Editori Mihaela Aluaş Simion Simon

Metode experimentale avansate pentru studiul şi analiza bio-nano-sistemelor

1

2

Editori Mihaela Aluaş Simion Simon

METODE EXPERIMENTALE AVANSATE
PENTRU STUDIUL ŞI ANALIZA BIO-NANO-SISTEMELOR

Casa Cărţii de Ştiinţă Cluj-Napoca, 2012 3

Coperta: Patricia Puşcaş

Editură acreditată CNCSIS (24)

© Universitatea „Babeş-Bolyai”, 2012

Material editat în cadrul proiectului „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, ID 36154

Descrierea CIP a Bibliotecii Naţionale a României Metode experimentale avansate pentru studiul şi analiza bio-nanosistemelor / ed.: Mihaela Aluaş, Simion Simon. - Cluj-Napoca : Casa Cărţii de Ştiinţă, 2012 Bibliogr. ISBN 978-606-17-0115-5 I. Aluaş, Mihaela (ed.) II. Simon, Simion (ed.) 53

4

Prefaţă
În calitate de director al proiectului cu titlul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract” POSDRU/21/1.5/G/36154, doresc să mulţumesc tuturor colaboratorilor care au contribuit prin expertiza şi profesionalismul lor la realizarea acestui volum şi, implicit, la dezvoltarea programului doctoral. Mulţumirile mele se îndreaptă de asemenea către echipa de management a proiectului, în următoarea componenţă: Prof. dr. Simion Simon, coordonator ştiinţific program doctoral Prof. dr. Octavian Popescu, coordonator ştiinţific relaţii internaţionale Cristina Dominic, asistent manager Andra Ghira, responsabil logistic şi asistent manager Jr. Alexandru Braşoveanu, consilier juridic Ec. Gelu Silviu Moldovan, responsabil financiar Ing. Carmen Ciplea, expert IT Ec. István Püsök, expert contabil Am convingerea că informaţia cuprinsă în această lucrare va sprijini generaţiile prezente şi viitoare de conducători de doctorat în activitatea lor de cercetare. De asemenea, va facilita orientarea doctoranzilor în lumea minunată a ştiinţei contribuind la determinarea acestora de a face din meseria de cercetător o vocaţie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară”, cod contract POSDRU/21/1.5/G/36154, a fost cofinanţat din Fondul Social European prin Programul Operaţional Sectorial Dezvoltarea Resurselor Umane 2007-2013. C.S.III. dr. Mihaela ALUAŞ 5

6

Cuvânt înainte
Institutul de Cercetări Interdisciplinare a fost înfiinţat prin Hotărârea Senatului Universităţii Babeş-Bolyai din data de 30.05.2001, ca unitate de cercetare şi transfer tehnologic, având ca obiectiv de activitate atât realizarea de studii şi cercetări interdisciplinare în domeniile biologie moleculară, biomateriale şi sisteme biologice, materiale avansate şi mediu ambiant, sisteme nanostructurate natural şi artificial, cât şi transferul rezultatelor obţinute către beneficiari locali, naţionali sau internaţionali. Institutul beneficiază de o clădire proprie, cu o suprafaţă desfăşurată de peste 3000 mp, modernizată la nivelul standardelor internaţionale din punct de vedere al dotărilor conexe şi având laboratoare de cercetare structurate în acord cu nevoile cercetărilor interdisciplinare menţionate. Între timp institutul, prin efortul conjugat al celor care au decis să-şi dedice energia şi cunoştinţele cercetărilor la interfaţa Bio-NanoSistemelor, a devenit Institutul de Cercetări Interdisciplinare în Bio-NanoŞtiinţe (ICI-BNS). În cadrul acestuia îşi desfăşoară activitatea în prezent 12 profesori universitari (dintre care 10 conducători de doctorat), 25 alte cadre didactice şi cercetători şi peste 40 de doctoranzi cu frecvenţă. Aceştia aparţin domeniilor Fizică, Chimie, Biologie, Informatică, Ştiinţa mediului şi Psihologie. Proiectul „Program doctoral performant pentru formarea resursei umane înalt calificate în cercetarea ştiinţifică interdisciplinară” a oferit posibilitatea de a mobiliza un set de cercetători valoroşi, cu experienţă deosebită în tehnicile experimentale frecvent utilizate în cercetările interdisciplinare din domeniul Bio-Nano-Ştiinţelor. Marea majoritate a experţilor a beneficiat de stagii doctorale sau postdoctorale în prestigioase laboratoare din lume unde au dobândit o bogată experienţă în utilizarea echipamentelor de înaltă performanţă de care dispune Institutul nostru. Studenţii doctoranzi, dar şi specialişti din domenii ca: fizică, chimie, biologie, geologie sau ştiinţa mediului interesaţi în studii experimentale interdisciplinare vor găsi în materialele incluse în prezentul volum date teoretice dar mai ales practice, despre tehnici experimentale avansate prezentate într-o formă accesibilă, cu exemple semnificative, menite a facilita înţelegerea fenomenelor studiate şi a contribui la creşterea aportului fiecărui cercetător la dezvoltarea domeniului în care îşi va desfăşura activitatea ştiinţifică. Prof. Dr. Simion SIMON Director ICI-BNS

7

8

CUPRINS
I. ANALIZE GENETICE ................................................................................................. 13 Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine.......................................................................................................................... 13 Asist. univ. dr. Iulia Lupan Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare ........... 36 Asist. univ. dr. Iulia Lupan II. CULTURI CELULARE ............................................................................................... 64 Culturi celulare ........................................................................................................... 64 Lect. dr. Mircea Teodor Chiriac Culturi celulare – partea a II-a .................................................................................... 82 Lect. dr. Mircea Teodor Chiriac III. MICROSCOPUL CONFOCAL RAMAN............................................................ 101 Microspectroscopia Raman....................................................................................... 101 Conf. dr. Monica Maria Baia Microspectroscopia Raman – partea a II-a................................................................ 121 Conf. dr. Monica Maria Baia IV. SPECTROMETRUL IR........................................................................................... 134 Spectroscopia de absorbţie în infraroşu .................................................................. 134 Lect. dr. Nicolae Leopold Tendinţe moderne în spectroscopia de absorbţie IR ............................................. 147 Lect. dr. Nicolae Leopold V. SPECTROFLUORIMETRUL .................................................................................. 160 Spectrofluorimetria .................................................................................................... 160 Conf. dr. Dana Maniu Spectrofluorimetria - aplicaţii ................................................................................... 172 Conf. dr. Dana Maniu VI. SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ ......... 191 Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) .................. 191 C.S.I. dr. Claudiu Filip, C.S.III. dr. Mihaela Aluaş Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă .......................................................................................................... 216 C.S.I. dr. Claudiu FILIP, C.S.III. dr. Mihaela Aluaş

9

Rezonanţa magnetică nucleară pe sisteme lichide ................................................ 246 Lect. dr. Mihai Vasilescu VII. MĂSURĂTORI TERMICE .................................................................................. 266 Analiză termică diferenţială. Analiză calorimetrică diferenţială......................... 266 Conf. dr. Raluca Ciceo-Lucăcel Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială. Ghid de interpretare a măsurătorilor DTA/TG şi DSC........................................................................................................................... 275 Conf. dr. Raluca Ciceo-Lucăcel VIII. DIFRACTOMETRUL DE RAZE X ................................................................... 286 Difracţie de raze X pe pulberi ................................................................................... 286 C.S.I. dr. Gheorghe Borodi Determinarea structurii cristaline prin difracţie de raze X................................... 305 C.S.I. dr. Gheorghe Borodi IX. MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE ........... 327 Microscopia electronică ............................................................................................. 327 şef lucrări dr. Lucian Barbu-Tudoran Microscopia electronică - partea a II-a .................................................................... 347 şef lucrări dr. Lucian Barbu-Tudoran X. MICROSCOPUL DE FORŢĂ ATOMICĂ ............................................................ 365 Microscopia de forţă atomică ................................................................................... 365 Conf. dr. Ioan Burda Microscopia de forţă atomică – partea a II-a ........................................................... 378 Conf. dr. Ioan Burda XI. SPECTROMETRUL DE FOTOELECTRONI DE RAZE X ŞI ULTRAVIOLETE .......................................................................................................... 394 Spectroscopia fotoelectronică ................................................................................... 394 C.S.III. dr. Maria Teodora Radu Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale ................................................................................... 424 C.S.III. dr. Teodora Maria Radu, C.S.dr. Emilia Sabina Varga XII. SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN .......... 437 Spectroscopia de rezonanţă electronică de spin ................................................... 437 C.S. dr. Milica Todea Spectroscopia de rezonanţă electronică de spin – partea a II- a ............................ 452 C.S. dr. Milica Todea

10

..... 509 Sisteme de analiză a suprafeţei specifice şi a dimensiunii particulelor . METODE ELECTROCHIMICE .......... Studiu de caz . dr.......... 509 Lect................. Graziella Liana Turdean XIV.......... ing...... SISTEME DE ANALIZĂ A SUPRAFEŢEI SPECIFICE ŞI A DIMENSIUNII PARTICULELOR ..... dr....... Réka Barabás     11 ......... 467 Conf...... 490 Conf....................XIII.. Graziella Liana Turdean Electrochimia unei substanţe cu potenţial biologic activ.......................................................... ing. ing...... 467 Elaborarea................ testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice .. dr..................

  12 .

........................ 33 4....... ANALIZE GENETICE Clonarea şi exprimarea genelor – o metodă excepţională pentru obţinerea de proteine Asist... ARNm rezultat serveşte ca matriţă în procesul de traducere a ADN (sinteza proteinelor) care are loc în ribozomi.. Păstrarea include transmiterea materialului genetic nemodificat de la o generaţie la alta............. 13 2........... Informaţia genetică nu poate fi transmisă invers............................................... Dogma centrală a biologiei presupune transmiterea unidirecţională a informaţiei de la ADN la proteine prin intermediul ARN (Figura 1)................................................................. univ..... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot ADN în sine are doar 2 funcţii importante şi anume păstrarea informaţiei genetice şi furnizarea acesteia pentru sinteza de proteine. Bibliografie ...............I........... Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare .. dr....... Nu există cazuri de transmitere a informaţiei de la ADN direct la proteine....... Informaţia genetică poate fi transmisă de la ARN la ADN în cazul retrovirusurilor la care materialul genetic este ARN.. 31 3............... Infrastructura existentă în cadrul Centrului de Biologie Moleculară ................. Practic ARN este cărăuşul informaţiei din nucleu în citoplasmă unde are loc sinteza proteinelor.... Mesagerul informaţiei între ADN şi proteine este ARN....... Prezentarea principiilor metodei de clonare şi exprimare a genelor în sistem procariot ............ 34 1................................ 13 .... A doua funcţie este legată de descifrarea informaţiei pentru sinteza de proteine.......... Acest fapt este realizat prin replicarea ADN şi împărţirea egală a celor două copii în timpul diviziunii celulare...................... Iulia Lupan Cuprins 1....... care este sintetizat în procesul de transcriere a ADN de către o enzimă numită ARN polimerază............ de la proteine la ADN.

ARN informaţional este ARN mesager (ARNm) care codifică un polipeptid şi serveşte ca matriţă în procesul de traducere (sinteză a proteinelor). Sumar. procesul clonării constă din următoarele etape: • amplificarea genei de interes • introducerea genei de interes într-un vector de clonare • introducerea moleculelor recombinate în celule gazdă • selecţia celulelor transformate (purtătoare ale moleculei recombinate) Figura 1. ci un fragment de ADN care nu poate fi separat dintr-un amestec heterogen de molecule apropiate ca mărime. fie prin copierea acestuia. Moleculele de ARN rezultate în urma transcrierii pot fi împărţite în 2 categorii: • ARN funcţional • ARN informaţional ARN funcţional este ARN care nu se traduce. A doua opţiune de copiere a fragmentului din genom este cea mai des 14 . În alte cazuri scopul clonării nu este obligatoriu o genă. Din această cauză în continuare se va utiliza doar termenul fragment ADN de interes pentru a evita confuziile. care necesită apoi o izolare din amestecul de fragmente generate. Prin multiplicarea celulelor cu genele clonate se pot obţine milioane de copii ale unei singure gene. Tăierea fragmentului din genom este mai dificilă deoarece necesită prezenţa unor situsuri (secvenţe specifice) la capetele fragmentului. Dogma centrală a biologiei. Deoarece fragmentul ADN de interes sau ţintă se află într-un genom este necesară extragerea acestuia. De cele mai multe ori genele de interes care sunt scopul clonării codifică un polipeptid. O genă este considerat orice fragment de ADN care se transcrie într-o moleculă de ARN. îndeplineşte anumite funcţii în celulă (în cea mai mare parte participă la procesul de traducere) şi ocupă cea mai mare parte din ARN total din celulă: ARN ribosomal (ARNr) şi ARN de transport (ARNt). iar numărul moleculelor deci şi cantitatea de ADN este mică. fie prin tăierea acestuia din genom. • verificarea moleculelor recombinate Amplificarea genei de interes. Există 2 modalităţi de a obţine fragmentul dorit.Clonarea genelor constă în izolarea unei gene dintr-un genom şi introducerea ei în alte celule gazdă pentru multiplicare şi în unele cazuri pentru exprimare.

Etapele de denaturare după primul ciclu sunt mai scurte. Amorsele (termenul englezesc este primer). sunt secvenţe scurte de ADN monocatenar. Denaturarea ADN presupune separarea celor două catene. Dacă secvenţa este necunoscută. Dacă în celule pentru replicare se foloseşte o întreagă serie de proteine. în special la capetele acesteia. Există mai multe formule de calcul. Principiul tehnicii PCR este o imitaţie a procesului de replicare a ADN care are loc în celule. denumite şi oligonucleotide. doar de 30-45 sec. Ca agent denaturant se utilizează temperaturi înalte de 94-98ºC. O condiţie obligatorie pentru o amplificare reuşită este cunoaşterea secvenţei ţintă. Temperatura de aliniere se stabileşte la câteva grade (2-5ºC) mai puţin decât temperatura de topire (Tm) a amorsei. Această etapă este numită de aliniere sau hibridizare. Această tehnică poate fi considerată un adevărat copiator de gene. Aceste amorse sunt complementare cu extremităţile secvenţei ţintă şi formează cu acestea porţiuni scurte dublu catenare. atunci se vor analiza cel puţin secvenţe ADN omoloage de la alte specii sau secvenţa de aminoacizi a proteinei dacă este vorba despre o genă. Denaturarea din primul ciclu durează câteva minute (2-6) deoarece pentru denaturarea moleculelor de ADN genomic. cea mai simplă formulă de calcul pentru o amorsă de până în 25 de nucleotide este: Tm = 4 (G + C) + 2(A + T) 15 . Reacţia de amplificare este una ciclică. cum ar fi spre exemplu denaturarea ADN. temperatura este coborâtă la 40-60ºC timp de câteva zeci de secunde. e nevoie de mai mult timp. este rapidă şi sensibilă deoarece necesită cantităţi foarte mici de ADN matriţă.utilizată. Tehnica este pe larg utilizată. iar după 35-40 de cicluri se obţin milioane de copii ale fragmentului ţintă pornind de la o singură copie. fiecare ciclu fiind alcătuit din 3 etape: • denaturarea ADN • alinierea amorselor • sinteza catenei complementare de către ADN polimerază După fiecare ciclu practic cantitatea de ADN se dublează. aici rolul unora dintre ele este preluat de unii factori fizici. catenele complementare formând molecula dublu catenară după înlăturarea agentului de denaturare. Procesul este reversibil. Denaturarea ADN este necesară pentru separarea celor 2 catene. Temperatura de topire se calculează în dependenţă de lungimea amorsei şi de compoziţia ei. În acest scop se utilizează tehnica PCR (Polymerase Chain Reaction). care sunt foarte mari. Pentru alinierea amorselor la secvenţele complementare.

dar şi ca punct start pentru ADN polimerază. De la aceste porţiuni dublu catenare formate între catena matriţă şi amorsa ADN. Taq polimeraza are activitatea optimă la 72°C şi nu se denaturează la temperaturi ridicate de peste 90°C foarte repede. Iniţial la originea tehnicii PCR se folosea ADN polimeraza izolată de la bacteria Escherichia coli. Numărul de G şi C se înmulţeşte dublu faţă de A şi T deoarece între acestea există 3 legături de hidrogen. Există câteva reguli pentru construirea amorselor şi anume: • numărul de nucleotide este de 15-35 • temperatura de topire a amorselor trebuie să fie între 40 şi 70ºC • conţinutul de G şi C nu trebuie să depăşească 50-55% • la capătul 3' al amorsei este de dorit să fie o G sau C. izolată de la o bacterie termofilă Thermococcus aquaticus (de unde şi denumirea ei). Enzima revoluţionară în acest sens. Astfel amplificarea fragmentelor de ADN era una foarte costisitoare. A şi T sunt numărul de nucleotide ce conţin aceste baze azotate. Amorsele servesc în primul rând la delimitarea fragmentului amplificat. Viteza de polimerizare a Taq polimerazei este de 16 . În acest fel tuburile de reacţie trebuiau schimbate de la o temperatură la alta şi după fiecare ciclu era nevoie de un surplus de ADN polimerază. altfel se vor forma porţiuni dublu catenare sau dimeri de amorse. iar ca rezultat se vor amplifica porţiunile scurte rămase monocatenare. deoarece oferă o stabilitate mai mare • amorsele nu trebuie să prezinte complementaritate internă. în consecinţă moleculele bogate în G şi C au o temperatură mai mare de topire. Salvarea acestei metode a venit după descoperirea şi descrierea ADN polimerazelor de la bacteriile termofile. polimeraza poate iniţia sinteza catenei complementare. C.Unde G. care are activitatea optimă de sinteză la 37°C. care sintetizează polimerizarea nucleotidelor trifosfat într-un lanţ polinucleotidic în direcţia 5′→3′. pe larg utilizată şi astăzi este Taq polimeraza. ADN polimeraza catalizează sinteza catenei complementare în direcţia 5'→3' (Figura 2). care nu poate porni sinteza de la zero şi are nevoie de un capăt liber 3'. astfel după câteva ore la 95°C pierderea de activitate este nesemnificativă. Cel mai mare dezavantaj al utilizării acestei enzime era inactivarea termică în timpul denaturării ADN. Această enzimă este o ADN polimerază. în caz contrar amorsa poate forma secvenţe interne dublu catenare care au aspect de stem sau buclă • cele două amorse sens (forward) şi antisens (reverse) nu trebuie sa fie complementare între ele.

aproximativ 1000 de nucleotide per minut. Etapa iniţială de denaturare 5' 3' ADN genomic cu fragmentul ţintă 3' 5' 5' 3' 3 5' Alinierea amorselor la capetele fragmentului ţintă 3' 5' 3 ' 5' Ciclu I 5' 3' Etapa de elongare sau sinteză a catenei complementare de către ADN polimerază 3' 5' 5' 3' Sfârşitul primului ciclu 3' 5' 5' 3' 3' 5' 5' 3' 3' 5' 5' 3' 5' 3' 3' 3' 5' Ciclu II 5' 3' 5' 3' 3' 3' 5' 17 . iar pentru un fragment de 2000 de nucleotide – 2minute. Durata elongării necesare sintezei va fi în dependenţă de mărimea fragmentului ţintă. Pentru un fragment de 500 de nucleotide vor fi suficiente 30 sec.

Un tip special de PCR este RT-PCR sau PCR de transcriere inversă. Ele pot fi numite cu alte cuvinte adevărate foarfece de ADN. care este de fapt o ADN polimerază ARN-dependentă. doar că foloseşte o matriţă de ARN pentru a sintetiza ADN. În ambele cazuri se porneşte de la ARNm (ARN informaţional care codifică proteine). Taq polimeraza este o ADN polimerază deoarece sintetizează ADN şi este ADN dependentă deoarece utilizează o matriţă ADN pentru sinteză. Restrictazele recunosc doar anumite secvenţe scurte numite situsuri specifice de recunoaştere. Aceste enzime au fost descoperite la bacterii şi se presupune că funcţia lor este de apărare contra bacteriofagilor (virusuri ale bacteriilor). În mo18 . Transcriptaza inversă a fost izolată de la virusurile care au material genetic ARN şi în momentul intrării în celulă necesită sinteza unei copii a materialului său genetic. Enzima responsabilă de această sinteză este transcriptaza inversă. Reprezentarea schematică a primelor cicluri de PCR. Acest tip este asemănător PCR obişnuit. se fixează de acestea şi taie legăturile fosfoesterice între nucleotide. Enzime de restricţie Enzimele de restricţie sau restrictazele sunt enzime care taie molecule monocatenare sau dublu catenare de ADN la anumite situsuri specifice. RT-PCR se utilizează pentru obţinerea copiilor de gene eucariote care nu conţin introni şi analiza exprimării de gene.5' 3' 5' 3' 3' 5' 3' 5' 5' 3' 3' 5' 3' 3' Ciclu III 5' 3' 3' 5' 3' 5' 3' 5' 5' 3' 3' 5' 5' 3' 3' Taq polimeraza amorsă amorsă ce indică direcţia de sinteză Figura 2.

A EcoRI B SmaI 5′ GAATTC CTTAAG 3′ 3′ 5′ 5′ GGGCCC CCCGGG 3′ 3′ 5′ 5′ G CTTAA 3′ AATTC G 3′ 5′ 5′ GGG CCC 3′ CCC GGG 3′ 5′ Figura 3. Capetele libere după tăierea de către enzimele de restricţie pot fi de 2 feluri: coezive sau drepte. Enzima BamHI şi EcoRI generează capete coezive după tăiere. Locurile de tăiere sunt indicate cu săgeţi. enzimele de restricţie. Enzimele cele mai utilizate în tehnicile moleculare sunt cele de tip II. enzimele de restricţie digeră aceste molecule. Toate aceste enzime se împart în 3 clase: I. în general. ADN bacterian propriu este protejat contra enzimelor de restricţie prin metilarea unor baze azotate. HindIII este izolată de Heamophilus influenzae tulpina Rd. Secvenţa palindrom este alcătuită din 4-6 nucleotide şi citită pe ambele catene în direcţia 5′→3′ este identică. Până acum au fost descrise 4000 de enzime de restricţie de la câteva sute de specii bacteriene. care au secvenţa de recunoaştere un palindrom şi utilizează ioni de Mg2+ ca şi cofactor. nu taie ADN metilat. Cu ajutorul unor programe speciale se pot alcătui hărţi de restricţie care reprezintă situsurile de recunoaştere pentru diferite restrictaze într-o secvenţă (Figura 4). II şi III. iar EcoRI de la Escherichia coli tulpina RY13. Nomenclatura enzimelor de restricţie porneşte de la denumirea bacteriei de la care a fost izolată. Astfel. iar enzimele SmaI şi EcoRV generează capete drepte sau netede (Figura 3).mentul intrării ADN fagic în bacterii. 19 . Această clasificare este în dependenţă de cofactorul utilizat şi de secvenţa de recunoaştere. Secvenţele de recunoaştere pentru enzimele EcoRI (A) şi SmaI (B) şi capetele libere după tăiere.

Această enzimă reface legăturile fosfoesterice între gruparea hidroxil a unui nucleotid (capătul 3′) şi gruparea fosfat de la nucleotidul altui fragment (capătul 5′) (Figura 5). Cu cifre în paranteze sunt indicate situsurile enzimelor de restricţie. Aceşti vectori sunt utilizaţi în dependenţă de scopul clonării. acestea nu pot fi legate prin creare de noduri sau nu există nici un lipici special. Reprezentarea schematică de legare de către ADN ligază a două fragmente ADN care au capete netede. Vectori de clonare Prin vectori de clonare subînţelegem molecule de ADN transportatoare ale fragmentului de ADN străin în celulele gazdă. Ligarea fragmentelor de ADN Deşi moleculele de ADN pot fi asemănate cu nişte fire. Harta de restricţie a unei gene de la drojdia Saccharomyces cerevisiae.B am H I (533) H inf I (7 5) E co RV (5 8) H inf I (32) H inf I (461) E co RI (605) H inf I (616) E co RI (633) B am H I (7 7 3) NcoI (7 7 7 ) H inf I (942 Y LR3 7 7 C 1047 bp Figura 4. bacteriofagi. care este circulară. Pentru legarea fragmentelor de ADN se utilizează o enzimă numită ADN ligază. Cele mai pe larg utilizate sunt plasmidele. Un plasmid este o moleculă dublu catenară de ADN. Funcţia ligazei în celule vii este legarea fragmentelor în timpul replicării. Vectorii sunt de mai multe tipuri: cosmide. Cea mai des utilizată este ADN ligaza T4 izolată de la bacteriofagul T4. plasmide şi vectori artificiali. Figura 5. închisă şi capabilă de replicare autonomă în celule 20 . recombinării şi după repararea ADN. ADN ligaza T4 utilizează ATP ca şi cofactor.

atunci produsul acestei gene împreună cu subunităţile codificate din genomul celulei gazdă bacteriene vor forma o enzimă activă capabilă să metabolizeze un derivat al galactozei numit X-Gal (bromo-cloro-indolil galactopiranozid) care este adăugat în mediu şi este incolor. vor supravieţui doar celulele care conţin plasmidul. În acest fel coloniile re21 . O regiune foarte importantă într-un vector de clonare este Situsul Multiplu de Clonare (termenul englezesc este Multiple Cloning Site).gazdă. Plasmidele au nişte secvenţe specifice necesare replicării. care este originea de replicare. Dacă în SMC nu a fost introdus niciun fragment ADN atunci gena este intactă. Spre exemplu dacă SMC se află în gena lacZ′ care codifică subunitatea α a enzimei β-galactozidază. Astfel dacă un amestec de celule transformate cu plasmide care vor conţine atât celule cu. Cei mai frecvenţi markeri utilizaţi sunt genele ce conferă rezistenţă la antibiotice. Atât vectorul cât şi fragmentul ADN sunt tăiate cu aceleaşi enzime de restricţie şi legate împreună cu ajutorul ligazei. produsul ei este o proteină activă. cât şi fără plasmid. SMC conţine secvenţele de recunoaştere pentru mai multe enzime de restricţie care nu se conţin în altă regiune a vectorului. se însămânţează pe un mediu cu ampicilină. Un alt fel de selecţie este selecţia celulelor transformate cu plasmid recombinat adică cu insert de cele cu plasmid fără insert. iar produsul format în urma reacţiei va avea o culoare albastră. O altă componentă foarte importantă a plasmidelor sunt markerii de selecţie care sunt de obicei nişte gene. În acest scop situsul multiplu de clonare se află într-o genă ce codifică o enzimă. clonării. Nicio moleculă de ADN nu poate fi replicată fără o origine de replicare. a căror produs (enzimă) fac posibilă selectarea celulelor cu plasmid de cele fără plasmid care sunt mai numeroase. Originea de replicare este o regiune a moleculei de ADN de unde poate începe replicarea şi care este recunoscută de anumite proteine care iniţiază replicarea. Plasmidele comerciale utilizate pe larg sunt plasmide naturale izolate de la bacterii care au fost modificate. Pentru replicarea autonomă în celule gazdă plasmidele conţin secvenţa ori. Dacă în SMC a fost introdus un fragment ADN atunci gena este modificată şi produsul ei este inactiv. Spre exemplu. Insert se referă la fragmentul de ADN ţintă clonat. mai corect spus produsul genei conferă rezistenţă. Plasmidele care conţin gena pentru această enzimă vor proteja celulele bacteriene de efectul antibioticului. β-lactamaza conferă rezistenţă la ampicilină. Dacă β-galactozidaza este activă atunci va metaboliza acest substrat. selecţiei şi uneori exprimării genelor. În această regiune se introduce fragmentul ţintă de ADN cu ajutorul enzimelor de restricţie şi a ligazei.

Acest fapt permite obţinerea unei cantităţi mari de ADN plasmidic dintr-o cultură mică de bacterii (din 3-5 ml de cultură se pot obţine câteva μg de ADN plasmidic). Aceste elemente sunt cele care se găsesc şi în genom şi fac parte dintr-o genă: promotorul.zultate după transformare care conţin vectorul fără insert vor fi albastre. Acest codon este de obicei inclus în situsul multiplu de clonare. situsul de legare al ribosomilor. Promotorul este o secvenţă care se află în amonte de genă şi este recunoscut de factorii de transcriere. Vectorii de clonare mai mici au de obicei un număr mai mare de copii per celulă. Pentru vectorii mai mari numărul copiilor per celulă este mai mic. doar de câteva mii de pb şi în care pot fi inserate fragmente de ADN de la 100 pb până la 2000-3000 pb (Figura 6: A. în consecinţă şi pentru a obţine o cantitate mai mare de ADN este necesară o cantitate mai mare de cultură. Astfel. Aceste etichete vor fi parte integrantă a proteinelor la 22 . Plasmidele de exprimare trebuie să mai conţină câteva elemente în plus faţă de vectorii de clonare. Un alt tip de selecţie utilizează o enzimă toxică pentru celulele bacteriene. Numai în prezenţa promotorului exprimarea va fi foarte scăzută. Cele mai des utilizate sunt eticheta de 6 histidine (His-tag). de aceea situsul de legare al ribozomilor (termenul englezesc este Ribosome Binding Site) este o secvenţă care se transcrie dar care nu se traduce şi care este recunoscută de ribosomi. Vectorii de exprimare sunt de asemenea vectori de clonare dar care oferă în plus posibilitatea exprimării genei clonate (Figura 6 C). O caracteristică importantă pentru plasmide este numărul de copii per celulă. În unele cazuri acesta este prezent după regiuni care codifică anumite aşa-zise etichete. Glutation S-transferaza (GST) şi proteina de legare a maltozei (Maltose Binding Protein. B). în caz contrar acesta se poate introduce în fragmentul ţintă cu ajutorul amorselor. Codonul STOP este inclus şi el de obicei în situsul de clonare. Etichetele facilitează purificarea proteinelor recombinate prin cromatografie de afinitate. MBP este termenul în engleză). care se fixează la nivelul promotorului şi iniţiază transcrierea. Vectorii de clonare au de obicei mărime mică. Celulele bacteriene care au plasmidul cu insert vor avea gena nefuncţională şi vor supraveţui. Codonul START la procariote este în cele mai dese cazuri ATG. celulele cu plasmid fără insert au gena funcţională care va provoca moartea celulelor. Ribosomii se leagă la acest situs şi se deplasează de-a lungul ARNm până întâlnesc primul codon START de unde începe traducerea. deoarece ele nu produc enzimă activă capabilă de metabolizarea substratului X-Gal. codonii START şi STOP care delimitează cadrul deschis de citire (termenul englezesc este Open Reading Frame). iar cele ce conţin vector recombinat vor fi albe.

A Eco RI (4360) Sca I (3847) Pvu I (3737) Cla I (25) HindIII (30) Eco RV (188) Bam HI (376) Sph I (567) Sal I (652) B LacZ Eco RI Sac I (6 AP r Pst I (3612) bla(AmR) Kpn I (6 TC r pTZ57R 2886 bp Xba I (6 Bam HI pBR322 4361 bp MCS Apa I (6 Sal I (6 Pst I (6 Hin dI ORI Bst Z17I (2247) T7 p T7 terminator C f1 origin His tag XhoI (159) Not I (167) HindIII (174) Sal I (180) Sac I (191) Ori M CS Eco RI (193) bla (Ap) Bam HI (199 Nde I (239 pET-21a 5443 bp T7 prom Bgl II (34 lacI ColE1 pBR322 origin Figura 6. Etichetele vor conferi proteinelor recombinate afinitate faţă de anumite răşini cromatografice. 23 . Plasmidul are rezistenţă la ampicilină. în dependenţă de gena selectată pentru inserare. promotorul de la fagul T7 care este inductibil cu IPTG. iar TCr rezistenţă la tetraciclină. B – harta plasmidului de clonare pTZ57R comercializat de firma Fermentas. iar situsul multiplu de clonare se află în gena lacZ' care oferă selecţia alb-albastră a clonelor pozitive. rezistenţa la antibioticul respectiv se va pierde . situsul multiplu de clonare îl poate constitui oricare dintre cele două gene de rezistenţă. C – harta vector de exprimare pET21a de la Novagen care include gena bla care conferă rezistenţă la ampicilină. situsul multiplu de clonare care conţine un codon START şi un codon STOP după eticheta de 6 histidine. A – harta plasmidului pBR322 include 2 gene de rezistenţă la antibiotice: Apr conferă rezistenţă la ampicilină.capătul ei C-terminal sau N-terminal dacă secvenţa ce codifică eticheta este prezentă după sau înainte de situsul de clonare respectiv. Hărţile unor vectori plasmidici.

Pentru acest tip de transformare este necesar un aparat numit electroporator. Numărul obţinut de la transformarea a 1 ng de ADN plasmidic se raportează la 1 μg de ADN (înmulţind valoarea la 1000). acestea având cea mai mare aplicabilitate şi simplitate în scopul obţinerii clonelor şi proteinelor recombinate. O eficienţă bună de transformare este 106. Transformarea are loc la o tensiune de 1800 sau 2500 V timp de câteva msec (Figura 7 B). Celulele sunt şocate termic foarte scurt.Introducerea moleculelor recombinate în celule gazdă Introducerea plasmidelor recombinate în celule gazdă se numeşte transformare dacă sunt utilizate celule bacteriene sau transfecţie dacă sunt celule eucariote. Amestecul de celule competente şi plasmide recombinate vor fi depuse într-o cuvă specială de electroporare. Prepararea celulelor competente presupune doar creşterea lor până în faza logaritmică (D=600nm = 0. După transformare celulele şocate sunt preluate în mediu de cultură şi apoi însămânţate pe mediu selectiv cu antibiotice. Ambele tipuri de transformare necesită inducerea unei competenţe de transformare. care va crea câmpul electric între doi electrozi. cea mai mare parte dintre ele fiind netransformate. În continuare se va detalia doar transformarea celulelor procariote. Numărul de colonii va corespunde numărului de celulele transformate deoarece fiecare colonie ia naştere dintr-o singură celulă. coli şi prin tratarea celulelor cu clorură de calciu la rece se poate induce transformarea celulelor bacteriene (Figura 7 A). Acest timp este suficient pentru intrarea moleculelor recombinate în celulele bacteriene. Această competenţă în cazul transformării chimice este indusă cu CaCl2. Transformarea în câmp electric este mai eficientă decât transformarea chimică. o valoare foarte mare ţinând cont de faptul că avem nevoie de o singură colonie 24 . la 42°C. În acest scop se realizează o cultură de E.6-0.8) şi înlăturarea prin spălări repetate a mediului de cultură. Eficienţa de transformare a celulelor se poate măsura efectuând o transformare cu o cantitate de 1 ng de ADN plasmidic şi apoi numărând coloniile rezultate. ai cărei pereţi laterali sunt electrozii. adică fără plasmid. Aceste spălări repetate vor asigura eliminarea ionilor care pot afecta transformarea. coli nu are proprietăţi de transformare naturală. timp de maxim 2 minute. deoarece E. ceea ce înseamnă ca la transformarea unui μg de plasmid s-ar obţine 1 milion de colonii. Există două tipuri de transformare a celulelor bacteriene pe larg utilizate în laboratoarele de biologie moleculară: • transformarea chimică • transformare sub influenţa câmpului electric. Doar unele celule bacteriene sunt transformate.

deoarece este mai laborioasă. mai ales în cazul fragmentelor mici. Această sarcină face posibilă migrarea moleculelor de ADN şi ARN 25 . Moleculele de acizi nucleici sunt încărcate negativ datorită grupărilor fosfat.sau de câteva când avem un amestec eterogen de molecule ţintă. Fiecare dintre cele două metode de transformare prezintă avantaje şi dezavantaje legate de eficienţa de transformare şi de costuri. Transformarea celulelor bacteriene cu ADN plasmidic. B – electroporarea celulelor bacteriene. Desigur în amestecul de ligare numărul de molecule recombinate este mic şi din această cauză este recomandată o eficienţă cât mai mare a celulelor competente.coli Celule transformate de E. Deşi metoda oferă o rezoluţie inferioară celei din poliacrilamidă. Electroforeza acizilor nucleici Electroforeza este procesul de migrare a moleculelor cu sarcină într-un câmp electric. Pentru proteine se aplică cel mai des electroforeza proteinelor în condiţii denaturante în gel de poliacrilamidă (termenul englezesc SDS-PAGE). Primul loc în utilizarea vizualizării acizilor nucleici aparţine electroforezei în gel de agaroză. ea este utilizată cu succes deoarece este mai simplă.coli Însămânţarea celulelor transformate pe mediu selectiv Spălarea celulelor bacteriene 1800 V 5 msec Figura 7. dar mai ieftină deoarece nu necesită aparatură şi cuve costisitoare. Această matrice este folosită mai rar în laboratoarele de analize genetice. A CaCl2 2 min 42ºC B Celule de E. A – transformarea chimică cu CaCl2. Transformarea chimică este mai puţin eficientă decât electroporarea. Migrarea moleculelor se realizează printr-o matrice specifică. Metoda este aplicată pentru analiza proteinelor şi a acizilor nucleici. Poliacrilamida se poate utiliza ca matrice şi pentru electroforeza acizilor nucleici care oferă o rezoluţie foarte bună a separării fragmentelor de ADN.

Gelurile de agaroză sunt plasate între cei doi electrozi în cuve speciale care conţin tampon de migrare. oferind separarea moleculelor între 0. Agaroza este un poliglucid extras din alge marine roşii. cu atât mărimea porilor va fi mai mică. Vizualizarea ne oferă informaţii despre integritatea ADN 26 . Gelurile de agaroză de 1% sunt cel mai des utilizate. Cele mai folosite tampoane sunt TAE (Tris/Acetat/EDTA) şi TBE (Tris/Borat/EDTA). Bromura de etidiu se intercalează între bazele azotate din molecula dublu catenară de ADN. Separarea unor fragmente de ADN cu ajutorul electroforezei în gel de agaroză. Lungimea de undă a luminii ultraviolete la care este expus gelul trebuie să fie cuprinsă între 260 şi 300 nm.într-un câmp electric de la catod la anod. iar concentraţii mari pentru fragmente mici. În concluzie concentraţii mai mici se folosesc pentru fragmente mari (câteva mii de pb). Acest tampon este acelaşi folosit şi pentru realizarea gelului. B – fotografia aceluiaşi gel. Cu cât concentraţia agarozei este mai mare. porii vor fi mai mari şi migrarea moleculelor mai rapidă. Amestecul de molecule nu se va deplasa în câmp electric cu aceeaşi viteză. Gelurile de agaroză se realizează prin încălzirea agarozei într-un tampon specific. A – imaginea gelului la expunerea în UV. Electroforeza în gel de agaroză este utilizată pentru vizualizarea şi purificarea ADN. Moleculele mici se vor deplasa mai repede prin porii matricei. Concentraţia agarozei în gel poate fi între 1 şi 3% în dependenţă de scopul urmărit. Deoarece ADN nu poate fi vizualizat cu ochiul liber este necesară utilizarea unui colorant. dar în godeu separat se va migra un amestec de molecule cu mase moleculare diferite dar cunoscute. Cel mai des folosită în acest scop este bromura de etidiu. Pentru estimarea aproximativă a mărimii fragmentelor în acelaşi gel. Astfel separarea moleculelor va fi în dependenţă de masa lor moleculară. Acest amestec de molecule se numeşte marker molecular ADN.1 şi 10 kpb. A B Figura 8. La concentraţii mai mici de agaroză. care fixată de ADN în lumină ultravioletă devine fluorescentă şi are o culoare portocalie (Figura 8). iar cele mai mari vor avansa mai lent.

SUA (laser cu detecţie pentru 5 fluorocromi). coli pe mediu selectiv. Analizor Genetic CEQ™ 8800 Genetic Analysis System (laser cu detecţie pentru 4 fluorocromi). Cultura se va incuba peste noapte cu agitare la 37°C. Ambele aparate utilizează principiul Sanger de secvenţiere. Apariţia coloniilor nu indică neapărat şi o reuşită deplină a clonării. dar nu va furniza nicio informaţie despre secvenţa fragmentului clonat. În cadrul Centrului de Biologie Moleculară există 2 secvenţiatoare: Analizorul Genetic ABI Prism 310. În unele cazuri se utilizează un amestec de 2 polimeraze (3 părţi de Taq polimerază şi o parte Pfu polimerază) pentru a combina un randament mai mare cu o fidelitate crescută. Pfu polimeraza. estimarea cantităţii de ADN obţinută în reacţiile PCR sau de extracţie. a. ADN plasmidic etc). ADN plasmidic urmează a fi analizat iniţial prin digestie enzimatică şi apoi prin secvenţializare. Ziua următoare din bacteriile rezultate se va purifica ADN plasmidic cu ajutorul unor metode clasice sau cu ajutorul unor kituri speciale. apoi la unul din capetele sale are loc ataşarea 27 . Această digestie va confirma prezenţa insertului în plasmid şi aproximativ mărimea acestuia. Acest principiu presupune utilizarea unei variante de PCR pentru secvenţiere. dar asigură de obicei randamente de sinteză mai mari. acestea necesită totuşi o dovadă în plus a prezenţei plasmidului recombinat. Matriţa ADN ce urmează a fi secvenţiată este denaturată. În acest scop se va efectua o cultură lichidă de 3-5 ml de mediu cu antibiotic care se va însămânţa cu o singură colonie. Tli polimeraza ş. ADN poate fi purificat din gel de agaroză după migrare prin excizarea fragmentului ţintă şi purificarea din gel cu kituri special predestinate acestui tip de purificări. deoarece acestea pot conţine un amestec de colonii pozitive şi colonii cu plasmid fără insert. rezultatul digestiilor enzimatice. Applied Biosystems. Astfel de ADN polimeraze sunt Vent polimeraza. Taq polimeraza nu are activitate de corectare a erorilor.(ADN genomic. Pentru a evita erorile în produşii PCR se poate utiliza o ADN polimerază care are proprietatea de a corecta erorile introduse. Digestia ADN plasmidic se va realiza cu enzimele de restricţie cu care acesta a fost introdus în vector sau care se află la extremele situsului multiplu de clonare. Secvenţializarea fragmentului ţintă este verificarea definitivă a clonării. Chiar dacă se foloseşte un sistem alb-albastru de selecţie a coloniilor pozitive. Această verificare este necesară deoarece ADN polimeraza utilizată pentru amplificarea insertului prin PCR poate introduce erori de sinteză. Verificarea moleculelor recombinate Rezultatul ligării şi transformării se poate vedea doar după 12-18 ore de la transformare când apar coloniile de E.

cele mai mici vor fi primele. Electroforegramele sunt apoi analizate şi comparate cu secvenţa existentă în bazele de date. Mărimea fragmentelor de ADN care pot fi secvenţializate variază între 600 şi 800 pb. Migrarea fragmentelor în gel este în dependenţă de mărimea lor. Exprimarea genelor în sistem procariot Clonarea genelor vizează în principal două obiective posibile: multiplicarea unui fragment ADN sau exprimarea genei clonate. Lipsa acestei grupări va face imposibilă continuarea sintezei ADN. Rezultatul acestui PCR vor fi fragmente monocatenare (deoarece se foloseşte o singură amorsă) de diferite mărimi. iar clonele pozitive sunt apoi secvenţializate. deoarece ADN polimeraza nu poate adăuga următorul nucleotid. iar la final cele mai mari. Amestecul PCR conţine dezoxiribonucleozide trifosfat (dNTP) dar şi di-dezoxiribonucleozide trifosfat (ddNTP) care nu conţin gruparea OH în poziţia 3' a dezoxiribozei. 28 . Electroforegrama unei secvenţe obţinută cu ajutorul analizorului ABI Prism 310. Pentru detecţia fragmentelor. În ultima parte a capilarului există o fereastră transparentă prin care un fascicol laser va excita fluorocromii. ceea ce permite sinteza tuturor fragmentelor care se opresc în toate punctele matriţei de ADN.unei amorse de la care ADN polimeraza va porni sinteza catenei complementare. Figura 9. fiecare ddNTP este marcat cu un fluorocrom. Numărul de cicluri este de 40. O cantitate de câţiva microlitri vor fi separaţi în gelul din capilar. Amestecul de fragmente rezultate sunt separate cu ajutorul electroforezei capilare. În acest scop amestecul de fragmente se clonează într-un vector de clonare. iar fluorescenţa emisă va fi captată şi prezentată sub forma unei electroforegrame (Figura 9). Clonarea în scopul multiplicării fragmentului este utilizată atunci când ADN supus analizei este de fapt un amestec de fragmente care nu pot fi separate cu ajutorul electroforezei şi la care se urmăreşte cunoaşterea secvenţei. care presupune utilizarea unui capilar cu un diametru de ordinul micrometrilor. Pentru fragmente mai mari sau pentru matriţe dificile (cu secvenţe repetitive) este necesară utilzarea unor kituri speciale.

Cel mai des utilizat inductor este IPTG (isopropil-tio-galactozid). Dacă această etichetă nu este necesară. codonul START în situsul multiplu de clonare şi codonul STOP după o etichetă de 6 histidine. adică împărţirea exactă pe codoni a genei de la primul codon tradus până la ultimul. un situs de legare a ribosomilor (rbs). Promotorul T7 nu este recunoscut de către ARN polimeraza de la E. Foarte important în acest caz este păstrarea cadrului deschis de citire. Această genă se află sub controlul promotorului lac UV5 şi a operatorului lac (Figura 10). vectorii de tip pET de la Novagen asigură de obicei o supraexprimare a genelor clonate. coli sunt utilizate pe larg în obţinerea de proteine recombinate. Vectorii pET necesită tulpini de E.Celulele de E. Figura 10. Clonarea în scopul exprimării genei şi obţinerii de proteină recombinată include câteva aspecte care sunt importante pentru exprimare. Ele pot fi numite adevărate fabrici de proteine la comandă. care însă câteodată „refuză” să sintetizeze proteinele comandate şi de ce cele mai dese ori străine celulei bacteriene. Promotorii din aceste tipuri de plasmide sunt de tip inductibil. atunci din genă se va înlătura codonul STOP. coli care conţin gena pentru ARN polimerază de la fagul T7. Spre exemplu. Plasmidele de exprimare conţin neapărat un promotor recunoscut de ARN polimeraza celulei gazdă. atunci în genă se va păstra codonul STOP şi traducerea se va opri înainte de etichetă. Dacă se optează pentru prezenţa unei etichete 6×His la capătul C-terminal a proteinei pentru facilitarea purificării. Plasmidul pET21 conţine promotorul de la fagul T7. coli în lipsa inductorului. situsul de recunoaştere a ribosomilor. un codon START şi unul STOP la capetele situsului multiplu de clonare. coli şi simpla prezenţă a plasmidului în celulele bacteriene nu va sigura o exprimare a genei. care este un analog al galactozei. Inhibiţia exprimării genei pentru ARN polimeraza de la fagul T7 şi a genei ţintă în celulele gazdă de E. 29 . Gena codificatoare poate fi clonată direct în vectorul de exprimare.

Atunci când în mediu nu există lactoză (sau analogi ai lactozei) represorul lac se fixează la operatorul lac şi împiedică transcrierea genei pe care o reglează. Represorul lac este codificat de gena lacI care se află atât în genomul bacteriei gazdă cât şi în plasmidul de exprimare. coli care va transcrie gena pentru T7 ARN polimerază.Operatorul lac este o secvenţă recunoscută de către o proteină numită represorul lac. Reprezentarea schematică a purificării de proteine recombinate prin cromatografie de afinitate. C – eluarea proteinei ţintă de pe coloană. Agentul care induce exprimarea este un analog al galactozei IPTG. A B C Figura 11. Aceasta din urmă va recunoaşte promotorul T7 din plamsid şi va transcrie gena ţintă. 30 . care în acest caz este gena pentru T7 ARN polimerază. astfel promotorul lac devine accesibil pentru ARN polimeraza de E. Ataşarea unor etichete la proteinele recombinate asigură purificarea proteinelor într-o singură etapă. atunci se poate recurge la înlăturarea acesteia prin digestie cu peptidaze. cum este spre exemplu situsul pentru trombină în cazul plasmidului pET28. Purificarea proteinelor recombinate Proteinele recombinate pot fi purificate prin metode cromatografice. În absenţa T7 ARN polimerazei nu va exista nici transcrierea genei ţintă din plasmid. În acest scop pentru clonare şi exprimare se va alege un plasmid care conţine situsul pentru peptidază. Acest sistem de exprimare este unul foarte puternic şi care poate asigura o producţie de proteină care va alcătui până la 50% din proteinele totale bacteriene. B – spălarea coloanei cu tampon şi fixarea proteinei ţintă de răşină. Pentru o purificare cât mai bună din amestecul total de proteine este necesară purificarea în cel puţin 2 etape prin metode cromatografice diferite. Dacă eticheta deranjează în analiza ulterioară a proteinei. A – încărcarea amestecului total de proteine pe coloana cu răşină. Moleculele de IPTG se fixează de represorul lac şi cauzează disocierea acestuia de la operatorul lac. ceea ce reduce timpul necesar şi asigură randamente de purificare mai mari (Figura 11).

• purificarea se face în mai multe etape care necesită timp. se pot fuziona proteine între ele sau regiuni ale unei proteine cu regiuni ale altei proteine. Una dintre aplicaţiile acestei tehnici. În cele mai multe cazuri purificarea unei proteine din celulele în care aceasta se exprimă în mod firesc natural prezintă mai multe dificultăţi: • cantitatea de proteine în ţesuturi este foarte mică. spre exemplu cum este cazul unor bacterii pe care nu putem să le cultivăm în condiţii de laborator. • obţinerea materialului pentru purificare implică probleme etice. importante nu numai pentru biologie. obţinerea de proteine din celule umane ar fi imposibilă. consumabile şi are randamente mai mici. Un mare avantaj al acestei metode este posibilitatea introducerii de mutaţii care pot dezvălui rolul unor domenii sau aminoacizi particulari în activitatea proteinei. Aceste dezavantaje ale purificării direct din material biologic sunt eliminate în cazul exprimării genelor în celule gazdă. • proteinele recombinate pot fi marcate. dar şi pentru studii interdisciplinare este utilizarea ei în scopul obţinerii de proteine recombinate. Clonarea genelor şi exprimarea lor în celule gazdă reprezintă o sursă foarte preţioasă de proteine.2. • deleţii în care porţiuni întregi din lanţul polipeptidic pot fi înlăturate. Utilizarea clonării de gene şi exprimării de proteine recombinate în studii interdisciplinare Clonarea genelor în ultimii ani a devenit o tehnică indispensabilă în laboratoarele de biologie moleculară. spre exemplu pentru purificarea unei proteine din bacterii este necesară o cantitate de zeci de litri de cultură bacteriană. Prin intermediul tehnicilor de mutageneză pot fi introduse mai multe tipuri de mutaţii: • mutaţii missens care schimbă un aminoacid cu altul. iar rezultatul purificărilor în câteva etape pot fi sub 100 mg de proteină. • obţinerea unei cantităţi mari de ţesut pentru purificare este aproape imposibil. • inserţii care constau în introducerea de fragmente noi în gena codificatoare şi respectiv în proteina recombinată. spre exemplu regiunea N-terminală a unei proteine de la o specie se poate fuziona cu capătul C-terminal al aceleiaşi proteine de la o specie înrudită. cum ar fi spre exemplu cazul unor proteine umane. Proteinele pot fi marcate 31 . • fuzionării.

Un alt dezavantaj (deşi în unele cazuri este un avantaj) este lipsa modificărilor post-traducere a polipeptidelor sintetizate în celule bacteriene. O altă problemă care poate apărea este neexprimarea genei. Un exemplu în acest sens este marcarea proteinelor cu izotopi stabili sau radioactivi. în alte cazuri este nevoie de condiţii speciale şi alte proteine care contribuie la adoptarea conformaţiei proteinei active. deoarece este mai rapidă şi mai puţin costisitoare. Corpii de incluziune oferă posibilitatea unei purificări printr-o singură etapă în condiţii denaturante. Proteinele denaturate purificate în acest mod pot fi utilizate pentru imunizarea de animale în scopul producerii de anticorpi. Există cazuri când acumularea proteinei sub forma corpilor de incluziune este un avantaj. atunci se va recurge la clonarea genei în sistem procariot şi exprimarea ei în celule gazdă eucariote. 32 . care apoi facilitează detecţia lor. astfel o proteină are structură: primară. Lipsa modificărilor post-traducere este un avantaj atunci când este cunoscută funcţia proteinei active şi se doreşte să se cunoască rolul grupărilor care sunt adăugate după sinteză. Exprimarea genelor şi sinteza proteinelor în celulele procariote asigură doar structura primară exactă a polipeptidului sintetizat. În unele cazuri proteinele adoptă structura secundară independent după sinteză. Unele proteine atât de la eucariote cât şi de la procariote sintetizate în celule gazdă de E. În acest fel proteina recombinată nu va fi modificată şi se va putea deduce rolul acestor grupări în activitatea proteinei. secundară. Exprimarea proteinelor sub forma corpilor de incluziune nu poate fi prezisă pe baza apartenenţei genei sau pe baza analizei structurii primare. Dacă prezenţa acestor modificări este absolut necesară. Majoritatea proteinelor de la eucariote necesită nu numai adaptări conformaţionale dar şi modificări post-traducere cum ar fi fosforilări. iar ca rezultat polipeptidele acumulate în citoplasmă formează corpi de incluziune. terţiară şi cuaternară. Proteinele sunt structuri cu mai multe nivele de organizare. coli nu reuşesc să adopte o structură secundară corectă.cu anumite molecule care sunt introduse în proteine în procesul lor de sinteză sau pot fi fuziuni. Un alt exemplu este marcarea proteinelor prin fuziunea lor cu proteine fluorescente. Cel mai important aspect pentru imunizare este secvenţa de aminoacizi a proteinei şi nu structura ei secundară sau terţiară. Clonarea genelor şi exprimarea lor în sistem procariot este tehnica la care se apelează cel mai des. Cauzele neexprimării pot fi toxicitatea proteinei asupra celulelor gazdă. a. glicozilări ş. în mod specific sau randomic.

198-1000 nm. max.2ml şi plăci ELISA cu 96 de godeuri.2 MΩ/cm (apa MilliQ) Centrifugarea probelor. Belgia pH-metru P901 (două bucăţi). 48 probe Masurarea pH-ului. Australia Electroporator Eppendorf. Eppendorf. rezoluţie 1 nm. Germania Două incubatoare bacteriologice. maximum 28000xg. Germania “Thermocycler”.5ml şi placi ELISA cu 96 de godeuri. Sigma. Memmert. Marea Britanie Spectrofotometru Jasco V-530 dublu-fascicul cu termostatare. Corbett Research. rotor 8x50ml şi rotor 4x250ml Fără răcire cu rotor Eppendorf (12 tuburi. Consort. Germania Caracteristici Achiziţia şi interpretarea imaginilor de pe geluri de poliacrilamidă sau geluri de agaroză Purificarea apei până la o rezistivitate de 18. de la 0. Scaltec. 13000xg) Pentru amplificarea ADN-ului prin PCR în tuburi de 0. Jasco. CamSpec. Sigma. Elga-Lab Water. Germania Centrifugă de masă Sigma 1-13. autocalibrare. pentru cinetică enzimatică Electroforeză verticală în gel de poliacrilamidă. Sanyo. gradient de temperatură Transformarea celulelor electrocompetente – bacterii şi drojdii Interval de fotometrare.3. Memmert. cu termostatare. Consort. max. Germania “Thermocycler”. Germania Doua bai de apa cu agitare. Infrastructura existentă în cadrul Centrului de Biologie Moleculară Denumire echipament Instalaţie de preluare şi prelucrare a imaginilor Ced Limited. Germania Spectrofotometru UV-Vis monofascicul M301. Japonia Patru instalaţii electroforeză proteine. Belgia Congelator temperaturi foarte scăzute. Olanda Două balanţe analitice. gradient de temperatură în tub Pentru amplificarea ADN-ului prin PCR în tuburi de 0. Japonia Congelator temperaturi foarte scăzute. 198-1000 nm. rezoluţie 1 nm Interval de fotometrare. Snijders Scientific. Belgia Şase instalaţii electroforeza acizi nucleici. rotor Eppendorf (24 tuburi). 100 litri. 32 probe Electroforeza orizontală în gel de agaroză.1mg la 160g.2ml. (3%) 33 . Marea Britanie Instalaţie de apă ultrapură.2ml la 1 litru. Marea Britanie Centrifugă cu răcire Sigma 3K18 (4 rotoare). 70 litri. rotor 6x30ml. Consort. 0. interfaţă pentru calculator şi imprimantă Incubarea culturilor bacteriene şi a probelor moleculare de la temperatura camerei la 70ºC Incubarea probelor biologice pana la 100ºC. electrod combinat prevăzut cu senzor de temperatură Congelare probe biologice la -82ºC Congelare probe biologice la -82ºC Domeniul de măsurare de la 0. răcire de la temperatura camerei la 0°C.

Roberts K...Analizor Genetic ABI Prism 310.R.Bibliografie 1... (2002).L. Miller J. Coreea de Sud reglabil în 9 trepte (0. Manipulation and Expression of Recombinant DNA.. (2005). Griffiths A.C. 9. Spania re. Academic Press. electroforeza capilară la 15kV.. New York: W.. Griffiths A. Japonia manţă. identificare umană şi determinarea polimorfismelor genetice. Spania Sterilizarea umedă sau uscată a mediilor de cultură. Lodish H.L. mateAutoclav AE-75-DRY Raypa. filtru HEPA (0. Suzuki D. Molecular Biology of the Cell. H. Zipursky L. 2nd Edition. Jasco.M. Nikon. and Robertson D. Berk A.. H. Darnell J. Miller J. gradient binar de înaltă presiune şi gradient cuaternar de joasă presiune Microscop inversat NIKON Studiul preparatelor celulare şi tisulare în lumina normaEclipse TE2000S. Glick B. (1995).M. 4.. (2009). rialelor şi instrumentelor Spania Ultrasonicator cu patru sonde. DNA Cloning: A Practical Approach: Expression Systems (The Practical Approach Series). Molecular Cell Biology.. Brown T... H.. Freeman Company.. Lewontin R. Gene Cloning and DNA Analysis: An Introduction. H. Selecta. Australia Secvenţierea fragmentelor de ADN. New York: W. iluminasteril. Wiley-Blackwell Publishing. detecţia simultană a 4 fluorocromi Separarea probelor prin cromatografie de înaltă perforInstalaţie HPLC. (2002).. ASM Press. preparare probe PCR (4% Filtru exahustare HEPA (0. prefiltru reciclabil (3-30 µm). 5th edition New York: W. ţesuturilor animale şi Sonics & Materials vegetale în volume de la 1ml până la 1 litru Hota PCR cu flux laminar Flux laminar vertical.97%). 7th edition. (2006). (2000). Baltimore D. Tymoczko J.A.M.. Gelbart W.3 um 99. Raff M.... 5th edition.C.. 34 . contrast de fază şi fluorescenţă nia Autoclav 80l... (1999). 2d edition..5 m/s)..3 Hota flux laminar biohazard µm 99.. 4. Carson S. Modern Genetic Analysis. Freeman Company.. Alberts B. and Walter P.M. Matsudaira P. soft-uri speciale pentru secvenţiere şi genotipare. Freeman Company. 8. Corbett Research.35-0. Glover D. Amplificarea ADN-ului în timp real. SUA laser cu detecţie pentru 5 fluorocromi Analizor Genetic CEQ™ 8800 Genetic Analysis System laser cu detecţie pentru 4 fluorocromi Instalaţie Real Time PCR. filtru bacteriologic HEPA. Biochemistry. 4th edition. Lewis J. Johnson A. 2. Applied Biosystems.. 4th edition.. Freeman Company. Dezintegrarea celulelor bacteriene.. Patten C. Japolă. flux de aer 100. 3. New York: W. Oxford University Press. (2000). 7.J.97%). and Lewontin R. 6. Telstar. and Gelbart W. 4th edition. and Stryer L.. New York: Garland Science.T. Berg J. An Introduction to Genetic Analysis. Molecular Biotechnology: Principles and Applications of Recombinant DNA. Pasternak J. 5..D. Hames B..

. PCR. W...G. Working with DNA (THE BASICS (Garland Science)). Bucureşti. 13.M. H. Myers R.10. Freeman Company.. 11. Metzenberg S.D. McPherson M. 35 . Witkowski J.. Recombinant DNA: Genes and Genomes .. Popescu O. 1st edition. (2006).A Short Course.. 1 edition.J. (2000). Mǿller S. and. Editura Tehnică. 12.. Watson J. Basics: from Background to Bench. 1990. Taylor & Francis. (2007).A.A. 3rd Edition. Springer-Verlag Telos. Caudy A. Electroforeza proteinelor în geluri de poliacrilamidă.

..... Această metodă capătă o amploare mai mare pe an ce trece datorită cererii mari de aminoacizi.......... se foloseau enzime nerecombinate produse de microorganisme.... Metoda enzimatică de sinteză a acizilor aminaţi Un număr mare de aminoacizi se pot obţine prin sinteză enzimatică................ Imobilizarea enzimelor în sintezele enzimatice prezintă două avantaje importante şi anume reutilizarea multiplă a enzimelor costisitoare şi recuperarea substratelor rămase. deoarece: • izomerii optici ai aminoacizilor se pot obţine direct din substratele corespunzătoare.. dr......... • necesită condiţii blânde de temperatură. univ.......... O sursă de triptofanază 36 ........ • se pot sintetiza D-izomeri..Aplicaţii ale tehnicilor de biologie moleculară în studii interdisciplinare Asist.... fiind stimulată sinteza lor prin diverse metode... • se pot obţine derivaţi ai aminoacizilor sau aminoacizi rari..... şi de derivaţi ai acizilor aminaţi...... care nu se aplică la scară industrială la fel ca în fermentarea directă.. din cauza costurilor prea mari a substratelor... Iulia Lupan Cuprins 1... pentru producerea acizilor aminaţi pe cale enzimatică...... pornind de la indol......... La început......... Metoda enzimatică de sinteză a acizilor aminaţi. • cantităţile produse şi concentraţiile sunt mai mari. enzimele nu se purificau şi se folosea lizatul celular ce conţinea enzime specifice...... pH. care nu se găsesc în natură.................. Sinteza enzimatică continuă prin imobilizarea enzimelor a fost aplicată în producerea L-tirozinei cu β-tirozinază şi a triptofanului cu triptofanază... Pentru a reduce costul sintezelor... Totuşi metoda enzimatică prezintă unele avantaje faţă de alte metode........ Bibliografie .... presiune................... 36 2.. piruvat şi săruri de amoniu..... folosite în exces........... • sintezele sunt uşor de manipulat........ care nu se pot obţine prin fermentare directă sau prin extracţie...... Tendinţe actuale în aplicarea bionanotehnologiilor .............. 60 1. 57 3..............

poate fi lizatul brut de E .. în cazul folosirii lizatului brut până la 92%. Numai în cazul sintezei alaninei s-a evidenţiat o creştere a randamentului sintezei de la 80%. Celule imobilizate de E. în care se utilizează enzime pentru regenerarea cofactorilor. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab.. Acest impediment a cauzat folosirea sistemelor enzimatice cuplate. costisitori în sintezele enzimatice. 1988]. Mediul de sinteză mai conţine formiat de amoniu.. Sinteza continuă a fost realizată prin încorporarea enzimelor în gel de poliacrilamidă. Honorat-Pascal şi colab. reacţie catalizată de alanin dehidrogenază într-un sistem cuplat cu formiat dehidrogenaza pentru regenerarea NADH. NADPH). 37 . Producerea acidului aspartic la scară industrială s-a realizat enzimatic pornind de la fumarat şi săruri de amoniu şi utilizând aspartaza ca şi catalizator [Chibata şi colab. ionul de amoniu fiind necesar în reacţia de sinteză a aminoacidului.. la care s-a indus sinteza acestei enzime. cu glucozo dehidrogenază pentru regenerarea NADH. În strategia de sinteză s-au utilizat enzime provenite de la un singur microorganism şi anume Bacillus megaterium. Honorat şi col. Tosa şi colab... 1974]. 1976]. pentru regenerarea NADH [Schütte şi colab. utilizând leucin dehidrogenază de la Bacillus stearothermophilus [Oshima şi colab.coli. Utilizarea enzimelor de la microorganismele termofile prezintă avantajul că au o stabilitate mai mare.. în cazul folosirii fracţiunilor purificate. 1981.. S-a testat eficienţa sintezelor în cazul folosirii lizatelor şi a enzimelor purificate. Aceeaşi metodă de imobilizare a fost folosită şi în sinteza alaninei cu celule de Pseudomonas dacunhae care prezentau o activitate mare a L-aspartat β-carboxilazei [Fusee şi Weber. 3-fluoroalanina s-a obţinut din 3-fluoropiruvat. 1976]. Utilizarea de cofactori (NADH. iar ionul formiat pentru reacţia de regenerare a NADH [Oshima şi colab. respectiv valin dehidrogenază.. [1990] au sintetizat L-alanina şi L-valina folosind sistemul cuplat de alanin dehidrogenază. 1985] şi formiat dehidrogenaza de la Candida boidinii. nu permite extinderea sintezelor la scară industrială.. Astfel. Sistemul multienzimatic a fost utilizat şi în sinteza L-leucinei din α-cetoisocaproat. Fukui şi colab. 1984]. 1979. 1990]. 1988. 1973]. Producerea continuă de L-valină folosind valin dehidrogenaza şi glucozo dehidrogenaza pentru regenerarea NADH a fost studiată detailat [Monot şi colab. folosite în exces [Deconttignies-Le Maréchal şi colab. Imobilizarea asigură sinteza continuă a aminoacizilor şi reciclarea amoniului şi piruvatului neutilizate.

Enzima are un rol important în furnizarea energiei necesare germinării sporilor. valin dehidrogenaza (ValDH) şi glutamat dehidrogenaza (GluDH).Aminoacid dehidrogenaze Aminoacid dehidrogenazele (EC 1.. care pot să monitorizeze nivelul ridicat de aminoacizi din plasma sanguină. L-alanina + NAD+ + H2O ↔ piruvat + NADH + H+ + NH3 Alanin dehidrogenaza a fost descrisă de către Wiame şi Piérard în 1955 [Norbert şi colab. 1. cu excepţia domeniului de legare a cofactorului. Aminoacid + NAD+ + H2O ↔ α-cetoacid + NADH + H+ + NH3 Majoritatea aminoacid dehidrogenazelor sunt specifice pentru α-aminoacizi. care include fenilalanin dehidrogenaza (PheDH). Această enzimă a fost purificată şi studiată în principal la mai multe specii din genul Bacillus. S-a demonstrat că în lipsa enzimei sporularea avea loc cu mari dificultăţi [Siranosian şi colab. în prezenţă de NAD(P)+. 1994]. valin. leucin-. Aminoacid dehidrogenazele au fost intens studiate în vederea utilizării lor în diverse ramuri industriale. Alanin dehidrogenaza Aminarea reductivă a cetoacizilor la L-aminoacizi în procese NAD(P)H-dependente este catalizată de o suprafamilie de enzime omoloage de aminoacid dehidrogenaze. leucin dehidrogenaza (LeuDH). care este comun pentru toate aceste enzime. 1998]. Deşi realizează unul şi acelaşi proces biologic. Deoarece ele acţionează stereospecific.şi glutamat dehidrogenaza). alanin dehidrogenazele şi suprafamilia de aminoacid dehidrogenaze au evoluat separat [Baker şi colab. alanin-.1. Aceste enzime au întrebuinţare şi în sinteza industrială de aminoacizi.X) sunt enzime care fac parte din familia oxidoreductazelor. Alanin dehidrogenaza (L-alanin oxidoreductază NAD+ dependentă.1.1) catalizează reversibil reacţia de dezaminare a L-alaninei cu formare de piruvat..4. Ele au fost folosite la construirea biosenzorilor. caracteristic în unele patologii. dar există şi câteva enzime care reacţionează şi cu aminoacizii β.4.. 38 . această caracteristică fiind foarte importantă pentru industria farmaceutică. Cele mai bine studiate aminoacid dehidrogenaze sunt cele care au importanţă industrială (fenilalanin-. Aceste enzime catalizează eliminarea grupării amino din L-aminoacizi cu formare de cetoacizi corespunzători. Nu există asemănări semnificative între secvenţele alanin dehidrogenazelor (AlaDH) şi membrii acestei familii de aminoacid dehidrogenaze. enzimele produc L-izomeri ai aminoacizilor naturali puri.

coli. Mycobacterium.. subtilis.. Diferenţele de termostabilitate ale proteinelor totale de E. stabile şi la alţi factori care afectează proteinele. 1989]. cu ultimul reacţia fiind mult mai lentă. stearothermophilus.3. coli şi proteina recombinată de LeuDH permit purificarea acesteia într-o singură etapă. 1994].9) (LeuDH) este o oxidoreductază NAD+-dependentă. O mare atenţie s-a acordat leucin dehidrogenazelor provenite de la microorganisme mezotermofile. iar proteina exprimată în celule de E. Alanin dehidrogenaza este o enzimă oligomerică.1. dar care nu este specifică altor aminoacid dehidrogenaze. în general.1993]. Una din aceste enzime este cea de la B. Natronobacterium magadii MS-3 [Katoh şi colab. sphaericus. 2003]. a cărei genă codificatoare a fost clonată. mediu acid sau alcalin. cum ar fi cele de la B. Enzimele termostabile nu prezintă numai avantajul termostabilităţii.1) catalizează reversibil transformarea acidului L-aspartic la fumarat şi NH4+.. Această 39 . Thermus. fiind. subtilis este esenţială în cataliză şi este conservată şi la alte alanin dehidrogenaze. prin denaturare termică. LeuDH intervine în catabolismul unor aminoacizi. Leucin dehidrogenaza Leucin dehidrogenaza (EC 1. Aspartat amoniu-liaza L-aspartat amoniu-liaza (AAL) sau aspartaza (EC 4. Enzima nu-şi pierde activitatea după incubare timp de 30 min la 70ºC [Oka şi colab. Majoritatea enzimelor studiate sunt hexameri. care catalizează reversibil dezaminarea L-leucinei şi a unor L-aminoacizi alifatici la cetoacizii corespunzători. Alanin dehidrogenaza este o enzimă NAD+ dependentă. B. B. solvenţi organici. 1997].. 1989]. Leucina + NAD+ + H2O ↔ α-cetoisocaproat + NADH + NH4+ + H+ Echilbrul reacţiei este deplasat spre formarea aminoacidului. Aminoacizii din vecinătatea acestei lizine prezintă o regiune conservată. detergenţi. AlaDH poate utiliza ca substrate în reacţia de aminare atât piruvatul. [Delforge şi colab. iar NADH în reacţia de aminare. cum ar fi enzime proteolitice. Leucin dehidrogenazele studiate provin în mare parte de la genul Bacillus precum şi de la Thermoactinomyces [Ohshima şi colab. Mecanismele cinetice ale AlaDH au fost studiate la mai multe specii. deoarece sunt mai stabile. Lizina din poziţia 74 din secvenţa de aminoacizi a AlaDH de la B. Un caz unic printre alanin dehidrogenazele bacteriene este cea de la Bacillus sp DSPM730 care reacţionează în egală măsură cu ambele substrate. stearothermophilus..4. Anabaena. 1988]. Această enzimă poate fi foarte utilă în sinteza de L-serină din 3-hidroxipiruvat [Nagata şi colab. [Nagata şi colab. cereus. Ca şi majoritatea aminoacid dehidrogenazelor.. NAD+ se leagă înaintea piruvatului în reacţia de dezaminare oxidativă.1. B. cât şi 3-hidroxipiruvatul.

la pH mai mic ea nu necesită ioni de metal [Karsten şi Viola. Amorsele utilizate pentru amplificarea prin PCR a genelor. 1991]. de circa 50 kDa. În secvenţa amorselor au fost incluse situsurile pentru enzime de restricţie necesare inserării genei în vectorul de exprimare. Pentru clonarea genelor ce codifică leucin dehidrogenaza. alanin dehidrogenaza de la Bacillus subtilis. Acest vector oferă posibilitatea exprimării genelor la inducere cu IPTG. Enzima AlaDH Q08352 LeuDH P13154 ALL (P0AC38) Amorsele utilizate 5΄-GAGGGATCCGATGATCATAGGGGTTCCTAAAG-3΄ 5΄-GGTCTCGAGTATAGCACCCGCCACAGATGATT-3΄ 5΄-GGTGGATCCGATGGAATTGTTCAAATATATGG-3’ 5΄-TATTCTCGAGTATTGCCGAAGCACCTGC-3΄ 5' –GGTAGGATCCGATGTCAAACAACATTCGTATCG– 3' 5' –GCTACTCGAGTTACTGTTCGCTTTCATCAGTA– 3' Escherichia coli Bacillus subtilis Bacillus stearothermophilus Organism sursă Enzime de restricţie BamHI XhoI BamHI XhoI NdeI BamHI NdeI BamHI NdeI BamHI Vector utilizat pET21b pET21b pET21b 5'-GGAATTCCATATGCTGAACGAAACTCCCGCAC-3' GalM Escherichia coli (P0A9C3) 5'-CGCGGATCCTCACTCAGCAATAAACTGATATTCCG-3' GlucDH P12310 5΄-GGAATTCCATATGTATCCGGATTTAAAAGGAAAAG-3΄ 5΄-CGCGGATCCTCAACCGCGGCCTGCCTGG-3΄ Bacillus subtilis pET24a pET24a Fragmentele ADN au fost purificate din gelul de agaroză. Produşii de digestie (produşii PCR şi vectorii) au fost separaţi cu ajutorul electroforezei în gel de agaroză. Vectorii de exprimare au fost digeraţi cu aceleaşi enzime de restricţie. Produşii PCR au fost purificaţi din gel şi digeraţi cu enzimele de restricţie corespunzătoare (Tabel 1). Tabelul 1. Majoritatea aspartazelor studiate au masa moleculară în jur de 200 kDa şi sunt alcătuite din patru monomeri identici. glucoz dehidrogenaza de la Bacillus subtilis şi aspartaza de la Escherichia coli au fost amplificate prin metoda PCR utilizând amorse specifice. care are proprietatea de a 40 . Pentru inserarea genelor în vectori s-a utilizat ADN ligaza. alanin dehidrogenaza şi aspartaza s-a utilizat vectorul de exprimare pET21b (Novagen). Enzima este activată în prezenţă de ioni de Mg2+ la un pH alcalin.enzimă joacă un rol important în metabolsimul azotului la bacterii. Metode Clonarea genelor pentru aminoacid dehidrogenaze Genele ce codifică leucin dehidrogenaza de la Bacillus sterothermophilus.

Secvenţele genelor clonate au fost verificate prin secvenţializare cu un aparat ABI Prism 310 Genetic Analyzer utilizând kitul de secvenţializare BigDye Terminator v3. Analiza exprimării genelor şi sintezei de proteine recombinate în celulele de E.1 (Applied Biosystems). După sonicare extractul bacterian a fost centrifugat (20 min la 21 000 ×g la 4°C). După ce densitatea optică (DO) la 600 nm a atins valorile de ~1.5-1L). Pereţii celulelor bacteriene au fost distruse prin sonicare.reface legăturile fosfoesterice.1 Figura 1. După câteva ore de la inducere (3-5 ore) bacteriile au fost centrifugate şi păstrate la -80°C până la utilizare.4→ 30 20. Celulele bacteriene au fost preluate în tampon Tris HCl pH=8. 41 .0 50 mM. Pentru obţinerea de proteine recombinate s-au realizat culturi mai mari (0. Se poate observa cantitatea mare de proteine recombinate raportată la cantitatea de proteine totale din celulele bacteriene.1 14. moleculele corect recombinate au fost introduse prin transformare în tulpina de Escherichia coli BL21(DE3). preum şi masele moleculare ale proteinelor recombinate. Sintezele enzimatice au fost realizate cu extracte celulare bacteriene. iar orice proces biotehnologic este cu atât mai valoros cu cât implică mai puţine costuri. s-a indus exprimarea genelor cu izopropil-β D-tiogalactopiranozid (IPTG) 1 mM. coli. Producerea de proteine recombinate Pentru exprimarea genelor. coli a fost urmărită cu ajutorul electroforezei în gel de poliacrilamidă în condiţii denaturante în prezenţă de SDS (Figura 1). Sinteza de proteine recombinate în celulele gazdă de E.4 30→ 20. O purificare a proteinelor recombinate ar implica costuri şi timp suplimentar. AlaDH 1 2 3 94 67 43 LeuDH 1 2 3 AAL 1 94→ 67→ 43→ ←54 2 ← ← 42→ ← ← ← ← 94 67 43 → → → → → ← 42 30 20. Moleculele recombinate rezultate după ligare (vector + gena) au fost introduse prin transformare în tulpina de Escherchia coli DH5α. iar supernatantul cu proteinele solubile a fost utilizat pentru măsurarea activităţii enzimatice. Cu cifre sunt indicate masele moleculare ale proteinelor din markerul molecular.1→ 14.

15 mM. NAD 2 mM. NH4Cl 1 M.0. NH4Cl 1 M. Tris HCl 50 mM pH 8. La această lungime de undă NADH prezintă maximul de absorbanţă şi are un coeficient molar de extincţie de 6.5 în reacţia de dezaminare c) GDH (glucozo dehidrogenaza): glucoză 10 mM.0 d) GalM (galacto mutarotaza): glucoză 10 mM. GDH 1 U e) LDH (lactat dehidrogenaza): piruvat 1 mM. MgCl2 6 mM Pentru măsurarea activităţii enzimatice a aspartzei s-a urmărit formarea acidului fumaric la 240 nm. Pentru măsurarea activităţii enzimatice s-au folosit câţiva µl de enzimă purificată sau extract brut bacterian.5. NADH 0. NAD 2 mM. glicocol 50 mM pH 10. L-alanină 10 mM.0 în reacţia de aminare. NADH 0. glicocol 50 mM pH 10. Tris HCl 50 mM pH8. Activitatea enzimatică s-a calculat după formula: A=[(DO/min)/6.15 mM. Sinteza de aminoacizi marcaţi cu 15N Mediul de reacţie pentru sintezele de aminoacizi marcaţi cu 15N a conţinut: 42 . S-a ales porţiunea dreptei cu activitatea cea mai mare. Mediile de reacţie pentru enzime au fost următoarele: a) LeuDH (leucin dehidrogenaza): cetoacid 10 mM.22]*(Vr/Vp) *FD *103 U/l DO/min – variaţia densităţii optice pe minut la 340 nm Vr – volumul reacţiei Vp – volumul probei FD – factorul de diluţie O unitate enzimatică (1U) corespunde formării unui µmol de produs într-un minut. care are un coeficient molar de extincţie la aceasă lungime de undă egal cu 2.0 în reacţia de aminare.54 ·103 ·M-1 ·cm-1. Tris HCl 50 mM pH 8. Tris HCl 50 mM pH 8.3. Tris HCl 50 mM pH 8.22 ·103 ·M-1 ·cm-1. astfel încât valorile DO/min să fie cuprinse între 0.5 în reacţia de dezaminare b) AlaDH (alanin dehidrogenaza): piruvat 10 mM. Tris HCl 50 mM pH 8. NADH 0. NAD 2 mM. L-leucină 10 mM. NAD 2 mM.05 şi 0.0 f) AAL (aspartat amoniuliaza): acid L-aspartic 100 mM.Măsurarea activităţii enzimatice a enzimelor Măsurătorile de activitate enzimatică a dehidrogenazelor s-au efectuat la 30ºC cu un spectrofotometru Jasco V-530 urmărindu-se scăderea absorbanţei NADH (reacţia de aminare a cetoacizilor) sau formarea acestuia (reacţia de dezaminare a aminoacizilor) la 340nm.15 mM.

068852 + 0. Aminoacidul s-a eluat cu NH4OH 1M. În Figura 2 este prezentată curba etalon de la sinteza de [15N]-L-metionină. 200 µl de hipoclorit de sodiu şi 590 µl apă.4 1. Purificarea aminoacizilor sintetizaţi Aminoacizii sintetizaţi au fost purificaţi pe o coloană cu răşină schimbătoare de ioni Dowex 50W x 8. timp de 15 min la 85ºC. a fenolnitroprusiatului şi a cloraminei. Fracţiunea cu aminoacid s-a concentrat pe 43 . după care s-a spălat până la un pH neutru. la interacţiunea ionului de amoniu. Ca martor a servit amestecul de sinteză fără clorură de amoniu (din care cauză se adăuga la sfârşit). Sintezele de aminoacizi marcaţi au fost efectuate la 30ºC cu urmărirea pH-lui şi agitare. Pe baza curbelor etalon s-a calculat cantitatea de ion de amoniu rămas în mediul de sinteză.013334x R= 0.2 0 0 20 40 60 80 100 120 DO 623nm NH Cl (% ) 4 Figura 2. în forma H+. Developarea culorii s-a făcut prin incubarea probelor timp de 2-3 min la 100ºC. Sintezele au fost oprite prin denaturarea termică a enzimelor. Curba etalon de la sinteza [15N] L-Metionină.• cetoacid 100 mM • 15NH4Cl 100 mM • NADH 1 mM • glucoză 670 mM Amestecul de sinteză a fost ajustat la pH 8.4 0.6 0.99935 1. Controlul eluării s-a făcut cu ninhidrină pentru aminoacizi.0 cu NaOH.8 0. y = 0.2 1 0. Reacţia s-a declanşat prin adăugarea enzimelor. 200 µl de fenolnitroprusiat. Înainte de declanşarea sintezelor s-a preluat o probă care a servit la alcătuirea unei curbe etalon. Pe parcursul sintezei s-a urmărit consumul de NH4Cl prin metoda Berthelot. S-a măsurat absorbanţa la 623 nm. Activarea umpluturii s-a făcut prin tratare cu HCl 2N. Amestecul de sinteză filtrat s-a încărcat pe coloană şi apoi s-a spălat cu apă (10 volume). Probele s-au preparat după următoarea procedură: 10 µl de probă diluată de 20 ori. Această metodă constă în formarea unui compus de culoare.

randamente scăzute datorită mai multor etape de sinteză. ia naştere un fragment cu masa M-159. s-a facut prin sililare. cum ar fi consumul unei cantităţi mari de amoniac. reactivul având şi un conţinut de 1% terţ-butil-dimetil-clorsilan. La ionizarea cu impact de electroni. Derivatizarea s-a făcut pe cantitaţi de probă de ordinul 0. M-57 şi M-85. Derivatizarea s-a făcut utilizând ca reactiv N-metil-N-(terţ-butil-dimetilsilil) triflouroacetamida (MTBSTFA) în calitate de donor al grupării silil. care trebuie facută la ambele funcţiuni polare ale moleculei de aminoacid. cum se întâmplă în cazul derivatizării cu grupări trimetilsilil. iar spectrele s-au înregistrat cu un spectrometru de masă cuadrupolar HP 5985. la amină se introduce o singură grupare silil. purităţii şi concentraţiei izotopice. aminoacizii sub formă de TBDMS-derivaţi se produc în cea mai mare parte sub formă de ioni prin fragmentarea moleculelor. utilizând metoda Das Neves şi Vasconcelos. În primele etape de marcare a acizilor aminaţi cu izotopi stabili s-au folosit metode de sinteză chimică. Derivatizarea. după care s-a precipitat cu etanol absolut. Separarea gaz-cromatografică a produşilor de sinteză sub formă de TBDMS-derivaţi s-a făcut pe o coloană capilară cu fază staţionară DB5 de 30 m lungime. Aceste metode prezintă un şir întreg de dezavantaje.baia de apă. Pentru analize s-a utilizat un cromatograf de gaze Hewlett Packard 5840 A. 44 . Precipitarea s-a lăsat peste noapte. în calitate de catalizator.5-1 mg de probă. iar precipitatul obţinut s-a filtrat şi uscat. În continuare. cu 150 µl de acetonitril ca solvent şi 50 µl reactiv MTBSTFA. datorită substituentului terţ-butil voluminos. aminoacizii astfel obţinuţi au fost supuşi determinării structurii. obţinerea racemicului. la carboxil şi amină. cu hidrogen ca şi gaz purtător şi cu temperatură programată între 55 şi 250ºC. adiacent. Acest tip de derivatizare are avantajul că. iar prin ruperea legăturii dintre carboxil şi atomul de carbon alfa. Prin ruperea în diferite poziţii din gruparea tert-butildimetilsilil se formează ioni cu masele M-43. care introduce la fiecare funcţiune polară din moleculă câte o grupare terţ-butil-dimetilsilil (TBDMS). la 120ºC timp de 20 minute. Analiza aminoacizilor sintetizaţi prin spectrometrie de masă Pentru analiza calitativă prin metoda spectrometriei de masă a aminoacizilor este necesară o derivatizare a produsului de reacţie. şi nu una sau două în mod statistic. Masele ionilor fragment fiind caracteristice fiecărui aminoacid. Sinteza de aminoacizi marcaţi cu 15N Marcarea aminoacizilor cu izotopi stabili se poate realiza prin sinteze chimice şi enzimatice.

. O metodă relativ simplă şi mai utilizată pentru obţinerea de aminoacizi marcaţi cu 15N este sinteza enzimatică pornind de la cetoacizi şi săruri de amoniu (15N). Reacţiile de sinteză sunt cuplate cu reacţii de regenerare a cofactorilor costisitori. marea majoritate provenind de la bacterii. 2000]. Din cauza preţului mare a acestora utilizarea lor în cantităţi stoichiometrice nu este eficientă. Sinteza de aminoa45 . Modalitatea cea mai eficientă pentru regenerarea coenzimelor rămâne metoda enzimatică.Folosirea enzimelor în sinteze de aminoacizi marcaţi cu izotopi stabili prezintă mai multe avantaje faţă de metodele chimice. Un dezavantaj al metodei îl prezintă specificitatea şi viteza de regenerare reduse. care constă în oxidarea unui mediator şi transferul electronului la NAD(P)+. cu utilizare de celule în creştere. Pentru a evita acest fenomen există câteva căi de regenerare continuă a coenzimelor pe parcursul sintezelor: • regenerarea în vivo. Schema de sinteză a aminocizilor marcaţi cu 15N utilizată în prezenta lucrare este reprezentată în Figura 3. Schema de sinteză a acizilor aminaţi cu 15N. • regenerarea enzimatică în vitro. 15NH4Cl Cetoacid NADH AADH Acid gluconic GDH GalM β-glucoză -glucoză L-(15N)aminoacid NAD+ Figura 3. Majoritatea enzimelor utilizate în sinteza diverşilor compuşi necesită coenzime (NADH sau NADP). datorită faptului că decurg stereoselectiv şi au randamente superioare. 1989). Piridin nucleotid transhidrogenaza de la Pseudomonas fluorescens a fost utilizată în regenerarea atât a NAD cât şi a NADP pentru producerea de hidromorfonă [Boonstra şi colab. AADH – aminoacid dehidrogenză Aminoacid dehidrogenazele catalizează reacţia de formare a aminoacizilor pornind de la 15NH4Cl şi cetoacizii corespunzători. Această metodă prezintă dezavantajul manipulării laborioase a celulelor şi caracterul enantioselectiv scăzut al reacţiei. Sursele enzimelor utilizate în regenerarea coenzimelor sunt destul de variate. • regenerarea electrochimică. cele mai utilizate enzime pentru regenerarea coenzimelor în sinteze fiind alcool dehidrogenaza şi formiat dehidrogenaza (Hummel şi Kula.

Reacţia s-a declanşat la adăugarea enzimelor (115 U de leucin dehidrogenază şi 60 U de glucozo-dehidrogenază). constanta de inhibiţie calculată de noi Ki=4. Activitatea alanin dehidrogenazei din B. O soluţie în acest 46 . nu conduce la mărirea randamentului reacţiei. DMTBS derivat. M = 318. Pe tot parcursul sintezei alaninei s-a urmărit consumarea clorurii de amoniu prin metoda Berthelot (Figura 4 A) care este o metodă colorimetrică foarte sensibilă de dozare a amoniacului. utilizând ca substrat glucoza cu formare de acid gluconic. Honorat şi colab. GlucDH a servit la regenerarea NADH. NADH 1 mM. După purificarea aminoacidului randamentul sintezei a fost de 60%. Acest fapt nu a influenţat randamentul sintezelor. 15NH4Cl pe parcursul sintezei de [15N]-alanină. cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. În unele sinteze s-a folosit galactozo-mutarotaza pentru transformarea α-glucozei în β-glucoză. subtilis este inhibată de piruvat. Astfel. 15NH4Cl 130 mM. Figura 4. glucoză 670 mM. Enzimele utilizate în sintezele de aminoacizi marcaţi nu au fost purificate. subtilis. Sinteza de L-alanină marcată cu 15N s-a realizat pentru o cantitate de 8 mmol. Enzimele recombinate.25 mM.cizi a fost cuplată cu reacţia catalizată de glucozo-dehidrogenaza (GlucDH) de la B.0. Sinteza de [15N]-alanină. coli. în general. (A) Consumul. exprimate în celule de E. Mediul de reacţie utilizat a conţinut: piruvat de Na 150 mM. la concentraţii mari de substrat activitatea enzimei este redusă. Purificarea acestora este o etapă suplimentară care. înainte de adăugarea enzimelor. reprezintă aproximativ 50% din proteinele totale existente în lizatul bacterian. [1990] au testat sinteza de L-alanină şi L-valină cu enzime (alanin dehidrogenază şi valin dehidrogenază) purificate şi în lizat bacterian. Sinteza de [15N] L-Ala Amestecul de sinteză a fost ajustat la pH 8. (B) Spectrul de masă al [15N]-Alaninei.

ceea ce demonstrează marcarea alaninei nu 15N (Figura 4 B). Mediul de reacţie pentru sinteza de [15N]-leucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode.caz ar fi declanşarea reacţiei de sinteză cu cantităţi mai mari de enzimă.7 (2. şi respectiv 200. Tabelul 2. a fost necesară o cantitate mai mare de enzimă. Masele caracteristice ale ionilor fragment ale leucinei cu conţinut izotopic natural au valorile m/z 316. NH4Cl 1M şi NADH 0. stearothermophilus în prezenţa diferiţilor α-cetoacizi α-cetoacid Acid α-cetoisovaleric Acid α ceto-β-metilvaleric Acid α-cetoizocaproic Acid α-cetocaproic Acid α-ceto-γ-metiltiobutiric Acid α-cetobutiric LeuDH429 168 (100) 46. Între paranteze este exprimată activitatea procentuală considerând rezultatul obţinut cu acid α-cetoisovaleric ca 100%. În cazul aminoacizilor mar47 .8) Activitatea enzimatică a fost determinată la 30°C în tampon Tris-HCl 50 mM.5 (28) 36.6) 4. pH 8. 302. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele menţionate mai sus. Activitatea specifică (U/mg de proteină) a LeuDH din B.8 (22) 17. α-cetoacid 10 mM. În ambele cazuri este necesară o urmărire minuţioasă a consumului clorurii de amoniu. Masele fragmentelor ion ale alaninei cu conţinut izotopic natural sunt m/z 274.4 (10) 7. Enzima are cea mai mare specificitate de substrat pentru acidul α-cetoisovaleric.15 mM. Masa moleculară a alaninei fără marcare izotopică este 317. 260. În cazul leucinei derivatizate cu două grupări silil.8 (4. De aceste valori ale activităţii enzimatice s-a ţinut cont în sintezele de aminoacizi marcaţi cu izotopul stabil al 15N. 274. 232 şi 158. masa moleculară exactă pentru leucină fără marcare izotopică la azot este M=359. stearothermophilus sunt prezentate în Tabelul 2. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 5 A). Specificităţile de substrat ale leucin dehidrogenazei native din B. O altă soluţie poate fi adăugarea piruvatului în mai multe etape.0. Sinteza de [15N]-L-Leu Leucin dehidrogenazele au specificitate pentru un număr mai mare de cetoacizi. În sintezele de aminoacizi la care enzima are o specificitate mai mică pentru precursorul acestora.

Raportul molar al reactanţilor (acid α-ceto isovaleric:15NH4Cl )a fost de 1:1. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-valină. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă (Figura 5 B). Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo-dehidrogenază. înainte de adăugarea enzimelor. cca 97 atom % 15N. M = 346. Din fiecare reactant s-a utilizat o cantitate de 8. DMTBS derivat. Sinteza de [15N]-L-Val Mediul de reacţie pentru sinteza de [15N]-valină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. DMTBS derivat. raportul reactan48 . S-au realizat câteva sinteze.0 mmol. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 6 A). (B) Spectrul de masă al [15N]-valinei. Figura 5. Figura 6. M = 360. Sinteza de [15N]-leucină (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-leucină. cca 97 atom % 15N NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero.caţi cu 15N. Sinteza s-a declanşat cu 205 U de leucin dehidrogenază şi 110 U de glucozo dehidrogenază. Din fiecare reactant s-a utilizat o cantitate de 8. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero.2 mmol. (B) Spectrul de masă al [15N]-Leucinei. Sinteza de [15N]-valină. înainte de adăugarea enzimelor.

292. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 7 A). Sinteza de [15N]-L-Met Mediul de reacţie pentru sinteza de 15N-metionină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. viteza reacţiei fiind direct proporţională cu concentraţia de substrat până la anumite valori. Spectrul de masă al valinei marcate isotopic este prezentat în Figura 6 B. Viteza reacţiei a scăzut foarte mult după primele 10 min când s-au consumat 50% din substrate (Figura 7 A). Scăderea vitezei de reacţie se poate explica prin scăderea concentraţiei substratelor. şi deci şi consumul de clorură de amoniu este foarte mare în primele minute de sinteză. După purificarea aminoacidului s-a constatat un randament al sintezei de 94%. Viteza a scăzut mult după încă 10 min (în primele 20 min ale sintezei s-au consumat 80% clorură de amoniu). 260 şi respective 186. În continuare viteza reacţiei a scăzut. acumularea de produşi de sinteză care pot inhiba activitatea enzimelor. şi 218. Tabelul 3. 288. Pentru consumarea celorlalte 20% NH4Cl au fost necesare 100 min. atât masa moleculară cât şi 49 . Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-γ-metiltiobutiric este aproximativ 8 U/mg proteină. Masele caracteristice ale ionilor fragment ale metioninei fără marcare izotopică au valorile m/z 320. masa moleculară exactă pentru valina fără marcare izotopică la azot este M=345 . Cel mai mare randament s-a constatat în cazul sintezei de 12 mmol.0 8.0 12. Astfel. Masele caracteristice ale ionilor fragment a valinei cu conţinut izotopic natural au valorile m/z 302. după 10 min s-a consumat 50% clorură de amoniu. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. În cazul metioninei marcate cu 15N.0 12. iar în cazul valinei marcate cu 15N. Sinteze de [15N]-L-valină Reactanţi (mmol) Acid cetoisovaleric 3.0 Randamentul sintezei (%) 79 86 92 Viteza de reacţie este.ţilor şi randamentele sintezelor sunt prezentate în Tabelul 3.0 8. Din această cauză a fost nevoie de o cantitate mai mare de proteină. În cazul valinei derivatizate cu două grupări silil. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice. Masa moleculară a metioninei derivatizată cu două grupări silil este de 377.0 15NH 4Cl 3.

7 mmol. Sinteza s-a declanşat cu 200 U de leucin dehidrogenază şi 125 U de glucozo dehidrogenază.8 mmol. (B) Spectrul de masă al [15N]-metioninei. Spectrul de masă al metioninei marcate isotopic este prezentat în Figura 7 B. Sinteza s-a declanşat cu 106 U de leucin dehidrogenază şi 86 U de glucozo dehidrogenază şi 39 U de galacto mutarotază. Figura 7. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-metionină. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. înainte de adăugarea enzimelor. M = 360. M = 378. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norleucină. DMTBS derivat. DMTBS derivat. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa metioninei marcate cu 15N în produsul sintezei enzimatice. Sinteza de [15N]-metionină. cca 97 atom % 15N Sinteza de [15N]-L-NorLeu Mediul de reacţie pentru sinteza de [15N]-norleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. (B) Spectrul de masă al [15N]-norleucinei. Din fiecare reactant s-a utilizat o cantitate de 4. 100 A 100 90 80 70 60 73 201 B 80 NH Cl (%) 60 I.masele ionilor fragment cresc cu o unitate de masă. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. Sinteza de [15N]-norleucină. înainte de adăugarea enzimelor. % 50 40 30 20 10 0 4 40 57 75 147 133 275 303 15 20 346 0 50 100 150 200 m/z 250 300 350 400 0 0 5 10 20 min 30 70 90 120 Figura 8. Din fiecare reactant s-a utilizat o cantitate de 5. Raportul molar al reactanţilor (acid α-ceto caproic:15NH4Cl )a fost de 1:1. Raportul molar al reactanţilor (acid α-ceto-γ-metiltiobutiric:15NH4Cl )a fost de 1:1. cca 97 atom % 15N 50 .

0 4. Raportul reactanţilor şi randamentele sintezelor sunt prezentate în Tabelul 4. Tabelul 4. Din fiecare reactant s-a utilizat o cantitate de 8.Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetocaproic este relativ mică (17. (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-norvalină.0 4.7 U/mg proteină. ceea ce constituie 2. Sinteza s-a declanşat cu 310 U de leucin dehidrogenază şi 204 U de glucozo dehidrogenază. Raportul molar al reactanţilor (acid α-ceto butiric:15NH4Cl)a fost de 1:1. Sinteza de [15N]-L-Norval Mediul de reacţie pentru sinteza de [15N]-norvalină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode. Masele fragmentelor ion ale norleucinei cu conţinut izotopic natural sunt sunt m/z 316.4 U/mg proteină). ceea ce demonstrează marcarea norleucinei nu 15N (Figura 8 B). 100 A 100 90 80 187 73 B 80 NH4Cl (%) 70 60 I. DMTBS derivat.7 Masa moleculară a norleucinei fără marcare izotopică este 359. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul cetobutiric este cea mai mică dintre substratele analizate (4.03 mmol. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 8 A). Sinteza de [15N]-norvalină. înainte de adăugarea enzimelor. Analiza spectrelor de masă a arătat prezenţa fragmentelor ion cu o unitate mai mult decât cele mai menţionate mai sus.8% din activitatea pentru acidul cetoisovaleric). % 60 50 40 261 147 57 133 303 331 0 50 100 150 200 250 300 350 289 15 40 30 20 20 10 0 0 0 5 15 30 m in 60 90 120 m/z Figura 9. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 9 A). 302. (B) Spectrul de masă al [15N]-norvalinei. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. cca 97 atom % 15N 51 . Sinteze de [15N]-L-norleucină Reactanţi (mmol) Acid cetocaproic 2. M = 346.7 15NH 4Cl Randamentul sintezei (%) 78 78 2. 274 şi 200.

masa moleculară exactă pentru izoleucină fără marcare izotopică la azot este M=359. Spectrul de masă al norvalinei marcate isotopic este prezentat în Figura 9 B. 274. M = 360. Masele caracteristice ale ionilor fragment ale valinei cu conţinut izotopic natural au valorile m/z 302. Sinteza de [15N]-isoleucină.În cazul norvalinei derivatizate cu două grupări silil. Sinteza s-a declanşat cu 290 U de leucin dehidrogenază şi 221 U de glucozo dehidrogenază. 52 . cca 97 atom % 15N În cazul izoleucinei derivatizate cu două grupări silil. A 100 80 NH Cl (%) 100 90 80 70 60 201 73 B I.27 mmol. DMTBS derivat. 288. şi respectiv 200. iar în cazul norvalinei marcate cu 15N . (A) Consumul de 15NH4Cl pe parcursul sintezei de [15N]-isoleucină. Masele fragmentelor ion obţinute prin spectrometrie de masă sunt mai mari cu o unitate. masa moleculară exactă pentru norvalină fără marcare izotopică la azot. 302. Activitatea specifică relativă a leucin dehidrogenazei pentru acidul α-ceto-β-metilvaleric (46. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa valinei marcate cu 15N în produsul reacţiei enzimatice. înainte de adăugarea enzimelor. Din fiecare reactant s-a utilizat o cantitate de 5. Masele caracteristice ale ionilor fragment ale izoleucinei cu conţinut izotopic natural au valorile m/z 316. Pe tot parcursul sintezei s-a urmărit consumul de NH4Cl (Figura 10). În cazul aminoacizilor marcaţi cu 15N. 260 şi 186. % 60 4 50 40 15 303 57 75 147 133 275 40 30 20 20 10 0 0 0 5 10 20 40 min 60 90 120 345 50 100 150 200 250 300 350 400 0 m/z Figura 10. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. NH4Cl 100% s-a considerat cantitatea de clorură la timpul zero. atât masa moleculară cât şi masele ionilor fragment cresc cu o unitate de masă. ceea ce demonstrează marcarea izoleucinei cu 15N (Figura 10 B). Sinteza de [15N]-L-Ile Mediul de reacţie pentru sinteza de [15N]-izoleucină s-a realizat cu reactivii la concentraţiile descrise la capitolul de materiale şi metode.8 U/mg proteină). este M=345. (B) Spectrul de masă al [15N]-izoleucinei.5 U/mg proteină) este mai mare decât pentru acidul cetoisocaproic (36.

251 0.Asp NH4Cl Fumarat L. În cazul reacţiilor reversibile nu se consumă tot substratul şi ca rezultat randamentul sintezelor scade.Sinteza de acid L-aspartic Aspartaza este folosită cu succes în sinteza de acid aspartic din acid fumaric şi clorură de amoniu.0 10. Acid L-aspartic ↔ Acid fumaric + NH4+ După o anumită perioadă de timp.648 20.0 0 1. Sinteza de acid aspartic s-a realizat la temperatura camerei. 1981. indicate în partea stângă a tabelului.43 2. Reacţia de sinteză s-a oprit prin denaturarea termică a enzimei. coli cu o activitate mare a aspartazei au fost utilizate în sinteza acidului aspartic [Fusee şi colab. Determinarea constantei de echilibru (Keq = [NH3] [acid fumaric] / [acid aspartic]) a reacţiei catalizate de aspartaza din E. MgCl2 6mM. Tosa şi colab. care este deplasat spre formarea de acid aspartic.Media celor 4 măsurători au indicat o valoare a Keq = 3.0 20.69 x 10 –3 M).352 4.523 10.432 3.. care este proporţională cu concentraţia de acid fumaric format (εmM = 2. Se adaugă apoi 1 U de aspartază recombinată. coli Concentraţia iniţială (mM) Concentraţia de echilibru (mM) Keq L.0 40. Rezultatele şi condiţiile acestor determinări sunt prezentate în Tabelul 5.0 0 3.352 0.28 2.70 Mediul de reacţie conţine la un volum de 1 ml următorii reactivi: tampon Tris-HCl 50 mM (pH 8.Asp NH4Cl Fumarat (mM) 1. Dozarea activităţii enzimatice a aspartazei s-a făcut de asemenea la temperatura camerei. La echilibru nu se mai observă nici o variaţie de extincţie. Reacţia de formare a acidului aspartic din fumarat este reversibilă. 53 . 1976]..5).434 0.749 10.. Celule imobilizate de E. Concentraţiile la echilibru de L-Asp şi NH4Cl se calculează din concentraţiile lor iniţiale şi concentraţia la echilibru de acid fumaric.477 3.477 0. Pentru a determina concentraţiile reactanţilor la care se stabileşte echilibrul reacţiei am făcut mai multe determinări ale constantei de echilibru.35 4.566 30.0 0 1. Tabelul 5. Pe tot parcursul sintezei s-a urmărit consumul de acid fumaric prin citirea absorbanţei la 240 nm (Figura 11 A).0 0 0.53). iar acidul aspartic având o cerere mare pe piaţa de aminoacizi.69 mM (sau 3. metoda fiind foarte eficientă şi simplă. între cei doi reactanţi (fumarat şi acid aspartic) se stabileşte un echilibru. iar la diferite intervale de timp se citeşte extincţia la 240 nm.0 10.251 3. Producerea acidului aspartic la scară industrială s-a realizat enzimatic din fumarat şi săruri de amoniu utilizând aspartaza ca şi catalizator [Chibata şi colab. diverse concentraţii de acid aspartic şi NH4Cl. 1973].

Fumarat mM Aspartat mM 1000 100 90 80 73 Fumarat/Aspartat (mM) 800 70 60 600 I. Componenţa mediului de sinteză a fost: acid fumaric 1 M. Sinteza de acid aspartic. Reacţia s-a declanşat cu aspartază 2 U/ml. 390 şi 316. Masa moleculară a acidului aspartic derivatizat cu trei grupări silil este de 457. coli. aproape de două ori mai mare decât enzima nativă. Masele caracteristice ale ionilor fragment ale acidului aspartic fără marcare izotopică au valorile m/z 432. DMTBS derivat. NH4Cl 0. (B) Spectrul de masă al acidului aspartic. Leucin dehidrogenaza de la B.8 M. iar echilibrul este deplasat spre formarea de aminoacid. fără marcare cu 15N. Până acum nu a fost descrisă o metodă enzimatică eficientă de producere a cetoacizilor. % 50 40 400 30 20 75 200 10 0 0 50 100 147 202 244 150 200 250 302 316 300 350 418 390 400 450 460 500 0 0 50 100 150 200 min 250 300 350 m/z Figura 11. catalizată de aspartaza recombinată din E. fapt care explică şi costurile mari a acestora. pH s-a ajustat la valoarea de 8. Datele spectrometrice de masă obţinute confirmă pe deplin prezenţa acidului aspartic în produsul sintezei enzimatice. (A) Consumul de acid fumaric şi formarea de acid aspartic în cursul reacţiei de sinteză a acidului aspartic. Acest fapt ne-a determinat să testăm o sinteză de acid cetoisocaproic (Figura 12). coli. După purificare s-a constat un randament de 70%. Sinteza de acid α-cetoisocaproic Sinteza chimică a cetoacizilor este dificil de realizat. Acesta reprezintă cel mai mare impediment în utilizarea AADH în sinteza enzimatică a cetoacizilor. 418. M = 457. Pentru sinteză am utilizat şi aspartază recombinată de la E. Spectrul de masă al acidului aspartic fără marcare izotopică este prezentat în Figura 11 B. Aminoacid dehidrogenazele (AADH) catalizează dezaminarea L-aminoacizilor cu formare de cetoacizi corespunzători. Reacţiile sunt reversibile. Aspartaza a servit la înlăturarea ionului de amoniu format în urma reacţiei 54 . stearothermophilus cu 9 aminoacizi lipsă la capătul C-terminal are o activitate specifică în reacţia de dezaminare a L-leucinei.5 cu NaOH.

L-leucină

NAD+ LeuDH358 NADH LDH

Lactat

Acid αcetoisocaproic NH4+

Piruvat

+
Fumarat AAL Acid aspartic

Figura 12. Schema de sinteză a acidului cetoisocaproic.

de dezaminare a L-leucinei. Reacţia catalizată de aspartază este şi ea reversibilă, dar în acest caz echilibrul reacţiei este deplasat spre formarea de acid aspartic, deci spre consumarea de NH4+. Pentru regenerarea coenzimei am utilizat lactat dehidrogenaza din muşchi de bovine. Un impediment care poate apărea pe parcursul sintezelor de acest gen (cu mai multe enzime) este reacţionarea enzimelor secundare cu produsul sintezei. Este cunoscută specificitatea strictă a aspartazei pentru acid aspartic, de aceea am testat numai activitatea LDH cu diferiţi cetoacizi (Tabelul 6). Surprinzător este faptul că, totuşi, unii cetoacizi sunt substrate pentru LDH. Pentru sinteza cetoacizilor ce servesc ca substrate şi pentru LDH trebuie căutate alte enzime pentru regenerarea coenzimei.
Tabelul 6. Activitatea LDH din muşchi de bovine (Boehringer) în prezenţa diferiţilor α-cetoacizi în raport cu substratul fiziologic (acid piruvic) α cetoacid Acid piruvic Acid hidroxipiruvic Acid fluoropiruvic Acid α cetobutiric Acid α cetocaproic Acid α cetovaleric Acid α ceto γ metiltiobutiric Acid α cetoizocaproic Acid α ceto β metilvaleric Activitate U/mg proteină 140 69 38 10 0,38 0,13, 0,02 0,00 0,00 % 100 49 27 7,1 0,27 0,093 0,014 0,00 0,00

Mediul de reacţie conţine în volumul final de 1 ml: tampon Tris–HCl 50 mM (pH 8,5), MgCl2 6 mM, NADH 0,15 mM, α-cetoacid 1 mM.

55

Sinteza de acid isocaproic s-a realizat pentru o cantitate de 5 mmol. Temperatura la care a fost efectuată sinteza a fost de 35ºC. Reacţiile au fost oprite prin denaturarea termică a enzimelor (15 min la 85ºC). Formarea acidului cetosiocaproic s-a urmărit prin consumarea piruvatului (Figura 13).
Piruvat mM cetoisocaproat mM 120

100 Piruvat/cetoisocaproat (mM)

80

60

40

20

0 0 50 100 min 150 200 250

Figura 13. Consumul de acid piruvic şi formarea de acid α-cetoisocaproic în cursul reacţiei de sinteză a acidului α-cetoisocaproic în sistemul cuplat LeuDH/AAL/LDH. Componenţa mediului de sinteză a fost: acid fumaric 150 mM, acid piruvic 120 mM, L-leucină 100 mM, NAD 1 mM, pH-ul s-a ajustat la valoarea de 8,5 cu NaOH. Reacţia s-a declanşat cu 2 U/ml aspartază, lactat dehidrogenază şi leucin dehidrogenază (LeuDH358).

Din amestecul de sinteză s-a purificat leucina rămasă după sinteză. Cantitatea de leucină recuperată a servit la calcularea randamentului sintezei, care a fost de 30%. Deşi randamentul este mic, sinteza este rentabilă din punctul de vedere al preţului reactanţilor, cei folosiţi sunt mai ieftini decât produsul final. În concluzie, tehnicile care utilizează ADN recombinat au aplicaţiile cele mai diverse în biotehnologie. Aplicarea lor cere însă expertize variate cum sunt: - calcularea randamentelor de reacţie pe baza echilibrelor termodinamice şi a parametrilor cinetici a enzimelor implicate, - utilizarea unor procedee rapide de purificare prin cristalizare sau cromatografie, dar nu în ultimul rând şi cunoaşterea pieţei internaţionale privind cererea şi oferta produselor. Piaţa moleculelor marcate cu 15N este redusă dar interesantă, considerând valoarea ridicată a acestor compuşi. Pentru comparaţie, 1 kg 56

de acid L-glutamic valorează în prezent ~1 €, în timp ce 1 g acid [15N]-L-glutamic valorează ~150 €

2. Tendinţe actuale în aplicarea bionanotehnologiilor
Bionanotehnologiile moderne se inspiră din organizarea celulară a lumii vii. Astfel, structurile nano la fel ca şi structurile vii, sunt alcătuite din componente de natură organică şi anorganică. Aceste structuri sunt speranţa pentru tratarea a numeroase cancere, existând în prezent deja aplicaţii ale nanoparticulelor în tratamentul unor cancere. Nanoparticulele sunt o speranţă nu numai pentru tratamentul numeroaselor boli, dar şi pentru stabilirea unor diagnostice. Utilizarea nanoparticulelor în medicină este axa prioritară în aplicarea bionanotehnologiilor. Limitările bionanotehnologiilor sunt: incapacitatea de a sintetiza particule de aceleaşi dimensiuni cu aceeaşi suprafaţă, controlul organizării lor. Ţesuturile tari, cum ar fi ţesutul osos, cochiliile la moluşte, conţin una sau mai multe componente organice de natură proteică care controlează organizarea structurală . Aplicaţii ale bionanotehnologiilor Nanoparticulele de aur (NP-Au) sunt o adevărată speranţă în diagnosticul şi tratamentul cancerelor. Au a fost utilzat timp de câteva decenii în diverse aplicaţii în medicină (implanturi dentare) datorită caractersticilor sale neutre. Nanoparticulele de Au au început să fie din ce în ce mai des utilizate în depistarea şi chiar tratamentul unor celule canceroase datorită faptului că acestea sunt inerte, non-toxice, au stabilitate mare, dimensiuni mici şi capacitate de legare mare. NP-Au sunt capabile de a acţiona asupra unor anumite tipuri de celule chiar în absenţa oricăror grupe funcţionalizate. NP-Au induc moartea celulară liniei de celule de carcinom pulmonar A549 de la om, dar nu au nici un efect asupra altor linii de celule HepG2 (carcinom hepatic hepatocelular uman) şi BHK21 (celule juvenile din rinichi de hamster) (Patra şi col., 2007). Diagnostic Diagnosticul nanomolecular al cancerului poate asigura depistarea celulelor canceroase în faze incipiente ale bolii. Nanoparticule de aur derivatizate cu nucleotide tiolate au fost utilizate pentru depistarea celulelor canceroase (Conde şi col., 2010). NP-Au la care s-au ataşat oligonucleotide de ADN au fost utilizate pentru diagnosticul timpuriu al leucemiilor mieloide acute. Oligonucleotidele ADN utilizate în acest scop 57

reprezentau un fragment din joncţiunea care rezultă în urma translocaţiiei t(9;22)(q34;q11). Un fragment dintr-un cromozom este translocat la un alt cromozom, în acest caz fragmentul de la cromozomul 9 este transferat pe cromozomul 22, cromozomul find cunoscut sub denumirea de cromozom Philadelphia. Această translocaţie este cauza leucemiilor mieloide cronice şi care sunt cauzate de fuziunea a 2 gene BCR(22)-Abl(9) (Figura 14).

Figura 14. Formarea cromozomului Philadelphia – translocaţia reciprocă între cromozomul 9 şi 22.

Produsul acestei gene este o proteină himeră cu activitate tirozin-kinazică. Metoda de detecţie cu ajutorul nanoparticulelor se bazează pe formarea de porţiuni hibride ADN:ARN (ADN sonda: ARNm din celulele canceroase) dublu catenare, care vor împiedica agregarea nanoparticulelor de Au odată cu creşterea concentraţiei de săruri. Metoda nanosondelor pentru diagnosticul acestui tip particular de cancer oferă avantaje faţă de metodele utilizate actual în diagnostic (FISH, transcrierea inversă a ARNm şi amplificarea prin PCR) prin faptul că este mai ieftină şi mai rapidă (~30 min) şi necesită cantităţi mici de ARNm (10 ng/μl). Diagnosticul timpuriu în asemenea cazuri este foarte important, în fazele ulterioare celulele canceroase devenind rezistente la chemoterapice. Nanoparticulele de argint (NP-Ag) au devenit atractive în domeniul bionanotehnologic după descoperirea efectului lor antibactericid (Sondi şi Salopek-Sondi, 2004). Acest efect este unul de importanţă majoră datorită faptului că bacteriile capătă din ce în ce mai multă rezistenţă la antibiotice. Nanoparticulele de argint par a avea o influenţă nu numai asupra bacteriilor, dar şi asupra virusurilor. Astfel NP-Ag la concentraţii non-toxice pentru celule inhibă replicarea virală (sinteza materialului genetic ai virusului) 58

atunci când nanoparticulele sunt administrate înainte de infectare sau imediat după (2-4 ore) aceasta (Speshock şi col., 2010). Unele substanţe chimice s-au dovedit a avea un efect inhibitor asupra proliferării celulare, angiogenezei şi rol antiinflamator. Un astfel de exemplu este colorantul DCPIP (2,6-diclorofenol-indofenol) care induce apoptoza (moartea celulară) în celule umane de melanom A375 şi G361 (Cabello şi col., 2009). DCPIP s-a dovedit a avea acţiune antiangiogeneză şi antiinflamatoare asupra celulelor canceroase umane de colon HCT116. Efectul acestuia este mai intens dacă este încapsulat în particule de poliacizi (lactic şi glicolic). Concentraţiile de ≥6 μg/ml de colorant (DCPIP) induc moartea celulară prin apoptoză (Mondalek şi col., 2010). Nanobiotehnologiile urmăresc nu numai crearea de nano-vehicule pentru transportarea diferitor substanţe, dar şi crearea şi manipularea unor adevărate nano-motoare, utile în nanomanipulare celulară. F1-ATP-aza este un veritabil nano-motor rotativ, a cărei mişcări pot fi controlate cu ajutorul unor stimuli optici şi chimici (Ristic şi col., 2009). Sisteme particulare capabile de transport ţintit şi eficient a diferitor substanţe, cu puţine efecte adverse, se datorează probabil endocitozei transportorilor. Nanoparticule cationice formate din lipide cationice şi polielectroliţi s-au dovedit a fi cărăuşi excelenţi pentru transportul amfotericinei B – un antifungicid pentru Candida albicans (Vieira şi Carmona-Ribeiro, 2008). Nanodiscurile de HDL (High Density Lipoprotein) sunt un strat bifosfolipidic cu aspect de disc (ND-HDL). Este cunoscut faptul că HDL este numit “colesterolul bun” deoarece este implicat în transportul moleculelor hidrofobe (colesterol) în fluxul sangvin care este un mediu hidrofil. Structura HDL (liporoteine cu densitate mare) este una simplă, fiind alcătuit din fosfolipide şi apolipoproteină (apo). Cea mai abundentă formă de lipoproteină din plasma sanguină umană este apoA-I, care este alcătuită din 243 de aminoacizi, este bine caracterizată şi la incubarea cu vezicule de fosfolipide în vitro formează HDL revers, capabil de transportul moleculelor hidrofobe (Ryan, 2010). Fosfolipidele cele mai frecvent utilizate pentru asamblarea veziculelor sunt DMPC (dimirisstoil-fosfatidil colina) şi DMPG (dimirisstoil-fosfatidil glicerol). Incubarea acestor vezicule cu apoA-I se autoasamblează ND-HDL. Aceste nano-discuri se pot autoasambla chiar dacă nu este utilizată enzima integrală, ci numai fragmente de apolipoproteine (Weers şi col., 2001). ND-HDL reprezintă astfel un mediu favorabil pentru studierea proteinelor transmembranare, transportul unor substanţe hidrofobe. 59

Stratul bilipidic este un mediu natural pentru proteinele transmembranare care îşi păstrează proprietăţile sale conformaţionale şi activitatea. Suprafaţa unui nanodisc cu diametrul de 20nm este de ~300 nm2, o suprafaţă suficientă pentru integrarea câtorva molecule proteice. Avantajul utilizării acestor structuri comparativ cu miceliile de detergenţi, este că asigură un mediu natural apropiat, fără prezenţa detergenţilor care pot schimba conformaţiile proteinelor. ND-HDL au fost utilizate în studierea a numeroase proteine transmembranare cum ar fi bacteriorodopsina (Bayburt ţi col., 2006; Blanchette şi col., 2008), citoromul p450 3A4 (Baas şi col., 2004), toxina antraxului (Katayama şi col., 2010), hidrogenaze enzime de membrană produse de Pyrococcus furiosus care pot sintetiza H2 (Baker şi col., 2009). ND-HDL au fost testate în utilizarea lor pentru transportul diferitor substanţe hidrofobe, care sunt insolubile în mediu sangvin hidrofil. Un exemplu în acest sens este transportul de către ND-HDL a amfotericinei B un potenţial antifungicid care inhibă creşterea Saccharomyces cerevisiae şi a altor fungi patogene, care administrat sub această formă nu mai este toxic la anumite concentraţii (Oda şi col., 2006). ND-HDL ce conţineau cucurmină (un polifenol hidrofob natural obţinut din Curcuma longa) au inhibat creşterea liniei celulare hepatice HepG2 comparativ cu administrarea curcuminei libere (Ghosh şi col., 2010). O altă aplicaţie a nanodiscurilor de HDL a fost încorporarea de lipide cu ioni bivalenţi de Ni2+, care au capacitatea de a fixa proteinele cu etichetă de 6-His (histidine). Proteina din învelişul virusului West Nile (Fischer şi col., 2010)

3. Bibliografie
1. Baas B. J., Denisov I. G., Sligar S. G., (2004). Homotropic cooperativity of monomeric cytochrome P450 3A4 în a nanoscale native bilayer environment, Archives of Biochemistry and Biophysics, 430(2), 218-28. Baker S. E., Hopkins R. C., Blanchette C. D., Walsworth V. L., Sumbad R., Fischer N. O., Kuhn E. A., Coleman M., Chromy B. A., Letant S. E., Hoeprich P. D., Adams M. W., Henderson P. T., (2009). Hydrogen production by a hyperthermophilic membrane-bound hydrogenase în water-soluble nanolipoprotein particles, Journal of the American Chemical Society, 131(22), 7508-7509. Baker P., Sawa Y., Shibata H., Sedelnikova S., Rice D., (1998). Analysis of the structure and substrate binding of Phormidium lapideum alanine dehydrogenase. Nature Structural Biology, 5, 561-67. Bayburt T. H., Grinkova Y. V., Sligar S. G., (2006). Assembly of single bacteriorhodopsin trimers în bilayer nanodiscs, Archives of Biochemistry and Biophysics, 450(2), 215-22. Blanchette C. D., Cappuccio J. A., Kuhn E. A., Segelke B. W., Benner W. H., Chromy B. A., Coleman M. A., Bench G., Hoeprich P. D., Sulchek T. A., (2008). Atomic force microscopy differentiates discrete size distributions between membrane protein

2.

3.

4.

5.

60

6.

7.

8. 9. 10.

11.

12. 13. 14.

15. 16.

17.

18.

19.

20. 21.

containing and empty nanolipoprotein particles, Biochimica et Biophysica Acta, 1788(3), 724-31. Boonstra B., Rathborne D. A., French C. E., Walker E. H., Bruce N. C., (2000). Cofactor regeneration by a soluble pyridine nucleotide transhydrogenase for biological production of hydromorphone. Applied Enviromental Microbiology, 66, 5161-66. Cabello C. M., Warner B. Bair W. B., Bause A. S., Wondrak G. T., (2009). Antimelanoma activity of the redox dye DCPIP (2,6-Dichlorophenolindophenol) is antagonized by NQO1, Biochemical Pharmacology, 78(4), 344-54. Chibata I., Tosa T., Sato T., (1976). Production of L-aspartic acid by microbial cells entrapped în polyacrylamide gels. Methods în Enzymology, 44, 739-746. Conde J., de la Fuente J. M., Baptista P. V., (2010). RNA quantification using gold nanoprobes - application to cancer diagnostics, Journal of Nanobiotechnology, 8:5. Deconttignies-Le Maréchal P., Calderon-Seguin R., Vandecasteele J.,P., Azerad R., (1979). Synthesis of L-tryptophan by immobilized Escherichia coli cells. European Jornal of Applied Microbiology and Biotechnology, 7, 33-44. Delforge D., Devreese B., Dieu M., Delaivre E., Beeumen J., Remacle J., (1997). Identification of lysine 74 în pyruvate bineding of alanine dehydrogenase from Bacillus subtilis. Journal of Biological Chemistry, 272, 2276-84. Ghosh M., Singh A. T., Xu W., Sulchek T., Gordon L. I., Ryan R. O., (2010). Curcumin nanodisks: formulation and characterization, Nanomedicine: Nanotechnology, Biology and Medicine, Honorat A., Monot F., Ballerini D., (1990). Synthesis of L-alanine and L-valine by enzyme system from Bacillus megaterium. Enzyme and Microbial Technology, 12, 515-20. Honorat-Pascal A., Monot F., Ballerini D., (1990). Coparative stady of the enzymatic synthesis of L-valine by purified enzymes, crude extract or permeabilized cells from Bacillus megaterium. Applied Microbiology and Biotechnology, 34, 236-41. Hummel W., Kula M-R., (1989). Dehydrogenases for the synthesis of chiral compounds. European Journal of Biochemistry, 184, 1-13. Fischer N.O., Infante E., Ishikawa T., Blanchette C.D., Bourne N., Hoeprich P.D., Mason P.W., (2010). Conjugation to nickel-chelating nanolipoprotein particles increases the potency and efficacy of subunit vaccines to prevent West Nile encephalitis, Bioconjugate Chemistry, 21(6), 1018-22. Fukui S., Ikeda S., Fujimura M., Yamada H., Kumagai H., (1974). Production of L-tryptophan, L-tyrosine and their analogues by immobilized tryptophanase and immobilized β-tyrosinase. European Journal of Applied Microbiology, 1, 25-39. Fusee M., Swann W., Calton G., (1981). Immobilization of Escherichia coli cells containing aspartase activity with polyurethane and its application for L-aspartic acid production. Applied Enviromental Microbiology, 42, 672-76. Fusee M., Weber J., (1984). Immobilization by polyurethane of Pseudomonas dacunhae cells containing L-aspartat β-decarboxylase activity and application to L-alanine production. Applied Enviromental Microbiology, 48, 694-98. Karsten W.E., Viola R.E., (1991). Kinetic studies of L-aspartase from Escherichia coli: pH-dependent activity changes. Archives of Biochemistry and Biophysics, 287, 60-67. Katayama H., Wang J., Tama F., Chollet L., Gogol E. P., Collier R. J., Fisher M. T., (2010). Three-dimensional structure of the anthrax toxin pore inserted into lipid nanodiscs and lipid vesicles, Proceedings of the National Academy of Sciences of the USA, 107(8), 3453-57.

61

22. Katoh R., Nagata S., Ozawa A., Ohshima T., Kamekura M., Misono H., (2003). Purification and characterization of leucine dehydrogenase from an alkaliphilic halophile, Natronobacterium magadii MS-3. Journal of Molecular Catalysis, 23, 231-38. 23. Mondalek F. G., Ponnurangam S., Govind J., Houchen C., Anant S., Pantazis P., Rama P Ramanujam R. P., (2010). Inhibition of angiogenesis- and inflammation-inducing factors în human colon cancer cells în vitro and în ovo by free and nanoparticle-encapsulated redox dye, DCPIP, Journal of Nanobiotechnology, 8:17, 1-9. 24. Monot F., Benoit Y., Lemal J., Honorat A., Ballerini D., (1988). Simultaneous production of amino acid dehydrogenase and glucose dehydrogenase by Bacillus megaterium and their utilization for L-valine synthesis with NADH regeneration. Biocatalysis, 2, 161-74. 25. Nagata S., Misono H., Nagasaki S., Esaki N., Tanaka H., Soda K., (1989). Thermostable alanine dehydrogenase of Bacillus sp.DSM730: gene cloning, purification, and characterization. Biochemistry, 71, 559-63. 26. Nagata S., Tanizawa K., Esaki N., Sakamoto Y., Ohshima T., Tanaka H., Soda K., (1988). Gene cloning and sequence determination of leucine dehydrogenase from Bacillus stearothermophilus and structural comparison with other NAD(P)+-dependent dehydrogenases. Biochemistry, 27, 9056-62. 27. Norbert M., Brunhuber W., Blanchard J.S., (1994). The biochemistry and enzymology of amino acids dehydrogenases. Critical Reviews în Biochemistry and Molecular Biology, 29, 415-67. 28. Oda M. N., Hargreaves P. L., Beckstead J. A., Redmond K. A., van Antwerpen R., Ryan R. O., (2006). Reconstituted high density lipoprotein enriched with the polyene antibiotic amphotericin B, Journal of Lipid Research, 47(2), 260-67. 29. Ohshima T., Nishida N., Bakthavatsalam S., Kataoka K., Takada H., Yoshimura T., Esaki N., Soda K., (1994). The purification, characterization, cloning and sequencing of the gene for a halostable and thermostable leucine dehydrogenase from Thermoactinomyces intermedius. European Journal of Biochemistry, 222, 305-12. 30. Ohshima T., Wandrey C., Conrad D., (1988). Continous production of 3-fluoro-L-alanine with alanine dehydrogenase. Biotechnology and Bioengineering, 34, 394-97. 31. Ohshima T., Wandrey C., Kula M-R., Soda K., (1985). Impovement for L-leucine production în a continously operated enzyme membrane reactor. Biotechnology and Bioengineering, 26, 1616-18. 32. Oka M., Yang Y.S., Nagata S., Esaki N., Tanaka H., Soda K., (1989). Overproduction of thermostable leucine dehydrogenase of Bacillus stearothermophilus and its one-step purification from recombinant cells of Escherichia coli. Biotchnology and Applied Biochemestry, 11, 307-11. 33. Patra H.K., Banerjee S., Chaudhuri U., Lahiri P., Dasgupta A., (2007). Cell selective response to gold nanoparticles, Nanomedicine: Nanotechnology, Biology, and Medicine, 3, 111–19 34. Ristic Z., Vitali M., Duci A., Goetze C., Kemnitz K., Zuschratter W., LillH., Bald D., (2009). Two-stimuli manipulation of a biological motor, Journal of Nanobiotechnology, 7:3. 35. Ryan R. O., (2010). Nanobiotechnology applications of reconstituted high density lipoprotein, Journal of Nanobiotechnology, 8:28. 36. Schütte H., Flossdorf J., Sahm H., Kul, M. R., (1976). Purification and properties of formaldehyde dehydrogenase and fromate dehydrogenase from Candida boidinii. European Journal of Biochemistry, 62, 151.

