH3 )3COH).Figura 17.

deci triplet. De asemenea. acestea reprezentând de fapt intensitatea relativă a semnalelor şi fiind. diferenţa de populaţie poate fi crescută prin scăderea temperaturii probei. în general. Integrarea semnalelor pentru proba: metil etil cetona (CH3(C=O)CH2CH3).Pentru aceste exemple identificarea corespondenţei între semnalele de rezonanţă şi poziţia protonilor în moleculă se face relativ simplu. identificarea corespondenţei celor trei semnale de rezonanţă este completă. aşa cum se vede în figura 20: Figura 20. Senzitivitatea spectrometrului RMN este o măsură a numărului minim de spini detectabili. senzitivitatea este îmbunătăţită de creşterea câmpului magnetic utilizat [5]. Redăm mai jos şi câteva exemple de analize 13C NMR pe probe relativ simple: 259 . proporţionale cu numărul de nuclee care produc semnalele respective. Solvent: CDCl3 Raportul relativ al celor trei integrale este 2:3:3. Informaţii suplimentare se obţin dacă calculăm integralele liniilor de rezonanţă. în timp ce protonii grupării legate de CH2 dau semnal despicat (n+1). Cum semnalul RMN creşte odată cu creşterea diferenţei de populaţie dintre nivelele energetice. Astfel. Pentru a identifica semnalele celor doua grupări CH3 vom ţine cont de faptul că protonii grupării legate de C=O dau semnal simplu (singlet). corespunzător numărului de protoni legaţi de fiecare dintre nucleele de carbon. Analizele de tip 13C NMR vor utiliza diferite metode ce conduc la îmbunătăţirea semnalului RMN.

Proba: toluen (C6H5CH3). Proba: benzen (C6H6). Solvent: CDCl3 260 . Solvent: CDCl3 Figura 23. Proba: ciclohexan (C6H12) .Figura 21. Solvent: CDCl3 Figura 22.

Proba: acetona (CH3(C=O)CH3) . Solvent: CDCl3 Fiurag 26. Solvent: CDCl3 Figura 25. Proba: metil etil cetona (CH3(C=O)CH2CH3). Solvent: CDCl3 261 .Figura 24. Proba: etil benzen (C6H5CH2CH3).

Proba: 1-propanol (CH3CH2CH2OH). Solvent: CDCl3 262 . Solvent: CDCl3 Figura 28.Figura 27. Proba: etanol (CH3CH2OH) . Solvent: D2O Figura 29. Proba: etanol (CH3CH2OH).

Proba: t-butanol ((CH3 )3COH).Figura 30. Solvent: CDCl3 Figura 32. Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Proba: 2-propanol ((CH3 )2CHOH). Solvent: CDCl3 263 . Solvent: CDCl3 Figura 31.

4Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide.1-0. se observă şi semnalul corespunzător solventului la 77. peste probă. • se pune solventul în eprubetă.4 grame proba). 264 . acolo unde s-a utilizat ca solvent CDCl3. • se dă comanda „lift on” de la BSMS pentru a crea perna de aer pentru eprubeta. • se agită pentru dizolvarea probei. Etapele înregistrării spectrului RMN pe probe lichide la spectrometrul Bruker Avance 400 din dotarea laboratorului: • se ia o eprubeta de 5 mm diametru.5 ml solvent). Solvent: CDCl3 În toate spectrele de mai sus.01 ppm. la nevoie se încălzeşte uşor eprubeta pentru a facilita dizolvarea. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca. semnal foarte util şi pentru a calibra spectrul în funcţie de referinţă.Figura 33. până când coloana de lichid are aproximativ 4 cm înălţime (circa 0. Proba: piridina (C5H5N). 3. • se pune eprubeta în suportul special: • se aşează eprubeta cu suportul în dispozitivul special de reglaj al distanţei şi se aşează eprubeta astfel încât ulterior proba să fie în centrul câmpului magnetic. curată • se pune proba în eprubetă (circa 0. utilizabil pentru analiza probelor lichide. se află spectrometrul de rezonanţă magnetică nucleară (RMN) Bruker Avance 400 cu câmp central de 9. specială pentru analize RMN.

Aceasta se realizează cu comanda „popt” şi se referă în general la setarea duratei pulsului de excitare (p1) şi respectiv a timpului de relaxare dintre două achiziţii consecutive (d1). p.S. Anterior înregistrării unui spectru este posibil ca parametrii de achiziţie să necesite o optimizare. 5.D. 31. P. se dă comanda „lift off” şi proba coboară în magnet.se aşează eprubeta pe perna de aer. Vol. 4. spectrometrul va intra în modul „lock”. • se realizează reglajele de „shimm” făcând corecţiile necesare de la BSMS. Vol. măsurând integrala lor şi atribuind în final semnalele nucleelor. Belton.cis. Introduction to Magnetic Resonance. Joseph P. • • • • 4. A. • se setează parametrii de achiziţie. făcându-se automat corecţiile variaţiilor externe. 30. 1-60. Blumich. deci câmpul va fi fixat şi stabilizat. 1-18. • se alege programul de pulsuri dorit şi nucleul pe care se doreşte realizarea analizei RMN. Hornak. funcţie de structura moleculară. (1994).edu/htbooks/nmr/ Mihai Vasilescu. se centrează semnalul de „lock” în fereastra de control a BSMS-ului. McLachlan. marcând peak-urile de rezonanţă.rit. modificând în principal câmpurile Z1 şi Z2. • se fazează corespunzător. • se calibrează spectrul în funcţie de referinţa aleasă. Academic Press. se dă comanda „lock” şi se alege solventul potrivit. la nevoie se modifică şi Z3. • se realizează măsurătoarea efectivă alegând un număr de achiziţii potrivit pentru obţinerea unui raport semnal/zgomot suficient de bun. 2007 Carrington. • se dă comanda „wobb” şi din şuruburile speciale ale capului de sondă se reglează frecvenţa de rezonanţă pentru nucleul studiat. Annual Reports on NMR Spectroscopy. 3. X sau Y. R. Grimmer and B. p. 2. London (1967) 265 . (1995). Chapman and Hall. NMR Basic Principles and Progress. Teza de doctorat. • se dă comanda „efp” pentru a trece din semnal timp (FID) în semnal frecvenţa (spectru). Z4. • se analizează spectrul. Bibliografie 1. http://www.

Robert Austin în anul 1899.C. • puritatea şi compatibilitatea materialelor. călduri specifice. cristalizare. • oxidarea. în funcţie de temperatură sau timp pe baza efectelor termice care însoţesc transformările din probă în timpul supunerii acesteia la procese de încălzire.. MĂSURĂTORI TERMICE Analiză termică diferenţială. hidratarea – dehidratarea etc. sublimare. răcire. descompunerea. dr. tratamente izoterme. de reacţie etc. • temperaturile caracteristice ale transformărilor de fază. Analiză calorimetrică diferenţială Conf. Fenomenele fizice şi chimice. • capacităţi calorice. reducerea.. • căldurile de topire. • coroziunea metalelor în diferite atmosfere. • re-cristalizarea sticlelor metalice etc.. • tranziţii vitroase ale solidelor ne-cristaline.VII. • cinetica reacţiilor şi a formării fazelor. de-vitrificare etc. fierbere. Raluca Ciceo-Lucăcel Analiza termică a materialelor acoperă o categorie largă de metode prin care sunt determinate proprietăţile fizice şi chimice ale acestora. Metodele de analiză termică diferenţială reprezintă varianta modernă a metodelor clasice de investigare a efectelor termice induse de variaţia temperaturii unui corp fiind pentru prima dată folosite de către W. Termenul de “metoda diferenţială” provine de la fap266 . cristalizare. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. etc.

DTA poate fi folosită si pentru a studia proprietăţile termice şi transformările de faze care nu se produc cu modificarea entalpiei materialului. 3.[2] Figura. 1) sunt: 1. 2. metoda constă în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic. concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă. iar panta curbei în orice punct va depinde de microstructura probei la temperatura respectivă. [1] Concret. Principalele componente ale unui sistem termic diferenţial Principalele componente ale unui sistem termic diferenţial (Fig. Linia de bază a unei înregistrări DTA prezintă astfel discontinuităţi la temperaturile de tranziţie. Programatorul de temperatură. Suportul pentru probe conţinând termocuplurile şi containerele pentru probe plasate într-un bloc ceramic sau metalic. De aceea. 267 .tul că aceste tehnici permit determinarea diferenţelor dintre variaţiile unor mărimi fizice ale probei în raport cu cele ale unui etalon. Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme. Analiza termică diferenţială (DTA) este suficient de sensibilă pentru a determina variaţii foarte mici de temperatură şi este capabilă să sesizeze transformările lente ce se produc în intervale largi de temperatură. Cuptorul. Suprafaţa de sub aria curbei este proporţională cu modificarea entalpiei şi nu depinde de capacitatea calorică a probei. 1.

eliminarea volatilelor şi asigurarea unui transfer termic cât mai bun). Sistemul de înregistrare. în scopul menţinerii unei atmosfere inerte în cuptor (pentru inhibarea oxidării probei. Termenul calorimetrie se referă exclusiv la măsurarea căldurii.4. nu de temperatură.conform IUPAC (International Union of Pure and Applied Chemistry). respectiv pozitivă a axei X. Orice proces endoterm sau exoterm (cum ar fi topirea sau cristalizarea) care are loc în probă la încălzire este înregistrat ca un peak în direcţia negativă. 2). Efectul termic care se produce în cazul unei tranziţii termice sau a unui proces fizico-chimic este înregistrat ca diferenţă de flux caloric între probă şi referinţă şi la rândul lui este tradus în semnal electronic. 5. pe care este reprezentată diferenţa de temperatură (semnalul DTA) (Fig. Căldura poate fi o cantitate de energie schimbată sub forma unui flux de căldură între două corpuri într-un interval de timp. 2 Schema idealizată a unei curbe DTA Calorimetria dinamică diferenţială (DSC) este o tehnică în care diferenţa de energie dintre o substanţă (şi/sau produşii de reacţie) şi un material de referinţă este măsurată ca funcţie de temperatură (sau timp) în timp ce substanţa şi materialul de referinţă sunt supuse unui program de temperatură controlat . Calorimetrele cu baleiaj diferenţial sunt tehnici îmbunătăţite ale DTA (analiza termică diferenţială) în sensul că ele au fost calibrate pentru măsurători de energie calorică. Figura. amplificat şi 268 . Sistemul de furnizare a gazelor.

3). • calorimetre DSC cu compensarea puterii calorice („power compensated” DSC). fluxul diferenţial de căldură de la cuptor spre probă şi referinţă este măsurat pe căi complet diferite. drept pentru care linia serveşte ca şi referinţă şi este numită linie de bază. iar „power compensated” DSC transformă această diferenţă de temperatură în puterea calorică necesară restabilirii echilibrului termic dintre probă şi referinţă. În continuare vom prezenta pe scurt câteva detalii pentru fiecare tehnică in parte. Sistemul „heat flux” DSC înregistrează diferenţa de temperatură între probă şi referinţă care apare în cursul unei transformări fizico-chimice. Schematic este prezentată o termogramă DSC în care linia de bază prezintă multiple modificări datorate proceselor şi tranziţiilor termice din probă (fig. atunci semnalul DSC va arăta ca o linie dreaptă. Dacă proba de analizat nu suferă o transformare fizico-chimică sau o tranziţie termică. Înregistrarea se redă sub forma unei curbe numită termogramă DSC care reprezintă o dependenţă a fluxului caloric măsurat funcţie de temperatură (analiză în regim dinamic) sau timp (analiză în regim izotermal). Faţă de această linie se vor măsura intensitatea şi temperatura la care se manifestă procesele termice din probă. astfel că orice diferenţă ce apare în capacitatea calorică a probei conduce la modificarea termogramei DSC. 3 Tipuri de procese care pot apărea într-o înregistrare DSC Există două tipuri de tehnici DSC utilizate în analizele termice: • calorimetre DSC cu flux de căldură („heat flux” DSC). Semnalul măsurat redat în termograma DSC este direct proporţional cu capacitatea calorică a probei. 269 . Deşi în ambele tipuri semnalul măsurat reprezintă diferenţa de temperatură generată de senzori.apoi prelucrat de componenta software a instrumentului. Figura.

prin diferenţa de putere electrică introdusă în rezistenţele de încălzire aşezate în imediata vecinătate a probei şi etalonului. iar în grafic apare o deviere de la linia de bază sub forma unor peak uri endoterme sau exoterme. se modifică gradientul de temperatură al probei faţă de etalon. pentru a menţine diferenţa de temperatură zero. Figura. este controlată în timp ce se înregistrează diferenţa de temperatură dintre cele două. Dacă în cuptor fluxul de căldură este echilibrat. care este şi parte integrantă a sistemului de înregistrare a temperaturii. iar graficul înregistrează aşa-numita linie de bază în funcţie de timp sau temperatură. 4. 5) – măsoară diferenţa de flux termic proba-etalon indirect. 270 . Căldura transportată la probă şi referinţă printr-un platan din argint sau constantan. în funcţie de tipul procesului.Heat flux DSC – măsoară diferenţa de temperatură dintre probă şi etalon. diferenţa de temperatură este zero. 4). Schema de principiu a metodei heat flux DSC Power compensated DSC (Fig. care este convertită în flux de căldură printr-o construcţie specială (Fig. Semnalul măsurat este folosit ulterior la măsurarea diferenţei de flux de căldură. Dacă în probă au loc transformări de fază sau alte procese care se produc la o anumită temperatură. Proba şi referinţa sunt menţinute la aceeaşi temperatură printr-un sistem electric format din două rezistenţe de încălzire.

Principalii astfel de factori de influenţă sunt [3]: 1. cu peak-uri mai înguste. La viteze de încălzire mai mari efectele termice sunt evidenţiate mai bine.sau endoterm). însă pot apărea suprapuneri de peak-uri. Semnalul electric dat de diferenţa de putere dintre cele 2 rezistenţe este proporţional cu diferenţa de flux termic şi este înregistrat sub forma curbei de analiză termică. Din punct de vedere experimental. Metalele cele mai frecvente utilizate le temperaturi înalte sunt nichelul. există o serie de factori care influenţează în mod direct efectele termice analizate şi implicit forma termogramelor. oţelul inoxidabil la temperaturi înalte. 5. Schema de principiu a metodei power compensated DSC Dacă în probă are loc un proces (exo. La o viteză mai mică efectele termice au loc la temperatură mai joasă. dar peak-urile înregistrate sunt mai largi. Rolul formei şi al materialului din care este format locaşul pentru probe Materialele folosite la construcţia locaşelor sunt de două categorii: metalice sau ceramice. Materialele ceramice utilizate la confecţionarea locaşurilor sunt 271 . metalele nobile şi seminobile.Figura. pentru ca temperatura probei să nu difere de cea a referinţei se cuplează sau decuplează rezistenţa de încălzire a acesteia până la egalizarea temperaturilor. Influenţa vitezei de încălzire asupra curbelor se explică prin aceea că odată cu creşterea ei creşte şi cantitatea de produşi sub formă de gaz care generează o diferenţă de temperatură mai mare între probă şi cuptor. Viteza de creştere sau descreştere a temperaturii în cuptor: viteza de încălzire afectează înălţimea şi lăţimea efectelor termice înregistrate de curbele DTA şi DTG. 2.

ele pot influenţa forma efectelor termice sau să se impurifice. sticle rezistente la temperatură şi. în cazul când în probă se află un compus care se topeşte. Cantitatea de probă ce trebuie luată în lucru este de 272 . 6. de multe ori. pe de altă parte. pentru aceeaşi cantitate de material reactant ca şi în cazul celor metalice. argilă arse. Dar dezavantajul lor este că intensitatea efectelor termice tinde să fie mică. Dar au şi acestea dezavantajele lor . Locaşurile metalice. pe cât posibil.alumină cu adaus de silice. au avantajul că pot fi mult mai uşor de confecţionat. la obţinerea unei linii de bază a curbei DTA sub forma unei linii drepte sau prin acoperirea probei se protejează unele reacţii violente ca de exemplu: fierberile sau descompunerile în urma cărora ar ieşi o cantitate de probă afară din locaş. în anumite cazuri. Un alt dezavantaj este acela că datorită structurilor poroase. în decursul timpului. aşezarea lor în cuptor este dificilă din cauza faptului că au o slabă conductibilitate termică iar atunci trebuie foarte bine centrate. Rolul acoperirii sau descoperirii probei Acoperirea probei poate să ajute. fapt ce denaturează foarte mult forma curbelor termice. Cu toate acestea este bine să se lucreze. din cauză că transferul de căldură care are loc se face rapid prin pereţii lor şi între aceşti pereţi şi masa probei. Această precauţie de a se lucra cu proba descoperită se ia pentru a nu influenţa admisia şi emisia gazelor şi a vaporilor de apă care însoţesc reacţiile termice şi care dacă ar fi într-un sistem închis ar duce la suprimarea unor reacţii. în timpul procesului termic. În ceea se priveşte forma locaşelor pentru probe. Influenţa gradului de mojarare a probei: cu cât granulaţia probei este mai mică cu atât temperaturile de descompunere sunt mai joase.2 şi 1g. s-au impus două tendinţe: utilizarea locaşurilor în formă de blocuri şi utilizarea locaşurilor în formă de creuzet. dau efecte termice cu intensităţi mari. cu probele descoperite. din cauză că transferul de căldură are loc încet prin pereţii lor. care sunt mai frecvent utilizate. deci ale liniei de bază a curbei DTA. 3. Cum ar fi. grafitul. fără ca această variaţie să aibă prea mare influenţă asupra rezultatelor. Cantitatea de probă luată în lucru: greutatea probei luată în lucru poate să varieze între 0. Locaşurile ceramice. iar suprafeţele efectelor termice sunt mai mici (cu excepţia oxidărilor). nu sunt poroase şi dau mici deviaţii ale fluxului de căldură. 4. 5. Densitatea sau gradul de tasare a probei în locaş: diferenţele în densitatea sau gradul de tasare a probei în locaş sunt cauzele cele mai obişnuite ale devierilor de la linia de bază a curbei DTA.

În analiza termică se foloseşte o substanţă termică inertă în vederea determinărilor fenomenelor care au loc la încălzirea unui produs solid. 9.obicei determinată de sensibilitatea aparaturii şi de intensitatea proceselor termice care au loc în substanţa cercetată. el trebuie să aibă aceeaşi mărime granulară şi să se ia aceeaşi cantitate în lucru ca şi proba de cercetat. sudaţi la un capăt între ei şi care au proprietatea ca prin încălzire la locul sudurii să dea naştere unui curent electric proporţional cu cantitatea de căldură aplicată.5 mm). Institutului de Cercetări Experimentale Interdisciplinare în Bio-Nano-Ştiinţe deţine două aparate performante destinate analizelor termice. Materialul de referinţă şi probele de analizat sunt puse în celule standard din alumină (având dimensiunile Ø: 5. 8. 7. Alegerea substanţei termice inerte este foarte importantă. Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min. Natura şi proprietăţile termocuplelor: un termocuplu este format din doi conductori de compoziţie diferită. cu o rată de încălzire a cuptorului de 5-10ºC/min (uzual) în domeniul maxim de temperatură de la 23 ºC (sau temperatura camerei) până la 1600 ºC. fiecare. Cele mai bune materiale inerte sunt acelea care au aceeaşi conductivitate termică ca şi materialul de cercetat. Termocuplele ideale sunt cele constituite din metale nobile. care sunt rezistente la atacul termic şi au o durată de utilizare lungă în comparaţie cu cele confecţionate din metale inferioare. Măsurătorile de analiză termică diferenţială se realizează cu un derivatograf termic Shimadzu tip DTG-60/60H. Materialul de referinţă şi probele de analizat sunt puse în celule standard din 273 . presiunea trebuie menţinută constantă pe tot parcursul determinărilor. dar. oricare ar fi materialul folosit. comparativ cu această substanţă termică inertă. între 100-800˚C se pot folosi termocuple confecţionate din aliaje speciale de Ni şi Cr. Pentru temperaturi cuprinse între 100-2200˚C se folosesc termocuple confecţionate dintr-un fir de Pt şi celălalt dintr-un aliaj de Pt cu rodiu. Acţiunea atmosferei din cuptor asupra desfăşurării reacţiilor: oricare ar fi procedeul experimental de reglare a presiunii din cuptor. Substanţa termică inertă. Măsurătorile de analiză calorimetrică se realizează pe un calorimetru diferenţial Shimadzu tip DSC-60.8 mm x h: 2.

Chicinaş.aluminiu Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min fiecare (având dimensiunile Ø: 5. Bucureşti. 3.5 mm).8 mm x h: 1. masteranzilor. Accesul la aceste aparate este deschis tuturor studenţilor. Second edition. Analiza termică a mineralelor. dizertaţie .. Centre de Cercetare partenere. Cluj Napoca. camerei) până la 600ºC. Introduction to thermal analysis: techniques and applications. N. Bibliografie 1. obţinute prin măsurători efectuate la ICIBNS se regăsesc în o serie de lucrări de licenţă. 2001. Brown. teze de doctorat si lucrări ştiinţifice cotate ISI (anexa I). Jumate. cercetătorilor din UBB sau din Universităţi.Metode Experimentale. 2001. Kluwer Academic Publishers. 1972. I. 274 . Ed.Pop. V. Presa Univ. Informaţii importante privind proprietăţile termice ale unor materiale. doctoranzilor. Fizica Materialelor. Todor D. cadrelor didactice. Tehnică. Michael E. Clujeană. în domeniul maxim de temperatură 23ºC (sau temp. Ed. Rata de încălzire a cuptorului este de 5-10ºC/min (uzual).N. 2. O baie de azot lichid permite determinări la temperaturi scăzute (de la -150ºC).

...................Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială. camerei – 1500ºC • Acurateţea balanţei: ± 1% • Detectorii: termocuplu de Pt plus 10% Pt/Rh 275 ................. 279 3.. Cluj Napoca... Ghid de interpretare a măsurătorilor DTA/TG şi DSC ...... Analiza termică diferenţială simultan (DTA/TG) – aparat Shimadzu tip DTG-60/60H cu termogravimetria Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp.. Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme......... dr....... 285 1........................................ în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic.......................... raportat la cele două aparate de măsura existente în cadrul Institutului de Cercetări Interdisciplinare în Bio-Nano-Ştiinţe............. Raluca Ciceo-Lucăcel Cuprins 1......... 275 2...... Bibliografie ......... În cele ce urmează sunt prezentaţi paşii necesari efectuării măsurătorilor DTA/TG şi DSC...................................... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială................. Ghid de interpretare a măsurătorilor DTA/TG si DSC Conf.. ca principiu...... concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă......... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială Metodele termice diferenţiale constau.. care prezintă pe abscisă timpul sau temperatura iar pe ordonată diferenţa de temperatura probă-referinţă (la DTA) sau diferenţa de flux termic (la DSC).....

5. Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor. iar creuzetul gol pe suportul din partea dreaptă. 8. 6.0ºC/min pe un domeniu de temperatură de la temperatura camerei (minim) până la 1500 ºC (maxim).1÷50. Se deschide cuptorul apăsând tasta [OPEN/CLOSE]. 3. apoi se apasă tasta [ZERO] pentru aducerea la valoarea zero a balanţei. 7. 2. se ia creuzetul 276 . • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min. Se pregătesc două creuzete curate: unul pentru proba de referinţă (α-alumina) altul pentru proba de analizat. • Rata de încălzire a cuptorului: 0. Se apasă o dată pe tasta [DISPLAY] când ecranul digital al aparatului afişajează valoarea masei. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. Se apasă tasta [OPEN/CLOSE] de pe afişajul digital al aparatului pentru a închide cuptorul.5 mm). 1 g Paşi în efectuarea unei măsurători DTA: 1. Se deschide cuptorul apăsând pe tasta [OPEN/CLOSE] de pe afişajul digital al aparatului.8 mm x h 2. 4. Se aşteaptă un timp pentru stabilizarea semnalului.• • • Interval măsurabil semnal DTA: ± 1 la ± 1000 µV Nivel de zgomot: < 1µV Materialul de referinţă (α-alumina) şi proba de analizat se pun în cellule standard din alumină (având dimensiunile Ø 5. • Cantitatea de probă folosită: max. Se deschid recipientele de gaze pentru a asigura atmosfera în cuptor.

Se apasă de două ori pe tasta [DISPLAY]. 9. Pornirea măsurătorii se face cu butonul [Start].gol de pe suport şi se pune în el o cantitate optimă de probă. ecranul digital al aparatului afişează valoarea semnalului DTA. Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp.) se poate face din programul de analiză TA60 care permite asemenea prelucrări ale termogramelor ca şi convertirea şi salvarea datelor în format text pentru prelucrări ulterioare în alte tipuri de programe de prelucrare date. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP]. Se deschide programul de analiză al aparatului. fişierul de analiză fiind salvat automat în directorul specificat. 11. Analiza calorimetrică (DSC) – calorimetru diferenţial Shimadzu tip DSC-60. Analiza datelor (pierderi de masă. identificare temperaturi evenimente termice etc. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. 12. dar şi la un sistem de gaz care asigură evacuarea elementelor volatile. existând posibilitatea salvării datelor înregistrate până în acel moment. 10. Aparatul este conectat la un sistem de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare. Se închide cuptorul. 13. apoi se pune din nou creuzetul pe suportul de probă. care se aduce la zero prin apăsarea tastei [ZERO]. ca şi greutatea probei. Valoarea afişată după stabilizarea semnalului TG reprezintă masa de probă. asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). unde se poate alege numele fişierului şi directorul unde va fi salvat. • Interval măsurabil semnal DSC: ± 40 mW • Nivel de zgomot flux de căldură: < 1µW 277 . Oprirea măsurătorii se face în condiţii normale. camerei – 500ºC sau minus 150ºC – 500ºC când se foloseşte baia de azot lichid.

cântărită în prealabil pe o balanţă digitală. 5. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. iar în celălalt creuzet se pune proba. Se pregătesc două creuzete curate. 3. Se apasă o dată pe tasta [DISPLAY]. iar creuzetul gol pe suportul din partea dreaptă. asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). • Rata de încălzire a cuptorului: 1 ÷ 50 ºC/min. Într-un creuzet se pune o cantitate de referinţă (α-alumina). Se deschide programul de analiză al aparatului. • Proba: substanţe în formă solidă sau lichidă la temperatura camerei. Se apasă tasta [ZERO] pentru aducerea la valoarea zero a semnalului. 278 . Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor. Se deschid recipientele de gaze pentru a asigura formarea atmosferei în cuptor. Şi acest aparat este conectat la sistemul de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare.5 mm). Paşi în efectuarea unei măsurători DSC: 1. 6.• Materialul de referinţă (α-alumina) şi proba de analizat se pun în celule standard din aluminiu (având dimensiunile Ø 5. • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min. şi la sistemul de gaz care asigură evacuarea elementelor volatile.8 mm x h 1. 4. 2. ecranul digital al aparatului afişează valoarea semnalului DSC.

de-vitrificare etc. sublimare.. călduri specifice. 8. 2.. • tranziţii vitroase ale solidelor ne-cristaline. • cinetica reacţiilor şi a formării fazelor. fişierul de analiză fiind salvat automat în directorul specificat. • puritatea şi compatibilitatea materialelor. • temperaturile caracteristice ale transformărilor de fază. cristalizare. În mod identic cu datele obţinute de la analiza DTATG. descompunerea. • cristalizarea sticlelor metalice etc. În cadrul laboratorului de analize termice de la Institutul de Cercetare Interdisciplinară în Bio-Nano-Ştiinţe au fost abordate o parte din aceste tipuri de măsurători. existând posibilitatea salvării datelor înregistrate până în acel moment. datele salvate într-o măsurătoare DSC pot fi analizate cu programul TA60. mai jos fiind prezentate câteva exemple semnificative cu scopul de a oferi o imagine cât mai exactă a modului de intepretare a datelor furnizate de metodele termice diferenţiale: 279 . Oprirea măsurătorii se face în condiţii normale. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. • coroziunea metalelor în diferite atmosfere. Ghid de interpretare a măsurătorilor DTA/TG şi DSC La modul general. iar proba eliberează mai multă căldură decât în referinţa. hidratarea-dehidratarea etc. unde se poate alege numele fişierului şi directorul unde va fi salvat. ca şi greutatea probei. reducerea. cristalizare. fenomenele fizice şi chimice. Când probele cristalizează. • căldurile de topire. de reacţie etc.7. rearanjarea atomic este un proces exotermic. fierbere. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP].. • capacităţi calorice. • oxidarea. Modificări subtile ale semnalului DTA pot indica prezenţa unui peak exotermic asociat cu o separare de faze. Pornirea măsurătorii se face cu butonul [Start].

38% → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei.094 % 20. pierdere de masă de ~ 52%→ suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3.382% -1.00 DTA uV -1. 280 .00 -20. fără pierdere de masă → topirea NH4NO3 • Tendo = 260ºC. fără pierdere de masă → începutul procesului de cristalizare a fazelor magnetit şi hematit. Analiza DTA/TG a unui sistem aluminosilicatic cu Fe60SiO2·20Al2O3·20Fe2O3 preparată prin metoda sol-gel la pH 8. eliminarea altor reziduuri volatile din probă.5 TGA mg 12.7 -10. • Tendo = 132ºC.00 274.00 274. identificate prin analiza XRD după un tratament termic la 500ºC.7ºC. • Texo = 274.00 0.00 8.37 C 10.00 260 100 200 Temp [C] 300 Semnalul DTA prezintă patru peak-uri endoterme: • Tendo = 58ºC. pierdere de masă în TG ~ 1.4 10.8 169. fără pierdere de masă → transformare structurală a NH4NO3 format în probă din precursorii azotaţi şi hidroxidul de amoniu introdus pentru cataliza bazică a hidrolizei din procesul sol-gel • Tendo = 169.38% Weight Loss -52% -52.4ºC.00 6.00 132 57.1.

prin metoda sol-gel. 15. HNO3.6 169. eliminarea altor reziduuri volatile din probă. • Tendo = 93. 281 . Linia semnalului DSC pentru cele 2 probe ce conţin Fe este aceeaşi.5) cu acidul azotic. 20.4 56 129 171 221 241.4ºC → eliminarea apei rezultate din reacţia hidroxidului de amoniu (introdus în soluţie pentru obţinerea unui pH de 8.6 0 100 200 300 Temp [C] 400 500 Semnalele DSC ale probelor prezintă cinci peak-uri endoterme: • Tendo = 54ºC şi 56ºC → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei.2. Analiza DSC a unor sisteme aluminosilicatice cu Fe(80-x)[SiO2]· 20Al2O3· x[Fe2O3]. DSC mW x=0 129 230 93 128.5. la pH 8. cele pentru 20% Fe fiind deplasate mai sus cu câteva grade.7 x=15 55 x=20 93. x = 0. indicând faptul că prezenţa în matrice a unei cantităţi mai mari de Fe influenţează schimburile energetice şi cauzează întârzierea producerii anumitor evenimente termice în probă.7ºC şi 171ºC → topirea NH4NO3 • Tendo = 221ºC şi 241ºC → suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3. rezultat din precursorul folosit pentru Al [Al(NO3)3·9H2O]: • NH4OH + HNO3 → NH4NO3 + H2O • Tendo = 128ºC şi 129ºC → transformare structurală a NH4NO3 • Tendo = 169. respectiv topirea NH4NO3). diferind doar temperaturile la care au loc evenimentele (în special cele două evenimente care indică descompunerea.

semnalul DTA etalează un peak exoterm (cu maximul la 993. • În intervalul 977 ºC – 1007 ºC.5 ºC (unde apare peak-ul exoterm îngust) într-o fază aluminiu-siliciu spinel.00 -10. • În intervalul de temperatură 354–660ºC se observă un peak endoterm foarte larg. care corespunde unui proces tipic de dehidratare prin dehidroxilarea caolinitului cu producerea fazei dezordonate metakaolinit.00 6. Analiza DTA/TG a unei argile minerale cu structură majoritară de caolinit TGA mg 8. se transformă la temperatura la 995. fără pierdere de masă în TG.00 DTA uV -0. având un maxim la 505ºC şi însoţit de o pierdere de masă de ~14 % din totalul masei probei.353% -14.50 1046 0. Al2Si2O7.542% -20. Dar pierderi continue de hidroxil sunt observate până la 900°C (~0.4ºC).50 0 500 Temp [C] 1000 • Pierderea iniţială de masă de ~0.00 505 -0.5%) şi pot fi atribuite deprotonării graduale prin oxolare a metakaolinitului.3. Faza dezordonată de metakaolin. o conversie structurală a metakaolinitului în altă stare polimorfă aluminosilicatică.00 7. care este considerată o structură tip γ-alumină [1]: 2 Al2Si2O7 –> Si3Al4O12 + SiO2 282 .4 10.00 7. Si3Al4O12.3% în intervalul de temperatură 30-109ºC corespunde dehidratării probei prin pierderea apei adsorbite la suprafaţa probei. corespunzător unei tranziţii structurale de stare solidă.765% 993. Al2Si2O7.

00 6.00 -13.00 -8.94C 445 7.4. cu pierderi de masă în TG – dehidroxilare • la 491 ºC şi la 507 ºC.786% 20.00 0.00 0.00 800.00 4.417% 5.68C -30.00 83. Analiza DTA/TG a două probe de hidroxiapatită (cu 30%Fe şi 50%Fe) – tratate termic la 450º C TGA mg -12.00 400.00 400.00 DTA uV 371 371.00 85 84.00 1000.00 -12.t HA+30%Fe-t 0.00 10.00 DTA uV 20.00 Semnalul DTA prezintă două peak-uri endotermice clare: • la 83.00 5.ºC şi 100ºC.32C -6.907% -20.00 100 200.00 Temp [C] 600.554% 507 507. Analiza DTA/TG a unei probe de corn de cerb deproteinată TGA mg 9.026% 15.00 10.90C -13.838% 50.18C HA+50%Fe .5 491 491.00 200.530% 8.00 -22.00 Temp [C] 600. cu pierdere de masă – descompunerea termică propriu-zisă în TCP (fosfat tricalcic) şi TTCP ( fosfat tetracalcic): Ca 10 ( PO 4 ) 6 ( OH ) 2 → 2 Ca 3 ( PO 4 ) 2 + Ca 4 P2 O 9 + H 2 O gas 5.00 -10.00 -50.00 283 .00 445.

apoi uscare în cuptor la 40ºC până la îndepărtarea completă a solventului. Analiza DTA/TG a unor materiale compozite polimer-sticle[5] Semnalele TG prezintă patru trepte de pierdere de masă: • I – intervalul de temperatură 20-400°C – volatilizarea apei de pe suprafaţa probelor 284 . Semnalul DTA etalează trei evenimente termice: • un peak endoterm având maximul la 85ºC.[2. asociat cu o scădere a masei probei în curba TG (pe intervalul 50ºC–150ºC). format din două peak-uri cu maximele la 371ºC şi la 446ºC.4] 6.Procedeul de deproteinare a probei a constat în degresare în acetonă timp de 48 h şi cu eter etilic timp de 30 min.3. Aceste evenimente pot corespunde degradării şi respectiv arderii matricii organice a osului însoţită de volatilizarea compuşilor gazoşi rezultaţi din acest proces. eveniment dependent şi de gradul de hidratare al materialului. dar şi eliminării apei libere ataşate în matricea de hidroxiapatită. eveniment care ar corespunde denaturării structurii triplu helix a colagenului din matricea osoasă. • un eveniment exoterm de intensitate mare în intervalul de temperatură 350–500ºC. însoţite de pierderi de masă considerabile.

Ma. Radu. Simon. Pe de altă parte.A. Thermal Analysis study of human bone. V. Lozano. Journal of Materials Science 38 (2003) 4777-4782 M. Ocotlan-Flores. A. Pena-Rico. Gomez-Cortes. Heredia. Artioli. V. J.. 5. Velazquez. I. Bellotto. Part I: kaolinite dehydroxylation. acompaniat de o pierdere de masă. Journal of Ceramic Processing Research. Chem. 11. III – intervalul de temperatură 500-800°C curba DTA prezintă la T ~ 740 °C un peak endotermic pronunţat care poate fi atribuit unui proces de disociere fără pierdere de masă IV – la aproximativ 810-830 °C apare un peak exotermic mic. No.A. Minerals 22.. No. Journal of Optoelectronics and Advanced Materials.F. Characterisation of natural hydroxyapatite extracted from bovine cortical bone ash. M. Kinetic study of the kaolinite-mullite reaction sequence. 958-960. M. 4. C. Javidi. G. 2. Thermoanalytical characterisation of new dental ionomer biocomposites. 3. Silaghi-Dumitrescu. intensitatea acestor peak-uri poate fi legată de efectul interacţiunii mutuale dintre produşii de hidratare cu polimerul utilizat în sinteză. J. M. M. Tamas. Acesta este. Tămăşan. 1995. L. Menţionăm că toate aceste măsurători au fost publicate şi/sau prezentate în cadrul unor conferinţe naţionale/internaţionale de specialitate. Belio. no.M. Simon. Bahrololoom. Băciuţ. T. 4 (2008). Vol. S.. 3. Prejmerean. vol. 10. 479-483. Phys. S. A. 10.• • • II – intervalul de temperatură 400-500°C – însoţită în DTA de un peak exoterm cu maximul la ~T = 450ºC – o reacţie de dehidroxilare aferentă restructurării reţelei polimerice a compozitelor. Coman. Journal of Optoelectronics and Advanced Materials.E. A. C. 129-138. Javadpour. Vol. S. L.. 4 (2009). R. M. cel mai probabil datorat formării unei faze cristaline în structura compozitelor. Simon. 285 . V. Gualtieri. Colceriu. 2 (2009). Thermal kinetics analysis of bone tissue organic phase. 207-214 . Bucio. L.Bibliografie 1. A. and Clark.

......4............................4................................ Metoda bazată pe analiza Rietveld ..................... Metoda de căutare în spaţiul direct....4.......1.....VIII.. Analiza calitativă de faze cristaline .................. Principiul metodei Difracţia de raze X este una dintre metodele cele mai utilizate pentru investigarea compuşilor în faza solidă cristalină......3.................1......................293 2........ DIFRACTOMETRUL DE RAZE X Difracţie de raze X pe pulberi C.........................289 2............................................................3......3...................................292 2..... Metode bazate pe utilizarea de standarde .............297 2......4...2..................... Principiul de funcţionare a unui difractometru de raze X este următorul: Cu ajutorul unui generator de înaltă tensiune se obţine tensiune de ordinul zecilor de kV....3........................................ Bibliografie ..................S......................292 2...................4.................1....... Determinarea structurii cristaline din pulberi .........3............................ Metode bazate pe analiza Rietveld ..............................................................2.............2.....292 2................2........... 286 ..............................289 2........... Gheorghe Borodi Cuprins 1..... Rafinarea Pawley sau Le Bail ................2.....................303 1................. Principiul metodei ......................................................294 2........................................... dr......290 2..................................300 3...296 2............302 4....4................................................1.................... Metoda Scherrer ...................................286 2....................................................................................... Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente ...................3........................... Metoda Warren-Averbach....... Această tensiune se aplică între catodul şi anodul tubului de raze X.............................294 2.....2................ Informaţiile care se obţin din difracţia de raze X pe pulberi .............299 2..................... Analiza cantitativă de faze ............ Aplicarea unor procedee de calcul pe monocristale la pulberi ............... Indexarea Difractogramelor ..........2............290 2.........I............1.......................... Rafinarea structurilor cristaline prin metoda Rietveld ...295 2................................. Analiza microstructurală..................4.....................3...........................

Proba este aşezată pe un suport plan. Electronii care lovesc anodul fac să se emită radiaţii X sub forma unui spectru continuu şi a unui spectru caracteristic. În timp ce proba se roteşte cu un anumit unghi. detectorul se roteşte cu un unghi dublu în aşa fel încât tot timpul unghiul de incidenţă este egal cu unghiul de reflexie. Orice compus cristalin cristalizează într-un anumit sistem cristalografic cu parametrii de reţea bine precizaţi. Astfel. Cu are lungimea de undă intermediară şi este cel mai utilizat. Liniile caracteristice pentru elementele grele cum sunt Mo şi Ag au lungimi de undă mică. În celula elementară se pot construi diverse seturi de plane cristalografice fiecare set fiind caracterizat prin indicii Miller corespunzători. Acest lucru se realizează în cazul montajului θ . l) dacă cel mai apropiat plan cristalografic faţă de origine intersectează axele cristalografice la distanţele: a/h. Difracţia razelor X se poate explica în mai multe feluri. dar există şi alte tipuri de montaje experimentale. Monocromatizarea radiaţiei X se face cu ajutorul filtrelor de raze X sau cu ajutorul monocromatoarelor de raze X. Cr. Electronii respectivi sunt acceleraţi între catodul şi anodul tubului. Cea mai uzuală interpretare este difracţia Bragg pe planele cristalografice. Dintre lungimile de undă emise de un tub de raze X cea mai intensă este radiaţia K α . Pentru aplicaţiile practice de difracţie pe pulberi este necesar să folosim o radiaţie cât mai monocromatică. Se poate considera difracţia pe astfel de plane cristalografice după cum este arătat în figura următoare: 287 . Radiaţia X emisă de tubul de raze X intră într-un goniometru. iar liniile caracteristice pentru Cr si Co au lungimi de undă mari. b/k. c/l. Spectrul continuu nu depinde de natura anodului în schimb spectru caracteristic depinde de anodul folosit. unghiul dintre radiaţia incidentă şi probă este egal cu unghiul dintre radiaţia difractată şi planul probei.Catodul tubului de raze X este alcătuit dintr-un filament care este de asemenea alimentat la o sursă de joasă tensiune şi care face ca filamentul să emită electroni. un anumit grup spaţial şi un mod de aranjare a atomilor în celula elementară. Fe. Anozii tuburilor de raze sunt din următoarele materiale: Cu. 2 θ . un set de plane cristalografice echidistante are indicii Miller (h. Mo. k. Ag etc. trece printr-un sistem de fante care sunt montate pe goniometru după care radiaţiile X ajung la detector unde este înregistrată. Co.

Dacă radiaţia X cade pe probă. Pentru alte sisteme cristalografice avem alte formule de calcul a distanţelor interplanare. Prin urmare. iar în cazul acesta. De aici se observă că fiecare set de plane cristalografice corespunde unui anumit unghi de difracţie. Aceste unde electromagnetice produse de atomii din celula elementară se suprapun şi se compun. atunci fiecare atom din celula elementară împrăştie radiaţiile incidente. intensităţile de difracţie vor depinde de natura şi 288 . Radiaţia X constă din unde electromagnetice în care componenta vectorului câmp electric şi magnetic oscilează perpendicular pe direcţia de propagare a undei. De aici rezultă că poziţiile maximelor de difracţie depind exclusiv de tipul reţelei cristaline şi de parametrii celulei elementare. Distanţa interplanară este determinată de sistemul cristalografic. radiaţii X. Vibraţiile vectorului câmpului electric produc oscilaţii ale electronilor atomilor. iar λ lungimea de undă. Dependenţa intensităţii factorilor de împrăştiere de sin θ / λ este dată în tabelele internaţionale sub forma unor relaţii empirice. Expresia factorului de structură este dată de relaţia: Fhkl= ∑ fj exp π 2 i(hxj+kj+lzj) (2) Intensităţile de difracţie sunt proporţionale cu pătratul factorilor de structură. Factorii de împrăştiere atomici scad cu unghiul de împrăştiere. De exemplu. Intensitatea radiaţiei X împrăştiate de către un singur atom este caracterizată prin factorul de împrăştiere atomic.Condiţia de difracţie este dată de relaţia: 2dsin θ = λ (1) unde d este distanţa interplanară. Factorii de împrăştiere atomici depind de numărul de electroni din componenta atomului dat. de parametrii celulei elementare şi de indicii Miller. θ unghiul de difracţie. Să vedem în continuare de cine depind intensităţile de difracţie. iar rezultanta este dată de factorul de structură. Dar orice sarcină care oscilează produce la rândul ei unde electromagnetice. pentru sistemul ortorombic avem 1/d2 = h2/a2 + k2/b2 + l2/c2.

ω . Intensităţile de difracţie depind şi de alţi factori. Informaţiile care se obţin din difracţia de raze X pe pulberi 2. iar Fhkl este factorul de structură. Pulberile constau din foarte multe cristalite mici de ordinul zecilor până la ordinul miilor de Å orientate haotic unele în raport cu altele. Probele se pun de obicei pe suporturi plane. V. e fiind sarcina electronului. numărul de cristalite care participă la difracţie este foarte mic. poziţiile maximelor de difracţie depind de celula elementară.(e2/mc2)2·Vcr·I0·Lp·A·T·I·FhklI2 unde (3) λ este lungimea de undă ω viteza unghiulară cu care se roteşte monocristalul V volumul celulei elementare I0 intensitatea fasciculului incident Lp este factorul Lorentz-polarizare A factorul de absorbţie T factorul de temperatură. iar c viteza luminii. În felul acesta intensitatea de difracţie corespunzătoare unui set de plane cristalografice este dată de relaţia: Ihkl=K·m·Lp·A·T·I·Fhkl·I2 (4) În această relaţie s-a introdus şi m care este factorul de multiplicitate.1. I0 sunt constante pentru un experiment de difracţie. În concluzie. De aceea. Vom obţine difracţie numai de la planele cristalografice care sunt paralele cu suprafaţa suportului de probă. Analiza calitativă de faze cristaline Analiza cantitativă de compuşi chimici în faza solidă se poate face prin metode chimice. toate acestea se pot grupa împreună sub forma unei constante notată cu K. Deoarece în general λ . Astfel se demonstrează că intensitatea radiaţiei difractate de către un mic monocristal care se roteşte cu viteza unghiulară ω este dată de relaţia [1] : Ihkl = ( λ 3/ ω V2). iar (e2/mc2) sunt constante universale. m masa acestuia. Acesta rezultă din aceea că pot să existe mai multe plane cristalografice care să producă difracţie la acelaşi unghi θ .poziţia atomilor în celula elementară. 289 . dar acestea necesită o abordare mai laborioasă şi timp mai mult. 2. Vcr. iar intensităţile de difracţie de poziţiile atomilor în celula elementară.

deoarece proprietăţile fizico-chimice depind de compoziţia procentuală. Identificarea fazelor cristaline se bazează pe următoarele considerente: fiecare fază cristalină aparţine unui anumit sistem cristalografic. În anumite cazuri difracţia de raze X pe pulberi cristaline poate să fie o metodă rapidă şi eficientă. aparţine unui anumit grup spaţial. atunci putem să simulăm difractograma acelui compus şi să o comparăm cu difractograma experimentală. analiza calitativă de produşi chimici cristalini se face în cea mai mare măsură prin difracţie de raze X pe pulberi. care ne dă datele cristalografice complete pentru compuşii care ne interesează. iar atomii compusului se plasează în anumite poziţii în celula elementară. are parametrii de reţea bine determinaţi sau care variază într-un interval relativ mic. Compararea difractogramei experimentale cu cele din catalog se face utilizând bazele de date.În prezent. Difracţia de raze X pe pulberi deosebeşte cu uşurinţă diferite forme polimorfice ale unui anumit compus. Dacă avem la dispoziţie baza de date CSD sau o altă bază de date. Analiza de faze cristaline se bazează pe compararea difractogramei de raze X experimentală cu difractogramele care se găsesc în bazele de date. Analiza cantitativă de faze se bazează pe faptul că fiecare fază cristalină produce propria difractogramă. 2. cu luarea în considerare a coeficienţilor de absorbţie a fazelor componente. Deci. 2. difractograma rezultată va fi o suprapunere a difractogramelor individuale. Obţinerea componentei procentuale a fazelor dintr-un amestec se poate face atât prin metode chimice. Se ştie că acelaşi compus chimic poate să se prezinte în diferite forme polimorfice sau. în diferite faze cristaline. pentru o anumită fază α există relaţia: 290 . cât şi prin difracţie de raze X. PDF-4. Metode bazate pe utilizarea de standarde Între intensităţile de difracţie şi fracţia în greutate Wα.2. iar dacă avem mai multe faze. ne interesează compoziţia procentuală a fiecărei faze din amestec. în special PDF-2. din analiza de faze putem să identificăm o anumită fază numai dacă aceasta a fost catalogată în prealabil. Analiza cantitativă de faze În foarte multe cazuri. cum se mai spune.2. când avem un amestec de faze cristaline.1. Aceasta face ca fiecare fază cristalină să aibă intensităţile de difracţie şi unghiurile la care apar aceste intensităţi bine determinate.

standard (ii). O altă metodă este aceea a raportului intensităţii de referinţă (RIR) (Reference Intensity Ratio). x ρα este densitatea fazei α. Intensitatea de reflexie Ijs este dată de relaţia: I js = C js Ws x ρsμm (6) Împărţind cele două relaţii rezultă: is Wα = K α sWs I iα I js (7) ij unde K α s = C js ρα Ciα ρ s ij poate fi determinat făcând un amestec cunoscut de fază standard şi Kα s fază de analizat. Se defineşte RIRαs = I isWs . şi de raportul dintre intensitatea liniei i a probei de analizat şi intensitatea liniei j a probei standard după relaţia: Wα = I iα W s I js RIRαs (8) 291 . măsurarea lui Iiα şi estimarea lui μ m O altă metodă este aceea a standardului intern care presupune includerea unui standard intern în proba de compoziţie procentuală cunoscută Ws.I iα = C i α Wα x ρα μ m (5) unde Ciα este o constantă pentru reflexie (sau un grup de reflexii) i a fazei α. Ca standard extern se alege în general corundum. Pentru aplicarea acestei relaţii este necesară (i) determinarea constantei Ciα prin prepararea de standarde cu compoziţie procentuală a fazei α bine x a probelor determinată şi estimarea coeficientului de absorbţie masic μ m x pentru probe necunoscute. I jsWd Fracţia Wα pentru faza necunoscută se determină în funcţie de fracţia Ws pentru proba standard. iar μ m este coeficientul de absorbţie masic pentru întreaga probă [2].

distribuite haotic unele în raport cu altele. β este lărgimea liniilor de difracţie 292 . Reducerea coeficienţilor de absorbţie se poate face prin utilizarea tuburilor de raze X cu lungime de undă mai mică. orientarea preferenţială a cristalitelor. din analiza Rietveld rezultă fracţia de faze din probă.2. inclusiv procentul de fază necunoscută. Se ştie că pulberile cristaline sunt formate din mici monocristale. a deformării reţelei cristaline şi a probabilităţilor de defecte. numite cristalite. 2. Cu cât dimensiunile cristalitelor sunt mai mici cu atât liniile de difracţie sunt mai largi. Dacă dimensiunile cristalitelor sunt sub 20 Å. Metoda bazată pe analiza Rietveld Analiza cantitativă de faze se poate face şi cu analiza Rietveld [3]. Dimensiunile acestor cristalite sunt de ordinul zecilor până la ordinul miilor de Å. Dar la lărgimea liniilor de difracţie contribuie şi deformările reţelei cristaline şi probabilităţile de defecte. liniile de difracţie de asemenea se lărgesc. Dacă reţeaua este mai deformată sau dacă avem mai multe defecte. Astfel.1. Metoda Scherrer Scherrer a arătat pentru prima dată că dimensiunile cristalitelor sunt legate de lărgimea de difracţie prin relaţia [2]: D= Kλ β cos θ (9) D este dimensiunea microcristalitelor. se consideră că compusul respectiv este sub formă amorfă. Se filtrează toţi parametrii de care depinde intensitatea de difracţie. 2.2. Factorii care limitează precizia analizei de fază sunt: dimensiunea diferită pentru particulele aparţinând la diferite faze de analizat. Într-o particulă pot să existe mai multe cristalite (monocristale) orientate diferit între ele. Analiza microstructurală Analiza microstructurală include determinarea dimensiunilor microcristalitelor şi eventual distribuţia acestora după dimensiune.3.2. Trebuie menţionat că dimensiunile particulelor sunt diferite de dimensiunile cristalitelor. microabsorbţia. Intensităţile de reflexie pentru probele cu coeficient mai mare de absorbţie vor fi mai intense. Erorile sunt cu atât mai mici cu cât dimensiunea particulelor este mai mică şi cu cât coeficienţii de absorbţie vor fi mai mici.3.

293 . Domeniul pe care precizia determinării dimensiunilor cristalitelor se consideră acceptabilă este de la aproximativ 20Å. care se defineşte ca fiind aria maximului de difracţie împărţită la intensitatea maximă pentru maximul respectiv. dacă aceasta se defineşte ca fiind dimensiunea liniară sau rădăcina de ordinul 3 din volum. iar θ este unghiul de difracţie. dacă profilul de difracţie este o funcţie de tip Lorentz şi β2 = B2 –b2. Precizia legată de determinarea dimensiunilor cristalitelor scade odată cu creşterea acestora.89. Astfel avem relaţia: β cosθ = 0. K este o constantă care depinde de modul cum se defineşte dimensiunea D.2.9λ + 4ε sinθ D (10) în cazul în care profilul liniei de difracţie este de tip Lorentz. În această relaţie B este lărgimea de difracţie măsurată. Lărgimea liniilor de difracţie creşte cu unghiul. unde ε este un parametru care reflectă deformaţia reţelei cristaline şi reprezintă deplasarea medie a atomilor faţă de poziţia de echilibru. Cea mai utilizată valoare a lui K = 0. Dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată dimensiunilor cristalitelor este diferită de dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată deformării reţelei cristaline. precum şi de alţi factori.3. Pentru a obţine b. deoarece cu cât dimensiunile sunt mai mari lărgimea liniilor de difracţie se apropie de lărgimea instrumentală şi depinde foarte mult cât de corect am ales lărgimea instrumentală.corectată de lărgimea instrumentală. până la 1000Ǻ. Unii autori iau ca lărgime a liniilor de difracţie lărgimea integrală. Metoda Warren-Averbach Am amintit că lărgimea liniilor de difracţie scade atât cu scăderea cristalitelor cât şi cu creşterea deformaţiilor reţelei cristaline. se foloseşte o probă foarte bine cristalizată şi se măsoară lărgimea maximelor de difracţie pentru unghiurile de difracţie apropiate cu cele ale probei de măsurat. dacă profilul de difracţie este o funcţie de tip Gauss. Lărgimea instrumentală se obţine din lărgimea de difracţie experimentală astfel: β = B-b. Ca măsură a lărgimii liniilor de difracţie se consideră lărgimea la semiînălţime. 2. iar b este lărgimea de difracţie instrumentală.

Ordonată la origine pentru această dreaptă reprezintă 0. U. V. 2. În continuare dimensiunile cristalitelor şi deformaţiile reţelei se calculează în funcţie de aceşti parametrii.3. dar poate ajunge şi până la 200. atunci avem relaţia: β 2 cos 2 θ = λ2 D2 + 16ε 2 sin 2 θ (11) Din reprezentarea grafică a lui β2cos2θ. ar trebui să obţinem o dreaptă. Y. lărgimea la semiînălţime depinde de unghiul θ. Metode bazate pe analiza Rietveld O altă modalitate de determinare a dimensiunilor cristalitelor şi a deformării reţelei cristaline se poate face prin analiza [4] Rietveld. astfel: ΓL = X + Y tgθ cosθ (12) pentru un profil de tip Lorentz. Dimensiunile cristalitelor se mai pot determina şi din analiza Fourier a liniilor de difracţie.9λ . iar panta D dreptei reprezintă 4ε. De aici putem să determinăm ε şi D.3. 2. W si P. Pentru un profil de tip Gauss avem: ΓG = Utg 2θ + Vtgθ + W + P cosθ (13) Din fitarea Rietveld rezulta X. unde ΓL este lărgimea la semiînălţime. Determinarea structurii cristaline din pulberi Determinarea structurii cristaline se face în general din datele de difracţie obţinute din monocristale.Reprezentând grafic βcosθ în funcţie de sinθ. Dacă profilul liniilor de difracţie este de tip Gauss.4. Se obţin mai puţine intensităţi de difracţie deoarece liniile de difracţie pot să se suprapună şi de ase294 . dacă considerăm diferite linii de difracţie. în funcţie de sin2θ. iar X si Y parametrii de fit. Conform formulei lui Caglioti. rezultă dimensiunile cristalitelor şi deformările reţelei. Numărul intensităţilor de difracţie care se pot obţine din pulberi cristaline este de ordinul zecilor. Numărul intensităţilor de difracţie care se pot obţine din difracţia pe monocristale este de ordinul zecilor de mii.

β. α. Un plan cristalografic de indicii Miller h. În acest caz se apelează la determinarea structurii cristaline din pulberi. Pentru o anumită celulă elementară putem să definim planele cristalografice.4. difracţia razelor X poate fi privită ca difracţia de pe planele cristalografice. Dar există situaţii când anumiţi compuşi nu se pot cristaliza şi totuşi ne interesează structura lor cristalină. Se ştie că difracţia razelor X pe atomi poate fi privită ca difracţie pe planele cristalografice.menea unele intensităţi de difracţie sunt foarte slabe şi nu se pot observa. a determina parametrii celulei elementare şi a atribui fiecărui maxim de difracţie indicii Miller corespunzători. În funcţie de a. a grupului spaţial şi a poziţiilor atomilor în celula elementară. unele maxime de difracţie se suprapun în cazul pulberilor. b.1 Indexarea Difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic în care cristalizează compusul. avem şapte sisteme cristalografice. Numărul de maxime de difracţie în cazul pulberilor care se observă este foarte mic comparativ cu numărul de maxime de difracţie observate pentru monocristal. Se obţin maxime de difracţie dacă este îndeplinită condiţia lui Bragg: Maximele de difracţie au intensităţi mai mari sau mai mici în funcţie de modul de distribuţie a atomilor în celula elementară. k. Parametrii care caracterizează celula elementară se numesc parametrii celulei elementare. a parametrilor celulei elementare. Orice compus este caracterizat de o anumită celulă elementară care este un paralelipiped cu muchiile a. Din reflexiile interzise se pot atribui grupurile spaţiale cele mai probabile. Determinarea structurii cristaline pentru un anumit compus înseamnă determinarea sistemului cristalografic. determinarea structurii cristaline este mult mai dificilă pentru pulberi decât pentru monocristale. c. l este un plan care intersectează axele cristalografice la distanţele a/h. Etapele principale pentru determinarea structurii cristaline din pulberi sunt: 2. De asemenea. Numărul mai mic de maxime de difracţie observat în cazul pulberilor precum şi suprapunerea unor maxime provenite de la plane cristalografice diferite este motivul pentru care este mult mai dificil de determinat structura cristalină din pulberi faţă de monocristale. Deoarece numărul de intensităţi de difracţie care se pot colecta din difractograma pe pulberi este mult mai mic decât pentru monocristale. b. După cum se ştie. c şi unghiurile dintre ele α. b/c si c/l de origine. β. γ. γ. Concordanţa dintre poziţiile maximelor de difracţie calculate şi obser295 .