62

37. Siranosian J.K., Ireton, K., Grossamn D.A., (1993). Alanine dehydrogenase (ald) is required for normal sporulation în Bacillus subtilis. Journal of Bacteriology. 175, 6789-96. 38. Sondi I., and Salopek-Sondi B., (2004). Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria, Journal of Colloid and Interface Science, 275, 177–82. 39. Speshock J. L., Murdock R. C., Braydich-Stolle L. K., Schrand A. M., Hussain S. M., (2010). Interaction of silver nanoparticles with Tacaribe virus, Journal of Nanobiotechnology, 8:19. 40. Tosa T., Sato T., Mori T., Chibata I., (1974). Basic studies for continous production of L-aspartic acid by immobilized Escherichia coli Cells. Applied Microbiology, 27, 886-89. 41. Vieira D. B., and Carmona-Ribeiro A. M., (2008) Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity în vitro, Journal of Nanobiotechnology, 6:6. 42. Weers P. M., Narayanaswami V., Ryan R. O., (2001). Modulation of the lipid binding properties of the N-terminal domain of human apolipoprotein E3, European Journal of Biochemistry, 268, 3728-35.

63

II. CULTURI CELULARE Culturi celulare
Lect. dr. Mircea Teodor Chiriac Cuprins
1. Prezentarea principiului tehnicii experimentale .................................................... 64 2. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu ............. 67 3. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente .................................................. 71 3.1. Echiparea laboratorului de culturi celulare ..................................................... 71 3.2. Strategii de lucru ............................................................................................ 74 3.3. Instruirea personalului ................................................................................... 75 3.4. Cultivarea celulelor ......................................................................................... 78 3.5. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora .......................................................................................... 78 3.6. Îngheţarea şi dezgheţarea celuluor .................................................................. 79 3.7. Subclonarea; tripsinizarea............................................................................... 81 4. Bibliografie ............................................................................................................. 81

1. Prezentarea principiului tehnicii experimentale
Multe dintre tehnicile introduse la un moment dat în diferite ştiinţe au revoluţionat felul în care acea ştiinţă a fost percepută ulterior. Culturile celulare sunt un asemenea exemplu în biologie. Introducerea acestei tehnici în urmă cu aproximativ 100 de ani a permis practic importul naturii în laborator, ceea ce a dus la standardizarea tehnicilor şi generalizarea strategiilor de studiu între cercetătorii din diverse instituţii, urmată de o explozie informaţională în lumea biologică. Avansarea cunoaşterii bio-medicale din ultimele decenii nu ar fi fost posibilă fără dezvoltarea printre altele a metodelor de lucru cu celulele. Cercetarea bio-medicală actuală foloseşte tehnicile de lucru cu celulele pentru investigarea unor probleme din domenii ca: biofizica, biochimie, biologie celulară şi moleculară, genetica, biologia dezvoltării organismelor, evolutionism, medicina moleculară, farmacologia, bio-nano-tehnologia, inteligent drug design etc. 64

studii de genomică. Avansarea cercetării din domeniul celulelor stem şi lucrul cu celulele embrionare face posibilă. cancere şi altele. Aceasta include şi cultivarea unor embrioni întregi. . secundare şi imortale/canceroase Proprietăţi Inhibiţia de contact1 Fenotipul faţă de situaţia in vivo Genotipul faţă de situaţia in vivo Necesarul factorilor de creştere Diferenţiate Număr de diviziuni Timp necesar cultivării Reproductibilitatea rezultatelor 1 primare da identic identic crescut da 2-3 crescut scăzută secundare da asemănător identic crescut da <100 scăzut crescută imortale/canceroase unele/nu asemănător/rotunde asemănător/diferit crescut/limitat da/nediferenţiate nelimitat scăzut crescută în mod normal. anticorpi monoclonali folosiţi în cercetare şi clinica medicală.cultura de celule . Tabel 1. metabolism.Este practic de neimaginat desfăşurarea activităţii într-un centru de cercetare bio-medical lipsit de laboratorul de culturi celulare. cultivarea organelor şi ţesuturilor cu aplicaţii în bolile cronice degenerative. 65 .cultura de organe . celulele pot fi folosite ca şi model pentru studiul răspunsurilor fiziologice la diferiţi factori de stres din mediu.cultura de ţesuturi . Celulele canceroase pierd această caracteristică fenotipică şi după ce ajung să fie confluente încep să crească una peste cealaltă formând ghemuri de celule uşor de distins la microscopul optic.presupune prelevarea unor ţesuturi şi digestia lor pentru obţinerea unei suspensii unicelulare care este apoi cultivată mai departe. hormoni. există trei tipuri de celule animale care sunt cultivate în laborator: primare. testarea agenţilor anticanceroşi. Într-un sens mai larg. interferoni.presupune prelevarea şi cultivarea unui organ în totalitate. Pe de altă parte. Din punct de vedere al tipului de cultură se poate vorbi despre: . secundare şi imortalizate (tabel 1). Aplicaţii curente sunt legate de: folosirea culturilor celulare pentru elaborarea vaccinurilor. eritropoietina). deocamdată teoretic. . moment în care îşi opresc creşterea. apoptoză. Dacă ne referim la cultura de celule. celulele cresc în vasul de cultură până când stabilesc contact cu vecinele lor.presupune prelevarea unor fragmente de ţesuturi şi cultivarea lor. producţia glico-proteinelor recombinante (cytokine. Caracteristicile celulelor primare. cultura celulară poate cuprinde cultura ţesuturilor şi organelor.

Este posibil ca celulele să formeze aderenţe între ele dar de obicei acestea sunt de o mică intensitate. După cum se poate observa din tabelul 1. Pe de altă parte. Cultivarea celulelor provenite din piele (keratinocite. aceste celule acumulează anumite caracteristici fenotipice care le fac să devină o linie celulară distinctă. celulele canceroase au unele proprietăţi care le diferenţiază de celelalte celule imortale necancreoase: nu mai prezintă inhibiţia de contact. Aceste celule vor creşte aderente de suprafaţa vasului de cultură. evitarea confluenţei care poate avea ca rezultat inhibarea creşterii.Culturi primare Majoritatea celulelor din culturile primare necesită ancoraj. cultivarea celulelor prelevate din sângele periferic se face într-o manieră care nu necesită ancorarea acestora de pereţii vasului de cultură. 66 . cu alte cuvinte transplantarea lor la animalele de laborator este urmată de apariţia tumorilor la acestea. Unele dintre aceste celule imortale (transformate) pot avea caracter oncogenic. îndepărtarea celulelor moarte şi a produşilor de metabolism celular şi adăugarea substanţelor nutritive. Pentru a le separa de acesta şi pentru separarea celulelor unele de altele se folosesc de obicei enzime proteolitice (tripsina). Diferite substanţe (factori de creştere ai diferitelor populaţii leucocitare şi/sau mitogeni – substanţe care stimulează mitoza) pot fi utilizate pentru diferenţierea şi înmulţirea celulelor în cultură. Aceste celule pot apărea ca urmare a unor modificări (transformări) la nivelul cromozomului prin factori chimici. Celulele dintr-o cultură secundară pot parcurge până la 100 de diviziuni înainte de a-şi pierde potenţialul proliferativ. subcultura are ca scop menţinerea celulelor în faza logaritmică de creştere. Deşi nu prezintă alterări ale setului de cromozomi (karyotipului). pot creşte cu mai puţini nutrienţi etc. Pe lângă derivarea culturilor secundare. Culturi de celule imortalizate Este posibil ca unele celule din culturile secundare să sufere anumite transformări care le conferă caracterul de imortalitate adică posibilitatea de a se divide la nesfârşit. fibroblaste) se face prin biopsierea ţesutului şi formarea unei suspensii unicelulare. fizici (radiaţii) sau biologici (virusurile oncogene). Culturi secundare Prin subcultivarea celulelor dintr-o cultură primară se pot obţine aşa-numitele culturi secundare.

Prin diferite metode de screening se pot găsi aceste celule care sunt ulterior subclonate dând naştere astfel unor linii celulare pure şi stabile are produc anticorpii monoclonali. traficului de membrană. agenţilor anticanceroşi etc. enzimelor. diferenţierii. celulele animale sunt deosebit de utile în testarea citotoxicităţii diferitelor substanţe incluzând noile terapii anticanceroase. Pe scurt tehnica presupune imunizarea unui animal de experienţă cu un antigen şi recoltarea celulelor B (cele care produc anticorpii) la un anumit interval de timp după imunizare (figura 1). În 1975 cei doi cercetători au publicat rezultatele prin care pot fi obtinuţi anticorpii monoclonali. Anticorpii monoclonali Una dintre aplicaţtiile culturilor celulare cu cel mai mare impact pentru societate la ora actuală este reprezentată de tehnologia de obţinere a anticorpilor monoclonali prin folosirea hibridoamelor.2. dezvoltarea în ultimii ani a cunoştinţelor şi tehnologiei de lucru cu celulele stem constituie una dintre temele cele mai actuale în domeniul biomedical. Este de aşteptat ca acest domeniu să revoluţioneze tratamentul diferitelor afecţiuni. eritropoietina). prin folosirea tehnologiei AND-ului recombinat este posibilă crearea celulelor transgene care constituie per se un model de studiu pentru investigarea metabolismului energetic. Nu în ultimul rând. anticorpilor monoclonali şi altor substanţe imunomodulatoare (interferoni. În plus. Aceste celule sunt fuzionate apoi în prezenţa poli-etilen-glicolului (PEG) cu o linie celulară canceroasă de mielom (cancer al plasmocitelor). ciclului celular. factorilor de coagulare. anticorpii monoclonali şi-au găsit foarte rapid aplicaţii în domenii variate cum ar fi: diagnosticul şi trata67 . În urma acestei fuziuni. antirabic). Această tehnologie a fost pusă la punct de către Milstein şi Koehler în urma cu aproape patru decenii. antiparotidita epidemică. îmbătrânirii şi apoptozei. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Aplicaţiile culturilor celulare îşi găsesc utilitatea în producerea: vaccinurilor (antirubeolic. hormonilor şi factorilor de creştere (insulina. Datorită specificităţii deosebit de mari (se consideră că un anticorp poate distinge antigenul pereche între 108 molecule). Mai mult. se formează celule hibrid (de unde şi numele de hibridoame) dintre care unele produc anticorpii cu specificitatea dorită (caracter dobândit de la celula B a animalului imunizat) într-o manieră continuă (dobândind caracterul imortal de la celulele de mielom). interleukine). antivaricela.

Folosirea terapeutică a anticorpilor monoclonali în diferite afecţiuni umane urmează două direcţii: markeri diagnostici care pot identifica diferite tipuri de antigene din populaţii celulare in vivo şi terapia ţintită a diferitelor afecţiuni în care anticorpului monoclonal îi sunt ataşate substanţe chimice toxice sau radioactive. Urmează apoi subclonarea realizată prin diluarea celulelor din coloniile producătoare în aşa fel încât fiecare 68 . Celulele B sunt izolate şi combinate cu mieloamele (partea stângă) în prezenţa PEG care mediază fuziunea celulelor.mentul clinic. Celulele hibrid sunt singurele care vor supravieţui în mediul suplimentat cu Hypoxanthine Aminopterin Thymidine (HAT). Screeningul face posibilă identificarea coloniilor care produc anticorpi faţă de antigenul dorit. catalizatori ai reacţiilor chimice (abzymes). antigen PEG HAT Screening Subclonare Linie celulară producatoare de anticorp monoclonal Figura 1 Producerea anticorpilor monoclonali Splina este izolată la câteva saptămâni (timp necesar pentru îmbogăţirea repertoriului de celule B specifice) după imunizarea animalului cu antigenul faţă de care se doreşte producerea anticorpilor monoclonali. cercetare fundamentală şi aplicată (metode de izolare a diferitelor substanţe recunoscute).

anticorpii de şoarece au fost umanizaţi. După sursa de provenienţă există două tipuri de celule stem: celule stem embrionare şi celule stem adulte. Deşi cercetarea în acest domeniu este relativ la început. Această abordare a permis medicilor oncologi să obţină rezultate spectaculoase în diferite forme de cancere. multipotente. Din acest motiv. O schiţă a diferenţierii celulare se găseşte în figura 2. Există la ora actuală şi peste 30 de anticorpi monoclonali folosiţi ca şi agenti terapeutici în diferite afecţiuni umane. anticorpii monoclonali produşi în şoarece prezintă neajunsul de a fi străini organismului uman. Cele mai bine studiate celule stem sunt cele derivate din măduva osoasă şi care constituie precursorii tuturor celulelor din sânge.recipient să conţină teoretic o singură celulă. Se obţin în acest fel colonii în care toate celule provin dintr-o singură celulă mamă şi deci vor produce acelaşi anticorp ca şi aceasta. numărul celor aflaţi în diferite stadii de testare depăşeşte 100. Se poate vorbi la ora actuală de cancere tratate cu anticorpi monoclonali în care pacienţii supravieţuiesc fără recidivă la 30 de ani de la administrarea terapiei. Celule stem Următorul pas în revoluţia din domeniul biomedical a fost reprezentat de posibilitatea cultivării celulelor stem în laborator. Ajunşi în organism aceşti anticorpi ca orice altă substanţă străină iniţiază un răspuns imun din partea gazdei care se poate manifesta prin secreţia de anticorpi umani anti-anticorpi monoclonali de şoarece. celule stem pot fi clasificate în: totipotente. cercetătorii au reuşit să izoleze şi cultive cu succes 69 . pluripotente. După numărul de precursori ai liniilor diferenţiate pe care le poate produce. în ultimii ani. Cu timpul anticorpii umani pot neutraliza şi distruge anticorpii monoclonali injectaţi anulându-le efectele terapeutice. Prin definiţie celulele stem sunt acele celule care prin diviziune dau naştere unei celule fiică identică şi unei alte celule care poate fi diferită. oligopotente. După cum implică numele. Aceste celule sunt reprezentate de către ovulul fertilizat şi celulele obţinute din primele diviziuni ale acestuia. Deşi nu sunt toxici. celulele totipotente sunt capabile să formeze un organism în totalitate. Tehnologia ADN-ului recombinat a făcut posibilă ataşarea părţii specifice (cea care recunoaşte antigenul) derivată de la şoarece cu un braţ constant (care consituie cea mai mare parte) de la om. Interesul major pentru biologia celulelor stem este explicat de potenţialul de diferenţiere al acestora în orice tip de ţesuturi şi organele dintr-un organism.

Pe lângă potenţialul terapeutic enorm. Se pot produce astfel animale „chimera” care exprimă genele implantate în diferite organe. celulele stem prezintă şi aplicaţii diagnostice. tehnologia cultivării celulelor stem embrionare este puternic îngrădită de normele actuale ale eticii cercetării. Este posibil ca una dintre cele opt celule ale embrionului rezultat în urma fertilizării in vitro a unui ovul să fie îndepărtată şi analizată din punct de vedere genetic (celula este dispensabilă deoarece restul celulelor rămase refac embrionul). Deşi deosebit de atractivă. Dacă aceste organe sunt chiar gonadele. În urma analizelor care pot să depisteze diferite defecte genetice se poate decide neimplantarea embrionului în uterul viitoarei mame. Celula stem Pluripotentă Celula stem Multipotentă Celula stem cu potenţial limitat Celula diferenţiată Parţial Celula diferenţiată final. atunci urmaşii unei împerecheri dintre doi astfel de şoareci chimera pot produce un knock-out/knock-in pentru acea genă.anumite celule stem din diferite surse unele dintre ele fiind apoi diferenţiate în numeroase celule finale. Folosirea acestor celule face posibilă şi obţinerea animalelor modificate genetic prin introducerea unor gene în embrionul tânăr. postmitotică Figura 2 Celulele stem pot da nastere unui numar mare de celule diferentiate final 70 .

71 . aranjarea spaţiului de lucru este descrisă în figura 4. Această nouă descoperire pune sub semnul întrebării principiile actuale care stau la baza tratamentului cancerului. Recent au fost descrise şi celule stem canceroase. tehnica asepteică (prezentate în cele ce urmează) şi experienţa personală a operatorului care contribuie decisiv la primele trei. în funcţie de tipul de celulp.Disputele asupra aspectelor etice ale lucrului cu celule stem embrionare au încurajat dezvoltarea tehnicilor de lucru cu celulele stem adulte. Echiparea laboratorului de culturi celulare Organizarea generală a laboratorului de culturi celulare include următoarele echipamente de bază (figura 3): a. Succesul în lucrul cu celule depinde de factori variaţi cum ar fi: utilarea laboratorului. calitatea celulelor şi a reactivilor. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente 3. Experimental s-a dovedit că un număr de doar 200 de celule considerate ca fiind celule stem canceroase este suficient pentru a transfera cancerul de la un animal la un altul în timp ce un număr de câteva sute de ori mai mare de celule canceroase care nu prezintă caracteristicile celulelor stem sunt incapabile să transfere boala.1. Existenţa acestor celule canceroase stem poate explica apariţia recidivelor prin participarea unui număr redus de celule care nu pot fi distinse/distruse prin tehnicile actuale. Incubator cu sursa de CO2 • creşterea celulelor. Rămâne de văzut dacă potenţialul unor astfel de celule stem adulte este la fel de nelimitat ca şi al celor embrionare. Hota cu flux laminar • Serveşte lucrului efectiv cu celulele. • este prevazută în mod obligatoriu cu o lampă de UV care va fi pornită 5-10 minute înainte de începerea lucrului şi repornită pentru 5-10 minute după încheierea lucrului. 3. concentraţia de CO2 este în general ajustată între 5% şi 7% pentru a obţine un sistem tampon optimal în combinaţie cu substanţele din mediul de cultură. • tipul de hotă folosită pe scară largă în cultura celulelor animale este hota cu flux de aer vertical care oferă o protecţie bună atât pentru celule cât şi pentru operator. b.

manuşi. Recipient cu azot lichid • stocarea celulelor pe termen lung.) (medii cultură. Microscop optic inversat cu contrast de fază (opţional aparat foto) • serveşte la observarea celulelor. Centrifuga de masă cu răcire • centrifugarea suspensiilor de celule în diverse scopuri. d. de obicei se găseşte într-o incintă anexată. de aceea este necesară utilizarea echipamentului de protecţie (ochelari/mască facială. stocuri de antibiotice. • deoarece în cultura de celule animale.• responsabil pentru menţinerea unei atmosfere sterile (filtre HEPA. Frigider/congelator • stocarea reactivilor L-glutamina etc. • o precauţie deosebită trebuie acordată faptului că recipientul este extrem de rece (-196 grade Celsisus) şi azotul poate produce arsuri în urma contactului cu pielea sau mucoasele. c. stabilitate în timp. economisirea consumului de energie. • 72 . Pompa de vid şi sisteme de sterilfiltrare o pentru lichidele instabile la autoclavare (de ex. Alte componente • Baie de apă o păstrarea mediilor şi altor reactivi la temperatura de 37 grade Celsius. igienizare uşoară. o o alternativă este înlocuirea apei cu perle metalice care prezintă următoarele avantaje: reducerea contaminării reactivilor cu care vin în contact. • Autoclav şi sterilzor cu aer uscat o Folosite pentru sterilizarea diferitelor soluţii şi recipiente folosite. • contrastul de fază îmbunătăţeşte vizualizarea specimenelor transparente (celulelor). e. f. high efficiency particulate air). umede şi cu temperatura constantă. celulele sunt în general situate pe suprafaţa bazei recipientului se foloseşte microscopul inversat. DMSO) se poate folosi şi ca sistem de aspirare a mediilor folosite. halat).

73 . Organizarea laboratorului de culturi celulare Consumabile • pipete serologice. pot fi din plastic (de unică folosinţă) sau din sticlă (refolosibile după sterilizare). • vase de cultură .codate în funcţie de aria utilă de cultivare şi de volumul maxim de mediu care poate fi conţinut.Figura 3. • medii de cultură (multe celule pot fi cultivate în DMEM/RPMI+10%FBS la care se adaugă diferite concentraţii de L-glutamina şi antibiotice).

Compoziţia mediilor de cultură este complexă incluzând: aminoacizi.de unde şi numele de fetal bovine serum (FBS). accesul personalului în această cameră va fi restricţionat pe cât posibil. factori de creştere şi alte componente. toate acestea trebuie adaptate liniilor celulare cu care urmează a se lucra în laborator. • suplimente pentru mediile de cultură: antibiotice – uzual se foloseşte un ameste de penicilină/streptomicină. Cele mai multe medii conţin şi phenol red. • toate mediile şi suplimentele care urmează a fi folosite în cultura celulară trebuie să fie certificate pentru lucrul pe culturi de celule (indicaţia cell culture certified/approved trebuie să apară pe ambalaj/descrierea produsului).4. La ora actuală. de aceea încăperile vor fi semnalizate corespunzător.Conologic se poate vorbi de existenţa a două categorii de medii. Mediile de cultură sunt soluţii saline tamponate.2.Strategii de lucru Din punct de vedere tehnic. 3. Este de dorit ca această încapere să fie oarecum izolată faţă de restul laboratoarelor pentru a limita riscul de contaminare. hormoni. bicarbonat. microelemente. există riscul contaminării cu diferite microorganisme care datorită ratei 74 . cu unele excepţii serul este considerat un component de bază. Dacă acesta virează spre galben indicând un mediu acid este cazul ca mediul să fie schimbat. carbohidraţi. acizi graşi. serul provine de la animale mari. glucoză şi altele în funcţie de particularităţile experimentului. există câteva principii de bază ale lucrului cu celulele: • culturile celulare vor fi făcute într-o cameră dedicată acestui scop. Na-pyruvat. în general de la vacă . Chiar dacă este vorba de un mediu sintetic. celulele animale sunt pretenţioase în ceea ce priveşte condiţiile în care pot sa crească. L-glutamină. • acele încăperi care sunt dedicate lucrului cu celule prezintă risc infecţios pentru cei implicaţi. de aceea se va permite doar accesul celor care sunt direct implicaţi în procesul de lucru cu celulule. cele naturale care includ serul sanguin şi alte secreţii de origine animală şi medii sintetice în care componentele de bază sunt produse separat şi apoi amestecate de obicei de către firme specializate. săruri. vitamine. • spre deosebire de celulele vegetale şi bacterii. un indicator al pH-ului care trebuie să rămână între 7 şi 7. • personalul care urmează să lucreze cu celulele va fi instruit corespunzător (vezi mai jos). Tot din acest motiv.

creşterea celulelor animale urmează o curbă cu trei faze: o faza de echilibrare (primele 24h) în care celulele se acomodează cu noul mediu în care sunt introduse. celulele animale sunt limitate în ceea ce priveşte numărul de generaţii pe care le produc. o imediat după adăugarea suplimentelor în mediile de cultură se notează acest fapt pe recipientul respectiv.3. o faza de creştere exponenţială care durează în jur de 7-10 zile. Instruirea personalului Cultivarea celulelor este un lucru care se poate învaţa repede. o nimic din ceea ce vine în contact direct cu celulele nu se deschide în afara hotei sterile. lucrul bine organizat şi desfăşurat fără grabă este esenţial pentru o eficienţă maximă: o mişcările vor fi măsurate şi sigure. fie la 37 grade Celsius (10-20 min e suficient.. oricine poate învaţa să menţină culturile de celule după doar câteva zile petrecute în laborator dacă respectă protocoalele şi are la dispoziţie echipamentul necesar. şi o concentraţie a CO2 între 5 şi 7% condiţionează clutura celulelor animale (sistemul de tampon cel mai frecvent utilizat este cel cu bicarbonat de sodiu sau potasiu din mediul de cultură + CO2 din incubatorul folosit). Odată aparută. se poate porni un cronometru pentru a evita „uitarea” mediilor pentru un timp îndelungat şi degradarea lor (L-glutamina. o faza de inhibare a creşterii datorită inhibiţiei de contact. tripsina). osmolaritatea (290-310mOsm). pH-ul. Cu alte cuvinte.• • • • de creştere mult superioară celulelor animale vor deveni majoritare în scurt timp. Singurul lucru care este şi mai uşor şi nici măcar nu necesită învatare este să contaminezi celulele. 3. celulele animale se vor opri din creştere după un număr de generaţii care depinde de sursa primară a celulelor. înainte de scoaterea din hotă se verifică etanşeitatea închiderii. scăderii potenţialului de metabolizare a mediului. contaminarea se poate propaga din aproape în aproape şi duce în final la compromiterea nu doar a celulelor la care contaminarea a fost iniţial sem75 . De aceea desfăşurarea activităţii în linişte este esenţială în laboratorul de culturi celulare. substanţele pot fi preîncălzite fie la 22. în plus factori ca spre exemplu temperatura (37 de grade Celsius pentru celule mamifere). creşterii densităţii peste un nivel critic. Chiar şi în condiţii optime.

Toţi cei care urmează să lucreze cu celule vor fi în prealabil instruiţi teoretic înainte de a pătrunde pentru prima dată în laborator. recipient etc. 2 Excepţie fac pipetele de sticlă care pot fi spălate şi sterilizate.pentru evitarea contaminării celulelor şi operatorului: o halat cu mâneci lungi o pantofi închişi o mănuşi de unică folosinţă • Spălatul pe mâini înainte şi după lucrul cu celulele. Doar după această perioadă este permis lucrul direct. antibioticele care acţionează în interiorul organismului şi de asemenea dezinfectantele care distrug microorganismele aflate pe suprafeţele neaparţinând fiinţelor vii. nu este permisă păstrarea pipetei în mediu sau folosirea unei pipete pentru a transfera mediu de la un recipient la altul. Chiar şi după câştigarea independenţei în lucru. 3 Este vorba despre acele medii/suplimente/alte substanţe care nu mai pot fi sterilizate (fie prin sterilfiltrare fie prin autoclavare) şi respectiv obiecte care nu mai pot fi sterilizate. mai întâi sub supravegherea directă a celor familiarizaţi şi mai apoi în mod independent. 76 . cel proaspăt iniţiat va fi supravegheat din umbră de către un coleg cu experienţă care ar putea observa anumite manopere executate neconform cu normele curente. Practic. • O soluţie antimicrobiană1 de ethanol 70% trebuie să fie în permaneţă la îndemână. 1 În categoria substanţelor cu efect antimicrobian sunt incluse alături de antisepticele aplicate pe ţesuturi vii.nalată ci a întregului stoc de celule. • Instrumentele de lucru trebuie igienizate la intervale regulate. • Orice mediu sau obiect contaminat din greşeală va fi aruncat3. Pe lângă considerentele financiare. • Orice pipetă trebuie folosită o singură dată2.) care urmează să fie introdus în hota pentru lucrul steril trebuie dezinfectat înainte sau imediat după introducere. • Orice lichid care ajunge în contact cu suprafaţa de lucru sterilă va fi îndepărtat imediat cu ajutorul unui prosop de hârtie îmbibat în ethanol 70%. contaminarea recipientelor cu conţinut original (celule produse în laborator şi care nu pot fi achiziţionate de la companiile specializate sau transferate de la alţi investigatori) reprezintă cel mai neplăcut aspect care poate afecta un laborator de culturi celulare. ei vor începe prin a observa manoperele de lucru şi a le discuta cu un coleg familiarizat deja cu tehnicile. Asigurarea asepsiei şi antisepsiei Există anumite măsuri care asigură igiena în lucrul cu celulele: • Utilizarea echipamentului de protecţie . Orice obiect (pipeta.

Figura nu este la scală. Se pot astfel observa caracteristicile normale sau abateri de la acestea. aşa cum este ea întalnită în mod frecvent în majoritatea laboratoarelor. Se pot lua probe care sunt analizate pentru stabilirea prin diferite tehnici a gradului de puritate/contaminare. Linia din faţă: Dreapta – pipeta/pompa aspirare medii prevazută la capăt cu pipetă de unică folosinţă Centru – recipientul cu celule În plan posterior: Stânga – vasele cu resturi lichide şi respeciv solide etichetate corespunzător 77 . Figura corespunde pentru persoanele care folosesc cu precădere mâna dreaptă. Se pot de asemenea observa contaminări cu alte celule sau microorganisme. Organizarea spaţiului pentru lucrul steril Pentru reducerea la maxim a pericolului de contaminare este esenţială aranjarea locului de muncă sub hotă într-un mod care să evite încrucişarea mâinilor deasupra vaselor de cultură/mediilor. WASTE Figura 4 . Organizarea spaţiului de lucru steril Figura prezintă organizarea de bază a spaţiului.• Este necesară investigarea stării de sănătate a celulelor în fiecare zi. Pentru organizarea eficientă a „mesei” de lucru se poate consulta figura 4. Trebuie evitată supraîncărcarea spaţiului de lucru care poate duce pe de o parte la blocarea fluxului de aer şi pe de altă parte la accidente nedorite care pot produce contaminarea celulelor sau reactivilor.

această procedură care se aplică în faza logaritmică de creştere a celulelor permite obţinerea unor cantităţi crescute de celule prin împărţirea/transferul acestora dintr-un recipient de cultură în mai multe recipiente fiecare reprezentând o nouă sursă de celule. celulele eucariote pot fi împarţite în două mari categorii: cele care cresc aderent pe vasul de cultură şi cele care cresc în suspensie. se recomandă ca celulele să fie subcultivate. evaluarea celulelor se face în mod normal în fiecare zi prin vizualizarea lor sub microscopul optic. o evaluare de primă instanţă a celulelor se realizează prin vizualizarea macroscopică a culorii mediului din sticlele de cultură. Mediul de 78 . o culoare care virează spre galben indică necesitatea schimbării mediului. Separarea prin centrifugare a celulelor din mediul de cultură şi stabilirea viabilităţii acestora Pentru a subcultiva celulele/folosi celulele într-un anumit protocol este nevoie de stabilirea numărului de celule pe unitatea de volum.4.Dreapta – mediile de cultură Centru. 3.pipete serologice de diferite mărimi. starea de sănătate a celulelor este confirmată şi de creşterea numărului de la o zi la alta. culoarea standard a mediilor este roşu-orange. celulele care cresc aderent trebuie să apară distribuite pe suprafaţa de contact cu vasul în care cresc şi de cele mai multe ori capătă o formă poligonală. există anumite formule de calcul care permit aflarea cu precizie a combinaţiilor optime. Modul de lucru este asemănător pentru toate celulele dar există anumite particularităţi de care trebuie ţinut cont în cazul fiecărei grupe. Cultivarea celulelor • după felul în care cresc în flacoanele de cultură.5. în anumite situaţii este nevoie de utilizarea unor soluţii de tripsina/EDTA pentru crearea suspensiilor unicelulare (vezi Tripsinizarea). subcultivarea celulelor: deoarece aglomerarea celulară poate influenţa negativ vitalitatea celulelor (a se vedea mai sus). de asemenea se pot planifica în acest fel anumite experimente pentru anumite date. iar celulele care cresc în suspensie rămân rotunde şi uneori (în funcţie de linia cultivată) pot forma aglomerări de celule (asemănător cu o ciorchină de struguri). flacon cu ethanol 70%. • • • 3.suport pentru tuburi În afara hotei la îndemană .

5% şi pipetate în camera de numărat.cultură conţinând celulele este transferat unor tuburi în care se centrifughează (centrifuga trebuie echilibrată în prealabil . Îngheţarea şi dezgheţarea celuluor Doi paşi critici ai lucrului cu celulele sunt constituiţi de către îngheţarea şi dezgheţarea celulelor. În funcţie de tipul camerei de numărăt. De aceea cea mai sigură metodă de prezervare a liniilor celulare este cryoprezervarea care opreşte procesele metabolice nelăsând astfel loc modificărilor genotipului. Soluţia de trypan blue va pătrunde în celulele moarte care apar albastre. există formule de calcul după care putem să aflăm numărul total de celule.dacă avem un singur tub cu celule va trebui să folosim un al doilea tub cu aceeaşi greutate care poate să conţină apă distilată sau orice alt lichid cu densitate asemănătoare). leucocitele apar ca şi celule gălbui/transparente cu o membrană brună. Celulele vor sedimenta ca şi în figura 5. Pentru o separare bună este nevoie de 10 minute la 200-250g/min (într-o centrifugă de masă cu rotor standard 1000rpm). cryoconservarea este o metodă practică din punct de vedere economic: este mult mai simplu să păstrezi un tub cu celule îngheţate care nu au nevoie decât de o completare periodică a rezervei de azot decât să cultivi în mod repetat celulele în laborator. de aseme79 . • În plus. Sub microscopul optic. Îngheţarea este indispensabilă din următoarele considerente: • Celulele sunt supuse în permanenţă variaţiilor în compoziţia cromozomilor.6. Figura 5 . Aspectul celulelor în tub după centrifugare 3. O viabilitate de peste 90-95% este în general acceptată pentru toate manipulările ulterioare. După centrifugare celulele se resuspendă în mediu proaspăt şi apoi 10 microlitri sunt combinaţi cu 10 microlitri de soluţie Trypan blue 0.

după care se poate adăuga mai rapid mediu până la 10ml. pe gheaţa uscată. Există linii celulare la care se preferă folosirea altor substanţe în locul DMSO.nea transportul între laboratoare este mai uşor dacă celulele sunt îngheţate. Se centrifughează în general la 200rpm timp de 2-5 min pentru a elimina urmele mediului de îngheţare. 4 5 80 . După centrifugarea şi verificarea vitalităţii (se recomandă folosirea celulelor vitale în proporţie de >90-95% la colorarea cu trypan blue). Se resuspendă în 10 ml de mediu şi se transfera în sticlele de culturp etichetate. Mediul de îngheţare5 cel mai frecvent folosit conţine mediul de cultură recomandat pentru linia celulară + 20% FCS + 5-10% cryoprotector -Dimethyl sulfoxid (DMSO) sau 10-15% glycerol care are rolul de a scădea temperatura de îngheţ permiţând apei să iasă din celulă şi împiedicând astfel formarea cristalelor de gheaţă care ar putea distruge membrana. Odată ce dezgheţarea permite pipetarea suspensiei (>75% dezgheţată) aceasta se transferă într-un tub de 15ml peste care se adaugă picătură cu picătură8 o cantitate de mediu preîncălzit echivalentă cu de două-trei ori cantitatea suspensiei. Urmează apoi transferul peste noapte la -80 de grade Celsius şi apoi stocarea de lungă durată în azot lichid. Prin mişcări fine se distribuie celulele. 6 Numărul de celule/aliquot variază În funcţie de tipul de celule. De aceea trebuie limitat contactul acestuia cu celulele. Mediul va fi schimbat pentru a înlătura celulele moarte şi resturile de cryoprotector (DMSO – sterilfiltrat sau glycelor . Îngheţarea4 va fi lentă şi constantă pentru a minimaliza efectele adverse asupra viabilităţii celulelor.autoclavat). numărul de pasaj şi data la care a fost creat stocul. este important să avem o suspensie omogenă unicelulară. la îngheţare apa iese din celule unde presiunea osmotică va creşte. 8 Pentru a preveni socul osmotic. Dezgheţarea celulelor trebuie făcută extrem de rapid (ideal în mai puţin de un minut) prin transferul acestora din recipientul cu azot. După câteva ore (cel târziu a doua zi dimineaţa) se verifică starea celulelor prin vizualizarea la microscop. • Nu în ultimul rând. numărul de celule. Este esenţial ca înainte de începerea procedurii respective să notăm următoarele detalii pe fiecare tub: tipul de celulă. metoda face posibilă revenirea la celule cu un număr mai mic de pasaje. Există dispozitive speciale care permit coborarea temperaturii cu un grad pe minut. direct în baia de apă la 37 de grade Celsius. 7 DMOS este toxic pentru celuele la temperatura camerei. celulele vor fi resuspendate direct în mediul de îngheţare răcit în prealabil la 4 grade la o concentraţie de 1x106-1x107/ml6 şi transferate imediat7 la -20 de grade C pentru 1-2 ore.

Imediat.Garland Science. Alberts B. După centrifugare celulele sunt resuspendate în mediu pentru a obţine o suspensie unicelulară şi apoi numărate/investigate la microscop prin colorarea cu trypan blue (proporţia celulelor moarte). Freshney RI. 6. acţiunea trispinei este antagonizată prin adăugarea de ser urmată de transferul într-un tub adecvat şi centrifugarea.Bibliografie 1. Auflage. Urmărind sub microscop separarea celulelor (durează câteva minute) se poate evita efectul nociv al unei incubări prea îndelungate. Dasso M. La fiecare 2-4 săptămâni se centrifughează şi resuspendă celulele neaderente în mediu proaspăt.com 9 Acesti ioni pot scadea eficienţa tripsinei/EDTA 81 . Cea mai frecventă combinaţie folosită în acest scop este tripsina/EDTA. unele celule care cresc în suspensie). Culture of Animal Cells: A Manual of Basic Technique. 4.invitrogen.protocol-online. tripsinizarea Celulele formează aderenţe între ele şi suprafaţa vasului de cultură (celule aderente) şi/sau între ele (celulele aderente. Lewis J. spălarea cu o soluţie salină tampon fără9 calciu şi magneziu şi adăugarea unei cantităţi de trispină/EDTA care să acopere stratul de celule. La celulele neaderente nu se face tripsinizarea. 2. 2002 Short Protocols în Cell Biology – 1st ed. John Wiley & Sons 2004 Zell.org www.3. Celulele nu trebuie lăsate neacoperite timp îndelungat. Walter P . 3. Yamada KM. A doua zi se recomandă schimbarea mediului care permite înlăturarea celulelor moarte şi a resturilor de tripsină/EDTA. Dacă este vorba de celule aderente protocolul de lucru presupune îndepărtarea mediului. Pentru cele mai multe protocoale/manopere este necesară obţinerea unei suspensii unicelulare. Raff M. Celulele devin rotunde odată ce pierd aderenţele.. Bonifacino JS. Pentru a ajuta separarea este posibilă uşoara bătaie a sticlei de podul palmei. celule pot fi direct numărate iar densitatea lor este ajustată prin adăugarea mediului proaspăt. Roberts K. 4. se urmează paşii din protocolul respectiv. Dacă tripsinizarea s-a făcut în cadrul protocolului de subcultivare. Johnson A. Dacă manopera s-a făcut în alt scop. Subclonarea. celulele sunt apoi transferate vaselor noi de cultură şi incubate până a doua zi. Lindl T. Lippincott-Schwartz J. Harford JB.. 5.7. John Wiley & Sons 5th Edition 2005 Molecular Biology of the Cell – 4th ed.und Gewebekultur – 4. Spektrum Akademischer Verlag 2000 www.

. inteligent drug design etc. 88  1.............. Producerea proteinelor recombinate în celule mamifere.......... evoluţionism........... medicina moleculară. În acest context............ farmacologia..1...Culturi celulare – partea a II-a Lect.. vom discuta în cele ce urmează folosirea celulelor ca şi entităţi de producţie a proteinelor recombinate cu aplicaţii în autoimunitate şi producerea şi caracterizarea anticorpilor monoclonali bio-nano-funcţionalizaţi cu aplicaţii în cancere şi boli autoimune............. culturile celulare sunt folosite fie ca mini-bioreactoare pentru producerea diverselor produse biotehnologice fie ca şi model organismic pentru testarea efectelor/toxicităţii noilor medicamente........... bio-nano-tehnologia.... ţesuturilor şi proceselor biochimice care au funcţia de a ne proteja faţă de efectele nedorite ale agenţilor patogeni din mediu şi/sau acţiunii dăunătoare a structurilor proprii 82 . 94  4.......... Adaptarea/importul acestora la tematicile de cercetare ale platformei ........ 99  1....... 93  3. Dintre aplicaţiile moderne ale culturilor celulare........... Mircea Teodor Chiriac Cuprins 1.......... 88  2..................... genetică....... Studiul de literatură privind cercetări exploratorii recente ... biochimie................. Imunologia este ştiinţa care se ocupă cu studiul sistemului imun... biologie celulară şi moleculară.......................... De asemenea dezvoltarea industriei farmaceutice a profitat din plin de avansarea tehnicilor de lucru cu celulele.. dr...... Anticorpii monoclonali bio-nano-functionalizaţi ............ Recomandări pentru abordarea de noi tipuri de experimente şi metodologii ................ Studiul de literatură privind cercetări exploratorii recente Culturile celulare reprezintă una dintre cele mai puternice tehnologii/metodologii utilizate de către comunitatea ştiinţifică internaţională din domenii ca: biofizică..2.............. 82  1.......... Bibliografie ... biologia dezvoltării organismelor. Acesta este reprezentat de către totalitatea celulelor...

există diferite structuri care asigură trecerea lină de la un sistem la altul asigurând astfel o continuitate între cele două sisteme. Există aşa-numitele celule. Se consideră că bolile autoimune constituie un grup heterogen de afecţiuni care apar la aproximativ 5% din populaţie. După cum menţionam anterior. Din punct de vedere didactic. care aparţin sistemului imun înnăscut şi alte celule cum sunt limfocitele care aparţin sistemului adaptativ. Celulele ca şi macrofagele. Deoarece sistemul imun adapatativ nu apare în urma unui salt brusc de la sistemul imun înnăscut. există din ce în ce mai multe date care au permis elaborarea unor teorii şi modele experimentale care s-au dovedit utile în caracterizarea acestor boli. cum ar fi granulocitele. Datorită diversităţii extraordinare pe care mediul o oferă. Răspunsurile adaptative apar pentru prima dată pe scara evolutivă la peştii cartilaginoşi ca o completare a sistemului imun înnăscut.alterate (cum ar fi celulele tumorale). • răspunsul adaptativ numit şi specific care este iniţiat atunci când răspunsurile înnăscute nu reuşesc să producă efectul dorit. celulele dendritice. sudoare etc. funcţia sistemului imun este să ne protejeze faţă de patogenii din mediu şi faţă de structurile proprii modificate. există diverse mecanisme care au evoulat cu timpul pentru a satisface cu eficienţă maximă rezolvarea fiecărei situaţii ivite.) într-o formă finită. celulele B1. NKT sunt considerate a fi cele care prin diverşi receptori şi căi de semnalizare celulară fac posibilă comunicarea între sistemul adaptativ şi cel înnăscut. de sine stătătoare şi cel cu componente celulare în care celulele sunt cele care îndeplinesc funcţia majoră de apărare (Figura 1. Se vorbeşte despre un sistem imun cu componente umorale adică cel în care produşii celulelor imune circulă prin sânge sau secreţii (lacrimi. fenomen caracteristic bolilor autoimune. recunoaşterea structurilor străine se face într-un mod indirect. Se poate vorbi în acest context despre o împărţire judicioasă a sarcinilor în sistemul imun al mamiferelor. În ciuda specificităţii remarcabile a răspunsurilor imune. răspunsul imun poate cuprinde două variante: • răspunsul înnăscut care reprezintă o primă barieră întâmpinată de către agenţii patogeni veniţi din afară (acest tip de răspuns apare pe scara evolutivă încă de la bacterii şi plante şi este păstrat şi la mamiferele superioare inclusiv la om). Ele pot fi clasificate în boli specifice pentru anumite organe aşa cum este spre exemplul pemfigusul vulgar care interesează pielea 83 . Acest fapt permite apariţia unor erori care au ca şi rezultat declanşarea unor reacţii împotriva propriilor structuri. celulele natural killer etc. Tabel 1). Deşi mecanismul apariţiei acestor boli nu este pe deplin înţeles.

1 Limfocitele B şi limfocitele T Imunitate umorală Sistemul complement. Peptide antimicrobiene Anticorpii (imunoglobulinele) celulele dendritice şi monocitele/macrofagele aparţin didactic imunităţii înnăscute dar se găsesc din punct de vedere funcţional la graniţa dintre acesta şi sistemul adaptativ în sensul că fac legătura dintre antigen şi centrul de comandă reprezentat de limfocite. celule natural killer. diabetul zaharat de tip I care afectează celule beta ale pancreasului sau tiroidita Hashimoto care apare la glanda tiroida. produsi de secretie ai celulelor imune care mijlocesc schimbul de informatii intre acestea (sageata cu doua sensuri). sistemul imun este organizat ierarhic în sensul ca există o unitate de control care integreaza informatiile primite de la toate celelalte componente şi pe baza lor stabileşte care este cea mai bună soluţie de urmat. Acest centru de control şi decizie este reprezentat de către celula (limfocitul) T helper (Th). Exista totodata schimburi directe intre sistemul innascut şi cel adaptativ care au loc cel mai adesea prin intermediul citokinelor. NK. macrofage. sistem complement Tc B (Ig) Figura 1 Organizarea ierarhică a sistemului imun al mamiferelor. Acesta primeşte informaţii de la sistemul imun înnăscut. şi boli autoimnune generalizate care interesează mai multe organe sau ţesuturi aşa cum este spre exemplu lupusul sistemic eritematos în care unul dintre au84 . Tabel 1 Componente ale sistemului imun al mamiferelor Linia de apărare Primară = imunitatea înnăscută Secundară = imunitatea dobândită (adaptativă sau specifică) 1 Imunitate celulară Granulocite. coordoneaza activarea sistemului imun adaptativ şi controleaza mecanismele efectoare ale sistemului innascut inchizand astfel circuitul.Th Imunitate înnăscută Imunitate adaptativă Granulocyte. La mamifere. şi mucoasele.

La ora actuală. Paraclinic. bolile din grupa celor generalizate au tendinţa de a se croniciza. Cercetările din ultimii ani au reuşit să precizeze o parte dintre mecanismele efectoare responsabile de patologia observată. Aceste celule odată activate produc şi eliberează specii reactive de oxigen care activează enzime 85 . substanţe care produc deprimarea sistemului imun ca mijloc de aparare împotriva celulelor hiperreactive care întreţin distrucţia tisulară. Deoarece cromatina se găseşte practic în toate celulele nucleate. Bolile din această grupă. Anticorpii recrutează şi activează fie direct fie prin intermediul complementului granulocitele in situ. O grupă de boli autoimune care se manifestă la nivelul pielii şi mucoaselor este caracterizată de prezenţa autoanticorpilor şi celulelor T autoreactive îndreptate faţă de autoantigenele de la nivelul pielii şi mucoaselor. majoritatea pacienţilor sunt tratati cu ajutorul cortizonului şi derivaţilor acestuia. bule care se sparg lasând în urmă eroziuni acoperite parţial de cruste. autoanticorpii prezintă reactivitate cu forme recombinate ale autoantigenelor ţintă atât în ELISA cât şi în imunoblot.toantigenele ţintă este reprezentat de cromatina [1]. serurile majorităţii pacienţilor recunosc fomele native ale autantigenelor ţintă atât în imunoblot cât şi pe secţiuni de piele îngheţată. adică răspunsul autoimun este întreţinut în permanenţă de existenţa unui anumit nivel rezidual al autoantigenului. De asemenea. printre care se numară epidermoliza buloasă dobândită şi pemfigoidul bulos/pemfigoidul cicatricial sunt caracterizate de prezenţa anticorpilor circulanţi şi a anticorpilor legaţi la nivelul joncţiunii dermo-epidermale care fixează complementul in situ. Fie că este vorba despre boli specifice de organ fie că este vorba despre cele generalizate. Scenariul fazei efectoare propune o succesiune de evenimente care debutează cu legarea autoanticorpilor la nivelul autoantigenelor ţintă urmată de fixarea componentelor sistemului complement. Dezavantajul major al acestui tip de tratament se manifestă prin apariţtia multiplelor „atacuri” din partea microorganismelor patogene din mediu care găsesc un teren propice pentru dezvoltare într-un organism în care sistemul imun este deprimat. Necesitatea înţelegerii mecanismelor patogenetice la nivel molecular este esenţială nu doar din punctul de vedere al tratamentului dar şi din perspectiva unei depistări precoce sau chiar a posibilelor mijloace de prevenţie a unor asemenea afecţiuni. lipsa unei înţelegeri depline a mecanismelor care iniţiază şi mai apoi întreţin distrucţia ţesuturilor proprii se repercută nefavorabil asupra prognosticului şi totodată calităţii vieţii celor afectaţi. Din punct de vedere clinic aceste boli se caracterizează prin prezenţa bulelor la nivelul pielii şi mucoaselor.

(d) Controlul nostru negativ.8.10. Deşi deosebit de utilă în precizarea posibilelor ţinte terapeutice specifice lipsite de efectele adverse ale terapiilor actuale.6. Într-un model experimental ex vivo. arată lipsa separării dintre derm şi epiderm.9.12] (Figura 2). în care am folosit un ser de la un donator sănătos în loc de ser de la bolnavi. criosecţiuni de piele umană sunt incubate cu anticorpi de la (a-c) pacienţi cu boli autoimune subepidermale şi apoi cu granulocite amestecate sau nu cu diferite substanţe capabile să influenţeze nivelul producţiei de specii reactive de oxigen în granulocite.4.11. (a) Secţiunile incubate cu granulocite în lipsa altor substanţe rezultă în apariţia bulei experimentale. e Figura 2. prin degradarea inhibitorilor acestor enzime.5. caracterizarea exclusivă a fazei efectuare a răspunsului autoimun nu generează nici o indicaţie asu86 .7. (e) Diagrama prezintă lanţul de reacţii care produce speciile reactive de oxigen cu enzimele implicate (fundal roz şi albastru) şi respectiv inhibitori ai acestora (pe fundal verde) a-d. două enzime care sunt responsabile pentru conversia superoxidului în peroxid de hidrogen şi respectiv a celui din urmă în apă şi oxigen nu rezultă în inhibarea producerii separării dermo-epidermale. Odată eliberate aceste enzime digeră structurile proteice responsabile de asigurarea joncţiunii derm-epiderm [2. mărire 200x (după [13]).3.proteolitice prezente în veziculele granulocitare fie direct fie indirect. Folosirea unui amestec de granulocite cu (b) superoxid dismutază sau (c) catalază. Reprezentare schematică a implicării speciilor reactive de oxigen în patogeneza bolilor subepidermale.

imunoglobulina (numită şi anticorp când se gaseşte sub formă circulantă în sânge/secreţii) are două porţiuni: zona superioară (N-terminală) Fab are rolul de a recunoaşte specific antigenul iar zona inferioară (C-terminală) Fc are rolul de a îndeplini funcţiile efectoare. situate spre interior în această figură) şi două lanţuri uşoare (situate înspre exterior în partea de sus). interacţiunea cu diverse componente ale sistemului imun (cum ar fi complementul. De asemenea tehnologia producerii. receptorii pentru porţiunea Fc de pe fagocite.pra cauzelor care declanşează reacţia autoimună. Din punct de vedere funcţional. Pentru aceste modele active de boală. Prezentare schematică a unei imunoglobuline. În cele ce urmează vor fi descrise anumite caracteristici şi metode utile pentru înţelegerea acestor tehnologii. sau cu receptorii de pe celulele placentei – permit trecerea anticorpilor de la 87 . -COOH Fab Fc -NH2 Figura 3. Imunoglobulinele sunt glicoproteine heterogene alcătuite din două lanţuri grele (cu masa moleculară mai mare. Lanţurile grele sunt identice între ele la fel cum lanţurile uşoare sunt identice între ele. caracterizării şi utilizării anticorpilor (Figura 3) monoclonali ca mijloace moderne de combatere a diverselor afecţiuni mergând de la cancer la boli autoimune sau boli degenerative va fi descrisă în cele ce urmează. proteinele sunt produse prin tehnologia ADN-ului recombinat şi exprimate apoi în celulele mamifere care oferă un sistem de expresie superpozabil cu cel întâlnit in vivo. De aceea eforturile din ultima perioadă urmăresc reproducerea bolii prin imunizarea activă a animalelor cu proteine recombinate.

Anticorpii monoclonali bio-nano-functionalizaţi Terapia biologică cu ajutorul anticorpilor este considerată la ora actuală ca fiind cea mai activă branşă a industriei farmaceutice[16].15]. Din punct de vedere istoric. urmează exprimarea proteinelor codate şi purificarea acestora [14. este semnalată folosirea serurilor pentru protejarea persoanelor în Turcia şi apoi odată cu experimentele doctorului Edward Jenner de la sfârşitul secolului al XVIII şi în Anglia. În ciuda efectelor terapeutice extraordinare. folosind acest ADN complementar pot fi amplificate secvenţele de interes prin reacţia de PCR.15]. ţesutul care conţine antigenul ţintă este prelevat de la sursa de interes după care ARN-ul mesager obţinut în urma extracţiei este folosit ca şi matriţă pentru sinteza ADN-ului complementar [14. Totusi folosirea pe scară mai largă a anticorpilor în scop terapeutic a început să fie practicată începând cu secolul XX. 88 . • dificultăţilor tehnice în izolarea/producerea lor şi • necunoaşterea posibilelor ţinte terapeutice esenţiale pentru diferite afecţiuni. • anumite aspecte adverse (apriţia unui răspuns imun faţă de însuşi anticorpii) datorită utilizării anticorpilor de la alte specii. se găsesc reziduuri de glucide care au rol în modularea interacţiunii dintre Fc şi receptorii sistemului imun (vezi text). folosirea anticorpilor a fost însă limitată de anumite aspecte dintre care cele mai neconvenabile au fost: • lipsa unei surse constante de anticorpi omogeni. 1. 1. Pe scurt. Apoi în funcţie de aplicaţia dorită.1. Chinezii şi indienii sunt cei cărora li se atribuie folosirea terapeutică a serurilor (fracţiunea sângelui în care se găsesc anticorpii alături de alte proteine) încă înaintea erei noastre.mamă la făt). Cu ajutorul amorselor specifice. acestea vor fi utilizate fie la imunizarea pentru modelul activ de boală fie pentru cel pasiv. Producerea proteinelor recombinate în celule mamifere Tehnica de bază pentru producerea acestor proteine implică mai multe etape care sunt menţionate în tabelul 3. fragmentele de interes sunt amplificate prin tehnica PCR. prevenţia/terapia cu ajutorul anticorpilor este o procedură folosită de câteva mii de ani.2. După întocmirea strategiei de lucru. În urmă cu câteva secole. După clonarea acestor fragmente în celule. Ataşat de aceste cozi Fc.

noua tehnologie a premis obţinerea lor prin tehnici relativ simple şi cu costuri substanţial diminuate înlăturând astfel cel de-al treilea dintre dezavantajele amintite anterior. prima purtând haine de diferite mărimi. cu diferenţa dintre două persoane. Diferenţa între anticorpii policlonali (cei care erau la acea oră în uz medical) şi noii anticorpi (numiţi monoclonali) poate fi comparată. a dus la înlăturarea primului din cele două mari dezavantaje ale folosirii anticorpilor policlonali. Începând cu 1975 situaţia avea însă să se schimbe. Anticorpii monoclonali produşi iniţial au păstrat neajunsul de a fi produşi în alte specii ducând la declanşarea unui răspuns imun masiv din partea primitorului (cel de-al doilea neajuns). începând de la lenjerie şi până la ultimul nasture al paltonului. forme şi culori şi a doua purtând haine personalizate de către un croitor profesionist. 89 . Dezvoltarea acestei noi tehnici. lumea bio-medicală şi industria farmaceutică a fost în prima instanţă rezervată la posibila utilizare a acestora pe scară largă. chiar şi numai pentru a face lucrurile mai uşor de înţeles.Descoperirea antibioticelor în anii 30-40 ai secolului trecut alături de celelalte inconveniente amintite au dus la intrarea anticorpilor într-un con de umbră. cel de-al patrulea neajuns amintit mai sus) cât şi de către pragmatismul industriei farmaceutice (care găsea o nouă mină de aur în comercializarea noilor „gloanţe magice” aşa cum le numea Paul Ehrlich. Această temere a fost dublată şi de avansarea tehnicilor industriale de producere a moleculelor cu masă moleculară mică care păreau să fi rezolvat în sfârşit problema inexistenţei unor medicamente perfecte. şi anume lipsa unei surse constante de anticorpi cu caracteristici omogene. Totuşi în anii care au urmat. de asemenea. cu timpul. Chiar dacă uşor exagerată şi poate nu cea mai potrivită din punct de vedere bio-medical. doi cercetători anunţă în revista Nature [17] o metodă prin care se pot obţine cantităţi teoretic nelimitate de anticorpi cu specificitatea dorită. În ciuda acestor piedici. entuziaştii au continuat însă lucrul la producerea anticorpilor monoclonali ducând la aprobarea utilizării primului anticorp produs în acest fel nu însă mai repede de un deceniu de la publicarea metodologiei de către Koehler şi Milstein [16]. folosirea acesteia are un substrat uşor de înţeles şi anume în literatura de specialitate de limba engleză termenii „tailor made antibodies” sunt folosiţi pentru a descrie producerea de anticorpi monoclonali specifici pentru diferite situaţii [18]. Într-o lucrare de referinţă pentru literatura biomedicală. Cel mai probabil din acest motiv. potenţialul imens al noii tehnologii a incitat atât curiozitatea comunităţii ştiinţifice (interesată în definirea noilor aplicaţii pentru care anticorpii monoclonali reprezentau unealta mult-căutată.

Aceste date au menirea de a sublinia interesul major al comunităţii bio-medicale şi al guvernelor statelor industrializate (din moment ce majoritatea studiilor sunt finanţate din bani publici) pentru găsirea unor strategii terapeutice specifice pentru tratarea acestei maladii. tehnici care au cunoscut o dezvoltare extraordinară în ultimele două – trei decenii. în topul primelor zece produse folosite în tratamentul diverselor afecţiuni existau.părintele hematologiei şi chemoterapiei (acesta din urmă fiind un termen pe care l-a introdus chiar el). rituxan (rituximab). dezvoltarea tehnologiei producerii anticorpilor monoclonali reprezintă inovaţia secolului trecut în ceea ce priveste importanţa terapeutică. cu o singură excepţie. Majoritatea sunt folosiţi ca atare (neconjugati). cu mai bine de un secol în urmă) [19]. După cum aminteam anterior la 11 ani de la publicarea lucrării lui Koehler şi Milstein. Datorită eşecului relativ al utilizării acestui medicament şi datorită timpului îndelungat necesar dezvoltării unui nou medicament. Dacă în anul 2000. timpul scurs până la aprobarea celui de-al doilea anticorp monoclonal a fost de încă opt ani de la aprobarea OKT3. majoritatea sunt destinaţi tratării cancerelor. urmaţi de cei conjugaţi cu material radioactiv şi o mică proporţie sunt reprezentaţi de cei conjugaţi cu toxine. Mai mult. se estimează că cinci din cele zece substanţe vor fi reprezentate de anticorpi în 2014 [16]. un anticorp monoclonal împotriva CD20 de pe celulele 90 . După unii. Folosirea pe scară largă a Orthoclone OKT3 (muronomab CD3) a fost însă limitată de faptul că acest anticorp de origine murină (produs în celule de şoarece care diferă suficient de celulele umane) induce un răspuns imun amplu în organismul uman [20]. anticorpii sunt în aproape toate situaţiile luaţi în calcul la stabilirea strategiei terapeutice alternative sau câteodată constituie chiar terapia de primă alegere. în 1986 este aprobată utilizarea primului anticorp monoclonal pentru prevenirea rejetului de transplant. De asemenea dintr-un total de 1500 de studii clinice în care sunt testaţi noi anticorpi monoclonali peste75% sunt axate pe folosirea acestora în tratarea cancerelor. doar substanţe cu greutate moleculară mică. La ora actuală. administrarea acestui anticorp a dus la apariţia sindromului eliberării sistemice de cytokine [21] datorită interacţiunii OKT3 cu receptorii pentru porţiunea Fc a IgG. Desigur această turnură a fost posibilă prin îmbunătăţirea permanentă a protocoalelor de lucru şi obţinerea unor anticorpi modificaţi prin tehnologia ADN recombinat. diagnostică şi preventivă a îmbolnăvirilor umane [16]. Dintre cei peste 25 de anticorpi monoclonali aflaţi la ora actuală pe lista medicamentelor aprobate pentru tratamentul afecţiunilor umane. În 1997.

îmbunătăţirea proprietăţilor efectoare prin optimizarea interacţiunii cu sistemul complement.B devine cel de-al treilea medicament admis pe piaţa din SUA pentru tumori ale celulelor B. diabetul zaharat de tip I. bolile buloase (pemfigusul. . Acest anticorp chimer (combinaţie între uman şi murin) are multiple mecanisme de acţiune dintre care merită amintite: inducerea toxicităţii celulare indusă de anticorpi (ADCC) şi citotoxicitatea mediată de complement (CDC). Utilitatea acestei modificări poate fi exemplificată ca şi în figura 4. Pe scurt.îmbunătăţirea interacţiunii cu receptorii Fc sau Fc de tip neonatal (FcRn) de pe celulele efectoare. alături de un mecanism de inducere a apoptozei celulelor care exprimă CD20 pe suprafaţă. o 91 . În general. anemia hemolitică autoimună. În plus dacă anticorpii iniţiali aparţineau clasei IgG1. Mare parte dintre eforturile actuale au menirea de a creşte penetranţa acestor glicoproteine pentru ţinte din interiorul celulelor. Fab) fie prin fuzionarea lor pe domenii de Ig. prelungirea duratei de injumătăţire cu efecte favorabile datorate reducerii dozajului fie prin PEG-ylarea fragmentelor (scFv. o multispecificitatea. anticorpii sunt substanţe care interacţionează cu structuri extracelulare sau de pe suprafaţa celulelor. există câteva direcţii prin care se urmăreşte creşterea posibilelor interacţiuni terapeutice. Mai mult. pemfigoidul). investigaţii actuale sunt concentrate asupra diversificării activităţii prin schimbarea clasei şi deci a paletei de efecte posibile. Dintre acestea amintim: o modificarea porţiunii Fc a anticorpilor pentru: . anticorpul păstrează specificitatea pentru care a fost creat pe unul dintre fragmentele Fab cu care se va lega de ţinta dorită urmând ca pe celalalt fragment Fab să lege un receptor de pe o celulă efectoare (spre exemplu CD3 de pe celula T) care are proprietatea de a distruge celula recunoscută specific. vasculita autoimună etc. adică adăugarea unei alte specificităţi în zona de recunoaştere a Fab. Între timp acest medicament este folosit şi în tratamentul unor boli autoimune cum ar fi artrita reumatoidă.

anticorpul monoclonal recunoaşte antigenul specific. (A) Clasic. o enzimă sau chiar o cytokină care să crească puterea distructivă a anticorpului fie direct. (D) Este de asemenea posibil ca nanosfera să conţină un material radioactiv. de care se leagă. Modul de acţiune al anticorpilor bispecifici. în acest caz de pe celula tumorală. Existenţa a două fragmante Fab duce la legarea unui anticorp de două antigene invecinate. 92 .A Celula tumorala B Celula tumorala Celula imun Celula imun C Celula tumorală D Celula tumorală Celula Celula imun imun nano nano + Figura 4. Celula imună figurată cu linie punctată ramasă la distanţă nu este capabilă să distrugaă celula tumorală. o toxină. în cazul cytokinei prin recrutarea altor celule imune în zona respectivă. (B) Modificarea unuia dintre fragmentele Fab poate fi făcută în aşa fel încât acesta să nu mai recunoască ţinta iniţială ci un receptor de pe o celulă imună efectoare aducând-o în imediata vecinătate a celulei tumorale. (C) Alternativ porţiunea Fc poate fi modificată (funcţionalizată) prin ataşarea unei nanosfere care poate avea ca atare un efect toxic asupra celulei tumorale. fie. Puntea creată are ca efect reducerea dramatică a spaţiului dintre cele două celule permiţând celulei imune să distrugă celula canceroasă în condiţii optime.

Este de aşteptat ca o caracterizare precisă a mecanismelor patogenetice să necesite o perioadă relativ lungă de timp. În acest context. la ora actuală. Într-un set de experimente menite să caracterizeze potenţialul anticorpilor specifici faţă de diferiţi receptori de pe suprafaţa celulelor B de a determina distrugerea acestora. De asemenea protocoale specifice a căror necesitate poate să apară pe parcursul desfăşurării experimentelor pot fi obtinute de la colaboratorii din afara Institutului. De altfel. celule cu rol cheie în patogeneza autoimună a acestor boli. utilizând tehnicile şi aparatura specifică culturilor celulare vor fi produse diverse fragmente recombinate ale unor proteine cu rol cheie în asigurarea adeziunii dintre derm şi epiderm. vor fi luaţi în calcul anticorpi consacraţi cum ar fi anti-human CD20 alături de alţi anticorpi a căror ţintă se află tot pe celulele B dar a căror eficienţă în distrugerea acestor celule este încă necunoscută. Desigur importul premanent de know-how relevant pe plan internaţional este esenţial pentru consolidarea cercetării locale şi recunoaşterea validităţii datelor obţinute de către comunitatea ştiinţifică internaţională. Într-o primă fază. 93 . în paralel este de dorit abordarea acestei problematici din punct de vedere terapeutic. De asemenea instruirea personalului şi co-interesarea şi implicarea cercetătorilor externi în tematicile de cercetare ale platformei este esenţială pentru întărirea resursei umane cu expertiză în domeniu.2. caracterizarea precisă a mecanismelor patogenetice implicate în distrucţia tisulară din bolile autoimune sa permită o prevenţie. Adaptarea/importul acestora la tematicile de cercetare ale platformei Este de dorit ca în viitor. În vederea atingerii acestui obiectiv. Potenţialul acestor anticorpi va fi studiat fie în preparaţii care conţin doar anticorpul pur fie în alte instanţe cu anticorpul funcţionalizat (Tabelul 2). Tehnicile de lucru cu celulele mamifere sunt puse la punct în laborator. De aceea. Odată produse aceste fragmente vor fi caracterizate din punct de vedere bio-chimic şi folosite apoi fie separat fie în diferite combinaţii pentru producerea de anticorpi şi/sau pentru reproducerea bolii umane în animalele de experienţă. implementarea metodologiei şi tehnicilor moderne este un deziderat al activităţii prezente şi viitoare a grupului de cercetare. un deziderat este reprezentat de funcţionalizarea anticorpilor îndreptaţi faţă de molecule de pe celulele B. grupul de cercetare include în preocupările sale problematica legată de caracterizarea răspunsului autoimun în diferite modele de boală. un diagnostic precoce şi un tratament specific al acestor afecţiuni.

Obiective Stablilirea dozei 50%1 Model de studiu Culturi celulare ex vivo Strategie Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Anticorp pur Anticorp funcţionalizat cu nanosfere Anticorp funcţionalizat cu nanosfere + Rx/toxic Stabilirea potenţialului preventiv/curativ al anticorpilor funcţionalizaţi 1 Model animal în vivo Este vorba despre doza care provoacă moartea a 50% dintre celule. Un exemplu în acest sens îl constituie clonarea fragmentelor de integrine. Atenţia va fi concentrată pe producerea acelor autoantigene a cpror patogenitate este încă incomplet elucidată. la funcţii de recrutare şi transducerea semnalului. Strategiile de lucru abordate pentru atingerea celor două obiective majore. Defecte ale acestor integrine sunt considerate a fi implicate în patogeneza bolilor autoimune. Integrinele sunt o clasă heterogenă de proteine implicate în diverse procese de la asigurarea contactelor dintre celule şi mediul înconjurător. 94 . Un interes primar pentru preocupările noastre îl constituie producerea fragmentelor recombinate ale proteinelor care asigură adeziunea keratinocitelor de stratul dermal.Tabel 2. Ca şi metodologie de lucru. Recomandări pentru abordarea de noi tipuri de experimente şi metodologii Una dintre direcţiile de cercetare care vor fi abordate în viitor se va concentra pe producerea de fragmente recombinate ale diferitelor proteine autoantigen cu ajutorul culturilor celulare eucariote. contribuind astfel într-un mod inovativ la definirea naturii autoimune a diferitelor entităţi clinice. De aceea. odată produse aceste fragmente ar putea fi folosite în diferite combinaţii pentru a reproduce caracteristicile bolii umane în animalele de experienţă. 3. Nu este deocamdată clar în ce fel şi în ce masură autoanticorpii faţă de aceste molecule sunt implicaţi în patogeneza autoimună. producerea unui model de boală şi modularea acestuia în scop preventiv/terapeutic implică mai multe etape (Tabelul 3).

folosirea diverselor căi de administrare. diagnostic şi tratament a bolii induse: .izolarea claselor şi subclaselor din sursa de anticorpi policlonali şi investigarea mecanismelor efectoare prin care aceştia produc boala .folosirea anticorpilor monoclonali cruzi sau funcţionalizaţi cu nanosfere .folosirea nanosferelor direcţionate specific împotriva celulelor imune autoreactive Imunizarea unor animale intermediare cu diferite combinaţii de proteine recombinate şi izolarea anticorpilor specifici produşi Transferul pasiv al acestor anticorpi în şoarecii de laborator Dezvoltarea strategiilor de prevenţie.) .modificarea anticorpilor prin tehnica ADN-ului recombinat (se urmăreşte în acest fel modularea interacţiunii cu diferite mecanisme efectoare prin modificarea spre exemplu a porţiunii Fc a anticorpului) Producerea modelului activ de boală Producerea modelului pasiv de boală 95 .Tabel 3. Etape recomandate pentru modelare în scop preventiv/terapeutic a unei boli autoimune în animalele de experienţă Denumire etapă Obţinerea fragmentelor recombinate ale autoantigenului Activităţi Stabilirea planului de clonare Designul şi producerea de amorse specifice Izolarea ARN-ului mesager RT-PCR Clonarea produşilor obtinuţi prin PCR Exprimarea proteinelor recombinate Imunizarea animalelor de experienţă cu diferite combinaţii de proteine recombinate Evaluarea clinică şi paraclinică a inducerii bolii Dezvoltarea unor strategii de prevenţie. adjuvanţi. granulocite prin FcR etc.folosirea anticorpilor din diferite surse şi evaluarea mecanismelor patogenetice specifice fiecăruia (sistem complement. folosirea autoantigilor modificaţi . cantităţi variabile de autoanitgen. diagnostic şi tratament: .

semnificaţia funcţională a acestui detaliu structural a rămas un mister până de curând. interesul extraordinar în găsirea combinaţiilor optime de anticorpi care să identifice celulele tumorale ţintă şi în acelaşi timp să angajeze un răspuns prin modificare celui de-al doilea fragment Fab a început să fie balansată de interesul pentru modificarea porţiunii Fc în vederea creşterii efectivităţii. prin modificarea 96 . S-a dovedit recent că o scădere a syalilarii lanţului glucidic din această porţiune duce la creşterea activării celulelor efectoare cu receptror Fcgamma. Spre exemplu. Astfel. Explicaţia propusă a fost că diferenţa este datorată unor modificări postranslaţionale apărute în porţiunea Fc a anticorpilor. anticorpii multispecifici posedă şi alte specificităţi care să le crească capacitatea funcţională benefică. cea de-a doua porţiune Fab poartă specificitatea agentului terapeutic (nanosfera radioactivă sau toxina. patra etc. Ideea de bază este că un sistem imun „acordat” perfect reuşeşte să distrugă celulele nedorite prin implicarea la timpul şi momentul potrivit a potenţialului uriaş pe care celulele imunităţii il posedă. S-a dovedit astfel existenţa unei concordanţe între aceste secvenţe şi capacitatea lanţurilor codate de a activa anumite mecanisme efectoare. sistemul complement). Deşi acest lucru era cunoscut de mai multă vreme. De altfel interesul tot mai mare în explicarea la nivel molecular a susceptibilităţii la anumite afecţiuni a dus din ce în ce mai frecvent la obţinerea secvenţelor de nucleotide care codează pentru anticorpi. De asemenea structura primară a lanţului polipeptidic care formează porţiunea Fc a anticorpilor este implicată în reactivităţile diferite observate la folosirea diverselor preparaţii de anticorpi. Este vorba despre adăugarea diferitelor lanţuri glucidice care fac anticorpii entităţi glicoproteice. Tendinţa actuală este de a grupa aceste polimorfisme de la nivelul ADN în funcţie de capacitatea anticorpilor de a activa/inhiba o anumită clasă de celule efectoare cu implicare în terapia afecţiunilor autoimune şi cancerelor. un accent deosebit a fost pus pe studierea interacţiunilor dintre porţiunea Fc a anticorpilor şi alte proteine efectoare din sistemul imun (receptorii pentru Fc de la nivelul celulelor imunităţi înnăscute. specificitate pentru un alt receptor de pe o celulă citotoxică spre exemplu).În ultimii ani. Cercetări recente au arătat că există diferenţe esenţiale între acţiunea diverşilor anticorpi care la prima vedere sunt identici. specificitate este adusă de către modificarea/modificările din porţiunea Fc astfel încât acestea să poată activa cu succes diverse mecanisme imune (Figura 5). Pe lângă specificitatea pentru celula tumorală ţintă şi cea pentru nanoparticule. iar o a treia. Se vorbeşte în acest sens despre anticorpi trispecifici/multispecifici în care pe lângă specificitatea porţiunii Fab pentru ţinta dorită.

6… Celula imună 3 2 1 nano-r x/tox ROS. porţiunii Fc pe partea stângă a figurii.Celula imună Celula tumorală/ autoimună 4 5. prin „personalizarea” interacţiunii fragmentului Fc cu celulele care poartă receptori pentru acesta (partea dreapta jos) sunt transduse semnale puternice care pot avea ca rezultat o activare crescută a acestor celule cu producerea speciilor reactive de oxigen şi eliberarea proteazelor efectoare (5. Dintre avantajele folosirii anticorpilor ca şi agenţi biologici în tratamentul cancerului amintim: . folosirea unei duble specificităţi a porţiunii variabile a fragmentului Fab face posibilă recrutarea în vecinătatea tumorii a celulelor T citotoxice (4). anticorpul capătă proprietăţi sporite de activare a sistemului complement care fie direct (2) fie indirect (3) duce la distrugerea celulei canceroase/autoimune. proteaze CDC Figura 5.timpul de înjumătăţire crescut faţă de moleculele cu greutate moleculară mică ceea ce face posibilă scăderea dozei utilizate . De asemenea. Mecanisme de acţiune ale anticorpilor multispecifici. În prezent se urmăreşte lărgirea paletei de experimente şi metodologii care pot fi oferite la nivelul laboratorului.specificitatea şi afinitatea mare 97 .6…). În plus. Numeroşi membri ai acestuia se află în prezent în diverse laboratoare partenere unde deprind metode şi tehnici noi pe care dorim să le implementăm odată cu reintegrarea acestora în laboratorul de origine.

Cercetări recente au arătat că ADCC este mai eficientă la acei indivizi care prezintă anumite polimorfisme în porţiunea Fc (respondenţi cu grad înalt) [23. toxine. Diferite mecanisme de acţiune ale anticorpilor monoclonali Mecanism de acţiune propus ADCC1 CDC Inducerea apoptozei Blocarea interacţiunii factorilor de creştere cu receptorii specifici Blocarea fizică a dimerizării receptorilor pentru factorii de creştere Inhibarea neoformării vaselor sangvine Blocarea factorilor de creştere în forma solubilă Funcţionalizarea/conjugarea cu radioizotopi. enzime sau cytokine 1 Reprezentant Anti-CD20 Anti-CD20 Anti-CD20 Anti-EGFR Anti-EGFR Anti-Her2/neu Anti-EGFR Anti-VEGF-A AntiDiverşi Referinţa bibliografică [23. Tabel 4. fie prin inducerea apoptozei fie prin antagonizarea efectelor factorilor de creştere [22].24]. legarea concomitentă a Fv (partea a Fab) de antigenul ţintă şi a Fc de o celulă cum ar fi macrofagul sau celula NK care posedă receptori pentru această porţiune duce la activarea celulei imune urmată de distrugerea celulei ţintită specific.29] [22] Majoritatea anticorpilor monoclonali utilizaţi acţionează asupra ţintelor specifice prin acest mecanism.24] [22] [25] [26] [26] [27] [28. 98 .- - multiple mecanisme de acţiune care pot fi combinate (vezi anticorpi multispecifici pentru ADCC şi CDC) posibilitatea folosirii acestora ca şi terapie complementară/alternativă oricărei forme de terapie anti-canceroasă tradiţională utilizarea lor ca şi vehicul specific pentru transportul diverselor substanţe anticanceroase spre diverse destinaţii (vezi anticorpi bispecifici) utilizarea lor ca şi markeri de diagnostic/prognostic pentru diferite afecţiuni în anumite cazuri anticorpii pot per se să controleze creşterea tumorii prin interferarea cu căile de semnalizare celulară.

Ujiie H. et al. New York and London: Garland. Oswald E. 9. Shield CF. J Autoimmun 31: 331-338. Li Z. Kohler G. J Immunol 183: 4088-4093. J Autoimmun. Otto C. Schwartz RS (2004) Paul Ehrlich's magic bullets. N Engl J Med 350: 1079-1080. Herrero-Gonzalez JE. (2007) IgG4 autoantibodies induce dermal-epidermal separation. Cell Mol Life Sci 67: 1343-1351. Chiriac MT. 13. Sitaru C. Shimizu H (2010) What's new în bullous pemphigoid.Bibliografie 1. 11. Ito K. Nishie W. Schroeder TJ. editor. Holers VM. Chiriac MT. Norman DJ. 14. 5. 19. (2009) Pathogenicity of IgG subclass autoantibodies to type VII collagen: Induction of dermal-epidermal separation. Shibaki A. Mihai S. Mihai S. 3. Jefferis R. (2007) NADPH oxidase is required for neutrophil-dependent autoantibody-induced tissue damage. Mihai S. (2007) The alternative pathway of complement activation is critical for blister induction în experimental epidermolysis bullosa acquisita. Zhiqiang A (2009) Therapeutic Monoclonal Antibodies: From Bench to Clinic. New Jersey: Wiley. (2009) A novel humanized neonatal autoimmune blistering skin disease model induced by maternally transferred antibodies. Sawamura D. Li N. Wang G. Sesarman A. Lisi P. Sitaru C. Zillikens D. Nat Med 13: 378-383. Zhao M. 120 p. Methods 36: 11-24. Liu Z. Sitaru C (2007) Immunopathology and molecular diagnosis of autoimmune bullous diseases. Feldrihan V. 15. Nishie W. Kimball JA. 12. 10. (2010) A novel active mouse model for bullous pemphigoid targeting humanized pathogenic antigen. 99 . Shinkuma S. et al. J Dermatol 37: 194-204. (2007) Humanization of autoantigen. (2008) Subepidermal blistering induced by human autoantibodies to BP180 requires innate immune players în a humanized bullous pemphigoid mouse model. et al. J Clin Invest 115: 870-878. Sui W. Goodall M. Chiriac MT. Chowdhury PS. Goto M. et al. Nishie W. (2010) Cross-reactivity of autoantibodies from patients with epidermolysis bullosa acquisita with murine collagen VII. Scharffetter-Kochanek K. Shibaki A. Takahashi K. Sawamura D. 7. Vidarsson G. Shibaki A. et al. 1st ed. Walport M (2007) Janeway's Immunobiology. et al. Nature 256: 495-497. Ujiie H. Sindrilaru A. In: Zhiqiang A. J Pathol 212: 56-65. et al. Goto M. Recke A. et al. Zillikens D (2005) Mechanisms of blister induction by autoantibodies. Mihai S. Csorba K. Wu H (2005) Tailor-made antibody therapeutics. (2005) Induction of dermal-epidermal separation în mice by passive transfer of antibodies to type VII collagen. Sawamura D. J Cell Mol Med 11: 1117-1128. Sitaru C. Exp Dermatol 14: 861-875. Cluj-Napoca: Babes-Bolyai University. J Cell Mol Med 11: 462-481. 6. Fritsch A. Travers P. 16. Natsuga K. (1995) The OKT3 4. Murphy KM.4. Roesler J. Evensen M. et al. 17. Milstein C (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. J Immunol 184: 2166-2174. et al. Chiriac MT. 18. et al. 8. Nishie W. Haußer I. Chiriac MT. Chiriac MT (2007) Inflammatory Mechanisms of Tissue Damage Induced by Antibodies. 20. 2. Thurman JM. J Immunol 178: 6514-6521.

Bardos P. 23. Thouard I. Ferran C. Rovira A.21. (2002) Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism în IgG Fc receptor FcgammaRIIIa gene. Transpl Immunol 3: 212-221. Shan D. Salles G. 29. Press OW (2000) Signaling events involved în anti-CD20-induced apoptosis of malignant human B cells. 24. Solal-Celigny P. et al. Armanini M. Transplantation 49: 697-702. Reiter Y (2007) Novel antibodies as anticancer agents. 28. Weng WK. Hillan KJ. 27. Chatenoud L. Blood 99: 754-758. Dacheux L. Nat Rev Drug Discov 3: 391-400. Levy R (2003) Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab în patients with follicular lymphoma. Winer J. Albanell J. J Clin Oncol 21: 3940-3947. Li B. Adv Exp Med Biol 532: 253-268. Oncogene 26: 3714-3733. (1990) în vivo cell activation following OKT3 administration. Gerber HP. Nature 362: 841-844. an anti-VEGF antibody for treating cancer. 22. et al. (1993) Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth în vivo. Ferrara N. Mellado B. Ledbetter JA. 26. Cartron G. Cancer Immunol Immunother 48: 673-683. Codony J. Gascon P (2003) Mechanism of action of anti-HER2 monoclonal antibodies: scientific update on trastuzumab and 2C4. Antibody Response Study: a multicentre study of human anti-mouse antibody (HAMA) production following OKT3 use în solid organ transplantation. 100 . Legendre C. Merite S. 25. Biochem Soc Trans 32: 742-745. Zafir-Lavie I. Michaeli Y. Systemic cytokine release and modulation by corticosteroids. Novotny W (2004) Discovery and development of bevacizumab. Kim KJ. Gillett N. et al. Ferguson KM (2004) Active and inactive conformations of the epidermal growth factor receptor.

....... 111 3...................... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii .......................... dr..............................3............... Înregistrarea spectrelor Raman confocale ...... Analiza medicamentelor anticanceroase ........2..................2..................................... Aplicaţii bio-medicale ..................................3...................... 105 2............ 108 2.... Structuri alotrope de carbon .....1........ Identificarea fazelor cristaline şi a tranziţiilor de fază..... 119 101 ............... Aspecte generale ale spectroscopiei Raman ................ Imagistica Raman confocală.... 110 2.... Cipuri ADN .................... Detecţia poluanţilor din apă........................3......... Bibliografie ......2......3....1.................................................................................................................... 115 3................................................................. Aplicaţii în stiinta mediului...............2..... Celula Linkam ............................... 117 3. Monica Maria Baia Cuprins 1..........3.................................................. Efectul Raman .......................... Efectul Raman rezonant......3..............III...................2............... 111 2...... 111 2......................................... Aplicaţii ale microspectroscopiei Raman... 113 3......2.......................................1................................................................1..................... 107 2... 104 1...............................2............... 112 3.2..................... 113 3............................................................................................................................... Studii structurale ale componentelor solului: Acidul humic ..............1...............................1........ 109 2.. Spectroscopia Raman amplificată de suprafaţă ............. Accesorii . 109 2... Localizarea şi identificarea unor bacterii ....... 107 2........ 112 3...................... Microspectroscopia Raman confocală ........1............ Modul de microscopie de forţă atomică model alpha 300 .............................................1....1........ 108 2........................................ Aplicaţii în ştiinţa materialelor ........ Analiza domeniilor amorfe ...... 109 2....4.............. Parametrii optimi de funcţionare ...........3.3.................3....................................2..................... 117 3........... 119 4.....................2......2.......................2.......... 102 1......1... Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 .... 102 1................... 107 2...........................................2.................. MICROSCOPUL CONFOCAL RAMAN Microspectroscopia Raman Conf...........................................1.................................... 103 1.............

Aspecte generale ale spectroscopiei Raman 1.) interacţionează cu atomii sau moleculele constituiente şi poate fi absorbită sau împrăştiată [1.1. un material. aşa încât. fie un proces de împrăştiere inelastică care este cunoscut sub denumirea de împrăştiere Raman şi în urma căruia sunt emise cuante de energie hν 0 ∓ hν s (Fig. procesul Raman. şi care poartă numele de împrăştiere Rayleigh. în urma căruia este eliberată o cuantă de energie hν 0 − hν s (linii Stokes). 2]. în conformitate cu legea de distribuţie a lui Boltzmann. Efectul Raman O rază de lumină incidentă pe o probă (de exemplu o celulă biologică. Nivel electronic excitat Energie hν0 hν0 hν0 h ν0 . 102 . în urma căruia rezultă o cuantă a cărei energie rămâne neschimbată. are o probabilitate de apariţie mult mai mare decât cel în urma căruia se eliberează o cuantă de energie hν 0 + hν s (linii anti-Stokes).h ν s hν0 h ν0 hν0 hν0 + hνs v=1 v=0 Imprastiere Rayleigh Imprastiere Raman (Stokes) Imprastiere Rayleigh Imprastiere Raman (anti-Stokes) Figura 1. etc. un micro-organism. de o parte şi de cealaltă a liniei Rayleigh [1. Liniile Raman denumite Stokes şi anti-Stokes se găsesc simetric. De aceea. 1). hν 0 . Diagrama tranziţiilor care au loc între diferite nivele energetice vibraţionale şi care corespund proceselor de împrăştiere Rayleigh şi Raman La temperatura mediului ambiant cea mai mare parte a electronilor se află pe nivelele vibraţionale ale stării electronice fundamentale cu energiile cele mai mici. pe nivelele vibraţionale ale stării fundamentale cu energii mai mari se va găsi un număr mult mai mic de electroni.1. Dacă o cuantă de lumină hν 0 nu este absorbită de o moleculă ea poate să sufere fie un proces de împrăştiere elastică. 2].

În unele cazuri observarea efectului Raman este impiedicată de apariţia fluorescenţei. În cele mai multe cazuri.hνs (a) (b) (c) Figura. (c) efectului Raman rezonant.h ν s h ν0 .2. ceea ce limitează detecţia unor molecule aflate în concentraţie mică. care la rândul său reprezintă aproximativ 10-4 . deci doar 10-6. 2. Se face distincţie între două tipuri de efecte Raman rezonant: efectul pre-rezonant şi efectul rezonant (vezi Fig. care este mai intensă cu câteva ordine de mărime decât semnalul Raman şi care apare mai ales la investigarea biomoleculelor şi a sistemelor biologice. cu cât energia de excitare este mai apropiată de energia necesară tranziţiei electronice cu atât este mai mare intensitatea 103 . dacă energia laserului este apropiată de valoarea energiei necesare unei tranziţii electronice (efect Raman rezonant).h ν s h ν0 hν0 . Aceste neajunsuri pot fi înlăturate prin utilizarea unei surse de excitare (laser) cu lungimea de undă situată în domeniul infraroşu-apropiat (NIR) sau prin utilizarea unor tehnici speciale cum ar fi cea bazată pe efectul Raman rezonant sau spectroscopia Raman amplificată de suprafaţă (surface-enhanced Raman spectroscopy SERS) [1-4]. 1. Efectul Raman rezonant În spectroscopia Raman se folosesc în mod curent ca surse de excitare lasere cu lungimi de undă situate în domeniul vizibil (verde şi rosu) şi infraroşu-apropiat care nu au energie suficientă pentru a produce prima tranziţie electronică a majorităţii moleculelor. evitându-se astfel excitarea fluorescenţei [1. (b) efectului Raman pre-rezonant. 2).Intensitatea benzilor Raman este în general de 3 ÷ 5 ordine de mărime mai mică decât intensitatea liniei Rayleigh. Diagrama tranziţiilor care au loc între diferite nivele energetice în cazul (a) efectului Raman convenţional.10-3 din intensitatea radiaţiei incidente excitatoare.10-8 din fotonii incidenţi sunt transformaţi în fotoni Raman. 3]. Totuşi există substanţe care au capacitatea de a împrăştia radiaţia laser cu o intensitate de până la 106 ori mai mare decât cea a semnalului Raman normal. h ν0 h ν0 h ν0 .

se modifică regulile de selecţie şi vor fi amplificate doar anumite tranziţii vibraţionale Raman.3. În plus. O amplificare suplimentară apare datorită excitării plasmonilor de suprafaţă de către radiaţia Raman emisă de molecule. Astfel. care sunt asociaţi oscilaţiilor colective ale electronilor de conducţie de pe suprafaţa particulelor metalice. Amplificarea semnalului Raman rezultă din excitarea acestor plasmoni de suprafaţă de către radiaţia incidentă. proteine). Modificarea regulilor de selecţie precum şi amplificarea tranziţiilor vibraţionale specifice de până la 106 ori permit utilizarea spectroscopiei Raman pre-rezonantă cât şi rezonanţa la un număr mare de aplicaţii din fizicp. Ionul negativ obţinut are configuraţii geometrice de echilibru diferite faţă de cele 104 . Pentru folosirea efectului Raman rezonant nu este necesar un echipament special. chimie. la aşa numiţii cromofori. care duce la procese de transfer de sarcină între nivelele fundamentale şi cele excitate ale moleculelor adsorbite [6]. Amplificarea Raman rezonantă permite izolarea benzilor Raman datorate acestor cromofori şi a unităţilor structurale situate în vecinătatea lor facilitând astfel analizarea zonei cromoforice care este de obicei zona activă. 1. care de obicei nu se observă într-un spectru Raman convenţional. biochimie şi biologie. care este proporţională cu pătratul amplitudinii câmpului electric incident pe moleculă. O contribuţie majoră la amplificarea electromagnetică este datorată plasmonilor de suprafaţă. se folosesc doar lasere cu lungime de undă variabilă care să permită ajustarea energiei de excitare la valoarea necesară unei absorbţii electronice. sunt deseori observabile într-un spectru Raman rezonant. Câmpurile locale rezultate amplifică intensitatea radiaţiei Raman emise. Efectul chimic al amplificării este asociat suprapunerii funcţiilor de undă ale metalului şi adsorbatului. 4. Amplificarea semnalului Raman (de 106-108 ori) este explicată cu ajutorul a două mecanisme principale de amplificare [1. Spectroscopia Raman rezonantă se foloseşte mai ales la investigarea moleculelor poliatomice mari. în lipsa unor semnale spectrale datorate mediului înconjurător (ex. unde absorbţia este localizată într-o anumită zonă a moleculei. apar benzi noi din analiza cărora se pot obţine informaţii structurale suplimentare. Spectroscopia Raman amplificată de suprafaţă Efectul amplificării semnificative a semnalului Raman al moleculelor adsorbite pe suprafaţa rugoasă a unui electrod de argint a fost descoperit de Fleischman şi colab. Tranziţiile de ordin superior. 5]: electromagnetic (amplificare a semnalului Raman de 104÷106 ori) şi chimic (amplificare a semnalului Raman de 10÷102 ori).benzilor observate. săi în 1974 [5]. cum sunt cele biologice.

biomedical. filmele metalice de Au şi Ag. modurile de vibraţie care rezultă dintr-o modificare a polarizabilităţii perpendicular pe suprafaţă vor fi amplificate.Microspectroscopia Raman confocală În urmă cu aproximativ două decenii au fost efectuate primele măsurători Raman cu ajutorul unui microscop. etc.ale moleculei neutre neadsorbite. sunt utilizate mai multe tipuri de substrate active SERS. suspensiile coloidale de Au şi Ag. Recent. În particular. SERS a fost utilizată ca un mecanism de transpunere a semnalului în senzori chimici. transferul de sarcină duce la apariţia unei molecule neutre excitată vibraţional şi la emisia unui foton Raman. deoarece intensitatea câmpului electromagnetic local este maximă pe direcţia perpendiculară la suprafaţă. 8]. Cele mai des folosite sunt electrozii de Au. Acest lucru combinat cu faptul că intensitatea câmpului electromagnetic scade cu creşterea distanţei faţă de suprafaţă permite determinarea orientării speciilor adsorbite în raport cu suprafaţa. 105 . antrax [12]. Datorită sensibilităţii de detecţie remarcabile şi a flexibilităţii sale de aplicare tehnică SERS este utilizată în mod frecvent pentru a soluţiona o mare varietate de probleme cu caracter analitic. Astfel. SERS poate fi exploatată la identificarea selectivă a unor specii moleculare precum şi la detecţia unei singure molecule [10]. Astfel de exemple sunt analiza unor cantităţi reduse de pesticide [11]. glucoza [14] şi a unor reziduuri nucleare [15]. Pentru a optimiza amplificarea electromagnetică frecvenţa laserului trebuie să coincidă cu frecvenţa de rezonanţă plasmonică. Pentru a întelege mai bine raţiunile care au stat la baza evoluţiei spectroscopiei micro-Raman este foarte importantă cunoaşterea tuturor factorilor care contribuie la modificarea intensităţii semnalului ( S ) „livrat” de detectorul unui spectrometru în cazul unei linii Raman înregistrată la o lungime de undă λ . Îmbunătăţirea majoră era dată de folosirea unui obiectiv de microscop prin intermediul căruia se realiza atât iluminarea probei cât şi colectarea luminii împrăştiate. 1. Cu. Deoarece amplificarea depinde de proprietăţile substratului. Regulile de selecţie ale spectroscopiei Raman amplificată de suprafaţă (SERS surface-enhanced Raman spectroscopy) sunt în principiu aceleaşi ca şi în cazul spectroscopiei Raman convenţionale [7.4. a unor antigene specifice prostatei [13]. Pentru realizarea unui experiment SERS se foloseşte în principiu acelaşi echipament ca şi în cazul realizării unui experiment Raman convenţional. şi de securitate globală şi naţională [9]. De aceea. Ag. de mediu.

În microscopul convenţional întregul câmp vizual este uniform 106 . şi a unui obiectiv de microscop. În numeroase studii micro-Raman apare un neajuns deoarece informaţia spectrală obţinută nu este culeasă dintr-un volum suficient de mic (referirea se face în termeni de rezoluţie spaţială perpendiculară la axa optică sau rezoluţie laterală. Se poate observa că atunci cand se doreşte examinarea unui volum V P foarte mic dintr-o probă. etc. care focalizează radiaţia laser şi culege lumina împrăştiată sub un unghi solid mare. Ω este unghiul solid din care se face colectarea luminii împrăştiate Raman. unde I L este intensitatea radiaţiei laser incidentă pe probă (W⋅cm-2). utilizarea unei linii laser. Utilizarea unui astfel de mediu (apă.S ∝ I L ⋅ σ λ ⋅ N m ⋅ Ω ⋅ Tλ ⋅ s λ . specificate foarte exact de către producător. N m reprezintă numărul de molecule din volumul de probă investigat V P . Se poate observa că în cazul unor măsurători efectuate cu un obiectiv de microscop imersat într-un mediu al cărui indice de refracţie este apropiat de cel al probei investigate (nu există o modificare a drumului razelor de lumină la trecerea într-un mediu cu indice de refracţie diferit) apare o îmbunătăţire a eficienţei de colectare şi a rezoluţiei spaţiale. duce atât la obţinerea unui spectru Raman mai bun din punct de vedere calitativ cât şi la localizarea unei anumite zone de interes comparativ cu cazul în care acesta este înregistrat fără obiectiv de microscop [16]. doar câţiva parametrii pot fi modificaţi astfel încât să se compenseze reducerea numărului de molecule N m . Astfel.) impune utilizarea unor obiective speciale care posedă caracteristici diferite pentru fiecare mediu. şi rezoluţie spaţială paralelă la axa optică sau rezoluţie axială). ulei. iar Tλ and s λ reprezintă capacitatea de înregistrare a instrumentului şi respectiv sensibilitatea detectorului la lungimea de undă λ . Aceştia sunt intensitatea radiaţiei laser incidentă pe proba I L şi unghiul solid Ω din care se face colectarea luminii împrăştiate Raman. a cărei putere poate fi reglată într-un domeniu relativ larg. Important în astfel de situaţii ramâne faptul ca mediul în care se face imersarea să nu influenţeze structura şi proprietăţile probei investigate. Eficienţa de colectare a luminii este aproape în totalitate influenţată de apertura numerică NA a obiectivului de microscop care este definită de relaţia NA = n sin θ max în care n este indicele de refracţie al mediului dintre obiectiv şi probă iar θ max este unghiul maxim de colectare al obiectivului. σ λ este secţiunea specifică de împrăştiere Raman (cm2⋅sterad-1⋅molecula-1).

la detector ajungând doar radiaţia din volumul în care a fost focalizat laserul [17]. ca fiind neinvazivă. spectroscopia Raman poate fi singura metodă care să permită detecţia lor în interiorul celulelor în absenţa unor marcări fluorescenţi.1.9 – 0. Astfel. Analiza medicamentelor anticanceroase Producerea unor structuri moleculare capabile să se ataşeze de diferite secvenţe ale unui lanţ de ADN reprezintă un domeniu de cercetare intens datorită importanţei pe care o are acest subiect în obţinerea unor compuşi noi cu potenţial terapeutic. Experimentele iniţiale constă în înregistrarea spectrelor medicamentelor în soluţie în vederea realizării unei caracterizări Raman fundamentale. Aplicaţii ale microspectroscopiei Raman Spectroscopia Raman este o tehnică care pe lângă faptul că permite obţinerea de informaţii extrem de rapide despre structura.iluminat şi observat. Utilizarea primei metode de obţinere a confocalităţii necesită în general folosirea unor obiective de microscop cu apertură numerică mare (NA = 0. 2.1. Aplicaţii bio-medicale 2. în funcţie de tipul aplicaţiei. 107 . microscopul confocal utilizează o diafragmă (pinhol) care izolează radiaţia luminoasă care provine din zona marginală a volumului în care a fost focalizat fascicolul laser (zona din afara focarului). în cazul unor medicamente anticanceroase care nu prezintă fluorescenţă. În paragrafele următoare sunt prezentate succint principalele informaţii care se pot obţine în urma aplicării microspectroscopiei Raman pe diferite sisteme de studiu. prin prezenţa pinholului se realizează o filtrare spaţială a radiaţiei.95) şi poate conduce la obţinerea de informaţie spectrală dintr-un tub focal cu un diametru de 1. modificările structurale şi morfologice care apar în diferite tipuri de probe poate oferi şi unele avantaje unice în comparaţie cu alte tehnici. 2. Astfel. nedistructivă şi extrem de puţin sensibilă la prezenţa apei.1. Confocalitatea poate fi de asemenea obţinută şi prin restrângerea ariei de pe detector unde intensitatea radiaţiei Raman este mare (realizarea unei ”aperturi electronice”). Astfel. Spre deosebire de acesta.22λ/NA şi o adâncime de 4λ/NA2 [17]. această tehnică spectroscopică poate fi considerată. În plus. Spectroscopia Raman poate fi utilizată pentru a examina interacţiunile dintre molecule mici şi ADN. în cele mai multe cazuri aplicarea ei nu necesită prepararea prealabilă a probei.

2. în care diagnosticarea pe baza hibridizării este utilizată în mod eficient pentru a obţine informaţii despre secvenţele de ADN. Majorita108 . Astfel. În cele din urmă. dacă în spectrul SERS se observă benzile moleculei folosite ca marker înseamnă că s-a produs hibridizarea ADN-ului. pentru a detecta cantităţi extrem de reduse ale unui anumit lanţ de ADN existent într-o probă se foloseşte tehnica SERS [18]. ca de ex. nucleu sau citoplasmă). (b) localizarea sa într-o anumită regiune sub-celulară (de ex. În aceste experimente. Acest fenomen este cunoscut sub denumirea de hibridizare şi stă la baza tehnologiei de obţinere a cipurilor ADN. Prin înregistrarea spectrului Raman este posibilă diferenţierea marcărilor fluorescenţi care dau benzi Raman specifice. dacă există o secvenţă cunoscută de ADN fixată într-o anumită zonă a suprafeţei cipului şi dacă apare procesul de hibridizare al unui lanţ de ADN în acea poziţie.1.2. se poate determina secvenţa de ADN din acel lanţ [18]. fapt care face posibilă testarea diferitelor secvenţe care există într-o zonă a cipului. Astfel. suprafaţa cipului se foloseşte atât ca imobilizator al lanţului de ADN cât şi ca substrat activ SERS pentru lanţul de ADN marcat care va fi adus în vecinătate datorită procesului de hibridizare cu lanţul imobilizat.3.Următorul pas constă în efectuarea de studii Raman ale medicamentelor ataşate de anumite secvenţe ale unor oligonucleotide pentru a obţine informaţii de bază care vor fi mai apoi utilizate când se studiază in vitro aceste procese [18].1. dacă sunt posibile formele protonate sau neprotonate) [18]. Cipuri ADN Biocipurile revoluţionează diagnosticarea clinică modernă şi tehnicile farmaceutice datorită rapidităţii de testare a probelor şi de livrare a rezultatelor. Metoda standard de detecţie a procesului de hibridizare foloseşte marcări fluorescenţi. microscopia Raman se poate utiliza pentru a studia medicamentele în interiorul celulelor şi a furniza informaţii despre: (a) interacţiunea dintre compus şi mediul celular. Localizarea şi identificarea unor bacterii Cercetările din medicină şi biologie se confruntă cu necesitatea identificării precise a unor micro-organisme. 2. Tehnica SERS poate fi utilizată în semnalarea unirii unui lanţ de ADN cu lanţul complementar şi formarea structurii dublu elicoidale. bacterii sau viruşi. (c) forma chimică a compusului în interiorul celulei (de ex. În plus.

Trebuie menţionat faptul că prin folosirea laserului care excită rezonant cromoforii se obţin doar benzile acestora. suferă o tranziţie de la faza de rutil la anatas atunci când dimensiunile lor depăşesc 5 nm [20].2. s-a reuşit identificarea unor bacterii care conţin un cromofor (β-carotina. În plus. Un alt studiu a dovedit că temperatura la care are loc tranziţia de fază ortorombic-tetragonal a structurii ceramice de BaTiO3 depinde de mărimea grăunţilor [21]. care uneori este în strânsă corelare cu tranziţiile de fază. sarcinaxantin) în citoplasma membranei. Pentru aceasta au fost cultivate mai multe bacterii Rhodotorula rubra şi Micrococcus luteus. contribuţiile celorlalte componente nefiind prezente în spectru [3]. 2.2. obţinuţi prin depunere din faza gazoasă. Existenţa unei diferenţe în energia de suprafaţă ca urmare a modificării dimensiunii nanoparticulelor. 2. Aplicaţii în ştiinţa materialelor 2. ceea ce facilitează identificarea directă a fazelor cristaline [19]. Spectroscopia Raman confocală oferă posibilitatea identificării unor bacterii individuale. apoi au fost amestecate şi o mostră de analiză a fost investigată cu ajutorul unui echipament Raman confocal. După înregistrarea spectrelor Raman şi analizarea benzilor date de β-carotina. Identificarea fazelor cristaline şi a tranziţiilor de fază Spectrul Raman a diverse nanostructuri este asemănător spectrului unui monocristal.2. care este prezentă în Rhodotorula rubra şi a benzilor date de sarcinaxantin. Este cazul structurilor preponderent amorfe.2.1. observarea unor moduri vibraţionale interzise în spectrele Raman reprezintă o dovadă a distorşilor care apar la nivelul reţelei cristaline [19]. poate fi de asemenea evidenţiată prin spectroscopia Raman. De exemplu. S-a arătat faptul că structura cristalină a clusterilor nanometrici de TiO2. Analiza domeniilor amorfe Informaţiile obţinute prin aplicarea spectroscopiei micro-Raman sunt uneori mult mai utile decât cele determinate din analiza de raze X. Atât studiile cristalografice cât şi 109 . s-a reuşit identificarea celor două bacterii. Cunoaşterea spectrelor Raman ale diferitelor faze cristaline permite caracterizarea tranziţiilor de fază care apar la modificarea temperaturii sau a presiunii prin analiza comparativă a modificărilor care apar în cazul modurilor de vibraţie. existent în Micrococcus luteus.tea metodelor de identificare folosesc o evaluare morfologică combinată cu teste specifice în care se urmăreşte dezvoltarea micro-organismelor în diferite medii şi care durează până la 72 de ore.

dar nu poate fi facută o separare spaţială a acestora [22].cele de spectroscopie Raman se bazează pe a interpreta măsura dezordinii în termeni de lărgime a benzii. Aplicarea spectroscopiei micro-Raman la studiul materialelor şi în special al polimerilor poate face uneori distincţie între domeniile conformaţionale submicrometrice cristaline şi amorfe. nanotuburi.5 nm) şi respectiv în cea de a doua (0.3. Separarea fazelor poate fi de asemenea studiată în cazul sticlelor unde valoarea numărului de undă la care apare semnalul Raman este strâns legată de conectivitatea unităţilor structurale poliedrice constitutive [24].). Este una dintre puţinele tehnici sensibile la modificările structurale care apar în aceste tipuri de materiale. în prima sferă de coordinare (0. Cel mai rapid mod de a obţine componenta amorfă şi cea cristalină este de a deconvoluţiona modurile Raman situate la numere de undă mici în vecinătatea liniei Rayleigh care conţin cele două componente [23]. mai exact atunci când apar modificări structurale în ordinea la mică distanţă. etc. În timp ce în cazul difracţiei de raze X apariţia lărgimii benzii este asociată cu abaterile de la periodicitate a reţelei cristaline pentru un număr însemnat de atomi.1-0. Dacă se ţine seama de descrierea moleculară a vibraţiilor. Astfel. 26]. modurile Raman de deformare sunt influenţate de dezordinea geometriei locale. Atribuirea benzilor în aceste cazuri se face pe baza comparaţiei cu spectrele experimentale obţinute pe faze cristaline similare compoziţional structurii sticlelor sau vitroceramicilor investigate. Structuri alotrope de carbon Microspectroscopia Raman a fost des utilizată la studiul structurilor alotrope ale carbonului (diamant. în timp ce modurile de intindere sunt afectate de dezordinea vecinătăţilor. Din datele obţinute în urma analizei de difracţie de raze X se poate evidenţia faptul că există domenii cu structura periodică şi dezordonată.5-5 nm) [19]. care sunt reprezentate de anumiţi atomi ai altor subreţele sau de defecte care apar ca urmare a substituţiei de atomi sau a prezenţei vacanţelor.2. în cazul spectroscopiei Raman doar modurile de vibraţie ale reţelei şi cele de libraţie (care se găsesc la numere mici de undă) sunt afectate de dezordinea la mare distanţă. grafit. Lărgimea celorlalte benzi Raman este în principal afectată atunci când au loc modificări ale câmpului cristalin local. cu precădere în cazul structurilor dominate de legături covalente puternice. de la structuri cu grad de cristalinitate extrem de ridicat la structuri amorfe. 2. sau cu cele obţinute prin simulări teoretice [25. fulerene. Raportul ariilor celor două benzi oferă o bună estimare a gradului de cristalinitate al probei. în spectrele Raman ale acestor structuri 110 .

3. Detecţia poluanţilor din apă Prezenţa poluanţilor organici în apă a devenit o problemă de actualitate pentru comunitatea internaţională.apar clar definite benzi datorate vibraţiilor date de structuri grafitice (notate G) şi de structuri dezordonate (notate D şi D’). Tehnica SERS datorită sensibilităţii sale este capabilă să detecteze concentraţii extrem de scăzute ale acestor substanţe.3. Aplicaţii în ştiinţa mediului 2.1. benzile datorate modurilor de respiraţie radială (Radial Breathing Mode) cu ajutorul cărora se poate determina diametrul nanotubului (relaţie de inversă proporţionalitate cu valoarea frecvenţei Raman) [19]. fenolii sau derivaţii naftalinei sunt prezenţi în mediile acvatice datorită utilizării lor ca pesticide sau în procesele industriale. Persistenţa precum şi efectele toxicologice ale acestor compuşi şi ale produşilor lor intermediari sunt semnale de alarmă pentru agenţiile de resort din lume. Extrem de important este faptul că în cazul nanotuburilor de carbon apar. în regiunea numerelor mici de undă (< 200 cm-1). Cunoaşterea proprietăţilor chimice este esenţială pentru dezvoltarea unor modele ecologice folosite pentru remedierea şi detoxificarea de compuşi antropogenici sau chiar de reziduuri nucleare [3]. 111 . 2. derivaţii toxici de azot. Studii structurale ale componentelor solului: Acidul humic Caracterizarea structurală a acidului humic precum şi determinarea comportamentului lui de complexare sunt extrem de importante în ştiinţa mediului. Determinarea substratului SERS cel mai potrivit pentru fiecare tip de poluant reprezintă un prim pas în dezvoltarea unui senzor bazat pe metoda SERS. 2. Acidul humic apare în sol şi în apele subterane şi este implicat în numeroase procese chimice şi biologice care au loc în mediul terestru şi acvatic.2. Studiile SERS ale acidului humic au condus la obţinerea unor informaţii legate de mecanismele de legare şi/sau configuraţiile de complexare ale acidului humic. Cu ajutorul acestei tehnici este posibilă determinarea orientării şi a modului de adsorbţie al acestor molecule pe suprafaţa substratului activ SERS [27].3. Acestea au stabilit o concentraţie maximă permisă a acestor compuşi în apa potabilă de < 1 μg/l. Compuşi chimici precum hidrocarburile aromatice. Pentru a detecta aceste concentraţii mici este necesară folosirea unor tehnici instrumentale extrem de sensibile.

50X şi respectiv 100X (uscat şi în ulei de imersie).3. Dimensiunea maximă a probelor care pot fi măsurate este de 120 mm în diametru şi 20 mm înălţime. 20X.achiziţie de spectru/pixel (scanare) . Echipamentul mai conţine un sistem de focalizare motorizat cu posibilitate de deplasare pe o distanţă de 30 mm şi o rezoluţie de 50 nm (un pas) şi o platformă de scanare prin acţionare piezo-electrică cu următoarele caracteristici: suprafaţa de scanare de 200 μm x 200 μm x 20 μm. două reţele de difracţie cu 600 şi respectiv 1800 linii/mm. 3) [28].microscopie confocală în reflexie .8 şi 1. detecţie Raman între 150-3500 cm-1. detector CCD cu răcire Peltier (1340 x 100 pixeli) şi iluminare prin spate tip Marconi. 0. domeniul lungimilor de undă de excitaţie 442-785 nm.9 HDDIC. acurateţe de poziţionare pe direcţiile x şi y sub 4 nm iar pe direcţia z sub 1 nm.45. 0. conectori. fibre optice multimod (100. Sistemul de microscopie Raman confocală lucrează în următoarele moduri de operare: .25 şi mărire 10X. 50 şi 25 μm).1. spectrometru UHTS 300.imagistica spectrală Raman la lungimi de undă fixe. x-z şi y-z (pănă la 1024 x 1024 pixeli) . Rezoluţia optică laterală la linia laserului de 532 nm este de 250 nm.imagistica de fluorescenţă confocală (prin montare de filtre adecvate) Sistemul dispune în prezent de 2 lasere. reflector de câmp intunecat .3. Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 şi a parametrilor optimi de funcţionare pentru diverse aplicaţii 3. Prezentarea echipamentului de microscopie Raman confocală WITec CRM 200 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este dotat cu un microscop optic care este echipat cu 4 obiective plan acromatizate de apertura numerică (NA) 0. 112 . incluzând de asemenenea un obiectiv (cu cantilever ataşat) pentru analiza AFM în lichide şi o cameră video color. un YAG 532 nm şi un He-Ne 633 nm. cuplaj cu fibră optică standard SMA. Drumul razelor în interiorul echipamentului CRM 200 este prezentat în schema de mai jos (Fig. posibilitate de poziţionare a probei în planul x-y într-o regiune de 20 mm x 20 mm cu o rezoluţie mai mică de 1 μm.microscopie de câmp întunecat cu obiectiv EC Epiplan-Neofluar 100X/0.achiziţie de spectre din arii selectate (confocal micro-Raman) . pe direcţiile x-y.

camera video Figura. fibra optică multimod 06. iar pentru vPmax ≤ 4 nu se modifică semnificativ rezoluţia axială).2. Relaţia care trebuie îndeplinită în cazul măsurătorilor Raman confocal este πd 0 M . laserul 02.01. Înregistrarea spectrelor Raman confocale În echipamentul CRM 200 radiaţia laser ajunge în microscop printr-o fibră optică standard iar radiaţia Raman împrăştiată. unde M este mărirea obiectivului. Echipamentul CRM 200 are în dotarea standard trei fibre multimod cu diametre de 100. Parametrii optimi de funcţionare 3.5. 3. d0 diametrul ≥ NA v P max λ pinholului. sistem de focalizare motorizat pe axa z 09. 50 şi 25 μm. lampa cu lumină albă pentru iluminare 08. Fibra este montată în planul imagine al microscopului şi poate fi ajustataă astfel încât să se obţină eficienţa maximă de colectare. colectată cu ajutorul obiectivului de microscop. 113 . Partea stângă a ecuaţiei este legată doar de parametrii obiectivului de microscop. Drumul razelor în microscopul Raman WITec CRM 200. λ lungimea de undă.1. Diametrul acestei fibre joacă rolul pinholului cu ajutorul căruia se realizează confocalitatea [29]. iar vPmax este un parametru variabil a cărui valoare trebuie stabilită în funcţie de tipul de informaţie spectrală care se doreşte a fi obţinută (ex. spectrometru UHTS 300 07. este transmisă spectrometrului echipat cu o cameră CCD prin intermediul unei fibre optice multimod. NA apertura numerică a obiectivului de microscop. pentru a obţine cea mai mare rezoluţie laterală vPmax ≤ 0. fibra optică standard 03.2. obiectivul 04. 3. platforma de scanare 05.

în vederea stabilirii parametrilor optimi.25 80 100 / 1.Tabelul 1. Raportul πd0/2. . De exemplu.pentru a stabili puterea laserului.4 71 Tabelul 2.6 67 60 / 0. un obiectiv de microscop cu mărire de 100 şi o apertură numerică de 0. În caz contrar.se lucrează cu fibra de 100 şi cu obiectivul de 20X sau 50X. iar spectrele obţinute să aibă un raport semnal/zgomot multumitor.25 53 20 / 0.5λ pentru diferite lungimi de undă şi diametre ale pinholului. în experimente SERS pe molecule biologice se foloseşte o putere a laserului sub 1 mW. se schimbă obiectivul de 100X. Înaintea efectuării măsurătorilor propriu-zise. Lungime de undă [nm] d0 = 10 μm d0 = 25 μm d0 = 50 μm d0 = 100 μm d0 = 200 μm 440 29 71 142 286 571 488 26 64 129 258 515 532 24 59 118 236 472 633 20 50 99 199 397 785 16 40 80 160 320 Cu ajutorul celor două tabele poate fi determinată mărimea corectă a pinholului în măsurătorile Raman confocal efectuate cu echipamentul CRM 200.9. se foloseşte intensitatea liniei Rayleigh (ar fi bine să nu depăşească 400 ccd cts. Obiectiv microscop M/NA 10 / 0. Puterea laserului trebuie aleasă astfel încât să nu inducă transformări probei (fotodegradare.stabilirea timpului de înregistrare se face în funcţie de intensitatea semnalului Raman obţinut (se poate alege de ordinul milisecundelor sau de ordinul minutelor) 114 . Astfel. Raportul M/NA pentru diferite tipuri de obiective de microscop. Dacă semnalul Raman obţinut este bun. în timp ce cea mai mare rezoluţie laterală s-ar obţine pentru un diametru optim al pinholului de 10 μm.9 111 100 / 1. Dacă proba de interes nu este predispusă la transformări din cauza laserului. apare riscul de a obţine semnal de la contaminanţi sau se poate degrada molecula.). pentru măsurători în care este utilizat un laser cu lungimea de undă de 532 nm. cea mai mare rezoluţie axială s-ar obţine pentru un diametru optim al pinholului de 50 μm. În anumite situaţii se poate schimba şi fibra (vezi detaliile despre confocalitate prezentate mai sus) .4 50 40 / 0. se pot utiliza puteri mai mari (≤ 3 mW). se parcurg următoarele etape: . în cazul în care nu se obţine semnal Raman se creşte puterea laserului). etc. fiind indicat să fie chiar mai mică de 200 ccd cts.8 75 100 / 0.

Înaintea efectuării unei scanări se stabilesc parametrii optimi de înregistrare (puterea laserului şi timpul de integrare) prin măsurarea spectrelor individuale şi time series. Referitor la timpul de integrare.8 nm • puterea laserului 640 μW • timp de integrare/măsurare 60 s 3.1 s şi 1 s). Exemplu. 35000 30000 25000 Intensity [ccd cts] 20000 15000 10000 5000 0 400 600 800 1000 1200 -1 1400 1600 1800 Raman shift [cm ] Parametrii folosiţi: • fibra multimode de 100 μm • obiectivul 100X aer • linia laser 632. ideal este să fie cât mai mic cu puţinţă (între 0. 115 . de puterea laserului şi de aria scanată. Harta spectrală a intensităţii benzii Raman de la 737 cm-1 din spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenina pe o sticlă de microscop. Imagistica Raman confocală Pentru imagistică este indicată utilizarea obiectivului de 100X (în aer sau cu imersie în ulei). iar stabilirea lui depinde de tipul probei. În ceea ce priveşte stabilirea numărului de linii şi de puncte pentru suprafaţa pe care dorim s-o scanpm.2.Exemplu: Spectrul SERS al adeninei înregistrat pe substrat solid obţinut prin picurarea soluţiei coloidale de argint cu adenină pe o sticlă de microscop. în general pentru o arie de 10 μm x 10 μm se utilizeazp minim 75 linii şi 75 de puncte pentru fiecare linie (la un număr prea mic de linii şi de puncte imaginea este de proastă calitate).2.

500

737

400

Intensity [ccd cts]

300

200

100

0 500 1000 1500
-1

Raman shift [cm ]

În spectrul selectat din imaginea scanată se poate observa semnalul “curat” de la adenină. Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 632.8 nm • puterea laserului: 640 μW • suprafaţa scanată: 10 μm x 10 μm • 75 linii; 75 puncte/linie • timp de integrare 0.5 s/punct (softul calculează timpul de integrare pentru o linie – în acest caz 37,5 s (trace) şi 0.075 s (retrace) Exemplu. Imagistica Raman pe o secţiune dintr-un dinte, la interfaţa dintre dinte şi plombă

116

Parametrii folosiţi: • fibra optică multimod 100 μm • obiectivul 100X (aer) • linia laser 532 nm • putere laser 3 mW. • suprafaţa scanată 10 μm x 10 μm • nr. de linii 150, puncte 150/linie • timp de integrare 0.2 s/punct

3.3. Accesorii
3.3.1. Modul de microscopie de forţă atomică model alpha 300 Echipamentul de microscopie Raman confocală CRM 200 cu scaner este combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300.

01. camera video 02. unitatea de deflexie a razelor 03. lampa cu lumină albă pentru iluminare 04. obiectivul AFM cu cantilever 05. platforma de scanare 06. masa antivibraţie

Figura 4. Drumul razelor în microscopul de forţă atomică alpha300.

Microscopul AFM alpha 300 lucrează în următoarele moduri: contact mod, forţă laterală, acustic (tapping) mod, contact mod intermitent cu imagistica în fază şi amplitudine cu o rezoluţie de 16 bit, digitizare 5 MHz, şi frecvenţa 10-500 KHz. Sistemul dispune de un laser de deflexie 980 nm, o unitate de detecţie a deflexiei, masa antivibraţie 0.7 – 1000 Hz, > 1000 Hz pasivă. Aria de scanare este de 100 μm x 100 μm x 20 μm. Drumul razelor în interiorul microscopului de forţă atomică alpha 300 este prezentat în schema de mai sus (Fig. 4) [30]. 117

Parametrii optimi de funcţionare 1. Modul acustic (AFM AC-Mode) • Este modul de operare uzual, utilizat mai ales în cazul probelor moi (probe biologice). • Se folosesc tip-uri de Si3N4 fixate pe cantilever-uri cu frecvenţa de rezonanţă mare (200 – 300 kHz). • În vederea realizării alinierii se efectuează următorii paşi: • Se determină frecvenţa liberă de oscilaţie a cantileverului aplicând o tensiune de 0.05 –0.1 V • Se ajustează amplitudinea oscilaţiilor libere ale cantilever-ului până la o tensiune de 2 V • Se setează un setpoint de 1.5 V • Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. • Valorile tipice ale parametrilor pentru scanare sunt: • Număr puncte pe linie: 256 • Număr linii pe imagine: 256 • Timpul scanare pe linie: 0.5 – 2 s • În timpul scanării se ajustează P-gain şi I-gain astfel încât drumul înainte şi drumul înapoi să coincidă. • Apropierea tip-ului de substrat se face automat.

Imagine topografică AFM

Imagine fază AFM

2. Modul contact (AFM contact mode) - Permite înregistrarea de imagini, scanarea de-a lungul unei singure linii sau înregistrarea curbelor de forţă. - în vederea realizării alinierii se efectuează următorii paşi: - Se utilizează tip-ul de AFM dorit. 118

Se setează P-gain (proportional gain) la 5.0 şi I-gain (integral gain) la 5.0. - Apropierea tip-ului de substrat se face automat. - Valori tipice ale parametrilor pentru scanare: - Număr puncte pe linie: 256 - Număr linii pe imagine: 256 - Timpul scanare pe linie: 0.5 – 2 s peraturi.
• • • • •

3.3.2. Celula Linkam pentru efectuarea unor măsurători la diferite temDomeniul de temperatură: -196 - 600 °C. Stabilitate < 0.1 °C. Rata de încălzire: max 150 °C/min. Senzor din platină 100 Ω. Sistem de răcire a corpului celulei cu apă pentru temperaturi > 300 °C.

4.Bibliografie
I. R. Lewis, H. G.M. Edwards (Eds.), Handbook of Raman Spectroscopy, Marcel Dekker Inc. New York, 2001. 2. S. Astilean, Metode şi tehnici moderne de spectroscopie optica, Spectroscopia IR şi Raman, Editura Casa Cartii de Stiinta, Cluj-Napoca, 2002. 3. R. Petry, M. Schmitt, J. Popp, Raman Spectroscopy–A Prospective Tool în the Life Sciences, ChemPhysChem, 4, 14, 2003. 4. S. Schluecker, (Ed.), Surface Enhanced Raman Spectroscopy: Analytical, Biophysical and Life Science Applications, Wiley VCH, 2010. 5. M. Fleischmann, P. J. Hendra, A. J. McQuillan, Raman spectra of pyridine adsorbed at a silver electrode, Chem. Phys. Lett., 26, 163, 1974. 6. T. Vo-Dinh, SERS chemical sensors and biosensors: new tools for environmental and biological analysis, Sensors and Actuators B, 29, 183, 1995. 7. J. A. Creighton în Spectroscopy of Surfaces, Vol. 21 (Eds.: R. J. H. Clark, R. E. Hester), John Wiley & Sons, New York, 1988. 8. D. A. Weitz, M. Moskovits, J. A. Creighton în Surface-Enhanced Raman Spectroscopy with Emphasis on Liquid - Solid Interfaces, Vol. 2 (Eds.: R. B. Hall, A. B. Ellis),VCH, Deer field Beach, FL, pp. 197- 243, 1986. 9. G. A. Baker, D. S. Moore, Progress în plasmonic engineering of surface-enhanced Raman-scattering substrates toward ultra-trace analysis, Anal. Bioanal. Chem. 382, 1751, 2005. 10. K. Kneipp, H. Kneipp, P. Corio, S. D. M. Brown, K. Shafer, J. Motz, L. T. Perelman, E. B. Hanlon, A. Marucci, G. Dresselhaus, M. S. Dresselhaus, Surface-Enhanced and Normal Stokes and Anti-Stokes Raman Spectroscopy of Single-Walled Carbon Nanotubes, Phys. Rev. Let. 84, 3470, 2000. 11. N. Weissenbacher, B. Lendl, J. Frank, H. D. Wanzenboeck, B. Mizaikoff, R. Kellner, Continuous Surface Enhanced Raman Spectroscopy for the Detection of Trace Organic Pollutants în Aqueous Systems, J. Mol. Struct. 539, 410, 1997. 1.

119

12. X. Zhang, M. A. Young, O. Lyandres, R. P. Van Duyne, Rapid Detection of an Anthrax Biomarker by Surface-Enhanced Raman Spectroscopy, J. Am. Chem. Soc. 127, 4484, 2005 13. D. S. Grubisha, R. J. Lipert, H. Y. Park, J. Driskell, M. D. Porter, Femtomolar detection of prostate-specific antigen: an immunoassay based on surface-enhanced Raman scattering and immunogold labels, Anal. Chem., 75, 5936, 2003. 14. K. E. Shafer-Peltier, C. L. Haynes, M. R. Glucksberg, R. P. Van Duyne, Toward a Glucose Biosensor Based on Surface-Enhanced Raman Scattering, J. Am. Chem. Soc., 125, 588, 2003; C. R. Yonzon, C. L. Haynes, X. Zhang, J. T. Jr. Walsh, R. P. Van. Duyne, A glucose biosensor based on surface-enhanced Raman scattering: improved partition layer, temporal stability, reversibility, and resistance to serum protein interference, Anal. Chem. 76, 78, 2004. 15. L. Bao, S. M. Mahurin, R. G. Haire, S. Dai, Silver-doped sol-gel film as a surface-enhanced Raman scattering substrate for detection of uranyl and neptunyl ions, Anal. Chem. 75, 6614, 2003. 16. J. M. Chalmers and P. R. Griffiths, (Eds.), Handbook of Vibrational Spectroscopy, John Wiley and Sons, Chichester, pp. 1419-1428, 2002. 17. N. J., Everall, Depth Profiling with Confocal Raman Microscopy, Part II, Spectroscopy 19, 16, 2004. 18. C. G. Coates, J. J. McGarvey, On the Pulse: Andor tehchnology, 1(8), 2001. 19. G. Gouadec, P. Colomban, Raman Spectroscopy of nanomaterials: How spectra relate to disorder, particle size and mechanical properties, Progress în Crystal Growth and Characterization of Materials 53, 1, 2007. 20. E. Barborini, I. N. Kholmanov, P. Piseri, C. Ducati, C.E. Bottani, P. Milani, Engineering the nanocrystalline structure of TiO2 films by aerodynamically filtered cluster deposition, Appl. Phys. Lett. 81, 3052, 2002. 21. M. H. Frey, D. A. Payne, Grain-size effect on structure and phase transformations for barium titanate, Phys. Rev. B, 54, 3158, 1996. 22. A. Guinier, Théorie et Technique de la Radiocristallographie, Dunod, Paris, 1956. 23. M. F. Cerqueira, L. Rebouta, M. Andritschky, J.A. Ferreira, M. F. Da-Silva, Microcrystalline silicon thin films prepared by RF reactive magnetron sputter deposition, Vacuum 46, 1385, 1995. 24. D. G. Georgiev, M. Mitkova, P. Boolchand, G. Brunklaus, H. Eckert, M. Micoulaut, Molecular structure, glass transition temperature variation, agglomeration theory, and network connectivity of binary P-Se glasses, Phys. Rev. B, 64, 134204, 2001. 25. D. G. Georgiev, P. Boolchand, K.A. Jackson, Intrinsic nanoscale phase separation of bulk As2S3 glass, Phil. Mag., 83, 2941, 2003. 26. Y. Wang, J. Wells, D. G. Georgiev, P. Boolchand, K. Jackson, M. Micoulaut, Sharp Rigid to Floppy Transition Induced by Dangling Ends în a Network Glass, Phys. Rev. Lett., 87, 185503, 2001. 27. E. A. Carrasco, M. Campos-Vallette, P. Leyton, G. Diaz, R. E. Clavijo, J. V. Garcıa-Ramos, N. Inostroza, C. Domingo, S. Sanchez-Cortes, R. Koch, Study of the Interaction of Pollutant Nitro Polycyclic Aromatic Hydrocarbons with Different Metallic Surfaces by Surface-Enhanced Vibrational Spectroscopy (SERS and SEIR), J. Phys. Chem. A, 107, 9611, 2003. 28. http://www.witec.de/en/company/witecnews/19/crm200flyer.pdf 29. Manual WITec CRM200. 30. www.witec.de/en/download/AFM/alpha300Aflyer.pdf

120

Microspectroscopia Raman – partea a II-a
Conf. dr. Monica Maria Baia Cuprins
1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman................... 121 1.1. Substrate SERS ............................................................................................. 122 1.2. Identificarea unor bacterii ............................................................................. 122 1.3. Caracterizarea celulelor ................................................................................. 123 1.4. Diagnosticarea unor boli ............................................................................... 124 1.5. Aplicaţii în domeniul farmaceutic................................................................. 125 1.6. Aplicaţii în domeniul alimentar .................................................................... 125 1.7. Nanotuburi de carbon ................................................................................... 126 2. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS................................................................................... 126 3. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS .......................................... 128 4. Bibliografie ........................................................................................................... 130

1. Stadiul actual al cercetărilor exploratorii prin spectroscopie Raman
În ultima perioadă, odată cu dezvoltarea tehnologică a aparaturii aferente care permite înregistrarea rapidă a spectrelor Raman folosind diferite linii de excitare laser precum şi vizualizarea zonelor cu ajutorul microscopiei de forţă atomică sau a celei electronice de baleiaj, microspectroscopia Raman este din ce în ce mai mult aplicată în diverse domenii cum ar fi: medicină, biologie, studiul materialelor, geologie şi mineralogie, arta, ştiinţa mediului, controlul calităţii alimentelor, etc. [1]. Datele bibliometrice furnizate de Thomson Reuters ISI Web of Science confirmă faptul că în perioada 2001-2009 numărul publicaţiilor referitoare la spectroscopia Raman şi aplicaţiile ei s-a dublat de la 1931 înregistrate în 2001 la 4078 apărute în 2009 [1]. Această creştere a numărului de publicaţii este datorată, în principiu, următoarelor motive: (a) dezvoltării continue a metodei SERS; (2) progresului extraordinar înregistrat în domeniul fabricării controlate a nanomaterialelor şi a nanostructurilor; (3) creşterii eficienţei în imagistica biomedicală şi de diagnosticare a bolilor; (4) numărului tot 121

mai mare de aplicaţii în afara laboratorului (artă, arheologie, criminalistică, farmaceutice), (5) designului tot mai sofisticat şi controlat al pulsurilor laser ultrarapide utilizate în aplicaţii care exploatează efectele Raman neliniare. Din domeniul vast de aplicabilitate al spectroscopiei Raman se remarcă cu precădere aplicaţiile biomedicale, axate pe diagnosticarea unor boli, de identificare a unor bacterii, de investigare a unor celule vii, cele din domeniul nanoparticulelor şi nanomaterialelor, precum şi cele din domeniul artei şi arheologiei, farmaceutic şi alimentar. Astfel, în continuare vom face o trecere în revistă a principalelor domenii de aplicabilitate, făcând o referire concretă la cele mai recente cercetări.

1.1. Substrate SERS
În ultimii ani, metoda SERS s-a dezvoltat considerabil datorită obţinerii unor substrate SERS capabile să producă o amplificare importantă a semnalului Raman al speciilor adsorbite, reproductibilă şi stabilă în timp. Uniformitatea răspunsului SERS al substratelor depinde de morfologia lor. Astfel, s-a dovedit că gradul de amplificare poate fi controlat prin utilizarea unor metode de nanofabricare a structurii suprafeţei în termeni de mărime, formă şi distanţa dintre formaţiunile de pe suprafaţă, pe care adsorb speciile moleculare. Astfel, în ultima perioadă pe lângă substratele SERS obţinute prin litografie cu fascicul de electroni, litografie cu nanosfere de polistiren [2-4] au fost preparate şi substrate constând din nanoparticule anizotrope de forme diferite [5, 6]. De asemenea, au fost realizate noi substrate constând din nanotuburi de TiO2 pe care a fost depus Ag, sau nanofire de ZnO pe care a fost depus Au [7, 8] toate manifestând o activitate SERS remarcabilă.

1.2. Identificarea unor bacterii
Identificarea rapidă şi precisă a micro-organismelor a devenit o cerinţă importantă nu numai pentru analizele clinice, sau cele ale unor materiale frauduloase, ci şi în diferite aplicaţii cum ar fi producţia de medicamente sau tehnologia de procesare a mâncării. În toate aceste aplicaţii este de dorit ca timpul de cultivare a micro-organismelor să fie minimizat pentru a prescrie pacienţilor în timp util tratamentul corespunzător sau pentru a reduce timpul în care unităţile de producţie sunt închise din cauza unor disfuncţionalităţi. Majoritatea metodelor convenţionale de identificare a bacteriilor se bazează pe efectuarea unor teste chimice după cultivarea microorganismelor în diferite medii şi necesită timp îndelungat. Dintre tehnicile 122

care permit identificarea rapidă a micro-organismelor spectrosopia Raman a devenit una dintre cele mai promiţătoare metode [9] . Procedura de caracterizare a unei celule bacteriene cu ajutorul spectroscopiei Raman constă în patru etape: colectarea micro-organismelor, localizarea moleculelor biologice cu ajutorul unor markeri fluorescenţi, înregistrarea spectrelor Raman şi compararea lor cu alte spectre existente în baze de date în scopul identificării bacteriilor. Combinând rezultatele Raman cu o metodă de clasificare bazată pe chemometrie s-a reuşit identificarea subspeciei unor bacterii cu o probabilitate de 98% [10]. O altă modalitate de identificare a bacteriilor şi/sau a sporilor este cu ajutorul metodei SERS. În acest caz, se detectează prezenţa unui compus chimic, cunoscut ca biomarker al sporilor sau al bacteriei [11]. Relativ recent, a fost dezvoltată o metodă de identificare a unor bacterii pe un cip microfluidic [12]. Prin aplicarea unui câmp electric pe un electrod de aur s-a reuşit sortarea bacteriilor, concentrarea lor şi apoi, prin înregistrarea specrelor SERS în cip, cercetătorii au fost capabili să identifice fiecare bacterie pe baza semnăturii sale spectrale. Testele au fost efectuate pentru două tipuri de bacterii Gram positive (Staphylococcus aureus) şi Gram negative (Pseudomonas aeruginosa). Cu ajutorul acestei metode se îmbunătăţeste semnificativ timpul şi efortul necesar identificării diferitelor bacterii din mâncare sau altă materie organică.

1.3. Caracterizarea celulelor
Spectroscopia Raman este o metodă sensibilă pentru studiul biochimic al celulei fiind capabilă să pună în evidenţă modificări care apar în urma interacţiunii cu diferiţi agenţi [13]. Pe de altă parte, microscopia de forţă atomică oferă informaţii despre topografia suprafeţei, adeziunea şi elasticitatea celulară a unei celule. Prin utilizarea combinată a celor două metode pot fi investigate proprietăţile biomecanice şi biochimice ale celulelor vii în diferite condiţii fiziologice [14]. Spectrele Raman ale celulelor vii constă din benzi corespunzătoare biopolimerilor existenţi în celule (lipide, proteine, ADN, ARN). Cu ajutorul spectrelor Raman este posibilă discriminarea celulelor vii de cele moarte. Acest lucru este extrem de important în realizarea unui biosenzor. De asemenea, cu ajutorul spectroscopiei Raman este posibilă monitorizarea în timp a interacţiunii dintre celule şi diverse medicamente, precum şi diferite elemente toxice folosite în bioterorism, în vederea stabilirii efectelor acestei interacţiuni.

123

1.4. Diagnosticarea unor boli
După introducerea spectroscopiei Raman în studiul pielii de către Williams et all în 1992 [15] utilizarea ei în acest domeniu a devenit tot mai frecventă. În prezent, spectrele Raman înregistrate pe piele sunt bine analizate şi pe baza diferenţelor s-a pus în evidenţă existenta unor boli [16, 17]. Deoarece intensitatea semnalului Raman este scăzută, timpii de achiziţie sunt extrem de lungi şi din această cauză aplicaţiile clinice sunt reduse. Relativ recent, s-a reuşit implemetarea spectroscopiei Raman în aplicaţii clinice prin intermediul unui sistem capabil să înregistreze şi să analizeze în timp real spectre Raman in vivo [18]. Cu ajutorul acestui sistem s-a reuşit efectuarea unei evaluări a pielii unor voluntari precum şi diagnosticarea unor boli ale pielii. S-a constatat că există regiuni spectrale care prezintă benzi specifice pentru piele provenită din diferite regiuni ale corpului. De asemenea, s-a constatat că semnăturile spectrale specifice ale pielii diferă de la un individ la altul. Astfel, prin evaluarea raportului dintre conţinutul de lipide şi proteine se poate face o evaluare a pielii precum şi o diagnosticare cu ajutorul spectroscopiei Raman [19]. De asemenea spectroscopia Raman permite identificarea şi monitorizarea melaninei, un pigment natural care acţionează ca un scut împotriva radiaţiei solare, înlătură speciile chimice active şi produce radicali activi care afectează ADN-ul. Cancerul este o boală complexă indusă de o instabilitate genetică şi o acumulare a unor alternări moleculare multiple [20]. Deoarece diagnosticarea timpurie implică o rată de supravieţuire ridicată, un interes deosebit l-a avut dezvoltarea unor metode de detecţie moleculară care să permită vizualizarea unor biomarkeri sau a unor evenimente celulare şi să indice starea de fapt a cancerului. Spectroscopia Raman este o metodă utilă în diagnosticarea cancerului datorită sensibilităţii sale de a detecta modificări moleculare extrem de mici care sunt asociate cu cancerul, cum ar fi o creştere a raportului dintre nucleu şi citoplasmă, existenţa cromatinei dezordonate, o activitate metabolică crescută şi modificări ale cantităţilor de lipide şi proteine [21]. În principal spectroscopia Raman a fost aplicată la diagnosticarea cancerului de piele, de sân, de tract gastrointestinal şi cervical sau de col uterin [21]. Senzorii optici bazaţi pe metoda SERS au fost în ultima perioadă destul de des folosiţi pentru diagnosticarea in vitro şi in vivo a cancerului [22]. Ei sunt capabili să ofere informaţii moleculare specifice despre moleculele ţintă de interes, fără o marcare prealabilă a acestora.

124

1.5. Aplicaţii în domeniul farmaceutic
Spectroscopia Raman a devenit o metodă rapidă, directă şi nedistructivă în analizele farmaceutice, odată cu dezvoltarea aparatelor şi a metodelor chemometrice de analiză. Majoritatea studiilor se bazează pe investigarea ingredientului farmaceutic activ şi în consecinţă, bazele de date existente conţin informaţii referitoare la aceste ingrediente. Reletiv recent [23] a fost publicată o bază de date cu spectre Raman ale mediului excipient în care este înglobat ingredientul farmaceutic activ, astfel încât se pot realiza analize complete ale produselor farmaceutice. În ultima perioadă, creşterea cantităţii de medicamente contrafăcute pe piaţă pune în pericol sănătatea cetăţenilor şi ridică un semnal de alarmă. Aceste produse pot fi dăunătoare sănătăţii deoarece conţin impurităţi inodore, pot fi inactive şi/sau să aibă o absorbabilitate scăzută sau chiar inexistentă. De asemenea, aceste medicamente pot conţine alte ingrediente decât cele dorite, cantităţi incorecte ale agenţilor farmaceutici activi sau ambalaje necorespunzătoare. Cu ajutorul spectroscopiei Raman se pot obţine informaţii specifice legate de identificarea ingredientului farmaceutic activ, a mediului excipient, precum şi informaţii utile legate de identificarea elementelor necunoscute [24].

1.6. Aplicaţii în domeniul alimentar
Melamina este un ingredient folosit la obţinerea plasticului, dar este frecvent adăugat în mod abuziv şi în mâncare, pentru a crea impresia falsă a unui conţinut ridicat de proteine, deoarece această moleculă conţine un număr mare de atomi de azot. În anul 2007, aproximativ 1700 de câini şi pisici din SUA au murit ca urmare a consumului de mâncare contaminată cu melamină [25]. În ţesuturile şi urina animalelor moarte au fost detectate, pe lângă melamină, şi cantităţi reduse de acid cianuric, amelina şi amelida, care au rezultat cel mai probabil din descompunerea unor derivaţi ai melaminei [26]. În anul 2008, 54000 de copii au fost intoxicaţi iar 5 au murit ca urmare a consumului de lapte contaminat, produs în China. Mai târziu s-a aflat că melamina a fost introdusă intenţionat în multe alte produse lactate produse în China şi destinate exportului [25]. Spectroscopia Raman a fost utilizată în analizarea melaminei din gluten, hrana pentru pui, prăjituri şi tăiţei [27]. A fost de asemenea identificată melamina din făina contaminată, gluten din porumb, hrana pe bază de soia, lapte praf şi a fost stabilit un algoritm de analiză calitativă şi cantitativă a melaminei din amestecuri [26]. În plus, spectroscopia Raman împreună cu 125

Acest fapt ar permite utilizarea acestei metode pentru monitorizarea on-line a conţinutului acestor substanţe în sucurile aflate în diferite stagii de producţie. printre tematicile de cercetare ale platformei se regăsesc multe dintre cele prezentate anterior. Limita de detecţie a melaminei a fost de 1%. 2. această metodă ar putea oferi informaţii şi despre caracteristicile lor biochimice. monitorizarea apei.imagistica Raman au fost utilizate pentru o testare rapidă a hranei în vederea detecţiei melaminei pentru a creşte siguranţa şi securitatea publică. S-a demonstrat modul în care deschiderea sau închiderea reversibilă a nanotuburilor poate fi utilizată pentru a monitoriza cu succes procesul de umplere [32]. Tematici de cercetare ale laboratorului de microscopie Raman confocală din cadrul platformei ICI-BNS În prezent. nanotuburi de carbon cu un perete sau cu mai mulţi pereţi. pe lângă faptul că ar detecta particule nedorite. Spectroscopia micro-Raman confocală a fost utilizată şi la stabilirea compoziţiei unor sucuri de fructe [28]. S-a determinat existenţa a trei componente importante ale sucurilor de fructe şi anume pectina. în special [30]. etc. microspectroscopia Raman poate fi o metodă de analiză complementară sau alternativă măsurătorilor de turbiditate care sunt de obicei utilizate în industria alimentară în producţia berii. Heise şi colaboratorii săi [31] au caracterizat materiale pe bază de carbon utilizând spectroscopia Raman prin compararea spectrelor înregistrate pe filtre cu nanotuburi de carbon. În toate aceste studii s-a urmărit banda caracteristică a melaminei de la 676 cm-1. Spectroscopia Raman a fost de asemenea aplicată la investigarea nanomaterialelor încapsulate în nanotuburi de carbon pentru a determina procesul de umplere a nanotuburilor cu C60. Nanotuburi de carbon Spectroscopia Raman este o metodă consacrată pentru caracterizarea nanotuburilor de carbon. Astfel. fructoza şi β-carotenul. 1.7. se desfăşoară cercetări interdisciplinare axate pe fabricarea şi biofuncţionalizarea unor nanoparticule de metal nobil. Prin utilizarea combinată a spectroscopiei Raman cu alte tehnici de analiză se pot obtine informaţii cantitative referitoare la particulele nedorite prezente în sucurile de fructe [29]. În plus. precum şi a unor 126 . carbon poros grafitizat şi grafit. în cadrul grupului care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu un modul de microscopie de forţă atomică (AFM) model alpha 300. C59N şi antracena. Astfel. în general şi a celor funcţionalizate.

41. În cadrul unui studiu.).) cu nanoparticule metalice de forme şi dimensiuni diferite [39-41. Selecţie de imagini a substratelor SERS ordonate (a) şi a nanoparticulelor de metal nobil sintetizate (b). chimice 127 . glutation etc. folosind metode de auto-asamblare.nanostructuri hibride. O mare parte a activităţii de cercetare este concentrată pe obţinerea de noi substrate SERS. O parte a substratelor SERS obţinute. cu scopul de a permite dezvoltarea unor noi aplicaţii spectroscopice şi plasmonice. albumină. Toate aceste studii contribuie la înţelegerea mecanismelor care stau la baza amplificării SERS. 44]. s-a reuşit corelarea activităţii SERS cu topologia substratului cu ajutorul imagisticii Raman [35]. proteine şi biopolimeri relevanţi (PEG. 1b). În figura de mai jos (Fig. S-a studiat interacţiunea diferitelor biomolecule (triptofan. s-a dovedit a avea proprietăţi multifuncţionale atât ca senzor SERS cât şi ca senzor LSPR [33. etc. Câteva dintre nanoparticulele obţinute au fost utilizate în aplicaţii biomedicale cu impact în nanomedicină bazate pe proprietăţile optice. (a) (b) Figura. chitosan. 1) este prezentată o selecţie a tipurilor de substrate SERS ordonate obţinute (Fig. 1. 42]. Astfel. iar în cazul celor dezordonate au fost obţinute diferite tipuri de nanoparticule metalice care au fost asamblate pe substrate solide funcţionalizate/nefuncţionalizate anterior [37-45]. 43. Prin combinarea imagisticii AFM cu imaginile SERS înregistrate prin microspectroscopie Raman confocală s-a reusit evidenţierea implicării mecanismului plasmonic de amplificare la semnalul de bază SERS [36]. ordonate şi dezordonate. mai ales cele constând din nanoparticule de metal nobil. în cazul substratelor ordonate s-au folosit nanosfere de polistiren peste care au fost depuse filme metalice [33-36]. 1a) şi a nanoparticulelor sintetizate şi testate din punct de vedere a capacităţii lor de amplificare a semnalului Raman al unor specii moleculare adsorbite pe suprafaţa lor (Fig.

şi osteogeneza imperfectă.şi termice ale nanoparticulelor de aur în detecţia şi tratamentul la nivel celular al cancerului (hipertermie locală indusă laser) sau în evaluarea profilului de toxicitate a nanopartirculelor în medii celulare. s-ar putea aborda noi tipuri de experimente bio-medicale de diagnosticare a unor boli cum ar fi cele ale sistemului osos sau arteroscleroza. Astfel. Se ştie că 128 . 3. Tematici de cercetare posibil de implementat în cadrul laboratorului de microscopie Raman confocală al platformei ICI-BNS Având în vedere stadiul actual al cercetărilor exploratorii prin spectroscopie Raman precum şi dotările existente în cadrul platformei. În cadrul unui alt studiu s-a dovedit că o serie de nanoparticule de argint de formă triunghiulară invelite în chitosan posedă activitate bactericidală. Au fost efectuate numeroase investigaţii cu scopul înţelegerii spectrelor. cercetătorii au considerat spectroscopia vibraţională ca o metodă capabilă să furnizeze informaţii legate de diagnosticarea bolilor care apar la nivelul ţesuturilor muscularo-scheletale [46. Există numeroase studii în literatură referitoare la utilizarea metodelor spectroscopice complementare Raman şi de absorbţie în IR în analizarea osului şi a cartilajelor. caracteristici care conferă acestui tip de markeri SERS aplicabilitate ca şi agenţi imagistici în interiorul organismelor vii [44]. fiind capabile să distrugă Staphylococcus aureus [45]. care constă dintr-o serie de defecte genetice care afectează scheletul. conservându-şi identitatea Raman in vitro. 47]. În majoritatea studiilor spectroscopia Raman a fost acompaniată de imagistica Raman sau AFM. pot fi utilizate în terapia fototermică a cancerului [40]. la animale şi în câteva cazuri şi la oameni. Doar în ultimii ani. realizându-se şi studii complementare de absorbţie în IR. de obicei învelite într-un strat polimeric biocompatibil. şi corelării caracteristicilor spectrale cu modificările care apar datorită vârstei sau a diverselor boli. s-a demonstrat că o serie de nanobastonaşe de aur sau alte nanoparticule de metal nobil anizotrope. în grupul de cercetare care utilizează echipamentul de microscopie Raman confocală WITec CRM 200 combinat cu modulul de microscopie de forţă atomică (AFM) model alpha 300. Au fost de asemenea efectuate studii de detecţie SERS intracelulare utilizând nanoparticule de aur PEGylate şi marcate cu coloranţi [44] Rezultatele obţinute demonstrează faptul că nanoparticulele prezintă stabilitate. o boală metabolică. Au fost investigate două dintre cele mai importante boli ale oaselor şi anume osteoporoza.

De asemenea au fost investigate prin spectroscopie Raman efectele de confinare a fononilor optici în materialele nanostructurate [53]. infarct miocardic. arteriopatie obliterantă etc. Arteroscleroza stă la baza apariţiei majorităţii bolilor cardiovasculare (angina pectorală. elastina. Metodele spectroscopice complementare Raman şi de absorbţie în IR sunt capabile să coreleze informaţiile histopatalogice ale unei aorte afectate de arteroscleroză cu compoziţia chimică a unei aorte sănătoase [49-51]. şi se pot localiza plăcile ateromatoase prin prezenţa benzilor caracteristice carbonatului de calciu [49-51]. Se pot monitoriza benzile caracteristice proteinelor (colagen. Ea se datorează prezenţei aşa-numitelor plăci ateromatoase pe pereţii arterelor. prin depunerea de calciu se formează plăcile ateromatoase. ea devine turbulentă şi inegală. actina. în spectrul Raman. Ele stânjenesc din ce în ce mai mult circulaţia liberă a sângelui prin artera afectată: din laminară şi fluentă. Osteogeneza imperfectă este o maladie genetică al cărei principal semn clinic este fragilitatea osoasă crescută. Aceste modificări ale structurii sunt reflectate în spectrele Raman şi IR ale probelor [46.un os afectat de osteoporoză are un grad de cristalinitate crescut şi un domeniu mai îngust de cristalinitate decât osul sănătos. deoarece absenţa periodicităţii la dimesiuni sub cele ale particulei relaxează regulile de selecţie ale fononilor optici în regiunea centrală a zonei Brillouin şi prin urmare. Studii efectuate pe nanostructuri poroase 129 . Aceste plăci se formează datorită colesterolului şi grăsimilor prezente în cantităţi excesive în sânge (datorită greşelilor de alimentaţie) care se "infiltrează" în pereţii arterelor. Această boala apare ca urmare a mutaţiilor de la nivelul genelor care codifică producerea de colagen tip I. etc. Această confinare duce la modificări ale spectrului de vibraţie al materialelor nanostructurate în comparaţie cu cel al materialului bulk. accident vascular cerebral. maladia se tratează medical cu aminobisfosfonaţi iar spectroscopia poate juca un rol important în urmărirea progresului tratamentului. 47]. vor exista contribuţii ale fotonilor din afara acestei zone. manifestată în special prin fracturi la nivelul oaselor lungi. S-a constatat că în principiu metodele spectroscopice vibraţionale pot fi atât un instrument de diagnosticare cât şi o metodă care să monitorizeze progresul tratamentului asupra bolii. În cadrul unui studiu a fost analizată dependenţa deplasării benzilor Raman în funcţie de dimensiunea unor nanocristale [52]. spectroscopia Raman s-a dovedit a fi o metodă fezabilă în studiul materialelor nanostructurate. În ultima perioadă. În prezent.) şi lipidelor. Metodele spectroscopice vibraţionale sunt capabile să identifice ţesuturile anormale afectate de această boală [48]. În timp. cardiopatie ischemică.).

monumente de piatră [56]. B 110. Nafie. L. Cu ajutorul acestei metode se obţin informaţii despre compuşii moleculari aflaţi în probele supuse analizei. Astfel. 41. Li şi colaboratorii săi [58] au realizat analiza decoraţiunilor şi au identificat pigmenţii folosiţi la decorarea unui covor chinezesc din secolul al 5-lea cu ajutorul tehnicilor complementare micro-Raman şi FT-IR. aşa cum au fost observate în cazul şi sau Ge poros. Part IV. J. ceramici. 853. 2010. Pe de altă parte. Bom. S. Gold Films Deposited over Regular Arrays of Polystyrene Nanospheres as Highly Effective SERS Substrates from Visible to NIR. M. pot fi diferenţiate operele de artă veritabile de cele contrafăcute sau falsificate. sculpturi. 2002. un număr de cinci picturi în miniatură achiziţionate de Muzeul Victoria şi Albert în 2008. Sackmann. 2. Metal Film over Nanosphere (MFON) Electrodes for Surface-Enhanced Raman Spectroscopy (SERS): Improvements în Surface Nanostructure Stability and Suppression of Irreversible Loss. Raman Spectrosc. Metoda este prezentă în departamentele de conservare şi restaurare a celor mai recunoscute muzee şi librării din lume şi este utilizată pentru identificarea unor materiale. efectele de confinare pot fi utilizate pentru a determina dimensiunea acestora [54]. Baia. L. McFarland. A. J. 1566. B 106. În acest mod. J. C. Astilean. Acest lucru a fost confirmat cu ajutorul microspectroscopiei Raman [57]. P Van Duyne. De exemplu. 4. Phys. A. presupuse a fi lucrări medievale autentice. 2006. sticle. D. Phys. A. de la pigmenţi anorganici la biomateriale. acompaniată în ultimii ani de microscopie şi de tehnica SERS. Baia. Materny. spectroscopia Raman. Balster. 23982. S. 4. Recent advances în linear and nonlinear Raman spectroscopy. a devenit o metodă de investigare extrem de utilă în domeniul patrimoniului cultural. Popp. Dick. Nanostructured Gold Surfaces as 3. având în vedere aceste considerente şi ţinând seama de echipamentele existente în cadrul platformei. utilizate în artifacte ca de exemple manuscrise. textile. picturi. Chem. printre tematicile de cercetare care ar putea fi abordate în viitor s-ar putea regăsi atât studiul unor materiale nanostructurate de tipul nanofirelor şi a filmelor nanostructurate cât şi al unor obiecte din patrimoniul cultural. J. L. A. Studii Raman ale nanofirelor sau nanoconurilor de GaP au dovedit faptul că există o dependenţă între intensitatea spectrală şi caracterul spaţial al radiaţiei Raman împrăştiate şi dimensiunea. R. L. T. Chem.Bibliografie 1. M. Haynes. forma şi compoziţia nanofirelor [55]. s-au dovedit a fi pictate la sfârşitul secolului al 19-lea sau începutul secolului 20. 130 .semiconductoare au dovedit faptul că în cazul unor unităţi structurale de câţiva nanometri.

Wu. H. D. H. 2007. Billheimder. Zhou. 89–165. M. Raman Spectrosc. Nie.-L. în Biomedical Photonics Handbook. 515-522. M. P. 40. 40. G. 24. 7. Microscopy: Science. A. 9. D. G. Integrated real time Raman system for clinical în vivo skin analysis. T. 7. Roguska. Raman Spectrosc. J. 38. Vo-Dinh. Washington DC. 455-474. Popp. Yu. De Beer. Cheng. 81. I. M. Dolata. de Veij. Remon. 1343. 17. Roesch. R. M. J. 2009. Lewandowska. Surface-enhanced Raman scattering spectroscopy via gold nanostars. 461. McEwen. And Tech. The use of Raman spectroscopy în the detection of counterfeit 131 . pp. Ronneberger. J. 2006. New Developments în Biomedical Engineering. 2003.-C.1117/2. Qian. R. Popp. S. Pisarek..Weinheim. 12. pp. Lasers în Surgery and Medicine.-D. Schmautz. Puppels. Chem. J. 2009. Hogan. 1992. McLean. Identification of micro-organisms by Raman spectroscopy. D. Santos. Kudelski. Rocha. Petry. Raman investigations of TiO2 nanotube substrates covered with thin Ag or Cu deposits. Hanahan. Díaz (Eds. H.. Ed. Lieber. L. M.. 2003). 572.-Q. Z. P. 11. Witkowski. 37. Lin. (CRC Press. A. 15. Shanker. D. 2010. H. 912. Fourier transform Raman spectroscopy a novel application for examining human stratum corneum. Domenico Campolo. Notingher. 40. Raman Spectrosc. Cell 100. Raman Spectrosc. Sensors. Combined în Vivo Confocal Raman Spectroscopy and Confocal Microscopy of Human Skin. 484. 2010. P. Surface-enhanced Raman spectroscopic detection of a bacteria biomarker using gold nanoparticle immobilized substrates. A. Motzkus. Williams. Biomicrofluidics 4. J. Biophys. Reproducible Substrates for Surface Enhanced Raman Spectroscopy. 2009. Thiele.). 183. J. T. Cheng. Pharm. Weinberg. H. Combined AFM/Raman microspectroscopy for characterization of living cells în near physiological conditions. 10. D. A. M. 14. Wiley-VCH. Peschke. Zhao. Moens. Zhao. Reference database of Raman spectra of pharmaceutical excipients. I-F. 2007. Ellis. Technology. FORMATEX 2010. Janik-Czachor. 30:1–30:27. 1652. M. D. G. 2008. Riesenberg. B. R.. J. Size-dependent SERS enhancement of colloidal silver nanoplates: the case of 2-amino-5-nitropyridine. Esenturk. Int.-W.-W. J. N. P. 10. A. J. A. 21. SPIE Proceeding. 297. HightWalker. R. 2009. C. Wu. Lankers. McLean. A.A. 277. P. R. Raman Spectrosc. Shen. Burkhardt. 40. C. Mahadevan-Jansen. J. pp. A dielectrophoretic chip with a roughened metal surface for on-chip surface-enhanced Raman scattering analysis of bacteria. 2000. Online monitoring and identification of bioaerosols (OMIB). Barry. The Hallmarks of Cancer. S. Ed. S.0856. Lin. H. 23. Huan. J. Skin Res.-L. R. Krause. 86. Zeng. M. L. Lui. I. C. 19. Vandenabeele. Lui. 6. H. A. Harz. M. Khan. Zeng. Zanchet. 40. 14. Edwards.. H. 9902. 1539. Applications and Education A. H.5. Mahadevan-Jansen. M. Sant’Ana. 85. 22.. Gold-coated zinc oxide nanowire-based substrate for surface-enhanced Raman spectroscopy. 81. M. D. ch. H. 13. X. 8. 2009. Raman Spectrosc. G. 2009. Y. A.-Y. R11. 2008. I. Temperini. B. Biophotonics: Vision for a better Health Care. D. în vivo nonmelanoma skin cancer diagnosis using Raman microspectroscopy. M.-Y. 18. T. P. A. E. 034104. A. H. Méndez-Vilas and J. Raman Spectroscopy Cell-based Biosensors. R. S.1200708. T. 2008. 16. J. 20.Wuttig. O. C. 57. H. 40. InTech. Majumder. J. Lucassen. Hofer.-C. M. Anal.. Schuele. S. A. K. G. Single-molecule and single-nanoparticle SERS: from fundamental mechanisms to biomedical applications. pp. Caspers. Chang. Chem Soc Rev.

38. D. 43. Astilean. 2007. Astilean. Plank. A. Multifunctional plasmonic sensors on low-cost subwavelength metallic nanoholes arrays. L. S. R. Srivastava. S. Olkhovyk. M. Farcau . 344. F. M. H. S. W. Lin. 2010. Nanopart. Biro. D. Pfeiffer. V. Astilean. M. 2007. S. S. 2010. J. Astilean. Localized surface plasmon resonance (LSPR) and surface-enhanced Raman scattering (SERS) studies of 4-aminothiophenol adsorption on gold nanorods. D. fluorescence. Chao. 420. 38. D. Appl. C. Y. 47. M. S. Spectrosc. Silver half-shell arrays with controlled plasmonic response for fluorescence enhancement optimization. 29. 2008. P. Struct. Maniu. He. 2011. N. Instrum. 11717.. 42. 21. ChemPhysChem 10. 2008.. Heise. 2009. 95. S. Multilayer Structures of Self-Assembled Gold Nanoparticles as a Unique SERS and SEIRA Substrate. Hasi.. Priore. 38. 26. Astilean. 28. 477. Commun. N. Srivastava. 2049. Boca. 73. J. M. Sensors. Mol. Mita. 372. Investigation on Clarified fruit juice composition by using visible light micro-Raman spectroscopy. O. Detoxification of gold nanorods by conjugation with thiolated poly(ethylene glycol) and their assessment as SERS-active carriers of Raman tags. Astilean. P. Canpean. Gabudean. D. H. S. 2009. M. Sect. C. S. Detection of Melamine în Gluten. B. 33. 30. 36. Yang. R. 235601. Baia. dual LSPR-SERS plasmonic sensors of high sensitivity and stability based on chitosan coated anisotropic silver nanoparticles. A. H. Lancet. Li. Tagmatarchis.and multi-walled nanotubes. 1444. L. Diano. Farcau. Appl. Chem. Methods Phys. F. Phys. The study of Raman enhancement efficiency as function of nanoparticle size and shape. January/February 2005. J. and SERS spectroscopyJ. 2007. Awika. single. E. Chan. M. Raman Spectrosc. G. C. A. Ojha. B 267. 673. Astilean. Lab Chip 9. Astilean. 2843. Camerlingo. Astilean. S. Raman Spectrosc. F. Res. Liu. 2011. Baia. M. Characterisation of carbonaceous materials using Raman spectroscopy: a comparison of carbon nanotube filters. H. V. Potara. Astilean. Ch. Gabudean. Astilean. T129. J. 3861. K. Res. 2009. R. I. and adulterated pharmaceutical products. Chicken Feed. 37. 35. Farcau.25. S. D. Lett. graphitised porous carbon and graphite. 32. K. Tuschel. Lepore. 40. Kuzmany. Raman scattering from nanomaterials encapsulated into single wall carbon nanotubes. and Processed Foods Using Surface Enhanced Raman Spectroscopy and HPLC. 39. S. Gabudean. S. Evidence of a surface plasmon-mediated mechanism în the generation of the SERS background. J. Y. 704. C. Y. J. Chen. 2010. Wiley: New York. Schaman. A. Focsan (Iosin). Canpean. 406. 1106. G. S. J. Raman spectroscopy of covalently functionalized single-wall carbon nanotubes. Raman Spectrosc. Martens. F. Graupner. 2009. Boca. Multivariate Calibration. Potential of Raman spectroscopy and imaging methods for rapid and routine screening of the presence of melamine în animal feed and foods. Chem C 114. Study of tryptophan assisted synthesis of gold nanoparticles by combining UV–Vis. L. Ledoux. J Food Sci. 3625. 63. Kim. Solution-phase. Pagona. Chem. Maniu. Mapping the SERS Efficiency and Hot-Spots Localization on Gold Film over Nanospheres Substrates. Zenone. 31. Iosin. 2009. 993. C. Toderas. T. Mustapha. 1993. Nucl. Baldeck. Delfino. Phys. 7. A. Nanotechnology 21. Simon. M. 41. R. V. Kuckuk. Griffiths. 193110. W. 2011. Mater. J. Noes. M. Rotas. Formation 132 . 12. S. 27. American Pharmaceutical Review. 3574. G. 2009. A. Farcau. C. Public-health risks of melamine în milk products. 40. 34. Asthana. R.

On the Raman scattering from semiconductor nanowires. Biomed. Popescu. 47. Chem.. T. A. 40. L. Adar. Elucidation of the atherosclerostic disease process în apo E and wild type mice by vibrational spectroscopy. M. Mat. Nogueira. Cao. R. Chavantes. Boca.-Y. 38. 2009. Irmer. 2011. Raman Spectrosc. A. D.-S..1 of 9). 2009. 46. 60. Synergistic Antibacterial Activity of Chitosan–Silver Nanocomposites on Staphylococcus Aureus. N. Ricci. J. V. Rugina. Raman Spectrosc. McHugh. A. S. 2006. J. Raman scattering of nanoporous semiconductors. Laane Ed. 11.133-173. M. W. Sivasubramanian. 2007. Flower-shaped gold nanoparticles: synthesis. S. 055702. J. 51. 2031. 2009. K. 031117. L. C. V. H. A. Nanotechnology 22. 58. Jakab.-J. J. Salis.. B. J. 55. S. Jr. C. Raman spectroscopy study of atherosclerosis în human carotid artery. A. J. 10. “Raman Spectroscopy în Art and Archaeology: A New Light on Historical Mysteries” în Frontiers of Molecular Spectroscopy.-M. Y. Appl. P. A. Raman Spectrosc. Pigment identification and decoration analysis of a 5th century Chinese lacquer painting screen: a micro-Raman and FTIR study. Optics. Fang. Astilean. S. M. G. O.-L. An analytical form for the Raman shift dependence on size of nanocrystals. Jelicks. C. S. 2006. J. J. 57. 38. 7 5321A-11 (p. L. Schulmerich. 604. Xie. Zângaro. Burgio. Vanasse. Spectroscopic investigation of modern pigments on purportedly medieval miniatures by the "Spanish Forger". E. Smukler. T. Anedda. J. P. Identifying chemical changes în subchondral bone taken from murine knee joints using Raman spectroscopy.SPIE 2004. Arora. P. of size and shape tunable gold nanoparticles în solution by bio-assisted synthesis with bovine serum albumin în native and denaturated state. T. J. 49. B. R. K A.. 52. Potara. Naudin. E. F. Pintea. Elsevier 2009. C.-F. Hark. J. characterization and their application as SERS-active tags inside living cells. Li. Yang. Valenzuela. Wang. A.44. 2005. Damert. 2002. R. L.M. pp. 634. H. . 56. Matousek. A. A. Edwards. J. He. Raman spectroscopy of optical phonon confinement în nanostructuredmaterials. Dehring. 50. M. M. Raman Spectrosc. X. Goldstein. B. Nabet. Pasqualucci. Rajalakshmi. G. Bakker Schut. 1134. V. Y. 38. V. Yeh. R. Nanotechnology 22. C. Martin. 40. 1911. D. K. 1341. 60. E. 2011. 45. C.. L. Spectrosc. Spanier. 53. 697. van de Poll. Morris. M. Raman Spectroscopy.. Transcutaneous fiber optic Raman spectroscopy of bone using annular illumination and a circular array of collection fibers. Rousseau. 2007. J. Roessler. J. 64. Phys.G. V. M. R. 54. D. Barbu-Tudoran. Laim. 48. 33. 060502. 544. M. L. Astilean. T. 2006. A. A. J. Canpean. van der Laarse. 2007. Dooley. Clark. D. Morris. M. Biomed. J. Silveira. 939. 40. Inverse Spatially Offset Raman Spectroscopy for Deep Noninvasive Probing of Turbid Media. Raman Spectrosc. în situ investigation of the chemical composition of ceroid în human atherosclerosis by Raman spectroscopy. Shi.. A. Raman Spectrosc. Ravindran.. 2011. Crane. Opt. Applied Spectroscopy. T. T. D. S. Pacheco. R. 129. Puppels. 133 . 135101. G. Q.

.............................. 141 7............. SPECTROMETRUL IR Spectroscopia de absorbţie în infraroşu Lect.......... Introducere .................................................................. În unda de lumină.... Legea Lambert-Beer ....................... câmpul electric oscilează cu o frecvenţă de aproximativ 1015 Hz. Bibliografie ..................................... 135 3................. 134 2............................................................................ cum ar fi un atom. sau un solid prezintă o distribuţie de sarcină specifică................ ceea ce înseamnă că modificarea distribuţiei de sarcină va avea loc 134 ... câmpul electric (şi într-o măsură mai mică şi cel magnetic) al undei electromagnetice poate să modifice distribuţia de sarcină şi în acest fel să inducă un moment de dipol..................... 138 5....... Moduri de vibraţie ..... 146 1...... 139 6. Introducere Materia este formată din electroni. Fiecare subdiviziune a materiei........... În interacţiunea luminii cu materia.......................... dr............. Nicolae Leopold Cuprins 1...... ci sunt sarcini pozitive şi negative ce formează dipoli şi multipoli electrici............. o moleculă........................ ioni pozitivi şi negativi.... Aceste sarcini nu sunt doar sarcini izolate (monopoli)................................................ nuclee............................................IV............ 137 4.. Instrumentaţia şi metodologia obţinerii spectrelor IR ........................ Reguli de selecţie pentru spectroscopia IR ............................................... Oscilatorul armonic ...........

unde moleculele se pot roti liber. acele vibraţii care duc la o modificare a polarizabilităţii moleculare vor fi active Raman. la rându-i. Astfel. modificări (oscilaţii) ale distribuţiei de sarcină. un câmp electric. activitatea unui mod vibraţional depinde de simetria lui şi de simetria moleculei. O vibraţie va fi activă IR dacă are loc o variaţie a momentului de dipol în timpul vibraţiei. Molecula are aşadar 3N grade de libertate. şi alte două (molecule liniare) sau trei (molecule neliniare) grade sunt necesare pentru a specifica mişcarea de rotaţie. Aceste procese. Probabilitatea specifică. procesele sunt descrise de anihilarea unui foton. urmate de tranziţia în stări de energie mai mari. pot fi observate doar frecvenţele de vibraţie ale probei. sau generarea unui foton când sistemul trece de la o stare energetică ridicată la una joasă. Geometria moleculară este specificată de coordonatele carteziene ale fiecărui atom. vibraţiile active Raman nu sunt active IR. Benzile vibraţional-rotaţionale sunt observate doar când proba se află în stare de gaz. Pe de altă parte. pe scurt spectroscopia IR. oferind informaţii unice despre materie.cu aceeaşi frecvenţă în materie. În fazele condensate (lichidă sau solidă). Conform acesteia. precum un dipol oscilator poate genera. Moduri de vibraţie Spectroscopia de absorbţie în infraroşu. O regulă simplă de simetrie este aşa numita “regula excuziunii mutuale”. În funcţie de simetria moleculei. În teoria cuantică. şi 3N-6 pentru moleculele neliniare. schimbul de energie între unda electromagnetică şi materie este de asemenea specifică. sunt în tratarea clasică procesele de bază ale fiecărei metode spectroscopice. precum şi spectroscopia Raman oferă informaţii despre modurile vibraţionale şi vibraţional-rotaţionale ale moleculelor. ce apar la interacţiunea luminii cu materia. şi invers. ca fotonii să interacţioneze cu materia este descrisă de aşa numita “secţiune eficace “ a efectului spectroscopic. În schimb. 2. De vreme ce distribuţia de sarcină este specifică pentru un anumit tip de materie. Numărul modurilor de vibraţie posibile al unei molecule poate fi determinat din numărul atomilor N din moleculă şi geometria moleculară. în cazul moleculelor cu centru de simetrie. pot fi privite ca fiind complementare. 135 . cele două tehnici. trei dintre aceste grade fiind folosite pentru specificarea mişcării de translaţie a moleculei în spaţiu. molecula unei anumite substanţe de exemplu. Gradele de libertate rămase corespund numărului modurilor de vibraţie: 3N-5 pentru molecule liniare. IR şi Raman.

De exemplu, vibraţiile fundamentale ale moleculei de apă, H2O, sunt prezentate în Figura 1. Apa, fiind o moleculă neliniară prezintă trei vibraţii fundamentale:

întindere simetrică

întindere asimetrică

deformare (forfecare)

Figura 1. Moduri de vibraţie de întindere şi deformare ale H2O.

Dioxidul de carbon, CO2, este o moleculă liniară, astfel că va prezenta patru vibraţii fundamentale (Figura 2). Vibraţia de întindere asimetrică a CO2 generează o bandă intensă în spectrul IR la 2350 cm-1. De menţionat este că această bandă se observă de regulă în spectrul IR al background-ului, datorită prezenţei CO2 în atmosferă.

întindere asimetrică

deformare (forfecare) perpendiculară pe planului foii

întindere simetrică

deformare (forfecare) în planul foii

Figura 2. Moduri de vibraţie de întindere şi deformare ale CO2.

Cele două vibraţii de deformare (forfecare) sunt echivalente, vibraţia acestora având loc la aceeaşi frecvenţă, fiind astfel numite degenerate, şi apar în spectrul IR la 666 cm-1. Vibraţia de întindere simetrică a CO2 este inactivă IR deoarece această vibraţie nu produce modificare în momentul de dipol al moleculei.

136

3. Oscilatorul armonic
Cel mai simplu model pentru vibraţia unei molecule diatomice este oscilatorul armonic. În acest model se consideră cei doi atomi de mase m1 şi m2 ai moleculei legaţi printr-un resort elastic. Descrierea matematică a mişcării de vibraţie a acestor două corpuri cu masele m1 şi m2 poate fi simplificată prin considerarea unui singur corp cu masa redusă µ=m1*m2/(m1+m2), ce oscilează în jurul centrului de masă al moleculei biatomice, într-un câmp potenţial de tipul kx2/2.

Figura 3. Modelul oscilatorului armonic pentru molecula diatomică. Variaţia energiei potenţiale cu distanţa internucleară.

Din punct de vedere fizic, aşa cum se poate deduce din Figura 3, o energie mai mare a oscilatorului armonic corespunde unei amplitudini mai mari a oscilaţiei, frecvenţa fiind aceeaşi pentru toate nivelele de energie. Energiile vibraţionale cuantificate se obţin în urma rezolvării ecuaţiei Schrödinger pentru oscilatorul armonic: Ev=hν(v+

1 ) , v=0,1,2…. 2

(1.1)

unde v este numărul cuantic de vibraţie, ν este frecvenţa de vibraţie şi h este constanta lui Planck. Frecvenţa de vibraţie a oscilatorului armonic depinde de puterea legăturii (constanta de forţă a legăturii k) şi masa redusă µ: ν=

1 2π

k

μ

(1.2)

137

Nivelele de energie vibraţionale sunt la distanţe egale (echidistante) în modelul oscilatorului armonic, diferenţa între două nivelele de energie adiacente E fiind: ΔE=hν=ћ k μ (1.3)

4. Reguli de selecţie pentru spectroscopia IR
O moleculă diatomică va absoarbe radiaţie IR numai dacă momentul ei de dipol se modifică în urma variaţiei distanţei internucleare. Probabilitatea de tranziţie depinde de diferenţa de populaţie ΔN dintre două stări cuantice şi pătratul momentului de dipol al tranziţiei, M: probabilitatea de tranziţie ~ ΔN M
2

(1.4)

unde, pentru o moleculă aflată într-o stare electronică dată, momentul de dipol al tranziţiei pentru o tranziţie vibraţională este dat de:
* (e) M= Ψν " μ 0 Ψν ' d τ

(1.5)

Funcţiile de undă ψ ν " şi ψ ν ' reprezintă stările vibraţionale finală şi respec(e) tiv iniţială, iar μ 0 este momentul de dipol electric permanent în această stare electronică. Pentru vibraţia unei molecule diatomice, momentul de dipol electric permanent poate fi extins într-o serie Taylor după distanţa internucleară de echilibru re :

∂μ ⎞ (e) =µe+ ⎛ μ0 ⎜ ⎟ q+ ⎝ ∂r ⎠ re

1 2

⎛ ∂ 2 μ ⎞ q2+ … ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

(1.6)

Aici q=r-re, iar r este distanţa internucleară la un moment dat, şi µe este momentul de dipol când legatura se află în poziţia de echilibru. Probabilitatea apariţiei unei tranziţii vibraţionale într-o moleculă diatomică poate fi obţinută substituind forma extinsă a momentului de dipol electric permanent în ecuaţia momentului de dipol pentru tranziţia vibraţională:

∫ Ψν

*
'

(e) μ0 Ψν d τ =
'

* µe Ψν " Ψν ' d τ + ⎜

⎛ ∂μ ⎞ 1 * ⎟ ∫ Ψν ' q Ψν d τ + 2 ⎝ ∂r ⎠ re
'

⎛ ∂2μ ⎞ ⎜ ⎜ ∂r 2 ⎟ ⎟ ⎝ ⎠ re

∫ Ψν

*
"

q2 Ψν ' d τ + … (1.7)

138

Primul termen din această ecuaţie este egal cu zero de vreme ce funcţiile de undă vibraţionale ψ ν " şi ψ ν ' sunt ortogonale. Al doilea termen este diferit de zero doar dacă momentul de dipol depinde de distanţa internucleară r

⎛ ∂μ ⎞ ⎜ ⎟ ≠0 ⎝ ∂r ⎠

(1.8)

De aceea, moleculele biatomice prezintă absorbţie vibraţională în spectrul IR doar atunci când există o modificare a momentului de dipol în cadrul mişcării de vibraţie. Moleculele diatomice homonucleare au momentele de dipol zero pentru toate lungimile legăturilor, astfel nu prezintă spectru de absorbţie vibraţional. Astfel, teoria mecanicii cuantice specifică faptul că absorbţia luminii infraroşii va apărea doar dacă un mod vibraţional implică o modificare a momentului de dipol şi că nivelele de energie vibraţionale în moleculă sunt cuantificate. Teoria ne spune de asemenea şi faptul că tranziţiile pot avea loc doar între nivele de energie adiacente, deoarece integrala din cel de-al doilea termen pentru polinoamele Hermite care descrie funcţia de undă a oscilatorului armonic, este diferită de zero doar dacă Δv= ± 1.

5. Legea Lambert-Beer
Domeniul spectral IR al radiaţiei electromagnetice este poziţionat între domeniul vizibil şi cel al microundelor. Prin convenţie, domeniul spectral IR este subdivizat în domeniul IR apropiat (Near Infrared Region - NIR), IR mijlociu (Mid Infrared Region - MIR) şi IR îndepărtat (Far Infrared Region FIR) (Figura 4). Spectrele IR discutate în această lucrare sunt toate din domeniul spectral MIR.

Figura 4. Domeniile spectrului electromagnetic şi subdiviziunile domeniului IR.

139

Spectrul IR se obţine prin înregistrarea intensităţii radiaţiei în lipsa probei de analiză (spectrul background) şi a intensităţii radiaţiei IR după ce aceasta trece prin probă. În urma trecerii prin probă, intensitatea fasciculului se va atenua datorită absorbţiei de radiaţie de către analit, precum şi a împrăştierii radiaţiei la interfaţa şi în interiorul probei (Figura 5a). Astfel, spectrul IR reprezentat va fi dat de mărimea: T= Is/IR unde, T este transmitanţa, Is intensitatea radiaţiei IR după, iar IR înainte de a traversa radiaţia proba. Valorile transmitanţei sunt între 0 şi 1, sau 0–100% pentru transmitanţa exprimată în procente. Între transmitanţă şi concentraţia unui compus relaţia este logaritmică. De aceea, pentru o reprezentare mai convenientă, în majoritatea cazurilor, în locul transmitanţei se foloseşte o altă mărime, absorbanţa A:

A = lg

1 = − lg T T

Relaţia dintre transmitanţă şi absorbanţă în funcţie de concentraţie este reprezentată în Figura 5b

Figura 5. (a) Atenuarea unui fascicul de radiaţie la refelexia interfeţei probei, împrăştierea de către particule şi absorbţia analitului. (b) Relaţia dintre transmitanţă, T, şi absorbanţă, A, în funcţie de concentraţia unui compus ipotetic.

În mod independent, Bouguer în 1729 şi Lambert în 1760, au stabilit că la concentraţie constantă, absorbanţa este direct proporţională cu grosimea probei, iar Beer în 1852 a observat că dacă grosimea probei este constantă, absorbanţa este proporţională cu concentraţia. Combinarea acestor observaţii a dus la legea Lambert-Beer, ce exprimă absorbanţa: 140

(I.2) unde a este absorbtivitatea – o constantă de proporţionalitate a moleculei la o lungime de undă specifică, d este lungimea drumului optic prin probă, iar c reprezintă cocentraţia substanţei analizate. Concluzionând, spectroscopia IR oferă atât informaţii moleculare calitative, prin modurile de vibraţie specifice fiecărei molecule, cât şi informaţii cantitative, aşa cum rezultă din legea Lambert-Beer.

A = a⋅d ⋅c

6. Instrumentaţia şi metodologia obţinerii spectrelor IR
Odată cu introducerea spectroscopiei transformată Fourier (FTIR) principalele dezavantaje ale spectroscopiei ”clasice” dispersive IR au putut fi înlăturate. Pe scurt, spectroscopia FTIR nu mai înregistrează intensitatea la fiecare lungime de undă, în mod secvenţial, la o lungime de undă după alta, şi de asemenea, spre deosebire de spectrometrele dispersive nu necesită prismă sau reţea de difracţie monocromatoare, unde apar pierderi majore în energia emisă de sursa IR la trecerea prin diferite fante de intrare şi ieşire. În spectroscopia FTIR, se aplică modularea interferometrică a radiaţiei (Figura 6). Pentru aceasta, un divizor de undă, de regulă din KBr acoperit cu un film de germaniu, împarte radiaţia în două fascicule, un fascicul fiind direcţionat către o oglindă fixă, iar celălalt fascicul către o oglindă mobilă (Figura 6). Aceste două fascicule sunt reflectate înapoi pe divizorul de undă, după care se recombină, intensitatea fasciculului variind în timp, datorită alternării interferenţei constructive şi destructive în funcţie de diferenţa de drum optic dintre cele două oglinzi, la fiecare moment de timp. Astfel, fiecare parcurs al oglinzii mobile este caracterizat de o interferogramă în funcţie de timp. Diferenţa de drum δ este proporţională cu timpul t, deoarece oglinda mobilă se deplasează cu viteză constantă v, astfel că δ = 2vt. Prin folosirea unui algoritm de transformată Fourier rapidă (Fast Fourier Transform - FFT algorithm), interferograma în funcţie de timp, I(δ), este convertită într-o interferogramă în funcţie de frecvenţă, I( v ), folosind următoarea relaţie:

I (δ ) = 0.5 H (v ) I (v ) cos 2πvδ I (δ )
unde H( v ) este un factor de corecţie dependent de numărul de undă şi de caracteristicile spectrometrului. Interferograma convertită în domeniul frecvenţelor se numeşte spectru de tip single-beam.

141

IR-light source

Figura 6. Spectrometrul FTIR. (a) Schema bloc a componentelor de bază ale unui spectrometru IR. (b) Principiul de funcţionare a unui interferometru Michelson format din sursă de lumină, divizor de undă, oglindă fixă, oglindă mobilă, detector şi probă (panel sus). Oglinda mobilă a interferometrului (panel sus) produce un semnal sinusoidal la detector pentru fiecare frecvenţă modulată (panel central). Pentru sursa IR, cu domeniu spectral de frecvenţe larg, semnalele modulate se suprapun şi formează o interferogramă complexă (panel jos).

Spectrometrele FTIR prezintă mai multe avantaje faţă de instrumentele convenţionale IR dispersive, incluzând o îmbunătăţire dramatică a raportului semnal-zgomot (S/N), obţinută prin multiplexare (detectarea simultană a tuturor frecvenţelor), reducerea timpului de scanare, precum şi un câştig mai mare în energia radiativă. Un alt avantaj important este reproductibilitatea excelentă în lungimea de undă a spectrometrelor FTIR, datorită utilizării unui laser de referinţă intern (de regulă HeNe, 632.8 nm ), ceea ce permite manipularea datelor spectrale, cum ar fi scăderea, adunarea sau scalarea spectrelor cu un grad foarte ridicat de acurateţe. De asemenea, progresul spectroscopiei FTIR a fost facilitat şi de dezvoltarea calculatoarelor personale, ce permit utilizarea de programe soft complexe, pentru aplicaţii calitative şi cantitative. Pentru partea practică a acestei lucrări, spectrele au fost înregistrate cu un spectrometru Jasco FTIR-6200 cuplat cu un microscop IR Jasco IRT-5000 (Figura 7). 142

Figura 7. Aparatura IR Jasco: spectrometrul FTIR-6200 şi microscopul IRT-5000.

Principalele părţi componente ale spectrometrului FTIR sunt sursa de emisie, interferometrul şi detectorul. Sursa de emisie IR este componenta cea mai simplă a instrumentului, constând într-un filament incadescent (10000C). Interferometrul este de tip Michelson, iar parcursul maxim al oglinzii mobile determină rezoluţia spectrală a spectrometrului. Alegerea detectorului este legată de aplicaţiile abordate. Astfel dacă se urmăreşte de exemplu cinetica unei reacţii chimice, este absolut necesară folosirea unui detector de tip MCT (Mercury Cadmium Telluride). Acestea sunt de două tipuri: MCT A, detector de foarte înaltă sensibilitate în domeniul spectral 650-7800 cm-1 ce permite înregistrarea rapidă a spectrelor (până la ns), şi MCT B, detector de înaltă sensibilitate în domeniul spectral 400-7800 cm-1, de asemena pentru înregistrări rapide. De menţionat că detectoarele MCT necesită răcirea cu azot lichid. Detectoarele de tip DTGS (Deuterated L-Alanine doped Triglycene Sulphate) lucrează la temperatura camerei într-un domeniu spectral larg 10-7800 cm-1, însă sensibilitatea acestora este de până la două ordine de mărime mai mică faţă de detectoarele MCT. De menţionat însă că domeniul spectral de detecţie al spectrometrului este limitat de fereastra din faţa detectorului (de regulă KBr) precum şi de divizorul de undă (beamsplitter, de regulă din KBr acoperit cu un strat de Ge), astfel că spectrometrele IR uzuale nu permit înregistrarea spectrelor sub 400 cm-1. Spectrometrul FTIR-6200 permite înregistrarea spectrelor IR în modul transmisie, pentru acest mod fiind necesară prepararea în prealabil a probe143

lor sub formă de dispersie în pastile KBr. Tot pentru măsurători IR în transmisie se poate presa proba între două discuri/ferestre dintr-un material ce nu absoarbe (este transparent) în domeniul IR mijlociu, de exemplu ZnSe, Si, Ge, KBr etc. Microscopul IRT-5000 este dotat cu un obiectiv tip Cassegrain şi unul de tip ATR (Attenuated Total Reflectance). Obiectivul de tip Cassegrain se pretează doar pentru probe plane (filme, suprafeţe lucioase etc.). În prealabil, la folosirea obiectivului Cassegrain, se înregistrează spectrul background prin focalizarea pe oglinda de aur, un accesoriu din dotare. Modul de analiză ATR (Attenuated Total Reflection) este utilizat pentru investigarea probelor lichide şi solide. De asemenea, modul ATR se pretează pentru caracterizarea materialelor care sunt fie prea groase sau prea puternic absorbante pentru a fi analizate prin spectroscopie în transmisie. În modul de analiză ATR, radiaţia IR trece printr-un cristal transparent în infraroşu, cu un indice de refracţie ridicat, astfel că fasciculul IR va efectua reflexii interne succesive în cristalul ATR, aşa cum este prezentat schematic în Figura 8.

Figura 8. Prezentare schematică a tehnicii de analiză ATR-IR.

În vederea analizei, suprafaţa probei este presată astfel încât să fie în contact optic cu suprafaţa superioară a cristalului ATR. La reflexia internă a fasciculului, aşa numita undă evanescentă IR pătrunde în afara cristalului ATR, astfel că o mică parte din radiaţie penetrează proba. În modul de analiză ATR nu este necesară o preparare în prealabil a probei în vederea analizei. Dezavantajul constă în limitarea spectrală datorită cristalului ATR, de exemplu pentru un cristal ATR din ZnSe spectrele se pot înregistra începând de la 650 cm-1. De regulă, în prealabil, la folosirea modului ATR, se înregistrează spectrul background al atmosferei, cristalul ATR fiind în aer. Folosind microscopul IRT-5000 în modul de analiză ATR, au fost înregistrate spectrele FTIR/ATR a următoarelor substanţe de interes farmaco144

logic: aspirina, paracetamol şi deferoxamina. Structurile moleculare ale acestora sunt prezentate mai jos.

Aspirina

Paracetamol

Deferoxamina Tabloul spectral din Figura 9 prezintă spectrele de absorbţie în IR ale celor trei substanţe analizate.

Figura 9 Spectrele FTIR/ATR ale substanţelor de interes farmacologic: aspirina, paracetamol şi deferoxamina.

145

Cluj-Napoca.M. O. 2005.Methods and Applications. Selected Applications. Dent. 1986. 2. S. 11. Cluj-Napoca. I. Engelke. Napoca Star. Casa Cărţii de Ştiinţă. Iliescu. 6. Napoca Star. Aplicaţii ale spectroscopiei vibraţionale. Leopold. S. David. 7. pentru fiecare substanţă putându-se identifica o amprentă spectrală caracteristică. N. 2007. Maniu. D. T. T. J. 2002. Teoria Grupurilor în Fizica Atomului şi Moleculei. O. Probleme de Fizica Moleculei. 10. 1992. Teubner. Bibliografie 1. 3. Simetrie Moleculară. 7. Leopold. Smith and G. Spectroscopia IR şi Raman. Ed. Vol. 2000. V. 5. L. Cîntă-Pînzaru. Schrader. 2002. VCH. 1998. Grecu. Aştilean. UK. B. Wiley. Stuttgart. Weinheim. Surface-Enhanced Raman Spectroscopy. Chichester. Aufbau der Moleküle. Germany. 2009. Iliescu. N. 9. S. Cluj-Napoca. Spectroscopie Optică Moleculară. 2004. Litografia Universitatii Babes-Bolyai. Chichester. Cluj-Napoca. Cluj-Napoca. F. Atribuirea benzilor de vibraţie se poate face pe baza literaturii de specialitate comparând spectrele cu cele ale compuşilor asemănători sau prin calcularea teoretică a spectrelor IR folosind programe dedicate de chimie cuantică. 8. W. Chiş. Cluj-Napoca. Chiş. Cozar. Cluj-Napoca.Spectrele din Figura 9 sunt caracteristice structurilor moleculare corespunzătoare. R. Modern Raman Spectroscopy – A Practical Approach. 2001. 4.E. Hollas. Cozar. Litografia Universităţii Babeş-Bolyai. Germany. Simon. Casa Cărţii de Ştiinţă. Wiley. Infrared and Raman Spectroscopy . Casa Cărţii de Ştiinţă. Aştilean. Metode şi tehnici moderne de spectroscopie optică. UK. Modern Spectroscopy. 146 .

.................................... Aplicaţii analitice ale spectroscopieie IR ..................................1. Aplicaţii ale spectroscopiei IR în geoştiinţe............................................................................................................1................ Nicolae Leopold Cuprins 1........................................ 151 4.............................. Publicaţiile din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR pot fi clasificate pe domenii ştiinţifice după cum este prezentat în Figura 1........ 150 2.................. Introducere Spectroscopia de absorbţie în infraroşu (IR) reprezintă o metodă analitică de investigaţie moleculară utilizată într-un număr vast de domenii.........Tendinţe moderne în spectroscopia de absorbţie IR Lect........... 157 1.......................... dr...... 147 ....................1...................................................... 154 5. Bibliografie ...... 155 6...2....... Spectroscopia IR în calitatea şi siguranţa alimentelor ......... Cuplajul on-line cromatografia de lichide (lc)-IR ....... Îmbunăţiri tehnice recente în cuplajul LC-IR........................ Cuplajul on-line electroforeza capilară (CE)-IR ..... 148 2............ 147 2........... Aplicaţii biomedicale ale spectroscopiei IR .......................... 149 2....... 150 3................ Introducere .......................

scopus. Clasificarea pe domenii a numărului de publicaţii din ultimii 5 ani cu tematica legată de spectroscopia de absorbţie IR (www.com) Este evident din numărul mare al publicaţiilor în domeniile chimiei şi a fizicii că spectroscopia de absorbţie IR este în continuare o metodă experimentală de bază în cercetarea fundamentală. astfel că pot fi foarte greu cuprinse într-o prezentare unitară. De aceea s-a ales în mod reprezentativ cuplarea on-line a detecţiei IR în metodele de separare cromatografie de lichide (LC) şi electroforeza capilară (CE). 2.Figura 1. 148 . Aplicaţii analitice ale spectroscopieie IR Aplicaţiile analitice ale spectroscopiei IR sunt extrem de diversificate.

cristalizare sau degradare oxidativă. De regulă. aceste metode de separare sunt cuplate cu metode de detecţie ca. absorbţia UV-VIS sau spectrometria de masă. 2. în mod special a celei cu transformată Fourier (FTIR) ca şi mijloc de detecţie on-line în urma separării cromatografice a fost demonstrată în mod repetat în ultimii ani [1-3]. Utilitatea spectroscopiei de absorbţie IR.1. Detecţia on-line LC-FTIR a fost limitată în trecut de un anumit număr de restricţii privind aplicabilitatea în problemele analitice de tip real-life. aceste metode prezintă avantaje şi dezavantaje în funcţie de analizele efectuate. fiind pusă la îndoială în mod frecvent viabilitatea acestui cuplaj. incluzând o rezoluţie cromatografică îmbunătăţită. Cuplarea on-line permite totodată înregistrarea de spectre IR pentru analiţi fără o anumită orientare. Desigur. Cele două subiecte sunt strâns corelate. identificare şi cuantificare. Cuplajul on-line cromatografia de lichide (lc)-IR Cromatografia de lichide este cea mai uzuală metodă instrumentală folosită în laboratoarele analitice pentru separarea amestecurilor fizice. sau laboratoare pentru studii farmacologice. Cert este faptul că în ultimii ani sunt depuse eforturi pentru a cupla cu spectrometria de masă şi alte metode de detecţie cum ar fi spectroscopia Raman sau spectroscopia de absorbţie IR. 149 .Metodele de separare cromatografice şi electroforetice sunt tehnici standard în laboratoare analitice privind siguranţa şi autenticitatea alimentelor. precum şi posibilitatea de a utiliza soluţii tampon nevolatile [3-4]. laboratoare medicale. şi ii) senzitivitatea redusă datorată utilizării unui drum optic redus al celulor pentru a evita saturarea semnalului ce intervine datorită absorbţiei eluentului. Totuşi. fie on-line folosind celule de curgere (flow-through cells) transparente pentru radiaţia infraroşie. Cuplarea cromatografiei de lichide cu un sistem de detecţie IR se poate realiza fie în modul off-line după înlăturarea solventului. Două dintre cele mai citate dezavantaje ale cuplajului LC-FTIR sunt următoarele: i) dificultatea de a corecta absorbţia de fond a solvenţilor şi a aditivilor folosiţi pentru prepararea fazei mobile. iar atunci când sunt ambele luate în considerare este uşor de înţeles numărul limitat de referinţe cu privire la cuplarea on-line a spectroscopiei de absorţie IR cu cromatografia de lichide. aspecte ce pot interveni la înlăturarea solvenţilor. abordarea on-line este de preferat datorită unor avantaje majore. detecţia substanţelor interzise. În dectecţia off-line folosirea interfeţelor de înlăturare a solventului duce la îmbunătăţirea senzitivităţii. furnizarea de informaţii în timp real.

cu un volum intern al celulei de 7. Urmând studii anterioare [7]. Prin reducerea dimensiunii şi a costurilor aparaturii se conturează o direcţie clară în ceea ce priveşte detecţia on-line IR dedicată cromatografiei de lichide. [5] folosind o micro-celulă de curgere [6] cu ferestre transparente în IR mijlociu din CaF2.2. facilitând o serie de noi aplicaţii.1. 2. pe coloană. limite de detecţie între 35-94 ng. Un alt factor de limitare pentru detecţia IR cuplată cu cromatografia de lichide este legată de absorbţia puternică a apei în domeniul spectral MIR.5 nL. obţinându-se astfel on-line. Acest lucru a fost evidenţiat de coeficienţii de corelare cuprinşi între 89-96% (în regiunea spectrală 1700-1050 cm-1) şi utilizaţi pentru compararea spectrelor de referinţă cu cele obţinute în urma injectării în sistemul cromatografic a unei cantităţi între 230-270 ng din analiţi. Îmbunăţiri tehnice recente în cuplajul LC-IR Pentru a creşte senzitivitatea cuplajului LC-FTIR şi pentru a obţine astfel o limită de detecţie mai bună s-a realizat interfaţarea unui sistem de cromatografie capilară pentru lichide cu spectrometrul FTIR. care a fost plasat pe un condensor al fasciculului optic ataşat spectrometrului.1. Separarea apare în urma aplicării unei tensiuni înalte. duce la o nouă abordare a detecţiei IR on-line [7-10] folosind noi dispozitive [11]. fapt care duce la o curgere electro-osmotică în capilar. mai ales în analizele bio-chimice din cauza eficienţei mari a separării cât şi consumului redus de substanţă [13-15]. Kuligowski et al. Cuplajul on-line electroforeza capilară (CE)-IR Electroforeza capilară (CE) a devenit o tehnică de separare importantă. Un set-up optic bazat pe trei oglinzi de aur şi un separator de fascicule din ZnSe a fost folosit pentru a direcţiona lumina emisă de laser printr-o celulă fluidică cu un drum optic de 52 µm către un detector MCT (mercury-cadmium-telluride). [12] au folosit două lasere QCL pentru detecţia on-line în cromatografia de lichide de înaltă performanţă. 150 . Dezvoltarea din ultimii ani a unei noi tehnologii laser pentru surse IR.quantum-cascade laser. Avantajul surselor IR de tip QCL constă în posibilitatea reglării lungimii de undă a laserului prin reglarea temperaturii de funcţionare [12]. QCL . Au fost puşi în mişcare gradienţi liniari în limitele 50:50-35:65 [apă(0. Folosind tehnica gradienţilor s-au putut obţine spectre de înaltă calitate ale analiţilor în urma aplicării unei corecţii ale fondului (semnal background) la datele înregistrate. Sistemul a fost utilizat pentru separarea a opt constituenţi ai vinului şi ai sucului de struguri.2.05% TFA-acid trifluoroacetic):acetonitril] timp de 15 min pentru separarea soluţiilor standard de nitrofenoli.

col uterin [26-34]. Acest ultim aspect este cel care face spectroscopia FTIR o metodă de analiză biomoleculară foarte atrăgătoare [20]. Interacţiunea moleculelor analit cu selectorul chiral a produs diastereomeri cu un spectru IR clar. Maturitatea cuplajului CE-FTIR on-line este considerată prin separarea şi cuantificarea cu succes a glucidelor din băuturi răcoritoare [18]. prostată [54-55]. limfon non-Hodgkin’s [53]. limfoid [51]. bucal [50]. Aplicaţii biomedicale ale spectroscopiei IR Analiza FTIR este folosită într-o serie largă de studii biologice cuprinzând măsurători pe diverse ţesuturi ca: piele [21-25]. fibroblast [60]. Aplicaţiile principale în acest domeniu sunt cele privind dinamica proteinelor şi elucidarea structurii secundare. guaninei şi a adenosinei-5’ monofosfat în domeniul ng folosind electroforeza capilară convenţională [16]. aşa cum s-a arătat la discriminarea on-line de enantiomeri în timpul separării chirale într-un mediu neapos. Un alt studiu prezintă separarea şi detecţia IR a 5 analiţi. Wood et al. os [61] sau ţesut tumoral [62]. detecţia în CE este dificilă. creier [47-49]. sau pentru monitorizarea glucozei [67].De obicei. Un alt domeniu în care spectrometria IR poate furniza informaţii importante este analiza proteinelor. plămân [35-37]. [26] au evidenţiat potenţialul spectroscopiei FTIR ca instrument de biodiagnostic în cancerul de col uterin. distinct. Pentru detecţia prin spectroscopia infraroşie mijlocie s-au raportat măsurători atât off-line cât şi on-line. Detecţia on-line bazată pe tehnica reflexiei totale atenuate ocoleşte această problemă prin reducerea eficientă a drumului optic. sân [38-42]. Acest articol raportează prima separare a unor proteine în electroforeza capilară cu detecţia FTIR on-line. Recent însă. Utilitatea detecţiei FTIR on-line a fost demonstrată prin separarea şi cuantificarea adenosinei. rezultatele fiind foarte bune din punct de vedere calitativ şi cantitativ [17]. 3. gastrointestinal [43-46]. Informaţia moleculară specifică livrată de spectrul IR poate fi interpretată în mod avantajos. tot mai multe studii arată că detecţia on-line FTIR este utilizată cu succes. din cauza concentraţiei mici de substanţă disponibilă pentru detecţie. permiţând discriminarea moleculelo analit [19]. iar în cazul detecţiei UV-Vis sensitivitatea este limitată de diametrul mic al capilarului. colon [56-59]. În măsurători de transmisie folosind celule transparente manufacturate special pentru IR o parte din spectru este blocat din cauza absorbţiei puternice a fazei lichide. Alte studii relevante au fost efectuate pe bacterii [63-64] ADN [65]. limfocite [52]. Spectrele înregistrate 151 . medicamente anti-cancer [66].

Studiul iniţiat de Mordechai et al. Wang et al. respectiv limfocitele au o caracteristică spectrală în zona legăturii fosfodiester (1300-900 cm-1). şi totodată o pronunţată bandă atribuită întinderii simetrice a grupării fosfat la 1078 cm-1. Rezultatele lor demonstrează că sunt diferenţe semnificative între celulele normale din plămân şi cele tumorale. Un avantaj major al acestei metode îl reprezintă posibilitatea de a obţine rezultate determinante foarte rapid. Privind aceeaşi afecţiune. Acest studiu a demonstrat potenţialul de aplicabilitate a tehnologiei automatizate FTIR în monitorizarea cancerului de col uterin în mediul clinic. probele păreau să fie 152 . Yano et al. Zona de interes a studiilor comparative de spectroscopie IR pentru Fabian et al. în vederea implementării acesteia ca şi tehnică medicală în acest domeniu. [28] au investigat cu microspectroscopia FTIR tipurile de celule şi potenţialele variabile care ar duce la confuzii în diagnosticarea malignităţii acestui ţesut. [38] a fost reprezentată de cancerul la sân. a culturilor celulare şi a xenogrefelor de acest tip. Caracteristicile spectrale care sugerează transformări de malignitate sunt în principal modurile de vibraţie simetrice şi antisimetrice ale grupării fosfat precum şi reducerea în intensitate a benzii atribuite glicogenului. [35] s-au concentrat asupra studiilor microscopice FTIR ale celulelor canceroase din fluidul pleural. Pentru evaluarea cantitativă a malignităţii s-au ales intensităţile benzilor de la 1045 şi 1465 cm-1. [36] se bazează pe posibilitatea de achiziţie directă de pe ţesut de plămân canceros sau normal prin microscopia FTIR. Wood et al. Diferenţa considerabilă este reprezentată de raportul benzilor de la 1030 şi 1080 cm-1. încercând astfel diferenţierea ţesutului canceros de cel normal. Spectrele înregistrate au fost analizate privind posibilele modificări în ceea ce priveşte nivelul biomoleculelor: ADN. fosfaţi şi carbohidraţi. Nivelul acestora din urmă s-a dovedit a fi un bun indicator în diagnosticarea şi detecţia cancerului de col uterin. sugerând prin aceasta modificări spre malignitate. Acestea reprezintă un factor discriminant privind ţesutul de plămân canceros şi cel normal. atribuite glicogenului şi colesterolului. ARN. La nivel macroscopic. Într-un alt studiu. [30] pe melanom fixat cu formalină şi pe celule canceroase de col uterin bazat pe microspectroscopia FTIR a urmărit detecţia unor biomarkeri comuni care apar în cele două afecţiuni. atribuită glicogenului şi grupării fosfat din acizii nucleici. Scopul acestui studiu a fost determinarea eficienţei spectroscopiei IR în diagnosticare şi în acest sens s-a descoperit că leucocitele.pe celule epiteliale normale prezintă benzi intense ale glicogenului la 1022 cm-1 şi 1150 cm-1.

s-a reuşit determinarea cantitativă a apei în fiecare caz. [23] a utilizat spectroscopia ATR-FTIR (spectroscopia IR cu tranformată Fourier în reflexie totală atenuată) pentru a măsura gradul de hidratare al corneei. Andrus şi Strickland [51] au monitorizat gradual tumori limfoide cu ajutorul spectroscopiei FTIR. 66%. Lucassen et al. Fukuyama et al. respectiv să diferenţieze materia albă de cea cenuşie cu acurateţe de 90%. Prin utilizarea mai multor metode multivariate au arătat că este posibil să se clasifice datele spectroscopice non-subiectiv.omogene din punct de vedere al ţesutului conjunctiv care a fost ales ca şi amprentă spectrală. Astfel. colon. 74%. Prin comparare cu spectre ale cheratinei pure şi ale colagenului s-au obţinut rezultate care să susţină introducerea acestor investigaţii în clinici. dar acest stu153 . S-a concluzionat că un studiu de spectroscopie IR poate deveni foarte util în interpretarea corectă şi înţelegerea pe deplin a patologiei acestui ţesut. Weng et al. [43] au raportat diferenţierea spectroscopică între ţesutul gastric normal şi cel tumoral. urmărindu-se raportul benzilor de la 1460 şi 1400 cm-1. ficat şi a altor părţi ale sistemului digestiv cu ajutorul fibrei optice FTIR şi a spectroscopiei FT-Raman. [62] au ales un studiu de reflexie FTIR prin absorpţie amplificată la suprafaţă a acizilor nucleici din celulele tumorale. [46] au realizat o investigare a biopsiilor cu spectroscopia ATR-FTIR privind afecţiuni ca şi: gastrită superficială. Dovbeshko et al. respectiv 90%. urmărind absorbţia atribuită colagenului. cancer de stomac şi gastrită cronică prin comparare cu ţesut normal şi a obţinut o acurateţe în diagnostic de 90%. achiziţia de informaţii având loc la contactul cu o sondă ATR. intestin subţire. Fujioka et al. Rezultatele au indicat faptul că banda atribuită întinderii C=O a adipozei poate fi identificată în spectrele probelor de ţesut normal. rect. Choo et al. urmărind vibraţia de deformare a apei în combinaţie cu cea de întindere a legăturii OH în cazul unei suprafeţe normal hidratată de cornee şi a uneia nehidratate suficient din cauza unor ocluzii. Utilizând spectroscopia FTIR s-a realizat această discriminare cu o acurateţe de 88. Ulterior s-au detectat modificări în conţinutul de colagen şi a depozitării celulelor lipidice. Li et al. [44] au studiat tumori de stomac.6%. [47] au aplicat spectroscopia IR în diagnosticarea afecţiunii Alzheimer investigând spectre achiziţionate pe ţesut uman de sistem nervos central. [50] au folosit spectroscopia FTIR pentru a studia diferenţele între celule canceroase gingivale şi celulele epiteliale gingivale normale. însă foarte rar în cele de ţesut tumoral. Se presupune că pentru această apreciere este necesară obţinerea de informaţii fundamentale privind pătrunderea şi pierderea lichidului apos de la nivelul corneei.

Autorii au 154 .Spectroscopia IR în calitatea şi siguranţa alimentelor Spectroscopia FTIR este o tehnologie promiţătoare pentru industria agroalimentară deoarece permite măsurători simple. Un parametru important în monitorizarea autenticităţii piureurilor.diu a ridicat anumite probleme. Extracţia fazei solide a minimizat interferenţa zahărului cu spectrele şi a izolat componentele fenolice care au oferit o amprentă unică în autentificarea sucurilor. He et al. Spectre MIR au fost folosite pentru a diferenţia sucurile concentrate pure din rodii de cele contrafăcute cu suc de struguri concentrat (2%-14% v/v) folosind analiza de componente principale (PCA) în regiunea IR 1780-1685 cm-1. Datorită utilizării tehnicii FTIR în aplicaţii de control a calităţii şi a procesării. În mod similar. iar pentru fiecare produs s-au stabilit limite inferioare ale acestuia. spectroscopia de absorbţie IR reprezintă o metodă senzitivă în ceea ce priveşte analiza malignităţii ţesuturilor cu potenţial real pentru aplicaţii clinice în detecţia şi diagnosticarea a diverse afecţiuni. atribuită în principal întinderii C=O [68]. Rodiile sunt foarte apreciate pentru activitatea lor antioxidantă cât şi pentru potenţialele efecte chemopreventive împotriva cancerului de prostată [68]. [70] au analizat afine. struguri Concord. Progresul în instrumentaţia FTIR combinat cu dezvoltarea unor metode statistice multivariate de analiză a datelor fac această tehnologie ideală pentru monitorizare rapidă cât şi caracterizarea compuşilor din alimente la nivel de urme. Regresia de tip parţial least-squares (PLS) ce corelează conţinutul de fructe şi spectrele FTIR centrate pe o bandă la 1729 cm-1 a asigurat o bună calibrare statistică la analizarea gemului de căpşuni [69]. Spectre înregistrate după extracţia fazei solide din sucuri a îmbunătăţit puterea de modelare pentru compararea cu sucul pur şi a recunoaşterii prin folosirea unui tipar (soft independent analysis of class analogy (SIMCA)) şi a permis diferenţierea sucurilor de origini diferite. În concluzie. industria agroalimentară este deja familiarizată cu această tehnologie şi cu potenţialul ei de implementare în monitorizarea alimentelor. rapide şi nedistructive ale compuşilor chimici. merişor. 4. Spectroscopia MIR a fost folosită în autentificarea sucurilor cu ingrediente de înaltă calitate contrafăcute din surse inferioare. respectiv apariţia prin interpretarea spectrelor a unor configuraţii “ciudate” de baze şi zaharuri. preparatelor şi a gemurilor de fructe este procentul care desemnează conţinutul de fructe. nectar de prune şi sucuri de mere de la diferiţi producători. spectroscopia MIR a fost de mare succes în diferenţierea varietăţilor de fructe şi a originilor geografice. până la părţi pe milliard (ppb).

Autorii aduc la cunoştinţă că spectroscopia MIR combinată cu tehnici chemometrice au permis o discriminare bună între probele produse în sisteme de producţie organică şi anorganică. şi analiza discriminantă liniară (LDA). Până în 2009 nu a fost o metodă standardizată în industria viticolă care să permită determinarea eficientă a compoziţiei şi autenticităţii vinurilor organice [71]. Consumatorii sunt tot mai interesaţi de produse organice şi sunt dispuşi să plătească un preţ mai mare pentru aceste produse. [71] au fost primii care au folosit tehnologia IR pentru a clasifica vinuri comerciale provenite de la sisteme de producţie organică şi anorganică. 5. 155 . rezultatul analizei PCA a separat vinurile organice de cele anorganice. DPLS a clasificat corect 85% din vinurile organice. regresia PLS discriminantă (DPLS). folosesc solvenţi dăunători şi monitorizează doar un parametru la un moment dat. niciuna dintre ele fiind foarte practică pentru că sunt costisitoare din punct de vedere al timpului necesar efectuării lor şi al setărilor pentru controlul de calitate. Metodele tradiţionale pentru autentificarea sucurilor de fructe includ cromatografia sau analiza raportului izotopilor de carbon.atras atenţia asupra limitărilor acestei metode. Aplicaţii ale spectroscopiei IR în geoştiinţe Concentraţia şi distribuţia apei în rocile vulcanice din Sumisu Caldera şi Vulcanul Torishima din arcul Izu-Bonin (Japonia) au fost studiate de Wysoczanski şi Tani [72]. În general. iar LDA a reuşit să clasifice 75%.4 % (wt) H2O. care ar contribui la discriminarea vinurilor. Industria de vinuri a recunoscut acest trend şi astfel în multe podgorii se pune accentul pe vinuri organice. dar a existat o uşoară suprapunere [71]. iar pentru obsidian 0. estimată la circa 5µm [72]. incluzând compuşi fenolici volatili şi nevolatili. inclusiv în procesul de extracţie şi asupra nevoii unui spectru larg de probe pentru a îmbunătăţi repetabilitatea acestui model. Masa brută a dacitelor din Sumisu Caldera conţine între 1. rezultând o precizie similară şi o rezoluţie spaţială chiar mai bună. ci mai degrabă mai mulţi compuşi chimici. Rezultatele au fost comparabile cu cele obţinute prin metoda convenţională bazată pe micro-FTIR. Aproape 200 de soiuri de vinuri roşii şi albe din 13 regiuni din Australia au fost analizate folosind spectroscopia MIR combinată cu PCA.2-1. valori corespunzătoare cu saturarea apei la presiunile de erupţie. dar au subliniat că această metodă este o îmbunătăţire reală comparativ cu încercărilor anterioare [70]. Explorarea rezultatelor analizei PLS nu a desemnat un parametru chimic individual care să fi explicat diferenţierea vinurilor. Cozzolino et al.2 % (wt) H2O.

colecţia de imagini obţinute prin scanare a arătat. Mircescu şi Mast. procesele de deformare cât şi a unui “geotermometru” privind rocile din crusta terestră [83]. fiind 3 peak-uri bine definite la 3604 cm-1. 156 . Numeroase studii recente au arătat că specii volatile ca şi CO2 şi specii hidride ca şi OH şi H2O pot fi de asemenea încorporate în circumstanţe speciale în majoritatea mineralelor din crustă [75-77]. precum era de aşteptat. aceste studii fiind folositoare în determinarea genezei şi a evoluţiei sistemelor magmatice [78]. De fapt. Pe lângă caracterizarea cristalo-chimică. [76] au studiat un set de cristale leucite transparente atent selecţionate provenind din vulcanul Alban Hills (Roma. dar teste efectuate pe incluziunile de fluide din minerale sunt rare [81]. O microanaliză preliminară a acestor probe a dezvăluit o absorpţie în regiunea 3000-4000 cm-1 datorată vibraţiilor de întindere a apei. Della Ventura et al. Concluzia lui Della Ventura et al. Aceste incluziuni determină totodată şi dezvoltarea modelelor restrictive în geneza depozitării minereurilor şi oferă informaţii pentru exploatarea geotermală şi petrolieră în producţia la nivel industrial. faptul că acel conţinut de CO2 depinde puternic de faza mineralului [82]. În acest context. Aplicând fluorescenţa de raze X. Analiza apei în minerale [79] şi roci [80] cu ajutorul spectroscopiei FTIR este aproape o tehnică de rutină. mineralele au o largă răspândire în istoria rocilor ornamentale sau a pigmenţilor utilizaţi în operele de artă. la 3500 cm-1 şi la 3245 cm-1. Studiile care tratează incluziunile de fluide sunt foarte utile în definirea rolului fluidelor în geneza. Astfel se susţine ideea că o analiză amănunţită a speciilor volatile din minerale poate oferi informaţii cantitative şi calitative privind activitatea apei şi a CO2. fugacitatea oxigenului şi compoziţia fluidelor în sistemele minerale. în special privind studiile arheologice şi problemele de conservare. Mulţumiri pentru suportul acordat de Drd. Krisztian Herman la redactarea acestui material. de aceea aceste materiale merită ca toată atenţia. Italia). analiza spectroscopică a CO2 fiind comună în studiul rocilor. Nicoleta E. conţinutul de CO2 din lazurite a fost propus ca şi indicator al sursei naturale ultramarine de pigmenţi.Este bine cunoscut faptul că mineralele anhidride nominale formate în condiţii de înaltă presiune conţin urme de specii hidride [73-74]. a fost că imagistica FTIR a distribuţiei apei în leucite reprezintă un instrument valoros în monitorizarea evoluţiei sistemelor magmatice. studiul speciilor volatile în minerale are aplicaţii şi în alte domenii.

Lammerhofer and B. Anastos. 2. Sukuta and R. Bruch. W. A. 3. Edelmann. 15. Zakim and M. J. Bibliografie 1. P. Frank. Stranc. Godwin. Wood. Quarterly Reviews of Biophysics 35 (2002) 369-430. Hislop. http://www. Edwards and A. Arce. Sensors and Actuators a-Physical 115 (2004) 591-599. Journal of Microscopy-Oxford 215 (2004) 86-91. 26. Barry. M. Lewis. Lucassen. M. Biospectroscopy 4 (1998) 47-53. W. M. S. M. D. 4. J. C. Austria http://daylightsolutions. Sahu. W. A. E. Quinn. Ashdown.quantared. M. Lendl. Lendl. R. Journal of Chromatography A 934 (2001) 123-128. Lendl. B. C. Applied Spectroscopy 58 (2004) 662-666. H. Svasek. Kolhed. Journal of Raman Spectroscopy 23 (1992) 641-645. A. C. Pivik and B. J. Quintas and B. G. I. M. 6. R. 27. B. V. Baena. F. A. Nilsson. J. B. M. T. Zarou. N. Beck and J. B. Gynecologic Oncology 90 (2003) 10-14. Brinkman. A. Surowiec. McNaughton. Pilavdzic and A. Svasek. J. K. M. Muller. Wong. Jackson. G.com J. R. N. Z. M. 18. D. Analytical Chemistry 72 (2000) 1645-1648. Frank. W. Talanta 67 (2005) 269-279. Brunetto. Podshyvalov. Veen and J. R. K.com Vienna. Analytical Chemistry 81 (2009) 3746-3753. A. P. Journal of Chromatography A 1080 (2005) 132-139. A. B. E. S. S. Quinn. Wood. Udomprasertgul. Diem. Mordechai. 24. Lasers în Surgery and Medicine 24 (1999) 382-388. T. Yee. 25. Hinsmann. Williams. Kantarovich. Crowson. Righetti. Warakamin. Journal of Chromatography A 1068 (2005) 3-30. Somsen. H. 9. Lendl. R. Mantsch. B. Svasek. 5. 12. 10. P. 19. Schrenk. B. T. Kolhed. G. M. D. Goldstein. Lendl and B. Kolhed. Karlberg and B. R. Quintas. Gallignani and M. 29. Karlberg. Applied Spectroscopy 58 (2004) 667-670. Trojanowicz and B. Sindhuphak. Issaravanich. J. Lendl and M. H. J. McNaughton. 13. Karlberg. Lendl and B. Zscherp. Xie. Goldstein and S. N. P. 157 . Sindhuphak. V. Frank. P. Analytical Chemistry 74 (2002) 3843-3848. 16. W. Analyst 130 (2005) 772-778. S. M. 21. Barth and C. S. Laurell. P. Srisookho. Vellekoop. S. N. Biospectroscopy 4 (1998) 75-91. Burden and D. Hinsmann. Faist. Lendl. Kolhed and B. Ruzicka. Barnett and S. M. G. M. 30. Haberkorn. L. G. T. Grekin. 11. Strasser. Lammerhofer. Frank. H. M. D. Frank. Lendl. Jansen. Schaden. Mark. L. 7. M. 8. J. Hinsmann. J. Biospectroscopy 2 (1996) 143-153. Guterman. M. G. Kuligowski. Argov. B. McIntosh. Gornik and G. Gooijer and U. A. Kuligowski and B. B. S. Hammody. Cancer Research 53 (1993) 762-765. Romeo and D. Analyst 128 (2003) 2-6. Baena and B. J. 20. M. Karlberg. R. Lendl. 14. B. 23. Dusitsin. V. P. 22. A. T. S. P. Vigorita. R. T. Journal of Chromatography A 1079 (2005) 24-40. Electrophoresis 24 (2003) 687-692. C. P. Chiriboga. L. R. W. Rigas.6. F. Svasek. Schindler. Journal of Biomedical Optics 3 (1998) 267-280. Tait. C. Talanta 64 (2004) 1127-1146. M. P. 17. Lendl. 28. Applied Physics B-Lasers and Optics 99 (2010) 833-840. Journal of Investigative Dermatology 112 (1999) 951-956. G. R. Journal of Chromatography A 856 (1999) 213-242. M. H. Boonbundarlchai and N.

Mordechai. J. Biopolymers 78 (2005) 311-317. M. Y. J. Xu. Technology în Cancer Research & Treatment 5 (2006) 157-167. K. Ghanbari-Siahkali. Strickland. R. Fichtner and H. Halliday and H. Kumaido. A. S. R. 42. Biospectroscopy 1 (1995) 357-364. Wong. M. P. Y. Argov. Huleihel. S. Mantsch. Analytical Chemistry 67 (1995) 777-783. Biospectroscopy 4 (1998) 55-59. 55. S. J. G. Analytical Biochemistry 287 (2000) 218-225. M. T. Fujioka. U. Q. B. J. R. 52. Bernshtain. Proceedings of the SPIE 3918 (2000) 66-77. Hu. Arai and M. P. S. T. Mikhael. 38. D. Biospectroscopy 4 (1998) 37-46. Kikuchi. Li. Salman. Lockyer. Biospectroscopy 1 (1995) 141-148. U. Crowe. P. Wu. Takeshita. F. A. A. 45. Sule-Suso. S. K. Andrus. Shanks. Gardner. 44. Gazi. Hammody. Sockalingum. 48. Y. J. American Clinical Laboratory 19 (2000) 20. Argov. Zakim and M. Wade. Ramesh. Watanabe and H. S. J. R. T. Fung. McCreery and D. Paluszkiewicz and W. A. Okuyama. W. Vickerman. Biospectroscopy 3 (1997) 281-290. Cancer Detection and Prevention 28 (2004) 32-36. Katayama. Biospectroscopy 1 (1995) 37-45. D. J. Song. J. R. Xie. Zhou and J. 43. Jackson. Journal of Raman Spectroscopy 28 (1997) 119-&. S. Z. Y. K. G. Mahadevan-Jansen. Applied Spectroscopy 55 (2001) 955-959. Somorjai. Wang and Y. Cohen. 40. Yoshida. L. J. H. G. F. Xu. V. N. Weng. C. P. 53. Chaims and Z. Science of the Total Environment 204 (1997) 283-287. Lacelle and P. Shimizu. 35. Biopolymers 75 (2004) 384-392. 41. Sun. H. K. D. M. G. Richards-Kortum. C. H. A. J. J. D. Moser and J. M. Mordehai. Yanagisawa and M. Scott. F. M. Heintzelman. X. Miyazaki. Clarke. Fitzmaurice. E. H. N. Miyan. D. B. 50. L. Treado. K. N. Fabian. 56. X. Kegelaer. Goldstein. C. X. M. A. Sakai. 47. Chiriboga. 158 . T. K. J. B. Zhang. Frank. F. 39. N. P. A. Hart and M. A. Feld. H. J. Gridina. 49. E. Y. S. T. Mikhael. Huang. Li. J. V. Journal of Pathology 201 (2003) 99-108. Dasari and M. T. Kobayashi. H. 51.31. Biospectroscopy 2 (1996) 155-165. Vigorita. Salman. C. Vibrational Spectroscopy 27 (2001) 165-173. H. Mantsch. T. Y. Wu. Y. Nguyen. P. 32. C. M. Kruglova and O. Mordechai. Yuasa. Kline and P. Lacelle. S. Che and W. 46. Diem. X. Mansfield. E. W. Z. Wong. Application of FTIR microspectroscopy for the follow-up of childhood leukemia chemotherapy 4491 (2001) 243-250. Senterman. E. L. W. Erukhimovitch. R. Murphy. B. L. Utzinger. Malpica. Y. G. Huang. H. Ohoshima. Dwyer. X. Gotou. J. W. Eckel. Weng. Ling. O. Kwiatek. Z. Senterman and N. Zhang. Kapelushnik C. Talanta 53 (2000) 233-246. Myles. M. 33. Shi and J. Biospectroscopy 5 (1999) 117-126. Morimoto. S. Brown. I. Levi. Zarou. Follen and R. D. A. O. L. Y. G. Choo. Yano. Fukuyama. L. Watson. P. Guan. Manfait and A. S. L. M. Z. M. H. Clinical Chemistry 51 (2005) 346-350. S. Mordechai. S. C. I. Huo. Erukhimovitch. P. 34. Fung. G. J. Pashchuk. X. Zelig and S. R. Yang. A. M. N. Shohat. Moriguchi and H. N. Pizzi. Yang. M. M. El Haj. 37. 36. Journal of Molecular Structure 565 (2001) 329-334. Jackson. Journal of Raman Spectroscopy 33 (2002) 552-563. J. C. S. J. V. Andrus and R. L. L. K. F. K. H. Dovbeshko. 54. Haka. Sun. S. Wang. I. Redd. Y. S. Sato. P. P. W. Yoshida. Sahu. N. S. J. P. Yang. C. Shafer-Peltier. F.

L. Johnson. McMillan. V. Tarumi. Tryndiak. Journal of Raman Spectroscopy 35 (2004) 939-946. Jalkanen. Shimada. E. R. Goldman and P. C. Jurgensen. M. Claussen. Cozzolino. I. A. Canadian Mineralogist 42 (2004) 1275-1282. Proceedings of the National Academy of Sciences of the United States of America 87 (1990) 8140-8144. G. R. S. T. M. Murakami. J. Rigas and P. 73. A. 75. Richter. P. Lithos 55 (2001) IX-XI. G. Journal of Materials Science-Materials în Medicine 5 (1994) 775-778. Andersen. M. Piccinini. Dovbeshko. Giusti. Mossoba. Water în Nominally Anhydrous Minerals 62 (2006) 155-167. Joe. F. P. Mauer. J. Rossman. Bellatreccia and M. Lima and J. Rahim. 67. A. Salzer. Fry. M. B. Wysoczanski and K. J. G. V. Cynkar and P. Al-Khaldi. V. Libowitzky and G. A. T. J. I. Schieber. E. A. Brilli. L. C. M. Kirkwood. T. 69. A. H. G. A. I. Della Ventura. Cancer Research 52 (1992) 84-88. Libowitzky H. Webster. 61. Elements 1 (2005) 19-24. Nielsen. 66. M. K. Holdstock. Water în Nominally Anhydrous Minerals 62 (2006) 117-154. 59. 72. Binoy. U. Fugel. Food Chemistry 116 (2009) 761-765. Dambergs. M. M. Vardin. Piccinini. I. Rehman. G. Niehaus. Johannsen. Y. J. R. Sedman and A. International Journal of Quantum Chemistry 106 (2006) 1160-1198. 70. T. R. G. G. H. M. Wong. R. Jung. D. H. S. 71. Hammody and S. Keppler and S. N. Jayakumar. M. Salman. M. P. M. R. 58. H. 64. Steiner. Rigas. Smith. 60. Infrared and NIR raman spectroscopy în medical microbiology 3257 (1998) 245-257. Naumann H. Gridina. 81. Frimand and S. B. F. S. Biopolymers 67 (2002) 470-486. H. K. Journal of Volcanology and Geothermal Research 156 (2006) 302-314. Physics în Medicine and Biology 48 (2003) 2373-2390. J. Rendiconti Lincei-Scienze Fisiche E Naturali 19 (2008) 141-159. K. S. 74. Nieminen. Todor and C. Linnen. 79. A. Rodriguez-Saona and M. Arimoto and Y. Wade. M. T.57. Wong. F. Degtyarenko. S. Burke. He. Sterner. R. Mordechai. R. F. 65. I. 159 . O. L. J. I. Keppler. F. Journal of Agricultural and Food Chemistry 55 (2007) 4443-4452. Chegel. Mineral. Bellatreccia. M. R. M. M. 77. 83. R. Suhai. J. Vibrational Spectroscopy 28 (2002) 103-110. Carle and A. Mag. D. W. Shirshov. T. A. Water în natural mantle minerals II: Olivine. P. Yamada. F. Erukhimovich. American Mineralogist 93 (2008) 1538-1544. Abu-Id. 82. B. Tani. M. G. Ozen and L. F. Smith and I. M. Piccinini. Knapp-Mohammady. Volatiles în Magmas 30 (1994) 67-121. B. T. Repnytska. Journal of Biochemical and Biophysical Methods 50 (2002) 111-121. A. J. Herrmann. Hervig and P. Z. V. Della Ventura. I. Food Chemistry 108 (2008) 742-748. 62. V. R. A. 78. Bergmann. J. Ramesh. Tay. M. Tamura. E. 63. Skogby. Mantsch. H. Cavallo and M. R. Morgello. H. Abraham. Jensen. F. De Vivo. 73 (2009) 399-413. H. A. D. S. A. D. 80. Della Ventura. 76. Bellatreccia and M. Rodig and B. W. Y. L. Huleihel. garnet and accessory minerals 62 (2006) 169-191. Physics and Chemistry of Minerals 23 (1996) 319-327. Solyanik. 68. T. F. Frezzotti and E. R. Beran and E. Ihinger. Nardi. Trends în Food Science & Technology 16 (2005) 433-441. Pettit and O. Ismail. R. Vibrational Spectroscopy 38 (2005) 229-235.

............................ procesul se numeşte fluorescenţă... molecula dezexcitându-se............................... Energia stării excitate nu poate fi menţinută decât o perioadă foarte scurtă.......... Tehnica experimentală ............... se numesc molecule fluorescente sau fluorofori....... Din aceeaşi clasă fac parte şi fosforescenţa şi fosforescenţa întârziată......... aceasta poate trece într-o stare electronică excitată (cu energie mai mare) în urma absorbţiei de energie de la radiaţia luminoasă...................... deci nu emit radiaţie de fluorescenţă........ Bibliografie ........ Aplicaţii ale spectrofluorimetriei ................... Dana Maniu Cuprins 1................... De aceea ele 160 .................................. Prin absorbţie de radiaţie luminoasă moleculele pot fi excitate prin trecerea unui electron de pe nivelul fundamental pe un nivel excitat. 171 1.................... În starea electronică fundamentală moleculele fluorescente se află într-o configuraţie stabilă...... 164 3..... Avantajele spectrofluorimetriei ..... Energia acestor nivele depinde de energia (lungimea de undă) radiaţiei luminoase care produce excitarea......................................V............. Consideraţii teoretice Fluorescenţa este un fenomen de fotoluminiscenţă (procesul prin care substanţele absorb lumină şi după aceea reemit lumină cu o lungime de undă diferită)........ dr. 160 2......... Consideraţii teoretice........ Există o mulţime de nivele vibraţionale ale stării electronice excitate pe care se poate afla o moleculă fluorescentă...................................... Moleculele fluorescente sunt instabile atunci când se află pe un nivel vibraţional al stării electronice excitate................ Atunci când radiaţia luminoasă ajunge pe o moleculă fluorescentă.. 166 4. Dacă molecula se dezexcită (electronul trece din starea excitată în starea fundamentală) prin emisie de lumină....................... 169 6.............................................................. Moleculele care au această proprietate............................. 166 5................... SPECTROFLUORIMETRUL Spectrofluorimetria Conf................................... Aparatura disponibilă ...

Această proprietate face ca fluorescenţa să fie o tehnică foarte senzitivă (chiar şi o mică cantitate de substanţă poate fi detectată). pot trece în prima stare de triplet (T1).10-11 s). I) sau la metale. relaxarea vibraţională se face prin pierderea de energie în urma ciocnirilor dintre molecule (10-14 .moleculele aflate pe diferite nivele vibraţionale se relaxează pe nivelul fundamental al stării electronice respective. care este semi-stabilă. făcându-se prin ciocnirea cu alte molecule. După acest interval. pierderea de energie este neradiativă. sunt posibile următoarele procese (ilustrate în figura 1): .trec în cea mai joasă stare electronică excitată. Radiaţia luminoasă de fluorescenţă are energie mai mică decât radiaţia luminoasă absorbită de moleculă. De fapt. care să excite molecula. În urma absorbţiei unui foton de către o moleculă. . O radiaţie luminoasă de mare intensitate poate provoca modificarea structurii moleculei fluorescente.conversia internă (IC) . moleculele fluorescente sunt instabile structural în intervalul de timp cât se află în stare de excitaţie (timpul de viaţă).intersystem crossing (ISC) . astfel încât aceasta să nu mai emită radiaţie de fluorescenţă. deci procesul descris mai sus poate fi repetat. deci emisia de fosforescenţă poate continua şi după încetarea iradierii iniţiale. În realitate. Acest proces este numit “photobleaching“.unele molecule aflate în prima stare electronică excitată. Acest proces se poate observa la atomii grei (Br. deoarece înseamnă că o moleculă poate emite radiaţie de fluorescenţă de mai multe ori. De obicei fosforescenţa apare doar la temperaturi scăzute sau în medii cu vâscozitate mare (dezexcitatea nivelului T1 se poate face şi prin conversie internă sau alte procese neradiative). Deci lungimea de undă a radiaţiei emise este totdeauna mai mare decât lungimea de undă a radiaţiei absorbite datorită energiei pierdute de moleculă în timpul trecerii pe cea mai joasă stare electronică excitată.fosforescenţa . 161 . ceea ce face posibilă degradarea ei. Molecula fluorescentă poate absorbi energie luminoasă din nou. procesul de fluorescenţă este ciclic şi are loc atâta timp cât există o radiaţie luminoasă. stare de singlet (S1). Timpul de viaţă a unei stări excitate de triplet poate ajunge până la 10 s. Intervalul de timp în care o moleculă fluorescentă se află în stare excitată se numeşte “timp de viaţă“ şi are o valoare foarte mică (între 10-15 şi 10-9 s). excesul de energie dintre cele două stări regăsindu-se în energia radiaţiei luminoase emise în procesul de dezexcitare.moleculele aflate în starea de triplet pot să se dezexcite prin emisia unui foton. O tranziţie triplet-singlet este mult mai puţin probabilă decât o tranziţie singlet-singlet. moleculele fluorescente trec din stare electronică excitată în stare electronică fundamentală. . Acest fapt este deosebit de util.

moleculele fluorescente au spectre de absorbţie şi de fluorescenţă caracteristice. . Majoritatea moleculelor nu sunt fluorescente deoarece starea excitată S1 se suprapune cu nivelele vibraţionale ale stării fundamentale S0.fluorescenţa. Diagrama Perrin-Jablonski. Fluorescenţa de tip Stokes reprezintă emisia de fotoni cu lungime de undă mai mare (frecvenţă mai mică) de către o moleculă ce a absorbit fotoni cu o lungime de undă mai mică (frecvenţă mai mare). Atât absorbţia cât şi emisia de fluorescenţă sunt unice pentru fiecare moleculă. Fluorescenţa poate să apară doar în timpul absorbţiei (timpul de viaţă a unei stări excitate de singlet este între 10-9 şi 10-15 s). este proprietatea moleculelor de a emite radiaţie electromagnetică la trecerea de pe prima stare excitată de singlet S1 pe un nivel vibraţional al stării electronice fundamentale S0. În acest caz relaxarea vibraţională este mai rapidă decât relaxarea prin fluorescenţă. Fluorescenţa observată cu ajutorul spectrofluorimetrelor este cunoscută ca Fluorescenţa de tip Stokes. 162 . valoarea maximă fiind 1. Lumina emisă are totdeauna lungime de undă mai mare decât lumina absorbită (figura 2).Figura 1. Fluorescenţa se poate măsura cu ajutorul eficienţei cuantice Q (randament cuantic): Q = (numărul de fotoni emişi) / (numărul de fotoni absorbiţi) Q are o valoare fixă pentru fiecare moleculă (pentru aceleaşi condiţii). De aceea.

Curba de calibrare 163 . Intensitatea radiaţiei fluorescente este proporţională cu intensitatea radiaţiei absorbită de o moleculă fluorescentă: F = K'(I0-I) unde I0 este intensitatea radiaţiei incidente pe probă. I este intenstitatea radiaţiei după ce a traversat un strat de substanţă de lungime b. iar K' este o constantă ce depinde de condiţiile experimentale şi de eficienţa cuantică a fluorescenţei. unde A = bcε este absorbanţa. Dacă ţinem cont de legea Beer: I/I0 = 10-εbc . Spectru de fluorescenţă (emisie) şi de absorbţie (excitaţie) caracteristic.Figura 2. atunci printr-o simplă înlocuire se obţine legea fluorescenţei: F = K' I0 (1 .10-εbc) Figura 3.

05) termenii de ordin superior pot fi consideraţi nuli. monocromator a radiaţiei excitatoare. Un fluorimetru măsoară abilitatea unei probe de a absorbi lumină la o anumită lungime de undă şi de a emite lumină la o lungime de undă mai mare. Fluorimetrele se folosesc pentru măsurători cantitative pentru compuşi specifici (măsurători de rutină). deci putem scrie: F = 2. orice spectrofluorimetru modern este interfaţat cu un computer cu ajutorul căruia se setează parametrii de măsurare. Pentru o concentraţie mai mare decât c1 curba de calibrare nu mai este liniară. camera probei. Spectrofluorimetrele folosesc două monocromatoare. Bineînţeles.. 2. detector (figura 4). Semnalul detectat poate fi reprezentat în funcţie de cele două lungimi de undă sau numai în funcţie de una din cele două lungimi de undă. Tehnica experimentală Pentru a măsura fluorescenţa există două tipuri de instrumente: fluorimetre şi spectrofluorimetre. iar celalalt analizează lungimea de undă a radiaţiei de fluorescenţă (emise). monocromator al radiaţiei emise. se înregistrează şi se prelucrează datele. Dacă folosim o descompunere în serie Taylor. Radiaţia emisă este colectată la un 164 .3·K'·ε·b·c·I0 Relaţia de mai sus ne arată ca pentru concentraţii suficient de mici intensitatea de fluorescentă este proporţională cu concentraţia şi cu intensitatea radiaţiei excitatoare la frecvenţa de absorbţie.3 ⋅ ε ⋅ b ⋅ c)3 − . Primul monocromator analizează lungimea de undă a radiaţiei excitatoare.⎤ F = K ' I 0 ⎢2. unul pentru lumina excitatoare şi unul pentru radiaţia de fluorescenţă emisă. Părţile principale ale unui spectrofluorimetru sunt: sursa.3 ⋅ ε ⋅ b ⋅ c − ⎥ 2! 2! ⎣ ⎦ Dacă εbc are o valoare suficient de mică (< 0. avem: ⎡ (2. intensitatea radiaţiei de fluorescenţă nu depinde liniar de concentraţie. proprietăţile fluorescente ale probei pot fi scanate pentru un domeniu larg de lungimi de undă ale radiaţiei excitatoare (200-1000 nm).. Avantajul spectrofluorimetrelor este faptul că permit variaţia controlată a lungimii de undă a radiaţiei excitatoare.3 ⋅ ε ⋅ b ⋅ c)2 + (2..Spre deosebire de legea Beer. Astfel.

165 .unghi de 90° faţă de radiaţia excitatoare pentru a preveni orice interferenţă între radiaţia excitatoare şi cea emisă. Acesta descompune radiaţia de fluorescenţă emisă de probă în culorile componente. lichide şi gazoase. Detectorul este poziţionat la ieşirea din cel de-al doilea monocromator. sau pentru controlarea temperaturii probei. Schema bloc pentru un spectrofluorimetru Sursa unui spectrofluorimetru emite în domeniul UV şi vizibil (de obicei se folosesc lămpi cu Xenon). cât şi lungimea de undă a acesteia este monitorizată şi controlată cu ajutorul unui fotodetector suplimentar situat între monocromator şi camera probei. Prin fanta de ieşire a monocromatorului radiaţiei excitatoare iese lumină cu lungimea de undă dorită. Fanta de intrare este ajustabilă continuu (cu ajutorul soft-ului) pentru a se asigura maximul de rezoluţie şi reproductibilitate. sursă monocromator detector probă monocromator Figura 4. Primul monocromator descompune radiaţia excitatoare în culorile componente. Deoarece radiaţia de fluorescenţă are totdeauna lungime de undă mai mare decât radiaţia excitatoare. Atât intensitatea luminoasă a radiaţiei incidente. sau poate să se modifice continuu pe tot domeniul de emisie al sursei. Camera probei este de obicei destul de spaţioasă. pentru a permite instalarea diferitelor accesorii pentru probe solide. elementul dispersiv al celui de-al doilea monocromator este astfel conceput încât să aibă maximul de eficienţă în domeniul vizibil. Astfel radiaţia luminoasă incidentă pe probă poate să aibă lungime de undă fixă pentru tot timpul măsurătorii. Lumina emisă de sursă este focalizată pe fanta de intrare a primului monocromator cu ajutorul unei oglinzi sferice sau eliptice. Lumina emisă de probă este focalizată pe fanta de intrare al celui de-al doilea monocromator.

sau chiar dacă au fluorescentă este puţin probabil ca două substanţe să absoarbă şi să emită radiaţie de fluorescenţă în acelaşi domeniu. Această extraordinară senzitivitate permite detecţia sigură a substanţelor fluorescente (clorofilă. Avantajele spectrofluorimetriei Senzitivitatea: Limitele de detecţie depind în mare măsură de proprietăţile probei de măsurat. Aplicaţii ale spectrofluorimetriei Medicină şi farmacologie Sensitivitatea deosebită a spectroscopiei de fluorescenţă. Tehnicile spectrofotometrice au probleme de interferenţă deoarece multe materiale absorb lumina. Spectrofluorimetrele au limite de detecţie mult mai bune decât spectrofotometrele. Domeniu de concentraţie: Intensitatea semnalului de fluorescenţă este direct proporţional cu concentraţia substanţei fuorescente pe un domeniu larg. Astfel. Datele obţinute în urma măsurătorilor efectuate se pot prelucra cu ajutorul programelor speciale. Fluorescenţa oferă informaţii asupra dinamicii. Spectrofluorometrele au o specificiate ridicată şi apar mult mai puţine probleme de interferenţă deoarece substanţele fluorescente pot fi incluse în solvenţi sau matrici care nu sunt fluorescente. ceea ce face dificil izolarea semnalului de la materialul de analizat din matricea în care se află. face ca această tehnică să fie folosită atât pentru cercetări avansate cât şi pentru analize de rutină sau controlul calităţii în domeniile farmaciei şi medicinii. Fluorimetria poate fi folosită pe un domeniu mare de concentraţii fără a fi nevoie de diluţia eşantioanelor sau de modificarea celulei în care se pune eşantionul.) folosind probe foarte mici. studiile pot fi efectuate în soluţii apoase fără a fi nevoie ca probele să fie tratate. Pentru multe substanţe fluorescente este obişnuită o limită de detecţie de părţi/miliard sau chiar părţi/triliard. prin intermediul computerului se pot seta toţi parametri necesari derulării diferitelor tipuri de măsurători. De asemenea. etc. Senzitivitatea şi specificitatea mare a acestei tehnici reduce sau chiar elimină procedurile de preparare a probelor. 4. rigidităţii şi structurii proteinelor. hidrocarburi aromatice.Toate spectrofluorimetrele moderne sunt controlate de computer. vi166 . Viteză şi simplitate: spectrofluorimetria este o tehnică analitică relativ simplă. Specificitatea: Spectrofotometrele măsoară doar lumina absorbită. 3.

mucegaiuri.momentul de dipol al stării excitate .efectul general de solvent .ruşilor.reacţia la diferite suprafeţe Industria alimentară şi agricultura În industria alimentară este importantă îmbunătăţirea calităţii nutriţionale a alimentelor. pentru detectarea diferitelor substanţe sunt necesare tehnici de mare senzitivitate şi selectivitate care să evite multiplele surse de interferenţă. Culturile de bacterii ce pot să apară pe alimente sunt distructive şi periculoase datorită potenţialului de contaminare şi îmbolnăvire pe care îl au. mutageni sau substanţe canceroase. a apei şi a solului prin detectarea urmelor de substanţe organice sau inorganice. Deoarece probele preluate din mediul înconjurător sunt deosebit de complexe. Prin determinări de fluorescenţă pot fi determinate: . toxine.efectul prezenţei atomilor grei . fapt ce are deosebite aplicaţii în imunologie. şi chiar pesticide utilizate în mod normal pentru a preveni răspândirea unor boli. Fluores167 . Cu ajutorul fluorescenţei se poate identifica prezenţa unui număr foarte mare de analiţi chiar dacă aceştia sunt în cantităţi foarte mici (sub picomolar). pot fi elaborate metode şi teste de rutină pentru analizele de laboratoar. Calitatea ambalajelor este de asemenea importantă atât ca membrană protectoare împotriva oxidării alimentelor cât şi datorită faptului că sunt o posibilă sursă de contaminare cu urme de plastic sau de polimeri. creşterea termenului de garanţie precum şi a calităţii ambalajelor. Mediul înconjurător Cu ajutorul fluorescenţei se poate monitoriza calitatea aerului. microorganisme. După ce sunt determinate caracteristicile de bază (excitaţie. etc.efectul temperaturii . emisie. Pentru a asigura calitatea produselor alimentare. De asemenea măsurătorile de fluorescenţă 3D sunt folosite pentru determinarea surselor geologice a diferitelor eşantioane de petrol. Spectrele de fluorescenţă 3D pot fi folosite ca o amprentă unică care duce la identificarea calitativă a compuşilor. Chimia analitică În chimia analitică se studiază spectrele de luminescenţă precum şi eficienţa cuantică a speciilor flourescente în funcţie de matriţa în care sunt puse. AND-ului. producătorii trebuie să identifice contaminanţi. randament cuantic) ale unei substanţe fluorescente.timpul de viaţă şi randamentul cuantic .

tehnică mai avantajoasă decât cea clasică în care se măsoară intensitatea absolută de fluorescenţă la o singură lungime de undă. . identificarea şi controlul tumorilor. 168 . Fabricanţii de instrumentar medical şi clinic studiază sistemele invazive pe bază de fibre optice (ce pot fi introduse în interiorul arterelor sau a altor orificii).mecanismul molecular de transfer prin membrana de proteină a bacteriorhodopsinei (o membrană integrală de proteină care acţionează ca o pompă de protoni . emolientele pe bază de lipide şi cremele anti-rid. Biologie celulară În studiul proceselor biologice sunt implicaţi o largă varietate de markeri fluorescenţi. înălbitorilor optici şi suprafeţelor fosforescente.caracterizarea substanţelor fotoreceptoare (flavine. a plascticelor. etc). vitaminelor.conversia biologică de energie în fotosinteza plantelor verzi. Companiile de cosmetice şi produse pentru îngrijirea sănătăţii evaluează eficacitatea unor noi produse cum ar fi loţiunile pentru protecţie solară.cenţa poate fi folosită şi în determinarea randamentului şi calităţii anumitor culturi în urma aplicării fertilizatorilor. şi a altor substanţe biologice. Aplicaţiile fotochimice ale fluorescenţei includ: .terapia fotodinamică . Una din tehnicile cele mai folosite în acest domeniu este determinarea raportului dintre intensităţile semnalului de fluorescenţă emis de markerul folosit la diferite lungimi de undă. Fotochimie Mecanismul absorbţiei luminii precum şi proprietăţile fotofizice ale unei substanţe determină rolul său în procesele biologice şi chimice. hormonilor. . Industrie Producătorii folosesc fluorescenţa pentru a monitoriza calitatea vopselelor. . a polimerilor. proteinelor.folosirea "quantum dots"-urilor ca probe biologice în diagnosticarea cancerului şi studierea ţesuturilor. carotenoide. Aceştia pot fi caracterizaţi cu ajutorul spectrelor de fluorescenţă de excitaţie şi de emisie. pentru analiza medicamentelor. . fluorescenţa este folosită ca instrument de cercetare în domeniul biotehnologiilor. De asemenea.o tehnică pentru localizarea.capturează energie luminoasă şi o foloseşte pentru a transfera protoni în exteriorul celulei).

măsurători de cinetică. lichide şi gazoase).determinarea stabilităţii intensităţii de fluorescenţă în timp.măsurători la lungimi de undă fixă. Spectrofluorimetrul este echipat cu accesorii pentru modificarea controlată a temperaturi probei şi pentru polarizarea luminii incidente. Aparatura disponibilă Spectrofluorimetru Jasco FP 6500 Spectrofluorimetrul Jasco 6500 are următoarele caracteristici: Sursa este o lampă cu xenon de 150 W dotată cu un fotomultiplicator ce monitorizează şi compensează orice variaţie în intensitate asigurându-se astfel maximul de stabilitate.determinarea concentraţiei de substanţă fluorescentă (analiză cantitativă).000 nm/ min pentru ambele monocromatoare. Fantele monocromatoarelor au dimensiuni reglabile. Cele două monocromatoare sunt echipate cu reţele de difracţie holografice concave (1500 trăsături/mm) cu unghi de "blaze" optimizat. . Cu ajutorul spectrofluorimetrului Jasco 6500 pot fi efectuate următoarele tipuri de măsurători: . ceea ce asigură maxim de senzitivitate pe întregul domeniu de lungimi de undă (200-850 nm). precum şi cu suporturi pentru diferite tipuri de probe (solide.rezoluţia monocromatoarelor este de 1 nm. atât ca lăţime cât şi ca înălţime.determinarea timpului de viaţă în cazul probelor fosforescente. . . .zgomot este 200:1 sau mai mare. . .raportul semnal . .5.acurateţea lungimii de undă este ±2 nm pentru ambele monocromatoare.determinarea spectrului de fluorescenţă a unei probe.viteza de scanare este între 20 şi 10. .măsurători 3D de fluorescenţă. Alte caracteristici ale spectrofluorimetrului Jasco FP 6500 sunt: . . Calibrarea spectrofluorimetrului se face cu ajutorul kit-ului inclus ce utilizează ca probă standard Rodamina B.determinarea spectrului de fosforescenţă a unei probe. 169 . .

Rezultatele măsurătorilor probelor de concentraţie necunoscută vor fi date în unitatea de măsură de concentraţie în care a fost construită curba de calibrare. Astfel. Se face citirea la o lungime de undă selectabilă într-un interval de timp selectabil. fie pe emisie. la viteze diferite de scanare. Modul "3D Fluorescence measurements" permite măsurarea în acelaşi timp a (i) spectrului de fluorescenţă a unei probe în timp ce se modifică lungimea de undă a radiaţiei excitatoare şi (ii) măsurarea spectrului de excitaţie în timp ce se modifică lungimea de undă de emisie. Se pot face spectre de excitaţie sau de emisie. fapt deosebit de util pentru probe necunoscute. se pot face spectre pe tot domeniul sau pe un domeniu selectat de utilizator. respectiv de emisie.Controlul acestor măsurători se face folosind programul "Spectra manager" Modul "Quantitative analysis": pentru a efectua o analiză cantitativă trebuie trasată o curbă de calibrare. Această acţiune presupune măsurarea soluţiilor etalon. Modul "Spectrum measurement" permite măsurarea fluorescenţei probelor prin scanare de spectru. construirea şi stocarea curbei de calibrare. selectabile fie pe excitaţie. 170 .) Analiza acestor spectre permite determinarea poziţiei maximului de excitaţie şi de emisie. Se obţin spectre tridimensionale (pe o axă este reprezentată intensitatea semnalului de fluorescenţă şi pe celelalte două axe avem lungimea de undă de excitaţie. Modul "Fixed wavelength measurement" permite efectuarea măsurării fluorescenţei probelor la maxim 4 lungimi de undă simultan. Modul "Time course measurement" permite verificarea stabilităţii în timp a intensităţii fluorescenţei soluţiilor.

Ed.Modul "Phospho. 2006 http://www. 3.com/Products/Spectroscopy/FP-6000-Series-Spectrophotom eters.jascoinc. 2. Bibliografie 1. Principles of Fluorescence Spectroscopy. 6. Springer. Ed. Bernard Valeur. spectrum measurement" permite măsurarea spectrului de fosforescenţă al probelor. Wiley-VCH. Molecular Fluorescence: Principles and Applications.aspx 171 . 2002 Joseph Lakowicz.

.... 176 2..................... cum ar fi difuzia rotaţională. Dana Maniu Cuprins 1........................................ 180 3.......... Multe evenimente macromoleculare... Deoarece timpul de viaţă de fluorescenţă a unei molecule este foarte sensibil la vecinătatea sa moleculară...... apar pe aceeaşi scară temporală cu emisia de fluorescenţă........3. Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur.. pentru a obţine informaţii chimice mai amănunţite trebuie determinată variaţia în timp a fluorescenţei............................ 175 2.... Astfel............2..........1.................................... 172 2...... transferul rezonant de energie şi stingerea dinamică........ Microscopia de fluorescenţă avansată ............................... Determinarea interacţiunii dintre albumina bovină şi nanoparticule de aur ..... spectroscopia de fluorescenţă în timp real poate fi utilizată pentru a investiga aceste procese şi a obţine informaţii despre vecinătatea chimică a fluoroforului.....Spectrofluorimetria ......... 184 3......3......................aplicaţii Conf..2................................................................................................... Fluorescenţa în timp real furnizează mai multe informaţii despre moleculele ce se află în imediata vecinătate a fluoroforului......................... Este important să ne amintim că timpul de viaţă de fluorescenţă este timpul mediu pentru ca o moleculă să rămână în stare excitată înainte de a emite un foton............................ Unele molecule excitate vor emite radiaţie de fluorescenţă înainte de durata 172 ................................ Fluorescenţa în timp real Deşi măsurătorile normale de fluorescenţă pot fi folosite ca o sondă non-invazivă extrem de selectivă şi sensibilă................... în urma modificărilor de temperatură şi pH..1.... Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) ................................................. 187 4.... 174 2....... 180 3.... Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) .............. ........... Exemple de aplicaţii ale spectrofluorimetriei ...................... determinarea acestui timp de viaţă este deosebit de util în determinarea stării fluoroforului. Microscopia confocală de fluorescenţă ................................................ Bibliografie ........... Fluorescenţa în timp real ................................................. 178 3....................................... Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului .. 190 1.............. dr........ Fiecare moleculă individuală emite aleatoriu după excitaţie............

cristalele neliniare sunt confecţionate din potasiu-dihidrogen-fosfat (KDP) sau borat de bariu (BBO). ceea ce ne demonstrează că există o coincidenţă temporală şi spaţială între ω1 şi ωfl. Cu cât este mai mare decalajul temporar dintre pulsul ω1 şi emisia de fluorescenţă ωfl. fiind separat de fundamentală cu ajutorul unui divizor de undă dicroic. De obicei. Pulsul de frecvenţă ω1 trece printr-un dispozitiv optic ce produce o întârziere de fază (optical delay line). cristalul trebuie rotit la diferite unghiuri. Pentru o poziţie dată a cristalului. iar pulsul de frecvenţă ω2 este focalizat pe probă (flow cell). Intensitatea Isum a pulsului cu frecvenţa ωsum pentru un anumit decalaj temporar între pulsul de frecvenţă ω1 şi emisia de fluorescenţă de frecvenţă ωfl este proporţională cu funcţia de corelaţie dintre intensitatea de fluorescenţă Ifl şi intensitatea I1 a pulsului de frecvenţă ω1: I sum (τ ) ≈ ∫ I fl (t ) I1 (t − τ )dt −∞ ∞ În acest fel se poate determina dependenţa intensităţii de fluorescenţă de timp prin modificarea timpului de întârziere (prin intermediul dispozitivului "optical delay line"). Armonica a doua a acestui puls (frecvenţa ω2) este generat într-un cristal neliniar. O sursă laser emite un puls ultra scurt (de ordinul femtosecundelor) cu lungimea de undă λ1 corespunzătoare frecvenţei ω1. deşi în unele cazuri pot avea ordinul sutelor de nanosecunde sau să fie mai mici decat 1 ns (sute de femtosecunde). în general. Emisia de fluorescenţă incoerentă emisă de probă este colectată şi mixată cu pulsul de frecvenţă ω1 într-un cristal neliniar. Deci dacă interesează întreg domeniu de fluorescenţă. cu atât intensitatea de fluorescenţă este mai mică. iar alte molecule excitate vor emite radiaţie de fluorescenţă mult timp după durata medie de viaţă.medie de viaţă. numai pentru un domeniu îngust din spectrul de fluorescenţă apare coincidenţa temporală şi spaţială cu pulsul de frecvenţă. 173 . Din această cauză este foarte important ca aparatura experimentală folosită pentru acest tip de masurători să aibă rezoluţie temporală foarte bună. Cristalele din borat de bariu au avantajul transparenţei în UV şi eficienţei cuantice mai mare (cu un factor de 4-6). de ordinul 1-10 ns. Această mixare ("fluorescence up-conversion") generează lumină cu frecvenţa ωsum = ω1 + ωfl . În figura 1 este prezentat un montaj experimental folosit pentru determinări de fluorescenţă în timp real. Timpii de viaţă de fluorescenţă sunt.

).) şi a proceselor intermoleculare (elctron transfer etc. CCD . Profunzimea de câmp a unui microscop convenţional cu fluorescenţă este 2-3 µm.placă semi-undă. fluorescenţa în timp real a fost folosită cu succes în studii ale proceselor biologice care au loc în prezenţa luminii (proteina galbenă fotoactivă.numărător) Măsurătorile de fluorescenţă în timp real sunt foarte potrivite pentru investigarea proceselor intramoleculare fotoinduse (charge transfer.coupled device). De asemenea. a unui film fotografic sau a unei camere cu detector CCD (charge. dar este de asemenea folosită pentru a studia diferite sisteme chimice cum ar fi coloizi. BBO -cristal neliniar. Set-up experimental pentru fluorescenţă în timp real (Mialocq and Gustavsson. Un microscop de fluorescenţă convenţional diferă de un microscop standard prin faptul că este folosită o sursă de lumină (lampă cu mercur sau oxigen) ce emite şi în domeniu UV.oglindă dicroică. colorarea fibrelor etc. M .). Lungimea de undă de excitaţie este selectată cu ajutorul unui filtru de interferenţă sau a unui monocromator. HW .fotomultiplicator. cristale lichide. 2.filtru. lockin . Observarea emisiei de fluorescenţă poate fi efectuată cu ajutorul ochiului observatorului. proton transfer etc. Microscopia de fluorescenţă avansată Microscopia de fluorescenţă convenţională este folosită. proteina verde fotoactivă etc. în principal. proteina albastră fluorescentă. mixturi polimerice. GG420 . PM . (DM . 174 . pentru a investiga celulele şi ţesuturile vii.monochromator. 2001).Figura 1. iar rezoluţia maximă este aproximativ egală cu jumatatea lungimii de undă a radiaţiei folosite la excitare.cameră video. fotodegradarea polimerilor naturali.