N20 este numărul de linii diferite calculate până la linia corespunzătoare lui Q20. Există o suprapunere sistematică a intensităţilor de difracţie şi o suprapunere accidentală. Suprapunerea exactă a intensităţilor de difracţie are loc mai ales pentru sistemele cristalografice de înaltă simetrie. De exemplu. dar mai ales pentru sisteme cristalografice cu simetrie joasă şi se datoreşte creşterii numărului de reflexii independente. Există mai multe metode de indexare dintre care cele mai importante sunt: Metoda Ito[7]. Un alt factor de încredere datorat lui Smith si Snyder [6] se defineşte astfel: FN= N < Δ 2θ > . care este valoarea în θ pentru limita superioară selectată.4. Au fost dezvoltate două metode de extragere a intensităţilor de difracţie din pulberi. Una dintre figurile de merit se datorează lui P. Dacă avem M20 > 10.N (θg ) (15) unde N( θg ) este numărul de linii de difracţie calculate până la θ g. Există mai multe moduri de definire ale figurilor de merit sau gradului de încredere în indexarea respectivă.vate se caracterizează şi prin aşa numite figuri de merit. indexarea este probabil corectă. Metoda Le Bail [11] de extragere a intensi296 . 2. Cea mai utilizată figură de merit este M20. şi anume: Metoda Le Bail şi metoda propusă de Pawley. de Woolf [5]: M 20 = Q 20 2 < Q > N 20 (14) Q20 este valoarea lui Q pentru a 20-a linie de difracţie.2. Suprapunerea reflexiilor este cu atât mai probabilă cu cât celula elementară are volumul mai mare. rafinarea celulei elementare şi atribuirea grupului spaţial cel mai probabil. reflexiile 333 şi 511 pentru sistemul cubic sau 43l şi 50l pentru sistemul tetragonal. Rafinarea Pawley sau Le Bail Rafinarea Pawley sau Le Bail este utilizată pentru extragerea intensităţilor de difracţie.M. metoda Dicvol [8] X-Cel [9] si metoda Treor [10]. < Δ 2 θ > este abaterea medie dintre liniile de difracţie calculate şi observate. Suprapunerea accidentală are loc atât pentru sisteme cu simetrie ridicată. iar <Q> este abaterea medie dintre liniile de difracţie calculate şi observate.

Putem să avem atomi. octaedrii etc. molecule. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale. Obţinerea unui model structural 2. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine.14] au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură în schimbul intensităţilor de difracţie.4. În timp ce metoda Le Bail este o metodă iterativă. Unii autori [13. în care mărimile care trebuie determinate sunt intensităţile de difracţie. Deşi procesul de rafinare este în general stabil.5 dintr-un pas de înregistrare a difractogramei.3.1. 297 . fragmente din molecule.3. există şi cazuri când prezintă instabilităţi. Această metodă nu cere extragerea factorilor de structură din difractogramă. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0.tăţilor de difracţie este inspirată din metoda Rietveld. Pawley [12] a elaborat o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X fără a avea un model structural. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative.4. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie. Aceasta este o metodă de analiză prin cele mai mici pătrate. mai ales atunci când fondul de difracţie este supraestimat. ca de exemplu. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. 2. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. grupe de atomi aranjaţi într-o anumită configuraţie. Deşi metoda este în general robustă. Ca intensităţi de pornire se pot considera valorile calculate ale intensităţilor de difracţie. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. tetraedrii. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală.

eventual a unghiurilor de valenţă şi a distanţelor dintre atomi.Δ CF/T). În schimbul utilizării unui singur lanţ de configuraţii. În timpul procesului de căutare temperatura se scade treptat. un alt algoritm a fost dezvoltat. o variantă a acesteia numită Parallel tempering şi Tehnica algoritmilor genetici. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. Dacă CF este mai mare decât cea precedentă.17]. şi anume Parallel Tempering (PT) [18]. T fiind temperatura distribuţiei. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. Pentru moleculele organice. dintre care amintim: Răcire simulată (simulated annealing). pentru a evita să cădem într-un minim local. în faza iniţială a procesului de căutare a configuraţiei optime se poate uşor trece de la un minim local la un alt minim în scopul determinării minimului absolut. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2 = exp[(CF2-CF1)/T]. cu descreşterea temperaturii se aleg de la 298 . probabilitatea de a găsi un alt minim este de asemenea mică. atunci se reţine noua configuraţie. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. atunci se reţine noua configuraţie cu probabilitatea exp(.Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. Una dintre posibilităţi este să se aleagă ca fiind rezidiul R. când T este foarte mic. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. dar în faza finală. dintre care amintim Powder Solve [15]. În cazul metodei de răcire simulată se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. Totuşi. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. Funcţia de cost CF se poate alege în diverse moduri. Astfel. se consideră funcţia de cost CF. Astfel pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. se testează potrivirea dintre difractograma calculată şi cea experimentală. definit în felul următor: Σ i wi ( y Rwp=[ obd i − i y calc i )2 ]1/2 (16) Σ i wi ( y ) 2 obs Dacă funcţia de cost CF este mai mică decât cea precedentă. Fox [16.

Datorită faptului că atomi oscilează în jurul poziţiilor de echilibru. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul zecilor. Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. Deoarece intensităţile de difracţie se măsoară în unităţi arbitrare. Dar factorii de structură sunt numere complexe. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. posibilitatea de a se obţine minime locale este mai mică. Dacă se fac corecţiile intensităţilor de difracţie. Sinteza Fourier şi sinteza Patterson. factorul de polarizare. Determinarea fazei factorilor de structură [19. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice aplicate invarianţilor şi semiinvarianţilor. factorul de extincţie.început mai multe configuraţii (un număr mic de configuraţii). În felul acesta. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat.20].2. 2. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi. intervine un factor de scală K care trebuie determinat. deci în acest caz factorii de structură sunt numere reale pozitive sau negative. în unele cazuri s-au obţinut rezultate bune. Determinarea factorului de scală şi a factorului global de temperatură. dintre care amintim: Factorul Lorentz. intensităţile acestora se reduc cu un factor de temperatură. Cunoscând factorii de struc299 . pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. se obţine modulul factorilor de structură. Cu toate acestea. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces.3.4. se determină factorul de scală şi de temperatură. factorul de absorbţie. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. până la 3 sau 4 sute. Paşii care trebuie urmaţi sunt: corectarea intensităţilor de difracţie de diverşi factori.

În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim.v.tură. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate. 2.Rafinarea modelului structural prin metoda celor mai mici pătrate. Dintre programele de calcul cel mai utilizat este GSAS [22]. de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate.4.factorul de pondere şi este wi=1/yi. .l cos( 2π ( hx + ky + lz )) (18) Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi mai ales distanţele dintre atomii grei.w)= 1 V h . după relaţia: P(u. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [21]. putem să determinăm densitatea electronică de sarcină în celula elementară cu ajutorul următoarei relaţii: ρ ( x.4. Funcţia ce trebuie minimizată este: S y = ∑ wi ( y i − y ci ) 2 i (19) unde: wi . Pe baza densităţii electronice se poate construi un model structural aproximativ. atunci putem face sinteza Patterson.l ∑F 2 h . unde densitatea electronică este mai mare. y . Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară dacă aceştia există. k . 300 . există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. k . z ) = 1 V ∑F hkl hkl exp( −2πi ( hx + ky + lz )) (17) Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât. În cazul obţinerii modelului structural s-a făcut o căutare globală potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. deoarece nu sunt necesare variaţii mari ale acestor parametrii.

Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma[24].intensitatea calculată la pasul i. fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. La început se rafinează factorul de scală. Pentru o difractogramă oricât de perfectă maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară.yi . V.intensitatea observată la pasul i. W sunt parametri care se pot rafina. deformaţiile de reţea. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. factorul care descrie absorbţia razelor X. în general trebuie impuse constrângeri. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RP = ∑| y − y ∑y i i ci | (21) 1/ 2 RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ (22) unde wi=1/yi şi se numesc factori de pondere. yci . În ultimele etape. se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. factorul de temperatură şi coeficienţii polinomului care descriu fondul. Din literatură şi din experienţă proprie am constatat că este necesar să se adopte următoarea strategie. exprimată prin funcţia lui Caglioti [23]: H 2 = U tan 2 θ + V tanθ + W (20) unde. În general. mai ales dacă avem un număr mare 301 . H este lărgimea la semiînălţime şi U. şi factorul de polarizare. factorii care descriu asimetria liniilor de difracţie etc. Calitatea rafinării se apreciază pe baza unor indici de rezidiu. Urmează rafinarea deplasării punctului de zero pentru difractogramă. Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective.

de aceea. mai este necesară o calibrare mai complectă la fiecare lună. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. C–O pentru legături simple sau duble. Modul de aliniere şi calibrarea lunară se găsesc în documentaţia de folosire a difractometrului. Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi. de exemplu C–C. În cazul în care se fac măsurători pentru compuşi anorganici cu 302 . este necesar ridicarea unei difractograme pentru un etalon de siliciu. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. De exemplu. Timpul de înregistrare pentru difractograme şi fantele folosite depind de tipul de măsurători efectuate. aceste distanţe pot să varieze între anumite limite. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. Suporţii de probă aduşi de firmă nu au permis analiza unor cantităţi mici de probă. Pentru analiza calitativă. Pe lângă aceasta. Pentru o mai mare siguranţă referitoare la punctul de zero al difractometrului. au fost adaptaţi alţi suporţi de probă care să permită difracţie pentru cantităţi foarte mici de probă. 3. Este recomandat ca difractometrul să fie aliniat în fiecare dimineaţă înainte de a începe experimentele. Totuşi. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain” [25] şi “rigid body“ [26]. în procesul de rafinare a complecşilor de incluziune.de atomi pe celula elementară. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu [27]. De exemplu. timpul de înregistrare este suficient să fie 0 2 /minut. permiţând translaţia şi rotaţia acestora. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente Aparatura de difracţie disponibilă este un difractometru Shimadzu XRD–600 prevăzut cu un monocromator pentru fasciculul difractat. Unităţile glicozidice au fost legate între ele prin constrângeri slabe. dar forma ansamblului să nu se schimbe. Aceasta ar trebui făcută săptămânal. Difractometru este prevăzut cu o bază de date pentru efectuarea de analize calitative şi cu software pentru determinarea raportului cristalin-amorf. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei împreună cu atomii de oxigen secundari au fost considerate ca “rigid body”.

Willey& Sons. P. 24.L. Appl. M.celula elementară mică. chiar dacă acestea nu funcţionează.M.W. Visser J. Neumann J.Louer J. 4. Ed. Cryst. R. Dinnebier and S.E. Nu este indicată achiziţionarea de tuburi de raze X care să nu se utilizeze deoarece tuburile de raze X se deteriorează în timp. dacă este cazul. H. Snyder J. de Woolff.E. 5. adâncimea de pătrundere a razelor X este mult mai mică în cazul utilizării tubului de Cr. G. 36. Inc 1974. Appl.L. este avantajos utilizarea tubului de Cr. J. Powder diffraction. măsurătorile trebuie să se facă aproximativ între 10 si 800. 89 (1969). Tubul de Cu dă fluorescenţă pentru probele care conţin Fe sau Mn. Dacă se lucrează cu probe care conţin Fe sau Mn este de dorit să se folosească tub de Cr care există în dotarea laboratorului. R. A. Appl. Boultif. D. iar pentru compuşi organici care au celula elementară mai mare între 3 si 450. Smith and R. C. Oxford University Press 2002. Eds D. Appl.Bish and J.L. adică timpul de înregistrare să fie în jur de 20 ore. În cazul în care se încearcă determinarea structurii pentru un nou compus. Pentru indexarea compuşilor şi determinarea parametrilor de reţea este indicat să se folosească şi standard intern deoarece în acest caz se poate evalua mai precis punctul de zero al difractometrului şi se pot determina mai exact poziţiile liniilor de difracţie. Cryst. Pentru analiza microstructurală nu este necesară înregistrarea difractogramei pe întreg domeniul. 108-113 (1968). 987-993 (1991). 9. să fie curăţate. Bibliografie 1.C Publishing 2008. 1. fantele trebuie să fie cât mai înguste. Din punct de vedere tehnic. În acest caz. 4. 3.S. 7. Cryst. Powder Diffraction Reviews in Mineralogy Vol 20 1989. 10. de aceea. Cryst. 6. care poate fi chiar proba cântărită din etalonul de Si. Cryst. 2. 8. 303 . 2. 252-255 (1977). Post. când dorim să vedem efectele structurale de suprafaţă sau când avem probă puţină. De asemenea. Alexander X-Ray Diffraction Procedures J. Appl. Klug and L.P.E. Fundamentals of crystallography. Ed. Pentru analiza cantitativă de faze este indicat să se lucreze cu metoda standardului intern. 356-365 (2003).S. timpul de înregistrare trebuie să fie mare.J. eventual să se lase aparatul să funcţioneze şi peste noapte. J. ci doar înregistrarea maximelor de difracţie care trebuie să se facă cât mai precis. Billinge. este indicat să se controleze filtrele pentru apă odată la 3 luni şi. Giacovazzo.

18. F. 87545. Appl. L. 84-92 (1999). 899-908 (2000). C. 32. D.E. Cox. The Rietveld Method. Giacovazzo. J. Le Bas.L. Tsoucaris Acta. Werner. Appl. Attfield and J.B. 27. Leuse. Crystallogr. Los Alamos National Laboratory. Westdahl J. V. Appl. P. 22. O. K. Nowell. 1754-1766 (1999). USA. V.Engel. Le Bail. 23.S. M. G.W.A. Mentzafos. 25. Appl.10. 35. 20. Von Dreele. Dinnebier Powder Diffraction 14. R. Deem J. 15. 32.Eriksson. 1169-1179 (1999). 357-361 (1981). 2. 14. Cole Acta Cryst. Chem. NM. I. Res. F. Konig. Appl. Wike.E. Favre-Nicolin and R. R.B. 835-840 (2002). Engel. L. Appl. 734-743 (2002). S. K. Koning. 24. 33.D. Fundamentals of crystallography. Harris. 367-370 (1985). D. 23. 16. 65-71 (1969). H. G. 13. Appl. 36-50 (1999). 1169 (1999). 32. Young Oxford University Press (1993). Direct phasing in crystallography.C.Wilke. A. Coelho J. Cerny J. Von Dreele General Structure Analysis System (GSAS). Duroy. G. Phys. Cryst.E. Mavridis. R.B. Cryst. Leusen J. B B58.Scardi J. Crystallogr. Crystallogr. Ed. J. Cryst. S.D. Cryst. Falcioni. Larson & R.J.C. 17. M. B47. Giacovazzo.E. Oxford Science Publications 1999. 219. A. 447-452 (1988). Oxford University Press 2002. Report LAUR 86-748.P. Bull. 11.M. O. M. 21.E. Kristallogr. 18. 304 . C. J.M Rietveld J. H. Louer and P. Cryst. 110.M. Favre-Nicolin and R. Pawley J. Cerny Z.Harris. Fourquet Mater. Cryst. 19. G. McCusker. 847-856 (2004). 746-757 (1991). 26. H. Ed. Appl. 14. G. D. 12.

..................... Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect ... 307 1.................. 312 2.I.. A determina structura cristalină pentru un anumit compus înseamnă determinarea sistemului cristalografic în care acesta cristalizează... Totuşi............................................. în cazul pulberilor...................... structura cristalină se determină din monocristale.................................................................................... 311 2.........1...... 319 4................ În general.................... ..... 305 ........... dr........... Rafinarea structurilor cristaline prin metoda Rietveld ......3....... 309 2................................................ se obţin doar câteva zeci....................... 306 1... Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina..........2..4]-tiadiazol-2-il0-toluensulfonamida...... Algoritmi de indexare .......................................................... Extragerea intensităţilor de difracţie..........................2............. a parametrilor celulei elementare.............S........ 307 1............1........... Câteva metode uzuale de idexare ............ 311 2..... Determinarea structurii cristaline se face în principal prin difracţie de raze X................................ iar extragerea acestora este dificilă şi afectată de erori........... Aplicarea unor procedee de calcul pe monocristale la pulberi ....2.................................................. În cazul în care nu se pot obţine monocristale se încearcă determinarea structurii cristaline din pulberi...... cât şi în industrie şi tehnologie........... Determinarea structurii cristaline din pulberi este mai dificilă deoarece............ Metodele pentru monocristale aplicate la pulberi ...... 314 3............ Indexarea difractogramelor ................. în timp ce la monocristale se pot colecta mii de intensităţi de difracţie. Gheorghe Borodi Cuprins 1............... Exemple privind determinarea structurii cristaline din pulberi ....................................... 311 2.... 325 Determinarea structurii cristaline este foarte importantă......................... atât în diferitele ramuri ale ştiinţei. 322 5................. Structura cristalină pentru N-(5-etil-[1...............................3............................... 319 4........... Bibliografie ...................1........... dar de foarte mare ajutor sunt metodele spectroscopice şi de modelare moleculară care pot să furnizeze informaţii structurale deosebit de utile.. foarte multe intensităţi de difracţie se suprapun................... deoarece proprietăţile materialelor în stare solidă depind de structura cristalină şi moleculară a acestora..........1.. a grupului spaţial şi a poziţiilor atomilor în celula elementară..........1... Pentru orice compus nou preparat într-un anumit fel este de dorit să se determine structura cristalină..........................1...... Obţinerea modelului structural ........... Pe lângă aceasta........ Metoda de căutare în spaţiul direct ...Determinarea structurii cristaline prin difracţie de raze X C............................... 316 4......................2...........

Etapele principale pentru determinarea structurii cristaline din pulberi sunt: indexarea difractogramelor. din difractogramele pe pulberi se determină unghiurile de difracţie din care rezultă modulul unui număr limitat de vectori din reţeaua reciprocă din care se doreşte să se reconstituie întreaga reţea reciprocă. cât şi direcţia pentru un număr foarte mare de vectori din reţeaua reciprocă. Indexarea difractogramelor este primul pas în determinarea structurii cristaline. Celula elementară este un paralelipiped în interiorul căruia se găsesc atomii sau moleculele şi dacă acesta se translatează după cele 3 direcţii. De asemenea. În general. cu atât are mai multe linii de difracţie. dintre care unele se suprapun 306 . Vom descrie aceste etape. Aceasta este total diferită faţă de cazul determinării structurii cristaline din monocristale. Astfel. atunci se obţin poziţiile tuturor atomilor din celula elementară. trebuie menţionat că indexarea este cu atât mai dificilă cu cât simetria este mai scăzută. iar la final se vor da câteva exemple de determinare a structurii cristaline din pulberi. o celulă elementară se poate defini în mai multe moduri. compuşii care cristalizează în sistemul triclinic. Astfel. 1. cel mai dificil.în ultimul timp. datorită creşterii puterii de calcul şi rezoluţiei difractometrelor. Astfel. parametrii celulei elementare şi atribuirea fiecărei linii de difracţie a indicilor Miller corespunzători. la difracţia pe pulberi se obţin doar câteva zeci de unghiuri de difracţie din care se determină modulul vectorilor corespunzători din reţeaua reciprocă. cu cât sistemul cristalografic are simetrie mai joasă. dacă aceasta nu este făcută corect. dacă poziţiile maximelor de difracţie ar fi determinate exact. în timp ce în cazul difracţiei pe monocristale se obţin mii de vectori din reţeaua reciprocă. în cazul pulberilor. Dificultăţile în indexarea difractogramelor provin din erorile legate de determinarea poziţiilor maximelor de difracţie. indexarea ar fi imediată. cel mai uşor se indexează compuşii care cristalizează în sistemul cubic şi. Dificultatea indexării provine din faptul că. Deoarece în cadrul ICE există difractometru pentru pulberi ne vom ocupa doar de determinarea structurii cristaline din pulberi cristaline. unde se determină atât modulul. dar se alege acea celulă care are volumul cât mai mic şi simetria cât mai mare. Aceasta deoarece. datele experimentale sunt proiecţia unidimensională a reţelei reciproce care este tridimensională. obţinerea modelului structural şi rafinarea Rietveld a modelului obţinut. foarte multe structuri cristaline au fost determinate din pulberi. Indexarea difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic. nu se poate determina structura cristalină.

de exemplu.1 Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect sunt: a) Să existe linii de difracţie observabile la unghiuri cât mai mici. În programele de calcul elaborate în ultimul timp se poate face indexarea chiar când există un număr mic de reflexii care aparţin impurităţilor şi acestea sunt excluse dacă celelalte linii de difracţie se potrivesc cu celula elementară găsită. se variază parametrii celulei elementare într-un anumit mod şi se aleg acele 307 . Indexarea este cu atât mai dificilă cu cât simetria reţelei cristaline este mai joasă. b) Numărul de extincţii pentru maximele de difracţie la unghiuri mici să nu fie foarte mare. Cele mai importante erori sistematice sunt poziţia de zero a difractometrului şi deplasarea probei. Aceasta deoarece la unghiuri mici peak-urile de difracţie sunt mai rare şi şansele de a se suprapune sunt mai mici. iar pentru sistemul triclinic depinde de şase parametrii. Erorile sistematice sunt mai nefavorabile pentru indexare decât erorile întâmplătoare. Pentru corectarea erorilor sistematice se poate folosi atât standard extern. definirea celulei elementare pentru sistemul cubic depinde de un singur parametru. Dacă. c) Să avem o precizie mare pentru determinarea poziţiilor de difracţie. Cea mai precisă corecţie se face prin utilizarea de standard intern. Erorile sistematice pot să fie minimizate prin alinierea difractometrului. dacă avem impurităţi. Acest lucru este foarte important deoarece nu se poate distinge între liniile de difracţie ale compusului şi liniile de difracţie ale impurităţii. obţinem o celulă elementară incorectă. Indexarea difractogramelor se face în mod automat folosind diferiţi algoritmi de calcul[1]. 1. În cazul căutării în spaţiul direct. d) Să nu existe impurităţi în proba de analizat. cât şi standard intern. unul dintre indicii Miller este tot timpul par din cauza reflexiilor interzise. În general.2 Algoritmi de indexare Există două abordări pentru algoritmii de indexare şi anume căutarea în spaţiul direct şi în spaţiul reciproc.parţial. Astfel. pentru sistemul ortorombic depinde de trei parametrii. Aceasta presupune introducerea în proba de analizat a unui compus pentru care se ştiu exact poziţiile maximelor de difracţie. atunci la indexare s-ar putea să avem o celulă cu o constantă de reţea dublă faţă de cea reală. ceea ce face ca să nu se poată determina precis poziţiile maximelor de difracţie. 1.

Aceasta este tot o variantă a metodei Monte Carlo. Valoarea indicilor Miller variază între 0 308 . γ cu 0. în special pentru sistemul triclinic şi monoclinic.10 şi se caută cea mai bună potrivire dintre poziţiile calculate şi observate ale unghiurilor de difracţie. utilizând spaţiul direct. pentru sistemul triclinic fiind 6. este mult mai mare decât în spaţiul reciproc. dacă se lucrează în spaţiul direct. Timpul de calcul.b. Există şi posibilitatea utilizării algoritmilor genetici pentru indexarea difractogramelor. β . Deci se cunosc un număr limitat de vectori ai reţelei reciproce şi se urmăreşte să se găsească vectorii elementari ai reţelei reciproce care să genereze întreaga reţea reciprocă. Căutarea în spaţiul reciproc poate fi implementat în două variante. Dintre programele de calcul care utilizează căutarea în spaţiul direct. Prima este mai eficientă pentru sisteme cu simetrie ridicată de la cubic la ortorombic. Această metodă este metoda directă de căutare în spaţiul direct. Vectorii reţelei reciproce sunt legaţi de unghiurile de difracţie prin relaţia (2sin θ )/ λ =1/d. pentru sistemul cubic numărul unghiurilor din setul de bază este 1 pentru sistemul tetragonal.01 Å şi unghiurile α. este o metodă iterativă şi Monte Carlo ce utilizează poziţiile liniilor de difracţie pe baza descompunerii difractogramei şi extragere a intensităţilor de difracţie LSI (Least Square Indexing) and LP-Search [5]. care se numeşte setul de bază şi care sunt liniile de difracţie cu cele mai mici unghiuri.valori pentru care poziţiile maximelor de difracţie calculate se potrivesc cât mai bine cu cele observate. La căutarea în spaţiul reciproc se caută să se găsească vectorii elementari ai celulei reciproce folosind unghiurile de difracţie. Astfel. mai ales în cazul compuşilor cu simetrie scăzută. se variază parametrii celulei elementare a. O altă posibilitate de căutare este utilizarea metodei Monte Carlo. este 2 şi aşa mai departe.c cu aproximativ 0. Din vectorii elementari ai reţelei reciproce rezultă imediat vectorii elementari ai reţelei directe. Metoda de încercare şi eroare se bazează pe atribuirea de indici Miller la un număr minim de peak-uri de difracţie. şi anume: metoda de încercare şi eroare şi metoda de căutare pe zone. McMaille [3] şi SVDIndex [4] care se bazează pe metode de căutare de tip Monte Carlo. În cazul indexării. Metodele de indexare care utilizează spaţiul reciproc sunt mai eficiente decât cele de căutare în spaţiul direct. O altă tehnică de indexare foarte puternică şi care este implementată în programul de calcul de către firma Bruker Topas. merită menţionate următoarele: Autox [2]. Numărul unghiurilor de difracţie din setul de bază este egal cu numărul parametrilor ce caracterizează celula elementară. iar a doua variantă este mai eficientă pentru sisteme cu simetrie joasă.

Când o zonă tridimensională (reţeaua) a fost construită. Având parametrii celulei elementare. km. h. Se reţin acei parametrii de reţea pentru care unghiurile calculate se potrivesc cel mai bine cu unghiurile experimentale şi care indexează toate sau aproape toate unghiurile experimentale. Programele de calcul care fac indexarea prin metoda Dicvol încep de la sistemul cubic.0.k. 0. Dacă difractograma experimentală are şi impurităţi. se încearcă atribuirea indicilor Miller pentru toate reflexiile Bragg observate.l şi bidimensionale. dacă în intervalul respectiv se găseşte soluţia elementară. 1. adică de tipul h.k.3 Câteva metode uzuale de idexare Metoda Treor. se generează unghiurile de difracţie şi se verifică dacă unghiurile calculate se potrivesc cu cele experimentale. Metoda Dicvol [7] este o metodă de căutare în spaţiul direct şi se bazează pe metoda dihotomiei care constă în variaţia lungimilor celulei elementare şi a unghiurilor dintre axe între anumite limite şi reducerea intervalelor respective.0. l notate cu hm. după care se calculează parametrii celulei elementare [6].l şi construirea zonelor tridimensionale utilizând liniile comune din zonele bidimensionale. se generează toate poziţiile posibile ale maximelor de difracţie şi se verifică dacă poziţiile unghiulare ale maximelor de difracţie observate sunt incluse în cele calculate în limita unor erori de măsură.şi valori maxime preselectate pentru h. Cu acest program se poate indexa orice sistem cristalografic. Se testează toate sistemele cristalografice începând de la sistemul cubic până la sistemul triclinic. Această metodă este o metodă de căutare în spaţiul reciproc şi se bazează pe atribuirea unor indici Miller la primele linii de difracţie.h.0.l. Operaţia se repetă atribuind alţi indici Miller primelor maxime de difracţie şi se ordonează soluţiile în ordinea descrescătoare a factorilor de încredere.k.0. după care se calculează factorul de încredere. Metoda Dicvol. dar cele mai bune rezultate se obţin pentru sistemele cu simetrie ridicată. Aceste valori sunt între 2 şi 4. lm.0. Pentru fiecare permutare a indicilor se determină parametrii celulei elementare. Se reţin acele valori ale parametrilor de reţea care se potrivesc cel mai bine cu valorile experimentale şi se calculează pentru acestea factorul de încredere. care este de simetria cea mai ridicată şi termină cu sistemul triclinic. 0. Metoda căutării pe zone începe prin căutarea zonelor unidimensionale. atunci această metodă nu poate să facă corect indexarea deoarece nu are posibilitatea să dis309 .0. adică de tipul h. 0.

din programele de indexare rezultă mai multe soluţii foarte diverse între ele. O altă observaţie în alegerea soluţiei corecte se referă la densitatea calculată. În general. în special triclinic şi monoclinic. Pentru a se indexa cu această metodă se parcurg următorii paşi: a) Găsirea potenţialelor zone utilizând primele 20 unghiuri Bragg. Maximelor de difracţie experimentale li se pun în corespondenţă cele mai apropiate maxime de difracţie calculate. O primă observaţie este că dacă nu au fost indexate toate liniile de difracţie. în acest caz. b) Construirea reţelelor tridimensionale prin găsirea de zone bidimensionale care au o zonă unidimensională comună. rămânând una sau două linii de difracţie neindexate. realizează o căutare a zonelor în spaţiul reciproc şi transformare a axelor celulei pentru a găsi o celulă cât mai potrivită [9]. cu atât şansa de a obţine mai repede soluţia corectă la indexare este mai mare. cu condiţia ca liniile de difracţie neindexate să fie de mică intensitate şi. Programul cere cel puţin 20 de reflexii Bragg şi nu funcţionează cu mai puţine linii de difracţie. Ca o remarcă generală: cu cât poziţiile liniilor de difracţie sunt determinate mai precis şi cu cât proba de analizat este mai pură. Pentru fiecare combinaţie de parametrii ai celulei elementare se generează poziţiile maximelor de difracţie. Programul mai ţine cont de densitatea aproximativă a compusului şi de numărul posibil de molecule pe celula elementară. Această metodă de calcul. Programul Ito este folosit în special pentru indexarea sistemelor cu simetria joasă. Pe lângă aceste programe de calcul am mai elaborat şi noi un program [10] care se bazează pe căutarea în spaţiul direct pentru parametrii reţelei cuprinşi într-un anumit interval şi cu un anumit pas. împreună cu programul aferent.tingă între liniile de difracţie ale compusului şi ale impurităţilor. Cele mai comune versiuni sunt ITO13 şi ITO15. Metoda Ito. Se ordonează soluţiile în ordinea descrescătoare a erorii medii. Cu această metodă de indexare se obţine şi grupul spaţial la care aparţine compusul. d) Atribuirea indicilor Miller pentru toate maximele observate şi calcularea figurilor de merit. c) Reducerea celulei găsite şi transformarea acesteia în una din cele 14 reţele Bravais. se calculează eroarea medie dintre poziţiile maximelor calculate şi cele experimentale şi se trece la pasul următor. s-ar putea ca soluţia să fie corectă. dar aceasta trebuie confirmată. acestea să aparţină unor impurităţi. O metodă asemănătoare cu Dicvol şi care se bazează tot pe procedeul dihotomiei. dar care nu este foarte sensibilă la impurităţi se numeşte X-cel [8]. După indexare cunoaştem volu310 . Un număr de 30-35 de reflexii Bragg este recomandat.

atunci o putem compara cu densitatea calculată şi să confirmăm dacă indexarea poate fi corectă cu soluţia aleasă. modelul structural obţinut nu va putea fi rafinat. Dacă indexarea se face cu Dicvol. în caz contrar. mai ales atunci când fondul de difracţie este supraestimat. Un alt criteriu foarte important este valoarea figurii de merit.1. 2. metoda Le Bail şi metoda Pawley. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie.1 Extragerea intensităţilor de difracţie Metoda Le Bail de extragere a intensităţilor de difracţie este inspirată din metoda Rietveld. 2. Le Bail a extins această metodă pentru estimarea valorilor absolute a factorilor de structură. Le Bail a propus o metodă iterativă de determinare a intensităţilor de difracţie observate. şi anume: metode utilizate în cazul monocristalelor şi metode de căutare în spaţiul direct. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale.1 Metodele pentru monocristale aplicate la pulberi În acest caz. Intensităţile de difracţie pentru iteraţia (r+1) se exprimă în funcţie de intensităţile de difracţie pentru iteraţia r. mai întâi se extrag intensităţile de difracţie deoarece se ştie că în cazul difracţiei pe pulberi foarte multe intensităţi de difracţie se suprapun. Dacă s-a determinat densitatea experimentală. Treor sau Ito. se pot considera valorile calculate ale intensităţilor de difracţie. figura de merit trebuie să fie neapărat mai mare ca 4. când nu există un model structural. există şi cazuri când prezintă instabilităţi.mul celulei elementare şi dacă presupunem un anumit grup spaţial putem determina numărul de molecule pe celula elementară şi de aici densitatea. Densitatea calculată trebuie să aibă o valoare rezonabilă în funcţie de elementele care se găsesc în compus. Obţinerea modelului structural Pentru obţinerea modelului structural există două posibilităţi. 2. Vom descrie pe scurt cele două tipuri de metode. Vom descrie pe scurt cele două metode. Ca intensităţi de pornire. Dacă indexarea este corectă. şi anume. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei 311 . Deşi metoda este în general robustă. atunci putem să mergem mai departe pentru a obţine modelul structural şi să-l rafinăm. Există două tehnici de extragere a intensităţilor de difracţie.

este corectarea acestora de factori fizici sau geometrici care afectează intensităţile de difracţie. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. (iii) Determinarea fazei factorilor de structură. în schimbul intensităţilor de difracţie. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. Dar factorii de 312 .2 Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley. factorul de absorbţie şi factorul de extincţie. în unele cazuri s-au obţinut rezultate bune. 2. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. factorul de polarizare. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative. care nu necesită un model structural. Unii autori au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură. În timp ce metoda Le Bail este o metodă iterativă.Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. Primul pas. Cu toate acestea. Metoda Pawley este o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X. (ii) Determinarea factorului de scală şi a factorului global de temperatură. Dacă se fac corecţiile intensităţilor de difracţie. după ce au fost obţinute intensităţile de difracţie. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi.5 dintr-un pas de înregistrare a difractogramei. Deşi procesul de rafinare este în general stabil. Paşii care trebuie urmaţi sunt: (i) Corectarea intensităţilor de difracţie.1. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. se determină factorul de scală şi de temperatură şi se obţine modulul factorilor de structură. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul a zecilor până la 3 sau 4 sute. Datorită faptului că atomii oscilează în jurul poziţiilor de echilibru. Aceştia sunt: Factorul Lorentz. intensităţile acestora se reduc cu un factor de temperatură.

faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. Modelele structurale obţinute prin metodele directe sau metoda Patterson sunt adesea incomplete chiar şi pentru monocristale. Δ z. (v) Rafinare Fourier.w) = ∑ Fh . Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. atunci putem face sinteza Patterson. y . Cunoscând factorii de structură. z ) = 313 . (iv) Sinteza Fourier şi sinteza Patterson. mai ales. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice şi probabilităţi condiţionate. k . dacă densitatea electronică este mai mare. v. putem să determinăm densitatea electronică de sarcină în celula elementară. iar pentru pulberi cu atât mai mult pentru că numărul de intensităţi experimentale este mult mai mic.l cos( 2π ( hx + ky + lz )) V h . cu ajutorul relaţiei: 1 ∑ Fhkl exp( −2πi(hx + ky + lz )) V hkl Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât. Cele mai importante tehnici de rafinare Fourier sunt: Sinteze Fourier succesive şi Sinteza Diferenţă. după relaţia: 2 1 P(u. ρ ( x. Pentru a îmbunătăţi şi completa modelul se apelează la tehnici de rafinare Fourier. există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi.structură sunt numere complexe.v. Pe baza densităţii electronice se poate construi un model structural aproximativ. distanţele dintre atomii grei.l unde u. Δ y. k . w reprezintă respectiv Δ x. dacă aceştia există. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. deci în acest caz factorii de structură sunt numere reale pozitive sau negative.

Să presupunem că la cele 6 grade de libertate (translaţii şi rotaţii) se adaugă doar 4 grade de libertate interne şi să avem în total 10 grade de libertate. La aceasta se adaugă gradele de libertate interne legate de modificarea configuraţiei moleculare prin modificarea unghiurilor de torsiune. metoda Monte Carlo inversă [11].2. de exemplu. Aceasta înseamnă că nu se pot testa toate configuraţiile şi de aceea se apelează la metode probabilistice. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală. Astfel. grupe de atomi aranjaţi într-o anumită configuraţie.2. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. presupunem că pentru fiecare grad de libertate corespunde doar 10 zece paşi de căutare. eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. În acest caz. ca de exemplu. Dacă. se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. avem în mod obligatoriu 3 grade de libertate de translaţie. ca de exemplu. Această metodă nu cere extragerea factorilor de structură din difractogramă. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. o variantă a acesteia numită parallel tempering şi tehnica algoritmilor genetici. ceea ce cere un timp foarte mare de calcul. fragmente din molecule. tetraedrii. octaedrii etc. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. 3 grade de libertate de rotaţie. distanţe. Să presupunem că avem doar o moleculă pe celula elementară. Putem să avem atomi. rezultă că numărul total de configuraţii care trebuie să fie testat este de 10x10=1010. În cazul metodei de răcire simulată. pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. unghiurilor de legătură dintre atomi şi. Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. mai rar. dintre care amintim: Răcire simulată (simulated annealing). Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. Pentru moleculele organice. molecule. se testează potrivirea dintre difractograma calculată şi cea expe314 .

315 .14]. şi anume. definit în felul următor: Rwp=[ Σ i wi ( y obd i − i y calc i )2 Σ i wi ( y ) obs 2 ]1/2 Dacă funcţia de cost CF este mai mică decât cea precedentă.rimentală. funcţia care descrie fondul (background) şi o funcţie care sumează liniile de difracţie. poate să se introducă ca şi criteriu pentru modelul obţinut.Δ CF/T). Funcţia de cost CF se poate alege în diverse moduri. Lorentziana sau pseudos-Voigt. În schimbul utilizării unui singur lanţ de configuraţii cu descreşterea temperaturii. şi anume. În timpul procesului de căutare. Profilul liniilor de difracţie se descrie de obicei prin funcţii standard de tipul Gaussiana. se consideră funcţia de cost CF. se poate uşor trece de la un minim local la un alt minim. în afară de potrivirea dintre difractograma calculată şi cea observată. fiecare linie de difracţie fiind centrată corespunzător. minimizarea energiei potenţiale de interacţiune inter . Totuşi. Parallel Tempering (PT) [15]. pentru a evita probabilitatea să cădem într-un minim local.şi intramoleculară. Difractogramele pot fi modelate ca o sumă de două funcţii. T fiind temperatura distribuţiei. cu probabilitatea exp(. Una dintre posibilităţi este să se aleagă ca fiind reziduul R. posibilitatea de a se obţine minime locale este mai mică. Powder Solve [12]. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2=exp[(CF2-CF1)/T]. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. dintre care amintim. un alt algoritm a fost dezvoltat. în faza iniţială a procesului de căutare a configuraţiei optime. se aleg de la început mai multe configuraţii (un număr mic de configuraţii). temperatura se scade treptat. în scopul determinării minimului absolut. Astfel. atunci se reţine noua configuraţie. În felul acesta. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. se poate introduce un factor numit ‘anti-bump’. probabilitatea de a găsi un alt minim este de asemenea mică. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. Pentru ca unităţile structurale să nu se apropie foarte mult unele de altele. când T este foarte mic. În procesul de căutare a minimului global ca şi Cost Function. Dacă CF este mai mare decât cea precedentă. Fox [13. atunci se reţine noua configuraţie. dar în faza finală. Orientarea preferenţială poate fi descrisă prin funcţii de tip March-Dollase.

factorul de scală. şi anume: de factorii de structură şi indicii Miller corespunzători factorilor de structură respectivi. factorul de absorbţie.factorul de structură pentru atomul j. iar wi=1/yi este factorul de ponderare. cel mai utilizat este GSAS [17]. Lorentz. Expresia factorilor de structură este dată de relaţia: Fhkl ⎛ B sin 2 θ ⎞ = ∑ N j f j exp[2Π(hx j + ky j + lz j )]exp⎜ ⎟ ⎜ − λ2 ⎟ j ⎠ ⎝ (2) unde: Nj . se poate aproxima prin diverse funcţii: de tip Gauss. B . fondul de difracţie în punctul respectiv etc. yj. zj . Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate.factorul de ocupare. deoarece nu sunt necesare variaţii mari ale acestor parametrii. Profilul liniei de difracţie. de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate. este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [16]. ϕ. Cu alte cuvinte. yci depind de o serie de factori. factorul Lorentz–polarizare. care este descrisă ca fiind o combinaţie a funcţiei Gauss şi Lorentz: 316 . funcţia de profil pentru liniile de difracţie.3. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural. dându-se intensitatea de difracţie la fiecare pas. Funcţia ce trebuie minimizată este: (1) S y = wi ( y i − y ci ) 2 ∑ i unde yi si yci sunt intensităţile observate şi calculate la pasul i. fj .coordonatele atomului j. etc. yci este difractograma care se calculează la pasul i pentru că difractograma se calculează în paşi. potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată. Forma liniilor de difracţie este o convoluţie datorată probei şi efectelor instrumentale. Dintre acestea. În cazul obţinerii modelului structural. În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim. cea mai utilizată este funcţia pseudo Voigt. pseudo-Voigt. xj.factorul de temperatură (care se datoreşte vibraţiilor termice). Dintre programele de calcul. s-a făcut o căutare globală. pV.

funcţia pseudo-Voigt . exprimată prin funcţia lui Caglioti[18]: H 2 = U tan 2 θ + V tanθ + W (3) unde. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară.intensitatea măsurată.coeficientul March care variază între 0 şi 1. Calitatea rafinării se apreciază pe baza unor indici de rezidiu. G funcţia Gaus iar η parametru de amestecare a celor două funcţii. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RB = RP = ∑| I K ( obs ) ∑| y − y ∑y i i ∑I − I K ( calc) | (5) (6) K ( obs ) ci | 317 . Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective. αK . L fiind funcţia Lorentz. Orientarea preferenţială are loc când cristalitele din probă tind să se orienteze preferenţial după anumite direcţii. Aceasta face ca unele maxime de difracţie să fie mai intense. Iobs . unde 0 se referă la 100% orientare preferenţială a cristalitelor în probă şi 1 se referă la orientare complet întâmplătoare a cristalitelor. W sunt parametri care se pot rafina. Icor . V.unghiul ascuţit dintre vectorul de împrăştiere pentru reflexia K şi direcţia preferenţială de orientare a planului cristalitelor faţă de planul probei.pV = ηL + (1-η)G unde: pV . March-Dollase [19]: I cor = I obs (G 2 cos2 α K + 1 2 sin α K ) −3 / 2 G (4) unde. iar altele mai puţin intense faţă de cazul când nu ar exista orientare preferenţială. G . H este lărgimea la semiînălţime şi U. PK este funcţia care descrie orientarea preferenţială. ca de exemplu.intensitatea corectată pentru orientare preferenţială. Orientarea preferenţială poate fi modelată matematic cu ajutorul unor funcţii.

De exemplu. wj=1/ σ 2 (Roj) (8) (yoi) j unde yoi şi yci sunt intensităţile observate şi calculate la pasul i. La început se rafinează factorul de scală. Totuşi. C-O. Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma [20]. În general fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. de exemplu C-C. factorul de temperatură şi coeficienţii polinomului care descriu fondul.RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ 1/ 2 (7) Cei mai utilizaţi indici sunt RP si RWP. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain”[21] şi “rigid body“[22]. atunci la funcţia din formulă (5). mai trebuie să adăugăm şi termenii care iau în considerare constrângerile slabe. factorii care descriu asimetria liniilor de difracţie etc. maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. funcţia ce trebuie minimizată este: SyR= ∑ w (y i i oi-yci) 2+C w ∑ w (R -R j oj cj(x)) 2 . mai ales dacă avem un număr mare de atomi pe celula elementară. Din literatură şi din experienţa proprie. Urmează rafinarea deplasării punctului de zero pentru difractogramă. deformaţiile de reţea. În ultimele etape se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. aceste distanţe pot să varieze între anumite limite. Pentru o difractogramă oricât de perfectă. pentru legături simple sau duble. wi=1/ σ 2 (yoi) . Dacă rafinarea se face ţinând cont de constrângerile slabe. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. în general trebuie impuse constrângeri. În acest caz. care trebuie minimizată. am constatat că este necesar să se adopte următoarea strategie. factorul care descrie absorbţia razelor X şi factorul de polarizare. În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. σ 318 este .

Unităţile glicozidice au fost legate între ele prin constrângeri slabe. cw este un factor de ponderare care permite să se varieze contribuţia constrângerilor în procesul de rafinare. Complecşii de incluziune cu β -ciclodextrina se folosesc pentru a îmbunătăţi biodisponibilitatea. În cazul în care există şi grupări plane.z). una dintre aceste unităţi este prezentată în figura 1. Exemple privind determinarea structurii cristaline din pulberi 4. Aceasta are o formă toroidală în care se pot încapsula diferiţi compuşi bioactivi şi se poate realiza eliberarea treptată a acestora. solubilitatea şi stabilitatea diferitelor medicamente în soluţii apoase. În general. au fost considerate ca “rigid body”. În cazul programului de rafinare GSAS [17]. δ (Roj) este deviaţia standard a pseudo-observabilei. iar Rcj(x) este valoarea calculată din poziţiile atomilor (x. împreună cu atomii de oxigen secundari. Cu cât cw este mai mare. unghiuri etc (aşa numita pseudo observabilă). Roj este valoarea aşteptată pentru mărimea stereochimică respectivă care poate fi lungime de legătură. de ordinul miilor. permiţând translaţia şi rotaţia acestora.deviaţia standard a intensităţii lor măsurate. De exemplu. constrângerile puternice “rigid bodies” sunt incompatibile cu constrângerile slabe. Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi dar forma ansamblului să nu se schimbe. 319 . atunci este necesară aplicarea constrângerilor de planeitate [23]. β -ciclodextrina este compusă din 7 unităţi glicosidice. în procesul de rafinare a complecşilor de incluziune. se porneşte cu un cw mare. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. pentru ciclu benzenic. şi se tot reduce în procesul de rafinare.y. cu atât constrângerile sunt mai puternice. când în afară de constrângerile slabe se aplică şi constrângeri ca molecula să fie planară.1 Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina. ca de exemplu. aceasta înseamnă că atomilor care aparţin unui corp rigid nu le pot fi aplicate constrângerile slabe în acelaşi timp. 4.

complexul de incluziune cristalizează în sistemul monoclinic având grupul spaţial C2 cu 4 molecule de 320 . Structura cristalină pentru atenolol nu a fost cunoscută la acel moment. De aceea. Formula structurală pentru Atenolol este prezentată în figura 2. Configuraţia moleculară pentru β ciclodextrină a fost luată din baza de date Cambridge Structural Database [29]. Dar la interacţiunea cu atenololul structura cristalină se modifică total în sensul că se schimbă grupul spaţial. celula elementară şi modul în care interacţionează şi se cuplează cele două molecule pentru a forma complexul de incluziune.Figura 1 Unitate glicozidică din componenta β Ciclodextrina Noi am urmărit să determinăm structura cristalină pentru Atenolol cu β -Ciclodextrina. Structura cristalină pentru β Ciclodextrină se cunoştea. celula elementară şi configuraţia moleculară.0 [20]. configuraţia moleculară pentru atenolol a fost calculată cu ajutorul programului de modelare moleculară Cerius 2. indexarea s-a făcut cu ajutorul programului de calcul Ito [9]. grupul spaţial. În urma indexării s-a stabilit că. Figura 2 Formula structurală pentru Atenolol După determinarea poziţiilor maximelor de difracţie. adică să determinăm sistemul cristalografic.

fa pentru restrângerile de unghiuri. dar între anumite limite.914Å.450Å. Restrângerile slabe nu se pot aplica pentru atomii din cadrul unui grup aparţinand la “rigid body”. În urma modelării s-a constatat că molecula de atenolol intră în cavitatea β -ciclodextrinei.. Volumul celulei elementare este V=6772. împreună cu atomii de oxigen O4. cu ajutorul restrângerilor de planeitate.375g/cm3. Au fost rafinaţi de asemenea parametrii termici. Pentru obţinerea unui model structural realist s-a procedat la aplicarea unor serii de restrângeri şi constrângeri. iar oxigenii de la capătul grupărilor glicozidice au fost legaţi între ei prin restrângeri slabe (soft restrains). Pentru aceasta s-a utilizat programul de calcul GSAS. În continuare. adică fondul de difracţie care a fost aproximat cu un polinom. Fiecare unitate glicozidică. În schimb. s-a permis rotaţia şi translaţia. a fost considerată ca “rigid bodies”. pentru restrângerile slabe este permisă mişcarea atomilor. γ =900. Reamintim că în cadrul unui grup de atomi care au fost definiţi ca “rigid bodies” nu se permite nici o mişcare a atomilor din cadrul grupului. α =900. c=15. Au fost aplicate restrângeri de planeitate pentru gruparea fenil din cadrul atenololului. s-a pus condiţia ca toţi cei 7 atomi de oxigen O4 să fie aproximativ în acelaşi plan. Obţinerea modelului structural s-a făcut cu ajutorul programului de calcul. s-a procedat la rafinarea modelului structural prin metoda Rietveld. b=24. β =110. Densitatea calculată este ρ =1. unghiurile de torsiune pentru molecula de atenolol. H. De asemenea. rigidizarea este cu atât mai mare cu cât factorii de pondere pentru restrângerile slabe sunt mai mari.640. parametrii de reţea.649Å . fd fiind factorul de pondere pentru restrângerile de distanţe. background-ul. Astfel. restrângerile slabe referitoare la planeitatea atomilor (O4)n a fost în cazul ciclodextrinei de 0. o valoare plauzibilă pentru compuşii organici care conţin C. O. Pentru unităţile glicozidice.05 Å. De asemenea. Ca grade de libertate au fost translaţiile şi rotaţiile pentru molecula de ciclodextrină şi molecula de atenolol. N. Iniţial. utilizând tehnica ”simulated anealling” şi ”paralel tempering”.55Å3. au fost aplicate restrângeri slabe pentru toate distanţele dintre atomi şi unghiurile de legătura dintre aceştia.ciclodextrină şi 4 molecule de atenolol pe celula elementară şi următorii parametrii de reţea: a= 18. factorii de pondere pentru restrângerile slabe au fost: fd=fa=fp=5000. unele în raport cu altele. Pentru funcţiile de profil s-au folosit 12 parametrii. Profilul de difracţie a fost aproximat prin funcţii de tip pseudo-Void. unghiurile de torsiune dintre unităţile glicizidice şi unghiurile dintre unităţile glicozidice. iar fp pentru restrângerile de planeitate. punctul de zero pentru 321 .

În mod asemănător s-a determinat structura cristalină pentru complexul de incluziune Acid Mefenamic. vedere după axa b şi c. În final. s-a obţinut un rezidiu Rp=7.4]-tiadiazol-2-il0-toluensulfonamida Structura cristalină pentru acest compus a fost determinată prin combinarea difracţiei de raze X pe pulberi cu informaţii obţinute din RMN pen322 . bineînţeles. care au fost în număr de 288. 4.β CD. Figura 3 Configuraţia moleculară pentru complexul de incluziune atenolol.difractogramă şi.8% şi Rwp=11. Configuraţia moleculară pentru complexul de incluziune văzut după axa b şi după axa c este prezentată în figura 3. formând un fel de dimeri. Se observă ca moleculele de ciclodextrină şi cele de atenolol se grupează între ele prin legături de hidrogen.2. Structura cristalină pentru N-(5-etil-[1.3.58%.β -Ciclodextrina. parametrii de poziţie.

s-a utilizat radiaţia Cu K α 1 9 λ =1. Modelul obţinut în acest mod a fost în continuare rafinat prin metoda Rietveld. s-a calculat densitatea ca fiind ρ =1. rezultă că numărul de molecule pe celula elementară este 8. Cea mai bună soluţie corespunde sistemului ortorombic cu următorii parametrii de reţea: a=8. Considerând 8 molecule pe celula elementară. S-a obţinut un fit cu Rp=0.3846 Å şi volumul celulei elementare fiind V=2740. utilizând programul de calcul GSAS [17] combinat cu interfaţa grafică EXPGUI [31] .05 şi Rwp=0.54056Å. unghiuri fa şi planeitate fp au fost reduşi treptat în cursul ciclurilor de rafinare de la 500 la 100.5364Å. La acest grup spaţial corespund un număr de 8 poziţii generale.37g/cm3. s-au aplicat o serie de restrângeri slabe pentru distanţe. S-a lucrat varianta geometria Bragg-Brentano θ -2 θ prin reflexie.0148 Å si c=21. dintre care 6 corespund pentru poziţia moleculei şi orientarea acesteia. se obţin informaţii structurale foarte importante. Deoarece deplasarea chimică obţinută din RMN pe solide este sensibilă chiar şi la mici modificări de împachetare moleculară şi modificare conformaţională din spectrul RMN. În continuare s-a făcut fitarea Le Bail a difractogramei experimentale pentru confirmarea grupului spaţial selectat. ceea ce confirmă grupul spaţial ales din reflexiile interzise. Deoarece nu există nici un motiv ca moleculele să se plaseze în poziţii speciale. Profilul maximelor de difracţie de pe întregul interval 2 θ = 3. folosind programul de calcul Dash [30]. care reprezintă o valoare rezonabilă.tru 13C şi din modelare moleculară. Determinarea structurii cristaline s-a făcut prin metoda căutării în spaţiul direct. Indexarea compusului s-a făcut utilizând programul de calcul Dicvol [9]. Un factor de temperatură global a fost rafinat pentru toţi atomii.5-500 au fost modelate cu funcţii de profil de 323 . Factorii de pondere corespunzători restrângerilor pentru distanţe fd. Prin examinarea difractogramei cu ajutorul programului de calcul Checkcell [28]. echipat cu un monocromator de Ge (111) pentru fasciculul incident pentru înlăturarea radiaţiei K α 2 şi.072. pentru un anumit grup de reflexii interzise corespund mai multe grupuri spaţiale. Noi vom descrie în special aportul difracţiei de raze X la determinarea structurii cristaline pentru acest compus. Pentru a avea un model structural realist în timpul rafinării. în cele mai multe cazuri. prin ajustarea a 10 grade de libertate. cel mai probabil grup spaţial a fost găsit ca fiind Pbca. prin urmare. Modelul structural de pornire a fost obţinut cu ajutorul programului de calcul Molden.914 Å3. unghiuri şi planeitate a grupării fenil. iar 4 la unghiurile de torsiune pentru moleculă. b=15. D8 Advance. Menţionăm că. Difractograma de raze X pe pulberi a fost obţinută cu difractometrul de raze X.

Rwp=0. modelul a fost îmbunătăţit utilizând tehnici de modelare moleculară combinată cu informaţii obţinute din măsurători de deplasare chimică din spectul RMN. Rexp= 0. difractograma calculată şi diferenţa dintre difractograma calculată şi cea experimentală. 324 . χ 2=6. Se observă o potrivire foarte bună între cele două difractograme.053. Fondul de difracţie a fost modelat cu un polinom Chebyshev de ordinul întâi. În figura 4 este prezentată împachetarea în celula elementară pentru compusul studiat şi aranjarea supramoleculară sub formă de două şuviţe formate din molecule puse cap la cap.tipul pseudo-Voight cu 18 termeni. În final.71.113. Figura 4 Împachetarea în celula elementară şi aranjarea supramoleculară Un alt compus pentru care s-a determinat structura cristalină prin combinarea difracţiei pe pulberi cu spectroscopie RMN şi modelare moleculară a fost Etoxiazolamida [27]. În figura 5 este prezentată difractograma experimentală. În continuare.079. s-au obţinut următorii factori care caracterizează figura de merit a modelului structural: Rp=0. deci modelul structural este corect.

110 . 36. Le Bail.Cerny Z. Giacovazzo. Visser. Cryst. 89 (1969) Gh. Boultif and D. Kern. P. 734. 16. 86 (2003). A. The Third Pharmaceutical Powder X-ray Symposium (PXRD-3).Deem J. F. I. 325 . 249 (2004) J.Cerny J. Oxford University Press.Wilke .Simul. A. 35. 12. 6.Harris . J. 847-856. 5 Comparaţie dintre difractograma observată şi cea calculată 5. in: Structure determination from powder diffraction data. Rizzi. (2002) V.A. A. Cryst.Pusztai . 8. Eds. S.Phys. J. New York (2002) J.G. J. J. Powder Diffraction.Appl. 724 (2004) J. 1. Moliterni. Shankland. Cryst. K. C.Favre-Nicolin and R. (1969) 2.M Rietveld . 32.E. 25. 19.W. 3.M. 69 (1992). Appl. Baerlocher. Lou¨er. 51(7-10) 983 (1999) R. 15.D.W. and Ch. Appl. (2004) M. Coelho. L.Favre-Nicolin and R.Mol. Appl. Gavira Roumanian Reports in Physics.B.. Bibliografie 1. 356 (2003). McCusker. IUCr monographs on crystallography . Monte Carlo indexing with McMaille.L.359 (1988) G. Altomare. Cryst. Gh. 1754 (1999) H. Cryst. Cryst. Bratu.Kristallogr. F.J.Engel. A.A. (2004).Werner. A. Oxford. A.McGreevy. 11. K.-E. W. Autoindexing. Crystallogr.Figura. R. L. 9.Chem. 4. 7. Werner J.Appl. J.Appl. 2. 1169. 14. M. 65. 36. 2. 10. 33. 219. P.Leusen. 13. David. Appl. 5. Borodi. Mihailescu. 37. O.Koning.-E.Cryst. Guagliardi.(1999) V.G. I. Cryst. Appl. Appl. 1180 (2000).Falcioni.

M. D. Los Alamos National Laboratory.70. (2010) 27. 267. Appl. Bogdan. (1001) 326 .Shankland. B58. 1036. NM.39. W. Filip. W. France. C. A. D. B47. D. G. Acta Cryst. 10.Appl.C. J.Pidcock.5122.Cole.Cole. J. 29. le Bas.Mavridis. David. Tripon. Attfield and J.Am. J. Chem. Oprean and C. (1999) 23.Nowell. Dollase. G. H.E. L. Bratu. I.. D. (2008) 25. Van de Streek. B66.S. G.(2002 22. 36.H.Pop. Borodi. E. Mentzafos.210. 746 (1991) 24. Morari. F. USA.Cryst. Phys. Borodi. Cryst. Cryst. X. (2002). Shenk Acta Cryst. DOI. M.P. R. J. Acta. J. 31. 18. I. G. Soc. 34.B B58 835. L. C. 19. R.A. K. Peschar.Chem. Cryst. Peschar. Young Oxford University Press (1993) 19. R. R..Larson & R. Laboratoire des Materaux et du Genie Physique de l’Ecole Superieur de Physique de Grenoble. Borodi. J. 116. Dinnebier Powder Diffraction 14. K. Koeller J. Borodi and C. A. 32. (1986) 20.Bochu CHECKCELL.17.and B.A. G.F.M. A. J. Goubitz. Cryst. Tsoucaris.B.D. 615. Acta Cryst. 87545.Scardi J. H. 1041.J. W. Steiner and G. Von Dreele. B. Hangan. Toby. X.Louer and P. 84.1039/c1cp21878f.A. McCusker. Helmbholdt.C. R.. 26. B. Chem.B. 28. Report LAUR 86-748. Phys. Colaborative Computational Project Number 14 (CCP14). Von Dreele General Structure Analysis System (GSAS). Filip. Filip. T. Cox.Laugier.E. Hernanz. 21.I. (2006). 910.B. Filip. The Rietveld Method edited by R.Appl. Motherwell.(1994) 30. Dragan.C. Spectrochimica Acta A. De Ridder. G. Appl.

. Compania Siemens a patentat invenţia celor doi germani.. ceea ce înseamnă că două caracteristici aflate la o distanţă mai mică de 250 nm nu vor putea fi diferenţiate....... Pentru observarea detaliilor mai mici a fost necesar crearea unui microscop care să utilizeze o sursă de iluminare caracterizată printr-o lungime de undă mult mai mică........... Printre alte surse se numără razele X şi neutronii............... obiect ce utilizează lentila pentru a focaliza lumina reflectată de un obiect într-o imagine mai mare. Generalităţi Microscoapele sunt instrumente utilizate pentru a facilita observarea unor obiecte la o mărire mai mare decât cea a obiectului observat.. Lucian Barbu-Tudoran Cuprins 1...... Ruska a creat primul microscop a cărui rezoluţie era superioară unui microscop optic... MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE Microscopia electronică şef lucrări dr. 338 1.............. Generalităţi ............. În 1931... Cel mai comun microscop este lupa............... Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) . Microscoapele optice (figura 1) sunt instrumente mai complexe care conţin un set de lentile care măresc imaginea.... Rezoluţia este limitată de lungimea de undă a fotonilor utilizaţi ca sursă de iluminare a specimenului.............IX..... 328 3... Limitările microscopiei optice constă în rezoluţia obţinută prin această tehnică (aprox.. 327 ........ Doi ani mai târziu....... Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) .................. iar în 1939 primul microscop electronic de transmisie a fost produs în scopuri comerciale... fizicianul Ernst Ruska şi inginerul Max Knoll au construit un microscop electronic prototip......... 327 2. Accelerarea electronilor permite reducerea lungimii de undă a unui fascicul de electroni ceea ce face posibila vizualizarea detaliilor cele mai fine....... 250 nm)...

interacţionează cu aceasta în grosimea ei. Microscopul optic 2. Ca limitare se aminteşte natura bidimensională a proiecţiei rezultate. Astfel obiectele având structură internă diferită pot fi diferenţiate deoarece proiecţiile acestora vor fi diferite.1 – ocular 2 – revolver 3 – obiective 4 – viza macrometrică 5 – viza micrometrică 6 – platina 7 – sursă de lumină 8 . informaţiile aparţinând axei z se vor pierde. Electronii pătrund prin probă. Organizarea unui microscop electronic 328 . incluzând suprafaţa şi structurile interne. aceştia putând fi deviaţi sau nu.diafragma şi lentila condensor Figura 1. Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) Prin intermediul TEM imaginea observată este proiecţia probei în grosimea ei. Probele analizate trebuie să fie foarte subţiri deoarece ar absorbi o mare parte a fasciculului de electroni.

2500K) pentru a învinge ’’the work function’’ a metalului. În interiorul coloanei se va stabili un vid înalt pentru a minimaliza interacţiunile dintre electroni şi molecuFigura 2 . Tunul de electroni are mai multe componente: filamentul. În vârful coloanei există un emiţător de electroni cu voltaj înalt care va genera fasciculul de electroni care va traversa coloana. un vârf Wehnelt şi un anod de extracţie. iar în final vor fi focalizaţi pe ecranul situat la capătul coloanei. prin probă.Principiile funcţionării unui croscop electronic de transmite nu diferă cu mult faţă de cele ale unui microscop optic. 329 . Cele mai comune microscoape sunt cele de emisie termionică si FEG (Field Emission Guns). de obicei tungsten sau hexaborid de lantaniu. Pentru a modifica mărirea şi punctul focal al unei imagini se pot utiliza diferite lentile. electronii pot fi pompaţi de către filament spre placa anodică şi coloana microscopului. circuitul de interferenţă (biasing circuit). Prin conectarea filamentului de partea negativă a generatorului de energie. lentile şi aperturi. care este încărcat mult mai negativ decât filamentul în sine. Tunul de electroni Electronii sunt emişi de un filament supraîncălzit de un curent electric până când suficientă energie va fi produsă (aprox. Aceşti electroni vor penetra proba şi vor trece printr-o serie de lentile magnetice. se asigură convergenţa optimă a electronilor încă din momentul emisiei.Secţiune prin coloana unui TEM lele de aer. Aperturile de pe traseul fasciculul de electroni au rolul de a schimba contrastul şi rezoluţia imaginii. Electronii emişi au o distribuţie Boltzman a energiei şi trebuie să fie concentraţi pentru ca fasciculul rezultat să străbată coloana. astfel circuitul fiind complet. Prin construirea unui cilindru Wehnelt.

Figura 4. de aceea este mai eficient. dar are ”the work function” mai mică. Schema unui tun de electroni Tipuri de tunuri de electroni Tungsten: filamentul este fabricat din tungsten. FEG: filamentul nu este unul termic. iar principiul de funcţionare se aseamănă cu cel al funcţionării unui bec.Figura 3. pe măsură ce filamentul se încălzeşte electronii vor fi emişi. Tipuri de tunuri de electroni: filament de tungsten şi cristal de hexaborid de lantaniu 330 . Hexaborid de lantaniu: este tot un filament de emisie termionică. Mărimea şi gradul de apropiere a câmpului electric cauzează desprinderea electronilor de pe filament. Emisia de electroni este asigurată de aplicarea unui puternic câmp electric imediat în vecinătatea vârfului filamentului.

apertura condensator. este localizată în vecinătatea tunului de electroni şi este utilizată pentru concentrarea electronilor şi menţinerea coerenţei fasciculului.Fasciculul de electroni se caracterizează prin coerenţă.focalizează şi proiectează imaginea finală pe suprafaţa folosită pentru vizualizare. Această apertură controlează contrastul unei imagini. în schimb distribuţia este de tip Boltzman şi diferă în funcţie de natura filamentului. apertura obiectiv. Prin urmare în urma trecerii fasciculului printr-o lentilă acesta va suferi o scindare. Prima apertură. Faza electronilor afectează coerenţa fasciculul. Dacă electronii sunt în fază ei vor interfera constructiv. Coerenţa spaţială. iar fasciculul va pierde din intensitate. În cazul unui microscop performant se doreşte ca raportul ∆E/E să fie cât mai mic. Cuplată cu apertura obiectiv va genera contrastul de amplitudine. Deoarece lentilele sunt reglate pentru o anumită lungime de undă acestea vor concentra electronii cu alte lungimi de undă mai puţin uniforme. În cazul prismei lumina este refractată sub diferite unghiuri. lumina fiind descompusă în radiaţii cu lungimi de undă diferite. Lentila obiectiv are rolul de a realiza primul pas de mărire şi focalizare a unei imagini. adică distribuţia energiei să fie o mică fracţiune din energia medie a electronilor. În cazul lentilelor electro-magnetice acestea pot roti fasciculul de electroni dacă sunt ajustate corespunzător. Dacă electronii sunt defazaţi. Lentilele Lentilele utilizate în microscopia electronică sunt bobine magnetice care au scopul de a focaliza şi direcţiona fasciculul de electroni. mărirea imaginii sau pattern-ul de difracţie. vor interfera distructiv. este localizată sub probă imediat după lentila obiectiv. Dacă electronii emişi sunt paraleli atunci fasciculul va fi coerent o mai multă perioadă. distribuţia energiei nu este sub forma unui singur peak. Când acest fenomen are loc imaginea se va roti pe măsură ce vor fi introduse în coloană alte lentile. A doua apertură. ideal toţi electronii emişi ar trebui să fie în fază. Se referă la intensitatea fasciculului. Coerenţa temporală. prin poziţia şi puterea ei. Lentila intermediară controlează. Funcţia unei aperturi este determinată de poziţia acesteia în coloana microscopului. Ultima lentilă – lentila proiector . Pentru formarea imaginii se folosesc 3 tipuri de lentile. 331 . Deoarece electronii emişi sunt supraîncălziţi. Aperturile Aperturile sunt găuri de-a lungul coloanei microscopului care pot limita mărimea fasciculul de electroni. Această aberaţie cromatică se aseamănă cu scindarea luminii când o rază traversează o prismă.

Principii ale formării imaginii În momentul în care fasciculul trece prin grosimea unui specimen au loc mai multe fenomene. iar aceasta într-un holder de metal (fig. curentul. În cazul microscopiei electronice de transmisie proba analizată este depusă pe o grilă de metal. iar legea conservării momentului va determina unghiul la care acesta a fost deviat de la traiectorie. voltajul curentului etc. alinierea. va asigura introducerea probei în vidul din coloana microscopului cu o scădere minimă a presiunii din interiorul coloanei. Acest electron va conferi o rezoluţie înaltă imaginii. Acest electron va cauza apariţia zgomotului în imagine.5). goniometrul se poate roti pentru a schimba unghiul probei. astfel când electronul va ajunge la nivelul ecranului va avea energia diminuată şi un unghi de incidenţă necunoscut.Exteriorul microscopului Consola utilizatorului constă dintr-un ecran pe care se vor afişa parametrii sub care funcţionează microscopul precum: mărirea. Dacă electronul nu loveşte un atom din probă acesta va avea o traiectorie nedeviată până la ecranul care va colecta imaginea.Holder utilizat în microscopia electronică de transmisie Dacă se doreşte vizualizarea unei probe sub diferite unghiuri sau realizarea unei tomograme. Acest holder de metal. Figura 5 . nu va pierde din energie. Microscoapele electronice de nouă generaţie au interfeţe cu computerele ceea ce conferă utilizatorului o mai mare flexibilitate şi control. 332 . focalizarea şi mărirea. Pe consolă se mai află butoane care controlează poziţia specimenului în interiorul coloanei. prin intermediul goniometrului. luminozitatea fasciculului. Dacă electronul intră în contact cu atomi din probă poate suferi o ciocnire elastică. În cazul unei ciocniri inelastice electronul va ceda o cantitate variabilă de energie specimenului. valoarea defocalizării.

Într-un microscop electronic de transmisie electronii trec prin probă înainte de a impresiona ecranul şi conţin informaţii cu privire la structura internă a acestei probe. marginea fiind cea mai închisă. Electronii cu deflecţie mare conţin informaţii importante legate de rezoluţie. intensitatea diminuându-se spre marginile discului. astfel de electroni nu sunt folosiţi în microscopia electronică. Observarea directă a imaginii de către utilizator are loc la nivelul unui ecran de fosfor. Contrastul dintr-o imagine ia naştere în urma interferenţei electronilor ce au unghiuri diferite. Figura 6. Electronii care vor fi deviaţi de la traiectoria iniţială în urma interacţiunii cu atomii specimenului vor interfera constructiv sau distructiv cu fasciculul principal de electroni. Pentru a înregistra imaginea se utilizează negative care sunt impresionate de fasciculul de electroni sau camere CCD (Charge Coupled Device) care traduc în format digital interacţiunile electronilor cu senzorul camerei. Colectarea imaginilor se poate face în diverse moduri.Electronii pot fi deviaţi la unghiuri mai mari de 90°. În cazul sferei goale gradientul va fi în direcţia opusă. Dacă se utilizează o apertură obiectiv mică electronii care sunt deviaţi sub un unghi mare nu vor contribui la formarea imaginii. Un pattern de difracţie poate fi colectat din probe care conţin un motiv care se repetă. Spre exemplu. iar contrastul este îmbunătăţit. Diferenţa dintre proiecţiile unei sfere solide şi a unei sfere goale în momentul vizualizării la TEM Microscoapele electronice pot fi utilizate pentru vizualizarea pattern-urilor de difracţie a probelor. dacă privim o sferă goală pe dinăuntru sau una plină. Pattern-ul de difracţie se formează ” in the back focal plane” al lentilei obiectiv. aceste informaţii fiind pierdute. proiecţiile acestora vor diferi (figura 6). Lentila intermediară determină vizualizarea imaginii sau a pattern-ului de difracţie pe ecran. 333 . Sfera solidă va genera un disc întunecat la interior. Aceste proiecţii diferă deoarece gradul de întunecare a unei imagini este direct proporţional cu capacitatea materialului de a absorbi electronii. de exemplu din cristale bidimensionale.

Tehnici de preparare a probelor Grile În cazul microscopiei electronice de transmisie specimenele sunt depozitate pe grile. După stabilirea vidului un 334 . Există două metode pentru depozitarea filmului pe grile: una implică aşezarea grilelor pe suprafaţa filmului flotat pe apă. fiind des folosit în microscopia electronică. vedere superioară şi secţiune Filme de suport Filmul Formvar este un film de natură polimerică (formal de polivinil). Filmele de carbon Probele trebuie depuse pe un film care este foarte stabil sub acţiunea fasciculului de electroni. Figura 7. Substanţa se găseşte sub formă solidă şi este solubilă în solvenţi organici. nichel. Pe această grilă se va depozita un film care va conferi suport specimenului. Grilele sunt discuri de metal (cupru. Grilă de microscopie electronică. platină) având un diametru de 3. aur. Pentru a obţine un film continuu de Formvar o lamă de sticlă pentru microscopia optică este curăţată şi scufundată uniform în soluţia de Formvar.05 mm care prezintă o reţea. Principiul evaporării carbonului este unul foarte simplu. hexagon). O foaie de mică este proaspăt clivată. Feţele proaspăt clivate ale micăi sunt perfect plate din punct de vedere atomic ceea ce îmbunătăţeşte proprietăţile filmului de carbon. Deasupra platoului pe care sunt aşezate cele două foiţe de mică se află un fragment de sfoară de carbon conectată la un circuit de mare voltaj. Ochiurile reţelei pot avea diferite dimensiuni şi forme (pătrat. iar noile plăci sunt introduse cu partea proaspăt clivată în interiorul unei camere în care se va stabili un vid înalt. iar a doua depunerea pe grile a filmului flotat. Filmele de carbon sunt foarte stabile. cei mai utilizaţi fiind cloroformul şi dioxanul.

probele sunt impregnate cu săruri de metale grele. Ionii de 335 . În cazul microscopiei optice se aplica contrastul de fază. Ionii negativi se vor depozita pe suprafaţa filmului de carbon. Coloraţia negativă În cazul microscopiei. în acest moment carbonul se va evapora şi depozita pe mică formând un film continuu. După coloraţie. În funcţie de cantitatea de energie absorbită intensitatea fasciculului care va impresiona ecranul diferă şi se va forma o imagine. în cazul acestei tehnici lumina care penetrează proba suferă o schimbare a fazei. uraniu sau tungsten. Grilele sunt aşezate pe o sită de metal într-un vas plin cu apă. Pentru a îmbunătăţi contrastul se folosesc diferite tehnici. datorită descoperirii graphene-ului şi a remarcabilelor sale proprietăţi se investighează aplicaţia acestui film în microscopia electronică. iar dacă o picătură de apă este depusă pe suprafaţa unui astfel de film aceasta va avea tendinţa de a-şi micşora suprafaţa care întră în contact cu carbonul. acestea nefiind foarte dense. contrastul specimenului este prea slab pentru ca ochiul uman să diferenţieze marginile şi detaliile probei observate. Microscopia electronică de transmisie utilizează un fascicul de electroni de înaltă energie pentru a bombarda specimenul. În ultimii ani. Pentru ca o coloraţie să aibă efect trebuie să se lege de preferenţial anumite părţi ale probei. Coloranţii se bazează fie pe vopsele sau pe materiale foarte absorbante. Pentru a face filmele mai accesibile substanţelor aflate în soluţie apoasă carbonul trebuie hidrofilizat. iar când voltajul este aplicat între anod şi catod potenţialul electronic ionizează aerul din încăpere. În cazul probelor biologice care sunt formate din atomi precum carbon. Aceasta se poate realiza fie prin tratarea cu UV a grilelor sau prin glow discarching. De aceea. Depozitarea filmului de carbon are loc prin evacuarea vasului de apă. oxigen. azot şi hidrogen. proba se va usca şi va putea fi examinată la microscop. pentru o vizualizare mai bună.curent se aplică sforii de carbon până când aceasta devine incandescentă. cantitatea de energie absorbită este foarte mică comparativ cu energia fasciculului. Carbonul este o substanţă hidrofobă. Alte metode se bazează pe colorarea probelor pentru evidenţierea unor caracteristici. În cazul glow discharching grilele sunt introduse într-o cameră parţial evacuată. Coloraţia în cazul microscopiei electronice de transmisie se bazează pe săruri de metale grele derivate din molibden. această nouă rază va interfera cu fasciculul iniţial şi contrastul se creează. Plăcile de mică sunt imersate treptat în apă ceea ce permite filmului hidrofob să se desprindă.

Aceasta corespunde cu mărimea granulei sării folosite pentru coloraţia negativă. Coloraţia cu aceşti atomi grei se numeşte coloraţie negativă deoarece în microscop se va observa o zona neacoperită de colorant înconjurată de coloraţia negativă. În timpul uscării specimenul îşi pierde învelişul hidratant. Tehnica este una simplă: proba este depusă pe grilă şi lăsată câteva zeci de secunde urmată fiind de ‘’spălarea’’ grilei cu 3 picături de colorant. iar după uscare grila poate fi examinată. Pregătirea probei nu necesită aparatură şi nu ia mult timp (aprox. ceea ce va determina contrastul şi rezoluţia imaginii. de aceea diferite regiuni ale probei pot avea diferite densităţi de electroni şi pot fi diferenţiate în proiecţiile obţinute. Contrastul optim se obţine când coloraţia înconjoară complet specimenul si zonele adiacente. Zona este neacoperită deoarece proba (proteina de exemplu) împiedică depunerea sării pe filmul de carbon. Alterarea datorită radiaţiei este irelevantă deoarece sărurile metalice nu sunt la fel de susceptibile la efectele electronilor precum molecule organice. În cazul proteinelor menţinerea unei stări hidratate este importantă pentru păstrarea configuraţiei.metale grele vor interacţiona cu electronii. Interacţiunea dintre un specimen (coloraţie negativă) şi fasciculul de electroni Avantaje şi dezavantaje ale coloraţiei negative Pro Contrast foarte mare. 336 Contra În timpul colorării particulele pot fi distorsionate. . electronii ce vor interacţiona cu atomii de metale grele vor fi puternic deviaţi. Excesul va fi îndepărtat cu ajutorul unei hârtii de filtru. Rezoluţia este limitată la 20 Å în condiţii optime. Figura 8. 4 minute). Colorantul absoarbe electronii mult mai bine decât mediul înconjurător. Contrastul apare în urma interacţiunii electronilor cu specimenul. iar apertura obiectiv îi va elimina pe cei care vor fi deviaţi la un unghi prea mare. Ca urmare a distribuţiei inegale a coloraţiei pot să apară artefacte. În figura 8 se observă o proteină colorată negativ.

Proba poate să aibă o orientare preferenţială pe grilă în cazul Dezavantaje Raportul semnal/zgomot este foarte mic deoarece absorbţia electronilor e scăzută. Pregătirea probelor necesită mult 337 . prin urmare forma observată este cea reală în stare nativă. sită o doză minimă de electroni penîngheţarea probei tru a evita alterarea probei datorită radiaţiei. Înregistrarea imaginilor pentru tomografie e dificilă deoarece prin rotire stratul de gheaţă expus este prea gros. apa din jurul probei va îngheţa. Schemă a instalaţiei utilizate pt. Îngheţarea se face prin dropping a unei grile pe care proba este deja depozitată. Avantaje şi dezavantaje ale cryo-electronmicroscopiei faţă de coloraţia negativă Avantaje Specimenul este tot timpul în soluţie şi nu intră în contact cu suprafeţe. cristaline care va estompa detaliile specimenului. dar capacitatea calorică este foarte mică. Procesul este laborios deoarece plonjarea grilei în recipientul de etan lichid trebuie să fie suficient de rapidă pentru a împiedica formarea gheţii cubice. iar proba va fi protejată.Îngheţarea probei – metoda cryo Microscopia cryo este o tehnică prin care proba este îngheţată într-un refrigerent pentru o mai bună păstrare şi protecţie în timpul observaţiei. Pentru a vizualiza proba în cryo-electronmicroscopie trebuie foloFigura 9. De aceea se preferă utilizarea etanului lichid. Doza recomandată e de 6-10 electroni/Å2. în momentul introducerii unei grile aflate la temperatura camerei fierbe ceea ce favorizează formarea gheţii cristaline. -195˚). Azotul lichid are o temperatură ideală (aprox. Nu există colorant care să distorsioneze preparatul.

Acest înveliş metalic asigură o suprafaţă conductoare. Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) În cazul SEM. ceea se asigură prezervarea probei. 3. 338 . ceea ce se evită timp. Imaginile SEM sunt utilizate într-o mare varietate media. Imaginea se formează pe un ecran datorită electronilor care sunt reflectaţi de învelişul metalic. iar obţinerea gheţii vitroase în cazul cryo. Microscopul electronic scanning (SEM) permite observarea şi caracterizarea materialelor organice şi anorganice heterogene la o scară cuprinsă între nanometri (nm) şi micrometri (µm). Se foloseşte doza minimă de electroni. Popularitatea SEM-ului e datorată capacităţii sale de a obţine imagini aparent tridimensionale ale suprafeţelor unei game largi de materiale. SEM-ul are o adaptabilitate mare. Fasciculul de electroni este concentrat şi utilizat pentru a scana suprafaţa obiectului observat. de la jurnale ştiinţifice la reviste de popularizare şi filme. specimenele sunt acoperite cu un strat subţire de metal pentru ca electronii să fie reflectaţi. iar informaţiile privitoare la structura internă lipsesc. Prin intermediul microscopiei electronice de baleiaj se pot observa detalii de pe suprafaţa unui specimen.coloraţiei negative. astfel se evită încărcarea electrică a probei. poate fi problematică. Deşi principala lui utilizare este de a obţine imagini topografice la o mărire cuprinsă între de 10-10000 de ori.

Cele mai multe micrografii SEM se efectuează la măriri sub 8000 de ori.La SEM. Un motiv puternic pentru utilitatea SEM-ului este rezoluţia mare ce poate fi obţinută când sunt examinate obiecte voluminoase. care e cea responsabilă în parte pentru aparenţa tridimensională a imaginii specimenului. precum şi efectului de umbră dat de contrastul electronilor secundari şi reflectaţi. aleasă la diferite valori ale energiei razei de electroni.). care poate fi trecut în raster (linie cu linie) deasupra suprafeţei specimenului pentru a forma mai multe imagini. cristalografia. din regiuni ale unui specimen având mărimea de 1µm în diametru şi 1µm în adâncime (în condiţii normale de operare). se emit şi raze X caracteristice. sau care poate fi static pentru a obţine analiza unei singure poziţii. Tipurile de semnale rezultate din interacţiunea fascicolului cu probă includ electroni secundari. pentru că aceştia variază în primul rând datorită diferenţelor topografice. suprafaţa de examinat sau microvolumul de analizat este iradiată cu un fascicol îngust de electroni. compoziţia etc. Cu cât e mai mare această adâncime a câmpului cu atât se furnizează mai multe informaţii despre specimen. Semnalele de imagine de cel mai mare interes sunt electronii secundari şi reflectaţi. ca şi rezultat al bombardamentului de electroni. raze X caracteristice şi alţi fotoni cu energii variate. rezoluţii instrumentale cu ordin de 1-5 nm (10-50 Å) se folosesc azi ca rutină la instrumente comerciale. unde aparatul ope339 . electroni reflectaţi. Aparenţa tridimensională a imaginii se datorează unei adâncimi mari a câmpului microscopului electronic. La SEM. Capacităţi de imagistică Microscopul electronic scanning este unul dintre cele mai versatile instrumente disponibile pentru examinarea şi analizarea caracteristicilor microstructurale ale obiectelor solide. regăsiţi într-un volum foarte mic în apropierea zonei de impact a fascicolului. O altă caracteristică importantă a SEM-ului este adâncimea câmpului. această calitate a SEM-ului fiind cea mai apreciată de către un utilizator. Emisia de electroni secundari. Evoluţia SEM-ului şi capacităţile specifice ale instrumentelor comerciale moderne se vor discuta în cele ce urmează. Aceste semnale se obţin din emisii de volum specifice probei şi pot fi folosite pentru a examina multe caracteristici ale probei (topografia. permite formarea de imagini la o rezoluţie apropiată de cea a mărimii fascicolului de electroni. Analiza acestor raze emise de către probă poate scoate în evidenţă atât caracteristici calitative cât şi informaţii cantitative de element.

Principalele componente ale SEM-ului sunt sistemele de lentile.Mullan a fost urmat de Smith (1956) care a observat că procesarea semnalului ar putea îmbunătăţi micrografiile. În plus. (Smith. iar aparatul său includea multe instrumente care de atunci au devenit standard. Primul SEM utilizat să examineze specimene dense a fost descris de Zwokyn şi col. tubii catodici fotocolectori de raze. Atât aspectele teoretice cât şi cele practice ale STEM-ului au fost explicate în detaliu de către von Ardenne. W. pentru că imaginea SEM vine cu informaţii adiţionale imaginii obţinute la microscopul optic. colectorul de electroni. Spre exemplu.Mullan au construit primul lor SEM care până în 1952 a atins rezoluţia de 50 nm. Colectorul a fost înclinat pozitiv aproximativ cu 50 V înspre specimen şi al doilea curent acumulat în el a produs o cădere de tensiune de-a lungul unui rezistor. (1942).rează bine în limitele propriilor capacităţi de rezoluţie. Autorii au realizat că emisia de electroni secundari este cea responsabilă pentru contrastul topografic. mecanisme de contrast mai slab ar putea fi mai bine studiate. şi a introdus amplificarea neliniară a semnalului. tunul. În următorii câţiva ani. mai târziu Wells (1959) a făcut primele studii ale efectelor penetrării fascicolului cu scopul formării imaginii la SEM. prin comparaţie cu performanţele obţinute atunci cu TEM-ul în continuă perfecţionare. De asemenea a îmbunătăţit sistemul de scanare prin introducerea de scanare prin dublă deflecţie. Astfel. Mc. A urmat apoi von Ardenne (1938) care a construit microscopul electronic scanning de transmisie (STEM) prin adăugarea unei lentile de baleiere la microscopul electronic de transmisie (TEM). şi părţile electronice asociate. şi primul care a utilizat perechi 340 . Prima lucrare recunoscută ca descriind conceptul de microscop electronic scanning este cea a lui Knoll (1935). această metodă a fost considerată neincitantă şi dezvoltarea pe această ramură a stagnat. Oatley şi Everhart au putut observa pentru prima dată contrastul de voltaj. de către Everhart şi Thornley (1960). şi a fost primul care a inclus un stigmator în SEM. SEM-ul are capacitatea de a analiza la măriri foarte mici. Dar. Schimbarea multiplicatorului de electroni cu mult mai eficientul fotomultiplicator a crescut cantitatea semnalului colectat şi a rezultat un mai bun raport semnal-zgomot. proprietate foarte utilă în studii de criminalistică şi nu numai. care a fost apoi transmisă printr-o ţeavă de lumină direct pe suprafaţa fotomultiplicatorului. 1956) Următorul pas înainte a fost refacerea detectorului secundar de electroni. C. Ei au adăugat un scintilator pentru a converti electronii în lumină. astfel s-a obţinut o rezoluţie de aproximativ 50 nm. Mc. Alte utilizări ale SEM-ului au fost dezvoltate în această perioadă. Oatley şi studentul său D.

Sursele de electroni au nevoie totuşi de vid de ordinul a cel puţin 10-8 Pa pentru a opera într-un mod de încredere. Marea Britanie.stereografice pentru a produce imagini tridimensionale la SEM. Japonia. Stewart şi coechipierii de la compania Cambridge Scientific Instrument au finalizat design-ul comercial şi împachetarea produsului (Oatley. cu trei lentile magnetice. 1972). care conţinea şi sistemul detector Everhart-Thornley. A. Acest aparat a devenit primul prototip comercial numit . Odată stocată în format digital imaginea poate fi procesată în multe moduri. una din ele fiind dezvoltarea surselor de lumină puternică precum catodul de hexaborid de lantan (LaB6). D.Stereoscan” (Cambridge Scientific Instruments Mark I). Germania şi Franţa.. (Wells. Cu această sursă o mai mare cantitate de electroni au putut fi concentraţi pe o suprafaţă mai mică. Majoritatea SEM-urilor sunt dotate cu capacitatea de a stoca imagini digitale. Cu toate că au crescut costurile şi complexitatea SEM-urilor cu emisie de curent. Imaginile pot fi observate pe un ecran. În anii ce au urmat mai mult de 50 000 de unităţi SEM au fost vândute de către producători din S. Disponibilitatea unor computere puternice şi ieftine dotate cu capacitate de stocare mare şi pachete de soft capabile de o varietate mare de procesări şi funcţii pentru imagini digitale. decât filamentele convenţionale de tungsten.. 341 . precum prin amplificare non-lineară.U. Această lumină puternică permite pătrunderea a de 1000 de ori mai mulţi electroni pe cele mai mici dintre probe. Alte avansări în utilizarea SEM-ului includ mecanismele de contrast precum contrastul prin canalizarea electronilor produs prin variaţii în orientarea cristalografică şi contrast magnetic produs din domenii magnetice din materiale uniaxiale şi cubice. Sursa de emisie de electroni. s-a dezvoltat în aşa măsură încât poate fi acum folosită pentru imagini de cea mai înaltă rezoluţie. Olanda. obţinându-se astfel o rezoluţie mai bună. diferenţiere etc. De la primul aparat comercial din 1965 s-au făcut numeroase îmbunătăţiri.A. şi astfel de nevoi cer o atenţie specială tehnologiei de vidare. utilizată pentru prima dată la SEM în 1942. oferă microscopistului o mare flexibilitate şi uşurinţă în utilizarea SEM-ului. la nivel de rutină. Avantajul tunului de emisie este dimensiunea sa mică astfel încât poate fi obţinută o imagine a unei probe de 1 nm. deşi în aparatele mai vechi imaginile încă se mai fac prin fotografierea tubului catodic de raze. printate sau reţinute pe un CD sau alte unităţi de memorie. aceste microscoape şi-au găsit utilitatea în numeroase domenii de cercetare şi tehnologie în care rezoluţia înaltă şi energia mică a sursei sunt importante. G. 1960) Pease a construit un sistem cunoscut ca SEM V.

uscat sau umed. Acest tip de aparat permite examinarea suprafeţelor a aproape oricărui tip de specimen. Majoritatea materialelor biologice sunt umede. Dezvoltarea procesărilor la temperaturi scăzute a ajutat la reducerea pierderii de masă şi a distrugerilor termice la specimenele sensibile (Echlin. Pentru a colecta maximum de intensitate în modelul de difracţie. În formatul său modern. se pot efectua experimente în aparat în care suprafaţa specimenului poate interacţiona cu atmosfera gazoasă. Totuşi. sensibile la radiaţii. VPSEM-ul poate detecta electroni secundari şi retroîmprăştiaţi la fel de bine precum razele X. dezvoltările în domeniul biologic au depins de avansarea în prepararea specimenului.20 torri). Au apărut echipamente care permit evaluarea cantitativă a suprafeţei şi urmărirea în timp real şi de înaltă rezoluţie a specimenului prin intermediul SEM-ului.Printre primele micrografii scanate au fost câteva materiale biologice precum carcasa unor insecte sau fibre lemnoase. termolabile. slabi conductori. pentru că mediul înconjurător specimenului nu mai este nevoie să fie la vid înalt (Danilatos. Analiza structurală Una din cele mai promiţătoare dezvoltări din domeniul SEM-ului este abilitatea de a determina structura cristalină şi orientarea lor pe suprafaţa specimenelor preparate.. În plus. suprafaţa specime342 . 1993). Probele biologice sunt ideale pentru studiul la acest aparat. 1992). Un sistem diferenţial de pompare a vidului este folosit pentru a menţine tunul de electroni la vid înalt în timp ce specimenul este sub o presiune mai mare. 2000). Una dintre cele mai importante descoperiri recente este microscopul electronic scanning cu presiune variabilă (VPSEM). Imaginile tridimensionale permit interpretarea corectă a caracteristicilor morfologice şi măsurarea lor. aşadar.2. Dimensiunea mare a adâncimii câmpului întâlnită la SEM face posibilă observarea tridimensională a obiectelor utilizând stereoscopia. 1991. Mai târziu Thornley a prezentat imagini SEM ale materialelor uscate prin îngheţare şi analizate la 1 keV pentru a evita încărcarea electrostatică. îndepărtării sau imobilizării fluidelor celulare. Această capacitate se foloseşte de difracţia electronilor reflectaţi de pe suprafaţa specimenului (Schwartz şi col. S-a dat multă atenţie la stabilizarea materialelor organice delicate. şi acoperirii lor cu un strat subţire de material conductor. Mediul poate fi alcătuit din vapori de apă sau alte gaze în intervalul de 25-2500 Pa (0. care au fost suficient de puternice pentru a rezista procesului de vidare fără să se deformeze (Smith şi Oatley. de contrast mic şi emisivitate de electroni slabă şi sunt. 1955). şi este cunoscută sub numele de difracţie electrono-reflectată (EBSD).

Castaing sub îndrumarea lui A. aşa cum se face azi în SEM-rile actuale.microsondă electronica”(Castaing. adăugarea 343 . Conceptul unui microanalizator electronic de probe a apărut în anii 1940 (Hillier. În timpul anilor 1950 câteva aparate EPMA au fost dezvoltate în laboratoare din Europa şi S. dar a şi subliniat modul în care această informaţie poate fi cuantificată. Aceste pattern-uri sunt mai apoi analizate printr-o metodă de indexare asistată de computer. Recunoaşterea complexităţii transformării intensităţii razelor X în compoziţie chimică a dus la perfecţionarea analizei cantitative de către numeroşi investigatori pe parcursul ultimilor 50 de ani. Analiza elementală SEM-ul poate fi utilizat pentru a obţine informaţii legate de compoziţie folosind razele X caracteristice.1. Cea mai recentă descoperire în aplicaţia modelului Kikuchi la volume de analizat este dezvoltarea sistemului de înregistrare a modelului folosind o cameră video de înaltă sensibilitate sau mai recent o cameră video tensio-cuplată (CCD). cei doi oameni de ştiinţă treceau fascicolul brusc pe suprafaţa probei. precum şi contrastul semnalului. Cosslett şi Duncumb (1956) au construit primul microanalizor electronic scanning de probe la Laboratoarele Cavendish în Cambridge. 1951).A. Castaing nu numai că a demonstrat că o analiză chimică localizată poate fi desfăşurată pe suprafaţa specimenului. şi de abia în 1949 R.U. 1947). Deşi conceptul de analiză locală cu raze X este în sine un stimulent pentru folosirea microanalizatorului. Indexarea automată a modelelor şi cartarea orientării straturilor de cristale asistată electronic permite identificarea fazelor de cristalizare şi arată orientarea greşită printre limitele cristalelor.1 µm pe specimen. de aceea e nevoie de camere ultrasensibile şi senzori fini de captare a contrastului.Guinier au descris şi construit un instrument numit . De asemenea mai făcea parte din aparat şi un microscop optic pentru găsirea corectă a punctului de analiză şi una sau mai multe spectrometre WDS pentru analizarea intensităţii radiaţiei X emise în funcţie de energie. iar primul aparat comercial a fost introdus de CAMECA în Franţa în 1956. Optica electronică era formată dintr-un tun electronic urmat de lentile convergente ce formau o sondă electronică cu un diametru de 0.. Intensitatea modelului reflectat Kikuchi este relativ mică. În teza sa de doctorat. Dacă până atunci microprobele electronice operau cu fascicole statice de electroni.. Dezvoltarea unui instrument de analiza chimică localizată a probelor solide (EPMA) s-a produs deodată cu apariţia SEM-ului.nului este dintr-o dată răsucită la un unghi de 70º faţă de orizontală.

prin spectrometrie EDS de raze X se mai poate realiza şi o analiză cantitativă foarte fină. Pentru probe plate şlefuite. la curenţi tipici utilizaţi la imagistica electronică secundară a SEM-ului. s-au făcut numeroase îmbunătăţiri. toate găsind o tot mai mare utilizare în cadrul SEM-ului. pe lângă analiza calitativă rapidă. Un EPMA modern are în mod normal capacităţile unui SEM. Spectrometrele dispersive de energie moderne sunt capabile de detectarea razelor X caracteristice ale tuturor elementelor cu număr atomic mai mare decât 4. În anii ce au urmat de la prima apariţie a EPMA-ului. După ce pentru mulţi ani principalele linii de concentrare au fost în direcţia dezvoltării tehnologiilor existente. O altă însuşire importantă a SEM-ului cu EDS şi WDS este capacitatea de cartare compoziţională folosind raze X caracteristice. Într-un SEM tipic echipat cu detectori EDS şi WDS. EDS-ul e utilizat pentru a analiza razele X caracteristice elementelor majore (>10 wt%). printr-o analiză normală cu fascicolul de electroni se obţine o acurateţe de 1-2% (5-10% la probele biologice) din cantitatea respectivului element prezent. câteva descoperiri recente au dat noi tendinţe în conceptele de detectori şi design. SEM-ul şi EPMA-ul au fost considerate aparate separate pentru încă un deceniu. dar azi EPMA-ul este considerat a fi un echipament aparţinând SEM-ului. Atracţia acestei forme de acumulare a informaţiei este detaliul microcompoziţional ce poate fi corelat cu metalografia optică şi electronică. Adăugarea unui spectrometru EDS la microanalizorul electronic pentru a măsura razele X a atras atenţia asupra nevoii utilizării lui şi în cadrul SEM-ului (Fitzgerald şi col. pe când WDS-ul este utilizat pentru detecta razele X ale elementelor minore (<10 wt%) sau chiar pentru a le recunoaşte în probă. Proba este analizată fără a fi afectată şi analiza cantitativă poate fi obţinută la o rezoluţie spaţială de 1 µm pe probă. un microscop optic pentru observarea suprafeţei specimenului şi un fascicol de curent de electroni care se stabilizează prin analiza de raze X.conceptului de scanare a fost o contribuţie foarte semnificativă. În plus. şi utilizarea de spectrometre de cristale plate împreună cu optică capilară X-ray.. Marea majoritate a SEM-urilor vândute azi sunt echipate cu capacităţi EDS. printre care o descoperire a fost de mare importanţă: difracţia cristalelor din moleculele organice cu spaţieri mari interplanare 344 . Sistemul EDS oferă o modalitate rapidă de analiză a elementelor constituente în probă.1968). Detectorii de raze X se bazau pe o formă solidă de silicon derivat de litiu [Si (Li)]. Câteva dintre acestea cuprind microcalorimetria în raze X. detectorii din derivaţi de silicon. având şi lentile optice şi una şi mai multe unităţi WDS. două sau mai multe spectrometre de lungime de undă (WDS).

Deşi prepararea specimenului biologic este mult mai exactă decât procedura pentru alte ştiinţe. Avantajul energiei mici a fascicolului de electroni este că apare posibilitatea minimizării dimensiunii sursei de raze X şi a minimizării efectului de absorbţie în procedura cantitativă. 1965). în care efectele absorbţiei şi de fluorescenţă sunt neglijabile. În plus. în primul rând datorită faptului că unii parametri de corecţie sunt funcţie de concentraţie şi. Recent au fost dezvoltaţi difractori mari de spaţii interplanare ce utilizează depunerea fizică alternativă de straturi de vapori de elemente grele şi uşoare.(Henke. aparatele au fost construite să permită posibilitatea unei analize de încredere cu fascicol de electroni si raze X de energie mică. După ce s-a observat capacitatea de măsurare a razelor X care poate fi extinsă şi la specimene nonmetalice. în plus preparatorul trebuie să fie foarte atent ca elementele pentru măsurat să rămână în cadrul punctului de analiză şi să nu se îndepărteze sau să dispară pe parcursul preparării. Aceste cristale eliberează raze X cu lungime mare de undă din elementele cu număr atomic mic (B. 1965). Microanaliza în raze X a materialelor biologice şi polimerice întâlneşte aceiaşi problemă în examinarea probelor la SEM. În ultima vreme. S-au creat programe care pot să convertească raportul intensităţii razelor X în compoziţii chimice. culoarea luminii vizibile (catodluminiscenţa). fac aproximările succe345 . Efectele de suprafaţă pot fi mai uşor de măsurat. produsă din interacţiunea electronilor cu specimenul a fost asociată cu prezenţa unor impurităţi în material (Long şi Agrell. N. O) ce pot fi măsurate de spectrometre dispersive de lungime de undă. Utilizarea tot mai intensă a computerului împreună cu SEM-ul a crescut calitatea şi cantitatea de informaţii adunate prin intermediul aparatului. metodele cantitative sunt în principiu simple. a apărut ipoteza folosirii şi altor tipuri de fenomene de excitaţie. De exemplu. 1966). se mai poate studia şi emisia de fotoni vizibili din recombinarea excesului de perechi de goluri de electroni dintr-un semiconductor (Kyser şi Wittry. prin urmare. C. Măsurarea catoluminiscenţei a devenit azi o parte importantă a SEM-ului mai ales în industria microelectronicelor. Ele se bazează pe analiza unor secţiuni subţiri. Totuşi materialele biologice sunt mult prea uşor afectate de fascicolul de electroni şi astfel că în deceniile trecute s-a depus mult efort în instrumentare precum şi în procedurile preparative şi analitice cum sunt analiza la temperatură scăzută. Capacitatea de a detecta elemente cu număr atomic mic le dă utilizatorilor de EPMA posibilitatea de a investiga numeroase noi probleme ale aparatului. deşi intervine problema contaminării cu carbon din cauza vacumizării slabe a SEM-ului.

Se face câte o analiză completă executată de calculator. la cartarea cantitativă de compoziţie. creşte numărul analizelor efectuate. Imaginile rezultate sunt hărţi compoziţionale şi au la fiecare element constitutiv (pixel) valoare numerică completă a concentraţiei. pentru fiecare rază discretă din suprafaţa scanată. 346 . şi spectrometrele. Valorile concentraţiilor corespunzătoare poziţiei razelor pe specimen sunt asamblate într-o imagine digitală cu un procesor de imagini prin codificarea axelor concentraţiei cu nuanţa de gri corespunzătoare. şi îi permite operatorului să se concentreze pe evaluarea analizelor.sive necesare. Dezvoltarea cartării compoziţiei cantitative este un alt punct forte în legătura dintre imagistică. În plus programele pot acum să controleze fascicolul de electroni. capacitatea de analiză cantitativă a elementelor şi utilizarea automatizată computaţională a SEM-ului. Aceste programe derulează calcularea compoziţiei în câteva secunde şi astfel operatorul se bucură de mai multă flexibilitate în obţinerea rezultatelor. În acest fel analistul poate să revadă analizele corespunzătoare fiecărui pixel sau şir de pixeli. Automatizarea e de mare ajutor în operaţiunile repetitive. iar hărţile pot fi corelate cu imagini SEM preparate prin oricare alt fel de semnal. mişcarea specimenului.

.. coloraţia negativă este cea mai utilizată metodă pentru vizualizarea topografiei şi structurii bacteriilor... fiind una din cele mai uşoare şi mai rapide proceduri pentru detectarea virusurilor...... problemele preparării probelor biologice au rămas mult în urma îmbunătăţirilor aduse performanţelor microscoapelor electronice..... în general............... Depăşirea barierei de 1....... în timp ce detaliile probelor biologice.. deci.. Dezvoltarea unui microscop electronic de baleiaj şi transmisie (STEM) de înaltă rezoluţie (0......5 – 2.....5 nm pentru specimenele biologice s-ar putea realiza prin utilizarea acestui STEM... Lucian Barbu-Tudoran Cuprins 1... răspunzătoare de acurateţea interpretării imaginilor........ Microscopia electronică de transmisie.. Pe lângă metodele clasice de contrastare a probelor biologice.... 349 2.................. Plaja efectelor induse de diferitele tratamente premergătoare analizei electronomicroscopice este foarte largă. O imagine electronomicroscopică este diferită de situaţia reală din organismul viu. Atâta vreme cât artefactele inevitabile sunt interpretabile.2 nm) a permis vizualizarea unui singur atom de metal greu............ Când microscopia imunoelectronică este folosită în conjuncţie cu coloraţia negativă............. organitelor celulare izolate (inclusiv membrane) şi macromoleculelor....Microscopia electronică ... Microscopia electronică de baleiaj ................partea a II-a şef lucrări dr.. eliminându-se astfel nevoia contrastării.. 359 Din păcate..... virusuri cu ultrastructuri similare pot fi diferenţiaţi cu sensibilitate mare......... iar înţelegerea acestora este esenţială pentru extrapolarea detaliilor oferite de microscop la situaţia existentă in vivo..0 nm. performanţă uşor de atins acum pentru materiale anorganice. virusurilor. absolut necesare pentru obţinerea unor imagini utilizabile.. gradul alterării probei depinzând foarte mult de tehnica de pregătire a materialului biologic........... iar marcarea antigenilor de suprafaţă se poate realiza cu uşu347 ... nu sunt mai bune de 1.... luarea în calcul a tratamentelor la care este supusă proba până la ajungerea în faza de examinare...... ce oferă un contrast superior şi mai multe tipuri de informaţii simultan sau prin utilizarea câmpului întunecat într-un TEM convenţional. acestea sunt acceptate.... fiind necesară.........

fixarea cu glutaraldehidă într-un cuptor cu microunde. iar ca dezavantaje: deteriorarea eritrocitelor din ţesuturile nefixate. picornavirus şi parvovirus. Un marker de aur coloidal este util. 348 . şi aici există pericolul producerii de artefacte în intervalul de temperatură dintre cea fiziologică şi cea de imobilizare. Dintre avantajele fixării cu căldura microundelor menţionăm: capilarele pulmonare interstiţiale nu colapsează cum se întâmplă în cazul fixării cu formaldehidă. straturile superficiale pot fi suprafixate. dilatarea excesivă a secţiunilor anumitor ţesuturi (limfoid).rinţă prin colorarea imunonegativă. esenţiale funcţiilor biologice. obişnuit. Coloraţia negativă a probelor deshidratate prin îngheţare ar putea evidenţia ultrastructura virusurilor şi a membranelor fără colapsul specimenului. pe lângă beneficiile crioprotecţiei. oscilaţia dielectrică a moleculelor de apă şi o energie a fotonului de 10-5 eV. crioelectron . chiar la 370C. deşi. ce includ răcirea ultrarapidă a celulelor şi ţesuturilor. În plus. vitrificarea nefiind uşor de realizat. cu o frecvenţă de 2.microscopia probelor colorate negativ este o metodă importantă pentru investigarea structurii tridimensionale a proteinelor cristalizate. precum şi în cazul nivelelor scăzute de virusuri. cromatina este mult mai distinctă în ţesuturile tumorale. Unele din acestea pot fi evitate prin fixarea cu aldehide într-un cuptor cu microunde. cum ar fi contractarea sau umflarea probelor şi extracţia componentelor celulare datorate difuziei lente a fixatorilor. artefactele dependente de timp. Criotehnicile. pentru detecţia virusurilor foarte mici. în timp ce cele din zona profundă vor fi subfixate. Undele electromagnetice sunt radiaţii neionizante ce produc deplasări moleculare prin migrarea ionilor şi rotirea moleculelor dipolare. Microundele sunt unde electromagnetice generate. scopul acestora fiind de a stabiliza ultrastructura celulei aşa cum există in vivo. Cea mai bună soluţie rămâne combinarea celor două metode. respectiv. De asemenea. sunt o alternativă la fixarea chimică. dar suficientă pentru a interacţiona cu cele necovalente cum sunt legăturile sterice (legături de H şi interacţiuni van der Waals). apar destul de des. Marcarea imunogold în combinaţie cu coloraţia negativă au un potenţial considerabil în detectarea virusurilor.45 GHz (1 GHz = 109 cicluri / sec) şi prezentând o lungime de undă de 12. O altă abordare este utilizarea coloraţiei negative în combinaţie cu vitrificarea pentru realizarea unui contrast crescut.4 cm. în special. Fixarea pieselor de dimensiuni mari prin metode convenţionale prezintă un gradient de calitate a fixării. antigenilor virali şi a anticorpilor. energie prea mică pentru a afecta legăturile covalente. astfel.

Se prelevează fragmente suficiente pentru prepararea a câte 3 blocuri/probă (adică cel puţin 6 cuburi). toate celelalte operaţii. examinarea şi developarea suporturilor fotografice. Se realizează o fixare chimică a pieselor. sunt următoarele: recoltarea. deshidratarea. până la secţionare. Pentru menţinerea neschimbată a ultrastructurii – deci păstrarea ei identică cu cea din momentul sacrificării animalului. fragmentele recoltate la rece (pe gheaţă). principalul agent de fixare utilizat în microscopia electronică de transmisie. cu latura de maxim 1 mm. acţionate în sens contrar pentru a se evita lezarea mecanică (zdrobirea/sfâşierea) ţesutului. se trec rapid pe glutaraldehidă 2. FIXAREA Procesul de fixare asigură stabilizarea structurii biologice cât mai aproape de starea nativă. A. se pipetează soluţia de glutaraldehidă pe suprafaţa organului de inte349 . contrastarea. se vor desfăşura sub nişă. înainte de recoltare. Acesta nu fixează corespunzător la o profunzime mai mare de 0. RECOLTAREA Recoltarea fragmentelor de ţesut trebuie efectuată foarte rapid (1-2 min) după sacrificarea animalelor pentru a se împiedica instalarea unor alterări morfo-funcţionale la nivelul ţesutului.7%) în Tampon fosfat 0. includerea.1 M. Rezultate foarte bune se obţin dacă. datorită toxicităţii mari a reactivilor cu care se lucrează. fixarea.1. Dimensiuni mai mari nu ar permite penetrarea pieselor de către tetraoxidul de osmiu. cu ajutorul unor agenţi capabili să creeze legături încrucişate între moleculele constitutive ale materialului prelucrat. Este indicată pipetarea soluţiei de glutaraldehidă peste organul ce urmează a fi recoltat. Din fragmentele aflate pe glutaraldehidă se taie foarte repede cuburi mici.7-3% (primul agent fixator). modelarea. încapsularea. nepermiţându-se deteriorarea arhitectonicii ultrastructurale. Începând cu această etapă. cu doi agenţi fixatori la 4ºC. Microscopia electronică de transmisie Principalele etape de a căror acurateţe depinde foarte mult obţinerea unor informaţii cât mai apropiate de situaţia reală din celula vie.5 mm. secţionarea. Prefixarea Prefixarea se efectuează cu o soluţie de glutaraldehidă 2-6% (2. înainte de prelevarea acestuia din organismul animal. Pentru decuparea cuburilor se recomandă folosirea a două lame de ras noi.

asigurându-se astfel o răspândire rapidă a acestuia la nivelul ţesuturilor. Glutaraldehida [O=CH-(CH2)3-CH=O] are proprietatea de a lega grupările active de hidrogen.5 ml glutaraldehidă. prepararea soluţiei 2. pătrunde mai uşor şi acţionează rapid asupra ultrastructurii preparatului. în special de la alcooli şi grupările amino. Glutaraldehida se utilizează în soluţie apoasă 2. conferind astfel o mare stabilitate structurilor celulare cu care vine în contact. acestea sunt trecute în tuburi de sticlă şi păstrate timp de 15-30 minute în 1-1. Tuburile de sticlă cu care se lucrează vor fi foarte curate (bine spălate cu detergent şi amestec sulfocromic.Glutaraldehidă (25%) pentru microscopie electronică .154 g (18. Dacă este ţinută la temperatura camerei.1 M se prepară după reţeta: .Na2HPO4 anhidru (Na2HPO4 · 12H2O) . în soluţie apar polimeri ai glutaraldehidei. Ele se acoperă cu dop (de cauciuc rezistent) – care nu se va fărâmiţa sub acţiunea substanţelor ce se vor folosi. Există. După obţinerea cuburilor de ţesut. Glutaraldehida pură prezintă un singur vârf de absorbţie în UV.7% preparată extemporaneu după reţeta: .res. formând punţi încrucişate şi punţi intermoleculare. care vor avea un nou vârf de absorbţie la 235 nm.37 g (1.56 g) 7. Glutaraldehida este primul fixator utilizat curent. urmate de spălare abundentă cu apă distilată).7% se va face extemporaneu. respectiv introducerea fixatorului în circulaţie.1 M pH 7. După 15-30 minute se schimbă glutaraldehida şi se continuă fixarea timp de încă 1-2-3 ore în funcţie de consistenţa ţesutului. iar fixarea se va face la 4ºC.(din moleculele proteice) şi imino-.NaH2PO4 · H2O (NaH2PO4 · 2H2O) .Apă distilată Tamponul fosfat 0.2 ml . posibilitatea perfuziei ţesuturilor cu fixator.apă distilată 350 1. deoarece este mai puţin toxic. Prin urmare va prezerva foarte bine ultrastructura celulară şi activitatea enzimatică a celulelor. Deci glutaraldehida 25% (sau 50%) stoc se va păstra numai la frigider. la 280 nm.Tampon fosfat 0.4 . de asemenea. permite o mai uşoară manipulare a preparatului.036 g) Până la 500 ml 2 ml 10 ml 4.

Se va evita contactul soluţiei cu obiecte metalice.15 M se prepară după reţeta: . pH 7. şi anume. Spălarea După prefixare. după care se lasă 24 ore la 4ºC pentru dizolvarea completă. După îndepărtarea glutaraldehidei se adaugă peste piese (care nu vor rămâne niciodată neacoperite) tampon fosfat 0. Se înlătură această soluţie. pentru 15 minute. prezervarea structurii fine a celulelor şi stabilizarea acestora pentru a face posibile etapele ulterioare de preparare în scopul vizualizării în microscopul electronic de transmisie. 351 . la post-fixare lipidele din membrane nu se vor fixa bine cu OsO4.1 M.Na2HPO4 anhidru (Na2HPO4 · 12H2O) 10. dacă urmele de aldehide nu sunt eliminate din ţesut. pH 7. Tamponul fosfat 0.15 M. Se închide sticla şi se agită puternic până la spargerea fiolei. Prin reacţia posibilă între cele două substanţe fixatoare aplicate succesiv. C. poate rezulta un precipitat electron-dens care dăunează calităţii preparatului. dar şi de a mări contrastul la nivelul ultrastructurii ţesutului.4 în 4 băi succesive a câte o oră (în a patra baie piesele se pot ţine peste noapte).15 M pH 7. este foarte important a se înlătura prin spălare orice urmă de glutaraldehidă. Există cazuri când fixarea a fost prelungită peste noapte pentru fiecare fixator. pe care o colorează prin depunerea osmiului. cu dop rodat. iar trecerea soluţiei în alte flacoane se va face numai prin răsturnare.765 g (27. o soluţie 1% (sau 2%) de OsO4 în Tampon Fosfat 0.4.366 g) . se adaugă o soluţie proaspătă de OsO4 în care piesele vor mai sta timp de 85 minute.139 g) . în tuburile cu piesele prefixate şi spălate se adaugă cel de-al doilea agent fixator. Culoarea unei soluţii proaspete de OsO4 este galben pal.apă distilată Până la 500 ml OsO4 2% se prepară astfel: 1 g OsO4 se trece într-o sticlă foarte curată. Prin procedura de fixare menţionată se urmăreşte stoparea proceselor metabolice din ţesturi. După înlăturarea tamponului fosfat. ale cărei reziduuri vor împiedica legarea osmiului. conţinând 50 ml tampon fosfat 0. şi spălarea se va face în aceleaşi condiţii. Rolul acidului osmic este de a stabiliza atât proteinele cât şi bistraturile lipidice.NaH2PO4 · H2O (NaH2PO4 · 2H2O) 2.064 g (2. În plus. Postfixarea Postfixarea se realizează cu tetraoxid de osmiu (OsO4) 1-4% în funcţie de consistenţa ţesutului de studiat. Dacă prefixarea s-a făcut la frigider.B.4.

pentru o cât mai bună includere. 50% timp de 15 minute. Până la concentraţia de 70% se lucrează la temperatura de 4ºC după care tuburile vor putea fi păstrate la temperatura camerei. 70% timp de 30 minute. 80% timp de 30 minute. este necesar ca toată apa introdusă în timpul spălării în piese să fie extrasă fără a produce modificări în structura moleculară a celulelor. Deci. 90% timp de 30 minute. La includerea în Epon 812 pot urma două băi de oxid de propilen de câte 15 minute fiecare. După îndepărtarea tetraoxidului de osmiu se adaugă peste piese (care nu vor rămâne niciodată neacoperite) Tampon Fosfat 0. 100% (anhidră) timp de 15 minute. deoarece alcoolul sau acetona se evaporă uşor şi piesele pot suferi procese 352 . şi spălarea se va face în aceleaşi condiţii. cu urmări asupra polimerizării blocurilor la includere. pH 7. dioxan sau toluol în etapele finale.4. în 4 băi succesive de câte o oră (în a patra baie piesele se pot ţine peste noapte). Dacă fixarea s-a făcut la frigider. înlocuirea solventului trebuie făcută foarte rapid. În cazul fixărilor succesive duble. DESHIDRATAREA În vederea includerii pieselor (pentru a se putea efectua secţiunile ultrafine) se utilizează răşini epoxidice: Vestopal W sau Epon 812 care sunt substanţe organice hidrofobe. Cantitatea de soluţie folosită pentru fiecare etapă de deshidratare trebuie să fie de 2-5 ml în funcţie de numărul pieselor din fiecare flacon. Extragerea apei se face treptat şi în timpi scurţi pentru ca procesul să nu fie însoţit de alterări structurale (eventuale extracţii de proteine din ţesut). Pentru deshidratare se utilizează acetona (pentru epon se poate folosi şi alcoolul etilic) şi în unele cazuri oxidul de propilen.D. Spălarea După terminarea procesului de fixare pe cale chimică trebuie să urmeze imediat spălarea pentru înlăturarea totală a excesului de fixator din ţesut. spălarea trebuie efectuată după fiecare fixator folosit. Prezenţa urmelor de fixator în ţesut facilitează reacţii între acesta şi soluţiile de solvenţi organici folosite la deshidratare. Când se ajunge la etapele finale. în soluţii apoase de concentraţii crescătoare: 30% timp de 15 minute.15 M. 100% (anhidră) timp de 15 minute. 100% (anhidră) timp de 15 minute.

prin infiltrarea în ţesut. selectronul etc. Între soluţiile de deshidratare şi cele de includere este bine să se intercaleze câteva băi cu solvenţi de tranziţie.de strângere. În cazul includerii cu răşini epoxidice. peste noapte. fiind foarte fluid şi miscibil cu aceste răşini. Dintre răşinile epoxidice se pot enumera: Araldita. Specimenele sunt infiltrate în toată masa lor cu materialul de includere. Epon 812 –Araldită. cel mai bun intermediar este oxidul de propilen care acţionează ca deshidratant şi fixator şi. 3:1 şi în Vestopal (Epon) pur. Maraglas 655 – DER 732. rigolacul. 2:1. cel mai frecvent utilizat este Vestopalul W. A. care înlocuieşte substanţa în care se efectuează deshidratarea. asigură o foarte bună infiltrare a ţesuturilor. Din această categorie pot fi amintite: durcupanul. etc. Vestopal W Vestopalul W este o răşină poliesterică – un copolimer format dintr-un poliester nesaturat şi stiren. Este recomandabil ca alcoolul sau acetona folosite în ultimele băi să fie anhidre. Tot ca intermediar este recomandat xilolul sau toluolul. Pentru includera în Vestopal sau Epon piesele sunt ţinute câte 1 oră în soluţii de Vestopal (Epon)/acetonă (anhidră) în concentraţii crescătoare: 1:2. răşini poliesterice şi unele răşini epoxidice. care nu necesită deshidratarea pieselor după fixare şi spălare. fiind mai volatil. Există şi medii de includere hidrofile. Din categoria mediilor de includere hidrofobe fac parte cele pe bază de metacrilat. În paralel cu deshidratarea se prepară soluţie de Vestopal sau Epon pentru includere. acest solvent trebuie evitat deoarece inhibă unele enzime. din aceeaşi clasă mai fac parte lacul poliesteric ME 6611. INCLUDEREA Obţinerea secţiunilor ultrafine care. prepolimerizaţi împreună până la starea unui 353 . Eponul 812. prin grosimea lor redusă să permită transmisia electronilor şi deci obţinerea imaginilor în TEM este condiţionată de includerea pieselor într-un mediu suficient de dur care să faciliteze secţionarea pieselor. respectiv acetona (sau dacă este cazul – alcoolul etilic). Toate operaţiile de includere şi încapsulare se desfăşoară în nişă. urmate de modificări nedorite. să nu altereze structurile. DER 332 – DER 732. dar care. 1:1. ceea ce se poate realiza introducând în vase o cantitate oarecare de sulfat de sodiu anhidru. În cazul cercetărilor de localizare enzimatică. Dintre răşinile poliesterice. fără dop. glicol-metacrilatul sau aquonul.