În acest caz imaginea se poate îmbunătăţi cu ajutorul computerului. Una din caracteristicile microscopiei confocale de fluorescenţă este faptul că se pot obţine imaginile unor straturi cu o grosime bine definită. Microscopia confocală de fluorescenţă În cazul unui microscop confocal.În cazul în care proba este mai subţire decît valoarea profunzimii de câmp. Deoarece în microscopia confocală de fluorescenţă se colectează numai 175 . Emisia de fluorescentă produsă de proba situată în afara planului de focalizare nu va trece prin fanta multiplicatorului deoarece se va lovi de tubul ocularului (figura 2). fasciculul de lumină este focalizat pe probă. imaginea este neclară datorită defocalizării. prin folosirea microscopiei optice în câmp apropiat (near-field scanning optical microscopy (NSOM)) se poate lucra dincolo de limita de difracţie optică. deci prin deplasarea probei pe verticală se obţine imaginea tridimensională a acesteia. folosind o lentilă cu apertură numerică mare. grosimea secţiunilor confocale poate atinge limita teoretică de aproximativ 0. dar. Astfel. de obicei. cum ar fi microscopia confocală (confocal microscopy) sau microscopia prin excitaţia cu doi fotoni (two-photon excitation microscopy). De asemenea. 2.1. Figura 2. este de preferat folosirea altor tehnici.5 µm. Emisia de fluorescenţă este separată de lumina excitatoare cu ajutorul unei oglinzi dicroice şi este focalizată cu ajutorul lentilelor obiectivului pe fanta unui fotomultiplicator. Principiul microscopiei confocale (stânga) comparativ cu microscopia convenţională (dreapta).

Secţiunea eficace a procesului de absorbţie a doi fotoni este foarte mică (10-50 cm4·s/foton·moleculă pentu rodamina B). În consecinţă. determinarea distribuţiei potenţialului electric. absorbţia a doi fotoni din domeniul roşu poate excita o moleculă care absoarbe în domeniul UV. iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu două culori (two-color excitation fluorescence microscopy). Probabilitatea absorbţiei a doi fotoni depinde de coincidenţa temporală şi spaţială a fotonilor incidenţi (diferenţa dintre timpul în care cei doi fotoni ajung la fluorofor trebuie să fie sub 10-18 s). iar tehnica se numeşte microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy). de asemenea. cei doi fotoni absorbiţi sunt identici. atunci fotonii sunt diferiţi (1/λe = 1/λ1 + 1/λ2).o parte din fasciculul de fluorescenţă emis. Dacă se folosesc două lasere. microscopia confocală de fluorescenţă a fost folosită în studii din domeniul coloizilor. Excitaţia fluoroforului este. Dacă este folosit un singur laser. imagistica Ca2+. etc. fenomen numit photobleaching. Creşterea energiei fasciculului de excitare duce la descompunere fotochimică a fluoroforului. Microscopia de fluorescenţă folosind excitaţia cu doi fotoni (two-photon excitation fluorescence microscopy) În spectroscopia de fluorescenţă convenţională. energia de excitare necesară trebuie să fie mai mare decât în microscopia de fluorescenţă convenţională. 2. De exemplu. posibilă prin absorbţia simultană a doi fotoni de energie mai mică (lungime de undă mai mare) prin intermediul unei stări virtuale cu timp de viaţă foarte scurt (Figura 3). Microscopia confocală de fluorescenţă poate fi combinată cu tehnicile domeniu-timp şi frecvenţă-timp (time-domain. imagistica pH. vor fi excitaţi numai fluoroforii situaţi într-o 176 .2. frequency-domain) pentru a se obţine imagini din perioada numită timp de viaţă al fluoroforului (lifetime imaging). fluoroforul este excitat prin absorbţia unui foton a cărui energie corespunde cu diferenţa de energie dintre starea electronică fundamentală şi starea electronică excitată. Microscopia confocală de fluorescenţă este o tehnică utilizată pe scară largă în biologia celulară (vizualizarea celulelor. a cristalelor lichide şi a amestecurilor de polimeri. De asemenea. pentru a putea folosi unui fascicul excitator cu putere mai mică. Excitaţia cu doi fotoni este un proces neliniar.). Reducerea efectelor nedorite datorate fenomenului de photobleaching se face prin utilizarea de fluorofori stabili şi prin folosirea unui microscop confocal echipat cu detector cu sensibilitate mare şi obiectiv cu apertură numerică mare. absorbţia depinde de pătratul intensităţii luminii folosite la excitaţie.

peste 80% din intensitatea totală de fluorescenţă va fi emisă dintr-o zonă situată la 1 mm în jurul focarului. Comparaţie între excitaţia cu doi fotoni şi excitaţia cu un foton. Deşi efectul secţionării 3-D este comparabil cu cel din microscopia confocală. fenomenul de difuzie duce la scăderea intensităţii fasciculului de fluorescenţă emis din focar. ceea ce duce la creşterea adâncimii de penetrare a fasciculului excitator.1-1 femptolitri. Comparativ cu fluorometrele convenţionale.25 şi un fascicul de excitare având 780 nm.regiune unde fluxul de fotoni este foarte mare. Volumul de excitaţie este de ordinul a 0. în ambele tipuri de excitari (cu doi fotoni sau cu două culori). Excitarea cu două culori se foloseşte atunci când se doreşte observarea unor obiecte microscopice situate în medii puternic difuzante. Deci. în cazul excitarii cu două culori nu apare decât o creştere minimală a background-ului de fluorescenţă. 177 . în cazul excitării cu doi fotoni avem următoarele avantaje: (i) deoarece fasciculul de excitare este concentrat atât în timp cât şi în spaţiu nu apare fenomenul de photobleaching în afara focarului şi (ii) fasciculul excitator nu este atenuat de abosorbţia din afara focarului. nedorit. deci trebuie folosiţi laseri cu putere mare şi funcţionare în impulsuri. Excitarea cu doi fotoni permite obţinerea unei rezoluţii tridimensională deosebită în microscopia de fluorescenţă.) Deoarece intensitatea fasciculului de excitare variază cu pătratul distanţei de la planul focal. cum ar fi laserul cu Ti-safir. probabilitatea de absorbţie a doi fotoni în afara regiunii focale scade cu puterea a patra a distanţei. ceea ce duce la obţinerea unui contrast mai bun pentru obiecte de mici dimensiuni. acesta reprezintă o reducere a volumului de excitare de 1010 ori. Figura 3. (Linia punctată reprezintă starea virtuală care mediază absorbţia a doi fotoni. Folosind un obiectiv cu o apertură numerică de 1. Deşi. excitarea cu doi fotoni a fluoroforului poate avea loc doar în focar.

Principiul scanării în câmp apropiat (conform ideii lui Synge) Ideea de optică în "câmp apropiat" este atribuită cercetătorului E. Radiaţia luminoasă incidentă trece printr-o fantă cu dimensiuni sub-lungime de undă. care oferă avantajul de a furniza imagini normale şi permite ca regiunea de studiat să fie localizată cu rezoluţie mare. montat sub suportul pe care se află proba şi detec178 . Fanta acţionează ca o sondă luminoasă de dimensiune sub-lungime de undă care poate fi folosită pentru a lumina suprafaţa probei înainte ca lumina să fie difractată. care permite deplasarea pe verticală . Această tehnică are o rezoluţie spaţială foarte mare (de ordinal sub-micrometrilor) şi o sensibilitate foarte bună. Această limită poate fi depăşită prin utilizarea unei surse de lumină cu lungime de undă mai mică şi prin plasarea probei foarte aproape de această sursă (în câmp apropiat). H. Fasciculul laser trece printr-o fibră optică uni-modală la ataşată de un vârf special pentru determinările în câmp apropiat (vârf NSOM). care permite deplasarea ei în planul xy. astfel încât fasciculul emergent este forţat să interacţioneze cu proba. Synge (figura 4). Suprafaţa probei este poziţionată în imediata apropiere a fantei. Limita de rezoluţie este de aproximativ λ/2. Vârful este montat într-un cap piezo. Microscopia de fluorescenţă prin scanare optică în câmp apropiat (NSOM) Rezoluţia unui microcop convenţional este limitată datorită fenomenelor de interferenţă şi difracţie.3. Majoritatea instrumentelor NSOM sunt construite în jurul unui microscop cu fluorescenţă inversat. Figura 4. iar emisia de fluorescenţă este colectată de obiectivul cu apertură numerică mare. unde λ este lungimea de undă a sursei de luminii.2.axa Oz). de tip NSOM (Figura 5). Proba se află pe un suport piezo. Lumina din vârful NSOM ataşat fibrei optice excită proba.

(polimeri electroluminiscenţi. localizarea proteinelor. cartografierea cromozomilor şi microstructura membranelor. Acest lucru poate fi realizat cu ajutorul feedback-ului bazat în general pe metoda de forţă-forfecare: vârful este intercalat lateral la una dintre frecvenţele sale de rezonanţă cu o amplitudine de aproximativ 2-5 nm. etc. cristale lichide. Cu ajutorul tehnicii NSOM au fost investigate cu succes sisteme fotosintetice.mod iluminare. 179 . Acest mod este numit modul iluminare. Tehnica NSOM este remarcabilă pentru analiza filmelor subtiri. în modul colectare. forţele de forfecare atenueză amplitudinea vibraţiilor acestuia. Sistemele care scanează piezo şi înregistrează imaginile sunt similare cu cele utilizate în microscopia de forţă atomică.). Figura 5. Microscopia de fluorescenţă prin scanare optică în câmp apropiat poate oferi noi perspective în studiul sistemelor biologice complexe din cauza rezoluţiei mai mari decât în microscopia confocală.tată printr-un filtru (pentru a elimina lumina reziduală de la laserul folosit pentru excitare) şi un detector. proba este iluminată de la un câmp îndepărtat şi emisia de fluorescenţă este colectată de către un vârf NSOM. Această amplitudine poate fi monitorizată şi folosită pentru a genera un semnal de feedback cu ajutorul căruia se controlează distanţa dintre probă şi vârf în timpul scanării. Alternativ. Pentru a obţine imagini de înaltă rezoluţie este necesară poziţionarea precisă a vârfului NSOM (de ordinul nm) faţă de suprafaţa probei. Instrument NSOM construit în jurul unui microscop de fluorescenta inversat . a capacităţii de cartografiere a topografiei suprafeţei şi datorită faptului că fenomenul de photobleaching este redus. Când vârful NSOM interacţionează cu câmpul de forţe Van der Waals a probei.

Deoarece interacţiunea dintre proteine şi nanoparticulele de aur este foarte sensibilă la starea conformaţională a proteinei şi la chimia suprafeţei nanoparticulelor. ce le permite conjugarea uşoară cu diferite biomolecule. folosită des în aplicaţii din domeniul bio-nanotehnologiilor. cu ajutorul căruia temperatura poate fi modificată controlat de la −10 °C la +110 °C.3. structura terţiară cuprinde trei domenii omoloage (I. cu formă aproximativ elipsoidală (4nm×4nm×14nm). Determinarea interacţiunii nanoparticule de aur dintre albumina bovină şi Iosin şi colaboratorii [4] au demonstrat interacţiunea directă dintre nanoparticulele de aur şi albumina bovină. Albumina bovina (Bovine Serum Albumin) este o proteină globulară. Albumina bovină (BSA) se găseşte în cantităţi mari în plasmă. este foarte importantă determinarea modificărilor conformaţionale pe care le suferă proteina în urma adsorbţiei la suprafaţa nanoparticulei. Semnalul de fluorescenţă al albuminei (BSA) a fost obţinut la 337 nm prin excitarea reziduului de triptofan cu o radiaţie având lungimea de undă 280 nm.1. 180 . Nanoparticulele de aur (GNP) sunt sonde ideale pentru investigarea proceselor biologice datorită biocompatibilităţii lor. În unele cazuri interacţiunea dintre proteină şi suprafaţa nanoparticulelor de aur poate determina modificări de structură ce duc la alterarea proprietăţilor proteinei. Albumina bovină (BSA) este utilizată ca proteină model în studiile biologice deoarece are o structură bine cunoscută şi posedă proprietăţi de fluorescenţă specifice. II şi III). stabilizate de o reţea internă de 17 legături disulfide. Exemple de aplicaţii ale spectrofluorimetriei 3. datorită prezenţei celor două reziduuri de triptofan din structura ei. Cunoaşterea efectelor biologice ale nanoparticulelor de aur necesită determinarea legăturilor ce apar între nanoparticule şi proteinele cu care interacţionează. Structura nativă a albuminei bovine (BSA) este caracterizată de un singur lanţ polipeptidic compus din 583 reziduri de aminoacizi. şi joacă un rol important în procesele fiziologice. ci determină biocompatibilizarea (funcţionalizarea) acestor nanoparticule pentru alte interacţiuni sau cuplaje cu mediul biologic. Soluţia de bioconjugate (nanoparticule de aur şi BSA) a fost pusă într-o cuvă de cuarţ având dimensiunea de 10 mm. fiecare domeniu fiind format din şase elice. Pe de altă parte conjugarea dintre proteină şi nanoparticulele de aur nu are ca efect doar stabilizarea sistemului proteină-nanoparticulă. Iosin şi colaboratorii [4] au înregistrat spectrele de fluorescenţă ale bioconjugatelor BSA-nanoparticule de aur cu ajutorul unui Spectrofluorimetru Jasco LP-6500 cuplat cu un dispozitiv pentru controlarea temperaturii (ADP-303T).

(b) 0.55×10-11 M. 181 . Soluţia apoasă de BSA are o bandă puternică de fluorescenţă cu maximul situat la 336 nm. (c) 1. (d) 1.65×10-11 M. de aceea studiul emisiei de fluorescenţă a acestuia este deosebit de utilă în determinarea modificărilor conformaţionale ale proteinei şi adsorbţia la nanoparticule. tirosina şi fenilalanina a căror emisie de fluorescenţă poate fi stinsă. Măsurătorile de fluorescenţă au fost efectuate cu o radiaţie excitatoare de 280 nm. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanosfere de aur. regiune ce coincide cu banda de emisie a triptofanului. bandă ce este datorată emisiei reziduurilor de triptofan. După cum se poate observa în figura 6. carboxyl sau triptofan. deoarece fenilalanina are un randament cuantic foarte mic. iar nanoparticulele de aur nu prezintă emisie de fluorescenţă. Spectrele de fluorescenţă ale unor soluţii având diferite concentraţii de nanoparticule de aur şi albumină bovină (BSA) au fost monitorizare în domeniul 290-450 nm.2×10-11 M. iar fluorescenţa tirosinei este aproape stinsă dacă este ionizată sau dacă este aproape de un grup amino. Albumina bovină (BSA) conţine trei cromofori: triptofan. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. (e) 2.1×10-11 M. Iosin şi colaboratorii [4]. fluorescenţa intrinsecă a BSA-ului este dată în principal de reziduurile de triptofan. lungime de undă ce este departe de banda plasmonică de rezonanţă a nanoparticulelor de aur. F – concentraţii intermediare. Pe langă efectul evident Figura 6. În realitate. au monitorizat stingerea semnalului de fluorescenţă prin creşterea concentraţiei nanoparticulelor de aur de formă sferică. Triptofanul este deosebit de senzitiv la modificarea vecinătăţii locale.Din spectrele de fluorescenţă se pot obţine informaţii importante (constanta de legătură şi numărul ”siturilor” de legătură) referitoare la modul de legare a proteinelor de suprafaţa nanoparticulelor de aur. Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii ale nanosferelor de aur: (a) 0.

Spectrele de fluorescenţă ale reziduului de triptofan din BSA pentru diferite concentraţii de nanobastonaşe de aur: (a) 0. F0 – intensitatea de fluorescenţă relativă a soluţiei apoase de BSA. adaugarea în continuare a nanoparticulelor nu duce la apariţia de noi legături BSA-nanoparticule). [6]: (F0 – Fsat)/(F – Fsat) = ([M]/Kdiss)n unde F0. autorii au observant şi o deplasare spre roşu a maximului benzii de fluorescenţă cu 4 nm (de la 336 nm la 340 nm).06×10-14 M.18×10-14 M. deplasare ce indică o modificare a polarităţii din jurul reziduului de triptofan. Figura 7. F – concentraţii intermediare. În cazul complexului BSA-nanobastonaşe nu se observă nici o deplasare a maximului benzii de fluorescenţă odată cu modificarea concentraţiei. Fsat – intensitatea de fluorescenţă relativă a soluţiei de BSA saturată cu nanobastonaşe de aur. (d) 3.24×10-14 M. (b) 1. Fsat şi F sunt intensităţile de fluorescenţă datorate reziduurilor de triptofan din BSA: 182 . Această comportare se datorează unui efect de saturaţie (când toate moleculele de BSA sunt legate de nanoparticulele de aur. Se observă că intensitatea benzii de fluorescenţă descreşte odată cu creşterea concentraţiei de nanobastonaşe de aur.de stingere a fluorescenţei. (c) 2. În figura 7 sunt prezentate spectrele de fluorescenţă ale complexului BSA-nanobastonaşe de aur. folosind metoda descrisă de Tedesco et al. în ambele cazuri. intensitatea emisiei de fluorescenţă rămâne constantă după atingerea unui nivel de concentratie a nanoparticulelor de aur. (e) 4. pentru diferite concentraţii. Din spectrele de fluorescenţă de mai sus autorii au determinat constanta de legătură (Kb) precum şi numărul siturilor de legătură dintre nanoparticulele de aur şi BSA.12×10-14 M.

iar nanosferele au sarcină electrică negativă. Concentraţia nanoparticulelor de aur a fost estimată cu ajutorul relaţiei A = [M]dε unde: A este absorbanţa soluţiei.5 × 105 n 1. [M] reprezintă concentraţia nanoparticulelor de aur. Fsat este intensitatea de fluorescenţă a soluţiei de BSA saturată cu nanoparticule de aur.Fsat)] = 0 au obţinut constanta de disociere (Kdiss). [M] este concentraţia particulelor (în moli). În concluzie. iar din valoarea lui log[M] pentru care log[(F0 . Tabelul 1. Din panta graficului au calculat numărul siturilor de legătură ‘‘n”. indus de suprafaţa metalică a nanoparticulei comjugată. În plus nanobastonaşele sunt stabilizate cu citrat de sodiu pe când nanosferele sunt stabilizate cu CTAB. d este grosimea cuvei folosită pentru înregistrarea spectrelor. Valorile astfel calculate se găsesc în tabelul 1.37 0. F este F intensitatea de fluorescenţă a soluţiilor de BSA având concentraţii intermediare.Fsat)] în funcţie de log([M]).34 × 1011 0.F)/ (F . n reprezintă numărul ”siturilor” de legătură dintre nanoparticulele de aur şi BSA Kdiss este valoarea reciprocă a constantei de legătură Kb.F)/(F .38 Valoarea mai mare a constantei de legatură în cazul nanosferelor este datorată faptului că cele două tipuri de nanoparticule au sarcinii electrice şi o chimie a suprafeţei diferite: nanobastonaşele au sarcină electrică pozitivă. interacţiunea locală dintre nanoparticulele de aur şi albumina bovină a fost investigată cu ajutorul spectroscopiei de fluorescenţă. e reprezintă coeficientul de extincţie molară Pentru a calcula parametrii ‘‘n” şi ‘‘Kb” autorii au reprezentat grafic log[(F0 . nanosfere de aur nanobastonaşe de aur Kb 2.F0 este intensitatea de fluorescenţă a soluţiei apoase de BSA pur. Constanta de legătură (Kb) şi numărul siturilor de legatură (n) pentru complexul BSA-nanoparticule de aur. 183 . folosind efectul de stingere a emisiei de fluorescenţă a triptofanului din BSA.

neutră pentru pH= pI şi negativă pentru pH> pI. În cazul albuminei bovine. fiind pozitivă pentru pH< pI. având o influenţă majoră asupra interfeţei dintre nanoparticule şi substanţele biologice. poate fi folosită pentru a obţine informaţii legate de modificările coinformaţionale ale proteinelor induse de interacţiunea cu nanoparticulele de aur la diferite valori ale pH-ului şi la diferite temperaturi. Valoarea pH-ului afectează atât structura albuminei bovine cât şi sarcina grupării funcţionale a proteinei. Sarcina netă a albuminei bovine este puternic dependentă de pH-ul soluţiei. Spectrele înregistrate sugerează faptul că nanoparticulele de aur inhibă emisia de fluorescenţă a reziduurilor de triptofan din BSA. Deplasarea maximul benzii de emisie indică faptul că modificarea pH-ului soluţiei duce la obţinerea de stări con184 . 336 nm respectiv 339 nm.7 [7]. Spectroscopia de fluorescenţă. atracţia sau respingerea nanoparticulelor de aur. determinând. După cum se observă în figura 8. Nanoparticulele de aur folosite sunt încărcate negativ la suprafaţă datorită faptului că sunt acoperite cu citrat pentru a prevenii agregarea lor. punctul izoelectric este 4. spectrul c) are maximul benzii de emisie la 337 nm. în consecinţă. Evaluarea modificărilor conformaţionale induse în albumina bovină adsorbită la suprafaţa nanoparticulelor de aur. unde pI reprezintă punctul izoelectric [6]. Structura albuminei bovine este puternic dependentă de pH şi temperatură. Aceste modificări ale structurii proteinelor pot duce la apariţia cancerului. grupare aflată într-o poziţie hidrofobică). fiecare stare conformaţională având formă şi dimensiune proprie. 5 (spectrul b) şi 9 (spectrul d) au maximul benzii de emisie la 324 nm.3. Iosin şi colaboratorii [5] au monitorizat mecanismul de interactiune între albumina bovină (BSA) şi nanoparticulele de aur cu ajutorul spectroscopiei de fluorescenţă. grupare expusă mai puternic influenţei vecinătăţii hidrofilice) şi în interiorul proteinei (în domeniul II: Trp-213. M.2. a diabetului şi a afecţiunilor cardiovasculare. grupărilor de triptofan ce sunt localizate pe suprafaţa proteinei (în domeniul I: Trp-134. după cum am mai amintit. în urma modificărilor de temperatură şi pH. în soluţie. în principal printr-un mecanism static (constanta de legatură Kb este dependentă de valoarea pH-ului). Proprietăţile fluorescente ale albuminei bovine (BSA) sunt datorate. Modificări conformaţionale ale proteinelor pot fi induse de variaţii ale temperaturii şi ale pH-ului. datorită senzitivităţii mari. spectrul de fluorescenţă al soluţiei pure de BSA (pH = 6. iar spectrele de fluorescenţă ale soluţiilor de BSA cu valori ale pH-ului 2 (spectrul a).

în timp ce la pH = 2 şi pH = 9 albumina bovină are formă extinsă (‘E-form’) respectiv bazică (‘B. 185 . Spectre de fluorescenţă ale albuminei bovine la pH 2 (a). pH 6 (c) şi pH 9 (d). în comparaţie cu emisia albuminei bovine de tipul ‘N-form’. autorii au calculat constanta de stingere a fluorescenţei (KSV) folosind ecuaţia Stern–Volmer: F0/F = 1 + Kqτ0[GNPs] = 1 + KSV[GNPs] unde: F0 şi F sunt intensităţile relative de flkuorescenţă ale triptofanului în absenţa şi în prezenţa nanoparticulelor de aur. iar deplasarea maximului benzii de emisie spre lungimi de undă mari ne indică faptul că triptofanul este mai expus solventului. Spectrele de fluorescenţă înregistrate (figura 9) demonstrează scăderea drastică a emisiei de fluorescenţă (quenching) a triptofanului din albumina bovină la pH = 2 odată cu creşterea concentraţiei nanoparticulelor de aur (de la 0. Figura 8. Emisia de fluorescenţă a albuminei bovine de tipul ‘E-form’ are maximul deplasat spre albastru. Astfel. Din spectrele de fluorescenţă. datorită creşterii separaţiei inter-domeniu şi schimbării configuraţiei proteinei astfel încât gruparea triptofan are o vecinătate mai hidrofobică. la pH neutru albumina bovină are o formă nativă (‘N-form’). Deplasarea maximului benzii de emisie spre lungimi de undă mai mici indică faptul că triptofanul din albumina bovină are o vecinătate mai hidrofobică (se modifică structura terţiară).form’).75×10−11 M). Iosin şi colaboratorii [5] au folosit o concentraţie fixă de BSA titrată în cantităţi diferite de soluţie de nanoparticule de aur. Pentru a obţine informaţii legate de emisia de fluorescenţă a triptofanului din albumina bovină la diferite valori ale pH-ului în prezenţa nanoparticulelor de aur.formaţionale diferite ale albuminei.55×10−11 M la 2. pH 5 (b).

32×1018 M−1 s−1 la pH = 9. Astfel.55×10−11 M. ce indică senzitivitatea fluoroforului la molecula ce determină stingerea fluorescenţei (quencher). Prin fitare liniară s-a obţinut KSV = 1. În mod similar au fost calculate constantele de stingere Stern–Volmer pentru pH = 6 şi pH = 9. Iosin şi colaboratorii [5] au determinat constanta de legătură la echilibru Kb (indică echilibrul dintre speciile adsorbante şi cele resorbante). (b) 0.1×10−11 M. obţinându-se valorile KSV = 1.77 la pH 2.65×10−11 M. Graficul inserat reprezintă curba Stern–Volmer.11×109 M−1. în cazul bioconjugatelor BSA–GNPs stingerea emisiei de fluorescenţă nu este iniţiată de ciocniri dinamice ci de formarea unui complex nefluorescent în urma unui mecanism de stingere static. Deci. În urma calculelor s-au obţinut următoarele valori pentru numărul siturilor de legătură (n): 1.97 la 186 .75×10−11 M.2×10−11 M şi (f) 2. [GNPs] reprezintă concentraţia nanoparticulelor de aur. (d) 1.34×1018 M−1 s−1 la pH = 6. Kq = 0. Spectre de fluorescenţă ale grupării triptofan din BSA la pH = 2 pentru diferite concentraţii ale nanoparticulelor de aur: (a) 0. constanta de stingere bimoleculară Kq a fost calculată. (e) 2. τ0 = 5×10−9 s este timpul de viaţă mediu al albuminei bovine în absenţa nanoparticulelor de aur. precum şi numărul siturilor de legătură (n) dintre nanoparticule şi BSA conform relaţiilor din pargraful anterior.0×1010 M−1 s−1) în cazul stingerii emisiei de fluorescenţă a macromoleculelor biologice datorită mecanismului de ciocnire. KSV este constanta de stingere Stern–Volmer.Kq este constanta de stingere bimoleculară. Valoarea obţinută pentru constanta de stingere bimoleculară Kq este mai mare decât valoarea obţinută (2.22×1018 M−1 s−1 pentru bioconjugatele BSA– GNPs la pH = 2. Figura 9. obţinându-se valorile: Kq = 0. respectiv Kq = 0.6×109 M−1 pentru pH = 9. (c) 1. 1.7×109 M−1 pentru pH = 6 şi KSV = 1.

Monitorizarea denaturării termice a albuminei bovine la diferite valori ale pH-ului Denaturarea termică a proteinelor este un proces intrinsec. curba de denaturare a albuminei bovine pure sugerează existenţa a două temperaturi de tranziţie: una la 43 ºC. 1. La temperatura camerei.74×109 M−1 şi Kq = 0.3. Platoul curbei de denaturare indică faptul că albumina îşi menţine starea nativă pînă la aproximativ 42 ºC. Numărul siturilor de legătură şi constanta de legătură pentru pH = 5 este: n = 1. De menţionat că valorile mai mari ale constantei de legătură indică o atracţie mai puternică între cele două specii. au fost monitorizate modificările emisiei de fluorescenţă a triptofanului din BSA pentru temperaturi cuprinse între 22 ºC şi 85 ºC (domeniu în care apare o modificare importantă a structurii terţiare a albuminei). maximul benzii de fluorescenţă datorată triptofanului se deplasează spre numere de undă mai mici. După cum observă şi autorii. analizând emisia de fluorescenţă a triptofanuluui din BSA. 3. În acest scop. La aceste temperaturi apare o modificare a vecinătăţii triptofanului din albumină.85 şi Kb = 2. soluţia apoasă pură de BSA are o emisie de fluorescenţă puternică. sau regiunile hidrofobice devin predispuse la interacţiuni intermoleculare noi. iar cealaltă la 65 ºC. ajungând până la 330 nm (figura 10).6×109 M−1 la pH 2.03×109 M−1 la pH 9.82×109 M−1. prima temperatură de tranziţie apărând în 187 .81×109 M−1 la pH 6 şi 2. Graficul inserat (denaturation curve) indică o relaţie neliniară între deplasarea maximului benzii de absorbţie şi temperatură. valori ce indică faptul că adsorbţia maximă a moleculelor de albumină la suprafaţa nanoparticulelor de aur apare pentru o valoare a pH-ului apropiată de punctul izoelectric (pI) al BSA-ului. grupările –SH libere. respectiv pentru constanta de legătură Kb: 2. Constanta de stingere Stern–Volmer şi constanta de stingere bimoleculară obţinute pentru această valoare a pH-ului sunt: KSV = 1. Odată cu creşterea temperaturii.76 la pH 9.348×1018 M−1 s−1. Pentru a mima o vecinătate biologică reală.pH 6 şi 1. prin creşterea temperaturii forma nativă a proteinei devine mai flexibilă. înainte şi după absorbţia la suprafaţa nanoparticulelor de aur. Iosin şi colaboratorii [5] au studiat modificările structurale ce apar în cazul denaturării termice a albuminei bovine. cerntrată la 337 nm. deci determinarea condiţiilor în care are loc acest proces este foarte importantă pentru înţelegerea stabilităţii proteinelor. autorii au studiat formarea bioconjugatelor la pH = 5. deci creşterea temperaturii duce la apariţia de modificări structurale ale proteinei. Ca urmare a acestui fapt. De fapt.

În urma măsurătorilor efectuate s-a observat o dependenţă accentuată de valoarea pH-ului a temperaturii de tranziţie la care proteina îşi modifică conformaţia. pe lângă denaturarea proteinei. în mediu acid (pH mic) proteina este mai stabilă termic. Inserat: curba de denaturare termică (variaţia maximului benzii de fluorescenţă în funcţie de temperatură . temperatura de tranziţie la care începe denaturarea termică este mai mare (46 °C) decât în mediu neutru. Între 43 ºC şi 65 ºC se observă o deplasare spre albastru a maximului emisiei de fluorescenţă a albuminei bovine. Figura 10. Prin măsurarea emisiei de fluorescenţă a triptofanului din albumină în procesul de răcire. apare şi scăderea în intensitate a emisiei de fluorescenţă a triptofanului. creşterea temperaturii de la 22 ºC la 85 ºC determină descreşterea cu 72% a emisiei de fluorescenţă. în mediu alcalin (pH mare) temperatura de tranziţie este mult mai scăzută (32 °C) decât în mediu neutru (pH = 6) ceea ce indică o denaturare termică mult mai rapidă în mediu bazic. valoare la care apare un al doilea platou în curba de denaturare. la pH 6. O dată cu creşterea temperaturii. prin compararea denaturării termice (între 22 ºC şi 85 ºC) a proteinei în soluţie pentru diferite valori ale pH-ului (2 . deplasare ce sugerează tranziţia albuminei de la starea nativă (compactă) la o stare cu o structură mai deschisă. Autorii au studiat efectul combinat al pH-ului şi al temperaturii înainte şi după conjugarea albuminei bovine cu nanoparticulele de aur. Dependenţa de temperatură a emisiei de fluorescenţă a grupărilor de triptofan din albumina bovină. s-a determinat faptul că procesul de denaturare termică a albuminei bovine este ireversibil.la creşterea şi descreşterea temperaturii). datorită expunerii triptofanului la moleculele de solvent.jurul pragului maxim admis al febrei ce apare în condiţii de boală (42 ºC). Astfel.9). În mod contrar. După cum se observă în figu188 . Denaturarea completă a proteinei se face după 65 ºC. Astfel.

deci modifică comportarea termică a proteinei.ra 11. a emisiei de fluorescenţă. prezenţa nanoparticulelor de aur îmbunătăţeşte stabilitatea termică a proteinei. rezultând creşterea temperaturii de tranziţie indiferent de valoarea pH-ului. bioconjugarea albuminei bovine cu nanoparticule de aur. spre numere de undă mari. Deci. modifică forma curbei de denaturare. De exemplu. 189 . Variaţia maximului emisiei de fluorescenţă a triptofanului din BSA. prezenţa nanoparticulelor induce o deplasare. După cum se observă şi din figura 11. Pentru a investiga efectul temperaturii asupra fenomenului de stingere a fluorescenţei albuminei bovine de către nanoparticulele de aur a fost calculată constanta de stingere KSV pentru diferite temperaturi. în funcţie de temperatură pentru diferite valori ale pH-ului. Figura 12. Inserat: dependenţa constantei de stingere Stern–Volmer de temperatură. pentru pH = 6 temperatura de tranziţie creşte de la 42 °C la 47 °C. respectiv din bioconjugatul BSA-nanoparticule. Figura 11. Curbele Stern–Volmer pentru stin gerea fluorescenţei BSA-ului de către nanoparticule de aur (pH = 6).

Struct. Astilean. Curry.0651 0. Ghuman. Tsuchida. Fluorescence Spectroscopy: New Trends în Fluorescence Spectroscopy.E. Biophys. Study of protein-gold nanoparticle conjugates by fluorescence and surface-enhanced Raman scattering. R .0683 0. Wiley-VCH. 358 K) ne indică faptul că constanta de stingere KSV scade odată cu creşterea temperaturii (figura 12). 4. E. Springer. S.70x109 1. Canpean. Komatsu.9994 0. (2011). Eds B. confirmă faptul că mecanismul de stingere a fluorescenţei triptofanului din albumina bovină de către nanoparticulele de aur este iniţiat de formarea unui complex ne-fluorescent prin adiţia moleculelor de albumină bovină la nanoparticulele de aur. (2002). J. Springer Verlag.A. J. 924–926 (2009) 196–200. Georgescu.Graficul Stern-Volmer ce caracterizează stingerea emisie de fluorescenţă a triptofanului din albumina bovină de către nanoparticulele de aur. J.R. 338. Crystal structural analysis of human serum albumin complexed with hemin and fatty acid.29 -28. Zunszain.0782 0.G.11 10. Ed. Toderas. P.60x109 1. 395-401.70 -64.0721 0. Alexov. Bibliografie 1. Biol. 7.96 81. 217. (SD . Gunner. R. 5.88x109 5. Ed. Astilean. 83 (2002) 1731–1748.59 55. Mialocq and T. 318. 3. J.9983 0. M.22 2 Proporţionalitatea inversă dintre constanta de stingere KSV şi temperatură (tabelul 2). 4. E. Berlin (2001). BMC Struct. Iosin. J. Journal of Photochemistry and Photobiology A: Chemistry.9980 0. S. Tabelul 2. “Molecular Fluorescence: Principles and Applications”. M.9982 0. Investigation of femtosecond chemical reactivity by means of fluorescence up-conversion. Bernard Valeur. 2.9975 ΔH(kJ/mol) ΔS(J/mol K) ΔG(kJ/mol) -48. T. Gustavsson. F. P. 190 .79 132. S.35 -54. Combining conformational flexibility and continuum electrostatics for calculating pKas în proteins.9988 0. Iosin.0601 0. 3 (2003) 1–9.0700 R 0.87 53.41x109 9. Valeur. (2006).and thermally induced conformational changes of Bovine Serum Albumin adsorbed onto gold nanoparticles.coeficientul de corelaţie) pH 6 T (K) 295 318 338 295 318 338 KSV (L/mol) 1.deviaţia standard pentru valorile coeficientului KSV.05x109 SD 0. Brochon. la pH 6 pentru diferite temperaturi (295. V. Joseph Lakowicz. Spectroscopic studies on pH.11x109 6. “Principles of Fluorescence Spectroscopy”. Mol. M. Baldeck.-C. Constanta de stingere KSV şi parametrii termodinamici pentru complexul BSA-nanoparticule de aur.-C. 6.32 51.

... asociate speciei nucleare i.......................S...................... T1......... cu relevanţă în special pentru sisteme moleculare organice........ 215 1. proba va fi caracterizată de o magnetizare macroscopică orientată de-a lungul direcţiei câmpului magnetic extern.S.. B0 ~ 7-23 T (generat cu ajutorul unei bobine supraconductoare).......... 196 3.............VI...III.......... 202 4... sunt prezentate în tabelul de mai jos: 191 . iar γ i reprezintă factorul giromagnetic.... Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice ..................... distribuite izotrop în momentul aplicării lui B0... Claudiu Filip C. astfel încât după o perioadă de ordinul aşa numitului timp de relaxare longitudinal... dr. Mihaela Aluaş Cuprins 1........... Principalele proprietăţi ale câtorva nuclee active RMN......... 191 2............ SPECTROMETRUL DE REZONANŢĂ MAGNETICĂ NUCLEARĂ Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) C.......... Principiul metodei Generarea semnalului RMN Spectroscopia RMN se bazează pe fenomenul de rezonanţă magnetică aplicat asupra momentelor magnetice nucleare μi = γiS...... Principiul metodei............... dr....... în jurul direcţiei câmpului magnetic static (direcţia z).γiB0..............I..... unde S este numărul cuantic de spin.......i = ........... se vor reorienta sub acţiunea câmpurilor magnetice locale fluctuante uşor datorită mişcării termice........................ Infrastructura existentă la UBB Cluj pentru exprimente RMN-S . şi (ii) polarizările spinilor..... Plasarea probei care conţine momente magnetice nucleare într-un camp magnetic extern intens.............. ω0........ Bibliografie . are două efecte majore: (i) axa polarizării de spin efectuează o mişcare de precesie cu frecventa Larmor........

02 1. adică sub forma unui puls.7 T 500 76.7 Abundenţa naturală [%] 99.i tp = π/2) necesită aplicarea câmpului rf pe durata tp de ordinul câtorva µs.9 90 Deoarece magnetizarea longitudinală nu poate genera un semnal RMN.i /2π este de ordinul zecilor de kHz.1 6. Pentru valori tipice ale lui B1 utilizate în spectroscopia RMN-S. i 1H 2H 13C 14N 15N γ iγ S 1/2 1 1/2 1 1/2 [ 107 rad s-1T-1] 26.5 125 35. frecvenţa de nutatie ν1.i. este necesară mai întâi rotirea polarizării de spin în planul transversal.37 ν0.5 50 B0 = 21 T 900 137. După încetarea acţiunii pulsului rf magnetizarea Figura 1 192 .8 4.Specia nucleară.i = γiB1 a polarizării spinilor i în jurul direcţiei lui B1 dacă ωrf satisface condiţia de rezonanţă.6 0. rf) va determina o mişcare de precesie cu frecvenţa ω1. câmpul oscilant (numit şi câmp de radiofrecvenţă.1 99. ωrf = ω0. sau este apropiată de aceasta: în literatura RMN această precesie este deseori denumită nutaţie. astfel încât rotirea magnetizării în plan transversal (ω1.i [MHz] B0 = 11. xy.7 1. perpendicular pe câmpul magnetic extern: el este generat de curentul aplicat asupra unei bobine de transmisie în interiorul căreia este plasată proba.i = ω1. şi amplitudinea B1.9 -2.7 225 63. Deşi în practică B1 << B0.98 0. Acest lucru se realizează prin aplicarea unui câmp magnetic oscilant cu frecvenţa ωrf.

1 se obţine un spectru RMN 1D (unidimensional) ale cărui proprietăţi (poziţii. în jurul lui ω0. de exemplu deplasările (faţă de ω0. adică spectrul RMN. etc.transversală va precesa liber în jurul lui B0. Frecvenţele asociate interacţiunilor de spin interne sunt mult mai mici decât frecvenţele Larmor. şi constituie astfel baza multiplelor aplicaţii ale spectroscopiei RMN în (bio)chimie. iar conţinutul lui de informaţii ar fi extrem de sărac. ω0.i. soluţia practică utilizată în spectroscopia RMN modernă corespunde aşa-numitului mod de lucru pe canale rf distincte. pe durata căruia se produce defazarea polarizării transversale. spectrul asociat speciei nucleare i ar conţine o singură linie la poziţia frecvenţei Larmor asociate. corespunzător modului de detecţie în cuadratură. ΔΩi << ω0. După o perioadă de aproximativ t0 ~ 5T1 polarizarea de spin se reconstruieşte de-a lungul direcţiei z şi experimentul poate fi repetat. despicările şi/sau lărgirile liniilor individuale sunt în directă conexiune cu elemente de structură chimică/spaţială bine determinate. cât şi cel în domeniul de frecvenţă. ştiinţa materialelor. prezenţa aşa-numitor interacţiuni de spin interne conduce la valori ale câmpului magnetic local la poziţiile diferitor spini i uşor diferite de B0. precum este cel ilustrat în Fig. 2 în cazul nucleelor 13C: 193 . Această mişcare induce un curent electric oscilant pe bobina de detecţie (aceeaşi cu bobina de transmisie) ce poartă numele de semnal RMN. Descrierea de mai sus se referă la aşa-numitul experiment RMN de “un puls”. numit timp de achiziţie. să existe o fereastră spectrală de lărgime limitată. conţin o parte reală şi una imaginară.i care conţine întregul spectru RMN-1D al speciei nucleare respective. sau FID (free-induction decay). Cu ajutorul experimentului din Fig. ceea ce face ca pentru fiecare specie nucleară i. şi deci implicit la apariţia mai multor linii în spectrul RMN 1D. Detecţia semnalului RMN Aplicând transformata Fourier asupra FID-ului se obţine reprezentarea acestuia în domeniul de frecvenţă. 1.i.i). adică înregistrarea de spectre RMN distincte pentru fiecare specie nucleară în parte. Considerând doar interacţiunea cu câmpul static extern. În realitate. FID-ul este înregistrat în intervalul de timp t2. şi este ilustrat schematic în Fig. astfel încât amplitudinea lui se apropie de zero. Atât semnalul în domeniul temporal. forme şi intensităţi de linie) depind în mod esenţial de interacţiunile la care sunt supuşi spinii nucleari pe durata t2. Parametrii spectrali. B0. În acest context.

De exemplu. Deplasările chimice reflectă deplasările frecvenţei de precesie la diferite poziţii ale nucleelor 13C în sistemul molecular investigat faţă de valoarea ω0. prin identificarea grupărilor chimice distincte din moleculă în funcţie de regiunea spectrală specifică în care se plasează liniile RMN. 2 sunt determinate de valorile izotrope ale ecranării chimice. sunt interacţiunea dipolară (homo. poziţiile liniilor în spectrul 13C din Fig.Figura 2 Interacţiunile de spin cu relevanţă în aplicaţiile spectroscopiei RMN-S pe probe organice. au fost dezvoltate o serie de tehnici speciale numite de decuplare: ele acţionează în sensul atenuării efectului produs de anizotropia interacţiunilor de spin şi conduc la spectre RMN-S de înaltă rezoluţie. şi sunt prin urmare reprezentative pentru gruparea chimică din care nuceele respective fac parte. spectre RMN 1D precum cel ilustrat în Fig. În acest mod. În consecinţă. aşa-numitele deplasări chimice. Primele două sunt dominante în cazul nucleelor cu spin ½ (având constante de cuplaj de la câţiva kHz până la aproximativ 100 kHz) şi au un caracter anizotrop.C ca urmare a diferenţelor în intensitatea câmpului magnetic local indus de distribuţia electronică din vecinătate.şi heteronucleara). 194 . cu linii suficient de înguste încât să permită identificarea componentelor izotrope ale acestora. şi interacţiunea scalară (cuplajul J). 2 sunt utile pentru determinarea structurii chimice. Ele produc în general spectre cu linii foarte largi caracterizate prin suprapuneri severe ce fac imposibilă extragerea de informaţii utile. interacţiunea de ecranare chimică.

fie în unităţi relative numite părţi pe milion (ppm) care reprezintă raportul dintre această deplasare faţă de frecvenţa de referinţă şi frecvenţa Larmor a speciei respective.Noţiunile introductive vor fi completate în final cu câteva precizări utile. • Un puls rf se caracterizează prin trei parametri distincţi: (i) unghiul α de rotire a magnetizării faţă de direcţia z – aşa-numitul unghi de tilt (de exemplu α = π/2. menite să asigure legătura între baza conceptual-teoretică prezentată mai sus şi elementele concrete cu caracter aplicativ. şi (iii) frecvenţa de offset. ca şi deplasare faţă de o linie de referinţă caracteristică fiecărei specii nucleare.).7 T va fi denumit spectrometru de 500 MHz) • Pentru a obţine un spectru RMN de calitate (cu raport semnal/zgomot cât mai mic) este în general nevoie de înregistrarea unui număr N de FID-uri. factorul giromagnetic. Δωi = ωrf . Pentru exemplificare. în timp ce pentru un spectru 1H de calitate este suficientă înregistrarea unui singur scan. π. în cazul în care ωrf nu este exact în rezonanţă cu frecvenţa de precesie Larmor a speciei nucleare i. 1). etc. Cel de-al doilea mod este de obicei preferat pentru că poziţiile liniilor într-un compus dat vor fi aceleaşi indiferent de valoarea câmpului magnetic .i. abundenţa izotopică şi numărul de poziţii chimice distincte în sistemul studiat. Aceasta din urmă este dată în principal de cantitatea de probă. care vor fi adunate pentru a genera semnalul RMN final. câmpul magnetic static. cu un timp de repetiţie determinat de valoarea lui t0 (conform Fig. (ii) faza pulsului. • Poziţiile liniilor într-un spectru RMN sunt date fie în unităţi absolute de frecvenţă (Hz). care reprezintă unghiul φ pe care îl face B1 faţă de axa Ox. Valoarea optimă a lui N (denumit număr de scanuri în terminologia de specialitate) depinde pentru fiecare specie nucleară de sensibilitatea asociată. spectrul RMN-S 13C a unui compus în faza policristalină cu izotopul 13C în abundenţă naturală şi cu un număr de până la 10 poziţii chimice distincte a carbonilor din moleculă necesită acumularea unui număr de ordinul miilor de scanuri pentru a obţine un raport semnal/zgomot acceptabil (> 30). • Fiecare specie nucleară distinctă este caracterizată de o aşa-numită fereastră spectrală de lărgime limitată în interiorul căreia se plasează toate liniile RMN posibile: de exemplu lărgimile tipice ale acestei 195 .ω0. privind implementarea lor concretă în practica curentă: • Un spectrometru RMN este caracterizat în mod tradiţional prin valoarea frecvenţei Larmor a spinilor 1H în câmpul magnetic al acestuia (de exemplu un spectrometru cu un criomagnet care produce un câmp B0 = 11.

transformarea Fourier se va aplica asupra acestui semnal digitizat. 300 ppm (pentru 13C). pot fi găsite în literatura de specialitate. Exemplul prezentat în Fig. Magnetul acestora este autoecranat. 1 prezintă cel mai simplu experiment posibil în spectroscopia RMN. 2. Referinţe detaliate cu privire la fundamentarea teoretică a acestor tehnici moderne. 1) se realizează în mod discret (digital) cu un timp de eşantionare numit dwell time.4 Tesla. respectiv 14. această tehnologie fiind introdusă chiar de firma Bruker în 1996. şi permit extragerea selectivă a informaţiilor dorite. De-a lungul timpului a fost dezvoltată o diversitate foarte mare de tehnici RMN complexe care presupun aplicarea de secvenţe multi-puls extrem de sofisticate. şi 500 ppm (pentru 15N). Spectrometrul Bruker DRX 400 din dotarea CNRM 196 . şi se realizează utilizând aşa-numitul algoritm FFT (fast Fourier transform). iar câmpul generat de acesta este de 9. precum şi la implementarea lor experimentală. Infrastructura existentă la UBB Cluj pentru experimente RMN-S Descrierea componentelor hardware Laboratoarele Centrului Naţional de Rezonanţă Magnetică (CNRM) sunt dotate cu două spectrometre Bruker. În consecinţă.• • ferestre spectrale sunt de aproximativ 20 ppm (pentru 1H). achiziţionate în anii 2002 şi 2009. simultan pe mai multe canale rf.1 Tesla cu frecvenţa de rezonanţă pentru nucleii de hidrogen de 400 MHz şi 600MHz. Achiziţionarea directă a semnalului RMN (pe durata lui t2 în Fig.

Magnetul spectrometrului Bruker DRX 600 din dotarea CNRM Unitatea MAS folosită pentru controlul automat sau manual al rotirii probelor solide la unghiul magic 197 . 27Al. Ambele sisteme pot analiza atât probe în stare condensată cât şi probe în stare lichidă. Pentru studiul probelor solide există în dotare mai multe capete de sondă care permit efectuarea experimentelor la temperaturi între -80 °C şi 200 °C. Pot fi efectuate măsurători spectroscopice de rezonanţă magnetică nucleară pe o gamă foarte largă de nuclee: 1H. 69Ga etc. iar rotirea mecanică a probei se poate face la o frecvenţă de rotatie de până la 35 kHz. 13C.Spectrometrele Bruker DRX 400 şi Bruker DRX 600 sunt complet digitale iar controlul acestora se face în totalitate prin intermediul unui calculator de tip PC. 57Fe. 15N.

Se mai poate observa şi conexiunea cablului care serveşte la detectarea. prin intermediul fibrei optice. a vitezei de rotaţie a probei. Descrierea componentelor software Pentru comanda modulelor electronice ale unui spectrometru RMN există pachete software specializate prin intermediul cărora elementele distincte ale unui experiment RMN sunt transpuse în comenzi specifice. începând cu generaţia de spectrometre Avance III. Cele două versiuni ale soft-ului de comandă Bruker diferă prin interfaţa grafică şi prin numărul 198 . Se pot observa conectările acestui cap de probă la surse de aer necesar atât pentru rotirea probei la unghiul magic cât şi pentru controlul temperatuii probei. În imaginea de mai sus se poate observa rotorul şi instrumentaţia specifică.Capul de probă folosit pentru măsurătorile pe probe solide introdus în câmpul magnetic static. iar programul TopSpin comandă spectrometrul Bruker DRX 600. În cazul spectrometrelor Bruker. Corespunzător echipamentelor existente la UBB Cluj. necesară introducerii şi tasării substanţei de măsurat precum şi scoaterii acesteia din rotor. şi respectiv TopSpin. soft-ul de comandă se numeşte XWin NMR (până la generaţia Avance II). primul este instalat pe spectrometrul Bruker DRX 400.

. o serie de proprietăţi specifice • Primul tip de acţiuni corespunde elementelor standard ale unui experiment RMN (precum cel ilustrat în Fig. după care se ajustează puterea la ieşire a transmiţătorului astfel încât curentul transmis pe bobină să producă o intensitate B1 a câmpului rf care să corespundă unui puls de 900 (în cazul exemplificat. 1. precum şi faptul caă este aplicat pe canalul f1. prin intermediul unor variabile care poartă acelaşi nume. x. dn (d – delay. Valorile lui p1 şi f1 sunt introduse explicit de către utilizator în aşa numita tabela de achiziţie (acquisition table). 31 – indicele asociat). conform relaţiei 2πν1tp = π/2). n = 0 . 31 – indicele asociat). α. în continuare vom face o foarte scurtă prezentare axată pe evidenţierea principiior fundamentale. durata fiecăruia dintre acestea şi. Pentru o privire completă a modului de lucru cu fazele. Faza ph1 este în schimb explicitată la sfârşitul programului de pulsuri (valorile corespund convenţiei Bruker în care 0. cu faza ph1. ele sunt echivalente la nivel conceptual.sporit de scripturi pentru calibrarea parametrilor experimentali existente în TopSpin dar. calibrarea acestui puls se realizează prin fixarea duratei lui p1. perioade de evoluţie liberă şi perioada de achiziţie directă. respectiv: pulsuri rf. reprezintă fazele 0. y. De aceea. comune ambelor programe: • Comanda unui experiment RMN se realizează prin intermediul aşa numitului program de pulsuri (pulse program) care specifică acţiunile aplicate în cadrul experimentului. 199 . Ele au asociate următoarele comenzi specifice în programul de pulsuri: pn (p – puls. În mod similar se procedează şi în cazul în care se calibrează un puls cu orice altă valoare a unghiului de tilt. incluzând cazul general în care acestea nu sunt multipli de 900. ν1 trebuie să fie 100 kHz. în rest. Ea specifică durata acestuia.. 1). • Sensibilitatea spectrală maximă se obţine pentru o valoare α = 900 a unghiului de tilt pentru pulsul p1 (asa-numitul puls de 900). şi go=n (go – este un script care transmite comenzi specifice receptorului pentru achiziţionarea digitală a semnalului RMN. În practică. în funcţie de tipul acţiunii. de exemplu la 2. -x şi –y).5 μs. 1). iar în reprezentarea modelului vectorial. necesar în experimentul considerat. comanda referitoare la aplicarea pulsului rf este p1:f1 ph1.. 180 şi respectiv 2700.. se recomandă consultarea manualului de utilizare Bruker. 90. n = 0 . p1. iar n este eticheta liniei de comandă care va fi efectuată după încheierea achiziţiei) • În programul de pulsuri prezentat mai jos (care implementează experimentul RMN de un puls în Fig. 2 şi 3.

astfel încât orice comandă pn care apare după aceasta linie va aplica un puls rf de durata pn şi cu un nivel de putere pl1). 2us pl1:f1 (pe durata unui delay fixat la 2 μs se setează atenuatorii la ieşirea transmiterului la valoarea specificată prin parametrul de achiziţie pl1. go=2 ph31. a nivelurilor de putere la ieşirea transmiţătorului. iar în exemplul nostru concret d1 corespunde unei valori rezervate. Linia de comandă 2 d1 din programul de pulsuri de mai jos reprezintă o perioadă de durată d1 (a cărei valoare este introdusă explicit în tabela de achiziţie) în care intensitatea câmpului rf transmis/receptat este zero. wr #0 (scrie în memorie datele achiziţionate. adică semnalul RMN digitizat). aceste tipuri de acţiuni sunt reprezentate de comenzile: 1 ze (efectuează resetarea tuturor modulelor electronice la valorile lor iniţiale). de exemplu între pulsuri rf consecutive. cu scopul comutării lor între diferite regimuri de funcţionare.• • • Nivelul de putere al unui puls rf este cel specificat în programul de pulsuri anterior comenzii de aplicare a pulsului respectiv. în afară de recycle delay vor exista mai multe perioade de evoluţie liberă a sistemului. pl1. Ea reprezintă aşa numitul delay. 200 . Al doilea tip de acţiuni specificate într-un program de pulsuri nu au echivalent în schema standard a unui experiment RMN. în exemplul nostru. linia de comandă are în faţă indicele 2. pentru a achiziţiona un nou scan: acest fapt este explicitat în linia de comandă asociată achiziţiei semnalului RMN. a fazelor. iar valoarea lui este introdusă explicit în tabela de achiziţie. unde ph31 este faza receptorului). scrierea datelor achiziţionate etc. şi exit (comanda de încheiere a experimentului). care vor fi specificate prin comenzi de tipul dn. În exemplul de mai jos.) şi au asociat un timp (ideal cât mai scurt) pe durata căruia comutarea se poate realiza din punct de vedere fizic. Din acest motiv. şi sunt necesare pentru implementarea practică a elementelor componente în experimentul RMN dat (de exemplu comutarea frecvenţelor de offset. respectiv recycle delay. şi corespund atenuării care trebuie aplicată la ieşirea transmiţătorului pentru a obţine valoarea dorită a câmpului rf pe bobina. valorile pln sunt date în decibeli (dB). Ele corespund în general unor comenzi care se aplică asupra modulelor electronice. adică timpul necesar reconstruirii magnetizării longitudinale după detecţia sa. ce reprezintă punctul de unde experimentul RMN se repetă. În experimente multi-puls mai complexe. În convenţia Bruker.

2D. Pentru detalii.). Aceştia sunt parametri cei mai importanţi în cadrul unui experiment RMN tipic. În afară de aceştia.). adică durata între două puncte consecutive. de asemenea. pe canalul f2. însă reprezintă doar o mică parte din numărul total de parametri posibili (câţi anume dintre aceştia sunt utilizaţi efectiv într-un experiment dat depinde de complexitatea lui).• • • Liniile care încep cu . tipul de achiziţie directă (qsim – în cuadratură. Pentru o descriere detaliată. sf2. Parametri specifici acestui proces sunt incluşi în aşa numita tabelă de procesare. frecvenţele de offset pe canalele pe care se lucrează (o1. se recomandă consultarea manualelor Bruker. se recomandă consultarea manualelor Bruker. şi reprezintă devierea (cu + sau -) faţă de frecvenţa de bază pe canalul respectiv (sf1. numărul de scanuri (ns) – numărul de semnale RMN achiziţionate direct şi adunate între ele în scopul reducerii nivelului de zgomot la un nivel acceptabil.). care oferă informaţii cu privire la: tipul de experiment (1D. tipul nucleului asociat cu canalele rf utilizate în experimentul dat ( f1. numele programului de pulsuri utilizat în experimentul considerat (pulprog). f2. exprimate de obicei în multiplii de 16. 201 . qseq – în cuadratură. etc. iar tipul şi numărul acestor parametri depinde de complexitatea experimentului avut în vedere. etc. tabela de achiziţie va mai conţine în mod obligatoriu şi alţi parametri caracteristici experimentelor RMN. dewll time (dw) – durata de eşantionare a semnaluilui RMN digitizat. o2. acesta trebuie supus transformării Fourier pentru a genera spectrul RMN. etc. După achiziţionarea semnalului RMN. dar colectând altenativ puncte în partea reală şi imaginară a semnalului RMN. etc. pe canalul f1. valorile numerice ale parametrilor incluşi în programul de pulsuri sunt specificate în tabela de achiziţie.) – se exprimă în Hz sau ppm. reprezintă linii de comentarii: ele sunt necesare (în special în cazul experimentelor multi-puls mai complexe) pentru a explicita semnificaţia parametrilor incluşi în programul de pulsuri asociat. etc. colectând simultan puncte în partea reală şi imaginară a semnalului RMN. După cum s-a precizat mai sus. : pentru fiecare nucleu aceasta este fixată în momentul configurării spectrometrului). domeniul temporal (td) – numărul de puncte achiziţionate.

la lărgirea liniilor de rezonanţă.Avance2. şi spectrul aceluiaşi compus aflat în stare solidă.# 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/zg" . caracterizat de rezoluţie înaltă. Tehnici experimentale de bază pentru aplicaţii RMN-S în sisteme moleculare organice Tehnici specifice de înaltă rezoluţie în solide: rotirea în jurul unghiului magic (MAS – Magic Angle Spinning). decuplarea homonucleară.p1 : f1 channel . în 202 . fapt care duce la menţinerea caracterului anizotrop al interacţiunilor de spin şi. Anizotropia interacţiunilor prezintă pe de o parte dezavantajul de a conduce la pierderea rezoluţiei prin suprapunerea liniilor RMN: în Fig. obţinut spre exemplu cu ajutorul experimentului de un puls ilustrat în Fig. efectul componentelor anizotrope ale interacţiunilor de spin prezente în sistem este mediat la zero.1D sequence # 1 "C:/Bruker/XWIN-NMR/exp/stan/nmr/lists/pp/Avance. 3 este ilustrată comparaţia dintre un spectru 1H RMN tipic al unui compus organic în soluţie.d1 : relaxation delay.incl 1 ze 2us pl1:f1 2 d1 p1:f1 ph1 go=2 ph31 wr #0 exit ph1=0 2 2 0 1 3 3 1 ph31=0 2 2 0 1 3 3 1 . şi decuplarea heteronucleară Aspectul liniilor de rezonanţă dintr-un spectru RMN 1D. respectiv lichidă sau solidă. păstrându-se doar partea lor izotropă. În stare solidă mişcarea rapidă de reorientare moleculară este absentă. 1 diferă fundamental în funcţie de starea de agregare a probei. datorată mişcării moleculare rapide: prin aceasta. adică un spectru cu linii de rezonanţă înguste şi bine separate în funcţie de deplasările chimice izotrope. Spectrele compuşilor în soluţie sunt caracterizate de o rezoluţie foarte bună. implicit.high power pulse .pl1 : f1 channel . 1-5 * T1 3.power level for pulse (default) .incl" 1 .

Pentru a diminua efectul negativ al anizotropiei interacţiunilor de spin în spectroscopia RMN-S. adică la rezoluţie spectrală înaltă şi (ii) reintroducerea selectivă pe durata celorlate perioade ale exeprimentului a unor componente anizotrope ale interacţiunilor de spin (care să afecteze mărimi spectrale altele decât lărgimile de linie). care vor fi introduse în raportul următor. În mod explicit. manifestarea caracterului anizotrop al interacţiunilor de spin în probe solide prezintă şi avantaje de ordin practic. care să conducă la separarea liniilor RMN-S în funcţie de deplasările chimice izotrope ale diferitelor grupări chimice din sistemul molecular investigat.care se observă cu usurinţă pierderea completă a rezoluţiei prin suprapunerea severă a liniilor RMN. anizotropia ecranării chimice furnizează informaţii despre structura electronică (prin tipul orbitalilor moleculari) şi legăturile dintre atomi. pentru a codifica în spectrul obţinut şi informaţii specifice cu privire la structura şi/sau dinamica moleculară din sistem – în acest scop sunt aplicate aşa numitele metode de recuplare. iar anizotropia cuplajului dipolar conţine informaţii despre distanţele internucleare. deoarece componentele anizotrope conţin informaţii importante cu privire la structura şi dinamica din sistem. rezultă necesitatea dezvoltării de metode specifice ale spectroscopiei RMN-S care să conducă în cadrul aceluiaşi experiment la două efecte distincte: (i) pe durata anumitor perioade ale experimentului să se obţină medierea componentelor anizotrope ale interacţiunilor de spin. la mijlocul anilor ’50 a fost introdusă tehnica MAS 203 . Având în vedere toate aceste considerente. Figura 3 Comparaţie între spectrul 1H RMN static al unui compus organic tipic în stare solidă (a) şi în stare lichidă (b) Pe de altă parte.

numit “unghiul magic”. ∀ t1 . va fi diferit. După cum se va prezenta în continuare. efectul lor asupra dinamicii de spin. trebuie menţionat că. Din acest punct de vedere. Conform descrierii teoretice de mai sus.(Magic Angle Spinnining) în cadrul căreia proba este rotită în jurul unei axe înclinate la un unghi. mediază efectul anizotropiei interacţiunilor de spin prin faptul că rotaţia mecanică a probei determină oscilaţia în timp a termenilor anizotropi şi prin aceasta micşorează efectul lor de lărgire asupra liniilor RMN. t2 şi (ii) interacţiuni omogene (interacţiunea dipola204 . ilustrată schematic în Fig. De asemenea. efectul termenilor modulaţi devine din ce în ce mai mic cu creşterea frecvenţtei de rotaţie a probei: în perioada scursă de la introducerea metodei MAS şi până în prezent tehnologia în domeniu a avansat extrem de mult. 4. şi două componente dependente de timp ce corespund unei modulări periodice cu frecvenţele υR. care devine zero când axa de rotaţie este înclinată la unghiul magic în raport cu direcţia câmpului magnetic static. Figura 4 Majoritatea metodelor RMN-S moderne de înaltă rezoluţie sunt aplicate în condiţii de rotaţie a probei în jurul unghiului magic. permiţând rotaţii de până la 70 kHz ale probei în jurul unghiului magic. şi implicit asupra lărgirii liniilor RMN. Această metodă. în funcţie de forma explicită a hamiltonienilor asociaţi acestor interacţiuni. se pot evidenţia două cazuri distincte: (i) interacţiuni neomogene (deplasarea chimică şi interacţiunea dipolară heteronucleară pentru care [ H (t1 ). în raport cu direcţia câmpului magnetic static. H (t2 )] = 0. mecanismul de îngustare prin MAS a liniilor RMN în solide se bazează pe manipularea părţii spaţiale a hamiltonianului de interacţiune: termenii anizotropi ai acestuia în proba rotită se descompun într-o componentă statică. şi respectiv 2υR.

ră homonucleară în [ H (t1 ). t2 . respectiv adamantanul şi policarbonatul. datoraţi interacţiunii dipolare homonucleare în sisteme multi-spin. 5 sunt prezentate spectrele 1H RMN pentru diferite frecvenţe de rotaţie υR în cazul a doi compuşi organici. În aceste două cazuri. în care datorită numărului mare de protoni inter205 . Astfel. încep să se contureze atât linia centrală de rezonanţă. Evoluţia lărgimii liniilor RMN. în Fig. iar pentru υR ~ 3 kHz. fără rezoluţie. Mergând spre limita superioară a frecvenţei de rotaţie. pentru frecvenţe de rotatie în intervalul 0 – 35 kHz Un pas foarte important în îmbunătăţirea rezoluţiei spectrale pentru sisteme de tip multi-spin. precum şi benzile de rotaţie laterale. care apar la multiplii întregi ai frecvenţei de rotaţie. ∀ t1 . caracterizaţi prin dinamica moleculară complet diferită. Figura 5 Spectele 1H RMN-MAS ale adamantanului (a). respectiv ale policarbonatului (b). se consideră acţiunea Hamiltonienilor de tip omogen. H (t2 )] ≠ 0. exemplifică modalitatea prin care frecvenţa de rotaţie acţionează asupra caracterului omogen al interacţiunilor de spin din sistem. în cazul static se obţine doar un spectru foarte larg. forma spectrelor se apropie de cea întalnită în cazul în care predomină interacţiunile neomogene. sisteme multi-spin) pentru care Pentru a ilustra efectul interacţiunilor omogene asupra formei şi lărgimii liniilor de rezonanţă. pornind de la cazul static până la domeniul de frecvenţe înalte (35 kHz).

la 0. Figura 6 În clasa metodelor de decuplare homonucleră. una dintre secvenţele intens utilizate în prezent. precum şi RNnυ şi SAM (Smooth Amplitude Modulation). astfel încât interacţiunea dominantă din sistem rămâne ecranarea chimică (cu componentele ei izotropa. Comparând spectrele obţinute se observă o creştere apreciabilă a rezoluţiei spectrale în cazul decuplării homonucleare.1 ppm în cazul (a). 206 . respectiv anizotropa). mai pot fi enumerate şi FSLG. Acestea presupun aplicarea pe canalul 1H (care este şi canalul de detecţie) a unor secvenţe de pulsuri adecvate care să conducă la medierea efectului produs de interacţiunile dipolare homonucleare. De exemplu. de tip omogen. constă în combinarea tehnicii MAS cu metode de decuplare homonucleară. deoarece este aplicabilă în cazul rotirii probei cu frecvenţe înalte de ordinul a 65 – 70 kHz. iar apoi prin aplicarea celor două tehnici . este predominantă. astfel încât lărgimea liniei grupării metil scade de la 1. 6 este prezentat spectrul 1H al dipeptidei β-L-Asp-L-Ala obţinut rotind proba cu υR= 65 kHz (a). PMLG. pe lângă mai sus amintita metodă DUMBO. se numeşte DUMBO. În cazul sistemelor de spini cu factor giromagnetic mic (de exemplu 13C sau 15N) în abundenţă naturală (adică separaţi prin distanţe mari) cuplajele dipolare devin neglijabile.MAS şi decuplare homonucleră cu ajutorul secvenţei DUMBO (b). În Fig.acţiunea dipolară homonucleară.32 ppm în cazul (b). ultimele două metode fiind aplicate în timpul perioadei de evoluţie indirectă a experimentelor de tip bidimensional.

liniile de rezonaţă fiind largi. nucleele 13C (15N) sunt Figura 7 Evoluţia cu frecvenţa de înconjurate în compuşii organici de un rotaţie a liniilor de rezonanţă din număr mare de protoni. La o frecvenţă de rotaţie mică. υR= 1 kHz. care ilustrează comportarea în condiţii de MAS a unor interacţiuni de spin de tip pur neomogen: în realitate. 7 corespunde unui model teoretic idealizat. Chiar şi în cazul frecvenţelor de rotaţie mari se vor obţine linii de rezonanţă ale 13C (15N) cu lărgimi reziduale mari dacă se foloseşte doar tehnica MAS. evoluţia cu frecvenţa de rotaţie a liniilor într-un spectru RMN 1D într-un sistem de trei spini 13C care nu interacţionează dipolar dar sunt supuşi ecranării chimice este prezentată în Fig. Din punct de vedere teoretic. adică η =1 în cazul grupării COO-. Pentru a creşte rezoluţia spectrală în aceste cazuri este nevoie de combinarea teh207 . Forma liniilor este dată de valoarea parametrului de asimetrie. centrate la valori ale deplasării chimice izotrope asociate fiecărei grupări chimice. situate la multiplii întregi ai frecvenţei de rotaţie. Odată cu creşterea lui υR până la valori mari. astfel încât efectul spectrul RMN 13C al L-alaninei. în care se consideră doar efectul ecranării chimice. este de aşteptat în principiu ca odată cu creşterea frecvenţei de rotaţie a probei să se obţină spectre cu rezoluţie şi sensibilitatea spectrală din ce în ce mai înalte. liniile celor trei grupări se descompun într-o serie de benzi de rotaţie laterale.În acest caz.3 pentru CH3. Spectrul static al L-Alaninei prezintă caracteristicile tipice întâlnite în cazul unui sistem de spini izolaţi. intensităţile benzilor rotaţionale se reduc semnificativ astfel încât un spectru MAS de înaltă rezoluţie va conţine cu o bună aproximaţie doar linii poziţionate la valori ale deplasărilor chimice izotrope corespunzătoare grupărilor chimice din probă. respectiv 0. 0.5 pentru CH2. în interacţiunilor suplimentare datorate acesprezenţa ecranării chimice tora nu poate fi neglijat în practică. 7. Situaţia prezentată în Fig.

poziţionate la valori ale deplasării chimice izotrope caracteristice fiecărei grupări structurale. utilizarea decuplării heteronucleare în condiţii de MAS conduce la linii de rezonanţă înguste. Din punct de vedere practic. asemănătoare celor simulate pentru cazul idealizat al interacţiunilor pur neomogene (Fig. în timpul achiziţionării semnalului RMN pe canalul 13C (15N). cu o diferenţă de un ordin de mărime faţă de valorile întâlnite în mod uzual în cazul compuşilor în stare lichidă. Lărgimile liniilor pentru toate cele trei grupări sunt în intervalul 20 – 50 Hz. această tehnică constă în aplicarea pe canalul 1H a unui câmp rf intens. bine separate.nicii MAS cu o tehnică suplimentară numită decuplare heteronucleară în scopul de a se limita efectul de lărgire produs de protonii din vecinătate. valoarea B1 a câmpului rf exprimat în kHz) generat de transmiter pe canalul 1H în funcţie de valoarea atenuării (in dB) se utilizează experimentul simplu de un puls din Fig. 7). al cărui program de pulsuri este listat la finalul Secţiunii 2. sub formă continuă sau de pulsuri cu modulaţie în fază. Figura 8 După cum se observă în Fig. În esenţă. 8 pentru cazul spectrului RMN pe 13C al L-alaninei măsurat la o frecvenţă de rotaţie de 10 kHz. procedura constă în următoarele: • Se utilizează adamantanul drept probă standard pentru calibrarea nivelurilor de putere pe canalul protonilor deoarece spectrul 208 . 1. Calibrarea parametrilor pe canalul 1H cu ajutorul experimentului de un puls Pentru calibrarea nivelului de putere (sau echivalent.

caz în care se va putea începe cu o valoare de strat pl1 = 2-0 dB care va fi scăzută în paşi mai mari la început (de exemplu 0. se scanează pl1 cu paşi mai mici (0. În funcţie de capul de probă folosit. 6. sau direct prin comenzile p1 <valoare> (in us). se procedează la operaţiunile preliminare standard de acordare a frecvenţei de rezonanţă şi a impedanţelor (aşa numitele tuning şi matching).67. Se recomandă calibrarea în ordinea descrescătoare a câmpului rf .1 dB) în jurul valorii pentru care acesta s-a obţinut. şi stabilizarea rotaţiei la frecvenţa aleasă. ceea ce reduce foarte mult tăria cuplajelor dipolare 1H-1H După plasarea probei în magnet. Aceste proprietăţi favorabile conduc la o sensitivitate şi o rezoluţie foarte bună care permit calibrarea rapidă şi precisă a pulsului de 1800 (după cum se va descrie mai jos). şi se utilizează comanda zg). 75 şi 50 kHz). În cazul inversării.• • • • RMN-S 1H al acestui compus constă dintr-o singură linie. se recomandă utilizarea unor frecvenţe de rotaţie cuprinse între 10 şi 30 kHz Se începe apoi procedura de calibrare a puterilor pe canalul protonilor prin rularea repetată a experimentului de un puls (programul de pulsuri redat mai sus. cu lărgime mai mică decât a altor compuşi organici în fază solidă (sub 1 kHz pentru frecvenţe de rotaţie a probei mai mari decât 10 kHz). şi respectiv pl1 <valoare> (in dB) Mai întâi se fixează durata pulsului p1 astfel încât aceasta să corespundă unui puls de 1800 pentru un set de valori dorite ale câmpului rf pe canalul 1H (de exemplu. pentru câmpuri de 100.5 dB) până se constată anularea (sau inversarea) liniei RMN-S. Modificarea acestor parametri se poate face înscriind valorile dorite în tabela de achiziţie. Trebuie avut însă în vedere că scăzând câmpul 209 . şi 10 us. p1) considerate. Se repetă apoi în mod identic procedura de baleiere a nivelurilor de putere pl1 descrisă mai sus pentru toate valorile câmpului rf (implicit. şi se determină în final valoarea exactă a pl1 pentru care intensitatea liniei se anulază complet: această valoare va corespunde deci pulsului de 1800 pentru câmpul rf considerat. p1 = 5. Pentru fiecare dintre aceste valori fixe se baleiează parametrul pl1 până când intensitatea liniei din spectrul RMN-S înregistrat devine zero. şi se datorează faptului că molecula de adamantan nu este rigidă în reţeaua cristalină ci efectuează mişcări rapide de rotaţie simultan în jurul a trei axe de simetrie. în cadrul căruia se modifică durata pulsului (p1) şi nivelul de putere asocial (pl1) şi se înregistrează spectrul RMN-S 1H al adamantanului.

Calibrarea parametrilor pe canalul 13C cu ajutorul experimentului CP-MAS Secvenţa de pulsuri asociată experimentului de Cross-Polarizare în condiţii MAS (CP-MAS) este ilustrată în Fig. sau <valoare> us).0) . dn. pln. 9.basic cp experiment 1 ze 2 d1 do:f2 210 . deoarece monitorizarea rezultatului prin intermediul unui semnal care se anulează este mai sensibilă decât dacă s-ar urmări valoarea maximă a acestuia. 9 utilizând reprezentarea schematică convenţională din RMN. Figura 9 # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-const" . şi listat mai jos.• rf valoarea de start a parametrului pl1 creşte în mod corespunzător. Pentru a face mai uşoară o comparaţie directă între aceasta reprezentare schematică. pentru a se evita de exemplu să se pornească cu o valoare care deja corespunde unui puls > 1800. de putere. incluşi în programul de pulsuri cp-const asociat acestei secvenţe.cp (TopSpin 2. şi respectiv de fază. şi implementarea ei pe spectrometrul Bruker. şi delay-uri. în figură sunt menţionaţi explicit parametrii de timp (pulsuri. phn. pn. descrisă în Fig. În practică se preferă calibrarea prin intermediul pulsului de 1800 şi nu 900.

go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. este necesară calibrarea unui câmp rf pe canalul carbonului de 35 sau 65 kHz pentru a asigura un transfer maxim de 211 .pl12 is used here with tppm. and p30 the pulse CP-MAS este un experiment de dublă rezonanţă. deoarece presupune aplicarea de câmpuri rf (pulsuri) simultan pe două canale distincte (f1: 13C şi f2: 1H în cazul particular ilustrat mai sus). În cadrul prezentului raport. Procesul de transfer de polarizare 1H <-> 13C(15N) prin aşa-numitul mecanism de polarizare încrucişată (cross-polarization. ν1H = ν13C +(-) nνR.1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u pl12:f2 . În general se lucrează cu valori ale câmpului în jur de 50 kHz pe canalul protonilor. şi vom începe prin a explica de ce se preferă în practică experimentul CP-MAS pentru a înregistra spectre RMN-S 1D ale 13C(15N) în locul experimentului mult mai simplu de un puls. 1m exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 . cât şi ca parte componentă în experimente multi-dimensionale mai complexe.2.13C(15N) şi se desfăşoară în condiţiile iradierii simultane cu câmpuri rf pe canalele asociate (aşa numitele pulsuri de contact: Fig. unde n=1. Procesul de transfer prezintă maxime de eficienţă dacă amplitudinile celor două câmpuri rf de contact satisfac aşa-numita condiţie Hartmann-Hahn de matching. 9).pl12 is used here with cw . El este un experiment standard în spectroscopia RMN-S care se utilizează atât pentru înregistrarea spectrelor 1D convenţionale ale nucleelor cu factor giromagnetic mic. precum 13C sau 15N. la condiţia de matching n =1: aceasta înseamnă că valoarea câmpului pe canalul 13C(15N) va fi astfel calibrată încât să fie mai mare (sau mai mică) cu valoarea frecvenţei de rotaţie a probei. pentru o rotaţie cu νR = 15 kHz (o valoare uzuală pentru înregistrarea spectrelor 13C) a probei în jurul unghiului magic. se va considera în detaliu doar primul aspect. CP) este un proces coerent generat de interacţiunile dipolare heteronucleare 1H. De exemplu.

şi respectiv de zece ori în cazul spinilor 15N. Deoarece la echilibru termic raportul dintre aceste polarizări este proporţional cu raportul factorilor giromagnetici corespunzători. însă şi în aceste condiţii câştigul în intensitate al semnalului RMN este semnificativ. Ambele mecanisme conduc la creşterea substanţială a sensibilităţii spectrale în cazul utilizării metodei CP/MAS. Polarizarea transferată pe 212 . Avantajele principale ale unui experiment CP-MAS rezultă din faptul că polarizarea iniţială care conduce la formarea semnalului RMN-S este cea transferată de la spinii 1H. şi nu polarizarea asociată nucleelor 13C(15N). Plecând de la secvenţa de pulsuri ilustrată schematic în Fig. Deoarece. Această polarizare este apoi „blocată” – aşa-numitul „spin locking” – cu ajutorul pulsului de contact p15 aplicat pe canalul f2 cu faza x (deoarece direcţia câmpului rf asociat şi direcţia polarizării trebuie să coincidă). Utilizarea polarizării transferate de la protoni mai are încă un avantaj important care este determinat de valorile mult mai mici ale timpului de relaxare longitudinal T1 în cazul nucleelor 1H în comparaţie cu cei asociaţi 13C(15N): deoarece aceşti timpi practic guvernează valoarea duratei de repetiţie a experimentului (aşa-numita recycle delay. 9). De asemenea. şi respectiv programul de pulsuri asociat. rezultă că într-un anumit interval dat se pot acumula mult mai multe scanuri cu ajutorul CP/MAS decât ar fi posibile în cazul utilizării experimentului simplu de un puls. 9. comparativ cu intensitatea care s-ar obţine printr-un experiment de un puls.15N la aceeaşi distanţă internucleară. prin aplicarea pulsului p3 de 900 cu faza y pe canalul f2 asociat protonilor). şi valoarea optimă a pulsului de contact va creşte corespunzător (în acest caz se obţine un transfer maxim de polarizare la valori ale p15 cuprinse între 3-7 ms). În realitate aceşti factori teoretici sunt rareori obţinuţi în practică datorită proceselor de relaxare care se desfăşoară pe durata pulsului de contact. valorile optime pentru durata pulsului de contact (p15) în cazul nucleelor de 13C este cuprinsă între câteva sute de μs.polarizare 1H -> 13C. cuplajul dipolar 1H.13C este de aproximativ 2. rezultă o amplificare de aproximativ patru ori în intensitatea semnalului RMN-S 13C.5 ori mai mare decât cuplajul 1H. d1. un experiment CP/MAS standard (sau convenţional) se derulează în modul următor: mai întâi se aduce polarizarea longitudinală a spinilor nucleari 1H în planul transversal (de exemplu de-a lungul direcţiei x. până la 1-2 ms: această durată depinde direct de tăria medie a cuplajelor dipolare dintre fiecare spin 13C din probă şi protonii cei mai apropiaţi. Simultan se aplică pulsul de contact de aceeaşi durată p15 şi pe canalul carbonului cu un nivel de putere corespunzător unui transfer maxim de polarizare 1H->13C (adică să satisfacă una dintre condiţiile de matching Hartmann-Hahn descrise mai sus). în Fig.

Pentru a obţine spectre RMN-S 13C de calitate ale compusului studiat. Compuşii standard cel mai des utilizaţi în acest scop sunt adamantanul (calibrarea nivelelor de putere pe canalul carbonului) şi glicina (ajustarea valorii unghiului magic). ceea ce conduce la o sensibilitate spectrală foarte bună.durata lui p15 se construieşte de-a lungul direcţiei câmpului de contact aplicat pe canalul f1: aceasta reprezintă în fapt o polarizare transversală a spinilor 13C astfel că. În final trebuie menţionat că detecţia FID-ului se face în condiţii de decuplare heteronucleară. şi (ii) alternarea în paşi de 900. respectiv ph3 = 90 şi 2700. însă şi metoda CW este preferată uneori. în momentul încetării acţiunii pulsului de contact. adică prin utlizarea unor tehnici speciale care au drept scop minimalizarea efectelor produse de interacţiuniile dipolare 1H-13C şi 1H-1H (în special efectul de lărgire a liniilor spectrale) pe durata achiziţionării semnalului RMN 13C. care conţine două subcicluri suprapuse: (i) alternarea cu 1800 a fazei pulsului p3. iar în cadrul unei metode mai recente. respectiv 0. cu Δφ având valori cuprinse în general între 15 şi 300. 90. respectiv la un timp de acumulare scurt. φ = φ + Δφ. adică în cazurile în care nu este necesar aplicarea unor câmpuri rf de decuplare foarte intense. sau la înregistrarea de spectre 15N RMN-S. adamantanul prezintă avantajul că se obţin linii 13C RMN-S relativ înguste (2-3 Hz). toate tehnicile de decuplare heteronucleară constau în aplicarea unui câmp rf pe canalul protonilor de-a lungul întregii durate de achiziţie a semnalului RMN. pentru un experiment CP/MAS: în acest fel. pentru a elimina contribuţia polarizării iniţiale a spinilor 13C la semnalul detectat. numite Continuous Wave – CW. câmp ce trebuie să satisfacă anumite cerinţe în funcţie de condiţiile experimentale concrete: în cadrul celei mai simple metode. Ca şi în cazul calibrării puterilor pe canalul 1H. 180 şi 2700. cu performanţe îmbunătăţite. deoarece acesta necesită în general 213 . adamantanul este considerat un compus ideal pentru procesul de calibrare a experimentului CP/MAS. parametrii caracteristici ai experimentului CP/MAS trebuie mai întâi calibraţi cu ajutorul unor compuşi de referinţă (standard). câmpul se aplică în mod continuu cu faza arbitrară. TPPM este tehnica de decuplare heteronucleară cel mai des utilizată pentru înregistrarea de spectre 13C RMN-S pe compuşi organici cristalini. În principiu. a fazei receptorului în sincronie cu faza ph1 a pulsului de contact pe canalul f1 (aşa-numitul Cyclops phase cycling) pentru a elimina eventualele imperfecţiuni ale circuitelor de detecţie în cuadratură. de exemplu în scopul calibrării experimentului CP/MAS. de ordinul zecilor de secunde. În mod uzual un experiment CP/MAS se efectuează cu un phase cycling de 8 paşi. numita TPPM (Two Pulse Phase Modulation) câmpul se aplică sub formă de trenuri de două pulsuri cu faze alternante. ea evoluează liber şi poate fi achiziţionată ca şi semnal RMN (FID).

Aceasta este etapa cea mai laborioasă din cadrul procedurii. pl1. astfel încât acestea să corespundă unei valori a câmpului rf de 50 kHz: şi în acest caz se utilizează rezultatele anterioare ale calibrării puterilor pe canalul 1H. trebuie deci calibrate puterile pl3.5 şi 38. pentru pulsul de contact pe canalul protonului. Plecând de la aceste considerente. Setul de spectre obţinut astfel furnizează aşa-numită curba de matching Hartmann-Hahn. se porneşte de la valori mari ale lui pl1 (de exemplu. (ii) nivelurile de putere ale pulsurilor de contact p15 pe cele două canale sunt astfel ajustate încât să îndeplinească condiţia Hartmann-Hahn de matching descrisă mai sus. şi respectiv câmpul de decuplare prin CW. Conform schemei experimentale din Fig. Corespunzător acestor elemente. Pentru a evita posibile efecte de offset. • Se setează valorile pl2 şi pl12. 2. respectiv dependenţa puterii pe canalul 13C a intensităţii spectrale.5 ppm. procedura de calibrare a experimentului CP/MAS poate fi descrisă pe scurt în felul următor: • Pentru valorarea fixată a lui p3 se setează puterea pl3 (determinată anterior în procesul de calibrare a puteriolor pe canalul protonului) astfel încât aceasta să corespundă unui puls de 900. Valorile particulare ale parametrului pl1 pentru care se obţin aceste maxime se transformă în valori ale câmpului rf asociat utilizând relaţia ν13C = 50 kHz +(-) nνR. intensitatea spectrală obţinută este maximă dacă sunt îndeplinite simultan următoarele trei condiţii: (i) pulsul p3 pe canalul protonilor este un puls 900.achiziţionarea unui număr mare de spectre până când sunt determinate valorile optime ale tuturor parametrilor de interes. determinate de grupările CH şi CH2 din moleculă). respectiv a eficienţei procesului de transfer de polarizare prin CP. pl2 şi pl12 (în condiţiile în care se consideră fixate valorile pulsurilor p3 şi p15. 1. iar metoda de decuplare utilizată pentru adamantan este CW). şi (iii) tehnica de decuplare utilizată să conducă la îngustarea maximă posibilă pentru compusul dat. 5 dB) şi se scanează acest parametru în paşi de 0. frecvenţa de iradiere pe canalul f2 va fi cea corespunzătoare frecvenţei de rezonanţă a liniei adamantanului din spectrul 1H RMN-S. 9. În particular. • Se ajustează valoarea puterii pl1 a câmpului de contact pe canalul carbonului până când se obţine o intensitate maximă a liniilor RMN în spectrul CP/MAS achiziţionat. În cazul fiecărui parametru optimizarea se face prin maximizarea intensităţii liniilor RMN în spectrul achiziţionat (în cazul particular al adamantanului avem două linii poziţionale la 29.1 dB mergând înspre valori mici. 214 . Curba de matching Hartmann-Hahn prezintă cinci maxime corespunzătoare celor cinci condiţii menţionate anterior. cu n = 0.

2. Introduction to High-Resolution Solid-State NMR. durata optimă a pulsului p15 se apropie în general de cea a unui puls de 1800. Wiley 2010 T.5 ppm) are lărgime minimă (implicit. 2008 215 . Bodenhousen. G. astfel încât calibrarea lui p31 se face pornind de la această valoare de referinţă. NMR Spectroscopy. Experimentul CP/MAS cu parametri calibraţi pe adamantan din punct de vedere al nivelurilor de putere. Datorită faptului că glicina este o moleculă relativ rigidă în reţeaua cristalină (aşa cum sunt majoritatea compuşilor organici) decuplarea prin CW la câmpuri mici. se utilizează în continuare pe glicină pentru ajustarea valoarii unghiului magic şi pentru optimizarea pulsurilor p31 asociate decuplării prin metoda TPPM. se modificăa uşor înclinarea axei rotorului până ce se obţine un spectru 13C RMN-S a glicinei în care linia carbonilului (de la 176. Levitt.Bibliografie 1. TOPSPIN User Manual.• În final. pentru o ajustare mai fină a pulsului iniţial de 900 pe canalul protonului se revine la primul pas. Alegerea acestui compus standard este motivată de faptul că el are un spectru RMN-S simplu care conţine doar două linii (deci sensibilitate spectrală mare) dintre care una corespunde grupării carbonil a cărei lărgime este foarte sensibilă la deplasări mici ale înclinării axei de rotaţie a probei faţă de valoarea unghiului magic: acest efect se datorează anizotropiei mari a deplasării chimice. 3. Keeler. 4. 6. Wokaun. Wiley 2001 Bruker Biospin Group. astfel încât se preferă metoda TPPM la câmpuri intense (ideal pl12 ar trebui să corespundă unor câmpuri de cel puţin 100 kHz). Principles of Nuclear Magnetic Resonance în One and Two Dimensions. de ordinul a 50 kHz. nu mai poate produce o rezoluţie spectrală satisfăcătoare. Spin Dynamics: Basics of Nuclear Magnetic Resonance. Understanding NMR Spectroscopy. Guenther.H. 5. prin modificarea uşoară a puterii pl3 în jurul valorii fixate iniţial. Wiley 2008 J. În practică. Gullion. 4. A. Pentru valoarea setată a lui pl12. Oxford University Press. După acest pas este trecut se procedează în continuare la ajustarea pulsului p31 în secvenţa de decuplare heteronucleară prin TPPM pentru a se obţine în final îngustarea maximă posibilă a liniilor spectrale. amplitudine maximă). Elsevier Science 2007 H. Oxford 1987 M. Ernst. şi se reţine acea valoare pentru care intensitatea spectrală atinge un maxim absolut. Această etapă este necesară deoarece valorile câmpului rf pe canalul 1H în general sunt determinate cu un grad de eroare mai mare prin experimentul de un puls decât cu ajutorul experimentului CP/MAS. R.R.

............. Claudiu Filip C...... în ordinea creşterii complexităţii lor: se vor descriere mai întâi experimente care necesită înregistrarea de seturi de date bidimensionale (2D)....................... Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) ..........I. Introducere ........ Deoarece acestea sunt considerate ca făcând parte din „arsenalul de bază” al metodologiei moderne RMN-S pe sisteme moleculare organice............... care să permită rotaţii ale probei până la 70 kHz.... nu vor putea fi prezentate o serie de metode RMN-S intensiv utilizate în domeniu..................219 3..... chiar dacă nu pot fi utilizate în practică la UBB Cluj.............. Bibliografie . Introducere În acest raport se vor prezenta în mod detaliat o serie de experimente RMN-S avansate. de exemplu cele care implică lucrul simultan pe trei canale rf [1] (metode de triplă rezonanţă)..216 2..........III.......................................................... Accentul va fi pus pe experimente RMN-S de dublă rezonanţă pe 13C...............226 4...... dr........... Introducerea metodelor se va face progresiv....... metode ce au fost până în prezent implementate şi testate experimental pe infrastructura existentă la UBB Cluj.. care necesită o electronică adaptată secvenţelor de decuplare homonucleară [2] şi/sau capuri de probă de tip „ultra-fast MAS”......S.................................. dar care nu necesită transformarea lor în spectre 2D.. sau metode de înaltă rezoluţie pe 1H. recomandăm studenţilor aprofundarea lor cel puţin la nivel teoretic (consultând bibliografia indicată mai sus)........ însă doar în cazul acelor compuşi unde se obţine o rezoluţie spectrală satisfăcătoare în condiţiile tehnice date......S............................... Drept urmare.........Spectroscopie de rezonanţă magnetică nucleară pe solide (RMN-S) – Implementarea de metode avansate RMN-S pentru aplicaţii pe sisteme moleculare organice în faza solidă C...........................237 5........ dr...................... Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C ............................. Mihaela Aluaş Cuprins 1...... şi vom ajunge în final la prezentarea de metode care 216 .. Vor fi ilustrate de asemenea tehnici bazate pe detecţia 1H......... Metode RMN-S 2D de corelare 13C-13C ................245 1............ cu aplicaţii în investigarea structurii sistemelor moleculare organice cristaline......................

prin intermediul semnalul RMN. De asemenea. semnalul RMN este descris de o funcţie care depinde de două variabile de timp. Schema generală pentru un experiment RMN bidimensional este redată în Fig. Figura 1: Schema de principiu a unui experiment RMN bidimensiuonal (2D) În prima perioadă. 3Δt1…nΔt1. semnalul RMN bidimensional constă dintr-un set de n FID-uri. polarizare transversală. este de menţionat că. deoarece ea defineşte corelaţiile care se stabilesc între mărimile care evoluează în t1 şi polarizarea transversală asociată fiecărui spin care se detectează în mod direct. În fiecare caz. respectiv că toţi parametri experimentali relevanţi. se înregistrează şi se stochează FID-ul corespunzător acestei valori. pentru fiecare tehnică RMN-S avută în vedere. în urma cărora se generează o mărime fizică asociată sistemului de spini (de ex. 217 . Pentru a se obţine spectrul în frecvenţă. În consecinţă.furnizează informaţii structurale pe bază de spectre RMN-S 2D de corelaţie. 1. t1 şi t2. şi va depinde explicit de ambele variabile temporale. în afară de aspecte pur practice se va face şi o scurtă prezentare a fundamentelor teoretice pe care aceasta se bazează. în spectroscopia RMN bidimensională (2D). au fost calibrate corespunzător.) care va evolua pe durata t1. în acest caz transformata Fourier trebuie aplicată de două ori. Un spectru RMN 2D se obţine în următorul mod: se aplică secvenţa de pulsuri pentru t1 = 0. constă în aplicarea celui de-al doilea puls (sau pulsuri) de radiofrecvenţă. unde spectrul RMN se obţine prin transformarea Fourier a FID-ului. etc. se presupune că mai întâi au fost parcurşi paşii prezentaţi în raportul anterior. Această succesiune de perioade poartă denumirea de secvenţă de pulsuri 2D. t1 (corespunzător dimensiunii indirecte F1) şi t2 (corespunzător dimensiunii directe F2). iar informaţia care se regăseşte în spectrul RMN depinde concret de tipul interacţiunii care a fost selectată în perioadele de preparare şi de mixing. cea de preparare. Secvenţa de mixing are rolul cel mai important într-un experiment 2D. unde n este de obicei cuprins între câteva zeci şi câteva sute). pe durata lui t2. Spre deosebire de varianta unidimensională. şi în special nivelurile de putere pe fiecare canal rf. se aplică unul sau mai multe pulsuri rf. Apoi se repetă aceeaşi procedură pentru t1 egal cu multiplii întregi ai perioadei de sampling Δt1 (adica Δt1. 2Δt1. Următoarea perioadă – perioada de mixing. coerente de mai multe cuante.

în cazul spectrelor de corelare ambele dimensiuni codifică deplasările chimice izotrope. şi perioada de mixing coincid.Figura 2: Exemple de spectre RMN 2D şi modalitatea în care apar peakurile diagonale. ilustrată în Fig. generează spectre care conţin ambele tipuri de peak-uri. t1. se pot obţine două tipuri distincte de spectre RMN 2D: de separare. respectiv cross-peakurile Modul de apariţie a peak-urilor în spectre RMN bidimensionale şi interpretarea acestora vor fi descrise pe scurt în cele ce urmează. iar pe durata perioadei de mixing acelaşi semnal a fost transformat cu ajutorul unei anumite secvenţe de pulsuri într-un alt semnal care evoluează cu frecvenţa ωB pe durata t2. Un alt tip de peak-uri care se pot obţine într-un spectru RMN 2D. corespund cazului în care frecvenţa de rezonanţă a unui semnal generat în timpul perioadei de preparare va rămâne neafectată de pulsul (sau pulsurile) care alcătuieşte perioada de mixing. F1. şi (ii) interacţiunea de spin recuplată pe durata perioadei de mixing. 2(c). 1. care va evolua în dimensiunea indirectă F1. atunci pe durata perioadei de preparare s-a format un semnal care a evoluat cu frecvenţa ωA de-a lungul lui t1. De 218 . Spre deosebire de spectrele RMN 2D de separare. în dimensiunea F2 se obţine spectrul izotrop al compusului studiat. iar în dimensiunea indirectă. În practică. În funcţie de tipul de experiment RMN de corelare utilizat. şi respectiv de corelare [3]. Conform schemei generale a unui experiment 2D. Multe dintre tehnicile RMN 2D utilizate în mod curent. separat. numite peak-uri diagonale. iar interacţiunea recuplată va genera peakuri de corelatie (cross-peakuri) între nucleele diferitelor grupări chimice dintr-un anumit compus. Astfel. în funcţie de succesiunea de pulsuri aleasă. pentru fiecare linie izotropă. În cazul spectrelor bidimensionale de separare. vor exista diferenţe în ceea ce priveşte (i) mărimea fizică asociată sistemului de spini (de exemplu coerente de una sau mai multe cuante). dacă într-un spectru 2D va apărea un peak poziţionat la ωA în dimensiunea F1 şi la ωB în dimensiunea F2 (aşa numitele cross-peakuri). o secvenţă de pulsuri specifică spectroscopiei RMN 2D de separare corespunde cazului particular în care domeniul temporal indirect. de exemplu Fig. se obţine spectrul anizotrop al interacţiunii recuplate.

şi respectiv de fază. şi anume. utilizând reprezentarea schematică convenţională din RMN. dn. etc. şi delay-uri. şi respectiv faze asociate acestor pulsuri. roşu şi verde reprezintă durate. cât şi în programul de pulsuri. Referitor la notaţiile atât în reprezentarea schematică. phn. Secvenţa de pulsuri asociată acestui experiment este redată mai jos în Fig. 2. niveluri de putere ale pulsurilor rf. pln. în figură sunt mentionaţi explicit parametrii de timp (pulsuri. experimentele bidimensionale pot fi clasificate şi în funcţie de tipul de nuclee implicate. Figura 3: Reprezentarea schematică a experimentului RMN 2D de investigare a transferului de polarizare 1H-13C prin intermediul secvenţei CP-MAS clasice 219 . sau <valoare> us). incluşi în programul de pulsuri cp-var asociat acestei secvenţe. şi implementarea ei pe un spectrometru Bruker. şi anume experimente de corelare homonucleare sau heteronucleare. Toate celelalte elemente (comenzi. Metode RMN-S 2D de separare pentru pe investigarea dinamicii transferului de polarizare 1H-13C Metoda RMN-S 2D bazată pe secvenţa CP-MAS clasică Exemplul cel mai ilustrativ al unei metode RMN-S 2D de separare este reprezentat de experimentul de recuplare a interacţiunii dipolare heteronucleare C – H cu ajutorul secvenţei clasice CP-MAS ce are drept efect un transfer de polarizare între protoni şi nucleele 13C din vecinătate.asemenea. variabilele notate cu albastru. cu eficienţe care depind de distanţele dintre spinii nucleari implicaţi. pn. 3. Pentru a face mai uşoară o comparaţie directă între această reprezentare schematică. se foloseşte aceeaşi convenţie ca şi în raportul anterior. şi listat mai jos. descrisă în raportul anterior. de putere. parametri adimensionali.) sunt reprezentate cu negru.

experimentul descris în Fig. achiziţionate prin intermediul secvenţei CP-MAS clasice: la fiecare dintre cele N repetiţii ale experimentului. 3 presupune înregistrarea unui set de date 2D. Lista este cuprinsă în fişierul care este specificat în tabela parametrilor de achiziţie. şi se obţine astfel 220 .go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. lo to 2 times td1 (loop la linia 2. secvenţele CP-MAS efectiv utilizate diferă între ele prin durata pulsului de contact. 1m 1m if 1m ivp lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph31= 0 2 2 0 1 3 3 1 . După achiziţionarea celor N semnale RMN distincte.basic cp experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (vp ph1):f1 (vp ph2):f2 1u pl12:f2 . În programul de pulsuri. de un număr de ori specificat prin parametrul de achiziţie td1) – repetă experimentul de N ori (N = td1) pentru a acumula toate datele prevăzute în experimentul 2D.# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/cp-var" . modul de achiziţie 2D este specificat prin comenzile de incrementare şi de repetiţie (loop) specifice: if (increment file – trece la un nou fişier unde va fi stocat următorul FID din cadrul setului de date 2D). ivp (increment variable pulse – trece la următoarea valoare a pulsului de contact specificată în lista de pulsuri).pl12 is used here with tppm.cp (TopSpin 2. Valorile acestor pulsuri sunt stocate într-o aşa-numită listă de pulsuri (variable pulse list) care este apelată în cadrul programului de pulsuri prin comanda vp (variable pulse). care constă dintr-un număr N de semnale RMN 13C distincte.pl12 is used here with cw . and p30 the pulse În esenţă. urmează procesarea datelor: concret.0) . se aplică transformata Fourier de-a lungul dimensiunii directe (F2) prin intermediul comenzii xf2.

obţinându-se spectrul izotrop al compusului. se reprezintă grafic evoluţia intensităţii de linie în funcţie de durata lui p15. Peste această valoare a lui p15 se pot utiliza creşteri cu paşi din ce în ce mai mari. care afectează dinamica procesului de transfer de polarizare 1H -> 13C la durate de ordinul milisecundelor. astfel încât numărul de N de repetiţii ale experimentului. Acesta este format din N spectre 13C CP-MAS. respectiv COOH). Transformata Fourier s-a aplicat doar în dimensiunea directă. dinamica procesului de transfer de polarizare de la protonii învecinaţi (în principiu. Procedura descrisă mai sus face parte dintr-o clasă mai largă de metode RMN-S numite 221 .setul de date 2D. contribuţii însemnate vor avea cei situaţi până la o distanţă de 2. În Fig. respectiv COOH. În practică. 5 – 10 μs). să fie menţinut la o valoare rezonabilă. Pentru fiecare dintre liniile RMN din spectru. aşezate în ordinea crescătoare a duratei pulsurilor de contact p15 utilizate. 4 este prezentat un set de date bidimensional înregistrat utilizând tehnica descrisă mai sus în cazul particular al L-Alaninei. pentru durate ale pulsului de contact p15 cuprinse în intervalul 0 – 200 μs e preferabilă utilizarea unei eşantionări în paşi egali (de exemplul. 30-50.5-3 Å). în dimensiunea indirectă se obţin curbele de transfer de polarizare (CP) corespunzătoare fiecărei grupări chimice: forma specifică a fiecărei dintre aceste curbe reflectă tăria cuplajelor dipolare heteronucleare recuplate. proprietăţile caracteristice ale unei asemenea curbe descriu. cu cât rata de creştere a unei astfel de curbe CP este mai mare şi oscilaţiile dipolare mai pronunţate (vezi curba CP corespunzătoare grupării CH comparativ cu cele pentru CH3. pentru fiecare poziţie chimică distinctă a atomilor de carbon din sistemul molecular investigat. Pentru a putea caracteriza şi parametrii relaxării spin-reţea în sistemul rotitor. Astfel. se recomandă de asemenea înregistrarea curbei până la valori ale pulsului de contact de 3 – 5 ms. ţinând cont de caracteristicile procesului de transfer de polarizare 1H -> 13C. obţinându-se în final aşa-numitele curbe CP-MAS. Considerând variaţia intensităţilor de linie cu poziţia spectrului CP-MAS din setul de date 2D. deoarece în interiorul acestui domeniu temporal caracterul coerent al procesului de transfer este dominant. cu cele trei linii de rezonanţă caracteristice grupărilor CH. care coincide cu numărul de puncte ce definesc curbele CP-MAS înregistrate. Dacă transformata Fourier se aplică şi de-a lungul lui t1. CH3. cu atât cuplajul dipolar heteronuclear asociat este mai puternic. şi se manifestă prin apariţia aşa-numitelor oscilaţii dipolare în curbele CP-MAS corespunzătoare. în locul curbelor CP se vor obţine aşa-numitele spectre dipolare: cele două modalităţi de a extrage informaţii despre parametrii interacţiunii dipolare sunt însă echivalente.

tehnica CP-MAS de recuplare a interacţiunii dipolare heteronucleare este în general înlocuită cu tehnici mai sofisticate [4. Figura 4: Set de date 2D obţinut în cazul compusului L-alanina. prin combinarea tehnicii de recuplare heteronucleară CP cu metode de decuplare homonucleară a protonilor. Metoda Remote Protons CP-MAS O nouă metodă RMN-S 2D de separare este bazată pe experimentul anterior. această secvenţă numită CPPI (Cross-Polarization Polarization-Inversion) are drept scop generarea unei 222 . în condiţii de rotire a probei la unghi magic. În dimensiunea directă se aplică transformata Fourier şi se obţin liniile de rezonanţă ale grupărilor chimice din compus. Aceste curbe au fost înregistrate după ce în prealabil puterile pe cele două canale rf au fost calibrate la condiţia n = -1 de matching Hartmann-Hahn. iar în dimensiunea indirectă sunt ilustrate curbele CP corespunzătoare acestor grupări. 5]. cum ar fi metodele LG (Lee-Goldburg) sau FSLG (Frequency-Switched Lee-Goldburg). care să ţină cont de detaliile structurale dorite. se obţine o recuplare eficientă a interacţiunii dipolare heteronucleare.de tip SLF (Separated Local Field Spectroscopy): în cadrul acestora. În general. şi de prezenţa sau nu a ordonării în probele investigate. însă extinde domeniul acesteia de aplicabilitate prin încorporarea unei noi secvenţe în perioada de preparare.

cum este cazul experimentului CP-MAS clasic.go=2 ph31 cw:f2 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu.remote protons CP-MAS experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 (p16 ph1):f1 (p16 ph6):f2 (vp ph1):f1 (vp ph8):f2 1u pl12:f2 . care poate fi creată cu ajutorul configuraţiei experimentale formată din cele două blocuri CP ale secvenţei CPPI de durate bine determinate.cp (TopSpin 2. 1m 1m if 1m ivp . p15 şi p16. Noua stare iniţială constă într-o distribuie neuniformă a polarizării protonilor.stări iniţiale diferită de polarizarea uniformă 1H.pl12 is used here with cw . and p30 the pulse 223 . iar faza celui de-al doilea bloc este inversată în raport cu faza primului.pl12 is used here with tppm. Figura 5: Reprezentarea schematică a experimentului RMN 2D „Remote Protons CP-MAS” de investigare a transferului de polarizare 1H-13C de la protonii nelegaţi chimic de catonii din probă # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/rem_prot_cp" .0) .

lo to 2 times td1 exit ph3= 1 3 ph1= 0 0 2 2 1 1 3 3 ph2= 0 ph4= 2 ph31= 0 2 2 0 1 3 3 1

Alternând fazele celor două pulsuri CP care formează secvenţa CPPI se creează o stare iniţială de polarizare egală cu zero atât pentru nucleul 13C, cât şi pentru protonii direct legaţi chimic de acesta. Ca o condiţie necesară pentru ca în curbele de transfer de polarizare să fie cuantificat doar procesul de transfer de la protonii îndepărtaţi, secvenţa CPPI trebuie să aducă simultan la zero polarizarea spinului central 13C şi a protonilor direct ataşaţi, în timp ce polarizarea protonilor îndepărtaţi este menţinută la o valoare cât mai mare. Pentru a verifica în ce măsură această condiţie este îndeplinită, am efectuat simulări numerice utilizând programul Spinevolution. În acest scop, sistemul de spini ales este format dintr-un nucleu 13C înconjurat de 7 protoni, care aparţin moleculei de L-Alanina. Pentru cazul grupării CH rezultatele analizei sunt prezentate în Fig. 6: în aceste grafice este ilustrată evoluţia polarizării pentru fiecare spin din sistem în funcţie de creşterea timpului de inversie, p17, şi pentru trei valori diferite ale frecvenţei de rotaţie, νR = 5; 8, respectiv 15 kHz. Pentru sistemul de spini utilizat, primul bloc CP are o durata fixă, p16 = 70 μs, corespunzătoare transferului maxim de polarizare de la protonul legat chimic de spinul central 13C. Dependenţa curbelor de polarizare

Figura 6: Simulări ale dependenţei polarizării de spin de timpul de inversie τ2 din secvenţa de pulsuri CPPI pentru υR = 5; 8 respectiv 15 kHz, în cazul grupării CH din L-Alanina. Prin linie continuă sunt reprezentate curbele de inversie ale polarizării pentru spinul 13C (cu negru), respectiv a protonului legat chimic de acesta (cu roşu). Cu linie punctată este reprezentată polarizarea remanentă pe protonii îndepărtaţi, care aparţin grupării CH3 (albastru), respectiv NH3 (verde) din sistemul de spini considerat.

224

din Fig. 6 arată că polarizările din cadrul grupării CH (adică nucleului 13C şi a protonul sau direct ataşat) pot fi aduse simultan la zero pentru frecvenţe de rotaţie a probei mai mari decât 5 kHz, iar valoarea efectivă a duratei pulsului p17 pentru care această condiţie este îndeplinită depinde în mod explicit de valoarea frecvenţei de rotaţie: de exemplu pentru νR = 8 kHz se obţine un puls de contact p17 cu o durată de 42 μs. În măsura în care starea iniţială dorită poate fi generată cu ajutorul secvenţei CPPI, curbele de transfer de polarizare înregistrate experimental prin incrementarea duratei celui de-al treilea bloc CP din Fig. 5 se consideră ca reflectă doar contribuţia protonilor îndepărtaţi. Pentru a verifica acest lucru, predicţiile teoretice referitoare la procesul de transfer de polarizare de la protonii îndepărtaţi realizat prin noua metodă Remote Protons CP-MAS, au fost testate experimental [6]. În acest scop, am extins configuraţia utilizată în simulări numerice la un sistem de 10 spini (9 protoni şi un nucleu 13C) din L-Alanina, iar curbele CP simulate au fost comparate cu cele experimentale. Molecula de L-Alanina a fost alesă deoarece poziţiile protonilor, şi implicit distanţele H-H şi C-H, sunt determinate precis, prin difracţie de neutroni (cu precizie de ±0.003 Å). Simulările numerice au fost efectuate considerând două cazuri distincte şi anume: în primul caz se consideră gruparea NH3 ca fiind rigidă, iar în cel de-al doilea caz aceeaşi grupare se consideră în regim de rotaţie rapidă în jurul axei sale. În ambele situaţii gruparea CH3 este considerată a efectua o mişcare de rotaţie rapidă. Prin compararea curbelor CP-MAS simulate cu cele experimentale (Fig. 7)

Figura 7: Comparaţia între curbele CP/MAS teoretice şi experimentale corespunzătoare nucleului 13C din gruparea CH din L-Alanina, obţinute prin utilizarea secvenţei CP clasice (curbele roşii), respectiv a secvenţei de transfer de la protonii nelegaţi (curbele cu albastru). Curbele experimentale sunt reprezentate prin cercuri, iar cele simulate prin linie punctată (pe un sistem format din 8 spini), respectiv linie continuă (sistem format din 10 spini). Gruparea CH3 se consideră a efectua o mişcare de rotaţie rapidă în ambele cazuri, iar gruparea NH3 se consideră în aproximaţie rigidă în (a), respectiv în regim de rotaţie rapidă în (b).

225

se observă o foarte bună concordanţă în cazul în care gruparea NH3 este considerată quasi-rigidă. Totuşi, există unele mici diferenţe între curba calculată şi cea măsurată, diferenţe care cel mai probabil se datorează faptului că gruparea NH3 efectuează în realitate o mişcare de rotaţie lentă (la scală de timp a procesului de transfer de polarizare, de ordinul µs). Cea mai importantă concluzie care rezultă în urma comparării efectuate este sensibilitatea crescută a curbei Remote CP-MAS la dinamica moleculară prezentă în sistemul molecular studiat, în timp ce curba CP clasică nu este atât de sensibilă la detalii ale mişcării moleculare caracteristice grupării NH3.

3. Metode RMN-S 2D de corelare 13C-13C
Metoda Proton Driven Spin-Diffusion Metoda RMN-S 2D numită Proton Driven Spin Diffusion (PDSD) este o metodă de corelare: după cum se observă din schema experimentală asociată acestui experiment (Fig. 8), pe durata ambelor perioade de evoluţie indirectă şi directă, t1 şi t2, magnetizarea transversală 13C evoluează în condiţii de decuplare heteronucleară prin TPPM aplicată pe canalul protonilor şi rotaţie a probei în jurul unghiului magic, astfel încât ambele dimensiuni spectrale în spectrul RMN 2D vor codifica preponderent informaţii cu privire la deplasările chimice izotrope ale carbonilor din sistemul molecular investigat (cu o lărgire reziduală determinată de imperfecţiunea metodei de decuplare). Pe durata perioadei de mixing, se generează o stare de polarizare longitudinală

Figura 8: Reprezentarea schematică a experimentului RMN 2D „Proton Driven Spin-Diffusion” (PDSD) de investigare a transferului de polarizare 13C-13C mediat de interacţiunea dipolară cu protonii

226

diferenţială, care va fi transferată între spinii 13C între care există cuplaje dipolare suficient de puternice. Din această cauză, în afară de peakurile diagonale, în spectrul RMN 2D obţinut prin metoda PDSD apar şi cross-peakuri de corelaţie între oricare două poziţii chimice distincte între care se stabileşte transfer de polarizare (spin diffusion), cu intensităţi care depind de distanţa la care se află nucleele 13C corespunzătoare.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/sp-diff" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 pl4:f1 1u do:f2 (p1 ph4):f1 d5 (p1 ph5):f1 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0 lo to 2 times td1 exit

; tau mix ;pl12 is used here with tppm, and p30 the pulse

ph3= 1 3 ph1= (4) 0 0 2 2 ph2= 0 ph4= 0 0 0 0 0 0 0 0 2 2 2 2 2 2 2 2 ph5= 1 1 1 1 3 3 3 3 ph31= 0 2 2 0 1 3 3 1

Transferul de polarizare 13C-13C în experimentul PDSD este iniţiat de interacţiunile dipolare homonucleare între spinii nucleari corespunzători, însă el se produce prin intermediul protonilor situaţi între aceşti carboni. Deoarece aceste cuplaje dipolare C-C sunt în general slabe, durata perioadei de mixing, d5 – în secvenţa de pulsuri ilustrată mai sus, trebuie să fie 227

relativ mare, între câteva sute de µs până la 10-100 ms, pentru a avea un transfer eficient în domeniul de distante 2-5 Å. Din această cauză, metoda este preponderent utilizată pe probe marcate uniform cu 13C: cu toate acestea, există şi câteva cazuri în care PDSD a fost demonstrat şi pe probe cu 13C în abundenţă naturală, însă în aceste cazuri este nevoie de durate de mixing de ordinul secundelor pentru a identifica cross-peakuri cu intensităţi măsurabile. Cu privire la implementarea practică a unui experiment RMN 2D, introduse prin acest exemplu, trebuie menţionate următoarele aspecte: (i) sintaxa ph1= (4) 0 0 2 2 utilizată în programul de pulsuri asociat secvenţei PDSD pentru faza pulsului de contact p15 pe canalul 13C specifică procedura numită TPPI (Time Proportional Phase Incrementation) aplicată pentru înregistarea semnalului în cuadratură pe dimensiunea indirectă – în practică înseamnă că la fiecare experiment nou în dimensiunea indirectă fazele vor fi incrementate cu 3600/4 = 900 faţă de experimentul anterior (adică dacă pentru primul FID din setul de date 2D se utilizează fazele 0 0 2 2 pentru pulsul p15, al doilea FID va avea fazele 1 1 3 3, şi aşa mai departe; (ii) pasul temporal în dimensiunea indirecta este denumit in0 (increment delay 0), iar durata totală de achiziţie indirectă este notată cu aq1, şi se calculează înmulţind incrementul in0 cu numărul de puncte al semnalului înregistrat în dimensiunea indirectă, respectiv td1.

Figura 9: Spectru 13C CP-MAS pe L-Tirozina HCl, şi o reprezentare schematica a atribuirii liniilor pentru cele 7 poziţii chimice distincte ale carbonilor din molecula

228

În final vom ilustra utilizarea metodei PDSD cu rezultatele experimentale obţinute în cazul particular al compusului L-Tirozina HCl, marcată uniform cu 13C. Mai întâi prezentăm în Fig. 9 spectrul 13C RMN-S 1D obţinut prin CP-MAS la o frecvenţă de rotaţie a probei de 10 kHz. Atribuirea liniilor spectrale corespunde indexării poziţiilor de carbon din reprezentarea schematică a moleculei de L-Tirozina inclusă în aceeaşi figură. Am ales acest caz particular pentru că ne permite comportaţii în cadrul unor domenii de distanţe internucleare 13C-13C scurte (1.5 Å – între carboni direct legaţi chimic), medii (3-4 Å, de exemplu între carbonii alifatici şi cei de pe inelul benzenic), şi respectiv lungi (4-5.5 Å, între C1 şi C7 sau C8). Posibilitatea de a estima astfel de distante C-C din spectre PDSD de corelaţie 13C-13C este ilustrată în continuare prin exemplele prezentate în Fig. 10. Primul corespunde unei durate de mixing scurte, de 300 µs, şi evidenţiază faptul că la această scală de timp transferul de polarizare este eficient doar pe distanţe scurte, între carbonii direct legaţi chimic. Utilitatea practică a unui asemenea spectru este evidentă, respectiv identificarea conectivităţilor chimice în cazul unui compus nou, şi pe această cale este un instrument extrem de util în procesul de atribuire spectrală.

Figura 10: Spectre RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina aplicând metoda PDSD; ele ilustrează dinamica procesului de transfer de polarizare la durate de mixing scurte (300 μs), şi respectiv lungi (5 ms)

Cel de-al doilea spectru PDSD ilustrat în Fig. 10 corespunde unei perioade de mixing mult mai mari, de 5 ms, şi este reprezentativ pentru situaţia în care transferul de polarizare se reduce pe distanţe mult mai mari, până la 5 Å, după cum se poate observa din prezenţa peakului de corelaţie C1-C7. Astfel de spectre sunt utile pentru a extrage constrângeri structurale utile pentru investigarea conformaţiei moleculare în sistemul investigat. 229

Metoda CHHC Metoda CHHC pe care o vom discuta în continuare permite determinarea distanţelor 1H-1H, cu rezoluţie înaltă datorită implementării în cadrul spectroscopiei RMN-S 2D de corelaţie 13C-13C. Metoda este demonstrată efectiv pe L-Tirozina·HCl sintetizată sub formă poli-cristalină şi marcată uniform cu 13C. L-Tirozina·HCl a fost aleasă drept sistem model deoarece spectrul 13C RMN-S 1D prezintă o rezoluţie suficient de bună pentru a putea separa liniile corespunzătoare tuturor grupărilor chimice din molecula (Fig. 9), iar structura sa cristalină este bine caracterizată. În Fig. 11 este ilustrată secvenţa de pulsuri asociată metodei CHHC. Experimentul începe cu prepararea unei stări iniţiale prin transfer de polarizare prin CP de la 1H la 13C. Polarizarea transversală astfel creată evoluează sub influenţa deplasărilor chimice izotrope al carbonilor pe durata perioadei de evoluţie indirectă, t1, în condiţii de decuplare heteronucleară prin TPPM pe canalul 1H. Polarizarea 13C care a evoluat cu deplasările chimice izotrope corespunzătoare fiecărei poziţii distincte din moleculă este apoi transferată prin intermediul unei perioade scurte (65 μs) de cross-polarizare (CP) a protonilor direct conectaţi chimic. Polarizarea transversală astfel obţinută este apoi adusă de-a lungul direcţiei z (este transformată în polarizare longitudinală) prin aplicarea unui puls π/2 asupra spinilor 1H. Deoarece polarizările 1H astfel obţinute nu au aceeaşi valoare la toţi protonii, pe durata perioadei de mixing, tmix, se va realiza o redistribuire a acestora prin intermediul aşa-numitului proces de schimb de magnetizare, şi se generează astfel cross-peakuri a căror intensitate este proporţională cu cantitatea de

Figura 11: Reprezentarea schematică a experimentului RMN 2D CHHC de investigare a transferului de polarizare 1H-1H codificat în spectre de corelaţie 2D 13C-13C

230

polarizare schimbată de protonii corelaţi. Deoarece schimbul de magnetizare se datorează interacţiunilor dipolare 1H-1H, intensitatea fiecărui cross-peak obţinut codifică informaţii cu privire la tăria cuplajului dipolar dintre protonii implicaţi si, implicit, cu privire la distanţele internucleare dintre aceştia. După parcurgerea etapei de mixing urmează transformarea polarizării longitudinale în polarizare 1H transversală (prin aplicarea a incă unui puls π/2 pe canalul 1H), iar aceasta apoi transferată către nucleele 13C direct conectaţi chimic (prin intermediul unei perioade scurte de CP, similară celei prin care s-a realizat transferul 13C->1H iniţial). În final, polarizarea transversală 13C este detectată sub formă de semnal RMN pe durata perioadei de evoluţie directă, t2. Detecţia semnalului se face de asemenea în condiţii de înaltă rezoluţie, adică se urmăreşte evoluţia polarizării transversale 13C sub acţiunea deplasărilor chimice izotrope asociate carbonilor din probă, în condiţii de decuplare heteronucleară prin TPPM.
# 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chhc" ;cp (TopSpin 2.0) ;13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f2 1u pl3:f2 p3:f2 ph8 d5 p3:f2 ph9 1u pl2:f2 (p16 ph7):f1 (p16 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu, 1m 1m if 1m in0

; tau mix

;pl12 is used here with tppm, and p30 the pulse

231

lo to 2 times td1 exit ph3= 0 0 2 2 1 1 3 3 ph1= (4) 1 ph2= 3 3 3 3 0 0 0 0 ph4= 3 1 ph5= 1 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph8= 0 ph9= 2 ph31= 3 1 3 1 0 2 0 2

Un spectru CHHC tipic este ilustrat în Fig. 12, unde este considerat cazul particular al spectrului 2D de corelaţie 13C-13C înregistrat la o valoare tmix de 50 μs, utilizând o fereastră spectrală care se limitează la carbonii protonaţi (indexaţi conform schemei din Fig. 9). Corelaţiile care se stabilesc între protonii asociaţi diferitelor poziţii de carbon din moleculă sunt identificate în spectrul CHHC prin apariţia cross-peakurilor care conectează poziţiile chimice corespunzătoare. Deoarece mecanismul de stabilire a corelaţiilor în spectre CHHC se bazează pe schimbul de magnetizare longitudinală 1H-1H determinat de interacţiunea dipolară, amplitudinea fiecărui cross-peak va fi o măsură a tăriei acestui cuplaj şi, implicit, a distanţei internucleare dintre protonii asociaţi poziţiilor de carbon corelate. Acest mecanism este exemplificat în Fig. 12 cu corelaţii ale carbonului A (a se vedea liniile punctate). În particular, se observă apariţia unui cross-peak intens între A şi carbonul C, însă este de remarcat de asemenea lipsa uni peak de corelaţie similar cu carbonul din poziţia B. Din punct de vedere calitativ, acest rezultat este în perfectă concordanţă cu distanţele intra-moleculare dintre protonii conectaţi chimic de aceştia, şi anume: 3.2 Å între protonii cei mai apropiaţi de carbonii A şi C, şi respectiv de 4.8 Å pentru ceilalţi doi protoni prezentaţi în exemplul din Fig. 12. O analiză cu caracter cantitativ relevantă pentru determinarea de distanţe 1H-1H cu ajutorul metodei CHHC trebuie însă să ia în considerare şi alte efecte care influenţează intensităţile cross-peakurilor din spectru: pentru aceasta am elaborat un model teoretic al dinamicii de spin în condiţii specifice experimentului CHHC [7]. Rezultatele modelării ne-au permis îmbunătăţirea procesului de analiză a datelor experimentale, prin introducerea de corecţii adecvate pentru o serie de procese perturbative, şi anume: (i) caracterul neselectiv al transferului de polarizare 1H<->13C pe durata blocurilor CP care “flanchează” perioada de transfer de magnetizate (tmix în Fig. 11), (ii) efectul protonilor care nu contribuie direct la semnalul RMN-S detectat (protonii care nu sunt legaţi chimic de carbon, şi respectiv protonii din molecule nemarcate izotopic cu 13C), şi 232

Figura 12: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcată uniform cu 13C aplicând metoda CHHC; spectrul a fost obţinut pentru o durată de mixing de 50 µs şi ilustrează modul în care dinamica procesului de transfer de polarizare 1H-1H (si implicit distanţa dintre protonii implicaţi) este codificată prin intensitatea cross-peakurilor corespunzătoare din spectrul de corelaţie 2D.

Figura 13: Curbe CHHC reprezentative pentru protoni cu contacte intermoleculare scurte (de exemplu protonul legat de C5 de pe inelul aromatic), şi respectiv lungi (protonii ataşaţi lui C2) în urma împachetării moleculelor de L-Tirozina în reţeaua cristalină (figura din dreapta)

233

0) 234 . şi respectiv C5 din molecula de L-Tirozină. 13). Figura 14: Reprezentarea schematică a experimentului RMN 2D CHCC de investigare a transferului de polarizare 1H-13C codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/chcc" . CH3). am proiectat şi implementat practic un nou tip de experiment de corelare 13C-13C. efectul multiplicităţii protonice pentru diferite grupări chimice din sistem (CH. În această figură ilustrăm comportamentul observat pentru transferul de polarizare în care sunt implicaţi protonii ataşaţi poziţiilor de carbon C2.cp (TopSpin 2. numit CHCC: acesta prezintă avantajul de a cuantifica pe ambele dimensiuni spectrale deplasări chimice ale nucleelor 13C. Metoda CHCC Având în vedere rezoluţia spectrală limitată a protonilor în experimente RMN-S 2D de tip HETCOR.(iii). Corecţiile introduse conduc la creşterea semnificativă a gradul de precizie cu care sunt estimate distanţele proton-proton din spectre RMN-S de tip CHHC. metoda CHCC se aplică în cazul compuşilor uniform marcaţi cu 13C. iar procesul care stă la baza experimentului CHCC este şi în acest caz transferul de polarizare proton-carbon. CH2. unde transferul de polarizare este utilizat pentru a codifica cuplajele dipolare 1H-1H. Informaţia codificată în acest tip de spectre se referă tot la cuplajele dipolare 1H-13C. În mod similar cu metoda CHHC. în particular prin intermediul aşa-numitelor curbe CHHC extrase dintr-un set de astfel de spectre înregistrate pentru diferite valori ale timpului de mixing (Fig. adică spectre de înaltă rezoluţie. care sunt utilizate în mod tradiţional pentru investigaţii structurale bazate pe determinarea de distante C-H.

cât şi în cea indirectă. Informaţii cu privire la eficienţa procesului de transfer de polarizare de la nuclee individuale 1H la toate nucleele 13C aflate în vecinătate sunt codificate în perioada de mixing.13C-13C spin diffusion experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u cpd2:f2 1u pl12:f2 d0 1u do:f2 1u pl2:f2 (p16 ph5):f1 (p16 ph4):f1 (p17 ph7):f1 (p17 ph6):f2 1u pl12:f1 go=2 ph31 cpd2:f2 1m do:f2 wr #0 HaltAcqu. Pe durata celui de-al doilea bloc CP din secvenţa de mixing transferul de polarizare 1H-13C se realizează în mod clasic. 14) constă în trei blocuri CP distincte. Pentru a obţine rezoluţie înaltă. dintre care ultimele două formează perioada de mixing a experimentului. 235 . astfel încât liniile de rezonanţă specifice fiecărei grupări chimice să fie separate. and p30 the pulse Secvenţa de pulsuri corespunzătoare metodei CHCC (Fig. astfel încât polarizarea fiecărui 13C este transferată în mod selectiv doar către protonul (protonii) direct legaţi. atât în dimensiunea directă.. polarizarea de spin va evolua în condiţii de decuplare heteronucleară prin TPPM. Primul bloc CP din perioada de mixing este unul de durată scurtă.pl12 is used here with tppm. 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 3 1 3 1 3 1 3 ph1= (4) 0 ph2= 0 ph4= 1 ph5= 0 ph6= 1 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 .