Vestopal W . Secţiunile sunt rezistente la fasciculul de electroni. se prepară vestopalul astfel: se adaugă în puţin Vestopal peroxidul de benzoil (iniţiator al polimerizării Vestopalului) pentru predizolvare şi se amestecă foarte bine cu o baghetă de sticlă. Pentru 3 probe (15 blocuri) reţeta de preparare a Vestopalului este următoarea: . cristale care se răzuiesc şi se mărunţesc. De aceea. duritatea blocurilor poate fi modificată după dorinţă. pătrunde repede în ţesuturi.4 ml) Peroxidul de benzoil se activează în prealabil prin recristalizarea din cloroform. şi pentru deshidratare trebuie să se folosească acetona.Peroxid de benzoil . Substanţa activată se depune sub formă de cristale incolore pe pereţii vasului respectiv. În timpul lucrului se va avea grijă să nu se amestece direct iniţiatorul cu activatorul. care îşi schimbă culoarea. se omogenizează din nou foarte bine şi se adaugă 8 picături de activator (la 3 probe) (octoat de cobalt) cu o pipetă la care 1 ml corespunde pentru 20 de picături. B.sirop consistent. îşi pierd activitatea în decurs de o lună. Epon 812 Eponul 812 este o răşină epoxi-alifatică pe bază de glicerol. Fiind parţial polimerizat. aceştia din urmă trebuie reînnoiţi în fiecare lună. după care se pun în tuburi. nu produce procese de strângere a ţesuturilor. se pot monta pe grile fără pelicule suport şi permit obţinerea unei înalte rezoluţii. se adaugă Vestopal în cantitate de 1 g/bloc. Vestopalul W nu este miscibil cu alcoolul. Pentru includere şi încapsulare. iar secţiunile sunt foarte rezistente la fascicolul de electroni. Atât răşinile cât şi iniţiatorul şi activatorul se pot păstra la rece. În timp ce răşina poate fi păstrată câteva luni la rece. obţinută prin condensarea epiclorohidrinei cu glicerol. stirenul. chiar la rece. Ca amestec de includere. 354 . ţesuturile au un contrast ridicat şi sunt excelent prezervate. deoarece amestecul este exploziv. altfel blocurile vor fi moi şi de slabă calitate. Blocurile se pot secţiona uşor cu cuţitul de sticlă. iniţiatorul şi activatorul. dioxanul sau chiar glicometacrilatul.Octoat de cobalt preparat astfel: 1 ml α-metil stiren + 7 picături de octoat de cobalt 15 g 150 mg 8 picături (0. Cel care expiră mai repede este activatorul. se secţionează uşor cu cuţitul de sticlă. uşor gălbui.

În urma polimerizării se obţin blocuri dure. iar dacă predomină soluţia B (3:7).4. ele trebuie scoase de la frigider şi ţinute la temperatura camerei timp de câteva ore pentru a evita condensarea vaporilor de apă pe ele. După încapsulare se induce polimerizarea mediului de includere prin introducerea capsulelor la etuvă la o temperatură de 60ºC timp de 24-48 de ore. cu preponderenţă la periferia blocurilor. blocurile vor fi mai dure. Înainte de amestecarea celor două soluţii. deci includerea corectă.6-dimetil-aminometil fenol) – acceleratorul polimerizării. blocurile vor fi mai moi. Ulterior se face etichetarea capsulelor (pe etichete se scrie cu creionul chimic pentru Vestopal şi cu creion obişnuit pentru Epon – pentru a se evita ştergerea simbolurilor la contactul cu mediul de includere) şi completarea concomitentă a tuturor capsulelor de gelatină.Reţeta de preparare a Eponului este următoarea: Soluţia A Epon 812 (Epitoke 212) DDSA (anhidrida dodecenil-succinică) ml 66 100 Soluţia B (dă duritatea) Epon 812 NMA (anhidrida metil-nadică) ml 100 84 Soluţiile A şi B pot fi păstrate timp de peste 6 luni la 4ºC în sticle bine închise şi ferite de umezeală. transparente. Se amestecă foarte bine cu o baghetă de sticlă şi apoi se centrifughează pentru eliminarea bulelor de aer. ÎNCAPSULAREA Încapsularea specimenelor se face în capsule de gelatină foarte bine uscate (ţinute câteva ore la etuvă la 60°C) – în fiecare capsulă se pune o picătură de mediu de includere şi apoi câte două cuburi dintr-o probă pentru fiecare bloc. sub o lupă binoculară cu posibilităţi de mărire de 70-100×. Se completează cu Vestopal (Epon) circa 3/4 din volumul capsulelor. ceea ce ar afecta polimerizarea. Pentru două probe (6 blocuri). MODELAREA BLOCURILOR Blocurile de răşină se fasonează cu ajutorul unei lame de ras nouă. raportul de combinare A:B = 5:5 la care se adaugă 150 μl DMP 30 (2. Temperatura mai ridicată poate duce la polimerizarea neomogenă. dacă predomină soluţia A (7:3). pentru ca blocul să fie relativ scurt. spre a intra aproape în întregime în suportul ultramicrotomului. conţinând în interior piesele – de culoare neagră. Raportul 5:5 duce la obţinerea unor blocuri potrivit de dure. În vârful blocurilor. 355 . sau chiar la spargerea acestora.

Operaţiunea de modelare a blocurilor este necesară pentru ca în momentul secţionării să se obţină secţiuni trapezoidale care vor forma benzi rectilinii. sticla pentru cuţite. prismatică. cu grosimea de 5-8 mm. imediat sub tăişul cuţitului se formează o linie curbă. Cu cât secţiunile sunt mai groase. pe diagonala cărora se va face o nouă tăietură. Folosirea knife-maker-ului are ca rezultat obţinerea de cuţite cu tăiş drept. Apăsarea pe foaia de sticlă trebuie să fie uşoară. mult mai accesibile. în timp ce zonele învecinate prezintă dinţi de fierăstrău. Se poate întinde înainte de tăiere o urmă de petrol cu ajutorul unui tampon de vată. lungi de 400 mm. deoarece acestea pătrund prea adânc. rezultând câte două cuţite de formă triunghiulară. Din cauza tensiunii de fracturare. La marginea 356 . asigurându-se astfel o tăiere uşoară şi o rupere a benzilor de sticlă fără tensiuni. Pentru tăierea sticlei nu se folosesc cuţite de diamant. şi la fracturare sticlei se produc tensiuni care afectează calitatea cuţitului. SECŢIONAREA Această operaţie este necesară pentru obţinerea secţiunilor ultrafine. Pentru secţionare se pot folosi cuţite de diamant sau cele de sticlă.2 mm. late de 25 mm şi groase de 5. de aceeaşi intensitate pe toată linia de tăiere. Înainte de folosire este necesară pregătirea suplimentară a cuţitelor. strălucitoare.la nivelul probei se execută un trunchi de piramidă care să poarte în vârf o suprafaţă trapezoidală cu laturile de aproximativ 0. Înainte de confecţionarea cuţitelor. cu atât tensiunea de accelerare a electronilor va trebui să fie mai mare pentru a se putea obţine imaginea pe ecranul fluorescent al microscopului. S-a demonstrat că dacă nu există sticlă specială pentru cuţite. Cele mai potrivite sunt rondelele de metal din comerţ. Tăierea se va face pe o folie de cauciuc. în cazul tăierii manuale. aşa-zisa linie Wallner. cu ajutorul căreia se poate detecta zona utilă a cuţitului. Se modelează câte două blocuri pentru fiecare probă. cuţitele pot avea muchia de tăiere oblică. câte un bloc fiind păstrat ca rezervă. barele de sticlă se curăţă uşor cu un tampon de vată cu acetonă anhidră după care se şterg cu o bucată de tifon curat. pentru care se foloseşte ca materie primă. cu o grosime care să permită străbaterea lor de către fasciculul de electroni acceleraţi la tensiuni de 50-100 kW în TEM. la o mărire de 50-100×. sub formă de bare. Aceasta începe în punctul unde linia Wallner se curbează: zona cea mai ascuţită examinată la microscopul stereoscopic al ultramicrotomului. poate fi folosită orice sticlă albă plană.5 mm. apare ca o linie albă. Cuţitele selecţionate pentru secţionare se păstrează ferite de praf. Din barele de sticlă se vor tăia în prima fază pătrate.1-0. Pentru realizarea cuţitelor se poate utiliza aparatul special conceput pentru aceasta (knife maker).

pe o suprafaţă cât mai mare posibilă (ideal este completă) a acesteia. bara înaintează cu o distanţă reglabilă. reflexia luminii să se realizeze cât mai uniform la suprafaţa băii. La nivelul bazinului se va ajusta cantitatea de alcool 10% astfel încât. Bara de înaintare va efectua mişcări succesive în plan vertical. Se spală de cel puţin 3 ori cu alcool (10% sau acetonă 10%) sau cu apă distilată. După fiecare mişcare de tăiere. Pentru secţionare blocurile se montează pe rând în dispozitivul barei de înaintare al ultramicrotomului LKB.prismei unde se află suprafaţa de secţionare se construieşte un bazin prin lipirea unei benzi adezive în poziţie perfect orizontală. mişcând uşor. şi apoi micrometrică a ultramicrotomului. în zona cea mai ascuţită a acestuia. În cazul ultramicrotomului LKB avansul este controlat prin dilatarea termică a unei tije metalice (aliaj de nichel). prin reglarea poziţiei lămpii fluorescente. în paralel. astfel încât suprafaţa de secţionare a blocului cade pe faţa de tăiere a cuţitului de sticlă sau de diamant. ceea ce ar putea determina udarea blocului şi compromiterea secţionării. piramida realizată la nivelul probei trebuie să se afle la nivelul gurii cuţitului (în plan vertical). Cuţitul se instalează în ultramicrotom raportat la limitatorul din stânga locaşului cuţitului şi la un unghi de 3º. De asemenea. Blocurile se montează astfel ca baza mare a trapezului din vârful piramidei să fie perfect paralelă cu lama cuţitului. În poziţia blocată a barei de înaintare. Pentru realizarea acestui lucru se reglează angrenajele intermediare care ajută la fixarea suportului care poartă blocul de bară de înaintare a ultramicrotomului. grosimea acestora fiind apreciată după culoarea lor: Cenuşie Cenuşiu-argintie Argintie Argintiu-gălbuie Galben pai 100-200 Å 300-400 Å 500 Å 600 Å 650-700 Å Galben intens-maroniu Maro Maro – albăstrui Albăstrui Verde 700-800 Å 800-850 Å 900-1000 Å 1000-1100 Å 1300-1500 Å 357 . bara de înaintare în sus şi în jos prin acţionarea manuală a acesteia – de la viza de pe panoul de comandă. apoi se face oglinda. egală cu grosimea secţiunii (500-1000 Å). Secţiunile obţinute vor pluti la suprafaţa apei distilate din baia cuţitului (care formează oglinda). oglinda de apă trebuie să fie orizontală. să nu prezinte menisc. temperatura camerei trebuie să fie cât mai scăzută posibil. Pentru aceasta. Se apropie cât mai mult posibil cuţitul de bloc prin manevrarea voxelor macrometrică.

Numărul de ochiuri pe care le poate avea o grilă variază între 50 şi 1000. cu atât dispersia electronilor şi implicit contrastul imaginii sunt mai mari. N. După uscarea peliculei la temperatura camerei. secţiunile de culoare argintie sunt foarte convenabile. H). În cazul de faţă contrastarea se face în două etape.Alcool etilic 50% în apă distilată 358 2.6 g 20 ml . Se evaporă diluantul rămânând o peliculă de 100 Å grosime.Pentru cercetări de rutină. Stratul de carbon are rolul de a proteja pelicula de parlodion de acţiunea distrugătoare a fasciculului de electroni. în mijlocul unui cristalizor cu apă bidistilată se pipetează o picătură de parlodion. Pe această peliculă se aşează grilele. cu doi contrastanţi diferiţi: A. Secţiunile sunt preluate pe grile electrolitice de cupru (200 mesh) acoperite în prealabil cu o peliculă fină de parlodion. însă în mod curent sunt folosite grile cu 100-200 de ochiuri. Soluţia de acetat de uranil se prepară după reţeta: . şi ca urmare.Acetat de uranil . Grilele electrolitice sunt reţele de cupru cu cadrul de 3 mm. grilele fiind ferite de praf. datorită fineţei lor şi a compoziţiei chimice. pentru a le evidenţia sunt contrastate cu săruri ale metalelor grele. Pentru obţinerea peliculei de parlodion. Grosimea secţiunilor se va alege şi ţinând cont de caracteristicile microscopului în care se va face examinarea. O. Contrastarea cu acetat de uranil. obţinute prin electroliză. Contrastarea urmăreşte creşterea capacităţii de împrăştiere diferenţiată a electronilor de către materialul biologic secţionat. Deoarece moleculele din structurile biologice sunt constituite din atomi cu număr atomic mic (C. CONTRASTAREA Ţesuturile biologice incluse în mase plastice. Uscarea grilelor se face cu hârtie de filtru prin tamponarea laterală a grilelor. Din fiecare bloc se vor culege secţiuni pe cel puţin câte 2 grile. Contrastul imaginii obţinute în microscopul electronic depinde de numărul atomic al elementelor din care este alcătuit specimenul: cu cât acest număr este mai mare. se trece la acoperirea cu carbon (un strat de circa 100 Å) a grilelor într-un evaporator cu vid (metalizor). cu faţa în jos. contrastul acestora este foarte scăzut. Grilele se păstrează în cutii Petri cu capac pentru a fi ferite de praf (pe hârtie de filtru pe care se trec simbolurile corespunzătoare specimenelor). au putere mică de împrăştiere a electronilor. Grilele sunt apoi scoase cu ajutorul unor rondele de hârtie.

Raza primară (incidentă) a electronilor acceleraţi şi concentraţi ce cade pe suprafaţa probei. într-un sistem cu mai multe lentile. iar colorarea să se facă în apropierea câtorva granule de NaOH care să absoarbă CO2. Electronii emişi de tunul de electroni al microscopului şi acceleraţi de o tensiune înaltă (0. sub 10 nm. care se compune din numărul total al liniilor. în timp ce la cel de baleiaj. se numeşte raster. după care se lasă grilele cu secţiunile în jos pe picăturile de contrastant. imaginea se formează punct cu punct în forma rasterului. Se ţin grilele pe citratul de plumb maxim 9 minute (timp după care apar precipitate).85) NaOH 1N Se agită timp de 5 minute Apă distilată Se aduce pH-ul la valoarea 12 Se completează până la 50 ml 1. În microscopul electronic de transmisie clasic imaginea se formează în întregime. Soluţia de citrat de plumb se prepară după reţeta: Citrat de plumb (GM 1053. Pentru evitarea apariţiei precipitatelor (reprezentate de carbonatul de plumb ce apare la contactul citratului de plumb cu CO2 atmosferic). Se ţin grilele pe acetat de uranil 15-20 minute după care se spală la jet de pisetă cu apă distilată-alcool şi se iau pe hârtie de filtru spre a nu adera la vârful pensei fine cu care se lucrează.Se pipetează acetatul de uranil în godeurile unei plăci de parafină (ceară). după care s-au lăsat grilele cu secţiunile în jos pe picăturile de contrastant. Se pipetează citratul de plumb în godeurile plăcii de parafină (ceară). Cel mai bine este să se folosească o soluţie proaspătă preparată. interacţionează cu materialul. interacţiune în urma căreia apar următoarele semnale: 359 . Microscopia electronică de baleiaj Microscopul electronic de baleiaj sau scanning (SEM) diferă fundamental de microscopul electronic de transmisie în privinţa modului de formare a imaginii. pe suprafaţa probei cercetate. simultan. Imaginea finală.410 g 8 ml Se dizolvă în 30 ml apă distilată şi se agită puternic timp de 5-10 minute 2. într-un fascicul îngust al cărui diametru în locul de încrucişare are.5–30 kV) sunt concentraţi. B. după care se spală la jet de apă distilată. filtrată. se va evita contactul contrastantului cu aerul atmosferic. Contrastarea cu citrat de plumb.

4 pentru 60 – 90 minute la 4 0C.• Electroni secundari (SE) • Electroni reflectaţi (BE) • Electroni Auger • Electroni absorbiţi de probă (AE) • Electroni transmişi prin probă (TE) • Fotoni • Radiaţii X. Neavând de a face cu electroni transmişi prin probă.1M. suficient de profunde pentru a nu mai înregistra un aspect normal al acestora. pH 7. Ca şi în cazul TEM. . a patra peste noapte. dimensiunilor probei.îndepărtarea fixatorului în exces prin trecerea probei în tampon fosfat 0. pH 7. 360 . o deshidratare naturală a materialului biologic produce alterări ale suprafeţei probelor datorate tensiunii superficiale. Timpii de lucru ai acestor etape vor fi adaptaţi tipului de ţesut organic şi. limitarea fiind dată doar de mărimea incintei probei. capabil de a genera electroni secundari sub impactul fasciculului incident provenit din filamentul microscopului. dar pentru probele biologice este necesară acoperirea acestora cu un strat foarte subţire de metal (prin evaporare în vid). Pentru fixarea probelor biologice cu conţinut ridicat de apă se foloseşte aceeaşi combinaţie de fixatori ca şi pentru microscopia electronică de transmisie: . Deşi rezoluţia acestui microscop nu permite observarea unor detalii de ordinul celor din TEM. DESHIDRATAREA LA PUNCT CRITIC Deshidratarea la punct critic reprezintă o metodă de eliminare a oricărei substanţe volatile.15M. şi aici probele trebuiesc deshidratate.7% în tampon fosfat 0.4 . toate la 4 0C. îndepărtându-se orice urmă de solvent sau a vreunei substanţe volatile din materialul biologic.prefixarea cu glutaraldehidă 2.4 timp de 75-90 minute. generatoare de vapori (ce pot diminua nivelul vidului din microscop) dintr-o probă biologică în vederea examinării acesteia la microscopul electronic cu baleiaj. în special.15M. . de asemenea. pentru SEM dimensiunile preparatelor pot depăşi 3 cm grosime. pH 7. în condiţii de vacuum înalt. examinarea desfăşurându-se. de asemenea la 4 0C.trei băi consecutive a câte 60 minute fiecare.postfixarea cu acid osmic (Os O4) 1% în tampon fosfat 0.

Prin creşterea temperaturii gazului lichefiat. suprafaţa lichidului devine foarte instabilă şi. cauza primară a acestora fiind efectele tensiunii superficiale. 361 . trece în faza de gaz. Când este atins punctul critic este posibilă trecerea de la faza de lichid la faza de gaz fără modificări dramatice. Deshidratarea normală prin evaporare la temperatura camerei induce deformări ale majorităţii specimenelor. va parcurge această tranziţie spre un mediu gazos “uscat” fără a fi în contact cu suprafaţa. Dacă tensiunea superficială scade foarte mult. studierea morfologiei suprafeţelor probelor biologice implică prezervarea detaliilor de suprafaţă. metodă superioară sublimării apei în vid. meniscul devine plat. unde aceasta este de câteva ori mai mică. aşteptându-se deformări minore ale suprafeţei probei în timpul deshidratării. în final. dar se pot folosi şi alte gaze lichefiate ca şi fluid de tranziţie. indicând o reducere a tensiunii superficiale. Totuşi.În 1952. intervenţia aşa-numitei continuităţi de fază sugerează o metodă de deshidratare pentru care tensiunea superficială poate fi redusă la zero. Anderson a dezvoltat această metodă folosind CO2 lichid. Dacă proba biologică a fost în lichid. spre deosebire de acetonă. Cel mai comun mediu al probelor biologice este apa. În acest sens. proba fiind supusă forţelor prezente la limita fazei lichid – vapori. cu păstrarea nealterată a detaliilor de suprafaţă. evitând astfel posibilitatea apariţiei deformărilor datorate tensiunii superficiale. Tensiunea superficială poate fi redusă prin substituirea cu un lichid ce are o tensiune superficială mult mai mică decât a apei. care prezintă o tensiune superficială la aer foarte mare.

devin similare şi. Dacă lichidul a fost încălzit într-o incintă închisă. cel mai utilizat fiind. valori la care are loc tranziţia.1 MONOXID DE CARBON -141. o continuitate de stare. astfel. CO2 rămâne cel mai utilizat mediu pentru deshidratarea la punct critic şi este numit fluid de tranziţie. aceasta fiind temperatura critică căreia i se asociază o presiune critică. Acest fapt este realizat pe izoterma de 31. orice menisc vizibil va dispărea. unde poate fi lichefiată. deşi se pot utiliza şi variante cu două fluide intermediare. aşa încât presiunea critică să poată fi atinsă la temperatura critică. tensiunea superficială fiind zero având. proprietăţile stării de lichid şi ale stării de gaz (vapori) ale aceleiaşi substanţe. de regulă. procedura glutaraldehidă – osmium. deci. Deasupra acestei temperaturi gazul nu poate fi lichefiat prin aplicarea presiunii.1 oC pentru CO2. o substanţă poate fi clasificată drept gaz doar deasupra temperaturii critice.1 APĂ +374 Presiunea critică (atm) 20 50 33 73 36 219 Deci. Aşa cum s-a menţionat. Înaintea acestor etape se realizează fixarea probei. dioxidul de carbon. în consecinţă. stadiul intermediar implică deshidratarea probei biologice cu ajutorul lichidului intermediar: (proba umedă) H2O > Acetonă > CO2 > DPC (proba uscată) 362 . în cazul probelor biologice la unele dintre acestea ar interveni modificări termice suplimentare. Chiar dacă valorile critice ale diferitelor substanţe pot fi atinse practic. schimbă apa din ţesut şi este miscibil cu CO2. apa din proba biologică trebuie înlocuită cu un alt fluid miscibil cu CO2. CONSTANTE CRITICE Substanţa Temperatura critică (oC) HIDROGEN -234. Acest fluid intermediar. sub această valoare. Nefiind miscibil cu apa. tipic pentru microscopia electronică. este mult mai precis termenul de vapori.5 OXIGEN -118 AZOT -146 DIOXID DE CARBON +31. coincid. în final.Graficul indică faptul că. la atingerea punctului critic (caracterizat de valori ale presiunii şi temperaturii foarte precise).

Specimenul este trecut prin diferite concentraţii crescătoare ale fluidului intermediar.7% şi OsO4 1% în tampon fosfat. încălzirea incintei până la atingerea punctului critic. Această acoperire este necesară pentru eliminarea sau reducerea încărcării electrice ce se instalează rapid la suprafaţa unei probe neconductive la baleierea acesteia de către un flux de electroni de energie înaltă. substituirea acetonei cu CO2 lichid sub presiune – operaţie repetată în funcţie de dimensiunile probelor. specimenul poate acumula o încărcătură suficient de mare pentru a decelera fluxul primar. Materialul uzual pentru acoperirea probelor este aurul.câte 10 minute fiecare ---------------------¤ . culminând cu înlocuirea completă a apei din ţesut cu acest fluid. fiind mai puţin susceptibil deformărilor datorate evaporării fluidului de tranziţie ce-l va înlocui. imersia probei în acetonă în incinta aparatului. specimenele nonconductive examinate la parametri optimi prezintă invariabil fenomenul încărcării electrice ce conduce la distorsionarea imaginii şi la distrucţii termice. 363 . proba acţionând în acest caz ca oglindă pentru electroni. eliberarea vaporilor de CO2. _______________acetonă________________________ H2O > 30% > 50% > 60% > 70% > 80% > 90% > 100% > CO2 ¤ ------------------. deshidratarea cu acetonă. În absenţa stratului de acoperire. deoarece prezintă o tensiune superficială foarte scăzută. 6. 3.trei schimbări FLUIDE INTERMEDIARE / DESHIDRATANTE Substanţa ETANOL ACETONĂ FREON (113) APĂ Tensiunea superficială (dyne/cm) 23 24 19 73 Principalele etape ale deshidratării la punct critic: 1. 5. În situaţii extreme. ACOPERIREA CU METALE Toate probele neconductive necesită acoperirea cu un film subţire de material conductiv. 4. având drept rezultat pierderi semnificative de material din probă. 2. fixarea probei cu glutaraldehidă 2.

la capete aplicându-se o tensiune continuă de 1 – 3 kV. 364 . Orientarea probei pe suport în aceasta fază este foarte importantă. Probe biologice de tipul insectelor chitinoase. O anexă importantă a SEM este sistemul de microanaliza elementală cu raze X (EDX). probe de tipul microfosilelor (foraminifere) sau segmente de aparate bucale. aurul este cel mai utilizat element pentru acoperirea probelor. Probele astfel pregătite se introduc în microscop si se examinează la diferite măriri.Când scopul analizei nu este achiziţia unui spectru de raze X. pot fi aranjate în ordine pe un singur suport. Astfel. putându-se realiza chiar hărţi cu distribuţia fiecărui element chimic în zona luată în studiu. Acoperirea se realizează prin evaporarea metalului în vid. la celelalte probe este obligatorie uscarea la punct critic pentru prevenirea deformărilor datorate unei deshidratări brutale în aer. Detectorul special al EDX identifică. imaginile fiind preluate în format digital sau clasic pe film. pe baza radiaţiei X (specifică fiecărei specii chimice) generate din probă. Pulberile. în timp ce. surplusul fiind îndepărtat în momentul introducerii în vid pentru metalizare. antene. ce presupune legarea metalului la polul pozitiv şi a probei la cel negativ. sporii sau alte probe ce nu pot fi manipulate cu pensa. ţinând cont de posibilitatea limitată de înclinare a probei în microscop. aşa încât zona de interes să fie expusă direct fasciculului de electroni ce balează proba. EXAMINAREA DIFERITELOR PROBE IN SEM Probele pentru examinarea în SEM sunt montate pe suporturi conductive din cupru cu ajutorul unor discuri de carbon adezive pe ambele feţe. abia apoi realizându-se acoperirea cu metale a acestora. de câteva sute de nanometri. precum şi cele cu un conţinut nesemnificativ de apă (frunze uscate) pot fi montate pe suport şi metalizate fără deshidratare. compoziţia chimică a probei analizate atât calitativ cât şi cantitativ. palpi (insecte). vor fi presărate pe suportul adeziv. montarea probelor se va realiza sub lupa binocular unde. dispozitiv instalat într-o incintă ce menţine un nivel de vacuum (10-2 Pa) suficient pentru a asigura o depunere a atomilor de aur într-un strat uniform şi foarte subţire.

............................X...... 371 5.... MICROSCOPUL DE FORŢĂ ATOMICĂ Microscopia de forţă atomică Conf....................... .......................SPM) este o microscopie mecanică ce acoperă câteva tehnici de vizualizare a suprafeţei unui eşantion (morfologia suprafeţei) cu o rezoluţie la nivelul moleculelor sau a grupurilor de atomi............ Weibel in 1981 was marked as the invention of STM................... 374 7.. H....... Ioan Burda Cuprins 1................... 373 6................................. Microscopia de Forţă Atomică .... Microscopia de Scanare a Probei .................. 375 8............... Microscopia de Scanare a Probei Microscopia cu scanarea probei (Scanning Probe Microscopy .... An observation of this dependence between a W-tip and Pt surface by G................... se poate vizualiza dintr-un eşantion maxim 150 X 150 um dacă rugozitatea în zona scanată este 365 Figura 1.. 365 2................................................. Gerber and E....... dr.............................................................................. Ch................................. 369 3.............................. 376 Quantum mechanics predicts an exponential dependence of tunneling current with a separate distance between the two electrodes................................ Imagine SEM x1000 pentru un cantiliver – tip......................... Aplicaţii ale Microscopiei de Forţă Atomică ........................ Nanolitografie cu Microscopul de Forţă Atomică .............. 1................. Spectroscopia de Forţă Atomică .......... Rohrer......................... Avantajele şi Limitele Microscopiei de Forţă Atomică .. Nanomanipularea cu ajutorul Microscopului de Forţă Atomică ... Bibliografie .................... 371 4.. Binnig................................ În cazul celor mai performante echipamente SPM disponibile în prezent........

Scanner piezoelectric de forma prin sensibilitatea lor (raportul dintre tubulara. În prezent. Scanner-ul SPM este realizat din material piezoelectric (PZT) care se expandează şi contractă proporţional cu tensiunea aplicată. Tehnologia SPM are la bază un concept simplu: scanarea unei suprafeţe cu ajutorul unui vârf (tip) foarte ascuţit (sharp. Pentru valori mari ale tensiunii. scanner-ul este construit sub forma unui tub (Figura 3) cu electrozi pentru deplasarea pe X. Cu ajutorul unui astfel de sistem de detecţie este posibilă măsurarea indirectă a forţei dintre tip şi suprafaţa eşantionului studiat. De performanţele mecan. atât cât se extinde sau contractă un material piezoelectric per volt. De regulă. Y şi Z iar cu ajutorul lui se poate poziţiona proba (tip-ul) cu extremă precizie în 3D (3 Dimensiuni). Cunoaşterea acestor forţe este unui fascicul laser şi a unui fotodetector. iar z este distanţa pe care cantilever-ul a suferit o Figura 2. Pentru a calcula forţa de interacţie utilizăm legea lui Hook (F = kz). vârf cu raza de curbură de circa 3-50 nm. Detecţia deflexiei cu ajutorul deflexie. Acest tip este ataşat de o grindă (cantilever) flexibilă.mai mică de 10 um. tip) şi eşantionul scanat. cele mai multe sisteme SPM utilizează un fascicol laser pentru a determina deflexia cantilever-ului. se poate spune că este singurul element puternic limitativ în evoluţia viitoare a microscopiei mecanice. unde k este constanta de elasticitate a cantilever-ului. se definesc tehnicile SPM. deplasarea pe o direcţie şi tensiunea aplicată pe acea direcţie) adică. deplasarea nu este 366 . În funcţie de mecanismul de interacţiune dintre probă (vârf. Mai mult. Figura 1). importantă pentru interpretarea imaginilor SPM sau pentru a determina proprietăţi mecanice locale ale eşantionului. respectiv cu polaritatea acesteia.electrice ale scanner-ului piezoelectric depind în ceea mai mare măsura performanţele întregului SPM. astfel încât să poată fi urmărit profilul suprafeţei scanate. Acest fascicul laser se reflectă de partea opusă tip-ului (fabricat din Si sau Si3N4) pe un fotodetector sensibil la poziţie (Figura 2). Scanner-ele sunt caracterizate Figura 3. Un alt element de bază al unui SPM este scanner-ul piezoelectric.

această tehnică a cunoscut o dezvoltare rapidă (în comparaţie cu STM). Desigur că acest efect poate fi limitat prin aplicarea unei tensiuni neliniare pentru scanare (identificată în procesul de calibrare a scanner-ului). Pentru a putea măsura efectul de tunelare distanţă dintre cei doi electrozi trebuie să fie de aproximativ 1 nm. aşa că. Cu toate acestea. Din această cauză. Prin utilizarea unei surse cvasi-punctiforme. Practic. • Near-Field Scanning Optical Microscopy (NSOM) utilizează o sursă de lumină de foarte mici dimensiuni ca mecanism de formare a imaginii. poate fi obţinută o rezoluţie dincolo de limita de difracţie. magnetice si mecanice. toate eşantioanele de material de orice tip (inclusiv de natură biologică) pot fi investigate/măsurate cu AFM. fabricantul utilizează cel putin 48 de ore scanner-ul înainte de a fi livrat pentru o aplicaţie. Pentru a limita efectele date de procesul de îmbătrânire. AFM-ul a fost dezvoltat în ultimele decenii pentru a măsura o mare varietate de proprietăţi pe suprafaţa eşantionului cum ar fi proprietăţile electrice. cu un diametru mai mic decât lungimea de undă. Această situaţie experimentală este posibilă în cazul unor suprafeţe conductoare curate (practic fără rugozitate) precum şi în lipsa vibraţiilor ambientale. Pe lângă morfologia suprafeţei. Cele mai comune tehnici SPM sunt: • Scanning Tunneling Microscopy (STM) este tehnica SPM de bază care a generat întreg domeniul acoperit azi de microscopia mecanică. 367 . Proba (un tip de fibră optică plus o apertură) trebuie să fie foarte aproape de suprafaţa eşantionului. Această diversitate este bazată pe principiul de funcţionare care implică existenţa unui tip (probă) în contact sau foarte apropiat de suprafaţa eşantionului. Poate cel mai neplăcut lucru legat de scanner este procesul exponenţial de îmbătrânire ce determină o scădere a sensibilităţii în timp. Principiul STM-ului este dat de efectul de tunelare al electronilor între doi electrozi în prezenţa unui câmp electric. • Atomic Force Microscopy (Microscopia de Forţă Atomică) a apărut ca o extensie în utilizarea microscopiei mecanice (1986) pentru eşantioanele nu foarte conductoare.liniară cu tensiunea aplicată şi această dependenţă diferă de la scanner la scanner. fiind extrem de utilă în multe domenii de cercetare. o recalibrare frecventă a scanner-ului se impune mai ales în primul an de utilizare. orice interacţiune dintre tip şi suprafaţa eşantionului este măsurabilă. Efectul final al acestei situaţii este identificat prin rezultate diferite funcţie de direcţia de scanare.

În cazul NSOM. indice de refracţie. dar intensitatea lumini este scăzuta si dependentă de forma probei. adică prin intermediul unui cantilever şi a unui sistem de detecţie al deflexiei cu fascicul laser. Dimensiunea punctului de lumină determină rezoluţia maximă ce poate fi obţinută. iar proba colectează lumina reflectată. O prima metodă este echivalentă cu cea din cazul AFM. Un al doilea mod este un mod rezonant (tuning fork) şi este monitorizată amplitudinea oscilaţiei când tip-ul se mişcă deasupra suprafeţei eşantionului. 368 . parcurge o apertură realizată prin acoperirea ei cu metal (cum ar fi Al) şi microfabricată la fel ca o probă AFM. mecanismele de contrast pot fi uşor adaptate pentru studierea diferitelor proprietăţi. sunt necesare eşantioane transparente. În funcţie de modul de obţinere a imaginii. fluorescenţă. prin intermediul unei fibre optice. se realizează prin două metode. Mutarea laterală a tip-ului este denumită “shear-force” feedback. În acest caz. structura chimică si stress-ul local. Detecţia semnalului se realizează prin: spectrometru. De regulă. birefringenta. avem mai multe moduri de operare: • Transmisie: lumina care vine prin apertura probei este transmisă prin eşantion. La fel ca în orice microscopie optică. feedback-ul necesar în sistem. tub fotomultiplicator sau CCD (Charge Coupled Devices). lumina laserului. sunt utilizate câteva mecanisme de contrast: polarizare. • Reflexie: lumina care vine prin apertura probei se reflectă pe suprafaţa eşantionului. Această regiune limitată de proba şi eşantion este numită “Near-Field” de unde şi numele acestei microscopii. pentru a menţine o distanţă de lucru dintre probă şi suprafaţa eşantionului. • Colectare: eşantionul este iluminat dintr-o sursă externă cu arie mare de iluminare. şi în acest caz. eşantionul poate fi opac. în cazul unui NSOM avem o rezoluţie laterală de circa 20 nm şi o rezoluţie verticală de 2-5 nm. cum ar fi indicele de refracţie. Pentru a vizualiza imaginile. cât şi de colectarea luminii reflectate.mai aproape decât lungimea de undă. topografie. Tipic. Rezoluţia imaginii este limitată de dimensiunea aperturii detectorului şi nu de lungimea de undă a luminii incidente. dependenţa de lungimea de undă şi reflectivitate. • Iluminare/Colectare: Proba este responsabilă atât de iluminare. APD (Avalanche Photo Diode).

pentru suprafeţe ale eşantionului cu rugozitate scăzuta să se opereze în modul distanţă constantă. cantilever-ul este foarte subţire. Tip-ul este în contact puternic cu suprafaţa eşantionului şi în modul distanţă constantă este posibilă rezoluţia atomică. cantilever-ul este optimizat pentru sensibilitate mare la forţele de frecare laterală. ceramici. • Microscopia de Forţă Laterală (Lateral Force Microscopy . 1986) a fost dezvoltată ca o soluţie tehnică pentru STM. Potentialul Lennard-Jones versus modurile de operare AFM. LFM este util în vizualizarea forţelor de frecare pe suprafaţa eşantionului. iar cantilever-ul este mutat în sus sau în jos pe timpul scanării. În acest scop. Microscopia de Forţă Atomică Microscopia de Forţă Atomică (AFM. Versatilitatea AFM-ului a dus în timp la o diversitate de moduri de operare şi adaptări. tocmai de aceea. de asemenea. Se poate. în medii chimice corozive sau medii biologice termostatate. tip-ul este menţinut (de obicei) la o forţă constantă puternic de respingere. sticle şi materiale biologice. precum şi pentru a pune în evidenţă muchiile de pe suprafaţa eşantionului. atracţie) al forţei Van der Waals ca o funcţie de distanţă. materiale compozite. Potenţialul Lennard-Jones (Figura 4) este un model aproximativ pentru cazul izotropic (repulsie şi Figura 4. Acesta a fost de altfel primul mod de operare AFM implementat ca o adaptare la STM. modificări la situaţii specifice: măsurători in lichide. de a măsura prin microscopie mecanică eşantioanele neconductoare. dacă eşantionul este special preparat. Modul de operare LFM este 369 . Relativ la natura forţelor implicate şi interacţiunea dintre tip şi suprafaţa eşantionului definim cele mai importante moduri AFM de operare (clasice): • Contact Mode (modul contact).LFM) măsoară forţele de frecare dintre tip şi suprafaţa eşantionului. Marele avantaj al AFM-ului este capacitatea acestuia de a investiga practic orice tip de suprafaţă inclusiv polimeri. Capabilitatea de a urmării suprafaţa eşantionului în acest mod este limitată doar de circuitul de feedback.2. care sunt determinate de neomogenităţile materialului. Aceste forţe sunt măsurate indirect prin deflecţia laterală (twist) a cantilever-ului.

370 .• • • • un mod derivat din modul de operare Contact Mode. de ordinul pN. în aşa fel încât. ceea ce înseamnă că tip-ul este apropiat de suprafaţa eşantionului. în acest caz. Avantajul acestui mod de operare este legat de rezoluţia laterală mai ridicată fără apariţia unor forţe de dragare. Tabelul 1 este departe de a fi complet (doar modurile esenţiale) şi mai mult. iar slop-ul. Phase Imaging este un mod în care sunt culese informaţii despre shift-ul de fază a cantilever-ului aflat în oscilaţie în raport cu semnalul de excitaţie. Force Modulation este un mod AFM de operare ce se referă la utilizarea proprietăţilor materialului probei pentru a controla interacţiunea cu suprafaţa eşantionului. Modurile de operare din Microscopia de Forţă Atomică sunt rezumate în Tabelul 1 cu referire la forţa de interacţiune pentru fiecare mod. Acest shift de fază se corelează cu proprietăţi specifice suprafeţei eşantionului (frecare. dar nu este în contact cu aceasta. cantilever-ul este oscilat în apropierea suprafeţei eşantionului. Tapping Mode) este denumirea clasică. forţa-distanţă este măsurată determinând astfel elasticitatea eşantionului. iar mai recent este denumit DFM (Dynamic Force Mode). adeziune. Acest mod de operare este un mod măsurat simultan cu modurile AC enumerate mai sus. cantilever-ul este oscilat îin regim de atracţie. În acest caz. Tip-ul este oscilat şi pus în regim de respingere. în fiecare an se adăuga noi moduri de operare sau noi versiuni ale acestora. dar părţi ale oscilaţiei sunt extinse în regimul de respingere. Aceste date pot fi culese simultan cu topografia suprafeţei eşantionului. Prin acest mod de operare AFM se pot determina şi compara simultan morfologia şi proprietăţile locale. vîscoelastice). Desigur că forţele de interacţiune dintre tip şi suprafaţa eşantionului sunt foarte mici. Contact Intermitent (Dynamic Force. NonContact Mode este un concept ce descrie familia modurilor AC (moduri de curent alternativ). Detecţia se bazează pe măsurarea diferenţelor de cuplaj cu suprafaţa eşantionului care determină schimbarea frecvenţei de rezonanţă a cantilever-ului şi/sau a amplitudinii de oscilaţie. tipul este în contact constant cu suprafaţa eşantionului. Şi în acest mod. tip-ul intră intermitent în contact cu suprafaţa eşantionului.

4.vibrarea probei forţele de frecare exercită o torsiune a cantileverului folosit în scanare câmpul magnetic de la suprafaţa eşantionului poate fi vizualizat distribuţia conductivităţii termice pe suprafaţa eşantionului este vizualizată. Aceasta tehnică inovativă este combinată cu probe specializate şi este corelată cu intensitatea spectrală (Raman) în timp real pentru a vizualiza legăturile chimice. Această metodă este utilă în măsurarea contactului la dimensiune nano (legături atomice. tip-ul este împins în faţă şi apoi retras de la suprafaţa eşantionului. iar deflexia cantilever-ului este monitorizată în funcţie de deplasarea scanner-ului. Aplicaţii ale Microscopiei de Forţă Atomică Datorită faptului că AFM-ul poate investiga practic orice tip de material fără o preparare specială a eşantionului. Spectroscopia de Forţă Atomică poate fi implementată ca şi deflexie statică sau mai recent în mod dinamic. Mod de Operare contact mode non-contact mode intermittent contact mode lateral force mode magnetic force thermal scanning Forţa de Interacţie puternic de respingere – forţa constantă sau distanţa constantă slabă de atracţie . această tehnică experimentală a devenit în timp cea mai utilizată tehnică în studierea macromoleculelor sau 371 . O altă metodă modernă de investigare mediată de AFM este nanoidentarea (nanoidentation). Limita de măsurare este în domeniul pN.Tabelul 1.1 nm. forţe Casimir) cum ar fi forţa de rupere a moleculelor de suprafaţa eşantionului. megapascali) care produce un shift în semnalul Raman corelat cu stresul aplicat. Force Spectroscopy) şi se referă la măsurarea directă a interacţiunii dintre tip şi suprafaţa eşantionului în funcţie de distanţa de separare. AFM-ul poate aplica un stres mecanic controlat pe suprafaţa eşantionului (raza de curbură a tip-ului este de câţiva nm aşa că P = F/A determină presiuni ridicate. Spectroscopia de Forţă Atomică O altă aplicaţie majoră AFM este Spectroscopia de Forţă Atomică (FS. În această metodă.vibrarea probei puternică de respingere . situaţie în care cantilever-ul este vibrat (metoda AC). forţe Van der Waals. iar distanţa pe axa Z este mai bună de 0. 3.

Dacă alegem un contact apropiat atunci AFM-ul va deveni foarte sensibil la zgomote (vibraţii) externe. medii de stocare a datelor. Modul de lucru AFM trebuie ales în funcţie de caracteristicile ce prezintă interes în investigare. încât multe din articolele ştiinţifice de ieri au devenit azi automatizare. dar va deforma mai puţin sau deloc eşantioanele moi. ¾ Distorsiuni ale imaginii induse de probă. Pentru a vizualiza atomi sau molecule este necesar ca interacţiunea să fie numai între tip şi atomul/molecula cea mai apropiată (acest lucru se poate realiza pentru rezoluţia atomică numai în tehnologia STM). cromozomi. circuite integrate). Modul contact este o bună alegere pentru suprafeţele dure. Reţinem din aceste timpuri istorice câteva distorsiuni induse de forma tip-ului care merită înţelese. dar nu este o alegere potrivită pentru suprafeţele moi. este importantă cunoaşterea formei tip-ului (geometria acestuia) pentru o interpretare corectă a imaginilor obţinute. În aceste situaţii. Acest lucru nu este posibil în cazul AFM şi este limitat atât fizic (Van der Waals). liniaritatea scanner-ului şi vibraţiile ambientale. vor degrada calitatea imaginii obţinute. Marii producători de echipamente de microscopie mecanicp au reuşit în ultimul timp să elimine o mare parte din limitările anterioare prin îmbunătăţirea componentelor mecanice şi electronice. calitatea tip-ului. este frecvent utilizată în studierea suprafeţelor în industria electronică (Silicon wafers. deoarece poate produce o contaminare a tip-ului sau poate îndepărta material de pe suprafaţa eşantionului. La rezoluţii ridicate.eşantioanelor biologice (proteine. imaginea obţinută este practic convoluţia dintre forma tip-ului şi morfologia locală. Murdăria şi efectele de capilaritate induse de apa de pe suprafaţa eşantionului vor avea un rol dominat si. reţele de difracţie. ceea ce vedem într-o imagine AFM este mai degrabă o imagine mediată a morfologiei suprafeţei eşantionului. De asemenea. precum şi în studierea unor nanostructuri (suprafaţa polimerilor. cât şi tehnologic prin limita de ascuţire a tip-ului. precum şi de natura suprafeţei eşantionului. bacterii). Aşa că. Performanţele unui AFM sunt limitate de un număr de factori dintre care amintim: capacitatea elementelor mecanice de a muta tip-ul cu precizie şi de a măsura poziţia acestuia. ceramici. Vizualizarea cu AFM a suprafeţelor pentru eşantioane cu relief înalt implică utilizarea unui 372 . în final. Calibrarea automată tridimensională a uşurat mult munca operatorului. în general. de exemplu. ¾ Restaurarea Imaginii (Deconvoluţia Probei). ADN. răşini naturale). Modurile AC (cu vibrarea probei) sau intermitente au fost imaginate pentru a investiga suprafaţa unor eşantioane biologice.

În figura 5. Dip-Pen Nanolithography (DPN) a fost prima metodă SPL disponibilă comercial pentru AFM. Metoda efectivă de deconvoluţie depinde de caracteristicile suprafeţei eşantionului şi de geometria tip-ului (un subiect frecvent prezent în literatura ştiinţifică). Trebuie menţionat că pe lângă nanolitografia de scanare a mai fost dezvoltată în ultimul timp şi litografia vectorială. 373 . o descriere sumară a principalelor tehnici este utilă: • Scanning Probe Lithography (SPL) este o unealtă/tehnologie promiţătoare pentru realizarea de pattering la scală nano. aşa că. În caz contrar. se pot vedea câteva exemple clasice de nanolitografie. • Atomic Force Microscopic Nanolithography (AFMN) este o metodă de pattering pe o suprafaţă chimică-mecanică pentru AFM. În aceste situaţii. Figura 5. În prezent. atomi individuali pot fi manipulaţi prin utilizarea tip-ului unui STM. litografie AFM (5 um). trebuie să apelam la metode matematice pentru a restaura imaginea (deconvoluţie). Nanolitografie cu Microscopul de Forţă Atomică Nanolitografia se referă la fabricarea de structuri nanometrice mai mici de 100 nm. această tehnică de utilizare a unui AFM este utilizată (nu foarte frecvent) în realizarea de circuite integrate (nanocircuite) sau de sisteme nanoelectromecanice (NEMS). Patter-ul poate fi creat manual sau automat. Nanolitografia nu se rezumă la utilizarea AFM. ceea ce vedem poate fi imaginea tip-ului reflectată de suprafaţă. 5.tip foarte ascuţit. Nanolitografie vectorială de la procedeu (a) la rezultat (b). De exemplu.

Prin utilizarea AFM-ului ca sistem nanorobotic. După cum am menţionat. Figura 6. Trebuie menţionat că AFM-ul poate fi utilizat ca un robot 3D (manipulator 3D) care are spaţiul de lucru la scală nano. 374 . pot fi manipulate pentru a realiza circuite electrice sau pentru a măsura proprietăţile lor mecanice. nanomanipularea poate deveni o operaţie relativ uşor de realizat. Un alt exemplu de nanomaipulare este prezentat în figura 7 a unor particule de latex cu diametrul de 100 nm într-o structură complicată. sau mai recent.6. Nanomanipularea unor nano cuburi de aur pe o suprafaţă de sticlă. Nanomanipularea cu ajutorul Microscopului de Forţă Atomică Diverse structuri nanometrice. prin utilizarea unei interfeţe haptic şi a unei aplicaţii de realitate îmbunătăţită. implicate în manipularea lor. Figura 7. pattern-ul poate fi realizat manual sau automat. cum ar fi nanotuburi şi nanofire care sunt pe suprafaţa unui eşantion. Nanomanipularea unor particule de latex cu diametrul de 100 nm. Un exemplu de nanomanipulare a unor particule de aur (nano cuburi) cu diametrul de 100 nm pe o suprafaţă de sticlă se poate vedea în figura 6.

respectiv a avantajelor.AFM-ul ca nano robot este extrem de util în nanomaipularea unor celule sau molecule. eşantionul nu necesită un tratament special (acoperirea cu metal sau carbon) care poate compro375 . iar altele ca un izolator. cum ar fi realizarea unor circuite electronice (motivată de studierea proprietăţilor electrice). Mai mult. Microscopul de Forţă Atomică are în aceeaşi măsură avantaje şi limite.4 nm şi este în esenţă o structură scurtă (3. În acelaşi timp. Cunoaşterea acestor limite. alte rezultate îl prezintă ca fiind un semiconductor. După aproximativ 15 ani de controverse relativ la mecanismul de conducţie (transfer de sarcină) este acum bine demonstrată dependenţa de distanţă (tunelarea într-un singur pas sau hopping termic mai mulţi paşi). în ultimul timp. un exemplu este prezentat în figura 8. în cazul AFM avem un profil 3D.6 nm) care se repetă. Aceste molecule cunoscute de mai mult de o jumătate de secol au atras atenţia. 7. Nanomanipularea ADN-ului pe o placă de polycarbonat (aria de scanare este de 5 um). Figura 8. Avantajele şi Limitele Microscopiei de Forţă Atomică La fel ca orice alt echipament. în literatura de specialitate ADN-ul rămâne pentru moment un subiect neelucidat. hopping termal) au fost studiate şi verificate indirect experimental. Elucidarea acestor situaţii nu se poate face decât prin experienţe de nanomanipulare a ADN-ului. Molecula de AND are un diametru de circa 2. în special nanomanipularea moleculelor ADN. este importantă în luarea unei decizii corecte înainte de a apela la acest echipament pentru investigarea unui eşantion. Microscopia concurenta SPM (AFM) este SEM (Scanning Electron Microscopy) dar spre deosebire de SEM unde avem o proiecţie 2D sau mai exact o imagine 2D pentru eşantion. pentru aplicaţii în nanotehnologie. unele rezultate sugerează că avem un bun conductor (chiar supraconductor la temperaturi joase). Ambele mecanisme (tunelarea sarcinii.

Peter (2001). cu posibilitatea de scanare simultană a unor arii diferite. Giessibl. Aceste limitări au fost eliminate în cazul microscoapelor AFM moderne prin scannere în bucla închisă sau scanner-e ortogonale. făcând lipsită de precizie măsurarea unor structuri. 8. Journal of the American Chemical Society 127 (45): 15688–9 Zhong.Z care necesită refacerea în software a imaginii. Aceste limitări sunt un subiect fierbinte în cercetarea instrumentală din acest domeniu şi câteva succese au fost obţinute prin utilizarea în paralel a mai multor cantilevere sau. mai recent. 4. "Direct measurement of interatomic force gradients using an ultra-low-amplitude atomic force microscope". La fel ca şi în orice altă tehnică bazată pe realizarea de imagini este posibilă apariţia de artefacte care pot fi induse de tip-ul instabil sau mediul ambiental impropriu sau chiar de eşantionul studiat. asigurând în principiu o rezoluţie mai bună decât SEM. care în cazul SEM este de ordinul milimetrilor. Y. "AFM single molecule experiments at the solid-liquid interface: în situ conformation of adsorbed flexible polyelectrolyte chains". Marele dezavantaj al AFM faţă de SEM se referă la aria scanată. bine cunoscută limitarea puternică indusă de existent pe eşantion a unor pereţi drepţi sau şanţuri foarte adânci şi înguste a căror morfologie nu poate fi pusă în evidenţă decât prin utilizarea unor tip-uri speciale şi extrem de scumpe. Imaginile obţinute cu AFM pot fi. (2003). Hoffmann. Q (1993). G. eşantionul. Bibliografie 1. această post-filtrare poate elimina unele caracteristici ale eşantionului. Un alt avantaj este posibilitatea de a investiga eşantionul în condiţii ambientale. AFM cu rata de scanare video. M. precum şi de efectele de mixare între axele X. Proceedings of the Royal Society a Mathematical Physical and Engineering Sciences 457: 1161. Reviews of Modern Physics 75: 949. 2. "Fractured polymer/silica fiber surface studied by tapping mode atomic force microscopy". toate acestea la o viteză mult mai mare. Franz J. lucru foarte important pentru eşantioanele biologice. distorsionate de efectul de hysteresis al materialului piezoelectric. comparabilă cu rezoluţia unui TEM (Transmission Electron Microscopy).Y. de asemenea. 3. Surface Science Letters 290: L688. în unele situaţii. S (Nov 2005). 376 . Roiter. Este. drift-ul termic poate induce distorsiuni pe imagine. "Advances în atomic force microscopy". Ahmet Oral. Din păcate. Datorită faptului că timpul de scanare în cazul AFM-ului este mare. Minko. Ralph A. de asemenea.mite.

Review of Scientific Instruments (USA: AIP) 69 (9): 3268–3276. 6. Proceedings of International Symposium on Smart Structures and Microsystems. 9. "Chemomechanical surface patterning and functionalization of silicon surfaces using an atomic force microscope". Phys. J. Proceeding of the 2003 IEEE International Conference on Robotics and Automation. 377 . 3-D nanomanipulation using atomic force microscopy. "Automatic lateral calibration of tunneling microscope scanners". F. Xi.Y. Fung. Yu. Li. 2000. Xi. D: Appl. F. “SPM-Based Investigation of Site Specific Biological Interactions”. C. W. G. Phys. M. (2003).Saglik and D. Proceedings of the 2001 1st IEEE Conference on Nanotechnology 10. H. V. J C Wolfe and B P Craver. "Neutral particle lithography: a simple solution to charge-related artefacts în ion beam proximity printing". N. 82 (5): 808–810. Hong Kong. M. V. Lapshin (1998). 41 (2008) 024007 (12pp) 7. V. K. October. B. Ayres.5.M. H. R. Appl. 8. K. Taiwan. R. N. Wang. May.Gilgenbach. Davis et al. Salam. Hummert. Ning Xi “Micro/Nano Motion Control for Biological Specimen Handling”. 2003. Phys. Goolsby. Ayres. Lett. Salam.

........................ Bibliografie ........... polarization. în microscopia modernă prelevate odată cu informaţia topografică........................................Scanning Probe Microscopy Introducere........386 4.......................... Tehnici Experimentale .... în primul rând merită remarcată informaţia 3D reală a topologiei suprafeţei dublată de măsurarea unor mărimi fizice pe suprafaţă.....................................Scanning Probe Microscopy ...... de regulă.............378 2......... dr..........................Microscopia de forţă atomică – partea a II-a Conf................ Tabel 1....................... Bibliografie ....................................................................... Implementarea Noilor Tehnologii....385 3. Dintre acestea............... Tehnici Experimentale ................... Optical microscope Scanning electron microscope Electron scattering Transmission electron microscope Electron absorption Atomic force microscope Forces of probe-sample interaction 1Å-200 μm 0..................... Ioan Burda Cuprins 1....... O evaluare obiectivă a tehnicilor microscopice (Tabelul 1) pune în evidenţă elemente de performanţă favorabile pentru SPM (Scanning Probe Microscopy)............ scattering etc) or fluorescence 200nm – 1mm 500nm – 10 mm 1nm-10 mm 1Å-100μm What is studied Complicated sample preparation optical slice optional 10 nm-1 mm limited by ultratome (10 nm-1 μm) surface real thin slice necessary necessary surface optional 378 .......5Å-20 μm Mechanism of contrast formation Range in XY Range in Z Light absorption (diffraction.....393 1..

Rezoluţia sistemului este asigurată de sistemul de control (electronic. …). acest lucru nu este posibil datorită lipsei de rigiditate a acestora. respectiv apelarea la instrumente SPM complexe (izolare la vibraţii avansată.1. Consecinţa acestei situaţii se reflectă în performanţa finală a experimentelor în care apelăm la un SPM şi putem spune că în mare măsură performanţa este dependentă de iscusinţa experimentatorului. respectiv amplitudinea de oscilaţie sau fază. Fasciculul este poziţionat în centrul unui foto-detector cu patru cadrane (fotodiodă).Dacă ne referim la modul de preparare a probelor pentru SPM. Digital Anolog Converter DAC) cantilever şi sondă (tip). Merită să reţinem că detectorul este mecanic şi de asemenea. nu ne putem aştepta să vedem diferite domenii în moleculele de proteină. În condiţii experimentale adecvate. temperatură scăzută. Scaning Probe Microscope. ne obligă să apelăm la o preparare complexă a eşantioanelor. dar nu poate elimina limitările mecanice Figura 1. subsistem pentru (din construcţie). un fir de păr) este suficient de potrivit dacă nu are o rugozitate comparabilă cu capacitatea de deplasare a scanner-ului pe direcţia Z (perpendicular pe eşantion). să reţinem că acest detector mecanic este capabil să pună în evidenţă atomii.1) de un sistem opto-electronic bazat pe reflexia unui fascicul laser pe cantilever. Viteza de scanare depinde de caracteristicile mecanice ale scanner-ului şi tot de calităţile mecanice ale acestuia depinde şi aria maximă ce poate fi scanată. atunci cuvântul „optional” nu sugerează întotdeauna ceva facil. Tehnica experimentală la nivel de detecţie a interacţiunii dintre un tip (sondă) şi eşantion se bazează pe un cantilever. Performanţa sistemului de control şi achiziţie este esenţială în performanţa finală a SPM-ului. Mărimea specifică de interes într-o situaţie particulară este detectată (Figura 1. orice material (de exemplu. atmosferă controlată. Sistemul optic nu are alt rol decât de a măsura deflexia cantileverului. 379 . SPM-urile moderne pot pune în evidenţă un singur atom. La o extremă. Obţinerea unor imagini unice în conţinut si performanţă. nici limitădetectia inneractiuni sonda (tip) si esantion. nu de puţine ori. Aşa că. mari schimbări de conformaţie (myosin) sau forme spiralate ale moleculelor DNA. dar în cazul unor eşantioane biologice (molecule).

după cum rezultă din Tabelul 1. cu o mai Figura 1. Proteine (Seleno Protein. interacţiunile respective latice MoTe2. cum ar fi: AFM plus microscopie laser confocală. performanţa unei tehnici experimentale sau a unui echipament modern este complet definită de imaginea obţinută pentru un eşantion dat. DNA (sus). o imagine mai bună este echivalentă cu mai multă informaţie. reconstrucţia 3D şi nanomanipularea. imagini SNOM. Virus Ebola. imaginea celulelor. Informaţiile care se pot obţine pe diferite sisteme de studiu cu ajutorul unui SPM. în general. sau imagine şi spectroscopie Raman. respectiv imagine 3D. Treponema Pallidum (Tp) antigens).3. acestea fiind parte din limitele fizice ale unui SPM. SPM poate include în platforma sa tehnici optice în special în cazul AFM. moleculare.2.rile induse de proprietăţile materialelor folosite la construcţia SPM-ului. 380 . Tocmai de aceea. Această situaţie este produsul unei lungi evoluţii a tehnologiilor de laborator şi asigură maximul de informaţie posibil în acest moment. Latice HPOG (stanga) grafia moleculară. Tehnologia experimentală actuală se bazează masiv pe conceptul de imagine. nu pot fi considerate complementare cu alte tehnici experimentale. Helicobacter Pilory). Specific şi unic în cazul SPM este capacitatea acestuia de a pune în evidenţă topoFigura 1. Bacterii (Anabaena Variabils.

2 se poate vedea la rezoluţie atomică o latice de MoTe2.3). cu un mai bun raport semnal zgomot. într-o poziţie dată (x. Interacţiunea dintre sondă (tip) şi eşantion. În acest sens.3). De asemenea.4. De mare interes sunt imaginile ce pot fi obţinute pe eşantioane biologice. adesiune intre sonda si suprafta esantionului. capacitatea de nanomanipulare simultană a acestor eşantioane asigură premisele unui nano laborator într-un singur echipament. În Figura 1.bună calitate. Nu exista adesiune (jos). este exploatată şi în spectroscopia locală de distanţă. Într-o măsurătoare locală. În acest sens. După cum se poate vedea în Figura 1. SPM-ul a fost primul echipament (STM) care a pus în evidenţă atomii şi acest lucru este posibil fără echipamente complexe pe eşantioane cu rugozitate scăzută (monostrat atomic). b) între sondă şi suprafaţa Figura 1.y). respectiv HOPG. este pusă în evidenţă o adeziune. Lărgirea platformei cu elemente specifice microscopiei optice. eşantionului. prin imagini. 381 . exemple cu ceea ce poate „vedea” un SPM (Figura 1. adică toate mărimile fizice istorice se regăsesc în final în calitatea imaginii. este uşor de pus în evidenţă curba forţă– distanţă atunci când o legătură specifică apare. sunt prezentate în continuare.4. SNOM şi spectroscopiei Raman întregeşte această tehnică modernă. două situaţii distincte pot fi observate în interacţiunea dintre sondă (tip) şi eşantionul studiat: a) nu există o adeziune la suprafaţa eşantionului. dat fiind interesul crescut pentru biologie şi biotehnologii. baza funcţionării SPM-ului. cu o mai bună liniaritate în sistemul de măsură. SPM are un rol bine definit prin capacitatea sa unică de a putea asigura o rezoluţie ridicată pentru eşantioane superficial pregătite (Figura 1.

S-a dovedit că receptori independenţi pot fi recunoscuţi de un vârf AFM funcţionalizat cu anticorpi. depind în mod esenţial de experienţa utilizatorului. tehnica funcţionalizării cu anumite biomolecule (proteine. Sistemul NTegra produs de NT-MDT Inc. Tehnica sondă-ligant şi analiza unei situaţii particulare prin intermediul curbelor locale forţă – distanţă sunt de mare folos în diferite experimente de recunoaştere a proteinelor. acizi nucleici) a unui vârf AFM a deschis o cale promiţătoare pentru recunoaşterea unor molecule particulare. cum sunt receptorii. numai pe baza acestor informaţii topografice. plecând de la tăria adeziunii pentru o situaţie dată. Discriminarea unor receptori pe suprafaţa unei perspectiva utilizării acescelule. În general. printr-o tehnică de cartare a forţei. În Figura 1. proteoglicani. în final. sonda funcţionalizată (molecula ligant) interacţionează cu un eşantion biologic special preparat.5. Progresele recente privind rezoluţia spaţială a tehnologiei AFM au făcut din obţinerea unor imagini topografice a unei singure proteine o operaţiune de rutină. avem câteva reguli generale. tuia. Toate aceste rezultate au fost obţinute prin observarea unor probe corespunzător preparate pe suprafeţe substrat şi nu în condiţii fiziologice. are multe elemente particulare care.5 este reprezentat schematic un astfel de experiment care printr-o tehnică specifică permite discriminarea unor receptori pe suprafaţa unei celule. Deoarece interacţiunea dintre liganzi şi receptori este foarte specifică.Bazat pe observaţia anterioară. se poate imagina un sistem de recunoaştere moleculară. cum ar fi: a) celula este un sistem prea labil pentru a putea observa o singură proteină pe suprafaţa ei. b) acest lucru este dificil şi în cazul unei topologii moleculare. glicani. Platforma Integrată pentru Nanotehnologii combină toate tehnologiile cunoscute în Scanning Probe Microscopy (SPM) într-un singur produs. fiecare experiment în care este implicat SPM – ul. generând astfel un nou şi performant echipament în acest domeniu. Cu toate acestea. din Figura 1. este cel mai recent echipament şi singurul 382 . Sunt încă dificil de recunoscut proteine specifice.

383 . măsurarea caracteristicilor probei şi generarea automată de rapoarte. un sistem SPM şi un controler de temperatură pentru măsurarea probelor biologice în aer sau lichid (inclusiv în mediul de cultură. Subsitem scanner integrat le (scratching. current).click). Sistemul NTegra se prezintă utilizatorului ca fiind o soluţie completă pentru cercetare. Nu în ultimul rând.6) a fost special proiectat pentru a permite înglobarea unor tehnici de analiză ştiinţifică (spectroscopie si/sau prepararea probelor) pe lângă cele specifice SPM. Aproape toate setările sistemului sunt controlate de programul NOVA. Programul de aplicaţie înglobează lunga experienţă NT-MDT Inc. in microscopul optic.pe plan mondial care poate fi încadrat în conceptul de NanoLaborator. trebuie menţionate metodele avansate de litografie disponibiFigura 1. Sitemul nând simplitatea utilizării cu facilităţile oferite. inclusiv procesarea de imagine 3D. În acest moment. pentru litografie. cu posibilitatea schimbării acestuia pe durata măsurătorilor). Ntegra. Laboratorul de Nanotehnologii Fizice are în dotare un sistem NTegra Vita care integrează două microscoape optice performante.6. care înseamnă perfect. Acest concept este sugerat şi prin numele echipamentului format din grupul de litere cheie NT care sunt prescurtarea de la NanoTechnology şi un al doilea grup de litere cheie care sunt prescurtarea de la intEGRA. astfel încât. Rezultatul acestui concept permite reconfigurarea sistemului pentru orice aplicaţie particulară (Figura 1. Programul NOVA (NT-MDT) controlează întreaga platformă. acesta este uşor de înţeles şi utilizat. de la achiziţia de imagine la arhivarea acesteia. chiar dacă sistemul este foarte complex.7. doar prin program (mouse . îmbiFigura 1. în producerea de echipamente şi programe pentru nanotehnologii.Vita. industrie şi nanotehnologie. Sistemul NTegra (Figura 1. Toate sistemele integrate în platforma NTegra utilizează acelaşi suport electronic şi acelaşi program.7).

Tabel 2 SPM methods in air and liquid AFM(contact. sau între experimente. Force Modulation. Phase Imaging. diverse tipuri de încălzitoare pentru lichid şi măsurarea probelor biologice cu schimbarea lichidului cu flux controlat pe parcursul experimentului. Lithography: AFM (current). facilităţi de generare automată de imagini sau mai mult. prin Vbscript. <= +/. Scanning Capacitance Microscopy. controlul temperaturii pentru lichide. LFM (Lateral Force Microscopy). În acest fel. Kelvin Probe Microscopy. Metodele de bază SPM. Ntegra Vita are facilitaţi de excepţie pentru investigarea de probe biologice cum ar fi: incinte închise/deschise stabile chimic care pot opera cu discuri Petri. procesare imagine şi generare de rapoarte. semi-contact. programul poate fi extins pentru orice aplicaţie utilizator fără a fi nevoie de cunoştinţe de programare avansată. STM by sample Φ 40 mm.01 ˚ C in air only Sample size in air in liquid Scan Range Temperature control (for operation in fluid environment ) Range Stability O pagină help bine documentată cu descrierea funcţiilor de bază şi câteva exemple de utilizare asigură accesul utilizatorului la semnale de bază din sistem. AFI(Adhesion Force Imaging). utilizăm intensiv facilitatea open software a programului NOVA care permite.programul NOVA are aplicaţii.0. pot fi preluate imagini „gray level” şi transpuse pe suprafaţa de investigat.0. AFM Lithography (scratching). cât şi unele performanţe ale sistemului NTegra Vita sunt enumerate in Tabelul 2. 15 mm in height by probe by sample up to 14x14x2. Forces-Distance Curves STM/MFM (Magnetic Force Microscopy).5 mm and by probe up to 15x15x3 mm 100x100x10 μm up to 200x200x20 μm in DualScan mode from RT to 60˚ C +/. realizarea unor extensii sau automatizarea unor secvenţe de genul măsurare. În proiectele noastre. 15 mm in height and Φ 100mm .005˚ C (typically). 384 . Spreading Resistance Imaging. Electrostatic Force Microscopy. non-contact).

present. 237-245. 1173-1175. 451. 2005. Stephens BJ. Wang Y. Nature. 19. Ann NY Acad Sci. 2007. Recent progress in AFM molecular recognition studies. 456. 2008. Zhang Y. New Jersey. Polak JM. Hu Q. Third-generation biomedical materials. Zumbusch A. Goodsell DS. Puchner EM. J Mater Chem. Positioning scission of single DNA molecules with nonspecific endonuclease based on nanomanipulation. 1995. Drexler KE. Stark RW. Peng L. Li X. 6. Polak JM. Nanodissection. Stem cells and tissue engineering: past. Nanomanipulation of single DNA molecules and its applications. Bibliografie 1. Yan SH. 7. Hoboken. Mavroidis C. 594-596. Bionanotechnology: lessons from nature. Binding strength between cell adhesion proteoglycans measured by atomic force microscopy. 23. Science. Surf Interface Anal. 1010-1013. Ann Rev Biophys Biomol Struct. 13. Science. 2004. and differentiation of bone marrow mesenchymal stem cells. Gao HB. Inc. Microsc Res Tech. 4690-4698. Cubicciotti R. 18. 8. 2007. Li H. 127-138. Gaub HE. 998-1004. Single-molecule cut-and-paste surface assembly. Zhou C. Golden handshake. Rubio-Sierra FJ. proliferation.Eur J Physiol. 36. 15. IEEE Robot Autom Mag. Li Z. Hu J. Seitz M. 1998. 539-544. Wei G. Maye MM. 295. 2005. 2006. and lithography using modified tapping mode atomic force microscope. 1068. Crocker JC. 372-381. Zhang Y. Revyakin A. 2006. Ebright RH. Liedl T. 2008. Manipulation. 3. Hu J. 6668-6669. Liu Z. van der Lelie D. and future. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Xu X.two key technologies in nanoscience and templating. Seeman NC. Li M. Wiley-Liss. A combined atomic force/fluorescence microscopy technique to select apatamers in a single cycle from a small pool of random oligonucleotides. 4. Gang O. 11. Science. Design and self-assembly of two-dimensional DNA crystals. Li MQ. Nature. 17. Molecular self-assembly and nanomanipulation . 7. 451. 12. 2. Gumpp H. Tang R. 13. Cai Y. 14. Bishop AE. 16. 1014-1017. 2007. Guntherodt HJ. Tan Z.. Zhang M. 20. 1994. Wenzler LA. 394. Ferreira A. 38. 267. Nanomanipulation by atomic force microscopy. Heckl WM. 534-540. Tao J. 549-552. 129. Brauchle C. 352–366. Kufer SK. Heckl WM. isolation. Anselmetti D. Li MQ. 10. Li B. Adv Eng Mater. Wagner P. Strick TR. Wang L. Lu J. 6. 377-405. Surf Interface Anal. Bonin K. Hartmann U. Zhang Y. 21. Molecular nanomachines: physical principles and implementation strategies. 2006. 2004. An H. Nykypanchuk D. Nature. DNA-guided crystallization of colloidal nanoparticles. 2004. Popescu O. 843-847. Hards A. 528-529. 2008. 17. 6. Dammer U. Simultaneous AFM manipulation and fluorescence imaging of single DNA strands. 193-196. Virtual reality and haptics for nanorobotics. 124-126. Dufrene YF. 2002. 69. and PCR amplification of single DNA molecules. 2006. Hinterdorfer P. Song Y. Winfree E. Microsc Res Tech. Sun L. 319. Pan H. Misevic GN. Effect of crystallinity of calcium phosphate nanoparticles on adhesion. Liu Y. Nat Methods. Lu JH.2. 5. Guthold M. 385 . Pflugers Arch . 2008. 9. Adv Eng Mater. dissection. 78-92. Ye M. Li B. J Am Chem Soc. 70. Liu F. 2. Chem Phys Chem. Hench LL. 2005. Hu J.

unde prin haptic înţelegem ştiinţa pipăitului. În viitorul apropiat. Aceste maşini sunt denumite interfeţe haptice.3. Implementarea Noilor Tehnologii Introducere. Mişcarea naturală a capului sau mâinilor poate fi utilizată pentru a investiga şi modifica suprafaţa care este afişata la scala cercetătorului. simţim lucruri interesante cu ajutorul mâinilor. Dezvoltarea unor interfeţe şi dispozitive haptice moderne necesită studii extensive pentru a înţelege legătura dintre fenomenele perceptuale şi măsurătorile biologice. privim comportamentul lucrurilor care se mişcă sau se schimbă. Motivare. Interfaţa ideală dintre om şi SPM trebuie să prezinte utilizatorului suprafaţa investigată ca o reprezentare 3D mărită pe care să o poată pipăi şi care să poată fi modificată cu ajutorul unor unelte controlate de mână. acestea au generat o adevărata competiţie în încercarea de a dezvolta o interfaţă haptică naturală. privim în jurul nostru. noi vom avea mult de învăţat despre lumea la scală 386 . urmată de încorporarea acestor cunoştinţe în ingineria interfeţelor haptice. Sistemul de control va translata mişcarea uneltei în mişcarea sondei SPM-ului şi va translata parametrii măsuraţi ai suprafeţei sub forma unei forţe aplicate uneltei simultan cu informaţii vizuale şi/sau audio despre parametrii suprafeţei. intuitive şi a unui feedback senzorial multi-modal a determinat proiectarea unor maşini care asigură utilizatorului generarea unor comenzi prin mişcarea mâinilor. spre deosebire de alte modalităţi de interacţiune: percepţia vizuală. cercetătorul percepe că poate interacţiona direct cu suprafaţa de investigat. Aceste dispozitive bazate pe interfaţa haptica prezintă o mare oportunitate în dezvoltarea unor aplicaţii generic asistative care să permită manipularea nano-obiectelor precum şi imersia totală în realitatea virtuală a utilizatorului. pentru a crea acestuia o percepţie naturală. Această metodă va asigura cercetătorului posibilitatea de a se concentra pe investigarea suprafeţei şi proprietarilor asociate şi nu asupra programării unei interfeţe. O problemă majoră legată de sistemul tactil uman constă în faptul că nu este foarte bine cunoscut. vorbirea sau sistemul motor. Deoarece cercetările iniţiale au fost promiţătoare. privim către lucruri din diverse unghiuri. Nevoia unei interacţiuni om-maşină naturale. utilizatorul primeşte informaţii despre forţe sau coliziuni ale mâinilor sale. biomecanicii şi elemente neurologice ale percepţiei haptice. putem lua lucrurile pentru a le rearanja şi putem interacţiona cu acestea pentru a vedea răspunsul lor. Studiul abilitaţilor tactile umane este o încercare recentă şi multe din sistemele disponibile astăzi nu incorporează cunoştinţe din domeniile psihofizicii. Când noi suntem prezenţi undeva. În acelaşi timp. Când este utilizat un astfel de sistem.

Figura 3. transportul de sarcină şi dinamica acestor proprietăţi sunt afectate de structura la scală atomică a nano-obiectelor. oferind cercetătorului posibilitatea de a fi virtual în dimensiune nano. Interfaţa SPIDAR. Nanomanipularea dă o semnificaţie aparte acestor probleme.1) cu feedback de forţă împreună cu controller-ul şi o reţea de calculatoare PC cu facilităţi grafice avansate. oferindu-ne posibilitatea de a investiga individual nano-obiecte cu facilitaţi de excepţie obţinute prin combinarea caracteristicilor unor proprietăţi fizice cu informaţiile structurale. Acest cluster local format din cel puţin trei calculatoare comunică printr-o reţea IP. inclusiv despre modul cum proprietăţile mecanice. Nanomanipulatorul este obţinut prin integrarea unui microscop de scanare a probei împreună cu controller-ul. precum şi legat de interfaţa cu obiectele la scală nano. Scopul unei interfeţe SPIDAR este de a asigura cercetătorului imersia virtuală în lumea la scală nano. Interfaţa utilizator avansată va juca un rol crucial prin modul transparent de a experimenta la scală nano.nano. Figura 3. Sistemul de Nanomanipulare.1. precum şi un control natural al funcţiilor acestuia. Beneficiile unei asemenea tehnologii sunt: 387 . un dispozitiv SPIDAR (Space Interface Devices for Artificial Reality. Semnificaţia interfeţei de realitate virtuală a SPM-ului este aceea de a simula prezenţa cercetătorului pe suprafaţa de investigat. Prin combinarea unui SPM cu o interfaţă de realitate virtuală asigurăm o afişare intuitivă a datelor produse de instrument.

În acest caz. Pentru vizualizarea ştiinţifică. Microscopul de scanare a probei (SPM) este un instrument extrem de rafinat pentru explorarea şi manipularea la scală nanometrică. Interfaţa SPIDAR. Figura 3. forţe laterale şi de adeziune (AFM). Câţiva dintre aceşti parametri sunt reprezentaţi natural pe canalele vizuale ca informaţie de culoare sau înălţime. Pe lângă datele despre topografia suprafeţei. este util să afişăm aceşti parametri într-un spaţiu virtual. într-un mod nerealist. Acestea includ măsurători de conductanţă şi măsurarea de curbe curent/distanţă (STM). dar într-o manieră utilă. dar această afişare nu permite cercetătorului să vadă corelarea dintre aceste informaţii şi topografia suprafeţei. urmat de un feedback al parametrilor pe durata modificărilor şi utilizând pseudo-culori sau imagini ale liniilor. utilitatea unei tehnici este mult mai importantă decât realismul. proprietăţi magnetice (MFM – magnetic force microscopy). 388 . transmisia laser a diverse lungimi de undă şi polarizări (NFOM – near field optical microscopy). Multe experimente au fost realizate prin controlul preprogramat sau în buclă deschisă a probei SPM-ului. pe măsura ce se colectează datele.a) îmbunătăţirea percepţiei structurilor 3D. SPM-ul poate colecta multe alte date despre parametrii fizici specifici eşantionului. temperatură sau alţi parametri fizici. b) explorarea efectivă a suprafeţei de investigat. c) abilitatea de a observa procese dinamice aproape în timp real d) şi posibilitatea de a modifica interactiv suprafaţa.1.

Se poate asigura interacţiunea în timp real cu parametrii de vizualizare cum ar fi direcţia iluminării. O procesare de imagine 3D utilizează un mixaj de imagini într-un head-mounted display (HMD). Utilizând procesarea de imagine 3D. Au fost studiate şi dezvoltate câteva moduri de vizualizare a unor seturi de date. O afişare naturală a unui set de date 3D este posibilă prin iluminarea direcţionată a suprafeţei. Figura 3. pe măsură ce datele sunt achiziţionate de SPM. unghiul de vizualizare şi scalarea. A fost revăzută problema relativ simplă a rendering-ului 3D pentru o suprafaţă. a feedback-ului de forţă. În această etapă tehnologică. pe timpul unor situaţii complexe. prin combinarea unui rendering grafic computerizat cu elementele ascunse. prin interfaţa haptică. efectiv o vedere cu raze X utilizatorului. ca un exemplu a consideraţiilor implicate.2. tehnologie bine cunoscută în câteva aplicaţii de avionică. Într-un caz simplu. Implementarea unei componente de vedere cu raze X la programul nanomanipulatorului SPM. Interfaţa SPIDAR in timpul unei operaţii de nano-manipulare. acest concept este foarte elegant în simplitatea sa şi foarte util pentru o unitate de nanomanipulare. setul de date pentru o abordare prin interfaţa SPIDAR este de fapt topografia suprafeţei (Figura 3. Acest concept generează noi aplicaţii în nanomanipulare şi asigură. 389 .Sistemul Multimodal.2). introduce conceptul de realitate îmbunătăţită. este acum posibil să creăm un rendering în timp real al suprafeţei.

Conceptual. să le facă neobservabile. cum ar fi controlul unghiului de vizualizare a suprafeţei. Asigurând afişarea stereoscopică şi nu cea monoscopică. Această abilitate 390 . pe perioada modificărilor suprafeţei. un feedback de forţă asigură un control intuitiv al probei şi permite sesizarea contururilor de pe suprafaţă. de regulă o vedere prin pseudo-culoare este superioară unei vizualizări 3D prin umbre. acest sistem este echivalent cu un sistem tele-robotic care operează între două scale foarte diferite. o suprafaţă plată are un mare conţinut de zgomot şi acesta este exprimat ca o fracţie.Vizualizarea 3D nu este întotdeauna cea mai bună soluţie pentru suprafeţe cu mici denivelări. De asemenea. grafica 3D bazată pe umbre cu hărţi de culoare iluminate puternic. Pentru imaginile SPM. micile caracteristici de pe suprafaţă conţinute în alte mari variaţii sunt mai bine puse în evidenţă prin utilizarea unei hărţi de culoare şi iluminarea puternică a suprafeţei 3D (acestea ar fi imperceptibile într-o reprezentare 2D). Noi utilizăm o interfaţă haptică cu feedback de forţă care sesizează poziţia 3D a o-ring-ului SPIDAR (cu capabilităţi adiţionale pentru a sesiza 3DOF – grade de libertate) şi aplică forţele de la nivel nano adecvat scalate în mâna utilizatorului. De asemenea. de asemenea. Pentru caracteristicile care sunt semnificative numai prin diferenţa mare de înălţime faţă de suprafaţa imaginii. imaginile pseudo-colorate au dedicat întreg domeniul de intensităţi pentru a evidenţia aceste diferenţe. pentru cercetător este mai uşor să perceapă adâncimea obiectelor virtuale apropiate. Este neaşteptat să ne imaginăm că putem acum oferi posibilitatea cercetătorului nu numai de a vedea nano suprafeţe cu ajutorul SPM. spre deosebire de sistemele tele-robot utilizate în chirurgie. Poziţia o-ring-ului în spaţiu poate controla diferite caracteristici afişate. Percepţia spaţială 3D a datelor SPM cu acurateţe face posibilă pentru cercetător utilizarea cunoştinţelor sale ştiinţifice la recunoaşterea unor structuri şi caracteristici de interes. Acest zgomot va determina o fluctuaţie a iluminării caracteristicilor cu aceeaşi magnitudine. Această tehnologie poate lucra bine pentru imagini lipsite de zgomot. din păcate. dar să şi acţioneze asupra lor şi să le atingă. Abilitatea cercetătorului de a recunoaşte structuri moleculare specifice în prezenţa zgomotului este îmbunătăţită prin vedere stereoscopică. dar imaginile din lumea reală conţin întotdeauna zgomot. utilizând numai o lumină ambientală cu intensitatea funcţie de înălţime. Acest lucru este adevărat din două considerente: pseudo-colorarea dedică întreg domeniul de intensitate adâncimii şi sunt. Folosirea umbrelor este echivalentă cu desenarea suprafeţei. netezite micile fluctuaţii cauzate de zgomotul conţinut în imaginea suprafeţei. uneori reuşind. din caracteristicile imaginii.

În al doilea rând. incluzând topografia suprafeţei şi canalele externe. numai dacă privim un obiect. Mai mult. Studiile efectuate pe persoane nevăzătoare arată că au abilitaţi eficiente în câteva activităţi spaţiale.asigură controlul precis al suprafeţei şi deschide calea unor noi experimente. 391 . În final. sistemul de nanomanipulare înregistrează toate datele. corelarea dintre văz . Cu toate acestea. O abilitate deosebită a oamenilor este aceea de a dezvolta capabilităţi de coordonare intermodală şi de procesare a modelelor. în special în discriminarea texturilor. cum ar fi conductanţa cu secvenţa de timp pe care o numim fişier stream. recunoaşterea obiectelor şi descrierea acestora. persoanele nevăzătoare construiesc modele intercorelate între canalul auditiv şi cel haptic. fedback-ul de forţă asigură utilizatorului posibilitatea de a localiza obiecte şi caracteristici ale suprafeţei. Utilizatorului ii este extrem de util să revadă experimentul pentru a vedea ce decizii a luat pe parcursul desfăşurării acestuia (analiza post-expriment).3) este extrem de importantă în activităţile zilnice cum ar fi conducerea maşinilor. inclusiv corelarea cu proprietăţile măsurate cu o up-datare a imaginilor structurii. simţind când proba SPM se apropie de punctul de la care sunt posibile modificările. navigaţia şi aşa mai departe. noi putem face o predicţie despre caracteristicile lui tactile cu o acurateţe rezonabilă. găsirea traseului pentru modificare şi asigurarea unei atingeri fine care să permită începerea unui ciclu experimental în secvenţa scanare-modificare-scanare. Vederea asigură fiecăruia abilitatea de a plănui şi executa activităţi spaţiale (zonă cunoscută ca fiind kinesferă). Feedback-ul de forţă este esenţial în găsirea structurilor ce urmează a fi modificate. Un sistem automat cu abilitatea de a face o predicţie despre cum simţim obiectele de tipul celor reprezentate prin valori ale pixelilor are multiple aplicaţii în generarea automată a datelor haptice. Percepţia Multimodală şi Intermodală. Un astfel de sistem poate fi de exemplu unul care construieşte nano-blocuri şi un dispozitiv care asistă cercetătorul şi asigură generarea de date haptice despre nano-mediul apropiat. iar cercetările psihologice au arătat că aceste modele nu sunt adaptate pentru percepţia de stimuli la distanţă. descrierea formelor. aşa cum avem în cazul văzului. o limitare majoră a percepţiei tactile este dată de dimensiunea kinesferei. Acest fişier poate fi redat mai târziu pentru a revedea întregul experiment. De exemplu. auz şi senzaţiile tactile determină redundanta în reprezentarea spaţială care asigură fiecăruia dintre noi utilizarea transferului intermodal şi coordonarea mecanică pentru activităţile spaţiale. Abilitatea de a sesiza şi percepe obiecte dincolo de zona accesibilă (Figura 3. discriminarea formelor. în descrierea acestora. De asemenea.

Odată ce un obiect a fost capturat vizual. Gesturile utilizate de cercetător pentru a percepe caracteristicile unui nano-obiect au o structură logică şi asigură înţelegerea caracteristicilor unui nano-obiect. dimensiunea. Feedback-ul de forţă capturează procese din SPM şi acest lucru este denumit în literatura „explorare haptică a nano-obiectelor”. în faza de antrenament. textura şi materialul nano-obiectului haptic. greutatea. Interfata SPIDAR in timpul unei operatii de recunoastere haptica a unei structuri create anterior prin nano-manipulare. Captura vizuală SPM poate fi ajutată prin stocarea profilului haptic sau de atingere al unui obiect sub forma miscărilor mâinii. Aceste structuri de date care stochează atât caracteristicile vizuale cât şi pe cele haptice ale obiectului sunt baza dezvoltării unor cartografieri automate dintre diferite caracteristici vizuale şi haptice. utilizată de cercetător pentru a percepe un nano-obiect.3. Nevoia de noi experimente şi dezvoltarea de algoritmi care pot îmbunătăţi percepţia în lumea de scală nano prin stimulare în timp real vizual. Modelele computaţionale sunt dezvoltate la nivelul tehnologic actual ca şi prototipuri vizual-haptice. Aceste modele computaţionale sunt dezvoltate pe baza modelelor neuropsihologice şi cognitiv psihologice ale analizei caracteristicilor vizual-haptice. Explorarea haptică a nano-obiectelor se referă în esenţă la mişcarea mâinii. Aceste prototipuri stocate într-o bază de obiecte haptice împreună cu strategiile de explorare haptic 392 . audio şi haptic este un domeniu fascinant de cercetare. utilizatorul urmează să categorisească perceptual forma.Figura 3.

. pp. Sled-Type Motion on the Nanometer Scale: Determination of Dissipation and Cohesive Energies of C60. S. Howald. P. Paulson. Koel. Academic Press.703 (01 Sep 2005). E. 8. 4. 1998. Clary. Natalia Conde e Silva. 1979 .. and Enge Wang. Maria Barbi. Dieter Neher. and Superfine. A. Vincent Croquette. Science 18 April 2003 300: 472-474. Burkhard Stiller. Nature Methods 2. Jean-Louis Viovy.. Baur. Microsc. F. W. fiind suportul oferit de tehnologia actuală pentru viitoare aplicaţii în nano-robotică. Roberts. R. Science 266 (December 23). 9. Christophe Lavelle. Jean-Marc Victor. Bugacov. Julien Mozziconacci. H.1981. and Superfine.. Helser. Luthi. 444 . E. Requicha. Taylorr II. and Guntherodt. BIOCHEMISTRY: RNA Polymerase. Xin Jiang. Jean-François Allemand. M.. 3.. Ludwig Brehmer. M. Aurélien Bancaud.. A. 2. L... Gaudeline Wagner.. Washburn.. Nanomanipulation experiments exploring frictional and mechanical properties of carbon nanotubes. Nature Structural & Molecular Biology 13. Nature Materials 4.. Taylor II. J.. Richard H Ebright. Gutmannsbauer.138 (01 Feb 2005). R.450 (01 May 2006). S. C.. Meyer. 1999. Madhukar. B.dimensional structures of nanoparticles using scanning force microscopy. 393 . 5. Falvo. 271-308. Andrey Revyakin. G.. Ullrich Pietsch.. A. H. Brooks Jr. A. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Tubular Graphite Cones. 4.. 504-512. 7. V. Building and manipulating three-dimensional and linked two. G. a Scrunching Machine. H. Terence R Strick. Jeffrey W. R. R. 4. 1998. Microanal.. S.. A. Structural plasticity of single chromatin fibers revealed by torsional manipulation.. S. 127 . Resch. 6. Ariel Prunell. Nalwa.. From anisotropic photo-fluidity towards nanomanipulation in the optical near-field.. Haefke. 699 . New York. M.. Science 17 November 2006 314: 1097-1098. in Handbook of Nanostructured Materials and Nanotechnology. Michael Giersig.. 66136616. R. 1994. R. Burkhard Schulz. Guangyu Zhang. Advanced Interfaces to Scanning Probe Microscopes.asigură baza de date pentru nano-spaţiu. Bibliografie 1. P. Peter Karageorgiev. and Will. Langmuir 14 (23). Chi.

......... Generarea fotonilor de raze X ...................... Analizorul de energie emisferic de tip PHOIBOS ..............3.............. Flood-Gun 15/40 ...................................... 397 2........ 415 1............................... 416 2.......... Informaţii generale .........................5............................ Spectrele UPS şi energia de rezoluţie ................................. 417 2.............2.............................. 398 3......... Detector Multicanal MCD ................................Concepte de bază ..... 422 3................ 421 2.....................................2..............2.......................... Caracteristici generale ...... Mecanismul de tăiere a orbitei .. Analiza de suprafaţă .................2....... Principiu de funcţionare......................................III... 412 1....... Răcirea cu apă .................................................. dr........................2.........1................................ Multiplicarea Electronică ...............................1...........................1. 402 1.............. Analizorul Emisferic (HSA) ................................5..3......................................................................................2................ 395 2.....1............1...................................................2.................. Descrierea Analizorului ... 410 1.....................2................ 401 1.....................................2..... Componente ............XI.. Maria Teodora Radu Cuprins I..............2....2..... Caracteristici generale ......................2.............. Modul de focalizare....... Monocromatorul ..............2.......... 402 1....................... Sistemul de lentile .............. Izolarea Magnetică ......... Spectroscopia fotoelectronică de raze X ... 422 3................................... SPECTROMETRUL DE FOTOELECTRONI DE RAZE X (XPS) ŞI ULTRAVIOLETE (UPS) Spectroscopia fotoelectronică C.........................1................... Sursa de raze X pentru FOCUS 500 (XR50 M) ........................5.......................... 400 II.... Design-ul şi principiul de funcţionare al spectrometrului de electroni ....................2....................... 396 2.............. Principiile Detecţiei .............................. 405 1. Informaţii generale în legătură cu sursa XR 50 M ............................................... 416 2.............. 422 3..S.......... 402 1......... 412 1.....3..... 414 1....4..................................................2..............5............... 417 2.................................. 414 1.................1......................................... 395 1............................................................................................... Bibliografie ................. 417 2................2............................... 423 394 ............................................................................. Coerenţa între şi pas .......3.........................2......................1...... Spectroscopia fotoelectronică cu radiaţie UV (UPS) .........................2........ 415 2... 422 4............1.........1........................2........................................................................................3................2............. Descrierea sursei .......... 421 2..............................................

Principiul fundamental al procesului de fotoemisie este prezentat schematic în fig. solidelor şi suprafeţelor [1-2]. În principiu se poate face distincţie între fotoemisia cu radiaţie în ultraviolet (UPS) utilizată în principal pentru investigaţii ale stărilor din benzile de valentă şi spectroscopia de fotoemisie cu raze X (XPS) care permite identificarea atomilor la suprafaţa solidelor şi determinarea deplasărilor în energiile de legătură ale core-level-urilor care sunt legate de diferite moduri de legături chimice.23 eV si He II: 40. de ex. folosirea unui monocromator suplimentar poate fi un avantaj atât pentru energia de rezoluţie cât mai ales pentru suprimarea background-ului şi a intensităţilor sateliţilor care pot să apară în spectru.82 eV) şi liniile ceraracteristice ale unei surse de raze X care utilizează de obicei ca materiale pentru anod aluminiul (Al .6 eV). Mai mult.V. Electronii cu energia de legătura EB pot fi excitaţi deasupra nivelului E de către fotoni cu energia hν > EB + Φ0. are pe scară largă implicaţii practice în diferite domenii ca de exemplu fizica şi chimia suprafeţelor sau ştiinţa materialelor. la energii de legătură mai mari.I. câţiva meV pentru lampa de descărcare şi aprox.1 Această figură simplificată arată atractivitatea spectroscopiei de fotoemisie. pentru că proprietăţile fotoelectronilor emişi reflectă în principal stările electronice proprii ale sistemului investigat.2: 1486. 1 eV pentru anozii sursei de raze X. cu gaze rare ca heliu (He I: 21. Deşi lărgimea liniei este de obicei suficient de mică pentru multe aplicaţii. În general. suprapunerea dintre rezultatele experimentele de spectroscopie de fotoemisie şi teorie este necesară pentru investigarea a numeroase proprietăţi a stării solide. Analiza de suprafaţă Spectroscopia fotoelectronică a fost stabilită ca una din cele mai importante metode de studiu a structurii electronice a moleculelor. Concepte de bază 1.2:1253. inclusiv dispersia benzii de valenţă magnetismul 395 . Distribuţia fotoelectronilor I(Ekin) poate fi măsurată de analizor şi reprezintă în prima aproximaţie o imagine a densităţii stărilor electronice ocupate N(EB) în proba analizată. Această separare se bazează în principal pe cele două tipuri diferite de sursă de excitare cvazi-monocromatică disponibile în laboratoarele de cercetare şi anume: spectrul liniei UV a lampei de descărcare pentru energii în domeniul de aproximativ 10-50 e.Kα1. şi a contribuit semnificativ la înţelegerea principiilor fundamentale din fizica corpului solid [1-5].6 eV) sau magneziul (Mg Kα1.

În prezent. furnizând informaţii despre dispersia fononilor în solide. aproape la fel ca difracţia de neutroni. Spectroscopia fotoelectronică cu radiaţie UV (UPS) Această tehnică este folosită pentru a studia nivelele de energie din banda de valenţă şi legăturile chimice corespunzătoare. Metoda a fost dezvoltată iniţial în 1962 de David W. De asemenea. gap-ul supraconductor al unui supraconductor conven396 . Investigarea experimentală a acestor proprietăţi necesită o energie de rezoluţie de ordinul meV. 2.Figura 1.d. tehnic în domeniul spectrometrelor de înaltă rezoluţie. Prezentare schematică a procesului de fotoemisie în modelul uni-particulă.v. trebuie menţionate câteva exemple pentru caracteristici “many-body” ce pot fi puse în evidenţă pe scala meV în spectrele de fotoemisie UPS a sistemelor solide: (111) stări de suprafaţă de tip Shockley pentru Cu(1 1 1) [7-8].p. UPS joacă un rol important în obţinerea structurii benzii de valenţă a unui număr mare de solide şi suprafeţe. şi suprafaţa Fermi. în cazul chemosorbţiei metoda ne permite studierea nivelelor electronice de energie derivate din orbitali moleculari ai sistemului substrat absorbit. Turner pentru studierea moleculelor în faza gazoasă[6] şi ulterior dezvoltată până la nivelul actual. în ultimii ani s-au efectuat îmbunătăţiri remarcabile d. Mai mult. În acest context.

ţional (V3Si). Ω. dc .diametrul capilarului (1. unde (1) Φ. [9] şi rezonanţă Kondo în sistemele cu fermioni grei. d . 2. În prima aproximaţie unghiul solid rezultă din zona iluminată a probei şi distanţa dintre capilar şi probă: Ω= π + r2 d2 (2 ) (3 ) R= d (1 − 2d*cr ) R .randamentul total de electroni 397 .unghiul solid (sr-1).fluxul fotonilor (sec-1). η . unde (4) I.densitatea fotonilor (sec-1sr-1). Iph .raza ariei excitate din proba. Figura 2. Schema pentru aproximaţia unghiului solid Fluxul de fotoni poate fi calculat folosind formula: Φ= 1 e*r . Caracteristici generale Fluxul fotonilor emişi de sursa de-a lungul axei optice poate fi determinat utilizând formula Φ = I ph * Ω . Aceste exemple sunt reprezentative pentru înţelegerea unor probleme mult mai complexe în fizica stării solide cum ar fi supraconductivitatea de temperatură înaltă (HTSC) şi compuşii cu fermioni grei.1.curentul fotonic pe probă.distanţa de la capilar la probă (aprox 40 mm).3 mm). (CeCu2Si2) [10-11].

spectrele UV ale fotoelectronilor exciţi pot fi comparate cu rezultatele teoretice obţinute din calculul structurilor de benzi. Determinarea funcţiei de lucru.2. Descărcarea VUV acoperă un interval de energie al fotonilor de la 10 la 50 eV. Dacă energia fotonilor este 40 eV structurile d-like sunt generate cu o probabilitate de excitare mare. depind puternic de energia fotonilor excitanţi. este în general de câţiva meV de aceea monocromatizarea suplimentară nu este necesară în cele mai multe cazuri. forma şi structura lor.01 eV) ceea ce permite rezolvarea structurilor vibraţionale moleculare. Φ.3 * 1015 fotoni sr-1sec-1 2.Din (1) si (4) rezultă: ⎛ d ⎞ 2 ⎟ I ph = I * ⎜ ⎜ 1 − dc ⎟ / e *π * r *η ⎝ 2*r ⎠ 2 (5) Pentru o arie iluminată a probei de aprox. De aceea. sau< 12 eV energie a fotonilor) spectrele fotoelectronilor UV excitaţi. 2. Lăţimea liniei de excitare. Figura 3. În intervalul VUV de energii joase (<20 ev.22 mm diametru şi un curent pe proba de 55 nA. şi folosite pentru determinarea unor informaţii specifice suplimentare în analiza de suprafaţă. densitatea fotonilor este calculată ca fiind: Iph= 8. Spectrele UPS şi energia de rezoluţie Sursa UV de tipul UVS 10/35 este în principal utilizată pentru studiul densităţii de stări a electronilor de valentă. în plus faţă de XPS. Pentru energiile fotonilor VUV în intervalul 20 . 0. cu UPS 398 .40 eV structurile electronilor de valenţă s-like sunt suprimate în comparaţie cu orbitalii p-like. Datorită caracterului cvasimonocromatic al liniilor de excitare se poate obţine energie de rezoluţie înaltă (aprox.

Emin= h * ν – Φ (10) Această diferenţă este egală cu distanţa de la A la B. este exprimată astfel: Φ= Evac . Φ. hν este energia fotonului. EF. (8 ) (9 ) Figura 4. Determinarea funcţiei de lucru. funcţia de lucru. adică lăţimea spectrului cu ΔE= constant în figura 4.Potrivit figurii 3. prin măsurători UPS Diferenţa dintre energiile cinetice ale electronilor la poziţiile A şi B este Emax . Pentru un electron emis de la nivelul Fermi (figura 3B).Emin) (11) 399 .Emin adică: Emax . Acest electron ar apărea în poziţia A în figura 4. Un electron emis de la un nivel de energie Ex < Ef (figura 3C) are o energie cinetică minimă (Emin= 0). unde (6 ) Evac. funcţia de lucru poate fi calculată folosind formula: Φ= h * ν – (Emax . Prin urmare. unde Emax este cea mai mare energie cinetică. pentru un electron emis de la un nivel de energie EB < EF: Ekin= h * ν – (EB . Φ.nivelul de energie al vidului. pentru energia de legătură şi energia cinetică avem: EB= 0 Emax= h * ν – Φ.nivelul Fermi.Φ) (7 ) unde. În general.EF.

Spectru fotoelectronic al plumbului care arată modul în care electronii scapă din solid. cunoscut sub 400 . Odată ce fotoelectronul a fost emis. Figura 5. în general suntem preocupaţi de o formă specială de fotoemisie. contribuie la fondul spectrului. EK este energia cinetică a electronilor şi W (cst) este funcţia de lucru a spectrometrului. acest lucru va fi efectuat de către sistemul de control sau de sistemul de date asociat cu spectrometrul. atomul ionizat trebuie să se relaxeze. contribuie la vârfurile caracteristice în spectru. unde. unde hv este energia fotonilor. Acest lucru este ilustrat în figura următoare.EK . Acest lucru poate fi realizat prin emisia unui foton de raze X. spectrul este suprapus pe o structură electronică schematică a plumbului pentru a studia modul în care fiecare orbital dă naştere la linii fotoelectronice. deoarece toţi electronii cu o energie de legătură mai mică decât energia fotonilor vor fi cuprinşi în spectru. contribuind la vârfuri discrete. care este considerată mai adecvată. Spectrul de fotoelectroni va reproduce structura electronică a unui element destul de precis. Cantităţile din dreapta relaţiei sunt cunoscute sau măsurabile. Operatorul doar selectează o scală de energie cinetică sau de legătură. dar acest lucru depinde de energia fotonilor razelor X implicate şi de aceea nu este o proprietate a materialelor intrinseci. sau pot suferi pierderi de energie şi să contribuie la fundal. Relaţia dintre parametrii implicaţi în XPS este: EB = hv . Energia fotoelectronului emis este apoi analizată de un spectrometru de electroni şi datele sunt prezentate ca un grafic de intensitate funcţie de energia fotoelectronilor emişi. adică de emiterea unui electron de la un nivel de bază datorită acţiunii unui foton de raze X de energie hv.3.W. spectrul XPS al plumbului este suprapus pe o reprezentare a orbitalilor electronici. cei care sunt supuşi unei împrăştieri inelastice şi suferă pierderi de energie. Energia de legătură a electronilor (EB) este parametrul care identifică specificul electronilor.Spectroscopia fotoelectronică de raze X În XPS. Aceşti electroni care sunt excitaţi şi scapă fără a pierde energie. În practică. Energia cinetică a electronilor (EK) este experimental măsurată cantitativ de spectrometru.

Sistemul de analiză a suprafeţelor SPECS În cel mai simplu mod. II. 401 .numele de fluorescenţă de raze X. cu toate că nu se practică la scară largă. Design-ul şi principiul de funcţionare al spectrometrului de electroni Figura 6. Camera de vid si de preparare poate fi dotată cu diferite instalaţii pentru prepararea probelor şi facilitaţi analitice auxiliare (neutralizator de sarcină. electronii Auger sunt produşi ca urmare a procesului XPS. sistem de tăiere a probelor. Sursa de radiaţii primare pentru spectroscopia fotoelectronilor de raze X face uz de razele X. XR50 • Sursa de raze X cu monocromator FOCUS 500 • Sursa UV UVS 10/35 • Sursa sputter IQE 11/35 cu ioni de Ar • Neutralizator de tip Flood Gun FG 15/40 Acestea sunt cuprinse într-o cameră de vid. Un sistem computerizat este folosit pentru achiziţia datelor şi de procesarea ulterioară. O altă posibilitate o constituie ejecţia unui electron Auger. adesea denumit X-AES (X-ray induced Auger electron spectroscopy). spectrometrul de electroni conţine următoarele componente: • Analizor de energie a electronilor de tip PHOIBOS 150 • Sursa de raze X.). în general cu catodul de aluminilu (Al Kα) sau catodul de magneziu (Mg Kα). care funcţionează în regim de vid ultra-înalt (UHV). sistem de curăţare cu ioni de Ar etc. Astfel. X-AES. poate conduce la informaţii chimice valoroase despre un atom.

Acesta are patru moduri de operare pentru diferite intervale de voltaj: . Voltajul emisferelor (intre -40 si 40 V) ţi voltajul de întârziere (între -40 şi 40 V) sunt schimbate independent. De aceea.1. Toate părţile sunt integrate într-o singură cutie compactă din aluminiu protejată RF.5 keV.400 şi 400 V) variază cu voltajul de întârziere (între -3500 şi 3500 V). . Unitatea poate fi folosită şi pentru aplicaţii la nivele mai mari de energie folosind un mod de operare corespunzător. Voltajul emisferelor (între -400 şi 400 V) şi voltajul de întârziere (între -400 şi 400 V) sunt schimbate independent. Partea electronică de detecţie este alimentată împreună cu unitatea analizoare de control.2. Voltajul emisferelor (între .Intervalul 3500 V. Descrierea Analizorului Analizorul PHOIBOS este format dintr-un sistem de vidare şi patru componente majore interne care sunt arătate în figurile de mai jos. nefiind necesară intervenţia celui care o foloseşte.Intervalul 1500 V. Voltajul emisferelor (între -400 şi 400 V) variază cu voltajul de întârziere (între -1500 şi 1500 V). analizorul permite măsurători rezolvate spaţial cu un diametru minim de 100 µm şi. un preamplificator. . Toate aceste 402 . este echipat cu 9 canale detectoare. Caracteristici generale Analizorul SPECS de energie emisferic electrostatic de tip PHOIBOS permite înregistrarea spectrelor de energie pentru particulele negative (electroni) şi particulele pozitive (ioni) în intervalul energiilor cinetice de la 0 eV la 3. Partea electronică pentru detecţie include un discriminator. Analizorul de acest tip poate detecta energii ale electronilor şi ionilor în intervalul 0-3500 eV cu o lărgime minimă a pasului de 7 meV. un numerator şi o interfaţă bus.Intervalul 40 V. Analizorul de energie emisferic de tip PHOIBOS 1. de asemenea.1. cercetarea unor suprafeţe largi asociate diferitelor unghiuri de recepţie ale lentilelor. 1. Analizorul PHOIBOS 150. . Un mecanism de tăiere a orbitei şi o lentilă multi-mod fac selectabile zona de pe proba de analizat şi unghiul de recepţie.Intervalul 400 V. Un ansamblu de lentile de transfer în doi paşi poate fi folosit în diferite moduri pentru rezolvarea spaţială şi unghiulară. Generatorul HSA3500 pentru analizatorul PHOIBOS este controlat în totalitate cu ajutorul computerului. Toate modurile lentilei pot fi setate electronic. Toate componentele sunt controlate de un program SPECS. Lentilele de intrare sunt proiectate pentru a se potrivi cu o gamă largă de aplicaţii.

pentru a evita ciocnirea particulelor emise de pe suprafaţa probei cu moleculele de gaz.componente sunt introduse într-un mediu de vid ultra-înalt (UHV). Figura 7. Uchannel HV/ Base – potenţialul pe anod/catod pentru canale. 403 . U0 = –Ekin(kinetic energy) + Ep(pass energy) + WF(work function). Schema de conectare a componentelor PHOIBOS Figura 8: Principalele componente ale analizorului şi principiul voltajului U0 – voltajul principal de întârziere.

Sistemul de lentile de intrare include zece segmente de lentile. Particulele care trec prin lentile sunt focalizate în poarta de tăiere S1. T1…T10 – electrozi ai lentilei de transfer multi-mod. S1 – intrarea de tăiere a capacitorului emisferic. Sistemul de lentile electronic şi părţile tăiate (intrarea şi ieşirea) au efecte importante asupra împrăştierii energiei detectate de analizor. 404 . Sistemul de lentile poate fi operat în diferite moduri pentru situaţii de rezolvare spaţială şi unghiulară pentru a adapta analizorul la diferite cerinţe.UHV–UBase – voltajul detectorului. UChannelBase-U0 – voltajul de conversie. Pentru obţinerea unei imagini nedegenerate. Succesiunea de lentile defineşte suprafaţa de analiză şi acceptanţa unghiulară prin imagistica particulelor emise la intrarea în analizor. pentru recepţionarea particulelor încărcate. • Analizorul emisferic de 180° (HSA) cu un diametru de 150 mm pentru măsurători spectroscopice de energie.5 sau 9 canale). sistemul de lentile nu conţine sau nu are interfranje. ioni. C1…C9 . Sursa excitatoare depinde de tehnica folosită. dar de obicei se folosesc razele X sau alte tipuri de fotoni. Înainte ca particulele să treacă prin analizorul semisferic. • Apertură iris cu interconexiune rotaţională exterioară. • Ansamblul detector pentru particule individuale. LA…LE – potenţialele pe lentile.detectori mono/multi-canal de colecţie discretă (1. Pentru analiza cu un spot mic este disponibilă o rezoluţie colaterală de până la 100 µm. În plus. trec mai întâi printr-un sistem de lentile electronic care taie fasciculul de particule. Componentele interne sunt: • Sistemul lentilelor de intrare. panourile de lentile definesc acceptanţa unghiulară şi suprafaţa pentru o anumită mărime a tăierii de intrare. sau electroni. unde sunt întârziate în lentile pentru o analiză energetică ulterioară. • Mecanism de tăiere a orbitei cu o interconexiune rotaţională exterioară. În modurile de amplificare rezolvarea unghiulară este realizată cu o apertură iris în planul de difracţie al sistemului de lentile. r0 – raza nominală a capacitorului (100 sau 150 mm). folosind modul de amplificare puternică si o apertură iris corespunzătoare. IH. S2 – planul de ieşire al capacitorului emisferic. OH – emisfera interioară/exterioară. Toate modurile lentilei pot fi setate electronic.

1. Particulele cu o energie cinetică mai mare sunt focalizate mai departe spre exterior.Folosind irisul. pentru rezolvarea spaţială şi unghiulară. În modurile unghiulare dispersive. Toată rezoluţia colaterală este pierdută. distribuţia emisiei după unghiuri este vizualizată în locul imaginii reale. • a accelera/decelera particulele la energia de trecere. Aceste moduri sunt concepute pentru schiţarea benzilor UPS. Cu detectorul multi-canal. fiecare canal este conectat la un preamplificator separat. Poziţia radială a imaginii tăiate în planul S2 depinde de energia cinetică a particulelor în capacitor. cu înregistrarea simultană a unei benzi de energie în jurul valorii de trecere optime a energiei. particulele care intră în S1 sunt focalizate în planul de ieşire al capacitorului S2. Modurile de transmisie sunt optimizate pentru transmisii înalte la mărimi diferite ale spotului. Ele sunt focalizate pe poziţia centrală radială a ieşirii plane S2.2. Rezoluţia colaterală este înrăutăţită şi suprafaţa de recepţie nu este definită în mod normal de lentile. Particulele care trec prin planul de ieşire al capacitorului S2 sunt accelerate în sistemul de detectori C. Preamplificatorii sunt citiţi de către detectorii multi-canal (MCD). Acesta poate fi folosit în diferite moduri care pot fi setate electronic. dar. rezoluţia unghiulară poate fi ajustată continuu menţinând suprafaţa de recepţie a probei constantă. 1. sunt focalizate mai în interiorul planului S2. La nivelul lentilei particulele ce ies de pe pro405 . iar particulele cu o energie cinetică mai mică. În capacitorul semisferic. • a defini zona probei analizată şi unghiul solid de recepţie de pe probă. Distanţa standard de lucru de 40 mm şi partea frontală de formă conică la un unghi de 44° al lentilei furnizează accesul optim la probă pentru toate tipurile de surse excitatoare. montat în afara vidului. Particulele de pe traiectoria centrală au energia de trecere optimă. suprafeţelor Fermi sau experimente similare. Sistemul de lentile Ansamblul de lentile de transfer în doi paşi a fost conceput pentru a oferi randament de transmisie foarte bun şi proprietăţi optice bine definite. informaţia dată de unghiurile de emisie este obţinută uşor. cu interfaţa pentru programul de achiziţie de date SPECS. Un sistem de lentile cu un mecanism variabil de tăiere a orbitei este necesar pentru: • a vizualiza planul probei pe intrarea plană HSA. Aceasta permite posibilitatea folosirii detectorilor multi-canal.

În interiorul primei lentile. particulele trec printr-o imagine intermediară înainte să fie focalizate în intrarea de tăiere S1 a capacitorului emisferic (figura 4). (figura 9). Amplificarea înaltă. În modul FAT. suprafaţa vizualizată a probei va avea dimensiunea DS egală cu: DS = D1 / M (1) Puterea de amplificare a planului de lentile poate fi selectată. Sistemul PHOIBOS poate funcţiona într-un nivel stabilit de întârziere (fixed retarding ratio – FRR) sau în transmisie stabilită de analiză (fixed analyzer transmission – FAT). ţinând aberaţia sferică la o valoare cunoscută şi acceptabilă. Mărimea reală a suprafeţei probei de analizat DS este în principiu dată de ecuaţia (1). conform teoriei. cu unghiul de recepţie al intrării lentilei. conectând la electrozii lentilelor voltajul optim. 40 mm în faţa primului electrod al lentilei T1.Epas + funcţie de lucru. Dacă S1 are diametrul D1. atunci. rezultând astfel dimensiuni mai mari ale probei decât cele date de ecuaţia (1). Planul imaginii probei este în coincidenţă cu planul intrării analizorului. pentru o amplificare dată. este în mod special potrivită pentru studii de rezolvare spaţială. proba fiind în planul focal al sistemului de lentile. energia de trecere are valoarea: Epas = Ekin / R. R fiind rata de întârziere. Amplificarea este schimbată electric. La nivelul S1 particulele sunt întârziate de diferenţa de energie dintre particulele cu energia cinetică preponderentă Ekin şi energia preponderentă de trecere Epas. Ekin este negativă pentru electroni şi pozitivă pentru ioni. Gradul de difuzie creşte. voltajul aplicat pe emisfere este dat de ecuaţia: Epas = (-q)kΔV În modul FRR. de exemplu. datorită aberaţiei sferice a intrării lentilei. Cu toate acestea. Din această cauză unghiul de recepţie al lentilei este selectabil prin modurile de amplificare. imaginea în planul de intrare este difuză. Valorile voltajului sunt dependente de voltajul spectrometrului U0 care este preponderant egal cu Ekin .ba S sunt vizualizate în intrarea de tăiere S1. Utilizatorul poate defini zona de recepţie a analizorului cu ajutorul intrării de tăiere deoarece traiectoriile electronilor emişi 406 . Aceasta înseamnă că zona observată în planurile focale ale intrării sistemului de lentile este tot mai împrăştiată cu creşterea unghiului.