(ii) aplicarea unui bloc CP de durată scurtă. Deoarece selectivitatea metodei CHCC poate fi afectată de influenţa polarizării iniţiale a carbonului. 15.5 ms (a). şi respectiv 1 ms (b). conform programului de pulsuri asociat schemei experimentale din Figura 14. Sz. Ca şi în cazul celorlalte două metode de corelare prezentate mai sus. (iii) incrementând durata ultimului puls CP (tmix) polarizarea 1H Figura 15: Spectru RMN 2D de corelaţie 13C-13C obţinute pe L-Tirozina marcata uniform cu 13C aplicând metoda CHCC pentru valori ale ultimului puls de contact (p17) de 0.către toate nucleele de carbon aflate în vecinătate. Cross-peakurile CHCC sunt generate conform următoarei scheme: (i) primul pas este format dintr-un bloc CP standard. spectrele 1D de mai jos reprezintă felii de-a lungul dimensiunii directe ce corespund poziţiilor de carbon C2 şi C8. aleasă astfel încât polarizarea de spin să fie transferată de la nucleele de 13C doar la protonii direct legaţi. informaţiile extrase în urma aplicării schemei experimentale CHCC sunt codificate în spectre 2D de corelaţie 13C-13C. în funcţie de distanţele carbon-proton individuale. 236 . iar prin asterisk este marcat în fiecare caz evoluţia cross-peakului specificat. urmat de evoluţia pe durata t1 a polarizării 13C sub acţiunea interacţiunii de ecranare chimică şi în condiţii de decuplare heteronucleră prin TPPM. Fig. şi de polarizarea rămasă pe canalul carbonilor după pulsul CP scurt (din cauza că această polarizare nu se transferă în întregime protonilor direct legaţi) se impune ca asupra secvenţei CHCC să se aplice procedeul de ”phase cycling”.

5 ms.9 Å). situate în intervalul 2. aceasta este transformată în polarizare longitudinală care apoi este utilizată pe durata aplicării secvenţei INADEQUATE (Fig. C3-C5.6 b). Secvenţa de pulsuri asociată experimentului INADEQUATE este redată în Fig. cross-peakurile datorate corelaţiilor între spini aflaţi la distanţe mai mari sunt şi ele bine conturate. Totuşi.7 Å). spre exemplu C7-C5(C4) (pentru distanţa C7-H5(H4) de 2. Metode RMN-S 2D de corelare DQ (Double Quantum) – SQ (Single Quantum) Metoda INADEQUATE Metoda numită INADEQUATE (Incredible Natural Abundance Double Quantum Transfer Experiment) este o metodă RMN-S 2D de corelatie 13C-13C în cadrul căreia în perioada de preparare se generează coerente de două cuante (DQ – Double Quantum). 16. adică ω1 şi ω2. unde r este disţanta 1Hi . de la 2. Secvenţa INADEQUATE constă în două pulsuri de 900 separate de o evoluţie liberă pe durata perioadei de mixing. respectiv 1 ms sunt prezentate în Fig. aceste coerenţe evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor corelaţi.65 Å (H3-C8). şi C2-C7 (4. ω1+ω2. Eficienţa transferului de polarizare către nuclee 13C individuale este reflectată în intensitatea cross-peakurilor obţinute. 4. Spectrele bidimensionale CHCC ale L-Tyrozinei·HCl uniform marcate 13 cu C pentru timpi de mixing de 0. C3-C4 (3. 5. În dimensiunea indirectă. Experimentul generează polarizare transversală a spinilor 13C prin secvenţa CP-MAS: cu ajutorul pulsului de 900 aplicat după pulsul de contact pe canalul carbonului.5. la 5. C2-C4) corespund celor mai mici distanţe internucleare 1H-13C.13 Å (H7-C8). iar în dimensiunea directă ele dau naştere semnalelor izotrope corespunzătoare ambilor spini. iar la jumătatea acestei perioade se aplică un puls de 1800. fiind în bună concordanţă cu datele teoretice (Figura 5. respectiv 1 ms) spectrele codifică informaţii structurale despre contactele intramoleculare scurte. tmix.68 Å). cât şi celor aflate în vecinătate.13Cj.20 Å. utilizând cuplajul J dintre diferite poziţii chimice în molecula investigată. 16b) pentru a genera coerenţele DQ. Discuţia rezultatelor experimentale se va concentra doar pe distanţe intermoleculare proton-carbon mai mici de 6 Å. se mai aplică o dată secvenţa INADEQUATE care va reconverti coerenţele DQ care au evoluat pe durata lui t1 în coerenţe 237 .6(a). Acest lucru arată că pentru timpii de mixing aleşi (tmix = 0. pentru a refocaliza evoluţia cu deplasarea chimică 13C la sfârşitul procesului de generare a coerenţelor DQ. Distanţele intra-moleculare 1H-13C acoperă un interval larg de valori. respectiv (b).15 – 2. La o analiză atentă a spectrelor CHCC se poate observa că cross-peakurile cele mai intense (C7-C8.se transferă atât nucleelor 13C direct legate de protonii polarizaţi. rata de transfer fiind proporţională cu 1/r3. În prealabil.

de tip Single Quantum (SQ). în exemplul de spectru INADEQUATE prezentat în Fig. Figura 16: Reprezentarea schematică a experimentului RMN 2D INADEQUATE utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 13C-13. adică între nucleele C1 şi C3. cuplajul J are valori semnificative pentru a produce coerente DQ în general între poziţii direct conectate prin legături chimice: din aceasta cauză.13C-13C INADEQUATE experiment 1 ze 2 d1 do:f2 1u pl3:f2 (p3 ph3):f2 (1u pl1:f1) (1u pl2 f2) (p15 ph1):f1 (p15 ph2):f2 1u (pl12:f2) (pl4:f1) (p1 ph4):f1 1u cpd2:f2 (p1 ph5):f1 d5 (2p1 ph6):f1 d5 (p1 ph7):f1 238 .cp (TopSpin 2.0) . codificat în spectre de corelaţie 2D 13C-13C # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/inadequate" . 17 nu va apărea cross-peakul corespunzător coerentei ω1+ω3. În cazul nucleelor 13C.

ωi şi ωj.d0 (p1 ph8):f1 d5 (2p1 ph9):f1 d5 (p1 ph10):f1 1m do:f2 wr #0 HaltAcqu. 1m 1m if 1m in0 lo to 2 times td1 exit ph3= 1 1 1 1 3 3 3 3 ph1= 0 ph2= 0 ph4= 3 3 3 3 1 1 1 1 ph5= (8) 0 2 4 6 ph6= (8) 0 2 4 6 ph7= (8) 4 6 0 2 ph8= 1 ph9= 1 ph10= 3 ph31= 0 2 0 2 2 0 2 0 Figura 17: Exemplu ilustrativ de spectru RMN 2D INADEQUATE: peakurile de corelaţie între două poziţii chimice. corespund formării unei coerenţe DQ care evoluează în dimensiunea indirectă cu frecvenţa ωi + ωj şi indică conectivitatea chimică directă între carbonii corespunzători 239 .

această moleculă prezintă o structură cristalină puternic ordonată. spectrul 13C unidimensional conţine 58 de linii RMN (fiecărei poziţii individuale a unui nucleu 13C ii va aparţine o linie de rezonanţă dublată). metoda INADEQUATE este intens utilizată în investigaţiile structurale din chimia organică. care conţine două molecule în unitatea asimetrică. Figura 18: Spectrul RMN 2D de corelare corespunzător acetatului de colesteril în abundenţă naturală (2 molecule pe unitatea asimetrică) obţinut cu ajutorul secvenţei de pulsuri INADEQUATE 240 . majoritatea situate în regiunea spectrală 10 – 60 ppm.Datorită particularităţilor sale. în abundenţă naturală [8]. În urma analizei spectrului 2D INADEQUATE s-au determinat toate corelaţiile posibile între nucleele de carbon din moleculă. Datorită acestui fapt. 18 corespunde spectrului 13C INADEQUATE înregistrat pe acetatul de colesteril (C29H48O2). În stare solidă. Un exemplu relevant pentru acest tip de aplicaţii practice ilustrat în Fig. concluzionându-se asupra acurateţei metodei INADEQUATE în caracterizarea conectivităţilor chimice în sisteme moleculare complexe. în abundenţă naturală. în scopul stabilirii conectivităţilor chimice dintre diferitele grupări prezente în molecula investigată.

pentru excitarea coerenţelor ilizează secvenţa numita BABA2 241 . 19) este aceeaşi ca şi în cazul INADEQUATE. detectabile direct. BABA2. În prezentul raport vom considera aşa-numita secvenţă BABA (Back to Back) [9]. unde rezoluţia spectrală este asigurată prin rotaţia rapidă în jurul unghiului magic. în cazul metodelor 1H-1H DQ-MAS coerenţele de două cuante se generează interacţiunile dipolare homonucleare 1H-1H recuplate pe durata perioadei de excitare şi reconversie cu ajutorul unor secvenţe de pulsuri specifice. şi respectiv de a le reconverti la coerenţe SQ. schema generală a experimentului 1H-1H DQ-MAS (Fig.Metoda 1H-1H DQ-MAS Metodele bazate pe excitarea coerentelor DQ se pot aplica şi în cazul protonilor. condiţie necesară pentru a realiza o recuplare eficientă a interacţiunilor dipolare 1H-1H. care conţine două cicluri BABA cu fazele relative astfel proiectate încât să minimizeze efectul evoluţiei sub acţiunea deplasărilor chimice 1H pe Figura 19: Reprezentarea schematică a experimentului RMN 2D 1H-1H DQ-MAS utilizat pentru investigarea eficienţei procesului de generare a coerenţelor Double Quantum (DQ) 1H-1H . Drept urmare. şi respectiv o versiune perfecţionată a ei. singura deosebire fiind secvenţa de pulsuri aplicată pentru a genera coerenţe DQ. unele implicând acţiunea continuă a câmpurilor rf. iar altele aplicarea de pulsuri rf intense: toate au însă în comun sincronizarea duratei secvenţei de excitare DQ cu perioada de rotaţie a probei în jurul unghiului magic. codificat în spectre de corelaţie 2D 1H-1H. În practică. au fost dezvoltate numeroase metode de excitare DQ pentru protoni. Spre deosebire de experimentul INADEQUATE prezentat anterior.

19 sunt tmix = 2tBABA = 2τR # 1 "C:/Bruker/TOPSPIN/exp/stan/nmr/lists/pp/user/dq-baba" . Fiecare ciclu BABA conţine două perechi de pulsuri de 900 alipite între ele.durata perioadei de excitare/reconversie. astfel încât duratele implicate în Fig.0) . având o separare între ele egală cu o jumătate de perioadă de rotaţie.1H-1H DQ-MAS experiment 1 ze 2 d1 1u pl1:f1 (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph2):f1 d1 (p1 ph3):f1 1u (p1 ph1):f1 d1 (p1 ph1):f1 1u (p1 ph3):f1 d1 (p1 ph2):f1 d0 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph5):f1 d1 (p1 ph6):f1 1u (p1 ph4):f1 d1 (p1 ph4):f1 1u (p1 ph6):f1 d1 242 .cp (TopSpin 2.

ω2). NH3). ωi+ωj. Analizând spectrul se constată şi similarităţi cu un spectru tipic INADEQUATE. 243 . asemănările sunt legate de faptul că liniile de rezonanţă corespunzătoare spinilor 1H corelaţi. Eficienţa maximă s-a obţinut pentru o singură secvenţă BABA2. frecvenţa de evoluţie în dimensiunea DQ va fi de 2ωj. 20. datorită multiplicităţii protonilor dintr-o anumită grupare chimică. dar şi deosebiri. la o frecvenţă de rotaţie a probei în jurul unghiului magic de νR = 30 kHz. Concret. şi respectiv (CH.ω3) corespunzătoare coerenţelor DQ care se generează între protoni aparţinând grupărilor (CH3. în dimensiunea indirectă (DQ). dar şi din cauza tăriei mari a cuplajelor dipolare 1H-1H care permit evidenţierea corelaţiilor dintre protonii CH (ω2) aparţinând la două molecule vecine (corelaţii intermoleculare): în cazul peakurilor diagonale ωj. evoluează cu o frecvenţă egală cu suma deplasărilor chimice asociată spinilor. considerând cazul relativ simplu al spectrului de corelaţie 1H-1H înregistrat pe L-alanina (Fig.(p1 ph5):f1 go=2 ph31 wr #0 HaltAcqu. cum este cazul grupărilor CH3 (ω1) şi NH3 (ω3) în spectrul din Fig. 1m 1m if 1m in0 lo to 2 times td1 exit ph1= (4) 0 2 4 6 ph2= (4) 2 4 6 0 ph3= (4) 4 6 0 2 ph4= 0 ph5= 1 ph6= 3 ph7= 1 1 3 3 2 2 0 0 ph31= 1 3 3 1 2 0 0 2 Aplicaţiile practice ale metodei 1H-1H DQ-MAS vor fi ilustrate în continuare. Deosebirile sunt legate de faptul că în spectre 1H-1H DQ-MAS pot apărea şi peakuri diagonale. de exemplu ωi şi ωj în dimensiunea directă.ω3) şi (ω2. (ω1. NH3). 20). (CH3. CH). unde am utilizat secvenţa BABA2. În spectrul DQ-MAS al L-alaninei acesta este cazul pakurilor de corelaţie (ω1.

între protonii grupării CH3. peakului diagonal (2ω1. care formează o reţea compactă de spini. ω1) a cărui intensitate în unităţi arbitrare este de 20 u. ω2) şi (ω3+ ω2.3 Å între protonii grupării CH aparţinând la două molecule vecine din reţeaua cristalină a L-Alaninei.6 Å.3 Å. pentru coerenţele de două cuante generate între grupările CH-CH3. şi anume 19 u. De exemplu.a.. de ~1. obţinută pentru peakul diagonal (ω2. intensitatea de ~ 4 u. Prin comparaţie.a.5 u. reflectă o distanţă semnificativ mai mare de ~2. Informaţii mai cantitative cu privire la distanţele internucleare dintre protonii din probă se pot obţine din analiza spectrelor 1H-1H DQ-MAS comparând intensităţile relative ale peakurilor de corelaţie. Pentru cross-peakurile (ω1+ ω2. În primul caz.Figura 20: Spectrul RMN 2D de corelare 1H-1H DQ-MAS achiziţionat utilizând secvenţa BABA2 pe L-Alanina. care implică o distanţă intramoleculară de ~2. ω2).a în cazul grupărilor CH-NH3 cu distanţa intramoleculara de ~2. ω2). o analiză riguroasă a intensităţilor relative ale peakurilor din spectrul 2D 1H-1H DQ-MAS ne poate conduce la 244 .7 Å. În consecinţă. intensităţile sunt comparabile. corespunde unor distanţe intranucleare mici.a. şi respectiv de 18.

S. Griffin. 8. C. Reson A 109 (1994) 270-272. Reson. M. 5. A. SolidSate Nuclear Magnetic Resonance 35 (2009) 2-11 R.R.H. Tripon. M. Magn.. Emsley. Brown. Phys. Opella. J. Chem. Demco. Steuernagel. Bibliografie 1. G. J. Oxford University Press. M. Graf. X. Introduction to High-Resolution Solid-State NMR. ChemPhysChem 5 (2004) 869-875. Ladizhansky. Magn. 245 . Filip. Tripon. J. Oxford 1987 C. H. T. A 122 (1996) 214.G. C. Filip. G. Ernst. D.W.J. 9. J. Reson. 5. P. Ramamoorthy. Ramamoothy.K. 7. Aluas.. 183 (2006) 68. A. Griffin. Magn. A. S. 3. D. 199 (2009) 173. L. T. Lett. R. Narasimhaswami.cuantificarea tuturor proximităţilor proton-proton din proba investigată. Bodenhousen. J. S. Spiess. Magn. S. Aluas.M. 408 (2005) 118-122. X. V.. Filip. 2. Elsevier Science 2007 P. C.E. Lee. Madhu. De Paepe. R. C. Filip. 6. K. rezultând caracterul aplicativ al acestei metode în caracterizarea structurală a compuşilor moleculari în fază solidă. Principles of Nuclear Magnetic Resonance în One and Two Dimensions. Gullion. Reson. Wu. Feike. A. 4. Hafner. Wokaun. Lesage.

.. Spectroscopia de rezonanţă magnetică nucleară are loc în regiunea undelor radio şi este asociată cu tranziţiile energetice ale spinilor nucleari......................... prezentăm mai jos protocolul de lucru pentru aceste echipamente.spectrometrul Bruker Avance 600 cu câmp central de 14 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide Utilizarea acestor spectrometre de către studenţii Facultăţii de Fizică presupune o stăpânire temeinică a noţiunilor şi principiilor de bază din RMN............... Bibliografie .. vor răspunde acestor efecte.......... 1....Rezonanţa magnetică nucleară pe sisteme lichide Lect........................ O particularitate importantă asociată cu tehnica RMN este sensibilitatea sa la mediul chimic.....4 Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide .. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu .................................................... Prezentarea principiului tehnicii experimentale Rezonanţa magnetică nucleară este un fenomen ce apare atunci când nucleele de un anumit tip se găsesc într-un câmp magnetic static şi sunt expuse la un al doilea câmp magnetic....................... Prezentarea principiului tehnicii experimentale . oscilant.......................246 2........... cunoaşterea părţilor componente ale unui spectrometru.... precum şi înţelegerea modului în care acestea funcţionează şi a rolului fiecărei părţi.......265 În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca se află două spectrometre de rezonanţă magnetică nucleară (RMN) performante şi anume: ............. Mihai Vasilescu Cuprins 1.... În scopul facilitării activităţilor de practică experimentală pentru utilizarea acestor echipamente de ultimă generaţie........................... Deoarece legăturile chimice sunt asociate cu valenţa ionilor şi structura moleculară........253 3.............. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente ...... doar acele spectroscopii care au scala lungimilor apropiată frecvenţelor de rezonanţă caracteristice....... 246 ......spectrometrul Bruker Avance 400 cu câmp central de 9................. dr.264 4.....

Proprietăţi RMN ale unor nuclee într-un câmp de 9.Spectroscopia RMN dă date despre toate nucleele rezonante din sistem. Într-un spectru RMN pot fi înregistrate semnale de la un singur tip de nuclee. în experimentele de RMN.395 T: Izotop 1H 2H 13C 14N 15N 17O 31P 35Cl 37Cl 43Ca Frecvenţa RMN (MHz) 400 61 100 29 40 54 161 39 32 27 Abundenţa naturală (%) 99. Aceste diferenţe mari ale frecvenţelor de rezonanţă (unele exemple sunt date în Tabelul 1) fac posibilă observarea nucleelor diferitelor elemente relativ independent unele de altele. câmpul efectiv din zona nucleului este influenţat şi de câmpurile locale interne. care conţin informaţii specifice structurii locale. câmpul magnetic este în domeniul 2. ele vor fi multe de acest fel.037 100 75. simetria locală şi numerele de coordinare.37 0. Pentru proton aceasta corespunde unor frecvenţe de rezonanţă între 100-600MHz.98 0.108 99. Cele mai importante interacţii sunt interacţia de deplasare chimică pentru toate nucleele şi interacţia cuadrupolară pentru nucleele cu I>1/2. ca orice metodă spectroscopică. Toate nucleele cu moment magnetic sunt capabile să ofere informaţii detaliate despre ordinea locală.47 0. Pe lângă câmpul magnetic static. Spectroscopia RMN este o metodă foarte utilă pentru studiul structurii locale şi a dinamicii constituenţilor compuşilor. presupune reprezentarea grafică a unui bilanţ energetic. Valorile frecvenţelor cu care se lucrează în RMN fac însă folosirea lor foarte anevoioasă. alte posibile nuclee rezonante fiind excluse prin reglarea spectrometrului pe domeniul de frecvenţe de interes. De obicei.53 24.3-14 T. precum şi despre procesele dinamice. tipic. despre atomii învecinaţi (din prima şi a doua sferă de coordinare).63 0.145 Rezonanţa magnetică nucleară. Domeniul corespunzător pentru C13 este 25-150MHz.015 1. Astfel se pot obţine date despre unghiurile dintre legături şi lungimea legăturilor. Tabel 1. în diverse medii chimice. Pentru 247 .

Îngustimea extraordinară a liniilor RMN este cea care face ca efectele deplasărilor chimice mici să fie măsurabile şi utile. A doua abordare demonstrează chiar mai clar distincţia dintre rezonanţa magnetică nucleară şi alte spectroscopii şi exemplifică folosirea descrierii clasice a câmpului de radiaţie. Deplasările chimice întâlnite în RMN sunt. Prima este similară ca şi concepţie cu alte forme dispersive de spectroscopii şi implică o analiză (“sweep”) spectrală în care fiecare condiţie de rezonanţă posibilă (echivalentă absorbţiei) este căutată secvenţial. acesta va fi un sistem de bobine acordate. Pentru a observa semnalele pot fi urmate două strategii. şi modificând câmpul magnetic principal. Baza experimentului de rezonanţă magnetică este plasarea probei într-un câmp magnetic uniform intens şi asigurarea iradierii ei cu un câmp electromagnetic printr-un sistem potrivit de emisie şi recepţie a frecvenţelor radio sau de microunde. o scală a deplasărilor chimice date de formula: δ = ν −ν 0 ν0 Unitatea de măsură pentru deplasările chimice este "partea per milion" sau "ppm". De obicei. dar a devenit rară în spectroscopia RMN. Pentru a urmări experimentul este necesar să folosim un sistem de coordonate care se roteşte cu frecvenţa Larmor ω0. ci prin iradierea cu un câmp electromagnetic slab. de frecvenţă fixată. substanţe de referinţă. Ulterior s-a recurs la un artificiu. Îngustimea liniilor în cazul lichidelor se datorează mişcării moleculare rapide [1]. Această abordare este adesea utilizată în RES. ea fiind rezultatul energiei foarte joase implicate în experimentele RMN. În aceste 248 . pentru rezonanţa magnetică nucleară. De obicei. a căror frecvenţă de rezonanţă să fie considerată nivelul zero al scalei energetice. Această abordare este mai uşoară din punct de vedere tehnic şi are la bază ecuaţia: ω0 = -γB0 echivalentă cu parcurgerea frecvenţelor. aceasta nu se face prin parcurgerea domeniului de frecvenţe. de obicei.simplificare s-a ales ca primă soluţie folosirea unor etaloane. de ordinul zecilor sau sutelor de ppm. Acesta este cunoscut ca sistemul rotativ (“the rotating frame”). acum reprezentându-se în loc de scală energetică propriu-zisă.

o situaţie de non-echilibru. În sistemul rotativ. Revenirea la echilibru este caracterizată de un timp. Dacă radiaţia electromagnetică este de aceeaşi frecvenţă cu frecvenţa Larmor. Când aplicăm B1 magnetizarea răspunde precesând în jurul lui B1 cu o frecvenţă ω1 dată de: ω1 = . T1. în loc să aplicăm un puls de 180. aplicăm un puls cu durata jumătate. Figura 1(b) ilustrează acest proces pentru un unghi de 1800. în mod clar. În această situaţie fiecare vector nuclear individual (vectori care sunt însumaţi pentru a da magnetizarea macroscopică) 249 . Figura 1. Dacă. După un “puls de 180” sensul magnetizării se inversează complet. Situaţia este ilustrată în figura 1(a) [2]. Aceasta corespunde unei inversii a populaţiei nivelelor energetice şi este. (c) Magnetizarea după un puls de 900. (b) Magnetizarea după un puls de 1800. atunci magnetizarea se roteşte cu 90 de grade în planul x’y’.γ B1 t aşa că magnetizarea poate fi înclinată la orice unghi doar prin simpla aplicare a unui puls electromagnetic de putere şi durată cunoscute.γ B1 Unghiul la care se mişcă magnetizarea este θ. dat de: θ = ω1 t = . cunoscut ca plan transversal (fig 1c). (a) Magnetizarea (M0) în sistemul rotativ în prezenta câmpului de radiofrecvenţa (B1). B0 poate fi ignorat şi este necesar doar să considerăm efectele câmpului de radiaţie. B1. cunoscut ca timp de relaxare spin-reţea sau timp de relaxare longitudinală. atunci va părea statică în sistemul de coordonate astfel ales.condiţii magnetizarea nucleară poate fi descrisă de un vector paralel cu direcţia z. Radiaţia electromagnetică este descrisă de componenta sa magnetică ca un vector la un anumit unghi faţă de direcţia câmpului. care este direcţia câmpului magnetic principal.

(a). vom avea tot atâtea nuclee ce se mişcă mai rapid ca şi numărul celor ce se mişcă mai lent. Imediat după ce aplicarea pulsului încetează. Pentru o descreştere exponenţiala spre echilibru. Acest proces este ilustrat în figura 3. Există o relaţie importantă între relaxarea transversală şi lărgimea liniei. Acolo unde avem un număr de rezonanţe deplasate se obţine un semnal oscilator complicat al relaxării. (c) şi (d) arată evoluţia în timp după un puls de 900. În lichide. Relaxarea transversală – fiecare săgeată reprezintă un vector magnetizare nucleară. Acest proces. dependente de timp. Pe măsura trecerii timpului suma vectorilor se va reduce la zero. care vor face ca vectorii nucleari individuali să se mişte cu viteze diferite faţă de viteza sistemului rotativ. ν½ . atunci setul de spini nucleari. vor produce variaţii aleatoare ale frecvenţei Larmor. FID) şi poate fi transformat într-un spectru printr-un proces matematic cunoscut sub numele de transformare Fourier. oscilează cu o frecvenţa egală cu diferenţa dintre frecvenţa de referinţă şi frecvenţa de rezonanţă a semnalelor deplasate. Figura 2. această relaxare poate fi adesea caracterizată ca un proces exponenţial cu constanta de timp T2. (b). numit relaxare spin-spin sau transversală. Efectele de câmp aleatoare. T2 este legat de lărgimea liniei la jumătatea înălţimii peak-ului. corespunzând liniilor deplasate. prin: 250 . Cum aceste câmpuri sunt aleatoare. este ilustrat în figura 2.este forţat de câmpul de radiaţie să se rotească coerent cu frecvenţa Larmor ω0. numit timp de relaxare spin-spin sau timp de relaxare transversală. Când apar deplasarea chimică (“chemical shift”) sau rezonanţele cuplate scalar. Semnalul obţinut prin relaxare se referă de obicei la relaxarea liberă a magnetizării (free induction decay. sistemul începe să se relaxeze.

Principiul unei astfel de metode este ca. este un exemplu de metodă multiplex. respectând condiţia ca pulsul excitaţiei să acopere o lărgime de bandă potrivită. toate frecvenţele sunt excitate în mod 251 . care este acum metoda aleasă în cele mai multe experimente RMN. intensitate (a) timp (b) frecventa Figura 3.ν½ = 1/(πT2) de aceea. din cauza lărgimii liniei deplasarea chimică sau informaţiile privind cuplajul sunt obscure sau chiar pierdute. cu cât relaxarea se produce mai rapid. În multe cazuri. Transformarea Fourier a unui FID (a) într-un spectru (b) Tehnica transformării Fourier. cu atât linia observată este mai largă.

În cazuri ideale. Ca rezultat al acestei metode. cu linii foarte înguste. deoarece semnalele mici. un semnal foarte intens în anumite părţi ale spectrului va creşte intensitatea tuturor punctelor din FID. pot apărea probleme cu digitizarea semnalului. în metoda undelor continue (continous wave. A doua problemă este direct legată de avantajul multiplexului. atunci liniile spectrale sunt foarte largi şi digitizarea devine o problemă. Ca o consecinţă. În RMN pot apare dificultăţi cu semnalele solidelor. Prima este durata FID-ului. atunci când se fac analize pe alimente. Deoarece N este de obicei mii sau zeci de mii. Aceasta poate fi o problemă importantă în spectrele RMN pentru protoni. de exemplu. atunci contribuţia semnalelor mici poate fi pierdută cu totul. În cazul RES. Dacă nu avem o rezoluţie suficientă în convertorul analog – digital. avantajul semnal/zgomot al metodei transformatei Fourier asupra metodei CW pentru acelaşi timp de achiziţie este N unde N este numărul de frecvenţe. Figura 4. Dacă aceasta este foarte scurtă. unde apa este adesea componentul majoritar şi poate domina spectrul. Cum toate frecvenţele contribuie la fiecare punct. aceasta limitează metoda transformatei Fourier la doar un grup restrâns de sisteme. Dimpotrivă. vor avea doar o mică contribuţie la FID. Metoda transformatei Fourier nu este însă lipsită de probleme. În aceste condiţii s-ar putea să fie avantajoasă folosirea metodei CW cuplată cu tehnici de scanare rapidă. CW tinde să fie mult mai lentă decât metoda transformatei Fourier. iar partea iniţială a semnalului este distorsionată de revenirea sistemului de recepţie după pulsul de radiaţie.egal şi toate contribuie la toate punctele din FID. de interes. acest avantaj este foarte consistent. Vedere generala asupra spectrometrului 252 . CW) frecvenţele sunt excitate secvenţial.

anume a izotopilor 1H şi 13C.2 K) • straturi termoizolante şi ecranante • azot lichid (T = 77. Secţiune schematică printr-un magnet RMN 2. 253 . bobina. bobine helmholtz • heliu lichid (T = 4. Dizolvarea probelor se face în solvenţi deuteraţi.Magnetul • cea mai scumpă parte a spectrometrului • electromagnet din fire supraconductoare • câţiva km de fir • solenoid. spectrometrul realizând fixarea câmpului cu ajutorul nucleelor de deuteriu. Analizele se fac utilizând recipienţi speciali pentru analize RMN. eprubete de quartz de 5 mm diametru. Interpretarea acestor spectre ne permite identificarea structurii probelor analizate. Prezentarea informaţiilor care se pot obţine pe diferite sisteme de studiu Cel mai adesea analizele probelor lichide se concentrează pe studiul spectrului RMN corespunzător nucleelor de hidrogen sau carbon.4 K) • straturi termoizolante şi ecranante • orificiu central vertical (îngust sau larg) Figura 5.

respectiv triplet la 77. Proba: ciclohexan (C6H12) .78 ppm pentru 1H.512 ppm pentru 1H.26 ppm pentru 1H. respectiv 30 ppm şi 206 ppm pentru 13C. Redăm mai jos şi câteva exemple de analize 1H NMR pe probe relativ simple [3]: Figura 6. Solvent: CDCl3 Figura 7. • TMS (tetrametilsilandeuterat) are frecvenţa de rezonanţă de 0 ppm pentru 1H. • C6D6 (benzen deuterat) are frecvenţa de rezonanţă de 7.47 ppm pentru 13C. Astfel: • CDCl3 (cloroform deuterat) are frecvenţa de rezonanţă de 7.156 ppm pentru 1H. • C3D6O (acetona deuterata) are frecvenţa de rezonanţă de 2.În acelaşi timp.01 ppm pentru 13C. Proba: benzen (C6H6).16 ppm pentru 1H. respectiv 128. Solvent: CDCl3 254 . • D2O (apa deuterată) are frecvenţa de rezonanţă de 4. respectiv 39. solvenţii au şi rol de referinţă. respectiv 0 ppm pentru 13C şi 0 ppm pentru 29Si. • DMSO (dimetilsulfoxid deuterat) are frecvenţa de rezonanţă de 2.032 ppm pentru 13C.

Figura 8. Proba: toluen (C6H5CH3). Proba: acetona (CH3(C=O)CH3) . Proba: etil benzen (C6H5CH2CH3). Solvent: CDCl3 Figura 9. Solvent: CDCl3 Figura 10. Solvent: CDCl3 255 .

Proba: metil etil cetona (CH3(C=O)CH2CH3). Proba: etanol (CH3CH2OH) . Solvent: CDCl3 256 . Solvent: CDCl3 Figura 12. Proba: apa (H2O) . Solvent: D2O Figura 13.Figura 11.

Figura 14. Proba: 2-propanol ((CH3 )2CHOH). Solvent: CDCl3 Figura 16. Solvent: CDCl3 257 . Solvent: D2O Figura 15. Proba: etanol (CH3CH2OH). Proba: 1-propanol (CH3CH2CH2OH).

Solvent: CDCl3 258 . Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Solvent: CDCl3 Figura 18.Figura 17. Proba: piridina (C5H5N). Solvent: CDCl3 Figura 19. Proba: t-butanol ((CH3 )3COH).

De asemenea. Solvent: CDCl3 Raportul relativ al celor trei integrale este 2:3:3. în timp ce protonii grupării legate de CH2 dau semnal despicat (n+1). corespunzător numărului de protoni legaţi de fiecare dintre nucleele de carbon. Redăm mai jos şi câteva exemple de analize 13C NMR pe probe relativ simple: 259 . Informaţii suplimentare se obţin dacă calculăm integralele liniilor de rezonanţă. identificarea corespondenţei celor trei semnale de rezonanţă este completă. senzitivitatea este îmbunătăţită de creşterea câmpului magnetic utilizat [5]. Astfel. Analizele de tip 13C NMR vor utiliza diferite metode ce conduc la îmbunătăţirea semnalului RMN.Pentru aceste exemple identificarea corespondenţei între semnalele de rezonanţă şi poziţia protonilor în moleculă se face relativ simplu. Pentru a identifica semnalele celor doua grupări CH3 vom ţine cont de faptul că protonii grupării legate de C=O dau semnal simplu (singlet). proporţionale cu numărul de nuclee care produc semnalele respective. acestea reprezentând de fapt intensitatea relativă a semnalelor şi fiind. diferenţa de populaţie poate fi crescută prin scăderea temperaturii probei. aşa cum se vede în figura 20: Figura 20. în general. Integrarea semnalelor pentru proba: metil etil cetona (CH3(C=O)CH2CH3). Senzitivitatea spectrometrului RMN este o măsură a numărului minim de spini detectabili. Cum semnalul RMN creşte odată cu creşterea diferenţei de populaţie dintre nivelele energetice. deci triplet.

Proba: benzen (C6H6). Proba: ciclohexan (C6H12) . Solvent: CDCl3 260 . Solvent: CDCl3 Figura 23. Solvent: CDCl3 Figura 22. Proba: toluen (C6H5CH3).Figura 21.

Solvent: CDCl3 261 . Proba: etil benzen (C6H5CH2CH3). Proba: metil etil cetona (CH3(C=O)CH2CH3). Solvent: CDCl3 Figura 25. Proba: acetona (CH3(C=O)CH3) .Figura 24. Solvent: CDCl3 Fiurag 26.

Solvent: D2O Figura 29. Proba: 1-propanol (CH3CH2CH2OH). Proba: etanol (CH3CH2OH). Solvent: CDCl3 Figura 28. Proba: etanol (CH3CH2OH) .Figura 27. Solvent: CDCl3 262 .

Proba: 2-propanol ((CH3 )2CHOH). Solvent: CDCl3 Figura 32.Figura 30. Solvent: CDCl3 Figura 31. Proba: 2-butanol (CH3CH2CH(OH)CH3 ). Solvent: CDCl3 263 . Proba: t-butanol ((CH3 )3COH).

• se pune eprubeta în suportul special: • se aşează eprubeta cu suportul în dispozitivul special de reglaj al distanţei şi se aşează eprubeta astfel încât ulterior proba să fie în centrul câmpului magnetic. • se pune solventul în eprubetă. curată • se pune proba în eprubetă (circa 0. acolo unde s-a utilizat ca solvent CDCl3. Proba: piridina (C5H5N). peste probă. 3.01 ppm. semnal foarte util şi pentru a calibra spectrul în funcţie de referinţă.Figura 33. utilizabil pentru analiza probelor lichide.4 grame proba). Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente În dotarea Facultăţii de Fizică a Universităţii Babeş-Bolyai din Cluj-Napoca.1-0. Solvent: CDCl3 În toate spectrele de mai sus.4Tesla şi posibilităţi de analiză atât a probelor lichide cât şi a celor solide. până când coloana de lichid are aproximativ 4 cm înălţime (circa 0.5 ml solvent). la nevoie se încălzeşte uşor eprubeta pentru a facilita dizolvarea. specială pentru analize RMN. se află spectrometrul de rezonanţă magnetică nucleară (RMN) Bruker Avance 400 cu câmp central de 9. se observă şi semnalul corespunzător solventului la 77. 264 . • se dă comanda „lift on” de la BSMS pentru a crea perna de aer pentru eprubeta. • se agită pentru dizolvarea probei. Etapele înregistrării spectrului RMN pe probe lichide la spectrometrul Bruker Avance 400 din dotarea laboratorului: • se ia o eprubeta de 5 mm diametru.

1-18. Introduction to Magnetic Resonance.S. • se dă comanda „wobb” şi din şuruburile speciale ale capului de sondă se reglează frecvenţa de rezonanţă pentru nucleul studiat. (1994). Vol. • se realizează reglajele de „shimm” făcând corecţiile necesare de la BSMS. R. modificând în principal câmpurile Z1 şi Z2.D. 3. P. 2007 Carrington. p.rit. Anterior înregistrării unui spectru este posibil ca parametrii de achiziţie să necesite o optimizare. • se calibrează spectrul în funcţie de referinţa aleasă. McLachlan. Annual Reports on NMR Spectroscopy. Z4. se dă comanda „lift off” şi proba coboară în magnet. 30. p. • se analizează spectrul. se dă comanda „lock” şi se alege solventul potrivit. 31. 5. Joseph P. Belton. Bibliografie 1. funcţie de structura moleculară. (1995). Chapman and Hall. spectrometrul va intra în modul „lock”. Vol. la nevoie se modifică şi Z3. • se alege programul de pulsuri dorit şi nucleul pe care se doreşte realizarea analizei RMN. 4. se centrează semnalul de „lock” în fereastra de control a BSMS-ului. • se setează parametrii de achiziţie. Aceasta se realizează cu comanda „popt” şi se referă în general la setarea duratei pulsului de excitare (p1) şi respectiv a timpului de relaxare dintre două achiziţii consecutive (d1). măsurând integrala lor şi atribuind în final semnalele nucleelor. • se fazează corespunzător. Academic Press. X sau Y. A. http://www.edu/htbooks/nmr/ Mihai Vasilescu. NMR Basic Principles and Progress. • se dă comanda „efp” pentru a trece din semnal timp (FID) în semnal frecvenţa (spectru). • se realizează măsurătoarea efectivă alegând un număr de achiziţii potrivit pentru obţinerea unui raport semnal/zgomot suficient de bun. Teza de doctorat. marcând peak-urile de rezonanţă. Blumich. Hornak. făcându-se automat corecţiile variaţiilor externe. 2.cis. Grimmer and B. 1-60. • • • • 4. deci câmpul va fi fixat şi stabilizat. London (1967) 265 .se aşează eprubeta pe perna de aer.

VII. tratamente izoterme. cristalizare. • coroziunea metalelor în diferite atmosfere. • capacităţi calorice.C. în funcţie de temperatură sau timp pe baza efectelor termice care însoţesc transformările din probă în timpul supunerii acesteia la procese de încălzire. • puritatea şi compatibilitatea materialelor. • temperaturile caracteristice ale transformărilor de fază. Termenul de “metoda diferenţială” provine de la fap266 . călduri specifice. • căldurile de topire. Analiză calorimetrică diferenţială Conf. descompunerea. sublimare.. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. MĂSURĂTORI TERMICE Analiză termică diferenţială. Fenomenele fizice şi chimice. hidratarea – dehidratarea etc. dr. Raluca Ciceo-Lucăcel Analiza termică a materialelor acoperă o categorie largă de metode prin care sunt determinate proprietăţile fizice şi chimice ale acestora. reducerea. cristalizare. • oxidarea. răcire. Metodele de analiză termică diferenţială reprezintă varianta modernă a metodelor clasice de investigare a efectelor termice induse de variaţia temperaturii unui corp fiind pentru prima dată folosite de către W.Robert Austin în anul 1899.. de reacţie etc. • tranziţii vitroase ale solidelor ne-cristaline. etc. • cinetica reacţiilor şi a formării fazelor. • re-cristalizarea sticlelor metalice etc.. de-vitrificare etc. fierbere.

[2] Figura. Suportul pentru probe conţinând termocuplurile şi containerele pentru probe plasate într-un bloc ceramic sau metalic. Analiza termică diferenţială (DTA) este suficient de sensibilă pentru a determina variaţii foarte mici de temperatură şi este capabilă să sesizeze transformările lente ce se produc în intervale largi de temperatură. 1) sunt: 1. 267 . De aceea. [1] Concret.tul că aceste tehnici permit determinarea diferenţelor dintre variaţiile unor mărimi fizice ale probei în raport cu cele ale unui etalon. iar panta curbei în orice punct va depinde de microstructura probei la temperatura respectivă. concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă. metoda constă în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic. DTA poate fi folosită si pentru a studia proprietăţile termice şi transformările de faze care nu se produc cu modificarea entalpiei materialului. Linia de bază a unei înregistrări DTA prezintă astfel discontinuităţi la temperaturile de tranziţie. 2. 3. Suprafaţa de sub aria curbei este proporţională cu modificarea entalpiei şi nu depinde de capacitatea calorică a probei. Cuptorul. Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme. Programatorul de temperatură. 1. Principalele componente ale unui sistem termic diferenţial Principalele componente ale unui sistem termic diferenţial (Fig.

2 Schema idealizată a unei curbe DTA Calorimetria dinamică diferenţială (DSC) este o tehnică în care diferenţa de energie dintre o substanţă (şi/sau produşii de reacţie) şi un material de referinţă este măsurată ca funcţie de temperatură (sau timp) în timp ce substanţa şi materialul de referinţă sunt supuse unui program de temperatură controlat . Calorimetrele cu baleiaj diferenţial sunt tehnici îmbunătăţite ale DTA (analiza termică diferenţială) în sensul că ele au fost calibrate pentru măsurători de energie calorică. Efectul termic care se produce în cazul unei tranziţii termice sau a unui proces fizico-chimic este înregistrat ca diferenţă de flux caloric între probă şi referinţă şi la rândul lui este tradus în semnal electronic. eliminarea volatilelor şi asigurarea unui transfer termic cât mai bun). Orice proces endoterm sau exoterm (cum ar fi topirea sau cristalizarea) care are loc în probă la încălzire este înregistrat ca un peak în direcţia negativă. nu de temperatură. în scopul menţinerii unei atmosfere inerte în cuptor (pentru inhibarea oxidării probei. pe care este reprezentată diferenţa de temperatură (semnalul DTA) (Fig. Termenul calorimetrie se referă exclusiv la măsurarea căldurii. Căldura poate fi o cantitate de energie schimbată sub forma unui flux de căldură între două corpuri într-un interval de timp. Figura. amplificat şi 268 . 5. Sistemul de furnizare a gazelor. Sistemul de înregistrare. 2). respectiv pozitivă a axei X.4.conform IUPAC (International Union of Pure and Applied Chemistry).

269 . Semnalul măsurat redat în termograma DSC este direct proporţional cu capacitatea calorică a probei. Schematic este prezentată o termogramă DSC în care linia de bază prezintă multiple modificări datorate proceselor şi tranziţiilor termice din probă (fig. Figura. Sistemul „heat flux” DSC înregistrează diferenţa de temperatură între probă şi referinţă care apare în cursul unei transformări fizico-chimice. Înregistrarea se redă sub forma unei curbe numită termogramă DSC care reprezintă o dependenţă a fluxului caloric măsurat funcţie de temperatură (analiză în regim dinamic) sau timp (analiză în regim izotermal). fluxul diferenţial de căldură de la cuptor spre probă şi referinţă este măsurat pe căi complet diferite. 3 Tipuri de procese care pot apărea într-o înregistrare DSC Există două tipuri de tehnici DSC utilizate în analizele termice: • calorimetre DSC cu flux de căldură („heat flux” DSC). Faţă de această linie se vor măsura intensitatea şi temperatura la care se manifestă procesele termice din probă. iar „power compensated” DSC transformă această diferenţă de temperatură în puterea calorică necesară restabilirii echilibrului termic dintre probă şi referinţă. drept pentru care linia serveşte ca şi referinţă şi este numită linie de bază. 3). Deşi în ambele tipuri semnalul măsurat reprezintă diferenţa de temperatură generată de senzori. astfel că orice diferenţă ce apare în capacitatea calorică a probei conduce la modificarea termogramei DSC. • calorimetre DSC cu compensarea puterii calorice („power compensated” DSC). În continuare vom prezenta pe scurt câteva detalii pentru fiecare tehnică in parte. atunci semnalul DSC va arăta ca o linie dreaptă.apoi prelucrat de componenta software a instrumentului. Dacă proba de analizat nu suferă o transformare fizico-chimică sau o tranziţie termică.

Căldura transportată la probă şi referinţă printr-un platan din argint sau constantan. 4. prin diferenţa de putere electrică introdusă în rezistenţele de încălzire aşezate în imediata vecinătate a probei şi etalonului.Heat flux DSC – măsoară diferenţa de temperatură dintre probă şi etalon. iar în grafic apare o deviere de la linia de bază sub forma unor peak uri endoterme sau exoterme. Semnalul măsurat este folosit ulterior la măsurarea diferenţei de flux de căldură. diferenţa de temperatură este zero. care este convertită în flux de căldură printr-o construcţie specială (Fig. Figura. se modifică gradientul de temperatură al probei faţă de etalon. este controlată în timp ce se înregistrează diferenţa de temperatură dintre cele două. 5) – măsoară diferenţa de flux termic proba-etalon indirect. în funcţie de tipul procesului. Schema de principiu a metodei heat flux DSC Power compensated DSC (Fig. Dacă în probă au loc transformări de fază sau alte procese care se produc la o anumită temperatură. 270 . Dacă în cuptor fluxul de căldură este echilibrat. iar graficul înregistrează aşa-numita linie de bază în funcţie de timp sau temperatură. pentru a menţine diferenţa de temperatură zero. care este şi parte integrantă a sistemului de înregistrare a temperaturii. Proba şi referinţa sunt menţinute la aceeaşi temperatură printr-un sistem electric format din două rezistenţe de încălzire. 4).

5. Materialele ceramice utilizate la confecţionarea locaşurilor sunt 271 .sau endoterm). La viteze de încălzire mai mari efectele termice sunt evidenţiate mai bine. Metalele cele mai frecvente utilizate le temperaturi înalte sunt nichelul.Figura. Schema de principiu a metodei power compensated DSC Dacă în probă are loc un proces (exo. Principalii astfel de factori de influenţă sunt [3]: 1. 2. dar peak-urile înregistrate sunt mai largi. există o serie de factori care influenţează în mod direct efectele termice analizate şi implicit forma termogramelor. Semnalul electric dat de diferenţa de putere dintre cele 2 rezistenţe este proporţional cu diferenţa de flux termic şi este înregistrat sub forma curbei de analiză termică. cu peak-uri mai înguste. Influenţa vitezei de încălzire asupra curbelor se explică prin aceea că odată cu creşterea ei creşte şi cantitatea de produşi sub formă de gaz care generează o diferenţă de temperatură mai mare între probă şi cuptor. Din punct de vedere experimental. metalele nobile şi seminobile. Rolul formei şi al materialului din care este format locaşul pentru probe Materialele folosite la construcţia locaşelor sunt de două categorii: metalice sau ceramice. pentru ca temperatura probei să nu difere de cea a referinţei se cuplează sau decuplează rezistenţa de încălzire a acesteia până la egalizarea temperaturilor. La o viteză mai mică efectele termice au loc la temperatură mai joasă. însă pot apărea suprapuneri de peak-uri. Viteza de creştere sau descreştere a temperaturii în cuptor: viteza de încălzire afectează înălţimea şi lăţimea efectelor termice înregistrate de curbele DTA şi DTG. oţelul inoxidabil la temperaturi înalte.

Cum ar fi. grafitul. Locaşurile metalice. din cauză că transferul de căldură are loc încet prin pereţii lor.2 şi 1g. cu probele descoperite. pentru aceeaşi cantitate de material reactant ca şi în cazul celor metalice. pe de altă parte. care sunt mai frecvent utilizate. în cazul când în probă se află un compus care se topeşte. Locaşurile ceramice. de multe ori. fapt ce denaturează foarte mult forma curbelor termice. Densitatea sau gradul de tasare a probei în locaş: diferenţele în densitatea sau gradul de tasare a probei în locaş sunt cauzele cele mai obişnuite ale devierilor de la linia de bază a curbei DTA. fără ca această variaţie să aibă prea mare influenţă asupra rezultatelor. iar suprafeţele efectelor termice sunt mai mici (cu excepţia oxidărilor). Cantitatea de probă ce trebuie luată în lucru este de 272 . nu sunt poroase şi dau mici deviaţii ale fluxului de căldură.alumină cu adaus de silice. 4. Această precauţie de a se lucra cu proba descoperită se ia pentru a nu influenţa admisia şi emisia gazelor şi a vaporilor de apă care însoţesc reacţiile termice şi care dacă ar fi într-un sistem închis ar duce la suprimarea unor reacţii. au avantajul că pot fi mult mai uşor de confecţionat. Dar dezavantajul lor este că intensitatea efectelor termice tinde să fie mică. ele pot influenţa forma efectelor termice sau să se impurifice. pe cât posibil. deci ale liniei de bază a curbei DTA. sticle rezistente la temperatură şi. s-au impus două tendinţe: utilizarea locaşurilor în formă de blocuri şi utilizarea locaşurilor în formă de creuzet. argilă arse. Rolul acoperirii sau descoperirii probei Acoperirea probei poate să ajute. Dar au şi acestea dezavantajele lor . Cantitatea de probă luată în lucru: greutatea probei luată în lucru poate să varieze între 0. 3. dau efecte termice cu intensităţi mari. în timpul procesului termic. Un alt dezavantaj este acela că datorită structurilor poroase. Influenţa gradului de mojarare a probei: cu cât granulaţia probei este mai mică cu atât temperaturile de descompunere sunt mai joase. 5. din cauză că transferul de căldură care are loc se face rapid prin pereţii lor şi între aceşti pereţi şi masa probei. la obţinerea unei linii de bază a curbei DTA sub forma unei linii drepte sau prin acoperirea probei se protejează unele reacţii violente ca de exemplu: fierberile sau descompunerile în urma cărora ar ieşi o cantitate de probă afară din locaş. În ceea se priveşte forma locaşelor pentru probe. 6. Cu toate acestea este bine să se lucreze. în anumite cazuri. aşezarea lor în cuptor este dificilă din cauza faptului că au o slabă conductibilitate termică iar atunci trebuie foarte bine centrate. în decursul timpului.

Acţiunea atmosferei din cuptor asupra desfăşurării reacţiilor: oricare ar fi procedeul experimental de reglare a presiunii din cuptor. În analiza termică se foloseşte o substanţă termică inertă în vederea determinărilor fenomenelor care au loc la încălzirea unui produs solid. 7. Natura şi proprietăţile termocuplelor: un termocuplu este format din doi conductori de compoziţie diferită. sudaţi la un capăt între ei şi care au proprietatea ca prin încălzire la locul sudurii să dea naştere unui curent electric proporţional cu cantitatea de căldură aplicată. Substanţa termică inertă. 8. comparativ cu această substanţă termică inertă. Termocuplele ideale sunt cele constituite din metale nobile. oricare ar fi materialul folosit. Cele mai bune materiale inerte sunt acelea care au aceeaşi conductivitate termică ca şi materialul de cercetat. 9. cu o rată de încălzire a cuptorului de 5-10ºC/min (uzual) în domeniul maxim de temperatură de la 23 ºC (sau temperatura camerei) până la 1600 ºC. Pentru temperaturi cuprinse între 100-2200˚C se folosesc termocuple confecţionate dintr-un fir de Pt şi celălalt dintr-un aliaj de Pt cu rodiu. Alegerea substanţei termice inerte este foarte importantă. Institutului de Cercetări Experimentale Interdisciplinare în Bio-Nano-Ştiinţe deţine două aparate performante destinate analizelor termice.5 mm).obicei determinată de sensibilitatea aparaturii şi de intensitatea proceselor termice care au loc în substanţa cercetată. dar.8 mm x h: 2. Materialul de referinţă şi probele de analizat sunt puse în celule standard din alumină (având dimensiunile Ø: 5. el trebuie să aibă aceeaşi mărime granulară şi să se ia aceeaşi cantitate în lucru ca şi proba de cercetat. care sunt rezistente la atacul termic şi au o durată de utilizare lungă în comparaţie cu cele confecţionate din metale inferioare. Măsurătorile de analiză termică diferenţială se realizează cu un derivatograf termic Shimadzu tip DTG-60/60H. presiunea trebuie menţinută constantă pe tot parcursul determinărilor. Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min. între 100-800˚C se pot folosi termocuple confecţionate din aliaje speciale de Ni şi Cr. fiecare. Măsurătorile de analiză calorimetrică se realizează pe un calorimetru diferenţial Shimadzu tip DSC-60. Materialul de referinţă şi probele de analizat sunt puse în celule standard din 273 .

N. Kluwer Academic Publishers. I. Fizica Materialelor. Chicinaş. în domeniul maxim de temperatură 23ºC (sau temp. Bucureşti.aluminiu Se lucrează în atmosferă de azot şi aer la un flux de 70 ml/min fiecare (având dimensiunile Ø: 5. Ed. Jumate. Ed. Michael E. Clujeană. camerei) până la 600ºC. V. Introduction to thermal analysis: techniques and applications. Brown. Rata de încălzire a cuptorului este de 5-10ºC/min (uzual). cadrelor didactice. 2001. 3. O baie de azot lichid permite determinări la temperaturi scăzute (de la -150ºC). Todor D. dizertaţie . teze de doctorat si lucrări ştiinţifice cotate ISI (anexa I). Cluj Napoca.N. cercetătorilor din UBB sau din Universităţi. obţinute prin măsurători efectuate la ICIBNS se regăsesc în o serie de lucrări de licenţă. Second edition. Bibliografie 1. masteranzilor..5 mm). Presa Univ.Metode Experimentale. 1972. Tehnică. Informaţii importante privind proprietăţile termice ale unor materiale. Analiza termică a mineralelor.Pop. 2001. Centre de Cercetare partenere. 2. doctoranzilor. Accesul la aceste aparate este deschis tuturor studenţilor. 274 .8 mm x h: 1.

.................. raportat la cele două aparate de măsura existente în cadrul Institutului de Cercetări Interdisciplinare în Bio-Nano-Ştiinţe................ camerei – 1500ºC • Acurateţea balanţei: ± 1% • Detectorii: termocuplu de Pt plus 10% Pt/Rh 275 ............................. 285 1............. concomitent înregistrându-se continuu temperatura cuptorului T şi diferenţa de temperatură ΔT (la metodele DTA) sau de flux termic Δ (dQ / dτ ) (la metodele DSC) care apare între probă şi materialul de referinţă............Ghid de utilizare a aparatelor de analiza termică diferenţială si analiză calorimetrică diferenţială.. în încălzirea sau/şi răcirea în condiţii identice a unei probe şi a unui material de referinţă inert din punct de vedere termic............... dr. Analiza termică diferenţială simultan (DTA/TG) – aparat Shimadzu tip DTG-60/60H cu termogravimetria Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp... 275 2................................... Graficele obţinute în urma determinărilor se numesc curbe de analiză termică sau termograme.. Ghid de interpretare a măsurătorilor DTA/TG şi DSC ........................ Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială Metodele termice diferenţiale constau.. ca principiu..... În cele ce urmează sunt prezentaţi paşii necesari efectuării măsurătorilor DTA/TG şi DSC............. Raluca Ciceo-Lucăcel Cuprins 1....... Bibliografie .......... Ghid de utilizare a aparatelor de analiză termică diferenţială şi analiză calorimetrică diferenţială. Cluj Napoca................................ Ghid de interpretare a măsurătorilor DTA/TG si DSC Conf.. care prezintă pe abscisă timpul sau temperatura iar pe ordonată diferenţa de temperatura probă-referinţă (la DTA) sau diferenţa de flux termic (la DSC)..... 279 3.

0ºC/min pe un domeniu de temperatură de la temperatura camerei (minim) până la 1500 ºC (maxim). apoi se apasă tasta [ZERO] pentru aducerea la valoarea zero a balanţei. Se deschide cuptorul apăsând pe tasta [OPEN/CLOSE] de pe afişajul digital al aparatului. Se apasă tasta [OPEN/CLOSE] de pe afişajul digital al aparatului pentru a închide cuptorul. se ia creuzetul 276 .• • • Interval măsurabil semnal DTA: ± 1 la ± 1000 µV Nivel de zgomot: < 1µV Materialul de referinţă (α-alumina) şi proba de analizat se pun în cellule standard din alumină (având dimensiunile Ø 5. • Rata de încălzire a cuptorului: 0. • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min.1÷50.8 mm x h 2. 6. 8. Se pregătesc două creuzete curate: unul pentru proba de referinţă (α-alumina) altul pentru proba de analizat. iar creuzetul gol pe suportul din partea dreaptă. 3. • Cantitatea de probă folosită: max. Se apasă o dată pe tasta [DISPLAY] când ecranul digital al aparatului afişajează valoarea masei. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. 2. Se aşteaptă un timp pentru stabilizarea semnalului. 1 g Paşi în efectuarea unei măsurători DTA: 1.5 mm). 5. Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor. 7. 4. Se deschid recipientele de gaze pentru a asigura atmosfera în cuptor. Se deschide cuptorul apăsând tasta [OPEN/CLOSE].

asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). Analiza datelor (pierderi de masă. Analiza calorimetrică (DSC) – calorimetru diferenţial Shimadzu tip DSC-60. existând posibilitatea salvării datelor înregistrate până în acel moment. Valoarea afişată după stabilizarea semnalului TG reprezintă masa de probă. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. 11.) se poate face din programul de analiză TA60 care permite asemenea prelucrări ale termogramelor ca şi convertirea şi salvarea datelor în format text pentru prelucrări ulterioare în alte tipuri de programe de prelucrare date. apoi se pune din nou creuzetul pe suportul de probă. • Interval măsurabil semnal DSC: ± 40 mW • Nivel de zgomot flux de căldură: < 1µW 277 . Se apasă de două ori pe tasta [DISPLAY]. identificare temperaturi evenimente termice etc. Se deschide programul de analiză al aparatului. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP]. 12. fişierul de analiză fiind salvat automat în directorul specificat. Aparatul este conectat la un sistem de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare. Oprirea măsurătorii se face în condiţii normale.gol de pe suport şi se pune în el o cantitate optimă de probă. Se închide cuptorul. Specificaţii aparat: • Intervalul de temperatură pe care se pot face măsurători: temp. ca şi greutatea probei. ecranul digital al aparatului afişează valoarea semnalului DTA. dar şi la un sistem de gaz care asigură evacuarea elementelor volatile. unde se poate alege numele fişierului şi directorul unde va fi salvat. 9. care se aduce la zero prin apăsarea tastei [ZERO]. 13. 10. Pornirea măsurătorii se face cu butonul [Start]. camerei – 500ºC sau minus 150ºC – 500ºC când se foloseşte baia de azot lichid.

şi la sistemul de gaz care asigură evacuarea elementelor volatile. TA-60WS Collection Monitor şi se introduc valorile parametrilor de analiză (programul de temperatură şi informaţii despre fişier) în fereastra [Measure] – [Setting Parameters]. 6. Se pune creuzetul cu materialul de referinţă pe suportul din partea stângă. Se deschid recipientele de gaze pentru a asigura formarea atmosferei în cuptor. Se deschide programul de analiză al aparatului.8 mm x h 1. 5. Se apasă o dată pe tasta [DISPLAY]. • Rata de încălzire a cuptorului: 1 ÷ 50 ºC/min. Se deschid aparatele şi se aşteaptă 30 min pentru a permite gazelor să formeze o atmosferă inertă în cuptor. • Proba: substanţe în formă solidă sau lichidă la temperatura camerei. Într-un creuzet se pune o cantitate de referinţă (α-alumina). • Se lucrează în atmosferă de aer şi azot la un flux de ~ 50-70 ml/min.• Materialul de referinţă (α-alumina) şi proba de analizat se pun în celule standard din aluminiu (având dimensiunile Ø 5. Paşi în efectuarea unei măsurători DSC: 1. iar în celălalt creuzet se pune proba.5 mm). 3. 4. Se apasă tasta [ZERO] pentru aducerea la valoarea zero a semnalului. Se pregătesc două creuzete curate. iar creuzetul gol pe suportul din partea dreaptă. cântărită în prealabil pe o balanţă digitală. Şi acest aparat este conectat la sistemul de purjare a unui gaz inert (în cazul de faţă azotul) care asigură o atmosferă inertă pentru protejarea probelor la oxidare. ecranul digital al aparatului afişează valoarea semnalului DSC. 2. asistarea transferului de căldură şi protejarea detectorilor (în cazul de fază aerul). 278 .

• căldurile de topire. În cadrul laboratorului de analize termice de la Institutul de Cercetare Interdisciplinară în Bio-Nano-Ştiinţe au fost abordate o parte din aceste tipuri de măsurători. mai jos fiind prezentate câteva exemple semnificative cu scopul de a oferi o imagine cât mai exactă a modului de intepretare a datelor furnizate de metodele termice diferenţiale: 279 . hidratarea-dehidratarea etc.. Oprirea măsurătorii se face în condiţii normale. iar proba eliberează mai multă căldură decât în referinţa. • coroziunea metalelor în diferite atmosfere. Modificări subtile ale semnalului DTA pot indica prezenţa unui peak exotermic asociat cu o separare de faze. de-vitrificare etc. Dacă se doreşte oprirea măsurătorii înainte de finalizarea programului stabilit se apasă butonul [STOP]. cristalizare. călduri specifice. rearanjarea atomic este un proces exotermic. Când probele cristalizează. 2. Ghid de interpretare a măsurătorilor DTA/TG şi DSC La modul general. descompunerea. • cristalizarea sticlelor metalice etc. sublimare. fişierul de analiză fiind salvat automat în directorul specificat. fierbere.7. • puritatea şi compatibilitatea materialelor. reducerea. • capacităţi calorice. • cinetica reacţiilor şi a formării fazelor. fenomenele fizice şi chimice. Pornirea măsurătorii se face cu butonul [Start]. • oxidarea. 8.. de reacţie etc.. constantele de material detectabile sau măsurabile prin analiza termică sunt: • comportarea materialelor la topire. cristalizare. existând posibilitatea salvării datelor înregistrate până în acel moment. ca şi greutatea probei. unde se poate alege numele fişierului şi directorul unde va fi salvat. • tranziţii vitroase ale solidelor ne-cristaline. În mod identic cu datele obţinute de la analiza DTATG. • temperaturile caracteristice ale transformărilor de fază. datele salvate într-o măsurătoare DSC pot fi analizate cu programul TA60.

fără pierdere de masă → începutul procesului de cristalizare a fazelor magnetit şi hematit. fără pierdere de masă → topirea NH4NO3 • Tendo = 260ºC.382% -1.7 -10. 280 . pierdere de masă de ~ 52%→ suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3.7ºC.00 8. • Texo = 274.00 0.1.5 TGA mg 12.38% Weight Loss -52% -52.00 132 57.8 169. fără pierdere de masă → transformare structurală a NH4NO3 format în probă din precursorii azotaţi şi hidroxidul de amoniu introdus pentru cataliza bazică a hidrolizei din procesul sol-gel • Tendo = 169. identificate prin analiza XRD după un tratament termic la 500ºC.094 % 20.37 C 10.00 DTA uV -1. pierdere de masă în TG ~ 1. Analiza DTA/TG a unui sistem aluminosilicatic cu Fe60SiO2·20Al2O3·20Fe2O3 preparată prin metoda sol-gel la pH 8.38% → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei.00 274. • Tendo = 132ºC.4ºC.00 260 100 200 Temp [C] 300 Semnalul DTA prezintă patru peak-uri endoterme: • Tendo = 58ºC.00 -20.4 10. eliminarea altor reziduuri volatile din probă.00 274.00 6.

7 x=15 55 x=20 93.4ºC → eliminarea apei rezultate din reacţia hidroxidului de amoniu (introdus în soluţie pentru obţinerea unui pH de 8. HNO3. • Tendo = 93. indicând faptul că prezenţa în matrice a unei cantităţi mai mari de Fe influenţează schimburile energetice şi cauzează întârzierea producerii anumitor evenimente termice în probă. 15. cele pentru 20% Fe fiind deplasate mai sus cu câteva grade. la pH 8.6 0 100 200 300 Temp [C] 400 500 Semnalele DSC ale probelor prezintă cinci peak-uri endoterme: • Tendo = 54ºC şi 56ºC → dehidratarea probei prin pierderea apei adsorbite pe suprafaţa probei. diferind doar temperaturile la care au loc evenimentele (în special cele două evenimente care indică descompunerea.5. Analiza DSC a unor sisteme aluminosilicatice cu Fe(80-x)[SiO2]· 20Al2O3· x[Fe2O3].5) cu acidul azotic.7ºC şi 171ºC → topirea NH4NO3 • Tendo = 221ºC şi 241ºC → suprapunerea unor evenimente termice cum ar fi: descompunerea NH4NO3.2. 20. rezultat din precursorul folosit pentru Al [Al(NO3)3·9H2O]: • NH4OH + HNO3 → NH4NO3 + H2O • Tendo = 128ºC şi 129ºC → transformare structurală a NH4NO3 • Tendo = 169. Linia semnalului DSC pentru cele 2 probe ce conţin Fe este aceeaşi.4 56 129 171 221 241. respectiv topirea NH4NO3). 281 . eliminarea altor reziduuri volatile din probă. DSC mW x=0 129 230 93 128. x = 0.6 169. prin metoda sol-gel.

având un maxim la 505ºC şi însoţit de o pierdere de masă de ~14 % din totalul masei probei. Dar pierderi continue de hidroxil sunt observate până la 900°C (~0.50 1046 0. Al2Si2O7.00 7. se transformă la temperatura la 995. fără pierdere de masă în TG.5 ºC (unde apare peak-ul exoterm îngust) într-o fază aluminiu-siliciu spinel. care este considerată o structură tip γ-alumină [1]: 2 Al2Si2O7 –> Si3Al4O12 + SiO2 282 . corespunzător unei tranziţii structurale de stare solidă.00 505 -0. Analiza DTA/TG a unei argile minerale cu structură majoritară de caolinit TGA mg 8.00 7.00 6. semnalul DTA etalează un peak exoterm (cu maximul la 993.3% în intervalul de temperatură 30-109ºC corespunde dehidratării probei prin pierderea apei adsorbite la suprafaţa probei.5%) şi pot fi atribuite deprotonării graduale prin oxolare a metakaolinitului. Si3Al4O12.765% 993.4ºC). Al2Si2O7. • În intervalul 977 ºC – 1007 ºC.00 -10. • În intervalul de temperatură 354–660ºC se observă un peak endoterm foarte larg.00 DTA uV -0. Faza dezordonată de metakaolin. o conversie structurală a metakaolinitului în altă stare polimorfă aluminosilicatică. care corespunde unui proces tipic de dehidratare prin dehidroxilarea caolinitului cu producerea fazei dezordonate metakaolinit.3.353% -14.542% -20.4 10.50 0 500 Temp [C] 1000 • Pierderea iniţială de masă de ~0.

00 10.00 100 200.00 Temp [C] 600. Analiza DTA/TG a unei probe de corn de cerb deproteinată TGA mg 9.00 -50.026% 15.4.94C 445 7.00 85 84. cu pierdere de masă – descompunerea termică propriu-zisă în TCP (fosfat tricalcic) şi TTCP ( fosfat tetracalcic): Ca 10 ( PO 4 ) 6 ( OH ) 2 → 2 Ca 3 ( PO 4 ) 2 + Ca 4 P2 O 9 + H 2 O gas 5.00 800.00 0.00 -8.5 491 491.00 -13.00 400.t HA+30%Fe-t 0.00 5.907% -20.00 Temp [C] 600.00 DTA uV 20.ºC şi 100ºC.00 -10.00 83.00 -12.32C -6.00 200.68C -30. cu pierderi de masă în TG – dehidroxilare • la 491 ºC şi la 507 ºC.00 DTA uV 371 371.00 4.00 1000.00 -22.786% 20.00 6. Analiza DTA/TG a două probe de hidroxiapatită (cu 30%Fe şi 50%Fe) – tratate termic la 450º C TGA mg -12.838% 50.530% 8.00 0.00 10.90C -13.00 400.417% 5.00 445.18C HA+50%Fe .554% 507 507.00 283 .00 Semnalul DTA prezintă două peak-uri endotermice clare: • la 83.

asociat cu o scădere a masei probei în curba TG (pe intervalul 50ºC–150ºC). însoţite de pierderi de masă considerabile. • un eveniment exoterm de intensitate mare în intervalul de temperatură 350–500ºC. dar şi eliminării apei libere ataşate în matricea de hidroxiapatită. format din două peak-uri cu maximele la 371ºC şi la 446ºC.[2. Semnalul DTA etalează trei evenimente termice: • un peak endoterm având maximul la 85ºC.3.4] 6. apoi uscare în cuptor la 40ºC până la îndepărtarea completă a solventului. eveniment care ar corespunde denaturării structurii triplu helix a colagenului din matricea osoasă. Analiza DTA/TG a unor materiale compozite polimer-sticle[5] Semnalele TG prezintă patru trepte de pierdere de masă: • I – intervalul de temperatură 20-400°C – volatilizarea apei de pe suprafaţa probelor 284 . eveniment dependent şi de gradul de hidratare al materialului. Aceste evenimente pot corespunde degradării şi respectiv arderii matricii organice a osului însoţită de volatilizarea compuşilor gazoşi rezultaţi din acest proces.Procedeul de deproteinare a probei a constat în degresare în acetonă timp de 48 h şi cu eter etilic timp de 30 min.

Simon. Heredia. Silaghi-Dumitrescu. acompaniat de o pierdere de masă. Simon. Bellotto. Artioli. M. Journal of Ceramic Processing Research. M. Journal of Optoelectronics and Advanced Materials. 285 . intensitatea acestor peak-uri poate fi legată de efectul interacţiunii mutuale dintre produşii de hidratare cu polimerul utilizat în sinteză. A. Belio. Thermoanalytical characterisation of new dental ionomer biocomposites.Bibliografie 1. 958-960. Journal of Materials Science 38 (2003) 4777-4782 M. Bucio. J. L. L. Pena-Rico. Thermal kinetics analysis of bone tissue organic phase. 129-138. no. Ocotlan-Flores. 2. V. T. Menţionăm că toate aceste măsurători au fost publicate şi/sau prezentate în cadrul unor conferinţe naţionale/internaţionale de specialitate.• • • II – intervalul de temperatură 400-500°C – însoţită în DTA de un peak exoterm cu maximul la ~T = 450ºC – o reacţie de dehidroxilare aferentă restructurării reţelei polimerice a compozitelor. No. C. A.. Vol. Journal of Optoelectronics and Advanced Materials. A. J.. Kinetic study of the kaolinite-mullite reaction sequence. 479-483. L. M. Băciuţ. Minerals 22. 10. Part I: kaolinite dehydroxylation. and Clark. C.A. 3. Characterisation of natural hydroxyapatite extracted from bovine cortical bone ash. Javadpour. Javidi. S.E. Bahrololoom. cel mai probabil datorat formării unei faze cristaline în structura compozitelor. A. S. 4 (2009). Lozano. Colceriu. 5. No. 11. vol. R. Gualtieri. Gomez-Cortes. Ma. 3. I. Chem. 4 (2008). Vol. III – intervalul de temperatură 500-800°C curba DTA prezintă la T ~ 740 °C un peak endotermic pronunţat care poate fi atribuit unui proces de disociere fără pierdere de masă IV – la aproximativ 810-830 °C apare un peak exotermic mic. 4. 2 (2009). Simon.F. Acesta este. Velazquez. Pe de altă parte.. Tămăşan.. 10. Prejmerean. Thermal Analysis study of human bone. Phys.M. V. S.A. 1995. Coman. M. Radu. V. M. 207-214 . Tamas. G.

......................2..1........................3..............................................292 2.............S.........4............303 1........................ Informaţiile care se obţin din difracţia de raze X pe pulberi ............289 2.............................................................. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente .......4......2......................................... Această tensiune se aplică între catodul şi anodul tubului de raze X.....................................................1........290 2..........2............................ Rafinarea structurilor cristaline prin metoda Rietveld ........................................................................................................ Analiza microstructurală.......................3..........4................... Rafinarea Pawley sau Le Bail .......................4..... Principiul metodei Difracţia de raze X este una dintre metodele cele mai utilizate pentru investigarea compuşilor în faza solidă cristalină..3.... Determinarea structurii cristaline din pulberi ................... Principiul metodei ...... Indexarea Difractogramelor ......................... DIFRACTOMETRUL DE RAZE X Difracţie de raze X pe pulberi C..........1.....................................289 2.................I.4....................................1......3..... Metoda de căutare în spaţiul direct..........................290 2............. Metode bazate pe utilizarea de standarde ..........................2............................2.............................................292 2......................... 286 ...............1..3......... dr.......................................296 2........................... Principiul de funcţionare a unui difractometru de raze X este următorul: Cu ajutorul unui generator de înaltă tensiune se obţine tensiune de ordinul zecilor de kV.....VIII....297 2......302 4............3........ Gheorghe Borodi Cuprins 1....293 2...2.................................................... Aplicarea unor procedee de calcul pe monocristale la pulberi ... Metoda bazată pe analiza Rietveld ........294 2...................292 2.....................................................................299 2............................................... Metoda Warren-Averbach.......... Analiza cantitativă de faze ... Bibliografie ............294 2........286 2.............2..............4...... Metoda Scherrer ...295 2..................300 3...............................................4...............3..... Metode bazate pe analiza Rietveld .................... Analiza calitativă de faze cristaline ..

Pentru aplicaţiile practice de difracţie pe pulberi este necesar să folosim o radiaţie cât mai monocromatică. Anozii tuburilor de raze sunt din următoarele materiale: Cu. Liniile caracteristice pentru elementele grele cum sunt Mo şi Ag au lungimi de undă mică. Fe. un anumit grup spaţial şi un mod de aranjare a atomilor în celula elementară. Ag etc. unghiul dintre radiaţia incidentă şi probă este egal cu unghiul dintre radiaţia difractată şi planul probei. dar există şi alte tipuri de montaje experimentale. b/k. trece printr-un sistem de fante care sunt montate pe goniometru după care radiaţiile X ajung la detector unde este înregistrată. Cu are lungimea de undă intermediară şi este cel mai utilizat.Catodul tubului de raze X este alcătuit dintr-un filament care este de asemenea alimentat la o sursă de joasă tensiune şi care face ca filamentul să emită electroni. Electronii respectivi sunt acceleraţi între catodul şi anodul tubului. Proba este aşezată pe un suport plan. Electronii care lovesc anodul fac să se emită radiaţii X sub forma unui spectru continuu şi a unui spectru caracteristic. Difracţia razelor X se poate explica în mai multe feluri. Acest lucru se realizează în cazul montajului θ . În celula elementară se pot construi diverse seturi de plane cristalografice fiecare set fiind caracterizat prin indicii Miller corespunzători. Spectrul continuu nu depinde de natura anodului în schimb spectru caracteristic depinde de anodul folosit. 2 θ . detectorul se roteşte cu un unghi dublu în aşa fel încât tot timpul unghiul de incidenţă este egal cu unghiul de reflexie. Co. k. Orice compus cristalin cristalizează într-un anumit sistem cristalografic cu parametrii de reţea bine precizaţi. Monocromatizarea radiaţiei X se face cu ajutorul filtrelor de raze X sau cu ajutorul monocromatoarelor de raze X. iar liniile caracteristice pentru Cr si Co au lungimi de undă mari. În timp ce proba se roteşte cu un anumit unghi. Mo. c/l. Dintre lungimile de undă emise de un tub de raze X cea mai intensă este radiaţia K α . Astfel. un set de plane cristalografice echidistante are indicii Miller (h. Cea mai uzuală interpretare este difracţia Bragg pe planele cristalografice. Cr. l) dacă cel mai apropiat plan cristalografic faţă de origine intersectează axele cristalografice la distanţele: a/h. Radiaţia X emisă de tubul de raze X intră într-un goniometru. Se poate considera difracţia pe astfel de plane cristalografice după cum este arătat în figura următoare: 287 .

Prin urmare. De exemplu. iar rezultanta este dată de factorul de structură. Factorii de împrăştiere atomici scad cu unghiul de împrăştiere. Să vedem în continuare de cine depind intensităţile de difracţie. Dar orice sarcină care oscilează produce la rândul ei unde electromagnetice. Vibraţiile vectorului câmpului electric produc oscilaţii ale electronilor atomilor.Condiţia de difracţie este dată de relaţia: 2dsin θ = λ (1) unde d este distanţa interplanară. radiaţii X. Aceste unde electromagnetice produse de atomii din celula elementară se suprapun şi se compun. Dacă radiaţia X cade pe probă. Expresia factorului de structură este dată de relaţia: Fhkl= ∑ fj exp π 2 i(hxj+kj+lzj) (2) Intensităţile de difracţie sunt proporţionale cu pătratul factorilor de structură. θ unghiul de difracţie. Pentru alte sisteme cristalografice avem alte formule de calcul a distanţelor interplanare. Distanţa interplanară este determinată de sistemul cristalografic. intensităţile de difracţie vor depinde de natura şi 288 . De aici se observă că fiecare set de plane cristalografice corespunde unui anumit unghi de difracţie. Intensitatea radiaţiei X împrăştiate de către un singur atom este caracterizată prin factorul de împrăştiere atomic. Dependenţa intensităţii factorilor de împrăştiere de sin θ / λ este dată în tabelele internaţionale sub forma unor relaţii empirice. atunci fiecare atom din celula elementară împrăştie radiaţiile incidente. De aici rezultă că poziţiile maximelor de difracţie depind exclusiv de tipul reţelei cristaline şi de parametrii celulei elementare. pentru sistemul ortorombic avem 1/d2 = h2/a2 + k2/b2 + l2/c2. Factorii de împrăştiere atomici depind de numărul de electroni din componenta atomului dat. Radiaţia X constă din unde electromagnetice în care componenta vectorului câmp electric şi magnetic oscilează perpendicular pe direcţia de propagare a undei. iar λ lungimea de undă. iar în cazul acesta. de parametrii celulei elementare şi de indicii Miller.

toate acestea se pot grupa împreună sub forma unei constante notată cu K. numărul de cristalite care participă la difracţie este foarte mic. iar (e2/mc2) sunt constante universale. poziţiile maximelor de difracţie depind de celula elementară. e fiind sarcina electronului. m masa acestuia.poziţia atomilor în celula elementară. I0 sunt constante pentru un experiment de difracţie. În concluzie. iar intensităţile de difracţie de poziţiile atomilor în celula elementară. Vcr. Analiza calitativă de faze cristaline Analiza cantitativă de compuşi chimici în faza solidă se poate face prin metode chimice. Informaţiile care se obţin din difracţia de raze X pe pulberi 2. Pulberile constau din foarte multe cristalite mici de ordinul zecilor până la ordinul miilor de Å orientate haotic unele în raport cu altele. V. iar Fhkl este factorul de structură.1. De aceea. Probele se pun de obicei pe suporturi plane.(e2/mc2)2·Vcr·I0·Lp·A·T·I·FhklI2 unde (3) λ este lungimea de undă ω viteza unghiulară cu care se roteşte monocristalul V volumul celulei elementare I0 intensitatea fasciculului incident Lp este factorul Lorentz-polarizare A factorul de absorbţie T factorul de temperatură. În felul acesta intensitatea de difracţie corespunzătoare unui set de plane cristalografice este dată de relaţia: Ihkl=K·m·Lp·A·T·I·Fhkl·I2 (4) În această relaţie s-a introdus şi m care este factorul de multiplicitate. Acesta rezultă din aceea că pot să existe mai multe plane cristalografice care să producă difracţie la acelaşi unghi θ . ω . dar acestea necesită o abordare mai laborioasă şi timp mai mult. 2. Vom obţine difracţie numai de la planele cristalografice care sunt paralele cu suprafaţa suportului de probă. Intensităţile de difracţie depind şi de alţi factori. iar c viteza luminii. 289 . Astfel se demonstrează că intensitatea radiaţiei difractate de către un mic monocristal care se roteşte cu viteza unghiulară ω este dată de relaţia [1] : Ihkl = ( λ 3/ ω V2). Deoarece în general λ .

în diferite faze cristaline. în special PDF-2. din analiza de faze putem să identificăm o anumită fază numai dacă aceasta a fost catalogată în prealabil. Analiza cantitativă de faze În foarte multe cazuri.În prezent. PDF-4. cu luarea în considerare a coeficienţilor de absorbţie a fazelor componente.2. Dacă avem la dispoziţie baza de date CSD sau o altă bază de date. Se ştie că acelaşi compus chimic poate să se prezinte în diferite forme polimorfice sau. analiza calitativă de produşi chimici cristalini se face în cea mai mare măsură prin difracţie de raze X pe pulberi. Analiza de faze cristaline se bazează pe compararea difractogramei de raze X experimentală cu difractogramele care se găsesc în bazele de date. Metode bazate pe utilizarea de standarde Între intensităţile de difracţie şi fracţia în greutate Wα. Analiza cantitativă de faze se bazează pe faptul că fiecare fază cristalină produce propria difractogramă. care ne dă datele cristalografice complete pentru compuşii care ne interesează. Obţinerea componentei procentuale a fazelor dintr-un amestec se poate face atât prin metode chimice.1. aparţine unui anumit grup spaţial. când avem un amestec de faze cristaline. Identificarea fazelor cristaline se bazează pe următoarele considerente: fiecare fază cristalină aparţine unui anumit sistem cristalografic. iar dacă avem mai multe faze. Deci. În anumite cazuri difracţia de raze X pe pulberi cristaline poate să fie o metodă rapidă şi eficientă. cât şi prin difracţie de raze X. pentru o anumită fază α există relaţia: 290 .2. difractograma rezultată va fi o suprapunere a difractogramelor individuale. are parametrii de reţea bine determinaţi sau care variază într-un interval relativ mic. ne interesează compoziţia procentuală a fiecărei faze din amestec. Aceasta face ca fiecare fază cristalină să aibă intensităţile de difracţie şi unghiurile la care apar aceste intensităţi bine determinate. atunci putem să simulăm difractograma acelui compus şi să o comparăm cu difractograma experimentală. cum se mai spune. Difracţia de raze X pe pulberi deosebeşte cu uşurinţă diferite forme polimorfice ale unui anumit compus. Compararea difractogramei experimentale cu cele din catalog se face utilizând bazele de date. 2. 2. deoarece proprietăţile fizico-chimice depind de compoziţia procentuală. iar atomii compusului se plasează în anumite poziţii în celula elementară.

măsurarea lui Iiα şi estimarea lui μ m O altă metodă este aceea a standardului intern care presupune includerea unui standard intern în proba de compoziţie procentuală cunoscută Ws. standard (ii). I jsWd Fracţia Wα pentru faza necunoscută se determină în funcţie de fracţia Ws pentru proba standard. iar μ m este coeficientul de absorbţie masic pentru întreaga probă [2]. Ca standard extern se alege în general corundum. x ρα este densitatea fazei α.I iα = C i α Wα x ρα μ m (5) unde Ciα este o constantă pentru reflexie (sau un grup de reflexii) i a fazei α. şi de raportul dintre intensitatea liniei i a probei de analizat şi intensitatea liniei j a probei standard după relaţia: Wα = I iα W s I js RIRαs (8) 291 . O altă metodă este aceea a raportului intensităţii de referinţă (RIR) (Reference Intensity Ratio). Pentru aplicarea acestei relaţii este necesară (i) determinarea constantei Ciα prin prepararea de standarde cu compoziţie procentuală a fazei α bine x a probelor determinată şi estimarea coeficientului de absorbţie masic μ m x pentru probe necunoscute. Intensitatea de reflexie Ijs este dată de relaţia: I js = C js Ws x ρsμm (6) Împărţind cele două relaţii rezultă: is Wα = K α sWs I iα I js (7) ij unde K α s = C js ρα Ciα ρ s ij poate fi determinat făcând un amestec cunoscut de fază standard şi Kα s fază de analizat. Se defineşte RIRαs = I isWs .

Astfel. 2. numite cristalite.2.3. se consideră că compusul respectiv este sub formă amorfă. Dacă dimensiunile cristalitelor sunt sub 20 Å.1. Cu cât dimensiunile cristalitelor sunt mai mici cu atât liniile de difracţie sunt mai largi.3. a deformării reţelei cristaline şi a probabilităţilor de defecte. orientarea preferenţială a cristalitelor. Erorile sunt cu atât mai mici cu cât dimensiunea particulelor este mai mică şi cu cât coeficienţii de absorbţie vor fi mai mici. Se ştie că pulberile cristaline sunt formate din mici monocristale. din analiza Rietveld rezultă fracţia de faze din probă. Metoda bazată pe analiza Rietveld Analiza cantitativă de faze se poate face şi cu analiza Rietveld [3]. Analiza microstructurală Analiza microstructurală include determinarea dimensiunilor microcristalitelor şi eventual distribuţia acestora după dimensiune. Trebuie menţionat că dimensiunile particulelor sunt diferite de dimensiunile cristalitelor. 2. Reducerea coeficienţilor de absorbţie se poate face prin utilizarea tuburilor de raze X cu lungime de undă mai mică. Dar la lărgimea liniilor de difracţie contribuie şi deformările reţelei cristaline şi probabilităţile de defecte. β este lărgimea liniilor de difracţie 292 . microabsorbţia. Dimensiunile acestor cristalite sunt de ordinul zecilor până la ordinul miilor de Å. Într-o particulă pot să existe mai multe cristalite (monocristale) orientate diferit între ele. liniile de difracţie de asemenea se lărgesc. distribuite haotic unele în raport cu altele. Metoda Scherrer Scherrer a arătat pentru prima dată că dimensiunile cristalitelor sunt legate de lărgimea de difracţie prin relaţia [2]: D= Kλ β cos θ (9) D este dimensiunea microcristalitelor. Dacă reţeaua este mai deformată sau dacă avem mai multe defecte. Se filtrează toţi parametrii de care depinde intensitatea de difracţie. Factorii care limitează precizia analizei de fază sunt: dimensiunea diferită pentru particulele aparţinând la diferite faze de analizat. inclusiv procentul de fază necunoscută. Intensităţile de reflexie pentru probele cu coeficient mai mare de absorbţie vor fi mai intense.2.2.

2. iar θ este unghiul de difracţie. se foloseşte o probă foarte bine cristalizată şi se măsoară lărgimea maximelor de difracţie pentru unghiurile de difracţie apropiate cu cele ale probei de măsurat. care se defineşte ca fiind aria maximului de difracţie împărţită la intensitatea maximă pentru maximul respectiv. Astfel avem relaţia: β cosθ = 0. Precizia legată de determinarea dimensiunilor cristalitelor scade odată cu creşterea acestora.9λ + 4ε sinθ D (10) în cazul în care profilul liniei de difracţie este de tip Lorentz. Domeniul pe care precizia determinării dimensiunilor cristalitelor se consideră acceptabilă este de la aproximativ 20Å. până la 1000Ǻ. Unii autori iau ca lărgime a liniilor de difracţie lărgimea integrală. iar b este lărgimea de difracţie instrumentală. Lărgimea instrumentală se obţine din lărgimea de difracţie experimentală astfel: β = B-b. 293 . 2.corectată de lărgimea instrumentală. deoarece cu cât dimensiunile sunt mai mari lărgimea liniilor de difracţie se apropie de lărgimea instrumentală şi depinde foarte mult cât de corect am ales lărgimea instrumentală. Dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată dimensiunilor cristalitelor este diferită de dependenţa de unghiul θ a lărgimii liniilor de difracţie datorată deformării reţelei cristaline. K este o constantă care depinde de modul cum se defineşte dimensiunea D. dacă profilul de difracţie este o funcţie de tip Gauss. Pentru a obţine b. Cea mai utilizată valoare a lui K = 0.3. Lărgimea liniilor de difracţie creşte cu unghiul. precum şi de alţi factori. dacă profilul de difracţie este o funcţie de tip Lorentz şi β2 = B2 –b2. dacă aceasta se defineşte ca fiind dimensiunea liniară sau rădăcina de ordinul 3 din volum. Ca măsură a lărgimii liniilor de difracţie se consideră lărgimea la semiînălţime. Metoda Warren-Averbach Am amintit că lărgimea liniilor de difracţie scade atât cu scăderea cristalitelor cât şi cu creşterea deformaţiilor reţelei cristaline. În această relaţie B este lărgimea de difracţie măsurată.89. unde ε este un parametru care reflectă deformaţia reţelei cristaline şi reprezintă deplasarea medie a atomilor faţă de poziţia de echilibru.

rezultă dimensiunile cristalitelor şi deformările reţelei.3.3. Pentru un profil de tip Gauss avem: ΓG = Utg 2θ + Vtgθ + W + P cosθ (13) Din fitarea Rietveld rezulta X.Reprezentând grafic βcosθ în funcţie de sinθ. W si P. iar panta D dreptei reprezintă 4ε. în funcţie de sin2θ. De aici putem să determinăm ε şi D. Metode bazate pe analiza Rietveld O altă modalitate de determinare a dimensiunilor cristalitelor şi a deformării reţelei cristaline se poate face prin analiza [4] Rietveld. Y. Se obţin mai puţine intensităţi de difracţie deoarece liniile de difracţie pot să se suprapună şi de ase294 . 2. iar X si Y parametrii de fit. Numărul intensităţilor de difracţie care se pot obţine din difracţia pe monocristale este de ordinul zecilor de mii. atunci avem relaţia: β 2 cos 2 θ = λ2 D2 + 16ε 2 sin 2 θ (11) Din reprezentarea grafică a lui β2cos2θ.9λ . ar trebui să obţinem o dreaptă. dacă considerăm diferite linii de difracţie. 2. dar poate ajunge şi până la 200. Dimensiunile cristalitelor se mai pot determina şi din analiza Fourier a liniilor de difracţie. Ordonată la origine pentru această dreaptă reprezintă 0. Numărul intensităţilor de difracţie care se pot obţine din pulberi cristaline este de ordinul zecilor.4. U. Dacă profilul liniilor de difracţie este de tip Gauss. Determinarea structurii cristaline din pulberi Determinarea structurii cristaline se face în general din datele de difracţie obţinute din monocristale. unde ΓL este lărgimea la semiînălţime. lărgimea la semiînălţime depinde de unghiul θ. În continuare dimensiunile cristalitelor şi deformaţiile reţelei se calculează în funcţie de aceşti parametrii. V. Conform formulei lui Caglioti. astfel: ΓL = X + Y tgθ cosθ (12) pentru un profil de tip Lorentz.

Etapele principale pentru determinarea structurii cristaline din pulberi sunt: 2. α. determinarea structurii cristaline este mult mai dificilă pentru pulberi decât pentru monocristale. Determinarea structurii cristaline pentru un anumit compus înseamnă determinarea sistemului cristalografic. b. a parametrilor celulei elementare. În funcţie de a.4. Se ştie că difracţia razelor X pe atomi poate fi privită ca difracţie pe planele cristalografice. Dar există situaţii când anumiţi compuşi nu se pot cristaliza şi totuşi ne interesează structura lor cristalină. Parametrii care caracterizează celula elementară se numesc parametrii celulei elementare. Un plan cristalografic de indicii Miller h. Pentru o anumită celulă elementară putem să definim planele cristalografice. Concordanţa dintre poziţiile maximelor de difracţie calculate şi obser295 . avem şapte sisteme cristalografice. După cum se ştie. În acest caz se apelează la determinarea structurii cristaline din pulberi. Numărul mai mic de maxime de difracţie observat în cazul pulberilor precum şi suprapunerea unor maxime provenite de la plane cristalografice diferite este motivul pentru care este mult mai dificil de determinat structura cristalină din pulberi faţă de monocristale.1 Indexarea Difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic în care cristalizează compusul. β. β. difracţia razelor X poate fi privită ca difracţia de pe planele cristalografice. c şi unghiurile dintre ele α. γ.menea unele intensităţi de difracţie sunt foarte slabe şi nu se pot observa. Din reflexiile interzise se pot atribui grupurile spaţiale cele mai probabile. l este un plan care intersectează axele cristalografice la distanţele a/h. a grupului spaţial şi a poziţiilor atomilor în celula elementară. Se obţin maxime de difracţie dacă este îndeplinită condiţia lui Bragg: Maximele de difracţie au intensităţi mai mari sau mai mici în funcţie de modul de distribuţie a atomilor în celula elementară. b/c si c/l de origine. γ. b. Deoarece numărul de intensităţi de difracţie care se pot colecta din difractograma pe pulberi este mult mai mic decât pentru monocristale. k. Numărul de maxime de difracţie în cazul pulberilor care se observă este foarte mic comparativ cu numărul de maxime de difracţie observate pentru monocristal. Orice compus este caracterizat de o anumită celulă elementară care este un paralelipiped cu muchiile a. a determina parametrii celulei elementare şi a atribui fiecărui maxim de difracţie indicii Miller corespunzători. unele maxime de difracţie se suprapun în cazul pulberilor. De asemenea. c.

M. Există o suprapunere sistematică a intensităţilor de difracţie şi o suprapunere accidentală.4. Suprapunerea exactă a intensităţilor de difracţie are loc mai ales pentru sistemele cristalografice de înaltă simetrie. Suprapunerea reflexiilor este cu atât mai probabilă cu cât celula elementară are volumul mai mare. rafinarea celulei elementare şi atribuirea grupului spaţial cel mai probabil. care este valoarea în θ pentru limita superioară selectată. reflexiile 333 şi 511 pentru sistemul cubic sau 43l şi 50l pentru sistemul tetragonal. De exemplu.vate se caracterizează şi prin aşa numite figuri de merit. N20 este numărul de linii diferite calculate până la linia corespunzătoare lui Q20. indexarea este probabil corectă. metoda Dicvol [8] X-Cel [9] si metoda Treor [10]. 2. iar <Q> este abaterea medie dintre liniile de difracţie calculate şi observate. Dacă avem M20 > 10. şi anume: Metoda Le Bail şi metoda propusă de Pawley. dar mai ales pentru sisteme cristalografice cu simetrie joasă şi se datoreşte creşterii numărului de reflexii independente. < Δ 2 θ > este abaterea medie dintre liniile de difracţie calculate şi observate. Există mai multe moduri de definire ale figurilor de merit sau gradului de încredere în indexarea respectivă. Una dintre figurile de merit se datorează lui P. Au fost dezvoltate două metode de extragere a intensităţilor de difracţie din pulberi. Un alt factor de încredere datorat lui Smith si Snyder [6] se defineşte astfel: FN= N < Δ 2θ > . Există mai multe metode de indexare dintre care cele mai importante sunt: Metoda Ito[7]. Cea mai utilizată figură de merit este M20.2. Metoda Le Bail [11] de extragere a intensi296 .N (θg ) (15) unde N( θg ) este numărul de linii de difracţie calculate până la θ g. Suprapunerea accidentală are loc atât pentru sisteme cu simetrie ridicată. de Woolf [5]: M 20 = Q 20 2 < Q > N 20 (14) Q20 este valoarea lui Q pentru a 20-a linie de difracţie. Rafinarea Pawley sau Le Bail Rafinarea Pawley sau Le Bail este utilizată pentru extragerea intensităţilor de difracţie.

metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială. Ca intensităţi de pornire se pot considera valorile calculate ale intensităţilor de difracţie. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. 2. există şi cazuri când prezintă instabilităţi. mai ales atunci când fondul de difracţie este supraestimat. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative.tăţilor de difracţie este inspirată din metoda Rietveld. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. Deşi procesul de rafinare este în general stabil. În timp ce metoda Le Bail este o metodă iterativă. Obţinerea unui model structural 2. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale. octaedrii etc.4. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. fragmente din molecule.1. Această metodă nu cere extragerea factorilor de structură din difractogramă. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme.14] au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură în schimbul intensităţilor de difracţie. grupe de atomi aranjaţi într-o anumită configuraţie. Aceasta este o metodă de analiză prin cele mai mici pătrate. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală. în care mărimile care trebuie determinate sunt intensităţile de difracţie. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare.5 dintr-un pas de înregistrare a difractogramei.3.3.4. tetraedrii. Pawley [12] a elaborat o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X fără a avea un model structural. 297 . Putem să avem atomi. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie. Deşi metoda este în general robustă. ca de exemplu. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. Unii autori [13. molecule.

17]. Astfel. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. dar în faza finală. cu descreşterea temperaturii se aleg de la 298 . definit în felul următor: Σ i wi ( y Rwp=[ obd i − i y calc i )2 ]1/2 (16) Σ i wi ( y ) 2 obs Dacă funcţia de cost CF este mai mică decât cea precedentă. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global. Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2 = exp[(CF2-CF1)/T]. probabilitatea de a găsi un alt minim este de asemenea mică. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. în faza iniţială a procesului de căutare a configuraţiei optime se poate uşor trece de la un minim local la un alt minim în scopul determinării minimului absolut. dintre care amintim: Răcire simulată (simulated annealing). dintre care amintim Powder Solve [15]. pentru a evita să cădem într-un minim local. atunci se reţine noua configuraţie cu probabilitatea exp(. Astfel pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. Funcţia de cost CF se poate alege în diverse moduri. În schimbul utilizării unui singur lanţ de configuraţii. se consideră funcţia de cost CF. Una dintre posibilităţi este să se aleagă ca fiind rezidiul R. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. se testează potrivirea dintre difractograma calculată şi cea experimentală. T fiind temperatura distribuţiei. o variantă a acesteia numită Parallel tempering şi Tehnica algoritmilor genetici. Fox [16. eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. În timpul procesului de căutare temperatura se scade treptat.Δ CF/T). şi anume Parallel Tempering (PT) [18]. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. În cazul metodei de răcire simulată se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare. când T este foarte mic.Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. Totuşi. atunci se reţine noua configuraţie. Dacă CF este mai mare decât cea precedentă. Pentru moleculele organice. un alt algoritm a fost dezvoltat.

Deoarece intensităţile de difracţie se măsoară în unităţi arbitrare. Datorită faptului că atomi oscilează în jurul poziţiilor de echilibru. Cunoscând factorii de struc299 . factorul de absorbţie. Cu toate acestea.3.20]. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. deci în acest caz factorii de structură sunt numere reale pozitive sau negative. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat. intensităţile acestora se reduc cu un factor de temperatură. În felul acesta. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. 2.început mai multe configuraţii (un număr mic de configuraţii). Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. dintre care amintim: Factorul Lorentz. Paşii care trebuie urmaţi sunt: corectarea intensităţilor de difracţie de diverşi factori. se determină factorul de scală şi de temperatură. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. intervine un factor de scală K care trebuie determinat. Dar factorii de structură sunt numere complexe. factorul de polarizare. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice. factorul de extincţie. Sinteza Fourier şi sinteza Patterson. Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley.4. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice aplicate invarianţilor şi semiinvarianţilor. se obţine modulul factorilor de structură. posibilitatea de a se obţine minime locale este mai mică. Dacă se fac corecţiile intensităţilor de difracţie. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi. Determinarea factorului de scală şi a factorului global de temperatură. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul zecilor.2. până la 3 sau 4 sute. Determinarea fazei factorilor de structură [19. în unele cazuri s-au obţinut rezultate bune.

tură. după relaţia: P(u.4. putem să determinăm densitatea electronică de sarcină în celula elementară cu ajutorul următoarei relaţii: ρ ( x. unde densitatea electronică este mai mare. k . Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară dacă aceştia există. există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă. z ) = 1 V ∑F hkl hkl exp( −2πi ( hx + ky + lz )) (17) Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât. Pe baza densităţii electronice se poate construi un model structural aproximativ. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate. k .4. Dintre programele de calcul cel mai utilizat este GSAS [22]. atunci putem face sinteza Patterson.w)= 1 V h . 300 . .factorul de pondere şi este wi=1/yi. În cazul obţinerii modelului structural s-a făcut o căutare globală potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată.l cos( 2π ( hx + ky + lz )) (18) Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi mai ales distanţele dintre atomii grei.v. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [21]. În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim.l ∑F 2 h . y . 2. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate.Rafinarea modelului structural prin metoda celor mai mici pătrate. Funcţia ce trebuie minimizată este: S y = ∑ wi ( y i − y ci ) 2 i (19) unde: wi . deoarece nu sunt necesare variaţii mari ale acestor parametrii.

mai ales dacă avem un număr mare 301 .intensitatea calculată la pasul i. În ultimele etape. fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. yci . H este lărgimea la semiînălţime şi U. Pentru o difractogramă oricât de perfectă maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. Urmează rafinarea deplasării punctului de zero pentru difractogramă.intensitatea observată la pasul i. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. W sunt parametri care se pot rafina. şi factorul de polarizare. factorul care descrie absorbţia razelor X. Din literatură şi din experienţă proprie am constatat că este necesar să se adopte următoarea strategie. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară. deformaţiile de reţea. factorii care descriu asimetria liniilor de difracţie etc. Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma[24]. La început se rafinează factorul de scală. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RP = ∑| y − y ∑y i i ci | (21) 1/ 2 RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ (22) unde wi=1/yi şi se numesc factori de pondere. în general trebuie impuse constrângeri. În general. V. factorul de temperatură şi coeficienţii polinomului care descriu fondul. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective. exprimată prin funcţia lui Caglioti [23]: H 2 = U tan 2 θ + V tanθ + W (20) unde.yi . Calitatea rafinării se apreciază pe baza unor indici de rezidiu.

în procesul de rafinare a complecşilor de incluziune. 3. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu [27]. Unităţile glicozidice au fost legate între ele prin constrângeri slabe. dar forma ansamblului să nu se schimbe. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain” [25] şi “rigid body“ [26].de atomi pe celula elementară. Prezentarea aparaturii disponibile şi stabilirea parametrilor optimi de funcţionare pentru diverse tipuri de experimente Aparatura de difracţie disponibilă este un difractometru Shimadzu XRD–600 prevăzut cu un monocromator pentru fasciculul difractat. De exemplu. permiţând translaţia şi rotaţia acestora. Este recomandat ca difractometrul să fie aliniat în fiecare dimineaţă înainte de a începe experimentele. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. Pe lângă aceasta. În cazul în care se fac măsurători pentru compuşi anorganici cu 302 . mai este necesară o calibrare mai complectă la fiecare lună. Pentru o mai mare siguranţă referitoare la punctul de zero al difractometrului. aceste distanţe pot să varieze între anumite limite. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei împreună cu atomii de oxigen secundari au fost considerate ca “rigid body”. Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi. De exemplu. de aceea. au fost adaptaţi alţi suporţi de probă care să permită difracţie pentru cantităţi foarte mici de probă. Suporţii de probă aduşi de firmă nu au permis analiza unor cantităţi mici de probă. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. Modul de aliniere şi calibrarea lunară se găsesc în documentaţia de folosire a difractometrului. timpul de înregistrare este suficient să fie 0 2 /minut. este necesar ridicarea unei difractograme pentru un etalon de siliciu. Difractometru este prevăzut cu o bază de date pentru efectuarea de analize calitative şi cu software pentru determinarea raportului cristalin-amorf. de exemplu C–C. Pentru analiza calitativă. Aceasta ar trebui făcută săptămânal. Timpul de înregistrare pentru difractograme şi fantele folosite depind de tipul de măsurători efectuate. C–O pentru legături simple sau duble. Totuşi.

Powder diffraction. adâncimea de pătrundere a razelor X este mult mai mică în cazul utilizării tubului de Cr. de Woolff.P. R. În cazul în care se încearcă determinarea structurii pentru un nou compus. 7. Inc 1974. 252-255 (1977). Pentru analiza cantitativă de faze este indicat să se lucreze cu metoda standardului intern. J. Appl.W. 3. este indicat să se controleze filtrele pentru apă odată la 3 luni şi.J. Appl. 36. H. măsurătorile trebuie să se facă aproximativ între 10 si 800. 24. 10. Bibliografie 1. 9. Willey& Sons. Appl. R. Cryst. dacă este cazul. G. Appl.S.L. timpul de înregistrare trebuie să fie mare. În acest caz. Smith and R. D. fantele trebuie să fie cât mai înguste. Appl. Cryst. iar pentru compuşi organici care au celula elementară mai mare între 3 si 450. Cryst. adică timpul de înregistrare să fie în jur de 20 ore. 2. 303 . 356-365 (2003). Post. 4. C. ci doar înregistrarea maximelor de difracţie care trebuie să se facă cât mai precis. Klug and L.S. Fundamentals of crystallography. Pentru indexarea compuşilor şi determinarea parametrilor de reţea este indicat să se folosească şi standard intern deoarece în acest caz se poate evalua mai precis punctul de zero al difractometrului şi se pot determina mai exact poziţiile liniilor de difracţie. 8. Oxford University Press 2002. Nu este indicată achiziţionarea de tuburi de raze X care să nu se utilizeze deoarece tuburile de raze X se deteriorează în timp. când dorim să vedem efectele structurale de suprafaţă sau când avem probă puţină. eventual să se lase aparatul să funcţioneze şi peste noapte. 1. J. Snyder J. Dinnebier and S. P. care poate fi chiar proba cântărită din etalonul de Si.E. Cryst. Eds D.celula elementară mică. de aceea. 108-113 (1968). Boultif. chiar dacă acestea nu funcţionează. Visser J.Louer J. Cryst.M. Ed. Din punct de vedere tehnic. Ed. A.L.L. Billinge. să fie curăţate.E. Neumann J. Dacă se lucrează cu probe care conţin Fe sau Mn este de dorit să se folosească tub de Cr care există în dotarea laboratorului. 4. Pentru analiza microstructurală nu este necesară înregistrarea difractogramei pe întreg domeniul. Tubul de Cu dă fluorescenţă pentru probele care conţin Fe sau Mn.Bish and J. De asemenea. 987-993 (1991). Powder Diffraction Reviews in Mineralogy Vol 20 1989. M. 89 (1969). este avantajos utilizarea tubului de Cr. 6. 2. 5. Alexander X-Ray Diffraction Procedures J.E. Giacovazzo.C Publishing 2008.

Deem J. 18. 23. 14. 12.P. Cox. Cryst. Cryst. 15.Engel. 18. Cryst. 219.Scardi J. R. I. Leuse. H. 19.B. O. Dinnebier Powder Diffraction 14. 21. S. 32. 1754-1766 (1999). D. 35. Chem. D. Appl. Nowell.C.Harris. L. 304 . Mentzafos. V. Appl. Engel. F. Wike. McCusker. 110.E. G. A. 25. Ed. H. J. 33.A. G. Crystallogr.J. Ed. 87545. USA. Westdahl J. Koning. Direct phasing in crystallography. Appl. 357-361 (1981). 27. Fundamentals of crystallography. 84-92 (1999). 20. 1169-1179 (1999). D. K. Report LAUR 86-748.M. 11. Falcioni. J. Konig. Cryst. 899-908 (2000). H. 65-71 (1969). NM. Crystallogr. Appl. V. Cryst. 847-856 (2004). 14. R. 2.10. 13. The Rietveld Method. Mavridis. Appl. G. 16. 24. Cole Acta Cryst.D. Tsoucaris Acta.E. Appl. Pawley J. A. Res.E. B B58.W. 36-50 (1999). Cerny Z. C.E. R.M Rietveld J. Bull. Le Bail. M. Cryst. 367-370 (1985).C. F. Fourquet Mater. G. Los Alamos National Laboratory. 26. 1169 (1999). M.S. 17. Giacovazzo. 734-743 (2002). L.D. 835-840 (2002). Werner. G.Eriksson. S. Crystallogr. Favre-Nicolin and R. B47. Larson & R. Favre-Nicolin and R. 22.B. J. Louer and P. 23. O. C. Appl. Von Dreele General Structure Analysis System (GSAS). P. 32. Oxford University Press 2002. Harris. Duroy. 447-452 (1988). Oxford Science Publications 1999. Phys. Le Bas. Cerny J.B. 32.L. Kristallogr.E. Young Oxford University Press (1993). M. 746-757 (1991). Coelho J.M. Attfield and J. Leusen J. Appl. K. Von Dreele. Giacovazzo.Wilke.

................... 307 1.................................. 309 2.......................... Câteva metode uzuale de idexare ..........................1................... 305 ......................................S...................2............. atât în diferitele ramuri ale ştiinţei...........1. a parametrilor celulei elementare....................... Exemple privind determinarea structurii cristaline din pulberi ....................3........... Gheorghe Borodi Cuprins 1........ ................. 325 Determinarea structurii cristaline este foarte importantă...... A determina structura cristalină pentru un anumit compus înseamnă determinarea sistemului cristalografic în care acesta cristalizează.2.... Determinarea structurii cristaline din pulberi este mai dificilă deoarece..... 312 2.. 311 2... foarte multe intensităţi de difracţie se suprapun.................. Obţinerea modelului structural .................................. se obţin doar câteva zeci..................................................1....................1........... 316 4........................... în timp ce la monocristale se pot colecta mii de intensităţi de difracţie......... Determinarea structurii cristaline se face în principal prin difracţie de raze X....... 322 5........... 306 1....... Structura cristalină pentru N-(5-etil-[1. 311 2............ Aplicarea unor procedee de calcul pe monocristale la pulberi .................................. Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect .....2........... 319 4......... cât şi în industrie şi tehnologie... 307 1.. Pe lângă aceasta..........2.................. Bibliografie ........... Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina.................. Extragerea intensităţilor de difracţie...........1......................... 319 4....3................... în cazul pulberilor....... Algoritmi de indexare ...........Determinarea structurii cristaline prin difracţie de raze X C........................................................ Totuşi.................. structura cristalină se determină din monocristale..................... Rafinarea structurilor cristaline prin metoda Rietveld ...... 314 3...................................... Indexarea difractogramelor ..I....................... dr. a grupului spaţial şi a poziţiilor atomilor în celula elementară......... Metoda de căutare în spaţiul direct .............................................. Pentru orice compus nou preparat într-un anumit fel este de dorit să se determine structura cristalină...........................................4]-tiadiazol-2-il0-toluensulfonamida.............. Metodele pentru monocristale aplicate la pulberi .... deoarece proprietăţile materialelor în stare solidă depind de structura cristalină şi moleculară a acestora................. În general........................ dar de foarte mare ajutor sunt metodele spectroscopice şi de modelare moleculară care pot să furnizeze informaţii structurale deosebit de utile........... 311 2.....1....... În cazul în care nu se pot obţine monocristale se încearcă determinarea structurii cristaline din pulberi.. iar extragerea acestora este dificilă şi afectată de erori............

cu atât are mai multe linii de difracţie. Aceasta este total diferită faţă de cazul determinării structurii cristaline din monocristale. Aceasta deoarece. cel mai dificil. Astfel. Celula elementară este un paralelipiped în interiorul căruia se găsesc atomii sau moleculele şi dacă acesta se translatează după cele 3 direcţii. Etapele principale pentru determinarea structurii cristaline din pulberi sunt: indexarea difractogramelor. în cazul pulberilor. dintre care unele se suprapun 306 . cu cât sistemul cristalografic are simetrie mai joasă. nu se poate determina structura cristalină. Indexarea difractogramelor A indexa o difractogramă înseamnă a determina sistemul cristalografic. Astfel. indexarea ar fi imediată. 1. În general. Vom descrie aceste etape. la difracţia pe pulberi se obţin doar câteva zeci de unghiuri de difracţie din care se determină modulul vectorilor corespunzători din reţeaua reciprocă. dar se alege acea celulă care are volumul cât mai mic şi simetria cât mai mare. cel mai uşor se indexează compuşii care cristalizează în sistemul cubic şi.în ultimul timp. trebuie menţionat că indexarea este cu atât mai dificilă cu cât simetria este mai scăzută. din difractogramele pe pulberi se determină unghiurile de difracţie din care rezultă modulul unui număr limitat de vectori din reţeaua reciprocă din care se doreşte să se reconstituie întreaga reţea reciprocă. cât şi direcţia pentru un număr foarte mare de vectori din reţeaua reciprocă. Dificultăţile în indexarea difractogramelor provin din erorile legate de determinarea poziţiilor maximelor de difracţie. obţinerea modelului structural şi rafinarea Rietveld a modelului obţinut. în timp ce în cazul difracţiei pe monocristale se obţin mii de vectori din reţeaua reciprocă. datorită creşterii puterii de calcul şi rezoluţiei difractometrelor. atunci se obţin poziţiile tuturor atomilor din celula elementară. unde se determină atât modulul. Astfel. datele experimentale sunt proiecţia unidimensională a reţelei reciproce care este tridimensională. dacă poziţiile maximelor de difracţie ar fi determinate exact. iar la final se vor da câteva exemple de determinare a structurii cristaline din pulberi. o celulă elementară se poate defini în mai multe moduri. De asemenea. Deoarece în cadrul ICE există difractometru pentru pulberi ne vom ocupa doar de determinarea structurii cristaline din pulberi cristaline. compuşii care cristalizează în sistemul triclinic. foarte multe structuri cristaline au fost determinate din pulberi. parametrii celulei elementare şi atribuirea fiecărei linii de difracţie a indicilor Miller corespunzători. Indexarea difractogramelor este primul pas în determinarea structurii cristaline. dacă aceasta nu este făcută corect. Dificultatea indexării provine din faptul că.

Indexarea este cu atât mai dificilă cu cât simetria reţelei cristaline este mai joasă. cât şi standard intern. Aceasta deoarece la unghiuri mici peak-urile de difracţie sunt mai rare şi şansele de a se suprapune sunt mai mici. Erorile sistematice sunt mai nefavorabile pentru indexare decât erorile întâmplătoare. 1. Astfel. În cazul căutării în spaţiul direct. 1. definirea celulei elementare pentru sistemul cubic depinde de un singur parametru. b) Numărul de extincţii pentru maximele de difracţie la unghiuri mici să nu fie foarte mare. se variază parametrii celulei elementare într-un anumit mod şi se aleg acele 307 . Cea mai precisă corecţie se face prin utilizarea de standard intern. d) Să nu existe impurităţi în proba de analizat. de exemplu. În programele de calcul elaborate în ultimul timp se poate face indexarea chiar când există un număr mic de reflexii care aparţin impurităţilor şi acestea sunt excluse dacă celelalte linii de difracţie se potrivesc cu celula elementară găsită. iar pentru sistemul triclinic depinde de şase parametrii. unul dintre indicii Miller este tot timpul par din cauza reflexiilor interzise. pentru sistemul ortorombic depinde de trei parametrii. obţinem o celulă elementară incorectă.1 Condiţiile pe care trebuie să le îndeplinească o difractogramă pentru a putea fi indexată corect sunt: a) Să existe linii de difracţie observabile la unghiuri cât mai mici. Pentru corectarea erorilor sistematice se poate folosi atât standard extern.parţial. atunci la indexare s-ar putea să avem o celulă cu o constantă de reţea dublă faţă de cea reală. Aceasta presupune introducerea în proba de analizat a unui compus pentru care se ştiu exact poziţiile maximelor de difracţie. dacă avem impurităţi.2 Algoritmi de indexare Există două abordări pentru algoritmii de indexare şi anume căutarea în spaţiul direct şi în spaţiul reciproc. Erorile sistematice pot să fie minimizate prin alinierea difractometrului. Acest lucru este foarte important deoarece nu se poate distinge între liniile de difracţie ale compusului şi liniile de difracţie ale impurităţii. În general. Dacă. ceea ce face ca să nu se poată determina precis poziţiile maximelor de difracţie. Indexarea difractogramelor se face în mod automat folosind diferiţi algoritmi de calcul[1]. Cele mai importante erori sistematice sunt poziţia de zero a difractometrului şi deplasarea probei. c) Să avem o precizie mare pentru determinarea poziţiilor de difracţie.

este mult mai mare decât în spaţiul reciproc. în special pentru sistemul triclinic şi monoclinic. Există şi posibilitatea utilizării algoritmilor genetici pentru indexarea difractogramelor. Deci se cunosc un număr limitat de vectori ai reţelei reciproce şi se urmăreşte să se găsească vectorii elementari ai reţelei reciproce care să genereze întreaga reţea reciprocă. este 2 şi aşa mai departe. Numărul unghiurilor de difracţie din setul de bază este egal cu numărul parametrilor ce caracterizează celula elementară. Această metodă este metoda directă de căutare în spaţiul direct. iar a doua variantă este mai eficientă pentru sisteme cu simetrie joasă. se variază parametrii celulei elementare a. Valoarea indicilor Miller variază între 0 308 . pentru sistemul cubic numărul unghiurilor din setul de bază este 1 pentru sistemul tetragonal. O altă posibilitate de căutare este utilizarea metodei Monte Carlo. utilizând spaţiul direct. β . Dintre programele de calcul care utilizează căutarea în spaţiul direct. merită menţionate următoarele: Autox [2]. Căutarea în spaţiul reciproc poate fi implementat în două variante. Metodele de indexare care utilizează spaţiul reciproc sunt mai eficiente decât cele de căutare în spaţiul direct. Timpul de calcul. În cazul indexării. este o metodă iterativă şi Monte Carlo ce utilizează poziţiile liniilor de difracţie pe baza descompunerii difractogramei şi extragere a intensităţilor de difracţie LSI (Least Square Indexing) and LP-Search [5]. Astfel.10 şi se caută cea mai bună potrivire dintre poziţiile calculate şi observate ale unghiurilor de difracţie. dacă se lucrează în spaţiul direct. pentru sistemul triclinic fiind 6.c cu aproximativ 0. Din vectorii elementari ai reţelei reciproce rezultă imediat vectorii elementari ai reţelei directe. McMaille [3] şi SVDIndex [4] care se bazează pe metode de căutare de tip Monte Carlo. Prima este mai eficientă pentru sisteme cu simetrie ridicată de la cubic la ortorombic. Vectorii reţelei reciproce sunt legaţi de unghiurile de difracţie prin relaţia (2sin θ )/ λ =1/d. γ cu 0. Aceasta este tot o variantă a metodei Monte Carlo. O altă tehnică de indexare foarte puternică şi care este implementată în programul de calcul de către firma Bruker Topas. şi anume: metoda de încercare şi eroare şi metoda de căutare pe zone. La căutarea în spaţiul reciproc se caută să se găsească vectorii elementari ai celulei reciproce folosind unghiurile de difracţie. mai ales în cazul compuşilor cu simetrie scăzută.01 Å şi unghiurile α. care se numeşte setul de bază şi care sunt liniile de difracţie cu cele mai mici unghiuri.b. Metoda de încercare şi eroare se bazează pe atribuirea de indici Miller la un număr minim de peak-uri de difracţie.valori pentru care poziţiile maximelor de difracţie calculate se potrivesc cât mai bine cu cele observate.

Metoda căutării pe zone începe prin căutarea zonelor unidimensionale. după care se calculează factorul de încredere.şi valori maxime preselectate pentru h.k.0. 0. km.l. dacă în intervalul respectiv se găseşte soluţia elementară. Pentru fiecare permutare a indicilor se determină parametrii celulei elementare.0. Având parametrii celulei elementare. l notate cu hm. 0. dar cele mai bune rezultate se obţin pentru sistemele cu simetrie ridicată. lm. Programele de calcul care fac indexarea prin metoda Dicvol încep de la sistemul cubic. adică de tipul h. se generează unghiurile de difracţie şi se verifică dacă unghiurile calculate se potrivesc cu cele experimentale. atunci această metodă nu poate să facă corect indexarea deoarece nu are posibilitatea să dis309 .l şi construirea zonelor tridimensionale utilizând liniile comune din zonele bidimensionale. Operaţia se repetă atribuind alţi indici Miller primelor maxime de difracţie şi se ordonează soluţiile în ordinea descrescătoare a factorilor de încredere. Dacă difractograma experimentală are şi impurităţi.l şi bidimensionale. se generează toate poziţiile posibile ale maximelor de difracţie şi se verifică dacă poziţiile unghiulare ale maximelor de difracţie observate sunt incluse în cele calculate în limita unor erori de măsură.k. Se reţin acele valori ale parametrilor de reţea care se potrivesc cel mai bine cu valorile experimentale şi se calculează pentru acestea factorul de încredere. Se testează toate sistemele cristalografice începând de la sistemul cubic până la sistemul triclinic. 1.0. se încearcă atribuirea indicilor Miller pentru toate reflexiile Bragg observate. Când o zonă tridimensională (reţeaua) a fost construită. h.k. Metoda Dicvol [7] este o metodă de căutare în spaţiul direct şi se bazează pe metoda dihotomiei care constă în variaţia lungimilor celulei elementare şi a unghiurilor dintre axe între anumite limite şi reducerea intervalelor respective. Această metodă este o metodă de căutare în spaţiul reciproc şi se bazează pe atribuirea unor indici Miller la primele linii de difracţie.3 Câteva metode uzuale de idexare Metoda Treor. adică de tipul h. 0. Aceste valori sunt între 2 şi 4.0.0.h. care este de simetria cea mai ridicată şi termină cu sistemul triclinic. Se reţin acei parametrii de reţea pentru care unghiurile calculate se potrivesc cel mai bine cu unghiurile experimentale şi care indexează toate sau aproape toate unghiurile experimentale.0. Cu acest program se poate indexa orice sistem cristalografic. Metoda Dicvol. după care se calculează parametrii celulei elementare [6].

Cu această metodă de indexare se obţine şi grupul spaţial la care aparţine compusul. Pentru fiecare combinaţie de parametrii ai celulei elementare se generează poziţiile maximelor de difracţie. b) Construirea reţelelor tridimensionale prin găsirea de zone bidimensionale care au o zonă unidimensională comună. Această metodă de calcul. Pe lângă aceste programe de calcul am mai elaborat şi noi un program [10] care se bazează pe căutarea în spaţiul direct pentru parametrii reţelei cuprinşi într-un anumit interval şi cu un anumit pas. Maximelor de difracţie experimentale li se pun în corespondenţă cele mai apropiate maxime de difracţie calculate. Un număr de 30-35 de reflexii Bragg este recomandat. se calculează eroarea medie dintre poziţiile maximelor calculate şi cele experimentale şi se trece la pasul următor. Programul mai ţine cont de densitatea aproximativă a compusului şi de numărul posibil de molecule pe celula elementară. împreună cu programul aferent. Cele mai comune versiuni sunt ITO13 şi ITO15. în acest caz. În general. cu atât şansa de a obţine mai repede soluţia corectă la indexare este mai mare. rămânând una sau două linii de difracţie neindexate. cu condiţia ca liniile de difracţie neindexate să fie de mică intensitate şi. dar care nu este foarte sensibilă la impurităţi se numeşte X-cel [8]. c) Reducerea celulei găsite şi transformarea acesteia în una din cele 14 reţele Bravais. Pentru a se indexa cu această metodă se parcurg următorii paşi: a) Găsirea potenţialelor zone utilizând primele 20 unghiuri Bragg. După indexare cunoaştem volu310 .tingă între liniile de difracţie ale compusului şi ale impurităţilor. Metoda Ito. s-ar putea ca soluţia să fie corectă. Se ordonează soluţiile în ordinea descrescătoare a erorii medii. O altă observaţie în alegerea soluţiei corecte se referă la densitatea calculată. Programul cere cel puţin 20 de reflexii Bragg şi nu funcţionează cu mai puţine linii de difracţie. acestea să aparţină unor impurităţi. O metodă asemănătoare cu Dicvol şi care se bazează tot pe procedeul dihotomiei. în special triclinic şi monoclinic. Programul Ito este folosit în special pentru indexarea sistemelor cu simetria joasă. d) Atribuirea indicilor Miller pentru toate maximele observate şi calcularea figurilor de merit. dar aceasta trebuie confirmată. O primă observaţie este că dacă nu au fost indexate toate liniile de difracţie. realizează o căutare a zonelor în spaţiul reciproc şi transformare a axelor celulei pentru a găsi o celulă cât mai potrivită [9]. din programele de indexare rezultă mai multe soluţii foarte diverse între ele. Ca o remarcă generală: cu cât poziţiile liniilor de difracţie sunt determinate mai precis şi cu cât proba de analizat este mai pură.

1.mul celulei elementare şi dacă presupunem un anumit grup spaţial putem determina numărul de molecule pe celula elementară şi de aici densitatea. 2. Dacă indexarea se face cu Dicvol.1 Extragerea intensităţilor de difracţie Metoda Le Bail de extragere a intensităţilor de difracţie este inspirată din metoda Rietveld. Deşi metoda este în general robustă. Obţinerea modelului structural Pentru obţinerea modelului structural există două posibilităţi. Rezultatele intensităţilor de difracţie extrase nu depind de valoarea intensităţilor iniţiale. Le Bail a extins această metodă pentru estimarea valorilor absolute a factorilor de structură. Treor sau Ito. când nu există un model structural. în caz contrar. Densitatea calculată trebuie să aibă o valoare rezonabilă în funcţie de elementele care se găsesc în compus. Dacă indexarea este corectă. Rietveld a propus un algoritm simplu de evaluare a factorilor de structură observaţi pentru o suprapunere parţială sau totală a maximelor de difracţie. mai ales atunci când fondul de difracţie este supraestimat. Vom descrie pe scurt cele două tipuri de metode. Dacă s-a determinat densitatea experimentală. Intensităţile de difracţie pentru iteraţia (r+1) se exprimă în funcţie de intensităţile de difracţie pentru iteraţia r. şi anume. Există două tehnici de extragere a intensităţilor de difracţie. Le Bail a propus o metodă iterativă de determinare a intensităţilor de difracţie observate. există şi cazuri când prezintă instabilităţi. 2. modelul structural obţinut nu va putea fi rafinat. mai întâi se extrag intensităţile de difracţie deoarece se ştie că în cazul difracţiei pe pulberi foarte multe intensităţi de difracţie se suprapun. Dar cel mai important aspect care a contribuit la creşterea popularităţii metodei 311 . se pot considera valorile calculate ale intensităţilor de difracţie. Vom descrie pe scurt cele două metode. Ca intensităţi de pornire. metoda Le Bail şi metoda Pawley. şi anume: metode utilizate în cazul monocristalelor şi metode de căutare în spaţiul direct. figura de merit trebuie să fie neapărat mai mare ca 4. Un alt criteriu foarte important este valoarea figurii de merit. 2. atunci putem să mergem mai departe pentru a obţine modelul structural şi să-l rafinăm. atunci o putem compara cu densitatea calculată şi să confirmăm dacă indexarea poate fi corectă cu soluţia aleasă.1 Metodele pentru monocristale aplicate la pulberi În acest caz.

Datorită faptului că atomii oscilează în jurul poziţiilor de echilibru. numărul de intensităţi care se pot obţine pentru pulberi este de ordinul a zecilor până la 3 sau 4 sute.5 dintr-un pas de înregistrare a difractogramei. factorul de polarizare.1. în unele cazuri s-au obţinut rezultate bune. Paşii care trebuie urmaţi sunt: (i) Corectarea intensităţilor de difracţie. (ii) Determinarea factorului de scală şi a factorului global de temperatură. după ce au fost obţinute intensităţile de difracţie. Experienţa arată că aceasta are loc când poziţiile a două maxime de difracţie sunt mai apropiate unele de altele cu 0. 2. care nu necesită un model structural. În timp ce pentru monocristale se pot colecta câteva mii de intensităţi. pentru obţinerea modelului structural se poate urma procedeul care se foloseşte pentru monocristale. Cu toate acestea. Dar factorii de 312 . Dacă se fac corecţiile intensităţilor de difracţie. este corectarea acestora de factori fizici sau geometrici care afectează intensităţile de difracţie. Mărimea matricei nu este o problemă deoarece matricea este cvasidiagonală. Dificultatea adaptării procedeului de calcul pentru monocristale la pulberi provine din aceea că metodele de calcul sunt metode statistice şi necesită un număr mare de intensităţi de difracţie. factorul de absorbţie şi factorul de extincţie. Unii autori au căutat să elimine maximele negative prin rafinarea mărimii factorilor de structură. metoda Pawley rezolvă problema de extragere a intensităţilor de difracţie printr-o tehnică matricială. Aceştia sunt: Factorul Lorentz.2 Aplicarea unor procedee de calcul pe monocristale la pulberi După extragerea intensităţilor de difracţie prin metoda Le Bail sau Pawley. Aceste corecţii pot să fie făcute şi în cadrul extragerii intensităţilor de difracţie. în schimbul intensităţilor de difracţie. termenii nediagonali diferiţi de zero provin de la suprapunerea maximelor de difracţie vecine. (iii) Determinarea fazei factorilor de structură. În timp ce metoda Le Bail este o metodă iterativă.Le Bail este că aceasta poate să fie uşor încorporată în tehnica Rietveld de rafinare. Metoda Pawley este o metodă pentru determinarea intensităţilor de difracţie din difractograma de raze X. Primul pas. Deşi procesul de rafinare este în general stabil. intensităţile acestora se reduc cu un factor de temperatură. se determină factorul de scală şi de temperatură şi se obţine modulul factorilor de structură. maxime de difracţie foarte apropiate pot duce uneori la apariţia de maxime de difracţie negative.