Datorită aberaţiilor lentilei. utilizând modul de amplificare înaltă şi apertură iris. Mod de arie medie de către probă sunt influenţate de către câmpurile electrice din jurul probei. Mai mult. aceste raze rele pot fi eliminate. menţinând zona de recepţie a probei constantă. Modurile de amplificare au fost optimizate pentru a permite unghiuri foarte mari de recepţie pentru surse punctiforme cu transmisie puternică (moduri de transmisie punctiformă). Mod de transmisie înaltă Figura 10. pot să găsească un drum spre intrarea analizorului. În aceste moduri. Folosind irisul. o rezoluţie laterală de până la 100 µm este disponibilă.T1 având un potenţial fix care este setat ca fond la schimbarea sursei de alimentare. Cu o apertură iris. rezoluţia unghiulară este realizată cu ajutorul aperturii iris în planul de difracţie al sistemului de lentile. Razele apropiate de axa 407 . apertura iris poate fi utilizată pentru ajustarea unghiului de recepţie a analizorului. Pentru analiza cu spoturi mici.Figura 9. rezoluţia unghiulară poate fi încontinuu ajustată între ± 10 şi ± 90 . razele care intră în lentilă depărtate faţă de axa ei la unghiuri mari.

dar rezoluţia spaţială este înrăutăţită. Asta face ca modurile de transmisie punctuale să fie cele mai potrivite pentru AES. Figura 11. Discul cu cea mai mică dezordine se află unde tubul de raze emergente are cel mai mic diametru. Focalizări mici sub lentilă.5 mm 17. electronii care părăsesc proba la o anumită distanţă unghiulară sunt focalizaţi pe aceeaşi 408 . Modul de amplificare înaltă Tabelul 1: Unghiul de recepţie versus diametrul irisului pentru o sursă punctiformă Unghiul de recepţie ± 1º ± 2º ± 3º ± 4º ± 5º ± 6º Diametrul irisului 3. ISS şi studii de sincroton. converg mai puternic. implică deplasarea discului de cea mai mică dezordine.5 mm 7 mm 10 mm 13 mm 15.lentilei (raze paraxiale) sunt focalizate în focarul Gaussian. Razele care intră în lentilă la unghiuri mai mari.5 mm În noul mod de suprafaţă medie cu unghiuri rezolvate. De aceea este realizat un unghi mare de recepţie. în planul imaginii.

Funcţia intensitate-poziţie a analizorului este o Gaussiană. Modurile unghiulare permit utilizatorului să optimizeze rezoluţia unghiulară până la ± 0. amplificarea şi apertura unghiulară sunt selectabile. Există mai multe combinaţii diferite disponibile. Setarea optimă a aperturii iris depinde de mărimea tăierii şi de calitatea dorită a suprafeţei de analizat. 409 .zonă a intrării analizorului indiferent de poziţia lor din probă. Figura 12. apertura iris poate fi folosită pentru micşorarea suprafeţei de analizat. Folosind apertura iris. aceste intensităţi pot fi suprimate. aceste intensităţi pot fi suprimate. Pentru o analiză cu spoturi mici. Setările lentilelor pot fi combinate cu diferite combinaţii ale tăierii. dar cu intensităţi mai mari în regiunile de margine. Suprafaţa de analizat a fost definită pentru a include între 90-99% din totalitatea semnalului fotoelectric. Folosind apertura iris. acest mod este alegerea ideală pentru studii de dependenţă unghiulară. La PHOIBOS. Cu un sistem de detecţie 2-D se pot obţine unghiuri de rezoluţie mare pe direcţia dispersiei. Profilul tipic intensitate-poziţie cu apertură iris Cozile de intensitate mică formează un disc. Intensitatea sa integrată poate atinge acelaşi ordin de magnitudine ca intensitatea peak-ului. rezultând astfel un număr de combinaţii egal cu produsul dintre modurile de setare a lentilei şi numărul de tăieri. fără restricţionarea unghiului de recepţie. a analizorului.050 cu mecanismul de tăiere a orbitei.

sunt deviate pe traiectorii eliptice de câmpul electric radial între emisfera internă Rin şi emisfera externă Rout. Pentru liniile de fotoemisie cele mai importante contribuţii adiţionale sunt: a) Lărgimea proprie a liniei pentru nivelul atomic ΔElevel (de exemplu O 1s. numai particulele cu energie cinetică cuprinsă într-un anumit interval. q – sarcina electrică a particulei. Dacă HSA acceptă jumătatea unghiului α pe direcţia dispersiei. de exemplu.urilor individuale.2.9375 2R0 (Rout − R in ) (3) (4) Aceste particule ajung pe S2. k= R in R out = 0. Razele emisferelor PHOIBOS sunt 1. Al Kα). Particulele cu energie cinetică mai mare se vor apropia de emisfera exterioară în timp ce particulele cu energie cinetică mai mică sunt deviate spre emisfera interioară. parcurgând un arc de cerc de rază R0. Particulele încărcate care intră în HSA prin intrarea de tăiere S1. pot să treacă integral prin devierea unghiulară de la intrarea de tăiere S1 la planul de ieşire S2. k – constanta de calibrare. FWHMtotal observat este dat de convoluţia FWHM . Există contribuţii în plus la lărgimea liniei observate în spectru. Intrarea de tăiere S1 şi planul de ieşire S2 sunt centrate în jurul razei R0: R0 = R in + R out = 150 mm 2 (2) Pentru un gradient fix al câmpului electric. Analizorul Emisferic (HSA) Analizorul emisferic PHOIBOS (HSA) cu o rază R0 (100mm/150mm) măsoară energia particulelor încărcate.2.1. b) Lărgimea naturală a liniei pentru radiaţia caracteristică folosită la excitare ΔEphoto (de exemplu Mg Kα. Acele particule care intră în HSA perpendicular pe S1 şi se mişcă prin emisfere pe o traiectorie circular centrală.25 R0 şi 0. au energia de trecere preponderentă Epass: Epass = (-q) kΔV. rezoluţia HSA sau FWHM (full width at half maximum).Vin). a liniei transmise ΔEan este dată de : ΔEan S α2 = + Epas 2R0 4 (5) unde S = (S1 + S2)/2. C 1s). Această valoare (S) este o constantă a analizorului. pentru lărgimea Gaussiană a liniilor: (6) FWHMtotal =(ΔEan 2 +ΔElevel2 +ΔEphoto2 )1/2 =ΔE 410 .75 R0. ΔV – diferenţa de potenţial aplicată pe emisfere (Vout .

datorită îngustării lărgimii liniei proprii a nivelului Si 2p. gradul de întârziere R este definit ca: R= Ekin Epas (10) În acest mod toate particulele sunt decelerate cu acelaşi factor constant. Ecuaţia rezultă din teorema lui Liouville.9 eV este de obicei suficientă pentru măsurători la rezoluţie mare. folosind doar o mică parte din suprafaţa spotului monocromatic de radiaţii X (datorită dispersiei energiei pe suprafaţa spotului).8 eV (7) În practică. de unde rezultă valori mai mici pentru FWHMextreme.65 eV este de obicei suficientă pentru studii de înaltă rezoluţie cu o excitare monocromatică a Al Kα. suprafaţa de recepţie a probei AS şi rezoluţia HSA. este posibilă folosirea radiaţiei X monocromatice de excitare. FWHM-ul razelor X trebuie să fie foarte mic.FWHMtotal este de obicei stabilit folosind o probă de argint curăţată prin împrăştiere ionică şi înregistrarea nivelului Ag 3d5/2.44 eV Pentru a atinge rezoluţia extremă de 0.44 eV. o rezoluţie de 0. : Ekin Ekin (9) sunt valorile de recepţie pentru HSA. în timp ce rezoluţia energetică scade. Pentru o rezoluţie mai mare a instrumentului. Analizorul poate fi operat în două moduri diferite: a) Gradul de întârziere fix (Fixed retarding ratio (FRR)). rezoluţia HSA la nivelele joase ale energiei de trecere pentru Ag 3d5/2 este : HMMgKa= 0. Pentru excitarea Mg Kα. energia de trecere este proporţională cu energia cinetică. Pentru radiaţie Al Kα monocromatică şi pentru nivelul Ag 3d5/2 rezoluţia extremă este: (8) FWHMextreme = 0. Intensitatea creşte cu creşterea energiei cinetice: I ∼ Ekin . De aceea. Intensitatea semnalului integral I al particulelor măsurate (suprafaţa cuprinsă în interiorul peak-ului până la nivelul fondului) este proporţională cu produsul dintre unghiul solid de recepţie ΩS. Ele sunt constante ale unde analizatorului. cu costul unei mari pierderi în intensitate. ΔEan : I:ΔEan ΩSAS =ΔEan Ω0A0 Epass Epass 2 . (11) 411 . după extracţia liniară a fondului. o rezoluţie de 0. În practică. Pentru radiaţia monocromatică. de exemplu radiaţie Al Kα monocromatică în mare parte. FWHMtotal este uneori determinat înregistrând nivelul Si 2p3/2 în loc la Ag 3d5/2.

ISS şi este preferabil pentru măsurători ale survey-ului. Analizatorul. Aceasta face posibilă cea mai mare rată de numărare permisă pentru aceşti parametrii şi de aceea rezultă un timp scurt de măsurare şi un raport bun semnal-zgomot. (inclusiv câmpul magnetic al pământului) de aceea este esenţial să eliminăm aceste câmpuri în volumul închis al analizatorului. Există unele aplicaţii în care unul dintre ele este de obicei preferabil. Mecanismul poziţionează o deschidere de intrare şi ieşire de o mărime adecvată în planul de intrare şi ieşire al analizorului. Izolarea Magnetică (13) Particulele încărcate sunt influenţate de câmpul magnetic rezidual. acestea sunt construite. Modul FRR este folosit cel mai mult în AIS. sunt măsurate cu aceeaşi scădere a rezoluţiei şi intensităţii cu energia cinetică: I∼ 1 Ekin (12) Cele două moduri sunt disponibile pentru toate tipurile de măsurători. Dacă Ekin este constantă şi acelaşi peak este măsurat pentru diferite energii de trecere. o zonă de analiză tolerată şi un unghi de recepţie. Tăierea posterioară se află în planul intrării şi defineşte energia de rezoluţie a analizorului (vezi ecuatia (5)). Raza de intrare este definită de două secţiuni care sunt la circa 6 mm depărtare.b) Transmisie fixă a analizorului (fixed analyzer transmission(FAT)). Pentru o rezoluţie energetică dată. Inelul de intrare poate fi poziţionat direct prin rotirea cadranului (vezi fi412 . din materiale non-magnetice într-o carcasa de µ-metal.5 mm grosime µ-metal pentru a ecrana câmpurile magnetice la un nivel minim.2.3. sistemul de lentile şi detectorul sunt înconjurate de un strat de 1. în întregime. în timp ce tăierea anterioară serveşte la compararea împrăştierii unghiulare pentru analizor. unde este necesară o informaţie detaliată şi rezoluţia nu trebuie să depindă de energie.2. rezultă că: I ∼ Epass 2 1. în care Epass şi ΔEan din ecuaţia (5) sunt constante ajustabile. Pentru o performanţă maximă a analizatorului şi sistemului de lentile. 1. Modul FAT este folosit preponderent în XPS şi UPS. Mecanismul de tăiere a orbitei Mecanismul de tăiere a orbitei este folosit pentru a schimba manual deschiderea intrării şi ieşirii analizorului. indiferent de energia lor cinetică. tăierea maximă posibilă poate fi selectată.4. Semnalele date de toate particulele. Factorul de izolare pentru regiunea analizatorului este de aproximativ 35.

Aranjamentul propriu-zis în analizor apare în secţiunea de tăiere a programului de control livrat împreună cu analizorul. Prin acest aranjament se pot alege puterile de intrare şi ieşire independent. Poziţiile tăierilor de ieşire sunt indicate cu litere (A-B. sau A.gura 10). Aceşti indicatori corespund celor care apar în setările programului de control al analizatorului SpecsLab2. Analizorii PHOIBOS. folosind acelaşi sistem rotaţional.B sau C). au 8 tăieri de intrare şi 2 de ieşire în configuraţia standard. Poziţiile tăierii de intrare sunt indicate cu numere (1-8) pe cadranul rotaţional exterior. începând cu ieşirea 5. Selecţia fantei de ieşire 413 . Pe de altă parte. Când deschiderea intrării şi ieşirii este schimbată. poziţiile trebuie introduse în zona de editare a datelor. Figura 13. inelul de ieşire este poziţionat indirect prin intermediul inelului de intrare (vezi figura 11).

Detector Multicanal MCD Detectorul este format din următoarele părţi: • Un aranjament de multiplicatori de electroni MCD • O punte ceramică multi-pin. 414 . Schimbând tensiunea spectrometrului U0. sunt cercuri concentrice. numărul particulelor din fiecare canal. având diferite energii în HSA. 5 sau 9 spectre paralele sunt înregistrate simultan.2. poate fi adăugat. Numărul particulelor Nn care sosesc la fiecare colector Cneste numărat separat. în principal datorită câmpurilor de refringenţă existente pe marginea analizorului.5. Valoarea teoretică a lui D este: D = 2R0 (16) (17) Valoarea experimentală determinată pentru dispersie poate fi puţin diferită. Imaginile electronilor. este selectată pentru a corespunde cerinţelor unei diferenţe de energie cinetică constantă între canalele vecine ΔEk. Energia cinetică En a particulelor ce ajung la colectorul Cn. Principiile Detecţiei Datorită simetriei sferice a HSA. Distanţa radială între ieşiri de tăiere vecine ΔR. este dată de: R − R0 Ek − Epass D = × R0 E pass R0 unde D este dispersia la HSA. şi în acest fel fiecare colector înregistrează un spectru corect. de voltaj înalt. fiind ştiută din ecuaţia (16). Într-o primă aproximaţie raza de poziţie R a electronilor cu energia cinetică Ek.1. iar aceste numere sunt stocate şi procesate într-o unitate de achiziţie a datelor.5. aparţinând aceleiaşi energii cinetice. traiectoria electronului este mutată între fiecare analizor pas cu pas. cu o compensare fixă a energiei între canalele vecine. baleând spectrul odat peste suprafaţa detectorului. În principiu. în planul ieşirii pentru electroni monocromatici cu energia preponderentă de trecere Epass. situată în vid • Preamplificatori MCD. rezultând numărul total de particule pentru fiecare energie cinetică.1.2. 1. există o imagine 1:1 a intrării circulare de tăiere cu o rază de curbură R0. cu 9 ieşiri de tăiere în cercuri concentrice în planul de ieşire. Detecţia multicanal se realizează aranjând corespunzător 9 CEMs (multiplicator de electroni cu canale) ca şi colectori.

conectat la CEM.2.1. 1. Acest efect este repetat succesiv. Aceşti electroni sunt acceleraţi de către voltajul înalt. prin interpolarea între numerele măsurate în canalul Cn la energiile măsurate cel mai apropiat dedesubt şi deasupra energiei nominale. cum ar fi electronii şi ionii. până când. Pentru asta. şi eliberează noi electroni secundari prin impactul în continuare de-a lungul peretelui CEM. deoarece nu există niciodată mai mult decât o energie nominală între două poziţii ale energiei măsurate. la energia cinetică nominală. în final. Coerenţa între Epass şi pas Din ecuaţia de dispersie energetică pentru analizor. câştigul trebuie selectat destul de înalt pentru a folosi CEMs în modul 415 . este: ΔEk = ΔR D D ΔR Epass (18) sau: Epass = ΔEk (19) unde D este dispersia pe analizor. Numărul mediu de electroni care pleacă din ansamblul CEM pe particula incidentă. În special în modul FRR. un program calculează numărul de particule Nn în canalul Cn.5. Programul validează valorile la cele mai apropiate valori. unde energia de trecere se schimbă în spectru (şi diferenţa de energie dintre canalele învecinate). la distanţa ΔR unul de celălalt. Performanţa acumulatorului (DAC steps. nu există o restricţie a pasului energiei datorată performanţei analizorului. Pentru detectarea unei singure particule. Impactul particulelor încărcate formează electroni secundari care sunt eliberaţi din peretele CEM. un “nor electronic” se formează la ieşirea din CEM. un calcul al energiei detectate a particulelor este necesar.3. sau radiaţia. Materialul rezistiv devine o dinodă (o serie de electrozi incorporaţi într-un fotomultiplicator) continuă când un potenţial este aplicat la capetele acestui tub. diferenţa de energie Δ între canalele vecine. Multiplicarea Electronică Un multiplicator de electroni cu canale (CEM) este un dispozitiv de achiziţie înaltă pentru detectarea particulelor energetice. Algoritmul este uniechivoc. se numeşte câştigul G. CEM este format dintr-un tub mic şi curbat de sticlă. Peretele interior este căptuşit cu un material de rezistenţă înaltă. Datorită procesului de interpolare. etc) limitează lărgimea şi distanţa posibilă a paşilor.2.5.2.

fiecare particulă incidentă eliberează un nor electronic la ieşirea aranjamentului CEM.4 eV pentru Al Kα. Cum este menţionat mai sus. Toate CEMs sunt montate într-o unitate paralelă pe o flanşă cu rol de punte. de exemplu. De obicei. ca o componentă de multiplicare electronică pentru analizorii PHOIBOS. de exemplu.saturat. această sursă este o sursă cu doi anozi. Fiecare anod poate fi operat în modul de focalizare sau non-focalizare. La fel ca şi XR 50. mărimea spotului de raze X pe anod este de 3. Selecţia între anodul 1 şi anodul 2 accesează fie radiaţia Al Kα la 1486. este accelerat în electrodul conectorului CEM. fie radiaţia Ag Lα la 2984. Unul sau un grup de CEM este folosit într-un aranjament special.2 mm2 pe probă). Puterea maximă este restricţionată la 150 W în modul de focalizare.1. În modul de non-focalizare.5 x 0. modul focalizare/non-focalizare este utilizabil pe amândoi anozii.74 eV. Dacă anodul de argint este activat. având ca materiale constituente Al şi Ag. monocromatorul este folosit în reflexia Bragg de ordinal 2. câştigul minim pentru operaţia de saturare este de aproximativ 107. Operaţia de saturare este necesară pentru o reflexie a zgomotului suficientă.5 mm2 (corespunde la 3. spotul sursei de raze X pe anod este de 3. Principiu de funcţionare Monocromatorul FOCUS 500 de raze X este echipat cu o versiune specială a sursei de raze X XR-50.5 x 1 mm2 pe probă) şi sursa de raze X poate fi operată la puterea maximă de 400 W ( 600 W pentru Ag Lα) la lărgimea liniei de 0. Sursa de raze X pentru FOCUS 500 (XR50 M) 2. a cărui sarcină este independentă de micile schimbări în voltajul multiplicator. un nor electronic format din mai mult de 107 electroni părăseşte CEM. rezoluţia maximă a monocromatorului de 0. în detectarea unei singure particule. Norul electronic emis.5 x 0. şi pulsul sarcinii purtate de norul electronic este detectat ca provenind de la una din particulele incidente şi numărate în canalul preamplificatorului. 2.3 eV. Datorită mărimii mici a sursei.5 x 4 mm2 (corespunde la 3. Dacă modul de focalizare este activat de către acumulatorul XRC 1000 M. Particulele ce trec de ieşirea aperturii. iar XR 50 M trebuie să fie mutat cu 16 mm. 416 .25 eV poate fi atinsă pentru Al Kα. sunt accelerate la o energie cinetică corespunzătoare în interiorul CEM. numită XR 50 M.

1. arătând voltajul şi curenţii pe sursă. care nu există în XR-50 standard.2. În afară de aceste două procese. Diagrama bloc a principiului de funcţionare a sursei 2. Aceasta este reflectată după legea lui Bragg pe oglinda elipsoidală din cuarţ în monocromatorul FOCUS 500 şi focalizată pe probă. Diagrama bloc a sursei de raze X este prezentată mai jos. permiţând o operaţie UHV. 417 . de către electronii întârziaţi. Conectorii de filtrare rapidă permit îndepărtarea rapidă a liniilor de răcire cu apă şi HV (de înaltă tensiune). vor fi generate raze X sau electroni Auger.Efectul de focalizare este obţinut cu ajutorul unei lentile electronice adiţionale. are loc un proces de ionizare al nivelelor electronice. amplasată în capul sursei. Voltajul de focalizare este generat de către un amplificator XRC 1000 M şi este transferat la sursa de raze X printr-un cablu de filament prin cele 4 punţi. va fi produsă şi o radiaţie cu o frecvenţă continuă a spectrului.2. Monocromatorul Radiaţia caracteristică este generată pe anodul XR-50 M şi pleacă de la sursă sub un unghi de 15°. Dacă aceste locuri vacante sunt umplute cu electroni cu o caracteristică energetică mai înaltă. 2. Figura 14. Descrierea sursei 2.2. Modulul XR-50 M (cu alimentarea de apă şi protecţia HV scoase) poate fi încălzit până la 250°C. Generarea fotonilor de raze X Dacă un material în stare solidă este bombardat cu electroni de înaltă energie.2.

• Un spot de raze X focalizat pe probă creşte sensibilitatea în XPS pe probe mici. Sursa este alimentată de către un acumulator XRC 1000 M şi de către o unitate de răcire CCX60. îngustând peak-urile spectrului. Prezentarea schematica a monocromatorului FOCUS 500 În anodul dual sunt produse raze X Al Kα (1486. 418 . Monocromatorul aduce următoarele avantaje sursei de raze X: • Distribuţia energetică a razei X cu benzi energetice înguste îmbunătăţeşte selectivitatea chimică. Figura 15. care reduce semnificativ uzajul indus asupra sursei. cu plane de cristal monoatomice orientate precis. Sursa de raze X XR 50 M este montată pe un manipulator după cele trei axe. • Un background mai mic.74 eV) sau Ag Lα (2984.3 eV).A) Descrierea generală a monocromatorului: Ansamblul cristalului este compus dintr-o oglindă din cristal de cuarţ şi un manipulator al oglinzii. • Eliminarea razelor X nedorite de la sateliţi şi impurităţile anodului. Oglinda este făcută dintr-un suport monolitic de încălzire. Manipulatorul oglinzii poate genera trei moduri de mişcare: translaţie (focalizare) şi două direcţii de înclinare. • Eliminarea Bremsstrahlung şi a radiaţiei termale de la sursa de raze X. care simplifică analiza spectrală. Este folosit pentru poziţionarea oglinzii în vederea obţinerii unui fascicul de raze X monocromatic.

Configuraţia monocromatorului cristalin elipsoidal Cristalele de cuarţ individuale sunt folosite în procesul de monocromatizare. pentru Al Kα unghiul de difracţie 2θ = 23.8419 nm eV Din cele două ecuaţii rezultă.851243 nm.B) Monocromatizarea prin difracţia pe cristal Figura 16. Există două cerinţe pentru ca difracţia de raze X să aibă loc în concordanţă cu legea lui Bragg: 1.149° şi pentru Ag Lα. Toate punctele de pe suprafaţa cristalului. Situaţia este explicată de ecuaţia lui Bragg: 2d cosθ = n λ În termenii energiei avem: 2dE cosθ = n 1239. va fi focalizată dacă sursa. Când razele X. Toate punctele de pe suprafaţă şi unghiul de reflexie 2θ al razei. O sursă de raze X divergentă. trebuie să fie la fel ca şi cele din planul de reflexie. are loc o interferenţă constructivă după împrăştiere numai dacă drumurile parţiale ale undelor pe plane diferă printr-un număr întreg de lungimi de undă. 2. unghiurile de incidenţă θ1 şi unghiurile de reflexie θ2. de lungime de undă λ cad pe cristal sub unghiul de incidenţă θ. luând 2d = 0.096°. se află pe un cerc. focarul şi suprafaţa oglinzii. 2θ = 25. trebuie să fie constante. Cercul Rowland este o condiţie geometrică pentru reflexie. 419 .

Aliniatorul sursei de raze X îi dă voie utilizatorului să poziţioneze anodul pe cercul Rowland. În modul de focalizare. Pentru monocromatorul elipsoidal FOCUS 500 sunt folosite doar cristale cu Δθ = ±10" . iar pentru Ag Lα este de 344 meV.Condiţia de reflexie necesită ca sursa şi proba să se afle pe cercul Rowland.7 eV Pentru Al Kα. iar planele reflectoare ale cristalului să fie concave. Există numeroase ajustări date pentru montajul optic. Legea lui Bragg presupune ca unghiul de reflexie să fie independent de punctul reflexiei. poate fi operată în modul non-focalizare. Diferenţa din ecuaţia Bragg duce la expresia pentru rezoluţia intrinsecă a oglinzii: Rezoluţia energetică intrinsecă la o anumită aliniere a planurilor cristalelor este ΔE=n Δθ (cosθ)2 1456. 420 . Figura 17. Ansamblul cristalului poate fi înclinat în două direcţii şi mutat pe direcţia y pentru a duce suprafaţa cristalului pe cercul Rowland. Sursa de raze X. unde se produce o lărgire datorată diametrelor finite ale spotului sursei de raze X. Poate fi operată în două moduri diferite. cu raza egală cu diametrul cercului Rowland şi să fie tangenţiale la cercul Rowland în punctul c (figura 15). rezoluţia energetică intrinsecă a FWHM este 167 meV. Profilul Gaussian al peak-ului de difracţie al unei raze monocromatice (Al Kα) Curba intensitate-unghi de difracţie pentru un anumit tip de cristal este cunoscută sub numele de “rocking curve”. XR M 50 este echipată cu o lentilă electrostatică care focalizează electronii pe anod. Ambele condiţii sunt îndeplinite doar pentru reflexia simetrică din punctul c. lărgirea datorată sursei este neglijabilă. Pentru fluxuri înalte.

UL trebuie să varieze liniar cu tensiunea pe anod. rezoluţia maximă a monocromatorului de 0.3. Al focalizat (anod 2F). Lărgimea spotului de raze X în functie de Puterea maximă şi tensiunea corespunzătoare UL pentru anozii de Al şi Ag. În modul non-focalizare. Fiecare anod poate opera în modul de focalizare sau non-focalizare. Ag non-focalizat (anod 1N).3.5 x 0. UL: Figura 18.2. Modul de focalizare În contrast cu sursa standard XR-50.5 x 4 mm2 şi sursa de raze X poate fi folosită la putere maximă. 3.1. Aceasta dă un total de patru moduri de operare pe anod: 1.25 eV poate fi atinsă pentru Al Kα. Această relaţie este setată automatic de către sursa XRC 1000 M. mărimea spotului de raze X pe anod este 3.5 mm2. pot fi setate în interiorul sursei XRC 1000 M. spotul sursei de raze X pe anod este de 3. Al non-focalizat (anod 2N). sursa XR-50 M este echipată cu o lentilă electronică în capul sursei. 4. 421 .2. 2. Ag focalizat (anod 1F). Informaţii generale în legătură cu sursa XR 50 M 2. Datorită mărimii mici a sursei. Dacă modul de focalizare este activat. Figura următoare arată lărgimea spotului pe probă în funcţie de tensiunea de focalizare. Această lentilă poate focaliza electronii care se fixează pe anod şi astfel este obţinut un spot de raze X de mărime variabilă. Pentru condiţiile optime de focalizare.2.

Anod.1. Informaţii generale Flood-Gun–ul FG 15/40 a fost conceput pentru neutralizarea generală a sarcinilor probelor. Diagrama operaţională • 422 Energia este controlată manual. Disiparea maximă de putere pe anod a sursei de raze X. şi este folosit special pentru aplicaţii XPS.3. a izolatorilor încărcaţi pozitiv.1. 3.1. 3.2.5-3. Filament. Lentile extractoare. Componente: 1. sau semiconductorilor. Curentul de emisie poate varia de la 0 la 5 mA. 2. Flood-Gun 15/40 3.5 bar (de obicei 5-6 bar) şi dacă debitul este de aproximativ 2. fisurarea anodului şi eliberarea apei în camera de vid.2. Temperaturile înalte au ca şi consecinţă suprasolicitarea. Fasciculul de energie poate varia între 0 şi 500 eV. Diagrama operaţională şi conexiunile electrice ale Flood-Gun-ului sunt arătate în figura următoare: Figura 19. de exemplu evaporarea materialului anodului sau în cel mai rău caz.5 l/m. Tensiunea şi curenţii necesari pentru operaţia FG-ului sunt asigurate cu PS FG 20. Răcirea cu apă Ca agent de răcire pentru XR-50 M se foloseşte apa. Temperaturi mai mici decât temperatura camerei vor duce la condensarea apei şi fenomene de descărcare în interiorul conductei de apă sau al învelişului de protecţie. . poate fi obţinută doar dacă presiunea de răcire a apei este mai mare decât 3.2. 3.

The Journal of Chemical Physics 37:3007 7. Matzdorf R. "Determination of Ionization Potentials by Photoelectron Energy Measurement". Meister G and Goldmann A 1993 Temperature-dependent photoemission spectra from Cu(1 0 0) and Cu(1 1 1) surfaces Surf. 56 317-23 8. Schmidt S and Hüfner S 2004 The electron-phonon selfenergy of metallic systems determined by angular resolved high resolution photoemission Physica B 351 229-34 10. PA: Saunders College) 11.• • Voltajul de extracţie nu este selectabil de către utilizator. Sci. Turner. I. Forster F. Ashcroft N W and Mermin N D 1988 Solid State Physics (Philadelphia. Nicolay G. W.Theory and Current Applications (Studies în Surface Science and Catalysis) 74) (Amsterdam: Elsevier) 5. Shockley W 1939 On the surface states associated with a periodic potential Phys. 286 56-65 1. 423 . Al (1962). Feuerbacher B. Rev. Jobory. Davison S G and Steslicka M 1992 Basic Theory of Surface States (Oxford: Oxford University Press) 9. D. Bibliografie Cardona M and Ley L (ed) 1978 Photoemission în Solids I (Topics în Applied Physics vol 26) (Berlin: Springer) 2. Kevan S D (ed) 1992 Angle Resolved Photoemission . Curentul de emisie este independent de energie şi este controlat manual 4. M. Hüfner S 2003 Photoelectron Spectroscopy.. Reinert F. Eltner B. Fitton B and Willis R F 1978 Photoemission and the Electronic Properties of Surfaces (Chichester: Wiley) 4.Principles and Applications 3rd edn (Berlin: Springer) 3.) 6. Schattke W and Van Hove M A (ed) 2003 Solid-State Photoemission and Related Methods: Theory and Experiment (Weinheim: Wiley-VCH Dec.

.................................. Introducere ..... măsurătorile XPS trebuie efectuate în condiţii de vid ultra-înalt (UHV) din cauza distanţei la care se află instrumentele de detecţie în instalaţiile XPS.. mai exact cei care pleacă din material de la o adâncime de aproximativ 10-12 nm.... faţă de suprafaţa iradiată cu raze X........... Pentru a detecta numărul de electroni la fiecare valoare a energiei de legătură (energie cinetica) cu eroare minimă......436 1. Emilia Sabina Varga Cuprins 1... Fiecare element determină un număr caracteristic de vârfuri XPS la valori caracteristice ale energiei de legătură care ne permit identificarea directă a elementelor care există pe suprafaţa investigată............... Bibliografie ................... De asemenea se poate folosi în analiza modificărilor care apar în chimia suprafeţei unui material după ce acesta a fost supus unor tratamente fizico-chimice........ Teodora Maria Radu.....Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale C....................424 2........ Toţi electronii fotoemişi de la adâncimi mai mari în urma penetrării materialului de către radiaţia X (aprox........S.... Înregistrarea energiei cinetice şi a numărului de electroni emişi de la suprafaţa materialului datorită acţiunii razei X de energie hν duc la obţinerea spectrului XPS........ La baza cuantificării unui spectru XPS obţinut stă presupunerea că numărul electronilor înregistraţi este proporţional cu numărul de atomi într-o stare dată... 1-5 µm) sunt recapturaţi sau blocaţi în diferite stări de excitare în interiorul materialului......... Instrumentul de bază pentru măsurarea numărului de 424 ....... Introducere Spectroscopia XPS este o tehnică de analiză foarte utilă în domeniul cercetării avansate în ştiinţa şi tehnologia materialelor.............. Această metodă permite determinarea elementelor care contaminează o suprafaţă şi uniformitatea compoziţiei elementale la suprafaţă sau în adâncime (depth profiling)............dr......... C. Este important de reţinut că XPS detectează numai acei electroni care ajung în vidul din incinta echipamentului... dr...........................S. Pentru majoritatea aplicaţiilor este de fapt o metodă nedistructivă prin care se determină chimia suprafeţei oricărui material......III.................

t% C-C). z%O. capacitatea de calibrare a scalei de energie este dependentă de capacitatea de compensare a sarcinii pozitive acumulate la suprafaţa probei în timpul măsurătorii şi de disponibilitatea unei linii spectrale la o energie de legătură cunoscută care să poată constitui un etalon pentru deplasarea scalei de energie. proba se va încărca relativ la suportul de probă având ca efect apariţia unui câmp electric de întârziere la suprafaţa probei care determină deplasarea spectrului spre energii cinetice 425 . Obiectivele principale ale regiunii de cuantificare sunt: definirea domeniului de energie în care semnalul poate fi atribuit tranziţiei de interes şi specificarea tipului de aproximaţie adecvat pentru eliminarea semnalului de fond care nu aparţine vârfului de interes. Y%C. etc. Spectrele de înaltă rezoluţie se înregistrează pe domenii energetice restrânse (10-15 eV) micşorând fereastra energetică. y%Si3+. Y%Si3+. Resursele software ajută la o analiză cantitativă (concentraţia relativă a tuturor elementelor prezente pe suprafaţă ) cu o precizie acceptabilă după 2-3 baleiaje a scalei energetice.. calibrarea cu exactitate a scalei energetice şi a scalei de intensitate este crucială. În acest caz numărul de “scan”-uri pe această plajă energetică îngustă va fi mai mare (10–20 baleiaje) pentru că sensibilitatea scade cu creşterea rezoluţiei. prin aceasta micşorând transmisia analizorului şi. Z%O. În aceste spectre de înaltă rezoluţie apar structurările secundare care ne permit studiul complex al elementelor în înconjurarea lor chimică şi structurală. Cu ajutorul acestor spectre (“high resolution” spectra) se identifică stările chimice ale elementelor detectate (deplasările chimice) din poziţia şi forma liniilor spectrale. t%Si1+) sau concentraţiile relative ale stărilor chimice prezente pe suprafaţă (x%Si4+. Cu excepţia cazului când electronii emişi sunt înlocuiţi. crescând rezoluţia energetică. din spectrele XPS se pot obţine concentraţiile relative ale elementelor pe suprafaţă ca de exemplu: x%Si. Trebuie menţionat că acest tip de analiză se realizează maximizând semnalul obţinut (sensibilitatea) cu preţul degradării rezoluţiei.electroni înregistraţi pentru o stare atomică este regiunea de cuantificare. Pentru a realiza măsurători de încredere şi pentru a putea face intercompararea rezultatelor cu alte laboratoare. În marea majoritate a cazurilor primul pas în analiza probei este acela de a înregistra spectrul pe scala energetică maximă disponibilă a spectrometrului pentru a determina elementele prezente pe suprafaţă (survey analysis). Aşadar. Mai mult. concentraţiile relative ale stărilor de oxidare ale unui singur element ( x% Si4+. în consecinţă. În figura 1 este ilustrat un spectru survey analizat folosind un tabel de cuantificare din baza de date a software-ului de prelucrare a datelor (Casa XPS) pentru regiunile selectate. z%Si2+.

pentru materialele izolatoare electronii emişi trebuie înlocuiţi de la o sursă externă . compensarea de sarcină nu înseamnă neapărat neutralizarea suprafeţei probei ci mai mult stabilizarea suprafeţei probei a. C1s.d.v. Ca. Si şi Mg. Pentru probe conductoare conectate electric la suport echilibrul de sarcină este restabilit uşor. B. electric. Este important de menţionat că. În absenţa compensării efective de sarcină . energia masurată pentru o linie fotoelectrică poate varia în funcţie de energia cinetică a electronilor. este deplasată cu 120 eV între cele doua situaţii (cu compensare de sarcina şi fără). O. Pentru ilustrarea acestui efect.un tun de electroni de energie joasă (flood gun) pentru a restabili o stare de echilibru d. î. mai mici (energii de legătură mai mari).Figura 1 Exemplificare spectru XPS cuantificat pe o probă cu conţinut de C. Linia spectrală a carbonului. forma liniilor spectrale sa fie cea mai bună concomitent cu asigurarea că distanţa dintre vârfuri între tranziţii este inde426 . figura 2 prezintă spectrul unei probe înregistrat înainte şi după compensarea de sarcină [1].p.

Si şi O: a) În absenta neutralizării (flood gun off). concretizate deja în lucrări ştiinţifice importante. Un experiment în care compensarea de sarcină este făcută corespunzător necesită de obicei deplasarea în energia de legătură folosind pagina “ Calibration property” din programul de cuantificare al spectrelor. spectrul este deplasat cu 120eV şi distorsionat b) În prezenţa neutralizatorului de sarcina dar cu parametrii de lucru selectaţi incorect. vârfurile sunt largi. Straturile de oxid pe materialele metalice pot transforma un material conductor într-o suprafaţă izolatoare care astfel necesita tratarea lor ca un material izolator. pe o proba cu conţinut de C.pendentă de energia la care sunt măsuraţi electronii. acumularea de sarcina este compensată insuficient c) Suprafaţa probei neutralizată corect. vârfurile au forma foarte îngustă Măsurătorile XPS prezentate mai jos reprezintă sinteza unor studii complexe pe diferite tipuri de materiale. Figura 2 Efectul compensării de sarcină în spectrul XPS. Casa XPS. aceste măsurători furnizează informaţii relevante despre limitele şi posibilităţile de îmbunătăţire ale acestei tehnici de analiză. De exemplu. Avantajele utilizării monocromatorului sunt: reduce semni427 .6 eV). Obţinerea unei energii de legătură corecte pentru o tranziţie cunoscută nu e neapărat un indicator al unei bune neutralizări de sarcină. [1]. Măsurătorile au fost realizate cu ajutorul unui echipament de tip SPECS PHOIBOS 150 MCD echipat cu o sursă AlKα monocromatică (hν=1486. cu scopul de a pune în evidenţă performanţele tehnice ale echipamentului folosit. metalul Al oxidează chiar şi în vid iar stratul subţire de oxid se comportă ca un izolator. însă forma vârfurilor este bună şi poziţiile relative ale vârfurilor sunt stabile. Mai mult.

În Fig. asigură o rezoluţie energetică şi spaţială foarte bună. transmisie în ultraviolet (UV) şi caracteristici optice. cu cele obţinute şi publicate recent [2] în literatura de specialitate cu un echipament similar. Se observă că.875 Intensitate ( u.ficativ fondul de radiaţie. î.375 (a) O1 (b) 540 535 530 525 520 Energie de legatura (eV) 540 535 530 525 520 Energie de legatura (eV) Figura 3 Deconvoluţia spectrului O1s de înaltă rezoluţie: (a) aşa cum a fost sugerată in literatură.2 eV.10-10 mbar.6 x=0. Materialele oxidice cu structură vitroasă pe bază de Bi2O3 prezintă interes foarte mare atât din punct de vedere ştiinţific cât şi tehnologic deoarece prezintă proprietăţi fizice mai bune decât alte sticle: coeficienţi de expansiune termică mari. Autorii au propus descompunerea spectrelor O1s obţinute pentru acest sistem în două componente : O1 – asociată legăturilor de tip B-O-B şi O2 atribuită legăturilor B-O-Bi şi Bi-O-Bi.875 O1s as prep x=0. temperatură de topire joasă.6 x=0. indicată în fig. pe acelaşi tip de probe. spectrul O1s se deplasează spre energii de legătură mai mici. Măsurătorile se realizează utilizând o sursă de raze X de putere 250 W.3a prin linia punctată. ) x=0. cu creşterea lui x. Proba care urmează a fi analizată este fixată pe un suport de molibden cu ajutorul unei benzi dublu adezive de carbon. Presiunea în camera de analiză este în intervalul 10-9. elimină sateliţii din spectru (vârfuri secundare care însoţesc tranziţiile de interes) . prezenţa O1s as prep x=0.375 O3 O2 x=0. a. Prin măsurarea probei B2O3 autorii au determinat poziţia vârfului O1s la o valoare a energiei de legătură de 533. 3a este prezentată descompunerea spectrului O1s urmărind scenariul propus în literatură. În acest studiu sunt comparate rezultatele XPS obţinute pentru sistemul (1-x) B2O3·xBi2O3 cu x = 25 – 65 cu echipamentul descris mai sus. a. (b) propusă în studiul nostru 428 .

Începând cu proba tratată termic la 700°C. 4B). spre deosebire de [3]. Acest tip materiale a atras o atenţie deosebită în ultimii ani [4. cu preponderenţa fazei de siliciu la suprafaţă. indică prezenţa oxigenului şi a carbonului de contaminare. vârful corespunzător oxigenului din reţeaua TiO2 (Ti-O-Ti) prezent în jurul valorii de 530.875. Analiza fotopicului Si 2p (102 eV) identifică formarea SiO2 (Fig. 5] în special pentru aplicaţii de fotocataliză.83 eV pentru cea tratată la 1400 eV. indică prezenţa TiO2 evidenţiat 429 . O2 şi O3 atribuite legăturilor de tipul B-O-B. asimetrică datorită suprapunerii mai multor componente specifice oxigenului din structura sistemului investigat (Fig. concentraţia legăturilor de tip Bi-O-Bi creşte. cu creşterea conţinutului de Bi. s-a reuşit o analiză mult mai detaliată a tipurilor de legături şi a modificărilor care apar la nivelul acestora în probe cu creşterea conţinutului de Bi. 3b este prezentată deconvoluţia spectrului O1s cu trei componente: O1.8 eV sunt bine separate (Fig. această componentă nu mai poate fi pusă în evidenţă. 4A. 4C).componentei B-O-B în spectru. în timp ce componenta atribuită legăturilor de tip B-O-B scade continuu a.5 eV şi cel corespunzător oxigenului în reţeaua SiO2 (Si-O-Si) observat la 532. nu mai poate fi clar evidenţiată. indicând o segregare a celor doua faze. şi de valorile energiilor de legătură ale oxigenului în B2O3 şi Bi2O3 raportate în literatură [3]. î. deoarece prezintă o fotoactivitate mult crescută faţă de oxidul de titan pur. 4B). 4D). Rezultatele XPS obţinute pentru sistemul cu raport Ti:Si 1:2. Bi-O-B şi Bi-O-Bi. acest studiu confirmă faptul că rezoluţia spectrelor înregistrate are un rol foarte important în analiza şi modul de interpretare a datelor.84 eV pentru proba netratată termic. Fotopicul O1s prezintă o formă complexă. O categorie de probe pe care au fost efectuate măsurători XPS în scopul evaluării modificărilor structurale induse la suprafaţa acestor sisteme prin aplicarea tratamentelor termice o reprezintă nanocompozitele pe bază de Si şi Ti preparate prin combinarea metodei sol-gel cu metoda uscării prin pulverizare. pentru proba cu x = 0. la 532. iar spectrul de înaltă rezoluţie corespunzător Ti 2p pentru substratul de Ti:Si 1:2 (Fig. Ţinând cont de echipamentul de înaltă rezoluţie utilizat în achiziţionarea acestor spectre (sursa -AlKα. împreună cu Ti. În Fig. Bi2O3 devine aşadar formator de reţea vitroasă ceea ce determina creşterea stabilităţii chimice a probelor. Si şi Gd. Prin creşterea temperaturilor de tratament termic acesta se deplasează de la 530. după cum se poate observa din spectrul survey prezentat în Fig. Astfel. Se observă că. Spectrul O1s pentru această probă constă din două componente atribuite legăturilor de tipul Bi-O-B şi Bi-O-Bi.monocromata) în laboratorul nostru.

pentru (a) proba netratată termic precum şi pentru probele tratate termic la (b) 350°C. (D) Ti 2p. cantitatea de Ti 2p la suprafaţă descreşte de la 12. (C) Si 2p.) (f) (e) (d) (c) (b) (a) 110 105 100 95 90 470 465 460 455 450 Energie de legatura (eV) Energie de legatura (eV) Figura 4A: Spectrele XPS survey pentru sistemul Ti:Si 1:2 (a) netratat termic. Formarea celor doi oxizi (SiO2 şi TiO2) este confirmată şi de forma vârfului O 1s (Fig. (d) 900°C.a. (c) 700°C.Ti LMM C KLL Gd 3d O KLL O 1s Gd 4d (A ) Si 2p C 1s (B) (f) (e) (d) (c) (b) (a) 545 540 535 530 525 Intensitate (u. fapt datorat îndepărtării oxigenului specific compuşilor organici sau grupărilor OH. După cum se poate observa din Tabelul 1.0 eV (Ti 2p3/2) şi 464. dar mai ales separării celor două faze. (d) 900°C. cum sunt atomii de Si în reţeaua SiO2. în timp ce cantitatea de Si 2p creşte de la 16. 430 . Acest fapt poate fi explicat printr-o migrare a titanului de la suprafaţă spre interior şi a siliciului din interior spre suprafaţă.05 %. (c) 700°C.5 eV (Ti 2p1/2).a. (e) 1100°C şi (f) 1400°C .Spectrele XPS de înaltă rezoluţie corespunzătoare (B) O 1s.28 % pentru proba netratată termic. respectiv tratat termic la (b) 350°C.87 % la 38. (e) 1100°C şi (f) 1400°C. Cantitatea de oxigen la suprafaţa probelor descreşte odată cu creşterea temperaturii de tratament.) Ti 2p (f) (e ) (d ) (c ) (b ) (a ) 1200 900 600 300 0 E n e r g ie d e le g a t u r a ( e V ) Energie de legatura (eV) (C) (D) (f) (e) (d) (c) (b) (a) Intensitate (u. la 2. reflectându-se astfel o substituţie a atomilor de Ti de către atomi cu o electronegativitate mai mare şi polarizabilitate mai mică.89 % pentru proba tratată termic la 1100°C. 4B). prin peak-ul de la 459.

688 64. Temperatura de tratament termic (ºC) Netratat termic 350 700 900 1100 1400 Compoziţia elementală (% at. Concentraţia relativă a principalelor componente.18 0.Tabel 1.331 Ti 2p 12.894 5. de la 101. excepţie făcând fotopicul de C 1s (Fig.76 29. probele spălate şi uscate au fost analizate cu ajutorul spectroscopiei XPS.367 7. 4B) sunt de asemenea deplasate spre energii de legătură mai mari.798 Gd 3d 0.640 58.9 eV pentru proba tratată termic la 1400°C.15 0.156 0. Pentru exemplificare sunt prezentate caracteristicile de adsorbţie a albuminei serice bovice (BSA) şi a fibrinogenului (Fg) la suprafaţa unui compus aluminosilicatic cu conţinut de Fe şi Y preparat prin metoda sol-gel (60%SiO220%Al2O310%Fe2O310%Y2O3 . Experimentele de adsorbţie a proteinelor s-au realizat prin imersarea compusului aluminosilicatic în lichid biologic simulat (SBF) îmbogăţit cu BSA.498 Si 2p 16.829 59.37 Spectrele de înaltă rezoluţie corespunzătoare Si 2p (Fig.875 24. B)).260 9. Ceramicele vitroase aluminosilicatice sunt foarte stabile în organism iar prin adăugarea oxidului de fier şi ytriu ele pot fi optimizate pentru aplicaţii simultane de hipertermie şi radioterapie [6].281 11. Pentru măsurători ulterioare pe probe funcţionalizate cu diverse tipuri de proteine este reco431 .procente molare). XPS ne permite de asemenea studiul biocompatibilităţii diferitelor tipuri de materiale. Prezenţa carbonului se explică prin expunerea probei la atmosferă.428 62. înainte şi după tratamentul termic.653 38.684 62.148 0.) O 1s 70. 5 (A.22 0. precum şi în soluţie tampon fosfatică (PBS) îmbogăţită cu Fg. Spectrul XPS survey înregistrat înainte de imersie prezintă doar fotopicuri corespunzătoare elementelor care intră în compoziţia sistemului (Y 3p. Motivul acestei deplasări este corelat cu deplasarea spectrelor O1s şi cu migrarea atomilor de Si spre suprafaţă odată cu creşterea temperaturii de tratament termic.43 eV pentru proba netratată termic la 102. Biocompatibilitatea este dictată de modul în care proteinele se adsorb la suprafaţa materialului odată ce acesta intră în contact cu mediul biologic. Fe 2p. După procedura de imersie. pentru sistemul Ti:Si 1:2. Si 2p şi Al 2p) pentru toate probele investigate.057 34.164 27. BSA şi Fg reprezintă principalele componente plasmatice şi proteinele relevante care se adsorb la suprafaţa biomaterialelor care intră în contact cu sângele. dar şi datorită benzii dublu adezive de carbon pe care a fost imobilizată proba pentru măsurare.549 2.

înainte şi după imersia în soluţiile de SBF/BSA.2 şi 400 eV.5.93 33.49 0.04 0. Tabel 2. Concentraţia relativă a principalelor componente. centrate la 398. caracteristice grupărilor C-NH2.16 2. Este de remarcat faptul că pentru suprafeţele funcţionalizate cu proteine. denotă o ataşare rapidă a proteinei la suprafaţa compusului. înregistrate deja după un timp de imersie de 5 minute.46 6.2 23 Fe 0.7 37.43 28. Rapoartele N:C de 0. 2 ore (c) şi 24 ore (d) de imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). Si 2p şi Al 2p a fost mai puţin evidentă datorită stratului de proteină format (Tabel 1. Deconvoluţia spectrelor de N 1s (Fig. O 1s O KLL C KLL N 1s Y 3p C 1s Si 2s Si 2p Al 2p (A) O KLL C KLL Fe 2p O 1s C 1s (B) N 1s Intensitate (u.19 1. detecţia elementelor Y 3p.08 37. concentraţia de azot a fost practic zero înainte de imersie în soluţiile cu proteină (Tabel 2.68 6. Timpul de imersie 0 5 min 2 ore 24 ore C 6.21 N 5.03 Y 0.67 Compoziţia elementală (% at.42 432 .75 0.18 0.47 25.54 36.21 35. Deoarece.a. Fotopicul N 1s înregistrat la aproximativ 400 eV este tipic pentru azotul din compuşii organici [8].) O Al Si 53.a.46 0. Fe 2p.) Fe 2p Y 3p Intensitate (u.) (d) (c) (b) (a) Si 2s Si 2p Al 2p O 2s (d) (c) (b) (a) 1200 800 400 0 1200 1000 800 600 400 200 0 Energie de legatura (eV) Energie de legatura (eV) Figura 5 Spectrele XPS survey înainte de imersie (a) şi după 5 minute (b).3 2.92 28.mandată utilizarea benzii de In în locul celei de C. În acelaşi timp. Măsurătorile XPS de concentraţie de azot pot fi utilizate şi ca metodă indirectă de determinare a cantităţii de proteină adsorbită la suprafaţă [7]. 6) de înaltă rezoluţie scoate în evidenţă două componente. 2). Rezultate similare au fost obţinute pentru ambele proteine (BSA/Fg) utilizate pentru funcţionalizare. datorită azotului prezent în fiecare aminoacid component al proteinelor. azotul poate fi utilizat ca un indicator sigur al ataşării proteinelor. analiza spectrelor survey indică fotopicuri corespunzătoare N 1s.77 25.71 1. 3).2 respectiv 0.

a.25 27.) 405 400 395 Energie de legatura (eV) 390 (a) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) Figura 6 Deconvoluţia spectrelor XPS de înaltă rezoluţie ale N 1s pentru BSA/Fg liofilizat (a) după 5 minute (b).41 0.08 29.52 O 53.Tabel 3.a.) (c) (c) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) (b) (b) Intensitate (u. În plus. 433 . înainte şi după imersia în soluţiile de PBS/Fg.69 11. (BSA).92 43.11 51.02 10.8 0.5 13. Intensitate (u.1 Si 36.16 - Analizele XPS confirmă creşterea conţinutului de azot după diferite perioade de imersie.77 15.75 0.a. produce un semnal de azot mai intens decât proteina mai mică. şi 24 ore (c) imersie în soluţiile de SBF/BSA (coloana stângă) şi PBS/Fg (coloana dreapta).18 0.02 Fe 0.81 48.01 Y 0. Timpul de imersie 0 5 min 2 ore 24 ore Compoziţia elementală (% at.02 0.) 410 405 400 395 390 410 Energie de legatura (eV) (a) Intensitate (u. (Fg). aşa cum este de aşteptat. Concentraţia relativă a principalelor componente. proteina mai mare.96 13.53 N 10.3 0.) C 6.26 23.83 Al 2.

fotopicul O 1s este evident lărgit şi se deplasează spre energii de legătură mai mici. semnalând formarea unor noi tipuri de legături specifice carbonului în proteine [8].a. respectiv Fg-ului la 531. este un indicativ al formării unui monostrat complet de proteină [9]. semnalele de înaltă rezoluţie ale C 1s (Fig.) (e) (d) (c) (b) (a) 292 288 284 280 276 272 Energie de legatura (eV) 292 288 284 280 276 272 Energie de legatura (eV) Figura 7 Spectrele XPS de înaltă rezoluţie ale C 1s înainte de imersie (a).2 eV (Fig.3 eV. ale C 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c).) (e) (d) (c) (b) Intensitate (u.a. 3) corespunde în mare parte oxigenului peptidic constituent al proteinelor. în cazul Fg-ului (Tabel 3). 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). datorită ataşării la suprafaţă a BSA/Fg-ului cu un conţinut scăzut în oxigen faţă de compusul oxidic utilizat (Fig.8). După imersia în soluţiile cu proteine.Potrivit rezultatelor publicate anterior privind adsorbţia proteinelor. 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). După imersia în soluţiile cu proteină. ale O 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c). evidenţiind ataşarea proteinelor la suprafaţa materialului şi totodată biocompatibilitatea materialului investigat [10-12]. 434 . conţinutul semnificativ diminuat al O 1s (Tabel 2. 7) sunt mai largi şi prezintă o formă asimetrică.8B) Astfel spectroscopia XPS a fost utilizată cu succes în acest studiu.a.) (B) (e) (d) (c) (b) (a) 545 540 535 530 525 545 540 535 530 (a) 525 Energie de legatura (eV) Energie de legatura (eV) Figura 8 Spectrele XPS de înaltă rezoluţie ale O1s înainte de imersie (a). pe baza componentei BSA-ului de la 530. o cantitate de 14% N.) (e) (d) (c) (b) (a) Intensitate (u. În cazul probelor imersate în soluţiile cu proteină. (A) (B) Intensitate (u. (A) Intensitate (u.a.

ce deschid noi oportunităţi în medicină. Au4f δ0 ΔE 0.3 0. (b) Spectrul XPS al benzii de valenţa (Au 5d) obţinut pe aceleaşi probe. 83. a.67 eV.Biomaterialele dopate cu particule nano ( Au.6 Intensitate (u.8CaO·7. Acest studiu publicat recent. Acest tip de materiale furnizează avantaje valoroase şi în diagnosticarea cancerului sau imagistica biomedicală. Mai jos sunt prezentate rezultatele XPS cu privire la nucleaţie şi procesul de creştere a nanoparticulelor de Au în sticla bioactivă CaO-SiO2-P2O5 tratată termic la diferite temperaturi. atribuiţi la trei specii de Au diferite: Auδ-. având despicarea. Spectrul Au4f este caracterizat de două componente spin-orbită. Au0 şi Auδ+.0 0. are importanţă ştiinţifică mare datorită faptului că demonstrează foarte clar legătura care există între dimensiunea nanoclasterilor care se formează în matrice şi modificările observate în spectrul Au4f şi cel al benzii de valenţă cu creşterea temperaturii de tratament a probei. ΔE = 3. 435 .72 şi 85. Identificarea speciilor de Au prezente în probe este foarte importantă deoarece studii recente au demonstrat faptul că toxicitatea nanoparticulelor de Au în tratamentul cancerului depinde de sarcina acestora [13].0 16 (b) 110 (a) 92 90 88 86 84 82 110 80 12 8 4 0 Energie de legatura (eV) Energie de legatura ( eV ) Figura 9(a) Spectrul XPS obţinut pentru Au 4f pe proba 0. Linia gri reprezintă spectrul obţinut pentru fiecare din cele trei probe fără nanoparticule de Au.3Au2O3·99.7[61.3 0. Deconvoluţia liniilor spectrale indica prezenţa speciilor de Au Auδ+. [14]. Ag) prezintă un interes crescut datorită caracteristicilor remarcabile ale acestora. Deconvoluţia spectrului Au4f înregistrat pentru probele tratate termic la 300 şi respectiv 500 °C prezintă trei dubleţi la energiile de legătură: 82. ) 300 300 0.5SiO2·30. Aceste rezultate furnizează dovezi experimentale complete pentru corelaţia dintre dimensiunea şi structura electronică a nanoparticulelor de Au care a fost prezisă teoretic.7P2O5] tratată termic la 110. 300 şi 500°C.0 0. Au 4f7/2 şi Au 4f5/2.3 0.95 eV. Au0 şi Auδ.în fiecare proba.6 0.6 T (°C) Au 5d T(°C) 500 δ+ 500 0.

Honma et al. 16. 6. 10. S. Hulshof MCCH. A. 4. 21:12327–12332. Neumann.. S. Prinz. Small 7. M. Prinz. M. Cavalu. 2009. Vanea. Dimitrov et al. J. Simon. Gonzalez Gonzalez D. et al. E.. V. V. 8. C. Phys. December 2010 Overgaard J. Int J Hyperther 2009. 55. Mat. Neumann. Y. Vanea. Structural characterization of some silicate xerogels and microspheres. 2006. (2008) 2325 Oana Ponta. V. D. Ciceo-Lucacel. Simon. Textor.T. 180. A. 43. Chem. Vanea. E. S. P. R. R. J Mater Sci: Mater Med. 9. E. Lewinski. Gispert.32-40. S1. 2002. Kjellin. 7. Phys. Radu. Glasses. N. 2008. Stenport. European Cells & Materials. Kennedy.P. Sul. R. Simon. 436 . 2. 100-112 (2002).1063/1. L. West. M. P. Solid State Ionics. of Solid State Chem. S. Bickford. V. V. Colaco. M. J Biomed Mater Res. S. J. 3. Michel. vol. R. 5. 20:1869-1879. A. R. Simon.. Langmuir 2005. 764–76. 163. Mocuta. Bibliografie 1. Y.78A:581-589. M. Ponta.3681307 14. O.L. J. A.C. Day. 25:323-334. Martins. Coughlin. Simon. Adv. Neumann. Brogueira. Drezek. A. Ponta and S. A New Era for Cancer Treatment: Gold-Nanoparticle-Mediated Thermal Therapies. J. S. Saramago. 2011 T. 13. E. 10. G. PhD Thesis. L. P. Simon. Serro. 257(2011) 2346-2352 L. S. doi:10. Dahl O. Benea. Mella O. 169-183. Arcangeli G. No. M. Simon. B. D. Arvidsson. Cavalu..2. Applied Surface Science. Simon. M. V. H. 12. F. 11. XPS study of protein adsorption onto nanocrystalline aluminosilicate microparticles. Hu. M. “Dual-Beam” Charge Neutralisation for monoXPS T. Currie. 2009. 9. Pasche S. Opt. J. O. Appl. Castner.