Cunoscând factorii de structură. Determinarea fazei factorilor de structură când se cunoaşte modulul factorilor de structură este cea mai complexă problemă în procesul de determinare a structurilor cristaline pentru monocristale. faza acestor numere complexe este arbitrară pentru structuri necentrosimetrice şi are valoarea 0 sau π pentru structuri centrosimetrice.structură sunt numere complexe. după relaţia: 2 1 P(u. Metodele de determinare a fazei factorilor de structură se numesc în cristalografie metode directe şi se bazează pe metode statistice şi probabilităţi condiţionate.l cos( 2π ( hx + ky + lz )) V h . mai ales. (v) Rafinare Fourier. Modelele structurale obţinute prin metodele directe sau metoda Patterson sunt adesea incomplete chiar şi pentru monocristale. ρ ( x. (iv) Sinteza Fourier şi sinteza Patterson. y . iar pentru pulberi cu atât mai mult pentru că numărul de intensităţi experimentale este mult mai mic. k . atunci putem face sinteza Patterson. Cu ajutorul acestei relaţii putem să determinăm distanţe dintre atomi şi. Cele mai importante tehnici de rafinare Fourier sunt: Sinteze Fourier succesive şi Sinteza Diferenţă. w reprezintă respectiv Δ x.l unde u. Pentru a îmbunătăţi şi completa modelul se apelează la tehnici de rafinare Fourier. putem să determinăm densitatea electronică de sarcină în celula elementară. Δ y. cu ajutorul relaţiei: 1 ∑ Fhkl exp( −2πi(hx + ky + lz )) V hkl Densitatea electronică de sarcină se exprimă direct în unităţi electronice astfel încât. Dacă nu s-au determinat fazele factorilor de structură şi avem numai modulul acestora. deci în acest caz factorii de structură sunt numere reale pozitive sau negative. dacă densitatea electronică este mai mare. există o probabilitate mai mare să avem atomi şi ne indică aproximativ şi numărul de atomi Z pentru maximul de densitate electronică respectivă.v. dacă aceştia există. k . distanţele dintre atomii grei. Δ z. Pe baza densităţii electronice se poate construi un model structural aproximativ. Cu ajutorul sintezei Patterson putem localiza poziţiile atomilor grei din celula elementară. v. z ) = 313 .w) = ∑ Fh .

2. în celula elementară putem avea o moleculă sau mai multe în unitatea asimetrică. metoda Monte Carlo inversă [11]. Metoda de căutare în spaţiul direct Metoda de căutare în spaţiul direct sau metoda grid search este o metodă de localizare a unităţilor structurale în celula elementară. Astfel. Această metodă nu cere extragerea factorilor de structură din difractogramă. Dacă. ca de exemplu. o variantă a acesteia numită parallel tempering şi tehnica algoritmilor genetici. La aceasta se adaugă gradele de libertate interne legate de modificarea configuraţiei moleculare prin modificarea unghiurilor de torsiune. Aceasta înseamnă că nu se pot testa toate configuraţiile şi de aceea se apelează la metode probabilistice. eventual a unghiurilor de valenţă şi a distanţelor dintre atomi. mai rar. se testează potrivirea dintre difractograma calculată şi cea expe314 . presupunem că pentru fiecare grad de libertate corespunde doar 10 zece paşi de căutare. octaedrii etc. Putem să avem atomi. Pentru compuşii anorganici avem atomi sau grupe de atomi aranjaţi sub diverse forme. tetraedrii. rezultă că numărul total de configuraţii care trebuie să fie testat este de 10x10=1010. În cazul metodei de răcire simulată. ceea ce cere un timp foarte mare de calcul. Să presupunem că avem doar o moleculă pe celula elementară. fragmente din molecule. În acest caz. se generează configuraţii întâmplătoare în spaţiul parametrilor de căutare.2. de exemplu. pentru fiecare compus avem un număr de grade de libertate care trebuie să fie modificate până când difractograma calculată se suprapune cât mai bine peste difractograma experimentală. 3 grade de libertate de rotaţie. ca de exemplu. dintre care amintim: Răcire simulată (simulated annealing). Există diverse tehnici Monte Carlo de căutare a configuraţiei optime. Să presupunem că la cele 6 grade de libertate (translaţii şi rotaţii) se adaugă doar 4 grade de libertate interne şi să avem în total 10 grade de libertate. Pentru moleculele organice ca unităţi structurale putem să considerăm întreaga moleculă ca fiind rigidă sau fragmente rigide din molecula care se mişcă unele în raport cu altele. modificându-şi configuraţia prin modificarea unghiurilor de torsiune. grupe de atomi aranjaţi într-o anumită configuraţie. molecule. astfel ca difractograma calculată să se suprapună cât mai bine cu difractograma experimentală. Tipul unităţilor structurale care trebuie să fie localizate în celula elementară depinde de natura compusului. Pentru moleculele organice. celelalte molecule fiind generate prin operaţiile de simetrie ale grupului spaţial care caracterizează compusul respectiv. distanţe. avem în mod obligatoriu 3 grade de libertate de translaţie. unghiurilor de legătură dintre atomi şi.

Pentru ca unităţile structurale să nu se apropie foarte mult unele de altele. Ca o măsură a potrivirii dintre difractograma calculată şi cea experimentală. Astfel. Parallel Tempering (PT) [15]. Lorentziana sau pseudos-Voigt. poate să se introducă ca şi criteriu pentru modelul obţinut. minimizarea energiei potenţiale de interacţiune inter . Una dintre posibilităţi este să se aleagă ca fiind reziduul R. în scopul determinării minimului absolut. în faza iniţială a procesului de căutare a configuraţiei optime. se consideră funcţia de cost CF.şi intramoleculară. Periodic se testează configuraţiile paralele şi se alege configuraţia optimă prin aceeaşi schemă ca în cadrul unui singur proces. temperatura se scade treptat. şi anume. 315 . În timpul procesului de căutare. În schimbul utilizării unui singur lanţ de configuraţii cu descreşterea temperaturii. se aleg de la început mai multe configuraţii (un număr mic de configuraţii). funcţia care descrie fondul (background) şi o funcţie care sumează liniile de difracţie. posibilitatea de a se obţine minime locale este mai mică. se poate uşor trece de la un minim local la un alt minim. cu probabilitatea exp(. pentru a evita probabilitatea să cădem într-un minim local. Orientarea preferenţială poate fi descrisă prin funcţii de tip March-Dollase. fiecare configuraţie porneşte cu o anumită temperatură care scade treptat.rimentală. probabilitatea de a găsi un alt minim este de asemenea mică.Δ CF/T). Probabilitatea relativă a celor două configuraţii de încercare respectă legea lui Boltzman: P1/P2=exp[(CF2-CF1)/T]. Totuşi. dar în faza finală. Difractogramele pot fi modelate ca o sumă de două funcţii. şi anume. Funcţia de cost CF se poate alege în diverse moduri. atunci se reţine noua configuraţie. Profilul liniilor de difracţie se descrie de obicei prin funcţii standard de tipul Gaussiana. Există mai multe programe de calcul care au implementat această modalitate de determinare a minimului global.14]. Dacă CF este mai mare decât cea precedentă. în afară de potrivirea dintre difractograma calculată şi cea observată. atunci se reţine noua configuraţie. T fiind temperatura distribuţiei. În procesul de căutare a minimului global ca şi Cost Function. definit în felul următor: Rwp=[ Σ i wi ( y obd i − i y calc i )2 Σ i wi ( y ) obs 2 ]1/2 Dacă funcţia de cost CF este mai mică decât cea precedentă. fiecare linie de difracţie fiind centrată corespunzător. un alt algoritm a fost dezvoltat. Fox [13. când T este foarte mic. În felul acesta. dintre care amintim. se poate introduce un factor numit ‘anti-bump’. Powder Solve [12].

se poate aproxima prin diverse funcţii: de tip Gauss. yci este difractograma care se calculează la pasul i pentru că difractograma se calculează în paşi. factorul de absorbţie. deoarece nu sunt necesare variaţii mari ale acestor parametrii. Forma liniilor de difracţie este o convoluţie datorată probei şi efectelor instrumentale. xj. factorul de scală.factorul de temperatură (care se datoreşte vibraţiilor termice). s-a făcut o căutare globală. de aceea este posibilă ajustarea parametrilor prin metoda celor mai mici pătrate.factorul de ocupare. Lorentz. fondul de difracţie în punctul respectiv etc. pseudo-Voigt. Cu alte cuvinte. etc. yci depind de o serie de factori. potrivindu-se parametrii de structură astfel încât difractograma calculată să concorde cât mai bine cu difractograma observată. iar wi=1/yi este factorul de ponderare. este necesară rafinarea parametrilor de care depinde difractograma experimentală în aşa fel încât difractograma calculată să se suprapună cât mai bine peste difractograma experimentală [16].factorul de structură pentru atomul j. Expresia factorilor de structură este dată de relaţia: Fhkl ⎛ B sin 2 θ ⎞ = ∑ N j f j exp[2Π(hx j + ky j + lz j )]exp⎜ ⎟ ⎜ − λ2 ⎟ j ⎠ ⎝ (2) unde: Nj . pV. Ajustarea parametrilor de care depinde difractograma experimentală se face prin metoda celor mai mici pătrate. În cazul metodei Rietveld de rafinare se presupune că suntem în apropierea unui minim. yj. care este descrisă ca fiind o combinaţie a funcţiei Gauss şi Lorentz: 316 . Funcţia ce trebuie minimizată este: (1) S y = wi ( y i − y ci ) 2 ∑ i unde yi si yci sunt intensităţile observate şi calculate la pasul i.coordonatele atomului j. fj . zj . Profilul liniei de difracţie. Rafinarea structurilor cristaline prin metoda Rietveld După obţinerea unui model structural. ϕ. factorul Lorentz–polarizare. funcţia de profil pentru liniile de difracţie. B .3. cea mai utilizată este funcţia pseudo Voigt. dându-se intensitatea de difracţie la fiecare pas. cel mai utilizat este GSAS [17]. Dintre programele de calcul. Dintre acestea. şi anume: de factorii de structură şi indicii Miller corespunzători factorilor de structură respectivi. În cazul obţinerii modelului structural.

Forma funcţiei de profil a liniilor de difracţie depinde şi de semilărgimea la semiînălţime a liniei de difracţie respective. Lărgimea la semiînălţime se notează cu FWHM (full width half maximum) şi are următoarea dependenţă unghiulară. March-Dollase [19]: I cor = I obs (G 2 cos2 α K + 1 2 sin α K ) −3 / 2 G (4) unde. care iau în considerare concordanţa dintre modelul calculat şi cel experimental şi care se definesc în felul următor: RB = RP = ∑| I K ( obs ) ∑| y − y ∑y i i ∑I − I K ( calc) | (5) (6) K ( obs ) ci | 317 .pV = ηL + (1-η)G unde: pV . Aceasta face ca unele maxime de difracţie să fie mai intense. ca de exemplu.coeficientul March care variază între 0 şi 1. L fiind funcţia Lorentz. Icor . G funcţia Gaus iar η parametru de amestecare a celor două funcţii. Orientarea preferenţială poate fi modelată matematic cu ajutorul unor funcţii. exprimată prin funcţia lui Caglioti[18]: H 2 = U tan 2 θ + V tanθ + W (3) unde. G . Calitatea rafinării se apreciază pe baza unor indici de rezidiu. unde 0 se referă la 100% orientare preferenţială a cristalitelor în probă şi 1 se referă la orientare complet întâmplătoare a cristalitelor. PK este funcţia care descrie orientarea preferenţială.funcţia pseudo-Voigt . V. H este lărgimea la semiînălţime şi U. Orientarea preferenţială are loc când cristalitele din probă tind să se orienteze preferenţial după anumite direcţii. Iobs . iar altele mai puţin intense faţă de cazul când nu ar exista orientare preferenţială.unghiul ascuţit dintre vectorul de împrăştiere pentru reflexia K şi direcţia preferenţială de orientare a planului cristalitelor faţă de planul probei. W sunt parametri care se pot rafina. αK .intensitatea măsurată.intensitatea corectată pentru orientare preferenţială.

deformaţiile de reţea. atunci la funcţia din formulă (5). Dacă rafinarea se face ţinând cont de constrângerile slabe. funcţia ce trebuie minimizată este: SyR= ∑ w (y i i oi-yci) 2+C w ∑ w (R -R j oj cj(x)) 2 . mai trebuie să adăugăm şi termenii care iau în considerare constrângerile slabe. pentru ciclu benzenic se impun constrângeri slabe referitoare la planeitatea acestui ciclu. factorii care descriu asimetria liniilor de difracţie etc. C-O. La început se rafinează factorul de scală. factorul care descrie absorbţia razelor X şi factorul de polarizare. maximele de difracţie calculate sunt uşor deplasate faţă de cele experimentale. În acest caz. În general fondul difractogramei se descrie cu un polinom a cărui grad poate fi între 10 şi 40. Pentru o difractogramă oricât de perfectă. Profilul liniilor de difracţie depinde de parametrii ce caracterizează dimensiunile cristalitelor. La fel se pot impune constrângeri slabe pentru unghiurile de legătură şi pentru unităţile structurale care sunt planare. Există două tipuri de constrângeri: constrângeri slabe sau “soft restrain”[21] şi “rigid body“[22]. Urmează rafinarea deplasării punctului de zero pentru difractogramă. factorul de temperatură şi coeficienţii polinomului care descriu fondul. În ultimele etape se rafinează poziţiile atomilor în celula elementară şi eventual factorii de ocupare pentru atomi. de exemplu C-C. pentru legături simple sau duble. în general trebuie impuse constrângeri. σ 318 este . Totuşi. am constatat că este necesar să se adopte următoarea strategie. În ceea ce priveşte rafinarea poziţiilor atomilor în celula elementară. Pentru o reuşită în rafinarea Rietveld trebuie adoptată o anumită strategie referitoare la ordinea în care se rafinează diferiţi parametrii de care depinde difractograma [20]. Din literatură şi din experienţa proprie. aceste distanţe pot să varieze între anumite limite. wj=1/ σ 2 (Roj) (8) (yoi) j unde yoi şi yci sunt intensităţile observate şi calculate la pasul i. mai ales dacă avem un număr mare de atomi pe celula elementară.RWP 2 ⎧ ⎪ ∑ wi ( y i − y ci ) ⎫ ⎪ =⎨ ⎬ 2 ⎪ ⎪ ⎩ ∑ wi ( y i ) ⎭ 1/ 2 (7) Cei mai utilizaţi indici sunt RP si RWP. De exemplu. Constrângerile slabe este necesar să fie impuse asupra distanţelor dintre atomi deoarece există distanţe standard dintre atomi. În continuare se rafinează parametrii de reţea după care urmează parametrii care descriu profilul liniilor de difracţie. care trebuie minimizată. wi=1/ σ 2 (yoi) .

când în afară de constrângerile slabe se aplică şi constrângeri ca molecula să fie planară. cw este un factor de ponderare care permite să se varieze contribuţia constrângerilor în procesul de rafinare. ca de exemplu. În general. De exemplu. atunci este necesară aplicarea constrângerilor de planeitate [23]. Exemple privind determinarea structurii cristaline din pulberi 4. au fost considerate ca “rigid body”. şi se tot reduce în procesul de rafinare. Unităţile glicozidice au fost legate între ele prin constrângeri slabe.z). β -ciclodextrina este compusă din 7 unităţi glicosidice. Roj este valoarea aşteptată pentru mărimea stereochimică respectivă care poate fi lungime de legătură. Cu cât cw este mai mare. iar Rcj(x) este valoarea calculată din poziţiile atomilor (x. unghiuri etc (aşa numita pseudo observabilă). În cazul programului de rafinare GSAS [17]. Complecşii de incluziune cu β -ciclodextrina se folosesc pentru a îmbunătăţi biodisponibilitatea. Aceasta are o formă toroidală în care se pot încapsula diferiţi compuşi bioactivi şi se poate realiza eliberarea treptată a acestora.y. δ (Roj) este deviaţia standard a pseudo-observabilei. În cazul în care există şi grupări plane. permiţând translaţia şi rotaţia acestora.1 Determinarea structurii cristaline pentru complexul de incluziune Atenolol + β ciclodextrina. 4. Acest fel de constrângeri urmăreşte să se reducă numărul parametrilor ce trebuie rafinaţi şi obţinerea unui model de structură realist. se porneşte cu un cw mare. solubilitatea şi stabilitatea diferitelor medicamente în soluţii apoase. de ordinul miilor. 319 .deviaţia standard a intensităţii lor măsurate. aceasta înseamnă că atomilor care aparţin unui corp rigid nu le pot fi aplicate constrângerile slabe în acelaşi timp. cu atât constrângerile sunt mai puternice. Constrângerile puternice sau “rigid body” se aplică atunci când urmărim ca o grupare de atomi să se mişte împreună sau să se modifice distanţele dintre atomi dar forma ansamblului să nu se schimbe. împreună cu atomii de oxigen secundari. în procesul de rafinare a complecşilor de incluziune. constrângerile puternice “rigid bodies” sunt incompatibile cu constrângerile slabe. una dintre aceste unităţi este prezentată în figura 1. fiecare din cele şapte unităţi glicozidice care intră în componenţa ciclodextrinei. pentru ciclu benzenic.

indexarea s-a făcut cu ajutorul programului de calcul Ito [9]. Structura cristalină pentru atenolol nu a fost cunoscută la acel moment. configuraţia moleculară pentru atenolol a fost calculată cu ajutorul programului de modelare moleculară Cerius 2. Dar la interacţiunea cu atenololul structura cristalină se modifică total în sensul că se schimbă grupul spaţial.0 [20]. grupul spaţial. Configuraţia moleculară pentru β ciclodextrină a fost luată din baza de date Cambridge Structural Database [29].Figura 1 Unitate glicozidică din componenta β Ciclodextrina Noi am urmărit să determinăm structura cristalină pentru Atenolol cu β -Ciclodextrina. adică să determinăm sistemul cristalografic. celula elementară şi configuraţia moleculară. În urma indexării s-a stabilit că. celula elementară şi modul în care interacţionează şi se cuplează cele două molecule pentru a forma complexul de incluziune. complexul de incluziune cristalizează în sistemul monoclinic având grupul spaţial C2 cu 4 molecule de 320 . De aceea. Formula structurală pentru Atenolol este prezentată în figura 2. Structura cristalină pentru β Ciclodextrină se cunoştea. Figura 2 Formula structurală pentru Atenolol După determinarea poziţiilor maximelor de difracţie.

s-a pus condiţia ca toţi cei 7 atomi de oxigen O4 să fie aproximativ în acelaşi plan.640. Pentru unităţile glicozidice. β =110. iar fp pentru restrângerile de planeitate. Ca grade de libertate au fost translaţiile şi rotaţiile pentru molecula de ciclodextrină şi molecula de atenolol. Au fost aplicate restrângeri de planeitate pentru gruparea fenil din cadrul atenololului. o valoare plauzibilă pentru compuşii organici care conţin C. restrângerile slabe referitoare la planeitatea atomilor (O4)n a fost în cazul ciclodextrinei de 0. Pentru funcţiile de profil s-au folosit 12 parametrii. Pentru obţinerea unui model structural realist s-a procedat la aplicarea unor serii de restrângeri şi constrângeri. O.55Å3. În schimb.05 Å. s-a procedat la rafinarea modelului structural prin metoda Rietveld. unghiurile de torsiune pentru molecula de atenolol. unele în raport cu altele. Volumul celulei elementare este V=6772. Au fost rafinaţi de asemenea parametrii termici. Densitatea calculată este ρ =1. c=15. Fiecare unitate glicozidică. fd fiind factorul de pondere pentru restrângerile de distanţe. cu ajutorul restrângerilor de planeitate.375g/cm3. au fost aplicate restrângeri slabe pentru toate distanţele dintre atomi şi unghiurile de legătura dintre aceştia. factorii de pondere pentru restrângerile slabe au fost: fd=fa=fp=5000. N. adică fondul de difracţie care a fost aproximat cu un polinom. punctul de zero pentru 321 . pentru restrângerile slabe este permisă mişcarea atomilor. background-ul. dar între anumite limite. utilizând tehnica ”simulated anealling” şi ”paralel tempering”. Reamintim că în cadrul unui grup de atomi care au fost definiţi ca “rigid bodies” nu se permite nici o mişcare a atomilor din cadrul grupului. iar oxigenii de la capătul grupărilor glicozidice au fost legaţi între ei prin restrângeri slabe (soft restrains). De asemenea. De asemenea. s-a permis rotaţia şi translaţia. fa pentru restrângerile de unghiuri.ciclodextrină şi 4 molecule de atenolol pe celula elementară şi următorii parametrii de reţea: a= 18. parametrii de reţea. În continuare. γ =900.450Å. În urma modelării s-a constatat că molecula de atenolol intră în cavitatea β -ciclodextrinei. Iniţial.649Å . Restrângerile slabe nu se pot aplica pentru atomii din cadrul unui grup aparţinand la “rigid body”. Obţinerea modelului structural s-a făcut cu ajutorul programului de calcul. a fost considerată ca “rigid bodies”. b=24. Astfel. α =900.914Å. împreună cu atomii de oxigen O4. Pentru aceasta s-a utilizat programul de calcul GSAS. rigidizarea este cu atât mai mare cu cât factorii de pondere pentru restrângerile slabe sunt mai mari. H. Profilul de difracţie a fost aproximat prin funcţii de tip pseudo-Void. unghiurile de torsiune dintre unităţile glicizidice şi unghiurile dintre unităţile glicozidice..

Configuraţia moleculară pentru complexul de incluziune văzut după axa b şi după axa c este prezentată în figura 3.β CD. Figura 3 Configuraţia moleculară pentru complexul de incluziune atenolol. s-a obţinut un rezidiu Rp=7.8% şi Rwp=11. vedere după axa b şi c. bineînţeles. Se observă ca moleculele de ciclodextrină şi cele de atenolol se grupează între ele prin legături de hidrogen.β -Ciclodextrina. În final.2. parametrii de poziţie.58%. 4. Structura cristalină pentru N-(5-etil-[1.difractogramă şi.4]-tiadiazol-2-il0-toluensulfonamida Structura cristalină pentru acest compus a fost determinată prin combinarea difracţiei de raze X pe pulberi cu informaţii obţinute din RMN pen322 .3. În mod asemănător s-a determinat structura cristalină pentru complexul de incluziune Acid Mefenamic. formând un fel de dimeri. care au fost în număr de 288.

dintre care 6 corespund pentru poziţia moleculei şi orientarea acesteia. b=15. s-a calculat densitatea ca fiind ρ =1.072. Deoarece nu există nici un motiv ca moleculele să se plaseze în poziţii speciale. folosind programul de calcul Dash [30].5364Å. prin ajustarea a 10 grade de libertate. Modelul obţinut în acest mod a fost în continuare rafinat prin metoda Rietveld.5-500 au fost modelate cu funcţii de profil de 323 .54056Å. Prin examinarea difractogramei cu ajutorul programului de calcul Checkcell [28].37g/cm3. rezultă că numărul de molecule pe celula elementară este 8. S-a lucrat varianta geometria Bragg-Brentano θ -2 θ prin reflexie. Cea mai bună soluţie corespunde sistemului ortorombic cu următorii parametrii de reţea: a=8. Noi vom descrie în special aportul difracţiei de raze X la determinarea structurii cristaline pentru acest compus. Menţionăm că. utilizând programul de calcul GSAS [17] combinat cu interfaţa grafică EXPGUI [31] . Difractograma de raze X pe pulberi a fost obţinută cu difractometrul de raze X. D8 Advance. iar 4 la unghiurile de torsiune pentru moleculă.0148 Å si c=21. prin urmare. se obţin informaţii structurale foarte importante. echipat cu un monocromator de Ge (111) pentru fasciculul incident pentru înlăturarea radiaţiei K α 2 şi. Determinarea structurii cristaline s-a făcut prin metoda căutării în spaţiul direct.3846 Å şi volumul celulei elementare fiind V=2740. în cele mai multe cazuri. Profilul maximelor de difracţie de pe întregul interval 2 θ = 3.914 Å3.05 şi Rwp=0. unghiuri fa şi planeitate fp au fost reduşi treptat în cursul ciclurilor de rafinare de la 500 la 100. ceea ce confirmă grupul spaţial ales din reflexiile interzise. S-a obţinut un fit cu Rp=0. Deoarece deplasarea chimică obţinută din RMN pe solide este sensibilă chiar şi la mici modificări de împachetare moleculară şi modificare conformaţională din spectrul RMN. Modelul structural de pornire a fost obţinut cu ajutorul programului de calcul Molden. Considerând 8 molecule pe celula elementară. Indexarea compusului s-a făcut utilizând programul de calcul Dicvol [9]. care reprezintă o valoare rezonabilă. s-au aplicat o serie de restrângeri slabe pentru distanţe. pentru un anumit grup de reflexii interzise corespund mai multe grupuri spaţiale. Factorii de pondere corespunzători restrângerilor pentru distanţe fd. La acest grup spaţial corespund un număr de 8 poziţii generale. Pentru a avea un model structural realist în timpul rafinării. Un factor de temperatură global a fost rafinat pentru toţi atomii. În continuare s-a făcut fitarea Le Bail a difractogramei experimentale pentru confirmarea grupului spaţial selectat.tru 13C şi din modelare moleculară. s-a utilizat radiaţia Cu K α 1 9 λ =1. unghiuri şi planeitate a grupării fenil. cel mai probabil grup spaţial a fost găsit ca fiind Pbca.

În figura 5 este prezentată difractograma experimentală. difractograma calculată şi diferenţa dintre difractograma calculată şi cea experimentală.079. Rwp=0.113.tipul pseudo-Voight cu 18 termeni. În figura 4 este prezentată împachetarea în celula elementară pentru compusul studiat şi aranjarea supramoleculară sub formă de două şuviţe formate din molecule puse cap la cap. s-au obţinut următorii factori care caracterizează figura de merit a modelului structural: Rp=0. 324 .71. În continuare. modelul a fost îmbunătăţit utilizând tehnici de modelare moleculară combinată cu informaţii obţinute din măsurători de deplasare chimică din spectul RMN.053. În final. Se observă o potrivire foarte bună între cele două difractograme. χ 2=6. Figura 4 Împachetarea în celula elementară şi aranjarea supramoleculară Un alt compus pentru care s-a determinat structura cristalină prin combinarea difracţiei pe pulberi cu spectroscopie RMN şi modelare moleculară a fost Etoxiazolamida [27]. Fondul de difracţie a fost modelat cu un polinom Chebyshev de ordinul întâi. deci modelul structural este corect. Rexp= 0.

Bratu. W. Monte Carlo indexing with McMaille. K. IUCr monographs on crystallography . Gavira Roumanian Reports in Physics. Appl. L.Koning.G. Oxford.Cryst. F. Appl. S. 13. Kern. Le Bail. 325 . Eds. 1. M. Baerlocher. Cryst. 356 (2003).E. (2004) M.M. (1969) 2. A.Leusen. J.Engel.Figura. 36. 10. 16. Oxford University Press. L. Gh. J. A. Autoindexing. 5 Comparaţie dintre difractograma observată şi cea calculată 5.Deem J. P. 32. C.(1999) V.Favre-Nicolin and R. 847-856. J. Shankland. 65. Boultif and D. A. in: Structure determination from powder diffraction data. A. 5. Appl. 2. Cryst. R.Appl. Moliterni. Cryst.D. Crystallogr. Mihailescu.Favre-Nicolin and R. Cryst. 1169.Falcioni. 33. 12. Visser. 69 (1992).B. J. K. I. (2004).Cerny J. 1754 (1999) H.G. Appl. and Ch. David.. 36.Cerny Z. 4. 7.W. 8. 11. Coelho.M Rietveld . 1180 (2000). 6.Simul. I. 51(7-10) 983 (1999) R. Rizzi. 89 (1969) Gh. F. 37.359 (1988) G. Appl. 219.Appl. 110 .Chem. Cryst. Appl. A.Pusztai . 25. P. Borodi. The Third Pharmaceutical Powder X-ray Symposium (PXRD-3). Giacovazzo. 3. Powder Diffraction.L.J. New York (2002) J. 14. Guagliardi.A. Altomare. 2. 15. Bibliografie 1.McGreevy. 724 (2004) J. Cryst.-E.-E. A. McCusker.Mol. O. 249 (2004) J.Appl.Wilke .W. 734. 9. Werner J. J. 35. Cryst. 19. 86 (2003).Phys.Werner. Lou¨er.Harris .Kristallogr.A. (2002) V.

(2002 22. W. Tripon. R. R. X. Cox. Bogdan. M.E. H.. Hangan. (1999) 23. McCusker. J. D. 28.B. 87545. 116. R. G. A. J. W. 36. Attfield and J. Tsoucaris.C. (2010) 27. 910. 267. Borodi. 26. G.I. I. David. Von Dreele General Structure Analysis System (GSAS). B. 84. Soc.C. G. (2002). Van de Streek.H. Shenk Acta Cryst.A. W. Appl.Mavridis.B. 31.39..E.Laugier.J. Appl. 1036. E. A. B47. L. Acta Cryst.Bochu CHECKCELL. 19. D. Peschar. Filip. G. Laboratoire des Materaux et du Genie Physique de l’Ecole Superieur de Physique de Grenoble. Hernanz. Mentzafos. De Ridder. M.A. Cryst.70. D.Nowell.C. D. Cryst.210. Steiner and G.Cole.Larson & R. 10. A. H. (1001) 326 . Phys. le Bas. USA. Von Dreele..17. Filip. 746 (1991) 24.Shankland. 32. Dinnebier Powder Diffraction 14.D. J. Borodi.Cole.Chem. R.Pop.Pidcock. France. Toby.and B. Filip.1039/c1cp21878f. Report LAUR 86-748.B B58 835.(1994) 30. B. Spectrochimica Acta A. Colaborative Computational Project Number 14 (CCP14). Acta. X. Dollase. 615. Filip. Borodi and C. DOI. Phys. J. B58.Appl. Cryst. J. T. 21. J. I. F.M. Goubitz.F. Acta Cryst. Motherwell.P.Am. 29. Chem. (1986) 20. 18. G.A. NM. K. C. Oprean and C.Cryst. G.Appl. Cryst. The Rietveld Method edited by R. Borodi. Helmbholdt. Dragan. Young Oxford University Press (1993) 19.S. C. (2006). Chem. Los Alamos National Laboratory. (2008) 25.B. Peschar. Bratu. L. K. R. 1041.5122. 34.Louer and P.Scardi J. B66. Koeller J. Morari. J.

.. 250 nm)... Doi ani mai târziu... Generalităţi Microscoapele sunt instrumente utilizate pentru a facilita observarea unor obiecte la o mărire mai mare decât cea a obiectului observat............. Ruska a creat primul microscop a cărui rezoluţie era superioară unui microscop optic. iar în 1939 primul microscop electronic de transmisie a fost produs în scopuri comerciale.. Printre alte surse se numără razele X şi neutronii. 327 ............ Cel mai comun microscop este lupa...... Lucian Barbu-Tudoran Cuprins 1........... MICROSCOPUL ELECTRONIC DE BALEAJ ŞI DE TRANSMISIE Microscopia electronică şef lucrări dr...... ceea ce înseamnă că două caracteristici aflate la o distanţă mai mică de 250 nm nu vor putea fi diferenţiate...... Rezoluţia este limitată de lungimea de undă a fotonilor utilizaţi ca sursă de iluminare a specimenului......IX............. obiect ce utilizează lentila pentru a focaliza lumina reflectată de un obiect într-o imagine mai mare..... 328 3......................... Accelerarea electronilor permite reducerea lungimii de undă a unui fascicul de electroni ceea ce face posibila vizualizarea detaliilor cele mai fine..... Compania Siemens a patentat invenţia celor doi germani....... Pentru observarea detaliilor mai mici a fost necesar crearea unui microscop care să utilizeze o sursă de iluminare caracterizată printr-o lungime de undă mult mai mică. Generalităţi . 338 1........... Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) ..... Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) .... fizicianul Ernst Ruska şi inginerul Max Knoll au construit un microscop electronic prototip......... Limitările microscopiei optice constă în rezoluţia obţinută prin această tehnică (aprox... Microscoapele optice (figura 1) sunt instrumente mai complexe care conţin un set de lentile care măresc imaginea..... În 1931......... 327 2...

Ca limitare se aminteşte natura bidimensională a proiecţiei rezultate.diafragma şi lentila condensor Figura 1. informaţiile aparţinând axei z se vor pierde. Electronii pătrund prin probă. Microscopul optic 2. Astfel obiectele având structură internă diferită pot fi diferenţiate deoarece proiecţiile acestora vor fi diferite. Organizarea unui microscop electronic 328 . Probele analizate trebuie să fie foarte subţiri deoarece ar absorbi o mare parte a fasciculului de electroni. interacţionează cu aceasta în grosimea ei. aceştia putând fi deviaţi sau nu. Microscopia electronică de transmisie (Transmission Electron Microscopy – TEM) Prin intermediul TEM imaginea observată este proiecţia probei în grosimea ei.1 – ocular 2 – revolver 3 – obiective 4 – viza macrometrică 5 – viza micrometrică 6 – platina 7 – sursă de lumină 8 . incluzând suprafaţa şi structurile interne.

Secţiune prin coloana unui TEM lele de aer. 329 . iar în final vor fi focalizaţi pe ecranul situat la capătul coloanei. Tunul de electroni Electronii sunt emişi de un filament supraîncălzit de un curent electric până când suficientă energie va fi produsă (aprox. prin probă. un vârf Wehnelt şi un anod de extracţie. Cele mai comune microscoape sunt cele de emisie termionică si FEG (Field Emission Guns). astfel circuitul fiind complet. Prin construirea unui cilindru Wehnelt. Prin conectarea filamentului de partea negativă a generatorului de energie. se asigură convergenţa optimă a electronilor încă din momentul emisiei. Electronii emişi au o distribuţie Boltzman a energiei şi trebuie să fie concentraţi pentru ca fasciculul rezultat să străbată coloana. Aceşti electroni vor penetra proba şi vor trece printr-o serie de lentile magnetice. 2500K) pentru a învinge ’’the work function’’ a metalului. În interiorul coloanei se va stabili un vid înalt pentru a minimaliza interacţiunile dintre electroni şi molecuFigura 2 . circuitul de interferenţă (biasing circuit). de obicei tungsten sau hexaborid de lantaniu. electronii pot fi pompaţi de către filament spre placa anodică şi coloana microscopului.Principiile funcţionării unui croscop electronic de transmite nu diferă cu mult faţă de cele ale unui microscop optic. lentile şi aperturi. În vârful coloanei există un emiţător de electroni cu voltaj înalt care va genera fasciculul de electroni care va traversa coloana. Aperturile de pe traseul fasciculul de electroni au rolul de a schimba contrastul şi rezoluţia imaginii. Pentru a modifica mărirea şi punctul focal al unei imagini se pot utiliza diferite lentile. Tunul de electroni are mai multe componente: filamentul. care este încărcat mult mai negativ decât filamentul în sine.

Emisia de electroni este asigurată de aplicarea unui puternic câmp electric imediat în vecinătatea vârfului filamentului. Mărimea şi gradul de apropiere a câmpului electric cauzează desprinderea electronilor de pe filament. iar principiul de funcţionare se aseamănă cu cel al funcţionării unui bec. pe măsură ce filamentul se încălzeşte electronii vor fi emişi. de aceea este mai eficient. dar are ”the work function” mai mică. Tipuri de tunuri de electroni: filament de tungsten şi cristal de hexaborid de lantaniu 330 . Figura 4. Schema unui tun de electroni Tipuri de tunuri de electroni Tungsten: filamentul este fabricat din tungsten. Hexaborid de lantaniu: este tot un filament de emisie termionică. FEG: filamentul nu este unul termic.Figura 3.

Prin urmare în urma trecerii fasciculului printr-o lentilă acesta va suferi o scindare. mărirea imaginii sau pattern-ul de difracţie. Coerenţa spaţială. Dacă electronii emişi sunt paraleli atunci fasciculul va fi coerent o mai multă perioadă. distribuţia energiei nu este sub forma unui singur peak. vor interfera distructiv. În cazul prismei lumina este refractată sub diferite unghiuri. În cazul lentilelor electro-magnetice acestea pot roti fasciculul de electroni dacă sunt ajustate corespunzător. Această apertură controlează contrastul unei imagini. Funcţia unei aperturi este determinată de poziţia acesteia în coloana microscopului. Dacă electronii sunt defazaţi.Fasciculul de electroni se caracterizează prin coerenţă. apertura condensator. iar fasciculul va pierde din intensitate. este localizată sub probă imediat după lentila obiectiv.focalizează şi proiectează imaginea finală pe suprafaţa folosită pentru vizualizare. Coerenţa temporală. Lentila obiectiv are rolul de a realiza primul pas de mărire şi focalizare a unei imagini. Deoarece electronii emişi sunt supraîncălziţi. ideal toţi electronii emişi ar trebui să fie în fază. este localizată în vecinătatea tunului de electroni şi este utilizată pentru concentrarea electronilor şi menţinerea coerenţei fasciculului. Lentilele Lentilele utilizate în microscopia electronică sunt bobine magnetice care au scopul de a focaliza şi direcţiona fasciculul de electroni. adică distribuţia energiei să fie o mică fracţiune din energia medie a electronilor. Dacă electronii sunt în fază ei vor interfera constructiv. Faza electronilor afectează coerenţa fasciculul. Lentila intermediară controlează. Se referă la intensitatea fasciculului. Ultima lentilă – lentila proiector . 331 . Această aberaţie cromatică se aseamănă cu scindarea luminii când o rază traversează o prismă. apertura obiectiv. Deoarece lentilele sunt reglate pentru o anumită lungime de undă acestea vor concentra electronii cu alte lungimi de undă mai puţin uniforme. În cazul unui microscop performant se doreşte ca raportul ∆E/E să fie cât mai mic. Când acest fenomen are loc imaginea se va roti pe măsură ce vor fi introduse în coloană alte lentile. Prima apertură. prin poziţia şi puterea ei. Cuplată cu apertura obiectiv va genera contrastul de amplitudine. Pentru formarea imaginii se folosesc 3 tipuri de lentile. lumina fiind descompusă în radiaţii cu lungimi de undă diferite. în schimb distribuţia este de tip Boltzman şi diferă în funcţie de natura filamentului. A doua apertură. Aperturile Aperturile sunt găuri de-a lungul coloanei microscopului care pot limita mărimea fasciculul de electroni.

goniometrul se poate roti pentru a schimba unghiul probei. luminozitatea fasciculului. Figura 5 . voltajul curentului etc.Holder utilizat în microscopia electronică de transmisie Dacă se doreşte vizualizarea unei probe sub diferite unghiuri sau realizarea unei tomograme. alinierea.Exteriorul microscopului Consola utilizatorului constă dintr-un ecran pe care se vor afişa parametrii sub care funcţionează microscopul precum: mărirea. În cazul microscopiei electronice de transmisie proba analizată este depusă pe o grilă de metal. iar legea conservării momentului va determina unghiul la care acesta a fost deviat de la traiectorie. Dacă electronul intră în contact cu atomi din probă poate suferi o ciocnire elastică. Principii ale formării imaginii În momentul în care fasciculul trece prin grosimea unui specimen au loc mai multe fenomene. Acest holder de metal. În cazul unei ciocniri inelastice electronul va ceda o cantitate variabilă de energie specimenului. prin intermediul goniometrului. Acest electron va cauza apariţia zgomotului în imagine. Pe consolă se mai află butoane care controlează poziţia specimenului în interiorul coloanei. Acest electron va conferi o rezoluţie înaltă imaginii. valoarea defocalizării. curentul. Microscoapele electronice de nouă generaţie au interfeţe cu computerele ceea ce conferă utilizatorului o mai mare flexibilitate şi control. Dacă electronul nu loveşte un atom din probă acesta va avea o traiectorie nedeviată până la ecranul care va colecta imaginea. astfel când electronul va ajunge la nivelul ecranului va avea energia diminuată şi un unghi de incidenţă necunoscut. nu va pierde din energie. focalizarea şi mărirea. 332 . va asigura introducerea probei în vidul din coloana microscopului cu o scădere minimă a presiunii din interiorul coloanei.5). iar aceasta într-un holder de metal (fig.

În cazul sferei goale gradientul va fi în direcţia opusă. Un pattern de difracţie poate fi colectat din probe care conţin un motiv care se repetă. astfel de electroni nu sunt folosiţi în microscopia electronică. Figura 6. marginea fiind cea mai închisă. Electronii care vor fi deviaţi de la traiectoria iniţială în urma interacţiunii cu atomii specimenului vor interfera constructiv sau distructiv cu fasciculul principal de electroni. Într-un microscop electronic de transmisie electronii trec prin probă înainte de a impresiona ecranul şi conţin informaţii cu privire la structura internă a acestei probe. Electronii cu deflecţie mare conţin informaţii importante legate de rezoluţie. Diferenţa dintre proiecţiile unei sfere solide şi a unei sfere goale în momentul vizualizării la TEM Microscoapele electronice pot fi utilizate pentru vizualizarea pattern-urilor de difracţie a probelor. 333 . intensitatea diminuându-se spre marginile discului. de exemplu din cristale bidimensionale. dacă privim o sferă goală pe dinăuntru sau una plină. aceste informaţii fiind pierdute. Sfera solidă va genera un disc întunecat la interior. iar contrastul este îmbunătăţit. Aceste proiecţii diferă deoarece gradul de întunecare a unei imagini este direct proporţional cu capacitatea materialului de a absorbi electronii. Lentila intermediară determină vizualizarea imaginii sau a pattern-ului de difracţie pe ecran. Contrastul dintr-o imagine ia naştere în urma interferenţei electronilor ce au unghiuri diferite. proiecţiile acestora vor diferi (figura 6). Spre exemplu. Pentru a înregistra imaginea se utilizează negative care sunt impresionate de fasciculul de electroni sau camere CCD (Charge Coupled Device) care traduc în format digital interacţiunile electronilor cu senzorul camerei. Colectarea imaginilor se poate face în diverse moduri. Dacă se utilizează o apertură obiectiv mică electronii care sunt deviaţi sub un unghi mare nu vor contribui la formarea imaginii. Observarea directă a imaginii de către utilizator are loc la nivelul unui ecran de fosfor.Electronii pot fi deviaţi la unghiuri mai mari de 90°. Pattern-ul de difracţie se formează ” in the back focal plane” al lentilei obiectiv.

iar noile plăci sunt introduse cu partea proaspăt clivată în interiorul unei camere în care se va stabili un vid înalt.Tehnici de preparare a probelor Grile În cazul microscopiei electronice de transmisie specimenele sunt depozitate pe grile. După stabilirea vidului un 334 .05 mm care prezintă o reţea. platină) având un diametru de 3. Pentru a obţine un film continuu de Formvar o lamă de sticlă pentru microscopia optică este curăţată şi scufundată uniform în soluţia de Formvar. vedere superioară şi secţiune Filme de suport Filmul Formvar este un film de natură polimerică (formal de polivinil). Pe această grilă se va depozita un film care va conferi suport specimenului. Există două metode pentru depozitarea filmului pe grile: una implică aşezarea grilelor pe suprafaţa filmului flotat pe apă. iar a doua depunerea pe grile a filmului flotat. O foaie de mică este proaspăt clivată. nichel. cei mai utilizaţi fiind cloroformul şi dioxanul. Deasupra platoului pe care sunt aşezate cele două foiţe de mică se află un fragment de sfoară de carbon conectată la un circuit de mare voltaj. Principiul evaporării carbonului este unul foarte simplu. fiind des folosit în microscopia electronică. Feţele proaspăt clivate ale micăi sunt perfect plate din punct de vedere atomic ceea ce îmbunătăţeşte proprietăţile filmului de carbon. Grilă de microscopie electronică. aur. Filmele de carbon Probele trebuie depuse pe un film care este foarte stabil sub acţiunea fasciculului de electroni. Filmele de carbon sunt foarte stabile. Substanţa se găseşte sub formă solidă şi este solubilă în solvenţi organici. Ochiurile reţelei pot avea diferite dimensiuni şi forme (pătrat. Grilele sunt discuri de metal (cupru. Figura 7. hexagon).

această nouă rază va interfera cu fasciculul iniţial şi contrastul se creează. acestea nefiind foarte dense. cantitatea de energie absorbită este foarte mică comparativ cu energia fasciculului. Pentru ca o coloraţie să aibă efect trebuie să se lege de preferenţial anumite părţi ale probei. De aceea. Alte metode se bazează pe colorarea probelor pentru evidenţierea unor caracteristici. Ionii de 335 . în acest moment carbonul se va evapora şi depozita pe mică formând un film continuu. În funcţie de cantitatea de energie absorbită intensitatea fasciculului care va impresiona ecranul diferă şi se va forma o imagine. azot şi hidrogen. În ultimii ani. Pentru a îmbunătăţi contrastul se folosesc diferite tehnici. uraniu sau tungsten. oxigen. Ionii negativi se vor depozita pe suprafaţa filmului de carbon. datorită descoperirii graphene-ului şi a remarcabilelor sale proprietăţi se investighează aplicaţia acestui film în microscopia electronică. Coloraţia în cazul microscopiei electronice de transmisie se bazează pe săruri de metale grele derivate din molibden. După coloraţie. pentru o vizualizare mai bună. Pentru a face filmele mai accesibile substanţelor aflate în soluţie apoasă carbonul trebuie hidrofilizat. probele sunt impregnate cu săruri de metale grele. În cazul glow discharching grilele sunt introduse într-o cameră parţial evacuată. Plăcile de mică sunt imersate treptat în apă ceea ce permite filmului hidrofob să se desprindă. Coloraţia negativă În cazul microscopiei. Grilele sunt aşezate pe o sită de metal într-un vas plin cu apă. iar când voltajul este aplicat între anod şi catod potenţialul electronic ionizează aerul din încăpere. Aceasta se poate realiza fie prin tratarea cu UV a grilelor sau prin glow discarching. Microscopia electronică de transmisie utilizează un fascicul de electroni de înaltă energie pentru a bombarda specimenul.curent se aplică sforii de carbon până când aceasta devine incandescentă. contrastul specimenului este prea slab pentru ca ochiul uman să diferenţieze marginile şi detaliile probei observate. În cazul probelor biologice care sunt formate din atomi precum carbon. Coloranţii se bazează fie pe vopsele sau pe materiale foarte absorbante. în cazul acestei tehnici lumina care penetrează proba suferă o schimbare a fazei. Depozitarea filmului de carbon are loc prin evacuarea vasului de apă. iar dacă o picătură de apă este depusă pe suprafaţa unui astfel de film aceasta va avea tendinţa de a-şi micşora suprafaţa care întră în contact cu carbonul. În cazul microscopiei optice se aplica contrastul de fază. Carbonul este o substanţă hidrofobă. proba se va usca şi va putea fi examinată la microscop.

Colorantul absoarbe electronii mult mai bine decât mediul înconjurător. Excesul va fi îndepărtat cu ajutorul unei hârtii de filtru. Contrastul apare în urma interacţiunii electronilor cu specimenul. iar apertura obiectiv îi va elimina pe cei care vor fi deviaţi la un unghi prea mare. de aceea diferite regiuni ale probei pot avea diferite densităţi de electroni şi pot fi diferenţiate în proiecţiile obţinute. Pregătirea probei nu necesită aparatură şi nu ia mult timp (aprox. Tehnica este una simplă: proba este depusă pe grilă şi lăsată câteva zeci de secunde urmată fiind de ‘’spălarea’’ grilei cu 3 picături de colorant. ceea ce va determina contrastul şi rezoluţia imaginii. Coloraţia cu aceşti atomi grei se numeşte coloraţie negativă deoarece în microscop se va observa o zona neacoperită de colorant înconjurată de coloraţia negativă. Interacţiunea dintre un specimen (coloraţie negativă) şi fasciculul de electroni Avantaje şi dezavantaje ale coloraţiei negative Pro Contrast foarte mare. Alterarea datorită radiaţiei este irelevantă deoarece sărurile metalice nu sunt la fel de susceptibile la efectele electronilor precum molecule organice. . electronii ce vor interacţiona cu atomii de metale grele vor fi puternic deviaţi.metale grele vor interacţiona cu electronii. În timpul uscării specimenul îşi pierde învelişul hidratant. În cazul proteinelor menţinerea unei stări hidratate este importantă pentru păstrarea configuraţiei. Contrastul optim se obţine când coloraţia înconjoară complet specimenul si zonele adiacente. Rezoluţia este limitată la 20 Å în condiţii optime. Ca urmare a distribuţiei inegale a coloraţiei pot să apară artefacte. În figura 8 se observă o proteină colorată negativ. iar după uscare grila poate fi examinată. Zona este neacoperită deoarece proba (proteina de exemplu) împiedică depunerea sării pe filmul de carbon. 336 Contra În timpul colorării particulele pot fi distorsionate. Figura 8. 4 minute). Aceasta corespunde cu mărimea granulei sării folosite pentru coloraţia negativă.

în momentul introducerii unei grile aflate la temperatura camerei fierbe ceea ce favorizează formarea gheţii cristaline. iar proba va fi protejată. Avantaje şi dezavantaje ale cryo-electronmicroscopiei faţă de coloraţia negativă Avantaje Specimenul este tot timpul în soluţie şi nu intră în contact cu suprafeţe. De aceea se preferă utilizarea etanului lichid. apa din jurul probei va îngheţa. Doza recomandată e de 6-10 electroni/Å2. Nu există colorant care să distorsioneze preparatul. sită o doză minimă de electroni penîngheţarea probei tru a evita alterarea probei datorită radiaţiei.Îngheţarea probei – metoda cryo Microscopia cryo este o tehnică prin care proba este îngheţată într-un refrigerent pentru o mai bună păstrare şi protecţie în timpul observaţiei. prin urmare forma observată este cea reală în stare nativă. Pregătirea probelor necesită mult 337 . Proba poate să aibă o orientare preferenţială pe grilă în cazul Dezavantaje Raportul semnal/zgomot este foarte mic deoarece absorbţia electronilor e scăzută. -195˚). Înregistrarea imaginilor pentru tomografie e dificilă deoarece prin rotire stratul de gheaţă expus este prea gros. dar capacitatea calorică este foarte mică. cristaline care va estompa detaliile specimenului. Procesul este laborios deoarece plonjarea grilei în recipientul de etan lichid trebuie să fie suficient de rapidă pentru a împiedica formarea gheţii cubice. Schemă a instalaţiei utilizate pt. Îngheţarea se face prin dropping a unei grile pe care proba este deja depozitată. Pentru a vizualiza proba în cryo-electronmicroscopie trebuie foloFigura 9. Azotul lichid are o temperatură ideală (aprox.

coloraţiei negative. Deşi principala lui utilizare este de a obţine imagini topografice la o mărire cuprinsă între de 10-10000 de ori. 338 . Se foloseşte doza minimă de electroni. Microscopia electronică de baleiaj (Scannig Electron Microscopy – SEM) În cazul SEM. Acest înveliş metalic asigură o suprafaţă conductoare. SEM-ul are o adaptabilitate mare. iar obţinerea gheţii vitroase în cazul cryo. astfel se evită încărcarea electrică a probei. 3. poate fi problematică. Imaginea se formează pe un ecran datorită electronilor care sunt reflectaţi de învelişul metalic. de la jurnale ştiinţifice la reviste de popularizare şi filme. ceea se asigură prezervarea probei. Popularitatea SEM-ului e datorată capacităţii sale de a obţine imagini aparent tridimensionale ale suprafeţelor unei game largi de materiale. ceea ce se evită timp. Prin intermediul microscopiei electronice de baleiaj se pot observa detalii de pe suprafaţa unui specimen. Imaginile SEM sunt utilizate într-o mare varietate media. Microscopul electronic scanning (SEM) permite observarea şi caracterizarea materialelor organice şi anorganice heterogene la o scară cuprinsă între nanometri (nm) şi micrometri (µm). iar informaţiile privitoare la structura internă lipsesc. Fasciculul de electroni este concentrat şi utilizat pentru a scana suprafaţa obiectului observat. specimenele sunt acoperite cu un strat subţire de metal pentru ca electronii să fie reflectaţi.

Analiza acestor raze emise de către probă poate scoate în evidenţă atât caracteristici calitative cât şi informaţii cantitative de element. Un motiv puternic pentru utilitatea SEM-ului este rezoluţia mare ce poate fi obţinută când sunt examinate obiecte voluminoase. Cele mai multe micrografii SEM se efectuează la măriri sub 8000 de ori. compoziţia etc. Emisia de electroni secundari. cristalografia. suprafaţa de examinat sau microvolumul de analizat este iradiată cu un fascicol îngust de electroni. se emit şi raze X caracteristice. Capacităţi de imagistică Microscopul electronic scanning este unul dintre cele mai versatile instrumente disponibile pentru examinarea şi analizarea caracteristicilor microstructurale ale obiectelor solide. La SEM. electroni reflectaţi.La SEM. din regiuni ale unui specimen având mărimea de 1µm în diametru şi 1µm în adâncime (în condiţii normale de operare).). Cu cât e mai mare această adâncime a câmpului cu atât se furnizează mai multe informaţii despre specimen. aleasă la diferite valori ale energiei razei de electroni. Aceste semnale se obţin din emisii de volum specifice probei şi pot fi folosite pentru a examina multe caracteristici ale probei (topografia. sau care poate fi static pentru a obţine analiza unei singure poziţii. unde aparatul ope339 . această calitate a SEM-ului fiind cea mai apreciată de către un utilizator. raze X caracteristice şi alţi fotoni cu energii variate. Evoluţia SEM-ului şi capacităţile specifice ale instrumentelor comerciale moderne se vor discuta în cele ce urmează. Semnalele de imagine de cel mai mare interes sunt electronii secundari şi reflectaţi. O altă caracteristică importantă a SEM-ului este adâncimea câmpului. rezoluţii instrumentale cu ordin de 1-5 nm (10-50 Å) se folosesc azi ca rutină la instrumente comerciale. care poate fi trecut în raster (linie cu linie) deasupra suprafeţei specimenului pentru a forma mai multe imagini. Tipurile de semnale rezultate din interacţiunea fascicolului cu probă includ electroni secundari. ca şi rezultat al bombardamentului de electroni. care e cea responsabilă în parte pentru aparenţa tridimensională a imaginii specimenului. precum şi efectului de umbră dat de contrastul electronilor secundari şi reflectaţi. regăsiţi într-un volum foarte mic în apropierea zonei de impact a fascicolului. pentru că aceştia variază în primul rând datorită diferenţelor topografice. permite formarea de imagini la o rezoluţie apropiată de cea a mărimii fascicolului de electroni. Aparenţa tridimensională a imaginii se datorează unei adâncimi mari a câmpului microscopului electronic.

A urmat apoi von Ardenne (1938) care a construit microscopul electronic scanning de transmisie (STEM) prin adăugarea unei lentile de baleiere la microscopul electronic de transmisie (TEM). Ei au adăugat un scintilator pentru a converti electronii în lumină. Mc. Spre exemplu.Mullan au construit primul lor SEM care până în 1952 a atins rezoluţia de 50 nm. Prima lucrare recunoscută ca descriind conceptul de microscop electronic scanning este cea a lui Knoll (1935). Dar. şi a fost primul care a inclus un stigmator în SEM. Oatley şi Everhart au putut observa pentru prima dată contrastul de voltaj. Astfel. Principalele componente ale SEM-ului sunt sistemele de lentile. şi a introdus amplificarea neliniară a semnalului. colectorul de electroni. şi părţile electronice asociate. 1956) Următorul pas înainte a fost refacerea detectorului secundar de electroni. mai târziu Wells (1959) a făcut primele studii ale efectelor penetrării fascicolului cu scopul formării imaginii la SEM. Atât aspectele teoretice cât şi cele practice ale STEM-ului au fost explicate în detaliu de către von Ardenne. (1942). De asemenea a îmbunătăţit sistemul de scanare prin introducerea de scanare prin dublă deflecţie. mecanisme de contrast mai slab ar putea fi mai bine studiate. tunul. tubii catodici fotocolectori de raze. care a fost apoi transmisă printr-o ţeavă de lumină direct pe suprafaţa fotomultiplicatorului. Autorii au realizat că emisia de electroni secundari este cea responsabilă pentru contrastul topografic. (Smith. Schimbarea multiplicatorului de electroni cu mult mai eficientul fotomultiplicator a crescut cantitatea semnalului colectat şi a rezultat un mai bun raport semnal-zgomot. Mc. iar aparatul său includea multe instrumente care de atunci au devenit standard. În plus. şi primul care a utilizat perechi 340 . de către Everhart şi Thornley (1960). proprietate foarte utilă în studii de criminalistică şi nu numai. astfel s-a obţinut o rezoluţie de aproximativ 50 nm. Oatley şi studentul său D.rează bine în limitele propriilor capacităţi de rezoluţie. prin comparaţie cu performanţele obţinute atunci cu TEM-ul în continuă perfecţionare. C. această metodă a fost considerată neincitantă şi dezvoltarea pe această ramură a stagnat. Colectorul a fost înclinat pozitiv aproximativ cu 50 V înspre specimen şi al doilea curent acumulat în el a produs o cădere de tensiune de-a lungul unui rezistor. pentru că imaginea SEM vine cu informaţii adiţionale imaginii obţinute la microscopul optic. SEM-ul are capacitatea de a analiza la măriri foarte mici. În următorii câţiva ani.Mullan a fost urmat de Smith (1956) care a observat că procesarea semnalului ar putea îmbunătăţi micrografiile. Alte utilizări ale SEM-ului au fost dezvoltate în această perioadă. Primul SEM utilizat să examineze specimene dense a fost descris de Zwokyn şi col. W.

Stereoscan” (Cambridge Scientific Instruments Mark I).stereografice pentru a produce imagini tridimensionale la SEM. Alte avansări în utilizarea SEM-ului includ mecanismele de contrast precum contrastul prin canalizarea electronilor produs prin variaţii în orientarea cristalografică şi contrast magnetic produs din domenii magnetice din materiale uniaxiale şi cubice. (Wells. Japonia. Stewart şi coechipierii de la compania Cambridge Scientific Instrument au finalizat design-ul comercial şi împachetarea produsului (Oatley.A. În anii ce au urmat mai mult de 50 000 de unităţi SEM au fost vândute de către producători din S. printate sau reţinute pe un CD sau alte unităţi de memorie. diferenţiere etc. Odată stocată în format digital imaginea poate fi procesată în multe moduri. Disponibilitatea unor computere puternice şi ieftine dotate cu capacitate de stocare mare şi pachete de soft capabile de o varietate mare de procesări şi funcţii pentru imagini digitale. Marea Britanie. şi astfel de nevoi cer o atenţie specială tehnologiei de vidare. G. s-a dezvoltat în aşa măsură încât poate fi acum folosită pentru imagini de cea mai înaltă rezoluţie. care conţinea şi sistemul detector Everhart-Thornley. deşi în aparatele mai vechi imaginile încă se mai fac prin fotografierea tubului catodic de raze. Acest aparat a devenit primul prototip comercial numit . De la primul aparat comercial din 1965 s-au făcut numeroase îmbunătăţiri.U. Cu această sursă o mai mare cantitate de electroni au putut fi concentraţi pe o suprafaţă mai mică. D. Sursele de electroni au nevoie totuşi de vid de ordinul a cel puţin 10-8 Pa pentru a opera într-un mod de încredere. una din ele fiind dezvoltarea surselor de lumină puternică precum catodul de hexaborid de lantan (LaB6). utilizată pentru prima dată la SEM în 1942. Avantajul tunului de emisie este dimensiunea sa mică astfel încât poate fi obţinută o imagine a unei probe de 1 nm. A. cu trei lentile magnetice. decât filamentele convenţionale de tungsten. aceste microscoape şi-au găsit utilitatea în numeroase domenii de cercetare şi tehnologie în care rezoluţia înaltă şi energia mică a sursei sunt importante. Olanda. 341 . precum prin amplificare non-lineară. 1972). Cu toate că au crescut costurile şi complexitatea SEM-urilor cu emisie de curent.. 1960) Pease a construit un sistem cunoscut ca SEM V. oferă microscopistului o mare flexibilitate şi uşurinţă în utilizarea SEM-ului. la nivel de rutină. obţinându-se astfel o rezoluţie mai bună. Majoritatea SEM-urilor sunt dotate cu capacitatea de a stoca imagini digitale. Sursa de emisie de electroni. Germania şi Franţa.. Imaginile pot fi observate pe un ecran. Această lumină puternică permite pătrunderea a de 1000 de ori mai mulţi electroni pe cele mai mici dintre probe.

Imaginile tridimensionale permit interpretarea corectă a caracteristicilor morfologice şi măsurarea lor. Dimensiunea mare a adâncimii câmpului întâlnită la SEM face posibilă observarea tridimensională a obiectelor utilizând stereoscopia. de contrast mic şi emisivitate de electroni slabă şi sunt. VPSEM-ul poate detecta electroni secundari şi retroîmprăştiaţi la fel de bine precum razele X. care au fost suficient de puternice pentru a rezista procesului de vidare fără să se deformeze (Smith şi Oatley. suprafaţa specime342 . dezvoltările în domeniul biologic au depins de avansarea în prepararea specimenului. îndepărtării sau imobilizării fluidelor celulare. slabi conductori. Dezvoltarea procesărilor la temperaturi scăzute a ajutat la reducerea pierderii de masă şi a distrugerilor termice la specimenele sensibile (Echlin. 1991. sensibile la radiaţii. S-a dat multă atenţie la stabilizarea materialelor organice delicate. 2000). Acest tip de aparat permite examinarea suprafeţelor a aproape oricărui tip de specimen. Majoritatea materialelor biologice sunt umede.2. termolabile. şi acoperirii lor cu un strat subţire de material conductor. Una dintre cele mai importante descoperiri recente este microscopul electronic scanning cu presiune variabilă (VPSEM). Probele biologice sunt ideale pentru studiul la acest aparat. uscat sau umed. În formatul său modern. şi este cunoscută sub numele de difracţie electrono-reflectată (EBSD). aşadar. 1993). 1992). se pot efectua experimente în aparat în care suprafaţa specimenului poate interacţiona cu atmosfera gazoasă.. Un sistem diferenţial de pompare a vidului este folosit pentru a menţine tunul de electroni la vid înalt în timp ce specimenul este sub o presiune mai mare.20 torri). Analiza structurală Una din cele mai promiţătoare dezvoltări din domeniul SEM-ului este abilitatea de a determina structura cristalină şi orientarea lor pe suprafaţa specimenelor preparate. Mai târziu Thornley a prezentat imagini SEM ale materialelor uscate prin îngheţare şi analizate la 1 keV pentru a evita încărcarea electrostatică. Pentru a colecta maximum de intensitate în modelul de difracţie. Au apărut echipamente care permit evaluarea cantitativă a suprafeţei şi urmărirea în timp real şi de înaltă rezoluţie a specimenului prin intermediul SEM-ului. În plus. Totuşi.Printre primele micrografii scanate au fost câteva materiale biologice precum carcasa unor insecte sau fibre lemnoase. Această capacitate se foloseşte de difracţia electronilor reflectaţi de pe suprafaţa specimenului (Schwartz şi col. Mediul poate fi alcătuit din vapori de apă sau alte gaze în intervalul de 25-2500 Pa (0. 1955). pentru că mediul înconjurător specimenului nu mai este nevoie să fie la vid înalt (Danilatos.

1951). În teza sa de doctorat. Castaing sub îndrumarea lui A. Intensitatea modelului reflectat Kikuchi este relativ mică. dar a şi subliniat modul în care această informaţie poate fi cuantificată. Cosslett şi Duncumb (1956) au construit primul microanalizor electronic scanning de probe la Laboratoarele Cavendish în Cambridge.microsondă electronica”(Castaing. Optica electronică era formată dintr-un tun electronic urmat de lentile convergente ce formau o sondă electronică cu un diametru de 0. adăugarea 343 . de aceea e nevoie de camere ultrasensibile şi senzori fini de captare a contrastului. De asemenea mai făcea parte din aparat şi un microscop optic pentru găsirea corectă a punctului de analiză şi una sau mai multe spectrometre WDS pentru analizarea intensităţii radiaţiei X emise în funcţie de energie. Dezvoltarea unui instrument de analiza chimică localizată a probelor solide (EPMA) s-a produs deodată cu apariţia SEM-ului. cei doi oameni de ştiinţă treceau fascicolul brusc pe suprafaţa probei. iar primul aparat comercial a fost introdus de CAMECA în Franţa în 1956. Deşi conceptul de analiză locală cu raze X este în sine un stimulent pentru folosirea microanalizatorului. precum şi contrastul semnalului. Aceste pattern-uri sunt mai apoi analizate printr-o metodă de indexare asistată de computer.. şi de abia în 1949 R..U.A.Guinier au descris şi construit un instrument numit . În timpul anilor 1950 câteva aparate EPMA au fost dezvoltate în laboratoare din Europa şi S. Castaing nu numai că a demonstrat că o analiză chimică localizată poate fi desfăşurată pe suprafaţa specimenului. Analiza elementală SEM-ul poate fi utilizat pentru a obţine informaţii legate de compoziţie folosind razele X caracteristice.nului este dintr-o dată răsucită la un unghi de 70º faţă de orizontală. Cea mai recentă descoperire în aplicaţia modelului Kikuchi la volume de analizat este dezvoltarea sistemului de înregistrare a modelului folosind o cameră video de înaltă sensibilitate sau mai recent o cameră video tensio-cuplată (CCD). Recunoaşterea complexităţii transformării intensităţii razelor X în compoziţie chimică a dus la perfecţionarea analizei cantitative de către numeroşi investigatori pe parcursul ultimilor 50 de ani. Indexarea automată a modelelor şi cartarea orientării straturilor de cristale asistată electronic permite identificarea fazelor de cristalizare şi arată orientarea greşită printre limitele cristalelor. Conceptul unui microanalizator electronic de probe a apărut în anii 1940 (Hillier.1.1 µm pe specimen. 1947). Dacă până atunci microprobele electronice operau cu fascicole statice de electroni. aşa cum se face azi în SEM-rile actuale.

După ce pentru mulţi ani principalele linii de concentrare au fost în direcţia dezvoltării tehnologiilor existente. În anii ce au urmat de la prima apariţie a EPMA-ului. Sistemul EDS oferă o modalitate rapidă de analiză a elementelor constituente în probă. detectorii din derivaţi de silicon. Câteva dintre acestea cuprind microcalorimetria în raze X. şi utilizarea de spectrometre de cristale plate împreună cu optică capilară X-ray. printre care o descoperire a fost de mare importanţă: difracţia cristalelor din moleculele organice cu spaţieri mari interplanare 344 . Detectorii de raze X se bazau pe o formă solidă de silicon derivat de litiu [Si (Li)].. două sau mai multe spectrometre de lungime de undă (WDS). toate găsind o tot mai mare utilizare în cadrul SEM-ului. pe lângă analiza calitativă rapidă. prin spectrometrie EDS de raze X se mai poate realiza şi o analiză cantitativă foarte fină.1968). Atracţia acestei forme de acumulare a informaţiei este detaliul microcompoziţional ce poate fi corelat cu metalografia optică şi electronică. un microscop optic pentru observarea suprafeţei specimenului şi un fascicol de curent de electroni care se stabilizează prin analiza de raze X. Un EPMA modern are în mod normal capacităţile unui SEM. În plus. Marea majoritate a SEM-urilor vândute azi sunt echipate cu capacităţi EDS. O altă însuşire importantă a SEM-ului cu EDS şi WDS este capacitatea de cartare compoziţională folosind raze X caracteristice. câteva descoperiri recente au dat noi tendinţe în conceptele de detectori şi design. s-au făcut numeroase îmbunătăţiri. printr-o analiză normală cu fascicolul de electroni se obţine o acurateţe de 1-2% (5-10% la probele biologice) din cantitatea respectivului element prezent. SEM-ul şi EPMA-ul au fost considerate aparate separate pentru încă un deceniu.conceptului de scanare a fost o contribuţie foarte semnificativă. Într-un SEM tipic echipat cu detectori EDS şi WDS. având şi lentile optice şi una şi mai multe unităţi WDS. Adăugarea unui spectrometru EDS la microanalizorul electronic pentru a măsura razele X a atras atenţia asupra nevoii utilizării lui şi în cadrul SEM-ului (Fitzgerald şi col. pe când WDS-ul este utilizat pentru detecta razele X ale elementelor minore (<10 wt%) sau chiar pentru a le recunoaşte în probă. Spectrometrele dispersive de energie moderne sunt capabile de detectarea razelor X caracteristice ale tuturor elementelor cu număr atomic mai mare decât 4. Proba este analizată fără a fi afectată şi analiza cantitativă poate fi obţinută la o rezoluţie spaţială de 1 µm pe probă. Pentru probe plate şlefuite. EDS-ul e utilizat pentru a analiza razele X caracteristice elementelor majore (>10 wt%). dar azi EPMA-ul este considerat a fi un echipament aparţinând SEM-ului. la curenţi tipici utilizaţi la imagistica electronică secundară a SEM-ului.

Aceste cristale eliberează raze X cu lungime mare de undă din elementele cu număr atomic mic (B. Recent au fost dezvoltaţi difractori mari de spaţii interplanare ce utilizează depunerea fizică alternativă de straturi de vapori de elemente grele şi uşoare. 1965). Utilizarea tot mai intensă a computerului împreună cu SEM-ul a crescut calitatea şi cantitatea de informaţii adunate prin intermediul aparatului. prin urmare. 1966). Ele se bazează pe analiza unor secţiuni subţiri. Microanaliza în raze X a materialelor biologice şi polimerice întâlneşte aceiaşi problemă în examinarea probelor la SEM. O) ce pot fi măsurate de spectrometre dispersive de lungime de undă. Efectele de suprafaţă pot fi mai uşor de măsurat. metodele cantitative sunt în principiu simple. Totuşi materialele biologice sunt mult prea uşor afectate de fascicolul de electroni şi astfel că în deceniile trecute s-a depus mult efort în instrumentare precum şi în procedurile preparative şi analitice cum sunt analiza la temperatură scăzută. De exemplu. După ce s-a observat capacitatea de măsurare a razelor X care poate fi extinsă şi la specimene nonmetalice. Avantajul energiei mici a fascicolului de electroni este că apare posibilitatea minimizării dimensiunii sursei de raze X şi a minimizării efectului de absorbţie în procedura cantitativă. în primul rând datorită faptului că unii parametri de corecţie sunt funcţie de concentraţie şi. fac aproximările succe345 . culoarea luminii vizibile (catodluminiscenţa). a apărut ipoteza folosirii şi altor tipuri de fenomene de excitaţie. deşi intervine problema contaminării cu carbon din cauza vacumizării slabe a SEM-ului. În plus.(Henke. Măsurarea catoluminiscenţei a devenit azi o parte importantă a SEM-ului mai ales în industria microelectronicelor. se mai poate studia şi emisia de fotoni vizibili din recombinarea excesului de perechi de goluri de electroni dintr-un semiconductor (Kyser şi Wittry. Capacitatea de a detecta elemente cu număr atomic mic le dă utilizatorilor de EPMA posibilitatea de a investiga numeroase noi probleme ale aparatului. produsă din interacţiunea electronilor cu specimenul a fost asociată cu prezenţa unor impurităţi în material (Long şi Agrell. în care efectele absorbţiei şi de fluorescenţă sunt neglijabile. În ultima vreme. N. în plus preparatorul trebuie să fie foarte atent ca elementele pentru măsurat să rămână în cadrul punctului de analiză şi să nu se îndepărteze sau să dispară pe parcursul preparării. Deşi prepararea specimenului biologic este mult mai exactă decât procedura pentru alte ştiinţe. C. 1965). S-au creat programe care pot să convertească raportul intensităţii razelor X în compoziţii chimice. aparatele au fost construite să permită posibilitatea unei analize de încredere cu fascicol de electroni si raze X de energie mică.

Dezvoltarea cartării compoziţiei cantitative este un alt punct forte în legătura dintre imagistică. Aceste programe derulează calcularea compoziţiei în câteva secunde şi astfel operatorul se bucură de mai multă flexibilitate în obţinerea rezultatelor. În acest fel analistul poate să revadă analizele corespunzătoare fiecărui pixel sau şir de pixeli. Automatizarea e de mare ajutor în operaţiunile repetitive. la cartarea cantitativă de compoziţie. creşte numărul analizelor efectuate. iar hărţile pot fi corelate cu imagini SEM preparate prin oricare alt fel de semnal. Se face câte o analiză completă executată de calculator. mişcarea specimenului. 346 . Imaginile rezultate sunt hărţi compoziţionale şi au la fiecare element constitutiv (pixel) valoare numerică completă a concentraţiei. În plus programele pot acum să controleze fascicolul de electroni. pentru fiecare rază discretă din suprafaţa scanată. şi spectrometrele. şi îi permite operatorului să se concentreze pe evaluarea analizelor. Valorile concentraţiilor corespunzătoare poziţiei razelor pe specimen sunt asamblate într-o imagine digitală cu un procesor de imagini prin codificarea axelor concentraţiei cu nuanţa de gri corespunzătoare.sive necesare. capacitatea de analiză cantitativă a elementelor şi utilizarea automatizată computaţională a SEM-ului.

Microscopia electronică ...... Depăşirea barierei de 1.......... eliminându-se astfel nevoia contrastării.......... în general......... O imagine electronomicroscopică este diferită de situaţia reală din organismul viu.... Dezvoltarea unui microscop electronic de baleiaj şi transmisie (STEM) de înaltă rezoluţie (0....... gradul alterării probei depinzând foarte mult de tehnica de pregătire a materialului biologic...... iar marcarea antigenilor de suprafaţă se poate realiza cu uşu347 ..... în timp ce detaliile probelor biologice.... Plaja efectelor induse de diferitele tratamente premergătoare analizei electronomicroscopice este foarte largă...... virusuri cu ultrastructuri similare pot fi diferenţiaţi cu sensibilitate mare.. organitelor celulare izolate (inclusiv membrane) şi macromoleculelor. nu sunt mai bune de 1.0 nm. Lucian Barbu-Tudoran Cuprins 1... performanţă uşor de atins acum pentru materiale anorganice... fiind una din cele mai uşoare şi mai rapide proceduri pentru detectarea virusurilor.. Microscopia electronică de transmisie.... deci........ coloraţia negativă este cea mai utilizată metodă pentru vizualizarea topografiei şi structurii bacteriilor..5 – 2.... iar înţelegerea acestora este esenţială pentru extrapolarea detaliilor oferite de microscop la situaţia existentă in vivo..... virusurilor....... fiind necesară..... luarea în calcul a tratamentelor la care este supusă proba până la ajungerea în faza de examinare.. Microscopia electronică de baleiaj .partea a II-a şef lucrări dr........... problemele preparării probelor biologice au rămas mult în urma îmbunătăţirilor aduse performanţelor microscoapelor electronice................... Pe lângă metodele clasice de contrastare a probelor biologice............ Când microscopia imunoelectronică este folosită în conjuncţie cu coloraţia negativă. răspunzătoare de acurateţea interpretării imaginilor..... 349 2......... ce oferă un contrast superior şi mai multe tipuri de informaţii simultan sau prin utilizarea câmpului întunecat într-un TEM convenţional......... absolut necesare pentru obţinerea unor imagini utilizabile.5 nm pentru specimenele biologice s-ar putea realiza prin utilizarea acestui STEM... 359 Din păcate.... Atâta vreme cât artefactele inevitabile sunt interpretabile....... acestea sunt acceptate...2 nm) a permis vizualizarea unui singur atom de metal greu...

sunt o alternativă la fixarea chimică. respectiv. pentru detecţia virusurilor foarte mici. Cea mai bună soluţie rămâne combinarea celor două metode. Un marker de aur coloidal este util. dilatarea excesivă a secţiunilor anumitor ţesuturi (limfoid). scopul acestora fiind de a stabiliza ultrastructura celulei aşa cum există in vivo.4 cm. În plus. picornavirus şi parvovirus. dar suficientă pentru a interacţiona cu cele necovalente cum sunt legăturile sterice (legături de H şi interacţiuni van der Waals). Marcarea imunogold în combinaţie cu coloraţia negativă au un potenţial considerabil în detectarea virusurilor. Unele din acestea pot fi evitate prin fixarea cu aldehide într-un cuptor cu microunde. pe lângă beneficiile crioprotecţiei. ce includ răcirea ultrarapidă a celulelor şi ţesuturilor. apar destul de des. 348 . Fixarea pieselor de dimensiuni mari prin metode convenţionale prezintă un gradient de calitate a fixării. oscilaţia dielectrică a moleculelor de apă şi o energie a fotonului de 10-5 eV. astfel. cromatina este mult mai distinctă în ţesuturile tumorale.rinţă prin colorarea imunonegativă. cu o frecvenţă de 2. Coloraţia negativă a probelor deshidratate prin îngheţare ar putea evidenţia ultrastructura virusurilor şi a membranelor fără colapsul specimenului. precum şi în cazul nivelelor scăzute de virusuri. şi aici există pericolul producerii de artefacte în intervalul de temperatură dintre cea fiziologică şi cea de imobilizare. Microundele sunt unde electromagnetice generate. în special. obişnuit. De asemenea. iar ca dezavantaje: deteriorarea eritrocitelor din ţesuturile nefixate.microscopia probelor colorate negativ este o metodă importantă pentru investigarea structurii tridimensionale a proteinelor cristalizate. în timp ce cele din zona profundă vor fi subfixate. crioelectron . Undele electromagnetice sunt radiaţii neionizante ce produc deplasări moleculare prin migrarea ionilor şi rotirea moleculelor dipolare. energie prea mică pentru a afecta legăturile covalente.45 GHz (1 GHz = 109 cicluri / sec) şi prezentând o lungime de undă de 12. straturile superficiale pot fi suprafixate. artefactele dependente de timp. cum ar fi contractarea sau umflarea probelor şi extracţia componentelor celulare datorate difuziei lente a fixatorilor. deşi. fixarea cu glutaraldehidă într-un cuptor cu microunde. O altă abordare este utilizarea coloraţiei negative în combinaţie cu vitrificarea pentru realizarea unui contrast crescut. Criotehnicile. antigenilor virali şi a anticorpilor. chiar la 370C. esenţiale funcţiilor biologice. vitrificarea nefiind uşor de realizat. Dintre avantajele fixării cu căldura microundelor menţionăm: capilarele pulmonare interstiţiale nu colapsează cum se întâmplă în cazul fixării cu formaldehidă.

RECOLTAREA Recoltarea fragmentelor de ţesut trebuie efectuată foarte rapid (1-2 min) după sacrificarea animalelor pentru a se împiedica instalarea unor alterări morfo-funcţionale la nivelul ţesutului. se pipetează soluţia de glutaraldehidă pe suprafaţa organului de inte349 . sunt următoarele: recoltarea. Se realizează o fixare chimică a pieselor. FIXAREA Procesul de fixare asigură stabilizarea structurii biologice cât mai aproape de starea nativă. modelarea. deshidratarea. înainte de recoltare. Rezultate foarte bune se obţin dacă. principalul agent de fixare utilizat în microscopia electronică de transmisie. includerea. încapsularea. Începând cu această etapă. Prefixarea Prefixarea se efectuează cu o soluţie de glutaraldehidă 2-6% (2.1 M. A.1. până la secţionare.5 mm. Pentru menţinerea neschimbată a ultrastructurii – deci păstrarea ei identică cu cea din momentul sacrificării animalului. se vor desfăşura sub nişă.7-3% (primul agent fixator). cu ajutorul unor agenţi capabili să creeze legături încrucişate între moleculele constitutive ale materialului prelucrat. Este indicată pipetarea soluţiei de glutaraldehidă peste organul ce urmează a fi recoltat. cu doi agenţi fixatori la 4ºC. datorită toxicităţii mari a reactivilor cu care se lucrează. Se prelevează fragmente suficiente pentru prepararea a câte 3 blocuri/probă (adică cel puţin 6 cuburi). acţionate în sens contrar pentru a se evita lezarea mecanică (zdrobirea/sfâşierea) ţesutului. se trec rapid pe glutaraldehidă 2. fixarea. Microscopia electronică de transmisie Principalele etape de a căror acurateţe depinde foarte mult obţinerea unor informaţii cât mai apropiate de situaţia reală din celula vie. Din fragmentele aflate pe glutaraldehidă se taie foarte repede cuburi mici. înainte de prelevarea acestuia din organismul animal.7%) în Tampon fosfat 0. fragmentele recoltate la rece (pe gheaţă). toate celelalte operaţii. Dimensiuni mai mari nu ar permite penetrarea pieselor de către tetraoxidul de osmiu. Acesta nu fixează corespunzător la o profunzime mai mare de 0. secţionarea. contrastarea. Pentru decuparea cuburilor se recomandă folosirea a două lame de ras noi. nepermiţându-se deteriorarea arhitectonicii ultrastructurale. examinarea şi developarea suporturilor fotografice. cu latura de maxim 1 mm.

prepararea soluţiei 2.154 g (18.56 g) 7.res. care vor avea un nou vârf de absorbţie la 235 nm. iar fixarea se va face la 4ºC. permite o mai uşoară manipulare a preparatului.apă distilată 350 1. Tuburile de sticlă cu care se lucrează vor fi foarte curate (bine spălate cu detergent şi amestec sulfocromic. posibilitatea perfuziei ţesuturilor cu fixator.Tampon fosfat 0. acestea sunt trecute în tuburi de sticlă şi păstrate timp de 15-30 minute în 1-1. la 280 nm. După obţinerea cuburilor de ţesut.7% se va face extemporaneu. Ele se acoperă cu dop (de cauciuc rezistent) – care nu se va fărâmiţa sub acţiunea substanţelor ce se vor folosi. respectiv introducerea fixatorului în circulaţie. După 15-30 minute se schimbă glutaraldehida şi se continuă fixarea timp de încă 1-2-3 ore în funcţie de consistenţa ţesutului.036 g) Până la 500 ml 2 ml 10 ml 4. conferind astfel o mare stabilitate structurilor celulare cu care vine în contact.1 M pH 7.7% preparată extemporaneu după reţeta: .(din moleculele proteice) şi imino-. în special de la alcooli şi grupările amino.37 g (1. Există. asigurându-se astfel o răspândire rapidă a acestuia la nivelul ţesuturilor.1 M se prepară după reţeta: . formând punţi încrucişate şi punţi intermoleculare. Dacă este ţinută la temperatura camerei.Na2HPO4 anhidru (Na2HPO4 · 12H2O) . Deci glutaraldehida 25% (sau 50%) stoc se va păstra numai la frigider. în soluţie apar polimeri ai glutaraldehidei.Apă distilată Tamponul fosfat 0. urmate de spălare abundentă cu apă distilată). pătrunde mai uşor şi acţionează rapid asupra ultrastructurii preparatului.2 ml . Glutaraldehida este primul fixator utilizat curent. de asemenea.NaH2PO4 · H2O (NaH2PO4 · 2H2O) .4 . Glutaraldehida se utilizează în soluţie apoasă 2.5 ml glutaraldehidă. Glutaraldehida pură prezintă un singur vârf de absorbţie în UV. Prin urmare va prezerva foarte bine ultrastructura celulară şi activitatea enzimatică a celulelor. deoarece este mai puţin toxic.Glutaraldehidă (25%) pentru microscopie electronică . Glutaraldehida [O=CH-(CH2)3-CH=O] are proprietatea de a lega grupările active de hidrogen.

După înlăturarea tamponului fosfat.15 M. ale cărei reziduuri vor împiedica legarea osmiului. pentru 15 minute. Se înlătură această soluţie.4. După îndepărtarea glutaraldehidei se adaugă peste piese (care nu vor rămâne niciodată neacoperite) tampon fosfat 0. în tuburile cu piesele prefixate şi spălate se adaugă cel de-al doilea agent fixator. se adaugă o soluţie proaspătă de OsO4 în care piesele vor mai sta timp de 85 minute. prezervarea structurii fine a celulelor şi stabilizarea acestora pentru a face posibile etapele ulterioare de preparare în scopul vizualizării în microscopul electronic de transmisie.NaH2PO4 · H2O (NaH2PO4 · 2H2O) 2. dar şi de a mări contrastul la nivelul ultrastructurii ţesutului. pe care o colorează prin depunerea osmiului. În plus. 351 . pH 7. Prin procedura de fixare menţionată se urmăreşte stoparea proceselor metabolice din ţesturi. C. pH 7. după care se lasă 24 ore la 4ºC pentru dizolvarea completă. Rolul acidului osmic este de a stabiliza atât proteinele cât şi bistraturile lipidice. Se va evita contactul soluţiei cu obiecte metalice. Prin reacţia posibilă între cele două substanţe fixatoare aplicate succesiv.15 M pH 7.1 M. şi anume. şi spălarea se va face în aceleaşi condiţii. dacă urmele de aldehide nu sunt eliminate din ţesut. iar trecerea soluţiei în alte flacoane se va face numai prin răsturnare. o soluţie 1% (sau 2%) de OsO4 în Tampon Fosfat 0. Tamponul fosfat 0. Se închide sticla şi se agită puternic până la spargerea fiolei.B.4. poate rezulta un precipitat electron-dens care dăunează calităţii preparatului. Spălarea După prefixare.Na2HPO4 anhidru (Na2HPO4 · 12H2O) 10.366 g) .4 în 4 băi succesive a câte o oră (în a patra baie piesele se pot ţine peste noapte). Dacă prefixarea s-a făcut la frigider. cu dop rodat. Culoarea unei soluţii proaspete de OsO4 este galben pal. conţinând 50 ml tampon fosfat 0.15 M se prepară după reţeta: .apă distilată Până la 500 ml OsO4 2% se prepară astfel: 1 g OsO4 se trece într-o sticlă foarte curată.765 g (27. este foarte important a se înlătura prin spălare orice urmă de glutaraldehidă.064 g (2.139 g) . la post-fixare lipidele din membrane nu se vor fixa bine cu OsO4. Există cazuri când fixarea a fost prelungită peste noapte pentru fiecare fixator. Postfixarea Postfixarea se realizează cu tetraoxid de osmiu (OsO4) 1-4% în funcţie de consistenţa ţesutului de studiat.

100% (anhidră) timp de 15 minute. este necesar ca toată apa introdusă în timpul spălării în piese să fie extrasă fără a produce modificări în structura moleculară a celulelor.D. După îndepărtarea tetraoxidului de osmiu se adaugă peste piese (care nu vor rămâne niciodată neacoperite) Tampon Fosfat 0. Când se ajunge la etapele finale. deoarece alcoolul sau acetona se evaporă uşor şi piesele pot suferi procese 352 . în 4 băi succesive de câte o oră (în a patra baie piesele se pot ţine peste noapte). dioxan sau toluol în etapele finale. Pentru deshidratare se utilizează acetona (pentru epon se poate folosi şi alcoolul etilic) şi în unele cazuri oxidul de propilen. Dacă fixarea s-a făcut la frigider. spălarea trebuie efectuată după fiecare fixator folosit. 100% (anhidră) timp de 15 minute. 70% timp de 30 minute. cu urmări asupra polimerizării blocurilor la includere. În cazul fixărilor succesive duble. 50% timp de 15 minute. 80% timp de 30 minute. şi spălarea se va face în aceleaşi condiţii. în soluţii apoase de concentraţii crescătoare: 30% timp de 15 minute.15 M. Până la concentraţia de 70% se lucrează la temperatura de 4ºC după care tuburile vor putea fi păstrate la temperatura camerei. 100% (anhidră) timp de 15 minute. La includerea în Epon 812 pot urma două băi de oxid de propilen de câte 15 minute fiecare. Spălarea După terminarea procesului de fixare pe cale chimică trebuie să urmeze imediat spălarea pentru înlăturarea totală a excesului de fixator din ţesut. DESHIDRATAREA În vederea includerii pieselor (pentru a se putea efectua secţiunile ultrafine) se utilizează răşini epoxidice: Vestopal W sau Epon 812 care sunt substanţe organice hidrofobe. Deci. înlocuirea solventului trebuie făcută foarte rapid. Cantitatea de soluţie folosită pentru fiecare etapă de deshidratare trebuie să fie de 2-5 ml în funcţie de numărul pieselor din fiecare flacon. pentru o cât mai bună includere.4. pH 7. Extragerea apei se face treptat şi în timpi scurţi pentru ca procesul să nu fie însoţit de alterări structurale (eventuale extracţii de proteine din ţesut). Prezenţa urmelor de fixator în ţesut facilitează reacţii între acesta şi soluţiile de solvenţi organici folosite la deshidratare. 90% timp de 30 minute.

care înlocuieşte substanţa în care se efectuează deshidratarea. să nu altereze structurile. fără dop. În cazul cercetărilor de localizare enzimatică. fiind foarte fluid şi miscibil cu aceste răşini. Tot ca intermediar este recomandat xilolul sau toluolul. Vestopal W Vestopalul W este o răşină poliesterică – un copolimer format dintr-un poliester nesaturat şi stiren. Din această categorie pot fi amintite: durcupanul.de strângere. ceea ce se poate realiza introducând în vase o cantitate oarecare de sulfat de sodiu anhidru. etc. Din categoria mediilor de includere hidrofobe fac parte cele pe bază de metacrilat. Dintre răşinile epoxidice se pot enumera: Araldita. În paralel cu deshidratarea se prepară soluţie de Vestopal sau Epon pentru includere. răşini poliesterice şi unele răşini epoxidice. INCLUDEREA Obţinerea secţiunilor ultrafine care. 1:1. selectronul etc. Eponul 812. Toate operaţiile de includere şi încapsulare se desfăşoară în nişă. peste noapte. prepolimerizaţi împreună până la starea unui 353 . dar care. urmate de modificări nedorite. prin grosimea lor redusă să permită transmisia electronilor şi deci obţinerea imaginilor în TEM este condiţionată de includerea pieselor într-un mediu suficient de dur care să faciliteze secţionarea pieselor. În cazul includerii cu răşini epoxidice. cel mai bun intermediar este oxidul de propilen care acţionează ca deshidratant şi fixator şi. Între soluţiile de deshidratare şi cele de includere este bine să se intercaleze câteva băi cu solvenţi de tranziţie. 3:1 şi în Vestopal (Epon) pur. Specimenele sunt infiltrate în toată masa lor cu materialul de includere. respectiv acetona (sau dacă este cazul – alcoolul etilic). Este recomandabil ca alcoolul sau acetona folosite în ultimele băi să fie anhidre. acest solvent trebuie evitat deoarece inhibă unele enzime. cel mai frecvent utilizat este Vestopalul W. glicol-metacrilatul sau aquonul. Există şi medii de includere hidrofile. Dintre răşinile poliesterice. rigolacul. Pentru includera în Vestopal sau Epon piesele sunt ţinute câte 1 oră în soluţii de Vestopal (Epon)/acetonă (anhidră) în concentraţii crescătoare: 1:2. care nu necesită deshidratarea pieselor după fixare şi spălare. asigură o foarte bună infiltrare a ţesuturilor. Maraglas 655 – DER 732. Epon 812 –Araldită. A. prin infiltrarea în ţesut. fiind mai volatil. 2:1. DER 332 – DER 732. din aceeaşi clasă mai fac parte lacul poliesteric ME 6611.

chiar la rece. se adaugă Vestopal în cantitate de 1 g/bloc. se omogenizează din nou foarte bine şi se adaugă 8 picături de activator (la 3 probe) (octoat de cobalt) cu o pipetă la care 1 ml corespunde pentru 20 de picături. Blocurile se pot secţiona uşor cu cuţitul de sticlă. stirenul. dioxanul sau chiar glicometacrilatul. Fiind parţial polimerizat.Peroxid de benzoil . De aceea. şi pentru deshidratare trebuie să se folosească acetona. Pentru includere şi încapsulare. se pot monta pe grile fără pelicule suport şi permit obţinerea unei înalte rezoluţii. nu produce procese de strângere a ţesuturilor. Atât răşinile cât şi iniţiatorul şi activatorul se pot păstra la rece. Vestopalul W nu este miscibil cu alcoolul. după care se pun în tuburi. altfel blocurile vor fi moi şi de slabă calitate. Pentru 3 probe (15 blocuri) reţeta de preparare a Vestopalului este următoarea: . uşor gălbui. Secţiunile sunt rezistente la fasciculul de electroni. În timpul lucrului se va avea grijă să nu se amestece direct iniţiatorul cu activatorul.4 ml) Peroxidul de benzoil se activează în prealabil prin recristalizarea din cloroform.Octoat de cobalt preparat astfel: 1 ml α-metil stiren + 7 picături de octoat de cobalt 15 g 150 mg 8 picături (0.sirop consistent. 354 . Cel care expiră mai repede este activatorul. obţinută prin condensarea epiclorohidrinei cu glicerol. Substanţa activată se depune sub formă de cristale incolore pe pereţii vasului respectiv. care îşi schimbă culoarea. deoarece amestecul este exploziv. În timp ce răşina poate fi păstrată câteva luni la rece. iniţiatorul şi activatorul. cristale care se răzuiesc şi se mărunţesc. Ca amestec de includere. se prepară vestopalul astfel: se adaugă în puţin Vestopal peroxidul de benzoil (iniţiator al polimerizării Vestopalului) pentru predizolvare şi se amestecă foarte bine cu o baghetă de sticlă. B. aceştia din urmă trebuie reînnoiţi în fiecare lună. pătrunde repede în ţesuturi. iar secţiunile sunt foarte rezistente la fascicolul de electroni. îşi pierd activitatea în decurs de o lună.Vestopal W . Epon 812 Eponul 812 este o răşină epoxi-alifatică pe bază de glicerol. duritatea blocurilor poate fi modificată după dorinţă. se secţionează uşor cu cuţitul de sticlă. ţesuturile au un contrast ridicat şi sunt excelent prezervate.

conţinând în interior piesele – de culoare neagră. MODELAREA BLOCURILOR Blocurile de răşină se fasonează cu ajutorul unei lame de ras nouă. În vârful blocurilor. Înainte de amestecarea celor două soluţii. blocurile vor fi mai dure. cu preponderenţă la periferia blocurilor.Reţeta de preparare a Eponului este următoarea: Soluţia A Epon 812 (Epitoke 212) DDSA (anhidrida dodecenil-succinică) ml 66 100 Soluţia B (dă duritatea) Epon 812 NMA (anhidrida metil-nadică) ml 100 84 Soluţiile A şi B pot fi păstrate timp de peste 6 luni la 4ºC în sticle bine închise şi ferite de umezeală. pentru ca blocul să fie relativ scurt.6-dimetil-aminometil fenol) – acceleratorul polimerizării. sub o lupă binoculară cu posibilităţi de mărire de 70-100×. Pentru două probe (6 blocuri). spre a intra aproape în întregime în suportul ultramicrotomului. blocurile vor fi mai moi. iar dacă predomină soluţia B (3:7). ceea ce ar afecta polimerizarea.4. După încapsulare se induce polimerizarea mediului de includere prin introducerea capsulelor la etuvă la o temperatură de 60ºC timp de 24-48 de ore. În urma polimerizării se obţin blocuri dure. Ulterior se face etichetarea capsulelor (pe etichete se scrie cu creionul chimic pentru Vestopal şi cu creion obişnuit pentru Epon – pentru a se evita ştergerea simbolurilor la contactul cu mediul de includere) şi completarea concomitentă a tuturor capsulelor de gelatină. ÎNCAPSULAREA Încapsularea specimenelor se face în capsule de gelatină foarte bine uscate (ţinute câteva ore la etuvă la 60°C) – în fiecare capsulă se pune o picătură de mediu de includere şi apoi câte două cuburi dintr-o probă pentru fiecare bloc. Se amestecă foarte bine cu o baghetă de sticlă şi apoi se centrifughează pentru eliminarea bulelor de aer. sau chiar la spargerea acestora. transparente. Se completează cu Vestopal (Epon) circa 3/4 din volumul capsulelor. ele trebuie scoase de la frigider şi ţinute la temperatura camerei timp de câteva ore pentru a evita condensarea vaporilor de apă pe ele. raportul de combinare A:B = 5:5 la care se adaugă 150 μl DMP 30 (2. Temperatura mai ridicată poate duce la polimerizarea neomogenă. deci includerea corectă. dacă predomină soluţia A (7:3). Raportul 5:5 duce la obţinerea unor blocuri potrivit de dure. 355 .

la o mărire de 50-100×. prismatică. deoarece acestea pătrund prea adânc. Înainte de folosire este necesară pregătirea suplimentară a cuţitelor. SECŢIONAREA Această operaţie este necesară pentru obţinerea secţiunilor ultrafine. Tăierea se va face pe o folie de cauciuc.5 mm. Operaţiunea de modelare a blocurilor este necesară pentru ca în momentul secţionării să se obţină secţiuni trapezoidale care vor forma benzi rectilinii. cu atât tensiunea de accelerare a electronilor va trebui să fie mai mare pentru a se putea obţine imaginea pe ecranul fluorescent al microscopului. Cele mai potrivite sunt rondelele de metal din comerţ. barele de sticlă se curăţă uşor cu un tampon de vată cu acetonă anhidră după care se şterg cu o bucată de tifon curat. apare ca o linie albă. imediat sub tăişul cuţitului se formează o linie curbă. asigurându-se astfel o tăiere uşoară şi o rupere a benzilor de sticlă fără tensiuni. Pentru realizarea cuţitelor se poate utiliza aparatul special conceput pentru aceasta (knife maker). şi la fracturare sticlei se produc tensiuni care afectează calitatea cuţitului. Se modelează câte două blocuri pentru fiecare probă. câte un bloc fiind păstrat ca rezervă. de aceeaşi intensitate pe toată linia de tăiere. Se poate întinde înainte de tăiere o urmă de petrol cu ajutorul unui tampon de vată. Folosirea knife-maker-ului are ca rezultat obţinerea de cuţite cu tăiş drept. Cuţitele selecţionate pentru secţionare se păstrează ferite de praf. sticla pentru cuţite.1-0. în cazul tăierii manuale. Apăsarea pe foaia de sticlă trebuie să fie uşoară. rezultând câte două cuţite de formă triunghiulară. Înainte de confecţionarea cuţitelor. pentru care se foloseşte ca materie primă. strălucitoare.la nivelul probei se execută un trunchi de piramidă care să poarte în vârf o suprafaţă trapezoidală cu laturile de aproximativ 0. pe diagonala cărora se va face o nouă tăietură. cu o grosime care să permită străbaterea lor de către fasciculul de electroni acceleraţi la tensiuni de 50-100 kW în TEM. sub formă de bare. mult mai accesibile. Aceasta începe în punctul unde linia Wallner se curbează: zona cea mai ascuţită examinată la microscopul stereoscopic al ultramicrotomului. Din cauza tensiunii de fracturare. Pentru secţionare se pot folosi cuţite de diamant sau cele de sticlă.2 mm. late de 25 mm şi groase de 5. cu ajutorul căreia se poate detecta zona utilă a cuţitului. poate fi folosită orice sticlă albă plană. La marginea 356 . lungi de 400 mm. aşa-zisa linie Wallner. cu grosimea de 5-8 mm. Cu cât secţiunile sunt mai groase. Pentru tăierea sticlei nu se folosesc cuţite de diamant. cuţitele pot avea muchia de tăiere oblică. S-a demonstrat că dacă nu există sticlă specială pentru cuţite. Din barele de sticlă se vor tăia în prima fază pătrate. în timp ce zonele învecinate prezintă dinţi de fierăstrău.

bara de înaintare în sus şi în jos prin acţionarea manuală a acesteia – de la viza de pe panoul de comandă. Blocurile se montează astfel ca baza mare a trapezului din vârful piramidei să fie perfect paralelă cu lama cuţitului. Pentru secţionare blocurile se montează pe rând în dispozitivul barei de înaintare al ultramicrotomului LKB. oglinda de apă trebuie să fie orizontală. apoi se face oglinda. să nu prezinte menisc. mişcând uşor. ceea ce ar putea determina udarea blocului şi compromiterea secţionării. pe o suprafaţă cât mai mare posibilă (ideal este completă) a acesteia. egală cu grosimea secţiunii (500-1000 Å). Pentru realizarea acestui lucru se reglează angrenajele intermediare care ajută la fixarea suportului care poartă blocul de bară de înaintare a ultramicrotomului. Cuţitul se instalează în ultramicrotom raportat la limitatorul din stânga locaşului cuţitului şi la un unghi de 3º. Se apropie cât mai mult posibil cuţitul de bloc prin manevrarea voxelor macrometrică. Bara de înaintare va efectua mişcări succesive în plan vertical. piramida realizată la nivelul probei trebuie să se afle la nivelul gurii cuţitului (în plan vertical). grosimea acestora fiind apreciată după culoarea lor: Cenuşie Cenuşiu-argintie Argintie Argintiu-gălbuie Galben pai 100-200 Å 300-400 Å 500 Å 600 Å 650-700 Å Galben intens-maroniu Maro Maro – albăstrui Albăstrui Verde 700-800 Å 800-850 Å 900-1000 Å 1000-1100 Å 1300-1500 Å 357 . în zona cea mai ascuţită a acestuia. După fiecare mişcare de tăiere. reflexia luminii să se realizeze cât mai uniform la suprafaţa băii. Secţiunile obţinute vor pluti la suprafaţa apei distilate din baia cuţitului (care formează oglinda). prin reglarea poziţiei lămpii fluorescente. În poziţia blocată a barei de înaintare. Pentru aceasta. astfel încât suprafaţa de secţionare a blocului cade pe faţa de tăiere a cuţitului de sticlă sau de diamant. În cazul ultramicrotomului LKB avansul este controlat prin dilatarea termică a unei tije metalice (aliaj de nichel). bara înaintează cu o distanţă reglabilă. în paralel. şi apoi micrometrică a ultramicrotomului. La nivelul bazinului se va ajusta cantitatea de alcool 10% astfel încât. Se spală de cel puţin 3 ori cu alcool (10% sau acetonă 10%) sau cu apă distilată. temperatura camerei trebuie să fie cât mai scăzută posibil.prismei unde se află suprafaţa de secţionare se construieşte un bazin prin lipirea unei benzi adezive în poziţie perfect orizontală. De asemenea.

După uscarea peliculei la temperatura camerei. Pentru obţinerea peliculei de parlodion. Grilele electrolitice sunt reţele de cupru cu cadrul de 3 mm. însă în mod curent sunt folosite grile cu 100-200 de ochiuri. grilele fiind ferite de praf. în mijlocul unui cristalizor cu apă bidistilată se pipetează o picătură de parlodion. obţinute prin electroliză. Soluţia de acetat de uranil se prepară după reţeta: . CONTRASTAREA Ţesuturile biologice incluse în mase plastice. Numărul de ochiuri pe care le poate avea o grilă variază între 50 şi 1000. secţiunile de culoare argintie sunt foarte convenabile.Acetat de uranil . O. Uscarea grilelor se face cu hârtie de filtru prin tamponarea laterală a grilelor. Deoarece moleculele din structurile biologice sunt constituite din atomi cu număr atomic mic (C. cu atât dispersia electronilor şi implicit contrastul imaginii sunt mai mari. pentru a le evidenţia sunt contrastate cu săruri ale metalelor grele. Contrastul imaginii obţinute în microscopul electronic depinde de numărul atomic al elementelor din care este alcătuit specimenul: cu cât acest număr este mai mare. H). Se evaporă diluantul rămânând o peliculă de 100 Å grosime. Stratul de carbon are rolul de a proteja pelicula de parlodion de acţiunea distrugătoare a fasciculului de electroni. Grilele se păstrează în cutii Petri cu capac pentru a fi ferite de praf (pe hârtie de filtru pe care se trec simbolurile corespunzătoare specimenelor).Pentru cercetări de rutină. cu doi contrastanţi diferiţi: A. se trece la acoperirea cu carbon (un strat de circa 100 Å) a grilelor într-un evaporator cu vid (metalizor). În cazul de faţă contrastarea se face în două etape. Contrastarea urmăreşte creşterea capacităţii de împrăştiere diferenţiată a electronilor de către materialul biologic secţionat. N. Pe această peliculă se aşează grilele.Alcool etilic 50% în apă distilată 358 2. contrastul acestora este foarte scăzut. Grosimea secţiunilor se va alege şi ţinând cont de caracteristicile microscopului în care se va face examinarea. Secţiunile sunt preluate pe grile electrolitice de cupru (200 mesh) acoperite în prealabil cu o peliculă fină de parlodion. cu faţa în jos.6 g 20 ml . Contrastarea cu acetat de uranil. Din fiecare bloc se vor culege secţiuni pe cel puţin câte 2 grile. şi ca urmare. Grilele sunt apoi scoase cu ajutorul unor rondele de hârtie. datorită fineţei lor şi a compoziţiei chimice. au putere mică de împrăştiere a electronilor.

Electronii emişi de tunul de electroni al microscopului şi acceleraţi de o tensiune înaltă (0. Se ţin grilele pe acetat de uranil 15-20 minute după care se spală la jet de pisetă cu apă distilată-alcool şi se iau pe hârtie de filtru spre a nu adera la vârful pensei fine cu care se lucrează. Soluţia de citrat de plumb se prepară după reţeta: Citrat de plumb (GM 1053. interacţiune în urma căreia apar următoarele semnale: 359 .410 g 8 ml Se dizolvă în 30 ml apă distilată şi se agită puternic timp de 5-10 minute 2. în timp ce la cel de baleiaj. pe suprafaţa probei cercetate. Se ţin grilele pe citratul de plumb maxim 9 minute (timp după care apar precipitate). iar colorarea să se facă în apropierea câtorva granule de NaOH care să absoarbă CO2. Imaginea finală. În microscopul electronic de transmisie clasic imaginea se formează în întregime. Raza primară (incidentă) a electronilor acceleraţi şi concentraţi ce cade pe suprafaţa probei. filtrată. sub 10 nm.85) NaOH 1N Se agită timp de 5 minute Apă distilată Se aduce pH-ul la valoarea 12 Se completează până la 50 ml 1. imaginea se formează punct cu punct în forma rasterului. după care se lasă grilele cu secţiunile în jos pe picăturile de contrastant. care se compune din numărul total al liniilor. simultan. se va evita contactul contrastantului cu aerul atmosferic. Pentru evitarea apariţiei precipitatelor (reprezentate de carbonatul de plumb ce apare la contactul citratului de plumb cu CO2 atmosferic). Cel mai bine este să se folosească o soluţie proaspătă preparată. într-un fascicul îngust al cărui diametru în locul de încrucişare are.Se pipetează acetatul de uranil în godeurile unei plăci de parafină (ceară). Microscopia electronică de baleiaj Microscopul electronic de baleiaj sau scanning (SEM) diferă fundamental de microscopul electronic de transmisie în privinţa modului de formare a imaginii. Se pipetează citratul de plumb în godeurile plăcii de parafină (ceară). se numeşte raster. după care se spală la jet de apă distilată. după care s-au lăsat grilele cu secţiunile în jos pe picăturile de contrastant. interacţionează cu materialul. Contrastarea cu citrat de plumb.5–30 kV) sunt concentraţi. B. într-un sistem cu mai multe lentile.

îndepărtarea fixatorului în exces prin trecerea probei în tampon fosfat 0. şi aici probele trebuiesc deshidratate. Deşi rezoluţia acestui microscop nu permite observarea unor detalii de ordinul celor din TEM.4 timp de 75-90 minute.trei băi consecutive a câte 60 minute fiecare. Neavând de a face cu electroni transmişi prin probă. Pentru fixarea probelor biologice cu conţinut ridicat de apă se foloseşte aceeaşi combinaţie de fixatori ca şi pentru microscopia electronică de transmisie: . a patra peste noapte. dimensiunilor probei.4 pentru 60 – 90 minute la 4 0C. pentru SEM dimensiunile preparatelor pot depăşi 3 cm grosime.4 . în condiţii de vacuum înalt. o deshidratare naturală a materialului biologic produce alterări ale suprafeţei probelor datorate tensiunii superficiale. . capabil de a genera electroni secundari sub impactul fasciculului incident provenit din filamentul microscopului. pH 7. DESHIDRATAREA LA PUNCT CRITIC Deshidratarea la punct critic reprezintă o metodă de eliminare a oricărei substanţe volatile. pH 7.7% în tampon fosfat 0. examinarea desfăşurându-se. îndepărtându-se orice urmă de solvent sau a vreunei substanţe volatile din materialul biologic.postfixarea cu acid osmic (Os O4) 1% în tampon fosfat 0. în special. Timpii de lucru ai acestor etape vor fi adaptaţi tipului de ţesut organic şi. limitarea fiind dată doar de mărimea incintei probei. Ca şi în cazul TEM. suficient de profunde pentru a nu mai înregistra un aspect normal al acestora.1M. toate la 4 0C. pH 7. generatoare de vapori (ce pot diminua nivelul vidului din microscop) dintr-o probă biologică în vederea examinării acesteia la microscopul electronic cu baleiaj.• Electroni secundari (SE) • Electroni reflectaţi (BE) • Electroni Auger • Electroni absorbiţi de probă (AE) • Electroni transmişi prin probă (TE) • Fotoni • Radiaţii X. dar pentru probele biologice este necesară acoperirea acestora cu un strat foarte subţire de metal (prin evaporare în vid).prefixarea cu glutaraldehidă 2.15M. 360 . de asemenea. .15M. de asemenea la 4 0C.

dar se pot folosi şi alte gaze lichefiate ca şi fluid de tranziţie. cauza primară a acestora fiind efectele tensiunii superficiale. Tensiunea superficială poate fi redusă prin substituirea cu un lichid ce are o tensiune superficială mult mai mică decât a apei. aşteptându-se deformări minore ale suprafeţei probei în timpul deshidratării. meniscul devine plat. proba fiind supusă forţelor prezente la limita fazei lichid – vapori. unde aceasta este de câteva ori mai mică. evitând astfel posibilitatea apariţiei deformărilor datorate tensiunii superficiale. cu păstrarea nealterată a detaliilor de suprafaţă. intervenţia aşa-numitei continuităţi de fază sugerează o metodă de deshidratare pentru care tensiunea superficială poate fi redusă la zero. 361 . în final. Totuşi. suprafaţa lichidului devine foarte instabilă şi. va parcurge această tranziţie spre un mediu gazos “uscat” fără a fi în contact cu suprafaţa. Dacă tensiunea superficială scade foarte mult.În 1952. Prin creşterea temperaturii gazului lichefiat. Dacă proba biologică a fost în lichid. indicând o reducere a tensiunii superficiale. Anderson a dezvoltat această metodă folosind CO2 lichid. Când este atins punctul critic este posibilă trecerea de la faza de lichid la faza de gaz fără modificări dramatice. trece în faza de gaz. care prezintă o tensiune superficială la aer foarte mare. În acest sens. studierea morfologiei suprafeţelor probelor biologice implică prezervarea detaliilor de suprafaţă. Cel mai comun mediu al probelor biologice este apa. Deshidratarea normală prin evaporare la temperatura camerei induce deformări ale majorităţii specimenelor. metodă superioară sublimării apei în vid. spre deosebire de acetonă.

devin similare şi. apa din proba biologică trebuie înlocuită cu un alt fluid miscibil cu CO2. CO2 rămâne cel mai utilizat mediu pentru deshidratarea la punct critic şi este numit fluid de tranziţie. Nefiind miscibil cu apa. sub această valoare. Deasupra acestei temperaturi gazul nu poate fi lichefiat prin aplicarea presiunii. aceasta fiind temperatura critică căreia i se asociază o presiune critică. valori la care are loc tranziţia. Acest fapt este realizat pe izoterma de 31. schimbă apa din ţesut şi este miscibil cu CO2.Graficul indică faptul că.1 MONOXID DE CARBON -141. o substanţă poate fi clasificată drept gaz doar deasupra temperaturii critice. Acest fluid intermediar. în cazul probelor biologice la unele dintre acestea ar interveni modificări termice suplimentare. dioxidul de carbon. orice menisc vizibil va dispărea. o continuitate de stare. la atingerea punctului critic (caracterizat de valori ale presiunii şi temperaturii foarte precise).5 OXIGEN -118 AZOT -146 DIOXID DE CARBON +31. deşi se pot utiliza şi variante cu două fluide intermediare. procedura glutaraldehidă – osmium. în final. unde poate fi lichefiată.1 oC pentru CO2. proprietăţile stării de lichid şi ale stării de gaz (vapori) ale aceleiaşi substanţe. Dacă lichidul a fost încălzit într-o incintă închisă. deci. astfel. Înaintea acestor etape se realizează fixarea probei. coincid. Chiar dacă valorile critice ale diferitelor substanţe pot fi atinse practic. este mult mai precis termenul de vapori. CONSTANTE CRITICE Substanţa Temperatura critică (oC) HIDROGEN -234.1 APĂ +374 Presiunea critică (atm) 20 50 33 73 36 219 Deci. cel mai utilizat fiind. tensiunea superficială fiind zero având. în consecinţă. stadiul intermediar implică deshidratarea probei biologice cu ajutorul lichidului intermediar: (proba umedă) H2O > Acetonă > CO2 > DPC (proba uscată) 362 . de regulă. Aşa cum s-a menţionat. aşa încât presiunea critică să poată fi atinsă la temperatura critică. tipic pentru microscopia electronică.

363 . proba acţionând în acest caz ca oglindă pentru electroni. substituirea acetonei cu CO2 lichid sub presiune – operaţie repetată în funcţie de dimensiunile probelor.Specimenul este trecut prin diferite concentraţii crescătoare ale fluidului intermediar. ACOPERIREA CU METALE Toate probele neconductive necesită acoperirea cu un film subţire de material conductiv. imersia probei în acetonă în incinta aparatului. deshidratarea cu acetonă. având drept rezultat pierderi semnificative de material din probă. specimenele nonconductive examinate la parametri optimi prezintă invariabil fenomenul încărcării electrice ce conduce la distorsionarea imaginii şi la distrucţii termice. deoarece prezintă o tensiune superficială foarte scăzută. 5. încălzirea incintei până la atingerea punctului critic. 4. culminând cu înlocuirea completă a apei din ţesut cu acest fluid. 3. _______________acetonă________________________ H2O > 30% > 50% > 60% > 70% > 80% > 90% > 100% > CO2 ¤ ------------------. specimenul poate acumula o încărcătură suficient de mare pentru a decelera fluxul primar.7% şi OsO4 1% în tampon fosfat. 2.trei schimbări FLUIDE INTERMEDIARE / DESHIDRATANTE Substanţa ETANOL ACETONĂ FREON (113) APĂ Tensiunea superficială (dyne/cm) 23 24 19 73 Principalele etape ale deshidratării la punct critic: 1. fiind mai puţin susceptibil deformărilor datorate evaporării fluidului de tranziţie ce-l va înlocui. În absenţa stratului de acoperire. Materialul uzual pentru acoperirea probelor este aurul. În situaţii extreme.câte 10 minute fiecare ---------------------¤ . Această acoperire este necesară pentru eliminarea sau reducerea încărcării electrice ce se instalează rapid la suprafaţa unei probe neconductive la baleierea acesteia de către un flux de electroni de energie înaltă. eliberarea vaporilor de CO2. 6. fixarea probei cu glutaraldehidă 2.

Acoperirea se realizează prin evaporarea metalului în vid. 364 . de câteva sute de nanometri. ţinând cont de posibilitatea limitată de înclinare a probei în microscop. Pulberile. la capete aplicându-se o tensiune continuă de 1 – 3 kV. Probe biologice de tipul insectelor chitinoase. sporii sau alte probe ce nu pot fi manipulate cu pensa. pe baza radiaţiei X (specifică fiecărei specii chimice) generate din probă. Orientarea probei pe suport în aceasta fază este foarte importantă. imaginile fiind preluate în format digital sau clasic pe film. în timp ce. ce presupune legarea metalului la polul pozitiv şi a probei la cel negativ. surplusul fiind îndepărtat în momentul introducerii în vid pentru metalizare. montarea probelor se va realiza sub lupa binocular unde.Când scopul analizei nu este achiziţia unui spectru de raze X. abia apoi realizându-se acoperirea cu metale a acestora. pot fi aranjate în ordine pe un singur suport. compoziţia chimică a probei analizate atât calitativ cât şi cantitativ. Detectorul special al EDX identifică. EXAMINAREA DIFERITELOR PROBE IN SEM Probele pentru examinarea în SEM sunt montate pe suporturi conductive din cupru cu ajutorul unor discuri de carbon adezive pe ambele feţe. antene. Probele astfel pregătite se introduc în microscop si se examinează la diferite măriri. Astfel. putându-se realiza chiar hărţi cu distribuţia fiecărui element chimic în zona luată în studiu. precum şi cele cu un conţinut nesemnificativ de apă (frunze uscate) pot fi montate pe suport şi metalizate fără deshidratare. probe de tipul microfosilelor (foraminifere) sau segmente de aparate bucale. aurul este cel mai utilizat element pentru acoperirea probelor. aşa încât zona de interes să fie expusă direct fasciculului de electroni ce balează proba. dispozitiv instalat într-o incintă ce menţine un nivel de vacuum (10-2 Pa) suficient pentru a asigura o depunere a atomilor de aur într-un strat uniform şi foarte subţire. la celelalte probe este obligatorie uscarea la punct critic pentru prevenirea deformărilor datorate unei deshidratări brutale în aer. vor fi presărate pe suportul adeziv. O anexă importantă a SEM este sistemul de microanaliza elementală cu raze X (EDX). palpi (insecte).

..............X..............................SPM) este o microscopie mecanică ce acoperă câteva tehnici de vizualizare a suprafeţei unui eşantion (morfologia suprafeţei) cu o rezoluţie la nivelul moleculelor sau a grupurilor de atomi.............. Microscopia de Scanare a Probei Microscopia cu scanarea probei (Scanning Probe Microscopy ........................... Avantajele şi Limitele Microscopiei de Forţă Atomică ........................................ Weibel in 1981 was marked as the invention of STM..... 373 6.............. H................ MICROSCOPUL DE FORŢĂ ATOMICĂ Microscopia de forţă atomică Conf.............................. se poate vizualiza dintr-un eşantion maxim 150 X 150 um dacă rugozitatea în zona scanată este 365 Figura 1.......... Bibliografie ................... Nanomanipularea cu ajutorul Microscopului de Forţă Atomică ... .............................................. Rohrer.... Ch.......................... Nanolitografie cu Microscopul de Forţă Atomică ........... 365 2.............. An observation of this dependence between a W-tip and Pt surface by G.. În cazul celor mai performante echipamente SPM disponibile în prezent.......................... 1........... 376 Quantum mechanics predicts an exponential dependence of tunneling current with a separate distance between the two electrodes......................................... 371 4... Aplicaţii ale Microscopiei de Forţă Atomică .. Binnig.............................. 369 3............... Ioan Burda Cuprins 1....................... Spectroscopia de Forţă Atomică ............... dr....... Microscopia de Scanare a Probei ....... 374 7.. Imagine SEM x1000 pentru un cantiliver – tip............... Gerber and E............................................................... 371 5........... 375 8........... Microscopia de Forţă Atomică ..........................................

cele mai multe sisteme SPM utilizează un fascicol laser pentru a determina deflexia cantilever-ului. Cunoaşterea acestor forţe este unui fascicul laser şi a unui fotodetector. Y şi Z iar cu ajutorul lui se poate poziţiona proba (tip-ul) cu extremă precizie în 3D (3 Dimensiuni).electrice ale scanner-ului piezoelectric depind în ceea mai mare măsura performanţele întregului SPM. tip) şi eşantionul scanat. deplasarea pe o direcţie şi tensiunea aplicată pe acea direcţie) adică. În prezent. importantă pentru interpretarea imaginilor SPM sau pentru a determina proprietăţi mecanice locale ale eşantionului. Tehnologia SPM are la bază un concept simplu: scanarea unei suprafeţe cu ajutorul unui vârf (tip) foarte ascuţit (sharp. respectiv cu polaritatea acesteia. De regulă. Scanner-ul SPM este realizat din material piezoelectric (PZT) care se expandează şi contractă proporţional cu tensiunea aplicată. Un alt element de bază al unui SPM este scanner-ul piezoelectric. Detecţia deflexiei cu ajutorul deflexie. Scanner-ele sunt caracterizate Figura 3. scanner-ul este construit sub forma unui tub (Figura 3) cu electrozi pentru deplasarea pe X. Pentru a calcula forţa de interacţie utilizăm legea lui Hook (F = kz). se definesc tehnicile SPM. În funcţie de mecanismul de interacţiune dintre probă (vârf. Figura 1). atât cât se extinde sau contractă un material piezoelectric per volt.mai mică de 10 um. De performanţele mecan. iar z este distanţa pe care cantilever-ul a suferit o Figura 2. Acest tip este ataşat de o grindă (cantilever) flexibilă. deplasarea nu este 366 . se poate spune că este singurul element puternic limitativ în evoluţia viitoare a microscopiei mecanice. astfel încât să poată fi urmărit profilul suprafeţei scanate. Pentru valori mari ale tensiunii. Mai mult. unde k este constanta de elasticitate a cantilever-ului. Cu ajutorul unui astfel de sistem de detecţie este posibilă măsurarea indirectă a forţei dintre tip şi suprafaţa eşantionului studiat. Scanner piezoelectric de forma prin sensibilitatea lor (raportul dintre tubulara. vârf cu raza de curbură de circa 3-50 nm. Acest fascicul laser se reflectă de partea opusă tip-ului (fabricat din Si sau Si3N4) pe un fotodetector sensibil la poziţie (Figura 2).

Pentru a limita efectele date de procesul de îmbătrânire. Pe lângă morfologia suprafeţei. Cele mai comune tehnici SPM sunt: • Scanning Tunneling Microscopy (STM) este tehnica SPM de bază care a generat întreg domeniul acoperit azi de microscopia mecanică. Desigur că acest efect poate fi limitat prin aplicarea unei tensiuni neliniare pentru scanare (identificată în procesul de calibrare a scanner-ului). Proba (un tip de fibră optică plus o apertură) trebuie să fie foarte aproape de suprafaţa eşantionului. o recalibrare frecventă a scanner-ului se impune mai ales în primul an de utilizare. magnetice si mecanice. • Atomic Force Microscopy (Microscopia de Forţă Atomică) a apărut ca o extensie în utilizarea microscopiei mecanice (1986) pentru eşantioanele nu foarte conductoare. Practic. aşa că. fabricantul utilizează cel putin 48 de ore scanner-ul înainte de a fi livrat pentru o aplicaţie. poate fi obţinută o rezoluţie dincolo de limita de difracţie. Din această cauză. orice interacţiune dintre tip şi suprafaţa eşantionului este măsurabilă. cu un diametru mai mic decât lungimea de undă. Cu toate acestea. fiind extrem de utilă în multe domenii de cercetare. Efectul final al acestei situaţii este identificat prin rezultate diferite funcţie de direcţia de scanare.liniară cu tensiunea aplicată şi această dependenţă diferă de la scanner la scanner. toate eşantioanele de material de orice tip (inclusiv de natură biologică) pot fi investigate/măsurate cu AFM. Prin utilizarea unei surse cvasi-punctiforme. Principiul STM-ului este dat de efectul de tunelare al electronilor între doi electrozi în prezenţa unui câmp electric. această tehnică a cunoscut o dezvoltare rapidă (în comparaţie cu STM). 367 . Această diversitate este bazată pe principiul de funcţionare care implică existenţa unui tip (probă) în contact sau foarte apropiat de suprafaţa eşantionului. Pentru a putea măsura efectul de tunelare distanţă dintre cei doi electrozi trebuie să fie de aproximativ 1 nm. AFM-ul a fost dezvoltat în ultimele decenii pentru a măsura o mare varietate de proprietăţi pe suprafaţa eşantionului cum ar fi proprietăţile electrice. • Near-Field Scanning Optical Microscopy (NSOM) utilizează o sursă de lumină de foarte mici dimensiuni ca mecanism de formare a imaginii. Poate cel mai neplăcut lucru legat de scanner este procesul exponenţial de îmbătrânire ce determină o scădere a sensibilităţii în timp. Această situaţie experimentală este posibilă în cazul unor suprafeţe conductoare curate (practic fără rugozitate) precum şi în lipsa vibraţiilor ambientale.

indice de refracţie. În acest caz. eşantionul poate fi opac. tub fotomultiplicator sau CCD (Charge Coupled Devices). Mutarea laterală a tip-ului este denumită “shear-force” feedback. APD (Avalanche Photo Diode). La fel ca în orice microscopie optică. Rezoluţia imaginii este limitată de dimensiunea aperturii detectorului şi nu de lungimea de undă a luminii incidente. pentru a menţine o distanţă de lucru dintre probă şi suprafaţa eşantionului. Detecţia semnalului se realizează prin: spectrometru. Pentru a vizualiza imaginile. avem mai multe moduri de operare: • Transmisie: lumina care vine prin apertura probei este transmisă prin eşantion. structura chimică si stress-ul local. • Colectare: eşantionul este iluminat dintr-o sursă externă cu arie mare de iluminare. prin intermediul unei fibre optice. în cazul unui NSOM avem o rezoluţie laterală de circa 20 nm şi o rezoluţie verticală de 2-5 nm. O prima metodă este echivalentă cu cea din cazul AFM. topografie. dependenţa de lungimea de undă şi reflectivitate. cum ar fi indicele de refracţie. se realizează prin două metode. şi în acest caz. sunt necesare eşantioane transparente. iar proba colectează lumina reflectată. În funcţie de modul de obţinere a imaginii. fluorescenţă. adică prin intermediul unui cantilever şi a unui sistem de detecţie al deflexiei cu fascicul laser. În cazul NSOM. sunt utilizate câteva mecanisme de contrast: polarizare. lumina laserului. 368 . De regulă.mai aproape decât lungimea de undă. feedback-ul necesar în sistem. dar intensitatea lumini este scăzuta si dependentă de forma probei. parcurge o apertură realizată prin acoperirea ei cu metal (cum ar fi Al) şi microfabricată la fel ca o probă AFM. Această regiune limitată de proba şi eşantion este numită “Near-Field” de unde şi numele acestei microscopii. • Reflexie: lumina care vine prin apertura probei se reflectă pe suprafaţa eşantionului. mecanismele de contrast pot fi uşor adaptate pentru studierea diferitelor proprietăţi. birefringenta. cât şi de colectarea luminii reflectate. Dimensiunea punctului de lumină determină rezoluţia maximă ce poate fi obţinută. Un al doilea mod este un mod rezonant (tuning fork) şi este monitorizată amplitudinea oscilaţiei când tip-ul se mişcă deasupra suprafeţei eşantionului. • Iluminare/Colectare: Proba este responsabilă atât de iluminare. Tipic.

1986) a fost dezvoltată ca o soluţie tehnică pentru STM. ceramici. materiale compozite. de a măsura prin microscopie mecanică eşantioanele neconductoare. Potentialul Lennard-Jones versus modurile de operare AFM. modificări la situaţii specifice: măsurători in lichide. cantilever-ul este optimizat pentru sensibilitate mare la forţele de frecare laterală. atracţie) al forţei Van der Waals ca o funcţie de distanţă. Relativ la natura forţelor implicate şi interacţiunea dintre tip şi suprafaţa eşantionului definim cele mai importante moduri AFM de operare (clasice): • Contact Mode (modul contact). Potenţialul Lennard-Jones (Figura 4) este un model aproximativ pentru cazul izotropic (repulsie şi Figura 4. iar cantilever-ul este mutat în sus sau în jos pe timpul scanării. LFM este util în vizualizarea forţelor de frecare pe suprafaţa eşantionului. în medii chimice corozive sau medii biologice termostatate.LFM) măsoară forţele de frecare dintre tip şi suprafaţa eşantionului.2. Aceste forţe sunt măsurate indirect prin deflecţia laterală (twist) a cantilever-ului. Versatilitatea AFM-ului a dus în timp la o diversitate de moduri de operare şi adaptări. În acest scop. cantilever-ul este foarte subţire. care sunt determinate de neomogenităţile materialului. pentru suprafeţe ale eşantionului cu rugozitate scăzuta să se opereze în modul distanţă constantă. Marele avantaj al AFM-ului este capacitatea acestuia de a investiga practic orice tip de suprafaţă inclusiv polimeri. dacă eşantionul este special preparat. Modul de operare LFM este 369 . sticle şi materiale biologice. Se poate. Tip-ul este în contact puternic cu suprafaţa eşantionului şi în modul distanţă constantă este posibilă rezoluţia atomică. Capabilitatea de a urmării suprafaţa eşantionului în acest mod este limitată doar de circuitul de feedback. tip-ul este menţinut (de obicei) la o forţă constantă puternic de respingere. precum şi pentru a pune în evidenţă muchiile de pe suprafaţa eşantionului. tocmai de aceea. Acesta a fost de altfel primul mod de operare AFM implementat ca o adaptare la STM. de asemenea. • Microscopia de Forţă Laterală (Lateral Force Microscopy . Microscopia de Forţă Atomică Microscopia de Forţă Atomică (AFM.