.......................................................1...................... 438 1.............. 447 3... Consideraţii teoretice .............. 449 4.. 447 3.3............................................................... 451 1............ Hamiltonianul de Spin .............................XII...................... SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN Spectroscopia de rezonanţă electronică de spin C..............................................1................................................. 447 3............................ 437 1......... Bibliografie ................... Metoda constă 437 ..................................................................... Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1....................2................................................. Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 ..........S.................. Principiul de funcţionare al unui spectrometrul RES........ 443 3.......2.................... RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale........................................ dr............ Obţinerea şi analiza spectrelor RES .. Spectrometrul portabil RES ADANI PS8400 ......................................................................................... Interacţiunea Zeeman ......................... Consideraţii teoretice Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor energetice ale centrilor paramagnetici..................................... 441 2.......... Caracterizarea instalaţiei experimentale RES .....

1. în domeniul microundelor. 4. 2]. Sisteme cu electroni de conducţie (metale şi semiconductori). ştiinţa materialelor. lichidă sau gazoasă. În cazul experimentelor de Rezonanţă Magnetică Nucleară (RMN). antropologie. 5. Interacţiunea Zeeman Metoda RES constă în studiul tranziţiilor induse între două subnivele Zeeman vecine.). geologie. Ioni ai metalelor tranziţionale şi ai pământurilor rare [1. este folosită în cazul experimentelor RES. 2. Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. procesele electrochimice. Biradicalii (molecule ce conţin doi electroni neîmperecheaţi. Solidele. schimbul electronic. astfel încât interacţiunea lor să fie slabă). Frecvenţa de ordinul gigahertzilor (GHz). etc.1. suficient de depărtaţi unul de altul. sub acţiunea unui câmp de microunde cu o anumită frec438 . ESEEM şi ENDOR) în conjuncţie cu RES este posibil să se obţină informaţii detaliate privind unele teme de interes ştiinţific.în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. etc. Astfel. un electron prins într-o vacanţă ionică negativă. chimie. spectroscopia RES a fost cu succes aplicată în diverse domenii ca biologie. Sistemele tipice care pot fi studiate prin RES sunt: 1. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi (de exemplu. ştiinţele medicale. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. Radicalii liberi în stare solidă. 6. cataliza şi reacţiile de polimerizare au fost toate studiate cu mare succes. De-a lungul anilor. structura cristalină. cel mai cunoscut din această clasă este centrul F. fizică. 3. atomii interstiţiali dintr-un cristal sau matricea unei sticle. lichidele şi gazele sunt deopotrivă accesibile spectroscopiei RES. De exemplu. 7. frecvenţele utilizate sunt de ordinul megahertzilor (MHz) din domeniul vizibil la cel ultraviolet. procesele de cinetică.2]. Defecte punctuale (imperfecţiuni localizate în cristale) în solide. Prin utilizarea unor tehnici specializate variate (cum ar fi metoda capcanelor de spin şi a radicalilor nitroxidici. Sisteme cu stare fundamentală de triplet (cu doi electroni neîmperecheaţi care interacţionează puternic). Sisteme cu trei sau mai mulţi electroni neîmperecheaţi.

netic de spin care poate lua valoarea M S → → (2) β = γ ⋅ . se cunoaşte faptul că electronul posedă o proprietate cuantică numită “spin”. 439 . care este privită clasic ca o rotaţie în jurul propriei axe. Diferenţa de energie în spectroscopia RES este predominant datorată interacţiunii electronilor neîmperecheaţi din probe cu câmpul magnetic produs de un magnet. Astfel regulile de selecţie impuse sunt Δ M S = ± 1 şi Δ M I = 0 . ecuaţia (2) poate avea doar două forme pentru o orientare dată a câmpului magnetic B: ⎛ 1⎞ E↑ = +⎜ ⎟ ⋅ β ⋅ g ⋅ B ⎝ 2⎠ . ⎛ 1⎞ E↓ = −⎜ ⎟⋅ β ⋅ g ⋅ B ⎝ 2⎠ (3) Regula de selecţie pentru tranziţia unui spin electronic este Δ M S = ± 1 .0023.este momentul cinetic de spin. Asemenea tranziţii corespund la o schimbare în momentul unghiular de spin de ( ± ). Astfel. iar MS este numărul cuantic mag= ± 1 2 . Din această cauză dacă Δ M S = + 1 când un foton este absorbit M I (numărul cuantic magnetic nuclear) trebuie să rămână neschimbat pentru ca momentul unghiular total să se conserve. în energie. iar γ este raportul giromagnetic electronic. Diferenţa dintre cele două direcţii ale spinului. În urma absorbţiei de energie electronii trec de pe nivelul de energie inferior pe unul superior. depinde de intensitatea câmpului magnetic aplicat. Un foton are momentul unghiular intrinsec egal cu . orientarea spinului trecând din cea paralelă cu câmpul în poziţia antiparalelă cu acesta. Ca urmare a acestei rotaţii electronul posedă un moment cinetic de spin S căruia i se asociază un moment magnetic μ S : → → μ S = −g ⋅γ ⋅ S → → (1) unde g este factorul Landé care pentru electronul liber are valoarea 2.venţă numită frecvenţă de rezonanţă [1]. Astfel. paralelǎ sau antiparalelǎ cu câmpul magnetic. spinul electronului poate avea două orientări. efect denumit efect Zeeman. S . Energia interacţiunii Zeeman a unui electron într-un câmp magnetic aplicat B este dată de relaţia: E Zeeman = − μ s ⋅ B = g ⋅ β ⋅ B⋅ M S unde β este magnetonul Bohr. Introdus într-un câmp magnetic static B.

ν frecvenţa de rezonanţă. iar B câmpul magnetic aplicat.Cu alte cuvinte. Nivelele energetice şi absorbţia de rezonanţă RES pentru interacţia Zeeman a unui electron (S = 1/2) În (Fig. având o frecvenţă fixă de oscilaţie ν şi deci energia (h·ν). De obicei linia de absorbţie nu este singulară apărând uneori un spectru de multipleţi datorită existenţei nucleelor magnetice în specia paramagnetică. Parametrul g determină poziţia liniei de absorbţie. spectrul RES măsoară energia necesară tranziţiei electronului (ΔE) între cele două nivele energetice. de obicei se obţine de la o sursă de energie electromagnetică. De asemenea. într-un câmp magnetic exterior. Figura 1. Spectrul de absorbţie măsurat la condiţia de rezonanţă este schematic reprezentat în partea de jos a figurii. Această energie. 440 . 1) sunt reprezentate schematic energiile Zeeman funcţie de magnetizarea câmpului aplicat B. în cazul unui electron neîmperecheat (S=1/2). Rezultă de aici condiţia de rezonanţă: h ⋅ν = g ⋅ β ⋅ B (4) unde h este constanta lui Planck. figura ilustrează tranziţia între nivelul de energie inferior « spin jos » şi nivelul de energie superior « spin sus » indusă prin introducerea probei în câmpul de microunde de frecvenţă ν.

reprezintă energia ionului liber care nu depinde de spin. Cel mai simplu formalism pentru interpretarea spectrelor RES este cel al hamiltonianului de spin. ƒ HD – descrie proprietăţile diamagnetice. iar ultimii doi sunt termenii ce dau structura fină. În esenţă hamiltonianul de spin este un operator echivalent care acţionează numai asupra coordonatelor de spin conducând la aceleaşi rezultate ca şi hamiltonianul total al sistemului. Toţi coeficienţii tensoriali din expresia hamiltonianului de spin se exprimă prin matrici care pot fi diagonalizate.1. rămân în hamiltonian numai termenul Zeeman şi termenul în D. ƒ HN – reprezintă termenul interacţiunii hiperfine. Starea unui ion paramagnetic având spinul nuclear nenul. HLS – este interacţiunea spin – orbită. este descrisă printr-un hamiltonian compus din mai mulţi termeni [1]. termenul E fiind 0. HSS – reprezintă interacţiunea de structură fină în aproximaţia de ordin II (sau termenul de despicare în câmp nul). Hamiltonianul de spin conţine o serie de coeficienţi care sunt mărimi tensoriale. ƒ HQ – interacţiunea electrostatică cu momentul de cuadrupol q al nucleului. 441 (5) ƒ ƒ ƒ . şi anume: H=H0+HLS+HSS+HZ+HN+HQ+HD+HC unde. D şi E reprezintă constantele de despicare în câmp nul. ƒ HZ – reprezintă interacţiunea electronului cu câmpul magnetic exterior (termenul Zeeman). axială. deci depind de forma funcţiei de undă şi de câmpul cristalin. Hamiltonianul de Spin Fenomenul RES poate fi tratat teoretic prin două metode: tratarea clasică cu ajutorul teoriei lui Bloch şi tratarea cuantică.2. Folosind teoria perturbaţiilor se ajunge la forma bine cunoscută a hamiltonianului de spin: 1 ⎤ 2 2 2 Hs = β ⋅ ( g xx S x Bx + g yy S y By + g zz S z Bz ) + D ⋅ ⎡ ⎢S z − 3 S (S + 1)⎥ + E ⋅ (S x − S y ) (6) ⎣ ⎦ Primul termen din acest hamiltonian este aşa numita interacţiune Zeeman. Dacă simetria este axială. respectiv rombică. ƒ HC – termenul câmpului cristalin şi reprezintă influenţa câmpului electrostatic cristalin. H0 . introdus într-o reţea cristalină şi aşezat într-un câmp magnetic static.

şi are următoarea formă: H = g ⋅ β ⋅ B ⋅ SZ (7) unde direcţia câmpului magnetic este aleasă ca fiind axa z. Pentru un singur electron cu g anizotrop hamiltonianul de spin este mai complicat din cauza diferiţilor operatori ai proiecţiei spinului. Hamiltonianul de spin care descrie starea energetică a unui centru paramagnetic electronic în interacţiune cu n nuclee cu spinul nuclear diferit de zero va fi: H = → → ~⋅ S + S ⋅ A ⋅ I i β ⋅ B⋅ g ∑ i i =1 → → n → ~ → (10) unde. descrisă de hamiltonianul de mai sus. în cazul unor simetrii nesferice atât g. De exemplu. cât şi Ai sunt mărimi tensoriale. BX este componenta câmpului magnetic de-a lungul direcţiei perpendiculare (x).Cea mai simplă formă a hamiltonianului de spin este pentru un singur electron cu g izotrop. Acest termen reprezintă interacţiunea momentului cinetic de spin I cu momentul de spin electronic S . pentru o simetrie axială hamiltonianul de spin are următoarea formă: H = g // ⋅ β ⋅ B Z ⋅ S Z + g ⊥ ⋅ β ⋅ B X ⋅ S X (8) unde BZ este componenta câmpului magnetic de-a lungul axei z (paralel). SZ este operatorul de spin corespunzător proiecţiei acestuia după axa z. Termenul HN (ecuaţia 5) reprezintă termenul interacţiunii hiperfine. Ordinul de mărime al energiei hiperfine este de 0 ÷ 10-2 cm-1. Dacă câmpul magnetic este direcţionat paralel cu direcţia axelor moleculare atunci situaţia este identică cu relaţia (7). Tocmai această interacţiune produce structura hiperfină a nivelelor energetice de spin. Interacţiunea dintre momentul magnetic de spin şi un moment magnetic nuclear se numeşte interacţiune hiperfină. Hamiltonianul de structură hiperfină produce o despicare simetrică a nivelelor energetice şi are următoarea formă: HN → ~ → = S⋅ A ⋅ I (9) unde A este tensorul interacţiunii hiperfine. 442 . fără interacţiuni hiperfine corespunzător ecuaţiei (4).

Măsurătorile RES se pot efectua pe probe gazoase. rezultă că se obţine o rezoluţie spectrală mult mai bună o dată cu creşterea frecvenţei de microunde. ceea ce duce la scăderea sensibilităţii. există limitări tehnice legate de utilizarea benzilor de frecvenţă ridicate: folosirea de probe de dimensiuni mici. Pentru un electron liber. pulberi şi monocristale. soluţii îngheţate. g rămâne apropiat de valoarea electronului liber. provocat de mişcarea orbitală. se datorează unui slab câmp perturbator indus. Unul din factori este datorat faptului că electronul posedă în plus un moment unghiular orbital căruia i se asociază un moment magnetic.2. creşterea absorbţiei o dată cu creşterea frecvenţei. În celelalte cazuri. obţinând o valoare a lui Δg pozitivă sau negativă. notată Δg. Factorul g este o mărime tensorială caracterizată prin trei valori principale. având în vedere posibilităţile de absorbţie şi de a da semnal RES al sticlei obişnuite. dificultăţi de obţinere a omogenităţii câmpului (δH/H) la frecvenţe mari. Spectrul RES al unui centru paramagnetic cu spinul ½ este bine definit dacă se cunosc tensorii g (factorul de despicare spectroscopică) şi A (constanta de despicare hiperfină). pentru probe sub formă de soluţii. abaterea factorului g de la valoarea 2. este indicat a se folosi cuarţul.5 GHz) şi Q (∼ 35 GHz). Pentru radicalii liberi.0023. În expresia factorului g. Cu toate acestea în probele care conţin centri paramagnetici intervin o serie de factori care abat valoarea factorului g de la valoarea amintită mai sus. momentul de spin şi cel orbital se pot combina. valoarea factorului g este ge = 2. Probele se introduc de obicei în tuburi şi. Aceşti tensori dau cele mai importante informaţii cu privire la structura centrului paramagnetic studiat. în afara unei mărimi constante intervine o mărime care dă abaterea factorului g de la valoarea corespunzătoare electronului liber. În sistemele chimice. Tuburile au diametre de câţiva milimetri şi lungimi de ordinul centimetrilor. Acest câmp perturbator se poate adăuga sau scădea la câmpul exterior. Deoarece sensibilitatea instrumentului creşte proporţional cu pătratul frecvenţei. Valoarea lui g definită prin 443 . Totuşi. Obţinerea şi analiza spectrelor RES În experimentele RES cele mai utilizate benzi de frecvenţe de microunde sunt benzile X (∼ 9. trebuie luate în considerare contribuţiile la momentul magnetic ale mişcării orbitale a electronului. În felul acesta în sisteme cu un electron neîmperecheat şi legătură π.0023. Astfel. electronii neîmperecheaţi ocupă un orbital care poate fi localizat pe un singur atom sau poate fi delocalizat pe o întreagă moleculă sau pe un radical.

relaţia g = h ⋅ν . acestea sunt influenţate atât de caracteristicile fizico-chimice ale substanţei paramagnetice.0036. dar poate ajunge la 9. De obicei se lucrează în banda X. Liniile de rezonanţă ale probelor solide sunt considerabil distorsionate de anizotropia factorului g sau de cuplajul dintre spinii electronici şi nucleari. utilizând valorile măsurate ale frecvenţei şi câmpului la rezonanţă. în particular prin alterarea timpului de relaxare spin-reţea. În ceea ce priveşte forma şi lărgimea semnalului RES.00 . mai rar scade mult sub această valoare.0. În experimentele RES uzuale efectuate în undă continuă se fixează frecvenţa şi se variază inducţia câmpului magnetic aplicat. 444 . Pentru a determina valoarea factorului g mai uşor. L şi S astfel: g =1+ J ⋅ ( J + 1) + S ⋅ ( S + 1) − L ⋅ ( L + 1) 2 J ⋅ ( J + 1) (11) unde J – numărul cuantic total. factorul g este calculat din condiţia de rezonanţă. Prezenţa anumitor tipuri de interacţiuni are ca efect lărgirea sau îngustarea liniei de rezonanţă. fiind necesar un câmp magnetic de ∼ 3300 G. cunoscută şi sub denumirea de g efectiv (gef ). se poate introduce în cavitatea de rezonanţă pe lângă proba de studiat şi un etalon. pentru semnale cu g ~ 2. cât şi de condiţiile experimentale. Valoarea lui g depinde de orientarea câmpului magnetic extern în raport cu cel electric cristalin şi este o mărime tensorială. Acestea sunt exemple de tehnici neliniare. L – numărul cuantic orbital. pentru care g = 2. poate fi β ⋅B diferită de 2. valoarea lui g pentru un sistem paramagnetic oarecare se calculează utilizând următoarea relaţie: g = g etalon ⋅ B etalon B proba (12) Există posibilitatea de a combina metode în care pot fi îndeplinite mai multe condiţii de rezonanţă pe lângă cele referitoare la spinul electronic. de exemplu ENDOR (Electron Nuclear DOuble Resonance) şi ELDOR (Electron Electron DOuble Resonance). Astfel. Cel mai uzual radical utilizat ca etalon pentru marcarea câmpului magnetic este DPPH (difenilpicrilhidrazil).00 sau mai mult. S – numărul cuantic de spin. Impurităţile paramagnetice pot de asemenea distorsiona semnalul RES. Astfel. deoarece ambele depind de saturaţie [3]. În acest caz valoarea factorului g depinde de numerele cuantice J. iar această ecuaţie reprezintă formula lui Lande.

445 . fluctuaţiile datorate mişcării spinilor în câmpul magnetic local. Liniile lărgite omogen. atunci când lărgirea nu este provocată de interacţiunile anizotrope. Lărgirea liniei RES poate fi omogenă sau neomogenă. sunt simetrice şi au o formă aproximativ Lorentziană (Fig. saturarea sistemului de spini cu o putere excesivă. apărute în urma unor fluctuaţii dinamice în sistemul de spini (variabile în timp). În cazul lărgirii omogene toţi spinii din probă răspund ca o unitate acţiunii cuantelor de microunde.Dintre factorii instrumentali care pot influenţa forma semnalului RES. Figura. dipolare dintre spini cu frecvenţe Larmour diferite. linii care au maxime de absorbţie uşor diferite între ele datorită distribuţiei de câmp magnetic local în probă. Cauzele care determină lărgirea neomogenă sunt : interacţiunea dipolară între spinii de acelaşi tip. linia de rezonanţă are în general o formă intermediară între cele două cazuri limită.2 Forma Lorentzianǎ şi gaussianǎ a liniilor RES Dacă numai anumite grupuri de spini sau pachete de spini din probă pot absorbi direct cuantele de o frecvenţă particulară. Liniile lărgite neomogen sunt înfăşurătoarele liniilor lărgite omogen corespunzătoare diferitelor pachete de spini. diversele scheme de modulaţie utilizate pentru a creşte detecţia. atunci linia este lărgită neomogen. avem: neomogenitatea câmpului magnetic static B0. neomogenităţilor câmpului magnetic static. neliniaritatea amplificatorului sau a detectorului. absorbind cuantele la o valoare bine determinată a câmpului magnetic. Pentru sistemele reale. relaxarea spin – reţea.2). Această linie este îngustă în zona centrală şi are o descreştere lentă spre extreme. difuzia de spin. interacţiunea dintre spinul electronic şi câmpul de microunde. Liniile lărgite neomogen. Cauzele lărgirii neomogene sunt fluctuaţii spaţiale de câmp magnetic şi sunt datorate prezenţei unor interacţiuni hiperfine. se apropie de o formă Gaussiană. anizotropiei tensorilor g şi de structura fină.

Factorul de despicare spectroscopică g are valoarea foarte apropiată de cea corespunzătoare electronului liber (g = 2. În cazul când electronii paramagnetici înconjoară mai multe nuclee cu spini nucleari diferiţi. căci apar (2I1+1)(2I2+1)…. deoarece majoritatea radicalilor detectaţi sunt radicali centraţi pe carbon sau azot. Studiile efectuate au pus în evidenţă la spectrele de rezonanţă ale radicalilor liberi. Prezenţa structurii hiperfine la radicalii liberi se datorează interacţiunii magnetice a electronului cu spin neîmperecheat cu momentul magnetic al nucleelor cuprinse în orbita acestui electron. II. descifrarea structurii hiperfine a spectrelor este destul de complicată. iar poziţia spectrelor este aproximativ aceeaşi în câmpul magnetic [4]. structura hiperfină a spectrelor RES (când este bine rezolvată) furnizează informaţii mai importante despre radicali decât valoarea factorului g. spectrul va avea (2nI+1) linii de structură hiperfină. II.. de faptul dacă aceste nuclee sunt identice sau nu. intensitatea lor şi valoarea despicării hiperfine depind de numărul nucleelor cuprinse în orbita electronului paramagnetic.În cazul radicalilor liberi generaţi prin iradiere γ în sisteme biofarmaceutice şi de interes biomedical. care permite în multe cazuri identificarea radicalilor liberi. identificarea radicalului liber studiat. Lărgimea liniei este de obicei mică. determinată de numărul de nuclee cuprinse în orbita electronului şi de gradul de localizare al electronului la fiecare dintre aceste nuclee. III. I. foarte precise. aşezate la intervale egale şi cu intensităţi care sunt mai mari în centrul spectrului şi descresc spre margini. Prezenţa unei structuri hiperfine caracteristice. caracterizate printr-un număr cuantic I. Valoarea factorului de despicare spectroscopică g apropiată de cea a electronului liber. 446 . Când orbita electronului cuprinde cu egală probabilitate un număr n de nuclee identice.0023). totuşi unele măsurători RES. în majoritatea cazurilor.(2In+1) linii de egală intensitate. au reuşit să pună în evidenţă dependenţa factorului g de structură într-o serie de substanţe organice [2]. o serie de particularităţi [1]: I. şi de densitatea de electroni cu spini neîmperecheaţi la fiecare dintre aceste nuclee. structura hiperfină permite. Numărul liniilor de structură hiperfină. Prin aceasta. dar situate la intervale neegale. arată că la radicalii liberi există o interacţiune spin-orbită foarte slabă şi electronii cu spinii neîmperecheaţi au un grad mare de localizare. Factorul g nu permite identificarea radicalilor liberi. structura fină lipseşte pentru că spinul este egal cu ½ . Fiecare radical liber are o structură hiperfină caracteristică.

Toate aceste elemente se găsesc cuplate prin intermediul probei de studiat care se află sub acţiunea câmpului magnetic static şi al câmpului de microunde. Structura hiperfină a spectrelor apare în special în cazurile când electronii cu spin neîmperecheat sunt electroni s sau σ. III. cu lungimea de 20 cm şi diametrul interior de 1mm. Caracterizarea instalaţiei experimentale RES 3. Spectrele RES se înregistrează la temperatura camerei cu ajutorul spectrometrului “ADANI Portable EPR Spectrometer PS8400”. care operează în banda X (9. Astfel. Interacţiunea hiperfină izotropă sau interacţiunea hiperfină de contact (interacţiunea de contact Fermi). deoarece în multe cazuri interacţiunea hiperfină anizotropă nu se rezolvă şi are ca efect doar o lărgire a liniilor de rezonanţă sau o anizotropie a formei şi lărgimii liniei.Există două tipuri de interacţiuni hiperfine: interacţiunea hiperfină anizotropă şi interacţiunea hiperfină izotropă.6 GHz) şi 447 . Principiul de funcţionare al unui spectrometru RES Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static al polarizării induse de o probă electromagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale particulelor paramagnetice.1 GHz ÷ 9. Lărgimea liniei fiind mică permite determinări foarte precise de concentraţie a radicalilor liberi şi separarea efectelor diferiţilor radicali prezenţi în acelaşi timp în proba studiată. 3. o cavitate de microunde şi un sistem computerizat pentru înregistrarea şi observarea fenomenului de rezonanţă. are loc între nucleul cu moment magnetic nenul şi electronii cu spini neîmperecheaţi. spectrometrul RES se compune dintr-un electromagnet capabil să creeze un câmp magnetic static B. un generator de microunde. Interacţiunea hiperfină anizotropă este interacţiunea de tip dipol magnetic între electronul cu spin neîmperecheat şi nucleul cu moment magnetic diferit de zero. un detector. a căror densitate la locul nucleului este diferită de zero. Interacţiunea hiperfină izotropă este partea principală a interacţiunii hiperfine în radicali liberi. De asemenea lărgimea mică a liniilor facilitează studiul structurii hiperfine.1. Structura fină lipseşte în cazul radicalilor liberi cu un singur electron neîmperecheat. în general despicarea hiperfină fiind mai mare decât lărgimea componentelor hiperfine. în care se introduce proba. 3. măsurătorile se efectuează folosind capilare speciale de sticlă.2. Spectrometrul portabil RES ADANI PS8400 În cazul tuturor experimentelor.

Spectrometrul poate opera în următoarele condiţii : temperatura mediului cuprinsă între (+18°C) şi (+28°C) . Modulaţia se realizează cu un semnal de frecvenţă ν = 100 kHz. lucrează în modul TE102 şi are un factor de calitate Q = 5000. iar Δν lărgimea la semiînălţime a rezonanţei. Puntea de microunde este o cutie de metal care ajută la amplificarea semnalelor slabe provenite de la probe. Canalul de semnal cuprinde partea electronică necesară detectării senzitive în fază. 4). iar rezoluţia este de 0. Valorile de “offset” ale câmpului magnetic şi timpul de baleiere sunt controlate de către sistemul de achiziţionare computerizat.800mmHg) (Fig. Sursa de microunde este reprezentată de un oscilator “GUNN”. Factorul de calitate Q indică cât de eficient stochează cavitatea energia de microundă. Factorul de calitate este dat de relaţia Q = ν res . Cu creşterea factorului de calitate Q. sensibilitatea spectrometrelor creşte. unde νres este frecvenţa Δν de rezonanţă. Parametrii spectrometrului utilizaţi la achiziţionarea spectrelor RES sunt diferiţi. computerizat.3). 448 . “ADANI PS8400” Figura.07 Gauss /cm. 3 ADANI Portable EPR Spectrometer PS8400 Cavitatea de microunde este de formă rectangulară. Sursa de radiaţie electromagnetică şi detectorul de află într-o cavitate numită “punte de microunde”. umiditatea relativă între 20% şi 80%. şi presiunea atmosferică (840 GPa – 1066 GPa). Sensibilitatea spectrometrului RES tip “ADANI PS8400” este 5×106 spin /Gauss. în funcţie de probele care urmează a fi studiate. O baleiere a câmpului este divizată în 4096 de paşi discreţi. (630 mmHg . Schema bloc a spectrometrului portabil “ADANI PS8400” este redată în (Fig.care este echipat cu un sistem de achiziţie al datelor.

Figura.4 Schema bloc a spectrometrului “Portable ADANI PS8400” La fiecare pas. o tensiune de referinţă corespunzătoare valorii de “offset” a câmpului magnetic este trimisă către acea parte a controlerului care reglează bobinele de baleiere. Toate aceste componente lucrează împreună pentru achiziţionarea unui spectru de rezonanţă electronică de spin (RES).3. Rata de baleiere este controlată prin varierea timpului de aşteptare între paşii individuali. 3. Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 a) spectrele RES ale unor probe de hidroxiapatită cu fier 449 .

) Intensitate (u.a.b) spectrele RES ale unor probe vitroase şi vitroceramice care conţin fier [5]: g = 4.3 x (mol %) 70 60 Intensitate (u.) 50 40 30 20 10 1000 2000 3000 4000 5000 50 40 g = 2.a.3 x (mol %) 70 60 g = 4.0 30 20 10 Camp magnetic (G) 1000 2000 3000 4000 5000 Camp magnetic (G) c) spectrele RES ale unor medicamente: spectrul experimental spectrul experimental spectrul simulat spectrul simulat 3250 3300 3350 B(G) 3400 3450 3250 3300 3350 B(G) 3400 3450 d) spectrele RES ale unor radicali liberi [6]: T im p (zile) 7 E (92 z) 5 1 E (ini) 0 3320 3340 3360 B (G ) 3380 3400 3250 3300 3350 B (G) 3400 3450 450 .

Bibliografie 1. Damian. C.S. I. Spectroscopic study on iron doped silica-bismuthate glasses and glass ceramics. V. Simon. submis la Radiation Physics and Chemistry. Rezonanţa electronică de spin. Study of radicalizing mechanisms of irradiated drugs (Radiosterilization of pharmaceuticals: radicals). Dina Petrişor. David. 3. Rezonanţa electronică de spin. G. Crăciun.România. Gamma-irradiated ExtraVit M nutritive supplement studied by EPR spectroscopy . Cluj-Napoca. 5. Bucureşti. J. 2007 451 . Academiei R. Todea. Chimie Nouvelle. 12: 1356 -1359. 28-29. 61-64 (1980) L. O. 2. 352. S. Rezonanţa magnetică. Ed.Ursu. Simon. Crucq. (2001) A-S. Non-Cryst.4. Nicula. (1965) Al. Presa Universitară Clujeană. (1994) S. Chiş. Editura Didactică şi Pedagogică. M. 6. (2006) 2947. 4. Solids. Cozar.

......a C....S...............454 4.......465 1................ Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1.. monocristalelor........................ Introducere ...............453 3................ mineralogiei si geologiei..................... dr...........Spectroscopia de rezonanţă electronică de spin – partea a II. fizicii...... chimiei........... care pot fi investigaţi prin RPE sunt ionii metalelor de tranziţie şi elemente ale pământurilor rare sau centrii asociaţi cu sarcinile electrice sau cu defectele neutre........ pulberilor policristaline................. non-distructive si non-invazive..................... Spectrele RES înregistrate de asemenea în cazul: sistemelor necristaline... Introducere Spectroscopia de rezonanţă electronică de spin (RES) este una dintre cele mai eficiente metode....... Exemple de aplicaţii ale rezonanţei electronice de spin .... Bibliografie: ...... soluţiilor congelate sau în cazul soluţiilor lichide aduc contribuţii importante cercetărilor din domeniul materialelor... Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor 452 .......... Centrii paramagnetici..... biologiei............... Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) ................................................................................... folosită pentru caracterizarea ordinii locale şi a interacţiunilor magnetice în materiale organice si anorganice................452 2.....

radicali ai oxigenului. Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) Spectroscopia RES are aplicaţii în cadrul cercetărilor din diferite domenii cum sunt: fizică. studiul materialelor. În domeniul fizicii • concentraţii de spin • ioni paramagnetici ai metalelor de tranziţie. mediu. Cu ajutorul rezonanţei paramagnetice electronice (RES) pot fi studiate: a. geologie. RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale. medicină. Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. În domeniul chimiei • radicali liberi • cataliza • procese de oxidare si reducere • stări de triplet a moleculelor • compuşi organo-metalici şi zeoliţi • cinetica de reacţie şi reacţii de polimerizare c. deformări locale • electroni de conducţie în conductori şi semiconductori • interacţii magnetice şi cristaline • procese de recombinare la temperaturi scăzute b. NO în sisteme biologice • fotosinteza 453 . centrii de culoare. medicinii şi mediului • markeri de spin • antioxidanţi şi agenţi de contrast • oximetrie • radicali liberi în ţesuturi. chimie. pământurilor rare şi actinidelor • defecte paramagnetice.energetice ale centrilor paramagnetici. Metoda constă în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. 2. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. Astfel. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi. nanomateriale. În domeniul biologiei. aplicaţiile industriale etc.2]. biologie. nanoştiinţelor.

care operează în banda X (9. În domeniul aplicaţiilor industriale • controlul calităţii produselor alimentare iradiate • dozimetrie pentru procesele de iradiere • vârste şi datări de materiale cu aplicaţii în arheologie. În domeniul caracterizării materialelor • proprietăţi ale polimerilor • defecte în fibre optice • materiale laser • conductori organici şi anorganici cu dimensionalitate redusă • influenţa impurităţilor şi defectelor în semiconductori • proprietăţi ale noilor materiale magnetice • proprietăţi ale materialelor utilizate în spintronică. Exemple de aplicaţii ale rezonanţei electronice de spin Spectrele RES au fost înregistrate pe pulberi la temperatura camerei cu ajutorul unui spectrometru portabil RES “ADANI Portable EPR Spectrometer PS8400”. nanocompozite • efecte miez interior . optoelectronică • manganiţi cu magnetorezistenţa colosală • supraconductori oxidici cu temperatură de tranziţie ridicată • semiconductori f. În domeniul nanomaterialelor şi nanoştiinţelor • efecte ale reducerii dimensionalităţii • dinamica de spin în nanomateriale.1 GHz – 9. fullerene şi compuşi derivaţi • proprietăţi ale conducţiei electrice şi transportului polaronic 3.strat superficial ale nanoparticulelor magnetice • proprietăţi ale nanoparticulelor şi nanofirelor magnetice • interacţii magnetice dipolare şi de schimb: efectele dimensiunii • nanometrologie: dimensiune medie a nanoparticulelor metalice şi magnetice • caracterizare nanotuburi de carbon. metabolism şi toxicitate • factori poluanţi d. geologie • detecţia radicalilor în polimeri iradiaţi şi procese de coroziune • prospeţimea uleiurilor vegetale • controlul calităţii sticlelor optice speciale • procese oxidative în vopsele utilizate în industria auto e.6 GHz) şi este 454 .• detecţie de droguri.

3 de compoziţia probelor este ilustrată în Fig. pentru probele vitroase din sistemul 0. Linia de la gef ≅ 4. Spectrul conţine o linie principală de rezonanţă relativ largă cu gef ≅ 4. 1 Spectrele RES înregistrate pentru probele netratate termic Caracteristicile spectrului RES pentru diferite rapoarte Bi2O3/SiO2 sunt complet similare pentru toate probele netratate termic (Fig. Fe3+ Spectrele RES înregistrate.echipat cu un sistem de achiziţie a datelor. Observăm că linia de rezonanţă de la gef=4. pentru care termenul Zeeman este dominant . sunt reprezentate în figura 1. 2.3 se îngustează pe măsură ce înlocuim Bi2O3 cu SiO2 (Fig.0 sunt atribuite ionilor paramagnetici aflaţi în poziţii caracterizate de câmp cristalin relativ puternic unde termenii de câmp cristalin sunt comparabili sau mai mari decât termenii Zeeman [9. Dependenţa lărgimii acestor linii de la gef ≅ 4. 12].) 50 40 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura. computerizat.3 şi o linie foarte slab rezolvată la gef ≅ 2.0 sunt atribuite ionilor paramagnetici izolaţi în poziţii caracterizate de câmpuri cristaline relativ slabe. g = 4. în timp ce liniile cu gef>2. acesta fiind în stare S şi frecvent utilizat în investigaţiile RES ale sticlelor.3 este specifică tuturor sticlelor ce conţin ioni Fe3+ ca impuritate sau ca dopant în concentraţii mici [5-8].99[xSiO2·(100-x)Bi2O3].3 x (mol %) 70 60 Intensitate (u. 1) arătând că vecinătatea ionilor Fe3+ nu depinde foarte mult de compoziţia matricilor vitroase. Îngustarea liniei de 455 . Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static a polarizării induse de o probă paramagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale centrilor paramagnetici. Exemplul1.a. 2).01Fe2O3·0. Sticlele şi vitroceramicile studiate conţin ionul paramagnetic Fe3+ (3d5 6S5/2).0. Liniile de la gef=2.

4. Pentru un conţinut scăzut de SiO2 (x ≤ 30) linia dominantă se găseşte la gef ≅ 2. spectrele RES ale Fe3+ (Fig. scade cu x aşa cum se observă în Fig. 456 .0 este slab evidenţiat iar linia dominantă fiind cea de la gef ≅ 4.0 în timp ce linia mai puţin intensă se situează la gef ≅ 4. înregistrată pentru probele cu un conţinut scăzut de SiO2.3. atât cea de la gef ≅ 2. din jurul ionilor Fe3+ responsabili pentru acest semnal. Acest rezultat indică faptul că ordinea la scurtă distantă.3. 3) arată schimbările apărute în ordinea locală în jurul ionilor de fier.5O9. În cazul probelor cu conţinut ridicat de siliciu (60 ≤ x ≤ 70) sunt prezente ambele linii.6Si0.3 este înregistrat pentru toate probele şi lărgimea liniei este de aproximativ 200 G pentru toate compoziţiile. Lărgimea liniei de la gef ≅ 2. semnalul de la gef ≅ 2. În probele tratate termic.3 de compoziţia probelor Pentru probele cu un conţinut mai ridicat de SiO2 (40 ≤ x ≤ 50) şi în cazul cărora a fost identificată prin difracţia de raze X faza cristalină Bi5.0 cât şi cea de la gef ≅ 4. Forma liniilor RES descrie şi dezordinea din jurul ionilor de fier rezonanţi şi caracteristicile structurale ale matricilor vitroase în care sunt încorporaţi aceşti ioni de fier.4. 2 Dependenţa lărgimii liniilor de rezonanţă de la gef ≅ 4.0. Semnalul de la gef = 4. Caracteristicile spectrelor RES pentru ionii Fe3+ în probele tratate termic sunt evident modificate aşa cum se poate vedea în Fig. 3. 230 220 210 200 ΔB (G) 190 180 170 160 10 20 30 40 50 60 70 x (mol%) Figura.3. este caracterizată de un câmp cristalin relativ puternic şi poate fi asociat cu poziţiile fierului în reţeaua necristalină bogată în siliciu.rezonanţa pentru x>20 indică o vecinătate a ionilor Fe3+ mai uniformă în sticlele bogate în siliciu.

a. 4) ceea ce denotă tendinţa de ordonare structurală în jurul ionilor Fe3+ rezonanţi dispuşi în aceste poziţii.0 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura. Luând în considerare razele ionice pentru ionii Bi3+ şi Fe3+ şi starea lor identică de valentă. până la x = 30 şi este atribuit ionilor Fe3+ situaţi în poziţii cu câmp cristalin slab cu simetrie octaedrală.g = 4.0 de compoziţia probelor 457 . 3 Spectrele RES pentru probele vitroceramice Linia cu gef = 2.3 x (mol %) 70 60 Intensitate (u.0 este linie rezolvată numai pentru conţinut scăzut de SiO2 . este de aşteptat ca ionii Fe3+ să ocupe poziţiile Bi3+ din faza cristalină Bi12SiO20.) 50 40 g = 2. Remarcăm de asemenea că linia se îngustează cu creşterea conţinutului de SiO2 (Fig. 4 Dependenţa lărgimii liniei de la g ≅ 2. 160 150 140 ΔB (G) 130 120 110 100 90 10 20 30 x (mol %) Figura.

5O9. 6). 14].0 x=0 x=0 x = 0. Ti3+. pe lângă asemenea poziţii. cât şi o linie largă la g ≅ 2.5O9.9 2.14 x = 0.33 x = 0.14 spectrele RES ale ionilor de Gd3+ sunt similare şi reflectă o vecinătate relaxată a acestora în matricea amorfă. 2. dacă în probele cu x = 0 şi x = 0.9 2. Exemplul 2: Gd3+ a) Analizele de rezonanţă paramagnetică electronică au pus în evidenţă compoziţii diferite ale ionilor de gadoliniu în probe cu conţinut mai mare de bismut (Fig. 70) spectrele RES prezintă atât linia cu g ≅ 4.9 şi2.Linia de rezonanţă slab rezolvată atribuită ionilor de fier dispuşi în câmp cristalin slab pentru probele vitroceramice cu 40 ≤ x ≤ 50 mol % arată că doar o mică parte dintre ionii de Fe3+ sunt situaţi în poziţiile Bi3+ ale fazei δ (Bi5.5 1000 2000 3000 4000 5000 B(G) 1000 2000 3000 4000 5000 B(G) Figura 5 Spectrele RES ale probelor preparate prin metoda sol-gel Figura 6 Spectrele RES ale probelor tratate termic 30 minute la 400oC b) Gd3+. Acestea indică faptul că există poziţii în matricea amorfă unde ionii de Gd3+ se află în 458 .33 x = 0. După tratamentul termic la 400oC ionii de gadoliniu ocupă poziţii în interiorul fazei cristaline de tip Bi5. dar se observă şi linii mici la ≈ 5.6Si0. odată cu creşterea conţinutului de bismut. În probele în care se dezvoltă faza cristalină de tipul Bi2SiO5 ( x = 60. gadoliniul ocupă poziţii in regiuni cvasicristaline în acord cu modificarea difractogramelor acestor probe. Probabil că majoritatea ionilor Fe3+ să fie dispuşi în faza rămasă necristalină bogată în Si [13.5 4.3 x = 0.8 2.8. Astfel. vecinătatea lor fiind puternic distorsionată [3.0 5.4 (Fig. 5). vacante de oxigen Spectrele RES înregistrate în cazul microsferelor netratate termic sunt dominate de o linie largă centrată la g ≈ 2.14 x = 0. 10.4).6Si 0.0 specifică ionilor din poziţii în câmp cristalin slab dar în vecinătate distorsionată sau între care se manifestă interacţiuni dipolare [15].0 care reflectă o vecinătate relaxată în matricea amorfă. 4.8 5.3 specifică ionilor de Fe3+ în poziţii cu câmp cristalin intens din matrici necristaline. 11].

Lărgimea liniei spectrelor RES. g ≈ 2. care creşte în intensitate odată cu creşterea temperaturii de tratament. 459 . oxigenul difuzează din interior spre suprafaţă şi se formează în regiunea de sub-suprafaţă vacante de oxigen. Prin aplicarea tratamentului termic. se modifică în intervalul de temperatură investigat. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g. În conformitate cu Kolodiazhnyi şi Petric am atribuit aceste linii vacanţelor de oxigen la titan (VTi) cu spin electronic neîmperecheat.0. specific matricelor policristaline dezordonate care conţin ioni de Gd3+ destul de omogen distribuiţi.8. În timp ce atomul de O difuzează el generează doi atomi de titan cu configuraţie incomplete.0 din spectrele probelor tratate termic la 350. în câmp cristalin slab.3 este atribuită fierului (III) şi apare datorită tuburilor de sticlă în care se pune proba pentru a efectua măsurătoarea RES. unde se formează ionii de Ti3+. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g. Linia largă de la g ≈ 2. suprapus peste componenta spectrală.0 din spectrele RES.9. 7-14). Spectrele RES pentru microsferele tratate termic în intervalul 350 – 1400°C sunt caracterizate printr-un semnal îngust. Unul dintre aceşti atomi de Ti captează un electron şi rămâne în configuraţia tetraedrală. Spectrele RES prezintă o uşoara asimetrie a liniei de rezonanţă (se abat de la o funcţie pur Lorentziană) care poate fi explicată prin prezenţa unei anizotropii uşoare şi/sau a unui fundal de rezonanţă relativ larg de o foarte joasă amplitudine. g ≈ 2. Linia de la g ≈ 4. Lărgimea liniei de la g ≈ 2. în timp ce titaniul difuzează de la suprafaţă spre interior. 700 şi 900°C ne indică că ionii de Gd3+ sunt preponderent dispuşi în faza reziduală necristalină. Se observă şi spectrul în ‘‘U’’ cu linii la g ≈ 5. legaţi anterior de atomul de oxigen. se modifică în intervalul de temperatură investigat [16].câmp intermediar. rezultat în urma relaxării structurale dar încă cu un grad mare de dezordine în jurul lor. la g ∼ 2. iar celălalt atom de Ti se relaxează într-o configuraţie planar trigonală. Modificările structurale induse în probele titano-silicatice amorfe prin tratamentele termice sunt bine puse în evidenţă în spectrele RES ale probelor parţial şi total cristaline (Fig.

98 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 11 Spectrele RES ale microsferelor tratate termic la 1100°C. (a) (b) 2. (b) 600 G. 460 . 30 minute. Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 9 Spectrele RES ale microsferelor tratate termic la 700°C. 30 minute.98 Ti:Si 1:2 Ti:Si 1:2 2. Figura 8 Spectrele RES ale microsferelor tratate termic la 350°C.9 4. utilizând un baleiaj de (a) 4000 G.3 Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 7 Spectrele RES ale microsferelor preparate prin metoda sol gel. Figura 10 Spectrele RES ale microsferelor tratate termic la 900°C.004 1. 30 minute.004 1.0 5.8 2.2. 30 minute.

(b) 2.004 1.(a) (b) Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 12 Spectrele RES ale microsferelor tratate termic la 1400°C. (a) o 1400 C 1100oC o 900 C 700oC o 350 C as-prep. utilizand un balaj de (a) 4000 G. (b) 600 G. atribuit ionilor de Ti3+.18]. 461 . 30 minutes. Centrii de Ti3+ sunt de obicei detectaţi la temperaturi sub 120K [17. utilizând un baleiaj de (a) 4000 G şi respectiv (b) 600 G. (a) o 1400 C o 1100 C o 900 C o 700 C o 350 C (b) 2.98. dar au mai fost detectaţi în literatura de specialitate [19] la temperatura camerei. Spectrele RES ale probelor tratate termic la 1400°C sunt caracterizate doar prin semnalul din jurul valorii g∼1. utilizand un baleaj de (a) 4000 G si respectiv (b) 600 G.98 o 1400 C o 1100 C o 900 C o 700 C as-prep. neexistând vacanţe de O din cauza atmosferei reducătoare.98 1400oC 1100oC 900oC 700oC 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 13 Spectrele RES ale sistemului Ti:Si 1:2 preparate prin metoda sol gel si supuse diferitelor tratamente termice.004 1. 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 14 Spectrele RES ale sistemului Ti:Si 1:1 preparate prin metoda sol gel şi supuse diferitelor tratamente termice.

[20] au raportat faptul că semnalul RES la g∼2.004 poate fi atribuit vacanţelor de oxigen. Spectrele RES evidenţiază integrarea ionilor de Ti3+ în această fază. Figura 16 Spectrele RES ale microsferelor tatate termic la 350°C.005 unui electron captat la o vacanţă de oxigen. Nakamura şi col.003 – 2. Ga2O3 Ga2O3 20% 10% 5% 1% 0% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 1000 2000 3000 4000 5000 B(G) B(G) Figura 15 Spectrele RES ale microsferelor preparate prin metoda sol gel. peak-ul de la g∼2. În Figurile 13 si 14 sunt evidenţiate evoluţiile vacanţelor de oxigen (pentru g∼2.13. Serwicka [21] a observat un astfel de semnal la g∼2. Semnale similare au fost observate şi în TiO2 – anatase dopate cu C [22-24]. semnalul RES provine numai de la ionii de Gd3+. Acest studiu este focusat în special pe efectul adiţiei oxidului de galiu în sisteme. În cazul microsferelor cu conţinut de galiu se dezvoltă după tratamentul termic la 1400°C o nouă faza. deoarece evoluţia defectelor: vacanţe de oxigen (g∼2.98) este similară cu cea discutată anterior. 14 se observă faptul că tratamentul termic joacă un rol important în formarea de centrii paramagnetici adiţionali. în urma tratamentelor termice.004) şi Ti3+ (g∼1. 462 .0055 în spectrele RES în probe de titan dopat cu C. Pentru microsferele tratate termic la 1100°C si 1400°C se observă efectul galiului în sensul prevenţiei formării vacanţelor de oxigen. în concordanţă cu difracţiile de raze X. În cazul microsferelor preparate prin metoda sol gel.004 detectat pe plasma de TiO2 tratată termic provine de la un electron captat la o vacanţă de oxigen.Din spectrele RES prezentate în Fig. Ga2TiO5.004) si Ti3+ (pentru g∼1. iar Serpone [27] a atribuit semnalele din intervalul g = 2.98). [26] în probe de TiO2 dopat cu N. 900 si 1100°C. În cazul microsferelor tratate termic la 350. în bună concordanţă cu literatura de specialitate şi rezultatele obţinute prin spectroscopie Raman unde a fost obţinut un semnal de fluorescenţă în cazul probelor tratate termic până la temperatura de 900°C. Au mai fost raportate astfel de semnale RES de către Li şi col. 700. după ce au fost folosite în teste fotocatalitice. cât şi de către Feng şi col. ambele sisteme având o dependenţă oarecum similară în raport cu tratamentul termic.003 pe TiO2 redus în vid şi l-a atribuit unui defect. cel mai probabil un electron captat la o vacanţă de oxigen. deoarece sistemul Ti:Si 1:1 nu prezintă modificări esenţiale. cât si în TiO2 dopat cu B [25]. Vor fi prezentate doar spectrele RES ale sistemului Ti:Si 1:2. [22] la g∼2.

Ga2O3 (a) 20% (b) 20% 10% 10% 5% 5% 1% 0% 1000 2000 3000 4000 5000 1% 0% Ga2O3 3000 3200 3400 3600 3800 B(G) B(G) Figura 18 Spectrele RES ale microsferelor tatate termic la 900°C. (b) 600 G. Ga2O3 (a) Ga2O3 (b) 20% 10% 5% 1% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 0% 3000 3200 3400 3600 3800 B(G) B(G) Figura 19 Spectrele RES ale microsferelor tatate termic la 1100°C. (b) 600 G. 463 . utilizand un baleaj de (a) 4000 G.Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 5% 10% 5% 1% 0% 1% 0% 3000 3200 3400 3600 3800 1000 2000 3000 4000 5000 B(G) B(G) Figura 17 Spectrele RES ale microsferelor tatate termic la 700°C. (b) 600 G. utilizand un baleaj de (a) 4000 G. utilizand un baleaj de (a) 4000 G.

ceea ce înseamnă că aceştia nu sunt incluşi în reţeaua silicatică sau germanată unde au avut o vecinătate mult mai distorsionată [28]. 464 .Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 10% 5% 5% 1% 1% 0% 0% 1000 2000 3000 4000 5000 3000 3200 3400 3600 3800 B(G) B(G) Figura 20 Spectrele RES ale microsferelor tatate termic la 1400°C. utilizand un baleaj de (a) 4000 G. c) Gd3+ Prin rezonanţa paramagnetică electronică a fost investigată ordinea structurală din jurul ionilor de Gd3+ si interacţiunea magnetică dintre ei. arată că această distribuţie pe suprafaţa nanoparticulelor nu este uniformă. În acest caz. (b) 600 G.5% mol Gd2O3). în funcţie de compoziţia probelor. unde efectul interacţiunii de schimb este clar evidenţiat [33].0 fapt ce denotă că vecinătatea ionilor de Gd3+ se confruntă cu câmpuri cristaline slabe. Spectrele RES ale probelor investigate sunt prezentate în figura 21. Liniile largi preconizate pentru o concentraţie atât de scăzută (0. Spectrele constau din linii relativ largi cu g = 2. Diferenţele observate în forma liniilor. Această lărgire a liniei de rezonanţă este în mod normal atribuită interacţiunii dipol-dipol dintre ionii de Gd3+. Prezenţa în probe a ionilor de Gd3+ ne dă informaţii cu privire la modificările structurale care au loc în vecinătatea lor. introduse în aceeaşi matrice. fiind mult mai grupată pentru probele cu raportul Si/Ge 1:2 şi 1:3. în funcţie de compoziţia matricii şi este utilă în caracterizarea locurilor în care s-ar putea distribuii alte pământuri rare neparamagnetice. distanţa medie dintre ionii de gadoliniu este mai mică decât în cazul distribuţiei uniforme în întregul volum şi se confruntă cu interacţiuni magnetice puternice. sprijină ipoteza distribuţiei sale pe suprafaţa nanoparticulelor. considerând că gadoliniu ar fi distribuit omogen în întregul volum de probă. dar şi dezordinii locale [29-32].

V. 10. 404 (2005) 25–29. 67 (1994) 156 S. Proceedings of XX Int.S. Chou.C.Ursu. Biedunkiewicz. Appl.S. Sands. P-10-011 R. S. Anagnostakis. Seraji. Nakamura. Non-Cryst. 21. V. R. Lett. Peteanu. Witkowska. Lips. Li. 10-13 September 2001 T. J. 8. Sci. 3336 – 3340. A. 11. 1. A. 7. Chem. Kokorin. Sakthivel. K. Cromack. Karkas. 2001. S. M. Ihara. I. Rezonanţa electronică de spin. Academiei R. 22. 15. G. Technol. 2. 331 (2003) 1 R. 6-thInternational Conference on Intermolecular Interactions în Matter. Rev. C.Konstantiniva. W. Figiel. Kutsuna. Phys. Glass. Pop. Mater. Bissey. J. Ardelean. 97. S. Coldea. S. Rezonanţa magnetică. V. N. Non-Cryst. Solids. M. Ber. Simon. Limmer. J. 621-624. S. 90. 16. N. Optoelectronics and Advanced Materials.005Gd2O3·0. J. Hwang. Tabuchi. J. Anpo. 23 (2010) 189-195. Ghosh. DiCicco. T.K. Journal of Materials Science Letters.J. Bull. K. Optoelectronics and Advanced Materials. Castner. Phys. Y. J.. 6. J. Editura Didactică şi Pedagogică. 13. 99 (1955) 1222 R. H.-C. 61-64 (1980) A. 12. V. 19.J. I. K. 20. J. Kubokawa. 352 (2006) 2947. Simon. A. Glastechn. O. M. Simon. Gdańsk – Poland. S. Chem. I. I. Kliava. S. 27Oct. Kisch.H. Todea. Y. A . A. Non-Cryst. J. Y. Typek. S. Wu. Yabuta. 5. M. Nanba. 947-949(3). Chem. Ioncu. Phys. Yahiaoui. 14. 4. 10 (2001) 5296 Pan. Notz. 13 (1985) 287–293. Soc. Ciorcas. J. Colloids Surf. E.J. Phys. Japan 59 (1986) 259. Micic. Holton. 9. Solids. (1993). Cao. Trifunac. Catal. G. Takeuchi. T. E. Spectrele RES ale probelor aparţinând sistemului 0. 18. Tokyo. Miura. J. E. K. N. Thurnauer.. Bibliografie: 1. Chimia 12 (2007) 61. No.P. A. A. Guskos. Berger. S. Zinsou. 112. Phys. M. P. J. J. Negishi. Kim. 17. J. Newell. M. F.. Solids 180 (1995) 151 T. 3. 12 (2008). Stößer. Bucureşti. Guskos. D. R. Adv. S. 3 (2000) 1503 I. M. A.995[(1−x)SiO2·xGeO2] 4. Vol. Simon. 465 .H. Zolnierkiewicz.România. 10. Chem. Congress. (1965) Al. Japan. E. Kodama. Beziade. Nicula. Lee. P. Serwicka. Todea. Mol.. Rev.S. A: Chem. M. D. Y. Simon. C.Figura. Forbess. Simon. Glass Sci. P. M. 7277. M. 32 (1960) 668d Y. Phys. 2004. Todea. Sugihara. 161 (2000) 205–212. Sept.P. Ed. C. 21. Number 10. Chem. C. Volume 20. Zhang. A. Simon. 9 (2007). Schlichter. Nguyen. Rybicki.M. H.

A. A. Solid State Commun. R. 31. S. Graziani. Gasparotto. J. Zarubina. Zhang. Feng. Matter 15 (2003) 6671–6681. M. J. Adv. M. 29. E. T. Kuznetsov. Phys. S. Yeshurun. 339 (2007) 111–123. V. Bruckental. V.V. Garcia. 26. Reson. New J. Gombac. E. Optoelectr. A. L. I. Z. Materials Science and Engineering B 172 (2010) 68–71 466 . Magn. M. Vicario. Cosma. Bruckental. J. C 113 (2009) 15110–15123. Berger. Rogatis. Jin. Zarubina. V. J. 8 (2006) 99–101. B 71 (2005) 104406. R. D. R. 32 (2008) 1038–1046. 25. Montini. Fornasiero. Phys. I. Kliava. Diana-Louisa Trandafir. Gombac.S. E. Edelman. Edelman. Potseluyko. Z. I. Rev. E. Mater. R. T. Mater. I. T. Acta 361 (2008) 3980–3987. S. Montini. Tondello. N.V.V. Y. 33. P. A. 32. Berger. E. S. Balducci. Y. Simon. Phys. Melnikova. Ardelean. Wu. 28. Chim. A. Wang. Gil. G. Bratu. P. Chem. A. Petrakovskaja. R. S. I. Chem. Turcu. 27. Filip. T. T. Potseluyko. Kliava. I. 24. 272–276 (2004) 1647–1649. Simon. Y. A. 116 (2000) 83–86. Petrovskii. Malakhovskii. Raftery. Kliava.A. Edelman. Zarubina. Barreca. J.F. G. Zhang. Y. I. Petrakovskaja. Yeshurun. Serpone. Chem. I. J. Potseluyko. Zhang. Bruckental. Sun.: Condens. J. Magn. Solid State Nucl. Z. Y. Fornasiero. Phys. Malakhovskii. Graziani. A. Fittipaldi. Yeshurun. 35 (2009) 74–81. S.M. Mag.23. Petrakovskaja. 30. Simon. D. C. G. J. D. Inorg. Malakhovskii. N. K. R. Y.

............................................................. de la o limită inferioară la o limită superioară a potenţialului.......... dr................................................................... 2............ 467 .. 467 2.................... potenţialul este baleiat într-un domeniu fix de potenţial cu o viteză constantă.... există două tipuri de metode voltametrice: * voltametrie cu baleiaj liniar de potenţial (LSV)................ Voltametrie cu baleiaj liniar de potenţial (LSV) ...... de obicei. aşa cum se arată in figura 1......... METODE ELECTROCHIMICE Elaborarea.................... * voltametrie ciclică (CV)........................................ Graziella Liana Turdean Cuprins 1...................................Voltametrie cu baleiaj liniar de potenţial (LSV) În voltametria cu baleiaj liniar de potenţial (LSV)....................... 471 4.... În principal...................... în care curnetul este măsurat ca o funcţie de potenţialul aplicat şi este utilizată la studiul cineticii reacţiei de transfer de electroni şi proprietăţile de transport ale reacţiilor... Una dintre aceste metode este voltametria................ 488 1..................... 474 6........................... Bibliografie ....... ing......................... Introducere Metodele electrochimice moderne oferă chimistului electroanalist o varietate de tehnici pentru a rezolva problemele analitice. Voltametria ciclică (sau CV) .................... Voltametria ciclică cu un cuplu redox activ...................................... testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice Conf......... Introducere .................. 467 3.................... 474 5......XIII........... Voltametria ciclică fără cuplu redox activ..

conform ecuaţiei 2: 468 . Caracteristicile voltamogramei înregistrate (figura 2) depind de o serie de factori. * viteza de baleiaj a potenţialului. În mod clar prin schimbarea timpului necesar pentru a baleia domeniul de potenţial se modifică viteza de baleiaj (scanare). Figura 2. Pentru a înţelege acest comportament. cum ar fi: * viteza reacţiei de transfer de electroni. Dacă avem în vedere reducerea electrochimica a Fe3+ la Fe2+. (1) Presupunem că scanarea începe din partea stângă a graficului curent/potenţial. Când potenţialul este baleiat spre dreapta (spre valori de reducere). * reactivitatea chimică a speciilor electroactive. unde iniţial nu este curent. Pentru sistemul Fe3+/Fe2+. eventual. În echilibrul electrochimic. Viteza de scanare (v) se calculează din panta dreptei din figura 1. viteza reacţiei de transfer de electroni este mai rapidă în comparaţie cu viteza de baleiaj a potenţialului. Voltamograma cu baleiaj liniar de potenţial. unde E este diferenţa de potenţial aplicat şi Eo este potenţial standard de electrod. Prin urmare. trebuie să se ia în considerare influenţa potenţialului asupra echilibrului stabilit la suprafaţa electrodului. unda aparută se datorează reacţiei 1. ecuaţia lui Nernst este cea care prezice relaţia dintre concentraţie şi potenţial (diferenţă de potenţial). începe să apară un curent care. Forma semnalului de excitare în voltametria cu baleiaj liniar de potenţial. Exemplu: Rezultatul măsurătorilor de LSV este rRESezentarea grafică a curentului obţinut versus potenţialul baleiat cu o viteză constantă. poate atinge şi un maxim înainte să scadă. la suprafaţa electrodului se stabileşte un echilibru identic cu cel prezis de termodinamică.Figura 1.