Prin acest mod de operare AFM se pot determina şi compara simultan morfologia şi proprietăţile locale. Tapping Mode) este denumirea clasică. vîscoelastice). Modurile de operare din Microscopia de Forţă Atomică sunt rezumate în Tabelul 1 cu referire la forţa de interacţiune pentru fiecare mod. Desigur că forţele de interacţiune dintre tip şi suprafaţa eşantionului sunt foarte mici. Tabelul 1 este departe de a fi complet (doar modurile esenţiale) şi mai mult. tipul este în contact constant cu suprafaţa eşantionului. ceea ce înseamnă că tip-ul este apropiat de suprafaţa eşantionului. de ordinul pN. iar slop-ul. NonContact Mode este un concept ce descrie familia modurilor AC (moduri de curent alternativ). forţa-distanţă este măsurată determinând astfel elasticitatea eşantionului.• • • • un mod derivat din modul de operare Contact Mode. Şi în acest mod. Acest mod de operare este un mod măsurat simultan cu modurile AC enumerate mai sus. 370 . cantilever-ul este oscilat în apropierea suprafeţei eşantionului. Avantajul acestui mod de operare este legat de rezoluţia laterală mai ridicată fără apariţia unor forţe de dragare. cantilever-ul este oscilat îin regim de atracţie. în aşa fel încât. Aceste date pot fi culese simultan cu topografia suprafeţei eşantionului. în fiecare an se adăuga noi moduri de operare sau noi versiuni ale acestora. Force Modulation este un mod AFM de operare ce se referă la utilizarea proprietăţilor materialului probei pentru a controla interacţiunea cu suprafaţa eşantionului. Tip-ul este oscilat şi pus în regim de respingere. Phase Imaging este un mod în care sunt culese informaţii despre shift-ul de fază a cantilever-ului aflat în oscilaţie în raport cu semnalul de excitaţie. în acest caz. Contact Intermitent (Dynamic Force. Acest shift de fază se corelează cu proprietăţi specifice suprafeţei eşantionului (frecare. adeziune. iar mai recent este denumit DFM (Dynamic Force Mode). dar părţi ale oscilaţiei sunt extinse în regimul de respingere. În acest caz. Detecţia se bazează pe măsurarea diferenţelor de cuplaj cu suprafaţa eşantionului care determină schimbarea frecvenţei de rezonanţă a cantilever-ului şi/sau a amplitudinii de oscilaţie. dar nu este în contact cu aceasta. tip-ul intră intermitent în contact cu suprafaţa eşantionului.

Mod de Operare contact mode non-contact mode intermittent contact mode lateral force mode magnetic force thermal scanning Forţa de Interacţie puternic de respingere – forţa constantă sau distanţa constantă slabă de atracţie . 3. această tehnică experimentală a devenit în timp cea mai utilizată tehnică în studierea macromoleculelor sau 371 .Tabelul 1. situaţie în care cantilever-ul este vibrat (metoda AC).1 nm. Spectroscopia de Forţă Atomică O altă aplicaţie majoră AFM este Spectroscopia de Forţă Atomică (FS. Această metodă este utilă în măsurarea contactului la dimensiune nano (legături atomice. 4. forţe Casimir) cum ar fi forţa de rupere a moleculelor de suprafaţa eşantionului. iar deflexia cantilever-ului este monitorizată în funcţie de deplasarea scanner-ului. forţe Van der Waals.vibrarea probei puternică de respingere . O altă metodă modernă de investigare mediată de AFM este nanoidentarea (nanoidentation).vibrarea probei forţele de frecare exercită o torsiune a cantileverului folosit în scanare câmpul magnetic de la suprafaţa eşantionului poate fi vizualizat distribuţia conductivităţii termice pe suprafaţa eşantionului este vizualizată. tip-ul este împins în faţă şi apoi retras de la suprafaţa eşantionului. Aplicaţii ale Microscopiei de Forţă Atomică Datorită faptului că AFM-ul poate investiga practic orice tip de material fără o preparare specială a eşantionului. Limita de măsurare este în domeniul pN. Force Spectroscopy) şi se referă la măsurarea directă a interacţiunii dintre tip şi suprafaţa eşantionului în funcţie de distanţa de separare. În această metodă. iar distanţa pe axa Z este mai bună de 0. Aceasta tehnică inovativă este combinată cu probe specializate şi este corelată cu intensitatea spectrală (Raman) în timp real pentru a vizualiza legăturile chimice. Spectroscopia de Forţă Atomică poate fi implementată ca şi deflexie statică sau mai recent în mod dinamic. AFM-ul poate aplica un stres mecanic controlat pe suprafaţa eşantionului (raza de curbură a tip-ului este de câţiva nm aşa că P = F/A determină presiuni ridicate. megapascali) care produce un shift în semnalul Raman corelat cu stresul aplicat.

este frecvent utilizată în studierea suprafeţelor în industria electronică (Silicon wafers. încât multe din articolele ştiinţifice de ieri au devenit azi automatizare. ¾ Restaurarea Imaginii (Deconvoluţia Probei). dar nu este o alegere potrivită pentru suprafeţele moi. Murdăria şi efectele de capilaritate induse de apa de pe suprafaţa eşantionului vor avea un rol dominat si. Pentru a vizualiza atomi sau molecule este necesar ca interacţiunea să fie numai între tip şi atomul/molecula cea mai apropiată (acest lucru se poate realiza pentru rezoluţia atomică numai în tehnologia STM). reţele de difracţie. Reţinem din aceste timpuri istorice câteva distorsiuni induse de forma tip-ului care merită înţelese. precum şi în studierea unor nanostructuri (suprafaţa polimerilor. Dacă alegem un contact apropiat atunci AFM-ul va deveni foarte sensibil la zgomote (vibraţii) externe. bacterii). Calibrarea automată tridimensională a uşurat mult munca operatorului. imaginea obţinută este practic convoluţia dintre forma tip-ului şi morfologia locală. în final. Marii producători de echipamente de microscopie mecanicp au reuşit în ultimul timp să elimine o mare parte din limitările anterioare prin îmbunătăţirea componentelor mecanice şi electronice. circuite integrate). de exemplu. Modul de lucru AFM trebuie ales în funcţie de caracteristicile ce prezintă interes în investigare. Modul contact este o bună alegere pentru suprafeţele dure. ceea ce vedem într-o imagine AFM este mai degrabă o imagine mediată a morfologiei suprafeţei eşantionului. în general. cât şi tehnologic prin limita de ascuţire a tip-ului. cromozomi. dar va deforma mai puţin sau deloc eşantioanele moi. este importantă cunoaşterea formei tip-ului (geometria acestuia) pentru o interpretare corectă a imaginilor obţinute. ADN. Performanţele unui AFM sunt limitate de un număr de factori dintre care amintim: capacitatea elementelor mecanice de a muta tip-ul cu precizie şi de a măsura poziţia acestuia. precum şi de natura suprafeţei eşantionului. calitatea tip-ului. Modurile AC (cu vibrarea probei) sau intermitente au fost imaginate pentru a investiga suprafaţa unor eşantioane biologice. Aşa că. deoarece poate produce o contaminare a tip-ului sau poate îndepărta material de pe suprafaţa eşantionului.eşantioanelor biologice (proteine. La rezoluţii ridicate. ceramici. De asemenea. În aceste situaţii. liniaritatea scanner-ului şi vibraţiile ambientale. Acest lucru nu este posibil în cazul AFM şi este limitat atât fizic (Van der Waals). ¾ Distorsiuni ale imaginii induse de probă. vor degrada calitatea imaginii obţinute. Vizualizarea cu AFM a suprafeţelor pentru eşantioane cu relief înalt implică utilizarea unui 372 . medii de stocare a datelor. răşini naturale).

În prezent. Trebuie menţionat că pe lângă nanolitografia de scanare a mai fost dezvoltată în ultimul timp şi litografia vectorială. Nanolitografie vectorială de la procedeu (a) la rezultat (b). În figura 5. Nanolitografia nu se rezumă la utilizarea AFM. Patter-ul poate fi creat manual sau automat. În caz contrar.tip foarte ascuţit. În aceste situaţii. aşa că. trebuie să apelam la metode matematice pentru a restaura imaginea (deconvoluţie). ceea ce vedem poate fi imaginea tip-ului reflectată de suprafaţă. o descriere sumară a principalelor tehnici este utilă: • Scanning Probe Lithography (SPL) este o unealtă/tehnologie promiţătoare pentru realizarea de pattering la scală nano. 373 . atomi individuali pot fi manipulaţi prin utilizarea tip-ului unui STM. se pot vedea câteva exemple clasice de nanolitografie. această tehnică de utilizare a unui AFM este utilizată (nu foarte frecvent) în realizarea de circuite integrate (nanocircuite) sau de sisteme nanoelectromecanice (NEMS). Figura 5. Metoda efectivă de deconvoluţie depinde de caracteristicile suprafeţei eşantionului şi de geometria tip-ului (un subiect frecvent prezent în literatura ştiinţifică). 5. Dip-Pen Nanolithography (DPN) a fost prima metodă SPL disponibilă comercial pentru AFM. Nanolitografie cu Microscopul de Forţă Atomică Nanolitografia se referă la fabricarea de structuri nanometrice mai mici de 100 nm. • Atomic Force Microscopic Nanolithography (AFMN) este o metodă de pattering pe o suprafaţă chimică-mecanică pentru AFM. litografie AFM (5 um). De exemplu.

pot fi manipulate pentru a realiza circuite electrice sau pentru a măsura proprietăţile lor mecanice. 374 . sau mai recent. Un alt exemplu de nanomaipulare este prezentat în figura 7 a unor particule de latex cu diametrul de 100 nm într-o structură complicată. Prin utilizarea AFM-ului ca sistem nanorobotic. pattern-ul poate fi realizat manual sau automat. Figura 6. Trebuie menţionat că AFM-ul poate fi utilizat ca un robot 3D (manipulator 3D) care are spaţiul de lucru la scală nano. Figura 7. Nanomanipularea unor particule de latex cu diametrul de 100 nm. Nanomanipularea cu ajutorul Microscopului de Forţă Atomică Diverse structuri nanometrice. implicate în manipularea lor. prin utilizarea unei interfeţe haptic şi a unei aplicaţii de realitate îmbunătăţită. Un exemplu de nanomanipulare a unor particule de aur (nano cuburi) cu diametrul de 100 nm pe o suprafaţă de sticlă se poate vedea în figura 6.6. cum ar fi nanotuburi şi nanofire care sunt pe suprafaţa unui eşantion. Nanomanipularea unor nano cuburi de aur pe o suprafaţă de sticlă. După cum am menţionat. nanomanipularea poate deveni o operaţie relativ uşor de realizat.

Molecula de AND are un diametru de circa 2. Figura 8.4 nm şi este în esenţă o structură scurtă (3.6 nm) care se repetă. Microscopia concurenta SPM (AFM) este SEM (Scanning Electron Microscopy) dar spre deosebire de SEM unde avem o proiecţie 2D sau mai exact o imagine 2D pentru eşantion. eşantionul nu necesită un tratament special (acoperirea cu metal sau carbon) care poate compro375 . Aceste molecule cunoscute de mai mult de o jumătate de secol au atras atenţia. Microscopul de Forţă Atomică are în aceeaşi măsură avantaje şi limite. Avantajele şi Limitele Microscopiei de Forţă Atomică La fel ca orice alt echipament. pentru aplicaţii în nanotehnologie. respectiv a avantajelor. În acelaşi timp. Mai mult. hopping termal) au fost studiate şi verificate indirect experimental.AFM-ul ca nano robot este extrem de util în nanomaipularea unor celule sau molecule. în special nanomanipularea moleculelor ADN. După aproximativ 15 ani de controverse relativ la mecanismul de conducţie (transfer de sarcină) este acum bine demonstrată dependenţa de distanţă (tunelarea într-un singur pas sau hopping termic mai mulţi paşi). Cunoaşterea acestor limite. în ultimul timp. Ambele mecanisme (tunelarea sarcinii. un exemplu este prezentat în figura 8. cum ar fi realizarea unor circuite electronice (motivată de studierea proprietăţilor electrice). 7. este importantă în luarea unei decizii corecte înainte de a apela la acest echipament pentru investigarea unui eşantion. Elucidarea acestor situaţii nu se poate face decât prin experienţe de nanomanipulare a ADN-ului. alte rezultate îl prezintă ca fiind un semiconductor. Nanomanipularea ADN-ului pe o placă de polycarbonat (aria de scanare este de 5 um). în cazul AFM avem un profil 3D. unele rezultate sugerează că avem un bun conductor (chiar supraconductor la temperaturi joase). iar altele ca un izolator. în literatura de specialitate ADN-ul rămâne pentru moment un subiect neelucidat.

Un alt avantaj este posibilitatea de a investiga eşantionul în condiţii ambientale. 376 . (2003). Y. în unele situaţii. Giessibl.Y. Bibliografie 1. care în cazul SEM este de ordinul milimetrilor. "AFM single molecule experiments at the solid-liquid interface: în situ conformation of adsorbed flexible polyelectrolyte chains". M. "Advances în atomic force microscopy". cu posibilitatea de scanare simultană a unor arii diferite. Roiter. Aceste limitări sunt un subiect fierbinte în cercetarea instrumentală din acest domeniu şi câteva succese au fost obţinute prin utilizarea în paralel a mai multor cantilevere sau. eşantionul. Minko. drift-ul termic poate induce distorsiuni pe imagine. 2. bine cunoscută limitarea puternică indusă de existent pe eşantion a unor pereţi drepţi sau şanţuri foarte adânci şi înguste a căror morfologie nu poate fi pusă în evidenţă decât prin utilizarea unor tip-uri speciale şi extrem de scumpe. Proceedings of the Royal Society a Mathematical Physical and Engineering Sciences 457: 1161. Franz J. Din păcate. Marele dezavantaj al AFM faţă de SEM se referă la aria scanată. "Direct measurement of interatomic force gradients using an ultra-low-amplitude atomic force microscope".mite. această post-filtrare poate elimina unele caracteristici ale eşantionului. G. Este. 8. Datorită faptului că timpul de scanare în cazul AFM-ului este mare.Z care necesită refacerea în software a imaginii. 3. 4. de asemenea. toate acestea la o viteză mult mai mare. Surface Science Letters 290: L688. lucru foarte important pentru eşantioanele biologice. făcând lipsită de precizie măsurarea unor structuri. "Fractured polymer/silica fiber surface studied by tapping mode atomic force microscopy". Reviews of Modern Physics 75: 949. Q (1993). La fel ca şi în orice altă tehnică bazată pe realizarea de imagini este posibilă apariţia de artefacte care pot fi induse de tip-ul instabil sau mediul ambiental impropriu sau chiar de eşantionul studiat. comparabilă cu rezoluţia unui TEM (Transmission Electron Microscopy). Journal of the American Chemical Society 127 (45): 15688–9 Zhong. Peter (2001). distorsionate de efectul de hysteresis al materialului piezoelectric. precum şi de efectele de mixare între axele X. AFM cu rata de scanare video. mai recent. Imaginile obţinute cu AFM pot fi. Ralph A. asigurând în principiu o rezoluţie mai bună decât SEM. S (Nov 2005). Ahmet Oral. de asemenea. Aceste limitări au fost eliminate în cazul microscoapelor AFM moderne prin scannere în bucla închisă sau scanner-e ortogonale. Hoffmann.

N. 41 (2008) 024007 (12pp) 7. 2003. V. J. F. N. Phys. “SPM-Based Investigation of Site Specific Biological Interactions”. W. V. Proceeding of the 2003 IEEE International Conference on Robotics and Automation. 2000. D: Appl. Xi. Proceedings of the 2001 1st IEEE Conference on Nanotechnology 10. Xi. Taiwan. K. October. Lett. 6. 3-D nanomanipulation using atomic force microscopy. Ayres. Proceedings of International Symposium on Smart Structures and Microsystems. H.5. R. Hong Kong. Wang. 82 (5): 808–810. R. (2003). Lapshin (1998). Fung. Phys. Ayres. Salam.Gilgenbach. F.M. Ning Xi “Micro/Nano Motion Control for Biological Specimen Handling”. "Neutral particle lithography: a simple solution to charge-related artefacts în ion beam proximity printing".Y. Hummert. 8. H. May. C. 377 . Goolsby. Review of Scientific Instruments (USA: AIP) 69 (9): 3268–3276. J C Wolfe and B P Craver. Li. M.Saglik and D. Yu. "Automatic lateral calibration of tunneling microscope scanners". Appl. M. "Chemomechanical surface patterning and functionalization of silicon surfaces using an atomic force microscope". K. Davis et al. Salam. V. 9. Phys. G. B.

....................... Optical microscope Scanning electron microscope Electron scattering Transmission electron microscope Electron absorption Atomic force microscope Forces of probe-sample interaction 1Å-200 μm 0.................... de regulă..................378 2.............................. Dintre acestea.Scanning Probe Microscopy Introducere........................ Tehnici Experimentale ...Microscopia de forţă atomică – partea a II-a Conf..................................... Bibliografie ............. dr......... O evaluare obiectivă a tehnicilor microscopice (Tabelul 1) pune în evidenţă elemente de performanţă favorabile pentru SPM (Scanning Probe Microscopy). în microscopia modernă prelevate odată cu informaţia topografică.........................5Å-20 μm Mechanism of contrast formation Range in XY Range in Z Light absorption (diffraction......... în primul rând merită remarcată informaţia 3D reală a topologiei suprafeţei dublată de măsurarea unor mărimi fizice pe suprafaţă................... Bibliografie ............. Implementarea Noilor Tehnologii.......................... Tehnici Experimentale ......393 1.................... scattering etc) or fluorescence 200nm – 1mm 500nm – 10 mm 1nm-10 mm 1Å-100μm What is studied Complicated sample preparation optical slice optional 10 nm-1 mm limited by ultratome (10 nm-1 μm) surface real thin slice necessary necessary surface optional 378 .....................Scanning Probe Microscopy ..................386 4.. Ioan Burda Cuprins 1............. polarization... Tabel 1.......................385 3...............................

1. Fasciculul este poziţionat în centrul unui foto-detector cu patru cadrane (fotodiodă). Viteza de scanare depinde de caracteristicile mecanice ale scanner-ului şi tot de calităţile mecanice ale acestuia depinde şi aria maximă ce poate fi scanată. să reţinem că acest detector mecanic este capabil să pună în evidenţă atomii.1) de un sistem opto-electronic bazat pe reflexia unui fascicul laser pe cantilever. 379 . Consecinţa acestei situaţii se reflectă în performanţa finală a experimentelor în care apelăm la un SPM şi putem spune că în mare măsură performanţa este dependentă de iscusinţa experimentatorului. La o extremă. nu ne putem aştepta să vedem diferite domenii în moleculele de proteină. Performanţa sistemului de control şi achiziţie este esenţială în performanţa finală a SPM-ului. Sistemul optic nu are alt rol decât de a măsura deflexia cantileverului. un fir de păr) este suficient de potrivit dacă nu are o rugozitate comparabilă cu capacitatea de deplasare a scanner-ului pe direcţia Z (perpendicular pe eşantion). Aşa că. nu de puţine ori. temperatură scăzută. mari schimbări de conformaţie (myosin) sau forme spiralate ale moleculelor DNA. orice material (de exemplu. respectiv amplitudinea de oscilaţie sau fază. dar în cazul unor eşantioane biologice (molecule). Scaning Probe Microscope. Merită să reţinem că detectorul este mecanic şi de asemenea. ne obligă să apelăm la o preparare complexă a eşantioanelor. Rezoluţia sistemului este asigurată de sistemul de control (electronic. atunci cuvântul „optional” nu sugerează întotdeauna ceva facil. În condiţii experimentale adecvate. …). subsistem pentru (din construcţie). dar nu poate elimina limitările mecanice Figura 1. Obţinerea unor imagini unice în conţinut si performanţă. Digital Anolog Converter DAC) cantilever şi sondă (tip). nici limitădetectia inneractiuni sonda (tip) si esantion. Mărimea specifică de interes într-o situaţie particulară este detectată (Figura 1. atmosferă controlată.Dacă ne referim la modul de preparare a probelor pentru SPM. acest lucru nu este posibil datorită lipsei de rigiditate a acestora. SPM-urile moderne pot pune în evidenţă un singur atom. Tehnica experimentală la nivel de detecţie a interacţiunii dintre un tip (sondă) şi eşantion se bazează pe un cantilever. respectiv apelarea la instrumente SPM complexe (izolare la vibraţii avansată.

Treponema Pallidum (Tp) antigens). respectiv imagine 3D. după cum rezultă din Tabelul 1. Specific şi unic în cazul SPM este capacitatea acestuia de a pune în evidenţă topoFigura 1. în general. sau imagine şi spectroscopie Raman. performanţa unei tehnici experimentale sau a unui echipament modern este complet definită de imaginea obţinută pentru un eşantion dat. nu pot fi considerate complementare cu alte tehnici experimentale. 380 . Helicobacter Pilory). Informaţiile care se pot obţine pe diferite sisteme de studiu cu ajutorul unui SPM. Proteine (Seleno Protein. Tehnologia experimentală actuală se bazează masiv pe conceptul de imagine. cu o mai Figura 1. reconstrucţia 3D şi nanomanipularea. Latice HPOG (stanga) grafia moleculară.rile induse de proprietăţile materialelor folosite la construcţia SPM-ului. o imagine mai bună este echivalentă cu mai multă informaţie. imaginea celulelor. Tocmai de aceea. imagini SNOM.2. interacţiunile respective latice MoTe2. Bacterii (Anabaena Variabils.3. Această situaţie este produsul unei lungi evoluţii a tehnologiilor de laborator şi asigură maximul de informaţie posibil în acest moment. Virus Ebola. moleculare. SPM poate include în platforma sa tehnici optice în special în cazul AFM. DNA (sus). acestea fiind parte din limitele fizice ale unui SPM. cum ar fi: AFM plus microscopie laser confocală.

4. prin imagini. b) între sondă şi suprafaţa Figura 1. adesiune intre sonda si suprafta esantionului. adică toate mărimile fizice istorice se regăsesc în final în calitatea imaginii. într-o poziţie dată (x. exemple cu ceea ce poate „vedea” un SPM (Figura 1. dat fiind interesul crescut pentru biologie şi biotehnologii. În acest sens. După cum se poate vedea în Figura 1.2 se poate vedea la rezoluţie atomică o latice de MoTe2. este pusă în evidenţă o adeziune. Într-o măsurătoare locală.4. capacitatea de nanomanipulare simultană a acestor eşantioane asigură premisele unui nano laborator într-un singur echipament. SNOM şi spectroscopiei Raman întregeşte această tehnică modernă. De asemenea. baza funcţionării SPM-ului. Lărgirea platformei cu elemente specifice microscopiei optice. sunt prezentate în continuare. respectiv HOPG. este exploatată şi în spectroscopia locală de distanţă. De mare interes sunt imaginile ce pot fi obţinute pe eşantioane biologice.y).bună calitate.3). cu un mai bun raport semnal zgomot. eşantionului. SPM-ul a fost primul echipament (STM) care a pus în evidenţă atomii şi acest lucru este posibil fără echipamente complexe pe eşantioane cu rugozitate scăzută (monostrat atomic). cu o mai bună liniaritate în sistemul de măsură. SPM are un rol bine definit prin capacitatea sa unică de a putea asigura o rezoluţie ridicată pentru eşantioane superficial pregătite (Figura 1. Interacţiunea dintre sondă (tip) şi eşantion. două situaţii distincte pot fi observate în interacţiunea dintre sondă (tip) şi eşantionul studiat: a) nu există o adeziune la suprafaţa eşantionului. 381 . este uşor de pus în evidenţă curba forţă– distanţă atunci când o legătură specifică apare. În Figura 1. Nu exista adesiune (jos).3). În acest sens.

În Figura 1. este cel mai recent echipament şi singurul 382 . proteoglicani. Sistemul NTegra produs de NT-MDT Inc. Platforma Integrată pentru Nanotehnologii combină toate tehnologiile cunoscute în Scanning Probe Microscopy (SPM) într-un singur produs. depind în mod esenţial de experienţa utilizatorului. cum ar fi: a) celula este un sistem prea labil pentru a putea observa o singură proteină pe suprafaţa ei. printr-o tehnică de cartare a forţei. Progresele recente privind rezoluţia spaţială a tehnologiei AFM au făcut din obţinerea unor imagini topografice a unei singure proteine o operaţiune de rutină.5. acizi nucleici) a unui vârf AFM a deschis o cale promiţătoare pentru recunoaşterea unor molecule particulare. plecând de la tăria adeziunii pentru o situaţie dată.Bazat pe observaţia anterioară. Cu toate acestea. fiecare experiment în care este implicat SPM – ul. sonda funcţionalizată (molecula ligant) interacţionează cu un eşantion biologic special preparat. glicani. cum sunt receptorii. Tehnica sondă-ligant şi analiza unei situaţii particulare prin intermediul curbelor locale forţă – distanţă sunt de mare folos în diferite experimente de recunoaştere a proteinelor. Sunt încă dificil de recunoscut proteine specifice. Toate aceste rezultate au fost obţinute prin observarea unor probe corespunzător preparate pe suprafeţe substrat şi nu în condiţii fiziologice. tuia.5 este reprezentat schematic un astfel de experiment care printr-o tehnică specifică permite discriminarea unor receptori pe suprafaţa unei celule. în final. numai pe baza acestor informaţii topografice. tehnica funcţionalizării cu anumite biomolecule (proteine. avem câteva reguli generale. În general. din Figura 1. Deoarece interacţiunea dintre liganzi şi receptori este foarte specifică. se poate imagina un sistem de recunoaştere moleculară. generând astfel un nou şi performant echipament în acest domeniu. b) acest lucru este dificil şi în cazul unei topologii moleculare. are multe elemente particulare care. Discriminarea unor receptori pe suprafaţa unei perspectiva utilizării acescelule. S-a dovedit că receptori independenţi pot fi recunoscuţi de un vârf AFM funcţionalizat cu anticorpi.

astfel încât. in microscopul optic. inclusiv procesarea de imagine 3D. trebuie menţionate metodele avansate de litografie disponibiFigura 1. care înseamnă perfect. 383 . Programul NOVA (NT-MDT) controlează întreaga platformă.6.7. în producerea de echipamente şi programe pentru nanotehnologii. un sistem SPM şi un controler de temperatură pentru măsurarea probelor biologice în aer sau lichid (inclusiv în mediul de cultură. Subsitem scanner integrat le (scratching. Ntegra. current). Nu în ultimul rând. acesta este uşor de înţeles şi utilizat. Sitemul nând simplitatea utilizării cu facilităţile oferite.Vita.7). Sistemul NTegra se prezintă utilizatorului ca fiind o soluţie completă pentru cercetare. Rezultatul acestui concept permite reconfigurarea sistemului pentru orice aplicaţie particulară (Figura 1. pentru litografie. cu posibilitatea schimbării acestuia pe durata măsurătorilor).pe plan mondial care poate fi încadrat în conceptul de NanoLaborator.click). Acest concept este sugerat şi prin numele echipamentului format din grupul de litere cheie NT care sunt prescurtarea de la NanoTechnology şi un al doilea grup de litere cheie care sunt prescurtarea de la intEGRA. chiar dacă sistemul este foarte complex. măsurarea caracteristicilor probei şi generarea automată de rapoarte. Sistemul NTegra (Figura 1. de la achiziţia de imagine la arhivarea acesteia. doar prin program (mouse . În acest moment. îmbiFigura 1. Toate sistemele integrate în platforma NTegra utilizează acelaşi suport electronic şi acelaşi program. industrie şi nanotehnologie. Programul de aplicaţie înglobează lunga experienţă NT-MDT Inc.6) a fost special proiectat pentru a permite înglobarea unor tehnici de analiză ştiinţifică (spectroscopie si/sau prepararea probelor) pe lângă cele specifice SPM. Laboratorul de Nanotehnologii Fizice are în dotare un sistem NTegra Vita care integrează două microscoape optice performante. Aproape toate setările sistemului sunt controlate de programul NOVA.

0. Force Modulation. 15 mm in height by probe by sample up to 14x14x2. cât şi unele performanţe ale sistemului NTegra Vita sunt enumerate in Tabelul 2. non-contact).5 mm and by probe up to 15x15x3 mm 100x100x10 μm up to 200x200x20 μm in DualScan mode from RT to 60˚ C +/. Kelvin Probe Microscopy. Spreading Resistance Imaging. procesare imagine şi generare de rapoarte. utilizăm intensiv facilitatea open software a programului NOVA care permite. AFI(Adhesion Force Imaging). programul poate fi extins pentru orice aplicaţie utilizator fără a fi nevoie de cunoştinţe de programare avansată. diverse tipuri de încălzitoare pentru lichid şi măsurarea probelor biologice cu schimbarea lichidului cu flux controlat pe parcursul experimentului. controlul temperaturii pentru lichide.005˚ C (typically).01 ˚ C in air only Sample size in air in liquid Scan Range Temperature control (for operation in fluid environment ) Range Stability O pagină help bine documentată cu descrierea funcţiilor de bază şi câteva exemple de utilizare asigură accesul utilizatorului la semnale de bază din sistem. În acest fel. Phase Imaging. facilităţi de generare automată de imagini sau mai mult. STM by sample Φ 40 mm. AFM Lithography (scratching).programul NOVA are aplicaţii. sau între experimente. 15 mm in height and Φ 100mm . 384 . LFM (Lateral Force Microscopy). Forces-Distance Curves STM/MFM (Magnetic Force Microscopy). prin Vbscript. realizarea unor extensii sau automatizarea unor secvenţe de genul măsurare. Electrostatic Force Microscopy. pot fi preluate imagini „gray level” şi transpuse pe suprafaţa de investigat. semi-contact. În proiectele noastre. Ntegra Vita are facilitaţi de excepţie pentru investigarea de probe biologice cum ar fi: incinte închise/deschise stabile chimic care pot opera cu discuri Petri. Metodele de bază SPM. <= +/. Scanning Capacitance Microscopy. Tabel 2 SPM methods in air and liquid AFM(contact. Lithography: AFM (current).0.

2007. Nature. proliferation. Molecular self-assembly and nanomanipulation . 20. and lithography using modified tapping mode atomic force microscope. Cubicciotti R. 998-1004. Nat Methods. 19. Science. Nykypanchuk D. 2007. Dammer U. Bibliografie 1. 21. Design and self-assembly of two-dimensional DNA crystals.. Liu Y. Li MQ. 11. Binding strength between cell adhesion proteoglycans measured by atomic force microscopy. Wang L. Li H. Zhang M. Goodsell DS. 1068. 352–366. Maye MM. 4. 129. and PCR amplification of single DNA molecules. Ann Rev Biophys Biomol Struct. Song Y. Stark RW.Eur J Physiol. 2008. Nanodissection. and differentiation of bone marrow mesenchymal stem cells. Cai Y. Lu J. 16. 2008. Hinterdorfer P. Surf Interface Anal. Recent progress in AFM molecular recognition studies. 6. Zhang Y. DNA-guided crystallization of colloidal nanoparticles. Bionanotechnology: lessons from nature. 2005. Rubio-Sierra FJ. Stephens BJ. Surf Interface Anal. 2008. Microsc Res Tech. 528-529. Li MQ. present. 377-405. dissection. Revyakin A. 12. 38. Zumbusch A. Heckl WM. 9. 372-381. Hu J. 451. Hoboken. Tang R. Seitz M. Hartmann U. Nanomanipulation of single DNA molecules and its applications. 3. Golden handshake. Virtual reality and haptics for nanorobotics. 2002. Gaub HE. Yan SH. Sun L. 2006. 127-138. Xu X. Nature. 17. A combined atomic force/fluorescence microscopy technique to select apatamers in a single cycle from a small pool of random oligonucleotides. 2. 2004. 2006. Stem cells and tissue engineering: past. Popescu O. New Jersey. Crocker JC. 1014-1017. 6668-6669. 7. Hu Q. 36. IEEE Robot Autom Mag. Brauchle C. Gao HB. 1998. 193-196. Peng L. 70. 2005. Wagner P.2. Science. Inc. Nature. Adv Eng Mater. Polak JM. Microsc Res Tech. van der Lelie D. 13. Puchner EM. 319. Guntherodt HJ. Anselmetti D. Li X. Hu J. Adv Eng Mater. 1995. Guthold M. 594-596. Zhou C. Wenzler LA. Li Z. 15. Liu F. Mavroidis C. Drexler KE. 2007. Gumpp H. Strick TR. Wei G. Wiley-Liss. Ye M. Simultaneous AFM manipulation and fluorescence imaging of single DNA strands. 6. Dufrene YF. Seeman NC. Nanomanipulation by atomic force microscopy. 534-540. Bonin K. Hards A. 18. Misevic GN. J Mater Chem. Bishop AE. Effect of crystallinity of calcium phosphate nanoparticles on adhesion. Liedl T. Gang O. Single-molecule cut-and-paste surface assembly. 78-92. Tao J. 1173-1175. 13. Liu Z. Third-generation biomedical materials. 4690-4698. Molecular nanomachines: physical principles and implementation strategies. 2004. 23. Kufer SK. 237-245. Pan H. Ann NY Acad Sci. Heckl WM. 2006. 539-544. 6. 2008. Positioning scission of single DNA molecules with nonspecific endonuclease based on nanomanipulation. 2. 295. Ebright RH. and future. Manipulation. 1010-1013. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Li B. 385 . 5. Hu J. 549-552. Zhang Y. Chem Phys Chem. Polak JM. Science. Tan Z. 843-847. 124-126. Pflugers Arch . 7. Zhang Y. 267.two key technologies in nanoscience and templating. Ferreira A. 2005. 14. 1994. 8. Wang Y. 451. Lu JH. An H. Li B. 456. 2006. 69. 394. Li M. 17. Hench LL. J Am Chem Soc. 10. Winfree E. 2004. isolation.

În acelaşi timp. cercetătorul percepe că poate interacţiona direct cu suprafaţa de investigat. privim către lucruri din diverse unghiuri. Sistemul de control va translata mişcarea uneltei în mişcarea sondei SPM-ului şi va translata parametrii măsuraţi ai suprafeţei sub forma unei forţe aplicate uneltei simultan cu informaţii vizuale şi/sau audio despre parametrii suprafeţei. biomecanicii şi elemente neurologice ale percepţiei haptice. Motivare. acestea au generat o adevărata competiţie în încercarea de a dezvolta o interfaţă haptică naturală. Aceste maşini sunt denumite interfeţe haptice. spre deosebire de alte modalităţi de interacţiune: percepţia vizuală. Mişcarea naturală a capului sau mâinilor poate fi utilizată pentru a investiga şi modifica suprafaţa care este afişata la scala cercetătorului. intuitive şi a unui feedback senzorial multi-modal a determinat proiectarea unor maşini care asigură utilizatorului generarea unor comenzi prin mişcarea mâinilor. Studiul abilitaţilor tactile umane este o încercare recentă şi multe din sistemele disponibile astăzi nu incorporează cunoştinţe din domeniile psihofizicii. Când noi suntem prezenţi undeva. Implementarea Noilor Tehnologii Introducere. Această metodă va asigura cercetătorului posibilitatea de a se concentra pe investigarea suprafeţei şi proprietarilor asociate şi nu asupra programării unei interfeţe. privim comportamentul lucrurilor care se mişcă sau se schimbă. În viitorul apropiat. putem lua lucrurile pentru a le rearanja şi putem interacţiona cu acestea pentru a vedea răspunsul lor. Deoarece cercetările iniţiale au fost promiţătoare.3. pentru a crea acestuia o percepţie naturală. O problemă majoră legată de sistemul tactil uman constă în faptul că nu este foarte bine cunoscut. simţim lucruri interesante cu ajutorul mâinilor. utilizatorul primeşte informaţii despre forţe sau coliziuni ale mâinilor sale. Aceste dispozitive bazate pe interfaţa haptica prezintă o mare oportunitate în dezvoltarea unor aplicaţii generic asistative care să permită manipularea nano-obiectelor precum şi imersia totală în realitatea virtuală a utilizatorului. Nevoia unei interacţiuni om-maşină naturale. urmată de încorporarea acestor cunoştinţe în ingineria interfeţelor haptice. unde prin haptic înţelegem ştiinţa pipăitului. noi vom avea mult de învăţat despre lumea la scală 386 . Dezvoltarea unor interfeţe şi dispozitive haptice moderne necesită studii extensive pentru a înţelege legătura dintre fenomenele perceptuale şi măsurătorile biologice. Când este utilizat un astfel de sistem. Interfaţa ideală dintre om şi SPM trebuie să prezinte utilizatorului suprafaţa investigată ca o reprezentare 3D mărită pe care să o poată pipăi şi care să poată fi modificată cu ajutorul unor unelte controlate de mână. vorbirea sau sistemul motor. privim în jurul nostru.

oferindu-ne posibilitatea de a investiga individual nano-obiecte cu facilitaţi de excepţie obţinute prin combinarea caracteristicilor unor proprietăţi fizice cu informaţiile structurale. precum şi un control natural al funcţiilor acestuia. Scopul unei interfeţe SPIDAR este de a asigura cercetătorului imersia virtuală în lumea la scală nano.nano. un dispozitiv SPIDAR (Space Interface Devices for Artificial Reality. Figura 3. Interfaţa utilizator avansată va juca un rol crucial prin modul transparent de a experimenta la scală nano. transportul de sarcină şi dinamica acestor proprietăţi sunt afectate de structura la scală atomică a nano-obiectelor. Nanomanipularea dă o semnificaţie aparte acestor probleme. inclusiv despre modul cum proprietăţile mecanice. Nanomanipulatorul este obţinut prin integrarea unui microscop de scanare a probei împreună cu controller-ul. Prin combinarea unui SPM cu o interfaţă de realitate virtuală asigurăm o afişare intuitivă a datelor produse de instrument.1. Interfaţa SPIDAR. Beneficiile unei asemenea tehnologii sunt: 387 . Sistemul de Nanomanipulare. Figura 3. Acest cluster local format din cel puţin trei calculatoare comunică printr-o reţea IP. Semnificaţia interfeţei de realitate virtuală a SPM-ului este aceea de a simula prezenţa cercetătorului pe suprafaţa de investigat. oferind cercetătorului posibilitatea de a fi virtual în dimensiune nano. precum şi legat de interfaţa cu obiectele la scală nano.1) cu feedback de forţă împreună cu controller-ul şi o reţea de calculatoare PC cu facilităţi grafice avansate.

Interfaţa SPIDAR. urmat de un feedback al parametrilor pe durata modificărilor şi utilizând pseudo-culori sau imagini ale liniilor. dar într-o manieră utilă. 388 . Microscopul de scanare a probei (SPM) este un instrument extrem de rafinat pentru explorarea şi manipularea la scală nanometrică.a) îmbunătăţirea percepţiei structurilor 3D. Figura 3. SPM-ul poate colecta multe alte date despre parametrii fizici specifici eşantionului. transmisia laser a diverse lungimi de undă şi polarizări (NFOM – near field optical microscopy). Pentru vizualizarea ştiinţifică. Acestea includ măsurători de conductanţă şi măsurarea de curbe curent/distanţă (STM). dar această afişare nu permite cercetătorului să vadă corelarea dintre aceste informaţii şi topografia suprafeţei. forţe laterale şi de adeziune (AFM). într-un mod nerealist. utilitatea unei tehnici este mult mai importantă decât realismul. proprietăţi magnetice (MFM – magnetic force microscopy). Multe experimente au fost realizate prin controlul preprogramat sau în buclă deschisă a probei SPM-ului. În acest caz. pe măsura ce se colectează datele. Pe lângă datele despre topografia suprafeţei. este util să afişăm aceşti parametri într-un spaţiu virtual. Câţiva dintre aceşti parametri sunt reprezentaţi natural pe canalele vizuale ca informaţie de culoare sau înălţime. c) abilitatea de a observa procese dinamice aproape în timp real d) şi posibilitatea de a modifica interactiv suprafaţa. b) explorarea efectivă a suprafeţei de investigat. temperatură sau alţi parametri fizici.1.

Sistemul Multimodal. O afişare naturală a unui set de date 3D este posibilă prin iluminarea direcţionată a suprafeţei. Au fost studiate şi dezvoltate câteva moduri de vizualizare a unor seturi de date. este acum posibil să creăm un rendering în timp real al suprafeţei.2). acest concept este foarte elegant în simplitatea sa şi foarte util pentru o unitate de nanomanipulare. Se poate asigura interacţiunea în timp real cu parametrii de vizualizare cum ar fi direcţia iluminării. introduce conceptul de realitate îmbunătăţită. a feedback-ului de forţă. efectiv o vedere cu raze X utilizatorului. În această etapă tehnologică. setul de date pentru o abordare prin interfaţa SPIDAR este de fapt topografia suprafeţei (Figura 3. tehnologie bine cunoscută în câteva aplicaţii de avionică. O procesare de imagine 3D utilizează un mixaj de imagini într-un head-mounted display (HMD). Implementarea unei componente de vedere cu raze X la programul nanomanipulatorului SPM. 389 . Într-un caz simplu. Interfaţa SPIDAR in timpul unei operaţii de nano-manipulare. ca un exemplu a consideraţiilor implicate. pe timpul unor situaţii complexe. unghiul de vizualizare şi scalarea.2. pe măsură ce datele sunt achiziţionate de SPM. Acest concept generează noi aplicaţii în nanomanipulare şi asigură. A fost revăzută problema relativ simplă a rendering-ului 3D pentru o suprafaţă. Utilizând procesarea de imagine 3D. prin interfaţa haptică. prin combinarea unui rendering grafic computerizat cu elementele ascunse. Figura 3.

utilizând numai o lumină ambientală cu intensitatea funcţie de înălţime. un feedback de forţă asigură un control intuitiv al probei şi permite sesizarea contururilor de pe suprafaţă. Pentru caracteristicile care sunt semnificative numai prin diferenţa mare de înălţime faţă de suprafaţa imaginii. De asemenea. Noi utilizăm o interfaţă haptică cu feedback de forţă care sesizează poziţia 3D a o-ring-ului SPIDAR (cu capabilităţi adiţionale pentru a sesiza 3DOF – grade de libertate) şi aplică forţele de la nivel nano adecvat scalate în mâna utilizatorului. Este neaşteptat să ne imaginăm că putem acum oferi posibilitatea cercetătorului nu numai de a vedea nano suprafeţe cu ajutorul SPM. Conceptual. pentru cercetător este mai uşor să perceapă adâncimea obiectelor virtuale apropiate. Abilitatea cercetătorului de a recunoaşte structuri moleculare specifice în prezenţa zgomotului este îmbunătăţită prin vedere stereoscopică. Această abilitate 390 . Asigurând afişarea stereoscopică şi nu cea monoscopică. imaginile pseudo-colorate au dedicat întreg domeniul de intensităţi pentru a evidenţia aceste diferenţe. din caracteristicile imaginii. acest sistem este echivalent cu un sistem tele-robotic care operează între două scale foarte diferite. uneori reuşind. dar să şi acţioneze asupra lor şi să le atingă. cum ar fi controlul unghiului de vizualizare a suprafeţei. micile caracteristici de pe suprafaţă conţinute în alte mari variaţii sunt mai bine puse în evidenţă prin utilizarea unei hărţi de culoare şi iluminarea puternică a suprafeţei 3D (acestea ar fi imperceptibile într-o reprezentare 2D). o suprafaţă plată are un mare conţinut de zgomot şi acesta este exprimat ca o fracţie. Această tehnologie poate lucra bine pentru imagini lipsite de zgomot. Folosirea umbrelor este echivalentă cu desenarea suprafeţei. de asemenea. Poziţia o-ring-ului în spaţiu poate controla diferite caracteristici afişate. pe perioada modificărilor suprafeţei. Acest zgomot va determina o fluctuaţie a iluminării caracteristicilor cu aceeaşi magnitudine. grafica 3D bazată pe umbre cu hărţi de culoare iluminate puternic. netezite micile fluctuaţii cauzate de zgomotul conţinut în imaginea suprafeţei. de regulă o vedere prin pseudo-culoare este superioară unei vizualizări 3D prin umbre. Acest lucru este adevărat din două considerente: pseudo-colorarea dedică întreg domeniul de intensitate adâncimii şi sunt. din păcate.Vizualizarea 3D nu este întotdeauna cea mai bună soluţie pentru suprafeţe cu mici denivelări. Pentru imaginile SPM. De asemenea. dar imaginile din lumea reală conţin întotdeauna zgomot. să le facă neobservabile. spre deosebire de sistemele tele-robot utilizate în chirurgie. Percepţia spaţială 3D a datelor SPM cu acurateţe face posibilă pentru cercetător utilizarea cunoştinţelor sale ştiinţifice la recunoaşterea unor structuri şi caracteristici de interes.

numai dacă privim un obiect. Un astfel de sistem poate fi de exemplu unul care construieşte nano-blocuri şi un dispozitiv care asistă cercetătorul şi asigură generarea de date haptice despre nano-mediul apropiat.asigură controlul precis al suprafeţei şi deschide calea unor noi experimente. găsirea traseului pentru modificare şi asigurarea unei atingeri fine care să permită începerea unui ciclu experimental în secvenţa scanare-modificare-scanare. incluzând topografia suprafeţei şi canalele externe. Abilitatea de a sesiza şi percepe obiecte dincolo de zona accesibilă (Figura 3. Mai mult. De exemplu. Utilizatorului ii este extrem de util să revadă experimentul pentru a vedea ce decizii a luat pe parcursul desfăşurării acestuia (analiza post-expriment). Cu toate acestea. sistemul de nanomanipulare înregistrează toate datele. navigaţia şi aşa mai departe. în special în discriminarea texturilor. cum ar fi conductanţa cu secvenţa de timp pe care o numim fişier stream. în descrierea acestora. În final. persoanele nevăzătoare construiesc modele intercorelate între canalul auditiv şi cel haptic. Percepţia Multimodală şi Intermodală. Feedback-ul de forţă este esenţial în găsirea structurilor ce urmează a fi modificate. descrierea formelor. auz şi senzaţiile tactile determină redundanta în reprezentarea spaţială care asigură fiecăruia dintre noi utilizarea transferului intermodal şi coordonarea mecanică pentru activităţile spaţiale. corelarea dintre văz . Vederea asigură fiecăruia abilitatea de a plănui şi executa activităţi spaţiale (zonă cunoscută ca fiind kinesferă). iar cercetările psihologice au arătat că aceste modele nu sunt adaptate pentru percepţia de stimuli la distanţă. recunoaşterea obiectelor şi descrierea acestora. Un sistem automat cu abilitatea de a face o predicţie despre cum simţim obiectele de tipul celor reprezentate prin valori ale pixelilor are multiple aplicaţii în generarea automată a datelor haptice. Studiile efectuate pe persoane nevăzătoare arată că au abilitaţi eficiente în câteva activităţi spaţiale. inclusiv corelarea cu proprietăţile măsurate cu o up-datare a imaginilor structurii. Acest fişier poate fi redat mai târziu pentru a revedea întregul experiment. discriminarea formelor. 391 . aşa cum avem în cazul văzului. De asemenea. noi putem face o predicţie despre caracteristicile lui tactile cu o acurateţe rezonabilă. o limitare majoră a percepţiei tactile este dată de dimensiunea kinesferei. simţind când proba SPM se apropie de punctul de la care sunt posibile modificările. O abilitate deosebită a oamenilor este aceea de a dezvolta capabilităţi de coordonare intermodală şi de procesare a modelelor. fedback-ul de forţă asigură utilizatorului posibilitatea de a localiza obiecte şi caracteristici ale suprafeţei.3) este extrem de importantă în activităţile zilnice cum ar fi conducerea maşinilor. În al doilea rând.

Aceste prototipuri stocate într-o bază de obiecte haptice împreună cu strategiile de explorare haptic 392 . Explorarea haptică a nano-obiectelor se referă în esenţă la mişcarea mâinii. utilizatorul urmează să categorisească perceptual forma. textura şi materialul nano-obiectului haptic. dimensiunea. Feedback-ul de forţă capturează procese din SPM şi acest lucru este denumit în literatura „explorare haptică a nano-obiectelor”. greutatea.3. Odată ce un obiect a fost capturat vizual. Nevoia de noi experimente şi dezvoltarea de algoritmi care pot îmbunătăţi percepţia în lumea de scală nano prin stimulare în timp real vizual. Modelele computaţionale sunt dezvoltate la nivelul tehnologic actual ca şi prototipuri vizual-haptice. Captura vizuală SPM poate fi ajutată prin stocarea profilului haptic sau de atingere al unui obiect sub forma miscărilor mâinii. utilizată de cercetător pentru a percepe un nano-obiect. în faza de antrenament. Interfata SPIDAR in timpul unei operatii de recunoastere haptica a unei structuri create anterior prin nano-manipulare.Figura 3. audio şi haptic este un domeniu fascinant de cercetare. Aceste modele computaţionale sunt dezvoltate pe baza modelelor neuropsihologice şi cognitiv psihologice ale analizei caracteristicilor vizual-haptice. Gesturile utilizate de cercetător pentru a percepe caracteristicile unui nano-obiect au o structură logică şi asigură înţelegerea caracteristicilor unui nano-obiect. Aceste structuri de date care stochează atât caracteristicile vizuale cât şi pe cele haptice ale obiectului sunt baza dezvoltării unor cartografieri automate dintre diferite caracteristici vizuale şi haptice.

V.703 (01 Sep 2005). Requicha.1981. Luthi. Bugacov..asigură baza de date pentru nano-spaţiu. Academic Press. Nature Methods 2. Xin Jiang. 66136616. Tubular Graphite Cones. Burkhard Stiller. Resch.dimensional structures of nanoparticles using scanning force microscopy.. A. Advanced Interfaces to Scanning Probe Microscopes.. 1979 .. Jean-François Allemand. E. Maria Barbi. BIOCHEMISTRY: RNA Polymerase. Science 266 (December 23). 4... Roberts. 1998. Building and manipulating three-dimensional and linked two. M. and Will. Howald. P. 1999. and Superfine. 7. 504-512. Paulson. C. W. 444 . Science 17 November 2006 314: 1097-1098. 3.. Gutmannsbauer.. Jean-Marc Victor. S. Christophe Lavelle.. R.. Meyer. M.. 8. Michael Giersig.. M. H. Nalwa.138 (01 Feb 2005). A. and Enge Wang.. 1998. Falvo. Andrey Revyakin. Burkhard Schulz. Haefke. A. Natalia Conde e Silva.. Richard H Ebright. Science 18 April 2003 300: 472-474. 393 . 127 . R.. pp. Taylor II.. 4. Bibliografie 1. 6. G. and Guntherodt. Microanal. A. R. B. Vincent Croquette. Julien Mozziconacci. Jean-Louis Viovy. Structural plasticity of single chromatin fibers revealed by torsional manipulation.450 (01 May 2006). S. Single-molecule DNA nanomanipulation: Improved resolution through use of shorter DNA fragments. Koel. G. From anisotropic photo-fluidity towards nanomanipulation in the optical near-field. R. a Scrunching Machine. in Handbook of Nanostructured Materials and Nanotechnology. 9. L. and Superfine. Dieter Neher. R. 271-308. Taylorr II. Baur. Ullrich Pietsch. S. Helser. Aurélien Bancaud. A. F.. Chi. 5. 4. Nature Structural & Molecular Biology 13. 2. Peter Karageorgiev. 699 . H. P. Langmuir 14 (23). fiind suportul oferit de tehnologia actuală pentru viitoare aplicaţii în nano-robotică.. 1994. Ariel Prunell. Ludwig Brehmer. New York.. Terence R Strick. Guangyu Zhang. J. Nature Materials 4. Brooks Jr. Washburn.. Nanomanipulation experiments exploring frictional and mechanical properties of carbon nanotubes. Sled-Type Motion on the Nanometer Scale: Determination of Dissipation and Cohesive Energies of C60.. H. Clary. R. Jeffrey W. Madhukar... S. E. Gaudeline Wagner.. Microsc.

........ Analizorul de energie emisferic de tip PHOIBOS ..................................... 422 3................................2.. 412 1........................1............... dr...................... Informaţii generale ....................... 421 2.................. Informaţii generale în legătură cu sursa XR 50 M ................................................................................... 414 1.Concepte de bază .......................3............. 416 2........................................................... Bibliografie ........... Design-ul şi principiul de funcţionare al spectrometrului de electroni .....................................3....2.......................... Monocromatorul ...5.....................1.2........................................................ 395 1.2....... Mecanismul de tăiere a orbitei ................................ Modul de focalizare......5................................ 415 2.........................2.......1.............................4........................ Componente ........................ 401 1..............................XI...... 410 1..1....... Răcirea cu apă ............. 397 2.................... 422 3.......................... 396 2.......................................... Spectrele UPS şi energia de rezoluţie ......................................................................................2.............. Sursa de raze X pentru FOCUS 500 (XR50 M) .....2.... Descrierea sursei .................2........... 400 II.................................... 422 4...................3........ Caracteristici generale . 417 2........................................................ 417 2...............................................................2....... 417 2............... 395 2..2............................................. Spectroscopia fotoelectronică de raze X . 405 1......... Generarea fotonilor de raze X .2............... 423 394 ..2................... Flood-Gun 15/40 .............. 421 2................. 402 1...................................................................................... Izolarea Magnetică ..... Spectroscopia fotoelectronică cu radiaţie UV (UPS) .............. Principiu de funcţionare... Detector Multicanal MCD ....................... 402 1. 414 1.......... Caracteristici generale ....................................... 415 1....1...............5................. Analiza de suprafaţă .1.......................................................................................................3............. Descrierea Analizorului .........................................................................5............................1........2...................... Coerenţa între şi pas .................. Maria Teodora Radu Cuprins I. 398 3........III.........2......................... SPECTROMETRUL DE FOTOELECTRONI DE RAZE X (XPS) ŞI ULTRAVIOLETE (UPS) Spectroscopia fotoelectronică C......... 402 1........ 422 3........................ Principiile Detecţiei .2.............2.........................................................S...................2.2...................................... Sistemul de lentile .............1...............................1. Analizorul Emisferic (HSA) .3....... 412 1.1.......................................2........................... Multiplicarea Electronică ...................... 416 2......2..............

1 Această figură simplificată arată atractivitatea spectroscopiei de fotoemisie.82 eV) şi liniile ceraracteristice ale unei surse de raze X care utilizează de obicei ca materiale pentru anod aluminiul (Al . Mai mult. suprapunerea dintre rezultatele experimentele de spectroscopie de fotoemisie şi teorie este necesară pentru investigarea a numeroase proprietăţi a stării solide. Principiul fundamental al procesului de fotoemisie este prezentat schematic în fig. la energii de legătură mai mari. folosirea unui monocromator suplimentar poate fi un avantaj atât pentru energia de rezoluţie cât mai ales pentru suprimarea background-ului şi a intensităţilor sateliţilor care pot să apară în spectru. Distribuţia fotoelectronilor I(Ekin) poate fi măsurată de analizor şi reprezintă în prima aproximaţie o imagine a densităţii stărilor electronice ocupate N(EB) în proba analizată. pentru că proprietăţile fotoelectronilor emişi reflectă în principal stările electronice proprii ale sistemului investigat. cu gaze rare ca heliu (He I: 21. Electronii cu energia de legătura EB pot fi excitaţi deasupra nivelului E de către fotoni cu energia hν > EB + Φ0. Concepte de bază 1.2:1253. 1 eV pentru anozii sursei de raze X. Deşi lărgimea liniei este de obicei suficient de mică pentru multe aplicaţii.V.23 eV si He II: 40.Kα1. de ex. câţiva meV pentru lampa de descărcare şi aprox.I. În principiu se poate face distincţie între fotoemisia cu radiaţie în ultraviolet (UPS) utilizată în principal pentru investigaţii ale stărilor din benzile de valentă şi spectroscopia de fotoemisie cu raze X (XPS) care permite identificarea atomilor la suprafaţa solidelor şi determinarea deplasărilor în energiile de legătură ale core-level-urilor care sunt legate de diferite moduri de legături chimice. are pe scară largă implicaţii practice în diferite domenii ca de exemplu fizica şi chimia suprafeţelor sau ştiinţa materialelor. Această separare se bazează în principal pe cele două tipuri diferite de sursă de excitare cvazi-monocromatică disponibile în laboratoarele de cercetare şi anume: spectrul liniei UV a lampei de descărcare pentru energii în domeniul de aproximativ 10-50 e. În general.2: 1486. şi a contribuit semnificativ la înţelegerea principiilor fundamentale din fizica corpului solid [1-5]. solidelor şi suprafeţelor [1-2]. Analiza de suprafaţă Spectroscopia fotoelectronică a fost stabilită ca una din cele mai importante metode de studiu a structurii electronice a moleculelor. inclusiv dispersia benzii de valenţă magnetismul 395 .6 eV).6 eV) sau magneziul (Mg Kα1.

tehnic în domeniul spectrometrelor de înaltă rezoluţie.p. trebuie menţionate câteva exemple pentru caracteristici “many-body” ce pot fi puse în evidenţă pe scala meV în spectrele de fotoemisie UPS a sistemelor solide: (111) stări de suprafaţă de tip Shockley pentru Cu(1 1 1) [7-8]. Prezentare schematică a procesului de fotoemisie în modelul uni-particulă. şi suprafaţa Fermi. Spectroscopia fotoelectronică cu radiaţie UV (UPS) Această tehnică este folosită pentru a studia nivelele de energie din banda de valenţă şi legăturile chimice corespunzătoare. Investigarea experimentală a acestor proprietăţi necesită o energie de rezoluţie de ordinul meV. în ultimii ani s-au efectuat îmbunătăţiri remarcabile d. Metoda a fost dezvoltată iniţial în 1962 de David W. furnizând informaţii despre dispersia fononilor în solide. În acest context. în cazul chemosorbţiei metoda ne permite studierea nivelelor electronice de energie derivate din orbitali moleculari ai sistemului substrat absorbit. 2. Mai mult. În prezent. gap-ul supraconductor al unui supraconductor conven396 . De asemenea. UPS joacă un rol important în obţinerea structurii benzii de valenţă a unui număr mare de solide şi suprafeţe. Turner pentru studierea moleculelor în faza gazoasă[6] şi ulterior dezvoltată până la nivelul actual.v.d. aproape la fel ca difracţia de neutroni.Figura 1.

densitatea fotonilor (sec-1sr-1). În prima aproximaţie unghiul solid rezultă din zona iluminată a probei şi distanţa dintre capilar şi probă: Ω= π + r2 d2 (2 ) (3 ) R= d (1 − 2d*cr ) R .ţional (V3Si).unghiul solid (sr-1). Aceste exemple sunt reprezentative pentru înţelegerea unor probleme mult mai complexe în fizica stării solide cum ar fi supraconductivitatea de temperatură înaltă (HTSC) şi compuşii cu fermioni grei. dc .fluxul fotonilor (sec-1). [9] şi rezonanţă Kondo în sistemele cu fermioni grei. unde (1) Φ. Schema pentru aproximaţia unghiului solid Fluxul de fotoni poate fi calculat folosind formula: Φ= 1 e*r .curentul fotonic pe probă. (CeCu2Si2) [10-11]. 2.randamentul total de electroni 397 . unde (4) I. η .raza ariei excitate din proba. d .3 mm). Iph . Ω.distanţa de la capilar la probă (aprox 40 mm).1.diametrul capilarului (1. Figura 2. Caracteristici generale Fluxul fotonilor emişi de sursa de-a lungul axei optice poate fi determinat utilizând formula Φ = I ph * Ω .

Figura 3. spectrele UV ale fotoelectronilor exciţi pot fi comparate cu rezultatele teoretice obţinute din calculul structurilor de benzi. Datorită caracterului cvasimonocromatic al liniilor de excitare se poate obţine energie de rezoluţie înaltă (aprox. depind puternic de energia fotonilor excitanţi. este în general de câţiva meV de aceea monocromatizarea suplimentară nu este necesară în cele mai multe cazuri.3 * 1015 fotoni sr-1sec-1 2. Determinarea funcţiei de lucru. 2. sau< 12 eV energie a fotonilor) spectrele fotoelectronilor UV excitaţi.40 eV structurile electronilor de valenţă s-like sunt suprimate în comparaţie cu orbitalii p-like. Lăţimea liniei de excitare. 0. Dacă energia fotonilor este 40 eV structurile d-like sunt generate cu o probabilitate de excitare mare. în plus faţă de XPS. densitatea fotonilor este calculată ca fiind: Iph= 8. cu UPS 398 . Descărcarea VUV acoperă un interval de energie al fotonilor de la 10 la 50 eV. De aceea. şi folosite pentru determinarea unor informaţii specifice suplimentare în analiza de suprafaţă.Din (1) si (4) rezultă: ⎛ d ⎞ 2 ⎟ I ph = I * ⎜ ⎜ 1 − dc ⎟ / e *π * r *η ⎝ 2*r ⎠ 2 (5) Pentru o arie iluminată a probei de aprox.22 mm diametru şi un curent pe proba de 55 nA. Spectrele UPS şi energia de rezoluţie Sursa UV de tipul UVS 10/35 este în principal utilizată pentru studiul densităţii de stări a electronilor de valentă. Φ. Pentru energiile fotonilor VUV în intervalul 20 . În intervalul VUV de energii joase (<20 ev. forma şi structura lor.2.01 eV) ceea ce permite rezolvarea structurilor vibraţionale moleculare.

funcţia de lucru poate fi calculată folosind formula: Φ= h * ν – (Emax . Acest electron ar apărea în poziţia A în figura 4. unde (6 ) Evac. este exprimată astfel: Φ= Evac . Φ. adică lăţimea spectrului cu ΔE= constant în figura 4. pentru un electron emis de la un nivel de energie EB < EF: Ekin= h * ν – (EB . Φ. hν este energia fotonului. EF. unde Emax este cea mai mare energie cinetică. pentru energia de legătură şi energia cinetică avem: EB= 0 Emax= h * ν – Φ.Potrivit figurii 3. Prin urmare. Un electron emis de la un nivel de energie Ex < Ef (figura 3C) are o energie cinetică minimă (Emin= 0). Pentru un electron emis de la nivelul Fermi (figura 3B). prin măsurători UPS Diferenţa dintre energiile cinetice ale electronilor la poziţiile A şi B este Emax .EF. funcţia de lucru.Emin= h * ν – Φ (10) Această diferenţă este egală cu distanţa de la A la B.Φ) (7 ) unde. (8 ) (9 ) Figura 4. În general.Emin) (11) 399 .nivelul Fermi. Determinarea funcţiei de lucru.Emin adică: Emax .nivelul de energie al vidului.

Cantităţile din dreapta relaţiei sunt cunoscute sau măsurabile. unde hv este energia fotonilor.Spectroscopia fotoelectronică de raze X În XPS. Spectrul de fotoelectroni va reproduce structura electronică a unui element destul de precis. EK este energia cinetică a electronilor şi W (cst) este funcţia de lucru a spectrometrului. Odată ce fotoelectronul a fost emis. Aceşti electroni care sunt excitaţi şi scapă fără a pierde energie. atomul ionizat trebuie să se relaxeze. care este considerată mai adecvată. adică de emiterea unui electron de la un nivel de bază datorită acţiunii unui foton de raze X de energie hv. Figura 5. Spectru fotoelectronic al plumbului care arată modul în care electronii scapă din solid. cunoscut sub 400 .3. Energia de legătură a electronilor (EB) este parametrul care identifică specificul electronilor. deoarece toţi electronii cu o energie de legătură mai mică decât energia fotonilor vor fi cuprinşi în spectru. Relaţia dintre parametrii implicaţi în XPS este: EB = hv . Operatorul doar selectează o scală de energie cinetică sau de legătură. unde. sau pot suferi pierderi de energie şi să contribuie la fundal. contribuie la vârfurile caracteristice în spectru. În practică. spectrul XPS al plumbului este suprapus pe o reprezentare a orbitalilor electronici. spectrul este suprapus pe o structură electronică schematică a plumbului pentru a studia modul în care fiecare orbital dă naştere la linii fotoelectronice. dar acest lucru depinde de energia fotonilor razelor X implicate şi de aceea nu este o proprietate a materialelor intrinseci.EK . în general suntem preocupaţi de o formă specială de fotoemisie. acest lucru va fi efectuat de către sistemul de control sau de sistemul de date asociat cu spectrometrul. contribuind la vârfuri discrete. Energia cinetică a electronilor (EK) este experimental măsurată cantitativ de spectrometru. contribuie la fondul spectrului. cei care sunt supuşi unei împrăştieri inelastice şi suferă pierderi de energie. Energia fotoelectronului emis este apoi analizată de un spectrometru de electroni şi datele sunt prezentate ca un grafic de intensitate funcţie de energia fotoelectronilor emişi. Acest lucru este ilustrat în figura următoare. Acest lucru poate fi realizat prin emisia unui foton de raze X.W.

poate conduce la informaţii chimice valoroase despre un atom. sistem de curăţare cu ioni de Ar etc. Design-ul şi principiul de funcţionare al spectrometrului de electroni Figura 6. Un sistem computerizat este folosit pentru achiziţia datelor şi de procesarea ulterioară. Sursa de radiaţii primare pentru spectroscopia fotoelectronilor de raze X face uz de razele X. II. sistem de tăiere a probelor.numele de fluorescenţă de raze X. Camera de vid si de preparare poate fi dotată cu diferite instalaţii pentru prepararea probelor şi facilitaţi analitice auxiliare (neutralizator de sarcină. care funcţionează în regim de vid ultra-înalt (UHV). XR50 • Sursa de raze X cu monocromator FOCUS 500 • Sursa UV UVS 10/35 • Sursa sputter IQE 11/35 cu ioni de Ar • Neutralizator de tip Flood Gun FG 15/40 Acestea sunt cuprinse într-o cameră de vid. spectrometrul de electroni conţine următoarele componente: • Analizor de energie a electronilor de tip PHOIBOS 150 • Sursa de raze X. O altă posibilitate o constituie ejecţia unui electron Auger. Sistemul de analiză a suprafeţelor SPECS În cel mai simplu mod. electronii Auger sunt produşi ca urmare a procesului XPS. X-AES. Astfel. adesea denumit X-AES (X-ray induced Auger electron spectroscopy). cu toate că nu se practică la scară largă.). 401 . în general cu catodul de aluminilu (Al Kα) sau catodul de magneziu (Mg Kα).

nefiind necesară intervenţia celui care o foloseşte. Generatorul HSA3500 pentru analizatorul PHOIBOS este controlat în totalitate cu ajutorul computerului. Un ansamblu de lentile de transfer în doi paşi poate fi folosit în diferite moduri pentru rezolvarea spaţială şi unghiulară. Lentilele de intrare sunt proiectate pentru a se potrivi cu o gamă largă de aplicaţii.Intervalul 1500 V.1.1. Caracteristici generale Analizorul SPECS de energie emisferic electrostatic de tip PHOIBOS permite înregistrarea spectrelor de energie pentru particulele negative (electroni) şi particulele pozitive (ioni) în intervalul energiilor cinetice de la 0 eV la 3. Toate modurile lentilei pot fi setate electronic. Partea electronică pentru detecţie include un discriminator. Voltajul emisferelor (între -400 şi 400 V) variază cu voltajul de întârziere (între -1500 şi 1500 V). Analizorul de energie emisferic de tip PHOIBOS 1.Intervalul 40 V.2. de asemenea. Analizorul PHOIBOS 150. Un mecanism de tăiere a orbitei şi o lentilă multi-mod fac selectabile zona de pe proba de analizat şi unghiul de recepţie. 1. De aceea. Voltajul emisferelor (între . . Voltajul emisferelor (între -400 şi 400 V) şi voltajul de întârziere (între -400 şi 400 V) sunt schimbate independent. Analizorul de acest tip poate detecta energii ale electronilor şi ionilor în intervalul 0-3500 eV cu o lărgime minimă a pasului de 7 meV. este echipat cu 9 canale detectoare. Toate aceste 402 .5 keV.Intervalul 400 V. . Toate componentele sunt controlate de un program SPECS. analizorul permite măsurători rezolvate spaţial cu un diametru minim de 100 µm şi. cercetarea unor suprafeţe largi asociate diferitelor unghiuri de recepţie ale lentilelor. Toate părţile sunt integrate într-o singură cutie compactă din aluminiu protejată RF. Partea electronică de detecţie este alimentată împreună cu unitatea analizoare de control. Acesta are patru moduri de operare pentru diferite intervale de voltaj: . . un preamplificator. un numerator şi o interfaţă bus.Intervalul 3500 V. Descrierea Analizorului Analizorul PHOIBOS este format dintr-un sistem de vidare şi patru componente majore interne care sunt arătate în figurile de mai jos. Unitatea poate fi folosită şi pentru aplicaţii la nivele mai mari de energie folosind un mod de operare corespunzător.400 şi 400 V) variază cu voltajul de întârziere (între -3500 şi 3500 V). Voltajul emisferelor (intre -40 si 40 V) ţi voltajul de întârziere (între -40 şi 40 V) sunt schimbate independent.

Uchannel HV/ Base – potenţialul pe anod/catod pentru canale. 403 . U0 = –Ekin(kinetic energy) + Ep(pass energy) + WF(work function). pentru a evita ciocnirea particulelor emise de pe suprafaţa probei cu moleculele de gaz.componente sunt introduse într-un mediu de vid ultra-înalt (UHV). Figura 7. Schema de conectare a componentelor PHOIBOS Figura 8: Principalele componente ale analizorului şi principiul voltajului U0 – voltajul principal de întârziere.

pentru recepţionarea particulelor încărcate. S1 – intrarea de tăiere a capacitorului emisferic. T1…T10 – electrozi ai lentilei de transfer multi-mod. panourile de lentile definesc acceptanţa unghiulară şi suprafaţa pentru o anumită mărime a tăierii de intrare. C1…C9 .UHV–UBase – voltajul detectorului. trec mai întâi printr-un sistem de lentile electronic care taie fasciculul de particule. Succesiunea de lentile defineşte suprafaţa de analiză şi acceptanţa unghiulară prin imagistica particulelor emise la intrarea în analizor.5 sau 9 canale).detectori mono/multi-canal de colecţie discretă (1. 404 . folosind modul de amplificare puternică si o apertură iris corespunzătoare. Particulele care trec prin lentile sunt focalizate în poarta de tăiere S1. r0 – raza nominală a capacitorului (100 sau 150 mm). Sursa excitatoare depinde de tehnica folosită. ioni. Sistemul de lentile electronic şi părţile tăiate (intrarea şi ieşirea) au efecte importante asupra împrăştierii energiei detectate de analizor. În modurile de amplificare rezolvarea unghiulară este realizată cu o apertură iris în planul de difracţie al sistemului de lentile. IH. LA…LE – potenţialele pe lentile. Sistemul de lentile poate fi operat în diferite moduri pentru situaţii de rezolvare spaţială şi unghiulară pentru a adapta analizorul la diferite cerinţe. • Apertură iris cu interconexiune rotaţională exterioară. • Ansamblul detector pentru particule individuale. • Analizorul emisferic de 180° (HSA) cu un diametru de 150 mm pentru măsurători spectroscopice de energie. sau electroni. Înainte ca particulele să treacă prin analizorul semisferic. S2 – planul de ieşire al capacitorului emisferic. Pentru analiza cu un spot mic este disponibilă o rezoluţie colaterală de până la 100 µm. Componentele interne sunt: • Sistemul lentilelor de intrare. sistemul de lentile nu conţine sau nu are interfranje. UChannelBase-U0 – voltajul de conversie. dar de obicei se folosesc razele X sau alte tipuri de fotoni. Pentru obţinerea unei imagini nedegenerate. În plus. Toate modurile lentilei pot fi setate electronic. Sistemul de lentile de intrare include zece segmente de lentile. OH – emisfera interioară/exterioară. • Mecanism de tăiere a orbitei cu o interconexiune rotaţională exterioară. unde sunt întârziate în lentile pentru o analiză energetică ulterioară.

Rezoluţia colaterală este înrăutăţită şi suprafaţa de recepţie nu este definită în mod normal de lentile. cu înregistrarea simultană a unei benzi de energie în jurul valorii de trecere optime a energiei. montat în afara vidului. Particulele care trec prin planul de ieşire al capacitorului S2 sunt accelerate în sistemul de detectori C. Preamplificatorii sunt citiţi de către detectorii multi-canal (MCD). Toată rezoluţia colaterală este pierdută. sunt focalizate mai în interiorul planului S2. dar. Poziţia radială a imaginii tăiate în planul S2 depinde de energia cinetică a particulelor în capacitor. distribuţia emisiei după unghiuri este vizualizată în locul imaginii reale. Particulele cu o energie cinetică mai mare sunt focalizate mai departe spre exterior. suprafeţelor Fermi sau experimente similare. • a accelera/decelera particulele la energia de trecere. La nivelul lentilei particulele ce ies de pe pro405 . Un sistem de lentile cu un mecanism variabil de tăiere a orbitei este necesar pentru: • a vizualiza planul probei pe intrarea plană HSA. Distanţa standard de lucru de 40 mm şi partea frontală de formă conică la un unghi de 44° al lentilei furnizează accesul optim la probă pentru toate tipurile de surse excitatoare. rezoluţia unghiulară poate fi ajustată continuu menţinând suprafaţa de recepţie a probei constantă. Aceste moduri sunt concepute pentru schiţarea benzilor UPS. 1.Folosind irisul.2. Acesta poate fi folosit în diferite moduri care pot fi setate electronic. • a defini zona probei analizată şi unghiul solid de recepţie de pe probă. fiecare canal este conectat la un preamplificator separat. Cu detectorul multi-canal. particulele care intră în S1 sunt focalizate în planul de ieşire al capacitorului S2. Ele sunt focalizate pe poziţia centrală radială a ieşirii plane S2.1. informaţia dată de unghiurile de emisie este obţinută uşor. Sistemul de lentile Ansamblul de lentile de transfer în doi paşi a fost conceput pentru a oferi randament de transmisie foarte bun şi proprietăţi optice bine definite. Aceasta permite posibilitatea folosirii detectorilor multi-canal. În modurile unghiulare dispersive. pentru rezolvarea spaţială şi unghiulară. cu interfaţa pentru programul de achiziţie de date SPECS. În capacitorul semisferic. iar particulele cu o energie cinetică mai mică. Modurile de transmisie sunt optimizate pentru transmisii înalte la mărimi diferite ale spotului. Particulele de pe traiectoria centrală au energia de trecere optimă.

ţinând aberaţia sferică la o valoare cunoscută şi acceptabilă. de exemplu. La nivelul S1 particulele sunt întârziate de diferenţa de energie dintre particulele cu energia cinetică preponderentă Ekin şi energia preponderentă de trecere Epas. voltajul aplicat pe emisfere este dat de ecuaţia: Epas = (-q)kΔV În modul FRR. conform teoriei. Ekin este negativă pentru electroni şi pozitivă pentru ioni. Amplificarea este schimbată electric. proba fiind în planul focal al sistemului de lentile. Utilizatorul poate defini zona de recepţie a analizorului cu ajutorul intrării de tăiere deoarece traiectoriile electronilor emişi 406 . rezultând astfel dimensiuni mai mari ale probei decât cele date de ecuaţia (1). R fiind rata de întârziere. Dacă S1 are diametrul D1. este în mod special potrivită pentru studii de rezolvare spaţială. conectând la electrozii lentilelor voltajul optim.ba S sunt vizualizate în intrarea de tăiere S1. Sistemul PHOIBOS poate funcţiona într-un nivel stabilit de întârziere (fixed retarding ratio – FRR) sau în transmisie stabilită de analiză (fixed analyzer transmission – FAT). (figura 9). energia de trecere are valoarea: Epas = Ekin / R.Epas + funcţie de lucru. Valorile voltajului sunt dependente de voltajul spectrometrului U0 care este preponderant egal cu Ekin . datorită aberaţiei sferice a intrării lentilei. Cu toate acestea. Amplificarea înaltă. atunci. Planul imaginii probei este în coincidenţă cu planul intrării analizorului. pentru o amplificare dată. Gradul de difuzie creşte. Aceasta înseamnă că zona observată în planurile focale ale intrării sistemului de lentile este tot mai împrăştiată cu creşterea unghiului. În interiorul primei lentile. În modul FAT. suprafaţa vizualizată a probei va avea dimensiunea DS egală cu: DS = D1 / M (1) Puterea de amplificare a planului de lentile poate fi selectată. 40 mm în faţa primului electrod al lentilei T1. Mărimea reală a suprafeţei probei de analizat DS este în principiu dată de ecuaţia (1). imaginea în planul de intrare este difuză. Din această cauză unghiul de recepţie al lentilei este selectabil prin modurile de amplificare. cu unghiul de recepţie al intrării lentilei. particulele trec printr-o imagine intermediară înainte să fie focalizate în intrarea de tăiere S1 a capacitorului emisferic (figura 4).

rezoluţia unghiulară poate fi încontinuu ajustată între ± 10 şi ± 90 . Mod de arie medie de către probă sunt influenţate de către câmpurile electrice din jurul probei. Modurile de amplificare au fost optimizate pentru a permite unghiuri foarte mari de recepţie pentru surse punctiforme cu transmisie puternică (moduri de transmisie punctiformă). Cu o apertură iris. apertura iris poate fi utilizată pentru ajustarea unghiului de recepţie a analizorului. pot să găsească un drum spre intrarea analizorului.T1 având un potenţial fix care este setat ca fond la schimbarea sursei de alimentare. o rezoluţie laterală de până la 100 µm este disponibilă. aceste raze rele pot fi eliminate. rezoluţia unghiulară este realizată cu ajutorul aperturii iris în planul de difracţie al sistemului de lentile. Pentru analiza cu spoturi mici. Datorită aberaţiilor lentilei. În aceste moduri.Figura 9. Folosind irisul. Razele apropiate de axa 407 . utilizând modul de amplificare înaltă şi apertură iris. menţinând zona de recepţie a probei constantă. Mai mult. Mod de transmisie înaltă Figura 10. razele care intră în lentilă depărtate faţă de axa ei la unghiuri mari.

Figura 11. converg mai puternic. Modul de amplificare înaltă Tabelul 1: Unghiul de recepţie versus diametrul irisului pentru o sursă punctiformă Unghiul de recepţie ± 1º ± 2º ± 3º ± 4º ± 5º ± 6º Diametrul irisului 3.lentilei (raze paraxiale) sunt focalizate în focarul Gaussian. Asta face ca modurile de transmisie punctuale să fie cele mai potrivite pentru AES. implică deplasarea discului de cea mai mică dezordine. Discul cu cea mai mică dezordine se află unde tubul de raze emergente are cel mai mic diametru. dar rezoluţia spaţială este înrăutăţită. electronii care părăsesc proba la o anumită distanţă unghiulară sunt focalizaţi pe aceeaşi 408 . în planul imaginii. De aceea este realizat un unghi mare de recepţie. ISS şi studii de sincroton.5 mm În noul mod de suprafaţă medie cu unghiuri rezolvate. Focalizări mici sub lentilă.5 mm 17.5 mm 7 mm 10 mm 13 mm 15. Razele care intră în lentilă la unghiuri mai mari.

409 . Setările lentilelor pot fi combinate cu diferite combinaţii ale tăierii. Folosind apertura iris. fără restricţionarea unghiului de recepţie. a analizorului.zonă a intrării analizorului indiferent de poziţia lor din probă. Folosind apertura iris. Setarea optimă a aperturii iris depinde de mărimea tăierii şi de calitatea dorită a suprafeţei de analizat. Cu un sistem de detecţie 2-D se pot obţine unghiuri de rezoluţie mare pe direcţia dispersiei. Există mai multe combinaţii diferite disponibile. aceste intensităţi pot fi suprimate. La PHOIBOS. amplificarea şi apertura unghiulară sunt selectabile.050 cu mecanismul de tăiere a orbitei. rezultând astfel un număr de combinaţii egal cu produsul dintre modurile de setare a lentilei şi numărul de tăieri. dar cu intensităţi mai mari în regiunile de margine. Modurile unghiulare permit utilizatorului să optimizeze rezoluţia unghiulară până la ± 0. Pentru o analiză cu spoturi mici. Suprafaţa de analizat a fost definită pentru a include între 90-99% din totalitatea semnalului fotoelectric. Intensitatea sa integrată poate atinge acelaşi ordin de magnitudine ca intensitatea peak-ului. apertura iris poate fi folosită pentru micşorarea suprafeţei de analizat. aceste intensităţi pot fi suprimate. acest mod este alegerea ideală pentru studii de dependenţă unghiulară. Funcţia intensitate-poziţie a analizorului este o Gaussiană. Figura 12. Profilul tipic intensitate-poziţie cu apertură iris Cozile de intensitate mică formează un disc.

numai particulele cu energie cinetică cuprinsă într-un anumit interval. C 1s).1.Vin).25 R0 şi 0. a liniei transmise ΔEan este dată de : ΔEan S α2 = + Epas 2R0 4 (5) unde S = (S1 + S2)/2. k – constanta de calibrare.75 R0. de exemplu. Această valoare (S) este o constantă a analizorului. Există contribuţii în plus la lărgimea liniei observate în spectru. Razele emisferelor PHOIBOS sunt 1. Analizorul Emisferic (HSA) Analizorul emisferic PHOIBOS (HSA) cu o rază R0 (100mm/150mm) măsoară energia particulelor încărcate. b) Lărgimea naturală a liniei pentru radiaţia caracteristică folosită la excitare ΔEphoto (de exemplu Mg Kα. ΔV – diferenţa de potenţial aplicată pe emisfere (Vout .urilor individuale. Pentru liniile de fotoemisie cele mai importante contribuţii adiţionale sunt: a) Lărgimea proprie a liniei pentru nivelul atomic ΔElevel (de exemplu O 1s. sunt deviate pe traiectorii eliptice de câmpul electric radial între emisfera internă Rin şi emisfera externă Rout. Particulele cu energie cinetică mai mare se vor apropia de emisfera exterioară în timp ce particulele cu energie cinetică mai mică sunt deviate spre emisfera interioară.2. pentru lărgimea Gaussiană a liniilor: (6) FWHMtotal =(ΔEan 2 +ΔElevel2 +ΔEphoto2 )1/2 =ΔE 410 . q – sarcina electrică a particulei.9375 2R0 (Rout − R in ) (3) (4) Aceste particule ajung pe S2. Acele particule care intră în HSA perpendicular pe S1 şi se mişcă prin emisfere pe o traiectorie circular centrală. Dacă HSA acceptă jumătatea unghiului α pe direcţia dispersiei. Intrarea de tăiere S1 şi planul de ieşire S2 sunt centrate în jurul razei R0: R0 = R in + R out = 150 mm 2 (2) Pentru un gradient fix al câmpului electric. FWHMtotal observat este dat de convoluţia FWHM . rezoluţia HSA sau FWHM (full width at half maximum). pot să treacă integral prin devierea unghiulară de la intrarea de tăiere S1 la planul de ieşire S2. Particulele încărcate care intră în HSA prin intrarea de tăiere S1.2. k= R in R out = 0. parcurgând un arc de cerc de rază R0. Al Kα). au energia de trecere preponderentă Epass: Epass = (-q) kΔV.

Pentru excitarea Mg Kα. folosind doar o mică parte din suprafaţa spotului monocromatic de radiaţii X (datorită dispersiei energiei pe suprafaţa spotului). gradul de întârziere R este definit ca: R= Ekin Epas (10) În acest mod toate particulele sunt decelerate cu acelaşi factor constant.8 eV (7) În practică. Analizorul poate fi operat în două moduri diferite: a) Gradul de întârziere fix (Fixed retarding ratio (FRR)). o rezoluţie de 0.65 eV este de obicei suficientă pentru studii de înaltă rezoluţie cu o excitare monocromatică a Al Kα. Pentru o rezoluţie mai mare a instrumentului. o rezoluţie de 0. FWHM-ul razelor X trebuie să fie foarte mic. Pentru radiaţia monocromatică. Ecuaţia rezultă din teorema lui Liouville.FWHMtotal este de obicei stabilit folosind o probă de argint curăţată prin împrăştiere ionică şi înregistrarea nivelului Ag 3d5/2. De aceea. cu costul unei mari pierderi în intensitate. În practică. rezoluţia HSA la nivelele joase ale energiei de trecere pentru Ag 3d5/2 este : HMMgKa= 0. în timp ce rezoluţia energetică scade. suprafaţa de recepţie a probei AS şi rezoluţia HSA. FWHMtotal este uneori determinat înregistrând nivelul Si 2p3/2 în loc la Ag 3d5/2. datorită îngustării lărgimii liniei proprii a nivelului Si 2p. (11) 411 . Pentru radiaţie Al Kα monocromatică şi pentru nivelul Ag 3d5/2 rezoluţia extremă este: (8) FWHMextreme = 0. este posibilă folosirea radiaţiei X monocromatice de excitare. : Ekin Ekin (9) sunt valorile de recepţie pentru HSA.9 eV este de obicei suficientă pentru măsurători la rezoluţie mare. după extracţia liniară a fondului. de exemplu radiaţie Al Kα monocromatică în mare parte. ΔEan : I:ΔEan ΩSAS =ΔEan Ω0A0 Epass Epass 2 . energia de trecere este proporţională cu energia cinetică. Intensitatea creşte cu creşterea energiei cinetice: I ∼ Ekin . Intensitatea semnalului integral I al particulelor măsurate (suprafaţa cuprinsă în interiorul peak-ului până la nivelul fondului) este proporţională cu produsul dintre unghiul solid de recepţie ΩS.44 eV. de unde rezultă valori mai mici pentru FWHMextreme.44 eV Pentru a atinge rezoluţia extremă de 0. Ele sunt constante ale unde analizatorului.

rezultă că: I ∼ Epass 2 1. Raza de intrare este definită de două secţiuni care sunt la circa 6 mm depărtare.4.3. Există unele aplicaţii în care unul dintre ele este de obicei preferabil. Pentru o rezoluţie energetică dată. Analizatorul. o zonă de analiză tolerată şi un unghi de recepţie. Tăierea posterioară se află în planul intrării şi defineşte energia de rezoluţie a analizorului (vezi ecuatia (5)). 1.2. Inelul de intrare poate fi poziţionat direct prin rotirea cadranului (vezi fi412 . Mecanismul poziţionează o deschidere de intrare şi ieşire de o mărime adecvată în planul de intrare şi ieşire al analizorului. sunt măsurate cu aceeaşi scădere a rezoluţiei şi intensităţii cu energia cinetică: I∼ 1 Ekin (12) Cele două moduri sunt disponibile pentru toate tipurile de măsurători. sistemul de lentile şi detectorul sunt înconjurate de un strat de 1. Mecanismul de tăiere a orbitei Mecanismul de tăiere a orbitei este folosit pentru a schimba manual deschiderea intrării şi ieşirii analizorului. acestea sunt construite. ISS şi este preferabil pentru măsurători ale survey-ului. tăierea maximă posibilă poate fi selectată. Modul FRR este folosit cel mai mult în AIS. (inclusiv câmpul magnetic al pământului) de aceea este esenţial să eliminăm aceste câmpuri în volumul închis al analizatorului.b) Transmisie fixă a analizorului (fixed analyzer transmission(FAT)).5 mm grosime µ-metal pentru a ecrana câmpurile magnetice la un nivel minim. în timp ce tăierea anterioară serveşte la compararea împrăştierii unghiulare pentru analizor. Modul FAT este folosit preponderent în XPS şi UPS. indiferent de energia lor cinetică. Aceasta face posibilă cea mai mare rată de numărare permisă pentru aceşti parametrii şi de aceea rezultă un timp scurt de măsurare şi un raport bun semnal-zgomot. din materiale non-magnetice într-o carcasa de µ-metal. în întregime. Factorul de izolare pentru regiunea analizatorului este de aproximativ 35. Izolarea Magnetică (13) Particulele încărcate sunt influenţate de câmpul magnetic rezidual. Dacă Ekin este constantă şi acelaşi peak este măsurat pentru diferite energii de trecere. Pentru o performanţă maximă a analizatorului şi sistemului de lentile.2. Semnalele date de toate particulele. în care Epass şi ΔEan din ecuaţia (5) sunt constante ajustabile. unde este necesară o informaţie detaliată şi rezoluţia nu trebuie să depindă de energie.

sau A. au 8 tăieri de intrare şi 2 de ieşire în configuraţia standard. Pe de altă parte.B sau C). Analizorii PHOIBOS. Poziţiile tăierilor de ieşire sunt indicate cu litere (A-B.gura 10). folosind acelaşi sistem rotaţional. Aranjamentul propriu-zis în analizor apare în secţiunea de tăiere a programului de control livrat împreună cu analizorul. Selecţia fantei de ieşire 413 . Poziţiile tăierii de intrare sunt indicate cu numere (1-8) pe cadranul rotaţional exterior. Când deschiderea intrării şi ieşirii este schimbată. începând cu ieşirea 5. Aceşti indicatori corespund celor care apar în setările programului de control al analizatorului SpecsLab2. Figura 13. inelul de ieşire este poziţionat indirect prin intermediul inelului de intrare (vezi figura 11). Prin acest aranjament se pot alege puterile de intrare şi ieşire independent. poziţiile trebuie introduse în zona de editare a datelor.

există o imagine 1:1 a intrării circulare de tăiere cu o rază de curbură R0. În principiu. Într-o primă aproximaţie raza de poziţie R a electronilor cu energia cinetică Ek. şi în acest fel fiecare colector înregistrează un spectru corect.5. sunt cercuri concentrice. Detecţia multicanal se realizează aranjând corespunzător 9 CEMs (multiplicator de electroni cu canale) ca şi colectori. 5 sau 9 spectre paralele sunt înregistrate simultan. numărul particulelor din fiecare canal. 414 . este selectată pentru a corespunde cerinţelor unei diferenţe de energie cinetică constantă între canalele vecine ΔEk. poate fi adăugat. având diferite energii în HSA. de voltaj înalt. baleând spectrul odat peste suprafaţa detectorului. Numărul particulelor Nn care sosesc la fiecare colector Cneste numărat separat.1. în principal datorită câmpurilor de refringenţă existente pe marginea analizorului.5. fiind ştiută din ecuaţia (16). este dată de: R − R0 Ek − Epass D = × R0 E pass R0 unde D este dispersia la HSA.1. în planul ieşirii pentru electroni monocromatici cu energia preponderentă de trecere Epass. traiectoria electronului este mutată între fiecare analizor pas cu pas. Valoarea teoretică a lui D este: D = 2R0 (16) (17) Valoarea experimentală determinată pentru dispersie poate fi puţin diferită. Detector Multicanal MCD Detectorul este format din următoarele părţi: • Un aranjament de multiplicatori de electroni MCD • O punte ceramică multi-pin. Energia cinetică En a particulelor ce ajung la colectorul Cn. rezultând numărul total de particule pentru fiecare energie cinetică. 1. Principiile Detecţiei Datorită simetriei sferice a HSA. Schimbând tensiunea spectrometrului U0.2. cu o compensare fixă a energiei între canalele vecine. iar aceste numere sunt stocate şi procesate într-o unitate de achiziţie a datelor. cu 9 ieşiri de tăiere în cercuri concentrice în planul de ieşire. Distanţa radială între ieşiri de tăiere vecine ΔR.2. situată în vid • Preamplificatori MCD. aparţinând aceleiaşi energii cinetice. Imaginile electronilor.

2.5. Pentru asta. Materialul rezistiv devine o dinodă (o serie de electrozi incorporaţi într-un fotomultiplicator) continuă când un potenţial este aplicat la capetele acestui tub. Impactul particulelor încărcate formează electroni secundari care sunt eliberaţi din peretele CEM. deoarece nu există niciodată mai mult decât o energie nominală între două poziţii ale energiei măsurate. este: ΔEk = ΔR D D ΔR Epass (18) sau: Epass = ΔEk (19) unde D este dispersia pe analizor. etc) limitează lărgimea şi distanţa posibilă a paşilor. se numeşte câştigul G. un “nor electronic” se formează la ieşirea din CEM. Aceşti electroni sunt acceleraţi de către voltajul înalt. CEM este format dintr-un tub mic şi curbat de sticlă.3. nu există o restricţie a pasului energiei datorată performanţei analizorului. diferenţa de energie Δ între canalele vecine. 1. Coerenţa între Epass şi pas Din ecuaţia de dispersie energetică pentru analizor. Peretele interior este căptuşit cu un material de rezistenţă înaltă. Algoritmul este uniechivoc. Performanţa acumulatorului (DAC steps. unde energia de trecere se schimbă în spectru (şi diferenţa de energie dintre canalele învecinate). cum ar fi electronii şi ionii. la energia cinetică nominală. În special în modul FRR.1. Pentru detectarea unei singure particule. un calcul al energiei detectate a particulelor este necesar. la distanţa ΔR unul de celălalt.5. Numărul mediu de electroni care pleacă din ansamblul CEM pe particula incidentă. câştigul trebuie selectat destul de înalt pentru a folosi CEMs în modul 415 . prin interpolarea între numerele măsurate în canalul Cn la energiile măsurate cel mai apropiat dedesubt şi deasupra energiei nominale. Multiplicarea Electronică Un multiplicator de electroni cu canale (CEM) este un dispozitiv de achiziţie înaltă pentru detectarea particulelor energetice. conectat la CEM. până când. sau radiaţia. în final. Programul validează valorile la cele mai apropiate valori.2. şi eliberează noi electroni secundari prin impactul în continuare de-a lungul peretelui CEM. un program calculează numărul de particule Nn în canalul Cn. Datorită procesului de interpolare.2. Acest efect este repetat succesiv.

câştigul minim pentru operaţia de saturare este de aproximativ 107. iar XR 50 M trebuie să fie mutat cu 16 mm. 416 . este accelerat în electrodul conectorului CEM. a cărui sarcină este independentă de micile schimbări în voltajul multiplicator.saturat. un nor electronic format din mai mult de 107 electroni părăseşte CEM. de exemplu. având ca materiale constituente Al şi Ag.74 eV. de exemplu. Selecţia între anodul 1 şi anodul 2 accesează fie radiaţia Al Kα la 1486. Toate CEMs sunt montate într-o unitate paralelă pe o flanşă cu rol de punte. Dacă modul de focalizare este activat de către acumulatorul XRC 1000 M. Unul sau un grup de CEM este folosit într-un aranjament special. în detectarea unei singure particule. Norul electronic emis. această sursă este o sursă cu doi anozi. Datorită mărimii mici a sursei. Operaţia de saturare este necesară pentru o reflexie a zgomotului suficientă. ca o componentă de multiplicare electronică pentru analizorii PHOIBOS. şi pulsul sarcinii purtate de norul electronic este detectat ca provenind de la una din particulele incidente şi numărate în canalul preamplificatorului. fiecare particulă incidentă eliberează un nor electronic la ieşirea aranjamentului CEM.2 mm2 pe probă).4 eV pentru Al Kα. La fel ca şi XR 50. sunt accelerate la o energie cinetică corespunzătoare în interiorul CEM. Puterea maximă este restricţionată la 150 W în modul de focalizare. modul focalizare/non-focalizare este utilizabil pe amândoi anozii. Sursa de raze X pentru FOCUS 500 (XR50 M) 2. monocromatorul este folosit în reflexia Bragg de ordinal 2.5 x 1 mm2 pe probă) şi sursa de raze X poate fi operată la puterea maximă de 400 W ( 600 W pentru Ag Lα) la lărgimea liniei de 0.3 eV. În modul de non-focalizare.5 x 0.25 eV poate fi atinsă pentru Al Kα. Fiecare anod poate fi operat în modul de focalizare sau non-focalizare. Principiu de funcţionare Monocromatorul FOCUS 500 de raze X este echipat cu o versiune specială a sursei de raze X XR-50. fie radiaţia Ag Lα la 2984. rezoluţia maximă a monocromatorului de 0. 2. spotul sursei de raze X pe anod este de 3. Cum este menţionat mai sus.1. Particulele ce trec de ieşirea aperturii. De obicei. numită XR 50 M. mărimea spotului de raze X pe anod este de 3.5 mm2 (corespunde la 3.5 x 4 mm2 (corespunde la 3.5 x 0. Dacă anodul de argint este activat.

2. permiţând o operaţie UHV. Diagrama bloc a principiului de funcţionare a sursei 2. 2. va fi produsă şi o radiaţie cu o frecvenţă continuă a spectrului. vor fi generate raze X sau electroni Auger. Generarea fotonilor de raze X Dacă un material în stare solidă este bombardat cu electroni de înaltă energie.1.2. are loc un proces de ionizare al nivelelor electronice. 417 .Efectul de focalizare este obţinut cu ajutorul unei lentile electronice adiţionale. Conectorii de filtrare rapidă permit îndepărtarea rapidă a liniilor de răcire cu apă şi HV (de înaltă tensiune).2. Modulul XR-50 M (cu alimentarea de apă şi protecţia HV scoase) poate fi încălzit până la 250°C. Dacă aceste locuri vacante sunt umplute cu electroni cu o caracteristică energetică mai înaltă. Monocromatorul Radiaţia caracteristică este generată pe anodul XR-50 M şi pleacă de la sursă sub un unghi de 15°. Diagrama bloc a sursei de raze X este prezentată mai jos. amplasată în capul sursei. care nu există în XR-50 standard. Figura 14. Descrierea sursei 2. În afară de aceste două procese.2. Voltajul de focalizare este generat de către un amplificator XRC 1000 M şi este transferat la sursa de raze X printr-un cablu de filament prin cele 4 punţi. arătând voltajul şi curenţii pe sursă. de către electronii întârziaţi. Aceasta este reflectată după legea lui Bragg pe oglinda elipsoidală din cuarţ în monocromatorul FOCUS 500 şi focalizată pe probă.

Manipulatorul oglinzii poate genera trei moduri de mişcare: translaţie (focalizare) şi două direcţii de înclinare. Figura 15. Sursa de raze X XR 50 M este montată pe un manipulator după cele trei axe.A) Descrierea generală a monocromatorului: Ansamblul cristalului este compus dintr-o oglindă din cristal de cuarţ şi un manipulator al oglinzii. Monocromatorul aduce următoarele avantaje sursei de raze X: • Distribuţia energetică a razei X cu benzi energetice înguste îmbunătăţeşte selectivitatea chimică. • Un spot de raze X focalizat pe probă creşte sensibilitatea în XPS pe probe mici. care simplifică analiza spectrală. Oglinda este făcută dintr-un suport monolitic de încălzire. cu plane de cristal monoatomice orientate precis. Este folosit pentru poziţionarea oglinzii în vederea obţinerii unui fascicul de raze X monocromatic.3 eV). Prezentarea schematica a monocromatorului FOCUS 500 În anodul dual sunt produse raze X Al Kα (1486. Sursa este alimentată de către un acumulator XRC 1000 M şi de către o unitate de răcire CCX60. îngustând peak-urile spectrului. • Eliminarea razelor X nedorite de la sateliţi şi impurităţile anodului. • Eliminarea Bremsstrahlung şi a radiaţiei termale de la sursa de raze X. care reduce semnificativ uzajul indus asupra sursei.74 eV) sau Ag Lα (2984. • Un background mai mic. 418 .

Situaţia este explicată de ecuaţia lui Bragg: 2d cosθ = n λ În termenii energiei avem: 2dE cosθ = n 1239. Toate punctele de pe suprafaţa cristalului.149° şi pentru Ag Lα. luând 2d = 0. Când razele X. 419 . va fi focalizată dacă sursa. trebuie să fie constante. focarul şi suprafaţa oglinzii. trebuie să fie la fel ca şi cele din planul de reflexie. Toate punctele de pe suprafaţă şi unghiul de reflexie 2θ al razei. unghiurile de incidenţă θ1 şi unghiurile de reflexie θ2. Există două cerinţe pentru ca difracţia de raze X să aibă loc în concordanţă cu legea lui Bragg: 1. de lungime de undă λ cad pe cristal sub unghiul de incidenţă θ.851243 nm. 2. O sursă de raze X divergentă. se află pe un cerc.B) Monocromatizarea prin difracţia pe cristal Figura 16. Configuraţia monocromatorului cristalin elipsoidal Cristalele de cuarţ individuale sunt folosite în procesul de monocromatizare. are loc o interferenţă constructivă după împrăştiere numai dacă drumurile parţiale ale undelor pe plane diferă printr-un număr întreg de lungimi de undă. Cercul Rowland este o condiţie geometrică pentru reflexie. pentru Al Kα unghiul de difracţie 2θ = 23.096°.8419 nm eV Din cele două ecuaţii rezultă. 2θ = 25.

Poate fi operată în două moduri diferite. Pentru fluxuri înalte. iar pentru Ag Lα este de 344 meV. Figura 17.Condiţia de reflexie necesită ca sursa şi proba să se afle pe cercul Rowland. 420 .7 eV Pentru Al Kα. Legea lui Bragg presupune ca unghiul de reflexie să fie independent de punctul reflexiei. Aliniatorul sursei de raze X îi dă voie utilizatorului să poziţioneze anodul pe cercul Rowland. Ansamblul cristalului poate fi înclinat în două direcţii şi mutat pe direcţia y pentru a duce suprafaţa cristalului pe cercul Rowland. rezoluţia energetică intrinsecă a FWHM este 167 meV. Ambele condiţii sunt îndeplinite doar pentru reflexia simetrică din punctul c. Pentru monocromatorul elipsoidal FOCUS 500 sunt folosite doar cristale cu Δθ = ±10" . Diferenţa din ecuaţia Bragg duce la expresia pentru rezoluţia intrinsecă a oglinzii: Rezoluţia energetică intrinsecă la o anumită aliniere a planurilor cristalelor este ΔE=n Δθ (cosθ)2 1456. XR M 50 este echipată cu o lentilă electrostatică care focalizează electronii pe anod. În modul de focalizare. lărgirea datorată sursei este neglijabilă. Există numeroase ajustări date pentru montajul optic. Profilul Gaussian al peak-ului de difracţie al unei raze monocromatice (Al Kα) Curba intensitate-unghi de difracţie pentru un anumit tip de cristal este cunoscută sub numele de “rocking curve”. Sursa de raze X. cu raza egală cu diametrul cercului Rowland şi să fie tangenţiale la cercul Rowland în punctul c (figura 15). poate fi operată în modul non-focalizare. iar planele reflectoare ale cristalului să fie concave. unde se produce o lărgire datorată diametrelor finite ale spotului sursei de raze X.

Datorită mărimii mici a sursei. Lărgimea spotului de raze X în functie de Puterea maximă şi tensiunea corespunzătoare UL pentru anozii de Al şi Ag. În modul non-focalizare.1.25 eV poate fi atinsă pentru Al Kα.5 x 0. Al non-focalizat (anod 2N). Ag non-focalizat (anod 1N). Ag focalizat (anod 1F). Modul de focalizare În contrast cu sursa standard XR-50. Această lentilă poate focaliza electronii care se fixează pe anod şi astfel este obţinut un spot de raze X de mărime variabilă. Aceasta dă un total de patru moduri de operare pe anod: 1.5 x 4 mm2 şi sursa de raze X poate fi folosită la putere maximă. sursa XR-50 M este echipată cu o lentilă electronică în capul sursei. pot fi setate în interiorul sursei XRC 1000 M. 2.3. Fiecare anod poate opera în modul de focalizare sau non-focalizare. 421 .2. spotul sursei de raze X pe anod este de 3. Pentru condiţiile optime de focalizare. Dacă modul de focalizare este activat.3. Figura următoare arată lărgimea spotului pe probă în funcţie de tensiunea de focalizare. UL trebuie să varieze liniar cu tensiunea pe anod. rezoluţia maximă a monocromatorului de 0. 4.2. Al focalizat (anod 2F). UL: Figura 18. 3. Această relaţie este setată automatic de către sursa XRC 1000 M. mărimea spotului de raze X pe anod este 3.2.5 mm2. Informaţii generale în legătură cu sursa XR 50 M 2.

Tensiunea şi curenţii necesari pentru operaţia FG-ului sunt asigurate cu PS FG 20. sau semiconductorilor. 2. Filament. fisurarea anodului şi eliberarea apei în camera de vid. Componente: 1.2. Flood-Gun 15/40 3.2. Disiparea maximă de putere pe anod a sursei de raze X.1. Diagrama operaţională • 422 Energia este controlată manual.1. 3.2. şi este folosit special pentru aplicaţii XPS. de exemplu evaporarea materialului anodului sau în cel mai rău caz. poate fi obţinută doar dacă presiunea de răcire a apei este mai mare decât 3.5 l/m. a izolatorilor încărcaţi pozitiv.5-3. Anod. Curentul de emisie poate varia de la 0 la 5 mA. 3. . Răcirea cu apă Ca agent de răcire pentru XR-50 M se foloseşte apa. Lentile extractoare. Diagrama operaţională şi conexiunile electrice ale Flood-Gun-ului sunt arătate în figura următoare: Figura 19. 3.3. Temperaturi mai mici decât temperatura camerei vor duce la condensarea apei şi fenomene de descărcare în interiorul conductei de apă sau al învelişului de protecţie. Informaţii generale Flood-Gun–ul FG 15/40 a fost conceput pentru neutralizarea generală a sarcinilor probelor. Fasciculul de energie poate varia între 0 şi 500 eV.5 bar (de obicei 5-6 bar) şi dacă debitul este de aproximativ 2.1. Temperaturile înalte au ca şi consecinţă suprasolicitarea.

Reinert F.• • Voltajul de extracţie nu este selectabil de către utilizator.Theory and Current Applications (Studies în Surface Science and Catalysis) 74) (Amsterdam: Elsevier) 5. W. 423 . Ashcroft N W and Mermin N D 1988 Solid State Physics (Philadelphia. Forster F. Schmidt S and Hüfner S 2004 The electron-phonon selfenergy of metallic systems determined by angular resolved high resolution photoemission Physica B 351 229-34 10. Kevan S D (ed) 1992 Angle Resolved Photoemission . Al (1962). Fitton B and Willis R F 1978 Photoemission and the Electronic Properties of Surfaces (Chichester: Wiley) 4.Principles and Applications 3rd edn (Berlin: Springer) 3. Nicolay G. 56 317-23 8.. Sci. Shockley W 1939 On the surface states associated with a periodic potential Phys. Curentul de emisie este independent de energie şi este controlat manual 4. Feuerbacher B. Rev. The Journal of Chemical Physics 37:3007 7. Turner. Davison S G and Steslicka M 1992 Basic Theory of Surface States (Oxford: Oxford University Press) 9. Meister G and Goldmann A 1993 Temperature-dependent photoemission spectra from Cu(1 0 0) and Cu(1 1 1) surfaces Surf. D. "Determination of Ionization Potentials by Photoelectron Energy Measurement". Hüfner S 2003 Photoelectron Spectroscopy. 286 56-65 1. Matzdorf R. I.) 6. Schattke W and Van Hove M A (ed) 2003 Solid-State Photoemission and Related Methods: Theory and Experiment (Weinheim: Wiley-VCH Dec. Eltner B. M. Bibliografie Cardona M and Ley L (ed) 1978 Photoemission în Solids I (Topics în Applied Physics vol 26) (Berlin: Springer) 2. Jobory. PA: Saunders College) 11.

............S...................III................. măsurătorile XPS trebuie efectuate în condiţii de vid ultra-înalt (UHV) din cauza distanţei la care se află instrumentele de detecţie în instalaţiile XPS.......424 2...S............ De asemenea se poate folosi în analiza modificărilor care apar în chimia suprafeţei unui material după ce acesta a fost supus unor tratamente fizico-chimice................................... C............... mai exact cei care pleacă din material de la o adâncime de aproximativ 10-12 nm........ faţă de suprafaţa iradiată cu raze X....... Instrumentul de bază pentru măsurarea numărului de 424 ......... Teodora Maria Radu.............dr. Emilia Sabina Varga Cuprins 1.. Este important de reţinut că XPS detectează numai acei electroni care ajung în vidul din incinta echipamentului.... Pentru majoritatea aplicaţiilor este de fapt o metodă nedistructivă prin care se determină chimia suprafeţei oricărui material.................... Introducere Spectroscopia XPS este o tehnică de analiză foarte utilă în domeniul cercetării avansate în ştiinţa şi tehnologia materialelor.... Introducere .... 1-5 µm) sunt recapturaţi sau blocaţi în diferite stări de excitare în interiorul materialului... Bibliografie ............... Pentru a detecta numărul de electroni la fiecare valoare a energiei de legătură (energie cinetica) cu eroare minimă..436 1........ dr. La baza cuantificării unui spectru XPS obţinut stă presupunerea că numărul electronilor înregistraţi este proporţional cu numărul de atomi într-o stare dată....... Înregistrarea energiei cinetice şi a numărului de electroni emişi de la suprafaţa materialului datorită acţiunii razei X de energie hν duc la obţinerea spectrului XPS.Studiul prin spectroscopie fotoelectronică de raze X a suprafeţelor diferitelor tipuri de materiale C.............. Această metodă permite determinarea elementelor care contaminează o suprafaţă şi uniformitatea compoziţiei elementale la suprafaţă sau în adâncime (depth profiling).... Fiecare element determină un număr caracteristic de vârfuri XPS la valori caracteristice ale energiei de legătură care ne permit identificarea directă a elementelor care există pe suprafaţa investigată............ Toţi electronii fotoemişi de la adâncimi mai mari în urma penetrării materialului de către radiaţia X (aprox...........

y%Si3+. Cu excepţia cazului când electronii emişi sunt înlocuiţi. Z%O. Y%Si3+. Mai mult. în consecinţă. z%Si2+. În marea majoritate a cazurilor primul pas în analiza probei este acela de a înregistra spectrul pe scala energetică maximă disponibilă a spectrometrului pentru a determina elementele prezente pe suprafaţă (survey analysis). crescând rezoluţia energetică. Obiectivele principale ale regiunii de cuantificare sunt: definirea domeniului de energie în care semnalul poate fi atribuit tranziţiei de interes şi specificarea tipului de aproximaţie adecvat pentru eliminarea semnalului de fond care nu aparţine vârfului de interes.electroni înregistraţi pentru o stare atomică este regiunea de cuantificare. calibrarea cu exactitate a scalei energetice şi a scalei de intensitate este crucială. Pentru a realiza măsurători de încredere şi pentru a putea face intercompararea rezultatelor cu alte laboratoare. În figura 1 este ilustrat un spectru survey analizat folosind un tabel de cuantificare din baza de date a software-ului de prelucrare a datelor (Casa XPS) pentru regiunile selectate. t%Si1+) sau concentraţiile relative ale stărilor chimice prezente pe suprafaţă (x%Si4+. Resursele software ajută la o analiză cantitativă (concentraţia relativă a tuturor elementelor prezente pe suprafaţă ) cu o precizie acceptabilă după 2-3 baleiaje a scalei energetice. concentraţiile relative ale stărilor de oxidare ale unui singur element ( x% Si4+. prin aceasta micşorând transmisia analizorului şi. Trebuie menţionat că acest tip de analiză se realizează maximizând semnalul obţinut (sensibilitatea) cu preţul degradării rezoluţiei. Cu ajutorul acestor spectre (“high resolution” spectra) se identifică stările chimice ale elementelor detectate (deplasările chimice) din poziţia şi forma liniilor spectrale. proba se va încărca relativ la suportul de probă având ca efect apariţia unui câmp electric de întârziere la suprafaţa probei care determină deplasarea spectrului spre energii cinetice 425 . Spectrele de înaltă rezoluţie se înregistrează pe domenii energetice restrânse (10-15 eV) micşorând fereastra energetică. Y%C. Aşadar. În acest caz numărul de “scan”-uri pe această plajă energetică îngustă va fi mai mare (10–20 baleiaje) pentru că sensibilitatea scade cu creşterea rezoluţiei. din spectrele XPS se pot obţine concentraţiile relative ale elementelor pe suprafaţă ca de exemplu: x%Si. etc.. capacitatea de calibrare a scalei de energie este dependentă de capacitatea de compensare a sarcinii pozitive acumulate la suprafaţa probei în timpul măsurătorii şi de disponibilitatea unei linii spectrale la o energie de legătură cunoscută care să poată constitui un etalon pentru deplasarea scalei de energie. În aceste spectre de înaltă rezoluţie apar structurările secundare care ne permit studiul complex al elementelor în înconjurarea lor chimică şi structurală. z%O. t% C-C).

C1s. Linia spectrală a carbonului. î.p. este deplasată cu 120 eV între cele doua situaţii (cu compensare de sarcina şi fără). Si şi Mg. Este important de menţionat că. În absenţa compensării efective de sarcină . forma liniilor spectrale sa fie cea mai bună concomitent cu asigurarea că distanţa dintre vârfuri între tranziţii este inde426 . O. B. Pentru probe conductoare conectate electric la suport echilibrul de sarcină este restabilit uşor. energia masurată pentru o linie fotoelectrică poate varia în funcţie de energia cinetică a electronilor. Ca.Figura 1 Exemplificare spectru XPS cuantificat pe o probă cu conţinut de C. electric. Pentru ilustrarea acestui efect. figura 2 prezintă spectrul unei probe înregistrat înainte şi după compensarea de sarcină [1]. pentru materialele izolatoare electronii emişi trebuie înlocuiţi de la o sursă externă . mai mici (energii de legătură mai mari).v. compensarea de sarcină nu înseamnă neapărat neutralizarea suprafeţei probei ci mai mult stabilizarea suprafeţei probei a.un tun de electroni de energie joasă (flood gun) pentru a restabili o stare de echilibru d.d.

concretizate deja în lucrări ştiinţifice importante. vârfurile sunt largi. Măsurătorile au fost realizate cu ajutorul unui echipament de tip SPECS PHOIBOS 150 MCD echipat cu o sursă AlKα monocromatică (hν=1486. pe o proba cu conţinut de C. De exemplu. metalul Al oxidează chiar şi în vid iar stratul subţire de oxid se comportă ca un izolator. însă forma vârfurilor este bună şi poziţiile relative ale vârfurilor sunt stabile. cu scopul de a pune în evidenţă performanţele tehnice ale echipamentului folosit. Figura 2 Efectul compensării de sarcină în spectrul XPS.6 eV). [1]. Straturile de oxid pe materialele metalice pot transforma un material conductor într-o suprafaţă izolatoare care astfel necesita tratarea lor ca un material izolator. spectrul este deplasat cu 120eV şi distorsionat b) În prezenţa neutralizatorului de sarcina dar cu parametrii de lucru selectaţi incorect. Un experiment în care compensarea de sarcină este făcută corespunzător necesită de obicei deplasarea în energia de legătură folosind pagina “ Calibration property” din programul de cuantificare al spectrelor. Mai mult. Obţinerea unei energii de legătură corecte pentru o tranziţie cunoscută nu e neapărat un indicator al unei bune neutralizări de sarcină. acumularea de sarcina este compensată insuficient c) Suprafaţa probei neutralizată corect.pendentă de energia la care sunt măsuraţi electronii. vârfurile au forma foarte îngustă Măsurătorile XPS prezentate mai jos reprezintă sinteza unor studii complexe pe diferite tipuri de materiale. Si şi O: a) În absenta neutralizării (flood gun off). Casa XPS. Avantajele utilizării monocromatorului sunt: reduce semni427 . aceste măsurători furnizează informaţii relevante despre limitele şi posibilităţile de îmbunătăţire ale acestei tehnici de analiză.

î. Proba care urmează a fi analizată este fixată pe un suport de molibden cu ajutorul unei benzi dublu adezive de carbon. cu creşterea lui x. Autorii au propus descompunerea spectrelor O1s obţinute pentru acest sistem în două componente : O1 – asociată legăturilor de tip B-O-B şi O2 atribuită legăturilor B-O-Bi şi Bi-O-Bi.10-10 mbar. Se observă că.875 O1s as prep x=0. (b) propusă în studiul nostru 428 . Măsurătorile se realizează utilizând o sursă de raze X de putere 250 W.3a prin linia punctată. Materialele oxidice cu structură vitroasă pe bază de Bi2O3 prezintă interes foarte mare atât din punct de vedere ştiinţific cât şi tehnologic deoarece prezintă proprietăţi fizice mai bune decât alte sticle: coeficienţi de expansiune termică mari.6 x=0. indicată în fig. Prin măsurarea probei B2O3 autorii au determinat poziţia vârfului O1s la o valoare a energiei de legătură de 533. a. ) x=0.375 O3 O2 x=0.875 Intensitate ( u. spectrul O1s se deplasează spre energii de legătură mai mici.2 eV. În Fig.6 x=0.375 (a) O1 (b) 540 535 530 525 520 Energie de legatura (eV) 540 535 530 525 520 Energie de legatura (eV) Figura 3 Deconvoluţia spectrului O1s de înaltă rezoluţie: (a) aşa cum a fost sugerată in literatură. transmisie în ultraviolet (UV) şi caracteristici optice. Presiunea în camera de analiză este în intervalul 10-9.ficativ fondul de radiaţie. 3a este prezentată descompunerea spectrului O1s urmărind scenariul propus în literatură. prezenţa O1s as prep x=0. temperatură de topire joasă. În acest studiu sunt comparate rezultatele XPS obţinute pentru sistemul (1-x) B2O3·xBi2O3 cu x = 25 – 65 cu echipamentul descris mai sus. pe acelaşi tip de probe. a. cu cele obţinute şi publicate recent [2] în literatura de specialitate cu un echipament similar. elimină sateliţii din spectru (vârfuri secundare care însoţesc tranziţiile de interes) . asigură o rezoluţie energetică şi spaţială foarte bună.

împreună cu Ti. î.monocromata) în laboratorul nostru. O2 şi O3 atribuite legăturilor de tipul B-O-B. iar spectrul de înaltă rezoluţie corespunzător Ti 2p pentru substratul de Ti:Si 1:2 (Fig. 4C).84 eV pentru proba netratată termic. Începând cu proba tratată termic la 700°C. nu mai poate fi clar evidenţiată. concentraţia legăturilor de tip Bi-O-Bi creşte. Prin creşterea temperaturilor de tratament termic acesta se deplasează de la 530. indică prezenţa oxigenului şi a carbonului de contaminare. indicând o segregare a celor doua faze. 5] în special pentru aplicaţii de fotocataliză. vârful corespunzător oxigenului din reţeaua TiO2 (Ti-O-Ti) prezent în jurul valorii de 530.83 eV pentru cea tratată la 1400 eV. Se observă că. Acest tip materiale a atras o atenţie deosebită în ultimii ani [4. Ţinând cont de echipamentul de înaltă rezoluţie utilizat în achiziţionarea acestor spectre (sursa -AlKα. în timp ce componenta atribuită legăturilor de tip B-O-B scade continuu a. cu preponderenţa fazei de siliciu la suprafaţă. În Fig.875. 4B).componentei B-O-B în spectru. Si şi Gd. 3b este prezentată deconvoluţia spectrului O1s cu trei componente: O1. deoarece prezintă o fotoactivitate mult crescută faţă de oxidul de titan pur. Astfel.8 eV sunt bine separate (Fig. acest studiu confirmă faptul că rezoluţia spectrelor înregistrate are un rol foarte important în analiza şi modul de interpretare a datelor. indică prezenţa TiO2 evidenţiat 429 . 4D). pentru proba cu x = 0. spre deosebire de [3]. Bi2O3 devine aşadar formator de reţea vitroasă ceea ce determina creşterea stabilităţii chimice a probelor. Fotopicul O1s prezintă o formă complexă. la 532. s-a reuşit o analiză mult mai detaliată a tipurilor de legături şi a modificărilor care apar la nivelul acestora în probe cu creşterea conţinutului de Bi. Analiza fotopicului Si 2p (102 eV) identifică formarea SiO2 (Fig. Bi-O-B şi Bi-O-Bi. Spectrul O1s pentru această probă constă din două componente atribuite legăturilor de tipul Bi-O-B şi Bi-O-Bi. asimetrică datorită suprapunerii mai multor componente specifice oxigenului din structura sistemului investigat (Fig. 4A. cu creşterea conţinutului de Bi. după cum se poate observa din spectrul survey prezentat în Fig. această componentă nu mai poate fi pusă în evidenţă. 4B). O categorie de probe pe care au fost efectuate măsurători XPS în scopul evaluării modificărilor structurale induse la suprafaţa acestor sisteme prin aplicarea tratamentelor termice o reprezintă nanocompozitele pe bază de Si şi Ti preparate prin combinarea metodei sol-gel cu metoda uscării prin pulverizare. şi de valorile energiilor de legătură ale oxigenului în B2O3 şi Bi2O3 raportate în literatură [3].5 eV şi cel corespunzător oxigenului în reţeaua SiO2 (Si-O-Si) observat la 532. Rezultatele XPS obţinute pentru sistemul cu raport Ti:Si 1:2.

prin peak-ul de la 459. cum sunt atomii de Si în reţeaua SiO2. dar mai ales separării celor două faze. 430 . (C) Si 2p.a. Cantitatea de oxigen la suprafaţa probelor descreşte odată cu creşterea temperaturii de tratament.a.5 eV (Ti 2p1/2).28 % pentru proba netratată termic.) (f) (e) (d) (c) (b) (a) 110 105 100 95 90 470 465 460 455 450 Energie de legatura (eV) Energie de legatura (eV) Figura 4A: Spectrele XPS survey pentru sistemul Ti:Si 1:2 (a) netratat termic. la 2. (D) Ti 2p. reflectându-se astfel o substituţie a atomilor de Ti de către atomi cu o electronegativitate mai mare şi polarizabilitate mai mică. (d) 900°C. 4B). Acest fapt poate fi explicat printr-o migrare a titanului de la suprafaţă spre interior şi a siliciului din interior spre suprafaţă. cantitatea de Ti 2p la suprafaţă descreşte de la 12. fapt datorat îndepărtării oxigenului specific compuşilor organici sau grupărilor OH. (d) 900°C. pentru (a) proba netratată termic precum şi pentru probele tratate termic la (b) 350°C.0 eV (Ti 2p3/2) şi 464.89 % pentru proba tratată termic la 1100°C. După cum se poate observa din Tabelul 1. (e) 1100°C şi (f) 1400°C. (c) 700°C. respectiv tratat termic la (b) 350°C.Ti LMM C KLL Gd 3d O KLL O 1s Gd 4d (A ) Si 2p C 1s (B) (f) (e) (d) (c) (b) (a) 545 540 535 530 525 Intensitate (u. Formarea celor doi oxizi (SiO2 şi TiO2) este confirmată şi de forma vârfului O 1s (Fig. (e) 1100°C şi (f) 1400°C .Spectrele XPS de înaltă rezoluţie corespunzătoare (B) O 1s. în timp ce cantitatea de Si 2p creşte de la 16.05 %.87 % la 38.) Ti 2p (f) (e ) (d ) (c ) (b ) (a ) 1200 900 600 300 0 E n e r g ie d e le g a t u r a ( e V ) Energie de legatura (eV) (C) (D) (f) (e) (d) (c) (b) (a) Intensitate (u. (c) 700°C.

684 62.Tabel 1. BSA şi Fg reprezintă principalele componente plasmatice şi proteinele relevante care se adsorb la suprafaţa biomaterialelor care intră în contact cu sângele. Si 2p şi Al 2p) pentru toate probele investigate. excepţie făcând fotopicul de C 1s (Fig.260 9. Pentru exemplificare sunt prezentate caracteristicile de adsorbţie a albuminei serice bovice (BSA) şi a fibrinogenului (Fg) la suprafaţa unui compus aluminosilicatic cu conţinut de Fe şi Y preparat prin metoda sol-gel (60%SiO220%Al2O310%Fe2O310%Y2O3 .37 Spectrele de înaltă rezoluţie corespunzătoare Si 2p (Fig. Experimentele de adsorbţie a proteinelor s-au realizat prin imersarea compusului aluminosilicatic în lichid biologic simulat (SBF) îmbogăţit cu BSA. înainte şi după tratamentul termic.15 0. Fe 2p.148 0.43 eV pentru proba netratată termic la 102.18 0. Temperatura de tratament termic (ºC) Netratat termic 350 700 900 1100 1400 Compoziţia elementală (% at. Pentru măsurători ulterioare pe probe funcţionalizate cu diverse tipuri de proteine este reco431 . Concentraţia relativă a principalelor componente.829 59. Spectrul XPS survey înregistrat înainte de imersie prezintă doar fotopicuri corespunzătoare elementelor care intră în compoziţia sistemului (Y 3p.9 eV pentru proba tratată termic la 1400°C. pentru sistemul Ti:Si 1:2.875 24. precum şi în soluţie tampon fosfatică (PBS) îmbogăţită cu Fg.367 7. probele spălate şi uscate au fost analizate cu ajutorul spectroscopiei XPS.057 34.164 27. 4B) sunt de asemenea deplasate spre energii de legătură mai mari.76 29. După procedura de imersie. Prezenţa carbonului se explică prin expunerea probei la atmosferă.640 58. Biocompatibilitatea este dictată de modul în care proteinele se adsorb la suprafaţa materialului odată ce acesta intră în contact cu mediul biologic.281 11.498 Si 2p 16. de la 101.894 5.procente molare). B)).22 0. 5 (A. dar şi datorită benzii dublu adezive de carbon pe care a fost imobilizată proba pentru măsurare.798 Gd 3d 0.) O 1s 70. Ceramicele vitroase aluminosilicatice sunt foarte stabile în organism iar prin adăugarea oxidului de fier şi ytriu ele pot fi optimizate pentru aplicaţii simultane de hipertermie şi radioterapie [6].549 2.156 0.331 Ti 2p 12. Motivul acestei deplasări este corelat cu deplasarea spectrelor O1s şi cu migrarea atomilor de Si spre suprafaţă odată cu creşterea temperaturii de tratament termic.688 64.653 38.428 62. XPS ne permite de asemenea studiul biocompatibilităţii diferitelor tipuri de materiale.

2 şi 400 eV.04 0. În acelaşi timp. înregistrate deja după un timp de imersie de 5 minute. datorită azotului prezent în fiecare aminoacid component al proteinelor.5. Rezultate similare au fost obţinute pentru ambele proteine (BSA/Fg) utilizate pentru funcţionalizare.92 28.a.mandată utilizarea benzii de In în locul celei de C. azotul poate fi utilizat ca un indicator sigur al ataşării proteinelor. Concentraţia relativă a principalelor componente.49 0. Fotopicul N 1s înregistrat la aproximativ 400 eV este tipic pentru azotul din compuşii organici [8]. concentraţia de azot a fost practic zero înainte de imersie în soluţiile cu proteină (Tabel 2.54 36. Si 2p şi Al 2p a fost mai puţin evidentă datorită stratului de proteină format (Tabel 1.19 1.71 1.16 2.75 0.2 23 Fe 0. înainte şi după imersia în soluţiile de SBF/BSA. centrate la 398.) O Al Si 53.) Fe 2p Y 3p Intensitate (u. 2 ore (c) şi 24 ore (d) de imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). Deoarece. Timpul de imersie 0 5 min 2 ore 24 ore C 6.67 Compoziţia elementală (% at.7 37. Măsurătorile XPS de concentraţie de azot pot fi utilizate şi ca metodă indirectă de determinare a cantităţii de proteină adsorbită la suprafaţă [7].03 Y 0.a.21 N 5.3 2. O 1s O KLL C KLL N 1s Y 3p C 1s Si 2s Si 2p Al 2p (A) O KLL C KLL Fe 2p O 1s C 1s (B) N 1s Intensitate (u.18 0.08 37. Este de remarcat faptul că pentru suprafeţele funcţionalizate cu proteine.47 25.42 432 .46 6. Fe 2p. analiza spectrelor survey indică fotopicuri corespunzătoare N 1s.68 6.21 35.46 0. 6) de înaltă rezoluţie scoate în evidenţă două componente.43 28. 3). 2). denotă o ataşare rapidă a proteinei la suprafaţa compusului.) (d) (c) (b) (a) Si 2s Si 2p Al 2p O 2s (d) (c) (b) (a) 1200 800 400 0 1200 1000 800 600 400 200 0 Energie de legatura (eV) Energie de legatura (eV) Figura 5 Spectrele XPS survey înainte de imersie (a) şi după 5 minute (b). Deconvoluţia spectrelor de N 1s (Fig. caracteristice grupărilor C-NH2. detecţia elementelor Y 3p.77 25.2 respectiv 0.93 33. Tabel 2. Rapoartele N:C de 0.

41 0.a.52 O 53. (Fg).a.Tabel 3.11 51.1 Si 36.25 27.77 15.a. Timpul de imersie 0 5 min 2 ore 24 ore Compoziţia elementală (% at.08 29.69 11.01 Y 0.) 410 405 400 395 390 410 Energie de legatura (eV) (a) Intensitate (u. 433 . Concentraţia relativă a principalelor componente. În plus.5 13.81 48.3 0.83 Al 2.02 10. produce un semnal de azot mai intens decât proteina mai mică. (BSA).) C 6. proteina mai mare. şi 24 ore (c) imersie în soluţiile de SBF/BSA (coloana stângă) şi PBS/Fg (coloana dreapta).75 0. Intensitate (u.02 Fe 0.53 N 10.8 0.92 43.) 405 400 395 Energie de legatura (eV) 390 (a) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) Figura 6 Deconvoluţia spectrelor XPS de înaltă rezoluţie ale N 1s pentru BSA/Fg liofilizat (a) după 5 minute (b).96 13.16 - Analizele XPS confirmă creşterea conţinutului de azot după diferite perioade de imersie.18 0.26 23.02 0. aşa cum este de aşteptat. înainte şi după imersia în soluţiile de PBS/Fg.) (c) (c) 410 405 400 395 390 410 405 400 395 390 Energie de legatura (eV) Energie de legatura (eV) (b) (b) Intensitate (u.

conţinutul semnificativ diminuat al O 1s (Tabel 2. (A) Intensitate (u.) (e) (d) (c) (b) Intensitate (u.) (e) (d) (c) (b) (a) 292 288 284 280 276 272 Energie de legatura (eV) 292 288 284 280 276 272 Energie de legatura (eV) Figura 7 Spectrele XPS de înaltă rezoluţie ale C 1s înainte de imersie (a).8B) Astfel spectroscopia XPS a fost utilizată cu succes în acest studiu.8). ale C 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c).a. 434 . 3) corespunde în mare parte oxigenului peptidic constituent al proteinelor. ale O 1s pentru BSA/Fg liofilizat (b) precum şi după 5 minute (c).2 eV (Fig.) (e) (d) (c) (b) (a) Intensitate (u.a. pe baza componentei BSA-ului de la 530. semnalând formarea unor noi tipuri de legături specifice carbonului în proteine [8]. evidenţiind ataşarea proteinelor la suprafaţa materialului şi totodată biocompatibilitatea materialului investigat [10-12]. (A) (B) Intensitate (u.) (B) (e) (d) (c) (b) (a) 545 540 535 530 525 545 540 535 530 (a) 525 Energie de legatura (eV) Energie de legatura (eV) Figura 8 Spectrele XPS de înaltă rezoluţie ale O1s înainte de imersie (a). 7) sunt mai largi şi prezintă o formă asimetrică. este un indicativ al formării unui monostrat complet de proteină [9].a. datorită ataşării la suprafaţă a BSA/Fg-ului cu un conţinut scăzut în oxigen faţă de compusul oxidic utilizat (Fig. 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B).Potrivit rezultatelor publicate anterior privind adsorbţia proteinelor.3 eV. în cazul Fg-ului (Tabel 3). După imersia în soluţiile cu proteină. o cantitate de 14% N. 2 ore (d) şi 24 ore (e) imersie în soluţiile de SBF/BSA (A) şi PBS/Fg (B). În cazul probelor imersate în soluţiile cu proteină. respectiv Fg-ului la 531. După imersia în soluţiile cu proteine. fotopicul O 1s este evident lărgit şi se deplasează spre energii de legătură mai mici.a. semnalele de înaltă rezoluţie ale C 1s (Fig.

Au0 şi Auδ+.8CaO·7.0 16 (b) 110 (a) 92 90 88 86 84 82 110 80 12 8 4 0 Energie de legatura (eV) Energie de legatura ( eV ) Figura 9(a) Spectrul XPS obţinut pentru Au 4f pe proba 0. Ag) prezintă un interes crescut datorită caracteristicilor remarcabile ale acestora.67 eV. 300 şi 500°C.3 0.0 0. Au 4f7/2 şi Au 4f5/2.3 0.6 T (°C) Au 5d T(°C) 500 δ+ 500 0. [14]. ΔE = 3. Linia gri reprezintă spectrul obţinut pentru fiecare din cele trei probe fără nanoparticule de Au. Spectrul Au4f este caracterizat de două componente spin-orbită.7[61. Mai jos sunt prezentate rezultatele XPS cu privire la nucleaţie şi procesul de creştere a nanoparticulelor de Au în sticla bioactivă CaO-SiO2-P2O5 tratată termic la diferite temperaturi. 83. ) 300 300 0. ce deschid noi oportunităţi în medicină.3Au2O3·99. Deconvoluţia liniilor spectrale indica prezenţa speciilor de Au Auδ+.3 0. Au0 şi Auδ. Acest tip de materiale furnizează avantaje valoroase şi în diagnosticarea cancerului sau imagistica biomedicală.5SiO2·30. Aceste rezultate furnizează dovezi experimentale complete pentru corelaţia dintre dimensiunea şi structura electronică a nanoparticulelor de Au care a fost prezisă teoretic.6 Intensitate (u. 435 . atribuiţi la trei specii de Au diferite: Auδ-.6 0. are importanţă ştiinţifică mare datorită faptului că demonstrează foarte clar legătura care există între dimensiunea nanoclasterilor care se formează în matrice şi modificările observate în spectrul Au4f şi cel al benzii de valenţă cu creşterea temperaturii de tratament a probei. Acest studiu publicat recent.0 0.95 eV.Biomaterialele dopate cu particule nano ( Au.în fiecare proba. (b) Spectrul XPS al benzii de valenţa (Au 5d) obţinut pe aceleaşi probe.72 şi 85. a. Identificarea speciilor de Au prezente în probe este foarte importantă deoarece studii recente au demonstrat faptul că toxicitatea nanoparticulelor de Au în tratamentul cancerului depinde de sarcina acestora [13].7P2O5] tratată termic la 110. având despicarea. Deconvoluţia spectrului Au4f înregistrat pentru probele tratate termic la 300 şi respectiv 500 °C prezintă trei dubleţi la energiile de legătură: 82. Au4f δ0 ΔE 0.

A. 25:323-334. 21:12327–12332. Solid State Ionics. Appl. et al. N. Y. Mella O. 163. PhD Thesis. O. Drezek. Neumann. vol. V. Vanea. 9. Y. Structural characterization of some silicate xerogels and microspheres. J. M. 8. Radu. Gonzalez Gonzalez D. E. Simon. S. 3. 2006. R. V. Honma et al. 20:1869-1879. Small 7. 10. M.. J Biomed Mater Res. 2009. Simon.32-40. D. doi:10. P. S1. Simon. Serro. Chem. Simon. Kennedy. No. Neumann. Kjellin. G. Simon. Prinz. 6. A New Era for Cancer Treatment: Gold-Nanoparticle-Mediated Thermal Therapies. Int J Hyperther 2009. Colaco. 10. Neumann. 2. Day. M. Benea. E. Stenport. 5.3681307 14. A. Cavalu. Mat. Sul. Simon. of Solid State Chem. West. 2009. Ponta and S. S. Michel. M. J Mater Sci: Mater Med. S. V. E. M. Adv. Applied Surface Science. 4. Simon. (2008) 2325 Oana Ponta.. D. XPS study of protein adsorption onto nanocrystalline aluminosilicate microparticles. 180. R. O. J. 11. Langmuir 2005. E. 169-183. M. Arvidsson. R. Brogueira. 9. Mocuta. 43.L. S. December 2010 Overgaard J. 764–76.. C. 2011 T. V. 12. M. Arcangeli G. Vanea. Ciceo-Lucacel. 7.T. Cavalu.C. J. P. “Dual-Beam” Charge Neutralisation for monoXPS T. A. L. M. Saramago. Opt. V. Bibliografie 1.P. P. Simon. F. 16. Martins. 2002. H. Hulshof MCCH. 13. 436 . Prinz. Hu. R. V. Ponta. 2008. Dahl O. Phys.. Gispert. S. European Cells & Materials. Lewinski. 100-112 (2002). 55. Vanea. S. A. R. Currie. Textor.1063/1. 257(2011) 2346-2352 L. Castner.78A:581-589. B. Dimitrov et al.2. L. J. S. Coughlin. Glasses. Pasche S. Phys. J. Bickford. A.

.................................................................3. Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1...................... Consideraţii teoretice ........................................................................................................... 443 3........ 438 1....S.... Consideraţii teoretice Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor energetice ale centrilor paramagnetici............................................................................ dr....... 451 1....................... 449 4.......... Caracterizarea instalaţiei experimentale RES ... Obţinerea şi analiza spectrelor RES ...........................1.................................................................. 447 3............................ RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale... Principiul de funcţionare al unui spectrometrul RES................... Spectrometrul portabil RES ADANI PS8400 ......................... SPECTROMETRUL DE REZONANŢĂ ELECTRONICĂ DE SPIN Spectroscopia de rezonanţă electronică de spin C......... 437 1........ 447 3.............. Hamiltonianul de Spin ............................2........................................ Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 ...... Bibliografie ..........................1............XII..................................................... 447 3.............................................................................2.... Interacţiunea Zeeman .......... 441 2.... Metoda constă 437 ....................

suficient de depărtaţi unul de altul. 3. 7. 6. un electron prins într-o vacanţă ionică negativă. În cazul experimentelor de Rezonanţă Magnetică Nucleară (RMN). 5. structura cristalină. geologie. fizică. este folosită în cazul experimentelor RES. Frecvenţa de ordinul gigahertzilor (GHz). Biradicalii (molecule ce conţin doi electroni neîmperecheaţi. De-a lungul anilor. procesele electrochimice. chimie.2].în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. Radicalii liberi în stare solidă. în domeniul microundelor. 1. Sisteme cu trei sau mai mulţi electroni neîmperecheaţi. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. Sisteme cu electroni de conducţie (metale şi semiconductori). procesele de cinetică. lichidă sau gazoasă. astfel încât interacţiunea lor să fie slabă). Sisteme cu stare fundamentală de triplet (cu doi electroni neîmperecheaţi care interacţionează puternic). Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. etc. cataliza şi reacţiile de polimerizare au fost toate studiate cu mare succes. Astfel. Defecte punctuale (imperfecţiuni localizate în cristale) în solide. ESEEM şi ENDOR) în conjuncţie cu RES este posibil să se obţină informaţii detaliate privind unele teme de interes ştiinţific.1. ştiinţele medicale. Interacţiunea Zeeman Metoda RES constă în studiul tranziţiilor induse între două subnivele Zeeman vecine. Ioni ai metalelor tranziţionale şi ai pământurilor rare [1. ştiinţa materialelor. atomii interstiţiali dintr-un cristal sau matricea unei sticle. schimbul electronic. 4.). 2]. spectroscopia RES a fost cu succes aplicată în diverse domenii ca biologie. Prin utilizarea unor tehnici specializate variate (cum ar fi metoda capcanelor de spin şi a radicalilor nitroxidici. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi (de exemplu. Solidele. De exemplu. 2. antropologie. sub acţiunea unui câmp de microunde cu o anumită frec438 . frecvenţele utilizate sunt de ordinul megahertzilor (MHz) din domeniul vizibil la cel ultraviolet. cel mai cunoscut din această clasă este centrul F. Sistemele tipice care pot fi studiate prin RES sunt: 1. etc. lichidele şi gazele sunt deopotrivă accesibile spectroscopiei RES.

orientarea spinului trecând din cea paralelă cu câmpul în poziţia antiparalelă cu acesta.este momentul cinetic de spin. Astfel. Un foton are momentul unghiular intrinsec egal cu . 439 . paralelǎ sau antiparalelǎ cu câmpul magnetic. Astfel. Introdus într-un câmp magnetic static B. care este privită clasic ca o rotaţie în jurul propriei axe. Astfel regulile de selecţie impuse sunt Δ M S = ± 1 şi Δ M I = 0 . ⎛ 1⎞ E↓ = −⎜ ⎟⋅ β ⋅ g ⋅ B ⎝ 2⎠ (3) Regula de selecţie pentru tranziţia unui spin electronic este Δ M S = ± 1 . iar γ este raportul giromagnetic electronic. Ca urmare a acestei rotaţii electronul posedă un moment cinetic de spin S căruia i se asociază un moment magnetic μ S : → → μ S = −g ⋅γ ⋅ S → → (1) unde g este factorul Landé care pentru electronul liber are valoarea 2. efect denumit efect Zeeman. Din această cauză dacă Δ M S = + 1 când un foton este absorbit M I (numărul cuantic magnetic nuclear) trebuie să rămână neschimbat pentru ca momentul unghiular total să se conserve. se cunoaşte faptul că electronul posedă o proprietate cuantică numită “spin”. depinde de intensitatea câmpului magnetic aplicat. ecuaţia (2) poate avea doar două forme pentru o orientare dată a câmpului magnetic B: ⎛ 1⎞ E↑ = +⎜ ⎟ ⋅ β ⋅ g ⋅ B ⎝ 2⎠ . iar MS este numărul cuantic mag= ± 1 2 . Asemenea tranziţii corespund la o schimbare în momentul unghiular de spin de ( ± ). în energie. Diferenţa de energie în spectroscopia RES este predominant datorată interacţiunii electronilor neîmperecheaţi din probe cu câmpul magnetic produs de un magnet. spinul electronului poate avea două orientări. S . netic de spin care poate lua valoarea M S → → (2) β = γ ⋅ .0023. Energia interacţiunii Zeeman a unui electron într-un câmp magnetic aplicat B este dată de relaţia: E Zeeman = − μ s ⋅ B = g ⋅ β ⋅ B⋅ M S unde β este magnetonul Bohr.venţă numită frecvenţă de rezonanţă [1]. Diferenţa dintre cele două direcţii ale spinului. În urma absorbţiei de energie electronii trec de pe nivelul de energie inferior pe unul superior.

având o frecvenţă fixă de oscilaţie ν şi deci energia (h·ν). Figura 1. într-un câmp magnetic exterior. spectrul RES măsoară energia necesară tranziţiei electronului (ΔE) între cele două nivele energetice. ν frecvenţa de rezonanţă. Spectrul de absorbţie măsurat la condiţia de rezonanţă este schematic reprezentat în partea de jos a figurii. Nivelele energetice şi absorbţia de rezonanţă RES pentru interacţia Zeeman a unui electron (S = 1/2) În (Fig. iar B câmpul magnetic aplicat. de obicei se obţine de la o sursă de energie electromagnetică. Rezultă de aici condiţia de rezonanţă: h ⋅ν = g ⋅ β ⋅ B (4) unde h este constanta lui Planck. De obicei linia de absorbţie nu este singulară apărând uneori un spectru de multipleţi datorită existenţei nucleelor magnetice în specia paramagnetică. 1) sunt reprezentate schematic energiile Zeeman funcţie de magnetizarea câmpului aplicat B. Parametrul g determină poziţia liniei de absorbţie. 440 . figura ilustrează tranziţia între nivelul de energie inferior « spin jos » şi nivelul de energie superior « spin sus » indusă prin introducerea probei în câmpul de microunde de frecvenţă ν. De asemenea.Cu alte cuvinte. Această energie. în cazul unui electron neîmperecheat (S=1/2).

Dacă simetria este axială. şi anume: H=H0+HLS+HSS+HZ+HN+HQ+HD+HC unde. este descrisă printr-un hamiltonian compus din mai mulţi termeni [1]. Hamiltonianul de Spin Fenomenul RES poate fi tratat teoretic prin două metode: tratarea clasică cu ajutorul teoriei lui Bloch şi tratarea cuantică.reprezintă energia ionului liber care nu depinde de spin. axială. deci depind de forma funcţiei de undă şi de câmpul cristalin. ƒ HZ – reprezintă interacţiunea electronului cu câmpul magnetic exterior (termenul Zeeman). Starea unui ion paramagnetic având spinul nuclear nenul. Cel mai simplu formalism pentru interpretarea spectrelor RES este cel al hamiltonianului de spin. HLS – este interacţiunea spin – orbită. Toţi coeficienţii tensoriali din expresia hamiltonianului de spin se exprimă prin matrici care pot fi diagonalizate. ƒ HC – termenul câmpului cristalin şi reprezintă influenţa câmpului electrostatic cristalin. introdus într-o reţea cristalină şi aşezat într-un câmp magnetic static. D şi E reprezintă constantele de despicare în câmp nul. ƒ HD – descrie proprietăţile diamagnetice. HSS – reprezintă interacţiunea de structură fină în aproximaţia de ordin II (sau termenul de despicare în câmp nul). ƒ HQ – interacţiunea electrostatică cu momentul de cuadrupol q al nucleului. 441 (5) ƒ ƒ ƒ . iar ultimii doi sunt termenii ce dau structura fină.2. Folosind teoria perturbaţiilor se ajunge la forma bine cunoscută a hamiltonianului de spin: 1 ⎤ 2 2 2 Hs = β ⋅ ( g xx S x Bx + g yy S y By + g zz S z Bz ) + D ⋅ ⎡ ⎢S z − 3 S (S + 1)⎥ + E ⋅ (S x − S y ) (6) ⎣ ⎦ Primul termen din acest hamiltonian este aşa numita interacţiune Zeeman. ƒ HN – reprezintă termenul interacţiunii hiperfine. Hamiltonianul de spin conţine o serie de coeficienţi care sunt mărimi tensoriale. rămân în hamiltonian numai termenul Zeeman şi termenul în D.1. În esenţă hamiltonianul de spin este un operator echivalent care acţionează numai asupra coordonatelor de spin conducând la aceleaşi rezultate ca şi hamiltonianul total al sistemului. termenul E fiind 0. respectiv rombică. H0 .

în cazul unor simetrii nesferice atât g. cât şi Ai sunt mărimi tensoriale. SZ este operatorul de spin corespunzător proiecţiei acestuia după axa z. pentru o simetrie axială hamiltonianul de spin are următoarea formă: H = g // ⋅ β ⋅ B Z ⋅ S Z + g ⊥ ⋅ β ⋅ B X ⋅ S X (8) unde BZ este componenta câmpului magnetic de-a lungul axei z (paralel). Hamiltonianul de spin care descrie starea energetică a unui centru paramagnetic electronic în interacţiune cu n nuclee cu spinul nuclear diferit de zero va fi: H = → → ~⋅ S + S ⋅ A ⋅ I i β ⋅ B⋅ g ∑ i i =1 → → n → ~ → (10) unde. fără interacţiuni hiperfine corespunzător ecuaţiei (4).Cea mai simplă formă a hamiltonianului de spin este pentru un singur electron cu g izotrop. Termenul HN (ecuaţia 5) reprezintă termenul interacţiunii hiperfine. Dacă câmpul magnetic este direcţionat paralel cu direcţia axelor moleculare atunci situaţia este identică cu relaţia (7). 442 . Ordinul de mărime al energiei hiperfine este de 0 ÷ 10-2 cm-1. şi are următoarea formă: H = g ⋅ β ⋅ B ⋅ SZ (7) unde direcţia câmpului magnetic este aleasă ca fiind axa z. Pentru un singur electron cu g anizotrop hamiltonianul de spin este mai complicat din cauza diferiţilor operatori ai proiecţiei spinului. Tocmai această interacţiune produce structura hiperfină a nivelelor energetice de spin. BX este componenta câmpului magnetic de-a lungul direcţiei perpendiculare (x). Interacţiunea dintre momentul magnetic de spin şi un moment magnetic nuclear se numeşte interacţiune hiperfină. Hamiltonianul de structură hiperfină produce o despicare simetrică a nivelelor energetice şi are următoarea formă: HN → ~ → = S⋅ A ⋅ I (9) unde A este tensorul interacţiunii hiperfine. descrisă de hamiltonianul de mai sus. De exemplu. Acest termen reprezintă interacţiunea momentului cinetic de spin I cu momentul de spin electronic S .

se datorează unui slab câmp perturbator indus. Factorul g este o mărime tensorială caracterizată prin trei valori principale. Totuşi. este indicat a se folosi cuarţul. trebuie luate în considerare contribuţiile la momentul magnetic ale mişcării orbitale a electronului.0023. având în vedere posibilităţile de absorbţie şi de a da semnal RES al sticlei obişnuite. Unul din factori este datorat faptului că electronul posedă în plus un moment unghiular orbital căruia i se asociază un moment magnetic. Aceşti tensori dau cele mai importante informaţii cu privire la structura centrului paramagnetic studiat.5 GHz) şi Q (∼ 35 GHz). creşterea absorbţiei o dată cu creşterea frecvenţei. Cu toate acestea în probele care conţin centri paramagnetici intervin o serie de factori care abat valoarea factorului g de la valoarea amintită mai sus. pentru probe sub formă de soluţii. Spectrul RES al unui centru paramagnetic cu spinul ½ este bine definit dacă se cunosc tensorii g (factorul de despicare spectroscopică) şi A (constanta de despicare hiperfină). În sistemele chimice. există limitări tehnice legate de utilizarea benzilor de frecvenţă ridicate: folosirea de probe de dimensiuni mici. Astfel. Acest câmp perturbator se poate adăuga sau scădea la câmpul exterior. Tuburile au diametre de câţiva milimetri şi lungimi de ordinul centimetrilor. provocat de mişcarea orbitală.0023. Pentru un electron liber. Pentru radicalii liberi. momentul de spin şi cel orbital se pot combina. În expresia factorului g. abaterea factorului g de la valoarea 2. g rămâne apropiat de valoarea electronului liber. Valoarea lui g definită prin 443 .2. Obţinerea şi analiza spectrelor RES În experimentele RES cele mai utilizate benzi de frecvenţe de microunde sunt benzile X (∼ 9. Deoarece sensibilitatea instrumentului creşte proporţional cu pătratul frecvenţei. valoarea factorului g este ge = 2. În felul acesta în sisteme cu un electron neîmperecheat şi legătură π. soluţii îngheţate. ceea ce duce la scăderea sensibilităţii. rezultă că se obţine o rezoluţie spectrală mult mai bună o dată cu creşterea frecvenţei de microunde. Probele se introduc de obicei în tuburi şi. pulberi şi monocristale. În celelalte cazuri. Măsurătorile RES se pot efectua pe probe gazoase. obţinând o valoare a lui Δg pozitivă sau negativă. electronii neîmperecheaţi ocupă un orbital care poate fi localizat pe un singur atom sau poate fi delocalizat pe o întreagă moleculă sau pe un radical. în afara unei mărimi constante intervine o mărime care dă abaterea factorului g de la valoarea corespunzătoare electronului liber. dificultăţi de obţinere a omogenităţii câmpului (δH/H) la frecvenţe mari. notată Δg.

se poate introduce în cavitatea de rezonanţă pe lângă proba de studiat şi un etalon. Pentru a determina valoarea factorului g mai uşor. Valoarea lui g depinde de orientarea câmpului magnetic extern în raport cu cel electric cristalin şi este o mărime tensorială. factorul g este calculat din condiţia de rezonanţă.00 sau mai mult.00 . pentru care g = 2. Cel mai uzual radical utilizat ca etalon pentru marcarea câmpului magnetic este DPPH (difenilpicrilhidrazil). acestea sunt influenţate atât de caracteristicile fizico-chimice ale substanţei paramagnetice. dar poate ajunge la 9. S – numărul cuantic de spin. În ceea ce priveşte forma şi lărgimea semnalului RES. în particular prin alterarea timpului de relaxare spin-reţea. Astfel. În experimentele RES uzuale efectuate în undă continuă se fixează frecvenţa şi se variază inducţia câmpului magnetic aplicat. 444 .0. De obicei se lucrează în banda X. poate fi β ⋅B diferită de 2. de exemplu ENDOR (Electron Nuclear DOuble Resonance) şi ELDOR (Electron Electron DOuble Resonance). pentru semnale cu g ~ 2.0036. L şi S astfel: g =1+ J ⋅ ( J + 1) + S ⋅ ( S + 1) − L ⋅ ( L + 1) 2 J ⋅ ( J + 1) (11) unde J – numărul cuantic total. iar această ecuaţie reprezintă formula lui Lande. Prezenţa anumitor tipuri de interacţiuni are ca efect lărgirea sau îngustarea liniei de rezonanţă. Liniile de rezonanţă ale probelor solide sunt considerabil distorsionate de anizotropia factorului g sau de cuplajul dintre spinii electronici şi nucleari. cât şi de condiţiile experimentale. fiind necesar un câmp magnetic de ∼ 3300 G. utilizând valorile măsurate ale frecvenţei şi câmpului la rezonanţă. L – numărul cuantic orbital. Acestea sunt exemple de tehnici neliniare. În acest caz valoarea factorului g depinde de numerele cuantice J. cunoscută şi sub denumirea de g efectiv (gef ). valoarea lui g pentru un sistem paramagnetic oarecare se calculează utilizând următoarea relaţie: g = g etalon ⋅ B etalon B proba (12) Există posibilitatea de a combina metode în care pot fi îndeplinite mai multe condiţii de rezonanţă pe lângă cele referitoare la spinul electronic.relaţia g = h ⋅ν . mai rar scade mult sub această valoare. deoarece ambele depind de saturaţie [3]. Impurităţile paramagnetice pot de asemenea distorsiona semnalul RES. Astfel.

anizotropiei tensorilor g şi de structura fină. avem: neomogenitatea câmpului magnetic static B0. fluctuaţiile datorate mişcării spinilor în câmpul magnetic local. sunt simetrice şi au o formă aproximativ Lorentziană (Fig. Liniile lărgite neomogen. atunci când lărgirea nu este provocată de interacţiunile anizotrope. diversele scheme de modulaţie utilizate pentru a creşte detecţia. Liniile lărgite omogen. Pentru sistemele reale. Liniile lărgite neomogen sunt înfăşurătoarele liniilor lărgite omogen corespunzătoare diferitelor pachete de spini. Această linie este îngustă în zona centrală şi are o descreştere lentă spre extreme.2 Forma Lorentzianǎ şi gaussianǎ a liniilor RES Dacă numai anumite grupuri de spini sau pachete de spini din probă pot absorbi direct cuantele de o frecvenţă particulară. atunci linia este lărgită neomogen. interacţiunea dintre spinul electronic şi câmpul de microunde. Lărgirea liniei RES poate fi omogenă sau neomogenă. difuzia de spin. Cauzele care determină lărgirea neomogenă sunt : interacţiunea dipolară între spinii de acelaşi tip.2). linia de rezonanţă are în general o formă intermediară între cele două cazuri limită. În cazul lărgirii omogene toţi spinii din probă răspund ca o unitate acţiunii cuantelor de microunde. saturarea sistemului de spini cu o putere excesivă. absorbind cuantele la o valoare bine determinată a câmpului magnetic. apărute în urma unor fluctuaţii dinamice în sistemul de spini (variabile în timp). 445 . neliniaritatea amplificatorului sau a detectorului. relaxarea spin – reţea. Figura. Cauzele lărgirii neomogene sunt fluctuaţii spaţiale de câmp magnetic şi sunt datorate prezenţei unor interacţiuni hiperfine. se apropie de o formă Gaussiană. neomogenităţilor câmpului magnetic static. linii care au maxime de absorbţie uşor diferite între ele datorită distribuţiei de câmp magnetic local în probă.Dintre factorii instrumentali care pot influenţa forma semnalului RES. dipolare dintre spini cu frecvenţe Larmour diferite.

dar situate la intervale neegale.. Prezenţa structurii hiperfine la radicalii liberi se datorează interacţiunii magnetice a electronului cu spin neîmperecheat cu momentul magnetic al nucleelor cuprinse în orbita acestui electron. spectrul va avea (2nI+1) linii de structură hiperfină. foarte precise. determinată de numărul de nuclee cuprinse în orbita electronului şi de gradul de localizare al electronului la fiecare dintre aceste nuclee. aşezate la intervale egale şi cu intensităţi care sunt mai mari în centrul spectrului şi descresc spre margini.(2In+1) linii de egală intensitate. şi de densitatea de electroni cu spini neîmperecheaţi la fiecare dintre aceste nuclee. iar poziţia spectrelor este aproximativ aceeaşi în câmpul magnetic [4]. Factorul de despicare spectroscopică g are valoarea foarte apropiată de cea corespunzătoare electronului liber (g = 2. Studiile efectuate au pus în evidenţă la spectrele de rezonanţă ale radicalilor liberi. în majoritatea cazurilor. care permite în multe cazuri identificarea radicalilor liberi. descifrarea structurii hiperfine a spectrelor este destul de complicată. caracterizate printr-un număr cuantic I. 446 . o serie de particularităţi [1]: I. II.În cazul radicalilor liberi generaţi prin iradiere γ în sisteme biofarmaceutice şi de interes biomedical. Valoarea factorului de despicare spectroscopică g apropiată de cea a electronului liber. structura hiperfină a spectrelor RES (când este bine rezolvată) furnizează informaţii mai importante despre radicali decât valoarea factorului g. Factorul g nu permite identificarea radicalilor liberi. Când orbita electronului cuprinde cu egală probabilitate un număr n de nuclee identice. Lărgimea liniei este de obicei mică. au reuşit să pună în evidenţă dependenţa factorului g de structură într-o serie de substanţe organice [2]. totuşi unele măsurători RES. căci apar (2I1+1)(2I2+1)….0023). structura hiperfină permite. Prin aceasta. de faptul dacă aceste nuclee sunt identice sau nu. Fiecare radical liber are o structură hiperfină caracteristică. structura fină lipseşte pentru că spinul este egal cu ½ . I. deoarece majoritatea radicalilor detectaţi sunt radicali centraţi pe carbon sau azot. Prezenţa unei structuri hiperfine caracteristice. intensitatea lor şi valoarea despicării hiperfine depind de numărul nucleelor cuprinse în orbita electronului paramagnetic. identificarea radicalului liber studiat. Numărul liniilor de structură hiperfină. III. II. În cazul când electronii paramagnetici înconjoară mai multe nuclee cu spini nucleari diferiţi. arată că la radicalii liberi există o interacţiune spin-orbită foarte slabă şi electronii cu spinii neîmperecheaţi au un grad mare de localizare.

III. Toate aceste elemente se găsesc cuplate prin intermediul probei de studiat care se află sub acţiunea câmpului magnetic static şi al câmpului de microunde. are loc între nucleul cu moment magnetic nenul şi electronii cu spini neîmperecheaţi. Structura fină lipseşte în cazul radicalilor liberi cu un singur electron neîmperecheat. Interacţiunea hiperfină izotropă este partea principală a interacţiunii hiperfine în radicali liberi. măsurătorile se efectuează folosind capilare speciale de sticlă. Interacţiunea hiperfină izotropă sau interacţiunea hiperfină de contact (interacţiunea de contact Fermi). un detector. o cavitate de microunde şi un sistem computerizat pentru înregistrarea şi observarea fenomenului de rezonanţă. Lărgimea liniei fiind mică permite determinări foarte precise de concentraţie a radicalilor liberi şi separarea efectelor diferiţilor radicali prezenţi în acelaşi timp în proba studiată. în general despicarea hiperfină fiind mai mare decât lărgimea componentelor hiperfine. Spectrele RES se înregistrează la temperatura camerei cu ajutorul spectrometrului “ADANI Portable EPR Spectrometer PS8400”. a căror densitate la locul nucleului este diferită de zero. deoarece în multe cazuri interacţiunea hiperfină anizotropă nu se rezolvă şi are ca efect doar o lărgire a liniilor de rezonanţă sau o anizotropie a formei şi lărgimii liniei. Structura hiperfină a spectrelor apare în special în cazurile când electronii cu spin neîmperecheat sunt electroni s sau σ. un generator de microunde.1.2. Interacţiunea hiperfină anizotropă este interacţiunea de tip dipol magnetic între electronul cu spin neîmperecheat şi nucleul cu moment magnetic diferit de zero. 3. în care se introduce proba. Astfel.1 GHz ÷ 9. care operează în banda X (9. Caracterizarea instalaţiei experimentale RES 3. cu lungimea de 20 cm şi diametrul interior de 1mm. spectrometrul RES se compune dintr-un electromagnet capabil să creeze un câmp magnetic static B. Principiul de funcţionare al unui spectrometru RES Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static al polarizării induse de o probă electromagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale particulelor paramagnetice.6 GHz) şi 447 . De asemenea lărgimea mică a liniilor facilitează studiul structurii hiperfine. Spectrometrul portabil RES ADANI PS8400 În cazul tuturor experimentelor.Există două tipuri de interacţiuni hiperfine: interacţiunea hiperfină anizotropă şi interacţiunea hiperfină izotropă. 3.

Modulaţia se realizează cu un semnal de frecvenţă ν = 100 kHz. umiditatea relativă între 20% şi 80%. “ADANI PS8400” Figura. în funcţie de probele care urmează a fi studiate. lucrează în modul TE102 şi are un factor de calitate Q = 5000. Schema bloc a spectrometrului portabil “ADANI PS8400” este redată în (Fig. sensibilitatea spectrometrelor creşte. Cu creşterea factorului de calitate Q. iar rezoluţia este de 0. Valorile de “offset” ale câmpului magnetic şi timpul de baleiere sunt controlate de către sistemul de achiziţionare computerizat. computerizat. Spectrometrul poate opera în următoarele condiţii : temperatura mediului cuprinsă între (+18°C) şi (+28°C) . Canalul de semnal cuprinde partea electronică necesară detectării senzitive în fază. iar Δν lărgimea la semiînălţime a rezonanţei. Factorul de calitate este dat de relaţia Q = ν res . Parametrii spectrometrului utilizaţi la achiziţionarea spectrelor RES sunt diferiţi.800mmHg) (Fig. Factorul de calitate Q indică cât de eficient stochează cavitatea energia de microundă.care este echipat cu un sistem de achiziţie al datelor. 3 ADANI Portable EPR Spectrometer PS8400 Cavitatea de microunde este de formă rectangulară. 4). Sursa de microunde este reprezentată de un oscilator “GUNN”. Sensibilitatea spectrometrului RES tip “ADANI PS8400” este 5×106 spin /Gauss. (630 mmHg . unde νres este frecvenţa Δν de rezonanţă. Sursa de radiaţie electromagnetică şi detectorul de află într-o cavitate numită “punte de microunde”. Puntea de microunde este o cutie de metal care ajută la amplificarea semnalelor slabe provenite de la probe. 448 . şi presiunea atmosferică (840 GPa – 1066 GPa). O baleiere a câmpului este divizată în 4096 de paşi discreţi.3).07 Gauss /cm.

Figura. o tensiune de referinţă corespunzătoare valorii de “offset” a câmpului magnetic este trimisă către acea parte a controlerului care reglează bobinele de baleiere.4 Schema bloc a spectrometrului “Portable ADANI PS8400” La fiecare pas. Toate aceste componente lucrează împreună pentru achiziţionarea unui spectru de rezonanţă electronică de spin (RES). Rata de baleiere este controlată prin varierea timpului de aşteptare între paşii individuali. Exemple de spectre RES achiziţionate cu ajutorul spectrometrului portabil ADANI PS8400 a) spectrele RES ale unor probe de hidroxiapatită cu fier 449 . 3.3.

) 50 40 30 20 10 1000 2000 3000 4000 5000 50 40 g = 2.) Intensitate (u.3 x (mol %) 70 60 g = 4.b) spectrele RES ale unor probe vitroase şi vitroceramice care conţin fier [5]: g = 4.a.a.3 x (mol %) 70 60 Intensitate (u.0 30 20 10 Camp magnetic (G) 1000 2000 3000 4000 5000 Camp magnetic (G) c) spectrele RES ale unor medicamente: spectrul experimental spectrul experimental spectrul simulat spectrul simulat 3250 3300 3350 B(G) 3400 3450 3250 3300 3350 B(G) 3400 3450 d) spectrele RES ale unor radicali liberi [6]: T im p (zile) 7 E (92 z) 5 1 E (ini) 0 3320 3340 3360 B (G ) 3380 3400 3250 3300 3350 B (G) 3400 3450 450 .

S. (1994) S. 12: 1356 -1359.4. 352. Todea. Spectroscopic study on iron doped silica-bismuthate glasses and glass ceramics. Rezonanţa electronică de spin. Editura Didactică şi Pedagogică. 2007 451 . David. Crucq. 5. Non-Cryst. submis la Radiation Physics and Chemistry. Crăciun. Bibliografie 1. Damian. 2. Simon. Academiei R. (2001) A-S. Rezonanţa magnetică. C. M.România. Chiş. Study of radicalizing mechanisms of irradiated drugs (Radiosterilization of pharmaceuticals: radicals). Gamma-irradiated ExtraVit M nutritive supplement studied by EPR spectroscopy . Simon. Bucureşti. Nicula.S. Cozar. Chimie Nouvelle. Presa Universitară Clujeană. Ed. 28-29. 61-64 (1980) L. J. (2006) 2947. Rezonanţa electronică de spin. O. 6. I. Solids. V. 3. (1965) Al. Dina Petrişor. Cluj-Napoca. 4.Ursu. G.

........................ soluţiilor congelate sau în cazul soluţiilor lichide aduc contribuţii importante cercetărilor din domeniul materialelor...................................................................... mineralogiei si geologiei... Rezonanţa electronică de spin este o metodă larg utilizată în descrierea stărilor fundamentale şi caracterizarea efectelor vecinătăţii asupra nivelelor 452 ........... Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) ..................454 4................ non-distructive si non-invazive...............a C.......... care pot fi investigaţi prin RPE sunt ionii metalelor de tranziţie şi elemente ale pământurilor rare sau centrii asociaţi cu sarcinile electrice sau cu defectele neutre..... dr....453 3............... Introducere Spectroscopia de rezonanţă electronică de spin (RES) este una dintre cele mai eficiente metode............452 2. pulberilor policristaline........... folosită pentru caracterizarea ordinii locale şi a interacţiunilor magnetice în materiale organice si anorganice....... Milica Todea 3000 3100 3200 3300 3400 3500 3600 3700 m agnetic field Cuprins 1...........................Spectroscopia de rezonanţă electronică de spin – partea a II.... fizicii........ chimiei.................. Exemple de aplicaţii ale rezonanţei electronice de spin .. monocristalelor..... Centrii paramagnetici..................465 1............... Spectrele RES înregistrate de asemenea în cazul: sistemelor necristaline....S.... biologiei............ Bibliografie: ...... Introducere .............

medicină.2]. geologie. pământurilor rare şi actinidelor • defecte paramagnetice. 2. RES este o metodă sensibilă la poziţiile atomilor în structură şi permite studiul simetriei locale. centrii de culoare. deformări locale • electroni de conducţie în conductori şi semiconductori • interacţii magnetice şi cristaline • procese de recombinare la temperaturi scăzute b. În domeniul fizicii • concentraţii de spin • ioni paramagnetici ai metalelor de tranziţie. chimie. mediu. biologie. nanomateriale. nanoştiinţelor. medicinii şi mediului • markeri de spin • antioxidanţi şi agenţi de contrast • oximetrie • radicali liberi în ţesuturi. Metoda constă în studiul tranziţiilor dintre nivelele electronice ale atomilor în prezenţa unui câmp magnetic extern [1. radicali ai oxigenului. Astfel. În domeniul chimiei • radicali liberi • cataliza • procese de oxidare si reducere • stări de triplet a moleculelor • compuşi organo-metalici şi zeoliţi • cinetica de reacţie şi reacţii de polimerizare c.energetice ale centrilor paramagnetici. NO în sisteme biologice • fotosinteza 453 . În domeniul biologiei. Aplicaţii ale spectroscopiei de rezonanţă electronică de spin (RES) Spectroscopia RES are aplicaţii în cadrul cercetărilor din diferite domenii cum sunt: fizică. studiul materialelor. Aceste câmpuri de obicei provin de la momentele magnetice nucleare ale diferiţilor nuclei care pot fi prezenţi în vecinătăţi. Cu ajutorul rezonanţei paramagnetice electronice (RES) pot fi studiate: a. spectroscopia RES este capabilă să furnizeze detalii de structură moleculară inaccesibile altor metode analitice. Aceasta se datorează faptului că momentul magnetic de spin al electronului neîmperecheat este foarte sensibil la câmpurile magnetice locale din interiorul probei. aplicaţiile industriale etc.

În domeniul aplicaţiilor industriale • controlul calităţii produselor alimentare iradiate • dozimetrie pentru procesele de iradiere • vârste şi datări de materiale cu aplicaţii în arheologie. Exemple de aplicaţii ale rezonanţei electronice de spin Spectrele RES au fost înregistrate pe pulberi la temperatura camerei cu ajutorul unui spectrometru portabil RES “ADANI Portable EPR Spectrometer PS8400”.strat superficial ale nanoparticulelor magnetice • proprietăţi ale nanoparticulelor şi nanofirelor magnetice • interacţii magnetice dipolare şi de schimb: efectele dimensiunii • nanometrologie: dimensiune medie a nanoparticulelor metalice şi magnetice • caracterizare nanotuburi de carbon. nanocompozite • efecte miez interior .1 GHz – 9. fullerene şi compuşi derivaţi • proprietăţi ale conducţiei electrice şi transportului polaronic 3. metabolism şi toxicitate • factori poluanţi d.• detecţie de droguri. care operează în banda X (9.6 GHz) şi este 454 . În domeniul nanomaterialelor şi nanoştiinţelor • efecte ale reducerii dimensionalităţii • dinamica de spin în nanomateriale. În domeniul caracterizării materialelor • proprietăţi ale polimerilor • defecte în fibre optice • materiale laser • conductori organici şi anorganici cu dimensionalitate redusă • influenţa impurităţilor şi defectelor în semiconductori • proprietăţi ale noilor materiale magnetice • proprietăţi ale materialelor utilizate în spintronică. optoelectronică • manganiţi cu magnetorezistenţa colosală • supraconductori oxidici cu temperatură de tranziţie ridicată • semiconductori f. geologie • detecţia radicalilor în polimeri iradiaţi şi procese de coroziune • prospeţimea uleiurilor vegetale • controlul calităţii sticlelor optice speciale • procese oxidative în vopsele utilizate în industria auto e.

99[xSiO2·(100-x)Bi2O3].3 este specifică tuturor sticlelor ce conţin ioni Fe3+ ca impuritate sau ca dopant în concentraţii mici [5-8]. 12].) 50 40 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura. Îngustarea liniei de 455 .3 de compoziţia probelor este ilustrată în Fig. sunt reprezentate în figura 1. 1 Spectrele RES înregistrate pentru probele netratate termic Caracteristicile spectrului RES pentru diferite rapoarte Bi2O3/SiO2 sunt complet similare pentru toate probele netratate termic (Fig. în timp ce liniile cu gef>2. pentru care termenul Zeeman este dominant .a. g = 4. Dependenţa lărgimii acestor linii de la gef ≅ 4. pentru probele vitroase din sistemul 0.3 şi o linie foarte slab rezolvată la gef ≅ 2. Observăm că linia de rezonanţă de la gef=4. Liniile de la gef=2. Spectrul conţine o linie principală de rezonanţă relativ largă cu gef ≅ 4. Exemplul1.0 sunt atribuite ionilor paramagnetici izolaţi în poziţii caracterizate de câmpuri cristaline relativ slabe.0 sunt atribuite ionilor paramagnetici aflaţi în poziţii caracterizate de câmp cristalin relativ puternic unde termenii de câmp cristalin sunt comparabili sau mai mari decât termenii Zeeman [9. 1) arătând că vecinătatea ionilor Fe3+ nu depinde foarte mult de compoziţia matricilor vitroase.01Fe2O3·0. Sticlele şi vitroceramicile studiate conţin ionul paramagnetic Fe3+ (3d5 6S5/2). Fe3+ Spectrele RES înregistrate.echipat cu un sistem de achiziţie a datelor.3 se îngustează pe măsură ce înlocuim Bi2O3 cu SiO2 (Fig. Funcţionarea spectrometrului se bazează pe înregistrarea într-un câmp magnetic static a polarizării induse de o probă paramagnetică în câmp de microunde datorită tranziţiilor cuantice între nivelele Zeeman ale centrilor paramagnetici. 2). Linia de la gef ≅ 4.3 x (mol %) 70 60 Intensitate (u. computerizat. acesta fiind în stare S şi frecvent utilizat în investigaţiile RES ale sticlelor.0. 2.

3.3. Pentru un conţinut scăzut de SiO2 (x ≤ 30) linia dominantă se găseşte la gef ≅ 2. 3. 3) arată schimbările apărute în ordinea locală în jurul ionilor de fier.0 cât şi cea de la gef ≅ 4. 230 220 210 200 ΔB (G) 190 180 170 160 10 20 30 40 50 60 70 x (mol%) Figura.0. În cazul probelor cu conţinut ridicat de siliciu (60 ≤ x ≤ 70) sunt prezente ambele linii. În probele tratate termic. înregistrată pentru probele cu un conţinut scăzut de SiO2.0 în timp ce linia mai puţin intensă se situează la gef ≅ 4. semnalul de la gef ≅ 2. Lărgimea liniei de la gef ≅ 2. atât cea de la gef ≅ 2. Forma liniilor RES descrie şi dezordinea din jurul ionilor de fier rezonanţi şi caracteristicile structurale ale matricilor vitroase în care sunt încorporaţi aceşti ioni de fier. 2 Dependenţa lărgimii liniilor de rezonanţă de la gef ≅ 4.3 este înregistrat pentru toate probele şi lărgimea liniei este de aproximativ 200 G pentru toate compoziţiile.5O9. 4. scade cu x aşa cum se observă în Fig. spectrele RES ale Fe3+ (Fig. Acest rezultat indică faptul că ordinea la scurtă distantă. Semnalul de la gef = 4.rezonanţa pentru x>20 indică o vecinătate a ionilor Fe3+ mai uniformă în sticlele bogate în siliciu. Caracteristicile spectrelor RES pentru ionii Fe3+ în probele tratate termic sunt evident modificate aşa cum se poate vedea în Fig.0 este slab evidenţiat iar linia dominantă fiind cea de la gef ≅ 4.3 de compoziţia probelor Pentru probele cu un conţinut mai ridicat de SiO2 (40 ≤ x ≤ 50) şi în cazul cărora a fost identificată prin difracţia de raze X faza cristalină Bi5.4. 456 .6Si0. este caracterizată de un câmp cristalin relativ puternic şi poate fi asociat cu poziţiile fierului în reţeaua necristalină bogată în siliciu. din jurul ionilor Fe3+ responsabili pentru acest semnal.3.

4) ceea ce denotă tendinţa de ordonare structurală în jurul ionilor Fe3+ rezonanţi dispuşi în aceste poziţii.3 x (mol %) 70 60 Intensitate (u.0 este linie rezolvată numai pentru conţinut scăzut de SiO2 . Remarcăm de asemenea că linia se îngustează cu creşterea conţinutului de SiO2 (Fig. 3 Spectrele RES pentru probele vitroceramice Linia cu gef = 2. Luând în considerare razele ionice pentru ionii Bi3+ şi Fe3+ şi starea lor identică de valentă. 4 Dependenţa lărgimii liniei de la g ≅ 2.) 50 40 g = 2.0 de compoziţia probelor 457 .g = 4. până la x = 30 şi este atribuit ionilor Fe3+ situaţi în poziţii cu câmp cristalin slab cu simetrie octaedrală. 160 150 140 ΔB (G) 130 120 110 100 90 10 20 30 x (mol %) Figura. este de aşteptat ca ionii Fe3+ să ocupe poziţiile Bi3+ din faza cristalină Bi12SiO20.0 30 20 10 1000 2000 3000 4000 5000 Camp magnetic (G) Figura.a.

gadoliniul ocupă poziţii in regiuni cvasicristaline în acord cu modificarea difractogramelor acestor probe.Linia de rezonanţă slab rezolvată atribuită ionilor de fier dispuşi în câmp cristalin slab pentru probele vitroceramice cu 40 ≤ x ≤ 50 mol % arată că doar o mică parte dintre ionii de Fe3+ sunt situaţi în poziţiile Bi3+ ale fazei δ (Bi5. 6). 14].0 care reflectă o vecinătate relaxată în matricea amorfă.14 x = 0.8 2.4). odată cu creşterea conţinutului de bismut. Astfel. 10. vecinătatea lor fiind puternic distorsionată [3.33 x = 0.14 spectrele RES ale ionilor de Gd3+ sunt similare şi reflectă o vecinătate relaxată a acestora în matricea amorfă.3 x = 0.9 şi2. 4. cât şi o linie largă la g ≅ 2. 11]. În probele în care se dezvoltă faza cristalină de tipul Bi2SiO5 ( x = 60. 2. vacante de oxigen Spectrele RES înregistrate în cazul microsferelor netratate termic sunt dominate de o linie largă centrată la g ≈ 2.5O9. Ti3+.5 4. dar se observă şi linii mici la ≈ 5.9 2.9 2.3 specifică ionilor de Fe3+ în poziţii cu câmp cristalin intens din matrici necristaline. 70) spectrele RES prezintă atât linia cu g ≅ 4. dacă în probele cu x = 0 şi x = 0.0 x=0 x=0 x = 0.14 x = 0.6Si 0.8 5. Acestea indică faptul că există poziţii în matricea amorfă unde ionii de Gd3+ se află în 458 .0 specifică ionilor din poziţii în câmp cristalin slab dar în vecinătate distorsionată sau între care se manifestă interacţiuni dipolare [15].6Si0. După tratamentul termic la 400oC ionii de gadoliniu ocupă poziţii în interiorul fazei cristaline de tip Bi5.5 1000 2000 3000 4000 5000 B(G) 1000 2000 3000 4000 5000 B(G) Figura 5 Spectrele RES ale probelor preparate prin metoda sol-gel Figura 6 Spectrele RES ale probelor tratate termic 30 minute la 400oC b) Gd3+. Probabil că majoritatea ionilor Fe3+ să fie dispuşi în faza rămasă necristalină bogată în Si [13.5O9.0 5. pe lângă asemenea poziţii.4 (Fig.33 x = 0. 5).8. Exemplul 2: Gd3+ a) Analizele de rezonanţă paramagnetică electronică au pus în evidenţă compoziţii diferite ale ionilor de gadoliniu în probe cu conţinut mai mare de bismut (Fig.

0 din spectrele probelor tratate termic la 350. se modifică în intervalul de temperatură investigat [16]. Se observă şi spectrul în ‘‘U’’ cu linii la g ≈ 5. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g.8. Linia de la g ≈ 4.9. Spectrele RES prezintă o uşoara asimetrie a liniei de rezonanţă (se abat de la o funcţie pur Lorentziană) care poate fi explicată prin prezenţa unei anizotropii uşoare şi/sau a unui fundal de rezonanţă relativ larg de o foarte joasă amplitudine.câmp intermediar. g ≈ 2. Prin aplicarea tratamentului termic. iar celălalt atom de Ti se relaxează într-o configuraţie planar trigonală.3 este atribuită fierului (III) şi apare datorită tuburilor de sticlă în care se pune proba pentru a efectua măsurătoarea RES. În timp ce atomul de O difuzează el generează doi atomi de titan cu configuraţie incomplete. 459 . Lărgimea liniei spectrelor RES. Modificările structurale induse în probele titano-silicatice amorfe prin tratamentele termice sunt bine puse în evidenţă în spectrele RES ale probelor parţial şi total cristaline (Fig. 700 şi 900°C ne indică că ionii de Gd3+ sunt preponderent dispuşi în faza reziduală necristalină. legaţi anterior de atomul de oxigen. care creşte în intensitate odată cu creşterea temperaturii de tratament. specific matricelor policristaline dezordonate care conţin ioni de Gd3+ destul de omogen distribuiţi. la g ∼ 2. rezultat în urma relaxării structurale dar încă cu un grad mare de dezordine în jurul lor. Linia largă de la g ≈ 2. Unul dintre aceşti atomi de Ti captează un electron şi rămâne în configuraţia tetraedrală. oxigenul difuzează din interior spre suprafaţă şi se formează în regiunea de sub-suprafaţă vacante de oxigen. în câmp cristalin slab. care reflectă în mod direct schimbările în rata de relaxare spin-reţea şi cel mai important în dinamica medie a anizotropiei factorului g. Lărgimea liniei de la g ≈ 2. Spectrele RES pentru microsferele tratate termic în intervalul 350 – 1400°C sunt caracterizate printr-un semnal îngust. În conformitate cu Kolodiazhnyi şi Petric am atribuit aceste linii vacanţelor de oxigen la titan (VTi) cu spin electronic neîmperecheat.0. în timp ce titaniul difuzează de la suprafaţă spre interior.0 din spectrele RES. se modifică în intervalul de temperatură investigat. g ≈ 2. suprapus peste componenta spectrală. unde se formează ionii de Ti3+. 7-14).

utilizând un baleiaj de (a) 4000 G.98 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 11 Spectrele RES ale microsferelor tratate termic la 1100°C. Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 9 Spectrele RES ale microsferelor tratate termic la 700°C.98 Ti:Si 1:2 Ti:Si 1:2 2.3 Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 1000 2000 3000 B(G) 4000 5000 Figura 7 Spectrele RES ale microsferelor preparate prin metoda sol gel.004 1. (a) (b) 2. 460 .9 4. 30 minute. 30 minute. 30 minute.2. (b) 600 G. Figura 10 Spectrele RES ale microsferelor tratate termic la 900°C.0 5.8 2. 30 minute.004 1. Figura 8 Spectrele RES ale microsferelor tratate termic la 350°C.

utilizand un baleaj de (a) 4000 G si respectiv (b) 600 G.18]. Spectrele RES ale probelor tratate termic la 1400°C sunt caracterizate doar prin semnalul din jurul valorii g∼1.98. (b) 2.004 1. (a) o 1400 C 1100oC o 900 C 700oC o 350 C as-prep. utilizând un baleiaj de (a) 4000 G şi respectiv (b) 600 G. (a) o 1400 C o 1100 C o 900 C o 700 C o 350 C (b) 2. 30 minutes. utilizand un balaj de (a) 4000 G.004 1. (b) 600 G. dar au mai fost detectaţi în literatura de specialitate [19] la temperatura camerei. Centrii de Ti3+ sunt de obicei detectaţi la temperaturi sub 120K [17. neexistând vacanţe de O din cauza atmosferei reducătoare. atribuit ionilor de Ti3+.98 o 1400 C o 1100 C o 900 C o 700 C as-prep. 461 .98 1400oC 1100oC 900oC 700oC 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 13 Spectrele RES ale sistemului Ti:Si 1:2 preparate prin metoda sol gel si supuse diferitelor tratamente termice.(a) (b) Ti:Si 1:2 Ti:Si 1:2 Ti:Si 1:1 Ti:Si 1:1 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 12 Spectrele RES ale microsferelor tratate termic la 1400°C. 1000 2000 3000 B(G) 4000 5000 3000 3200 3400 B(G) 3600 3800 Figura 14 Spectrele RES ale sistemului Ti:Si 1:1 preparate prin metoda sol gel şi supuse diferitelor tratamente termice.

004 detectat pe plasma de TiO2 tratată termic provine de la un electron captat la o vacanţă de oxigen. Spectrele RES evidenţiază integrarea ionilor de Ti3+ în această fază. Serwicka [21] a observat un astfel de semnal la g∼2. Acest studiu este focusat în special pe efectul adiţiei oxidului de galiu în sisteme. Figura 16 Spectrele RES ale microsferelor tatate termic la 350°C. după ce au fost folosite în teste fotocatalitice. 900 si 1100°C.Din spectrele RES prezentate în Fig. În cazul microsferelor tratate termic la 350. în concordanţă cu difracţiile de raze X. Ga2TiO5. 700. cât şi de către Feng şi col. deoarece evoluţia defectelor: vacanţe de oxigen (g∼2. cât si în TiO2 dopat cu B [25].003 – 2.004) si Ti3+ (pentru g∼1. În cazul microsferelor preparate prin metoda sol gel. ambele sisteme având o dependenţă oarecum similară în raport cu tratamentul termic. 462 . Nakamura şi col.0055 în spectrele RES în probe de titan dopat cu C. peak-ul de la g∼2. semnalul RES provine numai de la ionii de Gd3+.98) este similară cu cea discutată anterior. Vor fi prezentate doar spectrele RES ale sistemului Ti:Si 1:2. Pentru microsferele tratate termic la 1100°C si 1400°C se observă efectul galiului în sensul prevenţiei formării vacanţelor de oxigen. iar Serpone [27] a atribuit semnalele din intervalul g = 2.13.003 pe TiO2 redus în vid şi l-a atribuit unui defect. Au mai fost raportate astfel de semnale RES de către Li şi col. În cazul microsferelor cu conţinut de galiu se dezvoltă după tratamentul termic la 1400°C o nouă faza. [22] la g∼2.005 unui electron captat la o vacanţă de oxigen. [26] în probe de TiO2 dopat cu N.004 poate fi atribuit vacanţelor de oxigen. în bună concordanţă cu literatura de specialitate şi rezultatele obţinute prin spectroscopie Raman unde a fost obţinut un semnal de fluorescenţă în cazul probelor tratate termic până la temperatura de 900°C. Semnale similare au fost observate şi în TiO2 – anatase dopate cu C [22-24]. în urma tratamentelor termice.98). deoarece sistemul Ti:Si 1:1 nu prezintă modificări esenţiale. În Figurile 13 si 14 sunt evidenţiate evoluţiile vacanţelor de oxigen (pentru g∼2. 14 se observă faptul că tratamentul termic joacă un rol important în formarea de centrii paramagnetici adiţionali. [20] au raportat faptul că semnalul RES la g∼2. cel mai probabil un electron captat la o vacanţă de oxigen.004) şi Ti3+ (g∼1. Ga2O3 Ga2O3 20% 10% 5% 1% 0% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 1000 2000 3000 4000 5000 B(G) B(G) Figura 15 Spectrele RES ale microsferelor preparate prin metoda sol gel.

utilizand un baleaj de (a) 4000 G. Ga2O3 (a) Ga2O3 (b) 20% 10% 5% 1% 20% 10% 5% 1% 0% 1000 2000 3000 4000 5000 0% 3000 3200 3400 3600 3800 B(G) B(G) Figura 19 Spectrele RES ale microsferelor tatate termic la 1100°C.Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 5% 10% 5% 1% 0% 1% 0% 3000 3200 3400 3600 3800 1000 2000 3000 4000 5000 B(G) B(G) Figura 17 Spectrele RES ale microsferelor tatate termic la 700°C. (b) 600 G. utilizand un baleaj de (a) 4000 G. 463 . utilizand un baleaj de (a) 4000 G. Ga2O3 (a) 20% (b) 20% 10% 10% 5% 5% 1% 0% 1000 2000 3000 4000 5000 1% 0% Ga2O3 3000 3200 3400 3600 3800 B(G) B(G) Figura 18 Spectrele RES ale microsferelor tatate termic la 900°C. (b) 600 G. (b) 600 G.

Ga2O3 (a) Ga2O3 (b) 20% 20% 10% 10% 5% 5% 1% 1% 0% 0% 1000 2000 3000 4000 5000 3000 3200 3400 3600 3800 B(G) B(G) Figura 20 Spectrele RES ale microsferelor tatate termic la 1400°C.5% mol Gd2O3). fiind mult mai grupată pentru probele cu raportul Si/Ge 1:2 şi 1:3. unde efectul interacţiunii de schimb este clar evidenţiat [33]. în funcţie de compoziţia matricii şi este utilă în caracterizarea locurilor în care s-ar putea distribuii alte pământuri rare neparamagnetice.0 fapt ce denotă că vecinătatea ionilor de Gd3+ se confruntă cu câmpuri cristaline slabe. (b) 600 G. considerând că gadoliniu ar fi distribuit omogen în întregul volum de probă. distanţa medie dintre ionii de gadoliniu este mai mică decât în cazul distribuţiei uniforme în întregul volum şi se confruntă cu interacţiuni magnetice puternice. sprijină ipoteza distribuţiei sale pe suprafaţa nanoparticulelor. Liniile largi preconizate pentru o concentraţie atât de scăzută (0. Această lărgire a liniei de rezonanţă este în mod normal atribuită interacţiunii dipol-dipol dintre ionii de Gd3+. Prezenţa în probe a ionilor de Gd3+ ne dă informaţii cu privire la modificările structurale care au loc în vecinătatea lor. 464 . în funcţie de compoziţia probelor. arată că această distribuţie pe suprafaţa nanoparticulelor nu este uniformă. introduse în aceeaşi matrice. ceea ce înseamnă că aceştia nu sunt incluşi în reţeaua silicatică sau germanată unde au avut o vecinătate mult mai distorsionată [28]. Spectrele RES ale probelor investigate sunt prezentate în figura 21. c) Gd3+ Prin rezonanţa paramagnetică electronică a fost investigată ordinea structurală din jurul ionilor de Gd3+ si interacţiunea magnetică dintre ei. Spectrele constau din linii relativ largi cu g = 2. dar şi dezordinii locale [29-32]. utilizand un baleaj de (a) 4000 G. Diferenţele observate în forma liniilor. În acest caz.

Bull. 2001. Nguyen. M. 14. C. Coldea. S. Vol. 11.S. M. D. 22. Witkowska. Kisch. Chem. 67 (1994) 156 S.J. Anpo. Simon. G.M. Chem. Mater. M. Ed. Phys. 10. 9 (2007). Todea. Ioncu. S. 90. 465 . Japan 59 (1986) 259. Li. Solids. P. A. Phys. Kutsuna. (1965) Al. Rezonanţa electronică de spin. M. Bibliografie: 1.P. A. 16. Negishi. P. Sakthivel. Kodama. Spectrele RES ale probelor aparţinând sistemului 0. 10-13 September 2001 T. Todea. E. C. Stößer. H. Beziade. 8.H. 10 (2001) 5296 Pan.. Guskos. F. Y. Nicula. Forbess. Sept.H. Gdańsk – Poland. Kokorin. Adv. V. J. T. C. 9. Simon. M. Glastechn. 18. O. S. 32 (1960) 668d Y. Zinsou. Simon. 10. 3 (2000) 1503 I. Mol. Biedunkiewicz. Solids. Sci. Lips. D. Glass Sci. Ardelean. Colloids Surf. J. A. Japan. 99 (1955) 1222 R. Y. 6. Bissey. Catal. A: Chem. Phys. A. Pop. J.S. 7. 23 (2010) 189-195. Todea. 17. Guskos. Castner. Ber. 12. Editura Didactică şi Pedagogică. Solids 180 (1995) 151 T. Optoelectronics and Advanced Materials. Schlichter. Nanba. P. Appl. 947-949(3). A. J. Yabuta. 20. Ihara. E. Y. Optoelectronics and Advanced Materials. P-10-011 R. Hwang. 27Oct. A. 4. S. DiCicco. V. 97. (1993). Thurnauer. S. Peteanu. Technol. J.. Volume 20. Phys. 112. Newell. 352 (2006) 2947. Miura.Figura. Journal of Materials Science Letters. Non-Cryst.C. 6-thInternational Conference on Intermolecular Interactions în Matter. 3336 – 3340. J. A. I. Soc. E. Number 10. Kliava. 12 (2008). Figiel. M. N. C. Chem. S. 404 (2005) 25–29.Ursu. N. I. 15. Tokyo. Proceedings of XX Int. Bucureşti. I. Karkas. Seraji. W. Cromack. N. 3.K. Anagnostakis. H. Y. Sands. M. J. Ciorcas. J. J.995[(1−x)SiO2·xGeO2] 4.-C. 21. Nakamura. Simon. K. M. S. Berger. Cao. Rev. Serwicka. Kim.P. S. J. M. 5. Non-Cryst. Limmer. Sugihara. V. Academiei R. Zolnierkiewicz. Lee. T. A . Congress. Phys. M. Chou. E. No.005Gd2O3·0. Simon. 13. Tabuchi. Typek. R. K. G. 1. Chimia 12 (2007) 61. Lett.. Trifunac. S. Rybicki. 13 (1985) 287–293. K. J. 2. Phys. S. 19. Zhang. I. Yahiaoui. J. Rev. J.România. Rezonanţa magnetică. Holton. Takeuchi. K.. R. 621-624. Glass. Non-Cryst. Simon. Simon.S. 2004.Konstantiniva. Ghosh. 61-64 (1980) A. Wu. V. A. 21. Kubokawa. 7277. Chem. 161 (2000) 205–212.J. Micic. Notz. 331 (2003) 1 R.J. Chem. J.

Petrovskii. Y. Y. Phys. Malakhovskii. R. V. Malakhovskii. S. Z. Adv. Mag.F. I. I. Raftery. Edelman. T. R. Wang. Gombac. Mater. Phys. N. Rogatis. N. 8 (2006) 99–101. J. Simon. J. Magn. Phys. S.M. V. T. 32. Inorg. 30. Potseluyko. P. Zarubina. I. E. Fornasiero. Bruckental. T. Chem. Yeshurun. Kliava. Phys. Zarubina. P. S. Bruckental. Y. Y. Montini. Potseluyko. 116 (2000) 83–86. Acta 361 (2008) 3980–3987. 33. Simon. Serpone. E. Kliava. Chim. E. C 113 (2009) 15110–15123. R. Gasparotto. Z. Bratu. J. Gombac. I. 272–276 (2004) 1647–1649.V. Ardelean. S. Petrakovskaja. Edelman. Cosma. Matter 15 (2003) 6671–6681. Simon. Berger. Kuznetsov. Edelman. J. Yeshurun. 29. I. Chem. Mater. Barreca. Solid State Commun. J. Reson. New J.V. Kliava. Materials Science and Engineering B 172 (2010) 68–71 466 . A. Fornasiero.S.23. Graziani. Montini. B 71 (2005) 104406. 31. Zhang. Potseluyko. Z. 35 (2009) 74–81. J. 339 (2007) 111–123. Tondello. A. K. E. Graziani. A. I. Y.A. Zarubina. S. M. Melnikova. Balducci. V.V. Jin. T. Wu. Zhang. L. Turcu. A. 26. J. I. A. T. R. 27. S. D. Filip. Yeshurun. Y. A. Vicario. Chem. Feng. Garcia. Zhang. Solid State Nucl. Diana-Louisa Trandafir. I. A. J. D. Rev. D. G. Sun. Petrakovskaja.: Condens. R. Gil. Magn. M. G. Malakhovskii. M. Optoelectr. Petrakovskaja. Bruckental. Fittipaldi. 32 (2008) 1038–1046. 24. G. C. E. 28. R. 25. A. Berger.

......................................... 467 .................. 471 4................ 474 6........................................................... * voltametrie ciclică (CV).................. testarea şi verificarea protocoalelor de practică experimentală pentru echipamente de investigare prin metode electrochimice Conf..... 488 1........ METODE ELECTROCHIMICE Elaborarea..Voltametrie cu baleiaj liniar de potenţial (LSV) În voltametria cu baleiaj liniar de potenţial (LSV)......................... Bibliografie ......... Introducere ......................... de obicei..... dr....... de la o limită inferioară la o limită superioară a potenţialului........................ aşa cum se arată in figura 1...................................... există două tipuri de metode voltametrice: * voltametrie cu baleiaj liniar de potenţial (LSV)................... În principal.................................... Voltametria ciclică (sau CV) .................... 467 3..... 467 2........ Una dintre aceste metode este voltametria..................... potenţialul este baleiat într-un domeniu fix de potenţial cu o viteză constantă....... 2..... în care curnetul este măsurat ca o funcţie de potenţialul aplicat şi este utilizată la studiul cineticii reacţiei de transfer de electroni şi proprietăţile de transport ale reacţiilor...... Voltametria ciclică cu un cuplu redox activ... ing....... Graziella Liana Turdean Cuprins 1.........XIII................... Introducere Metodele electrochimice moderne oferă chimistului electroanalist o varietate de tehnici pentru a rezolva problemele analitice........................................... Voltametrie cu baleiaj liniar de potenţial (LSV) .................................. Voltametria ciclică fără cuplu redox activ.......... 474 5........................

Prin urmare. cum ar fi: * viteza reacţiei de transfer de electroni.Figura 1. * reactivitatea chimică a speciilor electroactive. Dacă avem în vedere reducerea electrochimica a Fe3+ la Fe2+. (1) Presupunem că scanarea începe din partea stângă a graficului curent/potenţial. Pentru a înţelege acest comportament. Exemplu: Rezultatul măsurătorilor de LSV este rRESezentarea grafică a curentului obţinut versus potenţialul baleiat cu o viteză constantă. la suprafaţa electrodului se stabileşte un echilibru identic cu cel prezis de termodinamică. trebuie să se ia în considerare influenţa potenţialului asupra echilibrului stabilit la suprafaţa electrodului. Caracteristicile voltamogramei înregistrate (figura 2) depind de o serie de factori. eventual. În echilibrul electrochimic. * viteza de baleiaj a potenţialului. începe să apară un curent care. În mod clar prin schimbarea timpului necesar pentru a baleia domeniul de potenţial se modifică viteza de baleiaj (scanare). conform ecuaţiei 2: 468 . Viteza de scanare (v) se calculează din panta dreptei din figura 1. Forma semnalului de excitare în voltametria cu baleiaj liniar de potenţial. unde E este diferenţa de potenţial aplicat şi Eo este potenţial standard de electrod. Când potenţialul este baleiat spre dreapta (spre valori de reducere). unda aparută se datorează reacţiei 1. Figura 2. unde iniţial nu este curent. Voltamograma cu baleiaj liniar de potenţial. ecuaţia lui Nernst este cea care prezice relaţia dintre concentraţie şi potenţial (diferenţă de potenţial). poate atinge şi un maxim înainte să scadă. viteza reacţiei de transfer de electroni este mai rapidă în comparaţie cu viteza de baleiaj a potenţialului. Pentru sistemul Fe3+/Fe2+.

conform ecuaţiilor 3: (3) Aşa cum curentul creşte cu potentialul. Figura 3. alura voltamogramei se modifică şi ea (Figura 3). Forma exactă a voltamogramei poate fi înţeleasă prin luarea în considerare şi a efectelor potenţialului şi transportului în masă. apare un curent. În această situaţie curentul începe să scadă.(2) Deci. datorită dimensiunilor stratului de difuzie şi a 469 . Fiecare curbă are aceeaşi formă. Peak-ul (vârful. echilibrul la suprafaţa electrodului începe să se modifice şi. scăderea curentului urmează acelaşi comportament ca şi cel estimat prin ecuaţia Cottrell. În cazul în care se modifică viteza de baleiaj. maximul) apare deoarece la un moment dat stratul de difuzie a crescut suficient încât fluxul de reactant la electrod nu este suficient de rapid pentru a satisface cerinţele impuse de ecuaţia lui Nernst. poziţia de echilibru se deplasează continuu în sensul conversiei reactantului. ca urmare. când potenţialul este baleiat de la valoarea V1 la V2. De fapt. dar este evident că curentul creşte cu creşterea vitezei de baleiaj. Când potenţialul este baleiat de la valoarea iniţiala V1. Influenţa vitezei de baleiaj asupra voltamogramelor cu baleiaj liniar de potenţial. poziţia de echilibru se modifică de la nici o conversie (la V1) la conversia completă (la V2) a reactantului la suprafaţa electrodului.

Prin urmare. În consecinţă. Aceste procese rapide sunt adesea menţionate ca reacţii reversibile de transfer de electroni. faţă de cele de la viteze de baleiaj mari. Conditii experimentale: viteza de baleiaj identica. prin urmare. În consecinţă. Pentru aceste cazuri. O altă observaţie este poziţia curentului de peak: este clar că peak-ul apare la aceeaşi valoare de potenţial (figura 3) şi aceasta este o caracteristică a reacţiilor de electrod. pentru diferite constante ale vitezei reactiei de reducere. deoarece 470 . potenţialul aplicat nu va duce la generarea concentraţiilor la suprafaţa electrodului conform estimărilor din ecuaţia Nernst. stratul de difuzie va creşte mai mult în comparaţie cu cazul în care viteza de scanare este mare. Cum mărimea curentului este proporţională cu fluxul spre electrod. Figura 4. În aceast caz. voltamograma se va obţine mai încet. cu cât viteza de baleiaj este mai mică. La o viteză de baleiaj mică. valoarea curentului va fi mai mică la valori mici ale vitezei de baleiaj. fluxul de la suprafaţa electrodului este considerabil mai mic la viteze de baleiaj mici. timpul necesar pentru a înregistra o voltamogramă) influenţează puternic comportamentele observate. În mod clar. grosimea stratului de difuzie de la suprafaţa electrodului va fi diferită în funcţie de viteza de baleiaj folosită. Figura 4 arată o serie de voltamograme înregistrate la o singură viteză de baleiaj pentru diferite valori ale constantei vitezei reacţiei de reducere (kred). Acest lucru evidenţiază un punct important atunci când se examinează LSV (şi CV): deşi nu există o axă a timpului pe grafic.timpului necesar pentru a înregistra voltamograma. se poate formula întrebarea referitoare la ce s-ar întâmpla în cazul în care procesele de transfer de electroni au fost "lente" (în raport cu viteza de baleiaj a potenţialului). viteza de balaiaj a potenţialului (şi. Voltamograma cu baleiaj liniar de potential. care au o cinetică rapidă de transfer de electroni. reacţiile sunt menţionate ca reacţii cvasi-reversibile sau ireversibile de transfer de electroni.

atunci când potenţialul aplicat este invers. de asemenea. din astfel de experimente se obţin informaţii despre potenţialul redox şi despre vitezele reacţiilor electrochimice. astfel. dar apoi va scădea deoarece concentraţia analitului se va epuiza în vecinătatea suprafeţei electrodului. De obicei. poziţia curentului de peak/maxim se schimbă în funcţie de constanta vitezei de reducere (şi. Curentul va creşte pe măsură ce potenţialul atinge potenţialul de oxidare a analitului. atunci curentul de peak 471 . potenţialul de electrod este baleiat liniar faţă de timp (figura 5). Spre deosebire de voltametria cu baleiaj linear. Dacă transferul de electroni la suprafaţă este rapid şi curentul este limitat de difuzia speciilor spre suprafaţa electrodului. pentru a studia proprietăţile electrochimice ale unui analit într-o soluţie. de viteza de baleiaj a potenţialului). potenţialul electrodului de lucru este baleiat liniar în funcţie de timp. Potenţialul este măsurat între electrodul de referinţă şi electrodul de lucru. deşi potenţialul este baleiat tot între două valori (V1 şi V2). care se încheie atunci când se ajunge la un potenţial stabilit (V2). se va ajunge la potenţialul la care se va reduce produsul format în prima reacţie de oxidare şi se va produce un curent de polaritate inversă faţă de scanarea directă. Voltametria ciclică este folosită. După cum se observă în voltamograma din figura 6. Ca urmare. în scanarea în sens direct se obţine un curent de peak pentru orice specie care poate fi oxidată în domeniul de potenţial baleiat. dar spre deosebire de reacţia reversibilă. iar curentul este măsurat între electrodul de lucru şi electrodul auxiliar. Voltamograma ciclică obţinută este rRESezentarea grafică a curentul obţinut la electrodul de lucru (i) faţă de potenţialul aplicat (E). echilibrele nu sunt stabilite rapid (în comparaţie cu viteza de baleiaj). În această situaţie. iar potenţialul este baleiat înapoi la V1. Într-un experiment de voltametrie ciclică. panta dreptei fiind cunoscută ca viteza de baleiaj (v [V/s]). 3. Acesta are loc deoarece curentul apare mai încet decât în cazurile reversibile. când potenţialul atinge V2 sensul de baleiaj este inversat. ca şi în cazul voltametriei liniare.Voltametria ciclică (sau CV) Este metoda electrochimică potenţiodinamică foarte similară cu LSV. Această inversare se poate produce de mai multe ori în timpul unui singur experiment. în general.cinetica de reacţie este "lentă" şi. În cazul în care cuplul redox este reversibil. peak-ul de reducere va avea o formă similară cu peak-ul de oxidare. În voltametrie ciclică. forma generală a voltamogramei înregistrate este similară cu cea de mai sus. în cazul CV.

Figura 5. Curentul apare din nou datorită speciilor din soluţie care difuzează spre electrod şi are sens invers decât procesul din prima etapă. În soluţie. este prezentată în figura 6. aşa cum se arată în figura 8. înregistrată pentru o reacţie reversibilă monoelectronică. Curentul de la suprafaţă este generat prin transferul de electroni de la electrod la speciile redox.(vârf) va fi proporţional cu rădăcina pătrată a vitezei de scanare. la potenţialul de interes? Răspunsul este că un curent tranzitoriu poate circula deoarece interfaţa electrod-soluţie se va comporta ca un condensator. convertind produsul (Fe2+) înapoi la reactant (Fe3+). Când sensul de baleiaj este inversat. ionii se mişcă spre suprafaţa electrodului pentru a forma un strat dublu electric. Se pune întrebarea dacă un curent poate apărea dacă nu există nici o specie în soluţia care poate transfera electroni la suprafaţă electrodului. Reacţia de electrod şi capacitatea electrodului Figura 7 descrie procesul care are loc în reacţii de electrod simple. În cazul reducerii. Voltamograma ciclică pentru un rectant participând la o reacţie monoelectronică de transfer de electroni. în absenţa unui cuplu redox nu este un condensator cu plăci paralele pur. iar pentru descrierea sistemelor electrochimice se preferă acest model 472 . specia (Ox) capabilă de a primi un electron de la electrod difuzează spre suprafaţă. O voltamogramă ciclică tipică. Semnalul de excitare în cazul voltametriei ciclice. ci se comportă mai degrabă ca şi cum ar fi. poziţia echilibrului se modifică în sens invers. curentul este transportat prin migraţia ionilor. O interfaţă electrod-soluţie. Când potenţialul electrodului este variat. Această relaţie este descrisă de ecuaţia Cottrell. Răspunsul la baleiajul în sens direct este identic cu cel de la LSV. primeşte un electron şi difuzează de la suprafaţă. Figura 6.

Figura 8. pentru un condensator cu plăci paralele. Cea mai simplă descriere a capacităţii electrochimice este dată de modelul Helmholtz: C εε 0 = A (5) unde: ε este constantă dielectrică a materialului de separare a plăcilor. Sistem electrochimic care include transferul de electroni şi circuitul echivalent corespunzător.care permite să se înţeleagă comportamentul electrozilor în absenţa unui cuplu redox. Figura 7. εo este permitivitatea spaţiului liber. sarcina condensatorului (Q) este proporţională cu căderea de tensiune în condensator (E): Q=CE (4) Constanta de proporţionalitate C este capacitatea mediului. Schema stratului dublu electric. Capacitatea este un factor esenţial în experimentele electrochimice pentru că dă naştere la un curent în timpul de încărcare al condensatorului. Destul de logic (şi fără imaginaţie). cât şi de electrolitul suport. numim această mărime curent de încărcare. Acest model nu descrie în mod adecvat toate interfeţele electrochimice dacă capacitatea depinde atât de potenţial. Astfel. iar A este aria de electrod. Pentru a calcula mărimea acestui curent. se diferenţiază ecuaţia (1) în raport cu t şi presupune că capacitatea este o mărime constantă: dQ dE =C dt dt (6) 473 . ℓ este distanţa de separare între plăcile paralele.

curentul îşi schimbă semnul. La inversarea vitezei de scanare. care se menţine atât cât se menţine variaţia de potenţial. Experiment de voltametrie ciclică. Astfel. puterea reală a acestei tehnici constă în capacitatea sa de a investiga mecanismul reacţiei de electrod. iar când se opreşte scanarea. se vor folosi condiţii în care curentul capacitiv este mic în comparaţie cu curentul de transfer de electroni (denumit curent faradaic). 4. şi se aplică semnalul de excitare a potenţialului având forma din figura 9a. Voltametria ciclică cu un cuplu redox activ Deşi curenţii capacitivi în voltametrie ciclică sunt o realitate. în care nu este prezent nici un cuplu redox activ (experimentul prezentat în figura 9). curentul revine la zero.Identificând dQ/dt ca o expresie a curentului şi dE/dt cu viteza de baleiaj a potenţialului (v). se obţine: I = C*v (7) Prin această derivare simplă. atunci acest curent este singurul care va fi observat. se poate determina capacitatea sistemului. Curentul atinge o stare de echilibru. în absenţa speciei redox active. atunci când se aplică o treaptă de potenţial. Figura 9. Curentul faradaic depinde de doi factori: cinetica transferului de electroni şi viteza la care specia redox difuzează spre suprafaţa electrodului. prin măsurarea curentului de încărcare la o anumită viteză de scanare. se obţine o expresie pentru curentul de încărcare în stare staţionară. De obicei. 474 . Dacă nu există nici o posibilitate de transfer de electroni între soluţie şi electrod (nu există un cuplu redox). voltamograma obţinută are forma din figura 9b. Voltametria ciclică fără cuplu redox activ Dacă se consideră cazul foarte simplu al voltametriei ciclice. 5. Rezultatul excitării sistemului este o creştere bruscă a curentului din cauza schimbării bruşte a vitezei de scanare (ν).

706 şi Anal. Dacă presupunem că concentraţiile de la suprafaţa electrodului sunt reglementate prin ecuaţia lui Nernst. 36. curentul i care este măsurat când potenţialul scade va fi direct proporţional cu fluxul speciilor oxidate care difuzează spre suprafaţa electrodului. conform ecuaţiei 10. cu cât este mai mare gradientul de concentraţie.0592 log 4− [Fe(CN)6 ] − [Fe(CN)3 6 ] unde: E este potenţialul aplicat şi E0’ este potenţialul formal de electrod. aşa că se presupune că la suprafeţele electrodului. concentraţiile de Fe(CN)63.Pentru cuplul redox Fe(CN)63-/4-. Se poate observa că. x este distanţa de la suprafaţa electrodului. 1965. Interpretări calitative. εo’ = 0. Presupunând că viteza de transfer de electroni este foarte rapidă. rRESoducerea fidelă a voltamogramei cuplului Fe(CN)63-/4(figura 6) necesită o soluţie analitică la două ecuaţii diferenţiale. C* este concentraţia de specie oxidată în volumul soluţiei.+ 1 e. cu atât este mai mare curentul catodic. cu atât este mai mare fluxul J şi. După cum se observă din ecuaţia 11.. care participă la reacţia 8 a cărei cinetică de transfer de electroni este destul de rapidă.respectă ecuaţia lui Nernst 9: Fe (CN)6 3. 1964..→ Fe(CN)6 4. (dC/dx)x=0 este gradientul de concentraţie la suprafaţa electrodului. conform ecuaţiei 10: i=nFAJ Fluxul este guvernat de legea lui Fick: (10) (C * −C x = 0 ) ⎛ dC ⎞ ≅D J = −D ⎜ ⎟ Δx ⎝ dx ⎠ x = 0 (11) unde: D este coeficientul de difuzie a speciilor. Chem.şi Fe(CN)64. ENH (8) (9) E = E o' − 0. şi Cx=0 este concentraţia sa la suprafaţa electrodului. 1351).trebuie să scadă la suprafaţa electrodului. (Detalii cu privire la simulări în voltametria ciclică pot fi găsite în Anal. 475 . Chem. concentraţia de Fe(CN)63. 37.356 V vs. prin urmare. deoarece potenţialul aplicat devine mai negativ. Chiar şi în cazul asumării comportamentului nernstian. concentraţia de specii oxidate la suprafaţă va scădea odată cu negativarea potenţialului. prin reacţia de reducere la Fe(CN)64-.

Dacă se va continua negativarea potenţialului. 476 . Profilul de concentraţie la diferite momente de timp. concentraţia speciilor oxidate la suprafaţa electrodului va tinde spre zero. dar concentraţia de suprafaţă începând să crească. Alura voltamogramei ciclice pentru o reacţie electrochimică nernstiană. Toate acestea vor duce la obţinerea unei curbe curent-potenţial care are forma din figura 11.Schimbarea gradientului de concentraţie pentru regiunea catodică din voltamograma ciclică este prezentată în figura 10. încă mai există un strat epuizat de specie oxidată. Parametrii electrochimici caracteristici. cu cât epuizarea stratului de specie redusă va creşte. astfel încât în conformitate cu legea de difuzie a lui Fick (ec. Apoi sistemul va trece prin intermediul profilelor de concentraţie similare pentru speciile reduse. curentul catodic vor fi mai mari. vom ajunge la o regiune unde curentul anodic începe să domine (figura 11). În acelaşi timp. În cele din urmă. cu atât va scădea fluxul spre suprafaţa electrodului şi curentul va începe să scadă. fluxul spre suprafaţă şi. concentraţia speciei oxidate se epuizează la suprafaţă. 11). Dacă se inversează potenţialul de scanare (nu este arătat în figura 10). în cadrul experimentului de CV (numai baleiaj negativ). Cu cât scade gradientul de concentraţie. Figura 11. prin urmare. faza de volum a soluţiei care este epuizată în specia oxidată va creşte şi gradientul de concentraţie va începe să scadă. Înainte ca un potenţial să fie aplicat la electrod (t = 0). iar soluţia are concentraţia uniformă din faza de volum C*. În momentul în care se aplică un potenţial. Această concentraţie mai mică la suprafaţă dă un gradient de concentraţie mai mare (cel puţin iniţial). Se va obţine un curent de peak negativ şi apoi curentul va scădea în amplitudine. Figura 10. curentul va scădea în continuare. nu există nici un gradient de concentraţie.

n este numărul de electroni transferaţi.Caracterizarea Aceasta a fost o descriere foarte calitativă a voltametriei ciclice. Separarea potenţialului de peak ΔEp (= Epc . O descriere teoretică a suprapotenţialului de polarizare este inclusă în ecuaţia Butler-Volmer şi ecuaţia Cottrell. Următorii parametrii sunt folosiţi pentru a caracteriza voltamograma ciclică a unui proces reversibil: a. conform reacţiei 12: Ox + e- → Red (12) Toate voltamogramele reversibile arată la fel şi au forma tipică indicată în figura 11. Curentul de peak într-o voltamogramă ciclică care conţine o singură specie este descrisă de ecuaţia Randles-Sevcik (ec. Un peak reversibil se obţine atunci când un analit este redus sau este oxidat pe un sens al baleiajului de potenţial şi apoi este reoxidat sau redus pe sensul invers al baleiajului. este foarte de dorit ca analitul să prezinte peak-uri reversibile. De asemenea. D este coeficientul de difuzie (în cm2 s-1). Simulările cantitative arată mai multe aspecte pentru un sistem nernstian. Analitul trebuie să fie o specie redox în domeniul de potenţial experimentat. În 1964. procesul redox este numit reversibil (echilibru impune ca concentraţiile de suprafaţă de Ox şi Red să fie menţinute la valorile prezise prin ecuaţia Nernst). la 25 oC. la 25 °C: ip = (2. v este viteza de baleiaj (în V/s) şi C* este concentraţia în faza de volum a speciei (în mol/cm3).Epa) = 59/n [mV]. Chiar şi cuplurile reversibile conţin suprapotenţiale de polarizare şi astfel prezintă o histereză între potenţialul absolut de reducere (Epc) şi de oxidare (Epa). Proces redox reversibil Utilitatea voltametriei ciclice este foarte dependentă de analitul studiat. 13). Parametrii importanţi pentru o voltamogramă ciclică sunt potenţialele de vârf (Ep ) şi curenţii de vârf (ip). la toate vitezele de scanare. Este foarte dificil pentru a atinge o sepa477 . care se cuantifică conform figurii 11.687 *105) n3/2 A D1/2 v1/2 C* (13) unde: ip este curentul de peak (în A). Acest suprapotenţial reiese dintr-o combinaţie a vitezelor de difuzie a analitului şi bariera intrinsecă de activare a transferului de electroni de la electrod la analit. Dacă un sistem redox rămâne în echilibru pe întreg domneiul de potenţial scanat. A este aria electrodului (în cm2). Nicholson şi Shain au efectuat simulări cantitative ale voltametriei care au dus la schimbări majore în domeniul electrochimiei.

Aceasta este o funcţie de pregătire a electrozilor. Figura 12. c. d. Acest raport poate fi perturbat pentru cuplurile reversibile în prezenţa unei reacţii chimice. ca funcţie de grosimea stratului de difuzie. (Se consideră o valoare mulţumitoare aceea de 70 mV.5/n [mV] la 25 °C. Curenţii de peak (ip) sunt proporţionali cu rădăcina pătrată a vitezei de scanare (v). Atunci când se obţin peak-uri reversibile. 478 . unde: n este numărul de electroni transferaţi. b. Influenţa vitezei de baleiaj asupra voltamogramelor ciclice ale unui cuplu redox monoelectronic reversibil. Influenţa vitezei de scanare asupra curentului pentru un transfer de electroni reversibil. Raportul curenţilor de peak este unitar (ipa/ipc = 1) la toate vitezele de scanare. Poziţia potenţialului de peak nu se modifică cu viteza de scanare. În cazul în care valorile constantelor de difuzie pentru speciile oxidate şi reduse sunt similare. (Ep/2). Voltamograma pentru o reacţie cvasi-reversibilă pentru diferite valori ale constantelor vitezelor de reducere şi de oxidare. cum ar fi: potenţialul de semi-undă (E01/2). în experimentele de stripare sau în prezenţa unui fenomen de nucleaţie. se pot determina informaţii termodinamice. Procese redox cvasi-reversibile Pentru sistemele cvasi-reversibile (cu 10-1> k °> 10-5 cm/s). funcţia ip/v1/2 este independentă de v. Figura 13. f. valoarea Eo’ poate fi estimată ca media aritmetică a valorilor potenţialelor de peak anodic şi catodic (Eo’ = (Epa + Epc )/2). iar conform ecuaţiei 13. curentul este controlat atât de transferul de încărcare. ilustrat în figura 12. poate fi explicată ca şi în cazul LSV. precum şi de viteză de scanare). e. cât şi de transportul de masă. este de 56. pe majoritatea electrozilor solizi. Diferenţa între potentialul de peak (Ep) şi potentialul la care curentul este jumătate decât la Ep. g.rare a peak-urilor în valoare de 59/n [mV].

care scade când cuplurile redox nu sunt în măsură să ajungă la suprafaţa electrodului. este posibil ca în scopul de a schimba un proces cvasi-reversibil într-unul reversibil să se micşoreze viteza de baleiaj v (ceea ce permite ca într-un timp mai îndelungat concentraţiile superficiale să se ajusteze la noile valori ce479 . Atâta timp cât reversibilitatea depinde de valoarea raportului ks/v. În aceste cazuri se observă că separarea de peak este o funcţie de viteză constantă a transferului de electroni. viteza de transfer de electroni are o şansă mai mare de a fi mai rapidă.Forma voltamogramei ciclice este funcţie de raportului k°/(πνnFD/RT)1/2. 1) Cinetica transferului de electroni lent Aşa cum s-a menţionat anterior. la valorile cerute de ecuaţia lui Nernst. Comportamentul unui electrod se poate apropia de cel al un sistem nernstian prin încetinirea vitezei de scanare. se poate demonstra rolul esenţial pe care îl joacă curăţenia electrodului prin compararea voltamogramelor obţinute cu electrodul curat şi modificat. Dacă raportul ks/v este suficient de mic încât concentraţiile nernstiene nu pot fi menţinute. Sistemele nernstiane de transfer de electroni la electrod complete sunt greu de găsit în practică şi moleculele redox-active sunt adesea destul de lente. Cu cât curentul este mai mic. v). Deviaţiile de la comportamentul reversibil sunt identificate prin variaţii de la parametrii expuşi anterior (a-g). pentru valori mici ale acestuia. Există două cazuri de comportament ireversibil descrise mai jos. În general. Un proces cvasi-reversibil se caracterizează prin: A) Separarea potenţialelor de peak are o valoare care depaşeşte 58/n mV şi care creşte cu creşterea v (ΔEp > 58/n mV). atunci procesul se spune că este cvasi-reversibil. Cu toate acestea. sistemele devin mai lente şi sunt apte să prezinte control cinetic. reversibilitatea depinde de valorile relative ale constantelor de viteză a transferului de electroni eterogen (ks) şi viteza de schimbare a potenţialului (viteza de scanare. potenţial de peak în comparaţie cu un sistem reversibil. comparativ cu difuzia. sistemul va prezenta un comportament ireversibil. Când se efectuează o voltamogramă ciclică pe un electrod modificat cu un monostrat auto-asamblat. Prin urmare. dacă electrozii nu sunt curăţati (sau sunt acoperiţi cu monostraturi). Pe măsură ce acest raport creşte. reversibilitatea impune ca cinetica de transfer de electroni să fie suficient de rapidă pentru a menţine concentraţiile de suprafaţă ale Ox şi Red. De asemenea. voltamogramele unui sistem cvasi-reversibil sunt mai extinse şi prezintă o separare mai mare. procesul se apropie de cazul reversibil.

în funcţie de viteza de scanare este posibil să se obţină o estimare pentru constantele vitezelor de transfer de electroni. În aceste cazuri. în cazul în care reducerea de la Red la Ox este urmată de conversia lui Red la P. în special despre procesul cinetic care urmează după cel electrochimic. 2) Reacţiile chimice ale Ox şi Red Valorile de echilibrul pentru Ox şi Red pot fi menţinute în timpul unui experiment de voltametrie ciclică. B) Din păcate. De exemplu. ks poate fi calculată din variaţiile Ep cu v. de asemenea. În mod similar cu cazul de reversibilitate. potenţialele de peak se deplasează spre valori mai pozitive/negative. Efectul unei reacţii chimice depinde de valoarea raportului k/v (unde k este constanta de viteză a reacţiei chimice). Prin urmare. Prin analizarea variaţiei potenţialului de peak. adică raportul ipa/ipc este diferit (mai mare sau mai mic) de 1. În plus. atunci mai mult Red trebuie generat pentru a compensa pierderea de Red. Dacă această valoare este mare. separarea potenţialelor de peak nu mai este fixă. prin compensare electronică cu feedback pozitiv şi prin manipularea ulterioară a datelor. C) Atunci când peak-urile sunt semi-reversibile. Valoarea curentului poate fi. Din nou. cu toate acestea. cauzată de rezistenţa necompensată a soluţiei (Ru). ΔEp depinde de valoarea ks/v şi. prin urmare. atât de oxidare. În plus. în timp ce valoarea ks este independentă de concentraţia de analit). 480 . Cele două efecte pot fi distinse prin varierea concentraţiei de analit (scăderea potenţialului datorită rezistenţei necompensate a soluţiei şi astfel. acest lucru poate fi înţeles în termeni de echilibru la suprafaţă care nu este stabilit atât de rapid. afectată de reacţii chimice care urmează după transferul de electroni. prima curbă prezintă cazul în care constantele de viteză ale proceselor. dar variază în funcţie de viteza de scanare. În figura 13. curentul de peak variază în funcţie de rădăcina pătrată a ratei de scanare. cât şi de reducere sunt încă rapide. creşterea ΔEp cu creşterea v poate fi. dacă ambele specii Ox şi Red sunt stabile în timpul experimentului. valoarea ΔEp rezultată creşte cu creşterea curentului. viteza de reducere creşte şi potenţialul de peak (Epc) se deplasează spre o valoare mai pozitivă. raportul ipa/ipc este mai mic decât unitatea (din moment ce doar o parte din moleculele care au fost reduse prin baleiajul direct sunt disponibile pentru reoxidation prin baleiajul invers).rute de schimbările de potenţial). este posibil să se determine mai multe informaţii. când constantele de viteză sunt reduse. de asemenea. Efectul Ru poate fi minimizat printr-un design experimental atent.

Valoarea lui k poate fi calculată fie prin studii de simulare. datorită unui suprapotenţial. b. În ciuda acestor limitări. De asemenea. Când un peak este ne-reversibil. este posibil ca peak-ul să fie ireversibil din cauza unui proces fizic. Cuplul redox ar putea fi ireversibil din cauza unui proces chimic care urmează. un exemplu comun pentru metale tranziţionale este o schimbare în geometria sferei de coordonare. atunci viteze mari de scanare pot arăta peak-uri reversibile. Dacă ambele efecte sunt prezente. Dacă este acesta cazul. există diferenţe considerabile în ceea ce priveşte parametrii voltamogramei. plasând o limită superioară a lui v decât poate fi utilizată. cel mai frec481 . În plus. prin cresterea v. cu toate acestea el necesită adesea existenţa de cantităţi egale de analit. Deşi voltametria ciclică este foarte utilizată pe scară largă pentru caracterizarea speciilor redox (de exemplu: potenţiale redox şi stabilitatea diferitelor stări de oxidare) şi de investigare calitativă a reacţiilor chimice care însoţesc transferul de electroni. fie prin investigarea efectului vitezei de baleiaj asupra raportului ipa/ipc.atunci reacţia chimică are un efect semnificativ. Efectele transferului eterogen de electroni lent şi reacţiile chimice nu pot fi separate. există o serie de dezavantaje inerente în cadrul acestui procedeu: a. voltametria ciclică este una din tehnicile standard utilizate pentru caracterizare. Procese redox ireversibile (control de transfer de sarcină) În cazul transferului de electroni ne-reversibil. în ambele stări de oxidare. Acest fapt restrânge limita de detecţie la aproximativ 10-5 M. în unele domenii de cercetare. Acesta poate fi însă determinat. exprimat prin vCdl (unde: Cdl este capacitatea la interfaţa electrodului de lucru). voltameteria ciclică nu poate determina dacă peak-ul este la potenţialul său termodinamic sau s-a deplasat la un potenţial mai extrem. atunci constantele de viteză pentru aceste procese nu pot fi calculate folosind metode de simulare. Când peak-urile sunt ne-reversibile este imposibil să se determine parametrul E01/2. Într-adevăr. Există un curent rezidual de încărcare în timpul experimentului. este posibil să se elimine efectul reacţiei chimice (deci să se restabilească reversibilitatea). raportul dintre curentul de peak faradaic şi curentul de încărcare scade cu creşterea v (în timp ip este proporţional cu v1/2). Prin urmare. voltametria ciclică este foarte potrivită pentru o gamă largă de aplicaţii. în timp ce un efect mai redus apare în cazul în care acest raport este mai mic.

după reducere sau oxidare. Solubilitatea unui analit se poate schimba drastic dacă se schimbă sarcina totală a acestuia. electrozii sunt statici şi aşezaţi în soluţii negitate. sarcina analitului. cel puţin. Această metodă permite. Această stratificare a analitului poate izola suprafaţa electrodului. de obicei. electrolit şi electrodul de lucru specific determină intervalul de potenţial baleiat. electrolitul este adăugat la soluţia de testat pentru a asigura o conductivitate suficientă. Figura 14. Condiţii experimentale Metoda utilizează o combinaţie de trei electrozi: electrodul de lucru. Celula electrochimică pentru experimentul de voltametrie liniară sau ciclică. Agitarea soluţiei între trasarea voltamogramelor este importantă pentru ca să furnizeze suprafaţei electrodului analit proaspăt în fiecare nou experiment. ele sunt în general în afara domeniului de aplicare al voltametriei ciclice. ca o parte din analit să rămână. acolo unde poate afişa în continuare activitate redox. Această metodă cu soluţie staţionară are ca şi consecinţă apariţia caracteristicilor de peak controlate de difuzie. De obicei. de asemenea. Combinaţia dintre solvent.vent. un electrod de referinţă şi un contraelectrod (figura 14). este uzual pentru analitul redus sau oxidat să precipite pe electrod. evidenţiind propria activitate redox în scanările ulterioare sau. În timpul voltametriei ciclice. Deoarece voltametria ciclică modifică. o formă de precipitare. poate modifica 482 . cu toate acestea. Unele speculaţii pot fi făcute în ceea ce priveşte peak-urile ireversibile.

sub numele de electrod auxiliar. Pentru a executa experimente de voltametrie ciclică la viteze de scanare mari este insuficient un electrod de lucru obişnuit. adesea este necesară curăţarea electrozilor între scanări. Contraelectrodul cunoscut. Exemplu Se realizează o soluţie de hexacianoferat de potasiu 0. care apar oricum indiferent dacă baleiajul se face dinspre valori pozitive sau negative. Remarci Voltametrie ciclică nu este o tehnică hidrodinamică. Aceste tehnici ţintesc condiţiile de stare de echilibru. în general. Pentru a minimiza curentul şi rezistenţa. Pentru a menţine curentul observat la contraelectrod. Pentru interpretarea rezultatelor de voltametrie ciclică este important ca electrodul să posede o arie a suprafaţei controlată cu o formă definită.suprafaţa electrodului. platina şi aurul. Utilizând voltametria ciclică să sa investigheze comportamentul cuplului redox Fe(CN)63-/4. având doar un disc expus la unul dintre capete. de asemenea. pompare a soluţiei sau rotaţia electrodului. se vor oxida sau reduce adesea electrolitul sau solventul.şi să se determine parametrii electrochimici: Eo’. pot fi folosiţi ultramicroelectrozi.5 mM K3Fe(CN)6 prin dizolvarea cantităţii corespunzătoare de sare în 100 ml de KCl 1 M. Într-o tehnică hidrodinamică. precum şi D. încastraţi într-un material izolator inert. Un electrod de lucru obişnuit are o rază de un ordin de mărime de câţiva mm. Materialele uzuale pentru electrozii de lucru sunt: cărbunele sticlos. Din acestea sau alte motive. atâta timp cât este asigurată o conducţie bună a curentului. uneori separaţi de soluţia testată prin capilare Luggin care să împiedice infestarea electrolitului cu KCl. ceea ce le limitează la voltametria cu baleiaj liniar de potenţial. care au ca rezultat creşterea rezistenţei. Vitezele mari de scanare creează peak-uri având intensităţi mari de curent. Celula electrochimică conţine 10 ml soluţie de analit şi este echipată cu 3 electrozi: electrod de lucru din grafit. Electrozii de referinţă uzuali sunt cei de calomel sau de Ag/AgCl saturaţi cu KCl. ipa/ipc. cum este în cazul electrozilor disc-rotitor şi disc-inel-rotitor. Aceşti electrozi sunt. ceea ce duce la denaturarea formei voltamogramei. fluxul spre suprafaţa electrodului este realizat prin agitare. contraelectrodul de platină şi electrodul de referinţă Ag/AgCl/KClsat. 483 . poate fi orice material care conduce cu uşurinţă şi nu va reacţiona cu volumul soluţiei. ΔEp. Reacţiile care apar la suprafaţa contraelectrodului sunt lipsite de importanţă.

În fereastra «Manual Control» se bifează toată gama de curenţi pentru ca rRESezentarea grafică on-line să se autoscaleze. În fereastra «Data presentation» va apărea voltamograma on-line.Procesele de electrod sunt: reducere: oxidare: [FeII(CN)6]3. se fixează şi parametrii pretratamentului (depinde de sistemul studiat). Figura 15.+ e. după ce s-a dat comanda “Start”.+ e(13) (14) Aparatura folosită este un potenţiostat Autolab PGStat 10 (EcoChimie. Eventual. Figura 16.→ [FeIII(CN)6]3. numărul de cicluri şi viteza de baleiaj. În fereastra «Edit Procedure» se fixează parametrii experimentului: potenţialul de start. potenţialul de întoarcere. Potenţiostat Autolab PGStat 10.→ [FeIII(CN)6]4[FeII(CN)6]4. 484 . La rularea softului GPES se deschid 3 ferestre (figura 16). Olanda) pilotat de computer (figura 15). Softul GPES pentru pilotarea potenţiostatului.

se obţin voltamogramele din figura 17.815 0. tampon fosfat 0.1 V/ Ag/AgCl.00050 -0. Voltamograma ciclică pe CV/NP (0.1 M. 2 cicluri.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl.8.254e-4 Ipc (A) -1.Pentru sistemul studiat.6 10 E/ V vs. curentul faradic rezultat la electrod este monitorizat ca funcţie de timp. potenţial de start. se observă ca mărimile ΔEp şi ipa/ipc au valori care plasează sistemul studiat în cazul sistemelor monoelectronice. pH = 6. Figura 18.0188:1)-Nafion în 5 mM K3[Fe(CN)6] + 1 M KCl. -0.278 0. Parametrii electrochimici ai sistemului studiat în figura 17.8. Condiţii experimentale: electrolit. cronoamperometria generează un curent mare.0 0. 0. KClsat.303 0. Cronoamperometrie Cronoamperometria este o tehnică electrochimică în care potenţialul electrodului de lucru este variat după un semnal tip treaptă. 2 cicluri. ca orice circuit RC.00025 -0. Dependenţa log I vs. potenţial de start.253 0. Din panta rRESezentării log I vs log v (figura 18) se stabileşte puterea lui v şi astfel se verifică posibilitatea de a utiliza ecuaţia Randles-Sencik pentru calculul coeficientului de difuzie.050 0.4 0. Ag/AgCl.00000 0.00075 20 mV/s 50 mV/s 70 mV/s 100 mV/s 200 mV/s 0.2 0. Condiţii experimentale: electrolit.1 V/ Ag/AgCl.303 Epc (V) 0. care scade exponenţial cu timpul.00025 -0.818 Din datele prezentate în tabelul 1.00075 log I 1E-4 I/A 0. v (mV/s) 50 100 Epa (V) 0. -0. Tabelul 1. Curentul obţinut (figura 19) are două componente: un curent datorat încărcării stratului dublu (figura 20) şi altul datorat transferului de electroni. pH = 6. Log v pentru electrodul CV/NP (0. Ca şi toate tehnicile cu puls de potenţial.00050 anodic catodic 1E-3 0.255e-4 -2. la diferite viteze de baleiaj.753e-4 Eo’ (V) 0.1 M. KClsat. KClsat log v Figura 17.253 Ipa (A) 1.050 ipa/ipc 0. tampon fosfat 0. 485 .023e-4 2.278 ΔEp (V) 0. reversibile (conform Anexei 1).

Un gradient similar. Iniţial. cu atât stratul de difuzie sărăcit în Ox. Aşa cum s-a discutat anterior. La un moment t0. evaluate la x = 0. potenţialul este modificat după un semnal de tip treaptă până la o valoare semnificativ mai negativă decât E0’ pentru cuplu redox (Es). ∂Ci/∂x. şi se lucrează în acele condiţii experimentale care să asigure că fluxul spre electrod să fie strict controlat de difuzie. un exces de electrolit inert. de asemenea. care după formarea sa este liber să difuzeze departe de suprafaţa electrodului. în faza de volum. de ex. prin care Ox din cea mai mare parte a soluţiei trebuie să difuze la suprafaţa electrodului. pe măsură ce trece timpul. dar în sens opus există pentru Red. în faza de volum de 1 mM. 486 .: 1 mM. electrodul este fixat la un potenţial (Ei) mult mai pozitiv decat ale E0’ a cuplului Red/Ox. Ca urmare a transformării. se extinde. asigurându-ne că doar Ox este prezent în soluţie. Această situaţie este prezentată în Figura 21. curentul faradaic în condiţii controlate de difuzie este direct legat cu gradientul de concentraţie. Cu cât electrodul rămâne mai mult la acest potenţial de reducere. iar forma Ox din vecinătatea electrodului este imediat transformată (după o cinetică reversibilă) la forma Red.Figura 19. concentraţia de Ox din vecinătatea electrodului este redusă la zero faţă de concentraţia iniţială. Profilul curentului stratului dublu electric Considerând o situaţie în care un electrod solid este cufundat într-o soluţie care conţine forma oxidată (Ox) a unui cuplu redox la concentraţie iniţială cunoscută (C0). Astfel. Aceasta duce la formarea unui gradient de concentraţie pentru Ox. unde este imediat redusă la Red. acelaşi lucru se va observa şi în cazul curentului. Soluţia conţine. Cronoamperograma Figura 20. cum panta profilului de concentrare pentru Ox scade cu timpul în urma excitării sub formă de treaptă de potenţial.

care descrie curentul observat (electrodul planar) în orice moment. Curentul datorat încărcării stratului dublu. la potenţialul Es. În general. i = n F A Co Do1/2 π-1/2 t-1/2 [A] 2 (15) unde n = numărul de electroni implicaţi în reactie. C0 = concentraţia speciei electroactiv (mol/cm ). această influenţă poate fi evitată numai luând în considerare datele i-t în ultimele 90% din timp. ic. Ecuaţia cea mai utilă în cronoamperometria este ecuaţia Cottrell. Prin natura lui acest curent capacitiv.gr/applets/AppletDiffus/Appl_Diffus2. în care potenţialul revine la o valoare finală (Ef) după ce este menţinut o perioadă de timp τ. raportul [Red] la [Ox] la suprafaţa electodului este dat de ecuaţia lui Nernst la orice potenţial. 487 2 3 . De obicei. contribuie la curentul total observat după aplicarea unei treapte de potenţial.485 C/echivalent).uoa. Semnalul de excitare in cronoamperometrie si evolutia profilului de concentratie la suprafata electodului.chem. în urma unui trepte de potenţial într-o reacţie redox reversibilă (sau la suprapotenţial mare) în funcţie de t-1/2.html). Acesta poate fi uşor înregistrat prin efectuarea experimentului într-o celulă care conţine doar electrolit. pentru un sistem reversibil (de reducere). concentraţia de Ox la suprafaţă a atins imediat valoarea zero pentru o treaptă de potenţial mult mai negativă decât E0’ a cuplului redox. Pe lângă cel mai frecvent experiment de cronoamperometrie. adică cel cu o singură treaptă de potenţial. există şi cele cu treaptă dublă de potenţial.Figura 21. si D0 = constanta de difuzie pentru specia electroactiv (cm /s). cu raportul 100:1 ajungând la o valoare de 118 mV mai negativă decât E0’. în care numai curentul rezultat este înregistrat. F = constanta Faraday (96. A = aria electrodului (cm ). În exemplul de mai sus. Informaţii suplimentare cu privire la formarea de gradienţilor de concentrare. scade ca funcţie de 1/t si are valori semnificative numai în perioada iniţială (de câteva ms) imediat după aplicarea semnalului treaptă. pot fi găsite la (http://www.

488 . Cu o suprafaţă de electrod cunoscută. Metoda dublei trepte de potenţial este deseori aplicată în măsuratori de constante de viteză pentru reacţii chimice (inclusiv produşi de adsorbţie) care apar în urma primei trepte de potenţial. unde este menţinut un timp τ.Prezenţa unei reacţii chimice după etapa de transfer de electroni va duce la un raport diferit de această valoare teoretică. Figura 22. În acest exemplu. M. Bard A. Curentul apărut la treapta de întoarcere este conceptual mai dificil de explicat decât cel de la prima treaptă. Brett Oliveira A. Un sistem simplu. fie de D0 pentru o specie electroactivă. valorile curentului măsurat la un moment egal cu τ/2.293 pentru raportul dintre [-ir (2τ)/if (τ). după fiecare treaptă de potenţial. Methods and Applications. A. pentru ca apoi să revină la Ef = Ei. Electrochemical Methods: Fundamentals and Applications. Cum era de aşteptat din ecuaţia Cottrell. De exemplu.. New York. Oxford University Press. 1993. 2. curentul din perioada de întoarcere este înregistrat tot pentru un inte rval de timp τ. curentul observat pentru prima treaptă scade cu t-1/2. Co si Do cunoscute]. Semnalul de excitare şi răspunsul în cronoamperometria cu treaptă dublă . J. John Wiley and Sons Publishers. după fiecare treaptă (notat ir şi if în figura 22) pentru un astfel de sistem ar duce la o valoare egală cu 0.Cronoamperometria cu pas dublu de potenţial este ilustrată în figura 22. reversibil poate fi identificat prin compararea valorile curentului direct şi invers măsurat în acelaşi interval de timp.Bibliografie 1. Pentru cei interesaţi detaliile se află în Bard şi Faulkner. Brett C. sunt uşor de realizat măsurători. cât şi electrochimic. 6. M. Electrochemistry: Principles. USA.. fie de n. 2001. În general. Cronoamperometria se pretează bine la măsurarea exactă a ariei electrodului (A) prin utilizarea unui cuplu redox bine-definit (cu n. transferul de electroni este reversibil atât chimic. .. Faulkner L. În partea stângă a figurii este arătat felul cum se aplică treapta de potenţial de la Ei la Es. R.

371 + XII p. Anal. S.687 *105) n3/2 AD1/2 v1/2C* [A].1. Shain I.. 36. Compton R. G. Shain I.E p/2 = 489 . Understanding voltammetry. Criterii de identificare pentru voltametria ciclică cu specia redox în soluţie ip = (2. Š. Anal..5 [mV] ⎛ ⎞ E p/2 = E1/2 + 1. Chem.. (Editor) Bioelectrochemistry: Fundamentals. Chem.109⎜ ⎟=− n ⎝ nF ⎠ RT 28.ogt. E. Theory and Application. edt) Springer-Verlag. Chem. Experimental Techniques and Applications. Berlin. 1965. 1965. se calculează ks s ⎟ ⎟ ⎜ ⎜D ⎟v −1 / 2 Ψ = ⎜ ⎝ Re d ⎠ 1/2 ⎜ ⎡ nF ⎤ ⎟ D π ⎜ ox ⎥ ⎟ ⎜⎢ RT ⎦ ⎟ ⎠ ⎝⎣ Sisteme ireversibile. Anal... 1965. Banks C. 9. 2008. 706. ISBN 981-270-625-9 5.5 [mV] ⎛ RT ⎞ E p . 37.Epa) = 59/n ipa/ipc = 1 Sisteme cvasi-reversibile ⎛ nF ⎞ i p = nFAC* D1/2 Ψ(E) v1/2 Ox ⎜ RT ⎟ ⎝ ⎠ ⎛ RT ⎞ Ep/2 . John Wiley & Sons. 8. se calculează D Sisteme reversibile 28. 37.3.E1/2 = . se calculeaza D na = număr de 1/2 o ⎞ ⎛ 1/2 ⎞ RT ⎛ αn F ⎞ 1/2 . Komorsky-Lovrić. Shain I. 1965. 2007.. Mirčeski.. 10. V.S. ip = (2. In: Monographs in Electrochemistry (F. World Scientific. Anal. Anal. Lovrić: Square-Wave Voltammetry. Bartlett P. Nicholson R. S. α )⎜ ⎟ ⎝ nF ⎠ ⎛ ⎜ ⎜ ko Λ=⎜ nF ⎜ ⎡D1−α Dα ⎜ ⎢ Ox Red RT ⎝⎣ ⎞ ⎟ ⎟ 1/2 ⎟ ⎤ v⎥ ⎟ ⎟ ⎦ ⎠ 1/2 ⎛ ⎛ D ⎞α/2 ⎞ ⎜ ⎜ ox ⎟ k ⎟ .99 *105) n(αna)1/2 A D1/2 v1/2 C* [A]. Chem. Scholz. 37(11)..pdf) Anexa 1. Singapore. M. 1351] E p . 37. S.. S. 1965. 6. ISBN 978-3-540-73739-1. 1351 (https://twiki.09⎜ ⎟ = E1 / 2 + n ⎝ nF ⎠ ΔEp (= Epc .Ep = (Λ .7 [mV]. 2007..N. Nicholson R..uk/twiki/pub/People/ElectrochemistryPapers/TheoryandApplicationofC yclicVoltammetryforMeasurementofElectrodeReactionKinetics. 37.. 178.78 + ln ⎜ D Ox ⎟ + ln ⎛ electroni transferaţi în E p = E o' ⎜ a ⎟ + lnv ⎟ o ⎜ ⎟ ⎜ ⎟ αn a F ⎝ RT ⎠ ⎝ k ⎠ etapa determinată de ⎝ ⎠ viteză 47. 7. Chem.. Nicholson R. Anal.(ISBN 978-0470843642) 4. se calculeaza αna αn a [Pentru identificarea notaţiilor şi detalii vezi: Nicholson. Ltd. Chem. Nicholson R. 1964.co.. se calculeaza k ⎜ 0. 190. Nicholson R . 667...

.......2....Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie .......Electrochimia unei substanţe cu potenţial biologic activ..........493 2... prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj.............................................................. Bibliografie ...... Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) imobilizată în polimeri .................................497 3. Anexă ........498 3.. Concluzii .....504 4...4.......................................... Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie.. Calculul constantei eterogene de transfer de electroni pentru sistemul G/SWCNT–Fe(III)P-Nafion ..................499 3..............490 2..494 2............. Studiul integrităţii filmului de Fe(III)P pentru sistemul G/SWCNT–Fe(III)P-Nafion prin calculul ariei suprafeţei active ..987......... Graziella Liana Turdean Cuprins 1............................................................ Influenţa vitezei de baleiaj asupra comportării heminei in soluţie (G//Fe(III)P) pe electrod de grafit............ pentru o viteză de baleiaj de 50 mV/s........................505 5..................... Influenţa pHului asupra comportării sistemului G//Fe(III)P pe electrod de grafit . Ec = 0............. Se trasează voltamogramele ciclice la diferite viteze de baleiaj pe electrodul de platină în soluţia de 5 mM K3[Fe(CN)6] care conţine 0........501 3.109 V......................................155 mA si Ipc = 0................ prin experimente realizate în K3[Fe(CN)6] la diferite viteze de baleiaj.............................................502 3...................507 1........................506 6............... a.....2....1.................354 V...................................................3.157 mA) având parametrii electrochimici (ΔE = 0........ Eo’ = 0............... Studiu de caz Conf........1 M KCl ca şi fond electrolitic pentru îmbunătăţirea conducţiei (Figura 1A)............ ing.................................................. ... Influenţa vitezei de baleiaj asupra comportării heminei adsorbită (G/SWCNT–Fe(III) P-Nafion) pe electrod de grafit ........ Influenţa pH-ului asupra comportării sistemului adsorbit (G/SWCNT– Fe(III)P-Nafion) pe electrod de grafit ....................495 3..........245 V...................................................5...... Ipa = 0..................... Exemplu de utilizare a voltametriei ciclice pe electrod de platină pentru estimarea coeficientului de difuzie.1......... dr........ Comportamentul redox al acestei substanţe considerată standard este descris de ecuaţia 1: Fe(CN)6 + e -3 - → Fe(CN)6 -4 (1) şi se manifestă prin apariţia unei perechi de picuri bine conturate (poziţionate la Ea = 0................ Estimarea stabilităţii sistemului G/SWCNT–Fe(III)P-Nafion la funcţionare continuă ..............................................................................300 V si Ipa/Ipc = 0........... 490 ...........

0 v 1 /2 / (V /s ) b. (C) Influenta vitezei de baleiaj asupra curentului de peak I pentru voltamogramele din fig 1A. Ecuaţiile regresiei liniare sunt prezentate în tabelul 1. Analiza datelor prezentate în tabelul 1 indică că specia redox studiată. K3[Fe(CN)6].0 0 . Astfel.0 0 . I. –0.2 (B) 5 m V /s 1 0 m V /s 2 5 m V /s 5 0 m V /s 7 5 m V /s 1 0 0 m V /s 2 5 0 m V /s 5 0 0 m V /s 7 5 0 m V /s 9 0 0 m V /s anodic catodic I / μA I/A 1E-4 10 100 1000 -1 v / (mV *s ) 0 . v1/2. log v pentru voltamogramele din fig 1A.6 E / V vs. C0* = concentraţia soluţiei în fază de volum (mol/cm3). Intensitatea curentului de peak (Ip) depinde de viteza de baleiaj (v) în conformitate cu ecuaţia Randles-Sevcic (ecuatia 2) pentru un sistem reversibil sub control difuziv [Bard A. log v (figura 1B). ESC (C) Figura 1. se află în soluţie. panta în jur de 0.6 0 .5..4 0 . Condiţii experimentale: potenţial iniţial. v = viteza de baleiaj (V/s) .4 0 .69*105 n3/2 A D01/2 v1/2 Co* (2) unde: Ip = curentul de peak (A). iar intensitatea curentului. (A) Voltamograma ciclica a 5 mM K3[Fe(CN)6]+ 0.2 0 .8 1/2 catodic 1 . dependenţa I vs. Panta acestor regresii ne dă indicii despre tipul de transfer de sarcină difuziv (specia în soluţie. n = numărul de electroni.(A) 800 600 400 200 0 -2 0 0 -4 0 0 -6 0 0 -0 . se trasează dependenta log I vs. 500 / μA anodic 400 300 200 100 I / μA I 0 -1 0 0 -2 0 0 -3 0 0 -4 0 0 0 . 1980]: Ip = 2. conform ecuaţiei Randles Sevcik) sau transfer de sarcină eterogen (specia adsorbită. panta în jur de 1).2 V vs. J.2 0 . (B) Dependenta log I vs. D0 = coeficientul de difuzie (cm2/s). respec491 . Ipc). ESC. A = aria electrodului (cm2).1 M KCl pe electrod de platina. cu ajutorul curenţilor de peak anodic şi catodic (Ipa.

438 ± 0.007) log v Ia /A= (2. 2004]. n=6 R = 0.9992. Prin urmare panta regresiei liniare este: a = 2.132 e-5 ± 4. v. ecuaţia 2 devine: Ip = 2.009) log v Ic /A= (-1.00517 102)2 = 1.817 10-4)2/(0. unde d= diametrul electrodului.c = (6. n=6 R = 0.518 ± 0.00517 102)2 Adică: Do. anodic log Ia = (-4.648e-5 ± 3.. pentru a putea utiliza corect rezultatele. 492 . Se înlocuiesc în ecuaţia Randles Sevcik (ecuaţia 2) parametrii cunoscuţi.552 ± 0.69*105 (1)3/2 [π (0.-S. pentru a putea utiliza ecuaţia Randles Sevcik la calculul coeficientului de difuzie. iar Dmediu = 1. v1/2.s log v şi respectiv. Astfel.a = (5. Valorile parametrilor regresiei liniare I vs.013) + (0.008e-5)v1/2 /V/s log Ic = (-4. în rRESezentarea I vs.00517 102 D01/2 de unde: D0 = a2/(0. Atentie.415 ± 0.33 10-6 cm2/s.011) + (0.858e-5) v1/2 /V/s R = 0. adică 5 mM = 5 10-6 mol/cm3. d.131e-4 ± 1.9 10-5 cm2/s obţinut cu o soluţie 5 mM K3[Fe(CN)6] [Ye J. Astfel: n = numărul de electroni este 1 în conformitate cu reacţia 1.220e-6) + (5.7)2]/4 D01/2 5 10-6 v1/2 analoaga unei ecuaţii liniare y = a x.7 cm. A = aria electrodului (cm2) este (πd2)/4.9994.69*105 (1)3/2 [π (0.9982 n = 6 catodic c. 2003] si D = 5. valorile curentului trebuie să fie în amperi (A) şi ale vitezei de baleiaj (v) în (V/s). Tabelul 1.7)2]/4 D01/2 5 10-6 = 0.817e-4 ± 2.131 10-4)2/(0. log v se poate trasa dependenţa I vs. Datele obţinute sunt în concordanţă cu cele din literatură care variază între: D = 6. I vs. unde a este panta.5 10-6 cm2/s obţinut cu o soluţie 20 mM K3[Fe(CN)6] [Hrapovic S.41 10-6 cm2/s. D. Având stabilită dependenţă log I vs. Regresii liniare pentru dependenţele log I v.90e-6) – (6. v1/2 sunt prezentate în tabelul 1. C0* = concentraţia soluţiei de K3[Fe(CN)6] în fază de volum (mol/cm3). v1/2 (figura 1C) şi estima panta regresiei liniare.tă dependenţa Randles-Sevcik faţă de v1/2.9976..265 10-6 cm2/s si Do. adică d = 0.00517 102)2 = 1. n = 6 R =0.

– din fr. care Porfiria este o boală ereditară cauzată de o tulburare a sintezei hemului (fracţiunea neproteică a hemoglobinei) şi caracterizată prin acumularea în ţesuturi a unor substanţe intermediare ale acestei sinteze. Hematina este considerată "factorul X" necesar pentru creşterea Haemophilus Figura 2. hématine [Dicţionarul explicativ al limbii române. în funcţie de pHul soluţiei. cu capete rotunjite. 17 – tetrametil . Mai exact.2. Cu toate acestea. ca barbituricele. nu formează spori.0.8. 18 –dipropanoato (2−)]fier(III). 12.5/0. influenzae13. este protoporfirina IX care conţine un ion de fier feric (Heme b) şi un ligand clorură. 11 Porfiria intermitentă acută se manifestă de cele mai multe ori la vârsta adultă prin dureri abdominale acute. 13 Haemophilus influenzae sunt cocobacili Gram negativi. Se distinge de hematină12 care are o grupare hidroxid în loc de clorură. contraceptivele orale.) pigment care provine din sânge şi conţine fier. Este non-motil.→ Fe(II)P Din 10 (3) conţine parametrii electrochimici ai tabelul 2. hematine. (s. 14 Potenţialul formal standard se calculează ca media aritmetică a potenţialelor de peak anodic şi catodic. cu bacili scurţi.f. în special în porfiria intermitentă acută11. 12 Hematină. Porfiriile sunt boli foarte rare. Voltamogramele ciclice ale Fe(III)P în soluţie obţinute la diferite viteze de baleiaj pe electrod de grafit arată o pereche de peak-uri bine definite plasate la un potenţial formal standard (εo’)14 care se plasează între – 0. drepţi. Este folosit în gestionarea atacurilor de porfirie10. 13 – divinilporfirin . mici (1 . 7. 493 . Numeroase medicamente.3 μm). KClsat. Ag/AgCl.350 to .Calculul parametrilor electrochimici pentru o substanţă redox (pe bază de fier) în soluţie Hemina (denumirea IUPAC: cloro[3.2. uneori prin crampe. Structura heminei. sulfamidele si fenitoina. pleomorfic. în conformitate cu reacţia 3: Fe(III)P + e. se află la originea acestor crize. porfirinele. 1998]. Institutul de Lingvistică „Iorgu Iordan”. denumirea comercială: Panhematina) este o porfirină cu conţinut de fier (figura 2). Academia Română. Editura Univers Enciclopedic.1. termenii sunt uneori echivalenţi.500 V vs. facultativ anaerobe. Urinele devin roşii atunci când sunt lăsate să aştepte. printr-o slăbiciune musculară şi prin tulburări psihice. Peak-urile au fost atribuite unui comportament reversibil monoelectronic al cuplului redox Fe(III)/Fe(II) coordinat în inelul porfirinic (Figura 3A).

indicând transformarea procesului reversibil. (B) Dependenta log I vs. (C) Influenta vitezei de baleiaj asupra curentului de peak I pentru voltamogramele din fig 3A. log v (figura 3B) a permis estimarea pantelor. Ca urmare. pH 8. potenţial initial. Influenţa vitezei de baleiaj asupra comportării heminei in soluţie (G//Fe(III)P) pe electrod de grafit Trasarea dependenţei log I vs. Ag/AgCl. indiferent de pHul soluţiei. caracteristic speciilor adsorbite. KClsat. nu este posibil calculul coeficientului de difuzie D al speciei studiate din ecuaţia Randles-Sevcik (aşa cum s-a descris în capitolul 1. TRIS 0. într-unul cvasi-reversibil. descris de o ecuaţie în care v este la puterea 1. log v pentru voltamogramele din fig 3A.85 V vs.voltamogramelor din figura 4A se observă că la viteze de baleiaj care depăşesc 300 mV*s-1. care având valori în jur de 1 (tabelul 3).5 mM Fe(III)P pe electrod de grafit (sistem G//Fe(III)P).1. soluţie dezaerată. 2. Condiţii experimentale: electrolit.05 M. -0. indică faptul că specia studiată se adsoarbe pe electrod în timpul trasării voltamogramelor. (A) Voltamogramele ciclice ale 0. (A) 300 200 100 v v v v v v v = = = = = = = 10 m V*s -1 20 m V*s -1 10