Fiecare curbă are aceeaşi formă. echilibrul la suprafaţa electrodului începe să se modifice şi. maximul) apare deoarece la un moment dat stratul de difuzie a crescut suficient încât fluxul de reactant la electrod nu este suficient de rapid pentru a satisface cerinţele impuse de ecuaţia lui Nernst. Influenţa vitezei de baleiaj asupra voltamogramelor cu baleiaj liniar de potenţial. În această situaţie curentul începe să scadă. Figura 3. conform ecuaţiilor 3: (3) Aşa cum curentul creşte cu potentialul. ca urmare. Forma exactă a voltamogramei poate fi înţeleasă prin luarea în considerare şi a efectelor potenţialului şi transportului în masă. În cazul în care se modifică viteza de baleiaj. Când potenţialul este baleiat de la valoarea iniţiala V1. datorită dimensiunilor stratului de difuzie şi a 469 . poziţia de echilibru se modifică de la nici o conversie (la V1) la conversia completă (la V2) a reactantului la suprafaţa electrodului. Peak-ul (vârful. scăderea curentului urmează acelaşi comportament ca şi cel estimat prin ecuaţia Cottrell. când potenţialul este baleiat de la valoarea V1 la V2.(2) Deci. dar este evident că curentul creşte cu creşterea vitezei de baleiaj. alura voltamogramei se modifică şi ea (Figura 3). apare un curent. poziţia de echilibru se deplasează continuu în sensul conversiei reactantului. De fapt.

Cum mărimea curentului este proporţională cu fluxul spre electrod. Prin urmare. Figura 4. voltamograma se va obţine mai încet. care au o cinetică rapidă de transfer de electroni. timpul necesar pentru a înregistra o voltamogramă) influenţează puternic comportamentele observate. În consecinţă. faţă de cele de la viteze de baleiaj mari. O altă observaţie este poziţia curentului de peak: este clar că peak-ul apare la aceeaşi valoare de potenţial (figura 3) şi aceasta este o caracteristică a reacţiilor de electrod. Pentru aceste cazuri. cu cât viteza de baleiaj este mai mică. viteza de balaiaj a potenţialului (şi. stratul de difuzie va creşte mai mult în comparaţie cu cazul în care viteza de scanare este mare. Aceste procese rapide sunt adesea menţionate ca reacţii reversibile de transfer de electroni. grosimea stratului de difuzie de la suprafaţa electrodului va fi diferită în funcţie de viteza de baleiaj folosită. potenţialul aplicat nu va duce la generarea concentraţiilor la suprafaţa electrodului conform estimărilor din ecuaţia Nernst. Figura 4 arată o serie de voltamograme înregistrate la o singură viteză de baleiaj pentru diferite valori ale constantei vitezei reacţiei de reducere (kred). reacţiile sunt menţionate ca reacţii cvasi-reversibile sau ireversibile de transfer de electroni. deoarece 470 . La o viteză de baleiaj mică. În aceast caz. valoarea curentului va fi mai mică la valori mici ale vitezei de baleiaj. În mod clar. Acest lucru evidenţiază un punct important atunci când se examinează LSV (şi CV): deşi nu există o axă a timpului pe grafic. În consecinţă. fluxul de la suprafaţa electrodului este considerabil mai mic la viteze de baleiaj mici. pentru diferite constante ale vitezei reactiei de reducere. Voltamograma cu baleiaj liniar de potential. se poate formula întrebarea referitoare la ce s-ar întâmpla în cazul în care procesele de transfer de electroni au fost "lente" (în raport cu viteza de baleiaj a potenţialului). prin urmare.timpului necesar pentru a înregistra voltamograma. Conditii experimentale: viteza de baleiaj identica.

Spre deosebire de voltametria cu baleiaj linear. Ca urmare. Această inversare se poate produce de mai multe ori în timpul unui singur experiment. Curentul va creşte pe măsură ce potenţialul atinge potenţialul de oxidare a analitului. se va ajunge la potenţialul la care se va reduce produsul format în prima reacţie de oxidare şi se va produce un curent de polaritate inversă faţă de scanarea directă. peak-ul de reducere va avea o formă similară cu peak-ul de oxidare. în cazul CV. panta dreptei fiind cunoscută ca viteza de baleiaj (v [V/s]). După cum se observă în voltamograma din figura 6. forma generală a voltamogramei înregistrate este similară cu cea de mai sus. atunci când potenţialul aplicat este invers. iar curentul este măsurat între electrodul de lucru şi electrodul auxiliar. când potenţialul atinge V2 sensul de baleiaj este inversat. 3. Dacă transferul de electroni la suprafaţă este rapid şi curentul este limitat de difuzia speciilor spre suprafaţa electrodului. din astfel de experimente se obţin informaţii despre potenţialul redox şi despre vitezele reacţiilor electrochimice. Voltametria ciclică este folosită. De obicei. deşi potenţialul este baleiat tot între două valori (V1 şi V2). echilibrele nu sunt stabilite rapid (în comparaţie cu viteza de baleiaj). Într-un experiment de voltametrie ciclică. Acesta are loc deoarece curentul apare mai încet decât în cazurile reversibile. în general. atunci curentul de peak 471 . potenţialul electrodului de lucru este baleiat liniar în funcţie de timp. de viteza de baleiaj a potenţialului). astfel. pentru a studia proprietăţile electrochimice ale unui analit într-o soluţie.Voltametria ciclică (sau CV) Este metoda electrochimică potenţiodinamică foarte similară cu LSV. În voltametrie ciclică. care se încheie atunci când se ajunge la un potenţial stabilit (V2). Voltamograma ciclică obţinută este rRESezentarea grafică a curentul obţinut la electrodul de lucru (i) faţă de potenţialul aplicat (E). În cazul în care cuplul redox este reversibil. de asemenea. potenţialul de electrod este baleiat liniar faţă de timp (figura 5). în scanarea în sens direct se obţine un curent de peak pentru orice specie care poate fi oxidată în domeniul de potenţial baleiat. ca şi în cazul voltametriei liniare. dar spre deosebire de reacţia reversibilă. În această situaţie.cinetica de reacţie este "lentă" şi. Potenţialul este măsurat între electrodul de referinţă şi electrodul de lucru. poziţia curentului de peak/maxim se schimbă în funcţie de constanta vitezei de reducere (şi. dar apoi va scădea deoarece concentraţia analitului se va epuiza în vecinătatea suprafeţei electrodului. iar potenţialul este baleiat înapoi la V1.

Când potenţialul electrodului este variat. O voltamogramă ciclică tipică. Semnalul de excitare în cazul voltametriei ciclice. Voltamograma ciclică pentru un rectant participând la o reacţie monoelectronică de transfer de electroni. ionii se mişcă spre suprafaţa electrodului pentru a forma un strat dublu electric. iar pentru descrierea sistemelor electrochimice se preferă acest model 472 . în absenţa unui cuplu redox nu este un condensator cu plăci paralele pur. primeşte un electron şi difuzează de la suprafaţă. Răspunsul la baleiajul în sens direct este identic cu cel de la LSV. Figura 5. aşa cum se arată în figura 8.(vârf) va fi proporţional cu rădăcina pătrată a vitezei de scanare. Curentul de la suprafaţă este generat prin transferul de electroni de la electrod la speciile redox. Această relaţie este descrisă de ecuaţia Cottrell. poziţia echilibrului se modifică în sens invers. curentul este transportat prin migraţia ionilor. Când sensul de baleiaj este inversat. Se pune întrebarea dacă un curent poate apărea dacă nu există nici o specie în soluţia care poate transfera electroni la suprafaţă electrodului. Curentul apare din nou datorită speciilor din soluţie care difuzează spre electrod şi are sens invers decât procesul din prima etapă. înregistrată pentru o reacţie reversibilă monoelectronică. O interfaţă electrod-soluţie. În cazul reducerii. la potenţialul de interes? Răspunsul este că un curent tranzitoriu poate circula deoarece interfaţa electrod-soluţie se va comporta ca un condensator. ci se comportă mai degrabă ca şi cum ar fi. Figura 6. este prezentată în figura 6. Reacţia de electrod şi capacitatea electrodului Figura 7 descrie procesul care are loc în reacţii de electrod simple. În soluţie. convertind produsul (Fe2+) înapoi la reactant (Fe3+). specia (Ox) capabilă de a primi un electron de la electrod difuzează spre suprafaţă.

se diferenţiază ecuaţia (1) în raport cu t şi presupune că capacitatea este o mărime constantă: dQ dE =C dt dt (6) 473 . Capacitatea este un factor esenţial în experimentele electrochimice pentru că dă naştere la un curent în timpul de încărcare al condensatorului. Astfel. cât şi de electrolitul suport. Cea mai simplă descriere a capacităţii electrochimice este dată de modelul Helmholtz: C εε 0 = A (5) unde: ε este constantă dielectrică a materialului de separare a plăcilor. sarcina condensatorului (Q) este proporţională cu căderea de tensiune în condensator (E): Q=CE (4) Constanta de proporţionalitate C este capacitatea mediului. Pentru a calcula mărimea acestui curent. numim această mărime curent de încărcare. pentru un condensator cu plăci paralele. Sistem electrochimic care include transferul de electroni şi circuitul echivalent corespunzător. ℓ este distanţa de separare între plăcile paralele.care permite să se înţeleagă comportamentul electrozilor în absenţa unui cuplu redox. iar A este aria de electrod. Destul de logic (şi fără imaginaţie). Figura 7. εo este permitivitatea spaţiului liber. Schema stratului dublu electric. Acest model nu descrie în mod adecvat toate interfeţele electrochimice dacă capacitatea depinde atât de potenţial. Figura 8.

în care nu este prezent nici un cuplu redox activ (experimentul prezentat în figura 9). Voltametria ciclică fără cuplu redox activ Dacă se consideră cazul foarte simplu al voltametriei ciclice. De obicei. atunci acest curent este singurul care va fi observat. puterea reală a acestei tehnici constă în capacitatea sa de a investiga mecanismul reacţiei de electrod. La inversarea vitezei de scanare. Astfel. Experiment de voltametrie ciclică. se obţine: I = C*v (7) Prin această derivare simplă. se obţine o expresie pentru curentul de încărcare în stare staţionară. iar când se opreşte scanarea. voltamograma obţinută are forma din figura 9b. 4.Identificând dQ/dt ca o expresie a curentului şi dE/dt cu viteza de baleiaj a potenţialului (v). Figura 9. care se menţine atât cât se menţine variaţia de potenţial. atunci când se aplică o treaptă de potenţial. curentul revine la zero. Curentul faradaic depinde de doi factori: cinetica transferului de electroni şi viteza la care specia redox difuzează spre suprafaţa electrodului. prin măsurarea curentului de încărcare la o anumită viteză de scanare. 5. şi se aplică semnalul de excitare a potenţialului având forma din figura 9a. curentul îşi schimbă semnul. se poate determina capacitatea sistemului. Dacă nu există nici o posibilitate de transfer de electroni între soluţie şi electrod (nu există un cuplu redox). se vor folosi condiţii în care curentul capacitiv este mic în comparaţie cu curentul de transfer de electroni (denumit curent faradaic). în absenţa speciei redox active. Rezultatul excitării sistemului este o creştere bruscă a curentului din cauza schimbării bruşte a vitezei de scanare (ν). 474 . Curentul atinge o stare de echilibru. Voltametria ciclică cu un cuplu redox activ Deşi curenţii capacitivi în voltametrie ciclică sunt o realitate.

cu atât este mai mare fluxul J şi. aşa că se presupune că la suprafeţele electrodului. 1351). (dC/dx)x=0 este gradientul de concentraţie la suprafaţa electrodului. Chem. Presupunând că viteza de transfer de electroni este foarte rapidă. εo’ = 0.şi Fe(CN)64. concentraţia de specii oxidate la suprafaţă va scădea odată cu negativarea potenţialului. Chem. curentul i care este măsurat când potenţialul scade va fi direct proporţional cu fluxul speciilor oxidate care difuzează spre suprafaţa electrodului. concentraţia de Fe(CN)63. conform ecuaţiei 10: i=nFAJ Fluxul este guvernat de legea lui Fick: (10) (C * −C x = 0 ) ⎛ dC ⎞ ≅D J = −D ⎜ ⎟ Δx ⎝ dx ⎠ x = 0 (11) unde: D este coeficientul de difuzie a speciilor. Chiar şi în cazul asumării comportamentului nernstian. 36. Se poate observa că. 37.+ 1 e. Interpretări calitative.→ Fe(CN)6 4.. 1964. concentraţiile de Fe(CN)63.trebuie să scadă la suprafaţa electrodului.Pentru cuplul redox Fe(CN)63-/4-.356 V vs. 475 . x este distanţa de la suprafaţa electrodului. 1965. După cum se observă din ecuaţia 11. deoarece potenţialul aplicat devine mai negativ.0592 log 4− [Fe(CN)6 ] − [Fe(CN)3 6 ] unde: E este potenţialul aplicat şi E0’ este potenţialul formal de electrod. rRESoducerea fidelă a voltamogramei cuplului Fe(CN)63-/4(figura 6) necesită o soluţie analitică la două ecuaţii diferenţiale. (Detalii cu privire la simulări în voltametria ciclică pot fi găsite în Anal. 706 şi Anal. cu atât este mai mare curentul catodic. ENH (8) (9) E = E o' − 0. care participă la reacţia 8 a cărei cinetică de transfer de electroni este destul de rapidă. şi Cx=0 este concentraţia sa la suprafaţa electrodului..respectă ecuaţia lui Nernst 9: Fe (CN)6 3. prin reacţia de reducere la Fe(CN)64-. prin urmare. cu cât este mai mare gradientul de concentraţie. C* este concentraţia de specie oxidată în volumul soluţiei. Dacă presupunem că concentraţiile de la suprafaţa electrodului sunt reglementate prin ecuaţia lui Nernst. conform ecuaţiei 10.

curentul catodic vor fi mai mari. faza de volum a soluţiei care este epuizată în specia oxidată va creşte şi gradientul de concentraţie va începe să scadă. curentul va scădea în continuare. Această concentraţie mai mică la suprafaţă dă un gradient de concentraţie mai mare (cel puţin iniţial). vom ajunge la o regiune unde curentul anodic începe să domine (figura 11).Schimbarea gradientului de concentraţie pentru regiunea catodică din voltamograma ciclică este prezentată în figura 10. cu atât va scădea fluxul spre suprafaţa electrodului şi curentul va începe să scadă. iar soluţia are concentraţia uniformă din faza de volum C*. Parametrii electrochimici caracteristici. În momentul în care se aplică un potenţial. Alura voltamogramei ciclice pentru o reacţie electrochimică nernstiană. În acelaşi timp. 476 . Dacă se inversează potenţialul de scanare (nu este arătat în figura 10). dar concentraţia de suprafaţă începând să crească. În cele din urmă. Apoi sistemul va trece prin intermediul profilelor de concentraţie similare pentru speciile reduse. nu există nici un gradient de concentraţie. Figura 11. Figura 10. Cu cât scade gradientul de concentraţie. Dacă se va continua negativarea potenţialului. Se va obţine un curent de peak negativ şi apoi curentul va scădea în amplitudine. Profilul de concentraţie la diferite momente de timp. 11). în cadrul experimentului de CV (numai baleiaj negativ). fluxul spre suprafaţă şi. Toate acestea vor duce la obţinerea unei curbe curent-potenţial care are forma din figura 11. Înainte ca un potenţial să fie aplicat la electrod (t = 0). cu cât epuizarea stratului de specie redusă va creşte. încă mai există un strat epuizat de specie oxidată. prin urmare. concentraţia speciei oxidate se epuizează la suprafaţă. concentraţia speciilor oxidate la suprafaţa electrodului va tinde spre zero. astfel încât în conformitate cu legea de difuzie a lui Fick (ec.

care se cuantifică conform figurii 11. Separarea potenţialului de peak ΔEp (= Epc . O descriere teoretică a suprapotenţialului de polarizare este inclusă în ecuaţia Butler-Volmer şi ecuaţia Cottrell. Simulările cantitative arată mai multe aspecte pentru un sistem nernstian. la 25 oC. n este numărul de electroni transferaţi. este foarte de dorit ca analitul să prezinte peak-uri reversibile. Nicholson şi Shain au efectuat simulări cantitative ale voltametriei care au dus la schimbări majore în domeniul electrochimiei. Acest suprapotenţial reiese dintr-o combinaţie a vitezelor de difuzie a analitului şi bariera intrinsecă de activare a transferului de electroni de la electrod la analit. la 25 °C: ip = (2. Analitul trebuie să fie o specie redox în domeniul de potenţial experimentat. Este foarte dificil pentru a atinge o sepa477 . În 1964. conform reacţiei 12: Ox + e- → Red (12) Toate voltamogramele reversibile arată la fel şi au forma tipică indicată în figura 11. Chiar şi cuplurile reversibile conţin suprapotenţiale de polarizare şi astfel prezintă o histereză între potenţialul absolut de reducere (Epc) şi de oxidare (Epa). v este viteza de baleiaj (în V/s) şi C* este concentraţia în faza de volum a speciei (în mol/cm3). Dacă un sistem redox rămâne în echilibru pe întreg domneiul de potenţial scanat. Curentul de peak într-o voltamogramă ciclică care conţine o singură specie este descrisă de ecuaţia Randles-Sevcik (ec. la toate vitezele de scanare.Caracterizarea Aceasta a fost o descriere foarte calitativă a voltametriei ciclice.Epa) = 59/n [mV].687 *105) n3/2 A D1/2 v1/2 C* (13) unde: ip este curentul de peak (în A). A este aria electrodului (în cm2). procesul redox este numit reversibil (echilibru impune ca concentraţiile de suprafaţă de Ox şi Red să fie menţinute la valorile prezise prin ecuaţia Nernst). Un peak reversibil se obţine atunci când un analit este redus sau este oxidat pe un sens al baleiajului de potenţial şi apoi este reoxidat sau redus pe sensul invers al baleiajului. Proces redox reversibil Utilitatea voltametriei ciclice este foarte dependentă de analitul studiat. D este coeficientul de difuzie (în cm2 s-1). Următorii parametrii sunt folosiţi pentru a caracteriza voltamograma ciclică a unui proces reversibil: a. Parametrii importanţi pentru o voltamogramă ciclică sunt potenţialele de vârf (Ep ) şi curenţii de vârf (ip). 13). De asemenea.

cum ar fi: potenţialul de semi-undă (E01/2). se pot determina informaţii termodinamice. Influenţa vitezei de baleiaj asupra voltamogramelor ciclice ale unui cuplu redox monoelectronic reversibil. cât şi de transportul de masă. Figura 12. În cazul în care valorile constantelor de difuzie pentru speciile oxidate şi reduse sunt similare. Diferenţa între potentialul de peak (Ep) şi potentialul la care curentul este jumătate decât la Ep. d. Curenţii de peak (ip) sunt proporţionali cu rădăcina pătrată a vitezei de scanare (v).5/n [mV] la 25 °C. în experimentele de stripare sau în prezenţa unui fenomen de nucleaţie. ilustrat în figura 12. precum şi de viteză de scanare). Atunci când se obţin peak-uri reversibile. (Se consideră o valoare mulţumitoare aceea de 70 mV. Voltamograma pentru o reacţie cvasi-reversibilă pentru diferite valori ale constantelor vitezelor de reducere şi de oxidare. valoarea Eo’ poate fi estimată ca media aritmetică a valorilor potenţialelor de peak anodic şi catodic (Eo’ = (Epa + Epc )/2). Poziţia potenţialului de peak nu se modifică cu viteza de scanare. c. g. Raportul curenţilor de peak este unitar (ipa/ipc = 1) la toate vitezele de scanare. f. (Ep/2). ca funcţie de grosimea stratului de difuzie. e. iar conform ecuaţiei 13.rare a peak-urilor în valoare de 59/n [mV]. poate fi explicată ca şi în cazul LSV. pe majoritatea electrozilor solizi. funcţia ip/v1/2 este independentă de v. Influenţa vitezei de scanare asupra curentului pentru un transfer de electroni reversibil. Acest raport poate fi perturbat pentru cuplurile reversibile în prezenţa unei reacţii chimice. unde: n este numărul de electroni transferaţi. 478 . Procese redox cvasi-reversibile Pentru sistemele cvasi-reversibile (cu 10-1> k °> 10-5 cm/s). Aceasta este o funcţie de pregătire a electrozilor. curentul este controlat atât de transferul de încărcare. b. Figura 13. este de 56.

Atâta timp cât reversibilitatea depinde de valoarea raportului ks/v. comparativ cu difuzia.Forma voltamogramei ciclice este funcţie de raportului k°/(πνnFD/RT)1/2. procesul se apropie de cazul reversibil. De asemenea. În aceste cazuri se observă că separarea de peak este o funcţie de viteză constantă a transferului de electroni. voltamogramele unui sistem cvasi-reversibil sunt mai extinse şi prezintă o separare mai mare. Când se efectuează o voltamogramă ciclică pe un electrod modificat cu un monostrat auto-asamblat. sistemele devin mai lente şi sunt apte să prezinte control cinetic. Cu toate acestea. dacă electrozii nu sunt curăţati (sau sunt acoperiţi cu monostraturi). atunci procesul se spune că este cvasi-reversibil. Prin urmare. Există două cazuri de comportament ireversibil descrise mai jos. Un proces cvasi-reversibil se caracterizează prin: A) Separarea potenţialelor de peak are o valoare care depaşeşte 58/n mV şi care creşte cu creşterea v (ΔEp > 58/n mV). reversibilitatea depinde de valorile relative ale constantelor de viteză a transferului de electroni eterogen (ks) şi viteza de schimbare a potenţialului (viteza de scanare. Cu cât curentul este mai mic. este posibil ca în scopul de a schimba un proces cvasi-reversibil într-unul reversibil să se micşoreze viteza de baleiaj v (ceea ce permite ca într-un timp mai îndelungat concentraţiile superficiale să se ajusteze la noile valori ce479 . potenţial de peak în comparaţie cu un sistem reversibil. Comportamentul unui electrod se poate apropia de cel al un sistem nernstian prin încetinirea vitezei de scanare. Pe măsură ce acest raport creşte. pentru valori mici ale acestuia. se poate demonstra rolul esenţial pe care îl joacă curăţenia electrodului prin compararea voltamogramelor obţinute cu electrodul curat şi modificat. Dacă raportul ks/v este suficient de mic încât concentraţiile nernstiene nu pot fi menţinute. care scade când cuplurile redox nu sunt în măsură să ajungă la suprafaţa electrodului. la valorile cerute de ecuaţia lui Nernst. sistemul va prezenta un comportament ireversibil. viteza de transfer de electroni are o şansă mai mare de a fi mai rapidă. În general. 1) Cinetica transferului de electroni lent Aşa cum s-a menţionat anterior. reversibilitatea impune ca cinetica de transfer de electroni să fie suficient de rapidă pentru a menţine concentraţiile de suprafaţă ale Ox şi Red. v). Deviaţiile de la comportamentul reversibil sunt identificate prin variaţii de la parametrii expuşi anterior (a-g). Sistemele nernstiane de transfer de electroni la electrod complete sunt greu de găsit în practică şi moleculele redox-active sunt adesea destul de lente.

Efectul Ru poate fi minimizat printr-un design experimental atent. când constantele de viteză sunt reduse. În figura 13. de asemenea. cauzată de rezistenţa necompensată a soluţiei (Ru). C) Atunci când peak-urile sunt semi-reversibile. dar variază în funcţie de viteza de scanare. în cazul în care reducerea de la Red la Ox este urmată de conversia lui Red la P. separarea potenţialelor de peak nu mai este fixă. B) Din păcate. prin compensare electronică cu feedback pozitiv şi prin manipularea ulterioară a datelor. acest lucru poate fi înţeles în termeni de echilibru la suprafaţă care nu este stabilit atât de rapid. prima curbă prezintă cazul în care constantele de viteză ale proceselor. În plus. În plus. 2) Reacţiile chimice ale Ox şi Red Valorile de echilibrul pentru Ox şi Red pot fi menţinute în timpul unui experiment de voltametrie ciclică. Prin urmare. în funcţie de viteza de scanare este posibil să se obţină o estimare pentru constantele vitezelor de transfer de electroni. Prin analizarea variaţiei potenţialului de peak. Efectul unei reacţii chimice depinde de valoarea raportului k/v (unde k este constanta de viteză a reacţiei chimice). atât de oxidare. 480 . curentul de peak variază în funcţie de rădăcina pătrată a ratei de scanare. dacă ambele specii Ox şi Red sunt stabile în timpul experimentului. în timp ce valoarea ks este independentă de concentraţia de analit). în special despre procesul cinetic care urmează după cel electrochimic. creşterea ΔEp cu creşterea v poate fi. Cele două efecte pot fi distinse prin varierea concentraţiei de analit (scăderea potenţialului datorită rezistenţei necompensate a soluţiei şi astfel. ΔEp depinde de valoarea ks/v şi.rute de schimbările de potenţial). de asemenea. În mod similar cu cazul de reversibilitate. ks poate fi calculată din variaţiile Ep cu v. cât şi de reducere sunt încă rapide. valoarea ΔEp rezultată creşte cu creşterea curentului. De exemplu. În aceste cazuri. Din nou. cu toate acestea. Dacă această valoare este mare. adică raportul ipa/ipc este diferit (mai mare sau mai mic) de 1. potenţialele de peak se deplasează spre valori mai pozitive/negative. este posibil să se determine mai multe informaţii. Valoarea curentului poate fi. prin urmare. raportul ipa/ipc este mai mic decât unitatea (din moment ce doar o parte din moleculele care au fost reduse prin baleiajul direct sunt disponibile pentru reoxidation prin baleiajul invers). atunci mai mult Red trebuie generat pentru a compensa pierderea de Red. afectată de reacţii chimice care urmează după transferul de electroni. viteza de reducere creşte şi potenţialul de peak (Epc) se deplasează spre o valoare mai pozitivă.

cu toate acestea el necesită adesea existenţa de cantităţi egale de analit. În ciuda acestor limitări. b. Efectele transferului eterogen de electroni lent şi reacţiile chimice nu pot fi separate. este posibil ca peak-ul să fie ireversibil din cauza unui proces fizic. exprimat prin vCdl (unde: Cdl este capacitatea la interfaţa electrodului de lucru). este posibil să se elimine efectul reacţiei chimice (deci să se restabilească reversibilitatea). Există un curent rezidual de încărcare în timpul experimentului. datorită unui suprapotenţial.atunci reacţia chimică are un efect semnificativ. De asemenea. există diferenţe considerabile în ceea ce priveşte parametrii voltamogramei. fie prin investigarea efectului vitezei de baleiaj asupra raportului ipa/ipc. în ambele stări de oxidare. Când un peak este ne-reversibil. Valoarea lui k poate fi calculată fie prin studii de simulare. Deşi voltametria ciclică este foarte utilizată pe scară largă pentru caracterizarea speciilor redox (de exemplu: potenţiale redox şi stabilitatea diferitelor stări de oxidare) şi de investigare calitativă a reacţiilor chimice care însoţesc transferul de electroni. în unele domenii de cercetare. Prin urmare. Când peak-urile sunt ne-reversibile este imposibil să se determine parametrul E01/2. un exemplu comun pentru metale tranziţionale este o schimbare în geometria sferei de coordonare. Dacă ambele efecte sunt prezente. există o serie de dezavantaje inerente în cadrul acestui procedeu: a. Într-adevăr. cel mai frec481 . Cuplul redox ar putea fi ireversibil din cauza unui proces chimic care urmează. Acesta poate fi însă determinat. plasând o limită superioară a lui v decât poate fi utilizată. Dacă este acesta cazul. Procese redox ireversibile (control de transfer de sarcină) În cazul transferului de electroni ne-reversibil. voltameteria ciclică nu poate determina dacă peak-ul este la potenţialul său termodinamic sau s-a deplasat la un potenţial mai extrem. raportul dintre curentul de peak faradaic şi curentul de încărcare scade cu creşterea v (în timp ip este proporţional cu v1/2). atunci viteze mari de scanare pot arăta peak-uri reversibile. Acest fapt restrânge limita de detecţie la aproximativ 10-5 M. În plus. prin cresterea v. în timp ce un efect mai redus apare în cazul în care acest raport este mai mic. atunci constantele de viteză pentru aceste procese nu pot fi calculate folosind metode de simulare. voltametria ciclică este una din tehnicile standard utilizate pentru caracterizare. voltametria ciclică este foarte potrivită pentru o gamă largă de aplicaţii.

acolo unde poate afişa în continuare activitate redox. Această metodă permite. Combinaţia dintre solvent. o formă de precipitare. cel puţin. Această metodă cu soluţie staţionară are ca şi consecinţă apariţia caracteristicilor de peak controlate de difuzie. sarcina analitului. electrolit şi electrodul de lucru specific determină intervalul de potenţial baleiat. un electrod de referinţă şi un contraelectrod (figura 14). De obicei. Agitarea soluţiei între trasarea voltamogramelor este importantă pentru ca să furnizeze suprafaţei electrodului analit proaspăt în fiecare nou experiment. cu toate acestea. Această stratificare a analitului poate izola suprafaţa electrodului. ca o parte din analit să rămână. evidenţiind propria activitate redox în scanările ulterioare sau. Deoarece voltametria ciclică modifică. ele sunt în general în afara domeniului de aplicare al voltametriei ciclice. Unele speculaţii pot fi făcute în ceea ce priveşte peak-urile ireversibile. În timpul voltametriei ciclice. electrozii sunt statici şi aşezaţi în soluţii negitate. după reducere sau oxidare. Solubilitatea unui analit se poate schimba drastic dacă se schimbă sarcina totală a acestuia. electrolitul este adăugat la soluţia de testat pentru a asigura o conductivitate suficientă. Condiţii experimentale Metoda utilizează o combinaţie de trei electrozi: electrodul de lucru.vent. este uzual pentru analitul redus sau oxidat să precipite pe electrod. Celula electrochimică pentru experimentul de voltametrie liniară sau ciclică. de obicei. Figura 14. de asemenea. poate modifica 482 .

atâta timp cât este asigurată o conducţie bună a curentului. ceea ce le limitează la voltametria cu baleiaj liniar de potenţial. de asemenea. fluxul spre suprafaţa electrodului este realizat prin agitare. Pentru a minimiza curentul şi rezistenţa. Pentru interpretarea rezultatelor de voltametrie ciclică este important ca electrodul să posede o arie a suprafaţei controlată cu o formă definită. contraelectrodul de platină şi electrodul de referinţă Ag/AgCl/KClsat. poate fi orice material care conduce cu uşurinţă şi nu va reacţiona cu volumul soluţiei. pot fi folosiţi ultramicroelectrozi. pompare a soluţiei sau rotaţia electrodului. Reacţiile care apar la suprafaţa contraelectrodului sunt lipsite de importanţă. Materialele uzuale pentru electrozii de lucru sunt: cărbunele sticlos. Celula electrochimică conţine 10 ml soluţie de analit şi este echipată cu 3 electrozi: electrod de lucru din grafit. Din acestea sau alte motive. Remarci Voltametrie ciclică nu este o tehnică hidrodinamică. Aceşti electrozi sunt. ipa/ipc.şi să se determine parametrii electrochimici: Eo’. Într-o tehnică hidrodinamică. uneori separaţi de soluţia testată prin capilare Luggin care să împiedice infestarea electrolitului cu KCl. sub numele de electrod auxiliar. în general. Electrozii de referinţă uzuali sunt cei de calomel sau de Ag/AgCl saturaţi cu KCl. care apar oricum indiferent dacă baleiajul se face dinspre valori pozitive sau negative. ceea ce duce la denaturarea formei voltamogramei. încastraţi într-un material izolator inert. Exemplu Se realizează o soluţie de hexacianoferat de potasiu 0. ΔEp. având doar un disc expus la unul dintre capete. adesea este necesară curăţarea electrozilor între scanări. platina şi aurul.5 mM K3Fe(CN)6 prin dizolvarea cantităţii corespunzătoare de sare în 100 ml de KCl 1 M. Pentru a menţine curentul observat la contraelectrod. precum şi D. Aceste tehnici ţintesc condiţiile de stare de echilibru.suprafaţa electrodului. Utilizând voltametria ciclică să sa investigheze comportamentul cuplului redox Fe(CN)63-/4. Pentru a executa experimente de voltametrie ciclică la viteze de scanare mari este insuficient un electrod de lucru obişnuit. Vitezele mari de scanare creează peak-uri având intensităţi mari de curent. 483 . Un electrod de lucru obişnuit are o rază de un ordin de mărime de câţiva mm. care au ca rezultat creşterea rezistenţei. cum este în cazul electrozilor disc-rotitor şi disc-inel-rotitor. se vor oxida sau reduce adesea electrolitul sau solventul. Contraelectrodul cunoscut.

+ e.→ [FeIII(CN)6]4[FeII(CN)6]4. Figura 16. În fereastra «Data presentation» va apărea voltamograma on-line. Eventual. La rularea softului GPES se deschid 3 ferestre (figura 16).+ e(13) (14) Aparatura folosită este un potenţiostat Autolab PGStat 10 (EcoChimie. 484 . Olanda) pilotat de computer (figura 15). se fixează şi parametrii pretratamentului (depinde de sistemul studiat). după ce s-a dat comanda “Start”. În fereastra «Edit Procedure» se fixează parametrii experimentului: potenţialul de start. Softul GPES pentru pilotarea potenţiostatului.→ [FeIII(CN)6]3. Potenţiostat Autolab PGStat 10.Procesele de electrod sunt: reducere: oxidare: [FeII(CN)6]3. În fereastra «Manual Control» se bifează toată gama de curenţi pentru ca rRESezentarea grafică on-line să se autoscaleze. numărul de cicluri şi viteza de baleiaj. potenţialul de întoarcere. Figura 15.

1 M.1 V/ Ag/AgCl. Cronoamperometrie Cronoamperometria este o tehnică electrochimică în care potenţialul electrodului de lucru este variat după un semnal tip treaptă.753e-4 Eo’ (V) 0. tampon fosfat 0. Figura 18.253 Ipa (A) 1.278 0. 485 . tampon fosfat 0.303 0.815 0. KClsat log v Figura 17. pH = 6.023e-4 2. 2 cicluri. care scade exponenţial cu timpul.253 0. curentul faradic rezultat la electrod este monitorizat ca funcţie de timp.255e-4 -2. ca orice circuit RC.00025 -0. Condiţii experimentale: electrolit.Pentru sistemul studiat.00050 -0. se observă ca mărimile ΔEp şi ipa/ipc au valori care plasează sistemul studiat în cazul sistemelor monoelectronice. pH = 6.2 0. Ca şi toate tehnicile cu puls de potenţial. Curentul obţinut (figura 19) are două componente: un curent datorat încărcării stratului dublu (figura 20) şi altul datorat transferului de electroni. KClsat. v (mV/s) 50 100 Epa (V) 0. KClsat.1 M.00050 anodic catodic 1E-3 0. Log v pentru electrodul CV/NP (0.8. Tabelul 1.1 V/ Ag/AgCl.00075 20 mV/s 50 mV/s 70 mV/s 100 mV/s 200 mV/s 0. Voltamograma ciclică pe CV/NP (0.8.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl.00025 -0.050 ipa/ipc 0. -0.00000 0.0 0. Dependenţa log I vs.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl. 2 cicluri.254e-4 Ipc (A) -1.6 10 E/ V vs.303 Epc (V) 0. la diferite viteze de baleiaj. 0. Din panta rRESezentării log I vs log v (figura 18) se stabileşte puterea lui v şi astfel se verifică posibilitatea de a utiliza ecuaţia Randles-Sencik pentru calculul coeficientului de difuzie.00075 log I 1E-4 I/A 0.050 0. potenţial de start.278 ΔEp (V) 0.4 0. se obţin voltamogramele din figura 17. Condiţii experimentale: electrolit. cronoamperometria generează un curent mare. potenţial de start. reversibile (conform Anexei 1). Ag/AgCl. -0.818 Din datele prezentate în tabelul 1. Parametrii electrochimici ai sistemului studiat în figura 17.

curentul faradaic în condiţii controlate de difuzie este direct legat cu gradientul de concentraţie. Iniţial. cum panta profilului de concentrare pentru Ox scade cu timpul în urma excitării sub formă de treaptă de potenţial. Aceasta duce la formarea unui gradient de concentraţie pentru Ox. unde este imediat redusă la Red. se extinde. concentraţia de Ox din vecinătatea electrodului este redusă la zero faţă de concentraţia iniţială.: 1 mM. în faza de volum de 1 mM. acelaşi lucru se va observa şi în cazul curentului. Cu cât electrodul rămâne mai mult la acest potenţial de reducere. care după formarea sa este liber să difuzeze departe de suprafaţa electrodului. evaluate la x = 0. Această situaţie este prezentată în Figura 21. Profilul curentului stratului dublu electric Considerând o situaţie în care un electrod solid este cufundat într-o soluţie care conţine forma oxidată (Ox) a unui cuplu redox la concentraţie iniţială cunoscută (C0). pe măsură ce trece timpul. asigurându-ne că doar Ox este prezent în soluţie. cu atât stratul de difuzie sărăcit în Ox. Un gradient similar.Figura 19. iar forma Ox din vecinătatea electrodului este imediat transformată (după o cinetică reversibilă) la forma Red. dar în sens opus există pentru Red. ∂Ci/∂x. de ex. potenţialul este modificat după un semnal de tip treaptă până la o valoare semnificativ mai negativă decât E0’ pentru cuplu redox (Es). Cronoamperograma Figura 20. Astfel. electrodul este fixat la un potenţial (Ei) mult mai pozitiv decat ale E0’ a cuplului Red/Ox. Ca urmare a transformării. Soluţia conţine. de asemenea. 486 . prin care Ox din cea mai mare parte a soluţiei trebuie să difuze la suprafaţa electrodului. Aşa cum s-a discutat anterior. în faza de volum. un exces de electrolit inert. La un moment t0. şi se lucrează în acele condiţii experimentale care să asigure că fluxul spre electrod să fie strict controlat de difuzie.

Semnalul de excitare in cronoamperometrie si evolutia profilului de concentratie la suprafata electodului. scade ca funcţie de 1/t si are valori semnificative numai în perioada iniţială (de câteva ms) imediat după aplicarea semnalului treaptă. În exemplul de mai sus. Ecuaţia cea mai utilă în cronoamperometria este ecuaţia Cottrell. Acesta poate fi uşor înregistrat prin efectuarea experimentului într-o celulă care conţine doar electrolit.uoa. pot fi găsite la (http://www. În general.gr/applets/AppletDiffus/Appl_Diffus2. această influenţă poate fi evitată numai luând în considerare datele i-t în ultimele 90% din timp. si D0 = constanta de difuzie pentru specia electroactiv (cm /s).485 C/echivalent). pentru un sistem reversibil (de reducere). i = n F A Co Do1/2 π-1/2 t-1/2 [A] 2 (15) unde n = numărul de electroni implicaţi în reactie. raportul [Red] la [Ox] la suprafaţa electodului este dat de ecuaţia lui Nernst la orice potenţial. există şi cele cu treaptă dublă de potenţial. ic. F = constanta Faraday (96. Pe lângă cel mai frecvent experiment de cronoamperometrie. Prin natura lui acest curent capacitiv. Informaţii suplimentare cu privire la formarea de gradienţilor de concentrare. în urma unui trepte de potenţial într-o reacţie redox reversibilă (sau la suprapotenţial mare) în funcţie de t-1/2.chem.html). A = aria electrodului (cm ). C0 = concentraţia speciei electroactiv (mol/cm ). concentraţia de Ox la suprafaţă a atins imediat valoarea zero pentru o treaptă de potenţial mult mai negativă decât E0’ a cuplului redox. Curentul datorat încărcării stratului dublu. în care potenţialul revine la o valoare finală (Ef) după ce este menţinut o perioadă de timp τ. care descrie curentul observat (electrodul planar) în orice moment. la potenţialul Es. cu raportul 100:1 ajungând la o valoare de 118 mV mai negativă decât E0’. 487 2 3 . contribuie la curentul total observat după aplicarea unei treapte de potenţial. în care numai curentul rezultat este înregistrat. adică cel cu o singură treaptă de potenţial.Figura 21. De obicei.

Prezenţa unei reacţii chimice după etapa de transfer de electroni va duce la un raport diferit de această valoare teoretică... R. Brett Oliveira A. Pentru cei interesaţi detaliile se află în Bard şi Faulkner. după fiecare treaptă de potenţial. A. unde este menţinut un timp τ. Un sistem simplu. 6. fie de D0 pentru o specie electroactivă. Metoda dublei trepte de potenţial este deseori aplicată în măsuratori de constante de viteză pentru reacţii chimice (inclusiv produşi de adsorbţie) care apar în urma primei trepte de potenţial. 1993. Brett C. De exemplu. valorile curentului măsurat la un moment egal cu τ/2. curentul observat pentru prima treaptă scade cu t-1/2. Co si Do cunoscute]. Methods and Applications.Bibliografie 1. Bard A. În general.Cronoamperometria cu pas dublu de potenţial este ilustrată în figura 22.. Electrochemistry: Principles. În partea stângă a figurii este arătat felul cum se aplică treapta de potenţial de la Ei la Es. sunt uşor de realizat măsurători. Curentul apărut la treapta de întoarcere este conceptual mai dificil de explicat decât cel de la prima treaptă. J. 488 . Semnalul de excitare şi răspunsul în cronoamperometria cu treaptă dublă . fie de n. . Cronoamperometria se pretează bine la măsurarea exactă a ariei electrodului (A) prin utilizarea unui cuplu redox bine-definit (cu n. Cum era de aşteptat din ecuaţia Cottrell. M. 2. Cu o suprafaţă de electrod cunoscută.293 pentru raportul dintre [-ir (2τ)/if (τ). Figura 22. Faulkner L. M. Electrochemical Methods: Fundamentals and Applications. John Wiley and Sons Publishers. Oxford University Press. USA. cât şi electrochimic. reversibil poate fi identificat prin compararea valorile curentului direct şi invers măsurat în acelaşi interval de timp. transferul de electroni este reversibil atât chimic. pentru ca apoi să revină la Ef = Ei. curentul din perioada de întoarcere este înregistrat tot pentru un inte rval de timp τ. după fiecare treaptă (notat ir şi if în figura 22) pentru un astfel de sistem ar duce la o valoare egală cu 0. New York. În acest exemplu. 2001.

Anal. S.. Anal. Shain I.co. Chem.. Singapore. Nicholson R. 37(11). 2007. Scholz. Berlin. Komorsky-Lovrić. se calculează ks s ⎟ ⎟ ⎜ ⎜D ⎟v −1 / 2 Ψ = ⎜ ⎝ Re d ⎠ 1/2 ⎜ ⎡ nF ⎤ ⎟ D π ⎜ ox ⎥ ⎟ ⎜⎢ RT ⎦ ⎟ ⎠ ⎝⎣ Sisteme ireversibile. 1964.. Banks C.5 [mV] ⎛ RT ⎞ E p . 8. 1965. 178. M. 1965. edt) Springer-Verlag. Experimental Techniques and Applications. Chem. In: Monographs in Electrochemistry (F. Understanding voltammetry. E. Bartlett P. S.09⎜ ⎟ = E1 / 2 + n ⎝ nF ⎠ ΔEp (= Epc .. 1965. Nicholson R. World Scientific.Epa) = 59/n ipa/ipc = 1 Sisteme cvasi-reversibile ⎛ nF ⎞ i p = nFAC* D1/2 Ψ(E) v1/2 Ox ⎜ RT ⎟ ⎝ ⎠ ⎛ RT ⎞ Ep/2 . se calculeaza k ⎜ 0..E1/2 = . Shain I. 7. Chem.1. (Editor) Bioelectrochemistry: Fundamentals. Anal.. Mirčeski. G. ISBN 978-3-540-73739-1. 1965. Nicholson R .. α )⎜ ⎟ ⎝ nF ⎠ ⎛ ⎜ ⎜ ko Λ=⎜ nF ⎜ ⎡D1−α Dα ⎜ ⎢ Ox Red RT ⎝⎣ ⎞ ⎟ ⎟ 1/2 ⎟ ⎤ v⎥ ⎟ ⎟ ⎦ ⎠ 1/2 ⎛ ⎛ D ⎞α/2 ⎞ ⎜ ⎜ ox ⎟ k ⎟ . se calculează D Sisteme reversibile 28. 706. Theory and Application.3.. 37.N. 1351] E p .. ISBN 981-270-625-9 5.pdf) Anexa 1. Chem. S. Nicholson R. John Wiley & Sons..7 [mV]. V.. 36.109⎜ ⎟=− n ⎝ nF ⎠ RT 28. Anal. se calculeaza D na = număr de 1/2 o ⎞ ⎛ 1/2 ⎞ RT ⎛ αn F ⎞ 1/2 . Anal. ip = (2. Anal. 37..(ISBN 978-0470843642) 4. 1965. 2008. 1351 (https://twiki. Ltd.78 + ln ⎜ D Ox ⎟ + ln ⎛ electroni transferaţi în E p = E o' ⎜ a ⎟ + lnv ⎟ o ⎜ ⎟ ⎜ ⎟ αn a F ⎝ RT ⎠ ⎝ k ⎠ etapa determinată de ⎝ ⎠ viteză 47. Š.99 *105) n(αna)1/2 A D1/2 v1/2 C* [A].Ep = (Λ . 6.uk/twiki/pub/People/ElectrochemistryPapers/TheoryandApplicationofC yclicVoltammetryforMeasurementofElectrodeReactionKinetics. 371 + XII p. S. 9. Nicholson R. Compton R..S. 10.5 [mV] ⎛ ⎞ E p/2 = E1/2 + 1. 2007..687 *105) n3/2 AD1/2 v1/2C* [A].ogt. 37. 37. 190. se calculeaza αna αn a [Pentru identificarea notaţiilor şi detalii vezi: Nicholson. 667..E p/2 = 489 . Chem. Lovrić: Square-Wave Voltammetry. Criterii de identificare pentru voltametria ciclică cu specia redox în soluţie ip = (2. Chem. Shain I..

..................Electrochimia unei substanţe cu potenţial biologic activ. Influenţa pHului asupra comportării sistemului G//Fe(III)P pe electrod de grafit ...........300 V si Ipa/Ipc = 0.....493 2. Estimarea stabilităţii sistemului G/SWCNT–Fe(III)P-Nafion la funcţionare continuă ........2...... Calculul constantei eterogene de transfer de electroni pentru sistemul G/SWCNT–Fe(III)P-Nafion ...................2...................................354 V...................................499 3........495 3............... ing........Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie ... .......................................................................................................1................. Ipa = 0....245 V..........497 3............................................................ prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj.......1 M KCl ca şi fond electrolitic pentru îmbunătăţirea conducţiei (Figura 1A)....501 3............494 2..4........... Studiul integrităţii filmului de Fe(III)P pentru sistemul G/SWCNT–Fe(III)P-Nafion prin calculul ariei suprafeţei active ................. Se trasează voltamogramele ciclice la diferite viteze de baleiaj pe electrodul de platină în soluţia de 5 mM K3[Fe(CN)6] care conţine 0............ Eo’ = 0............... Graziella Liana Turdean Cuprins 1.490 2..... Ec = 0.. Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie............................... Studiu de caz Conf.................507 1...........1........ prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj................987.498 3................................... Anexă ....... 490 ..............................................................3.......................................................................155 mA si Ipc = 0..................... a................5.......... Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) imobilizată în polimeri ............502 3........ Influenţa vitezei de baleiaj asupra comportării heminei in soluţie (G//Fe(III)P) pe electrod de grafit............ dr......................................... Influenţa vitezei de baleiaj asupra comportării heminei adsorbită (G/SWCNT–Fe(III) P-Nafion) pe electrod de grafit .................................504 4.......109 V. Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie.. Concluzii .................... pentru o viteză de baleiaj de 50 mV/s.........505 5.... Bibliografie ................. Comportamentul redox al acestei substanţe considerată standard este descris de ecuaţia 1: Fe(CN)6 + e -3 - → Fe(CN)6 -4 (1) şi se manifestă prin apariţia unei perechi de picuri bine conturate (poziţionate la Ea = 0...........506 6........... Influenţa pH-ului asupra comportării sistemului adsorbit (G/SWCNT– Fe(III)P-Nafion) pe electrod de grafit .......................157 mA) având parametrii electrochimici (ΔE = 0..

v = viteza de baleiaj (V/s) .2 0 . v1/2. D0 = coeficientul de difuzie (cm2/s). Analiza datelor prezentate în tabelul 1 indică că specia redox studiată. K3[Fe(CN)6]. Intensitatea curentului de peak (Ip) depinde de viteza de baleiaj (v) în conformitate cu ecuaţia Randles-Sevcic (ecuatia 2) pentru un sistem reversibil sub control difuziv [Bard A. Panta acestor regresii ne dă indicii despre tipul de transfer de sarcină difuziv (specia în soluţie.6 0 . C0* = concentraţia soluţiei în fază de volum (mol/cm3). se află în soluţie.0 0 . cu ajutorul curenţilor de peak anodic şi catodic (Ipa. panta în jur de 0.2 V vs.4 0 . se trasează dependenta log I vs. I. ESC.5.69*105 n3/2 A D01/2 v1/2 Co* (2) unde: Ip = curentul de peak (A). Ecuaţiile regresiei liniare sunt prezentate în tabelul 1.6 E / V vs. iar intensitatea curentului. log v (figura 1B).0 v 1 /2 / (V /s ) b.2 (B) 5 m V /s 1 0 m V /s 2 5 m V /s 5 0 m V /s 7 5 m V /s 1 0 0 m V /s 2 5 0 m V /s 5 0 0 m V /s 7 5 0 m V /s 9 0 0 m V /s anodic catodic I / μA I/A 1E-4 10 100 1000 -1 v / (mV *s ) 0 . n = numărul de electroni. conform ecuaţiei Randles Sevcik) sau transfer de sarcină eterogen (specia adsorbită. A = aria electrodului (cm2). ESC (C) Figura 1. log v pentru voltamogramele din fig 1A. (C) Influenta vitezei de baleiaj asupra curentului de peak I pentru voltamogramele din fig 1A.8 1/2 catodic 1 . dependenţa I vs.4 0 . J. Astfel. 500 / μA anodic 400 300 200 100 I / μA I 0 -1 0 0 -2 0 0 -3 0 0 -4 0 0 0 .(A) 800 600 400 200 0 -2 0 0 -4 0 0 -6 0 0 -0 .2 0 . 1980]: Ip = 2.1 M KCl pe electrod de platina. Ipc). panta în jur de 1). –0.. respec491 . Condiţii experimentale: potenţial iniţial. (B) Dependenta log I vs.0 0 . (A) Voltamograma ciclica a 5 mM K3[Fe(CN)6]+ 0.

132 e-5 ± 4.007) log v Ia /A= (2. Astfel. D.131 10-4)2/(0.00517 102 D01/2 de unde: D0 = a2/(0.69*105 (1)3/2 [π (0.648e-5 ± 3.41 10-6 cm2/s.a = (5.00517 102)2 = 1.9 10-5 cm2/s obţinut cu o soluţie 5 mM K3[Fe(CN)6] [Ye J.33 10-6 cm2/s.220e-6) + (5.817e-4 ± 2.69*105 (1)3/2 [π (0.00517 102)2 Adică: Do.. Atentie.552 ± 0.9994. I vs.tă dependenţa Randles-Sevcik faţă de v1/2. n = 6 R =0. Având stabilită dependenţă log I vs. Tabelul 1. unde a este panta.011) + (0.90e-6) – (6. v. v1/2 sunt prezentate în tabelul 1. Prin urmare panta regresiei liniare este: a = 2. log v se poate trasa dependenţa I vs. ecuaţia 2 devine: Ip = 2. A = aria electrodului (cm2) este (πd2)/4. n=6 R = 0.9992.c = (6.265 10-6 cm2/s si Do.7)2]/4 D01/2 5 10-6 = 0. Se înlocuiesc în ecuaţia Randles Sevcik (ecuaţia 2) parametrii cunoscuţi.00517 102)2 = 1.. 2003] si D = 5.7)2]/4 D01/2 5 10-6 v1/2 analoaga unei ecuaţii liniare y = a x.817 10-4)2/(0.415 ± 0. v1/2. adică d = 0. 492 . pentru a putea utiliza corect rezultatele. n=6 R = 0. pentru a putea utiliza ecuaţia Randles Sevcik la calculul coeficientului de difuzie. iar Dmediu = 1.009) log v Ic /A= (-1. unde d= diametrul electrodului.013) + (0. Datele obţinute sunt în concordanţă cu cele din literatură care variază între: D = 6. Valorile parametrilor regresiei liniare I vs.7 cm.858e-5) v1/2 /V/s R = 0. Astfel: n = numărul de electroni este 1 în conformitate cu reacţia 1. v1/2 (figura 1C) şi estima panta regresiei liniare.518 ± 0.131e-4 ± 1. adică 5 mM = 5 10-6 mol/cm3. 2004]. în rRESezentarea I vs.438 ± 0. anodic log Ia = (-4.s log v şi respectiv.008e-5)v1/2 /V/s log Ic = (-4. Regresii liniare pentru dependenţele log I v. valorile curentului trebuie să fie în amperi (A) şi ale vitezei de baleiaj (v) în (V/s).-S. C0* = concentraţia soluţiei de K3[Fe(CN)6] în fază de volum (mol/cm3).9976.9982 n = 6 catodic c.5 10-6 cm2/s obţinut cu o soluţie 20 mM K3[Fe(CN)6] [Hrapovic S. d.

12 Hematină. cu bacili scurţi. 17 – tetrametil . pleomorfic. cu capete rotunjite. printr-o slăbiciune musculară şi prin tulburări psihice.500 V vs.1. hématine [Dicţionarul explicativ al limbii române. Se distinge de hematină12 care are o grupare hidroxid în loc de clorură. Institutul de Lingvistică „Iorgu Iordan”. Peak-urile au fost atribuite unui comportament reversibil monoelectronic al cuplului redox Fe(III)/Fe(II) coordinat în inelul porfirinic (Figura 3A). facultativ anaerobe. se află la originea acestor crize. contraceptivele orale. Urinele devin roşii atunci când sunt lăsate să aştepte. KClsat. hematine. 14 Potenţialul formal standard se calculează ca media aritmetică a potenţialelor de peak anodic şi catodic. Mai exact.0.5/0. Academia Română. uneori prin crampe. porfirinele.3 μm). Hematina este considerată "factorul X" necesar pentru creşterea Haemophilus Figura 2.→ Fe(II)P Din 10 (3) conţine parametrii electrochimici ai tabelul 2. Structura heminei.2. 7.2.350 to . 1998]. în special în porfiria intermitentă acută11. termenii sunt uneori echivalenţi. 493 . 13 Haemophilus influenzae sunt cocobacili Gram negativi. în conformitate cu reacţia 3: Fe(III)P + e. ca barbituricele. care Porfiria este o boală ereditară cauzată de o tulburare a sintezei hemului (fracţiunea neproteică a hemoglobinei) şi caracterizată prin acumularea în ţesuturi a unor substanţe intermediare ale acestei sinteze. 12. în funcţie de pHul soluţiei. sulfamidele si fenitoina.f. Editura Univers Enciclopedic. 18 –dipropanoato (2−)]fier(III).Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie Hemina (denumirea IUPAC: cloro[3. Porfiriile sunt boli foarte rare. nu formează spori. Ag/AgCl. 11 Porfiria intermitentă acută se manifestă de cele mai multe ori la vârsta adultă prin dureri abdominale acute. Este folosit în gestionarea atacurilor de porfirie10.) pigment care provine din sânge şi conţine fier. este protoporfirina IX care conţine un ion de fier feric (Heme b) şi un ligand clorură. drepţi. (s.8. influenzae13. – din fr. Voltamogramele ciclice ale Fe(III)P în soluţie obţinute la diferite viteze de baleiaj pe electrod de grafit arată o pereche de peak-uri bine definite plasate la un potenţial formal standard (εo’)14 care se plasează între – 0. mici (1 . denumirea comercială: Panhematina) este o porfirină cu conţinut de fier (figura 2). Numeroase medicamente. 13 – divinilporfirin . Este non-motil. Cu toate acestea.

descris de o ecuaţie în care v este la puterea 1. indică faptul că specia studiată se adsoarbe pe electrod în timpul trasării voltamogramelor.05 M. Ca urmare dependenţa liniară I-v (figura 3C) confirmă un transfer de electroni heterogen. Ag/AgC l. potenţial initial. (A) 300 200 100 v v v v v v v = = = = = = = 10 m V*s -1 20 m V*s -1 100 m V*s -1 300 m V*s -1 500 m V*s -1 1000 m V*s -1 1500 m V*s -1 (B) anodic catodic 100 I/μA log I 0 10 -100 -200 -300 -750 1 E / m V vs . indiferent de pHul soluţiei. (C) Influenta vitezei de baleiaj asupra curentului de peak I pentru voltamogramele din fig 3A. pH 8. într-unul cvasi-reversibil. (B) Dependenta log I vs. indicând transformarea procesului reversibil. nu este posibil calculul coeficientului de difuzie D al speciei studiate din ecuaţia Randles-Sevcik (aşa cum s-a descris în capitolul 1. KClsat. separarea peak-urilor (ΔEp) devine superioară valorii de 59/n mV. care având valori în jur de 1 (tabelul 3